Sample records for increasing applied voltage

  1. Electrical system for measurement of breakdown voltage of vacuum and gas-filled tubes using a dynamic method

    NASA Astrophysics Data System (ADS)

    Pejović, Milić M.; Milosavljević, Čedomir S.; Pejović, Momčilo M.

    2003-06-01

    This article describes an electrical system aimed at measuring and data acquisition of breakdown voltages of vacuum and gas-filled tubes. The measurements were performed using a nitrogen-filled tube at 4 mbar pressure. Based on the measured breakdown voltage data as a function of the applied voltage increase rate, a static breakdown voltage is estimated for the applied voltage gradient ranging from 0.1 to 1 V s-1 and from 1 to 10 V s-1. The histograms of breakdown voltages versus applied voltage increase rates from 0.1 and 0.5 V s-1 are approximated by the probability density functions using a fitting procedure.

  2. Generation of a pulsed low-energy electron beam using the channel spark device

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Elgarhy, M. A. I., E-mail: elgarhy@azhar.edu.eg; Hassaballa, S. E.; Rashed, U. M.

    2015-12-15

    For the generation of low-energy electron beam, the design and characteristics of channel spark discharge (CSD) operating at a low voltage are presented in this paper. The discharge voltage, discharge current, X-ray emissions, and electron beam current were experimentally determined. The effects of the applied voltage, working gas pressure, and external capacitance on the CSD and beam parameters were measured. At an applied voltage of 11 kV, an oxygen gas pressure of 25 mTorr, and an external capacitance of 16.45 nF, the maximum measured current was 900 A. The discharge current increased with the increase in the pressure and capacitance,more » while its periodic time decreased with the increase in the pressure. Two types of the discharge were identified and recorded: the hollow cathode discharge and the conduction discharge. A Faraday cup was used to measure the beam current. The maximum measured beam current was 120 A, and the beam signal exhibited two peaks. The increase in both the external capacitance and the applied discharge voltage increased the maximum electron beam current. The electron-beam pulse time decreased with the increase in the gas pressure at a constant voltage and increased with the decrease in the applied discharge voltage. At an applied voltage of 11 kV and an oxygen gas pressure of 15 mTorr, the maximum beam energy was 2.8 keV. The X-ray signal intensity decreased with the increase in the gas pressure and increased with the increase in the capacitance.« less

  3. Investigation on the Micro-Discharge Characteristics of Dielectric Barrier Discharge in a Needle-Plate Geometry

    NASA Astrophysics Data System (ADS)

    Li, Xuechen; Niu, Dongying; Jia, Pengying; Zhao, Na; Yuan, Ning

    2011-04-01

    In this study, a dielectric barrier discharge device with needle-plate electrodes was used to investigate the characteristics of the micro-discharge in argon at one atmospheric pressure by an optical method. The results show that there are two discharge modes in the dielectric barrier discharge, namely corona mode and filamentary mode. The corona discharge only occurs in the vicinity of the needle tip when the applied voltage is very low. However, the filamentary discharge mode can occur, and micro-discharge bridges the two electrodes when the applied voltage reaches a certain value. The extended area of micro-discharge on the dielectric plate becomes larger with the increase in applied voltage or decrease in gas pressure. The variance of the light emission waveforms is studied as a function of the applied voltage. Results show that very narrow discharge pulse only appears at the negative half cycle of the applied voltage in the corona discharge mode. However, broad hump (about several microseconds) can be discerned at both the negative half cycle and the positive half cycle for a high voltage in the filamentary mode. Furthermore, the inception voltage decreases and the width of the discharge hump increases with the increase in applied voltage. These experimental phenomena can be explained qualitatively by analyzing the discharge mechanism.

  4. Multilevel DC link inverter

    DOEpatents

    Su, Gui-Jia

    2003-06-10

    A multilevel DC link inverter and method for improving torque response and current regulation in permanent magnet motors and switched reluctance motors having a low inductance includes a plurality of voltage controlled cells connected in series for applying a resulting dc voltage comprised of one or more incremental dc voltages. The cells are provided with switches for increasing the resulting applied dc voltage as speed and back EMF increase, while limiting the voltage that is applied to the commutation switches to perform PWM or dc voltage stepping functions, so as to limit current ripple in the stator windings below an acceptable level, typically 5%. Several embodiments are disclosed including inverters using IGBT's, inverters using thyristors. All of the inverters are operable in both motoring and regenerating modes.

  5. Synthesis and properties of hydroxyapatite-containing coating on AZ31 magnesium alloy by micro-arc oxidation

    NASA Astrophysics Data System (ADS)

    Tang, Hui; Han, Yu; Wu, Tao; Tao, Wei; Jian, Xian; Wu, Yunfeng; Xu, Fangjun

    2017-04-01

    In this study, hydroxyapatite-containing coatings were prepared by microarc oxidation on AZ31 magnesium alloy surface to improve its biodegradation performance. Five applied voltages were chosen to prepare the MAO coatings. The results demonstrate that the number of micropores in the films increases but their dimensions decrease after higher voltage is applied. As the surface roughness of the MAO coatings increases with the applied voltage, the wettability of the coatings improves continuously. The MAO coatings were mainly composed of magnesium oxide (MgO) and hydroxyapatite. The amount of hydroxyapatite phase increased with increasing voltage that was applied. The bonding strength became slightly weaker after a higher voltage was applied. But the bonding strengths of all the coatings were consistently higher than 37 MPa, which met the requirement of implant biomaterials. All coatings exhibited higher corrosion resistances and lower hydrogen evolution rate than the bare AZ31 Mg substrate, implying that the degradation rate of the AZ31 Mg alloy was enhanced by the hydroxyapatite-containing coatings. The results indicate that the present treatment of applying hydroxyapatite-containing coatings is a promising technique for the degradable Mg-based biomaterials for orthopedic applications.

  6. Independent variations of applied voltage and injection current for controlling the quantum-confined Stark effect in an InGaN/GaN quantum-well light-emitting diode.

    PubMed

    Chen, Horng-Shyang; Liu, Zhan Hui; Shih, Pei-Ying; Su, Chia-Ying; Chen, Chih-Yen; Lin, Chun-Han; Yao, Yu-Feng; Kiang, Yean-Woei; Yang, C C

    2014-04-07

    A reverse-biased voltage is applied to either device in the vertical configuration of two light-emitting diodes (LEDs) grown on patterned and flat Si (110) substrates with weak and strong quantum-confined Stark effects (QCSEs), respectively, in the InGaN/GaN quantum wells for independently controlling the applied voltage across and the injection current into the p-i-n junction in the lateral configuration of LED operation. The results show that more carrier supply is needed in the LED of weaker QCSE to produce a carrier screening effect for balancing the potential tilt in increasing the forward-biased voltage, when compared with the LED of stronger QCSE. The small spectral shift range in increasing injection current in the LED of weaker QCSE is attributed not only to the weaker QCSE, but also to its smaller device resistance such that a given increment of applied voltage leads to a larger increment of injection current. From a viewpoint of practical application in LED operation, by applying a reverse-biased voltage in the vertical configuration, the applied voltage and injection current in the lateral configuration can be independently controlled by adjusting the vertical voltage for keeping the emission spectral peak fixed.

  7. Single-contact tunneling thermometry

    DOEpatents

    Maksymovych, Petro

    2016-02-23

    A single-contact tunneling thermometry circuit includes a tunnel junction formed between two objects. Junction temperature gradient information is determined based on a mathematical relationship between a target alternating voltage applied across the junction and the junction temperature gradient. Total voltage measured across the junction indicates the magnitude of the target alternating voltage. A thermal gradient is induced across the junction. A reference thermovoltage is measured when zero alternating voltage is applied across the junction. An increasing alternating voltage is applied while measuring a thermovoltage component and a DC rectification voltage component created by the applied alternating voltage. The target alternating voltage is reached when the thermovoltage is nullified or doubled by the DC rectification voltage depending on the sign of the reference thermovoltage. Thermoelectric current and current measurements may be utilized in place of the thermovoltage and voltage measurements. The system may be automated with a feedback loop.

  8. DC Motor control using motor-generator set with controlled generator field

    DOEpatents

    Belsterling, Charles A.; Stone, John

    1982-01-01

    A d.c. generator is connected in series opposed to the polarity of a d.c. power source supplying a d.c. drive motor. The generator is part of a motor-generator set, the motor of which is supplied from the power source connected to the motor. A generator field control means varies the field produced by at least one of the generator windings in order to change the effective voltage output. When the generator voltage is exactly equal to the d.c. voltage supply, no voltage is applied across the drive motor. As the field of the generator is reduced, the drive motor is supplied greater voltage until the full voltage of the d.c. power source is supplied when the generator has zero field applied. Additional voltage may be applied across the drive motor by reversing and increasing the reversed field on the generator. The drive motor may be reversed in direction from standstill by increasing the generator field so that a reverse voltage is applied across the d.c. motor.

  9. Synaptic transistor with a reversible and analog conductance modulation using a Pt/HfOx/n-IGZO memcapacitor

    NASA Astrophysics Data System (ADS)

    Yang, Paul; Kim, Hyung Jun; Zheng, Hong; Beom, Geon Won; Park, Jong-Sung; Kang, Chi Jung; Yoon, Tae-Sik

    2017-06-01

    A synaptic transistor emulating the biological synaptic motion is demonstrated using the memcapacitance characteristics in a Pt/HfOx/n-indium-gallium-zinc-oxide (IGZO) memcapacitor. First, the metal-oxide-semiconductor (MOS) capacitor with Pt/HfOx/n-IGZO structure exhibits analog, polarity-dependent, and reversible memcapacitance in capacitance-voltage (C-V), capacitance-time (C-t), and voltage-pulse measurements. When a positive voltage is applied repeatedly to the Pt electrode, the accumulation capacitance increases gradually and sequentially. The depletion capacitance also increases consequently. The capacitances are restored by repeatedly applying a negative voltage, confirming the reversible memcapacitance. The analog and reversible memcapacitance emulates the potentiation and depression synaptic motions. The synaptic thin-film transistor (TFT) with this memcapacitor also shows the synaptic motion with gradually increasing drain current by repeatedly applying the positive gate and drain voltages and reversibly decreasing one by applying the negative voltages, representing synaptic weight modulation. The reversible and analog conductance change in the transistor at both the voltage sweep and pulse operations is obtained through the memcapacitance and threshold voltage shift at the same time. These results demonstrate the synaptic transistor operations with a MOS memcapacitor gate stack consisting of Pt/HfOx/n-IGZO.

  10. Synaptic transistor with a reversible and analog conductance modulation using a Pt/HfOx/n-IGZO memcapacitor.

    PubMed

    Yang, Paul; Jun Kim, Hyung; Zheng, Hong; Won Beom, Geon; Park, Jong-Sung; Jung Kang, Chi; Yoon, Tae-Sik

    2017-06-02

    A synaptic transistor emulating the biological synaptic motion is demonstrated using the memcapacitance characteristics in a Pt/HfOx/n-indium-gallium-zinc-oxide (IGZO) memcapacitor. First, the metal-oxide-semiconductor (MOS) capacitor with Pt/HfOx/n-IGZO structure exhibits analog, polarity-dependent, and reversible memcapacitance in capacitance-voltage (C-V), capacitance-time (C-t), and voltage-pulse measurements. When a positive voltage is applied repeatedly to the Pt electrode, the accumulation capacitance increases gradually and sequentially. The depletion capacitance also increases consequently. The capacitances are restored by repeatedly applying a negative voltage, confirming the reversible memcapacitance. The analog and reversible memcapacitance emulates the potentiation and depression synaptic motions. The synaptic thin-film transistor (TFT) with this memcapacitor also shows the synaptic motion with gradually increasing drain current by repeatedly applying the positive gate and drain voltages and reversibly decreasing one by applying the negative voltages, representing synaptic weight modulation. The reversible and analog conductance change in the transistor at both the voltage sweep and pulse operations is obtained through the memcapacitance and threshold voltage shift at the same time. These results demonstrate the synaptic transistor operations with a MOS memcapacitor gate stack consisting of Pt/HfOx/n-IGZO.

  11. Effect of applied voltage on surface properties of anodised titanium in mixture of β-glycerophosphate (β-GP) and calcium acetate (CA)

    NASA Astrophysics Data System (ADS)

    Chuan, Lee Te; Rathi, Muhammad Fareez Mohamad; Abidin, Muhamad Yusuf Zainal; Abdullah, Hasan Zuhudi; Idris, Maizlinda Izwana

    2015-07-01

    Anodic oxidation is a surface modification method which combines electric field driven metal and oxygen ion diffusion for formation of oxide layer on the anode surface. This method has been widely used to modify the surface morphology of biomaterial especially titanium. This study aimed to investigate the effect of applied voltage on titanium. Specifically, the titanium foil was anodised in mixture of β-glycerophosphate disodium salt pentahydrate (β-GP) and calcium acetate monohydrate (CA) with different applied voltage (50-350 V), electrolyte concentration (0.04 M β-GP + 0.4 M CA), anodising time (10minutes) and current density (50 and 70 mA.cm-2) at room temperature. Surface oxide properties of anodised titanium were characterised by digital single-lens reflex camera (DSLR camera), field emission scanning electron microscope (FESEM) and atomic force microscopy (AFM). At lower applied voltage (≤150 V), surface of titanium foils were relatively smooth. With increasing applied voltage (≥250 V), the oxide layer became more porous and donut-shaped pores were formed on the surface of titanium foils. The AFM results indicated that the surface roughness of anodised titanium increases with increasing of applied voltage. The porous and rough surface is able to promote the osseointegration and reduce the suffering time of patient.

  12. Experimental investigation of SDBD plasma actuator driven by AC high voltage with a superimposed positive pulse bias voltage

    NASA Astrophysics Data System (ADS)

    Qi, Xiao-Hua; Yan, Hui-Jie; Yang, Liang; Hua, Yue; Ren, Chun-Sheng

    2017-08-01

    In this work, a driven voltage consisting of AC high voltage with a superimposed positive pulse bias voltage ("AC+ Positive pulse bias" voltage) is adopted to study the performance of a surface dielectric barrier discharge plasma actuator under atmospheric conditions. To compare the performance of the actuator driven by single-AC voltage and "AC+ Positive pulse bias" voltage, the actuator-induced thrust force and power consumption are measured as a function of the applied AC voltage, and the measured results indicate that the thrust force can be promoted significantly after superimposing the positive pulse bias voltage. The physical mechanism behind the thrust force changes is analyzed by measuring the optical properties, electrical characteristics, and surface potential distribution. Experimental results indicate that the glow-like discharge in the AC voltage half-cycle, next to the cycle where a bias voltage pulse has been applied, is enhanced after applying the positive pulse bias voltage, and this perhaps is the main reason for the thrust force increase. Moreover, surface potential measurement results reveal that the spatial electric field formed by the surface charge accumulation after positive pulse discharge can significantly affect the applied external electric field, and this perhaps can be responsible for the experimental phenomenon that the decrease of thrust force is delayed by pulse bias voltage action after the filament discharge occurs in the glow-like discharge region. The schlieren images further verify that the actuator-induced airflow velocity increases with the positive pulse voltage.

  13. Electrochromatographic retention of peptides on strong cation-exchange stationary phases.

    PubMed

    Nischang, Ivo; Höltzel, Alexandra; Tallarek, Ulrich

    2010-03-01

    We analyze the systematic and substantial electrical field-dependence of electrochromatographic retention for four counterionic peptides ([Met5]enkephalin, oxytocin, [Arg8]vasopressin, and luteinizing hormone releasing hormone (LHRH) ) on a strong cation-exchange (SCX) stationary phase. Our experiments show that retention behavior in the studied system depends on the charge-selectivity of the stationary phase particles, the applied voltage, and the peptides' net charge. Retention factors of twice positively charged peptides ([Arg8]vasopressin and LHRH at pH 2.7) decrease with increasing applied voltage, whereas lower charged peptides (oxytocin and [Met5]enkephalin at pH 2.7, [Arg8]vasopressin and LHRH at pH 7.0) show a concomitant increase in their retention factors. The observed behavior is explained on the basis of electrical field-induced concentration polarization (CP) that develops around the SCX particles of the packing. The intraparticle concentration of charged species (buffer ions, peptides) increases with increasing applied voltage due to diffusive backflux from the enriched CP zone associated with each SCX particle. For twice charged and on the SCX phase strongly retained peptides the local increase in mobile phase ionic strength reduces the electrostatic interactions with the stationary phase, which explains the decrease of retention factors with increasing applied voltage and CP intensity. Lower charged and weaker retained peptides experience a much stronger relative intraparticle enrichment than the twice-charged peptides, which results in a net increase of retention factors with increasing applied voltage. The CP-related contribution to electrochromatographic retention of peptides on the SCX stationary phase is modulated by the applied voltage, the mobile phase ionic strength, and the peptides' net charge and could be used for selectivity tuning in difficult separations.

  14. Macro Fiber Piezocomposite Actuator Poling Study

    NASA Technical Reports Server (NTRS)

    Werlink, Rudy J.; Bryant, Robert G.; Manos, Dennis

    2002-01-01

    The performance and advantages of Piezocomposite Actuators are to provide a low cost, in-situ actuator/sensor that is flexible, low profile and high strain per volt performance in the same plane of poled voltage. This paper extends reported data for the performance of these Macrofiber Composite (MFC) Actuators to include 4 progressively narrower Intedigitized electrode configurations with several line widths and spacing ratios. Data is reported for max free strain, average strain per applied volt, poling (alignment of the electric dipoles of the PZT ceramic) voltage vs. strain and capacitance, time to poling voltage 95% saturation. The output strain per volt progressively increases as electrode spacing decreases, with saturation occurring at lower poling voltages. The narrowest spacing ratio becomes prone to voltage breakdown or short circuits limiting the spacing width with current fabrication methods. The capacitance generally increases with increasing poling voltage level but has high sensitivity to factors such as temperature, moisture and time from poling which limit its usefulness as a simple indicator. The total time of applied poling voltage to saturate or fully line up the dipoles in the piezoceramic was generally on the order of 5-20 seconds. Less sensitivity to poling due to the applied rate of voltage increase over a 25 to 500 volt/second rate range was observed.

  15. Effect of applied voltage on surface properties of anodised titanium in mixture of β-glycerophosphate (β-GP) and calcium acetate (CA)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chuan, Lee Te, E-mail: gd130079@siswa.uthm.edu.my; Rathi, Muhammad Fareez Mohamad, E-mail: cd110238@siswa.uthm.edu.my; Abidin, Muhamad Yusuf Zainal, E-mail: cd110221@siswa.uthm.edu.my

    Anodic oxidation is a surface modification method which combines electric field driven metal and oxygen ion diffusion for formation of oxide layer on the anode surface. This method has been widely used to modify the surface morphology of biomaterial especially titanium. This study aimed to investigate the effect of applied voltage on titanium. Specifically, the titanium foil was anodised in mixture of β-glycerophosphate disodium salt pentahydrate (β-GP) and calcium acetate monohydrate (CA) with different applied voltage (50-350 V), electrolyte concentration (0.04 M β-GP + 0.4 M CA), anodising time (10minutes) and current density (50 and 70 mA.cm{sup −2}) at room temperature. Surfacemore » oxide properties of anodised titanium were characterised by digital single-lens reflex camera (DSLR camera), field emission scanning electron microscope (FESEM) and atomic force microscopy (AFM). At lower applied voltage (≤150 V), surface of titanium foils were relatively smooth. With increasing applied voltage (≥250 V), the oxide layer became more porous and donut-shaped pores were formed on the surface of titanium foils. The AFM results indicated that the surface roughness of anodised titanium increases with increasing of applied voltage. The porous and rough surface is able to promote the osseointegration and reduce the suffering time of patient.« less

  16. Observation of electric potential in organic thin-film transistor by bias-applied hard X-ray photoemission spectroscopy

    NASA Astrophysics Data System (ADS)

    Watanabe, Takeshi; Tada, Keisuke; Yasuno, Satoshi; Oji, Hiroshi; Yoshimoto, Noriyuki; Hirosawa, Ichiro

    2016-03-01

    The effect of gate voltage on electric potential in a pentacene (PEN) layer was studied by hard X-ray photoelectron spectroscopy under a bias voltage. It was observed that applying a negative gate voltage substantially increases the width of a C 1s peak. This suggested that injected and accumulated carriers in an organic thin film transistor channel modified the potential depth profile in PEN. It was also observed that the C 1s kinetic energy tends to increase monotonically with threshold voltage.

  17. Nanowire NMOS Logic Inverter Characterization.

    PubMed

    Hashim, Yasir

    2016-06-01

    This study is the first to demonstrate characteristics optimization of nanowire N-Channel Metal Oxide Semiconductor (NW-MOS) logic inverter. Noise margins and inflection voltage of transfer characteristics are used as limiting factors in this optimization. A computer-based model used to produce static characteristics of NW-NMOS logic inverter. In this research two circuit configuration of NW-NMOS inverter was studied, in first NW-NMOS circuit, the noise margin for (low input-high output) condition was very low. For second NMOS circuit gives excellent noise margins, and results indicate that optimization depends on applied voltage to the inverter. Increasing gate to source voltage with (2/1) nanowires ratio results better noise margins. Increasing of applied DC load transistor voltage tends to increasing in decreasing noise margins; decreasing this voltage will improve noise margins significantly.

  18. Effects of surface dielectric barrier discharge on aerodynamic characteristic of train

    NASA Astrophysics Data System (ADS)

    Dong, Lei; Gao, Guoqiang; Peng, Kaisheng; Wei, Wenfu; Li, Chunmao; Wu, Guangning

    2017-07-01

    High-speed railway today has become an indispensable means of transportation due to its remarkable advantages, including comfortability, convenience and less pollution. The increase in velocity makes the air drag become the main source of energy consumption, leading to receiving more and more concerns. The surface dielectric barrier discharge has shown some unique characteristics in terms of active airflow control. In this paper, the influences of surface dielectric barrier discharge on the aerodynamic characteristics of a scaled train model have been studied. Aspects of the discharge power consumption, the temperature distribution, the velocity of induced flow and the airflow field around the train model were considered. The applied AC voltage was set in the range of 20 kV to 28 kV, with a fixed frequency of 9 kHz. Results indicated that the discharge power consumption, the maximum temperature and the induced flow velocity increased with increasing applied voltage. Mechanisms of applied voltage influencing these key parameters were discussed from the point of the equivalent circuit. The airflow field around the train model with different applied voltages was observed by the smoke visualization experiment. Finally, the effects of surface dielectric barrier discharge on the train drag reduction with different applied voltages were analyzed.

  19. Two-stage electrostatic precipitator using induction charging

    NASA Astrophysics Data System (ADS)

    Takashima, Kazunori; Kohno, Hiromu; Katatani, Atsushi; Kurita, Hirofumi; Mizuno, Akira

    2018-05-01

    An electrostatic precipitator (ESP) without using corona discharge was investigated herein. The ESP employed a two-stage configuration, consisting of an induction charging-based particle charger and a parallel plate type particle collector. By applying a high voltage of several kV, under which no corona discharge was generated in the charger, particles were charged by induction due to contact with charger electrodes. The amount of charge on the charged particles increased with the applied voltage and turbulent air flow in the charger. Performance of the ESP equipped with the induction charger was investigated using ambient air. The removal efficiency for particles ranging 0.3 µm to 5 µm in diameter increased with applied voltage and turbulence intensity of gas flow in the charger when the applied voltage was sufficiently low not to generate corona discharge. This suggests that induction charging can be used for electrostatic precipitation, which can reduce ozone generation and power consumption significantly.

  20. Characteristics of electroluminescence phenomenon in virgin and thermally aged LDPE

    NASA Astrophysics Data System (ADS)

    Bani, N. A.; Abdul-Malek, Z.; Ahmad, H.; Muhammad-Sukki, F.; Mas'ud, A. A.

    2015-08-01

    High voltage cable requires a good insulating material such as low density polyethylene (LDPE) to be able to operate efficiently in high voltage stresses and high temperature environment. However, any polymeric material will experience degradation after prolonged application of high electrical stresses or other extreme conditions. The continuous degradation will shorten the life of a cable therefore further understanding on the behaviour of the aged high voltage cable needs to be undertaken. This may be observed through electroluminescence (EL) measurement. EL occurs when a solid-state material is subjected to a high electrical field stress and associated with the generation of charge carriers within the polymeric material and that these charges can be produced by injection, de-trapping and field-dissociation at the metal-polymer interface. The behaviour of EL emission can be affected by applied field, applied frequency, ageing time, ageing temperature and types of materials, among others. This paper focuses on the measurement of EL emission of additive-free LDPE thermally aged at different temperature subjected to varying electric stresses at 50Hz. It can be observed that EL emission increases as voltage applied is increased. However, EL emission decreases as ageing temperature is increased for varying applied voltage.

  1. Effect of an alternating current electric field on Co(OH)2 periodic precipitation

    NASA Astrophysics Data System (ADS)

    Karam, Tony; Sultan, Rabih

    2013-02-01

    The present paper studies the effect of an alternating current (AC) electric field on Co(OH)2 Liesegang patterns. In the presence of an AC electric field, the band spacing increases with spacing number, but reaches a plateau at large spacing (or band) numbers. The band spacing increases with applied AC voltage, but to a much lesser extent than the effect of a DC electric field under the same applied voltage [see R. Sultan, R. Halabieh, Chem. Phys. Lett. 332 (2000) 331][1]. At low enough applied voltage, the band spacing increases with frequency. At higher voltages, the band spacing becomes independent of the field frequency. The effect of concentration of the inner electrolyte (Co2+), exactly opposes that observed under DC electric field; i.e., the band spacing decreases with increasing concentration. The dynamics were shown to be governed by a competitive scenario between the diffusion gradient and the alternating current electric field factor.

  2. Reliability Design for Neutron Induced Single-Event Burnout of IGBT

    NASA Astrophysics Data System (ADS)

    Shoji, Tomoyuki; Nishida, Shuichi; Ohnishi, Toyokazu; Fujikawa, Touma; Nose, Noboru; Hamada, Kimimori; Ishiko, Masayasu

    Single-event burnout (SEB) caused by cosmic ray neutrons leads to catastrophic failures in insulated gate bipolar transistors (IGBTs). It was found experimentally that the incident neutron induced SEB failure rate increases as a function of the applied collector voltage. Moreover, the failure rate increased sharply with an increase in the applied collector voltage when the voltage exceeded a certain threshold value (SEB cutoff voltage). In this paper, transient device simulation results indicate that impact ionization at the n-drift/n+ buffer boundary is a crucially important factor in the turning-on of the parasitic pnp transistor, and eventually latch-up of the parasitic thyristor causes SEB. In addition, the device parameter dependency of the SEB cutoff voltage was analytically derived from the latch-up condition of the parasitic thyristor. As a result, it was confirmed that reducing the current gain of the parasitic transistor, such as by increasing the n-drift region thickness d was effective in increasing the SEB cutoff voltage. Furthermore, `white' neutron-irradiation experiments demonstrated that suppressing the inherent parasitic thyristor action leads to an improvement of the SEB cutoff voltage. It was confirmed that current gain optimization of the parasitic transistor is a crucial factor for establishing highly reliable design against chance failures.

  3. Determination of electrostatic force and its characteristics based on phase difference by amplitude modulation atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Wang, Kesheng; Cheng, Jia; Yao, Shiji; Lu, Yijia; Ji, Linhong; Xu, Dengfeng

    2016-12-01

    Electrostatic force measurement at the micro/nano scale is of great significance in science and engineering. In this paper, a reasonable way of applying voltage is put forward by taking an electrostatic chuck in a real integrated circuit manufacturing process as a sample, applying voltage in the probe and the sample electrode, respectively, and comparing the measurement effect of the probe oscillation phase difference by amplitude modulation atomic force microscopy. Based on the phase difference obtained from the experiment, the quantitative dependence of the absolute magnitude of the electrostatic force on the tip-sample distance and applied voltage is established by means of theoretical analysis and numerical simulation. The results show that the varying characteristics of the electrostatic force with the distance and voltage at the micro/nano scale are similar to those at the macroscopic scale. Electrostatic force gradually decays with increasing distance. Electrostatic force is basically proportional to the square of applied voltage. Meanwhile, the applicable conditions of the above laws are discussed. In addition, a comparison of the results in this paper with the results of the energy dissipation method shows the two are consistent in general. The error decreases with increasing distance, and the effect of voltage on the error is small.

  4. Dynamic characteristics of corona discharge generated under rainfall condition on AC charged conductors

    NASA Astrophysics Data System (ADS)

    Xu, Pengfei; Zhang, Bo; Wang, Zezhong; Chen, Shuiming; He, Jinliang

    2017-12-01

    By synchronous measurement of corona current and the water droplet deformation process on a conductor surface, different types of corona discharge are visualized when AC voltage is applied on a line-ground electrode system. The corona characteristics are closely related to the applied voltage and water supply rate. With the increase of AC voltage, the positive Taylor cone discharge firstly appears and then disappears, replaced by the dripping and crashing discharge. Furthermore, the number of pulses in each pulse train increases with the increase of applied voltage. The mechanism of the transfer from the positive Taylor cone discharge to the dripping and crashing discharge is found to be related to the oscillation process of the water droplet. The water supply rate also has a great influence on the characteristics of corona currents. The number of positive pulse trains increases linearly when the water supply rate gets larger, leading to a higher audible noise and radio interference level from the AC corona, which is quite different from that of the DC corona. The difference between the AC and DC coronas under rainfall conditions is analyzed finally.

  5. The effects of cathodic micro-voltage combined with hydrothermal pretreatment on methane fermentation of lignocellulose substrate

    NASA Astrophysics Data System (ADS)

    Liu, Dianxin; Ning, Ping; Qu, Guangfei; Huang, Xi; Liu, Yuhuan; Zhang, Jian

    2017-05-01

    The methane fermentation study assisted with cathodic micro-voltage was carried out to investigate the electric field effects on the fermentation of hydrothermally pretreated lignocellulose substrate. It was illustrated that a 0.25V cathode voltage and hydrothermal pretreatment could improve the biogas production, biogas quality and lignocellulose degradation ratio significantly. The cumulative biogas productions in the fermentation of hydrothermally pretreated cow dungs at 50°C, 150°C and 200°C with a 0.25V cathode voltage were observed in a total of 6640mL, 9218mL and 9456mL respectively over a detention time of 33 days. In comparison with the fermentation pretreated at 200°C without any voltage, nearly doubled of cumulative biogas production was obtained in the process of cathode-assisted fermentation. It was also observed that the daily methane content greater than or equal to 70% in the biogas generated with cathode voltage were clearly greater than that without voltages. Furthermore, the fermentation applied with a 0.25V cathode voltage had resulted into significant increases of 12.64% and 9.44% in lignin and cellulose degradation ratio relative to voltage free fermentation. And in the process of fermentation applied with cathode voltage, the final lignocellulose degradation ratio increased with the hydrothermal pretreatment temperature. Thus, the hydrothermal pretreatment and assisting fermentation with low cathode voltage can effectively promote the lignocellulose degradation. All results revealed that cathodic micro-voltage combined with hydrothermal pretreatment can remarkably improve the fermentation of lignocellulosic materials, indicating that a more effective fermentation technology can be developed by applying with cathodic micro-voltage.

  6. A Feasibility Study to Control Airfoil Shape Using THUNDER

    NASA Technical Reports Server (NTRS)

    Pinkerton, Jennifer L.; Moses, Robert W.

    1997-01-01

    The objective of this study was to assess the capabilities of a new out-of-plane displacement piezoelectric actuator called thin-layer composite-unimorph ferroelectric driver and sensor (THUNDER) to alter the upper surface geometry of a subscale airfoil to enhance performance under aerodynamic loading. Sixty test conditions, consisting of combinations of five angles of attack, four dc applied voltages, and three tunnel velocities, were studied in a tabletop wind tunnel. Results indicated that larger magnitudes of applied voltage produced larger wafer displacements. Wind-off displacements were also consistently larger than wind-on. Higher velocities produced larger displacements than lower velocities because of increased upper surface suction. Increased suction also resulted in larger displacements at higher angles of attack. Creep and hysteresis of the wafer, which were identified at each test condition, contributed to larger negative displacements for all negative applied voltages and larger positive displacements for the smaller positive applied voltage (+102 V). An elastic membrane used to hold the wafer to the upper surface hindered displacements at the larger positive applied voltage (+170 V). Both creep and hysteresis appeared bounded based on the analysis of several displacement cycles. These results show that THUNDER can be used to alter the camber of a small airfoil under aerodynamic loads.

  7. Preparation and characterization of oriented poly(vinyl alcohol)/carbon nanotube composite nanofibers

    NASA Astrophysics Data System (ADS)

    Shimizu, Akikazu; Kato, Hayato; Sato, Taiga; Kushida, Masahito

    2017-07-01

    Oriented nanofiber mats blended with carbon nanotubes (CNTs) are expected to be applied as cell seeding scaffolds. Biomaterials that are often used for cell seeding scaffolds generally have low mechanical strength and low electrical conductivity; thus, it has been difficult to apply them to tissues such as heart and nerve. In this study, we prepared oriented poly(vinyl alcohol) (PVA) nanofiber mats blended with various CNT concentrations (up to 10 wt %) by electrospinning using the parallel plate electrodes as collectors with applied voltage. The morphology, mechanical properties, and electrical properties of the prepared oriented nanofiber mats were measured by using various techniques such as scanning electron microscopy (SEM). The tensile strength of the oriented nanofiber mats in the applied voltage direction increased from 2.5 to 9.7 MPa with CNT concentration. Furthermore, the electrical conductivity of the oriented nanofiber mats in the applied voltage direction increased from 0.67 × 10-7 to 4.3 × 10-7 S·m-1. Also, the mechanical strength and electrical conductivity of the oriented nanofiber mats in the applied voltage direction were 3-4 and 2-3 times higher than those in the perpendicular direction, respectively.

  8. Two-dimensional numerical study of two counter-propagating helium plasma jets in air at atmospheric pressure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yan, Wen; Sang, Chaofeng; Wang, Dezhen, E-mail: wangdez@dlut.edu.cn

    In this paper, a computational study of two counter-propagating helium plasma jets in ambient air is presented. A two-dimensional fluid model is applied to investigate the physical processes of the two plasma jets interaction (PJI) driven by equal and unequal voltages, respectively. In all studied cases, the PJI results in a decrease of both plasma bullets propagation velocity. When the two plasma jets are driven by equal voltages, they never merge but rather approach each other around the middle of the gas gap at a minimum approach distance, and the minimal distance decreases with the increase of both the appliedmore » voltages and initial electron density, but increases with the increase of the relative permittivity. When the two plasma jets are driven by unequal voltages, we observe the two plasma jets will merge at the position away from the middle of the gas gap. The effect of applied voltage difference on the PJI is also studied.« less

  9. Selective Dirac voltage engineering of individual graphene field-effect transistors for digital inverter and frequency multiplier integrations

    NASA Astrophysics Data System (ADS)

    Sul, Onejae; Kim, Kyumin; Jung, Yungwoo; Choi, Eunsuk; Lee, Seung-Beck

    2017-09-01

    The ambipolar band structure of graphene presents unique opportunities for novel electronic device applications. A cycle of gate voltage sweep in a conventional graphene transistor produces a frequency-doubled output current. To increase the frequency further, we used various graphene doping control techniques to produce Dirac voltage engineered graphene channels. The various surface treatments and substrate conditions produced differently doped graphene channels that were integrated on a single substrate and multiple Dirac voltages were observed by applying a single gate voltage sweep. We applied the Dirac voltage engineering techniques to graphene field-effect transistors on a single chip for the fabrication of a frequency multiplier and a logic inverter demonstrating analog and digital circuit application possibilities.

  10. Selective Dirac voltage engineering of individual graphene field-effect transistors for digital inverter and frequency multiplier integrations.

    PubMed

    Sul, Onejae; Kim, Kyumin; Jung, Yungwoo; Choi, Eunsuk; Lee, Seung-Beck

    2017-09-15

    The ambipolar band structure of graphene presents unique opportunities for novel electronic device applications. A cycle of gate voltage sweep in a conventional graphene transistor produces a frequency-doubled output current. To increase the frequency further, we used various graphene doping control techniques to produce Dirac voltage engineered graphene channels. The various surface treatments and substrate conditions produced differently doped graphene channels that were integrated on a single substrate and multiple Dirac voltages were observed by applying a single gate voltage sweep. We applied the Dirac voltage engineering techniques to graphene field-effect transistors on a single chip for the fabrication of a frequency multiplier and a logic inverter demonstrating analog and digital circuit application possibilities.

  11. Thermal Assisted In Vivo Gene Electrotransfer

    PubMed Central

    Donate, Amy; Bulysheva, Anna; Edelblute, Chelsea; Jung, Derrick; Malik, Mohammad A.; Guo, Siqi; Burcus, Niculina; Schoenbach, Karl; Heller, Richard

    2016-01-01

    Gene electrotransfer is an effective approach for delivering plasmid DNA to a variety of tissues. Delivery of molecules with electric pulses requires control of the electrical parameters to achieve effective delivery. Since discomfort or tissue damage may occur with high applied voltage, the reduction of the applied voltage while achieving the desired expression may be an important improvement. One possible approach is to combine electrotransfer with exogenously applied heat. Previous work performed in vitro demonstrated that increasing temperature before pulsing can enhance gene expres sion and made it possible to reduce electric fields while maintaining expression levels. In the study reported here, this combination was evaluated in vivo using a novel electrode device designed with an inserted laser for application of heat. The results obtained in this study demonstrated that increased temperature during electrotransfer increased expression or maintained expression with a reduction in applied voltage. With further optimization this approach may provide the basis for both a novel method and a novel instrument that may greatly enhance translation of gene electrotransfer. PMID:27029944

  12. Virtual cathode emission of an annular cold cathode

    NASA Astrophysics Data System (ADS)

    Park, S.-d.; Kim, J.-h.; Han, J.; Yoon, M.; Park, S. Y.; Choi, D. W.; Shin, J. W.; So, J. H.

    2009-11-01

    Recent measurement of voltage V and current I of the electron gun of a relativistic klystron amplifier revealed that the resulting current-voltage relationship appeared to differ from the usual Child-Langmuir law (I∝V3/2) especially during the initial period of voltage increase. This paper attempts to explain this deviation by examining the emission mechanism using particle-in-cell simulation. The emission area in the cathode increased stepwise as the applied voltage increased and within each step the current and voltage followed the Child-Langmuir law. The electron emission began when the voltage reached a threshold, and the perveance increased with the emission area. Furthermore, an apparent virtual cathode was formed which was larger than the cathode tip. This occurs because, above a certain voltage, the emission from the edge and the side of the cathode surface dominates the emission from the front-end surface.

  13. Fabrication and Characterization of Plasma Electrolytic Borocarburized Layers on Q235 Low-Carbon Steel at Different Discharge Voltages

    NASA Astrophysics Data System (ADS)

    Wang, Bin; Wu, Jie; Jin, Xiaoyue; Wu, Xiaoling; Wu, Zhenglong; Xue, Wenbin

    The influence of applied voltage on the plasma electrolytic borocarburizing (PEB/C) layer of Q235 low-carbon steel in high-concentration borax solution was investigated. XRD and XPS spectra of PEB/C layer confirmed that the modified boride layer mainly consisted of Fe2B phase, and the FeB phase only exists in the loose top layer. The applied voltage on Q235 steel played a key role in determining the properties of hardened layers. The thickness and microhardness of boride layers increased with the increase of the applied voltage, which led to superior corrosion and wear resistances of Q235 low-carbon steel. The diffusion coefficient (D) of boride layer at 280, 300 and 330V increased with borocarburizing temperature and ranged from 0.062×10-12m2/s to 0.462×10-12m2/s. The activation energy (Q) of boride layer growth during PEB/C treatment was only 52.83kJṡmol-1, which was much lower than that of the conventional boriding process.

  14. Experimental investigation on On-Off current ratio behavior near onset voltage for a pentacene based organic thin film transistor

    NASA Astrophysics Data System (ADS)

    Amrani, Aumeur El; Es-saghiri, Abdeljabbar; Boufounas, El-Mahjoub; Lucas, Bruno

    2018-06-01

    The performance of a pentacene based organic thin film transistor (OTFT) with polymethylmethacrylate as a dielectric insulator and indium tin oxide based electrical gate is investigated. On the one hand, we showed that the threshold voltage increases with gate voltage, and on the other hand that it decreases with drain voltage. Thus, we noticed that the onset voltage shifts toward positive voltage values with the drain voltage increase. In addition, threshold-onset differential voltage (TODV) is proposed as an original approach to estimate an averaged carrier density in pentacene. Indeed, a value of about 4.5 × 1016 cm-3 is reached at relatively high gate voltage of -50 V; this value is in good agreement with that reported in literature with other technique measurements. However, at a low applied gate voltage, the averaged pentacene carrier density remains two orders of magnitude lower; it is of about 2.8 × 1014 cm-3 and remains similar to that obtained from space charge limited current approach for low applied bias voltage of about 2.2 × 1014 cm-3. Furthermore, high IOn/IOff and IOn/IOnset current ratios of 5 × 106 and 7.5 × 107 are reported for lower drain voltage, respectively. The investigated OTFTs also showed good electrical performance including carrier mobility increasing with gate voltage; mobility values of 4.5 × 10-2 cm2 V-1 s-1 and of 4.25 × 10-2 cm2 V-1 s-1 are reached for linear and saturation regimes, respectively. These results remain enough interesting since current modulation ratio exceeds a value of 107 that is a quite important requirement than high mobility for some particular logic gate applications.

  15. DLC Film Formation Technologies by Applying Pulse Voltage Coupled with RF Voltage to Complicated 3-dimensional Substrates and Industrial Application

    NASA Astrophysics Data System (ADS)

    Suzuki, Yasuo

    A uniform plasma-based ion implantation and DLC film formation technologies on the surface of complicated 3-dimensional substrates have been developed by applying pulse voltage coupled with RF voltage to the substrates such as plastics, rubber as well as metals with the similar deposition rate. These technologies are widely applicable to both ion implantation and DLC film formation onto the automobile parts, mechanical parts and metal molds. A problem to be solved is reducing cost. The deposition rate of DLC films is expected to increase to around 10μm/hr, which is ten times larger than that of the conventional method, by hybridizing the ICP (Induction Coupling Plasma) with a plus-minus voltage source. This epoch-making technology will be able to substitute for the electro-plating method in the near future. In this paper, the DLC film formation technology by applying both RF and pulse voltage, its applications and its prospect are presented.

  16. An investigation on the effects of air on electron energy in atmospheric pressure helium plasma jets

    NASA Astrophysics Data System (ADS)

    Liu, Yadi; Tan, Zhenyu; Chen, Xinxian; Li, Xiaotong; Zhang, Huimin; Pan, Jie; Wang, Xiaolong

    2018-03-01

    In this work, the effects of air on electron energy in the atmospheric pressure helium plasma jet produced by a needle-plane discharge system have been investigated by means of the numerical simulation based on a two-dimensional fluid model, and the air concentration dependences of the reactive species densities have also been calculated. In addition, the synergistic effects of the applied voltage and air concentration on electron energy have been explored. The present work gives the following significant results. For a fixed applied voltage, the averaged electron energy is basically a constant at air concentrations below about 0.5%, but it evidently decreases above the concentration of 0.5%. Furthermore, the averaged densities of four main reactive species O, O(1D), O2(1Δg), and N2(A3Σu+) increase with the increasing air concentration, but the increase becomes slow at air concentrations above 0.5%. The air concentration dependences of the averaged electron energy under different voltage amplitudes are similar, and for a given air concentration, the averaged electron energy increases with the increase in the voltage amplitude. For the four reactive species, the effects of the air concentration on their averaged densities are similar for a given voltage amplitude. In addition, the averaged densities of the four reactive species increase with increasing voltage amplitude for a fixed air concentration. The present work suggests that a combination of high voltage amplitude and the characteristic air concentration, 0.5% in the present discharge system, allows an expected electron energy and also generates abundant reactive species.

  17. Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage.

    PubMed

    Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh

    2016-08-10

    This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.

  18. Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage

    PubMed Central

    Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh

    2016-01-01

    This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively. PMID:28773801

  19. Effects of Voltage on Microstructure and Corrosion Resistance of Micro-arc Oxidation Ceramic Coatings Formed on KBM10 Magnesium Alloy

    NASA Astrophysics Data System (ADS)

    Lu, J. P.; Cao, G. P.; Quan, G. F.; Wang, C.; Zhuang, J. J.; Song, R. G.

    2018-01-01

    Micro-arc oxidation (MAO) coatings on KBM10 magnesium alloy were prepared in an electrolyte system with sodium silicate, potassium hydroxide, sodium tungstate, and citric acid. The effects of voltage on the microstructure and corrosion resistance of MAO coatings were studied using stereoscopic microscopy, scanning electron microscopy, x-ray diffraction, scratch tests, potentiodynamic polarization, and electrochemical impedance spectroscopy. The results showed that the roughness of the MAO coatings, diameter, and number of pores increase with the increase in voltage. The coating formed at the voltage of 350 V exhibited the best adhesive strength when evaluated by the automatic scratch tester. The coatings were mainly composed of MgO, MgWO4, and Mg2SiO4, and the content of Mg2SiO4 increased with the increase in voltage. The corrosion resistance of MAO coatings could be improved by changing the applied voltage, and the best corrosion resistance of MAO coating was observed at the voltage of 350 V.

  20. Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

    PubMed

    Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

    2016-11-14

    Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

  1. Voltage-sensitive rhodol with enhanced two-photon brightness.

    PubMed

    Kulkarni, Rishikesh U; Kramer, Daniel J; Pourmandi, Narges; Karbasi, Kaveh; Bateup, Helen S; Miller, Evan W

    2017-03-14

    We have designed, synthesized, and applied a rhodol-based chromophore to a molecular wire-based platform for voltage sensing to achieve fast, sensitive, and bright voltage sensing using two-photon (2P) illumination. Rhodol VoltageFluor-5 (RVF5) is a voltage-sensitive dye with improved 2P cross-section for use in thick tissue or brain samples. RVF5 features a dichlororhodol core with pyrrolidyl substitution at the nitrogen center. In mammalian cells under one-photon (1P) illumination, RVF5 demonstrates high voltage sensitivity (28% ΔF/F per 100 mV) and improved photostability relative to first-generation voltage sensors. This photostability enables multisite optical recordings from neurons lacking tuberous sclerosis complex 1, Tsc1, in a mouse model of genetic epilepsy. Using RVF5, we show that Tsc1 KO neurons exhibit increased activity relative to wild-type neurons and additionally show that the proportion of active neurons in the network increases with the loss of Tsc1. The high photostability and voltage sensitivity of RVF5 is recapitulated under 2P illumination. Finally, the ability to chemically tune the 2P absorption profile through the use of rhodol scaffolds affords the unique opportunity to image neuronal voltage changes in acutely prepared mouse brain slices using 2P illumination. Stimulation of the mouse hippocampus evoked spiking activity that was readily discerned with bath-applied RVF5, demonstrating the utility of RVF5 and molecular wire-based voltage sensors with 2P-optimized fluorophores for imaging voltage in intact brain tissue.

  2. Fundamental investigation of vacuum PD tubes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Suyama, M.; Hirano, K.; Asakura, N.

    1994-08-01

    As a fundamental study of photodiodes (PDs) for electron bombardment, two types of PDs have been experimentally investigated to be applied in electron tubes. A PD bombarded from the front surface (FB-PD), where pn junction of planer structure existed, was evaluated to measure fast response characteristics such as 2.1ns in rise time, however, more than an order of magnitude increase of dark current was also confirmed after a long term stability test of 1,000 hours. On the other hand, a PD bombarded by electrons from the rear surface (RB-PD) showed no increase of dark current after the stability test andmore » fast rise time of 2.7ns. However, it was clarified that the rise time of RB-PD depended on applied voltage to the PD, and applied voltage of 200 V was necessary to achieve such fast response. Since it was a much higher voltage than expected, some modifications may be necessary to achieve fast response with lower applied voltage, considering the yield of the PDs. Comparison of two types of PDs on some other characteristics are discussed. Preliminary test results of an electron bombardment APD are also discussed.« less

  3. Arc Voltage Between Deion Grid Affected by Division of Arc in Magnetic Driven Arc

    NASA Astrophysics Data System (ADS)

    Inuzuka, Yutaro; Yamato, Takashi; Yamamoto, Shinji; Iwao, Toru

    2016-10-01

    Magnetic driven arc has been applied to DC breaker and fault current limiters. However, it has not been researched, especially stagnation and re-strike of the arc. In this paper, the arc voltage between deion grid affected by division of arc in magnetic driven arc and arc behavior are measured by using the oscilloscope and HSVC (High Speed Video Camera). As a result, arc voltage increased because of division of the arc. The arc mean moving speed increases with increasing the external magnetic field. However, when the arc was not stalemate, the arc moving speed does not change so much. The arc re-strike time increases and stalemate time decreases with increasing the external magnetic field. Therefore, the anode spot moving speed increases 8 times because arc re-strike occurs easily with the external magnetic field. Thus, the erosion of electrodes decreases and the arc movement becomes the smooth. When the arc is divided, the arc voltage increased because of the electrode fall voltage. Therefore, the arc voltage increases with increasing the number of deion grid.

  4. [Study on the micellar electrokinetic capillary chromatography (MECC) for several water soluble vitamins].

    PubMed

    Li, X; He, J

    1997-03-01

    In the paper, the influences of the concentration of sodium dodecyl sulphate (SDS) and borax (Na2B4O7), pH value and applied voltage on the MECC of water soluble vitamins--VB1, VB2, VB6, VB12 and VC in fused silica capillary were studied. In the system of SDS-Na2B4O7, the retention times of the vitamins mentioned above increase with the increase of concentration of SDS and Na2B4O7. But if SDS concentration is too high the separation will become worse, and if Na2B4O7 concentration is too high the peak will be broad because the increase of retention time will lead to the increase of diffusion of molecules. With the pH increasing, the separation efficiency is always increasing. The change of the applied voltage has little effect on the separation efficiency. However, at higher pH and applied voltage, the high ionic strength and large current will produce more Joule heat and cause higher background noise. The optimum run buffer for this separation contains 18mmol/L Na2B4O7 and 25mmol/L SDS, with pH at 8.5 by adjusted with hydrochloric acid. The separation was completed within 4min at an applied voltage of 14.0kV. The separation efficiencies ranged from 1.1 x 10(5) to 2.4 x 10(5) theoretical plates/meter. The application of this method to drug analysis is demonstrated.

  5. Ultrasteep Voltage Dependence in a Membrane Channel

    NASA Astrophysics Data System (ADS)

    Mangan, Patrick S.; Colombini, Marco

    1987-07-01

    A mechanism for regulating voltage-gated channels is presented. The treatment amplifies the effect of the applied membrane potential resulting in a dramatic increase in the channel's voltage dependence. Addition of a large polyvalent anion to the medium bathing a phospholipid bilayer containing the voltage-dependent channel from the mitochondrial outer membrane, VDAC, induced up to a 12-fold increase in the channel's voltage sensitivity. The highest polyvalent anion concentration tested resulted in an e-fold conductance change for a 0.36-mV change in membrane potential. On the low end, a concentration of 2 μ M resulted in a 50% increase in VDAC voltage dependence. A mechanism based on polyvalent anion accumulation in the access resistance region at the mouth of the pore is consistent with all findings. Perhaps the voltage dependence of voltage-gated channels is amplified in vivo by polyvalent ions. If so, the control of excitable phenomena may be under much finer regulation than that provided by membrane potential alone.

  6. [Desulphurization with multi-needle-water film electrodes by corona discharge].

    PubMed

    Huang, Xu-ran; Li, Guo-feng; Li, Jie; Wu, Yan

    2008-09-01

    The study of this paper adopted stainless steel multi-needle as a high voltage electrode system, and water film as low voltage electrode. The electrodes were supplied with negative DC high voltage. Polluted gas containing sulfur dioxide (SO2) flowed into the corona discharge field from the center of the high voltage electrode system in an axis direction, then get across the water surface. Under the effect of corona discharge plasma and water absorption, SO2 was removed by converting it into sulfuric acid. The effect of the three factors which were the applied voltage, SO2 inlet concentration and duration of the exposure to the corona discharge on desulphurization efficiency has been studied mostly. Moreover, the concentrations of SO3(2-) and SO4(2-) ions in the water were measured and the mechanism of desulphurization was analyzed. The results showed that there was a synergistic effect on the removal of SO2 when combining corona discharge and water absorption, and both the desulphurization efficiency and the amount of sulfuric acid increased evidently. As the applied voltage and the duration increased, the desulphurization efficiency increased. Also, the SO2 inlet concentration had effect on desulphurization efficiency. When the SO2 inlet concentration was 430 x 10(-6), the voltage was 14.5 kV and the duration was 7.5 s, a desulphurization efficiency of more than 90% could be attained.

  7. Ion peak narrowing by applying additional AC voltage (ripple voltage) to FAIMS extractor electrode.

    PubMed

    Pervukhin, Viktor V; Sheven, Dmitriy G

    2010-01-01

    The use of a non-uniform electric field in a high-field asymmetric waveform ion mobility spectrometry (FAIMS) analyzer increases sensitivity but decreases resolution. The application of an additional AC voltage to the extractor electrode ("ripple" voltage, U(ripple)) can overcome this effect, which decreases the FAIMS peak width. In this approach, the diffusion ion loss remains minimal in the non-uniform electric field in the cylindrical part of the device, and all ion losses under U(ripple) occur in a short portion of their path. Application of the ripple voltage to the extractor electrode is twice as efficient as the applying of U(ripple) along the total length of the device. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

  8. Removal of phenol by activated alumina bed in pulsed high-voltage electric field.

    PubMed

    Zhu, Li-nan; Ma, Jun; Yang, Shi-dong

    2007-01-01

    A new process for removing the pollutants in aqueous solution-activated alumina bed in pulsed high-voltage electric field was investigated for the removal of phenol under different conditions. The experimental results indicated the increase in removal rate with increasing applied voltage, increasing pH value of the solution, aeration, and adding Fe2+. The removal rate of phenol could reach 72.1% when air aeration flow rate was 1200 ml/min, and 88.2% when 0.05 mmol/L Fe2+ was added into the solution under the conditions of applied voltage 25 kV, initial phenol concentration of 5 mg/L, and initial pH value 5.5. The addition of sodium carbonate reduced the phenol removal rate. In the pulsed high-voltage electric field, local discharge occurred at the surface of activated alumina, which promoted phenol degradation in the thin water film. At the same time, the space-time distribution of gas-liquid phases was more uniform and the contact areas of the activated species generated from the discharge and the pollutant molecules were much wider due to the effect of the activated alumina bed. The synthetical effects of the pulsed high-voltage electric field and the activated alumina particles accelerated phenol degradation.

  9. First principle study of transport properties of a graphene nano structure

    NASA Astrophysics Data System (ADS)

    Kumar, Naveen; Sharma, Munish; Sharma, Jyoti Dhar; Ahluwalia, P. K.

    2013-06-01

    The first principle quantum transport calculations have been performed for graphene using Tran SIESTA which calculates transport properties using nonequilibrium Green's function method in conjunction with density-functional theory. Transmission functions, electron density of states and current-voltage characteristic have been calculated for a graphene nano structure using graphene electrodes. Transmission function, density of states and projected density of states show a discrete band structure which varies with applied voltage. The value of current is very low for applied voltage between 0.0 V to 5.0 V and lies in the range of pico ampere. In the V-I characteristic current shows non-linear fluctuating pattern with increase in voltage.

  10. A novel microfluidic valve controlledby induced charge electro-osmotic flow

    NASA Astrophysics Data System (ADS)

    Wang, Chengfa; Song, Yongxin; Pan, Xinxiang; Li, Dongqing

    2016-07-01

    In this paper, a novel microfluidic valve by utilizing induced charge electro-osmotic flow (ICEOF) is proposed and analyzed. The key part of the microfluidic valve is a Y-shaped microchannel. A small metal plate is placed at each corner of the junction of the Y-shaped microchannel. When a DC electrical field is applied through the channels, electro-osmotic flows occur in the channels, and two vortices will be formed near each of the metal plates due to the ICEOF. The two vortices behave like virtual ‘blocking columns’ to restrain and direct the flow in the Y-channel. In this paper, effects of the length of the metal plates, the applied voltages, the width of the microchannel, the zeta potential of the non-metal microchannel wall, and the orientation of the branch channels on the flow switching between two outlet channels are numerically investigated. The results show that the flow switching between the two outlet channels can be flexibly achieved by adjusting the applied DC voltages. The critical switching voltage (CSV), under which one outlet channel is closed, decreases with the increase in the metal plate length and the orientation angle of the outlet channels. The CSV, however, increases with the increase in the inlet voltage, the width of the microchannel, and the absolute value of the zeta potential of the non-metal microchannel wall. Compared with other types of micro-valves, the proposed micro-valve is simple in structure without any moving parts. Only a DC power source is needed for its actuation, thus it can operate automatically by controlling the applied voltages.

  11. Numerical study of the influence of applied voltage on the current balance factor of single layer organic light-emitting diodes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Fei-ping, E-mail: lufp-sysu@163.com; Liu, Xiao-bin; Xing, Yong-zhong

    2014-04-28

    Current balance factor (CBF) value, the ratio of the recombination current density and the total current density of a device, has an important function in fluorescence-based organic light-emitting diodes (OLEDs), as well as in the performance of the organic electrophosphorescent devices. This paper investigates the influence of the applied voltage of a device on the CBF value of single layer OLED based on the numerical model of a bipolar single layer OLED with organic layer trap free and without doping. Results show that the largest CBF value can be achieved when the electron injection barrier (ϕ{sub n}) is equal tomore » the hole injection barrier (ϕ{sub p}) in the lower voltage region at any instance. The largest CBF in the higher voltage region can be achieved in the case of ϕ{sub n} > ϕ{sub p} under the condition of electron mobility (μ{sub 0n}) > hole mobility (μ{sub 0p}), whereas the result for the case of μ{sub 0n} < μ{sub 0p}, is opposite. The largest CBF when μ{sub 0n} = μ{sub 0p} can be achieved in the case of ϕ{sub n} = ϕ{sub p} in the entire region of the applied voltage. In addition, the CBF value of the device increases with increasing applied voltage. The results obtained in this paper can present an in-depth understanding of the OLED working mechanism and help in the future fabrication of high efficiency OLEDs.« less

  12. Effect of Processing Parameters on Pore Structure and Thickness of Anodic Aluminum Oxide (AAO) Tubular Membranes.

    PubMed

    Belwalkar, A; Grasing, E; Van Geertruyden, W; Huang, Z; Misiolek, W Z

    2008-07-01

    Nanoporous anodic aluminum oxide (AAO) tubular membranes were fabricated from aluminum alloy tubes in sulfuric and oxalic acid electrolytes using a two-step anodization process. The membranes were investigated for characteristics such as pore size, interpore distance and thickness by varying applied voltage and electrolyte concentration. Morphology of the membranes was examined using light optical and scanning electron microscopy and characterized using ImageJ software. Results showed that membranes having narrow pore size and uniform pore distribution with parallel channel arrays were obtained. The pore sizes were ranging from 14 to 24 nm and the wall thicknesses as high as 76 microm. It was found that the pore size increased in direct proportion with the applied voltage and inversely with the electrolyte concentration while the interpore distance increased linearly with the applied voltage. It was also observed that increase in acid concentration increased tubular membrane wall thickness that improved mechanical handling. By using anodic alumina technology, robust ceramic tubes with uniformly distributed pore-structure and parallel nano-channels of lengths and sizes practical for industrial applications were reliably produced in quantity.

  13. Effect of Processing Parameters on Pore Structure and Thickness of Anodic Aluminum Oxide (AAO) Tubular Membranes

    PubMed Central

    Belwalkar, A.; Grasing, E.; Huang, Z.; Misiolek, W.Z.

    2008-01-01

    Nanoporous anodic aluminum oxide (AAO) tubular membranes were fabricated from aluminum alloy tubes in sulfuric and oxalic acid electrolytes using a two-step anodization process. The membranes were investigated for characteristics such as pore size, interpore distance and thickness by varying applied voltage and electrolyte concentration. Morphology of the membranes was examined using light optical and scanning electron microscopy and characterized using ImageJ software. Results showed that membranes having narrow pore size and uniform pore distribution with parallel channel arrays were obtained. The pore sizes were ranging from 14 to 24 nm and the wall thicknesses as high as 76 µm. It was found that the pore size increased in direct proportion with the applied voltage and inversely with the electrolyte concentration while the interpore distance increased linearly with the applied voltage. It was also observed that increase in acid concentration increased tubular membrane wall thickness that improved mechanical handling. By using anodic alumina technology, robust ceramic tubes with uniformly distributed pore-structure and parallel nano-channels of lengths and sizes practical for industrial applications were reliably produced in quantity. PMID:19578471

  14. Numerical investigation of the effect of driving voltage pulse shapes on the characteristics of low-pressure argon dielectric barrier discharge

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eslami, E., E-mail: eeslami@iust.ac.ir; Barjasteh, A.; Morshedian, N.

    2015-06-15

    In this work, we numerically compare the effect of a sinusoidal, triangular, and rectangular pulsed voltage profile on the calculated particle production, electric current, and gas voltage in a dielectric barrier discharge. The total argon gas pressure of 400 Pa, the distance between dielectrics of 5 mm, the dielectric thickness of 0.7 mm, and the temperature of T = 300 K were considered as input parameters. The different driving voltage pulse shapes (triangular, rectangular, and sinusoidal) are considered as applied voltage with a frequency of 7 kHz and an amplitude of 700 V peak to peak. It is shown thatmore » applying a rectangular voltage, as compared with a sinusoidal or triangle voltage, increases the current peak, while the peak width is decreased. Higher current density is related to high production of charged particles, which leads to the generation of some highly active species, such as Ar* (4s level), and Ar** (4p level) in the gap.« less

  15. Single-Cell Electric Lysis on an Electroosmotic-Driven Microfluidic Chip with Arrays of Microwells

    PubMed Central

    Jen, Chun-Ping; Amstislavskaya, Tamara G.; Liu, Ya-Hui; Hsiao, Ju-Hsiu; Chen, Yu-Hung

    2012-01-01

    Accurate analysis at the single-cell level has become a highly attractive tool for investigating cellular content. An electroosmotic-driven microfluidic chip with arrays of 30-μm-diameter microwells was developed for single-cell electric lysis in the present study. The cellular occupancy in the microwells when the applied voltage was 5 V (82.4%) was slightly higher than that at an applied voltage of 10 V (81.8%). When the applied voltage was increased to 15 V, the cellular occupancy in the microwells dropped to 64.3%. More than 50% of the occupied microwells contain individual cells. The results of electric lysis experiments at the single-cell level indicate that the cells were gradually lysed as the DC voltage of 30 V was applied; the cell was fully lysed after 25 s. Single-cell electric lysis was demonstrated in the proposed microfluidic chip, which is suitable for high-throughput cell lysis. PMID:22969331

  16. A comprehensive study to evaluate the effect of constant low voltage iontophoresis on transungual delivery.

    PubMed

    Nair, Anroop B; Singh, Kishan; Shinu, Pottathil; Harsha, Sree; Al-Dhubiab, Bandar E

    2013-05-01

    Treatment of nail diseases by topical drug delivery continues to draw much attention in the recent days. This study aims to systematically investigate the effect of constant voltage iontophoresis in the transungual drug delivery, using ciclopirox as a model drug. Preliminary permeation studies were carried out by applying constant voltage (6 V for 24 h) using a gel formulation across the human nail plate in a Franz diffusion cell. Different protocols have been studied to authenticate the potential of the proposed technique. Antifungal studies were carried out to assess the pharmacodynamic effect of drug depot formed in the nail plate. Initial studies revealed that application of constant voltage iontophoresis enhanced the permeation by an order of magnitude (p = 0.019) and delivered significant amount of drug into the deeper nail layers. Noticeably higher permeation was observed during the active phase in on-off studies. Excellent correlation was observed in permeation (r(2) = 0.98) and drug load (r(2) = 0.97) with the increase in applied voltage (3-12 V), indicating that the current technique is predictable. The data observed suggest that any further increase in voltage could eventually lead to increase in the permeation and drug load, as the saturation level is very distant. Furthermore, the enhancement in permeation with the applied voltage (3-12 V) was found to be 6-20 folds, compared to the passive process. Results of step up and step down studies substantiated the viability of the current technique. Zone of inhibition measured during the antifungal studies demonstrated that the drug molecules loaded into the nail plate by low voltage iontophoresis is active and releases over an extended period of time (~32 days). Given the excellent results, the current technique could be used as an effective approach for the delivery of antimycotics, which would localize the drug at the infection site and potentially offer higher patient compliance.

  17. Voltage-sensitive rhodol with enhanced two-photon brightness

    PubMed Central

    Kulkarni, Rishikesh U.; Kramer, Daniel J.; Pourmandi, Narges; Karbasi, Kaveh; Bateup, Helen S.

    2017-01-01

    We have designed, synthesized, and applied a rhodol-based chromophore to a molecular wire-based platform for voltage sensing to achieve fast, sensitive, and bright voltage sensing using two-photon (2P) illumination. Rhodol VoltageFluor-5 (RVF5) is a voltage-sensitive dye with improved 2P cross-section for use in thick tissue or brain samples. RVF5 features a dichlororhodol core with pyrrolidyl substitution at the nitrogen center. In mammalian cells under one-photon (1P) illumination, RVF5 demonstrates high voltage sensitivity (28% ΔF/F per 100 mV) and improved photostability relative to first-generation voltage sensors. This photostability enables multisite optical recordings from neurons lacking tuberous sclerosis complex 1, Tsc1, in a mouse model of genetic epilepsy. Using RVF5, we show that Tsc1 KO neurons exhibit increased activity relative to wild-type neurons and additionally show that the proportion of active neurons in the network increases with the loss of Tsc1. The high photostability and voltage sensitivity of RVF5 is recapitulated under 2P illumination. Finally, the ability to chemically tune the 2P absorption profile through the use of rhodol scaffolds affords the unique opportunity to image neuronal voltage changes in acutely prepared mouse brain slices using 2P illumination. Stimulation of the mouse hippocampus evoked spiking activity that was readily discerned with bath-applied RVF5, demonstrating the utility of RVF5 and molecular wire-based voltage sensors with 2P-optimized fluorophores for imaging voltage in intact brain tissue. PMID:28242676

  18. Electrofluid hydrolysis enhances the production of fermentable sugars from corncob via in/reverse-phase induced voltage.

    PubMed

    Wu, Fengfeng; Jin, Yamei; Li, Dandan; Zhou, Yuyi; Guo, Lunan; Zhang, Mengyue; Xu, Xueming; Yang, Na

    2017-06-01

    To improve the economic value of lignocellulosic biomasses, an innovative electrofluidic technology has been applied to the efficient hydrolysis of corncob. The system combines fluidic reactors and induced voltages via magnetoelectric coupling effect. The excitation voltage had a positive impact on reducing sugar content (RSC). But, the increase of voltage frequency at 400-700Hz caused a slight decline of the RSC. Higher temperature limits the electrical effect on the hydrolysis at 70-80°C. The energy efficiency increased under the addition of metallic ions and series of in-phase induced voltage to promote hydrolysis. In addition, the 4-series system with in-phase and reverse-phase induced voltages under the synchronous magnetic flux, exhibited a significant influence on the RSC with a maximum increase of 56%. High throughput could be achieved by increasing series in a compact system. Electrofluid hydrolysis avoids electrochemical reaction, electrode corrosion, and sample contamination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Removal of sodium chloride from human urine via batch recirculation electrodialysis at constant applied voltage

    NASA Technical Reports Server (NTRS)

    Gordils-Striker, Nilda E.; Colon, Guillermo

    2003-01-01

    The removal of sodium chloride (NaCl) from human urine using a six-compartment electrodialysis cell with batch recirculation mode of operation for use in advanced life support systems (ALSS) was studied. From the results obtained, batch recirculation at constant applied voltage yields high values (approximately 94% of NaCl removal. Based on the results, the initial rate of NaCl removal was correlated to a power function of the applied voltage: -r=2.0 x 10(-4)E(3.8). With impedance spectroscopy methods, it was also found that the anion membranes were more affected by fouling with an increase of the ohmic resistance of almost 11% compared with 7.4% for the cationic ones.

  20. Characteristics and dispersity of a two gap capillary discharge applied for long spark gap ignition in air

    NASA Astrophysics Data System (ADS)

    Huang, Dong; Yang, Lanjun; Guo, Haishan; Zhang, Zhiyuan; Jiang, Hongqiu; Xu, Haipeng

    2017-07-01

    In this paper, the characteristics and dispersity of a two gap capillary (TGC) discharge applied for long spark gap ignition are studied. Under the same discharge condition, 30 repetitive discharges are done to get a certain number of data samples. Accordingly, the change trend of the characteristics and the dispersity with the charging voltage of C1 are analyzed statistically. The delay of soft capillary discharge is determined by the saturation rate of the magnetic core of the pulse transformer and decreases with the increase in the charging voltage. The main discharge delay decreases from 1.0 kV to 2.0 kV and stops the decreasing trend when the charging voltage increases to 2.5 kV. In contrast, the current amplitude of soft capillary discharge and main discharge increases with charging voltage. Long tail extinction is witnessed at the charging voltage of 1.0 kV and the major cause is the insufficient pressure in the post discharge. The waveform of the capillary arc resistivity is U-like shape and the minimum resistivity decreases with the increase in the charging voltage. Meanwhile, the arc resistivity in the ascending stage is much higher than that in the descending stage with the same value of the discharge current. The energy consumption of the TGC discharge can be mainly divided into four parts and more than 70% of the energy is consumed in main discharge.

  1. Carrier velocity effect on carbon nanotube Schottky contact

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fathi, Amir, E-mail: fathi.amir@hotmail.com; Ahmadi, M. T., E-mail: mt.ahmadi@urmia.ac.ir; Ismail, Razali, E-mail: Razali@fke.utm.my

    One of the most important drawbacks which caused the silicon based technologies to their technical limitations is the instability of their products at nano-level. On the other side, carbon based materials such as carbon nanotube (CNT) as alternative materials have been involved in scientific efforts. Some of the important advantages of CNTs over silicon components are high mechanical strength, high sensing capability and large surface-to-volume ratio. In this article, the model of CNT Schottky transistor current which is under exterior applied voltage is employed. This model shows that its current has a weak dependence on thermal velocity corresponding to themore » small applied voltage. The conditions are quite different for high bias voltages which are independent of temperature. Our results indicate that the current is increased by Fermi velocity, but the I–V curves will not have considerable changes with the variations in number of carriers. It means that the current doesn’t increase sharply by voltage variations over different number of carriers.« less

  2. Spin-dependent electrical conduction in a pentacene Schottky diode explored by electrically detected magnetic resonance

    NASA Astrophysics Data System (ADS)

    Fukuda, Kunito; Asakawa, Naoki

    2017-02-01

    Reported is the observation of dark spin-dependent electrical conduction in a Schottky barrier diode with pentacene (PSBD) using electrically detected magnetic resonance at room temperature. It is suggested that spin-dependent conduction exists in pentacene thin films, which is explored by examining the anisotropic linewidth of the EDMR signal and current density-voltage (J-V) measurements. The EDMR spectrum can be decomposed to Gaussian and Lorentzian components. The dependency of the two signals on the applied voltage was consistent with the current density-voltage (J-V) of the PSBD rather than that of the electron-only device of Al/pentacene/Al, indicating that the spin-dependent conduction is due to bipolaron formation associated with hole polaronic hopping processes. The applied-voltage dependence of the ratio of intensity of the Gaussian line to the Lorentzian may infer that increasing current density should make conducting paths more dispersive, thereby resulting in an increased fraction of the Gaussian line due to the higher dispersive g-factor.

  3. Organic semiconductor photodiode based on indigo carmine/n-Si for optoelectronic applications

    NASA Astrophysics Data System (ADS)

    Ganesh, V.; Manthrammel, M. Aslam; Shkir, Mohd.; Yahia, I. S.; Zahran, H. Y.; Yakuphanoglu, F.; AlFaify, S.

    2018-06-01

    The fabrication of indigo carmine/n-Si photodiode has been done, and a robust dark and photocurrent-voltage ( I- V), capacitance vs. voltage ( C-V) and conductance vs. voltage ( G-V) studies were done over a wide range of applied voltage and frequencies. The surface morphology was assessed by atomic force microscope (AFM), and the grain size was measured to be about 66 nm. The reverse current increased with both increasing illumination intensity and bias potential, whereas the forward current increased exponentially with bias potential. The responsivity value was also calculated. Barrier height and ideality factor of diode were estimated through a log (I) vs log (V) plot, and obtained to be 0.843 and 4.75 eV, respectively. The Vbi values are found between 0.95 and 1.2V for frequencies ranging between 100 kHz and 1 MHz. The value of R s is found to be lower at higher frequencies which may be due to a certain distribution of localized interface states. A strong frequency and voltage dependency were observed for interface states density N ss in the present indigo carmine/n-Si photodiode, and this explained the observed capacitance and resistance variation with frequency. These results suggest that the fabricated diode has the potential to be applied in optoelectronic devices.

  4. A high-precision voltage source for EIT

    PubMed Central

    Saulnier, Gary J; Liu, Ning; Ross, Alexander S

    2006-01-01

    Electrical impedance tomography (EIT) utilizes electrodes placed on the surface of a body to determine the complex conductivity distribution within the body. EIT can be performed by applying currents through the electrodes and measuring the electrode voltages or by applying electrode voltages and measuring the currents. Techniques have also been developed for applying the desired currents using voltage sources. This paper describes a voltage source for use in applied-voltage EIT that includes the capability of measuring both the applied voltage and applied current. A calibration circuit and calibration algorithm are described which enables all voltage sources in an EIT system to be calibrated to a common standard. The calibration minimizes the impact of stray shunt impedance, passive component variability and active component non-ideality. Simulation data obtained using PSpice are used to demonstrate the effectiveness of the circuits and calibration algorithm. PMID:16636413

  5. Hot-Electron-Induced Device Degradation during Gate-Induced Drain Leakage Stress

    NASA Astrophysics Data System (ADS)

    Kim, Kwang-Soo; Han, Chang-Hoon; Lee, Jun-Ki; Kim, Dong-Soo; Kim, Hyong-Joon; Shin, Joong-Shik; Lee, Hea-Beoum; Choi, Byoung-Deog

    2012-11-01

    We studied the interface state generation and electron trapping by hot electrons under gate-induced drain leakage (GIDL) stress in p-type metal oxide semiconductor field-effect transistors (P-MOSFETs), which are used as the high-voltage core circuit of flash memory devices. When negative voltage was applied to a drain in the off-state, a GIDL current was generated, but when high voltage was applied to the drain, electrons had a high energy. The hot electrons produced the interface state and electron trapping. As a result, the threshold voltage shifted and the off-state leakage current (trap-assisted drain junction leakage current) increased. On the other hand, electron trapping mitigated the energy band bending near the drain and thus suppressed the GIDL current generation.

  6. Zero temperature coefficient of resistance of the electrical-breakdown path in ultrathin hafnia

    NASA Astrophysics Data System (ADS)

    Zhang, H. Z.; Ang, D. S.

    2017-09-01

    The recent widespread attention on the use of the non-volatile resistance switching property of a microscopic oxide region after electrical breakdown for memory applications has prompted basic interest in the conduction properties of the breakdown region. Here, we report an interesting crossover from a negative to a positive temperature dependence of the resistance of a breakdown region in ultrathin hafnia as the applied voltage is increased. As a consequence, a near-zero temperature coefficient of resistance is obtained at the crossover voltage. The behavior may be modeled by (1) a tunneling-limited transport involving two farthest-spaced defects along the conduction path at low voltage and (2) a subsequent transition to a scattering-limited transport after the barrier is overcome by a larger applied voltage.

  7. Method for exciting inductive-resistive loads with high and controllable direct current

    DOEpatents

    Hill, Jr., Homer M.

    1976-01-01

    Apparatus and method for transmitting dc power to a load circuit by applying a dc voltage from a standard waveform synthesizer to duration modulate a bipolar rectangular wave generator. As the amplitude of the dc voltage increases, the widths of the rectangular wave generator output pulses increase, and as the amplitude of the dc voltage decreases, the widths of the rectangular wave generator output pulses decrease. Thus, the waveform synthesizer selectively changes the durations of the rectangular wave generator bipolar output pulses so as to produce a rectangular wave ac carrier that is duration modulated in accordance with and in direct proportion to the voltage amplitude from the synthesizer. Thereupon, by transferring the carrier to the load circuit through an amplifier and a rectifier, the load current also corresponds directly to the voltage amplitude from the synthesizer. To this end, the rectified wave at less than 100% duty factor, amounts to a doubled frequency direct voltage pulse train for applying a direct current to the load, while the current ripple is minimized by a high L/R in the load circuit. In one embodiment, a power transmitting power amplifier means having a dc power supply is matched to the load circuit through a transformer for current magnification without sacrificing load current duration capability, while negative voltage and current feedback are provided in order to insure good output fidelity.

  8. Evaluation of resistive switching properties of Si-rich oxide embedded with Ti nanodots by applying constant voltage and current

    NASA Astrophysics Data System (ADS)

    Ohta, Akio; Kato, Yusuke; Ikeda, Mitsuhisa; Makihara, Katsunori; Miyazaki, Seiichi

    2018-06-01

    We have studied the resistive switching behaviors of electron beam (EB) evaporated Si-rich oxide (SiO x ) sandwiched between Ni electrodes by applying a constant voltage and current. Additionally, the impact of Ti nanodots (NDs) embedded into SiO x on resistive switching behaviors was investigated because it is expected that NDs can trigger the formation of a conductive filament path in SiO x . The resistive switching behaviors of SiO x show that the response time during resistance switching was decreased by increasing the applied constant current or constant voltage. It was found that Ti-NDs in SiO x enhance the conductive filament path formation owing to electric field concentration by Ti-NDs.

  9. Surface Flashover on Epoxy-Resin Printed Circuit Boards in Vacuum under Electron Irradiation

    NASA Astrophysics Data System (ADS)

    Fujii, Haruhisa; Hasegawa, Taketoshi; Osuga, Hiroyuki; Matsui, Katsuaki

    This paper deals with the surface flashover characteristics of dielectric material in vacuum during electron beam irradiation in order to design adequately the conductive patterns on printed circuit boards used inside a spacecraft. The dielectric material, glass-fiber reinforced epoxy resin, and the electrodes printed on it were irradiated with electrons of the energy of 3-10 keV. DC high voltage was applied between the two electrodes during electron irradiation. The voltage was increased stepwise until the surface flashover occurred on the dielectric material. We obtained the results that the surface flashover voltage increased with the insulation distance between the electrodes but electron irradiation made the flashover voltage lower. The flashover voltage characteristics were obtained as parameters of the electrode distance and the energy of the electron beam.

  10. Piezoelectric transformers for low-voltage generation of gas discharges and ionic winds in atmospheric air

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, Michael J.; Go, David B., E-mail: dgo@nd.edu; Department of Chemical and Biomolecular Engineering, University of Notre Dame, Notre Dame, Indianapolis 46556

    To generate a gas discharge (plasma) in atmospheric air requires an electric field that exceeds the breakdown threshold of ∼30 kV/cm. Because of safety, size, or cost constraints, the large applied voltages required to generate such fields are often prohibitive for portable applications. In this work, piezoelectric transformers are used to amplify a low input applied voltage (<30 V) to generate breakdown in air without the need for conventional high-voltage electrical equipment. Piezoelectric transformers (PTs) use their inherent electromechanical resonance to produce a voltage amplification, such that the surface of the piezoelectric exhibits a large surface voltage that can generate corona-like dischargesmore » on its corners or on adjacent electrodes. In the proper configuration, these discharges can be used to generate a bulk air flow called an ionic wind. In this work, PT-driven discharges are characterized by measuring the discharge current and the velocity of the induced ionic wind with ionic winds generated using input voltages as low as 7 V. The characteristics of the discharge change as the input voltage increases; this modifies the resonance of the system and subsequent required operating parameters.« less

  11. Investigation on the energy spectrums of electrons in atmospheric pressure argon plasma jets and their dependences on the applied voltage

    NASA Astrophysics Data System (ADS)

    Chen, Xinxian; Tan, Zhenyu; Liu, Yadi; Li, Xiaotong; Pan, Jie; Wang, Xiaolong

    2017-08-01

    This work presents a systematical investigation on the spatiotemporal evolution of the energy spectrum of electrons in atmospheric pressure argon plasma jets and its dependence on the applied voltage. The investigations are carried out by means of the numerical simulation based on a particle-in-cell Monte-Carlo collision model. The characteristics of the spatiotemporal evolution of the energy spectrum of electrons (ESE) in the discharge space have been presented, and especially the mechanisms of inducing these characteristics have also been revealed. The present work shows the following conclusions. In the evolution of ESE, there is a characteristic time under each applied voltage. Before the characteristic time, the peak value of ESE decreases, the peak position shifts toward high energy, and the distribution of ESE becomes wider and wider, but the reverse is true after the characteristic time. The formation of these characteristics can be mainly attributed to the transport of electrons toward a low electric field as well as a balance between the energy gained from the electric field including the effect of space charges and the energy loss due to inelastic collisions in the process of electron transport. The characteristic time decreases with the applied voltage. In addition, the average energy of electrons at the characteristic time can be increased by enhancing the applied voltage. The results presented in this work are of importance for regulating and controlling the energy of electrons in the plasma jets applied to plasma medicine.

  12. Studies on transient characteristics of unipolar resistive switching processes in TiO2 thin film grown by atomic layer deposition

    NASA Astrophysics Data System (ADS)

    Sahu, Vikas Kumar; Das, Amit K.; Ajimsha, R. S.; Misra, P.

    2018-05-01

    The transient characteristics of resistive switching processes have been investigated in TiO2 thin films grown by atomic layer deposition (ALD) to study the temporal evolution of the switching processes and measure the switching times. The reset and set switching times of unipolar Au/TiO2/Pt devices were found to be ~250 µs and 180 ns, respectively in the voltage windows of 0.5–0.9 V for reset and 1.9–4.8 V for set switching processes, obtained from quasi-static measurements. The reset switching time decreased exponentially with increasing amplitude of applied reset voltage pulse, while the set switching time remained insensitive to the amplitude of the set voltage pulse. A fast reset process with a switching time of ~400 ns was achieved by applying a reset voltage of ~1.8 V, higher than that of the quasi-static reset voltage window but below the set voltage window. The sluggish reset process in TiO2 thin film and the dependence of the reset switching time on the amplitude of the applied voltage pulse was understood on the basis of a self-accelerated thermal dissolution model of conducting filaments (CFs), where a higher temperature of the CFs owing to enhanced Joule heating at a higher applied voltage imposes faster diffusion of oxygen vacancies, resulting in a shorter reset switching time. Our results clearly indicate that fast resistive switching with switching times in hundreds of nanoseconds can be achieved in ALD-grown TiO2 thin films. This may find applications in fast non-volatile unipolar resistive switching memories.

  13. Enhanced ozone production in a pulsed dielectric barrier discharge plasma jet with addition of argon to a He-O2 flow gas

    NASA Astrophysics Data System (ADS)

    Sands, Brian; Ganguly, Biswa; Scofield, James

    2013-09-01

    Ozone production in a plasma jet DBD driven with a 20-ns risetime unipolar pulsed voltage can be significantly enhanced using helium as the primary flow gas with an O2 coflow. The overvolted discharge can be sustained with up to a 5% O2 coflow at <20 kHz pulse repetition frequency at 13 kV applied voltage. Ozone production scales with the pulse repetition frequency up to a ``turnover frequency'' that depends on the O2 concentration, total gas flow rate, and applied voltage. For example, peak ozone densities >1016 cm-3 were measured with 3% O2 admixture and <3 W input power at a 12 kHz turnover frequency. A further increase in the repetition frequency results in increased discharge current and 777 nm O(5 P) emission, but decreased ozone production and is followed by a transition to a filamentary discharge mode. The addition of argon at concentrations >=5% reduces the channel conductivity and shifts the turnover frequency to higher frequencies. This results in increased ozone production for a given applied voltage and gas flow rate. Time-resolved Ar(1s5) and He(23S1) metastable densities were acquired along with discharge current and ozone density measurements to gain insight into the mechanisms of optimum ozone production.

  14. Positive temperature coefficient thermistors based on carbon nanotube/polymer composites

    PubMed Central

    Zeng, You; Lu, Guixia; Wang, Han; Du, Jinhong; Ying, Zhe; Liu, Chang

    2014-01-01

    In order to explore availability of carbon nanotube (CNT)-based positive temperature coefficient (PTC) thermistors in practical application, we prepared carbon nanotube (CNT) filled high density polyethylene (HDPE) composites by using conventional melt-mixing methods, and investigated their PTC effects in details. The CNT-based thermistors exhibit much larger hold current and higher hold voltage, increasing by 129% in comparison with the commercial carbon black (CB) filled HDPE thermistors. Such high current-bearing and voltage-bearing capacity for the CNT/HDPE thermistors is mainly attributed to high thermal conductivity and heat dissipation of entangled CNT networks. Moreover, the CNT/HDPE thermistors exhibit rapid electrical response to applied voltages, comparable to commercial CB-based thermistors. In light of their high current-bearing capacity and quick response, the CNT-based thermistors have great potential to be used as high-performance thermistors in practical application, especially in some critical circumstances of high temperature, large applied currents, and high applied voltages. PMID:25327951

  15. Discharge processes and an electrical model of atmospheric pressure plasma jets in argon

    NASA Astrophysics Data System (ADS)

    Fang, Zhi; Shao, Tao; Yang, Jing; Zhang, Cheng

    2016-01-01

    In this paper, an atmospheric pressure plasma discharge in argon was generated using a needle-to-ring electrode configuration driven by a sinusoidal excitation voltage. The electric discharge processes and discharge characteristics were investigated by inspecting the voltage-current waveforms, Lissajous curves and lighting emission images. The change in discharge mode with applied voltage amplitude was studied and characterised, and three modes of corona discharge, dielectric barrier discharge (DBD) and jet discharge were identified, which appeared in turn with increasing applied voltage and can be distinguished clearly from the measured voltage-current waveforms, light-emission images and the changing gradient of discharge power with applied voltage. Based on the experimental results and discharge mechanism analysis, an equivalent electrical model and the corresponding equivalent circuit for characterising the whole discharge processes accurately was proposed, and the three discharge stages were characterised separately. A voltage-controlled current source (VCCS) associated with a resistance and a capacitance were used to represent the DBD stage, and the plasma plume and corona discharge were modelled by a variable capacitor in series with a variable resistor. Other factors that can influence the discharge, such as lead and stray capacitance values of the circuit, were also considered in the proposed model. Contribution to the Topical Issue "Recent Breakthroughs in Microplasma Science and Technology", edited by Kurt Becker, Jose Lopez, David Staack, Klaus-Dieter Weltmann and Wei Dong Zhu.

  16. Electrosorption of As(III) in aqueous solutions with activated carbon as the electrode

    NASA Astrophysics Data System (ADS)

    Dai, Min; Xia, Ling; Song, Shaoxian; Peng, Changsheng; Rangel-Mendez, Jose Rene; Cruz-Gaona, Roel

    2018-03-01

    The electrosorption of As(III) in aqueous solutions by using activated carbon (AC) as the electrode was studied in this work. This study was performed through the measurements of adsorption and desorption, Cyclic Voltammetry (CV), Electrochemical Impedance Spectroscopy (EIS) and X-ray photoelectron spectra (XPS). Three parameters, applied voltage, solution pH and initial As(III) concentration, on the electrosoprtion of As(III) were investigated. The experimental results have demonstrated that the electrosorption followed three steps: migration of As(III) to the anode, oxidation of As(III) to As(V) and accumulation of As(V) in the electric double layers of the anode. The electrodorption capacity increased with increasing applied voltage and initial As(III) concentration, whereas the effect of pH was complicated for the variation of arsenite species and the competition of OH-. The oxidation of As(III) increased with the increasing voltage and pH due to the increasing redox potential acted on As(III). The electrosorption served to reduce the toxicity of arsenic and was a promising technology for As(III) removal from water.

  17. Apparatus and methods for memory using in-plane polarization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Junwei; Chang, Kai; Ji, Shuai-Hua

    A memory device includes a semiconductor layer with an in-plane polarization component switchable between a first direction and a second direction. A writing electrode is employed to apply a writing voltage to the semiconductor layer to change the in-plane polarization component between the first direction and the second direction. A reading electrode is employed to apply a reading voltage to the semiconductor layer to measure a tunneling current substantially perpendicular to the polarization direction of the in-plane polarization component. The directions of the reading voltage and the writing voltage are substantially perpendicular to each other. Therefore, the reading process ismore » non-destructive. Thin films (e.g., one unit cell thick) of ferroelectric material can be used in the memory device to increase the miniaturization of the device.« less

  18. Demagnetization using a determined estimated magnetic state

    DOEpatents

    Denis, Ronald J; Makowski, Nathanael J

    2015-01-13

    A method for demagnetizing comprising positioning a core within the electromagnetic field generated by a first winding until the generated first electrical current is not substantially increasing, thereby determining a saturation current. A second voltage, having the opposite polarity, is then applied across the first winding until the generated second electrical current is approximately equal to the magnitude of the determined saturation current. The maximum magnetic flux within the core is then determined using the voltage across said first winding and the second current. A third voltage, having the opposite polarity, is then applied across the first winding until the core has a magnetic flux equal to approximately half of the determined maximum magnetic flux within the core.

  19. Superconductivity in FeTe0.8S0.2 induced by battery-like reaction

    NASA Astrophysics Data System (ADS)

    Yamashita, Aichi; Demura, Satoshi; Tanaka, Masashi; Deguchi, Keita; Yamaki, Takuma; Hara, Hiroshi; Suzuki, Kouji; Zhang, Yunchao; Denholme, Saleem James; Okazaki, Hiroyuki; Fujioka, Masaya; Yamaguchi, Takahide; Takeya, Hiroyuki; Takano, Yoshihiko

    2014-12-01

    Superconductivity is successfully induced by utilizing a battery-like reaction found in a typical Li-ion battery. Excess Fe in FeTe0.8S0.2 is electrochemically de-intercalated by applying a voltage in a citric acid solution. The superconducting properties improve with an increase in the applied voltage up to 1.5 V. This result suggests that an electrochemical reaction can be used as a novel method to develop new superconducting materials.

  20. The dependency of adhesion and friction on electrostatic attraction

    NASA Astrophysics Data System (ADS)

    Persson, B. N. J.

    2018-04-01

    I develop a general mean-field theory for the influence of electrostatic attraction between two solids on the contact mechanics. I assume elastic solids with random surface roughness. I consider two cases, namely, with and without an electrically insulating layer between the conducting solids. The former case is important for, e.g., the finger-touch screen interaction. I study how the electrostatic attraction influences the adhesion and friction. For the case of an insulating layer, I find that when the applied nominal contact pressure is relatively small, as the applied voltage increases, there is a sharp increase in the contact area, and hence in the friction, at a critical voltage.

  1. Chiral tunneling modulated by a time-periodic potential on the surface states of a topological insulator

    PubMed Central

    Li, Yuan; Jalil, Mansoor B. A.; Tan, S. G.; Zhao, W.; Bai, R.; Zhou, G. H.

    2014-01-01

    Time-periodic perturbation can be used to modify the transport properties of the surface states of topological insulators, specifically their chiral tunneling property. Using the scattering matrix method, we study the tunneling transmission of the surface states of a topological insulator under the influence of a time-dependent potential and finite gate bias voltage. It is found that perfect transmission is obtained for electrons which are injected normally into the time-periodic potential region in the absence of any bias voltage. However, this signature of Klein tunneling is destroyed when a bias voltage is applied, with the transmission probability of normally incident electrons decreasing with increasing gate bias voltage. Likewise, the overall conductance of the system decreases significantly when a gate bias voltage is applied. The characteristic left-handed helicity of the transmitted spin polarization is also broken by the finite gate bias voltage. In addition, the time-dependent potential modifies the large-angle transmission profile, which exhibits an oscillatory or resonance-like behavior. Finally, time-dependent transport modes (with oscillating potential in the THz frequency) can result in enhanced overall conductance, irrespective of the presence or absence of the gate bias voltage. PMID:24713634

  2. Effects of an applied voltage on direct interspecies electron transfer via conductive materials for methane production.

    PubMed

    Lee, Jung-Yeol; Park, Jeong-Hoon; Park, Hee-Deung

    2017-10-01

    Direct interspecies electron transfer (DIET) between exoelectrogenic bacteria and methanogenic archaea via conductive materials is reported as an efficient method to produce methane in anaerobic organic waste digestion. A voltage can be applied to the conductive materials to accelerate the DIET between two groups of microorganisms to produce methane. To evaluate this hypothesis, two sets of anaerobic serum bottles with and without applied voltage were used with a pair of graphite rods as conductive materials to facilitate DIET. Initially, the methane production rate was similar between the two sets of serum bottles, and later the serum bottles with an applied voltage of 0.39V showed a 168% higher methane production rate than serum bottles without an applied voltage. In cyclic voltammograms, the characteristic redox peaks for hydrogen and acetate oxidation were identified in the serum bottles with an applied voltage. In the microbial community analyses, hydrogenotrophic methanogens (e.g. Methanobacterium) were observed to be abundant in serum bottles with an applied voltage, while methanogens utilizing carbon dioxide (e.g., Methanosaeta and Methanosarcina) were dominant in serum bottles without an applied voltage. Taken together, the applied voltage on conductive materials might not be effective to promote DIET in methane production. Instead, it appeared to generate a condition for hydrogenotrophic methanogenesis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. SU-F-T-554: Dark Current Effect On CyberKnife Beam Dosimetry

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, H; Chang, A

    Purpose: All RF linear accelerators produce dark current to varying degrees when an accelerating voltage and RF input is applied in the absence of electron gun injection. This study is to evaluate how dark current from the linear accelerator of CyberKnife affect the dose in the reference dosimetry. Methods: The G4 CyberKnife system with 6MV photon beam was used in this study. Using the ion chamber and the diode detector, the dose was measured in water with varying time delay between acquiring charges and staring beam-on after applying high-voltage into the linear accelerator. The dose was measured after the timemore » delay with over the range of 0 to 120 seconds in the accelerating high-voltage mode without beam-on, applying 0, 10, 50, 100, and 200 MUs. For the measurements, the collimator of 60 mm was used and the detectors were placed at the depths of 10 cm with the source-to-surface distance of 80 cm. Results: The dark current was constant over time regardless of MU. The dose due to the dark current increased over time linearly with the R-squared value of 0.9983 up to 4.4 cGy for the time 120 seconds. In the dose rate setting of 720 MU/min, the relative dose when applying the accelerating voltage without beam-on was increased over time up to 0.6% but it was less than the leakage radiation resulted from the accelerated head. As the reference dosimetry condition, when 100 MU was delivered after 10 seconds time delay, the relative dose increased by 0.7% but 6.7% for the low MU (10 MU). Conclusion: In the dosimetry using CyberKnife system, the constant dark current affected to the dose. Although the time delay in the accelerating high-voltage mode without beam-on is within 10 seconds, the dose less than 100 cGy can be overestimated more than 1%.« less

  4. Circuits and methods for impedance determination using active measurement cancelation

    DOEpatents

    Jamison, David K.

    2016-12-13

    A delta signal and opposite delta signal are generated such that a sum of the two signals is substantially zero. The delta signal is applied across a first set of electrochemical cells. The opposite delta signal is applied across a second set of electrochemical cells series connected to the first set. A first held voltage is established as the voltage across the first set. A second held voltage is established as the voltage across the second set. A first delta signal is added to the first held voltage and applied to the first set. A second delta signal is added to the second held voltage and applied to the second set. The current responses due to the added delta voltages travel only into the set associated with its delta voltage. The delta voltages and the current responses are used to calculate the impedances of their associated cells.

  5. Effects of applied voltages and dissolved oxygen on sustained power generation by microbial fuel cells.

    PubMed

    Oh, S E; Kim, J R; Joo, J-H; Logan, B E

    2009-01-01

    Oxygen intrusion into the anode chamber through proton exchange membrane can result in positive redox conditions in fed-batch, two chamber MFCs at the end of a cycle when the substrate is depleted. A slight increase in dissolved oxygen to 0.3 mg/L during MFC operation was not found to adversely affect power generation over subsequent cycles if sufficient substrate (acetate) was provided. Purging the anode chamber with air or pure oxygen for up to 10 days and 10 hrs also did not affect power generation, as power rapidly returned to previous levels when the chamber was sparged with nitrogen gas. When MFCs are connected in series, voltage reversal can occur resulting in a positive voltage applied to the anode biofilm. To investigate if this adversely affected the bacteria, voltages of 1, 2, 3, 4, and 9 V, were applied for 1 hr to the MFC before reconnecting it back to a fixed external load (1,000 Omega). A voltage of <2 V did not affect power generation. However, applying 3 V resulted in a 15 h lag phase before recovery, and 9 V produced a 60 h lag phase suggesting substantial damage to the bacteria that required re-growth of bacteria in the biofilm. These results indicate that charge reversal will be a more serious problem than oxygen intrusion into the anode chamber for sustained performance of MFCs.

  6. An electrohydrodynamic technique for rapid mixing in stationary droplets on digital microfluidic platforms.

    PubMed

    Samiei, Ehsan; de Leon Derby, Maria Diaz; den Berg, Andre Van; Hoorfar, Mina

    2017-01-17

    This paper presents an electrohydrodynamic technique for rapid mixing of droplets in open and closed digital microfluidic (DMF) platforms. Mixing is performed by applying a high frequency AC voltage to the coplanar or parallel electrodes, inducing circulation zones inside the droplet which results in rapid mixing of the content. The advantages of the proposed method in comparison to conventional mixing methods that operate based on transporting the droplet back and forth and side to side include 1) a shorter mixing time (as fast as 0.25 s), 2) the use of a fewer number of electrodes, reducing the size of the chip, and 3) the stationary nature of the technique which reduces the chance of cross-contamination and surface biofouling. Mixing using the proposed method is performed to create a uniform mixture after merging a water droplet with another droplet containing either particles or dye. The results show that increasing the frequency, and or the amplitude of the applied voltage, enhances the mixing process. However, actuation with a very high frequency and voltage may result in shedding pico-liter satellite droplets. Therefore, for each frequency there is an effective range of the amplitude which provides rapid mixing and avoids shedding satellite droplets. Also, the increase in the gap height between the two plates (for the closed DMF platforms) significantly enhances the mixing efficiency due to the lower viscous effects. Effects of the addition of salts and DNA to the samples were also studied. The electrothermal effect decreased for these cases, which was solved by increasing the frequency of the applied voltage. To assure the high frequency actuation does not increase the sample temperature excessively, the temperature change was monitored using a thermal imaging camera and it was found that the increase in temperature is negligible.

  7. Electric-field induced surface instabilities of soft dielectrics and their effects on optical transmittance and scattering

    NASA Astrophysics Data System (ADS)

    Shian, Samuel; Kjeer, Peter; Clarke, David R.

    2018-03-01

    When a voltage is applied to a percolative, mechanically compliant mat of carbon nanotubes (CNTs) on a smooth elastomer bilayer attached to an ITO coated glass substrate, the in-line optical transmittance decreases with increasing voltage. Two regimes of behavior have been identified based on optical scattering, bright field optical microscopy, and confocal optical microscopy. In the low field regime, the electric field produces a spatially inhomogeneous surface deformation of the elastomer that causes local variations in optical refraction and modulates the light transmittance. The spatial variation is associated with the distribution of the CNTs over the surface. At higher fields, above a threshold voltage, an array of pits in the surface form by a nucleation and growth mechanism and these also scatter light. The formation of pits, and creases, in the thickness of the elastomer, is due to a previously identified electro-mechanical surface instability. When the applied voltage is decreased from its maximum, the transmittance returns to its original value although there is a transmittance hysteresis and a complicated time response. When the applied voltage exceeds the threshold voltage, there can be remnant optical contrast associated with creasing of the elastomer and the recovery time appears to be dependent on local jamming of CNTs in areas where the pits formed. A potential application of this work as an electrically tunable privacy window or camouflaging devices is demonstrated.

  8. High Efficient THz Emission From Unbiased and Biased Semiconductor Nanowires Fabricated Using Electron Beam Lithography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Balci, Soner; Czaplewski, David A.; Jung, Il Woong

    Besides having perfect control on structural features, such as vertical alignment and uniform distribution by fabricating the wires via e-beam lithography and etching process, we also investigated the THz emission from these fabricated nanowires when they are applied DC bias voltage. To be able to apply a voltage bias, an interdigitated gold (Au) electrode was patterned on the high-quality InGaAs epilayer grown on InP substrate bymolecular beam epitaxy. Afterwards, perfect vertically aligned and uniformly distributed nanowires were fabricated in between the electrodes of this interdigitated pattern so that we could apply voltage bias to improve the THz emission. As amore » result, we achieved enhancement in the emitted THz radiation by ~four times, about 12 dB increase in power ratio at 0.25 THz with a DC biased electric field compared with unbiased NWs.« less

  9. Influence of gas flow and applied voltage on interaction of jets in a cross-field helium plasma jet array

    NASA Astrophysics Data System (ADS)

    Wan, Meng; Liu, Feng; Fang, Zhi; Zhang, Bo; Wan, Hui

    2017-09-01

    Atmospheric Pressure Plasma Jet arrays can greatly enhance the treatment area to fulfill the need for large-scale surface processing, while the spatial uniformity of the plasma jet array is closely related to the interactions of the adjacent jets. In this paper, a three-tube one-dimensional (1D) He plasma jet array with a cross-field needle-ring electrode structure is used to investigate the influences of the gas flow rate and applied voltage on the interactions of the adjacent jets through electrical, optical, and fluid measurements. The repulsion of the adjacent plume channels is observed using an intensified charge-coupled device (ICCD) and the influence of the gas flow rate and applied voltage on the electrostatic repulsion force, Coulomb force, is discussed. It is found that electrical coupling, mainly electrostatic repulsion force, exists among the jets in the array, which causes both the divergence of the lateral plumes and the nonlinear changes of the discharge power and the transport charge. The deflection angle of the lateral plumes with respect to the central plume in the optical images increases with the increase of applied voltage and decreases with the increase of gas flow rate. The deflection angle of the lateral plumes in the optical images is obviously larger than that of the lateral gas streams in the Schlieren images under the same experimental conditions, and the unconformity of the deflection angles is mainly attributed to the electrostatic repulsion force in adjacent plasma plume channels. The experimental results can help understand the interaction mechanisms of jets in the array and design controllable and scalable plasma jet arrays.

  10. Irradiation apparatus

    DOEpatents

    Goldie, C.H.; Fernald, R.A.

    1974-01-29

    An apparatus for introducing ionizing radiation into compressed gas insulation systems, such as high-voltage generators or transmission lines to smooth out electrical discontinuities, particularly those caused by foreign particulates that produce high gradients, and to increase the voltage holding capability of the system is described. The apparatus of the invention may also be used to regulate and stabilize the voltage of the system by varying the amount of applied load. A corona discharge device may also be used in conjunction with the invention. (Official Gazette)

  11. Disinfection by electrohydraulic treatment.

    PubMed

    Allen, M; Soike, K

    1967-04-28

    Electrohydraulic treatment was applied to suspensions of Escherichia coli, spores of Bacillus subtilis var. niger, Saccharomyces cerevisiae, and bacteriophage T2 at an input energy that, in most cases, was below the energy required to sterilize. The input energy was held relatively constant for each of these microorganisms, but the capacitance and voltage were varied. Data are presented which show the degree of disinfection as a function of capacitance and voltage. In all cases, the degree of disinfection for a given input energy increases as both capacitance and voltage are lowered.

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thiemann, H.; Bogus, K.P.

    The behavior of solar cell modules at high voltages in a surrounding simulated LEO plasma has been characterized over an applied voltage range from -700 to +500 V. Measurements were obtained in a large chamber under high vacuum using argon ions from a Kaufman source to generate a high-density plasma of up to 10 to the 6th/cu cm. The results suggest that secondary electrons contribute to the anomalous current increase noted at positive module voltages above 300 V. The surface potential on the coverglasses of the solar cells was shown to increase to high values only in the vicinity ofmore » the interconnectors. 27 references.« less

  13. High-voltage solar-cell chip

    NASA Technical Reports Server (NTRS)

    Kapoor, V. J.; Valco, G. J.; Skebe, G. G.; Evans, J. C., Jr.

    1985-01-01

    Integrated circuit technology has been successfully applied to the design and fabrication of 0.5 x 0.5-cm planar multijunction solar-cell chips. Each of these solar cells consisted of six voltage-generating unit cells monolithically connected in series and fabricated on a 75-micron-thick, p-type, single crystal, silicon substrate. A contact photolithic process employing five photomask levels together with a standard microelectronics batch-processing technique were used to construct the solar-cell chip. The open-circuit voltage increased rapidly with increasing illumination up to 5 AM1 suns where it began to saturate at the sum of the individual unit-cell voltages at a maximum of 3.0 V. A short-circuit current density per unit cell of 240 mA/sq cm was observed at 10 AM1 suns.

  14. Enhanced electrohydrodynamic force generation in a two-stroke cycle dielectric-barrier-discharge plasma actuator

    NASA Astrophysics Data System (ADS)

    Sato, Shintaro; Takahashi, Masayuki; Ohnishi, Naofumi

    2017-05-01

    An approach for electrohydrodynamic (EHD) force production is proposed with a focus on a charge cycle on a dielectric surface. The cycle, consisting of positive-charging and neutralizing strokes, is completely different from the conventional methodology, which involves a negative-charging stroke, in that the dielectric surface charge is constantly positive. The two-stroke charge cycle is realized by applying a DC voltage combined with repetitive pulses. Simulation results indicate that the negative pulse eliminates the surface charge accumulated during constant voltage phase, resulting in repetitive EHD force generation. The time-averaged EHD force increases almost linearly with increasing repetitive pulse frequency and becomes one order of magnitude larger than that driven by the sinusoidal voltage, which has the same peak-to-peak voltage.

  15. Electrical treeing behaviors in silicone rubber under an impulse voltage considering high temperature

    NASA Astrophysics Data System (ADS)

    Yunxiao, ZHANG; Yuanxiang, ZHOU; Ling, ZHANG; Zhen, LIN; Jie, LIU; Zhongliu, ZHOU

    2018-05-01

    In this paper, work was conducted to reveal electrical tree behaviors (initiation and propagation) of silicone rubber (SIR) under an impulse voltage with high temperature. Impulse frequencies ranging from 10 Hz to 1 kHz were applied and the temperature was controlled between 30 °C and 90 °C. Experimental results show that tree initiation voltage decreases with increasing pulse frequency, and the descending amplitude is different in different frequency bands. As the pulse frequency increases, more frequent partial discharges occur in the channel, increasing the tree growth rate and the final shape intensity. As for temperature, the initiation voltage decreases and the tree shape becomes denser as the temperature gets higher. Based on differential scanning calorimetry results, we believe that partial segment relaxation of SIR at high temperature leads to a decrease in the initiation voltage. However, the tree growth rate decreases with increasing temperature. Carbonization deposition in the channel under high temperature was observed under microscope and proven by Raman analysis. Different tree growth models considering tree channel characteristics are proposed. It is believed that increasing the conductivity in the tree channel restrains the partial discharge, holding back the tree growth at high temperature.

  16. High-voltage nano-oxidation in deionized water and atmospheric environments by atomic force microscopy.

    PubMed

    Huang, Jen-Ching; Chen, Chung-Ming

    2012-01-01

    This study used atomic force microscopy (AFM), metallic probes with a nanoscale tip, and high-voltage generators to investigate the feasibility of high-voltage nano-oxidation processing in deionized water (DI water) and atmospheric environments. Researchers used a combination of wire-cutting and electrochemical etching to transform a 20-μm-thick stainless steel sheet into a conductive metallic AFM probe with a tip radius of 60 nm, capable of withstanding high voltages. The combination of AFM, high-voltage generators, and nanoscale metallic probes enabled nano-oxidation processing at 200 V in DI water environments, producing oxides up to 66.6 nm in height and 467.03 nm in width. Oxides produced through high-voltage nano-oxidation in atmospheric environments were 117.29 nm in height and 551.28 nm in width, considerably exceeding the dimensions of those produced in DI water. An increase in the applied bias voltage led to an apparent logarithmic increase in the height of the oxide dots in the range of 200-400 V. The performance of the proposed high-voltage nano-oxidation technique was relatively high with seamless integration between the AFM machine and the metallic probe fabricated in this study. © Wiley Periodicals, Inc.

  17. High-Capacity Cathode Material with High Voltage for Li-Ion Batteries

    DOE PAGES

    Shi, Ji -Lei; Xiao, Dong -Dong; Ge, Mingyuan; ...

    2018-01-15

    Electrochemical energy storage devices with a high energy density are an important technology in modern society, especially for electric vehicles. The most effective approach to improve the energy density of batteries is to search for high-capacity electrode materials. According to the concept of energy quality, a high-voltage battery delivers a highly useful energy, thus providing a new insight to improve energy density. Based on this concept, a novel and successful strategy to increase the energy density and energy quality by increasing the discharge voltage of cathode materials and preserving high capacity is proposed. The proposal is realized in high-capacity Li-richmore » cathode materials. The average discharge voltage is increased from 3.5 to 3.8 V by increasing the nickel content and applying a simple after-treatment, and the specific energy is improved from 912 to 1033 Wh kg-1. The current work provides an insightful universal principle for developing, designing, and screening electrode materials for high energy density and energy quality.« less

  18. High-Capacity Cathode Material with High Voltage for Li-Ion Batteries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi, Ji -Lei; Xiao, Dong -Dong; Ge, Mingyuan

    Electrochemical energy storage devices with a high energy density are an important technology in modern society, especially for electric vehicles. The most effective approach to improve the energy density of batteries is to search for high-capacity electrode materials. According to the concept of energy quality, a high-voltage battery delivers a highly useful energy, thus providing a new insight to improve energy density. Based on this concept, a novel and successful strategy to increase the energy density and energy quality by increasing the discharge voltage of cathode materials and preserving high capacity is proposed. The proposal is realized in high-capacity Li-richmore » cathode materials. The average discharge voltage is increased from 3.5 to 3.8 V by increasing the nickel content and applying a simple after-treatment, and the specific energy is improved from 912 to 1033 Wh kg-1. The current work provides an insightful universal principle for developing, designing, and screening electrode materials for high energy density and energy quality.« less

  19. High-intensity pulsed beam source with tunable operation mode

    NASA Astrophysics Data System (ADS)

    Nashilevskiy, A. V.; Kanaev, G. G.; Ezhov, V. V.; Shamanin, V. I.

    2017-05-01

    The report presents the design of an electron and an ion pulsed accelerator. The powerful high-voltage pulse generator of the accelerator and the vacuum bushing insulator is able to change the polarity of the output voltage. The low-inductance matching transformer provides an increase in the DFL output impedance by 4 times. The generator based on a high voltage pulse transformer and a pseudo spark switch is applied for DFL charging. The high-impedance magnetically insulated focusing diode with Br magnetic field and the “passive” anode was used to realize the ion beam generation mode. The plasma is formed on the surface of the anode caused by an electrical breakdown at the voltage edge pulse; as a result, the carbon ion and proton beam is generated. This beam has the following parameters: the current density is about 400 A/cm2 (in focus): the applied voltage is up to 450 kV. The accelerator is designed for the research on the interaction of the charged particle pulsed beams with materials and for the development of technological processes of a material modification.

  20. Effect of component compression on the initial performance of an IPV nickel-hydrogen cell

    NASA Technical Reports Server (NTRS)

    Gahn, Randall F.

    1987-01-01

    An experimental method was developed for evaluating the effect of component compression on the charge and discharge voltage characteristics of a 3 1/2 in. diameter boiler plate cell. A standard boiler plate pressure vessel was modified by the addition of a mechanical feedthrough on the bottom of the vessel which permitted different compressions to be applied to the components without disturbing the integrity of the stack. Compression loadings from 0.94 to 27.4 psi were applied by suspending weights from the feedthrough rod. Cell voltages were measured for 0.96-C, 55-min charge and for 1.37-C, 35-min and 2-C, 24-min discharges. An initial change in voltage performance on both charge and discharge as the loading increased was attributed to seating of the components. Subsequent variation of the compression from 2.97 to 27.4 psi caused only minor changes in either the charge or the discharge voltages. Several one month open-circuit voltage stands and 1100 cycles under LEO conditions at the maximum loading have produced no change in performance.

  1. Effect of component compression on the initial performance of an IPV nickel-hydrogen cell. [Individual Pressure Vessel

    NASA Technical Reports Server (NTRS)

    Gahn, Randall F.

    1987-01-01

    An experimental method was developed for evaluating the effect of component compression on the charge and discharge voltage characteristics of a 3 1/2 in. diameter boiler plate cell. A standard boiler plate pressure vessel was modified by the addition of a mechanical feedthrough on the bottom of the vessel which permitted different compressions to be applied to the components without disturbing the integrity of the stack. Compression loadings from 0.94 to 27.4 psi were applied by suspending weights from the feedthrough rod. Cell voltages were measured for 0.96-C, 55-min charge and for 1.37-C, 35-min and 2-C, 24-min discharges. An initial change in voltage performance on both charge and discharge as the loading increased was attributed to seating of the components. Subsequent variation of the compression from 2.97 to 27.4 psi caused only minor changes in either the charge or the discharge voltages. Several one month open-circuit voltage stands and 1100 cycles under LEO conditions at the maximum loading have produced no change in performance.

  2. Behavior of neutral solutes in pressurized flow driven electrochromatography using a mixed stationary phase of ODS and anion-exchange.

    PubMed

    Kitagawa, Shinya; Tsuda, Takao

    2003-05-02

    The behavior of neutral sample solutes in pressurized flow driven electrochromatography using a mixed stationary phase, which consisted of ODS and anion-exchange (ODS-SAX), was studied. Applications of both positive and negative voltage on a column induced increases in retention factors of sample solutes. The direction of an electroosmotic flow under applications of positive and negative voltage were the same, therefore, the sign of the surface charge density under positive and negative voltage was opposite. We proposed a new equation for the relationship between applied voltage and surface charge density, and the practical electroosmotic flow conformed to this equation. Studying the electroosmotic flow using our proposed equation revealed that the applied negative voltage accelerates the protonation of the quaternary ammonium group and dissociation of the silanol group on packing materials. The retention behavior of a neutral solute was affected by the existence of the charged functional groups. We propose that this phenomenon is applicable to the control of the retention behavior of a sample solute using an electric field.

  3. Carbon nanotube vacuum gauges with wide-dynamic range and processes thereof

    NASA Technical Reports Server (NTRS)

    Manohara, Harish (Inventor); Kaul, Anupama B. (Inventor)

    2013-01-01

    A miniature thermal conductivity gauge employs a carbon single-walled-nanotube. The gauge operates on the principle of thermal exchange between the voltage-biased nanotube and the surrounding gas at low levels of power and low temperatures to measure vacuum across a wide dynamic range. The gauge includes two terminals, a source of constant voltage to the terminals, a single-walled carbon nanotube between the terminals, a calibration of measured conductance of the nanotube to magnitudes of surrounding vacuum and a current meter in electrical communication with the source of constant voltage. Employment of the nanotube for measuring vacuum includes calibrating the electrical conductance of the nanotube to magnitudes of vacuum, exposing the nanotube to a vacuum, applying a constant voltage across the nanotube, measuring the electrical conductance of the nanotube in the vacuum with the constant voltage applied and converting the measured electrical conductance to the corresponding calibrated magnitude of vacuum using the calibration. The nanotube may be suspended to minimize heat dissipation through the substrate, increasing sensitivity at even tower pressures.

  4. Electrostatic turbulence intermittence driven by biasing in Texas Helimak

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Toufen, D. L.; Institute of Physics, University of São Paulo, 05315-970 São Paulo, São Paulo; Pereira, F. A. C.

    We investigate changes in the intermittent sequence of bursts in the electrostatic turbulence due to imposed positive bias voltage applied to control the plasma radial electric field in Texas Helimak [K. W. Gentle and H. He, Plasma Sci. Technol. 10, 284 (2008)]—a toroidal plasma device with a one-dimensional equilibrium, magnetic curvature, and shear. We identify the burst characteristics by analyzing ion saturation current fluctuations collected in a large set of Langmuir probes. The number of bursts increase with positive biasing, giving rise to a long tailed skewed turbulence probability distribution function. The burst shape does not change much with themore » applied bias voltage, while their vertical velocity increases monotonically. For high values of bias voltage, the bursts propagate mainly in the vertical direction which is perpendicular to the radial density gradient and the toroidal magnetic field. Moreover, in contrast with the bursts in tokamaks, the burst velocity agrees with the phase velocity of the overall turbulence in both vertical and radial directions. For a fixed bias voltage, the time interval between bursts and their amplitudes follows exponential distributions. Altogether, these burst characteristics indicate that their production can be modelled by a stochastic process.« less

  5. Voltage Preconditioning Allows Modulated Gene Expression in Neurons Using PEI-complexed siRNA

    PubMed Central

    Sridharan, Arati; Patel, Chetan; Muthuswamy, Jit

    2013-01-01

    We present here a high efficiency, high viability siRNA-delivery method using a voltage-controlled chemical transfection strategy to achieve modulated delivery of polyethylenimine (PEI) complexed with siRNA in an in vitro culture of neuro2A cells and neurons. Low voltage pulses were applied to adherent cells before the administration of PEI-siRNA complexes. Live assays of neuro2a cells transfected with fluorescently tagged siRNA showed an increase in transfection efficiency from 62 ± 14% to 98 ± 3.8% (after −1 V). In primary hippocampal neurons, transfection efficiencies were increased from 30 ± 18% to 76 ± 18% (after −1 V). Negligible or low-level transfection was observed after preconditioning at higher voltages, suggesting an inverse relationship with applied voltage. Experiments with propidium iodide ruled out the role of electroporation in the transfection of siRNAs suggesting an alternate electro-endocytotic mechanism. In addition, image analysis of preconditioned and transfected cells demonstrates siRNA uptake and loading that is tuned to preconditioning voltage levels. There is approximately a fourfold increase in siRNA loading after preconditioning at −1 V compared with the same at ±2–3 V. Modulated gene expression is demonstrated in a functional knockdown of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in neuro2A cells using siRNA. Cell density and dendritic morphological changes are also demonstrated in modulated knockdown of brain derived neurotrophic factor (BDNF) in primary hippocampal neurons. The method reported here has potential applications in the development of high-throughput screening systems for large libraries of siRNA molecules involving difficult-to-transfect cells like neurons. PMID:23531602

  6. Voltage Preconditioning Allows Modulated Gene Expression in Neurons Using PEI-complexed siRNA.

    PubMed

    Sridharan, Arati; Patel, Chetan; Muthuswamy, Jit

    2013-03-26

    We present here a high efficiency, high viability siRNA-delivery method using a voltage-controlled chemical transfection strategy to achieve modulated delivery of polyethylenimine (PEI) complexed with siRNA in an in vitro culture of neuro2A cells and neurons. Low voltage pulses were applied to adherent cells before the administration of PEI-siRNA complexes. Live assays of neuro2a cells transfected with fluorescently tagged siRNA showed an increase in transfection efficiency from 62 ± 14% to 98 ± 3.8% (after -1 V). In primary hippocampal neurons, transfection efficiencies were increased from 30 ± 18% to 76 ± 18% (after -1 V). Negligible or low-level transfection was observed after preconditioning at higher voltages, suggesting an inverse relationship with applied voltage. Experiments with propidium iodide ruled out the role of electroporation in the transfection of siRNAs suggesting an alternate electro-endocytotic mechanism. In addition, image analysis of preconditioned and transfected cells demonstrates siRNA uptake and loading that is tuned to preconditioning voltage levels. There is approximately a fourfold increase in siRNA loading after preconditioning at -1 V compared with the same at ±2-3 V. Modulated gene expression is demonstrated in a functional knockdown of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) in neuro2A cells using siRNA. Cell density and dendritic morphological changes are also demonstrated in modulated knockdown of brain derived neurotrophic factor (BDNF) in primary hippocampal neurons. The method reported here has potential applications in the development of high-throughput screening systems for large libraries of siRNA molecules involving difficult-to-transfect cells like neurons.Molecular Therapy-Nucleic Acids (2013) 2, e82; doi:10.1038/mtna.2013.10; published online 26 March 2013.

  7. Planar LTCC transformers for high voltage flyback converters.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schofield, Daryl; Schare, Joshua M.; Glass, Sarah Jill

    This paper discusses the design and use of low-temperature (850 C to 950 C) co-fired ceramic (LTCC) planar magnetic flyback transformers for applications that require conversion of a low voltage to high voltage (> 100V) with significant volumetric constraints. Measured performance and modeling results for multiple designs showed that the LTCC flyback transformer design and construction imposes serious limitations on the achievable coupling and significantly impacts the transformer performance and output voltage. This paper discusses the impact of various design factors that can provide improved performance by increasing transformer coupling and output voltage. The experiments performed on prototype units demonstratedmore » LTCC transformer designs capable of greater than 2 kV output. Finally, the work investigated the effect of the LTCC microstructure on transformer insulation. Although this paper focuses on generating voltages in the kV range, the experimental characterization and discussion presented in this work applies to designs requiring lower voltage.« less

  8. Write once read many memory device from Tris-8 (-hydroxyquinoline) aluminum and Indium tin oxide nano particles

    NASA Astrophysics Data System (ADS)

    Aneesh, J.; Predeep, P.

    2011-10-01

    Consequent to the fast increase in data storage requirements new materials and device structures are explored in a war footing. Organic memory devices are attracting lot of interest among the researchers and are becoming a hot topic of investigations. This study is an attempt to develop a tri-layer organic memory device using indium tin oxide (ITO) nanoparticles as charge trapping middle layer between tris-8(-hydroxyquinoline)aluminum (Alq3) layers employing spin coating technique. Device switching is studied by applying a current-voltage (I-V) sweep. On increasing the applied bias the device switched from the initial high resistance (OFF) state to a low resistance (ON) state at a switch on voltage of around 4 V. ON/OFF ratio is of the order of 100 at a read voltage of 2 V. The device is found to remain in the low resistance state on further scans, showing the applicability of this device as a write once read many times (WORM) memory.

  9. Bioelectrochemical reduction of volatile fatty acids in anaerobic digestion effluent for the production of biofuels.

    PubMed

    Kondaveeti, Sanath; Min, Booki

    2015-12-15

    This study proves for the first time the feasibility of biofuel production from anaerobic digestion effluent via bioelectrochemical cell operation at various applied cell voltages (1.0, 1.5 and 2.0 V). An increase in cell voltage from 1 to 2 V resulted in more reduction current generation (-0.48 to -0.78 mA) at a lowered cathode potential (-0.45 to -0.84 mV vs Ag/AgCl). Various alcohols were produced depending on applied cell voltages, and the main products were butanol, ethanol, and propanol. Hydrogen and methane production were also observed in the headspace of the cell. A large amount of lactic acid was unexpectedly formed at all conditions, which might be the primary cause of the limited biofuel production. The addition of neutral red (NR) to the system could increase the cathodic reduction current, and thus more biofuels were produced with an enhanced alcohol formation compared to without a mediator. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Electroluminescence from ZnCuInS/ZnS quantum dots/poly(9-vinylcarbazole) multilayer films with different thicknesses of quantum dot layer

    NASA Astrophysics Data System (ADS)

    Dong, Xiaofei; Xu, Jianping; Shi, Shaobo; Zhang, Xiaosong; Li, Lan; Yin, Shougen

    2017-05-01

    We report tunable electroluminescence (EL) from solution-processed ZnCuInS/ZnS (ZCIS/ZnS) quantum dots (QDs)/poly(9-vinlycarbazole) multilayer films. The EL spectra exhibit a red shift as the QD layer thickness increases. By analyzing the dependence of the applied voltage and the ZCIS/ZnS QD layer thickness on the EL spectra, the origin of the red shift is associated with the increased trap density of QDs that induces the injected electrons to be trapped in the deep donor level. The current conduction mechanism based on the current density-voltage curves at different voltage regions was discussed.

  11. Direct Analysis of JV-Curves Applied to an Outdoor-Degrading CdTe Module (Presentation)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jordan, D; Kurtz, S.; Ulbrich, C.

    2014-03-01

    We present the application of a phenomenological four parameter equation to fit and analyze regularly measured current density-voltage JV curves of a CdTe module during 2.5 years of outdoor operation. The parameters are physically meaningful, i.e. the short circuit current density Jsc, open circuit voltage Voc and differential resistances Rsc, and Roc. For the chosen module, the fill factor FF degradation overweighs the degradation of Jsc and Voc. Interestingly, with outdoor exposure, not only the conductance at short circuit, Gsc, increases but also the Gsc(Jsc)-dependence. This is well explained with an increase in voltage dependent charge carrier collection in CdTe.

  12. Microelectromechanical flow control apparatus

    DOEpatents

    Okandan, Murat [NE Albuquerque, NM

    2009-06-02

    A microelectromechanical (MEM) flow control apparatus is disclosed which includes a fluid channel formed on a substrate from a first layer of a nonconducting material (e.g. silicon nitride). A first electrode is provided on the first layer of the nonconducting material outside the flow channel; and a second electrode is located on a second layer of the nonconducting material above the first layer. A voltage applied between the first and second electrodes deforms the fluid channel to increase its cross-sectional size and thereby increase a flow of a fluid through the channel. In certain embodiments of the present invention, the fluid flow can be decreased or stopped by applying a voltage between the first electrode and the substrate. A peristaltic pumping of the fluid through the channel is also possible when the voltage is applied in turn between a plurality of first electrodes and the substrate. A MEM flow control assembly can also be formed by providing one or more MEM flow control devices on a common substrate together with a submicron filter. The MEM flow control assembly can optionally include a plurality of pressure sensors for monitoring fluid pressure and determining flow rates through the assembly.

  13. Multilayer Piezoelectric Stack Actuator Characterization

    NASA Technical Reports Server (NTRS)

    Sherrit, Stewart; Jones, Christopher M.; Aldrich, Jack B.; Blodget, Chad; Bao, Xioaqi; Badescu, Mircea; Bar-Cohen, Yoseph

    2008-01-01

    Future NASA missions are increasingly seeking to use actuators for precision positioning to accuracies of the order of fractions of a nanometer. For this purpose, multilayer piezoelectric stacks are being considered as actuators for driving these precision mechanisms. In this study, sets of commercial PZT stacks were tested in various AC and DC conditions at both nominal and extreme temperatures and voltages. AC signal testing included impedance, capacitance and dielectric loss factor of each actuator as a function of the small-signal driving sinusoidal frequency, and the ambient temperature. DC signal testing includes leakage current and displacement as a function of the applied DC voltage. The applied DC voltage was increased to over eight times the manufacturers' specifications to investigate the correlation between leakage current and breakdown voltage. Resonance characterization as a function of temperature was done over a temperature range of -180C to +200C which generally exceeded the manufacturers' specifications. In order to study the lifetime performance of these stacks, five actuators from one manufacturer were driven by a 60volt, 2 kHz sine-wave for ten billion cycles. The tests were performed using a Lab-View controlled automated data acquisition system that monitored the waveform of the stack electrical current and voltage. The measurements included the displacement, impedance, capacitance and leakage current and the analysis of the experimental results will be presented.

  14. New design of a passive type RADFET reader for enhanced sensitivity

    NASA Astrophysics Data System (ADS)

    Lee, Dae-Hee

    2016-07-01

    We present a new design of a passive type RADFET reader with enhanced radiation sensitivity. Using a electostatic plate, we have applied a static electric field to the gate voltage, which impacts a positive biasing on the p-type MOSFET. The resultant effect shows that 1.8 times of radiation sensitivity increased when we measured the threshold voltage shift of the RADFET exposed to 30 krad irradiation. We discuss further about the characteristic changes of a RADFET according to the positive biasing on the gate voltage.

  15. Charge carrier dynamics investigation of CuInS2 quantum dots films using injected charge extraction by linearly increasing voltage (i-CELIV): the role of ZnS Shell

    NASA Astrophysics Data System (ADS)

    Bi, Ke; Sui, Ning; Zhang, Liquan; Wang, Yinghui; Liu, Qinghui; Tan, Mingrui; Zhou, Qiang; Zhang, Hanzhuang

    2016-12-01

    The role of ZnS shell on the photo-physical properties within CuInS2/ZnS quantum dots (QDs) is carefully studied in optoelectronic devices. Linearly increasing voltage technique has been employed to investigate the charge carrier dynamics of both CuInS2 and CuInS2/ZnS QDs films. This study shows that charge carriers follow a similar behavior of monomolecular recombination in this film, with their charge transfer rate correlates to the increase of applied voltage. It turns out that the ZnS shell could affect the carrier diffusion process through depressing the trapping states and would build up a potential barrier.

  16. High-Throughput Fabrication of Quality Nanofibers Using a Modified Free Surface Electrospinning.

    PubMed

    Shao, Zhongbiao; Yu, Liang; Xu, Lan; Wang, Mingdi

    2017-12-01

    Based on bubble electrospinning (BE), a modified free surface electrospinning (MFSE) using a cone-shaped air nozzle combined with a solution reservoir made of copper tubes was presented to increase the production of quality nanofibers. In the MFSE process, sodium dodecyl benzene sulfonates (SDBS) were added in the electrospun solution to generate bubbles on a liquid surface. The effects of applied voltage and generated bubbles on the morphology and production of nanofibers were investigated experimentally and theoretically. The theoretical analysis results of the electric field were in good agreement with the experimental data and showed that the quality and production of nanofibers were improved with the increase of applied voltage, and the generated bubbles would decrease the quality and production of nanofibers.

  17. High-Throughput Fabrication of Quality Nanofibers Using a Modified Free Surface Electrospinning

    NASA Astrophysics Data System (ADS)

    Shao, Zhongbiao; Yu, Liang; Xu, Lan; Wang, Mingdi

    2017-07-01

    Based on bubble electrospinning (BE), a modified free surface electrospinning (MFSE) using a cone-shaped air nozzle combined with a solution reservoir made of copper tubes was presented to increase the production of quality nanofibers. In the MFSE process, sodium dodecyl benzene sulfonates (SDBS) were added in the electrospun solution to generate bubbles on a liquid surface. The effects of applied voltage and generated bubbles on the morphology and production of nanofibers were investigated experimentally and theoretically. The theoretical analysis results of the electric field were in good agreement with the experimental data and showed that the quality and production of nanofibers were improved with the increase of applied voltage, and the generated bubbles would decrease the quality and production of nanofibers.

  18. Preparation of nanocomposites resin from seed Pterodon emarginatus doped maghemite nanoparticles.

    PubMed

    Silveira, L B; Martins, Q S; Maia, J C; Santos, J G

    2012-06-01

    Electrical characterization and magnetic nanocomposite resin seeds Pterodon emarginatus (PE) doped with nanoparticles of maghemite and treated by different chemical processes is reported in this paper. The pure PE resin showed semiconducting characteristics probably the presence of natural iron oxide in its molecular structure. The analysis of Mössbauer spectra pure resin showed two magnetic sites presented on measurements made at temperature of 300 K. Six "LEDs" to have been doped maghemite nanoparticles forming concentrations of 2.6 x 10(15) to 1.56 x 10(16) particles/cm2 forming the LED-PEMN. In the presence of the applied current versus voltage (0 to 0.9 V) LED-PEMN shown semiconducting properties. In the presence of frequency versus voltage sample of pure resin and LED features small decrease. While samples of LED-PEMN suffers loss frequency linearly with concentration and voltage. The pure PE resin shows high resistance to the applied voltage while the LED-PEMN is observed linear increase with the strength and concentration of nanoparticles of maghemite.

  19. Enhancing fermentative hydrogen production with the removal of volatile fatty acids by electrodialysis.

    PubMed

    Wei, Pengfei; Xia, Ao; Liao, Qiang; Sun, Chihe; Huang, Yun; Fu, Qian; Zhu, Xun; Lin, Richen

    2018-05-08

    A three-chamber electrodialysis bioreactor comprising fermentation, cathode and anode chambers was proposed to remove in situ volatile fatty acids during hydrogen fermentation. The electrodialysis voltage of 4 V resulted in a volumetric hydrogen productivity of 1878.0 mL/L from the fermentation chamber, which is 55.4% higher than that (1208.5 mL/L) of the control group without voltage applied. Gas production was not observed in the cathode and anode chambers throughout fermentation. By applying different voltages (0-6 V), the hydrogen content accumulated to 54.6%-84.7%, and it exhibited increases of 7.1%-66.4% compared with that of the control. Meanwhile, the maximum concentrations of acetate and butyrate in the fermentation chamber decreased to 10.3 and 13.1 mmol/L at a voltage of 4 V, respectively, which are 68.0% and 62.4% lower than that for the control. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. Investigation on onset voltage and conduction channel temperature in voltage-induced metal-insulator transition of vanadium dioxide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoon, Joonseok; Kim, Howon; Ju, Honglyoul, E-mail: tesl@yonsei.ac.kr

    2016-03-28

    The characteristics of onset voltages and conduction channel temperatures in the metal-insulator transition (MIT) of vanadium dioxide (VO{sub 2}) devices are investigated as a function of dimensions and ambient temperature. The MIT onset voltage varies from 18 V to 199 V as the device length increases from 5 to 80 μm at a fixed width of 100 μm. The estimated temperature at local conduction channel increases from 110 to 370 °C, which is higher than the MIT temperature (67 °C) of VO{sub 2}. A simple Joule-heating model is employed to explain voltage-induced MIT as well as to estimate temperatures of conduction channel appearing after MIT inmore » various-sized devices. Our findings on VO{sub 2} can be applied to micro- to nano-size tunable heating devices, e.g., microscale scanning thermal cantilevers and gas sensors.« less

  1. Electro-optical phenomena based on ionic liquids in an optofluidic waveguide.

    PubMed

    He, Xiaodong; Shao, Qunfeng; Cao, Pengfei; Kong, Weijie; Sun, Jiqian; Zhang, Xiaoping; Deng, Youquan

    2015-03-07

    An optofluidic waveguide with a simple two-terminal electrode geometry, when filled with an ionic liquid (IL), forms a lateral electric double-layer capacitor under a direct current (DC) electric field, which allows the realization of an extremely high carrier density in the vicinity of the electrode surface and terminals to modulate optical transmission at room temperature under low voltage operation (0 to 4 V). The unique electro-optical phenomenon of ILs was investigated at three wavelengths (663, 1330 and 1530 nm) using two waveguide geometries. Strong electro-optical modulations with different efficiencies were observed at the two near-infrared (NIR) wavelengths, while no detectable modulation was observed at 663 nm. The first waveguide geometry was used to investigate the position-dependent modulation along the waveguide; the strongest modulation was observed in the vicinity of the electrode terminal. The modulation phase is associated with the applied voltage polarity, which increases in the vicinity of the negative electrode and decreases at the positive electrode. The second waveguide geometry was used to improve the modulation efficiency. Meanwhile, the electro-optical modulations of seven ILs were compared at an applied voltage ranging from ±2 V to ±3.5 V. The results reveal that the modulation amplitude and response speed increase with increasing applied voltage, as well as the electrical conductivity of ILs. Despite the fact that the response speed isn't fast due to the high ionic density of ILs, the modulation amplitude can reach up to 6.0 dB when a higher voltage (U = ±3.5 V) is applied for the IL [Emim][BF4]. Finally, the physical explanation of the phenomenon was discussed. The effect of the change in IL structure on the electro-optical phenomena was investigated in another new experiment. The results reveal that the electro-optical phenomenon is probably caused mainly by the change in carrier concentration (ion redistribution near charged electrodes), which induces the enhancement and suppression of NIR optical absorption (contributed by C-H and N-H groups) in the vicinity of the negative electrode and positive electrode, respectively.

  2. High Current Hollow Cathode Plasma Plume Measurements

    NASA Technical Reports Server (NTRS)

    Thomas, Robert E.; Kamhawi, Hani; Williams, George J., Jr.

    2014-01-01

    Plasma plume measurements are reported for a hollow cathode assembly (HCA) operated at discharge currents of 50, 70, and 100 A at xenon flow rates between 19 - 46 standard cubic centimeter per minute. The HCA was centrally mounted in the NASA-300MS Hall Thruster and was operated in the "spot" and "plume" modes with additional data taken with an applied magnetic field. Langmuir probes, retarding potential analyzers, and optical emission spectroscopy were employed to measure plasma properties near the orifice of the HCA and to assess the charge state of the near-field plasma. Electron temperatures (2-6 electron volt) and plasma potentials are consistent with probe-measured values in previous investigations. Operation with an applied-field yields higher discharge voltages, increased Xe III production, and increased signals from the 833.5 nm C I line. While operating in plume mode and with an applied field, ion energy distribution measurements yield ions with energies significantly exceeding the applied discharge voltage. These findings are correlated with high-frequency oscillations associated with each mode.

  3. The experimental study of the DC dielectric breakdown strength in magnetic fluids

    NASA Astrophysics Data System (ADS)

    Kopčanský, P.; Tomčo, L.; Marton, K.; Koneracká, M.; Potočová, I.; Timko, M.

    2004-05-01

    Magnetic fluids have been studied for use as a high-voltage insulation. High-voltage measurements on magnetic fluids based on transformer oil, as a function of volume concentrations of magnetite particles and applied magnetic field, showed the increase of the DC dielectric breakdown strength opposite transformer oil, if the saturation magnetization of magnetic fluid is up to 4 mT approximately.

  4. Back-Propagation Operation for Analog Neural Network Hardware with Synapse Components Having Hysteresis Characteristics

    PubMed Central

    Ueda, Michihito; Nishitani, Yu; Kaneko, Yukihiro; Omote, Atsushi

    2014-01-01

    To realize an analog artificial neural network hardware, the circuit element for synapse function is important because the number of synapse elements is much larger than that of neuron elements. One of the candidates for this synapse element is a ferroelectric memristor. This device functions as a voltage controllable variable resistor, which can be applied to a synapse weight. However, its conductance shows hysteresis characteristics and dispersion to the input voltage. Therefore, the conductance values vary according to the history of the height and the width of the applied pulse voltage. Due to the difficulty of controlling the accurate conductance, it is not easy to apply the back-propagation learning algorithm to the neural network hardware having memristor synapses. To solve this problem, we proposed and simulated a learning operation procedure as follows. Employing a weight perturbation technique, we derived the error change. When the error reduced, the next pulse voltage was updated according to the back-propagation learning algorithm. If the error increased the amplitude of the next voltage pulse was set in such way as to cause similar memristor conductance but in the opposite voltage scanning direction. By this operation, we could eliminate the hysteresis and confirmed that the simulation of the learning operation converged. We also adopted conductance dispersion numerically in the simulation. We examined the probability that the error decreased to a designated value within a predetermined loop number. The ferroelectric has the characteristics that the magnitude of polarization does not become smaller when voltages having the same polarity are applied. These characteristics greatly improved the probability even if the learning rate was small, if the magnitude of the dispersion is adequate. Because the dispersion of analog circuit elements is inevitable, this learning operation procedure is useful for analog neural network hardware. PMID:25393715

  5. Effects of oxidation potential and retention time on electrochromic stability of poly (3-hexyl thiophene) films

    NASA Astrophysics Data System (ADS)

    Kim, Tae-Ho; Hyun Song, Seok; Kim, Hyo-Jae; Oh, Seong-Hyeon; Han, Song-Yi; Kim, Goung; Nah, Yoon-Chae

    2018-06-01

    Herein, we report the effects of applied voltage on the electrochromic (EC) stability of poly(3-hexylthiophene) (P3HT) films during EC reactions. The transmittance difference and cycling stability of these films were monitored to optimize the oxidation voltage, and their chemical compositions were analyzed by X-ray photoelectron spectroscopy after long-term electrochemical cycling. High oxidation voltages increased the color contrast of P3HT films but decreased their cycling stability due to facilitating chemical degradation. Furthermore, at an optimized oxidation voltage, the retention time during potential pulsing was adjusted utilizing the optical memory of P3HT, revealing that the decreased voltage application time reduced power consumption by 9.6% and enhanced EC stability without loss of color contrast.

  6. Effect of electrode biasing on m/n  =  2/1 tearing modes in J-TEXT experiments

    NASA Astrophysics Data System (ADS)

    Liu, Hai; Hu, Qiming; Chen, Zhipeng; Yu, Q.; Zhu, Lizhi; Cheng, Zhifeng; Zhuang, Ge; Chen, Zhongyong

    2017-01-01

    The effects of electrode biasing (EB) on the m/n  =  2/1 tearing mode have been experimentally studied in J-TEXT tokamak discharges, where m and n are the poloidal and toroidal mode numbers. It is found that for a negative bias voltage, the mode amplitude is reduced, and the mode frequency is increased accompanied by the increased toroidal plasma rotation speed in the counter-I p direction. For a positive bias voltage, the mode frequency is decreased together with the change of the rotation velocity towards the co-I p direction, and the mode amplitude is increased. Statistic results show that the variations in the toroidal rotation speed, the 2/1 mode frequency and its amplitude linearly depend on the bias voltage. The threshold voltages for complete suppression and locking of the mode are found. The experimental results suggest that applied electrode biasing is a possible method for the avoidance of mode locking and disruption.

  7. Influence of the electrode gap separation on the pseudospark-sourced electron beam generation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, J., E-mail: junping.zhao@qq.com; State Key Laboratory of Electrical Insulation and Power Equipment, West Xianning Road, Xi'an 710049; Department of Physics, SUPA, University of Strathclyde, Glasgow, G4 0NG Scotland

    Pseudospark-sourced electron beam is a self-focused intense electron beam which can propagate without any external focusing magnetic field. This electron beam can drive a beam-wave interaction directly or after being post-accelerated. It is especially suitable for terahertz radiation generation due to the ability of a pseudospark discharge to produce small size in the micron range and very high current density and bright electron beams. In this paper, a single-gap pseudospark discharge chamber has been built and tested with several electrode gap separations to explore the dependence of the pseudospark-sourced electron beam current on the discharge voltage and the electrode gapmore » separation. Experimental results show that the beam pulses have similar pulse width and delay time from the distinct drop of the applied voltage for smaller electrode gap separations but longer delay time for the largest gap separation used in the experiment. It has been found that the electron beam only starts to occur when the charging voltage is above a certain value, which is defined as the starting voltage of the electron beam. The starting voltage is different for different electrode gap separations and decreases with increasing electrode gap separation in our pseudospark discharge configuration. The electron beam current increases with the increasing discharge voltage following two tendencies. Under the same discharge voltage, the configuration with the larger electrode gap separation will generate higher electron beam current. When the discharge voltage is higher than 10 kV, the beam current generated at the electrode gap separation of 17.0 mm, is much higher than that generated at smaller gap separations. The ionization of the neutral gas in the main gap is inferred to contribute more to the current increase with increasing electrode gap separation.« less

  8. Ion funnel device

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ibrahim, Yehia M.; Chen, Tsung-Chi; Harrer, Marques B.

    2017-11-21

    An ion funnel device is disclosed. A first pair of electrodes is positioned in a first direction. A second pair of electrodes is positioned in a second direction. The device includes an RF voltage source and a DC voltage source. A RF voltage with a superimposed DC voltage gradient is applied to the first pair of electrodes, and a DC voltage gradient is applied to the second pair of electrodes.

  9. Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins.

    PubMed

    Zeimpekis, I; Sun, K; Hu, C; Ditshego, N M J; Thomas, O; de Planque, M R R; Chong, H M H; Morgan, H; Ashburn, P

    2016-04-22

    We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH(-1) is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH(-1) measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%.

  10. Dual-gate polysilicon nanoribbon biosensors enable high sensitivity detection of proteins

    NASA Astrophysics Data System (ADS)

    Zeimpekis, I.; Sun, K.; Hu, C.; Ditshego, N. M. J.; Thomas, O.; de Planque, M. R. R.; Chong, H. M. H.; Morgan, H.; Ashburn, P.

    2016-04-01

    We demonstrate the advantages of dual-gate polysilicon nanoribbon biosensors with a comprehensive evaluation of different measurement schemes for pH and protein sensing. In particular, we compare the detection of voltage and current changes when top- and bottom-gate bias is applied. Measurements of pH show that a large voltage shift of 491 mV pH-1 is obtained in the subthreshold region when the top-gate is kept at a fixed potential and the bottom-gate is varied (voltage sweep). This is an improvement of 16 times over the 30 mV pH-1 measured using a top-gate sweep with the bottom-gate at a fixed potential. A similar large voltage shift of 175 mV is obtained when the protein avidin is sensed using a bottom-gate sweep. This is an improvement of 20 times compared with the 8.8 mV achieved from a top-gate sweep. Current measurements using bottom-gate sweeps do not deliver the same signal amplification as when using bottom-gate sweeps to measure voltage shifts. Thus, for detecting a small signal change on protein binding, it is advantageous to employ a double-gate transistor and to measure a voltage shift using a bottom-gate sweep. For top-gate sweeps, the use of a dual-gate transistor enables the current sensitivity to be enhanced by applying a negative bias to the bottom-gate to reduce the carrier concentration in the nanoribbon. For pH measurements, the current sensitivity increases from 65% to 149% and for avidin sensing it increases from 1.4% to 2.5%.

  11. Anode power deposition in applied-field MPD thrusters

    NASA Technical Reports Server (NTRS)

    Myers, Roger M.; Soulas, George C.

    1992-01-01

    Anode power deposition is the principle performance limiter of magnetoplasmadynamic (MPD) thrusters. Current thrusters lose between 50 and 70 percent of the input power to the anode. In this work, anode power deposition was studied for three cylindrical applied magnetic field thrusters for a range of argon propellant flow rates, discharge currents, and applied-field strengths. Between 60 and 95 percent of the anode power deposition resulted from electron current conduction into the anode, with cathode radiation depositing between 5 and 35 percent of the anode power, and convective heat transfer from the hot plasma accounting for less than 5 percent. While the fractional anode power loss decreased with increasing applied-field strength and anode size, the magnitude of the anode power increased. The rise in anode power resulted from a linear rise in the anode fall voltage with applied-field strength and anode radius. The anode fall voltage also rose with decreasing propellant flow rate. The trends indicate that the anode fall region is magnetized, and suggest techniques for reducing the anode power loss in MPD thrusters.

  12. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  13. Ozone synthesis improves by increasing number density of plasma channels and lower voltage in a nonthermal plasma

    NASA Astrophysics Data System (ADS)

    Arif Malik, Muhammad; Hughes, David

    2016-04-01

    Improvements in ozone synthesis from air and oxygen by increasing the number density of plasma channels and lower voltage for the same specific input energy (SIE) were explored in a nonthermal plasma based on a sliding discharge. The number of plasma channels and energy per pulse increased in direct proportion to the increase in the effective length of the anode (the high voltage electrode). Decreasing the discharge gap increased the energy per pulse for the same length and allowed the installation of more electrode pairs in the same space. It allowed the increase of the number of plasma channels in the same space to achieve the same SIE at a lower peak voltage with less energy per plasma channel. The ozone concentration gradually increased to ~1500 ppmv (140 to 50 g kWh-1) from air and to ~6000 ppmv (400 to 200 g kWh-1) from oxygen with a gradual increase in the SIE to ~200 J L-1, irrespective of the variations in electrode geometry, applied voltage or flow rate of the feed gas. A gradual increase in SIE beyond 200 J L-1 gradually increased the ozone concentration to a certain maximum value followed by a decline, but the rate of increase and the maximum value was higher for the greater number of plasma channels and lower peak voltage combination. The maximum ozone concentration was ~5000 ppmv (~30 g kWh-1) from air and ~22 000 ppmv (~80 g kWh-1) from oxygen. The results are explained on the basis of characteristics of the plasma and ozone synthesis mechanism.

  14. Mechanisms of anode power deposition in a low pressure free burning arc

    NASA Technical Reports Server (NTRS)

    Soulas, George C.; Myers, Roger M.

    1994-01-01

    Anode power deposition is a dominant power loss mechanism for arc jets and MPD thrusters. In this study, a free burning arc experiment was operated at pressures and current densities similar to those in arc jets and MPD thrusters in an attempt to identify the physics controlling this loss mechanism. Use of a free burning arc allowed for the isolation of independent variables controlling anode power deposition and provided a convenient and flexible way to cover a broad range of currents, anode surface pressures, and applied magnetic field strengths and orientations using an argon gas. Test results showed that anode power deposition decreased with increasing anode surface pressure up to 6.7 Pa (0.05 torr) and then became insensitive to pressure. Anode power increased with increasing arc current while the electron number density near the anode surface increased linearity. Anode power also increased with increasing applied magnetic field strength due to an increasing anode fall voltage. Applied magnetic field orientation had an effect only at high currents and low anode surface pressures, where anode power decreased when applied field lines intercepted the anode surface. The results demonstrated that anode power deposition was dominated by the current carrying electrons and that the anode fall voltage was the largest contributor. Furthermore, the results showed that anode power deposition can be reduced by operating at increased anode pressures, reduced arc currents, and applied magnetic field strengths and with magnetic field lines intercepting the anode.

  15. High throughput ion-channel pharmacology: planar-array-based voltage clamp.

    PubMed

    Kiss, Laszlo; Bennett, Paul B; Uebele, Victor N; Koblan, Kenneth S; Kane, Stefanie A; Neagle, Brad; Schroeder, Kirk

    2003-02-01

    Technological advances often drive major breakthroughs in biology. Examples include PCR, automated DNA sequencing, confocal/single photon microscopy, AFM, and voltage/patch-clamp methods. The patch-clamp method, first described nearly 30 years ago, was a major technical achievement that permitted voltage-clamp analysis (membrane potential control) of ion channels in most cells and revealed a role for channels in unimagined areas. Because of the high information content, voltage clamp is the best way to study ion-channel function; however, throughput is too low for drug screening. Here we describe a novel breakthrough planar-array-based HT patch-clamp technology developed by Essen Instruments capable of voltage-clamping thousands of cells per day. This technology provides greater than two orders of magnitude increase in throughput compared with the traditional voltage-clamp techniques. We have applied this method to study the hERG K(+) channel and to determine the pharmacological profile of QT prolonging drugs.

  16. Electric field modulated ferromagnetism in ZnO films deposited at room temperature

    NASA Astrophysics Data System (ADS)

    Bu, Jianpei; Liu, Xinran; Hao, Yanming; Zhou, Guangjun; Cheng, Bin; Huang, Wei; Xie, Jihao; Zhang, Heng; Qin, Hongwei; Hu, Jifan

    2018-04-01

    The ZnO film deposited at room temperature, which is composed of the amorphous-phase background plus a few nanograins or nanoclusters (about 1-2 nm), exhibits room temperature ferromagnetism (FM). Such FM is found to be connected with oxygen vacancies. For the Ta/ZnO/Pt device based on the medium layer ZnO deposited at room temperature, the saturation magnetization not only is modulated between high and low resistive states by electric voltage with DC loop electric current but also increases/decreases through adjusting the magnitudes of positive/negative DC sweeping voltage. Meanwhile, the voltage-controlled conductance quantization is observed in Ta/ZnO/Pt, accompanying the voltage-controlled magnetization. However, the saturation magnetization of the Ta/ZnO/Pt device becomes smaller under positive electric voltage and returns in some extent under negative electric voltage, when the DC loop electric current is not applied.

  17. DC attenuation meter

    DOEpatents

    Hargrove, Douglas L.

    2004-09-14

    A portable, hand-held meter used to measure direct current (DC) attenuation in low impedance electrical signal cables and signal attenuators. A DC voltage is applied to the signal input of the cable and feedback to the control circuit through the signal cable and attenuators. The control circuit adjusts the applied voltage to the cable until the feedback voltage equals the reference voltage. The "units" of applied voltage required at the cable input is the system attenuation value of the cable and attenuators, which makes this meter unique. The meter may be used to calibrate data signal cables, attenuators, and cable-attenuator assemblies.

  18. Ultraviolet radiation from the pulsed corona discharge in water

    NASA Astrophysics Data System (ADS)

    Lukes, Petr; Clupek, Martin; Babicky, Vaclav; Sunka, Pavel

    2008-05-01

    Quantitative analysis of ultraviolet radiation from the pulsed corona discharge in water with needle-plate electrode geometry (~1-3 J pulse-1) was performed using the potassium ferrioxalate actinometry. Photon flux J190-280 and radiant energy Q190-280 of the UV light emitted from the discharge at spectral region 190-280 nm was determined in dependence on the applied voltage (17-29 kV, positive polarity) and the solution conductivity (100-500 µS cm-1). The intensity of the UV radiation strongly increased with increasing water conductivity and applied voltage. Depending on the applied voltage the determined photon flux varied by more than two orders of magnitude within the range of solution conductivities 100-500 µS cm-1. It was found that photon flux from the discharge may be directly related to the discharge pulse mean power Pp as J190-280 = 44.33 P_p^{2.11} (quanta pulse-1). A significant role of UV radiation in the production of hydrogen peroxide and bacterial inactivation by the corona discharge in water has been identified. As the solution conductivity increased the yield of H2O2 produced by the discharge decreased due to increasing photolysis of H2O2 accounting for up to 14% of the total decomposition rate of H2O2. As regards bactericidal effects, it was estimated that the UV radiation contributes about 30% to the overall inactivation of Escherichia coli.

  19. Heat transport in electrically aligned multiwalled carbon nanotubes dispersed in water

    NASA Astrophysics Data System (ADS)

    Cervantes-Alvarez, F.; Macias, J. D.; Alvarado-Gil, J. J.

    2018-02-01

    A modified Ångström method was used to determine the thermal diffusivity and thermal conductivity of aqueous dispersions of multiwalled carbon nanotubes as a function of their weight fraction concentration and in the presence of an externally applied electric field. Measurements were performed in planar samples, with a fixed thickness of 3.18 mm applying an AC voltage in the range from 0 to 70~V_RMS and for concentrations of carbon nanotubes from 0 to 2 wf%. It is shown that this field induces the formation of clusters followed by their alignment along the electric field, which can favor heat transfer in that direction. Heat transfer measurements show two regimes, in the first one under 0.5 wf%, voltages lower than 30~V_RMS are not strong enough to induce the adequate order of the carbon nanostructures, and as a consequence, thermal diffusivity of the dispersion remains close to the thermal diffusivity of water. In contrast for higher concentrations (above 1.5 wf%), 10~V_RMS are enough to get a good alignment. Above such thresholds of concentrations and voltages, thermal diffusivity and conductivity increase, when the electric field is increased, in such a way that for an applied voltage of 20~V_RMS and for a concentration of 1.5 wf%, an increase of 49% of the thermal conductivity was obtained. It is also shown that this approach exhibits limits, due to the fact that the electric-field induced structure, can act as a heating element at high electric field intensities and carbon nanotubes concentrations, which can induce convection and evaporation of the liquid matrix.

  20. Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

    NASA Astrophysics Data System (ADS)

    Patel, N.; Branch, D. W.; Schamiloglu, E.; Cular, S.

    2015-08-01

    A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz-100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10-273 ps for DC voltages and 189-813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250-2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115-1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.

  1. Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Patel, N.; Department of Electrical and Computer Engineering, MSC01 1100, University of New Mexico, Albuquerque, New Mexico 87131-0001; Branch, D. W.

    2015-08-15

    A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO{sub 3}) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5more » μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.« less

  2. Comparative study of 0° X-cut and Y+36°-cut lithium niobate high-voltage sensing

    DOE PAGES

    Patel, N.; Branch, D. W.; Schamiloglu, E.; ...

    2015-08-11

    A comparison study between Y+36° and 0° X-cut lithium niobate (LiNbO 3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y+36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses tomore » both crystals, the voltage-induced shift scaled linearly with voltage. For the Y+36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y+36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y+36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. Furthermore, when the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.« less

  3. Geometric effects in applied-field MPD thrusters

    NASA Technical Reports Server (NTRS)

    Myers, R. M.; Mantenieks, M.; Sovey, J.

    1990-01-01

    Three applied-field magnetoplasmadynamic (MPD) thruster geometries were tested with argon propellant to establish the influence of electrode geometry on thruster performance. The thrust increased approximately linearly with anode radius, while the discharge and electrode fall voltages increased quadratically with anode radius. All these parameters increased linearly with applied-field strength. Thrust efficiency, on the other hand, was not significantly influenced by changes in geometry over the operating range studied, though both thrust and thermal efficiencies increased monotonically with applied field strength. The best performance, 1820 sec I (sub sp) at 20 percent efficiency, was obtained with the largest radius anode at the highest discharge current (1500 amps) and applied field strength (0.4 Tesla).

  4. Geometric effects in applied-field MPD thrusters

    NASA Technical Reports Server (NTRS)

    Myers, R. M.; Mantenieks, M.; Sovey, James S.

    1990-01-01

    Three applied-field magnetoplasmadynamic (MPD) thruster geometries were tested with argon propellant to establish the influence of electrode geometry on thruster performance. The thrust increased approximately linearly with anode radius, while the discharge and electrode fall voltages increased quadratically with anode radius. All these parameters increased linearly with applied-field strength. Thrust efficiency, on the other hand, was not significantly influenced by changes in geometry over the operating range studied, though both thrust and thermal efficiencies increased monotonically with applied field strength. The best performance, 1820 sec I(sub sp) at 20 percent efficiency, was obtained with the largest radius anode at the highest discharge current (1500 amps) and applied field strength (0.4 Tesla).

  5. Differential comparator cirucit

    DOEpatents

    Hickling, Ronald M.

    1996-01-01

    A differential comparator circuit for an Analog-to-Digital Converter (ADC) or other application includes a plurality of differential comparators and a plurality of offset voltage generators. Each comparator includes first and second differentially connected transistor pairs having equal and opposite voltage offsets. First and second offset control transistors are connected in series with the transistor pairs respectively. The offset voltage generators generate offset voltages corresponding to reference voltages which are compared with a differential input voltage by the comparators. Each offset voltage is applied to the offset control transistors of at least one comparator to set the overall voltage offset of the comparator to a value corresponding to the respective reference voltage. The number of offset voltage generators required in an ADC application can be reduced by a factor of approximately two by applying the offset voltage from each offset voltage generator to two comparators with opposite logical sense such that positive and negative offset voltages are produced by each offset voltage generator.

  6. Noise analysis and relaxation experiments of transport of hydrophobic anions across lipid membranes at equilibrium and nonequilibrium.

    PubMed

    Junges, R; Kolb, H A

    1983-06-01

    Under equilibrium and nonequilibrium steady-state conditions, the spectral intensity of current noise SJ(f) generated by the transport of hydrophobic anions across lipid bilayer membranes was investigated. The experimental results were compared with different reaction models. SJ(f) showed a characteristic increase proportional to f2 between frequency-independent tails at low and high frequencies. This gradient was found to be independent of applied voltage which indicates the contribution of a single voltage-dependent reaction step of ion translocation across the membrane. From the shape of SJ(f) at low frequencies the rate constant of ion desorption from the membrane into the aqueous phase could be estimated. Unambiguous evidence for the application of a general model, which includes the coupling of slow ion diffusion in the aqueous phase to ion adsorption/desorption at the membrane interface, could not be obtained from the low-frequency shape of SJ(f). The shot noise of this ion transport determines the amplitude of SJ(f) at high frequencies which decreases with increasing voltage applied. Analysis of voltage-jump current-relaxation experiments and of current noise carried out on one membrane yielded significant differences of the derived ion partition coefficient. This deviation is qualitatively described on the basis of incomplete reaction steps.

  7. Comparison of the surface dielectric barrier discharge characteristics under different electrode gaps

    NASA Astrophysics Data System (ADS)

    Gao, Guoqiang; Dong, Lei; Peng, Kaisheng; Wei, Wenfu; Li, Chunmao; Wu, Guangning

    2017-01-01

    Currently, great interests are paid to the surface dielectric barrier discharge due to the diverse and interesting application. In this paper, the influences of the electrode gap on the discharge characteristics have been studied. Aspects of the electrical parameters, the optical emission, and the discharge induced gas flow were considered. The electrode gap varied from 0 mm to 21 mm, while the applied AC voltage was studied in the range of 17 kV-27 kV. Results indicate that with the increase of the electrode gap, the variation of discharge voltage exhibits an increasing trend, while the other parameters (i.e., the current, power, and induced flow velocity) increase first, and then decrease once the gap exceeded the critical value. Mechanisms of the electrode gap influencing these key parameters were discussed from the point of equivalent circuit. The experimental results reveal that an optimal discharge gap can be obtained, which is closely related to the applied voltage. Visualization of the induced flow with different electrode gaps was realized by the Schlieren diagnostic technique. Finally, the velocities of induced gas flow determined by the pitot tube were compared with the results of intensity-integral method, and good agreements were found.

  8. Performance and Reliability of Electrowetting-on-Dielectric (EWOD) Systems Based on Tantalum Oxide.

    PubMed

    Mibus, Marcel; Zangari, Giovanni

    2017-12-06

    The electrowetting-on-dielectric behavior of Cytop/Tantalum oxide (TaOx) bilayers is studied by measuring their response vs applied voltage and under prolonged periodic cycling, below and above the threshold voltage V T corresponding to the breakdown field for the oxide. TaOx exhibits symmetric solid state I-V characteristics, with electronic conduction dominated by Schottky, Poole-Frenkel emission; conduction is attributed to oxygen vacancies (6 × 10 16 cm -3 ), resulting in large currents at low bias. Electrolyte/Metal Oxide/Metal I-V characteristics show oxide degradation at (<5 V) cathodic bias; anodic bias in contrast results in stable characteristics until reaching the anodization voltage, where the oxide thickens, leading eventually to breakdown and oxygen production at the electrode. Electrowetting angle vs applied voltage undergoes three different stages: a parabolic variation of contact angle (CA) with applied voltage, CA saturation, and rebound of the CA to higher values due to degradation of the polymer layer. The contact angle remained stable for several hundred cycles if the applied voltage was less than V T ; degradation in contrast is fast when the voltage is above V T . Degradation of the electrowetting response with time is linked to charge accumulation in the polymer, which inhibits the rebound of the CA when voltage is being applied.

  9. Fully depleted back illuminated CCD

    DOEpatents

    Holland, Stephen Edward

    2001-01-01

    A backside illuminated charge coupled device (CCD) is formed of a relatively thick high resistivity photon sensitive silicon substrate, with frontside electronic circuitry, and an optically transparent backside ohmic contact for applying a backside voltage which is at least sufficient to substantially fully deplete the substrate. A greater bias voltage which overdepletes the substrate may also be applied. One way of applying the bias voltage to the substrate is by physically connecting the voltage source to the ohmic contact. An alternate way of applying the bias voltage to the substrate is to physically connect the voltage source to the frontside of the substrate, at a point outside the depletion region. Thus both frontside and backside contacts can be used for backside biasing to fully deplete the substrate. Also, high resistivity gaps around the CCD channels and electrically floating channel stop regions can be provided in the CCD array around the CCD channels. The CCD array forms an imaging sensor useful in astronomy.

  10. Local doping of two-dimensional materials

    DOEpatents

    Wong, Dillon; Velasco, Jr, Jairo; Ju, Long; Kahn, Salman; Lee, Juwon; Germany, Chad E.; Zettl, Alexander K.; Wang, Feng; Crommie, Michael F.

    2016-09-20

    This disclosure provides systems, methods, and apparatus related to locally doping two-dimensional (2D) materials. In one aspect, an assembly including a substrate, a first insulator disposed on the substrate, a second insulator disposed on the first insulator, and a 2D material disposed on the second insulator is formed. A first voltage is applied between the 2D material and the substrate. With the first voltage applied between the 2D material and the substrate, a second voltage is applied between the 2D material and a probe positioned proximate the 2D material. The second voltage between the 2D material and the probe is removed. The first voltage between the 2D material and the substrate is removed. A portion of the 2D material proximate the probe when the second voltage was applied has a different electron density compared to a remainder of the 2D material.

  11. Voltage Quench Dynamics of a Kondo System.

    PubMed

    Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel

    2016-01-22

    We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.

  12. Field-effect amperometric immuno-detection of protein biomarker.

    PubMed

    Wang, Jiapeng; Yau, Siu-Tung

    2011-11-15

    The field-effect enzymatic detection technique has been applied to the amperometric immunoassay of the cancer biomarker, carcinoma antigen 125 (CA 125). The detection adopted a reagentless approach, in which the analyte, CA 125, was immobilized on the detecting electrode, which was modified using carbon nanotubes, and the detection signal was obtained by measuring the reduction peak current of the enzyme that was used to label the antibody. A gating voltage was applied to the detecting electrode, inducing increase in the signal current and therefore providing amplification of the detection signal. The voltage-controlled signal amplification of the detection system has increased the sensitivity and lowered the detection limit of the system. A detection limit of 0.9U/ml was obtained in the work. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Plasma density enhancement in atmospheric-pressure dielectric-barrier discharges by high-voltage nanosecond pulse in the pulse-on period: a PIC simulation

    NASA Astrophysics Data System (ADS)

    Sang, Chaofeng; Sun, Jizhong; Wang, Dezhen

    2010-02-01

    A particle-in-cell (PIC) plus Monte Carlo collision simulation is employed to investigate how a sustainable atmospheric pressure single dielectric-barrier discharge responds to a high-voltage nanosecond pulse (HVNP) further applied to the metal electrode. The results show that the HVNP can significantly increase the plasma density in the pulse-on period. The ion-induced secondary electrons can give rise to avalanche ionization in the positive sheath, which widens the discharge region and enhances the plasma density drastically. However, the plasma density stops increasing as the applied pulse lasts over certain time; therefore, lengthening the pulse duration alone cannot improve the discharge efficiency further. Physical reasons for these phenomena are then discussed.

  14. MULTIPLIER CIRCUIT

    DOEpatents

    Thomas, R.E.

    1959-01-20

    An electronic circuit is presented for automatically computing the product of two selected variables by multiplying the voltage pulses proportional to the variables. The multiplier circuit has a plurality of parallel resistors of predetermined values connected through separate gate circults between a first input and the output terminal. One voltage pulse is applied to thc flrst input while the second voltage pulse is applied to control circuitry for the respective gate circuits. Thc magnitude of the second voltage pulse selects the resistors upon which the first voltage pulse is imprcssed, whereby the resultant output voltage is proportional to the product of the input voltage pulses

  15. Electrolyte Concentration Effect of a Photoelectrochemical Cell Consisting of TiO 2 Nanotube Anode

    DOE PAGES

    Ren, Kai; Gan, Yong X.; Nikolaidis, Efstratios; ...

    2013-01-01

    The photoelectrochemical responses of a TiO 2 nanotube anode in ethylene glycol (EG), glycerol, ammonia, ethanol, urea, and Na 2 S electrolytes with different concentrations were investigated. The TiO 2 nanotube anode was highly efficient in photoelectrocatalysis in these solutions under UV light illumination. The photocurrent density is obviously affected by the concentration change. Na 2 S generated the highest photocurrent density at 0, 1, and 2 V bias voltages, but its concentration does not significantly affect the photocurrent density. Urea shows high open circuit voltage at proper concentration and low photocurrent at different concentrations. Externally applied bias voltage is alsomore » an important factor that changes the photoelectrochemical reaction process. In view of the open circuit voltage, EG, ammonia, and ethanol fuel cells show the trend that the open circuit voltage (OCV) increases with the increase of the concentration of the solutions. Glycerol has the highest OCV compared with others, and it deceases with the increase in the concentration because of the high viscosity. The OCV of the urea and Na 2 S solutions did not show obvious concentration effect.« less

  16. Synthesis of polymer nanostructures with conductance switching properties

    DOEpatents

    Su, Kai; Nuraje, Nurxat; Zhang, Lingzhi; Matsui, Hiroshi; Yang, Nan Loh

    2015-03-03

    The present invention is directed to crystalline organic polymer nanoparticles comprising a conductive organic polymer; wherein the crystalline organic polymer nanoparticles have a size of from 10 nm to 200 nm and exhibits two current-voltage states: (1) a high resistance current-voltage state, and (2) a low resistance current-voltage state, wherein when a first positive threshold voltage (V.sub.th1) or higher positive voltage, or a second negative threshold voltage (V.sub.th2) or higher negative voltage is applied to the nanoparticle, the nanoparticle exhibits the low-resistance current-voltage state, and when a voltage less positive than the first positive threshold voltage or a voltage less negative than the second negative threshold voltage is applied to the nanoparticle, the nanoparticle exhibits the high-resistance current-voltage state. The present invention is also directed methods of manufacturing the nanoparticles using novel interfacial oxidative polymerization techniques.

  17. Adhesion characteristics of VO2 ink film sintered by intense pulsed light for smart window

    NASA Astrophysics Data System (ADS)

    Youn, Ji Won; Lee, Seok-Jae; Kim, Kwang-Seok; Kim, Dae Up

    2018-05-01

    Progress in the development of energy-efficient coatings on glass has led to the research of smart windows that can modulate solar energy in response to an external stimulus like light, heat, or electricity. Thermochromic smart windows have attracted great interest because they provide highly visible transparency and intelligently controllable solar heat. VO2 has been widely used as coating material for thermochromism owing to its reversible metal-to-insulator transition near room temperature. However, unstable crystalline phases and expensive fabrication processes of VO2 films limit their facile application in smart windows. To overcome these restrictions, we manufactured nanoinks based on VO2 nanoparticles and fabricated films using spin coating and intense pulsed light (IPL) sintering on a quartz substrate. We examined adhesion between the VO2 nanoink films and the quartz substrate by varying the applied voltages and the number of pulses. The average adhesion of thin films increased to 83 and 108 N/m as the applied voltage during IPL sintering increased from 1400 to 2000 V. By increasing the number of pulses from 5 to 20, the adhesive strength increased from 83 to 94 N/m at 1400 V, and decreased from 108 to 96 N/m at 2000 V voltage.

  18. Control of plasma properties in a short direct-current glow discharge with active boundaries

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adams, S. F.; Demidov, V. I., E-mail: vladimir.demidov@mail.wvu.edu; West Virginia University, Morgantown, West Virginia 26506

    2016-02-15

    To demonstrate controlling electron/metastable density ratio and electron temperature by applying negative voltages to the active (conducting) discharge wall in a low-pressure plasma with nonlocal electron energy distribution function, modeling has been performed in a short (lacking the positive-column region) direct-current glow discharge with a cold cathode. The applied negative voltage can modify the trapping of the low-energy part of the energetic electrons that are emitted from the cathode sheath and that arise from the atomic and molecular processes in the plasma within the device volume. These electrons are responsible for heating the slow, thermal electrons, while production of slowmore » electrons (ions) and metastable atoms is mostly due to the energetic electrons with higher energies. Increasing electron temperature results in increasing decay rate of slow, thermal electrons (ions), while decay rate of metastable atoms and production rates of slow electrons (ions) and metastable atoms practically are unchanged. The result is in the variation of electron/metastable density ratio and electron temperature with the variation of the wall negative voltage.« less

  19. The influence of voltage applied between the electrodes on optical and morphological properties of the InGaN thin films grown by thermionic vacuum arc.

    PubMed

    Özen, Soner; Şenay, Volkan; Pat, Suat; Korkmaz, Şadan

    2016-01-01

    The aim of this research is to investigate the optical and morphological properties of the InGaN thin films deposited onto amorphous glass substrates in two separate experiments with two different voltages applied between the electrodes, i.e. 500 and 600 V by means of the thermionic vacuum arc technique. This technique is original for thin film deposition and it enables thin film production in a very short period of time. The optical and morphological properties of the films were investigated by using field emission scanning electron microscope, atomic force microscope, spectroscopic ellipsometer, reflectometer, spectrophotometer, and optical tensiometer. Optical properties were also supported by empirical relations. The deposition rates were calculated as 3 and 3.3 nm/sec for 500 and 600 V, respectively. The increase in the voltage also increased the refractive index, grain size, root mean square roughness and surface free energy. According to the results of the wetting experiments, InGaN samples were low-wettable, also known as hydrophobic. © Wiley Periodicals, Inc.

  20. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    PubMed

    Hao, Zhibin; Wang, Guozhu; Li, Wenbin; Zhang, Junguo; Kan, Jiangming

    2015-01-01

    The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  1. Optical fiber voltage sensor based on Michelsion interferometer using Fabry-Perot demodulation interferometer

    NASA Astrophysics Data System (ADS)

    Chen, Xinwei; He, Shengnan; Li, Dandan; Wang, Kai; Fan, Yan'en; Wu, Shuai

    2014-11-01

    We present an optical fiber voltage sensor by Michelsion interferometer (MI) employing a Fabry-Perot (F-P) interferometer and the DC phase tracking (DCPT) signal processing method. By mounting a MI fabricated by an optical fiber coupler on a piezoelectric (PZT) transducer bar, a dynamic strain would be generated to change the optical path difference (OPD) of the interferometer when the measured voltage was applied on the PZT. Applying an F-P interferometer to demodulate the optical intensity variation output of the MI, the voltage can be obtained. The experiment results show that the relationship between the optical intensity variation and the voltage applied on the PZT is approximately linear. Furthermore, the phase generate carrier (PGC) algorithm was applied to demodulate the output of the sensor also.

  2. Acetylcholine-induced current in perfused rat myoballs

    PubMed Central

    1980-01-01

    Spherical "myoballs" were grown under tissue culture conditions from striated muscle of neonatal rat thighs. The myoballs were examined electrophysiologically with a suction pipette which was used to pass current and perfuse internally. A microelectrode was used to record membrane potential. Experiments were performed with approximately symmetrical (intracellular and extracellular) sodium aspartate solutions. The resting potential, acetylcholine (ACh) reversal potential, and sodium channel reversal potential were all approximately 0 mV. ACh-induced currents were examined by use of both voltage jumps and voltage ramps in the presence of iontophoretically applied agonist. The voltage-jump relaxations had a single exponential time-course. The time constant, tau, was exponentially related to membrane potential, increasing e-fold for 81 mV hyperpolarization. The equilibrium current- voltage relationship was also approximately exponential, from -120 to +81 mV, increasing e-fold for 104 mV hyperpolarization. The data are consistent with a first-order gating process in which the channel opening rate constant is slightly voltage dependent. The instantaneous current-voltage relationship was sublinear in the hyperpolarizing direction. Several models are discussed which can account for the nonlinearity. Evidence is presented that the "selectivity filter" for the ACh channel is located near the intracellular membrane surface. PMID:7381423

  3. Effect of current compliance and voltage sweep rate on the resistive switching of HfO{sub 2}/ITO/Invar structure as measured by conductive atomic force microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, You-Lin, E-mail: ylwu@ncnu.edu.tw; Liao, Chun-Wei; Ling, Jing-Jenn

    2014-06-16

    The electrical characterization of HfO{sub 2}/ITO/Invar resistive switching memory structure was studied using conductive atomic force microscopy (AFM) with a semiconductor parameter analyzer, Agilent 4156C. The metal alloy Invar was used as the metal substrate to ensure good ohmic contact with the substrate holder of the AFM. A conductive Pt/Ir AFM tip was placed in direct contact with the HfO{sub 2} surface, such that it acted as the top electrode. Nanoscale current-voltage (I-V) characteristics of the HfO{sub 2}/ITO/Invar structure were measured by applying a ramp voltage through the conductive AFM tip at various current compliances and ramp voltage sweep rates.more » It was found that the resistance of the low resistance state (RLRS) decreased with increasing current compliance value, but resistance of high resistance state (RHRS) barely changed. However, both the RHRS and RLRS decreased as the voltage sweep rate increased. The reasons for this dependency on current compliance and voltage sweep rate are discussed.« less

  4. Lateral and Vertical Organic Transistors

    NASA Astrophysics Data System (ADS)

    Al-Shadeedi, Akram

    An extensive study has been performed to provide a better understanding of the operation principles of doped organic field-effect transistors (OFETs), organic p-i-n diodes, Schottky diodes, and organic permeable base transistors (OPBTs). This has been accomplished by a combination of electrical and structural characterization of these devices. The discussion of doped OFETs focuses on the shift of the threshold voltage due to increased doping concentrations and the generation and transport of minority charge carriers. Doping of pentacene OFETs is achieved by co-evaporation of pentacene with the n-dopant W2(hpp)4. It is found that pentacene thin film are efficiently doped and that a conductivity in the range of 2.6 x 10-6 S cm-1 for 1 wt% to 2.5 x 10-4 S cm-1 for 16 wt% is reached. It is shown that n-doped OFET consisting of an n-doped channel and n-doped contacts are ambipolar. This behavior is surprising, as n-doping the contacts should suppress direct injection of minority charge carriers (holes). It was proposed that minority charge carrier injection and hence the ambipolar characteristic of n-doped OFETs can be explained by Zener tunneling inside the intrinsic pentacene layer underneath the drain electrode. It is shown that the electric field in this layer is indeed in the range of the breakdown field of pentacene based p-i-n Zener homodiodes. Doping the channel has a profound influence on the onset voltage of minority (hole) conduction. The onset voltage can be shifted by lightly n-doping the channel. The shift of onset voltage can be explained by two mechanisms: first, due to a larger voltage that has to be applied to the gate in order to fully deplete the n-doped layer. Second, it can be attributed to an increase in hole trapping by inactive dopants. Moreover, it has been shown that the threshold voltage of majority (electron) conduction is shifted by an increase in the doping concentration, and that the ambipolar OFETs can be turned into unipolar OFETs at high doping concentrations. In subsequent chapters, the working mechanisms of OPBTs are discussed. OPBTs consist of two Schottky diodes (top and bottom diode), and the charge transport in these C60-based Schottky diodes is studied first. Two transport regimes can be distinguished in forward direction - injection limited currents (ILCs) and space charge limited currents (SCLCs). It is found that the current increases exponentially with applied voltage in the ILC regime and depends quadratically on the applied voltage in the SCLC regime. Furthermore, it is observed that the forward and backward currents of the Schottky diode are increased by decreasing the C60 layer thickness, increasing the active area, and increasing the temperature. Furthermore, in order to reach a high performance, various treatments have been applied. Air exposure, a variation of the thickness of the top electrode, as well as annealing of the diodes are used to optimize the diodes. OPBTs are processed by using the semiconductor C60 due its high charge carrier mobility and good film-forming properties. Again, the working mechanism of OPBTs is studied by electrical characterization (base-sweep measurements and output characteristics). To achieve a high performance of OPBTs, various treatments and techniques have been applied. The annealing of the OPBTs after fabrication changes the morphology of the base electrode. Thus, openings (pinholes) are formed in the base electrode, which enables a high current transfer from the upper to lower semiconductor layer. The formation of openings is proved by analyzing SEM and TEM image of the base electrode. Adding a doped layer at the emitter is another process to optimize the OPBTs. The doped layer ensures a high charge carrier injection at the emitter, leading to a high transmission and current gain. Furthermore, it has been observed that the ON/OFF ratio and transconductance of OPBTs increases by decreasing their active area. A very high transconductance gm of 37 S/cm2 is reached, which has the potential to boost the switching speed of organic transistors to 5 MHz. Furthermore, it is shown that the base electrode thickness is an essential parameter for OPBTs. The current gain beta decreases by increasing thickness of base electrode, whereas the ON/OFF ratio increases for thicker base electrodes.

  5. Measuring the bending of asymmetric planar EAP structures

    NASA Astrophysics Data System (ADS)

    Weiss, Florian M.; Zhao, Xue; Thalmann, Peter; Deyhle, Hans; Urwyler, Prabitha; Kovacs, Gabor; Müller, Bert

    2013-04-01

    The geometric characterization of low-voltage dielectric electro-active polymer (EAP) structures, comprised of nanometer thickness but areas of square centimeters, for applications such as artificial sphincters requires methods with nanometer precision. Direct optical detection is usually restricted to sub-micrometer resolution because of the wavelength of the light applied. Therefore, we propose to take advantage of the cantilever bending system with optical readout revealing a sub-micrometer resolution at the deflection of the free end. It is demonstrated that this approach allows us to detect bending of rather conventional planar asymmetric, dielectric EAP-structures applying voltages well below 10 V. For this purpose, we built 100 μm-thin silicone films between 50 nm-thin silver layers on a 25 μm-thin polyetheretherketone (PEEK) substrate. The increase of the applied voltage in steps of 50 V until 1 kV resulted in a cantilever bending that exhibits only in restricted ranges the expected square dependence. The mean laser beam displacement on the detector corresponded to 6 nm per volt. The apparatus will therefore become a powerful mean to analyze and thereby improve low-voltage dielectric EAP-structures to realize nanometer-thin layers for stack actuators to be incorporated into artificial sphincter systems for treating severe urinary and fecal incontinence.

  6. Nanopore tweezers: voltage-controlled trapping and releasing of analytes.

    PubMed

    Chinappi, Mauro; Luchian, Tudor; Cecconi, Fabio

    2015-09-01

    Several devices for single-molecule detection and analysis employ biological and artificial nanopores as core elements. The performance of such devises strongly depends on the amount of time the analytes spend into the pore. This residence time needs to be long enough to allow the recording of a high signal-to-noise ratio analyte-induced blockade. We propose a simple approach, dubbed nanopore tweezing, for enhancing the trapping time of molecules inside the pore via a proper tuning of the applied voltage. This method requires the creation of a strong dipole that can be generated by adding a positive and a negative tail at the two ends of the molecules to be analyzed. Capture rate is shown to increase with the applied voltage while escape rate decreases. In this paper we rationalize the essential ingredients needed to control the residence time and provide a proof of principle based on atomistic simulations.

  7. Use of a wire scanner for monitoring residual gas ionization in Soreq Applied Research Accelerator Facility 20 keV/u proton/deuteron low energy beam transport beam line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vainas, B.; Eliyahu, I.; Weissman, L.

    2012-02-15

    The ion source end of the Soreq Applied Research Accelerator Facility accelerator consists of a proton/deuteron ECR ion source and a low energy beam transport (LEBT) beam line. An observed reduction of the radio frequency quadrupole transmission with increase of the LEBT current prompted additional study of the LEBT beam properties. Numerous measurements have been made with the LEBT bream profiler wire biased by a variable voltage. Current-voltage characteristics in presence of the proton beam were measured even when the wire was far out of the beam. The current-voltage characteristic in this case strongly resembles an asymmetric diodelike characteristic, whichmore » is typical of Langmuir probes monitoring plasma. The measurement of biased wire currents, outside the beam, enables us to estimate the effective charge density in vacuum.« less

  8. Validation of finite element model of transcranial electrical stimulation using scalp potentials: implications for clinical dose

    NASA Astrophysics Data System (ADS)

    Datta, Abhishek; Zhou, Xiang; Su, Yuzhou; Parra, Lucas C.; Bikson, Marom

    2013-06-01

    Objective. During transcranial electrical stimulation, current passage across the scalp generates voltage across the scalp surface. The goal was to characterize these scalp voltages for the purpose of validating subject-specific finite element method (FEM) models of current flow. Approach. Using a recording electrode array, we mapped skin voltages resulting from low-intensity transcranial electrical stimulation. These voltage recordings were used to compare the predictions obtained from the high-resolution model based on the subject undergoing transcranial stimulation. Main results. Each of the four stimulation electrode configurations tested resulted in a distinct distribution of scalp voltages; these spatial maps were linear with applied current amplitude (0.1 to 1 mA) over low frequencies (1 to 10 Hz). The FEM model accurately predicted the distinct voltage distributions and correlated the induced scalp voltages with current flow through cortex. Significance. Our results provide the first direct model validation for these subject-specific modeling approaches. In addition, the monitoring of scalp voltages may be used to verify electrode placement to increase transcranial electrical stimulation safety and reproducibility.

  9. Fundamental Study on Self-healing Insulation Performance of Silicone Rubber Affected by Local Breakdown

    NASA Astrophysics Data System (ADS)

    Hozumi, Naohiro; Nishioka, Koji; Suematsu, Takeshi; Murakami, Yoshinobu; Nagao, Masayuki; Sakata, Hiroshi

    Feasibility of self-healing insulation system was studied. A silicone rubber without filler was mounted on a glass substrate with a needle electrode. An ac voltage with 4 kV in rms was applied. The voltage was cut off when the tree had propagated into 150 micrometers in length. After the cut-off, the partial discharge inception voltage was periodically observed. The partial discharge inception voltage had once reduced into as low as 2 kV. However, it gradually increased with time, and finally exceeded the tree inception voltage (4 kV) when 30 - 60 hours had passed. It was also observed by optical microscope that the tree gradually disappeared in parallel with the recovery of the partial discharge inception voltage. The same phenomenon was observed even if 1 kV ac voltage had been continuously applied during the process of the recovery. A simulation using a needle-shaped void was performed in order to clarify the mechanism of the self-healing effect. It was observed that the tip of the needle-shaped void gradually got wet with a liquid material. It would be the result of "bleed-out" of the low molecular component included in the rubber. The tip of the void was finally filled with the liquid, however, the rest of the needle-shaped void stayed without being filled. In this type of tree, it was suggested that the self-healing effect is expected if the diameter of the tree did not exceed ca. 5 micrometers.

  10. Improved performance of the microbial electrolysis desalination and chemical-production cell with enlarged anode and high applied voltages.

    PubMed

    Ye, Bo; Luo, Haiping; Lu, Yaobin; Liu, Guangli; Zhang, Renduo; Li, Xiao

    2017-11-01

    The aim of this study was to improve performance of the microbial electrolysis desalination and chemical-production cell (MEDCC) using enlarged anode and high applied voltages. MEDCCs with anode lengths of 9 and 48cm (i.e., the 9cm-anode MEDCC and 48cm-anode MEDCC, respectively) were tested under different voltages (1.2-3.0V). Our results demonstrated for the first time that the MEDCC could maintain high performance even under the applied voltage higher than that for water dissociation (i.e., 1.8V). Under the applied voltage of 2.5V, the maximum current density in the 48cm-anode MEDCC reached 32.8±2.6A/m 2 , which is one of the highest current densities reported so far in the bioelectrochemical system (BES). The relative abundance of Geobacter was changed along the anode length. Our results show the great potential of the BES with enlarged anode and high applied voltages. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Effect of pulsed corona discharge voltage and feed gas flow rate on dissolved ozone concentration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prasetyaningrum, A., E-mail: ajiprasetyaningrum@gmail.com; Ratnawati,; Jos, B.

    Ozonization is one of the methods extensively used for water purification and degradation of organic materials. Ozone (O{sub 3}) is recognized as a powerful oxidizing agent. Due to its strong oxidability and better environmental friendless, ozone increasing being used in domestic and industrial applications. Current technology in ozone production utilizes several techniques (corona discharge, ultra violet radiation and electrolysis). This experiment aimed to evaluating effect of voltage and gas flow rate on ozone production with corona discharge. The system consists of two net-type stainless steel electrode placed in a dielectric barrier. Three pulsed voltage (20, 30, 40 KV) and flowmore » rate (5, 10, 15 L/min) were prepare for operation variable at high frequency (3.7 kHz) with AC pulsed power supply. The dissolved ozone concentration depends on the applied high-voltage level, gas flow rate and the discharge exposure duration. The ozone concentration increases with decreasing gas flow rate. Dissolved ozone concentrations greater than 200 ppm can be obtained with a minimum voltage 40 kV.« less

  12. Effect of pulsed corona discharge voltage and feed gas flow rate on dissolved ozone concentration

    NASA Astrophysics Data System (ADS)

    Prasetyaningrum, A.; Ratnawati, Jos, B.

    2015-12-01

    Ozonization is one of the methods extensively used for water purification and degradation of organic materials. Ozone (O3) is recognized as a powerful oxidizing agent. Due to its strong oxidability and better environmental friendless, ozone increasing being used in domestic and industrial applications. Current technology in ozone production utilizes several techniques (corona discharge, ultra violet radiation and electrolysis). This experiment aimed to evaluating effect of voltage and gas flow rate on ozone production with corona discharge. The system consists of two net-type stainless steel electrode placed in a dielectric barrier. Three pulsed voltage (20, 30, 40 KV) and flow rate (5, 10, 15 L/min) were prepare for operation variable at high frequency (3.7 kHz) with AC pulsed power supply. The dissolved ozone concentration depends on the applied high-voltage level, gas flow rate and the discharge exposure duration. The ozone concentration increases with decreasing gas flow rate. Dissolved ozone concentrations greater than 200 ppm can be obtained with a minimum voltage 40 kV.

  13. Current's Fluctuations through Molecular Wires Composed of Thiophene Rings.

    PubMed

    Ojeda Silva, Judith Helena; Cortés Peñaranda, Juan Camilo; Gómez Castaño, Jovanny A; Duque, Carlos Alberto

    2018-04-11

    We study theoretically the electronic transport and quantum fluctuations in single-molecule systems using thiophene rings as integrated elementary functions, as well as the dependence of these properties with the increase of the coupled rings, i.e., as a quantum wire. In order to analyze the current flow through these molecular systems, the thiophene rings are considered to be connected to metal contacts, which, in general terms, will be related to the application of voltages (bias voltages or gate voltages) to generate non-equilibrium behavior between the contacts. Due to the nonlinear behavior that is generated when said voltages are applied, it is possible to observe quantum fluctuations in the transport properties of these molecular wires. For the calculation of the transport properties, we applied a tight-binding approach using the Landauer-Büttiker formalism and the Fischer-Lee relationship, by means of a semi-analytic Green's function method within a real-space renormalization (decimation procedure). Our results showed an excellent agreement with results using a tight-binding model with a minimal number of parameters reported so far for these molecular systems.

  14. A Substrate Bias Effect on Recovery of the Threshold Voltage Shift of Amorphous Silicon Thin-Film Transistors

    NASA Astrophysics Data System (ADS)

    Han, Chang-Wook; Han, Min-Koo; Choi, Nack-Bong; Kim, Chang-Dong; Kim, Ki-Yong; Chung, In-Jae

    2007-07-01

    Hydrogenated amorphous silicon (a-Si:H) thin-film transistors (TFTs) were fabricated on a flexible stainless-steel (SS) substrate. The stability of the a-Si:H TFT is a key issue for active matrix organic light-emitting diodes (AMOLEDs). The drain current decreases because of the threshold voltage shift (Δ VTH) during OLED driving. A negative voltage at a floated gate can be induced by a negative substrate bias through a capacitor between the substrate and the gate electrode without additional circuits. The negative voltage biased at the SS substrate can recover Δ VTH and reduced drain current of the driving TFT. The VTH of the TFT increased by 2.3 V under a gate bias of +15 V and a drain bias of +15 V at 65 °C applied for 3,500 s. The VTH decreased by -2.3 V and the drain current recovered 97% of its initial value under a substrate bias of -23 V at 65 °C applied for 3,500 s.

  15. The study of surface wetting, nanobubbles and boundary slip with an applied voltage: A review

    PubMed Central

    Pan, Yunlu; Zhao, Xuezeng

    2014-01-01

    Summary The drag of fluid flow at the solid–liquid interface in the micro/nanoscale is an important issue in micro/nanofluidic systems. Drag depends on the surface wetting, nanobubbles, surface charge and boundary slip. Some researchers have focused on the relationship between these interface properties. In this review, the influence of an applied voltage on the surface wettability, nanobubbles, surface charge density and slip length are discussed. The contact angle (CA) and contact angle hysteresis (CAH) of a droplet of deionized (DI) water on a hydrophobic polystyrene (PS) surface were measured with applied direct current (DC) and alternating current (AC) voltages. The nanobubbles in DI water and three kinds of saline solution on a PS surface were imaged when a voltage was applied. The influence of the surface charge density on the nanobubbles was analyzed. Then the slip length and the electrostatic force on the probe were measured on an octadecyltrichlorosilane (OTS) surface with applied voltage. The influence of the surface charge on the boundary slip and drag of fluid flow has been discussed. Finally, the influence of the applied voltage on the surface wetting, nanobubbles, surface charge, boundary slip and the drag of liquid flow are summarized. With a smaller surface charge density which could be achieved by applying a voltage on the surface, larger and fewer nanobubbles, a larger slip length and a smaller drag of liquid flow could be found. PMID:25161839

  16. The study of surface wetting, nanobubbles and boundary slip with an applied voltage: A review.

    PubMed

    Pan, Yunlu; Bhushan, Bharat; Zhao, Xuezeng

    2014-01-01

    The drag of fluid flow at the solid-liquid interface in the micro/nanoscale is an important issue in micro/nanofluidic systems. Drag depends on the surface wetting, nanobubbles, surface charge and boundary slip. Some researchers have focused on the relationship between these interface properties. In this review, the influence of an applied voltage on the surface wettability, nanobubbles, surface charge density and slip length are discussed. The contact angle (CA) and contact angle hysteresis (CAH) of a droplet of deionized (DI) water on a hydrophobic polystyrene (PS) surface were measured with applied direct current (DC) and alternating current (AC) voltages. The nanobubbles in DI water and three kinds of saline solution on a PS surface were imaged when a voltage was applied. The influence of the surface charge density on the nanobubbles was analyzed. Then the slip length and the electrostatic force on the probe were measured on an octadecyltrichlorosilane (OTS) surface with applied voltage. The influence of the surface charge on the boundary slip and drag of fluid flow has been discussed. Finally, the influence of the applied voltage on the surface wetting, nanobubbles, surface charge, boundary slip and the drag of liquid flow are summarized. With a smaller surface charge density which could be achieved by applying a voltage on the surface, larger and fewer nanobubbles, a larger slip length and a smaller drag of liquid flow could be found.

  17. Formation of diamond nanoparticle thin films by electrophoretic deposition

    NASA Astrophysics Data System (ADS)

    Goto, Yosuke; Ohishi, Fujio; Tanaka, Kuniaki; Usui, Hiroaki

    2016-03-01

    Thin films of diamond nanoparticles were prepared by electrophoretic deposition (EPD) using 0.5 wt % dispersions in water, ethanol, and 2-propanol. The film growth rate increased with increasing voltage applied to the electrodes. However, an excessive increase in voltage caused the degradation of film morphology. The optimum voltage was 4 V with an electrode separation of 5 mm. The film growth rate was higher in organic solvents than in water. The deposited film had a smooth surface with an average surface roughness comparable to the size of primary particles of the source material. It is notable that the EPD films had a considerably higher physical stability than spin-coated and cast films. The stability was further improved by thermally annealing the films. IR analysis revealed that the diamond nanoparticles have carboxy and amino groups on their surfaces. It is considered that the stability of the EPD films originate from a chemical reaction between these functional groups.

  18. Effect of water on sulfur dioxide (SO2) and nitrogen oxides (NOx) removal from flue gas in a direct current corona discharge reactor

    NASA Astrophysics Data System (ADS)

    Yang, Jiaxiang; Chi, Xiaochun; Dong, Limin

    2007-05-01

    A direct current (dc) corona discharge reactor composed of needle-plate electrodes in a glass container filled with flue gas was designed. To clarify the influence of water on discharge characteristics, water was introduced in the plasma reactor as electrode where plate electrode is immersed, under the application of dc voltage. Experiment results show that (1) corona wind forming between high-voltage needle electrode and water by corona discharge enhances the cleaning efficiency of flue gas due to the existence of water and the cleaning efficiency will increase with the increase of applied dc voltage within definite range and (2) both removal efficiencies of NOx and SO2 increased in the presence of water, which reach up to 98% for SO2, and about 85% for NOx under suitable conditions. These results play an important role in flue gas cleanup research.

  19. Ion manipulation device with electrical breakdown protection

    DOEpatents

    Chen, Tsung-Chi; Tang, Keqi; Ibrahim, Yehia M; Smith, Richard D; Anderson, Gordon A; Baker, Erin M

    2014-12-02

    An ion manipulation method and device is disclosed. The device includes a pair of substantially parallel surfaces. An array of inner electrodes is contained within, and extends substantially along the length of, each parallel surface. The device includes a first outer array of electrodes and a second outer array of electrodes. Each outer array of electrodes is positioned on either side of the inner electrodes, and is contained within and extends substantially along the length of each parallel surface. A DC voltage is applied to the first and second outer array of electrodes. A RF voltage, with a superimposed electric field, is applied to the inner electrodes by applying the DC voltages to each electrode. Ions either move between the parallel surfaces within an ion confinement area or along paths in the direction of the electric field, or can be trapped in the ion confinement area. The surfaces are housed in a chamber, and at least one electrically insulative shield is coupled to an inner surface of the chamber for increasing a mean-free-path between two adjacent electrodes in the chamber.

  20. Voltage-induced Metal-Insulator Transitions in Perovskite Oxide Thin Films Doped with Strongly Correlelated Electrons

    NASA Astrophysics Data System (ADS)

    Wang, Yudi; Gil Kim, Soo; Chen, I.-Wei

    2007-03-01

    We have observed a reversible metal-insulator transition in perovskite oxide thin films that can be controlled by charge trapping pumped by a bipolar voltage bias. In the as-fabricated state, the thin film is metallic with a very low resistance comparable to that of the metallic bottom electrode, showing decreasing resistance with decreasing temperature. This metallic state switches to a high-resistance state after applying a voltage bias: such state is non-ohmic showing a negative temperature dependence of resistance. Switching at essentially the same voltage bias was observed down to 2K. The metal-insulator transition is attributed to charge trapping that disorders the energy of correlated electron states in the conduction band. By increasing the amount of charge trapped, which increases the disorder relative to the band width, increasingly more insulating states with a stronger temperature dependence of resistivity are accessed. This metal-insulator transition provides a platform to engineer new nonvolatile memory that does not require heat (as in phase transition) or dielectric breakdown (as in most other oxide resistance devices).

  1. Thermal Control Utilizing an Thermal Control Utilizing an Two-Phase Loop with High Heat Flux Source

    NASA Technical Reports Server (NTRS)

    Jeong, Seong-Il; Didion, Jeffrey

    2004-01-01

    The electric field applied in dielectric fluids causes an imbalance in the dissociation-recombination reaction generated free space charges. The generated charges are redistributed by the applied electric field resulting in the heterocharge layers in the Vicinity of the electrodes. Proper design of the electrodes generates net axial flow motion pumping the fluid. The electrohydrodynamic (EHD) conduction pump is a new device that pumps dielectric fluids utilizing heterocharge layers formed by imposition of electrostatic fields. This paper evaluates the experimental performance of a two-phase breadboard thermal control loop consisting of an EHD conduction pump, condenser, pre-heater, high heat flux evaporator (HE), transport lines, and reservoir (accumulator). The generated pressure head and the maximum applicable heat flux are experimentally determined at various applied voltages and sink temperatures. Recovery from dryout condition by increasing the applied voltage to the pump is also demonstrated.

  2. Moderately nonlinear diffuse-charge dynamics under an ac voltage.

    PubMed

    Stout, Robert F; Khair, Aditya S

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  3. Optimization on drying conditions of a solar electrohydrodynamic drying system based on desirability concept

    PubMed Central

    Dalvand, Mohammad Jafar; Mohtasebi, Seyed Saeid; Rafiee, Shahin

    2014-01-01

    The purpose of this article was to present a new drying method for agricultural products. Electrohydrodynamic (EHD) has been applied for drying of agricultural materials due to several advantages such as energy saving, low cost equipment, low drying temperatures, and superior material quality. To evaluate this method, an EHD dryer based on solar (photovoltaic) energy was designed and fabricated. Moreover, the optimum condition for the EHD drying of kiwi fruit was studied by applying the Box–Behnken design of response surface methodology. The desirability function was applied for optimization in case of single objective and multiobjective functions. By using the multiobjective optimization method, maximum desirability value of 0.865 was obtained based on the following: applied voltage of 15 kV, field strength of 5.2 kV cm−1, without forced air stream, and finally a combination of 17 discharge electrodes (needles). The results indicated that increasing the applied voltage from 6 to 15 kV, moisture ratio (MR) decreased, though energy efficiency and energy consumption were increasing. On the other hand, field strength of 5.2 kV cm−1 was the optimal point in terms of MR. PMID:25493195

  4. Optimization on drying conditions of a solar electrohydrodynamic drying system based on desirability concept.

    PubMed

    Dalvand, Mohammad Jafar; Mohtasebi, Seyed Saeid; Rafiee, Shahin

    2014-11-01

    The purpose of this article was to present a new drying method for agricultural products. Electrohydrodynamic (EHD) has been applied for drying of agricultural materials due to several advantages such as energy saving, low cost equipment, low drying temperatures, and superior material quality. To evaluate this method, an EHD dryer based on solar (photovoltaic) energy was designed and fabricated. Moreover, the optimum condition for the EHD drying of kiwi fruit was studied by applying the Box-Behnken design of response surface methodology. The desirability function was applied for optimization in case of single objective and multiobjective functions. By using the multiobjective optimization method, maximum desirability value of 0.865 was obtained based on the following: applied voltage of 15 kV, field strength of 5.2 kV cm(-1), without forced air stream, and finally a combination of 17 discharge electrodes (needles). The results indicated that increasing the applied voltage from 6 to 15 kV, moisture ratio (MR) decreased, though energy efficiency and energy consumption were increasing. On the other hand, field strength of 5.2 kV cm(-1) was the optimal point in terms of MR.

  5. Characterization on performance of micromixer using DC-biased AC electroosmosis

    NASA Astrophysics Data System (ADS)

    Park, Bi-O.; Song, Simon

    2010-11-01

    An active micromixer using DC-biased AC-Electroosmosis (ACEO) is investigated to figure out the effects of design parameters on the mixing performance. The mixer consists of a straight microchannel, with a cross section of 60 x 100 μm, and gold electrode pairs fabricated in the microchannel. The design parameters include the number of electrode pairs, flow rate, DC-biased voltage, AC voltage and AC frequency. First, we found that a mixing index became 80% 100 μm downstream of a single electrode pair with a length of 2 mm when applying a 25Vpp, 2.0 VDC, 100 kHz sine signal to the electrodes. With decreasing AC frequency, the mixing index is affected little. But the mixing index significantly increases with increasing either DC-biased voltage or AC voltage. Also, we were able to increase the mixing index up to 90% by introducing alternating vortices with multiple electrode pairs. Finally, we discovered that the mixing index decreases as the flow rate increases in the microchannel, and there is an optimal number of electrode pairs with respect to a flow rate. Detailed quantitative measurement results will be presented at the meeting.

  6. Light-activated resistance switching in SiOx RRAM devices

    NASA Astrophysics Data System (ADS)

    Mehonic, A.; Gerard, T.; Kenyon, A. J.

    2017-12-01

    We report a study of light-activated resistance switching in silicon oxide (SiOx) resistive random access memory (RRAM) devices. Our devices had an indium tin oxide/SiOx/p-Si Metal/Oxide/Semiconductor structure, with resistance switching taking place in a 35 nm thick SiOx layer. The optical activity of the devices was investigated by characterising them in a range of voltage and light conditions. Devices respond to illumination at wavelengths in the range of 410-650 nm but are unresponsive at 1152 nm, suggesting that photons are absorbed by the bottom p-type silicon electrode and that generation of free carriers underpins optical activity. Applied light causes charging of devices in the high resistance state (HRS), photocurrent in the low resistance state (LRS), and lowering of the set voltage (required to go from the HRS to LRS) and can be used in conjunction with a voltage bias to trigger switching from the HRS to the LRS. We demonstrate negative correlation between set voltage and applied laser power using a 632.8 nm laser source. We propose that, under illumination, increased electron injection and hence a higher rate of creation of Frenkel pairs in the oxide—precursors for the formation of conductive oxygen vacancy filaments—reduce switching voltages. Our results open up the possibility of light-triggered RRAM devices.

  7. Low-Voltage Electrowetting on a Lipid Bilayer Formed on Hafnium Oxide

    DTIC Science & Technology

    2011-06-01

    currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY) 2. REPORT TYPE 3. DATES...exceeding 10 V [9-10]. Here we report the development of electrowetting systems that do not contain solid organic dielectrics such as fluoropolymers, but...and the effective thickness ( T 𔃺 : :) of the bilayer in response to applied voltage are plotted in Fig. 3(b). The capacitance per area increased with

  8. Switching of actin-myosin motors by voltage-induced pH bias in vitro.

    PubMed

    Hatori, Kuniyuki; Iwase, Takahiro; Wada, Reito

    2016-08-01

    ATP-driven motor proteins, which function in cell motility and organelle transport, have potential applications as bio-inspired micro-devices; however, their control remains unsatisfactory. Here, we show rapid-velocity control of actin filaments interacting with myosin motors using voltage applied to Pt electrodes in an in vitro motility system, by which immediate increases and decreases in velocity were induced beside the cathode and anode, respectively. Indicator dye revealed pH changes after voltage application, and alternate voltage switching allowed actin filaments to cyclically alter their velocity in response to these changes. This principle provides a basis for on-demand control of not only motor proteins but also pH-sensitive events at a microscopic level. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Focal length hysteresis of a double-liquid lens based on electrowetting

    NASA Astrophysics Data System (ADS)

    Peng, Runling; Wang, Dazhen; Hu, Zhiwei; Chen, Jiabi; Zhuang, Songlin

    2013-02-01

    In this paper, an extended Young equation especially suited for an ideal cylindrical double-liquid variable-focus lens is derived by means of an energy minimization method. Based on the extended Young equation, a kind of focal length hysteresis effect is introduced into the double-liquid variable-focus lens. Such an effect can be explained theoretically by adding a force of friction to the tri-phase contact line. Theoretical analysis shows that the focal length at a particular voltage can be different depending on whether the applied voltage is increasing or decreasing, that is, there is a focal length hysteresis effect. Moreover, the focal length at a particular voltage must be larger when the voltage is rising than when it is dropping. These conclusions are also verified by experiments.

  10. Voltage-dependent formation of gramicidin channels in lipid bilayers.

    PubMed Central

    Sandblom, J; Galvanovskis, J; Jilderos, B

    2001-01-01

    The formation kinetics of gramicidin A channels in lipid bilayer membranes has been characterized as a function of voltage for different solution conditions and membrane composition. The frequency of channel events was measured during the application of voltage ramps and counted in given intervals, a procedure that eliminated the effects of drift in gramicidin concentration. The formation rate was found to increase strongly with voltages up to approximately 50 mV and then to level off slightly. The shape of the voltage dependence was independent of lipid solvent and ramp speed but differed for different ions and different solution concentrations. This suggested an ion occupancy effect on the formation rate that was further supported by the fact that the minimum of the formation rate was shifted toward the equilibrium potential in asymmetric solution concentrations. The effects are explained in terms of a model that contains two contributions to the voltage dependence, a voltage-dependent ion binding to the monomers and a polarization of monomers by the applied electric field and by the occupied ions. The theory is found to give a good fit to experimental data. PMID:11463628

  11. Voltage droop Coordinating Control applied in UPFC and STATCOM system

    NASA Astrophysics Data System (ADS)

    Junhui, Huang; Zhuyi, Peng; Chengjie, Ni; Yiqing, Xu; Jiliang, Xue

    2018-04-01

    When UPFC, unified power flow controller is applied with other FACTS into power grid, it is possible that the voltage controlled vibrates constantly to response to a sudden reactive power turbulent in grid if the parameters of these FACTS are not coordinating reasonably. Moreover, the reactive power generated by these equipment will intertwine unexpectedly. The article proposes a method named voltage-reactive power droop control to allow the reference voltage fluctuating around the rating voltage so that the vibration is reduced and the power distribution is improved. Finally, the article cite a electric-magnetic simulation by EMTDC models of east-China power grid to prove it effective when applied to improve the response characteristics to sudden turbulence in power grid.

  12. Increasing The Electric Field For An Improved Search For Time-Reversal Violation Using Radium-225

    NASA Astrophysics Data System (ADS)

    Powers, Adam

    2017-09-01

    Radium-225 atoms, because of their unusual pear-shaped nuclei, have an enhanced sensitivity to the violation of time reversal symmetry. A breakdown of this fundamental symmetry could help explain the apparent scarcity of antimatter in the Universe. Our goal is to improve the statistical sensitivity of an ongoing experiment that precisely measures the EDM of Radium-225. This can be done by increasing the electric field acting on the Radium atoms. We do this by increasing the voltage that can be reliably applied between two electrodes, and narrowing the gap between them. We use a varying high voltage system to condition the electrodes using incremental voltage ramp tests to achieve higher voltage potential differences. Using an adjustable gap mount to change the distance between the electrodes, specific metals for their composition, and a clean room procedure to keep particulates out of the system, we produce a higher and more stable electric field. Progress is marked by measurements of the leakage current between the electrodes during our incremental voltage ramp tests or emulated tests of the actual experiment, with low and constant current showing stability of the field. This project is supported by Michigan State University, and the US DOE, Office of Science, Office of Nuclear Physics, under Contract DE-AC02-06CH11357.

  13. Effects of oxide replacement with fluoride at the CoFeB interface on interface magnetic anisotropy and its voltage control

    NASA Astrophysics Data System (ADS)

    Pankieiev, Mykhailo; Kita, Koji

    2018-05-01

    In this paper we report results of improving Co60Fe20B20 interface perpendicular magnetic anisotropy (PMA) by replacing neighbor oxide layer with fluoride one. We expected that fluorine as element with higher than oxide electronegativity could more effectively attract electrons from out-of-plane d orbitals of ferromagnetic, increasing role of in-plane orbitals. By this we wanted to increase PMA and its response to applied voltage bias. Polar magneto-optic Kerr effect measurement show decreasing of out-of-plane magnetic field needed to change magnetization to perpendicular in stacks with oxygen replaced by fluorine as well as increasing of coefficient of response to applied voltage α from < 10 fJ/Vm for CoFeB/Al2O3 interface to 20 fJ/Vm for CoFeB/AlF3/Al2O3 and 22 fJ/Vm for CoFeB/MgF2 stacks. Direct chemical interaction of Co with F was confirmed by x-ray photoelectron spectroscopy (XPS) measurement of Co2p core level region. Moreover angular-resolved XPS showed that F tends to stay at CoFeB interface rather than diffuse out of it.

  14. Disinfection of chicken fillets in packages with atmospheric cold plasma: effects of treatment voltage and time.

    PubMed

    Wang, J M; Zhuang, H; Lawrence, K; Zhang, J H

    2018-05-01

    To study effects of treatment voltage and time of in-package atmospheric cold plasmas (ACP) on quality of raw chicken meat. Meat was packed in trays in air, treated with ACP and stored at 4°C for 24 h or 3 days. Increasing voltage from 55 to 80 kV caused increasing O 3 inside packages, but had no effects on microbes, colour and pH after 24 h of storage at 4°C. There were no differences in O 3 , microbes, colour lightness and pH between treatment times 3, 6 and 9 min at 80 kV after 3-day storage. However, microbial populations on ACP-treated meat were lower than untreated control. Treatments at 80 kV for >3 min reduced meat redness and yellowness. ACP voltage does not affect microbes, colour and pH of meat after 24 h of storage. ACP treatments for ≥3 min at 80 kV reduce microbes and affect colour of raw meat. Our data demonstrate that increasing ACP voltage from 55 to 80 kV or time from 3 to 9 min may not affect meat microbial growth and pH. Increasing treatment time longer than 3 min may affect meat appearance. © 2017 The Society for Applied Microbiology.

  15. Dynamic neutral beam current and voltage control to improve beam efficacy in tokamaks

    NASA Astrophysics Data System (ADS)

    Pace, D. C.; Austin, M. E.; Bardoczi, L.; Collins, C. S.; Crowley, B.; Davis, E.; Du, X.; Ferron, J.; Grierson, B. A.; Heidbrink, W. W.; Holcomb, C. T.; McKee, G. R.; Pawley, C.; Petty, C. C.; Podestà, M.; Rauch, J.; Scoville, J. T.; Spong, D. A.; Thome, K. E.; Van Zeeland, M. A.; Varela, J.; Victor, B.

    2018-05-01

    An engineering upgrade to the neutral beam system at the DIII-D tokamak [J. L. Luxon, Nucl. Fusion 42, 614 (2002)] enables time-dependent programming of the beam voltage and current. Initial application of this capability involves pre-programmed beam voltage and current injected into plasmas that are known to be susceptible to instabilities that are driven by energetic ( E ≥ 40 keV) beam ions. These instabilities, here all Alfvén eigenmodes (AEs), increase the transport of the beam ions beyond a classical expectation based on particle drifts and collisions. Injecting neutral beam power, P beam ≥ 2 MW, at reduced voltage with increased current reduces the drive for Alfvénic instabilities and results in improved ion confinement. In lower-confinement plasmas, this technique is applied to eliminate the presence of AEs across the mid-radius of the plasmas. Simulations of those plasmas indicate that the mode drive is decreased and the radial extent of the remaining modes is reduced compared to a higher beam voltage case. In higher-confinement plasmas, this technique reduces AE activity in the far edge and results in an interesting scenario of beam current drive improving as the beam voltage reduces from 80 kV to 65 kV.

  16. Dynamic neutral beam current and voltage control to improve beam efficacy in tokamaks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Austin, Max E.; Bardoczi, Laszlo; Collins, Cami S.

    Here, an engineering upgrade to the neutral beam system at the DIII-D tokamak enables time-dependent programming of the beam voltage and current. Initial application of this capability involves pre-programmed beam voltage and current injected into plasmas that are known to be susceptible to instabilities that are driven by energetic (E ≥ 40 keV) beam ions. These instabilities, here all Alfvén eigenmodes (AEs), increase the transport of the beam ions beyond a classical expectation based on particle drifts and collisions. Injecting neutral beam power, P beam ≥ 2MW, at reduced voltage with increased current reduces the drive for Alfvénic instabilities andmore » results in improved ion confinement. In lower-confinement plasmas, this technique is applied to eliminate the presence of AEs across the mid-radius of the plasmas. Simulations of those plasmas indicate that the mode drive is decreased and the radial extent of the remaining modes is reduced compared to a higher beam voltage case. In higher-confinement plasmas, this technique reduces AE activity in the far edge and results in an interesting scenario of beam current drive improving as the beam voltage reduces from 80 kV to 65 kV.« less

  17. Dynamic neutral beam current and voltage control to improve beam efficacy in tokamaks

    DOE PAGES

    Austin, Max E.; Bardoczi, Laszlo; Collins, Cami S.; ...

    2018-04-20

    Here, an engineering upgrade to the neutral beam system at the DIII-D tokamak enables time-dependent programming of the beam voltage and current. Initial application of this capability involves pre-programmed beam voltage and current injected into plasmas that are known to be susceptible to instabilities that are driven by energetic (E ≥ 40 keV) beam ions. These instabilities, here all Alfvén eigenmodes (AEs), increase the transport of the beam ions beyond a classical expectation based on particle drifts and collisions. Injecting neutral beam power, P beam ≥ 2MW, at reduced voltage with increased current reduces the drive for Alfvénic instabilities andmore » results in improved ion confinement. In lower-confinement plasmas, this technique is applied to eliminate the presence of AEs across the mid-radius of the plasmas. Simulations of those plasmas indicate that the mode drive is decreased and the radial extent of the remaining modes is reduced compared to a higher beam voltage case. In higher-confinement plasmas, this technique reduces AE activity in the far edge and results in an interesting scenario of beam current drive improving as the beam voltage reduces from 80 kV to 65 kV.« less

  18. Processing Ti-25Ta-5Zr Bioalloy via Anodic Oxidation Procedure at High Voltage

    NASA Astrophysics Data System (ADS)

    Ionita, Daniela; Grecu, Mihaela; Dilea, Mirela; Cojocaru, Vasile Danut; Demetrescu, Ioana

    2011-12-01

    The current paper reports the processing of Ti-25Ta-5Zr bioalloy via anodic oxidation in NH4BF4 solution under constant potentiostatic conditions at high voltage to obtain more suitable properties for biomedical application. The maximum efficiency of the procedure is reached at highest applied voltage, when the corrosion rate in Hank's solution is decreased approxomately six times. The topography of the anodic layer has been studied using atomic force microscopy (AFM), and the results indicated that the anodic oxidation process increases the surface roughness. The AFM images indicated a different porosity for the anodized surfaces as well. After anodizing, the hydrophilic character of Ti-25Ta-5Zr samples has increased. A good correlation between corrosion rate obtained from potentiodynamic curves and corrosion rate from ions release analysis was obtained.

  19. Direct bioactive ceramics coating via reactive Growing Integration Layer method on α-Ti-alloy.

    PubMed

    Huang, Chi-Huang; Chen, Rong-Sheng; Yoshimura, Masahiro

    2017-07-01

    This paper demonstrates Ca-P-rich bio-ceramic and hydroxyapatite (HA) coatings formed directly from the solution of calcium acetate (CA) and sodium dihydrogen phosphate (SDP) on α-Ti-alloy substrates by Growing Integration Layer (GIL) technology under DC power supply. The composition of the α-Ti-alloy was Ti7Cu5Sn. The GIL coated films formed in 30min time with different voltages applied had porous and rough ceramic surfaces. They consisted mostly of various oxides like rutile, anatase, and calcium phosphates (including hydroxyapatite) that reduce corrosion rate and increase biocompatibility. An important feature was the reduction of Cu at the surfaces of the alloys. Furthermore, along with the applied voltage, the content of HA, the size of micro-pores, and hardness all increased, while the number of micro-pores in the ceramic membrane got reduced. The potential, current and resistance of corrosion were identified by potentiodynamic (PD) polarization and electrochemical impedance spectroscopy (EIS). The higher applied voltage improved the surface quality, HA formation rate, and the anti-corrosion behavior. Consequently, the samples - prepared at 350V and surface current density of 3A/cm 2 - possessed the most compact HA films, and also had the best corrosion resistance - in 0.9wt% NaCl solution at 37±1°C. Copyright © 2017. Published by Elsevier B.V.

  20. Vibration energy harvesting based on integrated piezoelectric components operating in different modes.

    PubMed

    Hu, Junhui; Jong, Januar; Zhao, Chunsheng

    2010-01-01

    To increase the vibration energy-harvesting capability of the piezoelectric generator based on a cantilever beam, we have proposed a piezoelectric generator that not only uses the strain change of piezoelectric components bonded on a cantilever beam, but also employs the weights at the tip of the cantilever beam to hit piezoelectric components located on the 2 sides of weights. A prototype of the piezoelectric generator has been fabricated and its characteristics have been measured and analyzed. The experimental results show that the piezoelectric components operating in the hit mode can substantially enhance the energy harvesting of the piezoelectric generator on a cantilever beam. Two methods are used and compared in the management of rectified output voltages from different groups of piezoelectric components. In one of them, the DC voltages from rectifiers are connected in series, and then the total DC voltage is applied to a capacitor. In another connection, the DC voltage from each group is applied to different capacitors. It is found that 22.3% of the harvested energy is wasted due to the series connection. The total output electric energy of our piezoelectric generator at nonresonance could be up to 43 nJ for one vibration excitation applied by spring, with initial vibration amplitude (0-p) of 18 mm and frequency of 18.5 Hz, when the rectified voltages from different groups of piezoelectric components are connected to their individual capacitors. In addition, the motion and impact of the weights at the tip of the cantilever beam are theoretically analyzed, which well explains the experimental phenomena and suggests the measures to improve the generator.

  1. Effective screening length of isotropic liquid samples submitted to an applied voltage.

    PubMed

    Zola, R S; Evangelista, L R; Barbero, G

    2006-05-25

    A cell of isotropic liquid in the shape of a slab of thickness d and containing ionic impurities is considered. It is shown that the screening effect produced by the ionic charges on the external field is characterized by an effective surface length, lambda(S)(U), depending on the applied voltage U. The analysis indicates that lambda(S)(U)) < lambda(D) when the applied voltage is very large, and lambda(S)(U) --> lambda(D) for very small values of the applied voltage, where lambda(D) is the Debye screening length. The presence of the ions is responsible also for a counterpotential, v, that for small U is such to cancel the effective electric field in the sample, whereas in the opposite limit it is inversely proportional to the applied difference of potential.

  2. Coordinated Voltage Control of Transformer Taps on account of Hierarchical Structure in Power System

    NASA Astrophysics Data System (ADS)

    Nakachi, Yoshiki; Kato, Satoshi; Ukai, Hiroyuki

    Participation of distributed generators (DG), such as wind turbines, co-generation system etc., is natural trend from ecological point of view and will increase more and more. The outputs of these DGs mainly depend on weather condition but don't correspond to the changes of electrical load demand necessarily. On the other hand, due to the deregulation of electric power market, the power flow in power system will uncertainly vary with several power transactions. Thus, complex power flow by DGs or transactions will cause the voltage deviation. It will be difficult to sustain the voltage quality by using the conventional voltage/reactive power control in near future. In this paper, in order to avoid such a voltage deviation and to decrease the frequency of transformer tap actions, the coordinated voltage control scheme of transformer taps on account of hierarchical structure in power system is proposed. In the proposed scheme, integral of voltage deviation at each layer bus is applied to decide the timing of each transformer tap action. It is confirmed by some numerical simulations that the proposed scheme is able to respond to every conditions on voltage deviation.

  3. Biosensing in a microelectrofluidic system using optical whispering-gallery mode spectroscopy

    PubMed Central

    Huang, Lei; Guo, Zhixiong

    2011-01-01

    Label-free detection of biomolecules using an optical whispering-gallery mode sensor in a microelectrofluidic channel is simulated. Negatively charged bovine serum albumin is considered as the model protein analyte. The analyte transport in aqueous solution is controlled by an externally applied electrical field. The finite element method is employed for solving the equations of the charged species transport, the Poisson equation of electric potential, the equations of conservation of momentum and energy, and the Helmholtz equations of electromagnetic waves. The adsorption process of the protein molecules on the microsensor head surface is monitored by the resonance frequency shifts. Frequency shift caused by temperature variation due to Joule heating is analyzed and found to be negligible. The induced shifts behave in a manner similar to Langmuir-like adsorption kinetics; but the time constant increases due to the presence of the external electrical field. A correlation of the frequency shift, the analyte feed concentration in the solution, and the applied voltage gradient is obtained, in which an excellent linear relationship between the frequency shift and the analyte concentration is revealed. The applied voltage gradient enhances significantly the analyte concentration in the vicinity of the sensor surface; thus, the sensor sensitivity which has a power function of the voltage gradient with exponent 2.85 in the controlled voltage range. Simulated detection of extremely low protein concentration to the pico-molar level is carried out. PMID:22662041

  4. The influence of geometrical characteristics on the photocatalytic activity of TiO2 nanotube arrays for degradation of refractory organic pollutants in wastewater.

    PubMed

    Noeiaghaei, T; Yun, J-H; Nam, S W; Zoh, K D; Gomes, V G; Kim, J O; Chae, S R

    2015-01-01

    The effects of geometrical characteristics such as surface area (SA) and porosity of TiO2 nanotube arrays (TNAs) on its photocatalytic activity were investigated by applying variable voltages and reaction times for the anodization of Ti substrates. While larger SA of nanotubes was observed under higher applied potential, the porosity of TNAs decreased by increasing anodizing voltage. Under applied potential of 80 V, the SA of TNAs increased from 0.164 to 0.471 m2/g as anodization time increased from 1 to 5 hours, respectively. However, no significant effect on the porosity of TNAs was observed. On the other hand, both SA and porosity of TNAs, synthesized at 60 V, increased by augmenting the anodization time from 1 to 3 hours. But further increasing of anodization time to 5 hours resulted in a decreased SA of TNAs with no effect on their porosity. Accordingly, the TNAs with SA of 0.368 m2/g and porosity of 47% showed the highest photocatalytic activity for degradation of 4-chlorobenzoic acid (4CBA). Finally, the degradation of refractory model compounds such as carbamazepine and bisphenol-A was tested and more than 50% of both compounds could be degraded under UV-A irradiation (λmax=365 nm).

  5. Towards an understanding of induced-charge electrokinetics at large applied voltages in concentrated solutions.

    PubMed

    Bazant, Martin Z; Kilic, Mustafa Sabri; Storey, Brian D; Ajdari, Armand

    2009-11-30

    The venerable theory of electrokinetic phenomena rests on the hypothesis of a dilute solution of point-like ions in quasi-equilibrium with a weakly charged surface, whose potential relative to the bulk is of order the thermal voltage (kT/e approximately 25 mV at room temperature). In nonlinear electrokinetic phenomena, such as AC or induced-charge electro-osmosis (ACEO, ICEO) and induced-charge electrophoresis (ICEP), several V approximately 100 kT/e are applied to polarizable surfaces in microscopic geometries, and the resulting electric fields and induced surface charges are large enough to violate the assumptions of the classical theory. In this article, we review the experimental and theoretical literatures, highlight discrepancies between theory and experiment, introduce possible modifications of the theory, and analyze their consequences. We argue that, in response to a large applied voltage, the "compact layer" and "shear plane" effectively advance into the liquid, due to the crowding of counterions. Using simple continuum models, we predict two general trends at large voltages: (i) ionic crowding against a blocking surface expands the diffuse double layer and thus decreases its differential capacitance, and (ii) a charge-induced viscosity increase near the surface reduces the electro-osmotic mobility; each trend is enhanced by dielectric saturation. The first effect is able to predict high-frequency flow reversal in ACEO pumps, while the second may explain the decay of ICEO flow with increasing salt concentration. Through several colloidal examples, such as ICEP of an uncharged metal sphere in an asymmetric electrolyte, we show that nonlinear electrokinetic phenomena are generally ion-specific. Similar theoretical issues arise in nanofluidics (due to confinement) and ionic liquids (due to the lack of solvent), so the paper concludes with a general framework of modified electrokinetic equations for finite-sized ions.

  6. An optical fiber Bragg grating and piezoelectric ceramic voltage sensor

    NASA Astrophysics Data System (ADS)

    Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui

    2017-10-01

    Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.

  7. An optical fiber Bragg grating and piezoelectric ceramic voltage sensor.

    PubMed

    Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui

    2017-10-01

    Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.

  8. Energy saving in ac generators

    NASA Technical Reports Server (NTRS)

    Nola, F. J.

    1980-01-01

    Circuit cuts no-load losses, without sacrificing full-load power. Phase-contro circuit includes gate-controlled semiconductor switch that cuts off applied voltage for most of ac cycle if generator idling. Switch "on" time increases when generator is in operation.

  9. Voltage stability analysis in the new deregulated environment

    NASA Astrophysics Data System (ADS)

    Zhu, Tong

    Nowadays, a significant portion of the power industry is under deregulation. Under this new circumstance, network security analysis is more critical and more difficult. One of the most important issues in network security analysis is voltage stability analysis. Due to the expected higher utilization of equipment induced by competition in a power market that covers bigger power systems, this issue is increasingly acute after deregulation. In this dissertation, some selected topics of voltage stability analysis are covered. In the first part, after a brief review of general concepts of continuation power flow (CPF), investigations on various matrix analysis techniques to improve the speed of CPF calculation for large systems are reported. Based on these improvements, a new CPF algorithm is proposed. This new method is then tested by an inter-area transaction in a large inter-connected power system. In the second part, the Arnoldi algorithm, the best method to find a few minimum singular values for a large sparse matrix, is introduced into the modal analysis for the first time. This new modal analysis is applied to the estimation of the point of voltage collapse and contingency evaluation in voltage security assessment. Simulations show that the new method is very efficient. In the third part, after transient voltage stability component models are investigated systematically, a novel system model for transient voltage stability analysis, which is a logical-algebraic-differential-difference equation (LADDE), is offered. As an example, TCSC (Thyristor controlled series capacitors) is addressed as a transient voltage stabilizing controller. After a TCSC transient voltage stability model is outlined, a new TCSC controller is proposed to enhance both fault related and load increasing related transient voltage stability. Its ability is proven by the simulation.

  10. [Analysis of streamer properties and emission spectroscopy of 2-D OH distribution of pulsed corona discharge].

    PubMed

    Zhao, Lei; Gao, Xiang; Luo, Zhong-Yang; Xuan, Jian-Yong; Jiang, Jian-Ping; Cen, Ke-Fa

    2011-11-01

    Streamer plays a key role in the process of OH radical generation. The propagation of primary and secondary streamers of positive wire-plate pulsed corona discharge was observed using a short gate ICCD in air environment. The influence of the applied voltage on the properties was investigated. It was shown that the primary streamer propagation velocity, electric coverage and length of secondary streamer increased significantly with increasing the applied voltage. Then 2-D OH distribution was investigated by the emission spectrum. With the analysis of the OH emission spectra, the distribution of OH radicals showed a trend of decreasing from the wire electrode to its circumambience. Compared with the streamer propagation trace, the authors found that OH radical distribution and streamer are in the same area. Both OH radical concentration and the intensity of streamer decreased when far away from the wire electrode.

  11. Polarization and Fowler-Nordheim tunneling in anodized Al-Al2O3-Au diodes

    NASA Astrophysics Data System (ADS)

    Hickmott, T. W.

    2000-06-01

    Polarization in anodic Al2O3 films is measured by using quasi-dc current-voltage (I-V) curves of Al-Al2O3-Au diodes. A reproducible polarization state is established by applying a negative voltage to the Au electrode of a rectifying Al-Al2O3-Au diode. The difference between subsequent I-V curves with Au positive is a measure of polarization in the sample. The magnitude of polarization charge in Al2O3 depends on the anodizing electrolyte. Al2O3 films formed in H2O-based electrolytes have approximately ten times the polarization charge of Al2O3 films formed in ethylene glycol-based electrolyte. Anodizing conditions that produce greater polarizing charge in anodic Al2O3 result in voltage-time curves during anodization under galvanostatic conditions that are nonlinear. Anodic films with greater polarizing charge also have a greater apparent interface capacitance which is independent of Al2O3 thickness. I-V curves of Al-Al2O3-Au diodes for increasing voltage are dominated by polarization. I-V curves for decreasing voltage are reproducible and parallel but depend on the maximum current and voltage reached during the measurement. There is no single current corresponding to a given voltage. I-V curves for decreasing voltage are analyzed assuming that the conduction mechanism is Fowler-Nordheim (FN) tunneling. There is a qualitative difference between the FN tunneling parameters for Al2O3 films formed in H2O-based electrolytes and those formed in ethylene glycol-based electrolyte. For the former the value of the exponential term in the FN analysis increases as the value of maximum voltage and current in an I-V characteristic increases, while the value of the pre-exponential term is nearly constant. For the latter, the exponential term is nearly constant as maximum voltage and current increase, but the pre-exponential term decreases by about 5 decades. Thus polarization charge incorporated during formation of anodized Al2O3 strongly affects the formation of the insulating film, the stability of the films under bias, and their conduction characteristics.

  12. Transport performance of a HTS current lead prepared by the TFA-MOD processed YBCO tapes

    NASA Astrophysics Data System (ADS)

    Shiohara, K.; Sakai, S.; Ohki, S.; Yamada, Y.; Tachikawa, K.; Koizumi, T.; Aoki, Y.; Hikichi, Y.; Nishioka, J.; Hasegawa, T.

    2009-10-01

    A superconducting current lead has been prepared using 12 tapes of the trifluoroacetates - metal organic deposition (TFA-MOD) processed Y 1Ba 2Cu 3O 7-δ (YBCO) coated conductors with critical current ( I c) of about 100 A at 77 K in self-field. The tapes are 4.5 mm in width, 220 mm in length and about 120 μm in overall thickness. The 1 μm thick superconducting YBCO layer was formed through the TFA-MOD process on Hastelloy TM substrate tapes with two buffer oxide layers of Gd 2Zr 2O 7 (GZO) and CeO 2. The 12 YBCO tapes were arrayed on the both sides (six tapes on each side) of a stainless steel board with 3 mm in thickness for a board type shape. They were similarly soldered to copper caps at the both ends. The transport current of 1000 A was stably applied for 10 min in the liquid nitrogen temperature without any voltage generation in all tapes. Although some voltage in some YBCO tapes generated at the applied currents of about 1100 A, the transport current of 1200 A was successfully applied without quenching. The voltage between both copper caps linearly increased with increasing the transport current, and it was about 300 μV at an applied current of 1000 A. A low joint resistance between the YBCO tapes and the copper caps resulted in small amounts of the Joule heating at the joints when 1000 A was applied. The overall (effective) thermal conductivity of the current leads composed of YBCO tapes and the stainless steel board was much lower than that of Non-superconducting current leads. Therefore, the present current leads with small heat leakage seemed to be practically promising for superconducting magnets.

  13. Analysis of partial discharge activity by a conducting particle in liquid nitrogen under AC voltages adopting UHF technique

    NASA Astrophysics Data System (ADS)

    Sarathi, R.; Giridhar, A. V.; Sethupathi, K.

    2010-01-01

    Liquid nitrogen (LN 2) is used as an insulant as well as coolant in high temperature superconducting power equipments. Particle contamination in liquid nitrogen is one of the major cause for formation of partial discharges during operation. An attempt has been made in the present study to understand the feasibility of using Ultra High Frequency (UHF) sensors for identification of partial discharge (PD) formed due to particle movement in liquid nitrogen under AC voltages. It is observed that the partial discharge formed in LN 2 radiates UHF signal. The results of the study indicate that the conventional partial discharge measurement and UHF peak amplitude measurement have direct correlation. The Phase Resolved Partial Discharge (PRPD) analysis indicates that the partial discharge formed due to particle movement occurs in the entire phase windows of the AC voltage. The PD magnitude increases with increase in applied voltage. The frequency content of UHF signal generated due to particle movement in liquid nitrogen under AC voltages lies in the range of 0.5-1.5 GHz. The UHF sensor output signal analyzed using spectrum analyzer by operating it in zero-span mode, indicates that burst type PD occurs due to particle movement.

  14. Features of current-voltage characteristic of nonequilibrium trench MOS barrier Schottky diode

    NASA Astrophysics Data System (ADS)

    Mamedov, R. K.; Aslanova, A. R.

    2018-06-01

    The trench MOS barrier Schottky diodes (TMBS diode) under the influence of the voltage drop of the additional electric field (AEF) appearing in the near-contact region of the semiconductor are in a nonequilibrium state and their closed external circuit flows currents in the absence of an external voltage. When an external voltage is applied to the TMBS diode, the current transmission is described by the thermionic emission theory with a specific feature. Both forward and reverse I-V characteristics of the TMBS diode consist of two parts. In the initial first part of the forward I-V characteristic there are no forward currents, but reverse saturation currents flow, in its subsequent second part the currents increase exponentially with the voltage. In the initial first part of the reverse I-V characteristic, the currents increase in an abrupt way and in the subsequent second part the saturation currents flow under the action of the image force. The mathematical expressions for forward and reverse I-V characteristic of the TMBS diode and also narrow or nanostructure Schottky diode are proposed, which are in good agreement with the results of experimental and calculated I-V characteristics.

  15. Noise-enhanced chaos in a weakly coupled GaAs/(Al,Ga)As superlattice.

    PubMed

    Yin, Zhizhen; Song, Helun; Zhang, Yaohui; Ruiz-García, Miguel; Carretero, Manuel; Bonilla, Luis L; Biermann, Klaus; Grahn, Holger T

    2017-01-01

    Noise-enhanced chaos in a doped, weakly coupled GaAs/Al_{0.45}Ga_{0.55}As superlattice has been observed at room temperature in experiments as well as in the results of the simulation of nonlinear transport based on a discrete tunneling model. When external noise is added, both the measured and simulated current-versus-time traces contain irregularly spaced spikes for particular applied voltages, which separate a regime of periodic current oscillations from a region of no current oscillations at all. In the voltage region without current oscillations, the electric-field profile consist of a low-field domain near the emitter contact separated by a domain wall consisting of a charge accumulation layer from a high-field regime closer to the collector contact. With increasing noise amplitude, spontaneous chaotic current oscillations appear over a wider bias voltage range. For these bias voltages, the domain boundary between the two electric-field domains becomes unstable and very small current or voltage fluctuations can trigger the domain boundary to move toward the collector and induce chaotic current spikes. The experimentally observed features are qualitatively very well reproduced by the simulations. Increased noise can consequently enhance chaotic current oscillations in semiconductor superlattices.

  16. Noise-enhanced chaos in a weakly coupled GaAs/(Al,Ga)As superlattice

    NASA Astrophysics Data System (ADS)

    Yin, Zhizhen; Song, Helun; Zhang, Yaohui; Ruiz-García, Miguel; Carretero, Manuel; Bonilla, Luis L.; Biermann, Klaus; Grahn, Holger T.

    2017-01-01

    Noise-enhanced chaos in a doped, weakly coupled GaAs /Al0.45Ga0.55As superlattice has been observed at room temperature in experiments as well as in the results of the simulation of nonlinear transport based on a discrete tunneling model. When external noise is added, both the measured and simulated current-versus-time traces contain irregularly spaced spikes for particular applied voltages, which separate a regime of periodic current oscillations from a region of no current oscillations at all. In the voltage region without current oscillations, the electric-field profile consist of a low-field domain near the emitter contact separated by a domain wall consisting of a charge accumulation layer from a high-field regime closer to the collector contact. With increasing noise amplitude, spontaneous chaotic current oscillations appear over a wider bias voltage range. For these bias voltages, the domain boundary between the two electric-field domains becomes unstable and very small current or voltage fluctuations can trigger the domain boundary to move toward the collector and induce chaotic current spikes. The experimentally observed features are qualitatively very well reproduced by the simulations. Increased noise can consequently enhance chaotic current oscillations in semiconductor superlattices.

  17. The Electrolytic Effect on the Catalytic Degradation of Dye and Nitrate Ion by New Ceramic Beads of Natural Minerals and TiO2

    NASA Astrophysics Data System (ADS)

    Sata, Akiyoshi; Sakai, Takako; Goto, Yusuke; Ohta, Toshiyuki; Hayakawa, Katumitu

    2007-05-01

    We have developed a new hybrid ceramic material "Taiyo" as a water processing catalyst. The porous ceramic has a core-shell structure. It decolorized completely the dye solutions as well as the wastewater output after primary water processing by microorganism in a pig farm. This new material showed the acceleration of water purification by applying electric voltage. The degradation of dyes and pig urine output from the primary treatments was accelerated by applying voltage. Nitrate in underground water was also decomposed only by applying voltage, while it was not decomposed without voltage.

  18. Certain applied electrical signals during EPG cause negative effects on stylet probing behaviors by adult Lygus lineolaris (Hemiptera: Miridae).

    PubMed

    Backus, Elaine A; Cervantes, Felix A; Godfrey, Larry; Akbar, Waseem; Clark, Thomas L; Rojas, Maria G

    This study is the first to fully evaluate whether electrical signals applied to large insects during electropenetrography (EPG; also called electrical penetration graph) negatively affect insect behavior. During EPG, electrical signals are applied to plants, and thus to the gold-wire-tethered insects feeding on them. The insect completes an electrical circuit whose changes in voltage reflect the insect's stylet probing/penetration behaviors, recorded as waveform output. For nearly 50 years of EPG science, evidence has supported that there are no or negligible effects on tiny insects from applied electricity during EPG. Recently however, EPG studies of large-bodied hemipterans such as heteropterans and sharpshooter leafhoppers have been published. The wider stylet diameters of such large insects cause them to have lower inherent resistances to applied signals compared with smaller insects, conveying more electrical current. The present study asked whether such increased currents would affect insect stylet probing, by comparing Lygus lineolaris behaviors on pin-head cotton squares using an AC-DC electropenetrograph. Effects of AC or DC applied signals were separately examined in two factorial studies, each comparing four input resistor (Ri) levels (10 6 , 10 7 , 10 8 and 10 9  Ω) and four applied voltage levels (2, 60, 150 and 250 mV). Results showed that changes in both probing and non-probing behaviors were indeed caused by changing signal type, Ri level, or applied voltage. Negative effects on feeding were numerically greater overall for DC than AC applied signals, perhaps due to muscular tetany from DC; however, AC versus DC could not be statistically tested. Results strongly support the need for flexible Ri and applied voltage levels and types, to tailor instrument settings to the size and special needs of each insect subject. Our findings will facilitate further EPG studies of Lygus spp., such as host plant resistance or insecticidal assays/bioassays to assess mode of action and appropriate dosage. It is hoped that this study will also inform EPG studies of similar, large heteropterans in the future. Published by Elsevier Ltd.

  19. Ion manipulation device to prevent loss of ions

    DOEpatents

    Tolmachev, Aleksey; Smith, Richard D; Ibrahim, Yehia M; Anderson, Gordon A; Baker, Erin M

    2015-03-03

    An ion manipulation method and device to prevent loss of ions is disclosed. The device includes a pair of surfaces. An inner array of electrodes is coupled to the surfaces. A RF voltage and a DC voltage are alternately applied to the inner array of electrodes. The applied RF voltage is alternately positive and negative so that immediately adjacent or nearest neighbor RF applied electrodes are supplied with RF signals that are approximately 180 degrees out of phase.

  20. Optical reset modulation in the SiO2/Cu conductive-bridge resistive memory stack

    NASA Astrophysics Data System (ADS)

    Kawashima, T.; Zhou, Y.; Yew, K. S.; Ang, D. S.

    2017-09-01

    We show that the negative photoconductivity property of the nanoscale filamentary breakdown path in the SiO2 electrolyte of the SiO2/Cu conductive bridge resistive random access memory (CBRAM) stack is affected by the number of positive-voltage sweeps applied to the Cu electrode (with respect to a non-metal counter electrode). The path's photo-response to white light, of a given intensity, is suppressed with an increasing number of applied positive-voltage sweeps. When this occurs, the path may only be disrupted by the light of a higher intensity. It is further shown that the loss of the path's photosensitivity to the light of a given intensity can be recovered using a negative-voltage sweep (which eliminates the path), followed by the reformation of the path by a positive-voltage sweep. The above behavior is, however, not seen in the SiO2/Si stack (which involves a non-metal Si electrode), suggesting that the photo-response modulation effect is related to the Cu electrode. The demonstrated reversible electrical modulation of the path's photo-response may afford greater flexibility in the electro-optical control of the CBRAM device.

  1. A Novel Concept for a Deformable Membrane Mirror for Correction of Large Amplitude Aberrations

    NASA Technical Reports Server (NTRS)

    Moore, Jim; Patrick, Brian

    2006-01-01

    Very large, light weight mirrors are being developed for applications in space. Due to launch mass and volume restrictions these mirrors will need to be much more flexible than traditional optics. The use of primary mirrors with these characteristics will lead to requirements for adaptive optics capable of correcting wave front errors with large amplitude relatively low spatial frequency aberrations. The use of low modulus membrane mirrors actuated with electrostatic attraction forces is a potential solution for this application. Several different electrostatic membrane mirrors are now available commercially. However, as the dynamic range requirement of the adaptive mirror is increased the separation distance between the membrane and the electrodes must increase to accommodate the required face sheet deformations. The actuation force applied to the mirror decreases inversely proportional to the square of the separation distance; thus for large dynamic ranges the voltage requirement can rapidly increase into the high voltage regime. Experimentation with mirrors operating in the KV range has shown that at the higher voltages a serious problem with electrostatic field cross coupling between actuators can occur. Voltage changes on individual actuators affect the voltage of other actuators making the system very difficult to control. A novel solution has been proposed that combines high voltage electrodes with mechanical actuation to overcome this problem. In this design an array of electrodes are mounted to a backing structure via light weight large dynamic range flextensional actuators. With this design the control input becomes the separation distance between the electrode and the mirror. The voltage on each of the actuators is set to a uniform relatively high voltage, thus the problem of cross talk between actuators is avoided and the favorable distributed load characteristic of electrostatic actuation is retained. Initial testing and modeling of this concept demonstrates that this is an attractive concept for increasing the dynamic range capability of electrostatic deformable mirrors.

  2. Three distinct modes in a surface micro-discharge in atmospheric pressure He + N{sub 2} mixtures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Dong; Liu, Dingxin, E-mail: liudingxin@mail.xjtu.edu.cn; He, Tongtong

    2015-12-15

    A surface micro-discharge in atmospheric pressure He + N{sub 2} mixtures is studied in this paper with an emphasis on the discharge modes. With the N{sub 2} admixture increasing from 0.1% to 20%, the discharge evolves from a spatially diffuse mode to a filamentary mode during positive half-cycles of the applied voltage. However during the negative half-cycles, an additional patterned mode emerges between the diffuse and the filamentary modes, which has not been reported before to exist in surface micro-discharges. In the diffuse and patterned modes, the plasmas cover almost the entirety of the mesh area during one cycle after plasma ignitionmore » in all mesh elements, and the discharge power increases linearly with the applied voltage. In contrast, plasma coverage of the mesh area is only partial in the filamentary mode and the plasma is more unstable with the discharge power increasing exponentially with the applied voltage. As the surface micro-discharge evolves through the three modes, the density of excited species changes significantly, for instance, the density of N{sub 2}{sup +}(B) drops by ∼20-fold from [N{sub 2}] = 0.2% to 20%. The N{sub 2}{sup +}(B) is predicted to be generated mainly through successive processes of Penning ionization by helium metastables and electron-impact excitation of N{sub 2}{sup +}(X), the latter is most responsible for the density decrease of N{sub 2}{sup +}(B) because much more N{sub 2}{sup +}(X) is converted to N{sub 4}{sup +}(X) as the increase of N{sub 2} fraction. Also, the electron density and electron temperature decrease with the discharge mode transition.« less

  3. The application of the barrier-type anodic oxidation method to thickness testing of aluminum films

    NASA Astrophysics Data System (ADS)

    Chen, Jianwen; Yao, Manwen; Xiao, Ruihua; Yang, Pengfei; Hu, Baofu; Yao, Xi

    2014-09-01

    The thickness of the active metal oxide film formed from a barrier-type anodizing process is directly proportional to its formation voltage. The thickness of the consumed portion of the metal film is also corresponding to the formation voltage. This principle can be applied to the thickness test of the metal films. If the metal film is growing on a dielectric substrate, when the metal film is exhausted in an anodizing process, because of the high electrical resistance of the formed oxide film, a sudden increase of the recorded voltage during the anodizing process would occur. Then, the thickness of the metal film can be determined from this voltage. As an example, aluminum films are tested and discussed in this work. This method is quite simple and is easy to perform with high precision.

  4. Electrically controllable liquid crystal random lasers below the Fréedericksz transition threshold.

    PubMed

    Lee, Chia-Rong; Lin, Jia-De; Huang, Bo-Yuang; Lin, Shih-Hung; Mo, Ting-Shan; Huang, Shuan-Yu; Kuo, Chie-Tong; Yeh, Hui-Chen

    2011-01-31

    This investigation elucidates for the first time electrically controllable random lasers below the threshold voltage in dye-doped liquid crystal (DDLC) cells with and without adding an azo-dye. Experimental results show that the lasing intensities and the energy thresholds of the random lasers can be decreased and increased, respectively, by increasing the applied voltage below the Fréedericksz transition threshold. The below-threshold-electric-controllability of the random lasers is attributable to the effective decrease of the spatial fluctuation of the orientational order and thus of the dielectric tensor of LCs by increasing the electric-field-aligned order of LCs below the threshold, thereby increasing the diffusion constant and decreasing the scattering strength of the fluorescence photons in their recurrent multiple scattering. This can result in the decrease in the lasing intensity of the random lasers and the increase in their energy thresholds. Furthermore, the addition of an azo-dye in DDLC cell can induce the range of the working voltage below the threshold for the control of the random laser to reduce.

  5. ELECTRONIC MULTIPLIER CIRCUIT

    DOEpatents

    Thomas, R.E.

    1959-08-25

    An electronic multiplier circuit is described in which an output voltage having an amplitude proportional to the product or quotient of the input signals is accomplished in a novel manner which facilitates simplicity of circuit construction and a high degree of accuracy in accomplishing the multiplying and dividing function. The circuit broadly comprises a multiplier tube in which the plate current is proportional to the voltage applied to a first control grid multiplied by the difference between voltage applied to a second control grid and the voltage applied to the first control grid. Means are provided to apply a first signal to be multiplied to the first control grid together with means for applying the sum of the first signal to be multiplied and a second signal to be multiplied to the second control grid whereby the plate current of the multiplier tube is proportional to the product of the first and second signals to be multiplied.

  6. Effect of a longitudinally applied voltage upon the growth of Zea mays seedlings

    NASA Technical Reports Server (NTRS)

    Desrosiers, M. F.; Bandurski, R. S.

    1988-01-01

    The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage.

  7. Effect of a longitudinally applied voltage upon the growth of Zea mays seedlings.

    PubMed

    Desrosiers, M F; Bandurski, R S

    1988-01-01

    The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage.

  8. Effect of a Longitudinally Applied Voltage Upon the Growth of Zea mays Seedlings 1

    PubMed Central

    Desrosiers, Mark F.; Bandurski, Robert S.

    1988-01-01

    The electrical parameters that affect young seedling growth were investigated. Voltages ranging from 5 to 40 volts were applied longitudinally along the mesocotyl region of 4-day old Zea mays L. (cv Silver Queen) seedlings for periods of 3 or 4 hours. It was determined that: (a) making the tips of the seedlings electrically positive relative to the base strongly inhibited shoot growth at 5 volts, whereas the reverse polarity had no effect; (b) at higher voltages, making the tip of the seedlings negative caused less growth inhibition than the reverse polarity at each voltage level; (c) the higher the applied voltage the greater the degree of inhibition; and, (d) the more growth inhibition experienced by the plants the poorer, and slower, their recovery. Previous observations of a relationship between the amount of free indole-3-acetic acid in the mesocotyl cortex and the growth rate of the mesocotyl and of gravitropism-induced movement of labeled indole-3-acetic acid from the seed to the shoot lead to the prediction of a voltage-dependent gating of the movement of indole-3-acetic acid from the stele to the cortex. This provided the basis for attempting to alter the growth rate of seedlings by means of an applied voltage. Images Fig. 1 PMID:11537877

  9. Transmittance and Tunneling Current through a Trapezoidal Barrier under Spin Polarization Consideration

    NASA Astrophysics Data System (ADS)

    Noor, F. A.; Nabila, E.; Mardianti, H.; Ariani, T. I.; Khairurrijal

    2018-04-01

    The transmittance and tunneling current in heterostructures under spin polarization consideration were studied by employing a zinc-blended structure for the heterostructures. An electron tunnels through a potential barrier by applying a bias voltage to the barrier, which is called the trapezoidal potential barrier. In order to study the transmittance, an Airy wave function approach was employed to find the transmittance. The obtained transmittance was then utilized to compute the tunneling current by using a Gauss quadrature method. It was shown that the transmittances were asymmetric with the incident angle of the electron. It was also shown that the tunneling currents increased as the bias voltage increased.

  10. Domain wall conductivity in KTiOPO4 crystals

    NASA Astrophysics Data System (ADS)

    Lindgren, G.; Canalias, C.

    2017-07-01

    We study the local ionic conductivity of ferroelectric domain walls and domains in KTiOPO4 single-crystals. We show a fourfold increase in conductivity at the domain walls, compared to that of the domains, attributed to an increased concentration of defects. Our current-voltage measurements reveal memristive-like behavior associated with topographic changes and permanent charge displacement. This behavior is observed for all the voltage sweep-rates at the domain walls, while it only occurs for low frequencies at the domains. We attribute these findings to the redistribution of ions due to the applied bias and their effect on the tip-sample barrier.

  11. Free-Energy Calculations. A Mathematical Perspective

    NASA Technical Reports Server (NTRS)

    Pohorille, Andrzej

    2015-01-01

    Ion channels are pore-forming assemblies of transmembrane proteins that mediate and regulate ion transport through cell walls. They are ubiquitous to all life forms. In humans and other higher organisms they play the central role in conducting nerve impulses. They are also essential to cardiac processes, muscle contraction and epithelial transport. Ion channels from lower organisms can act as toxins or antimicrobial agents, and in a number of cases are involved in infectious diseases. Because of their important and diverse biological functions they are frequent targets of drug action. Also, simple natural or synthetic channels find numerous applications in biotechnology. For these reasons, studies of ion channels are at the forefront of biophysics, structural biology and cellular biology. In the last decade, the increased availability of X-ray structures has greatly advanced our understanding of ion channels. However, their mechanism of action remains elusive. This is because, in order to assist controlled ion transport, ion channels are dynamic by nature, but X-ray crystallography captures the channel in a single, sometimes non-native state. To explain how ion channels work, X-ray structures have to be supplemented with dynamic information. In principle, molecular dynamics (MD) simulations can aid in providing this information, as this is precisely what MD has been designed to do. However, MD simulations suffer from their own problems, such as inability to access sufficiently long time scales or limited accuracy of force fields. To assess the reliability of MD simulations it is only natural to turn to the main function of channels - conducting ions - and compare calculated ionic conductance with electrophysiological data, mainly single channel recordings, obtained under similar conditions. If this comparison is satisfactory it would greatly increase our confidence that both the structures and our computational methodologies are sufficiently accurate. Channel conductance, defined as the ratio of ionic current through the channel to applied voltage, can be calculated in MD simulations by way of applying an external electric field to the system and counting the number of ions that traverse the channel per unit time. If the current is small, a voltage significantly higher than the experimental one needs to be applied to collect sufficient statistics of ion crossing events. Then, the calculated conductance has to be extrapolated to the experimental voltage using procedures of unknown accuracy. Instead, we propose an alternative approach that applies if ion transport through channels can be described with sufficient accuracy by the one-dimensional diffusion equation in the potential given by the free energy profile and applied voltage. Then, it is possible to test the assumptions of the equation, recover the full voltage/current dependence, determine the reliability of the calculated conductance and reconstruct the underlying (equilibrium) free energy profile, all from MD simulations at a single voltage. We will present the underlying theory, model calculations that test this theory and simulations on ion conductance through a channel that has been extensively studied experimentally. To our knowledge this is the first case in which the complete, experimentally measured dependence of the current on applied voltage has been reconstructed from MD simulations.

  12. Experimental study of rotating wind turbine breakdown characteristics in large scale air gaps

    NASA Astrophysics Data System (ADS)

    Wang, Yu; Qu, Lu; Si, Tianjun; Ni, Yang; Xu, Jianwei; Wen, Xishan

    2017-06-01

    When a wind turbine is struck by lightning, its blades are usually rotating. The effect of blade rotation on a turbine’s ability to trigger a lightning strike is unclear. Therefore, an arching electrode was used in a wind turbine lightning discharge test to investigate the difference in lightning triggering ability when blades are rotating and stationary. A negative polarity switching waveform of 250/2500 μs was applied to the arching electrode and the up-and-down method was used to calculate the 50% discharge voltage. Lightning discharge tests of a 1:30 scale wind turbine model with 2, 4, and 6 m air gaps were performed and the discharge process was observed. The experimental results demonstrated that when a 2 m air gap was used, the breakdown voltage increased as the blade speed was increased, but when the gap length was 4 m or longer, the trend was reversed and the breakdown voltage decreased. The analysis revealed that the rotation of the blades changes the charge distribution in the blade-tip region, promotes upward leader development on the blade tip, and decreases the breakdown voltage. Thus, the blade rotation of a wind turbine increases its ability to trigger lightning strikes.

  13. Effect of voltage waveform on dielectric barrier discharge ozone production efficiency

    NASA Astrophysics Data System (ADS)

    Mericam-Bourdet, N.; Kirkpatrick, M. J.; Tuvache, F.; Frochot, D.; Odic, E.

    2012-03-01

    Dielectric barrier discharges (DBDs) are commonly used for gas effluent cleanup and ozone generation. For these applications, the energy efficiency of the discharge is a major concern. This paper reports on investigations carried out on the voltage shape applied to DBD reactor electrodes, aiming to evaluate a possible energy efficiency improvement for ozone production. Two DBD reactor geometries were used: pin-to-pin and cylinder-to-cylinder, both driven either by a bi-directional power supply (voltage rise rate 1 kV/μs) or by a pulsed power supply (voltage rise rate 1 kV/ns). Ozone formed in dry air was measured at the reactor outlet. Special attention was paid to discharge input power evaluation using different methods including instantaneous current-voltage product and transferred charge-applied voltage figures. The charge transferred by the discharges was also correlated to the ozone production. It is shown that, in the case of the DBD reactors under investigation, the applied voltage shape has no influence on the ozone production efficiency. For the considered voltage rise rate, the charge deposit on the dielectric inserted inside the discharge gap is the important factor (as opposed to the voltage shape) governing the efficiency of the discharge - it does this by tailoring the duration of the current peak into the tens of nanosecond range.

  14. The structure, bond strength and apatite-inducing ability of micro-arc oxidized tantalum and their response to annealing

    NASA Astrophysics Data System (ADS)

    Wang, Cuicui; Wang, Feng; Han, Yong

    2016-01-01

    In this study, the tantalum oxide coatings were formed on pure tantalum (Ta) by micro-arc oxidation (MAO) in electrolytic solutions of calcium acetate and β-glycerophosphate disodium, and the effect of the applied voltage on the microstructure and bond strength of the MAO coatings was systematically investigated. The effect of annealing treatment on the microstructure, bond strength and apatite-inducing ability of the MAO coatings formed at 350 and 450 V was also studied. The study revealed that during the preparation of tantalum oxide coatings on Ta substrate by MAO, the applied voltage considerably affected the phase components, morphologies and bond strength of the coatings, but had little effect on surface chemical species. After annealing treatment, newly formed CaTa4O11 phase mainly contributed to the much more stronger apatite-inducing ability of the annealed tantalum oxide coatings than those that were not annealed. The better apatite-inducing ability of the MAO coatings formed at 450 V compared to those formed at 350 V was attributed to the less amorphous phase and more crystalline phase as well as more Ca and P contained in the MAO coatings with increasing the applied voltage.

  15. Weakly superconducting, thin-film structures as radiation detectors.

    NASA Technical Reports Server (NTRS)

    Kirschman, R. K.

    1972-01-01

    Measurements were taken with weakly superconducting quantum structures of the Notarys-Mercereau type, representing a thin superconductor film with a short region that is weakened in the sense that its transition temperature is lower than in the remaining portion of the film. The structure acts as a superconducting relaxation oscillator in which the supercurrent increases with time until the critical current of the weakened section is attained, at which moment the supercurrent decays and the cycle repeats. Under applied radiation, a series of constant-voltage steps appears in the current-voltage curve, and the size of the steps varies periodically with the amplitude of applied radiation. Measurements of the response characteristics were made in the frequency range of 10 to 450 MHz.

  16. Organic Bistable Memory Switching Phenomena in Squarylium-Dye Langmuir-Blodgett Films

    NASA Astrophysics Data System (ADS)

    Kushida, Masahito; Inomata, Hisao; Miyata, Hiroshi; Harada, Kieko; Saito, Kyoichi; Sugita, Kazuyuki

    2003-06-01

    We have investigated the relationship between the switching phenomena and H-like aggregates in squarylium-dye Langmuir-Blodgett (SQ LB) films. The current-voltage characteristics of SQ LB films sandwiched between the top gold electrode and the bottom aluminum electrode indicated conductance switching phenomena below the temperature of 100°C but not at 140°C. Current densities suddenly increased at switching voltages between 2 and 4 V. The switching voltage increased as the temperature increased between room temperature and 100°C. Current densities were 50-100 μA/cm2 in a low-impedance state (ON state). A high-impedance state (OFF state) can be recovered by applying a reverse bias, and therefore, these bistable devices are ideal for memory applications. The dependence of conductance switching phenomena and ultraviolet-visible absorption spectra on annealing temperatures was studied. The results revealed that conductance switching phenomena were caused by the presence of H-like aggregates in the SQ LB films.

  17. [Impact of introduction of O2 on the welding arc of gas pool coupled activating TIG].

    PubMed

    Huang, Yong; Wang, Yan-Lei; Zhang, Zhi-Guo

    2014-05-01

    In the present paper, Boltzmann plot method was applied to analyze the temperature distributions of the are plasma when the gas pool coupled activating TIG welding was at different coupling degrees with the outer gas being O2. Based on this study of temperature distributions, the changing regularities of are voltage and are appearance were studied. The result shows that compared with traditional TIG welding, the introduction of O2 makes the welding arc constricted slightly, the temperature of the are center build up, and the are voltage increase. When argon being the inner gas, oxygen serving as the outer gas instead of argon makes the are constricted more obviously. When the coupling degree increases from 0 to 2, the temperature of the are center and the are voltage both increase slightly. In the gas pool coupled activating TIG welding the are is constricted not obviously, and the reason why the weld penetration is improved dramatically in the welding of stainless steel is not are constriction.

  18. Functional significance of the pattern of renal sympathetic nerve activation.

    PubMed

    Dibona, G F; Sawin, L L

    1999-08-01

    To assess the renal functional significance of the pattern of renal sympathetic nerve activation, computer-generated stimulus patterns (delivered at constant integrated voltage) were applied to the decentralized renal sympathetic nerve bundle and renal hemodynamic and excretory responses determined in anesthetized rats. When delivered at the same integrated voltage, stimulus patterns resembling those observed in in vivo multifiber recordings of renal sympathetic nerve activity (diamond-wave patterns) produced greater renal vasoconstrictor responses than conventional square-wave patterns. Within diamond-wave patterns, increasing integrated voltage by increasing amplitude produced twofold greater renal vasoconstrictor responses than by increasing duration. With similar integrated voltages that were subthreshold for renal vasoconstriction, neither diamond- nor square-wave pattern altered glomerular filtration rate, whereas diamond- but not square-wave pattern reversibly decreased urinary sodium excretion by 25 +/- 3%. At the same number of pulses per second, intermittent stimulation produced faster and greater renal vasoconstriction than continuous stimulation. At the same number of pulses per second, increases in rest period during intermittent stimulation proportionally augmented the renal vasoconstrictor response compared with that observed with continuous stimulation; the maximum augmentation of 55% occurred at a rest period of 500 ms. These results indicate that the pattern of renal sympathetic nerve stimulation (activity) significantly influences the rapidity, magnitude, and selectivity of the renal vascular and tubular responses.

  19. Interactions between large space power systems and low-Earth-orbit plasmas

    NASA Technical Reports Server (NTRS)

    Stevens, N. J.

    1985-01-01

    There is a growing tendency to plan space missions that will incorporate very large space power systems. These space power systems must function in the space plasma environment, which can impose operational limitations. As the power output increases, the operating voltage also must increase and this voltage, exposed at solar array interconnects, interacts with the local plasma. The implications of such interactions are considered. The available laboratory data for biased array segment tests are reviewed to demonstrate the basic interactions considered. A data set for a floating high voltage array test was used to generate approximate relationships for positive and negative current collection from plasmas. These relationships were applied to a hypothetical 100 kW power system operating in a 400 km, near equatorial orbit. It was found that discharges from the negative regions of the array are the most probable limiting factor in array operation.

  20. Analysis performance of proton exchange membrane fuel cell (PEMFC)

    NASA Astrophysics Data System (ADS)

    Mubin, A. N. A.; Bahrom, M. H.; Azri, M.; Ibrahim, Z.; Rahim, N. A.; Raihan, S. R. S.

    2017-06-01

    Recently, the proton exchange membrane fuel cell (PEMFC) has gained much attention to the technology of renewable energy due to its mechanically ideal and zero emission power source. PEMFC performance reflects from the surroundings such as temperature and pressure. This paper presents an analysis of the performance of the PEMFC by developing the mathematical thermodynamic modelling using Matlab/Simulink. Apart from that, the differential equation of the thermodynamic model of the PEMFC is used to explain the contribution of heat to the performance of the output voltage of the PEMFC. On the other hand, the partial pressure equation of the hydrogen is included in the PEMFC mathematical modeling to study the PEMFC voltage behaviour related to the input variable input hydrogen pressure. The efficiency of the model is 33.8% which calculated by applying the energy conversion device equations on the thermal efficiency. PEMFC’s voltage output performance is increased by increasing the hydrogen input pressure and temperature.

  1. Phenomena of nonlinear oscillation and special resonance of a dielectric elastomer minimum energy structure rotary joint

    NASA Astrophysics Data System (ADS)

    Zhao, Jianwen; Niu, Junyang; McCoul, David; Ren, Zhi; Pei, Qibing

    2015-03-01

    The dielectric elastomer minimum energy structure can realize large angular deformations by a small voltage-induced strain of the dielectric elastomer, so it is a suitable candidate to make a rotary joint for a soft robot. Driven with an alternating electric field, the joint deformation vibrational frequency follows the input voltage frequency. However, the authors find that if the rotational inertia increases such that the inertial torque makes the frame deform over a negative angle, then the joint motion will become complicated and the vibrational mode will alter with the change of voltage frequency. The vibration with the largest amplitude does not occur while the voltage frequency is equal to natural response frequency of the joint. Rather, the vibrational amplitude will be quite large over a range of other frequencies at which the vibrational frequency is half of the voltage frequency. This phenomenon was analyzed by a comparison of the timing sequences between voltage and joint vibration. This vibrational mode with the largest amplitude can be applied to the generation lift in a flapping wing actuated by dielectric elastomers.

  2. AC electrical breakdown phenomena of epoxy/layered silicate nanocomposite in needle-plate electrodes.

    PubMed

    Park, Jae-Jun; Lee, Jae-Young

    2013-05-01

    Epoxy/layered silicate nanocomposite for the insulation of heavy electric equipments were prepared by dispersing 1 wt% of a layered silicate into an epoxy matrix with a homogenizing mixer and then AC electrical treeing and breakdown tests were carried out. Wide-angle X-ray diffraction (WAXD) analysis and transmission electron microscopy (TEM) observation showed that nano-sized monolayers were exfoliated from a multilayered silicate in the epoxy matrix. When the nano-sized silicate layers were incorporated into the epoxy matrix, the breakdown rate in needle-plate electrode geometry was 10.6 times lowered than that of the neat epoxy resin under the applied electrical field of 520.9 kV/mm at 30 degrees C, and electrical tree propagated with much more branches in the epoxy/layered silicate nanocomposite. These results showed that well-dispersed nano-sized silicate layers retarded the electrical tree growth rate. The effects of applied voltage and ambient temperature on the tree initiation, growth, and breakdown rate were also studied, and it was found that the breakdown rate was largely increased, as the applied voltage and ambient temperature increased.

  3. Fabrication and evaluation of variable focus and large deformation plano-convex microlens based on non-ionic poly(vinyl chloride)/dibutyl adipate gels

    NASA Astrophysics Data System (ADS)

    Kim, Sang-Youn; Yeo, Myoung; Shin, Eun-Jae; Park, Won-Hyeong; Jang, Jong-Seok; Nam, Byeong-Uk; Bae, Jin Woo

    2015-11-01

    In this paper, we propose a variable focus microlens module based on a transparent, electroactive, and non-ionic PVC/DBA gel. A non-ionic PVC/DBA (nPVC) gel on an ITO glass was confined beneath a rigid annular electrode, and applied pressure squeezed a bulge of the nPVC gel into the annular electrode, resulting in a hemispherical plano-convex nPVC gel microlens. The proposed nPVC gel microlens was analyzed and optimized. When voltage is applied to the circular perimeter (the annular electrode) of this fabricated microlens, electrically induced creep deformation of the nPVC gel occurs, changing its optical focal length. The focal length remarkably increases from 3.8 mm up to 14.3 mm with increasing applied voltages from 300 V to 800 V. Due to its compact, transparent, and electroactive characteristics, the proposed nPVC gel microlens can be easily inserted into small consumer electronic devices, such as digital cameras, camcorders, cell phones, and other portable optical devices.

  4. Foundations of DC plasma sources

    NASA Astrophysics Data System (ADS)

    Tomas Gudmundsson, Jon; Hecimovic, Ante

    2017-12-01

    A typical dc discharge is configured with the negative cathode at one end and a positive anode at the other end, separated by a gas filled gap, placed inside a long glass cylinder. A few hundred volts between the cathode and anode is required to maintain the discharge. The type of discharge that is formed between the two electrodes depends upon the pressure of the working gas, the nature of the working gas, the applied voltage and the geometry of the discharge. We discuss the current-voltage characteristics of the discharge as well as the distinct structure that develops in the glow discharge region. The dc glow discharge appears in the discharge current range from μA to mA at 0.5-300 Pa pressure. We discuss the various phenomena observed in the dc glow discharge, including the cathode region, the positive column, and striations. The dc glow discharge is maintained by the emission of secondary electrons from the cathode target due to the bombardment of ions. For decades, the dc glow discharge has been used as a sputter source. Then it is often operated as an obstructed abnormal glow discharge and the required applied voltage is in the range 2-5 kV. Typically, the cathode target (the material to be deposited) is connected to a negative voltage supply (dc or rf) and the substrate holder faces the target. The relatively high operating pressure, in the range from 2 to 4 Pa, high applied voltages, and the necessity to have a conductive target limit the application of dc glow discharge as a sputter source. In order to lower the discharge voltage and expand the operation pressure range, the lifetime of the electrons in target vicinity is increased through applying magnetic field, by adding permanent magnets behind the cathode target. This arrangement is coined the magnetron sputtering discharge. The various configurations of the magnetron sputtering discharge and its applications are described. Furthermore, the use of dc discharges for chemical analysis, the Penning discharge and the hollow cathode discharges and some of its applications are briefly discussed.

  5. The effect of voltage waveform and tube diameter on transporting cold plasma strings through a flexible dielectric tube

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sohbatzadeh, Farshad, E-mail: f.sohbat@umz.ac.ir; Nano and Biotechnology Research Group, Faculty of Basic Sciences, University of Mazandaran, Babolsar 47416-95447, Mazandaran; Omran, Azadeh Valinataj

    2014-11-15

    In this work, we developed transporting atmospheric pressure cold plasma using single electrode configuration through a sub-millimetre flexible dielectric tube beyond 100 cm. It was shown that the waveform of the applied high voltage is essential for controlling upstream and downstream plasma inside the tube. In this regard, sawtooth waveform enabled the transport of plasma with less applied high voltage compared to sinusoidal and pulsed form voltages. A cold plasma string as long as 130 cm was obtained by only 4 kV peak-to-peak sawtooth high voltage waveform. Optical emission spectroscopy revealed that reactive chemical species, such as atomic oxygen and hydroxyl, are generatedmore » at the tube exit. The effect of tube diameter on the transported plasma was also examined: the smaller the diameter, the higher the applied voltage. The device is likely to be used for sterilization, decontamination, and therapeutic endoscopy as already suggested by other groups in recent past years.« less

  6. Forecasting of high voltage insulation performance: Testing of recommended potting materials and of capacitors

    NASA Technical Reports Server (NTRS)

    Bever, R. S.

    1984-01-01

    Nondestructive high voltage test techniques (mostly electrical methods) are studied to prevent total or catastrophic breakdown of insulation systems under applied high voltage in space. Emphasis is on the phenomenon of partial breakdown or partial discharge (P.D.) as a symptom of insulation quality, notably partial discharge testing under D.C. applied voltage. Many of the electronic parts and high voltage instruments in space experience D.C. applied stress in service, and application of A.C. voltage to any portion thereof would be prohibited. Suggestions include: investigation of the ramp test method for D.C. partial discharge measurements; testing of actual flight-type insulation specimen; perfect plotting resin samples with controlled defects for test; several types of plotting resins and recommendations of the better ones from the electrical characteristics; thermal and elastic properties are also considered; testing of commercial capaciters; and approximate acceptance/rejection/rerating criteria for sample test elements for space use, based on D.C. partial discharge.

  7. High voltage pulse generator. [Patent application

    DOEpatents

    Fasching, G.E.

    1975-06-12

    An improved high-voltage pulse generator is described which is especially useful in ultrasonic testing of rock core samples. An N number of capacitors are charged in parallel to V volts and at the proper instance are coupled in series to produce a high-voltage pulse of N times V volts. Rapid switching of the capacitors from the paralleled charging configuration to the series discharging configuration is accomplished by using silicon-controlled rectifiers which are chain self-triggered following the initial triggering of the first rectifier connected between the first and second capacitors. A timing and triggering circuit is provided to properly synchronize triggering pulses to the first SCR at a time when the charging voltage is not being applied to the parallel-connected charging capacitors. The output voltage can be readily increased by adding additional charging networks. The circuit allows the peak level of the output to be easily varied over a wide range by using a variable autotransformer in the charging circuit.

  8. [Study of microorganism sterilization by instant microwave and electromagnetic pulse].

    PubMed

    Lu, Zhiyuan; Shi, Pinpin; Zhu, Manzuo; Sun, Wenquan; Ding, Hua; Hou, Jianqiang

    2008-08-01

    The sterilization effects of constant electromagnetic wave and instant pulse on foods and traditional Chinese medical pills are introduced in this paper. From the velum's voltage variation caused by the outward electric filed,the dielectric properties of membranaceous ion and the pass rate of the membranaceous ion, we could analyze the biological heating effect and the biological non-heating effect. The sterilization effect of constant electromagnetic wave is based on the biological heating effect, while the instant electromagnetic pulse is based on the biological non-heating effect. With the applied electronic field, the voltage of membrane could increase, which results in the gates of K+ open, and the flowing out of K+. And the variation of the membranaceous voltage makes the gates of Ca2+ open. The Ca2+ of large consistency could come into the cell by the gradient of voltage. It could induce the death of the cells. The greater the variation of membranaceous voltage becomes, the higher will be the death rate of the cells.

  9. An AC electroosmotic micropump for circular chromatographic applications.

    PubMed

    Debesset, S; Hayden, C J; Dalton, C; Eijkel, J C T; Manz, A

    2004-08-01

    Flow rates of up to 50 microm s(-1) have been successfully achieved in a closed-loop channel using an AC electroosmotic pump. The AC electroosmotic pump is made of an interdigitated array of unequal width electrodes located at the bottom of a channel, with an AC voltage applied between the small and the large electrodes. The flow rate was found to increase linearly with the applied voltage and to decrease linearly with the applied frequency. The pump is expected to be suitable for circular chromatography for the following reasons: the driving forces are distributed over the channel length and the pumping direction is set by the direction of the interdigitated electrodes. Pumping in a closed-loop channel can be achieved by arranging the electrode pattern in a circle. In addition the inherent working principle of AC electroosmotic pumping enables the independent optimisation of the channel height or the flow velocity.

  10. Ultrananocrystalline Diamond Cantilever Wide Dynamic Range Acceleration/Vibration /Pressure Sensor

    DOEpatents

    Krauss, Alan R.; Gruen, Dieter M.; Pellin, Michael J.; Auciello, Orlando

    2003-09-02

    An ultrananocrystalline diamond (UNCD) element formed in a cantilever configuration is used in a highly sensitive, ultra-small sensor for measuring acceleration, shock, vibration and static pressure over a wide dynamic range. The cantilever UNCD element may be used in combination with a single anode, with measurements made either optically or by capacitance. In another embodiment, the cantilever UNCD element is disposed between two anodes, with DC voltages applied to the two anodes. With a small AC modulated voltage applied to the UNCD cantilever element and because of the symmetry of the applied voltage and the anode-cathode gap distance in the Fowler-Nordheim equation, any change in the anode voltage ratio V1/V2 required to maintain a specified current ratio precisely matches any displacement of the UNCD cantilever element from equilibrium. By measuring changes in the anode voltage ratio required to maintain a specified current ratio, the deflection of the UNCD cantilever can be precisely determined. By appropriately modulating the voltages applied between the UNCD cantilever and the two anodes, or limit electrodes, precise independent measurements of pressure, uniaxial acceleration, vibration and shock can be made. This invention also contemplates a method for fabricating the cantilever UNCD structure for the sensor.

  11. Ultrananocrystalline diamond cantilever wide dynamic range acceleration/vibration/pressure sensor

    DOEpatents

    Krauss, Alan R [Naperville, IL; Gruen, Dieter M [Downers Grove, IL; Pellin, Michael J [Naperville, IL; Auciello, Orlando [Bolingbrook, IL

    2002-07-23

    An ultrananocrystalline diamond (UNCD) element formed in a cantilever configuration is used in a highly sensitive, ultra-small sensor for measuring acceleration, shock, vibration and static pressure over a wide dynamic range. The cantilever UNCD element may be used in combination with a single anode, with measurements made either optically or by capacitance. In another embodiment, the cantilever UNCD element is disposed between two anodes, with DC voltages applied to the two anodes. With a small AC modulated voltage applied to the UNCD cantilever element and because of the symmetry of the applied voltage and the anode-cathode gap distance in the Fowler-Nordheim equation, any change in the anode voltage ratio V1/N2 required to maintain a specified current ratio precisely matches any displacement of the UNCD cantilever element from equilibrium. By measuring changes in the anode voltage ratio required to maintain a specified current ratio, the deflection of the UNCD cantilever can be precisely determined. By appropriately modulating the voltages applied between the UNCD cantilever and the two anodes, or limit electrodes, precise independent measurements of pressure, uniaxial acceleration, vibration and shock can be made. This invention also contemplates a method for fabricating the cantilever UNCD structure for the sensor.

  12. Coordinated Control Method of Voltage and Reactive Power for Active Distribution Networks Based on Soft Open Point

    DOE PAGES

    Li, Peng; Ji, Haoran; Wang, Chengshan; ...

    2017-03-22

    The increasing penetration of distributed generators (DGs) exacerbates the risk of voltage violations in active distribution networks (ADNs). The conventional voltage regulation devices limited by the physical constraints are difficult to meet the requirement of real-time voltage and VAR control (VVC) with high precision when DGs fluctuate frequently. But, soft open point (SOP), a flexible power electronic device, can be used as the continuous reactive power source to realize the fast voltage regulation. Considering the cooperation of SOP and multiple regulation devices, this paper proposes a coordinated VVC method based on SOP for ADNs. Firstly, a time-series model of coordi-natedmore » VVC is developed to minimize operation costs and eliminate voltage violations of ADNs. Then, by applying the linearization and conic relaxation, the original nonconvex mixed-integer non-linear optimization model is converted into a mixed-integer second-order cone programming (MISOCP) model which can be efficiently solved to meet the requirement of voltage regulation rapidity. Here, we carried out some case studies on the IEEE 33-node system and IEEE 123-node system to illustrate the effectiveness of the proposed method.« less

  13. Coordinated Control Method of Voltage and Reactive Power for Active Distribution Networks Based on Soft Open Point

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Peng; Ji, Haoran; Wang, Chengshan

    The increasing penetration of distributed generators (DGs) exacerbates the risk of voltage violations in active distribution networks (ADNs). The conventional voltage regulation devices limited by the physical constraints are difficult to meet the requirement of real-time voltage and VAR control (VVC) with high precision when DGs fluctuate frequently. But, soft open point (SOP), a flexible power electronic device, can be used as the continuous reactive power source to realize the fast voltage regulation. Considering the cooperation of SOP and multiple regulation devices, this paper proposes a coordinated VVC method based on SOP for ADNs. Firstly, a time-series model of coordi-natedmore » VVC is developed to minimize operation costs and eliminate voltage violations of ADNs. Then, by applying the linearization and conic relaxation, the original nonconvex mixed-integer non-linear optimization model is converted into a mixed-integer second-order cone programming (MISOCP) model which can be efficiently solved to meet the requirement of voltage regulation rapidity. Here, we carried out some case studies on the IEEE 33-node system and IEEE 123-node system to illustrate the effectiveness of the proposed method.« less

  14. Conservation voltage regulation (CVR) applied to energy savings by voltage-adjusting equipment through AMI

    NASA Astrophysics Data System (ADS)

    Lan, B.-R.; Chang, C.-A.; Huang, P.-Y.; Kuo, C.-H.; Ye, Z.-J.; Shen, B.-C.; Chen, B.-K.

    2017-11-01

    Conservation voltage reduction (CVR) includes peak demand reduction, energy conservation, carbon emission reduction, and electricity bill reduction. This paper analyzes the energy-reduction of Siwei Feeders with applying CVR, which are situated in Penghu region and equipped with smart meters. Furthermore, the applicable voltage reduction range for the feeders will be explored. This study will also investigate how the CVR effect and energy conservation are improved with the voltage control devices integrated. The results of this study can serve as a reference for the Taiwan Power Company to promote and implement voltage reduction and energy conservation techniques. This study is expected to enhance the energy-reduction performance of the Penghu Low Carbon Island Project.

  15. Voltage controlled spintronic devices for logic applications

    DOEpatents

    You, Chun-Yeol; Bader, Samuel D.

    2001-01-01

    A reprogrammable logic gate comprising first and second voltage-controlled rotation transistors. Each transistor comprises three ferromagnetic layers with a spacer and insulating layer between the first and second ferromagnetic layers and an additional insulating layer between the second and third ferromagnetic layers. The third ferromagnetic layer of each transistor is connected to each other, and a constant external voltage source is applied to the second ferromagnetic layer of the first transistor. As input voltages are applied to the first ferromagnetic layer of each transistor, the relative directions of magnetization of the ferromagnetic layers and the magnitude of the external voltage determines the output voltage of the gate. By altering these parameters, the logic gate is capable of behaving as AND, OR, NAND, or NOR gates.

  16. New Modulation Method and Control Strategies for Power Electronics Inverters

    NASA Astrophysics Data System (ADS)

    Aleenejad, Mohsen

    The DC to AC power Converters (so-called Inverters) are widely used in industrial applications. The MLIs are becoming increasingly popular in industrial apparatus aimed at medium to high power conversion applications. In comparison to the conventional inverters, they feature superior characteristics such as lower total harmonic distortion (THD), higher efficiency, and lower switching voltage stress. Nevertheless, the superior characteristics come at the price of a more complex topology with an increased number of power electronic switches. The increased number of power electronics switches results in more complicated control strategies for the inverter. Moreover, as the number of power electronic switches increases, the chances of fault occurrence of the switches increases, and thus the inverter's reliability decreases. Due to the extreme monetary ramifications of the interruption of operation in commercial and industrial applications, high reliability for power inverters utilized in these sectors is critical. As a result, developing simple control strategies for normal and fault-tolerant operation of MLIs has always been an interesting topic for researchers in related areas. The purpose of this dissertation is to develop new control and fault-tolerant strategies for the multilevel power inverter. For the normal operation of the inverter, a new high switching frequency technique is developed. The proposed method extends the utilization of the dc link voltage while minimizing the dv/dt of the switches. In the event of a fault, the line voltages of the faulty inverters are unbalanced and cannot be applied to the 3-phase loads. For the faulty condition of the inverter, three novel fault-tolerant techniques are developed. The proposed fault-tolerant strategies generate balanced line voltages without bypassing any healthy and operative inverter element, makes better use of the inverter capacity and generates higher output voltage. These strategies exploit the advantages of the Selective Harmonic Elimination (SHE) and Space Vector Modulation (SVM) methods in conjunction with a slightly modified Fundamental Phase Shift Compensation (FPSC) technique to generate balanced voltages and manipulate voltage harmonics at the same time. The proposed strategies are applicable to several classes of MLIs with three or more voltage levels.

  17. Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line

    PubMed Central

    Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun

    2015-01-01

    A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid. PMID:26729119

  18. Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line.

    PubMed

    Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun

    2015-12-30

    A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid.

  19. Homogeneous dielectric barrier discharges in atmospheric air and its influencing factor

    NASA Astrophysics Data System (ADS)

    Ran, Junxia; Li, Caixia; Ma, Dong; Luo, Haiyun; Li, Xiaowei

    2018-03-01

    The stable homogeneous dielectric barrier discharge (DBD) is obtained in atmospheric 2-3 mm air gap. It is generated using center frequency 1 kHz high voltage power supply between two plane parallel electrodes with specific alumina ceramic plates as the dielectric barriers. The discharge characteristics are studied by a measurement of its electrical discharge parameters and observation of its light emission phenomena. The results show that a large single current pulse of about 200 μs duration appearing in each voltage pulse, and its light emission is radially homogeneous and covers the entire surface of the two electrodes. The homogeneous discharge generated is a Townsend discharge during discharge. The influences of applied barrier, its thickness, and surface roughness on the transition of discharge modes are studied. The results show that it is difficult to produce a homogeneous discharge using smooth plates or alumina plate surface roughness Ra < 100 nm even at a 1 mm air gap. If the alumina plate is too thin, the discharge also transits to filamentary discharge. If it is too thick, the discharge is too weak to observe. With the increase of air gap distance and applied voltage, the discharge can also transit from a homogeneous mode to a filamentary mode. In order to generate stable and homogeneous DBD at a larger air gap, proper dielectric material, dielectric thickness, and dielectric surface roughness should be used, and proper applied voltage amplitude and frequency should also be used.

  20. Method for the depth corrected detection of ionizing events from a co-planar grids sensor

    DOEpatents

    De Geronimo, Gianluigi [Syosset, NY; Bolotnikov, Aleksey E [South Setauket, NY; Carini, Gabriella [Port Jefferson, NY

    2009-05-12

    A method for the detection of ionizing events utilizing a co-planar grids sensor comprising a semiconductor substrate, cathode electrode, collecting grid and non-collecting grid. The semiconductor substrate is sensitive to ionizing radiation. A voltage less than 0 Volts is applied to the cathode electrode. A voltage greater than the voltage applied to the cathode is applied to the non-collecting grid. A voltage greater than the voltage applied to the non-collecting grid is applied to the collecting grid. The collecting grid and the non-collecting grid are summed and subtracted creating a sum and difference respectively. The difference and sum are divided creating a ratio. A gain coefficient factor for each depth (distance between the ionizing event and the collecting grid) is determined, whereby the difference between the collecting electrode and the non-collecting electrode multiplied by the corresponding gain coefficient is the depth corrected energy of an ionizing event. Therefore, the energy of each ionizing event is the difference between the collecting grid and the non-collecting grid multiplied by the corresponding gain coefficient. The depth of the ionizing event can also be determined from the ratio.

  1. Negative differential conductance in doped-silicon nanoscale devices with superconducting electrodes

    NASA Astrophysics Data System (ADS)

    Shapovalov, A.; Shaternik, V.; Suvorov, O.; Zhitlukhina, E.; Belogolovskii, M.

    2018-02-01

    We present a proof-of-concept nanoelectronics device with a negative differential conductance, an attractive from the applied viewpoint functionality. The device, characterized by the decreasing current with increasing voltage in a certain voltage region above a threshold bias of about several hundred millivolts, consists of two superconducting electrodes with an amorphous 10-nm-thick silicon interlayer doped by tungsten nano-inclusions. We show that small changes in the W content radically modify the shape of the trilayer current-voltage dependence and identify sudden conductance switching at a threshold voltage as an effect of Andreev fluctuators. The latter entities are two-level systems at the superconductor-doped silicon interface where a Cooper pair tunnels from a superconductor and occupies a pair of localized electronic states. We argue that in contrast to previously proposed devices, our samples permit very large-scale integration and are practically feasible.

  2. High-Efficiency Power Module

    NASA Technical Reports Server (NTRS)

    Simons, Rainee N (Inventor); Wintucky, Edwin G (Inventor)

    2013-01-01

    One or more embodiments of the present invention pertain to an all solid-state microwave power module. The module includes a plurality of solid-state amplifiers configured to amplify a signal using a low power stage, a medium power stage, and a high power stage. The module also includes a power conditioner configured to activate a voltage sequencer (e.g., bias controller) when power is received from a power source. The voltage sequencer is configured to sequentially apply voltage to a gate of each amplifier and sequentially apply voltage to a drain of each amplifier.

  3. High-Efficiency Power Module

    NASA Technical Reports Server (NTRS)

    Simons, Rainee N. (Inventor); Wintucky, Edwin G. (Inventor)

    2015-01-01

    One or more embodiments of the present invention pertain to an all solid-state microwave power module. The module includes a plurality of solid-state amplifiers configured to amplify a signal using a low power stage, a medium power stage, and a high power stage. The module also includes a power conditioner configured to activate a voltage sequencer (e.g., bias controller) when power is received from a power source. The voltage sequencer is configured to sequentially apply voltage to a gate of each amplifier and sequentially apply voltage to a drain of each amplifier.

  4. High-voltage crowbar circuit with cascade-triggered series ignitrons

    DOEpatents

    Baker, William R. [Orinda, CA

    1980-11-04

    A series string of ignitrons for switching a large current at high voltage to ground. Switching is initiated by means of a negative trigger pulse applied to the cathode of the lowest voltage level ignitron next to ground to draw ground current through diodes in the ignitor circuit. The trigger pulse is applied thereby to the next higher ignitron cathode and sequentially to the remainder of the ignitrons in the string through diodes in respective ignitor circuits. Full line voltage is held off of nonconducting diodes and ignitrons by means of varistors.

  5. High-voltage crowbar circuit with cascade-triggered series ignitrons

    DOEpatents

    Baker, W.R.

    A series string of ignitrons for switching a large current at high voltage to ground is discussed. Switching is initiated by means of a negative trigger pulse applied to the cathode of the lowest voltage level ignitron next to ground to draw ground current through diodes in the ignitor circuit. The trigger pulse is applied thereby to the next higher ignitron cathode and sequentially to the remainder of the ignitrons in the string through diodes in respective ignitor circuits. Full line voltage is held off of nonconducting diodes and ignitrons by means of varistors.

  6. High-voltage crowbar circuit with cascade-triggered series ignitrons

    DOEpatents

    Baker, W.R.

    1980-11-04

    A series string of ignitrons for switching a large current at high voltage to ground. Switching is initiated by means of a negative trigger pulse applied to the cathode of the lowest voltage level ignitron next to ground to draw ground current through diodes in the ignitor circuit. The trigger pulse is applied thereby to the next higher ignitron cathode and sequentially to the remainder of the ignitrons in the string through diodes in respective ignitor circuits. Full line voltage is held off of nonconducting diodes and ignitrons by means of varistors. 1 fig.

  7. Variation of nanopore diameter along porous anodic alumina channels by multi-step anodization.

    PubMed

    Lee, Kwang Hong; Lim, Xin Yuan; Wai, Kah Wing; Romanato, Filippo; Wong, Chee Cheong

    2011-02-01

    In order to form tapered nanocapillaries, we investigated a method to vary the nanopore diameter along the porous anodic alumina (PAA) channels using multi-step anodization. By anodizing the aluminum in either single acid (H3PO4) or multi-acid (H2SO4, oxalic acid and H3PO4) with increasing or decreasing voltage, the diameter of the nanopore along the PAA channel can be varied systematically corresponding to the applied voltages. The pore size along the channel can be enlarged or shrunken in the range of 20 nm to 200 nm. Structural engineering of the template along the film growth direction can be achieved by deliberately designing a suitable voltage and electrolyte together with anodization time.

  8. Template directed assembly of nanoelements in viscous polymer environments

    NASA Astrophysics Data System (ADS)

    Modi, Satyamkumar

    Polymer melt-based manufacturing methods, such as injection molding, offer the potential of directly fabricating three-dimensional parts with nanostructured surfaces in a one-step, high-rate, and solventless process. Electrophoretic deposition has the potential to produce in-mold assembly of nanoparticles during injection molding. The process is fast, is cost effective and can be automated. This electrophoretic deposition, however, has been performed from low-viscosity media and polymer melts are far more viscous. This research provided a fundamental understanding of the electrophoretic deposition process in viscous media. Electrophoresis was performed using a model system of carbon black and polystyrene in tetrahydrofuran (THF). Examined were the effects of processing parameters, polystyrene molecular weight, and carbon black charge. The presence of polystyrene did not prevent deposition of carbon black, but deposition rates decreased at shorter deposition times; deposition was not linear with increasing applied voltage; and greater solution concentrations reduced the critical voltages. A comparison of experimental data with Hamaker's model showed that about 1.6% of the available polystyrene was initially deposited with the carbon black. At voltages above the critical voltage, the deposited mass indicated formation of electrically insulating layers on the electrodes. Increases in polystyrene molecular weight reduced the electrophoretic deposition of the carbon black particles due to increases in suspension viscosity and preferential adsorption of the longer polystyrene chains on the carbon black particles. At low deposition times (≤ 5 seconds), only carbon black deposited onto the electrodes. For longer deposition times, polystyrene co-deposited with the carbon black, with the amount of polystyrene increasing with molecular weight and decreasing with greater charge on the polystyrene molecules. The additional of function groups to the carbon black surface decoupled the carbon black and polystyrene, however, the deposition of the carbon black particles, followed by deposition of a thick layer of polystyrene was observed. This polystyrene deposition was present regardless of the applied voltage, the deposition time, the polystyrene molecular weight, polystyrene material (i.e., charge), and solvent polarity. This deposition behavior suggests that use of lower molecular polymers and unmodified carbon blacks, and control of electrical properties will permit electrophoretic deposition of nanoparticles from polymer melts.

  9. Nanosecond liquid crystalline optical modulator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Borshch, Volodymyr; Shiyanovskii, Sergij V.; Lavrentovich, Oleg D.

    2016-07-26

    An optical modulator includes a liquid crystal cell containing liquid crystal material having liquid crystal molecules oriented along a quiescent director direction in the unbiased state, and a voltage source configured to apply an electric field to the liquid crystal material wherein the direction of the applied electric field does not cause the quiescent director direction to change. An optical source is arranged to transmit light through or reflect light off the liquid crystal cell with the light passing through the liquid crystal material at an angle effective to undergo phase retardation in response to the voltage source applying themore » electric field. The liquid crystal material may have negative dielectric anisotropy, and the voltage source configured to apply an electric field to the liquid crystal material whose electric field vector is transverse to the quiescent director direction. Alternatively, the liquid crystal material may have positive dielectric anisotropy and the voltage source configured to apply an electric field to the liquid crystal material whose electric field vector is parallel with the quiescent director direction.« less

  10. Trace Impurity Analysis in Ta Films Using Glow Discharge Mass Spectrometry: Concentration Change of Impurities by Applying Negative Substrate Bias Voltage

    NASA Astrophysics Data System (ADS)

    Lim, Jae-Won; Mimura, Kouji; Isshiki, Minoru

    2004-12-01

    Glow discharge mass spectrometry (GDMS) was used to analyze a Ta target and Ta films for trace impurities. The Ta films were deposited on Si (100) substrate at substrate bias voltages of 0 V and -125 V using a non-mass separated ion beam deposition system. Although both Ta films were contaminated by impurities during the deposition, the Ta film deposited at a substrate bias voltage of -125 V showed lower impurity content than the Ta film deposited without the substrate bias voltage, which means that applying a negative bias voltage to the substrate decreased the total concentration of impurities. Furthermore, the concentration change of individual impurities in the Ta film is related to their ionization ratio in the argon discharge plasma. Considering the effect of the ionization potential of an individual impurity on the ionization ratio, purification by applying a negative bias voltage to the substrate results from Penning ionization and an ionization mechanism proposed in this study, as well as from the difference between the kinetic energies of Ta neutral atoms and Ta+ ions accelerated toward the substrate with/without a negative substrate bias voltage.

  11. High voltage stability of LiCoO2 particles with a nano-scale Lipon coating

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Yoongu; Veith, Gabriel M; Nanda, Jagjit

    2011-01-01

    For high-voltage cycling of rechargeable Li batteries, a nano-scale amorphous Li-ion conductor, lithium phosphorus oxynitride (Lipon), has been coated on surfaces of LiCoO{sub 2} particles by combining a RF-magnetron sputtering technique and mechanical agitation of LiCoO{sub 2} powders. LiCoO{sub 2} particles coated with 0.36 wt% ({approx}1 nm thick) of the amorphous Lipon, retain 90% of their original capacity compared to non-coated cathode materials that retain only 65% of their original capacity after more than 40 cycles in the 3.0-4.4 V range with a standard carbonate electrolyte. The reason for the better high-voltage cycling behavior is attributed to reduction in themore » side reactions that cause increase of the cell resistance during cycling. Further, Lipon coated particles are not damaged, whereas uncoated particles are badly cracked after cycling. Extending the charge of Lipon-coated LiCoO{sub 2} to higher voltage enhances the specific capacity, but more importantly the Lipon-coated material is also more stable and tolerant of high voltage excursions. A drawback of Lipon coating, particularly as thicker films are applied to cathode powders, is the increased electronic resistance that reduces the power performance.« less

  12. Transition from Townsend to radio-frequency homogeneous dielectric barrier discharge in a roll-to-roll configuration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bazinette, R.; SIAME, Université de Pau et des Pays de l'Adour, Pau; Paillol, J.

    The aim of this paper is to better understand the transition from Townsend to radio-frequency homogeneous dielectric barrier discharge (DBD) at atmospheric pressure. The study is done in an Ar/NH{sub 3} Penning mixture for an electrode configuration adapted to roll-to-roll plasma surface treatment. The study was led in a frequency range running from 50 kHz up to 8.3 MHz leading to different DBD modes with a 1 mm gas gap: Glow (GDBD), Townsend (TDBD), and Radio-frequency (RF-DBD). In the frequency range between TDBD and RF-DBD, from 250 kHz to 2.3 MHz, additional discharges are observed outside the inter-electrode gas gap. Because each high voltagemore » electrode are inside a dielectric barrel, these additional discharges occur on the side of the barrel where the gap is larger. They disappear when the RF-DBD mode is attained in the 1 mm inter-electrode gas gap, i.e., for frequencies equal or higher than 3 MHz. Fast imaging and optical emission spectroscopy show that the additional discharges are radio-frequency DBDs while the inter-electrode discharge is a TDBD. The RF-DBD discharge mode is attained when electrons drift becomes low enough compared to the voltage oscillation frequency to limit electron loss at the anode. To check that the additional discharges are due to a larger gas gap and a lower voltage amplitude, the TDBD/RF-DBD transition is investigated as a function of the gas gap and the applied voltage frequency and amplitude. Results show that the increase in the frequency at constant gas gap or in the gas gap at constant frequency allows to obtain RF-DBD instead of TDBD. At low frequency and large gap, the increase in the applied voltage allows RF-DBD/TDBD transition. As a consequence, an electrode configuration allowing different gap values is a solution to successively have different discharge modes with the same applied voltage.« less

  13. Thermal latency adds to lesion depth after application of high-power short-duration radiofrequency energy: Results of a computer-modeling study.

    PubMed

    Irastorza, Ramiro M; d'Avila, Andre; Berjano, Enrique

    2018-02-01

    The use of ultra-short RF pulses could achieve greater lesion depth immediately after the application of the pulse due to thermal latency. A computer model of irrigated-catheter RF ablation was built to study the impact of thermal latency on the lesion depth. The results showed that the shorter the RF pulse duration (keeping energy constant), the greater the lesion depth during the cooling phase. For instance, after a 10-second pulse, lesion depth grew from 2.05 mm at the end of the pulse to 2.39 mm (17%), while after an ultra-short RF pulse of only 1 second the extra growth was 37% (from 2.22 to 3.05 mm). Importantly, short applications resulted in deeper lesions than long applications (3.05 mm vs. 2.39 mm, for 1- and 10-second pulse, respectively). While shortening the pulse duration produced deeper lesions, the associated increase in applied voltage caused overheating in the tissue: temperatures around 100 °C were reached at a depth of 1 mm in the case of 1- and 5-second pulses. However, since the lesion depth increased during the cooling period, lower values of applied voltage could be applied in short durations in order to obtain lesion depths similar to those in longer durations while avoiding overheating. The thermal latency phenomenon seems to be the cause of significantly greater lesion depth after short-duration high-power RF pulses. Balancing the applied total energy when the voltage and duration are changed is not the optimal strategy since short pulses can also cause overheating. © 2017 Wiley Periodicals, Inc.

  14. Modelling in conventional electroporation for model cell with organelles using COMSOL Multiphysics

    NASA Astrophysics Data System (ADS)

    Sulaeman, M. Y.; Widita, R.

    2016-03-01

    Conventional electroporation is a formation of pores in the membrane cell due to the external electric field applied to the cell. The purpose of creating pores in the cell using conventional electroporation are to increase the effectiveness of chemotherapy (electrochemotherapy) and to kill cancer tissue using irreversible electroporation. Modeling of electroporation phenomenon on a model cell had been done by using software COMSOL Multiphysics 4.3b with the applied external electric field with intensity at 1.1 kV/cm to find transmembrane voltage and pore density. It can be concluded from the results of potential distribution and transmembrane voltage, it show that pores formation only occurs in the membrane cells and it could not penetrate into inside the model cell so there is not pores formation in its organells.

  15. Child-Langmuir flow in a planar diode filled with charged dust impurities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang Xiaoyan; Institut fuer Theoretische Physik IV, Fakultaet fuer Physik und Astronomie, Ruhr-Universitaet Bochum, D-44870 Bochum; Shukla, Padma Kant

    The Child-Langmuir (CL) flow in a planar diode in the presence of stationary charged dust particles is studied. The limiting electron current density and other diode properties, such as the electrostatic potential, the electron flow speed, and the electron number density, are calculated analytically. A comparison of the results with the case without dust impurities reveals that the diode parameters mentioned above decrease with the increase of the dust charge density. Furthermore, it is found that the classical scaling of D{sup -2} (the gap spacing D) for the CL current density remains exactly valid, while the scaling of V{sup 3/2}more » (the applied gap voltage V) can be a good approximation for low applied gap voltage and for low dust charge density.« less

  16. Active voltage contrast imaging of cross-sectional surface of multilayer ceramic capacitor using helium ion microscopy

    NASA Astrophysics Data System (ADS)

    Sakai, C.; Ishida, N.; Masuda, H.; Nagano, S.; Kitahara, M.; Ogata, Y.; Fujita, D.

    2016-08-01

    We studied active voltage contrast (AVC) imaging using helium ion microscopy (HIM). We observed secondary electron (SE) images of the cross-sectional surface of multilayer ceramic capacitors (MLCCs) with and without a voltage applied to the internal electrodes. When no voltage was applied, we obtained an image reflecting the material contrast between the Ni internal electrode region and the BaTiO3 dielectric region of the cross-sectional surface of the MLCC. When a voltage was applied, the electrical potential difference between the grounded and the positively biased internal electrodes affected the contrast (voltage contrast). Moreover, attenuation of the SE intensity from the grounded to the positively biased internal electrodes was observed in the dielectric region. Kelvin probe force microscopy (KPFM) measurements of the contact potential difference (CPD) were performed on the same sample. By using the AVC image from the HIM observation and the CPD image from the KPFM measurement, we could quantitatively evaluate the electrical potential. We think that the results of this study will lead to an expansion in the number of applications of HIM.

  17. Collection of ultrafine diesel particulate matter (DPM) in cylindrical single-stage wet electrostatic precipitators.

    PubMed

    Saiyasitpanich, Phirun; Keener, Tim C; Lu, Mingming; Khang, Soon-Jai; Evans, Douglas E

    2006-12-15

    Long-term exposures to diesel particulate matter (DPM) emissions are linked to increasing adverse human health effects due to the potential association of DPM with carcinogenicity. Current diesel vehicular particulate emission regulations are based solely upon total mass concentration, albeit it is the submicrometer particles that are highly respirable and the most detrimental to human health. In this study, experiments were performed with a tubular single-stage wet electrostatic precipitator (wESP) to evaluate its performance for the removal of number-based DPM emissions. A nonroad diesel generator utilizing a low sulfur diesel fuel (500 ppmw) operating under varying load conditions was used as a stationary DPM emission source. An electrical low-pressure impactor (ELPI) was used to quantify the number concentration distributions of diesel particles in the diluted exhaust gas at each tested condition. The wESP was evaluated with respect to different operational control parameters such as applied voltage, gas residence time, etc., to determine their effect on overall collection efficiency, as well as particle size dependent collection efficiency. The results show that the total DPM number concentrations in the untreated diesel exhaust are in the magnitude of approximately108/cm(3) at all engine loads with the particle diameter modes between 20 and 40 nm. The measured collection efficiency of the wESP operating at 70 kV based on total particle numbers was 86% at 0 kW engine load and the efficiency decreased to 67% at 75 kW due to a decrease in gas residence time and an increase in particle concentrations. At a constant wESP voltage of 70 kV and at 75 kW engine load, the variation of gas residence time within the wESP from approximately 0.1 to approximately 0.4 s led to a substantial increase in the collection efficiency from 67% to 96%. In addition, collection efficiency was found to be directly related to the applied voltage, with increasing collection efficiency measured for increases in applied voltage. The collection efficiency based on particle size had a minimum for sizes between 20 and 50 nm, but at optimal wESP operating conditions it was possible to remove over 90% of all particle sizes. A comparison of measured and calculated collection efficiencies reveals that the measured values are significantly higher than the predicted values based on the well-known Deutsch equation.

  18. Electron emission phenomena controlled by a transverse electric field in compound emitters

    NASA Astrophysics Data System (ADS)

    Olesik, Jadwiga; Calusinski, Bogdan; Olesik, Zygmunt

    1996-09-01

    Influence of an inner electric field on such emission phenomena like: secondary emission, photoemission and field emission has been investigated. The applied sample-emitter was a glass wafer (thickness 0.2 mm) covered on both sides by semiconducting films In2O3:Sn. A voltage (in the interval -2000V divided by 0V) generating transverse electric field was applied to one of the films. This film had a thickness of about 200 nm. The second film (emitting electrons) had a thickness 100 nm or 10 nm. The secondary emission measurements were made by the retarding field method using four grid retarding potential analyzer. It was found that the secondary emission coefficient changes non- monotonically with increasing field intensity. Electron emission measurements without using a primary electron beam were made with the electron multiplier cooperating with a multichannel pulse amplitude analyzer. The measurements were performed in the vacuum of about 2 multiplied by 10-6 Pa. Influence of film thickness on the intensity of field controlled emission and field controlled photoemission was also studied. It was also found that the frequency of counts (generated by electrons in the electron multiplier) depends on the polarizing voltage approximately in an exponential way. Some departures from this dependence can be observed at higher Upol voltages (above 1000 V). Thus, at an appropriate high voltage Upol conditions for a cascade emission are created. At lower voltages the conditions correspond to a semiconductor with a negative electron affinity.

  19. Development of Repulsive Barrier Discharge from Twin Needles

    NASA Astrophysics Data System (ADS)

    Ueno, Hideki; Hata, Koji; Nakayama, Hiroshi

    2007-03-01

    Barrier discharge characteristics have been investigated for a twin needles-to-plane electrode configuration in dry air. The characteristics of barrier discharge under ac voltage application have been investigated for various distances between two needle tips (d=1.0--4.0 mm). We have found that corona discharge behavior strongly depends on needle-tip distance. In the case of a twin-needles configuration with a long needle-tip distance (d=4.0 mm), discharges from the two needle tips develop into a dielectric barrier with almost a straight path. On the contrary, the development of repulsive discharges from two needle tips in the gap between needles and a barrier was obtained for the shortest needle-tip distance investigated here (d=1.0 mm) and it was enhanced by increasing the peak voltage. From detailed time-resolved observations, development of repulsive discharge was observed only during positive polarity upon ac voltage application. Moreover, the degree of repulsion increased with increasing applied voltage of positive polarity. The observed unique discharge behavior can be interpreted as the effect of field relaxation induced not only by charge accumulation on the barrier surface, which is markedly enhanced at a short needle-tip distance, but also by space charge by coronas between two needles.

  20. The effect of the geomagnetic field on negative voltage spheres in the ionospheric plasma: Fluid simulation

    NASA Astrophysics Data System (ADS)

    Ma, T.-Z.; Schunk, R. W.

    1994-07-01

    Experiments involving the interaction of spherical conducting objects biases with hight voltages in the Low-Earth-Orbit (LEO) environment have been conducted and designed. In these experiments, both positive and negative voltages have been applied to the spheres. Previously, there have been theoretical and numerical studies of positive voltage spheres in plasmas with and without magnetic fields. There also have been studies of negative voltage objects in unmagnetized plasmas. Here, we used a fluid model to study the plasma response to a negative voltage sphere immersed in a magnetized plasma. Our main purpose was to investigate the role of the magnetic field during the early-time interaction between the negative voltage sphere and the ambient plasma in the LEO environment. In this study, different applied voltages, magnetic field strengths, and rise-times of the applied voltages were considered. It was found that with the strength of the geomagnetic field the ions are basically not affected by the magnetic field on the time scale of hundreds of plasma periods considered in this study. The ion density distribution around the sphere and the collected ion flux by the sphere are basically the same as in the case without the magnetic field. The electron motion is strongly affected by the magnetic field. One effect is to change the nature of the electron over-shoot oscillation from regular to somewhat turbulent. Although the electrons move along the magnetic field much more easily than across the magnetic field, some redirection effect causes the electron density to distribute as if the magnetic field effect is minimal. The sheath struture and the electric field around the sphere tend to be spherical. A finite rise-time of the applied voltage reduces the oscillatory activities and delays the ion acceleration. However, the effect of the rise-time depends on both the duration of the rise-time and the ion plasma period.

  1. Emission characteristics of kerosene-air spray combustion with plasma assistance

    NASA Astrophysics Data System (ADS)

    Liu, Xingjian; He, Liming; Zeng, Hao; Jin, Tao; Chen, Yi; Zhang, Yihan; Liu, Pengfei

    2015-09-01

    A plasma assisted combustion system for combustion of kerosene-air mixtures was developed to study emission levels of O2, CO2, CO, and NOx. The emission measurement was conducted by Testo 350-Pro Flue Gas Analyzer. The effect of duty ratio, feedstock gas flow rate and applied voltage on emission performance has been analyzed. The results show that O2 and CO emissions reduce with an increase of applied voltage, while CO2 and NOx emissions increase. Besides, when duty ratio or feedstock gas flow rate decreases, the same emission results would appear. The emission spectrum of the air plasma of plasma assisted combustion actuator was also registered to analyze the kinetic enhancement effect of plasma, and the generation of ozone was believed to be the main factor that plasma makes a difference in our experiment. These results are valuable for the future optimization of kerosene-fueled aircraft engine when using plasma assisted combustion devices to exert emission control.

  2. [Spectral investigation of atmospheric pressure plasma column].

    PubMed

    Li, Xue-Chen; Chang, Yuan-Yuan; Xu, Long-Fei

    2012-07-01

    Atmospheric pressure plasma column has many important applications in plasma stealth for aircraft. In the present paper, a plasma column with a length of 65 cm was generated in argon at atmospheric pressure by using dielectric barrier discharge device with water electrodes in coaxial configurations. The discharge mechanism of the plasma column was studied by optical method and the result indicates that a moving layer of light emission propagates in the upstream region. The propagation velocity of the plasma bullet is about 0.6 x 10(5) m x s(-1) through optical measurement. Spectral intensity ratios as functions of the applied voltage and driving frequency were also investigated by spectroscopic method. The variation in spectral intensity ratio implies a change in the averaged electron energy. Results show that the averaged electron energy increases with the increase in the applied voltage and the driving frequency. These results have significant values for industrial applications of the atmospheric pressure discharge and have extensive application potentials in stealth for military aircraft.

  3. Preparation and characterization of kefiran electrospun nanofibers.

    PubMed

    Esnaashari, Seyedeh Sara; Rezaei, Sasan; Mirzaei, Esmaeil; Afshari, Hamed; Rezayat, Seyed Mahdi; Faridi-Majidi, Reza

    2014-09-01

    In this study, we report the first successful production of kefiran nanofibers through electrospinning process using distilled water as solvent. For this purpose, kefiran was extracted from cultured kefir grains, and homogenous kefiran solutions with different concentrations were prepared and then electrospun to obtain uniform nanofibers. The effect of main process parameters, including applied voltage, tip-to-collector distance, and feeding rate, on diameter and morphology of produced nanofibers, was studied. Scanning electron microscopy (SEM) and attenuated total reflectance Fourier transform infrared (ATR-FTIR) spectroscopy were used to characterize electrospun mats. Rheological behavior of the kefiran solution was evaluated via a cone and plate rheometer too. The results exhibited that diameter of kefiran nanofibers increased with increasing polymer concentration, applied voltage, and polymer feeding rate, while tip-to-collector distance did not have significant effect on nanofiber diameter. ATR-FTIR spectra showed that kefiran has maintained its molecular structure during electrospinning process. Flow curves also demonstrated shear thinning behavior for kefiran solutions. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Microalgae dewatering based on forward osmosis employing proton exchange membrane.

    PubMed

    Son, Jieun; Sung, Mina; Ryu, Hoyoung; Oh, You-Kwan; Han, Jong-In

    2017-11-01

    In this study, electrically-facilitated forward osmosis (FO) employing proton exchange membrane (PEM) was established for the purpose of microalgae dewatering. An increase in water flux was observed when an external voltage was applied to the FO equipped with the PEM; as expected, the trend became more dramatic with both concentration of draw solution and applied voltage raised. With this FO used for microalgae dewatering, 247% of increase in flux and 86% in final biomass concentration were observed. In addition to the effect on flux improvement, the electrically-facilitated FO exhibited the ability to remove chlorophyll from the dewatered biomass, down to 0.021±0015mg/g cell. All these suggest that the newly suggested electrically-facilitated FO, one particularly employed PEM, can indeed offer a workable way of dewatering of microalgae; it appeared to be so because it can also remove the ever-problematic chlorophyll from extracted lipids in a simultaneous fashion. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. Performance analysis of cascaded h-bridge multilevel inverter using mixed switching frequency with various dc-link voltages

    NASA Astrophysics Data System (ADS)

    Citarsa, I. B. F.; Satiawan, I. N. W.; Wiryajati, I. K.; Supriono

    2016-01-01

    Multilevel inverters have been widely used in many applications since the technology is advantageous to increase the converter capability as well as to improve the output voltage quality. According to the applied switching frequency, multilevel modulations can be subdivided into three classes, i.e: fundamental switching frequency, high switching frequency and mixed switching frequency. This paper investigates the performance of cascaded H-bridge (CHB) multilevel inverter that is modulated using mixed switching frequency (MSF) PWM with various dc-link voltage ratios. The simulation results show the nearly sinusoidal load output voltages are successfully achieved. It is revealed that there is improvement in output voltages quality in terms of THD and low-order harmonics content. The CHB inverter that is modulated using MSF PWM with equal dc-link voltage ratio (½ Vdc: ½ Vdc) produces output voltage with the lowest low-order harmonics (less than 1% of fundamental) while the CHB inverter that is modulated using MSF PWM with un-equal dc-link voltage ratio (2/3 Vdc: 1/3 Vdc) produces a 7-level output voltage with the lowest THD (16.31%) compared to the other PWM methods. Improvement of the output voltage quality here is also in line with improvement of the number of available levels provided in the output voltage. Here only 2 cells H-bridge inverter (contain 8 switches) are needed to produce a 7- level output voltage, while in the conventional CHB inverter at least 3 cells of H-bridge inverter (contain 12 switches) are needed to produce a 7-level output voltage. Hence it is valuable in term of saving number of component.

  6. Electromagnetic fields (UHF) increase voltage sensitivity of membrane ion channels; possible indication of cell phone effect on living cells.

    PubMed

    Ketabi, N; Mobasheri, H; Faraji-Dana, R

    2015-03-01

    The effects of ultra high frequency (UHF) nonionizing electromagnetic fields (EMF) on the channel activities of nanopore forming protein, OmpF porin, were investigated. The voltage clamp technique was used to study the single channel activity of the pore in an artificial bilayer in the presence and absence of the electromagnetic fields at 910 to 990 MHz in real time. Channel activity patterns were used to address the effect of EMF on the dynamic, arrangement and dielectric properties of water molecules, as well as on the hydration state and arrangements of side chains lining the channel barrel. Based on the varied voltage sensitivity of the channel at different temperatures in the presence and absence of EMF, the amount of energy transferred to nano-environments of accessible groups was estimated to address the possible thermal effects of EMF. Our results show that the effects of EMF on channel activities are frequency dependent, with a maximum effect at 930 MHz. The frequency of channel gating and the voltage sensitivity is increased when the channel is exposed to EMF, while its conductance remains unchanged at all frequencies applied. We have not identified any changes in the capacitance and permeability of membrane in the presence of EMF. The effect of the EMF irradiated by cell phones is measured by Specific Absorption Rate (SAR) in artificial model of human head, Phantom. Thus, current approach applied to biological molecules and electrolytes might be considered as complement to evaluate safety of irradiating sources on biological matter at molecular level.

  7. How to use a phase-only spatial light modulator as a color display.

    PubMed

    Harm, Walter; Jesacher, Alexander; Thalhammer, Gregor; Bernet, Stefan; Ritsch-Marte, Monika

    2015-02-15

    We demonstrate that a parallel aligned liquid crystal on silicon (PA-LCOS) spatial light modulator (SLM) without any attached color mask can be used as a full color display with white light illumination. The method is based on the wavelength dependence of the (voltage controlled) birefringence of the liquid crystal pixels. Modern SLMs offer a wide range over which the birefringence can be modulated, leading (in combination with a linear polarizer) to several intensity modulation periods of a reflected light wave as a function of the applied voltage. Because of dispersion, the oscillation period strongly depends on the wavelength. Thus each voltage applied to an SLM pixel corresponds to another reflected color spectrum. For SLMs with a sufficiently broad tuning range, one obtains a color palette (i.e., a "color lookup-table"), which allows one to display color images. An advantage over standard liquid crystal displays (LCDs), which use color masks in front of the individual pixels, is that the light efficiency and the display resolution are increased by a factor of three.

  8. Active control of flexural vibrations in beams

    NASA Technical Reports Server (NTRS)

    Gerhold, Carl H.

    1987-01-01

    The feasibility of using piezoelectric actuators to control the flexural oscillations of large structures in space is investigated. Flexural oscillations are excited by impulsive loads. The vibratory response can degrade the pointing accuracy of cameras and antennae, and can cause high stresses at structural node points. Piezoelectric actuators have the advantage of exerting localized bending moments. In this way, vibration is controlled without exciting rigid body modes. The actuators are used in collocated sensor/driver pairs to form a feedback control system. The sensor produces a voltage that is proportional to the dynamic stress at the sensor location, and the driver produces a force that is proportional to the voltage applied to it. The analog control system amplifies and phase shifts the sensor signal to produce the voltage signal that is applied to the driver. The feedback control is demonstrated to increase the first mode damping in a cantilever beam by up to 100 percent, depending on the amplifier gain. The damping efficiency of the control system when the piezoelectrics are not optimally positioned at points of high stress in the beam is evaluated.

  9. Coupling of anodic oxidation and adsorption by granular activated carbon for chemical oxygen demand removal from 4,4'-diaminostilbene-2,2'-disulfonic acid wastewater.

    PubMed

    Wang, Lizhang; Zhao, Yuemin

    2010-01-01

    Experiments were performed to reduce chemical oxygen demand (COD) from 4,4'-diaminostilbene-2,2'-disulfonic (DSD) acid manufacturing wastewater using electrochemical oxidation coupled with adsorption by granular activated carbon. The COD removal is affected by the residence time and applied voltage. When the residence time is increased, lower value of COD effluent could be obtained, however, the average current efficiency (ACE) decreased rapidly, and so does the applied voltage. In addition, aeration could effectively enhance COD removal efficiency and protect anodes from corrosion. Furthermore, the acidic condition is beneficial to the rapid decrease of COD and the values of pH effluent are independent of the initial solution pH. The optimization conditions obtained from these experiments are applied voltage of 4.8 V, residence time of 180 min and air-liquid ratio of 4.2 with the COD effluent of about 690 mg L⁻¹. In these cases, the ACE and energy consumption are 388% and 4.144 kW h kg⁻¹ COD, respectively. These perfect results from the experiments illustrate that the combined process is a considerable alternative for the treatment of industrial wastewater containing high concentration of organic pollutants and salinity.

  10. Negative differential electrolyte resistance in a solid-state nanopore resulting from electroosmotic flow bistability.

    PubMed

    Luo, Long; Holden, Deric A; White, Henry S

    2014-03-25

    A solid-state nanopore separating two aqueous solutions containing different concentrations of KCl is demonstrated to exhibit negative differential resistance (NDR) when a constant pressure is applied across the nanopore. NDR refers to a decrease in electrical current when the voltage applied across the nanopore is increased. NDR results from the interdependence of solution flow (electroosmotic and pressure-engendered) with the distributions of K+ and Cl- within the nanopore. A switch from a high-conductivity state to a low-conductivity state occurs over a very narrow voltage window (<2 mV) that depends on the nanopore geometry, electrolyte concentration, and nanopore surface charge density. Finite element simulations based on a simultaneous solution of the Navier-Stokes, Poisson, and Nernst-Planck equations demonstrate that NDR results from a positive feedback mechanism between the ion distributions and electroosmotic flow, yielding a true bistability in fluid flow and electrical current at a critical applied voltage, i.e., the NDR "switching potential". Solution pH and Ca2+ were separately employed as chemical stimuli to investigate the dependence of the NDR on the surface charge density. The NDR switching potential is remarkably sensitive to the surface charge density, and thus to pH and the presence of Ca2+, suggesting possible applications in chemical sensing.

  11. Development of double-pulse lasers ablation system for generating gold ion source under applying an electric field

    NASA Astrophysics Data System (ADS)

    Khalil, A. A. I.

    2015-12-01

    Double-pulse lasers ablation (DPLA) technique was developed to generate gold (Au) ion source and produce high current under applying an electric potential in an argon ambient gas environment. Two Q-switched Nd:YAG lasers operating at 1064 and 266 nm wavelengths are combined in an unconventional orthogonal (crossed-beam) double-pulse configuration with 45° angle to focus on a gold target along with a spectrometer for spectral analysis of gold plasma. The properties of gold plasma produced under double-pulse lasers excitation were studied. The velocity distribution function (VDF) of the emitted plasma was studied using a dedicated Faraday-cup ion probe (FCIP) under argon gas discharge. The experimental parameters were optimized to attain the best signal to noise (S/N) ratio. The results depicted that the VDF and current signals depend on the discharge applied voltage, laser intensity, laser wavelength and ambient argon gas pressure. A seven-fold increases in the current signal by increasing the discharge applied voltage and ion velocity under applying double-pulse lasers field. The plasma parameters (electron temperature and density) were also studied and their dependence on the delay (times between the excitation laser pulse and the opening of camera shutter) was investigated as well. This study could provide significant reference data for the optimization and design of DPLA systems engaged in laser induced plasma deposition thin films and facing components diagnostics.

  12. 16 CFR 1505.6 - Performance.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... horizontal. No spillage of molten material or hot liquids from containers shall occur while the toy is... breakdown for 1 minute a sinusoidal test potential applied between the high-voltage and low-voltage windings... volts plus twice the rated voltage of the high-voltage winding. The test potential shall be supplied...

  13. Measuring surfactant concentration in plating solutions

    DOEpatents

    Bonivert, William D.; Farmer, Joseph C.; Hachman, John T.

    1989-01-01

    An arrangement for measuring the concentration of surfactants in a electrolyte containing metal ions includes applying a DC bias voltage and a modulated voltage to a counter electrode. The phase angle between the modulated voltage and the current response to the modulated voltage at a working electrode is correlated to the surfactant concentration.

  14. Broadening of Distribution of Trap States in PbS Quantum Dot Field-Effect Transistors with High-k Dielectrics

    PubMed Central

    2017-01-01

    We perform a quantitative analysis of the trap density of states (trap DOS) in PbS quantum dot field-effect transistors (QD-FETs), which utilize several polymer gate insulators with a wide range of dielectric constants. With increasing gate dielectric constant, we observe increasing trap DOS close to the lowest unoccupied molecular orbital (LUMO) of the QDs. In addition, this increase is also consistently followed by broadening of the trap DOS. We rationalize that the increase and broadening of the spectral trap distribution originate from dipolar disorder as well as polaronic interactions, which are appearing at strong dielectric polarization. Interestingly, the increased polaron-induced traps do not show any negative effect on the charge carrier mobility in our QD devices at the highest applied gate voltage, giving the possibility to fabricate efficient low-voltage QD devices without suppressing carrier transport. PMID:28084725

  15. Influence of sodium carbonate on decomposition of formic acid by pulsed discharge plasma inside bubble in water

    NASA Astrophysics Data System (ADS)

    Iwabuchi, Masashi; Takahashi, Katsuyuki; Takaki, Koichi; Satta, Naoya

    2016-07-01

    The influence of sodium carbonate on the decomposition of formic acid by discharge inside bubbles in water was investigated experimentally. Oxygen or argon gases were injected into the water through a vertically positioned glass tube, in which the high-voltage wire electrode was placed to generate plasmas at low applied voltage. The concentration of formic acid was determined by ion chromatography. In the case of sodium carbonate additive, the pH increased owing to the decomposition of the formic acid. In the case of oxygen injection, the percentage of conversion of formic acid increased with increasing pH because the reaction rate of ozone with formic acid increased with increasing pH. In the case of argon injection, the percentage of conversion was not affected by the pH owing to the high rate loss of hydroxyl radicals.

  16. Treating of solid earthen material and a method for measuring moisture content and resistivity of solid earthen material

    DOEpatents

    Heath, William; Richardson, Richard; Goheen, Steven

    1994-01-01

    The present invention includes a method of treating solid earthen material having volatile, semi-volatile and non-volatile contaminants. Six electrodes are inserted into a region of earthen material to be treated in a substantially equilateral hexagonal arrangement. Six phases of voltages are applied to corresponding electrodes. The voltages are adjusted within a first range of voltages to create multiple current paths between pairs of the electrodes. The current paths are evenly distributed throughout the region defined by the electrodes and therefore uniformly heat the region. The region of earthen material is heated to a temperature sufficient to substantially remove volatile and semi-volatile contaminants. This temperature is less than a melting temperature of the earthen material. The voltages are then increased to a second range of voltages effective to create dry regions around the electrodes. The dry regions have a perimeter which define a boundary between the dry regions and the earthen material exterior to the dry regions. Corona discharge occurs at the boundaries of the dry regions. As voltages are increased further, the dry regions move radially outward from the electrodes through the entire region. The corona boundaries decompose the non-volatilized contaminants remaining in the region. The hexagonal arrangement of electrodes is also preferable for measuring resistivity and moisture content of the earthen material. The electric field created between the electrodes is readily discernable and therefore facilitates accurate measurements.

  17. Impact of Reflow on the Output Characteristics of Piezoelectric Microelectromechanical System Devices

    NASA Astrophysics Data System (ADS)

    Nogami, Hirofumi; Kobayashi, Takeshi; Okada, Hironao; Masuda, Takashi; Maeda, Ryutaro; Itoh, Toshihiro

    2012-09-01

    An animal health monitoring system and a wireless sensor node aimed at preventing the spread of animal-transmitted diseases and improving pastoral efficiency which are especially suitable for chickens, were developed. The sensor node uses a piezoelectric microelectromechanical system (MEMS) device and an event-driven system that is activated by the movements of a chicken. The piezoelectric MEMS device has two functions: a) it measures the activity of a chicken and b) switches the micro-control unit (MCU) of the wireless sensor node from the sleep mode. The piezoelectric MEMS device is required to produce high output voltages when the chicken moves. However, after the piezoelectric MEMS device was reflowed to the wireless sensor node, the output voltages of the piezoelectric MEMS device decreased. The main reason for this might be the loss of residual polarization, which is affected by the thermal load during the reflow process. After the reflow process, we were not able to apply a voltage to the piezoelectric MEMS device; thus, the piezoelectric output voltage was not increased by repoling the piezoelectric MEMS device. To address the thermal load of the reflow process, we established a thermal poling treatment, which achieves a higher temperature than the reflow process. We found that on increasing the thermal poling temperature, the piezoelectric output voltages did not decreased low significantly. Thus, we considered that a thermal poling temperature higher than that of the reflow process prevents the piezoelectric output voltage reduction caused by the thermal load.

  18. Fiber-optic voltage measuring system

    NASA Astrophysics Data System (ADS)

    Ye, Miaoyuan; Nie, De-Xin; Li, Yan; Peng, Yu; Lin, Qi-Qing; Wang, Jing-Gang

    1993-09-01

    A new fibre optic voltage measuring system has been developed based on the electrooptic effect of bismuth germanium oxide (Bi4Ge3O12)crystal. It uses the LED as the light source. The light beam emitted from the light source is transmitted to the sensor through the optic fibre and the intensity of the output beam is changed by the applied voltage. This optic signal is transmitted to the PIN detector and converted to an electric signal which is processed by the electronic circuit and 8098 single chip microcomputer the output voltage signal obtained is directly proportional to the applied voltage. This paper describes the principle the configuration and the performance parameters of the system. Test results are evaluated and discussed.

  19. PEAK READING VOLTMETER

    DOEpatents

    Dyer, A.L.

    1958-07-29

    An improvement in peak reading voltmeters is described, which provides for storing an electrical charge representative of the magnitude of a transient voltage pulse and thereafter measuring the stored charge, drawing oniy negligible energy from the storage element. The incoming voltage is rectified and stored in a condenser. The voltage of the capacitor is applied across a piezoelectric crystal between two parallel plates. Amy change in the voltage of the capacitor is reflected in a change in the dielectric constant of the crystal and the capacitance between a second pair of plates affixed to the crystal is altered. The latter capacitor forms part of the frequency determlning circuit of an oscillator and means is provided for indicating the frequency deviation which is a measure of the peak voltage applied to the voltmeter.

  20. Bioelectrochemical methane (CH4) production in anaerobic digestion at different supplemental voltages.

    PubMed

    Choi, Kwang-Soon; Kondaveeti, Sanath; Min, Booki

    2017-12-01

    Microbial electrolysis cells (MECs) at various cell voltages (0.5, 0.7 1.0 and 1.5V) were operated in anaerobic fermentation. During the start-up period, the cathode potential decreased from -0.63 to -1.01V, and CH 4 generation increased from 168 to 199ml. At an applied voltage of 1.0V, the highest methane yields of 408.3ml CH 4 /g COD glucose was obtained, which was 30.3% higher than in the control tests (313.4ml CH 4 /g COD glucose). The average current of 5.1mA was generated at 1.0V at which the maximum methane yield was obtained. The other average currents were 1.42, 3.02, 0.53mA at 0.5, 0.7, and 1.5V, respectively. Cyclic voltammetry and EIS analysis revealed that enhanced reduction currents were present at all cell voltages with biocatalyzed cathode electrodes (no reduction without biofilm), and the highest value was obtained with 1V external voltage. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. 2 kV slanted tri-gate GaN-on-Si Schottky barrier diodes with ultra-low leakage current

    NASA Astrophysics Data System (ADS)

    Ma, Jun; Matioli, Elison

    2018-01-01

    This letter reports lateral GaN-on-Si power Schottky barrier diodes (SBDs) with unprecedented voltage-blocking performance by integrating 3-dimensionally a hybrid of tri-anode and slanted tri-gate architectures in their anode. The hybrid tri-anode pins the voltage drop at the Schottky junction (VSCH), despite a large applied reverse bias, fixing the reverse leakage current (IR) of the SBD. Such architecture led to an ultra-low IR of 51 ± 5.9 nA/mm at -1000 V, in addition to a small turn-on voltage (VON) of 0.61 ± 0.03 V. The slanted tri-gate effectively distributes the electric field in OFF state, leading to a remarkably high breakdown voltage (VBR) of -2000 V at 1 μA/mm, constituting a significant breakthrough from existing technologies. The approach pursued in this work reduces the IR and increases the VBR without sacrificing the VON, which provides a technology for high-voltage SBDs, and unveils the unique advantage of tri-gates for advanced power applications.

  2. Transdermal transport pathway creation: Electroporation pulse order.

    PubMed

    Becker, Sid; Zorec, Barbara; Miklavčič, Damijan; Pavšelj, Nataša

    2014-11-01

    In this study we consider the physics underlying electroporation which is administered to skin in order to radically increase transdermal drug delivery. The method involves the application of intense electric fields to alter the structure of the impermeable outer layer, the stratum corneum. A generally held view in the field of skin electroporation is that the skin's drop in resistance (to transport) is proportional to the total power of the pulses (which may be inferred by the number of pulses administered). Contrary to this belief, experiments conducted in this study show that the application of high voltage pulses prior to the application of low voltage pulses result in lower transport than when low voltage pulses alone are applied (when less total pulse power is administered). In order to reconcile these unexpected experimental results, a computational model is used to conduct an analysis which shows that the high density distribution of very small aqueous pathways through the stratum corneum associated with high voltage pulses is detrimental to the evolution of larger pathways that are associated with low voltage pulses. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Radial displacement sensor for non-contact bearings

    NASA Technical Reports Server (NTRS)

    McCormick, John A. (Inventor); Sixsmith, Herbert (Inventor)

    1998-01-01

    A radial position sensor includes four capacitive electrodes oriented about a shaft, arranged in two diametrically opposite pairs. Sensor circuitry generates an output signal in proportion to the capacitance between the electrodes and the shaft; the capacitance between an electrode and the shaft increases as the shaft approaches the electrode and decreases as the shaft recedes from the electrode. The sensor circuitry applies an alternating voltage to one electrode of a pair and a 180 degree out of phase alternating voltage to the other electrode of the pair. The electrical responses of the two electrodes to their respective input signals are summed to form a radial deviation signal which is relatively free from the alternating voltage and accurately represents the position of the shaft relative to the electrodes of the pair.

  4. Room-temperature low-voltage electroluminescence in amorphous carbon nitride thin films

    NASA Astrophysics Data System (ADS)

    Reyes, R.; Legnani, C.; Ribeiro Pinto, P. M.; Cremona, M.; de Araújo, P. J. G.; Achete, C. A.

    2003-06-01

    White-blue electroluminescent emission with a voltage bias less than 10 V was achieved in rf sputter-deposited amorphous carbon nitride (a-CN) and amorphous silicon carbon nitride (a-SiCN) thin-film-based devices. The heterojunction structures of these devices consist of: Indium tin oxide (ITO), used as a transparent anode; amorphous carbon film as an emission layer, and aluminum as a cathode. The thickness of the carbon films was about 250 Å. In all of the produced diodes, a stable visible emission peaked around 475 nm is observed at room temperature and the emission intensity increases with the current density. For an applied voltage of 14 V, the luminance was about 3 mCd/m2. The electroluminescent properties of the two devices are discussed and compared.

  5. Resonance fluorescence revival in a voltage-controlled semiconductor quantum dot

    NASA Astrophysics Data System (ADS)

    Reigue, Antoine; Lemaître, Aristide; Gomez Carbonell, Carmen; Ulysse, Christian; Merghem, Kamel; Guilet, Stéphane; Hostein, Richard; Voliotis, Valia

    2018-02-01

    We demonstrate systematic resonance fluorescence recovery with near-unity emission efficiency in single quantum dots embedded in a charge-tunable device in a wave-guiding geometry. The quantum dot charge state is controlled by a gate voltage, through carrier tunneling from a close-lying Fermi sea, stabilizing the resonantly photocreated electron-hole pair. The electric field cancels out the charging/discharging mechanisms from nearby traps toward the quantum dots, responsible for the usually observed inhibition of the resonant fluorescence. Fourier transform spectroscopy as a function of the applied voltage shows a strong increase in the coherence time though not reaching the radiative limit. These charge controlled quantum dots can act as quasi-perfect deterministic single-photon emitters, with one laser pulse converted into one emitted single photon.

  6. Thermoelectric spin voltage in graphene

    NASA Astrophysics Data System (ADS)

    Sierra, Juan F.; Neumann, Ingmar; Cuppens, Jo; Raes, Bart; Costache, Marius V.; Valenzuela, Sergio O.

    2018-02-01

    In recent years, new spin-dependent thermal effects have been discovered in ferromagnets, stimulating a growing interest in spin caloritronics, a field that exploits the interaction between spin and heat currents1,2. Amongst the most intriguing phenomena is the spin Seebeck effect3-5, in which a thermal gradient gives rise to spin currents that are detected through the inverse spin Hall effect6-8. Non-magnetic materials such as graphene are also relevant for spin caloritronics, thanks to efficient spin transport9-11, energy-dependent carrier mobility and unique density of states12,13. Here, we propose and demonstrate that a carrier thermal gradient in a graphene lateral spin valve can lead to a large increase of the spin voltage near to the graphene charge neutrality point. Such an increase results from a thermoelectric spin voltage, which is analogous to the voltage in a thermocouple and that can be enhanced by the presence of hot carriers generated by an applied current14-17. These results could prove crucial to drive graphene spintronic devices and, in particular, to sustain pure spin signals with thermal gradients and to tune the remote spin accumulation by varying the spin-injection bias.

  7. Observation of reflected waves on the SABRE positive polarity inductive adder MITL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cuneo, M.E.; Poukey, J.W.; Mendel, C.W.

    We are studying the coupling of extraction applied-B ion diodes to Magnetically Insulated Transmission Line (MITLs) on the SABRE (Sandia Accelerator and Beam Research Experiment, 6 MV, 300 kA) positive polarity inductive voltage adder. Our goal is to determine conditions under which efficient coupling occurs. The best total power efficiency for an ideal ion diode load (i.e., without parasitic losses) is obtained by maximizing the product of cathode current and gap voltage. MITLs require that the load impedance be undermatched to the self-limited line operating impedance for efficient transfer of power to ion diodes, independent of transit time isolation, andmore » even in the case of multiple cathode system with significant vacuum electron flow. We observe that this undermatched condition results in a reflected wave which decreases the line voltage and gap electron sheath current, and increases the anode and cathode current in a time-dependent way. The MITL diode coupling is determined by the flow impedance at the adder exit. We also show that the flow impedance increases along the extension MITL on SABRE. Experimental measurements of current and peak voltage are compared to analytical models and TWOQUICK 2.5-D PIC code simulations.« less

  8. SmartStretch™ technology. III. The impact of medium voltage stimulation and SmartStretch™ technology on sheep topside (m. semimembranosus) meat quality traits under commercial processing conditions.

    PubMed

    Toohey, E S; van de Ven, R; Thompson, J M; Geesink, G H; Hopkins, D L

    2013-02-01

    This study evaluated the interaction between medium voltage electrical stimulation, SmartStretch™ stretching and ageing treatments on key meat quality traits of hot boned sheep m. semimembranosus. Medium voltage stimulation reduced initial pH (P<0.001), but did not impact on other meat quality traits. There was a significant interaction between stretch treatment and ageing (P<0.001) for shear force such that samples which were both stretched and aged were the most tender. Sarcomere length was significantly (P<0.001) increased by SmartStretch™ treatment. Control (no stretching) resulted in greater (P<0.05) cooking loss, but there was significantly less purge loss (P<0.05). The ratio 630/580 nm and a* colour values at 0 and 5 days decreased at a significantly (P<0.05) slower rate when SmartStretch™ was applied. Overall medium voltage stimulation did not inhibit the effectiveness of the SmartStretch™ treatment. The SmartStretch™ treatment provided significant improvement in tenderness and the potential to increase meat display time. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.

  9. Exploring the validity and limitations of the Mott-Gurney law for charge-carrier mobility determination of semiconducting thin-films.

    PubMed

    Röhr, Jason A; Moia, Davide; Haque, Saif A; Kirchartz, Thomas; Nelson, Jenny

    2018-03-14

    Using drift-diffusion simulations, we investigate the voltage dependence of the dark current in single carrier devices typically used to determine charge-carrier mobilities. For both low and high voltages, the current increases linearly with the applied voltage. Whereas the linear current at low voltages is mainly due to space charge in the middle of the device, the linear current at high voltage is caused by charge-carrier saturation due to a high degree of injection. As a consequence, the current density at these voltages does not follow the classical square law derived by Mott and Gurney, and we show that for trap-free devices, only for intermediate voltages, a space-charge-limited drift current can be observed with a slope that approaches a value of two. We show that, depending on the thickness of the semiconductor layer and the size of the injection barriers, the two linear current-voltage regimes can dominate the whole voltage range, and the intermediate Mott-Gurney regime can shrink or disappear. In this case, which will especially occur for thicknesses and injection barriers typical of single-carrier devices used to probe organic semiconductors, a meaningful analysis using the Mott-Gurney law will become unachievable, because a square-law fit can no longer be achieved, resulting in the mobility being substantially underestimated. General criteria for when to expect deviations from the Mott-Gurney law when used for analysis of intrinsic semiconductors are discussed.

  10. Exploring the validity and limitations of the Mott-Gurney law for charge-carrier mobility determination of semiconducting thin-films

    NASA Astrophysics Data System (ADS)

    Röhr, Jason A.; Moia, Davide; Haque, Saif A.; Kirchartz, Thomas; Nelson, Jenny

    2018-03-01

    Using drift-diffusion simulations, we investigate the voltage dependence of the dark current in single carrier devices typically used to determine charge-carrier mobilities. For both low and high voltages, the current increases linearly with the applied voltage. Whereas the linear current at low voltages is mainly due to space charge in the middle of the device, the linear current at high voltage is caused by charge-carrier saturation due to a high degree of injection. As a consequence, the current density at these voltages does not follow the classical square law derived by Mott and Gurney, and we show that for trap-free devices, only for intermediate voltages, a space-charge-limited drift current can be observed with a slope that approaches a value of two. We show that, depending on the thickness of the semiconductor layer and the size of the injection barriers, the two linear current-voltage regimes can dominate the whole voltage range, and the intermediate Mott-Gurney regime can shrink or disappear. In this case, which will especially occur for thicknesses and injection barriers typical of single-carrier devices used to probe organic semiconductors, a meaningful analysis using the Mott-Gurney law will become unachievable, because a square-law fit can no longer be achieved, resulting in the mobility being substantially underestimated. General criteria for when to expect deviations from the Mott-Gurney law when used for analysis of intrinsic semiconductors are discussed.

  11. Design of a fast computer-based partial discharge diagnostic system

    NASA Technical Reports Server (NTRS)

    Oliva, Jose R.; Karady, G. G.; Domitz, Stan

    1991-01-01

    Partial discharges cause progressive deterioration of insulating materials working in high voltage conditions and may lead ultimately to insulator failure. Experimental findings indicate that deterioration increases with the number of discharges and is consequently proportional to the magnitude and frequency of the applied voltage. In order to obtain a better understanding of the mechanisms of deterioration produced by partial discharges, instrumentation capable of individual pulse resolution is required. A new computer-based partial discharge detection system was designed and constructed to conduct long duration tests on sample capacitors. This system is capable of recording large number of pulses without dead time and producing valuable information related to amplitude, polarity, and charge content of the discharges. The operation of the system is automatic and no human supervision is required during the testing stage. Ceramic capacitors were tested at high voltage in long duration tests. The obtained results indicated that the charge content of partial discharges shift towards high levels of charge as the level of deterioration in the capacitor increases.

  12. On electron heating in a low pressure capacitively coupled oxygen discharge

    NASA Astrophysics Data System (ADS)

    Gudmundsson, J. T.; Snorrason, D. I.

    2017-11-01

    We use the one-dimensional object-oriented particle-in-cell Monte Carlo collision code oopd1 to explore the charged particle densities, the electronegativity, the electron energy probability function, and the electron heating mechanism in a single frequency capacitively coupled oxygen discharge, when the applied voltage amplitude is varied. We explore discharges operated at 10 mTorr, where electron heating within the plasma bulk (the electronegative core) dominates, and at 50 mTorr, where sheath heating dominates. At 10 mTorr, the discharge is operated in a combined drift-ambipolar and α-mode, and at 50 mTorr, it is operated in the pure α-mode. At 10 mTorr, the effective electron temperature is high and increases with increased driving voltage amplitude, while at 50 mTorr, the effective electron temperature is much lower, in particular, within the electronegative core, where it is roughly 0.2-0.3 eV, and varies only a little with the voltage amplitude.

  13. Precision envelope detector and linear rectifier circuitry

    DOEpatents

    Davis, Thomas J.

    1980-01-01

    Disclosed is a method and apparatus for the precise linear rectification and envelope detection of oscillatory signals. The signal is applied to a voltage-to-current converter which supplies current to a constant current sink. The connection between the converter and the sink is also applied through a diode and an output load resistor to a ground connection. The connection is also connected to ground through a second diode of opposite polarity from the diode in series with the load resistor. Very small amplitude voltage signals applied to the converter will cause a small change in the output current of the converter, and the difference between the output current and the constant current sink will be applied either directly to ground through the single diode, or across the output load resistor, dependent upon the polarity. Disclosed also is a full-wave rectifier utilizing constant current sinks and voltage-to-current converters. Additionally, disclosed is a combination of the voltage-to-current converters with differential integrated circuit preamplifiers to boost the initial signal amplitude, and with low pass filtering applied so as to obtain a video or signal envelope output.

  14. Quadratic Electro-optic Effect in a Novel Nonconjugated Conductive Polymer, iodine-doped Polynorbornene

    NASA Astrophysics Data System (ADS)

    Narayanan, Ananthakrishnan; Thakur, Mrinal

    2009-03-01

    Quadratic electro-optic effect in a novel nonconjugated conductive polymer, iodine-doped polynorbornene has been measured using field-induced birefringence at 633 nm. The electrical conductivity^1 of polynorbornene increases by twelve orders of magnitude to about 0.01 S/cm upon doping with iodine. The electro-optic measurement has been made in a film doped at the medium doping-level. The electro-optic modulation signal was recorded using a lock-in amplifier for various applied ac voltages (4 kHz) and the quadratic dependence of the modulation on the applied voltage was observed. A modulation of about 0.01% was observed for an applied electric field of 3 V/micron for a 100 nm thick film The Kerr coefficient as determined is about 1.77x10-11m/V^2. This exceptionally large quadratic electro-optic effect has been attributed to the confinement of this charge-transfer system within a sub-nanometer dimension. 1. A. Narayanan, A. Palthi and M. Thakur, J. Macromol. Sci. -- PAC, accepted.

  15. Substrate bias effect on the fabrication of thermochromic VO2 films by reactive RF sputtering

    NASA Astrophysics Data System (ADS)

    Miyazaki, H.; Yasui, I.

    2006-05-01

    Vanadium oxide VOx films were deposited by reactive RF magnetron sputtering by applying a substrate bias, in which the Ar ions in plasma impacted the growing film surface. The vanadium valence of the VOx film decreased when the substrate negative bias voltage was increased. The VO2 film was successfully deposited at a substrate temperature of 400 °C and with a bias voltage of -50 to -80 V. The transition temperatures of the VO2 films with a substrate bias of -50 and -80 V were about 56 °C and 44 °C, respectively.

  16. Plenoptic camera based on a liquid crystal microlens array

    NASA Astrophysics Data System (ADS)

    Lei, Yu; Tong, Qing; Zhang, Xinyu; Sang, Hongshi; Xie, Changsheng

    2015-09-01

    A type of liquid crystal microlens array (LCMLA) with tunable focal length by the voltage signals applied between its top and bottom electrodes, is fabricated and then the common optical focusing characteristics are tested. The relationship between the focal length and the applied voltage signals is given. The LCMLA is integrated with an image sensor and further coupled with a main lens so as to construct a plenoptic camera. Several raw images at different voltage signals applied are acquired and contrasted through the LCMLA-based plenoptic camera constructed by us. Our experiments demonstrate that through utilizing a LCMLA in a plenoptic camera, the focused zone of the LCMLA-based plenoptic camera can be shifted effectively only by changing the voltage signals loaded between the electrodes of the LCMLA, which is equivalent to the extension of the depth of field.

  17. Systematic error of diode thermometer.

    PubMed

    Iskrenovic, Predrag S

    2009-08-01

    Semiconductor diodes are often used for measuring temperatures. The forward voltage across a diode decreases, approximately linearly, with the increase in temperature. The applied method is mainly the simplest one. A constant direct current flows through the diode, and voltage is measured at diode terminals. The direct current that flows through the diode, putting it into operating mode, heats up the diode. The increase in temperature of the diode-sensor, i.e., the systematic error due to self-heating, depends on the intensity of current predominantly and also on other factors. The results of systematic error measurements due to heating up by the forward-bias current have been presented in this paper. The measurements were made at several diodes over a wide range of bias current intensity.

  18. Surface photovoltage spectroscopy applied to gallium arsenide surfaces

    NASA Technical Reports Server (NTRS)

    Bynik, C. E.

    1975-01-01

    The experimental and theoretical basis for surface photovoltage spectroscopy is outlined. Results of this technique applied to gallium arsenide surfaces, are reviewed and discussed. The results suggest that in gallium arsenide the surface voltage may be due to deep bulk impurity acceptor states that are pinned at the Fermi level at the surface. Establishment of the validity of this model will indicate the direction to proceed to increase the efficiency of gallium arsenide solar cells.

  19. Voltage-Induced Nonlinear Conduction Properties of Epoxy Resin/Micron-Silver Particles Composites

    NASA Astrophysics Data System (ADS)

    Qu, Zhaoming; Lu, Pin; Yuan, Yang; Wang, Qingguo

    2018-01-01

    The nonlinear conduction properties of epoxy resin (ER)/micron-silver particles (MP) composites were investigated. Under sufficient high intensity applied constant voltage, the obvious nonlinear conduction properties of the samples with volume fraction 25% were found. With increments in the voltage, the conductive switching effect was observed. The nonlinear conduction mechanism of the ER/MP composites under high applied voltages could be attributed to the electrical current conducted via discrete paths of conductive particles induced by the electric field. The test results show that the ER/MP composites with nonlinear conduction properties are of great potential application in electromagnetic protection of electron devices and systems.

  20. Investigation of high voltage spacecraft system interactions with plasma environments

    NASA Technical Reports Server (NTRS)

    Stevens, N. J.; Berkopec, F. D.; Purvis, C. K.; Grier, N.; Staskus, J. V.

    1978-01-01

    An experimental investigation was undertaken for insulator and conductor test surfaces biased up to + or - 1kV in a simulated low earth orbit charged particle environment. It was found that these interactions are controlled by the insulator surfaces surrounding the biased conductors. For positive applied voltages the electron current collection can be enhanced by the insulators. For negative applied voltages the insulator surface confines the voltage to the conductor region. Understanding these interactions and the technology to control their impact on system operation is essential to the design of solar cell arrays for ion drive propulsion applications that use direct drive power processing.

  1. Epitaxial thinning process

    NASA Technical Reports Server (NTRS)

    Siegel, C. M. (Inventor)

    1984-01-01

    A method is described for thinning an epitaxial layer of a wafer that is to be used in producing diodes having a specified breakdown voltage and which also facilitates the thinning process. Current is passed through the epitaxial layer, by connecting a current source between the substrate of the wafer and an electrolyte in which the wafer is immersed. When the wafer is initially immersed, the voltage across the wafer initially drops and then rises at a steep rate. When light is applied to the wafer the voltage drops, and when the light is interrupted the voltage rises again. These changes in voltage, each indicate the breakdown voltage of a Schottky diode that could be prepared from the wafer at that time. The epitaxial layer is thinned by continuing to apply current through the wafer while it is immersed and light is applied, to form an oxide film and when the oxide film is thick the wafer can then be cleaned of oxide and the testing and thinning continued. Uninterrupted thinning can be achieved by first forming an oxide film, and then using an electrolyte that dissolves the oxide about as fast as it is being formed, to limit the thickness of the oxide layer.

  2. Active voltage contrast imaging of cross-sectional surface of multilayer ceramic capacitor using helium ion microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sakai, C., E-mail: SAKAI.Chikako@nims.go.jp; Ishida, N.; Masuda, H.

    2016-08-01

    We studied active voltage contrast (AVC) imaging using helium ion microscopy (HIM). We observed secondary electron (SE) images of the cross-sectional surface of multilayer ceramic capacitors (MLCCs) with and without a voltage applied to the internal electrodes. When no voltage was applied, we obtained an image reflecting the material contrast between the Ni internal electrode region and the BaTiO{sub 3} dielectric region of the cross-sectional surface of the MLCC. When a voltage was applied, the electrical potential difference between the grounded and the positively biased internal electrodes affected the contrast (voltage contrast). Moreover, attenuation of the SE intensity from themore » grounded to the positively biased internal electrodes was observed in the dielectric region. Kelvin probe force microscopy (KPFM) measurements of the contact potential difference (CPD) were performed on the same sample. By using the AVC image from the HIM observation and the CPD image from the KPFM measurement, we could quantitatively evaluate the electrical potential. We think that the results of this study will lead to an expansion in the number of applications of HIM.« less

  3. Electrically and magnetically dual-driven Janus particles for handwriting-enabled electronic paper

    NASA Astrophysics Data System (ADS)

    Komazaki, Y.; Hirama, H.; Torii, T.

    2015-04-01

    In this work, we describe the synthesis of novel electrically and magnetically dual-driven Janus particles for a handwriting-enabled twisting ball display via the microfluidic technique. One hemisphere of the Janus particles contains a charge control agent, which allows the display color to be controlled by applying a voltage and superparamagnetic nanoparticles, allows handwriting by applying a magnetic field to the display. We fabricated a twisting ball display utilizing these Janus particles and tested the electric color control and handwriting using a magnet. As a result, the display was capable of permitting handwriting with a small magnet in addition to conventional color control using an applied voltage (80 V). Handwriting performance was improved by increasing the concentration of superparamagnetic nanoparticles and was determined to be possible even when 80 V was applied across the electrodes for 4 wt. % superparamagnetic nanoparticles in one hemisphere. This improvement was impossible when the concentration was reduced to 2 wt. % superparamagnetic nanoparticles. The technology presented in our work can be applied to low-cost, lightweight, highly visible, and energy-saving electronic message boards and large whiteboards because the large-size display can be fabricated easily due to its simple structure.

  4. A General Approach to Kirchhoff's Laws

    ERIC Educational Resources Information Center

    Quintela, F. R.; Redondo, R. C.; Melchor, N. R.; Redondo, M.

    2009-01-01

    Kirchhoff's laws are usually considered as electrical current and voltage properties. Nevertheless, they are sometimes applied to nonelectrical systems. One way to increase their efficacy and range of applicability would be to show Kirchhoff's laws, and the properties deriving from them, as being independent of any physical system as far as…

  5. Off-set stabilizer for comparator output

    DOEpatents

    Lunsford, James S.

    1991-01-01

    A stabilized off-set voltage is input as the reference voltage to a comparator. In application to a time-interval meter, the comparator output generates a timing interval which is independent of drift in the initial voltage across the timing capacitor. A precision resistor and operational amplifier charge a capacitor to a voltage which is precisely offset from the initial voltage. The capacitance of the reference capacitor is selected so that substantially no voltage drop is obtained in the reference voltage applied to the comparator during the interval to be measured.

  6. Hybrid particle traps and conditioning procedure for gas insulated transmission lines

    DOEpatents

    Dale, Steinar J.; Cookson, Alan H.

    1982-01-01

    A gas insulated transmission line includes an outer sheath, an inner condor within the outer sheath, insulating supports supporting the inner conductor within the outer sheath, and an insulating gas electrically insulating the inner conductor from the outer sheath. An apertured particle trapping ring is disposed within the outer sheath, and the trapping ring has a pair of dielectric members secured at each longitudinal end thereof, with the dielectric members extending outwardly from the trapping ring along an arc. A support sheet having an adhesive coating thereon is secured to the trapping ring and disposed on the outer sheath within the low field region formed between the trapping ring and the outer sheath. A conditioning method used to condition the transmission line prior to activation in service comprises applying an AC voltage to the inner conductor in a plurality of voltage-time steps, with the voltage-time steps increasing in voltage magnitude while decreasing in time duration.

  7. Programmable Pulse Generator for Aditya Gas Puffing System

    NASA Astrophysics Data System (ADS)

    Patel, Narendra; Chavda, Chhaya; Bhatt, S. B.; Chattopadhyay, Prabal; Saxena, Y. C.

    2012-11-01

    In the Aditya Tokamak, one of primary requirement for plasma generation is to feed the required quantity of the fuel gas prior to plasma shot. Gas feed system mainly consists of piezoelectric gas leak valve and gas reservoir. The Hydrogen gas is prior to 300ms loop voltage for the duration of 4 msec to 7 msec. Gas is puffed during the shot for required plasma parameters and to increase plasma density using the same system. The valve is controlled by either continuous voltage or pulses of different width, amplitude and delay with respect to loop voltage. These voltage pulses are normally applied through standard pulse generator. The standard pulse generator is replaced by micro controller based in housed developed programmable pulse generator system consists of in built power supply, BNC input for external trigger, BNC output and serial interface. This programmable pulse generator is successfully tested and is in operation for gas puffing during ADITYA Tokamak experiments. The paper discusses the design and development aspect of the system.

  8. "Negative capacitance" in resistor-ferroelectric and ferroelectric-dielectric networks: Apparent or intrinsic?

    NASA Astrophysics Data System (ADS)

    Saha, Atanu K.; Datta, Suman; Gupta, Sumeet K.

    2018-03-01

    In this paper, we describe and analytically substantiate an alternate explanation for the negative capacitance (NC) effect in ferroelectrics (FE). We claim that the NC effect previously demonstrated in resistance-ferroelectric (R-FE) networks does not necessarily validate the existence of "S" shaped relation between polarization and voltage (according to Landau theory). In fact, the NC effect can be explained without invoking the "S"-shaped behavior of FE. We employ an analytical model for FE (Miller model) in which the steady state polarization strictly increases with the voltage across the FE and show that despite the inherent positive FE capacitance, reduction in FE voltage with the increase in its charge is possible in a R-FE network as well as in a ferroelectric-dielectric (FE-DE) stack. This can be attributed to a large increase in FE capacitance near the coercive voltage coupled with the polarization lag with respect to the electric field. Under certain conditions, these two factors yield transient NC effect. We analytically derive conditions for NC effect in R-FE and FE-DE networks. We couple our analysis with extensive simulations to explain the evolution of NC effect. We also compare the trends predicted by the aforementioned Miller model with Landau-Khalatnikov (L-K) model (static negative capacitance due to "S"-shape behaviour) and highlight the differences between the two approaches. First, with an increase in external resistance in the R-FE network, NC effect shows a non-monotonic behavior according to Miller model but increases according to L-K model. Second, with the increase in ramp-rate of applied voltage in the FE-DE stack, NC effect increases according to Miller model but decreases according to L-K model. These results unveil a possible way to experimentally validate the actual reason of NC effect in FE.

  9. Electric field control of ferromagnetism at room temperature in GaCrN (p-i-n) device structures

    NASA Astrophysics Data System (ADS)

    El-Masry, N. A.; Zavada, J. M.; Reynolds, J. G.; Reynolds, C. L.; Liu, Z.; Bedair, S. M.

    2017-08-01

    We have demonstrated a room temperature dilute magnetic semiconductor based on GaCrN epitaxial layers grown by metalorganic chemical vapor deposition. Saturation magnetization Ms increased when the GaCrN film is incorporated into a (p-GaN/i-GaCrN/n-GaN) device structure, due to the proximity of mediated holes present in the p-GaN layer. Zero field cooling and field cooling were measured to ascertain the absence of superparamagnetic behavior in the films. A (p-GaN/i-GaCrN/n-GaN) device structure with room temperature ferromagnetic (FM) properties that can be controlled by an external applied voltage has been fabricated. In this work, we show that the applied voltage controls the ferromagnetic properties, by biasing the (p-i-n) structure. With forward bias, ferromagnetism in the GaCrN layer was increased nearly 4 fold of the original value. Such an enhancement is due to carrier injection of holes into the Cr deep level present in the i-GaCrN layer. A "memory effect" for the FM behavior of the (p-i-n) GaCrN device structure persisted for 42 h after the voltage bias was turned off. These measurements also support that the observed ferromagnetism in the GaCrN film is not due to superparamagnetic clusters but instead is a hole-mediated phenomenon.

  10. Calibration of Voltage Transformers and High- Voltage Capacitors at NIST

    PubMed Central

    Anderson, William E.

    1989-01-01

    The National Institute of Standards and Technology (NIST) calibration service for voltage transformers and high-voltage capacitors is described. The service for voltage transformers provides measurements of ratio correction factors and phase angles at primary voltages up to 170 kV and secondary voltages as low as 10 V at 60 Hz. Calibrations at frequencies from 50–400 Hz are available over a more limited voltage range. The service for high-voltage capacitors provides measurements of capacitance and dissipation factor at applied voltages ranging from 100 V to 170 kV at 60 Hz depending on the nominal capacitance. Calibrations over a reduced voltage range at other frequencies are also available. As in the case with voltage transformers, these voltage constraints are determined by the facilities at NIST. PMID:28053409

  11. Dielectrophoretic concentration of particles under electrokinetic flow

    DOEpatents

    Miles, Robin R.; Bettencourt, Kerry A.; Fuller, Christopher K.

    2004-09-07

    The use of dielectrophoresis to collect particles under the conditions of electrokinetically-driven flow. Dielectrophortic concentration of particles under electrokinetic flow is accomplished by interdigitated electrodes patterned on an inner surface of a microfluid channel, a DC voltage is applied across the ends to the channel, and an AC voltage is applied across the electrodes, and particles swept down the channel electrokinetically are trapped within the field established by the electrodes. The particles can be released when the voltage to the electrodes is released.

  12. Dual-frequency glow discharges in atmospheric helium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Xiaojiang; Guo, Ying; Magnetic Confinement Fusion Research Center, Ministry of Education of the People's Republic of China, Shanghai 201620

    2015-10-15

    In this paper, the dual-frequency (DF) glow discharges in atmospheric helium were experimented by electrical and optical measurements in terms of current voltage characteristics and optical emission intensity. It is shown that the waveforms of applied voltages or discharge currents are the results of low frequency (LF) waveforms added to high frequency (HF) waveforms. The HF mainly influences discharge currents, and the LF mainly influences applied voltages. The gas temperatures of DF discharges are mainly affected by HF power rather than LF power.

  13. [Study on single-walled carbon nanotube thin film photoelectric device].

    PubMed

    Xie, Wen-bin; Zhu, Yong; Gong, Tian-cheng; Chen, Yu-lin; Zhang, Jie

    2015-01-01

    The single-walled carbon nanotube film photoelectric device was invented, and it can generate net photocurrent under bias voltage when it is illuminated by the laser. The influences of bias voltage, laser power and illuminating position on the net photocurrent were investigated. The experimental results showed that when the center of the film was illuminated, the photocurrent increased with the applied bias, but tended to saturate as the laser power increased. As the voltage and the laser power reached 0. 2 V and 22. 7 mW respectively, the photocurrent reached 0. 24 µA. When the voltage was removed, the photocurrent varied with the laser illuminating position on the film and its value was distributed symmetrically about the center of the device. The photocurrent reached maximum and almost zero respectively when the laser illuminated on two ends and the center of the film. Analysis proposes that the net photocurrent can be generated due to internal photoelectric effect when the device is under voltage and the laser illuminates on the center of the film. It can be also generated due to photo-thermoelectric effect when the device is under no voltage and the laser illuminates on the film, and the relation between the net photocurrent and the illuminating position was derived according to the nature of thermoelectric power of single-walled carbon nanotubes with the established temperature model, which coincides with experimental result. Two effects are the reasons for the generation and variety of the net photocurrent and they superimpose to form the result of the net photocurrent when the device is under general conditions of voltage and laser illuminating position. The device has potential applications in the areas of photovoltaic device and optical sensor for its characteristic.

  14. Differential effect of brief electrical stimulation on voltage-gated potassium channels

    PubMed Central

    Al Abed, Amr; Buskila, Yossi; Dokos, Socrates; Lovell, Nigel H.; Morley, John W.

    2017-01-01

    Electrical stimulation of neuronal tissue is a promising strategy to treat a variety of neurological disorders. The mechanism of neuronal activation by external electrical stimulation is governed by voltage-gated ion channels. This stimulus, typically brief in nature, leads to membrane potential depolarization, which increases ion flow across the membrane by increasing the open probability of these voltage-gated channels. In spiking neurons, it is activation of voltage-gated sodium channels (NaV channels) that leads to action potential generation. However, several other types of voltage-gated channels are expressed that also respond to electrical stimulation. In this study, we examine the response of voltage-gated potassium channels (KV channels) to brief electrical stimulation by whole cell patch-clamp electrophysiology and computational modeling. We show that nonspiking amacrine neurons of the retina exhibit a large variety of responses to stimulation, driven by different KV-channel subtypes. Computational modeling reveals substantial differences in the response of specific KV-channel subtypes that is dependent on channel kinetics. This suggests that the expression levels of different KV-channel subtypes in retinal neurons are a crucial predictor of the response that can be obtained. These data expand our knowledge of the mechanisms of neuronal activation and suggest that KV-channel expression is an important determinant of the sensitivity of neurons to electrical stimulation. NEW & NOTEWORTHY This paper describes the response of various voltage-gated potassium channels (KV channels) to brief electrical stimulation, such as is applied during prosthetic electrical stimulation. We show that the pattern of response greatly varies between KV channel subtypes depending on activation and inactivation kinetics of each channel. Our data suggest that problems encountered when artificially stimulating neurons such as cessation in firing at high frequencies, or “fading,” may be attributed to KV-channel activation. PMID:28202576

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Milkov, Mihail M.

    A comparator circuit suitable for use in a column-parallel single-slope analog-to-digital converter comprises a comparator, an input voltage sampling switch, a sampling capacitor arranged to store a voltage which varies with an input voltage when the sampling switch is closed, and a local ramp buffer arranged to buffer a global voltage ramp applied at an input. The comparator circuit is arranged such that its output toggles when the buffered global voltage ramp exceeds the stored voltage. Both DC- and AC-coupled comparator embodiments are disclosed.

  16. Over-current carrying characteristics of rectangular-shaped YBCO thin films prepared by MOD method

    NASA Astrophysics Data System (ADS)

    Hotta, N.; Yokomizu, Y.; Iioka, D.; Matsumura, T.; Kumagai, T.; Yamasaki, H.; Shibuya, M.; Nitta, T.

    2008-02-01

    A fault current limiter (FCL) may be manufactured at competitive qualities and prices by using rectangular-shaped YBCO films which are prepared by metal-organic deposition (MOD) method, because the MOD method can produce large size elements with a low-cost and non-vacuum technique. Prior to constructing a superconducting FCL (SFCL), AC over-current carrying experiments were conducted for 120 mm long elements where YBCO thin film of about 200 nm in thickness was coated on sapphire substrate with cerium oxide (CeO2) interlayer. In the experiments, only single cycle of the ac damping current of 50 Hz was applied to the pure YBCO element without protective metal coating or parallel resistor and the magnitude of the current was increased step by step until the breakdown phenomena occurred in the element. In each experiment, current waveforms flowing through the YBCO element and voltage waveform across the element were measured to get the voltage-current characteristics. The allowable over-current and generated voltage were successfully estimated for the pure YBCO films. It can be pointed out that the lower n-value trends to bring about the higher allowable over-current and the higher withstand voltage more than tens of volts. The YBCO film having higher n-value is sensitive to the over-current. Thus, some protective methods such as a metal coating should be employed for applying to the fault current limiter.

  17. Demonstrations with a Liquid Crystal Shutter

    ERIC Educational Resources Information Center

    Kraftmakher, Yaakov

    2012-01-01

    The experiments presented show the response of a liquid crystal shutter to applied electric voltages and the delay of the operations. Both properties are important for liquid crystal displays of computers and television sets. Two characteristics of the shutter are determined: (i) the optical transmittance versus applied voltage of various…

  18. Ozone generation in a kHz-pulsed He-O2 capillary dielectric barrier discharge operated in ambient air

    NASA Astrophysics Data System (ADS)

    Sands, Brian L.; Ganguly, Biswa N.

    2013-12-01

    The generation of reactive oxygen species using nonequilibrium atmospheric pressure plasma jet devices has been a subject of recent interest due to their ability to generate localized concentrations from a compact source. To date, such studies with plasma jet devices have primarily utilized radio-frequency excitation. In this work, we characterize ozone generation in a kHz-pulsed capillary dielectric barrier discharge configuration comprised of an active discharge plasma jet operating in ambient air that is externally grounded. The plasma jet flow gas was composed of helium with an admixture of up to 5% oxygen. A unipolar voltage pulse train with a 20 ns pulse risetime was used to drive the discharge at repetition rates between 2-25 kHz. Using UVLED absorption spectroscopy centered at 255 nm near the Hartley-band absorption peak, ozone was detected over 1 cm from the capillary axis. We observed roughly linear scaling of ozone production with increasing pulse repetition rate up to a "turnover frequency," beyond which ozone production steadily dropped and discharge current and 777 nm O(5P→5S°) emission sharply increased. The turnover in ozone production occurred at higher pulse frequencies with increasing flow rate and decreasing applied voltage with a common energy density of 55 mJ/cm3 supplied to the discharge. The limiting energy density and peak ozone production both increased with increasing O2 admixture. The power dissipated in the discharge was obtained from circuit current and voltage measurements using a modified parallel plate dielectric barrier discharge circuit model and the volume-averaged ozone concentration was derived from a 2D ozone absorption measurement. From these measurements, the volume-averaged efficiency of ozone production was calculated to be 23 g/kWh at conditions for peak ozone production of 41 mg/h at 11 kV applied voltage, 3% O2, 2 l/min flow rate, and 13 kHz pulse repetition rate, with 1.79 W dissipated in the discharge.

  19. Emission rate and internal quantum efficiency enhancement in different geometrical shapes of GaN LED

    NASA Astrophysics Data System (ADS)

    Rashid, S.; Wahid, M. H. A.; Hambali, N. A. M. Ahmad; Halim, N. S. A. Abdul; Ramli, M. M.; Shahimin, M. M.

    2017-09-01

    This work is based on the development of light emitting diode (LED) using different geometry of top surface on GaN p-n junction structure. Three types of LED chips are designed with different top surface to differ whether p-type layer or p contact plays an important role in improving its efficiency. The voltage applied ranges from 0V to 4V. Current-voltage characteristic for all three samples are obtained and analyzed. The results show that dome shaped of p-type layer operating at 4V increases the emission rate and internal quantum efficiency up to 70%, which is two times higher than basic cylindrically LED chip. Moreover, this new design effectively solved the higher forward voltage problem of the usual curve surface of p-contact GaN LED.

  20. Investigation of AlGaN/GaN HEMTs degradation with gate pulse stressing at cryogenic temperature

    NASA Astrophysics Data System (ADS)

    Wang, Ning; Wang, Hui; Lin, Xinpeng; Qi, Yongle; Duan, Tianli; Jiang, Lingli; Iervolino, Elina; Cheng, Kai; Yu, Hongyu

    2017-09-01

    Degradation on DC characteristics of AlGaN/GaN high electron mobility transistors (HEMTs) after applying pulsed gate stress at cryogenic temperatures is presented in this paper. The nitrogen vacancy near to the AlGaN/GaN interface leads to threshold voltage of stress-free sample shifting positively at low temperature. The anomalous behavior of threshold voltage variation (decrease first and then increase) under gate stressing as compared to stress-free sample is observed when lowing temperature. This can be correlated with the pre-existing electron traps in SiNX layer or at SiNX/AlGaN interface which can be de-activated and the captured electrons inject back to channel with lowering temperature, which counterbalances the influence of nitrogen vacancy on threshold voltage shift.

  1. Conditioning of high voltage radio frequency cavities by using fuzzy logic in connection with rule based programming

    NASA Astrophysics Data System (ADS)

    Perreard, S.; Wildner, E.

    1994-12-01

    Many processes are controlled by experts using some kind of mental model to decide on actions and make conclusions. This model, based on heuristic knowledge, can often be represented by rules and does not have to be particularly accurate. Such is the case for the problem of conditioning high voltage RF cavities; the expert has to decide, by observing some criteria, whether to increase or to decrease the voltage and by how much. A program has been implemented which can be applied to a class of similar problems. The kernel of the program is a small rule base, which is independent of the kind of cavity. To model a specific cavity, we use fuzzy logic which is implemented as a separate routine called by the rule base, to translate from numeric to symbolic information.

  2. Time-dependent photon heat transport through a mesoscopic Josephson device

    NASA Astrophysics Data System (ADS)

    Lu, Wen-Ting; Zhao, Hong-Kang

    2017-02-01

    The time-oscillating photon heat current through a dc voltage biased mesoscopic Josephson Junction (MJJ) has been investigated by employing the nonequilibrium Green's function approach. The Landauer-like formula of photon heat current has been derived in both of the Fourier space and its time-oscillating versions, where Coulomb interaction, self inductance, and magnetic flux take effective roles. Nonlinear behaviors are exhibited in the photon heat current due to the quantum nature of MJJ and applied external dc voltage. The magnitude of heat current decreases with increasing the external bias voltage, and subtle oscillation structures appear as the superposition of different photon heat branches. The overall period of heat current with respect to time is not affected by Coulomb interaction, however, the magnitude and phase of it vary considerably by changing the Coulomb interaction.

  3. Impact of magnetite nanoparticle incorporation on optical and electrical properties of nanocomposite LbL assemblies.

    PubMed

    Yashchenok, Alexey M; Gorin, Dmitry A; Badylevich, Mikhail; Serdobintsev, Alexey A; Bedard, Matthieu; Fedorenko, Yanina G; Khomutov, Gennady B; Grigoriev, Dmitri O; Möhwald, Helmuth

    2010-09-21

    Optical and electrical properties of polyelectrolyte/iron oxide nanocomposite planar films on silicon substrates were investigated for different amount of iron oxide nanoparticles incorporated in the films. The nanocomposite assemblies prepared by the layer-by-layer assembly technique were characterized by ellipsometry, atomic force microscopy, and secondary ion mass-spectrometry. Absorption spectra of the films reveal a shift of the optical absorption edge to higher energy when the number of deposited layers decreases. Capacitance-voltage and current-voltage measurements were applied to study the electrical properties of metal-oxide-semiconductor structures prepared by thermal evaporation of gold electrodes on nanocomposite films. The capacitance-voltage measurements show that the dielectric constant of the film increases with the number of deposited layers and the fixed charge and the trapped charge densities have a negative sign.

  4. Tunable negative differential resistance in planar graphene superlattice resonant tunneling diode

    NASA Astrophysics Data System (ADS)

    Sattari-Esfahlan, S. M.; Fouladi-Oskuei, J.; Shojaei, S.

    2017-04-01

    Here, we study the negative differential resistance (NDR) of Dirac electrons in biased planar graphene superlattice (PGSL) and investigate the transport characteristics by adopted transfer matrix method within Landauer-Buttiker formalism. Our model device is based on one-dimensional Kronig-Penney type electrostatic potential in monolayer graphene deposited on a substrate, where the bias voltage is applied by two electrodes in the left and right. At Low bias voltages, we found that NDR appears due to breaking of minibands to Wannier-Stark ladders (WSLs). At the critical bias voltage, delocalization appeared by WS states leads to tunneling peak current in current-voltage (I-V) characteristics. With increasing bias voltage, crossing of rungs from various WSL results in multi-peak NDR. The results demonstrate that the structure parameters like barrier/well thickness and barrier height have remarkable effect on I-V characteristics of PGSL. In addition, Dirac gap enhances peak to valley (PVR) value due to suppressing Klein tunneling. Our results show that the tunable PVR in PGSL resonant tunneling diode can be achievable by structure parameters engineering. NDR at ultra-low bias voltages, such as 100 mV, with giant PVR of 20 is obtained. In our device, the multiple same NDR peaks with ultra-low bias voltage provide promising prospect for multi-valued memories and the low power nanoelectronic tunneling devices.

  5. Voltage control in Z-source inverter using low cost microcontroller for undergraduate approach

    NASA Astrophysics Data System (ADS)

    Zulkifli, Shamsul Aizam; Sewang, Mohd Rizal; Salimin, Suriana; Shah, Noor Mazliza Badrul

    2017-09-01

    This paper is focussing on controlling the output voltage of Z-Source Inverter (ZSI) using a low cost microcontroller with MATLAB-Simulink that has been used for interfacing the voltage control at the output of ZSI. The key advantage of this system is the ability of a low cost microcontroller to process the voltage control blocks based on the mathematical equations created in MATLAB-Simulink. The Proportional Integral (PI) control equations are been applied and then, been downloaded to the microcontroller for observing the changes on the voltage output regarding to the changes on the reference on the PI. The system has been simulated in MATLAB and been verified with the hardware setup. As the results, the Raspberry Pi and Arduino that have been used in this work are able to respond well when there is a change of ZSI output. It proofed that, by applying/introducing this method to student in undergraduate level, it will help the student to understand more on the process of the power converter combine with a control feedback function that can be applied at low cost microcontroller.

  6. Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

    NASA Astrophysics Data System (ADS)

    Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

    2013-11-01

    As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

  7. Energy harvesting efficiency of piezoelectric polymer film with graphene and metal electrodes.

    PubMed

    Park, Sanghoon; Kim, Yura; Jung, Hyosub; Park, Jun-Young; Lee, Naesung; Seo, Yongho

    2017-12-11

    In this study, we investigated an energy harvesting effect of tensile stress using piezoelectric polymers and flexible electrodes. A chemical-vapor-deposition grown graphene film was transferred onto both sides of the PVDF and P(VDF-TrFE) films simultaneously by means of a conventional wet chemical method. Output voltage induced by sound waves was measured and analyzed when a mechanical tension was applied to the device. Another energy harvester was made with a metallic electrode, where Al and Ag were deposited by using an electron-beam evaporator. When acoustic vibrations (105 dB) were applied to the graphene/PVDF/graphene device, an induced voltage of 7.6 V pp was measured with a tensile stress of 1.75 MPa, and this was increased up to 9.1 V pp with a stress of 2.18 MPa for the metal/P(VDF-TrFE)/metal device. The 9 metal/PVDF/metal layers were stacked as an energy harvester, and tension was applied by using springs. Also, we fabricated a full-wave rectifying circuit to store the electrical energy in a 100 μF capacitor, and external vibration generated the electrical charges. As a result, the stored voltage at the capacitor, obtained from the harvester via a bridge diode rectifier, was saturated to ~7.04 V after 180 s charging time.

  8. High resolution separations of charge variants and disulfide isomers of monoclonal antibodies and antibody drug conjugates using ultra-high voltage capillary electrophoresis with high electric field strength.

    PubMed

    Henley, W Hampton; He, Yan; Mellors, J Scott; Batz, Nicholas G; Ramsey, J Michael; Jorgenson, James W

    2017-11-10

    Ultra-high voltage capillary electrophoresis with high electric field strength has been applied to the separation of the charge variants, drug conjugates, and disulfide isomers of monoclonal antibodies. Samples composed of many closely related species are difficult to resolve and quantify using traditional analytical instrumentation. High performance instrumentation can often save considerable time and effort otherwise spent on extensive method development. Ideally, the resolution obtained for a given CE buffer system scales with the square root of the applied voltage. Currently available commercial CE instrumentation is limited to an applied voltage of approximately 30kV and a maximum electric field strength of 1kV/cm due to design limitations. The instrumentation described here is capable of safely applying potentials of at least 120kV with electric field strengths over 2000V/cm, potentially doubling the resolution of the best conventional CE buffer/capillary systems while decreasing analysis time in some applications. Separations of these complex mixtures using this new instrumentation demonstrate the potential of ultra-high voltage CE to identify the presence of previously unresolved components and to reduce analysis time for complex mixtures of antibody variants and drug conjugates. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. PHASE DETECTOR

    DOEpatents

    Kippenhan, D.O.

    1959-09-01

    A phase detector circuit is described for use at very high frequencies of the order of 50 megacycles. The detector circuit includes a pair of rectifiers inverted relative to each other. One voltage to be compared is applied to the two rectifiers in phase opposition and the other voltage to be compared is commonly applied to the two rectifiers. The two result:ng d-c voltages derived from the rectifiers are combined in phase opposition to produce a single d-c voltage having amplitude and polarity characteristics dependent upon the phase relation between the signals to be compared. Principal novelty resides in the employment of a half-wave transmission line to derive the phase opposing signals from the first voltage to be compared for application to the two rectifiers in place of the transformer commonly utilized for such purpose in phase detector circuits for operation at lower frequency.

  10. RESONANT CAVITY EXCITATION SYSTEM

    DOEpatents

    Baker, W.R.; Kerns, Q.A.; Riedel, J.

    1959-01-13

    An apparatus is presented for exciting a cavity resonator with a minimum of difficulty and, more specifically describes a sub-exciter and an amplifier type pre-exciter for the high-frequency cxcitation of large cavities. Instead of applying full voltage to the main oscillator, a sub-excitation voltage is initially used to establish a base level of oscillation in the cavity. A portion of the cavity encrgy is coupled to the input of the pre-exciter where it is amplified and fed back into the cavity when the pre-exciter is energized. After the voltage in the cavity resonator has reached maximum value under excitation by the pre-exciter, full voltage is applied to the oscillator and the pre-exciter is tunned off. The cavity is then excited to the maximum high voltage value of radio frequency by the oscillator.

  11. Approach to fitting parameters and clustering for characterising measured voltage dips based on two-dimensional polarisation ellipses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    García-Sánchez, Tania; Gómez-Lázaro, Emilio; Muljadi, E.

    An alternative approach to characterise real voltage dips is proposed and evaluated in this study. The proposed methodology is based on voltage-space vector solutions, identifying parameters for ellipses trajectories by using the least-squares algorithm applied on a sliding window along the disturbance. The most likely patterns are then estimated through a clustering process based on the k-means algorithm. The objective is to offer an efficient and easily implemented alternative to characterise faults and visualise the most likely instantaneous phase-voltage evolution during events through their corresponding voltage-space vector trajectories. This novel solution minimises the data to be stored but maintains extensivemore » information about the dips including starting and ending transients. The proposed methodology has been applied satisfactorily to real voltage dips obtained from intensive field-measurement campaigns carried out in a Spanish wind power plant up to a time period of several years. A comparison to traditional minimum root mean square-voltage and time-duration classifications is also included in this study.« less

  12. Glucose and Applied Voltage Accelerated p-Nitrophenol Reduction in Biocathode of Bioelectrochemical Systems

    PubMed Central

    Wang, Xinyu; Xing, Defeng; Mei, Xiaoxue; Liu, Bingfeng; Ren, Nanqi

    2018-01-01

    p-Nitrophenol (PNP) is common in the wastewater from many chemical industries. In this study, we investigated the effect of initial concentrations of PNP and glucose and applied voltage on PNP reduction in biocathode BESs and open-circuit biocathode BESs (OC-BES). The PNP degradation efficiency of a biocathode BES with 0.5 V (Bioc-0.5) reached 99.5 ± 0.8%, which was higher than the degradation efficiency of the BES with 0 V (Bioc-0) (62.4 ± 4.5%) and the OC-BES (59.2 ± 12.5%). The PNP degradation rate constant (kPNP) of Bioc-0.5 was 0.13 ± 0.01 h-1, which was higher than the kPNP of Bioc-0 (0.024 ± 0.002 h-1) and OC-BES (0.013 ± 0.0005 h-1). PNP degradation depended on the initial concentrations of glucose and PNP. A glucose concentration of 0.5 g L-1 was best for PNP degradation. The initial PNP increased from 50 to 130 mg L-1 and the kPNP decreased from 0.093 ± 0.008 to 0.027 ± 0.001 h-1. High-throughput sequencing of 16S rRNA gene amplicons indicated differences in microbial community structure between BESs with different voltages and the OC-BES. The predominant populations were affiliated with Streptococcus (42.7%) and Citrobacter (54.1%) in biocathode biofilms of BESs, and Dysgonomonas were the predominant microorganisms in biocathode biofilms of OC-BESs. The predominant populations were different among the cathode biofilms and the suspensions. These results demonstrated that applied voltage and biocathode biofilms play important roles in PNP degradation. PMID:29636747

  13. Evidence for thermally assisted threshold switching behavior in nanoscale phase-change memory cells

    NASA Astrophysics Data System (ADS)

    Le Gallo, Manuel; Athmanathan, Aravinthan; Krebs, Daniel; Sebastian, Abu

    2016-01-01

    In spite of decades of research, the details of electrical transport in phase-change materials are still debated. In particular, the so-called threshold switching phenomenon that allows the current density to increase steeply when a sufficiently high voltage is applied is still not well understood, even though there is wide consensus that threshold switching is solely of electronic origin. However, the high thermal efficiency and fast thermal dynamics associated with nanoscale phase-change memory (PCM) devices motivate us to reassess a thermally assisted threshold switching mechanism, at least in these devices. The time/temperature dependence of the threshold switching voltage and current in doped Ge2Sb2Te5 nanoscale PCM cells was measured over 6 decades in time at temperatures ranging from 40 °C to 160 °C. We observe a nearly constant threshold switching power across this wide range of operating conditions. We also measured the transient dynamics associated with threshold switching as a function of the applied voltage. By using a field- and temperature-dependent description of the electrical transport combined with a thermal feedback, quantitative agreement with experimental data of the threshold switching dynamics was obtained using realistic physical parameters.

  14. Full phosphorescent white-light organic light-emitting diodes with improved color stability and efficiency by fine tuning primary emission contributions

    NASA Astrophysics Data System (ADS)

    Hua, Wang; Du, Xiaogang; Su, Wenming; Lin, Wenjing; Zhang, Dongyu

    2014-02-01

    In this paper, a novel type of white-light organic light emitting diode (OLED) with high color stability was reported, in which the yellow-light emission layer of (4,4'-N,N'-dicarbazole)biphenyl (CBP) : tris(2-phenylquinoline-C2,N')iridium(III) (Ir(2-phq)3) was sandwiched by double blue-light emission layers of 1,1-bis-[(di-4-tolylamino)pheny1]cyclohexane (TAPC) : bis[4,6-(di-fluorophenyl)-pyridinato-N,C2']picolinate (FIrpic) and tris[3-(3-pyridyl)mesityl]borane (3TPYMB):FIrpic. And, it exhibited the maximum current efficiency of 33.1 cd/A, the turn-on voltage at about 3 V and the maximum luminance in excess of 20000 cd/m2. More important, it realized very stable white-light emission, and its CIE(x, y) coordinates only shift from (0.34, 0.37) to (0.33, 0.37) as applied voltage increased from 5 V to 12 V. It is believed that the new scheme in emission layer of white-light OLED can fine tune the contribution of primary emission with applied voltage changed, resulting in high quality white-light OLED.

  15. Calcium dependent current recordings in Xenopus laevis oocytes in microgravity

    NASA Astrophysics Data System (ADS)

    Wuest, Simon L.; Roesch, Christian; Ille, Fabian; Egli, Marcel

    2017-12-01

    Mechanical unloading by microgravity (or weightlessness) conditions triggers profound adaptation processes at the cellular and organ levels. Among other mechanisms, mechanosensitive ion channels are thought to play a key role in allowing cells to transduce mechanical forces. Previous experiments performed under microgravity have shown that gravity affects the gating properties of ion channels. Here, a method is described to record a calcium-dependent current in native Xenopus laevis oocytes under microgravity conditions during a parabolic flight. A 3-voltage-step protocol was applied to provoke a calcium-dependent current. This current increased with extracellular calcium concentration and could be reduced by applying extracellular gadolinium. The custom-made ;OoClamp; hardware was validated by comparing the results of the 3-voltage-step protocol to results obtained with a well-established two-electrode voltage clamp (TEVC). In the context of the 2nd Swiss Parabolic Flight Campaign, we tested the OoClamp and the method. The setup and experiment protocol worked well in parabolic flight. A tendency that the calcium-dependent current was smaller under microgravity than under 1 g condition could be observed. However, a conclusive statement was not possible due to the small size of the data base that could be gathered.

  16. Soft-short management and remediation in 10-year-old NiCds in Geo orbit

    NASA Technical Reports Server (NTRS)

    Flordeliza, Nicanor A.; Bounds, Ronald W.

    1996-01-01

    After 10 years in Geo orbit, during the spring 1993 eclipse season, soft shorts occurred in cells of two of the three batteries on the F2R spacecraft On battery #1, the cell soft short turned suddenly into a hard short; the resulting sudden 1.2V fall in battery voltage and rise in temperature was observed via telemetry. On battery #3, the deleterious impact of its soft short increased day by day, manifesting itself as a drop in battery voltage part-way through each eclipse, causing high loading on the remaining good battery. This paper reports how by planned charge management, including applying (against-the-book) overcharge ratios (C/D) exceeding 1.75, the battery #3 cell soft short was 'built down' until the cell voltage fade ceased. The problem with the battery #3 soft-shorted cell was fought with partial success throughout the latter half of the fall 93 season, and the lessons learned were applied to alleviate the problem during the spring 94 and fall 94 eclipse seasons. The life of the spacecraft was successfully prolonged until it was retired in March 1995.

  17. Flutter and divergence instability of supported piezoelectric nanotubes conveying fluid

    NASA Astrophysics Data System (ADS)

    Bahaadini, Reza; Hosseini, Mohammad; Jamali, Behnam

    2018-01-01

    In this paper, divergence and flutter instabilities of supported piezoelectric nanotubes containing flowing fluid are investigated. To take the size effects into account, the nonlocal elasticity theory is implemented in conjunction with the Euler-Bernoulli beam theory incorporating surface stress effects. The Knudsen number is applied to investigate the slip boundary conditions between the flow and wall of nanotube. The nonlocal governing equations of nanotube are obtained using Newtonian method, including the influence of piezoelectric voltage, surface effects, Knudsen number and nonlocal parameter. Applying Galerkin approach to transform resulting equations into a set of eigenvalue equations under the simple-simple (S-S) and clamped-clamped (C-C) boundary conditions. The effects of the piezoelectric voltage, surface effects, Knudsen number, nonlocal parameter and boundary conditions on the divergence and flutter boundaries of nanotubes are discussed. It is observed that the fluid-conveying nanotubes with both ends supported lose their stability by divergence first and then by flutter with increase in fluid velocity. Results indicate the importance of using piezoelectric voltage, nonlocal parameter and Knudsen number in decrease of critical flow velocities of system. Moreover, the surface effects have a significant role on the eigenfrequencies and critical fluid velocity.

  18. Ag nanoparticle-filled TiO2 nanotube arrays prepared by anodization and electrophoretic deposition for dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Wei, Xing; Sugri Nbelayim, Pascal; Kawamura, Go; Muto, Hiroyuki; Matsuda, Atsunori

    2017-03-01

    A layer of TiO2 nanotube (TNT) arrays with a thickness of 13 μm is synthesized by a two-step anodic oxidation from Ti metal foil. Surface charged Ag nanoparticles (NPs) are prepared by chemical reduction. After a pretreatment of the TNT arrays by acetone vapor, Ag NP filled TNT arrays can be achieved by electrophoretic deposition (EPD). Effects of the applied voltage during EPD such as DC-AC difference, frequency and waveform are investigated by quantitative analysis using atomic absorption spectroscopy. The results show that the best EPD condition is using DC 2 V + AC 4 V and a square wave of 1 Hz as the applied voltage. Back illuminated dye-sensitized solar cells are fabricated from TNT arrays with and without Ag NPs. The efficiency increased from 3.70% to 5.01% by the deposition of Ag NPs.

  19. Electro-osmotic fluxes in multi-well electro-remediation processes.

    PubMed

    López-Vizcaíno, Rubén; Sáez, Cristina; Mena, Esperanza; Villaseñor, Jose; Cañizares, Pablo; Rodrigo, Manuel A

    2011-01-01

    In recent years, electrokinetic techniques on a laboratory scale have been studied but few applications have been assessed at full-scale. In this work, a mock-up plant with two rows of three electrodes positioned in semipermeable electrolyte wells has been used to study the electro-osmotic flux distribution. Water accumulated in the cathodic wells when an electric voltage gradient was applied between the two electrode-well rows. Likewise, slight differences in the water flux were observed depending on the position and number of electrodes used and on the voltage gradient applied. Results show that the electro-osmotic flow did not increase proportionally with the number of electrodes used. During the start-up of the study, there was an abrupt change in the current density, pH and conductivity of the soil portions closest to electrodic wells due to electrokinetic processes. These differences can be explained in terms of the complex current distributions from anode and cathode rows.

  20. Electrically tunable whispering gallery mode microresonator based on a grapefruit-microstructured optical fiber infiltrated with nematic liquid crystals.

    PubMed

    Yang, Chengkun; Zhang, Hao; Liu, Bo; Lin, Shiwei; Li, Yuetao; Liu, Haifeng

    2017-08-01

    An electrically tunable whispering gallery mode (WGM) microresonator based on an HF-etched microstructured optical fiber (MOF) infiltrated with nematic liquid crystals (NLCs) is proposed and experimentally demonstrated. Experimental results indicate that as the peak-to-peak voltage of the applied AC electric field increases from 160 to 220 V, WGM resonance peaks gradually move toward a shorter wavelength region by 0.527 nm with a wavelength sensitivity up to 0.01  nm/V for a TM1691 mode, and the Q-factor for each WGM resonance peak rapidly decreases with the increment of applied electric voltage. The proposed electrically controlled WGM tuning scheme shows a linear resonance wavelength shift with good spectral reversibility, which makes it a promising candidate to serve as an integrated functional photonic device in practical use and in related fundamental scientific studies.

  1. Effect of phase advance on the brushless dc motor torque speed respond

    NASA Astrophysics Data System (ADS)

    Mohd, M. S.; Karsiti, M. N.; Mohd, M. S.

    2015-12-01

    Brushless direct current (BLDC) motor is widely used in small and medium sized electric vehicles as it exhibit highest specific power and thermal efficiency as compared to the induction motor. Permanent magnets BLDC rotor create a constant magnetic flux, which limit the motor top speed. As the back electromotive force (EMF) voltage increases proportionally with motor rotational speed and it approaches the amplitude of the input voltage, the phase current amplitude will reach zero. By advancing the phase current, it is possible to extend the maximum speed of the BLDC motor beyond the rated top speed. This will allow smaller BLDC motor to be used in small electric vehicles (EV) and in larger applications will allow the use of BLDC motor without the use of multispeed transmission unit for high speed operation. However, increasing the speed of BLDC will affect the torque speed response. The torque output will decrease as speed increases. Adjusting the phase angle will affect the speed of the motor as each coil is energized earlier than the corresponding rise in the back emf of the coil. This paper discusses the phase advance strategy of Brushless DC motor by phase angle manipulation approaches using external hall sensors. Tests have been performed at different phase advance angles in advance and retard positions for different voltage levels applied. The objective is to create the external hall sensor system to commutate the BLDC motor, to establish the phase advance of the BLDC by varying the phase angle through external hall sensor manipulation, observe the respond of the motor while applying the phase advance by hall sensor adjustment.

  2. Sliding-mode control of single input multiple output DC-DC converter

    NASA Astrophysics Data System (ADS)

    Zhang, Libo; Sun, Yihan; Luo, Tiejian; Wan, Qiyang

    2016-10-01

    Various voltage levels are required in the vehicle mounted power system. A conventional solution is to utilize an independent multiple output DC-DC converter whose cost is high and control scheme is complicated. In this paper, we design a novel SIMO DC-DC converter with sliding mode controller. The proposed converter can boost the voltage of a low-voltage input power source to a controllable high-voltage DC bus and middle-voltage output terminals, which endow the converter with characteristics of simple structure, low cost, and convenient control. In addition, the sliding mode control (SMC) technique applied in our converter can enhance the performances of a certain SIMO DC-DC converter topology. The high-voltage DC bus can be regarded as the main power source to the high-voltage facility of the vehicle mounted power system, and the middle-voltage output terminals can supply power to the low-voltage equipment on an automobile. In the respect of control algorithm, it is the first time to propose the SMC-PID (Proportion Integration Differentiation) control algorithm, in which the SMC algorithm is utilized and the PID control is attended to the conventional SMC algorithm. The PID control increases the dynamic ability of the SMC algorithm by establishing the corresponding SMC surface and introducing the attached integral of voltage error, which endow the sliding-control system with excellent dynamic performance. At last, we established the MATLAB/SIMULINK simulation model, tested performance of the system, and built the hardware prototype based on Digital Signal Processor (DSP). Results show that the sliding mode control is able to track a required trajectory, which has robustness against the uncertainties and disturbances.

  3. Sliding-mode control of single input multiple output DC-DC converter.

    PubMed

    Zhang, Libo; Sun, Yihan; Luo, Tiejian; Wan, Qiyang

    2016-10-01

    Various voltage levels are required in the vehicle mounted power system. A conventional solution is to utilize an independent multiple output DC-DC converter whose cost is high and control scheme is complicated. In this paper, we design a novel SIMO DC-DC converter with sliding mode controller. The proposed converter can boost the voltage of a low-voltage input power source to a controllable high-voltage DC bus and middle-voltage output terminals, which endow the converter with characteristics of simple structure, low cost, and convenient control. In addition, the sliding mode control (SMC) technique applied in our converter can enhance the performances of a certain SIMO DC-DC converter topology. The high-voltage DC bus can be regarded as the main power source to the high-voltage facility of the vehicle mounted power system, and the middle-voltage output terminals can supply power to the low-voltage equipment on an automobile. In the respect of control algorithm, it is the first time to propose the SMC-PID (Proportion Integration Differentiation) control algorithm, in which the SMC algorithm is utilized and the PID control is attended to the conventional SMC algorithm. The PID control increases the dynamic ability of the SMC algorithm by establishing the corresponding SMC surface and introducing the attached integral of voltage error, which endow the sliding-control system with excellent dynamic performance. At last, we established the MATLAB/SIMULINK simulation model, tested performance of the system, and built the hardware prototype based on Digital Signal Processor (DSP). Results show that the sliding mode control is able to track a required trajectory, which has robustness against the uncertainties and disturbances.

  4. Removal of colour, turbidity, oil and grease for slaughterhouse wastewater using electrocoagulation method

    NASA Astrophysics Data System (ADS)

    Yusoff, Mohd Suffian; Azwan, Azlyza Mohd; Zamri, Mohd Faiz Muaz Ahmad; Aziz, Hamidi Abdul

    2017-10-01

    In this study electrocoagulation method is used to treat slaughterhouse wastewaters. The aim of this study is to determine the efficiency of electrocoagulation method for the removal of colour, turbidity, oil and grease of slaughterhouse wastewaters. The factors of electrode types, and voltage applied during treatment are the study parameters. The types of electrode used are Aluminium (Al) grade 6082 and Iron (Fe) grade 1050. Meanwhile, the ranges of voltage applied are 2, 4, 6, 8 volts at a time interval of 10, 20 and 30 minutes respectively. The effect of these factors on the removal of fat oil and grease (FOG), colour and turbidity are analyzed. The results show maximum removal of FOG, colour and turbidity are recorded using Fe electrode at 8 V of applied voltage with 30 minutes of treatment time. The increase in treatment time of the cell will also increase the amount of hydrogen bubbles at the cathode which results in a greater upwards flux and a faster removal of FOG,, turbidity and colour. The removal of FOG, colour and turbidity are 98%, 92% and 91 % respectively. Meanwhile, by using Al electrodes in the same condition, the removal of FOG, colour and turbidity are 91%, 85% and 87 % respectively. Whereas by using Fe-Al as electrodes pairs, the removal of FOG, colour and turbidity are found to be at 90%, 87% and 76 % respectively. In this case, the Fe-Fe pair electrodes have been proven to provide better performance for FOG, colour and turbidity removals of slaughterhouse wastewaters. Therefore, it is feasible to be considered as an alternative method for wastewater treatment.

  5. Voltage stress effects on microcircuit accelerated life test failure rates

    NASA Technical Reports Server (NTRS)

    Johnson, G. M.

    1976-01-01

    The applicability of Arrhenius and Eyring reaction rate models for describing microcircuit aging characteristics as a function of junction temperature and applied voltage was evaluated. The results of a matrix of accelerated life tests with a single metal oxide semiconductor microcircuit operated at six different combinations of temperature and voltage were used to evaluate the models. A total of 450 devices from two different lots were tested at ambient temperatures between 200 C and 250 C and applied voltages between 5 Vdc and 15 Vdc. A statistical analysis of the surface related failure data resulted in bimodal failure distributions comprising two lognormal distributions; a 'freak' distribution observed early in time, and a 'main' distribution observed later in time. The Arrhenius model was shown to provide a good description of device aging as a function of temperature at a fixed voltage. The Eyring model also appeared to provide a reasonable description of main distribution device aging as a function of temperature and voltage. Circuit diagrams are shown.

  6. HIGH POWER PULSED OSCILLATOR

    DOEpatents

    Singer, S.; Neher, L.K.

    1957-09-24

    A high powered, radio frequency pulse oscillator is described for generating trains of oscillations at the instant an input direct voltage is impressed, or immediately upon application of a light pulse. In one embodiment, the pulse oscillator comprises a photo-multiplier tube with the cathode connected to the first dynode by means of a resistor, and adjacent dynodes are connected to each other through adjustable resistors. The ohmage of the resistors progressively increases from a very low value for resistors adjacent the cathode to a high value adjacent the plate, the last dynode. Oscillation occurs with this circuit when a high negative voltage pulse is applied to the cathode and the photo cathode is bombarded. Another embodiment adds capacitors at the resistor connection points of the above circuit to increase the duration of the oscillator train.

  7. Magnetic field-modulated photo-thermo-electric effect in Fe/GaAs film

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qiao, Shuang; Liu, Jihong; Yan, Guoying

    2015-11-02

    Ferromagnet/semiconductor heterostructure, such as Fe/GaAs, is always one of the key issues in spintronics due to its prerequisite for the realization of spin sensitive devices. In this letter, a lateral photoelectric effect (LPE) was observed in Fe/GaAs. Our results show that the sensitivity was not related to laser wavelength, but only proportional to laser power, suggesting that the lateral photovoltage was induced by photo-thermo-electric effect. Moreover, we also observe that the voltage signal increases with the increase in applied field due to decreasing scattering probability for spin-polarized electrons. Our finding of LPE adds another functionality to the Fe/GaAs system andmore » will be useful in development of spin-polarized voltage devices.« less

  8. Steady state compact toroidal plasma production

    DOEpatents

    Turner, William C.

    1986-01-01

    Apparatus and method for maintaining steady state compact toroidal plasmas. A compact toroidal plasma is formed by a magnetized coaxial plasma gun and held in close proximity to the gun electrodes by applied magnetic fields or magnetic fields produced by image currents in conducting walls. Voltage supply means maintains a constant potential across the electrodes producing an increasing magnetic helicity which drives the plasma away from a minimum energy state. The plasma globally relaxes to a new minimum energy state, conserving helicity according to Taylor's relaxation hypothesis, and injecting net helicity into the core of the compact toroidal plasma. Controlling the voltage so as to inject net helicity at a predetermined rate based on dissipative processes maintains or increases the compact toroidal plasma in a time averaged steady state mode.

  9. Slaughterhouse Wastewater Treatment by Combined Chemical Coagulation and Electrocoagulation Process

    PubMed Central

    Bazrafshan, Edris; Kord Mostafapour, Ferdos; Farzadkia, Mehdi; Ownagh, Kamal Aldin; Mahvi, Amir Hossein

    2012-01-01

    Slaughterhouse wastewater contains various and high amounts of organic matter (e.g., proteins, blood, fat and lard). In order to produce an effluent suitable for stream discharge, chemical coagulation and electrocoagulation techniques have been particularly explored at the laboratory pilot scale for organic compounds removal from slaughterhouse effluent. The purpose of this work was to investigate the feasibility of treating cattle-slaughterhouse wastewater by combined chemical coagulation and electrocoagulation process to achieve the required standards. The influence of the operating variables such as coagulant dose, electrical potential and reaction time on the removal efficiencies of major pollutants was determined. The rate of removal of pollutants linearly increased with increasing doses of PACl and applied voltage. COD and BOD5 removal of more than 99% was obtained by adding 100 mg/L PACl and applied voltage 40 V. The experiments demonstrated the effectiveness of chemical and electrochemical techniques for the treatment of slaughterhouse wastewaters. Consequently, combined processes are inferred to be superior to electrocoagulation alone for the removal of both organic and inorganic compounds from cattle-slaughterhouse wastewater. PMID:22768233

  10. Sulfonated polyaniline-based organic electrodes for controlled electrical stimulation of human osteosarcoma cells.

    PubMed

    Min, Yong; Yang, Yanyin; Poojari, Yadagiri; Liu, Yidong; Wu, Jen-Chieh; Hansford, Derek J; Epstein, Arthur J

    2013-06-10

    Electrically conducting polymers (CPs) were found to stimulate various cell types such as neurons, osteoblasts, and fibroblasts in both in vitro and in vivo studies. However, to our knowledge, no studies have been reported on the utility of CPs in stimulation of cancer or tumor cells in the literature. Here we report a facile fabrication method of self-doped sulfonated polyaniline (SPAN)-based interdigitated electrodes (IDEs) for controlled electrical stimulation of human osteosarcoma (HOS) cells. Increased degree of sulfonation was found to increase the SPAN conductivity, which in turn improved the cell attachment and cell growth without electrical stimulation. However, an enhanced cell growth was observed under controlled electrical (AC) stimulation at low applied voltage and frequency (≤800 mV and ≤1 kHz). The cell growth reached a maximum threshold at an applied voltage or frequency and beyond which pronounced cell death was observed. We believe that these organic electrodes may find utility in electrical stimulation of cancer or tumor cells for therapy and research and may also provide an alternative to the conventional metal-based electrodes.

  11. Thermal and overcharge abuse analysis of a redox shuttle for overcharge protection of LiFePO4

    NASA Astrophysics Data System (ADS)

    Lamb, Joshua; Orendorff, Christopher J.; Amine, Khalil; Krumdick, Gregory; Zhang, Zhengcheng; Zhang, Lu; Gozdz, Antoni S.

    2014-02-01

    This work investigated the performance and abuse tolerance of cells protected using the redox shuttle 1,4-bis(2-methoxyethoxy)-2,5-di-tert-butylbenzene. The thermal efficiencies were evaluated using isothermal battery calorimetry. Cells containing the overcharge shuttle were observed to reach a steady state value of approximately 3.8 V, with a small variance in direct proportion to the applied current. In all cases the heat output from the cells was measured to reach ∼90% of the total input power. The heat output was also measured using isothermal calorimetry. At higher rates of overcharge, the data shows that the cell containing the shuttle rapidly reaches a steady state voltage, while the temperature increases until a moderately high steady state temperature is reached. The control cell meanwhile rapidly increases in both applied voltage and cell temperature until cell failure. Two cells in series were taken deliberately out of balance individually, then charged as a single pack to observe the time needed to bring the cells into balance with one another.

  12. Domain structures and local switching in lead-free piezoceramics Ba0.85Ca0.15Ti0.90Zr0.10O3

    NASA Astrophysics Data System (ADS)

    Turygin, A. P.; Neradovskiy, M. M.; Naumova, N. A.; Zayats, D. V.; Coondoo, I.; Kholkin, A. L.; Shur, V. Ya.

    2015-08-01

    Lead-free piezoelectrics are becoming increasingly important in view of environmental problems of currently used lead-based perovskites such as lead zirconate titanate (PZT). One of the recent candidates for PZT replacement, solid solutions of BaZr0.2Ti0.8O3 and Ba0.7Ca0.3TiO3, are investigated in this work by piezoresponse force microscopy. Coexistence of the tetragonal and rhombohedral phases in this material is observed, which probably gives rise to easy polarization switching due to multiple domain states. The period of observed domain lamella scales with the grain size obeying well-known square root dependence characteristic of BaTiO3 ceramics. Domain switching and relaxation are investigated at the nanoscale as a function of the applied voltage and duration of the applied voltage pulses. The observed distortion of piezoresponse hysteresis loops near grain boundaries is attested to the increased concentration of defects. Nanoscale piezoelectric properties of these materials are discussed.

  13. Slaughterhouse wastewater treatment by combined chemical coagulation and electrocoagulation process.

    PubMed

    Bazrafshan, Edris; Kord Mostafapour, Ferdos; Farzadkia, Mehdi; Ownagh, Kamal Aldin; Mahvi, Amir Hossein

    2012-01-01

    Slaughterhouse wastewater contains various and high amounts of organic matter (e.g., proteins, blood, fat and lard). In order to produce an effluent suitable for stream discharge, chemical coagulation and electrocoagulation techniques have been particularly explored at the laboratory pilot scale for organic compounds removal from slaughterhouse effluent. The purpose of this work was to investigate the feasibility of treating cattle-slaughterhouse wastewater by combined chemical coagulation and electrocoagulation process to achieve the required standards. The influence of the operating variables such as coagulant dose, electrical potential and reaction time on the removal efficiencies of major pollutants was determined. The rate of removal of pollutants linearly increased with increasing doses of PACl and applied voltage. COD and BOD(5) removal of more than 99% was obtained by adding 100 mg/L PACl and applied voltage 40 V. The experiments demonstrated the effectiveness of chemical and electrochemical techniques for the treatment of slaughterhouse wastewaters. Consequently, combined processes are inferred to be superior to electrocoagulation alone for the removal of both organic and inorganic compounds from cattle-slaughterhouse wastewater.

  14. Dynamics of colloidal particles in electrohydrodynamic convection of nematic liquid crystal.

    PubMed

    Takahashi, Kentaro; Kimura, Yasuyuki

    2014-07-01

    We have studied the dynamics of micrometer-sized colloidal particles in electrohydrodynamic convection of nematic liquid crystal. Above the onset voltage of electroconvection, the parallel array of convection rolls appears to be perpendicular to the nematic field at first. The particles are forced to rotate by convection flow and are trapped within a single roll in this voltage regime. A slow glide motion along the roll axis is also observed. The frequency of rotational motion and the glide velocity increase with the applied voltage. Under a much larger voltage where the roll axis temporally fluctuates, the particles occasionally hop to the neighbor rolls. In this voltage regime, the motion of the particles becomes two-dimensional. The motion perpendicular to the roll axis exhibits diffusion behavior at a long time period. The effective diffusion constant is 10(3)-10(4) times larger than the molecular one. The observed behavior is compared with the result obtained by a simple stochastic model for the transport of the particles in convection. The enhancement of diffusion can be quantitatively described well by the rotation frequency in a roll, the width of the roll, and the hopping probability to the neighbor rolls.

  15. Errors due to measuring voltage on current-carrying electrodes in electric current computed tomography.

    PubMed

    Cheng, K S; Simske, S J; Isaacson, D; Newell, J C; Gisser, D G

    1990-01-01

    Electric current computed tomography is a process for determining the distribution of electrical conductivity inside a body based upon measurements of voltage or current made at the body's surface. Most such systems use different electrodes for the application of current and the measurement of voltage. This paper shows that when a multiplicity of electrodes are attached to a body's surface, the voltage data are most sensitive to changes in resistivity in the body's interior when voltages are measured from all electrodes, including those carrying current. This assertion is true despite the presence of significant levels of skin impedance at the electrodes. This conclusion is supported both theoretically and by experiment. Data were first taken using all electrodes for current and voltage. Then current was applied only at a pair of electrodes, with voltages measured on all other electrodes. We then constructed the second data set by calculation from the first. Targets could be detected with better signal-to-noise ratio by using the reconstructed data than by using the directly measured voltages on noncurrent-carrying electrodes. Images made from voltage data using only noncurrent-carrying electrodes had higher noise levels and were less able to accurately locate targets. We conclude that in multiple electrode systems for electric current computed tomography, current should be applied and voltage should be measured from all available electrodes.

  16. Nonvolatile Analog Memory

    NASA Technical Reports Server (NTRS)

    MacLeod, Todd C. (Inventor)

    2007-01-01

    A nonvolatile analog memory uses pairs of ferroelectric field effect transistors (FFETs). Each pair is defined by a first FFET and a second FFET. When an analog value is to be stored in one of the pairs, the first FFET has a saturation voltage applied thereto, and the second FFET has a storage voltage applied thereto that is indicative of the analog value. The saturation and storage voltages decay over time in accordance with a known decay function that is used to recover the original analog value when the pair of FFETs is read.

  17. Zero bias conductance peak in InAs nanowire coupled to superconducting electrodes

    NASA Astrophysics Data System (ADS)

    Kim, Nam-Hee; Shin, Yun-Sok; Kim, Hong-Seok; Song, Jin-Dong; Doh, Yong-Joo

    2018-04-01

    We report the occurrence of the zero-bias conductance peak (ZBCP) in an InAs nanowire coupled to PbIn superconductors with varying temperature, bias voltage, and magnetic field. The ZBCP is suppressed with increasing temperature and bias voltage above the Thouless energy of the nanowire. Applying a magnetic field also diminishes the ZBCP when the resultant magnetic flux reaches the magnetic flux quantum h/2e. Our observations are consistent with theoretical expectations of reflectionless tunneling, in which the phase coherence between an electron and its Andreev-reflected hole induces the ZBCP as long as time-reversal symmetry is preserved.

  18. Switching synchronization in one-dimensional memristive networks

    NASA Astrophysics Data System (ADS)

    Slipko, Valeriy A.; Shumovskyi, Mykola; Pershin, Yuriy V.

    2015-11-01

    We report on a switching synchronization phenomenon in one-dimensional memristive networks, which occurs when several memristive systems with different switching constants are switched from the high- to low-resistance state. Our numerical simulations show that such a collective behavior is especially pronounced when the applied voltage slightly exceeds the combined threshold voltage of memristive systems. Moreover, a finite increase in the network switching time is found compared to the average switching time of individual systems. An analytical model is presented to explain our observations. Using this model, we have derived asymptotic expressions for memory resistances at short and long times, which are in excellent agreement with results of our numerical simulations.

  19. Transport Properties of Anatase-TiO2 Polycrystalline-Thin-Film Field-Effect Transistors with Electrolyte Gate Layers

    NASA Astrophysics Data System (ADS)

    Horita, Ryohei; Ohtani, Kyosuke; Kai, Takahiro; Murao, Yusuke; Nishida, Hiroya; Toya, Taku; Seo, Kentaro; Sakai, Mio; Okuda, Tetsuji

    2013-11-01

    We have fabricated anatase-TiO2 polycrystalline-thin-film field-effect transistors (FETs) with poly(vinyl alcohol) (PVA), ion-liquid (IL), and ion-gel (IG) gate layers, and have tried to improve the response to gate voltage by varying the concentration of mobile ions in these electrolyte gate layers. The increase in the concentration of mobile ions by doping NaOH into the PVA gate layer or reducing the gelator in the IG gate layer markedly increases the drain-source current and reduces the driving gate voltage, which show that the mobile ions in the PVA, IL, and IG gate layers cause the formation of electric double layers (EDLs), which act as nanogap capacitors. In these TiO2-EDL-FETs, the slow formation of EDLs and the oxidation reaction at the interface between the surface of the TiO2 film and the electrolytes cause unideal FET properties. In the optimized IL and IG TiO2-EDL-FETs, the driving gate voltage is less than 1 V and the ON/OFF ratios of the transfer characteristics are about 1×104 at RT, and the nearly metallic state is realized at the interface purely by applying a gate voltage.

  20. Fabrication and characterization of magnetically tunable metal-semiconductor schottky diode using barium hexaferrite thin film on gold

    NASA Astrophysics Data System (ADS)

    Kaur, Jotinder; Sharma, Vinay; Sharma, Vipul; Veerakumar, V.; Kuanr, Bijoy K.

    2016-05-01

    Barium Hexaferrite (BaM) is an extensively studied magnetic material due to its potential device application. In this paper, we study Schottky junction diodes fabricated using gold and BaM and demonstrate the function of a spintronic device. Gold (50 nm)/silicon substrate was used to grow the BaM thin films (100-150 nm) using pulsed laser deposition. I-V characteristics were measured on the Au/BaM structure sweeping the voltage from ±5 volts. The forward and reverse bias current-voltage curves show diode like rectifying characteristics. The threshold voltage decreases while the output current increases with increase in the applied external magnetic field showing that the I-V characteristics of the BaM based Schottky junction diodes can be tuned by external magnetic field. It is also demonstrated that, the fabricated Schottky diode can be used as a half-wave rectifier, which could operate at high frequencies in the range of 1 MHz compared to the regular p-n junction diodes, which rectify below 10 kHz. In addition, it is found that above 1 MHz, Au/BaM diode can work as a rectifier as well as a capacitor filter, making the average (dc) voltage much larger.

  1. Characterization of electrically-active defects in ultraviolet light-emitting diodes with laser-based failure analysis techniques

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Mary A.; Tangyunyong, Paiboon; Cole, Edward I.

    2016-01-14

    Laser-based failure analysis techniques demonstrate the ability to quickly and non-intrusively screen deep ultraviolet light-emitting diodes (LEDs) for electrically-active defects. In particular, two laser-based techniques, light-induced voltage alteration and thermally-induced voltage alteration, generate applied voltage maps (AVMs) that provide information on electrically-active defect behavior including turn-on bias, density, and spatial location. Here, multiple commercial LEDs were examined and found to have dark defect signals in the AVM indicating a site of reduced resistance or leakage through the diode. The existence of the dark defect signals in the AVM correlates strongly with an increased forward-bias leakage current. This increased leakage ismore » not present in devices without AVM signals. Transmission electron microscopy analysis of a dark defect signal site revealed a dislocation cluster through the pn junction. The cluster included an open core dislocation. Even though LEDs with few dark AVM defect signals did not correlate strongly with power loss, direct association between increased open core dislocation densities and reduced LED device performance has been presented elsewhere [M. W. Moseley et al., J. Appl. Phys. 117, 095301 (2015)].« less

  2. Preparation, characterization and electroluminescence studies of ZnO nanorods for optoelectronic device applications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Anju, E-mail: singh-nk24@yahoo.com; Vishwakarma, H. L., E-mail: horilal5@yahoo.com

    2015-07-31

    In this work, ZnO nanorods were achieved by a simple chemical precipitation method in the presence of capping agent Poly Vinyl Pyrrolidone (PVP) at room temperature. X-Ray Diffraction (XRD) result indicates that the synthesized undoped ZnO nanorods have wurtzite hexagonal structure without any impurities. It has been seen that the growth orientation of the prepared ZnO nanorods were (101). XRD analysis revealed that the nanorods having the crystallite size 49 nm. The Scanning Electron Microscopy (SEM) image confirmed the size and shape of these nanorods. The diameter of nanorods has been found that 1.52 µm to 1.61 µm and the lengthmore » of about 4.89 µm. It has also been found that at room temperature Ultra Violet Visible (UV-VIS) absorption band is around 355 nm (blue shifted as compared to bulk). Electroluminescence (EL) studies show that emission of light is possible at very small threshold voltage and increases rapidly with increasing applied voltage. It is seen that smaller ZnO nanoparticles give higher electroluminescence brightness starting at lower threshold voltage. The brightness is also affected by increasing the frequency of AC signal.« less

  3. Oxidation of ammonium sulfite by a multi-needle-to-plate gas phase pulsed corona discharge reactor

    NASA Astrophysics Data System (ADS)

    Ren, Hua; Lu, Na; Shang, Kefeng; Li, Jie; Wu, Yan

    2013-03-01

    The oxidation of ammonium sulfite in the ammonia-based flue gas desulfurization (FGD) process was investigated in a multi-needle-to-plate gas phase pulsed corona discharge reactor in this paper. The effect of several parameters, including capacitance and peak pulse voltage of discharge system, electrode gap and bubbling gas flow rate on the oxidation rate of ammonium sulfite was reviewed. The oxidation rate of ammonium sulfite could reach 47.2% at the capacitance, the peak pulse voltage, electrode gap and bubbling gas flow rate equal to 2 nF, -24.6 k V, 35 mm and 4 L min-1 within treatment time of 40 min The experimental results indicate that the gas phase pulsed discharge system with a multi-needle-to-plate electrode can oxide the ammonium sulfite. The oxidation rate increased with the applied capacitance and peak pulse voltage and decreased with the electrode gap. As the bubbling gas flow rate increased, the oxidation rate increased first and then tended to reach a stationary value. These results would be important for the process optimization of the (NH4)2SO3 to (NH4)2SO4 oxidation.

  4. Effects of Complex Structured Anodic Oxide Dielectric Layer Grown in Pore Matrix for Aluminum Capacitor.

    PubMed

    Shin, Jin-Ha; Yun, Sook Young; Lee, Chang Hyoung; Park, Hwa-Sun; Suh, Su-Jeong

    2015-11-01

    Anodization of aluminum is generally divided up into two types of anodic aluminum oxide structures depending on electrolyte type. In this study, an anodization process was carried out in two steps to obtain high dielectric strength and break down voltage. In the first step, evaporated high purity Al on Si wafer was anodized in oxalic acidic aqueous solution at various times at a constant temperature of 5 degrees C. In the second step, citric acidic aqueous solution was used to obtain a thickly grown sub-barrier layer. During the second anodization process, the anodizing potential of various ranges was applied at room temperature. An increased thickness of the sub-barrier layer in the porous matrix was obtained according to the increment of the applied anodizing potential. The microstructures and the growth of the sub-barrier layer were then observed with an increasing anodizing potential of 40 to 300 V by using a scanning electron microscope (SEM). An impedance analyzer was used to observe the change of electrical properties, including the capacitance, dissipation factor, impedance, and equivalent series resistance (ESR) depending on the thickness increase of the sub-barrier layer. In addition, the breakdown voltage was measured. The results revealed that dielectric strength was improved with the increase of sub-barrier layer thickness.

  5. Experimental investigation on a vectorized aerodynamic dielectric barrier discharge plasma actuator array

    NASA Astrophysics Data System (ADS)

    Neretti, Gabriele; Cristofolini, Andrea; Borghi, Carlo A.

    2014-04-01

    The Electro-Hydro-Dynamics (EHD) interaction, induced in atmospheric pressure still air by a surface dielectric barrier discharge (DBD) actuator, had been experimentally studied. A plasma aerodynamic actuator array, able to produce a vectorized jet, with the induced airflow oriented toward the desired direction, had been developed. The array was constituted by a sequence of single surface DBD actuators with kapton as dielectric material. An ac voltage in the range of 0-6 kV peak at 15 kHz had been used. The vectorization had been obtained by feeding the upper electrodes with different voltages and by varying the electrical connections. The lower electrodes had been connected either to ground or to the high voltage source, to produce the desired jet orientation and to avoid plasma formation acting in an undesired direction. Voltage and current measurements had been carried out to evaluate waveforms and to estimate the active power delivered to the discharge. Schlieren imaging allowed to visualize the induced jet and to estimate its orientation. Pitot measurements had been performed to obtain velocity profiles for all jet configurations. A proportional relation between the jet deflection angle and the applied voltage had been found. Moreover, a linear relation had been obtained between the maximum speed in the jet direction and the applied voltage. The active power of the discharge is approximated by both a power law function and an exponential function of the applied voltage.

  6. Treatment of emulsified oils by electrocoagulation: pulsed voltage applications.

    PubMed

    Genc, Ayten; Bakirci, Busra

    2015-01-01

    The effect of pulsed voltage application on energy consumption during electrocoagulation was investigated. Three voltage profiles having the same arithmetic average with respect to time were applied to the electrodes. The specific energy consumption for these profiles were evaluated and analyzed together with oil removal efficiencies. The effects of applied voltages, electrode materials, electrode configurations, and pH on oil removal efficiency were determined. Electrocoagulation experiments were performed by using synthetic and real wastewater samples. The pulsed voltages saved energy during the electrocoagulation process. In continuous operation, energy saving was as high as 48%. Aluminum electrodes used for the treatment of emulsified oils resulted in higher oil removal efficiencies in comparison with stainless steel and iron electrodes. When the electrodes gap was less than 1 cm, higher oil removal efficiencies were obtained. The highest oil removal efficiencies were 95% and 35% for the batch and continuous operating modes, respectively.

  7. Effects of various applied voltages on physical properties of TiO2 nanotubes by anodization method

    NASA Astrophysics Data System (ADS)

    Hoseinzadeh, T.; Ghorannevis, Z.; Ghoranneviss, M.; Sari, A. H.; Salem, M. K.

    2017-09-01

    Three steps anodization process is used to synthesize highly ordered and uniform multilayered titanium oxide (TiO2) nanotubes and effect of different anodization voltages are studied on their physical properties such as structural, morphological and optical. The crystalized structure of the synthesized tubes is investigated by X-ray diffractometer analysis. To study the morphology of the tubes, field emission scanning electron microscopy is used, which showed that the wall thicknesses and the diameters of the tubes are affected by the different anodization voltages. Moreover, optical studies performed by diffuse reflection spectra suggested that band gap of the TiO2 nanotubes are also changed by applying different anodization voltages. In this study using physical investigations, an optimum anodization voltage is obtained to synthesize the uniform crystalized TiO2 nanotubes with suitable diameter, wall thickness and optical properties.

  8. Mechanism for Si–Si Bond Rupture in Single Molecule Junctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Haixing; Kim, Nathaniel T.; Su, Timothy A.

    The stability of chemical bonds can be studied experimentally by rupturing single molecule junctions under applied voltage. Here, we compare voltage-induced bond rupture in two Si–Si backbones: one has no alternate conductive pathway whereas the other contains an additional naphthyl pathway in parallel to the Si–Si bond. We show that in contrast to the first system, the second can conduct through the naphthyl group when the Si–Si bond is ruptured using an applied voltage. We investigate this voltage induced Si–Si bond rupture by ab initio density functional theory calculations and molecular dynamics simulations that ultimately demonstrate that the excitation ofmore » molecular vibrational modes by tunneling electrons leads to homolytic Si–Si bond rupture.« less

  9. Mechanism for Si-Si Bond Rupture in Single Molecule Junctions.

    PubMed

    Li, Haixing; Kim, Nathaniel T; Su, Timothy A; Steigerwald, Michael L; Nuckolls, Colin; Darancet, Pierre; Leighton, James L; Venkataraman, Latha

    2016-12-14

    The stability of chemical bonds can be studied experimentally by rupturing single molecule junctions under applied voltage. Here, we compare voltage-induced bond rupture in two Si-Si backbones: one has no alternate conductive pathway whereas the other contains an additional naphthyl pathway in parallel to the Si-Si bond. We show that in contrast to the first system, the second can conduct through the naphthyl group when the Si-Si bond is ruptured using an applied voltage. We investigate this voltage induced Si-Si bond rupture by ab initio density functional theory calculations and molecular dynamics simulations that ultimately demonstrate that the excitation of molecular vibrational modes by tunneling electrons leads to homolytic Si-Si bond rupture.

  10. Atmospheric negative corona discharge using a Taylor cone as liquid electrode

    NASA Astrophysics Data System (ADS)

    Sekine, Ryuto; Shirai, Naoki; Uchida, Satoshi; Tochikubo, Fumiyoshi

    2012-10-01

    We examined characteristics of atmospheric negative corona discharge using liquid needle cathode. As a liquid needle cathode, we adopted Taylor cone with conical shape. A nozzle with inner diameter of 10 mm is filled with liquid, and a plate electrode is placed at 10 mm above the nozzle. By applying a dc voltage between electrodes, Taylor cone is formed. To change the liquid property, we added sodium dodecyl sulfate to reduce the surface tension, sodium sulfate to increase the conductivity, and polyvinyl alcohol to increase the viscosity, in distilled water. The liquid, with high surface tension such as pure water could not form a Taylor cone. When we reduced surface tension, a Taylor cone was formed and the stable corona discharge was observed at the tip of the cone. When we increased viscosity, a liquid filament protruded from the solution surface was formed and corona discharge was observed along the filament at position 0.7-1.0 mm above from the tip of the cone. Increasing the conductivity resulted in the higher light intensity of corona and the lower corona onset voltage. When we use the metal needle electrode, the corona discharge depends on the voltage and the gap length. Using Taylor cone, different types of discharges were observed by changing the property of the liquid.

  11. The ISR Asymmetrical Capacitor Thruster: Experimental Results and Improved Designs

    NASA Technical Reports Server (NTRS)

    Canning, Francis X.; Cole, John; Campbell, Jonathan; Winet, Edwin

    2004-01-01

    A variety of Asymmetrical Capacitor Thrusters has been built and tested at the Institute for Scientific Research (ISR). The thrust produced for various voltages has been measured, along with the current flowing, both between the plates and to ground through the air (or other gas). VHF radiation due to Trichel pulses has been measured and correlated over short time scales to the current flowing through the capacitor. A series of designs were tested, which were increasingly efficient. Sharp features on the leading capacitor surface (e.g., a disk) were found to increase the thrust. Surprisingly, combining that with sharp wires on the trailing edge of the device produced the largest thrust. Tests were performed for both polarizations of the applied voltage, and for grounding one or the other capacitor plate. In general (but not always) it was found that the direction of the thrust depended on the asymmetry of the capacitor rather than on the polarization of the voltage. While no force was measured in a vacuum, some suggested design changes are given for operation in reduced pressures.

  12. 16 CFR 1505.6 - Performance.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... waveform of the test voltage shall approximate a sine wave as closely as possible. (iii) The applied test... stalled-rotor current of the toy at maximum rated voltage. There shall be no electrical or mechanical... voltage with the rotor of the motor locked into position. During the test, exposed dead metal parts of the...

  13. 16 CFR 1505.6 - Performance.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... waveform of the test voltage shall approximate a sine wave as closely as possible. (iii) The applied test... stalled-rotor current of the toy at maximum rated voltage. There shall be no electrical or mechanical... voltage with the rotor of the motor locked into position. During the test, exposed dead metal parts of the...

  14. 16 CFR 1505.6 - Performance.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... waveform of the test voltage shall approximate a sine wave as closely as possible. (iii) The applied test... stalled-rotor current of the toy at maximum rated voltage. There shall be no electrical or mechanical... voltage with the rotor of the motor locked into position. During the test, exposed dead metal parts of the...

  15. Temperature controlled high voltage regulator

    DOEpatents

    Chiaro, Jr., Peter J.; Schulze, Gerald K.

    2004-04-20

    A temperature controlled high voltage regulator for automatically adjusting the high voltage applied to a radiation detector is described. The regulator is a solid state device that is independent of the attached radiation detector, enabling the regulator to be used by various models of radiation detectors, such as gas flow proportional radiation detectors.

  16. Microcircuit Modeling and Simulation beyond Ohm's Law

    ERIC Educational Resources Information Center

    Saxena, T.; Chek, D. C. Y.; Tan, M. L. P.; Arora, V. K.

    2011-01-01

    Circuit theory textbooks rely heavily on the applicability of Ohm's law, which collapses as electronic components reach micro- and nanoscale dimensions. Circuit analysis is examined in the regime where the applied voltage V is greater than the critical voltage V[subscript c], which triggers the nonlinear behavior. The critical voltage is infinity…

  17. Temperature dependent charge transport studies across thermodynamic glass transition in P3HT:PCBM bulk heterojunction: insight from J-V and impedance spectroscopy

    NASA Astrophysics Data System (ADS)

    Sarkar, Atri; Rahaman, Abdulla Bin; Banerjee, Debamalya

    2018-03-01

    Temperature dependent charge transport properties of P3HT:PCBM bulk heterojunction are analysed by dc and ac measurements under dark conditions across a wide temperature range of 110-473 K, which includes the thermodynamic glass transition temperature (Tg ˜320 K) of the system. A change from Ohmic conduction to space charge limited current conduction at higher (⩾1.2 V) applied bias voltages above  ⩾200 K is observed from J-V characteristics. From capacitance-voltage (C-V) measurement at room temperature, the occurrence of a peak near the built-in voltage is observed below the dielectric relaxation frequency, originating from the competition between drift and diffusion driven motions of charges. Carrier concentration (N) is calculated from C-V measurements taken at different temperatures. Room temperature mobility values at various applied bias voltages are in accordance with that obtained from transient charge extraction by linearly increasing voltage measurement. Sample impedance is measured over five decades of frequency across temperature range by using lock-in detection. This data is used to extract temperature dependence of carrier mobility (μ), and dc conductivity (σ_dc ) which is low frequency extrapolation of ac conductivity. An activation energy of  ˜126 meV for the carrier hopping process at the metal-semiconductor interface is estimated from temperature dependence of σ_dc . Above T g, μ levels off to a constant value, whereas σ_dc starts to decrease after a transition knee at T g that can be seen as a combined effect of changes in μ and N. All these observed changes across T g can be correlated to enhanced polymer motion above the glass transition.

  18. Changes in behavioral responses of Lygus lineolaris (Hemiptera: Miridae) from various applied signal voltages during EPG recordings

    USDA-ARS?s Scientific Manuscript database

    A 3rd-generation AC-DC electrical penetration graph (EPG) monitor was used to study feeding behaviors of pre-reproductive adult Lygus lineolaris (Hemiptera: Miridae) on pinhead (<3mm) cotton squares, applying different signal voltages at several input impedances. The AC-DC monitor allows a user to s...

  19. Fire protection system HMI in power plant

    NASA Astrophysics Data System (ADS)

    Zainal, Yuda Bakti

    2015-05-01

    The central power station, a place where there are machines that generate power, equipped with substation where the voltage is produced by the generator and increased to a certain voltage with a step up voltage transformer. Effect on transformer oil is very important, transformer may malfunction if the oil that serves as a coolant and insulator gradually decreased its ability, over time their use. Power transformer on usability is vital, so it needs to be maintained so that the temperature rise must be overcome by applying a temperature control that can inform and control the control valve to open the hydrant tap transformer cooling. HMI implemented to facilitate the operators cope with excess heat in the transformer using thermocouple censor. Test results show that the control transformer and monitored using PLC and HMI. Transformer can maintain the condition of a maximum of 80 degrees Celsius heat.

  20. IGZO TFT-based circuit with tunable threshold voltage by laser annealing

    NASA Astrophysics Data System (ADS)

    Huang, Xiaoming; Yu, Guang; Wu, Chenfei

    2017-11-01

    In this work, a high-performance inverter based on amorphous indium-gallium-zinc oxide thin-film transistors (TFTs) has been fabricated, which consists of a driver TFT and a load TFT. The threshold voltage (Vth) of the load TFT can be tuned by applying an area-selective laser annealing. The transfer curve of the load TFT shows a parallel shift into the negative bias direction upon laser annealing. Based on x-ray photoelectron spectroscopy analyses, the negative Vth shift can be attributed to the increase of oxygen vacancy concentration within the device channel upon laser irradiation. Compared to the untreated inverter, the laser annealed inverter shows much improved switching characteristics, including a large output swing range which is close to full swing, as well as an enhanced output voltage gain. Furthermore, the dynamic performance of ring oscillator based on the laser-annealed inverter is improved.

  1. Study on the influence of applied voltage and feed concentration on the performance of electrodeionization in nickel recovery from electroplating wastewater

    NASA Astrophysics Data System (ADS)

    Wardani, Anita K.; Hakim, Ahmad N.; Khoiruddin, Destifen, Welsen; Goenawan, Albertus; Wenten, I. G.

    2017-01-01

    Wastewaters from electroplating industries are usually contaminated with nickel up to 1000 mg/L. According to environmental regulations worldwide, nickel concentration on wastewaters must be controlled to an acceptable level before being discharged to the environment. This paper offers an alternative way to develop an efficient effluent-free technology to reduce the nickel content of rinse water so that the treated water could be recycled for rinsing and subsequently to workout methodology to recover nickel by electrodeionization (EDI). Electrical voltage and initial nickel concentration were varied to study the effect of the parameters. Results showed that EDI could remove nickel effectively which gives an outstanding result in terms of product quality. Nickel concentration on diluate chamber decreased up to 99% after 60 and 180 minutes for nickel concentration of 300 and 1000 mg/L, respectively. Meanwhile, the increase of electrical voltage led to faster nickel removal.

  2. Description of bipolar charge transport in polyethylene using a fluid model with a constant mobility: model prediction

    NASA Astrophysics Data System (ADS)

    LeRoy, S.; Segur, P.; Teyssedre, G.; Laurent, C.

    2004-01-01

    We present a conduction model aimed at describing bipolar transport and space charge phenomena in low density polyethylene under dc stress. In the first part we recall the basic requirements for the description of charge transport and charge storage in disordered media with emphasis on the case of polyethylene. A quick review of available conduction models is presented and our approach is compared with these models. Then, the bases of the model are described and related assumptions are discussed. Finally, results on external current, trapped and free space charge distributions, field distribution and recombination rate are presented and discussed, considering a constant dc voltage, a step-increase of the voltage, and a polarization-depolarization protocol for the applied voltage. It is shown that the model is able to describe the general features reported for external current, electroluminescence and charge distribution in polyethylene.

  3. The effects of interfacial recombination and injection barrier on the electrical characteristics of perovskite solar cells

    NASA Astrophysics Data System (ADS)

    Shi, Lin Xing; Wang, Zi Shuai; Huang, Zengguang; Sha, Wei E. I.; Wang, Haoran; Zhou, Zhen

    2018-02-01

    Charge carrier recombination in the perovskite solar cells (PSCs) has a deep influence on the electrical performance, such as open circuit voltage, short circuit current, fill factor and ultimately power conversion efficiency. The impacts of injection barrier, recombination channels, doping properties of carrier transport layers and light intensity on the performance of PSCs are theoretically investigated by drift-diffusion model in this work. The results indicate that due to the injection barrier at the interfaces of perovskite and carrier transport layer, the accumulated carriers modify the electric field distribution throughout the PSCs. Thus, a zero electric field is generated at a specific applied voltage, with greatly increases the interfacial recombination, resulting in a local kink of current density-voltage (J-V) curve. This work provides an effective strategy to improve the efficiency of PSCs by pertinently reducing both the injection barrier and interfacial recombination.

  4. Double Sided-Design of Electrodes Driving Tunable Dielectrophoretic Miniature Lens.

    PubMed

    Almoallem, Yousuf; Jiang, Hongrui

    2017-10-01

    We demonstrate the design methodology, geometrical analysis, device fabrication, and testing of a double-sided design (DSD) of tunable-focus dielectrophoretic liquid miniature lenses. This design is intended to reduce the driving voltage for tuning the lens, utilizing a double-sided electrode design that enhances the electric field magnitude. Fabricated devices were tested and measurements on a goniometer showed changes of up to 14° in the contact angle when the dielectrophoretic force was applied under 25 V rms . Correspondingly, the back focal length of the liquid lens changed from 67.1 mm to 14.4 mm when the driving voltage was increased from zero to 25 V rms . The driving voltage was significantly lower than those previously reported with similar device dimensions using single-sided electrode designs. This design allows for a range of both positive and negative menisci dependent on the volume of the lens liquid initially dispensed.

  5. Electrically and magnetically dual-driven Janus particles for handwriting-enabled electronic paper

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Komazaki, Y., E-mail: komazaki@dt.k.u-tokyo.ac.jp; Hirama, H.; Torii, T.

    In this work, we describe the synthesis of novel electrically and magnetically dual-driven Janus particles for a handwriting-enabled twisting ball display via the microfluidic technique. One hemisphere of the Janus particles contains a charge control agent, which allows the display color to be controlled by applying a voltage and superparamagnetic nanoparticles, allows handwriting by applying a magnetic field to the display. We fabricated a twisting ball display utilizing these Janus particles and tested the electric color control and handwriting using a magnet. As a result, the display was capable of permitting handwriting with a small magnet in addition to conventionalmore » color control using an applied voltage (80 V). Handwriting performance was improved by increasing the concentration of superparamagnetic nanoparticles and was determined to be possible even when 80 V was applied across the electrodes for 4 wt. % superparamagnetic nanoparticles in one hemisphere. This improvement was impossible when the concentration was reduced to 2 wt. % superparamagnetic nanoparticles. The technology presented in our work can be applied to low-cost, lightweight, highly visible, and energy-saving electronic message boards and large whiteboards because the large-size display can be fabricated easily due to its simple structure.« less

  6. Development of a low-flow multiplexed interface for capillary electrophoresis/electrospray ion trap mass spectrometry using sequential spray.

    PubMed

    Chen, Chao-Jung; Li, Fu-An; Her, Guor-Rong

    2008-05-01

    A multiplexed CE-MS interface using four low-flow sheath liquid ESI sprayers has been developed. Because of the limited space between the low-flow sprayers and the entrance aperture of the ESI source, multichannel analysis is difficult using conventional rotating plate approaches. Instead, a multiplexed low-flow system was achieved by applying an ESI potential sequentially to the four low-flow sprayers, resulting in only one sprayer being sprayed at any given time. The synchronization of the scan event and the voltage relays was accomplished by using the data acquisition signal from the IT mass spectrometer. This synchronization resulted in the ESI voltage being sequentially applied to each of the four sprayers according to the corresponding scan event. With this design, a four-fold increase in analytical throughput was achieved. Because of the use of low-flow interfaces, this multiplexed system has superior sensitivity than a rotating plate design using conventional sheath liquid interfaces. The multiplexed design presented has the potential to be applied to other low-flow multiplexed systems, such as multiplexed capillary LC and multiplexed CEC.

  7. A spatial light modulator that uses scattering in a cholesteric liquid crystal

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saito, Mitsunori, E-mail: msaito@rins.ryukoku.ac.jp; Uemi, Hiroto

    2016-03-15

    When a cholesteric liquid crystal (helical pitch: 5 μm) was sandwiched between two glass plates with no alignment coating (gap: 20 μm), a random-domain texture appeared and a strong light scattering took place. This translucent texture turned to a transparent homeotropic phase when an electric voltage of 20 V was applied to the liquid crystal layer. This phase transition was used for constructing a spatial light modulator that needed no polarizers. Indium-tin-oxide electrodes (0.8 mm square) were arranged on a glass substrate to create a 20 × 20 pixel array (20 mm square). The liquid crystal was injected into amore » gap (20 μm thickness) between this substrate and another glass plate with a uniform electrode (ground). The transmittance of the pixels was originally below 10% and decreased to 0% by 7 V application because of increase in the scattering loss. As the voltage was raised, the transmittance increased gradually in the 7–17 V range and then rapidly in the 17–20 V range, attaining 40% at 27 V. Various transmittance distributions or gray-scale images were attainable by applying a suitable voltage (7–27 V) to each pixel. The transmission range of this spatial light modulator extended from ultraviolet (350 nm) to infrared wavelengths (>800 nm). Owing to this wide transmission range as well as capability of the polarizer-free operation, this spatial light modulator is useful to control a lamp spectrum in spectroscopic measurements.« less

  8. Development of array piezoelectric fingers towards in vivo breast tumor detection

    NASA Astrophysics Data System (ADS)

    Xu, Xin; Chung, Youngsoo; Brooks, Ari D.; Shih, Wei-Heng; Shih, Wan Y.

    2016-12-01

    We have investigated the development of a handheld 4 × 1 piezoelectric finger (PEF) array breast tumor detector system towards in vivo patient testing, particularly, on how the duration of the DC applied voltage, the depression depth of the handheld unit, and breast density affect the PEF detection sensitivity on 40 patients. The tests were blinded and carried out in four phases: with DC voltage durations 5, 3, 2, to 0.8 s corresponding to scanning a quadrant, a half, a whole breast, and both breasts within 30 min, respectively. The results showed that PEF detection sensitivity was unaffected by shortening the applied voltage duration from 5 to 0.8 s nor was it affected by increasing the depression depth from 2 to 6 mm. Over the 40 patients, PEF detected 46 of the 48 lesions (46/48)—with the smallest lesion detected being 5 mm in size. Of 28 patients (some have more than one lesion) with mammography records, PEF detected 31/33 of all lesions (94%) and 14/15 of malignant lesions (93%), while mammography detected 30/33 of all lesions (91%) and 12/15 of malignant lesions (80%), indicating that PEF could detect malignant lesions not detectable by mammography without significantly increasing false positives. PEF's detection sensitivity is also shown to be independent of breast density, suggesting that PEF could be a potential tool for detecting breast cancer in young women and women with dense breasts.

  9. Pitch variable liquid lens array using electrowetting

    NASA Astrophysics Data System (ADS)

    Kim, YooKwang; Lee, Jin Su; Kim, Junoh; Won, Yong Hyub

    2017-02-01

    These days micro lens array is used in various fields such as fiber coupling, laser collimation, imaging and sensor system and beam homogenizer, etc. One of important thing in using micro lens array is, choice of its pitch. Especially imaging systems like integral imaging or light-field camera, pitch of micro lens array defines the system property and thus it could limit the variability of the system. There are already researches about lens array using liquid, and droplet control by electrowetting. This paper reports the result of combining them, the liquid lens array that could vary its pitch by electrowetting. Since lens array is a repeated system, realization of a small part of lens array is enough to show its property. The lens array is composed of nine (3 by 3) liquid droplets on flat surface. On substrate, 11 line electrodes are patterned along vertical and horizontal direction respectively. The width of line electrodes is 300um and interval is 200um. Each droplet is positioned to contain three electrode lines for both of vertical and horizontal direction. So there is one remaining electrode line in each of outermost side for both direction. In original state the voltage is applied to inner electrodes. When voltage of outermost electrodes are turned on, eight outermost droplets move to outer side, thereby increasing pitch of lens array. The original pitch was 1.5mm and it increased to 2.5mm after electrodes of voltage applied is changed.

  10. Measurement of OH, NO, O and N atoms in helium plasma jet for ROS/RNS controlled biomedical processes

    NASA Astrophysics Data System (ADS)

    Yonemori, Seiya; Kamakura, Taku; Ono, Ryo

    2014-10-01

    Atmospheric-pressure plasmas are of emerging interest for new plasma applications such as cancer treatment, cell activation and sterilization. In those biomedical processes, reactive oxygen/nitrogen species (ROS/RNS) are said that they play significant role. It is though that active species give oxidative stress and induce biomedical reactions. In this study, we measured OH, NO, O and N atoms using laser induced fluorescence (LIF) measurement and found that voltage polarity affect particular ROS. When negative high voltage was applied to the plasma jet, O atom density was tripled compared to the case of positive applied voltage. In that case, O atom density was around 3 × 1015 [cm-3] at maximum. In contrast, OH and NO density did not change their density depending on the polarity of applied voltage, measured as in order of 1013 and 1014 [cm-3] at maximum, respectively. From ICCD imaging measurement, it could be seen that negative high voltage enhanced secondary emission in plasma bullet propagation and it can affect the effective production of particular ROS. Since ROS/RNS dose can be a quantitative criterion to control plasma biomedical application, those measurement results is able to be applied for in vivo and in vitro plasma biomedical experiments. This study is supported by the Grant-in-Aid for Science Research by the Ministry of Education, Culture, Sport, Science and Technology.

  11. Frequency and voltage dependent profile of dielectric properties, electric modulus and ac electrical conductivity in the PrBaCoO nanofiber capacitors

    NASA Astrophysics Data System (ADS)

    Demirezen, S.; Kaya, A.; Yerişkin, S. A.; Balbaşı, M.; Uslu, İ.

    In this study, praseodymium barium cobalt oxide nanofiber interfacial layer was sandwiched between Au and n-Si. Frequency and voltage dependence of ε‧, ε‧, tanδ, electric modulus (M‧ and M″) and σac of PrBaCoO nanofiber capacitor have been investigated by using impedance spectroscopy method. The obtained experimental results show that the values of ε‧, ε‧, tanδ, M‧, M″ and σac of the PrBaCoO nanofiber capacitor are strongly dependent on frequency of applied bias voltage. The values of ε‧, ε″ and tanδ show a steep decrease with increasing frequency for each forward bias voltage, whereas the values of σac and the electric modulus increase with increasing frequency. The high dispersion in ε‧ and ε″ values at low frequencies may be attributed to the Maxwell-Wagner and space charge polarization. The high values of ε‧ may be due to the interfacial effects within the material, PrBaCoO nanofibers interfacial layer and electron effect. The values of M‧ and M″ reach a maximum constant value corresponding to M∞ ≈ 1/ε∞ due to the relaxation process at high frequencies, but both the values of M‧ and M″ approach almost to zero at low frequencies. The changes in the dielectric and electrical properties with frequency can be also attributed to the existence of Nss and Rs of the capacitors. As a result, the change in the ε‧, ε″, tanδ, M‧, M″ and ac electric conductivity (σac) is a result of restructuring and reordering of charges at the PrBaCoO/n-Si interface under an external electric field or voltage and interface polarization.

  12. Influence of the magnetic field profile on ITER conductor testing

    NASA Astrophysics Data System (ADS)

    Nijhuis, A.; Ilyin, Y.; ten Kate, H. H. J.

    2006-08-01

    We performed simulations with the numerical CUDI-CICC code on a typical short ITER (International Thermonuclear Experimental Reactor) conductor test sample of dual leg configuration, as usually tested in the SULTAN test facility, and made a comparison with the new EFDA-Dipole test facility offering a larger applied DC field region. The new EFDA-Dipole test facility, designed for short sample testing of conductors for ITER, has a homogeneous high field region of 1.2 m, while in the SULTAN facility this region is three times shorter. The inevitable non-uniformity of the current distribution in the cable, introduced by the joints at both ends, has a degrading effect on voltage-current (VI) and voltage-temperature (VT) characteristics, particularly for these short samples. This can easily result in an underestimation or overestimation of the actual conductor performance. A longer applied DC high field region along a conductor suppresses the current non-uniformity by increasing the overall longitudinal cable electric field when reaching the current sharing mode. The numerical interpretation study presented here gives a quantitative analysis for a relevant practical case of a test of a short sample poloidal field coil insert (PFCI) conductor in SULTAN. The simulation includes the results of current distribution analysis from self-field measurements with Hall sensor arrays, current sharing measurements and inter-petal resistance measurements. The outcome of the simulations confirms that the current uniformity improves with a longer high field region but the 'measured' VI transition is barely affected, though the local peak voltages become somewhat suppressed. It appears that the location of the high field region and voltage taps has practically no influence on the VI curve as long as the transverse voltage components are adequately cancelled. In particular, for a thin conduit wall, the voltage taps should be connected to the conduit in the form of an (open) azimuthally soldered wire, averaging the transverse conduit surface potentials initiated in the joints.

  13. Technical Trend of Environment-friendly High Voltage Vacuum Circuit Breaker (VCB)

    NASA Astrophysics Data System (ADS)

    Okubo, Hitoshi

    Vacuum Circuit Breakers (VCBs) have widely been used for low and medium voltage level, because of their high current interruption performance, maintenance free operations and environment-friendly characteristics. The VCB is now going to be applied to higher voltage systems for transmission and substation use. In this paper, the recent technical trend and future perspectives of high voltage VCBs are described, as well as their technical background.

  14. ELECTRICAL CIRCUITS USING COLD-CATHODE TRIODE VALVES

    DOEpatents

    Goulding, F.S.

    1957-11-26

    An electrical circuit which may be utilized as a pulse generator or voltage stabilizer is presented. The circuit employs a cold-cathode triode valve arranged to oscillate between its on and off stages by the use of selected resistance-capacitance time constant components in the plate and trigger grid circuits. The magnitude of the d-c voltage applied to the trigger grid circuit effectively controls the repetition rate of the output pulses. In the voltage stabilizer arrangement the d-c control voltage is a portion of the supply voltage and the rectified output voltage is substantially constant.

  15. Photovoltaic Impact Assessment of Smart Inverter Volt-VAR Control on Distribution System Conservation Voltage Reduction and Power Quality

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ding, Fei; Nagarajan, Adarsh; Chakraborty, Sudipta

    This report presents an impact assessment study of distributed photovoltaic (PV) with smart inverter Volt-VAR control on conservation voltage reduction (CVR) energy savings and distribution system power quality. CVR is a methodology of flattening and lowering a distribution system voltage profile in order to conserve energy. Traditional CVR relies on operating utility voltage regulators and switched capacitors. However, with the increased penetration of distributed PV systems, smart inverters provide the new opportunity to control local voltage and power factor by regulating the reactive power output, leading to a potential increase in CVR energy savings. This report proposes a methodology tomore » implement CVR scheme by operating voltage regulators, capacitors, and autonomous smart inverter Volt-VAR control in order to achieve increased CVR benefit. Power quality is an important consideration when operating a distribution system, especially when implementing CVR. It is easy to measure the individual components that make up power quality, but a comprehensive method to incorporate all of these values into a single score has yet to be undertaken. As a result, this report proposes a power quality scoring mechanism to measure the relative power quality of distribution systems using a single number, which is aptly named the 'power quality score' (PQS). Both the CVR and PQS methodologies were applied to two distribution system models, one obtained from the Hawaiian Electric Company (HECO) and another obtained from Pacific Gas and Electric (PG&E). These two models were converted to the OpenDSS platform using previous model conversion tools that were developed by NREL. Multiple scenarios including various PV penetration levels and smart inverter densities were simulated to analyze the impact of smart inverter Volt-VAR support on CVR energy savings and feeder power quality. In order to analyze the CVR benefit and PQS, an annual simulation was conducted for each scenario.« less

  16. Application of bias voltage to tune the resonant frequency of membrane-based electroactive polymer energy harvesters

    NASA Astrophysics Data System (ADS)

    Dong, Lin; Grissom, Michael; Fisher, Frank T.

    2016-05-01

    Vibration-based energy harvesting has been widely investigated to as a means to generate low levels of electrical energy for applications such as wireless sensor networks. However, for optimal performance it is necessary to ensure that resonant frequencies of the device match the ambient vibration frequencies for maximum energy harvested. Here a novel resonant frequency tuning approach is proposed by applying a bias voltage to a pre-stretched electroactive polymer (EAP) membrane, such that the resulting changes in membrane tension can tune the device to match the environmental vibration source. First, a material model which accounts for the change in properties due to the pre-stretch of a VHB 4910 EAP membrane is presented. The effect of the bias voltage on the EAP membrane, which induces an electrostatic pressure and corresponding reduction in membrane thickness, are then determined. The FEM results from ANSYS agree well with an analytical hyperelastic model of the activation response of the EAP membrane. Lastly, through a mass-loaded circular membrane vibration model, the effective resonant frequency of the energy harvester can be determined as a function of changes in membrane tension due to the applied bias voltage. In the case of an EAP membrane, pre-stretch contributes to the pre-stretch stiffness of the system while the applied bias voltage contributes to a change in bias voltage stiffness of the membrane. Preliminary experiments verified the resonant frequencies corresponding to the bias voltages predicted from the appropriate models. The proposed bias voltage tuning approach for the EAP membrane may provide a novel tuning strategy to enable energy harvesting from various ambient vibration sources in various application environments.

  17. A numerical study on piezoelectric energy harvesting by combining transverse galloping and parametric instability phenomena

    NASA Astrophysics Data System (ADS)

    Franzini, Guilherme Rosa; Santos, Rebeca Caramêz Saraiva; Pesce, Celso Pupo

    2017-12-01

    This paper aims to numerically investigate the effects of parametric instability on piezoelectric energy harvesting from the transverse galloping of a square prism. A two degrees-of-freedom reduced-order model for this problem is proposed and numerically integrated. A usual quasi-steady galloping model is applied, where the transverse force coefficient is adopted as a cubic polynomial function with respect to the angle of attack. Time-histories of nondimensional prism displacement, electric voltage and power dissipated at both the dashpot and the electrical resistance are obtained as functions of the reduced velocity. Both, oscillation amplitude and electric voltage, increased with the reduced velocity for all parametric excitation conditions tested. For low values of reduced velocity, 2:1 parametric excitation enhances the electric voltage. On the other hand, for higher reduced velocities, a 1:1 parametric excitation (i.e., the same as the natural frequency) enhances both oscillation amplitude and electric voltage. It has been also found that, depending on the parametric excitation frequency, the harvested electrical power can be amplified in 70% when compared to the case under no parametric excitation.

  18. An Optimal Control Strategy for DC Bus Voltage Regulation in Photovoltaic System with Battery Energy Storage

    PubMed Central

    Daud, Muhamad Zalani; Mohamed, Azah; Hannan, M. A.

    2014-01-01

    This paper presents an evaluation of an optimal DC bus voltage regulation strategy for grid-connected photovoltaic (PV) system with battery energy storage (BES). The BES is connected to the PV system DC bus using a DC/DC buck-boost converter. The converter facilitates the BES power charge/discharge to compensate for the DC bus voltage deviation during severe disturbance conditions. In this way, the regulation of DC bus voltage of the PV/BES system can be enhanced as compared to the conventional regulation that is solely based on the voltage-sourced converter (VSC). For the grid side VSC (G-VSC), two control methods, namely, the voltage-mode and current-mode controls, are applied. For control parameter optimization, the simplex optimization technique is applied for the G-VSC voltage- and current-mode controls, including the BES DC/DC buck-boost converter controllers. A new set of optimized parameters are obtained for each of the power converters for comparison purposes. The PSCAD/EMTDC-based simulation case studies are presented to evaluate the performance of the proposed optimized control scheme in comparison to the conventional methods. PMID:24883374

  19. TIME CALIBRATED OSCILLOSCOPE SWEEP

    DOEpatents

    Owren, H.M.; Johnson, B.M.; Smith, V.L.

    1958-04-22

    The time calibrator of an electric signal displayed on an oscilloscope is described. In contrast to the conventional technique of using time-calibrated divisions on the face of the oscilloscope, this invention provides means for directly superimposing equal time spaced markers upon a signal displayed upon an oscilloscope. More explicitly, the present invention includes generally a generator for developing a linear saw-tooth voltage and a circuit for combining a high-frequency sinusoidal voltage of a suitable amplitude and frequency with the saw-tooth voltage to produce a resultant sweep deflection voltage having a wave shape which is substantially linear with respect to time between equal time spaced incremental plateau regions occurring once each cycle of the sinusoidal voltage. The foregoing sweep voltage when applied to the horizontal deflection plates in combination with a signal to be observed applied to the vertical deflection plates of a cathode ray oscilloscope produces an image on the viewing screen which is essentially a display of the signal to be observed with respect to time. Intensified spots, or certain other conspicuous indications corresponding to the equal time spaced plateau regions of said sweep voltage, appear superimposed upon said displayed signal, which indications are therefore suitable for direct time calibration purposes.

  20. An optimal control strategy for DC bus voltage regulation in photovoltaic system with battery energy storage.

    PubMed

    Daud, Muhamad Zalani; Mohamed, Azah; Hannan, M A

    2014-01-01

    This paper presents an evaluation of an optimal DC bus voltage regulation strategy for grid-connected photovoltaic (PV) system with battery energy storage (BES). The BES is connected to the PV system DC bus using a DC/DC buck-boost converter. The converter facilitates the BES power charge/discharge to compensate for the DC bus voltage deviation during severe disturbance conditions. In this way, the regulation of DC bus voltage of the PV/BES system can be enhanced as compared to the conventional regulation that is solely based on the voltage-sourced converter (VSC). For the grid side VSC (G-VSC), two control methods, namely, the voltage-mode and current-mode controls, are applied. For control parameter optimization, the simplex optimization technique is applied for the G-VSC voltage- and current-mode controls, including the BES DC/DC buck-boost converter controllers. A new set of optimized parameters are obtained for each of the power converters for comparison purposes. The PSCAD/EMTDC-based simulation case studies are presented to evaluate the performance of the proposed optimized control scheme in comparison to the conventional methods.

  1. Control of power to an inductively heated part

    DOEpatents

    Adkins, Douglas R.; Frost, Charles A.; Kahle, Philip M.; Kelley, J. Bruce; Stanton, Suzanne L.

    1997-01-01

    A process for induction hardening a part to a desired depth with an AC signal applied to the part from a closely coupled induction coil includes measuring the voltage of the AC signal at the coil and the current passing through the coil; and controlling the depth of hardening of the part from the measured voltage and current. The control system determines parameters of the part that are functions of applied voltage and current to the induction coil, and uses a neural network to control the application of the AC signal based on the detected functions for each part.

  2. Control of power to an inductively heated part

    DOEpatents

    Adkins, D.R.; Frost, C.A.; Kahle, P.M.; Kelley, J.B.; Stanton, S.L.

    1997-05-20

    A process for induction hardening a part to a desired depth with an AC signal applied to the part from a closely coupled induction coil includes measuring the voltage of the AC signal at the coil and the current passing through the coil; and controlling the depth of hardening of the part from the measured voltage and current. The control system determines parameters of the part that are functions of applied voltage and current to the induction coil, and uses a neural network to control the application of the AC signal based on the detected functions for each part. 6 figs.

  3. Development of a voltage-dependent current noise algorithm for conductance-based stochastic modelling of auditory nerve fibres.

    PubMed

    Badenhorst, Werner; Hanekom, Tania; Hanekom, Johan J

    2016-12-01

    This study presents the development of an alternative noise current term and novel voltage-dependent current noise algorithm for conductance-based stochastic auditory nerve fibre (ANF) models. ANFs are known to have significant variance in threshold stimulus which affects temporal characteristics such as latency. This variance is primarily caused by the stochastic behaviour or microscopic fluctuations of the node of Ranvier's voltage-dependent sodium channels of which the intensity is a function of membrane voltage. Though easy to implement and low in computational cost, existing current noise models have two deficiencies: it is independent of membrane voltage, and it is unable to inherently determine the noise intensity required to produce in vivo measured discharge probability functions. The proposed algorithm overcomes these deficiencies while maintaining its low computational cost and ease of implementation compared to other conductance and Markovian-based stochastic models. The algorithm is applied to a Hodgkin-Huxley-based compartmental cat ANF model and validated via comparison of the threshold probability and latency distributions to measured cat ANF data. Simulation results show the algorithm's adherence to in vivo stochastic fibre characteristics such as an exponential relationship between the membrane noise and transmembrane voltage, a negative linear relationship between the log of the relative spread of the discharge probability and the log of the fibre diameter and a decrease in latency with an increase in stimulus intensity.

  4. Fast switching thyristor applied in nanosecond-pulse high-voltage generator with closed transformer core.

    PubMed

    Li, Lee; Bao, Chaobing; Feng, Xibo; Liu, Yunlong; Fochan, Lin

    2013-02-01

    For a compact and reliable nanosecond-pulse high-voltage generator (NPHVG), the specification parameter selection and potential usage of fast controllable state-solid switches have an important bearing on the optimal design. The NPHVG with closed transformer core and fast switching thyristor (FST) was studied in this paper. According to the analysis of T-type circuit, the expressions for the voltages and currents of the primary and secondary windings on the transformer core of NPHVG were deduced, and the theoretical maximum analysis was performed. For NPHVG, the rise-rate of turn-on current (di/dt) across a FST may exceed its transient rating. Both mean and maximum values of di/dt were determined by the leakage inductances of the transformer, and the difference is 1.57 times. The optimum winding ratio is helpful to getting higher voltage output with lower specification FST, especially when the primary and secondary capacitances have been established. The oscillation period analysis can be effectively used to estimate the equivalent leakage inductance. When the core saturation effect was considered, the maximum di/dt estimated from the oscillating period of the primary current is more accurate than one from the oscillating period of the secondary voltage. Although increasing the leakage inductance of NPHVG can decrease di/dt across FST, it may reduce the output peak voltage of the NPHVG.

  5. Dynamic memory of a single voltage-gated potassium ion channel: A stochastic nonequilibrium thermodynamic analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banerjee, Kinshuk, E-mail: kbpchem@gmail.com

    2015-05-14

    In this work, we have studied the stochastic response of a single voltage-gated potassium ion channel to a periodic external voltage that keeps the system out-of-equilibrium. The system exhibits memory, resulting from time-dependent driving, that is reflected in terms of dynamic hysteresis in the current-voltage characteristics. The hysteresis loop area has a maximum at some intermediate voltage frequency and disappears in the limits of low and high frequencies. However, the (average) dissipation at long-time limit increases and finally goes to saturation with rising frequency. This raises the question: how diminishing hysteresis can be associated with growing dissipation? To answer this,more » we have studied the nonequilibrium thermodynamics of the system and analyzed different thermodynamic functions which also exhibit hysteresis. Interestingly, by applying a temporal symmetry analysis in the high-frequency limit, we have analytically shown that hysteresis in some of the periodic responses of the system does not vanish. On the contrary, the rates of free energy and internal energy change of the system as well as the rate of dissipative work done on the system show growing hysteresis with frequency. Hence, although the current-voltage hysteresis disappears in the high-frequency limit, the memory of the ion channel is manifested through its specific nonequilibrium thermodynamic responses.« less

  6. Voltage-induced Interface Reconstruction and Electrical Instability of the Ferromagnet-Semiconductor Device.

    PubMed

    Chang, Shu-Jui; Chang, Po-Chun; Lin, Wen-Chin; Lo, Shao-Hua; Chang, Liang-Chun; Lee, Shang-Fan; Tseng, Yuan-Chieh

    2017-03-23

    Using x-ray magnetic spectroscopy with in-situ electrical characterizations, we investigated the effects of external voltage on the spin-electronic and transport properties at the interface of a Fe/ZnO device. Layer-, element-, and spin-resolved information of the device was obtained by cross-tuning of the x-ray mode and photon energy, when voltage was applied. At the early stage of the operation, the device exhibited a low-resistance state featuring robust Fe-O bonds. However, the Fe-O bonds were broken with increasing voltage. Breaking of the Fe-O bonds caused the formation of oxygen vacancies and resulted in a high-resistance state. Such interface reconstruction was coupled to a charge-transfer effect via Fe-O hybridization, which suppressed/enhanced the magnetization/coercivity of Fe electronically. Nevertheless, the interface became stabilized with the metallic phase if the device was continuously polarized. During this stage, the spin-polarization of Fe was enhanced whereas the coercivity was lowered by voltage, but changes of both characteristics were reversible. This stage is desirable for spintronic device applications, owing to a different voltage-induced electronic transition compared to the first stage. The study enabled a straightforward detection of the spin-electronic state at the ferromagnet-semiconductor interface in relation to the transport and reversal properties during operation process of the device.

  7. Study of the operating parameters of a helicon plasma discharge source using PIC-MCC simulation technique

    NASA Astrophysics Data System (ADS)

    Jaafarian, Rokhsare; Ganjovi, Alireza; Etaati, Gholamreza

    2018-01-01

    In this work, a Particle in Cell-Monte Carlo Collision simulation technique is used to study the operating parameters of a typical helicon plasma source. These parameters mainly include the gas pressure, externally applied static magnetic field, the length and radius of the helicon antenna, and the frequency and voltage amplitude of the applied RF power on the helicon antenna. It is shown that, while the strong radial gradient of the formed plasma density in the proximity of the plasma surface is substantially proportional to the energy absorption from the existing Trivelpiece-Gould (TG) modes, the observed high electron temperature in the helicon source at lower static magnetic fields is significant evidence for the energy absorption from the helicon modes. Furthermore, it is found that, at higher gas pressures, both the plasma electron density and temperature are reduced. Besides, it is shown that, at higher static magnetic fields, owing to the enhancement of the energy absorption by the plasma charged species, the plasma electron density is linearly increased. Moreover, it is seen that, at the higher spatial dimensions of the antenna, both the plasma electron density and temperature are reduced. Additionally, while, for the applied frequencies of 13.56 MHz and 27.12 MHz on the helicon antenna, the TG modes appear, for the applied frequency of 18.12 MHz on the helicon antenna, the existence of helicon modes is proved. Moreover, by increasing the applied voltage amplitude on the antenna, the generation of mono-energetic electrons is more probable.

  8. Powder free PECVD epitaxial silicon by plasma pulsing or increasing the growth temperature

    NASA Astrophysics Data System (ADS)

    Chen, Wanghua; Maurice, Jean-Luc; Vanel, Jean-Charles; Cabarrocas, Pere Roca i.

    2018-06-01

    Crystalline silicon thin films are promising candidates for low cost and flexible photovoltaics. Among various synthesis techniques, epitaxial growth via low temperature plasma-enhanced chemical vapor deposition is an interesting choice because of two low temperature related benefits: low thermal budget and better doping profile control. However, increasing the growth rate is a tricky issue because the agglomeration of clusters required for epitaxy leads to powder formation in the plasma. In this work, we have measured precisely the time evolution of the self-bias voltage in silane/hydrogen plasmas at millisecond time scale, for different values of the direct-current bias voltage applied to the radio frequency (RF) electrode and growth temperatures. We demonstrate that the decisive factor to increase the epitaxial growth rate, i.e. the inhibition of the agglomeration of plasma-born clusters, can be obtained by decreasing the RF OFF time or increasing the growth temperature. The influence of these two parameters on the growth rate and epitaxial film quality is also presented.

  9. Analytical and numerical analysis of charge carriers extracted by linearly increasing voltage in a metal-insulator-semiconductor structure relevant to bulk heterojunction organic solar cells

    NASA Astrophysics Data System (ADS)

    Yumnam, Nivedita; Hirwa, Hippolyte; Wagner, Veit

    2017-12-01

    Analysis of charge extraction by linearly increasing voltage is conducted on metal-insulator-semiconductor capacitors in a structure relevant to organic solar cells. For this analysis, an analytical model is developed and is used to determine the conductivity of the active layer. Numerical simulations of the transient current were performed as a way to confirm the applicability of our analytical model and other analytical models existing in the literature. Our analysis is applied to poly(3-hexylthiophene)(P3HT) : phenyl-C61-butyric acid methyl ester (PCBM) which allows to determine the electron and hole mobility independently. A combination of experimental data analysis and numerical simulations reveals the effect of trap states on the transient current and where this contribution is crucial for data analysis.

  10. 16 CFR § 1505.6 - Performance.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... waveform of the test voltage shall approximate a sine wave as closely as possible. (iii) The applied test... stalled-rotor current of the toy at maximum rated voltage. There shall be no electrical or mechanical... voltage with the rotor of the motor locked into position. During the test, exposed dead metal parts of the...

  11. Study of electric field distorted by space charges under positive lightning impulse voltage

    NASA Astrophysics Data System (ADS)

    Wang, Zezhong; Geng, Yinan

    2018-03-01

    Actually, many insulation problems are related to electric fields. And measuring electric fields is an important research topic of high-voltage engineering. In particular, the electric field distortion caused by space charge is the basis of streamer theory, and thus quantitatively measuring the Poisson electric field caused by space charge is significant to researching the mechanism of air gap discharge. In this paper, we used our photoelectric integrated sensor to measure the electric field distribution in a 1-m rod-plane gap under positive lightning impulse voltage. To verify the reliability of this quantitative measurement, we compared the measured results with calculated results from a numerical simulation. The electric-field time domain waveforms on the axis of the 1-m rod-plane out of the space charge zone were measured with various electrodes. The Poisson electric fields generated by space charge were separated from the Laplace electric field generated by applied voltages, and the amplitudes and variations were measured for various applied voltages and at various locations. This work also supplies the feasible basis for directly measuring strong electric field under high voltage.

  12. Voltage-step pulsed electromembrane as a novel view of electrical field-induced liquid-phase microextraction.

    PubMed

    Rezazadeh, Maryam; Yamini, Yadollah; Seidi, Shahram; Arjomandi-Behzad, Leila

    2014-01-10

    In the present work, the effect of application of voltage steps on extraction efficiency of pulsed electromembrane extraction (PEME) was investigated for the first time. The effects of voltage variations including initial and final voltages, number of steps between the initial and final voltages as well as their time durations were studied on the extraction efficiencies of three different classes of analytes. These classes include amitriptyline (AMI) and nortriptyline (NOR) as more hydrophobic analytes, diclofenac (DIC) and mefenamic acid (MEF) as acidic drugs and salbutamol (SB) and terbutaline (TB) as hydrophilic compounds. It was anticipated that the application of high voltages is not necessary at the beginning of the extraction, since large amounts of target analytes exist around the supported liquid membrane (SLM)/sample solution interface. So, they could be easily transferred into the acceptor phase utilizing lower voltages. Results showed that the benefits of voltage-step PEME (VS-PEME) are more obvious in systems with low electrical resistance (regarding the SLM composition). Efficiencies of VS-PEME for extraction of AMI and NOR (96% and 89% for AMI and NOR, respectively) were comparable with those achieved from applying a constant voltage (95% for AMI and 83% for NOR). However, recoveries from the VS-PEME of DIC and MEF (53% and 44% for DIC and MEF, respectively) were significantly higher than those from the application of a constant voltage (33% for DIC and 31% for MEF). Also, recoveries obtained from the VS-PEME for SB and TB were approximately 3 orders of magnitude greater than those from a constant voltage. Moreover, it was demonstrated that in all cases analytes could effectively be extracted at the beginning of extraction by applying low voltages. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Large negative differential resistance in graphene nanoribbon superlattices

    NASA Astrophysics Data System (ADS)

    Tseng, P.; Chen, C. H.; Hsu, S. A.; Hsueh, W. J.

    2018-05-01

    A graphene nanoribbon superlattice with a large negative differential resistance (NDR) is proposed. Our results show that the peak-to-valley ratio (PVR) of the graphene superlattices can reach 21 at room temperature with bias voltages between 90-220 mV, which is quite large compared with the one of traditional graphene-based devices. It is found that the NDR is strongly influenced by the thicknesses of the potential barrier. Therefore, the NDR effect can be optimized by designing a proper barrier thickness. The large NDR effect can be attributed to the splitting of the gap in transmission spectrum (segment of Wannier-Stark ladder) with larger thicknesses of barrier when the applied voltage increases.

  14. Electrical aging markers for EPR-based low-voltage cable insulation wiring of nuclear power plants

    NASA Astrophysics Data System (ADS)

    Verardi, L.; Fabiani, D.; Montanari, G. C.

    2014-01-01

    This paper presents results of electrical property measurements on EPR-based insulations of low-voltage power cables used in nuclear power plants. The specimens underwent accelerated aging through the simultaneous application of high temperature and gamma-radiation. Mechanical properties and the dielectric response at different frequencies were investigated. Results showed significant variation of the electrical and mechanical properties of aged cables at low frequencies, i.e. lower than 10-2 Hz. In particular, the real and imaginary parts of permittivity increase with aging time, accumulated dose and stress levels applied showing good correlation with elongation at break, which decreases as a function of extent of insulation aging.

  15. Method for voltage-gated protein fractionation

    DOEpatents

    Hatch, Anson [Tracy, CA; Singh, Anup K [Danville, CA

    2012-04-24

    We report unique findings on the voltage dependence of protein exclusion from the pores of nanoporous polymer exclusion membranes. The pores are small enough that proteins are excluded from passage with low applied electric fields, but increasing the field enables proteins to pass through. The requisite field necessary for a change in exclusion is protein-specific with a correlation to protein size. The field-dependence of exclusion is important to consider for preconcentration applications. The ability to selectively gate proteins at exclusion membranes is also a promising means for manipulating and characterizing proteins. We show that field-gated exclusion can be used to selectively remove proteins from a mixture, or to selectively trap protein at one exclusion membrane in a series.

  16. Wind Generators

    NASA Technical Reports Server (NTRS)

    1989-01-01

    When Enerpro, Inc. president, Frank J. Bourbeau, attempted to file a patent on a system for synchronizing a wind generator to the electric utility grid, he discovered Marshall Space Flight Center's Frank Nola's power factor controller. Bourbeau advanced the technology and received a NASA license and a patent for his Auto Synchronous Controller (ASC). The ASC reduces generator "inrush current," which occurs when large generators are abruptly brought on line. It controls voltage so the generator is smoothly connected to the utility grid when it reaches its synchronous speed, protecting the components from inrush current damage. Generator efficiency is also increased in light winds by applying lower than rated voltage. Wind energy is utilized to drive turbines to generate electricity for utility companies.

  17. Second harmonic detection in the electrochemical strain microscopy of Ag-ion conducting glass

    DOE PAGES

    Yang, Sangmo; Okatan, Mahmut Baris; Paranthaman, Mariappan Parans; ...

    2014-11-14

    The first and second harmonic electromechanical responses and their cross-correlation in Ag-ion conducting glass were investigated using band-excitation electrochemical strain microscopy (ESM). Consecutive ESM images with increasing magnitudes of the applied AC voltage allowed observation of not only reversible surface displacement but also irreversible silver nanoparticle formation above a certain threshold voltage. The second harmonic ESM response was anticorrelated with the first harmonic response in many local regions. Furthermore, the nucleation sites of silver nanoparticles were closely related to the anti-correlated regions, specifically, with low second harmonic and high first harmonic ESM responses. The possible origins of the second harmonicmore » ESM response are discussed.« less

  18. Differential effect of brief electrical stimulation on voltage-gated potassium channels.

    PubMed

    Cameron, Morven A; Al Abed, Amr; Buskila, Yossi; Dokos, Socrates; Lovell, Nigel H; Morley, John W

    2017-05-01

    Electrical stimulation of neuronal tissue is a promising strategy to treat a variety of neurological disorders. The mechanism of neuronal activation by external electrical stimulation is governed by voltage-gated ion channels. This stimulus, typically brief in nature, leads to membrane potential depolarization, which increases ion flow across the membrane by increasing the open probability of these voltage-gated channels. In spiking neurons, it is activation of voltage-gated sodium channels (Na V channels) that leads to action potential generation. However, several other types of voltage-gated channels are expressed that also respond to electrical stimulation. In this study, we examine the response of voltage-gated potassium channels (K V channels) to brief electrical stimulation by whole cell patch-clamp electrophysiology and computational modeling. We show that nonspiking amacrine neurons of the retina exhibit a large variety of responses to stimulation, driven by different K V -channel subtypes. Computational modeling reveals substantial differences in the response of specific K V -channel subtypes that is dependent on channel kinetics. This suggests that the expression levels of different K V -channel subtypes in retinal neurons are a crucial predictor of the response that can be obtained. These data expand our knowledge of the mechanisms of neuronal activation and suggest that K V -channel expression is an important determinant of the sensitivity of neurons to electrical stimulation. NEW & NOTEWORTHY This paper describes the response of various voltage-gated potassium channels (K V channels) to brief electrical stimulation, such as is applied during prosthetic electrical stimulation. We show that the pattern of response greatly varies between K V channel subtypes depending on activation and inactivation kinetics of each channel. Our data suggest that problems encountered when artificially stimulating neurons such as cessation in firing at high frequencies, or "fading," may be attributed to K V -channel activation. Copyright © 2017 the American Physiological Society.

  19. Line transients with corona

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Saied, M.M.; Safar, Y.A.; Salama, M.H.

    1987-01-01

    This paper investigates the effect of corona on the electromagnetic transients along high voltage overhead lines. A method is presented to simulate the line by dividing it into a number of sections connected in cascade. For {ital n} line sections, the number of the unknown variables is 2{ital n} + 1. The method allows any waveform of the exciting voltage function, as well as any impedance loading condition. The corona is represented by voltage-dependent shunt current sources. A systematic way for writing a sufficient number of differential equations is shown. For their solution, a digital computer subroutine based on themore » Runge--Kutta--Verner method was used. An artificial frequency-dependent damping by means of linear resistors was used to suppress the Gibb's oscillations in the solution. The proposed method is applied to study the transients on a 40 km high voltage line with 30-ft flat phase spacing and a single 1.4 inch ACSR conductor per phase. The exciting voltage has a double-exponential impulse waveform. Solutions are given for three values of resistive loads Z{sub {ital c}}2Z{sub {ital c}} and Z{sub {ital c}}/2, where Z{sub {ital c}} is the line surge impedance. The results of two interesting cases of inductive and capacitive loads are also given. Physical interpretations for the different solutions are given. Also, the current-voltage duality between inductive and capacitive loads is recognized. The corona was found to attenuate and distort the travelling waves. For example, during one wave excursion, the reduction of the current wave peaks can reach values as high as 8.5%. The effect is more noticeable in the current than in the voltage waves. As expected, it increases also with the line corona losses. The effect of the increase of the line effective capacitance due to the corona discharge is also demonstrated.« less

  20. Influences of Excess Oscillation of Voltage Pulse and Discharge Mode on NO Removal Using Barrier-Type Plasma Reactor

    NASA Astrophysics Data System (ADS)

    Kadowaki, Kazunori; Suzuki, Yoshiaki; Ihori, Haruo; Kitani, Isamu

    This paper presents experimental results of NO removal from a simulated exhausted-gas using a barrier type reactor with screw electrodes subjected to polarity-reversed voltage pulses. The polarity-reversed pulse was produced by direct grounding of a charged coaxial cable because a traveling wave voltage was negatively reflected at the grounding end with a change in its polarity and then it propagated to the plasma reactor at the opposite end. Influence of cable length on NO removal was studied for two kinds of cable connection, single-connected cable and parallel-connected cables. NO removal ratio for a 50m-long cable was lower than that for much shorter cables in both single and parallel connections when the applied voltage became high. Energy efficiency for NO removal also increased with decreasing the cable length. This was because excess discharges during the voltage oscillation caused by the large stored energy in the long cable resulted in reproduction of NO molecules. Energy efficiency was further improved by changing the discharge mode from dielectric barrier discharge (DBD) to surface discharge (SD). Energy efficiency was up to 110g/kWh with 55% NO removal ratio and 34g/kWh with 100% NO removal ratio by using a single 10m-long cable in SD mode.

  1. The smooth transition from field emission to a self-sustained plasma in microscale electrode gaps at atmospheric pressure

    NASA Astrophysics Data System (ADS)

    Bilici, Mihai A.; Haase, John R.; Boyle, Calvin R.; Go, David B.; Sankaran, R. Mohan

    2016-06-01

    We report on the existence of a smooth transition from field emission to a self-sustained plasma in microscale electrode geometries at atmospheric pressure. This behavior, which is not found at macroscopic scales or low pressures, arises from the unique combination of large electric fields that are created in microscale dimensions to produce field-emitted electrons and the high pressures that lead to collisional ionization of the gas. Using a tip-to-plane electrode geometry, currents less than 10 μA are measured at onset voltages of ˜200 V for gaps less than 5 μm, and analysis of the current-voltage (I-V) relationship is found to follow Fowler-Nordheim behavior, confirming field emission. As the applied voltage is increased, gas breakdown occurs smoothly, initially resulting in the formation of a weak, partial-like glow and then a self-sustained glow discharge. Remarkably, this transition is essentially reversible, as no significant hysteresis is observed during forward and reverse voltage sweeps. In contrast, at larger electrode gaps, no field emission current is measured and gas breakdown occurs abruptly at higher voltages of ˜400 V, absent of any smooth transition from the pre-breakdown condition and is characterized only by glow discharge formation.

  2. Aberration control in adaptive optics: a numerical study of arbitrarily deformable liquid lenses.

    PubMed

    Lima, N C; Mishra, K; Mugele, F

    2017-03-20

    By means of numerical simulations, using a computational fluid dynamics software together with an optical ray tracing analysis platform, we show that we can tune various optical aberrations by electrically manipulating the shape of liquid lenses using one hundred individually addressable electrodes. To demonstrate the flexibility of our design, we define electrode patterns based on specific Zernike modes and show that aspherical, cylindrical and decentered shapes of liquid lenses can be produced. Using different voltages, we evaluate the tuning range of spherical aberration (Z11), astigmatism (Z5 and Z6) and coma (Z7), while a hydrostatic pressure is applied to control the average curvature of a microlens with a diameter of 1mm. Upon activating all electrodes simultaneously spherical aberrations of 0.15 waves at a pressure of 30Pa can be suppressed almost completely for the highest voltages applied. For astigmatic and comatic patterns, the values of Z5, Z6 and Z7 increase monotonically with the voltage reaching values up to 0.06, 0.06 and 0.2 waves, respectively. Spot diagrams, wavefront maps and modulation transfer function are reported to quantify the optical performance of each lens. Crosstalk and independence of tunability are discussed in the context of possible applications of the approach for general wavefront shaping.

  3. Full phosphorescent white-light organic light-emitting diodes with improved color stability and efficiency by fine tuning primary emission contributions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hua, Wang, E-mail: wmsu2008@sinano.ac.cn, E-mail: wanghua001@tyut.edu.cn; Du, Xiaogang; Research Center of Advanced Materials Science and Technology, Taiyuan University of Technology, Taiyuan 030024

    2014-02-15

    In this paper, a novel type of white-light organic light emitting diode (OLED) with high color stability was reported, in which the yellow-light emission layer of (4,4{sup ′}-N,N{sup ′}-dicarbazole)biphenyl (CBP) : tris(2-phenylquinoline-C2,N{sup ′})iridium(III) (Ir(2-phq){sub 3}) was sandwiched by double blue-light emission layers of 1,1-bis-[(di-4-tolylamino)pheny1]cyclohexane (TAPC) : bis[4,6-(di-fluorophenyl)-pyridinato-N,C2{sup ′}]picolinate (FIrpic) and tris[3-(3-pyridyl)mesityl]borane (3TPYMB):FIrpic. And, it exhibited the maximum current efficiency of 33.1 cd/A, the turn-on voltage at about 3 V and the maximum luminance in excess of 20000 cd/m{sup 2}. More important, it realized very stable white-light emission, and its CIE(x, y) coordinates only shift from (0.34, 0.37) to (0.33, 0.37)more » as applied voltage increased from 5 V to 12 V. It is believed that the new scheme in emission layer of white-light OLED can fine tune the contribution of primary emission with applied voltage changed, resulting in high quality white-light OLED.« less

  4. Evidence for thermally assisted threshold switching behavior in nanoscale phase-change memory cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Le Gallo, Manuel; Athmanathan, Aravinthan; Krebs, Daniel

    2016-01-14

    In spite of decades of research, the details of electrical transport in phase-change materials are still debated. In particular, the so-called threshold switching phenomenon that allows the current density to increase steeply when a sufficiently high voltage is applied is still not well understood, even though there is wide consensus that threshold switching is solely of electronic origin. However, the high thermal efficiency and fast thermal dynamics associated with nanoscale phase-change memory (PCM) devices motivate us to reassess a thermally assisted threshold switching mechanism, at least in these devices. The time/temperature dependence of the threshold switching voltage and current inmore » doped Ge{sub 2}Sb{sub 2}Te{sub 5} nanoscale PCM cells was measured over 6 decades in time at temperatures ranging from 40 °C to 160 °C. We observe a nearly constant threshold switching power across this wide range of operating conditions. We also measured the transient dynamics associated with threshold switching as a function of the applied voltage. By using a field- and temperature-dependent description of the electrical transport combined with a thermal feedback, quantitative agreement with experimental data of the threshold switching dynamics was obtained using realistic physical parameters.« less

  5. A novel variable stiffness mechanism for dielectric elastomer actuators

    NASA Astrophysics Data System (ADS)

    Li, Wen-Bo; Zhang, Wen-Ming; Zou, Hong-Xiang; Peng, Zhi-Ke; Meng, Guang

    2017-08-01

    In this paper, a novel variable stiffness mechanism is proposed for the design of a variable stiffness dielectric elastomer actuator (VSDEA) which combines a flexible strip with a DEA in a dielectric elastomer minimum energy structure. The DEA induces an analog tuning of the transverse curvature of the strip, thus conveniently providing a voltage-controllable flexural rigidity. The VSDEA tends to be a fully flexible and compact structure with the advantages of simplicity and fast response. Both experimental and theoretical investigations are carried out to reveal the variable stiffness performances of the VSDEA. The effect of the clamped location on the bending stiffness of the VSDEA is analyzed, and then effects of the lengths, the loading points and the applied voltages on the bending stiffness are experimentally investigated. An analytical model is developed to verify the availability of this variable stiffness mechanism, and the theoretical results demonstrate that the bending stiffness of the VSDEA decreases as the applied voltage increases, which agree well with the experimental data. Moreover, the experimental results show that the maximum change of the relative stiffness can reach about 88.80%. It can be useful for the design and optimization of active variable stiffness structures and DEAs for soft robots, vibration control, and morphing applications.

  6. Electrocoagulation and nanofiltration integrated process application in purification of bilge water using response surface methodology.

    PubMed

    Akarsu, Ceyhun; Ozay, Yasin; Dizge, Nadir; Elif Gulsen, H; Ates, Hasan; Gozmen, Belgin; Turabik, Meral

    Marine pollution has been considered an increasing problem because of the increase in sea transportation day by day. Therefore, a large volume of bilge water which contains petroleum, oil and hydrocarbons in high concentrations is generated from all types of ships. In this study, treatment of bilge water by electrocoagulation/electroflotation and nanofiltration integrated process is investigated as a function of voltage, time, and initial pH with aluminum electrode as both anode and cathode. Moreover, a commercial NF270 flat-sheet membrane was also used for further purification. Box-Behnken design combined with response surface methodology was used to study the response pattern and determine the optimum conditions for maximum chemical oxygen demand (COD) removal and minimum metal ion contents of bilge water. Three independent variables, namely voltage (5-15 V), initial pH (4.5-8.0) and time (30-90 min) were transformed to coded values. The COD removal percent, UV absorbance at 254 nm, pH value (after treatment), and concentration of metal ions (Ti, As, Cu, Cr, Zn, Sr, Mo) were obtained as responses. Analysis of variance results showed that all the models were significant except for Zn (P > 0.05), because the calculated F values for these models were less than the critical F value for the considered probability (P = 0.05). The obtained R(2) and Radj(2) values signified the correlation between the experimental data and predicted responses: except for the model of Zn concentration after treatment, the high R(2) values showed the goodness of fit of the model. While the increase in the applied voltage showed negative effects, the increases in time and pH showed a positive effect on COD removal efficiency; also the most effective linear term was found as time. A positive sign of the interactive coefficients of the voltage-time and pH-time systems indicated synergistic effect on COD removal efficiency, whereas interaction between voltage and pH showed an antagonistic effect.

  7. A Multi-agent Based Cooperative Voltage and Reactive Power Control

    NASA Astrophysics Data System (ADS)

    Ishida, Masato; Nagata, Takeshi; Saiki, Hiroshi; Shimada, Ikuhiko; Hatano, Ryousuke

    In order to maintain system voltage within the optimal range and prevent voltage instability phenomena before they occur, a variety of phase modifying equipment is installed in optimal locations throughout the power system network and a variety of methods of voltage reactive control are employed. The proposed system divided the traditional method to control voltage and reactive power into two sub problems; “voltage control” to adjust the secondary bus voltage of substations, and “reactive power control” to adjust the primary bus voltage. In this system, two types of agents are installed in substations in order to cooperate “voltage control” and “reactive power control”. In order to verify the performance of the proposed method, it has been applied to the model network system. The results confirm that our proposed method is able to control violent fluctuations in load.

  8. A grid-connected single-phase photovoltaic micro inverter

    NASA Astrophysics Data System (ADS)

    Wen, X. Y.; Lin, P. J.; Chen, Z. C.; Wu, L. J.; Cheng, S. Y.

    2017-11-01

    In this paper, the topology of a single-phase grid-connected photovoltaic (PV) micro-inverter is proposed. The PV micro-inverter consists of DC-DC stage with high voltage gain boost and DC-AC conversion stage. In the first stage, we apply the active clamp circuit and two voltage multipliers to achieve soft switching technology and high voltage gain. In addition, the flower pollination algorithm (FPA) is employed for the maximum power point tracking (MPPT) in the PV module in this stage. The second stage cascades a H-bridge inverter and LCL filter. To feed high quality sinusoidal power into the grid, the software phase lock, outer voltage loop and inner current loop control method are adopted as the control strategy. The performance of the proposed topology is tested by Matlab/Simulink. A PV module with maximum power 300W and maximum power point voltage 40V is applied as the input source. The simulation results indicate that the proposed topology and the control strategy are feasible.

  9. Pulsed source ion implantation apparatus and method

    DOEpatents

    Leung, Ka-Ngo

    1996-01-01

    A new pulsed plasma-immersion ion-implantation apparatus that implants ions in large irregularly shaped objects to controllable depth without overheating the target, minimizing voltage breakdown, and using a constant electrical bias applied to the target. Instead of pulsing the voltage applied to the target, the plasma source, for example a tungsten filament or a RF antenna, is pulsed. Both electrically conducting and insulating targets can be implanted.

  10. Method and apparatus to provide power conversion with high power factor

    DOEpatents

    Perreault, David J.; Lim, Seungbum; Otten, David M.

    2017-05-23

    A power converter circuit rectifies a line voltage and applies the rectified voltage to a stack of capacitors. Voltages on the capacitors are coupled to a plurality of regulating converters to be converted to regulated output signals. The regulated output signals are combined and converted to a desired DC output voltage of the power converter. Input currents of the regulating converters are modulated in a manner that enhances the power factor of the power converter.

  11. Laminar and turbulent flow modes of cold atmospheric pressure argon plasma jet

    NASA Astrophysics Data System (ADS)

    Basher, Abdulrahman H.; Mohamed, Abdel-Aleam H.

    2018-05-01

    Laminar and turbulent flow modes of a cold atmospheric pressure argon plasma jet are investigated in this work. The effects of the gas flow rate, applied voltage, and frequency on each plasma mode and on intermodal transitions are characterized using photographic, electrical, and spectroscopic techniques. Increasing the gas flow rate increases the plasma jet length in the laminar mode. Upon transition to the turbulent mode, increasing the gas flow rate leads to a decrease in the plasma jet length. The flow rate at which the jet transitions from laminar to turbulent increases with the applied voltage. The presence of nitric oxide (NO) radicals is indicated by the emission spectra of the turbulent plasmas only, while excited Ar, N2, OH, and O excited species are produced in both laminar and turbulent modes. With no distinctive behavior observed upon transition between the two operating modes, the power consumption was found to be insensitive to gas flow rate variation, while the energy density was found to decrease exponentially with the gas flow rate. Rotational and vibrational temperature measurements of the two plasma modes indicated that they are of the non-thermal equilibrium plasma type. Since they offer NO radicals while maintaining the benefits of the laminar plasma jet, the turbulent plasma jet is more useful than its laminar counterpart in biomedical applications.

  12. Oxygen Displacement in Cuprates under Ionic Liquid Field-Effect Gating

    PubMed Central

    Dubuis, Guy; Yacoby, Yizhak; Zhou, Hua; He, Xi; Bollinger, Anthony T.; Pavuna, Davor; Pindak, Ron; Božović, Ivan

    2016-01-01

    We studied structural changes in a 5 unit cell thick La1.96Sr0.04CuO4 film, epitaxially grown on a LaSrAlO4 substrate with a single unit cell buffer layer, when ultra-high electric fields were induced in the film by applying a gate voltage between the film (ground) and an ionic liquid in contact with it. Measuring the diffraction intensity along the substrate-defined Bragg rods and analyzing the results using a phase retrieval method we obtained the three-dimensional electron density in the film, buffer layer, and topmost atomic layers of the substrate under different applied gate voltages. The main structural observations were: (i) there were no structural changes when the voltage was negative, holes were injected into the film making it more metallic and screening the electric field; (ii) when the voltage was positive, the film was depleted of holes becoming more insulating, the electric field extended throughout the film, the partial surface monolayer became disordered, and equatorial oxygen atoms were displaced towards the surface; (iii) the changes in surface disorder and the oxygen displacements were both reversed when a negative voltage was applied; and (iv) the c-axis lattice constant of the film did not change in spite of the displacement of equatorial oxygen atoms. PMID:27578237

  13. A compensation method for the full phase retardance nonuniformity in phase-only liquid crystal on silicon spatial light modulators.

    PubMed

    Teng, Long; Pivnenko, Mike; Robertson, Brian; Zhang, Rong; Chu, Daping

    2014-10-20

    A simple and efficient compensation method for the full correction of both the anisotropic and isotropic nonuniformity of the light phase retardance in a liquid crystal (LC) layer is presented. This is achieved by accurate measurement of the spatial variation of the LC layer's thickness with the help of a calibrated liquid crystal wedge, rather than solely relying on the light intensity profile recorded using two crossed polarizers. Local phase retardance as a function of the applied voltage is calculated with its LC thickness and a set of reference data measured from the intensity of the reflected light using two crossed polarizers. Compensation of the corresponding phase nonuniformity is realized by applying adjusted local voltage signals for different grey levels. To demonstrate its effectiveness, the proposed method is applied to improve the performance of a phase-only liquid crystal on silicon (LCOS) spatial light modulator (SLM). The power of the first diffraction order measured with the binary phase gratings compensated by this method is compared with that compensated by the conventional crossed-polarizer method. The results show that the phase compensation method proposed here can increase the dynamic range of the first order diffraction power significantly from 15~21 dB to over 38 dB, while the crossed-polarizer method can only increase it to 23 dB.

  14. Voltage-controlled magnetization switching in MRAMs in conjunction with spin-transfer torque and applied magnetic field

    NASA Astrophysics Data System (ADS)

    Munira, Kamaram; Pandey, Sumeet C.; Kula, Witold; Sandhu, Gurtej S.

    2016-11-01

    Voltage-controlled magnetic anisotropy (VCMA) effect has attracted a significant amount of attention in recent years because of its low cell power consumption during the anisotropy modulation of a thin ferromagnetic film. However, the applied voltage or electric field alone is not enough to completely and reliably reverse the magnetization of the free layer of a magnetic random access memory (MRAM) cell from anti-parallel to parallel configuration or vice versa. An additional symmetry-breaking mechanism needs to be employed to ensure the deterministic writing process. Combinations of voltage-controlled magnetic anisotropy together with spin-transfer torque (STT) and with an applied magnetic field (Happ) were evaluated for switching reliability, time taken to switch with low error rate, and energy consumption during the switching process. In order to get a low write error rate in the MRAM cell with VCMA switching mechanism, a spin-transfer torque current or an applied magnetic field comparable to the critical current and field of the free layer is necessary. In the hybrid processes, the VCMA effect lowers the duration during which the higher power hungry secondary mechanism is in place. Therefore, the total energy consumed during the hybrid writing processes, VCMA + STT or VCMA + Happ, is less than the energy consumed during pure spin-transfer torque or applied magnetic field switching.

  15. Electrokinetically controlled fluid injection into unicellular microalgae.

    PubMed

    Zhou, Xuewen; Zhang, Xixi; Boualavong, Jonathan; Durney, Andrew R; Wang, Tonghui; Kirschner, Scott; Wentz, Michaela; Mukaibo, Hitomi

    2017-10-01

    Electrokinetically controlled microinjection is reported as an effective transport mechanism for microinjection into the wild-type strain of the widely studied model microalga Chlamydomonas reinhardtii. A microinjection system using glass capillary pipettes was developed to capture and impale the motile cells. To apply an electric field and induce electrokinetic flow (e.g., electrophoresis and electroosmosis), an electrode was inserted directly into the solution inside the impaling injection pipette and another electrode was inserted into the external cell media. The viability of the impaled cells was confirmed for more than an hour under 0.01 V using the fluorescein diacetate/propidium iodide dual fluorescent dye based assay. The viability was also found to increase almost logarithmically with decreasing voltage and to depend strongly on the solution within the injection pipette. Successful electrokinetic microinjection into cells was confirmed by both an increase in cell volume under an applied voltage and electric field dependent delivery of fluorescent fluorescein molecules into an impaled cell. Our study offers novel opportunities for quantitative delivery of biomolecules into microalgae and advancing the research and development of these organisms as biosynthetic factories. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Application of the superposition principle to solar-cell analysis

    NASA Technical Reports Server (NTRS)

    Lindholm, F. A.; Fossum, J. G.; Burgess, E. L.

    1979-01-01

    The superposition principle of differential-equation theory - which applies if and only if the relevant boundary-value problems are linear - is used to derive the widely used shifting approximation that the current-voltage characteristic of an illuminated solar cell is the dark current-voltage characteristic shifted by the short-circuit photocurrent. Analytical methods are presented to treat cases where shifting is not strictly valid. Well-defined conditions necessary for superposition to apply are established. For high injection in the base region, the method of analysis accurately yields the dependence of the open-circuit voltage on the short-circuit current (or the illumination level).

  17. Variable frequency inverter for ac induction motors with torque, speed and braking control

    NASA Technical Reports Server (NTRS)

    Nola, F. J. (Inventor)

    1975-01-01

    A variable frequency inverter was designed for driving an ac induction motor which varies the frequency and voltage to the motor windings in response to varying torque requirements for the motor so that the applied voltage amplitude and frequency are of optimal value for any motor load and speed requirement. The slip frequency of the motor is caused to vary proportionally to the torque and feedback is provided so that the most efficient operating voltage is applied to the motor. Winding current surge is limited and a controlled negative slip causes motor braking and return of load energy to a dc power source.

  18. A Gain-Programmable Transit-Time-Stable and Temperature-Stable PMT Voltage Divider

    NASA Astrophysics Data System (ADS)

    Liu, Yaqiang; Li, Hongdi; Wang, Yu; Xing, Tao; Xie, Shuping; Uribe, J.; Baghaei, H.; Ramirez, R.; Kim, Soonseok; Wong, Wai-Hoi

    2004-10-01

    A gain-programmable, transit-time-stable, temperature-stable photomultiplier (PMT) voltage divider design is described in this paper. The signal-to-noise ratio can be increased by changing a PMT gain directly instead of adjusting the gain of the preamplifier. PMT gain can be changed only by adjusting the voltages for the dynodes instead of changing the total high voltage between the anode and the photocathode, which can cause a significant signal transit-time variation that cannot be accepted by an application with a critical timing requirement, such as positron emission tomography (PET) or time-of-flight (TOF) detection/PET. The dynode voltage can be controlled by a digital analog converter isolated with a linear optocoupler. The optocoupler consists of an infrared light emission diode (LED) optically coupled with two phototransistors, and one is used in a servo feedback circuit to control the LED drive current for compensating temperature characteristics. The results showed that a six times gain range could be achieved; the gain drift was <0.5% over a 20/spl deg/C temperature range; 250 ps transit-time variation was measured over the entire gain range. A compact print circuit board (PCB) for the voltage divider integrated with a fixed-gain preamplifier has been designed and constructed. It can save about $30 per PMT channel compared with a commercial PMT voltage divider along with a variable gain amplifier. The preamplifier can be totally disabled, therefore in a system with a large amount of PMTs, only one channel can be enabled for calibrating the PMT gain. This new PMT voltage divider design is being applied to our animal PET camera and TOF/PET research.

  19. Electric-field-control of magnetic anisotropy of Co0.6Fe0.2B0.2/oxide stacks using reduced voltage

    NASA Astrophysics Data System (ADS)

    Kita, Koji; Abraham, David W.; Gajek, Martin J.; Worledge, D. C.

    2012-08-01

    We have demonstrated purely electrical manipulation of the magnetic anisotropy of a Co0.6Fe0.2B0.2 film by applying only 8 V across the CoFeB/oxide stack. A clear transition from in-plane to perpendicular anisotropy was observed. The quantitative relationship between interface anisotropy energy and the applied electric-field was determined from the linear voltage dependence of the saturation field. By comparing the dielectric stacks of MgO/Al2O3 and MgO/HfO2/Al2O3, enhanced voltage control was also demonstrated, due to the higher dielectric constant of the HfO2. These results suggest the feasibility of purely electrical control of magnetization with small voltage bias for spintronics applications.

  20. Morphology effect on the light scattering and dynamic response of polymer network liquid crystal phase modulator.

    PubMed

    Xiangjie, Zhao; Cangli, Liu; Jiazhu, Duan; Jiancheng, Zeng; Dayong, Zhang; Yongquan, Luo

    2014-06-16

    Polymer network liquid crystal (PNLC) was one of the most potential liquid crystal for submillisecond response phase modulation, which was possible to be applied in submillisecond response phase only spatial light modulator. But until now the light scattering when liquid crystal director was reoriented by external electric field limited its phase modulation application. Dynamic response of phase change when high voltage was applied was also not elucidated. The mechanism that determines the light scattering was studied by analyzing the polymer network morphology by SEM method. Samples were prepared by varying the polymerization temperature, UV curing intensity and polymerization time. The morphology effect on the dynamic response of phase change was studied, in which high voltage was usually applied and electro-striction effect was often induced. The experimental results indicate that the polymer network morphology was mainly characterized by cross linked single fibrils, cross linked fibril bundles or even both. Although the formation of fibril bundle usually induced large light scattering, such a polymer network could endure higher voltage. In contrast, although the formation of cross linked single fibrils induced small light scattering, such a polymer network cannot endure higher voltage. There is a tradeoff between the light scattering and high voltage endurance. The electro-optical properties such as threshold voltage and response time were taken to verify our conclusion. For future application, the monomer molecular structure, the liquid crystal solvent and the polymerization conditions should be optimized to generate optimal polymer network morphology.

  1. Electropherogram of capillary zone electrophoresis with effective mobility axis as a transverse axis and its analytical utility. I. Transformation applying the hypothetical electroosmotic flow.

    PubMed

    Ikuta, N; Yamada, Y; Hirokawa, T

    2000-01-01

    For capillary zone electrophoresis, a new method of transformation from migration time to effective mobility was proposed, in which the mobility increase due to Joule heating and the relaxation effect of the potential gradient were eliminated successfully. The precision of the mobility evaluated by the proposed transformation was discussed in relation to the analysis of rare earth ions. By using the transformation, almost the same pherograms could be obtained even from the pherograms obtained originally at different applied voltages.

  2. The Mechanism of Extracellular Stimulation of Nerve Cells on an Electrolyte-Oxide-Semiconductor Capacitor

    PubMed Central

    Schoen, Ingmar; Fromherz, Peter

    2007-01-01

    Extracellular excitation of neurons is applied in studies of cultured networks and brain tissue, as well as in neuroprosthetics. We elucidate its mechanism in an electrophysiological approach by comparing voltage-clamp and current-clamp recordings of individual neurons on an insulated planar electrode. Noninvasive stimulation of neurons from pedal ganglia of Lymnaea stagnalis is achieved by defined voltage ramps applied to an electrolyte/HfO2/silicon capacitor. Effects on the smaller attached cell membrane and the larger free membrane are distinguished in a two-domain-stimulation model. Under current-clamp, we study the polarization that is induced for closed ion channels. Under voltage-clamp, we determine the capacitive gating of ion channels in the attached membrane by falling voltage ramps and for comparison also the gating of all channels by conventional variation of the intracellular voltage. Neuronal excitation is elicited under current-clamp by two mechanisms: Rising voltage ramps depolarize the free membrane such that an action potential is triggered. Falling voltage ramps depolarize the attached membrane such that local ion currents are activated that depolarize the free membrane and trigger an action potential. The electrophysiological analysis of extracellular stimulation in the simple model system is a basis for its systematic optimization in neuronal networks and brain tissue. PMID:17098803

  3. Microsecond Electron Beam Source with Electron Energy Up to 400 Kev and Plasma Anode

    NASA Astrophysics Data System (ADS)

    Abdullin, É. N.; Basov, G. F.; Shershnev, S.

    2017-12-01

    A new high-power source of electrons with plasma anode for producing high-current microsecond electron beams with electron energy up to 400 keV has been developed, manufactured, and put in operation. To increase the cross section and pulse current duration of the beam, a multipoint explosive emission cathode is used in the electron beam source, and the beam is formed in an applied external guiding magnetic field. The Marx generator with vacuum insulation is used as a high-voltage source. Electron beams with electron energy up to 300-400 keV, current of 5-15 kA, duration of 1.5-3 μs, energy up to 4 kJ, and cross section up to 150 cm2 have been produced. The operating modes of the electron beam source are realized in which the applied voltage is influenced weakly on the current. The possibility of source application for melting of metal surfaces is demonstrated.

  4. Comparison of free radicals formation induced by cold atmospheric plasma, ultrasound, and ionizing radiation.

    PubMed

    Rehman, Mati Ur; Jawaid, Paras; Uchiyama, Hidefumi; Kondo, Takashi

    2016-09-01

    Plasma medicine is increasingly recognized interdisciplinary field combining engineering, physics, biochemistry and life sciences. Plasma is classified into two categories based on the temperature applied, namely "thermal" and "non-thermal" (i.e., cold atmospheric plasma). Non-thermal or cold atmospheric plasma (CAP) is produced by applying high voltage electric field at low pressures and power. The chemical effects of cold atmospheric plasma in aqueous solution are attributed to high voltage discharge and gas flow, which is transported rapidly on the liquid surface. The argon-cold atmospheric plasma (Ar-CAP) induces efficient reactive oxygen species (ROS) in aqueous solutions without thermal decomposition. Their formation has been confirmed by electron paramagnetic resonance (EPR) spin trapping, which is reviewed here. The similarities and differences between the plasma chemistry, sonochemistry, and radiation chemistry are explained. Further, the evidence for free radical formation in the liquid phase and their role in the biological effects induced by cold atmospheric plasma, ultrasound and ionizing radiation are discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Modeling in conventional and supra electroporation for model cell with organelles

    NASA Astrophysics Data System (ADS)

    Sulaeman, Muhammad Yangki; Widita, Rena

    2015-09-01

    Electroporation is a formation of pores in the membrane cell due to the external electric field applied to the cell. There are two types of electroporation, conventional and supra-electroporation. The purpose of creating pores in the cell using conventional electroporation are to increase the effectiveness of chemotherapy (electrochemotherapy) and to kill cancer tissue using irreversible electroporation. Supra-electroporation shows that it can induce electroporation in the organell inside the cell, so it can kill the cell by apoptosis mechanism. Modeling of electroporation phenomenon on a model cell had been done by using software COMSOL Multiphysics 4.3b with the applied external electric field used are 1.1 kV/cm for conventional electroporation and 60 kV/cm for supra-electroporation to find the difference between transmembrane voltage and pore density for both electroporation. It can be concluded from the results that there is a big difference between transmembrane voltage and pores density on conventional and supra electroporation on model cell.

  6. Fabrication and characterization of tea polyphenols loaded pullulan-CMC electrospun nanofiber for fruit preservation.

    PubMed

    Shao, Ping; Niu, Ben; Chen, Hangjun; Sun, Peilong

    2018-02-01

    Edible packaging films using polymer for food preservation have been developed for a long time. In this study, the effects of different concentrations (0.5%, 1%, 1.5%, w/v) of tea polyphenols incorporated into pullulan-Carboxymethylcellulose sodium (Pul-CMC) solutions on electrospun nanofiber films were evaluated. The fiber size distribution was characterized by scanning electron microscopy. The morphological features of nanofibers were modulated through adjusting process parameters (e.g. concentration of polymer solution, applied voltage and feeding rate). Increasing the applied voltage from 19 to 21kV and the feed rate from 0.36 to 0.6mL/h leads to a reduction in mean fiber diameter. Fruit packaging potential was evaluated using strawberry. The pullulan-CMC-TP nanofibers significantly decreased weight loss and maintained the firmness of the strawberries, and improved the quality of the fruit during storage. The findings demonstrate a facile packaging route to improve food sustainability and reduce waste. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. High Current Hollow Cathode Plasma Plume Measurements

    NASA Technical Reports Server (NTRS)

    Thomas, Robert E.; Kamhawi, Hani; Williams, George J., Jr.

    2013-01-01

    Plasma plume measurements are reported for a hollow cathode assembly (HCA) oper-ated at discharge currents of 50, 70, and 100 A at xenon ow rates between 19 - 46 sccm.The HCA was centrally mounted in the annulus of the NASA-300MS Hall Thruster andwas operated in the spot and plume modes with additional data taken with an appliedmagnetic eld. Langmuir probes, retarding potential analyzers, and optical emission spec-troscopy were employed to measure plasma properties near the orice of the HCA and toassess the charge state of the near-eld plasma. Electron temperatures (2-6 eV) and plasmapotentials are consistent with probe-measured values in previous investigations. Operationwith an applied-eld yields higher discharge voltages, increased Xe III production, andincreased signals from the 833.5 nm C I line. While operating in plume mode and with anapplied eld, ion energy distribution measurements yield ions with energies signicantlyexceeding the applied discharge voltage. These ndings are correlated with high-frequencyoscillations associated with each mode.

  8. Wrinkling of flexoelectric nano-film/substrate systems

    NASA Astrophysics Data System (ADS)

    Su, Shengkai; Huang, Huaiwei; Liu, Yijie; Zhu, Zheng H.

    2018-02-01

    The study of wrinkling mechanisms essentially helps to establish stable and controllable performance in electronic products. To gain some basic understanding of the wrinkling process in flexoelectric dielectrics, this paper models the wrinkling of nano-film/substrate systems, typically seen in stretchable electronics, subjected to substrate prestrain and voltage loading on electrodes. Flexoelectricity is considered through the constitutive equations proposed by Shen and Hu, and Euler-Bernoulli beam theory is applied to formulate the expressions of wrinkling wavelength and amplitude through the Ritz method. The effects of flexoelectricity, surface parameters, prestrain, applied voltage, structural scale etc on wrinkling behaviors, including wrinkling deformation and the wrinkling critical condition, are discussed. Results reveal that the action of both flexoelectric and surface effects is significant over only a small scale range, with film thickness less than 10 nm. Alongside these issues, the fundamental difference between flexoelectric and piezoelectric effects on wrinkling behaviors is highlighted. Piezoelectricity may act as a promoter or suppressor of wrinkling initiation and amplitude, depending on the applied voltage, while flexoelectricity not only reduces the critical prestrain or voltage required for wrinkling, but also decreases the wrinkling wavelength and amplitude.

  9. Discussion on optical response of liquid-crystal BPIII driven by an inclined electric field.

    NASA Astrophysics Data System (ADS)

    Chen, Hui-Yu; Wang, Yen-Wen

    Three blue phases exist between the chiral nematic and the liquid phase. Compared with the electro-optical properties of BPI and BPII, BPIII is a fast response photonic device with no residual birefringence, and less hysteresis effect when an in-plane electric field is applied. However, the in-the-plane field is not uniform and then the electro-optical properties is more complicate than that we can image. This is a key point for further application of BP. In this paper, a grating-like vertical electric field is used to induce the two different optical phenomena of BPIII. As the electric field is turned on, the light transmittance rapidly increases to a stable value (<0.5 ms, Kerr effect). If the applied voltage is a dc, the transmittance will remind in this stable value. However, when the applied voltage is ac, the transmittance will oscillate with the frequency. The change in transmittance will be obvious in a low frequency. From our observation, we have known that the oscillation of the transmittance is not caused by the ion effect. It is induced by reorientation of the induced optical axis (flexoeletric effect). Thus, we can control the applied frequency and the amplitude to modulate the contribution of Kerr effect and flexoelectric effect. MOST 105-2112-M-005-010.

  10. OmpF, a nucleotide-sensing nanoprobe, computational evaluation of single channel activities

    NASA Astrophysics Data System (ADS)

    Abdolvahab, R. H.; Mobasheri, H.; Nikouee, A.; Ejtehadi, M. R.

    2016-09-01

    The results of highthroughput practical single channel experiments should be formulated and validated by signal analysis approaches to increase the recognition precision of translocating molecules. For this purpose, the activities of the single nano-pore forming protein, OmpF, in the presence of nucleotides were recorded in real time by the voltage clamp technique and used as a means for nucleotide recognition. The results were analyzed based on the permutation entropy of current Time Series (TS), fractality, autocorrelation, structure function, spectral density, and peak fraction to recognize each nucleotide, based on its signature effect on the conductance, gating frequency and voltage sensitivity of channel at different concentrations and membrane potentials. The amplitude and frequency of ion current fluctuation increased in the presence of Adenine more than Cytosine and Thymine in milli-molar (0.5 mM) concentrations. The variance of the current TS at various applied voltages showed a non-monotonic trend whose initial increasing slope in the presence of Thymine changed to a decreasing one in the second phase and was different from that of Adenine and Cytosine; e.g., by increasing the voltage from 40 to 140 mV in the 0.5 mM concentration of Adenine or Cytosine, the variance decreased by one third while for the case of Thymine it was doubled. Moreover, according to the structure function of TS, the fractality of current TS differed as a function of varying membrane potentials (pd) and nucleotide concentrations. Accordingly, the calculated permutation entropy of the TS, validated the biophysical approach defined for the recognition of different nucleotides at various concentrations, pd's and polarities. Thus, the promising outcomes of the combined experimental and theoretical methodologies presented here can be implemented as a complementary means in pore-based nucleotide recognition approaches.

  11. Investigation of nanosecond pulsed dielectric barrier discharge using plate-to-plate electrode with asymmetric dielectric arrangement in airflow

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qi, Haicheng; School of Physics Science and Technology, Anshan Normal University, Anshan 114005; Fan, Zhihui

    Atmospheric pressure dielectric barrier discharge plasma is produced in airflow by applying nanosecond high voltage pulses with peak voltage about 35 kV and rising time about 40 ns on a plate-to-plate electrode arrangement. The effects of airflow rate (0–50 m/s) on the discharge characteristics are investigated under different barrier conditions (the bare anode case and the bare cathode case). For both cases, the breakdown voltage and the time lag increase distinctly and the discharge intensity decreases sharply when the airflow rate increases from 0 to 30 m/s, and then keep almost constant until the airflow rate is further increased to 50 m/s. For the baremore » anode case (the cathode is covered by dielectric plate), the discharge mode transforms gradually from filamentary to diffuse discharge with the increasing airflow rate. While for the bare cathode case, some micro-discharge channels are still excited, though the discharge becomes more diffuse when the airflow rate is higher than 30 m/s. By acquiring the time-resolved images of the discharge, it is proved that it is the primary discharge which becomes diffuse when airflow is introduced and the following two discharges of the same voltage pulse occur principally at the positions where the primary discharge is more intense. And in both cases, the plasma temperatures are reduced, but the degree is different. All the phenomena can be explained mainly by the variation of the space charge distribution when the airflow is introduced into the discharge gap. And it is indicated that the bare anode case has an advantage in obtaining diffuse discharge.« less

  12. Voltage-Load Sensitivity Matrix Based Demand Response for Voltage Control in High Solar Penetration Distribution Feeders

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Xiangqi; Wang, Jiyu; Mulcahy, David

    This paper presents a voltage-load sensitivity matrix (VLSM) based voltage control method to deploy demand response resources for controlling voltage in high solar penetration distribution feeders. The IEEE 123-bus system in OpenDSS is used for testing the performance of the preliminary VLSM-based voltage control approach. A load disaggregation process is applied to disaggregate the total load profile at the feeder head to each load nodes along the feeder so that loads are modeled at residential house level. Measured solar generation profiles are used in the simulation to model the impact of solar power on distribution feeder voltage profiles. Different casemore » studies involving various PV penetration levels and installation locations have been performed. Simulation results show that the VLSM algorithm performance meets the voltage control requirements and is an effective voltage control strategy.« less

  13. Fabrication of an artificial nanosucker device with a large area nanotube array of metallic glass.

    PubMed

    Chen, Wei-Ting; Manivannan, Karthikeyan; Yu, Chia-Chi; Chu, Jinn P; Chen, Jem-Kun

    2018-01-18

    The concurrent attachment and detachment movements of geckos on virtually any type of surface via their foot pads have inspired us to develop a thermal device with numerous arrangements of a multi-layer thin film together with electrodes that can help modify the temperature of the surface via application of a voltage. A sequential fabrication process was employed on a large-scale integration to generate well-defined contact hole arrays of photoresist for use as templates on the electrode-based device. The photoresist templates were then subjected to sputter deposition of the metallic glass Zr 55 Cu 30 Al 10 Ni 5 . Consequently, a metallic glass nanotube (MGNT) array having a nominal wall thickness of 100 nm was obtained after removal of the photoresist template. When a water droplet was placed on the MGNT array, close nanochambers of metallic glass were formed. By applying voltage, the surface was heated to increase the pressure inside the nanochambers; this generated an expanding force that raised the droplet; thus, the static water contact angle (SWCA) was increased. In contrast, a sucking force was generated during surface cooling, which decreased the SWCA. Our fabrication strategy exploits the MGNT array surface as nanosuckers, which can mimic the climbing aptitude of geckos as they attach to (>10 N m -2 ) and detach from (0.26 N m -2 ) surfaces at 0.5 and 3 V of applied voltage, respectively. Thus, the climbing aptitude of geckos can be mimicked by employing the processing strategy presented herein for the development of artificial foot pads.

  14. Power-MOSFET Voltage Regulator

    NASA Technical Reports Server (NTRS)

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  15. Adaptive control system for pulsed megawatt klystrons

    DOEpatents

    Bolie, Victor W.

    1992-01-01

    The invention provides an arrangement for reducing waveform errors such as errors in phase or amplitude in output pulses produced by pulsed power output devices such as klystrons by generating an error voltage representing the extent of error still present in the trailing edge of the previous output pulse, using the error voltage to provide a stored control voltage, and applying the stored control voltage to the pulsed power output device to limit the extent of error in the leading edge of the next output pulse.

  16. Nanocontainers made of Various Materials with Tunable Shape and Size

    NASA Astrophysics Data System (ADS)

    Zhao, Xianglong; Meng, Guowen; Han, Fangming; Li, Xiangdong; Chen, Bensong; Xu, Qiaoling; Zhu, Xiaoguang; Chu, Zhaoqin; Kong, Mingguang; Huang, Qing

    2013-07-01

    Nanocontainers have great potentials in targeted drug delivery and nanospace-confined reactions. However, the previous synthetic approaches exhibited limited control over the morphology, size and materials of the nanocontainers, which are crucial in practical applications. Here, we present a synthetic approach to multi-segment linear-shaped nanopores with pre-designed morphologies inside anodic aluminium oxide (AAO), by tailoring the anodizing duration after a rational increase of the applied anodizing voltage and the number of voltage increase during Al foil anodization. Then, we achieve nanocontainers with designed morphologies, such as nanofunnels, nanobottles, nano-separating-funnels and nanodroppers, with tunable sizes and diverse materials of carbon, silicon, germanium, hafnium oxide, silica and nickel/carbon magnetic composite, by depositing a thin layer of materials on the inner walls of the pre-designed AAO nanopores. The strategy has far-reaching implications in the designing and large-scale fabrication of nanocontainers, opening up new opportunities in nanotechnology applications.

  17. Biased four-point probe resistance

    NASA Astrophysics Data System (ADS)

    Garcia-Vazquez, Valentin

    2017-11-01

    The implications of switching the current polarity in a four-point probe resistance measurement are presented. We demonstrate that, during the inversion of the applied current, any change in the voltage V produced by a continuous drop of the sample temperature T will induce a bias in the temperature-dependent DC resistance. The analytical expression for the bias is deduced and written in terms of the variations of the measured voltages with respect to T and by the variations of T with respect to time t. Experimental data measured on a superconducting Nb thin film confirm that the bias of the normal-state resistance monotonically increases with the cooling rate dT/dt while keeping fixed dV/dT; on the other hand, the bias increases with dV/dT, reaching values up to 13% with respect to the unbiased resistance obtained at room temperature.

  18. Effects of strychnine on the potassium conductance of the frog node of Ranvier

    PubMed Central

    1977-01-01

    The nature of the block of potassium conductance by strychnine in frog node of Ranvier was investigated. The block is voltage-dependent and reaches a steady level with a relaxation time of 1 to several ms. Block is increased by depolarization or a reduction in [K+]O as well as by increasing strychnine concentration. A quaternary derivative of strychnine produces a similar block only when applied intracellularly. In general and in detail, strychnine block resembles that produced by intracellular application of the substituted tetraethylammonium compounds extensively studied by C.M. Armstrong (1969. J. Gen Physiol. 54:553-575. 1971. J. Gen. Physiol. 58:413-437). The kinetics, voltage dependence, and dependence on [K+]O of strychnine block are of the same form. It is concluded that tertiary strychnine must cross the axon membrane and block from the axoplasmic side in the same fashion as these quaternary amines. PMID:302320

  19. Nanocontainers made of Various Materials with Tunable Shape and Size

    PubMed Central

    Zhao, Xianglong; Meng, Guowen; Han, Fangming; Li, Xiangdong; Chen, Bensong; Xu, Qiaoling; Zhu, Xiaoguang; Chu, Zhaoqin; Kong, Mingguang; Huang, Qing

    2013-01-01

    Nanocontainers have great potentials in targeted drug delivery and nanospace-confined reactions. However, the previous synthetic approaches exhibited limited control over the morphology, size and materials of the nanocontainers, which are crucial in practical applications. Here, we present a synthetic approach to multi-segment linear-shaped nanopores with pre-designed morphologies inside anodic aluminium oxide (AAO), by tailoring the anodizing duration after a rational increase of the applied anodizing voltage and the number of voltage increase during Al foil anodization. Then, we achieve nanocontainers with designed morphologies, such as nanofunnels, nanobottles, nano-separating-funnels and nanodroppers, with tunable sizes and diverse materials of carbon, silicon, germanium, hafnium oxide, silica and nickel/carbon magnetic composite, by depositing a thin layer of materials on the inner walls of the pre-designed AAO nanopores. The strategy has far-reaching implications in the designing and large-scale fabrication of nanocontainers, opening up new opportunities in nanotechnology applications. PMID:23867836

  20. Demonstration of Scalable Nernst Voltage in a Coiled Galfenol Wire

    NASA Astrophysics Data System (ADS)

    Codecido, Emilio; Yang, Zihao; Marquez, Jason; Zheng, Yuanhua; Heremans, Joseph; Myers, Roberto

    Transverse thermopower by the Nernst effect is usually considered far too weak an effect for waste heat recovery and power generation. We propose that magnetostriction provides a pathway to enhance the Nernst effect because it increases phonon and magnon coupling. Here, we measure the Nernst coefficient in the magnetostrictive alloy, Galfenol (Fe0.85Ga0.15) and observe an extraordinarily large Nernst coefficient at room temperature of 4 μV/KT. Next we demonstrate a new geometry for efficient and low cost power generation by wrapping Galfenol wire around a hot cylinder. This coil geometry results in a radial temperature gradient direction. With a magnetic field applied in the axial direction, a uniform Nernst electric field is produced along the azimuthal direction at every point along the coil. As a result of this geometry, the Nernst voltage is shown to increase linearly with wire length, proving the concept of scalable Nernst thermal power generation.

  1. Modification of graphene oxide films by radiofrequency N2 plasma

    NASA Astrophysics Data System (ADS)

    Neustroev, E. P.; Burtseva, E. K.; Soloviev, B. D.; Prokopiev, A. R.; Popov, V. I.; Timofeev, V. B.

    2018-04-01

    The effect of treatment in nitrogen plasma on the properties of partially reduced graphene oxide (rGO) was studied. A comparison is made between two different sample locations in the reaction chamber. It is shown that in the case when rGO films were turned towards the inductor of the plasma system, the etching rate is much higher. Effective nitrogen functionalization of rGO was established in the second position, when the rGO films were turned in the opposite direction. In this case, the nitrogen content increases to 5 at% of the initial value. The change in the current-voltage characteristics is observed under illumination, which is independent of the wavelength. On and off daylight changes the resistance to 30% of the initial value. The magnitude of the photocurrent increases depending on the applied voltage. The effect is most noticeable for thin rGO films 10-15 nm in thickness.

  2. Constant-current regulator improves tunnel diode threshold-detector performance

    NASA Technical Reports Server (NTRS)

    Cancro, C. A.

    1965-01-01

    Grounded-base transistor is placed in a tunnel diode threshold detector circuit, and a bias voltage is applied to the tunnel diode. This provides the threshold detector with maximum voltage output and overload protection.

  3. Characterization of electrically-active defects in ultraviolet light-emitting diodes with laser-based failure analysis techniques

    DOE PAGES

    Miller, Mary A.; Tangyunyong, Paiboon; Edward I. Cole, Jr.

    2016-01-12

    In this study, laser-based failure analysis techniques demonstrate the ability to quickly and non-intrusively screen deep ultraviolet light-emitting diodes(LEDs) for electrically-active defects. In particular, two laser-based techniques, light-induced voltage alteration and thermally-induced voltage alteration, generate applied voltage maps (AVMs) that provide information on electrically-active defect behavior including turn-on bias, density, and spatial location. Here, multiple commercial LEDs were examined and found to have dark defect signals in the AVM indicating a site of reduced resistance or leakage through the diode. The existence of the dark defect signals in the AVM correlates strongly with an increased forward-bias leakage current. This increasedmore » leakage is not present in devices without AVM signals. Transmission electron microscopyanalysis of a dark defect signal site revealed a dislocation cluster through the pn junction. The cluster included an open core dislocation. Even though LEDs with few dark AVM defect signals did not correlate strongly with power loss, direct association between increased open core dislocation densities and reduced LED device performance has been presented elsewhere [M. W. Moseley et al., J. Appl. Phys. 117, 095301 (2015)].« less

  4. Electrochemical anodizing treatment to enhance localized corrosion resistance of pure titanium.

    PubMed

    Prando, Davide; Brenna, Andrea; Bolzoni, Fabio M; Diamanti, Maria V; Pedeferri, Mariapia; Ormellese, Marco

    2017-01-26

    Titanium has outstanding corrosion resistance due to the thin protective oxide layer that is formed on its surface. Nevertheless, in harsh and severe environments, pure titanium may suffer localized corrosion. In those conditions, costly titanium alloys containing palladium, nickel and molybdenum are used. This purpose investigated how it is possible to control corrosion, at lower cost, by electrochemical surface treatment on pure titanium, increasing the thickness of the natural oxide layer. Anodic oxidation was performed on titanium by immersion in H2SO4 solution and applying voltages ranging from 10 to 80 V. Different anodic current densities were considered. Potentiodynamic tests in chloride- and fluoride-containing solutions were carried out on anodized titanium to determine the pitting potential. All tested anodizing treatments increased corrosion resistance of pure titanium, but never reached the performance of titanium alloys. The best corrosion behavior was obtained on titanium anodized at voltages lower than 40 V at 20 mA/cm2. Titanium samples anodized at low cell voltage were seen to give high corrosion resistance in chloride- and fluoride-containing solutions. Electrolyte bath and anodic current density have little effect on the corrosion behavior.

  5. A Paramagnetic Molecular Voltmeter

    PubMed Central

    Surek, Jack T.; Thomas, David D.

    2008-01-01

    We have developed a general electron paramagnetic resonance (EPR) method to measure electrostatic potential at spin labels on proteins to millivolt accuracy. Electrostatic potential is fundamental to energy-transducing proteins like myosin, because molecular energy storage and retrieval is primarily electrostatic. Quantitative analysis of protein electrostatics demands a site-specific spectroscopic method sensitive to millivolt changes. Previous electrostatic potential studies on macromolecules fell short in sensitivity, accuracy and/or specificity. Our approach uses fast-relaxing charged and neutral paramagnetic relaxation agents (PRAs) to increase nitroxide spin label relaxation rate solely through collisional spin exchange. These PRAs were calibrated in experiments on small nitroxides of known structure and charge to account for differences in their relaxation efficiency. Nitroxide longitudinal (R1) and transverse (R2) relaxation rates were separated by applying lineshape analysis to progressive saturation spectra. The ratio of measured R1 increases for each pair of charged and neutral PRAs measures the shift in local PRA concentration due to electrostatic potential. Voltage at the spin label is then calculated using the Boltzmann equation. Measured voltages for two small charged nitroxides agree with Debye-Hückel calculations. Voltage for spin-labeled myosin fragment S1 also agrees with calculation based on the pK shift of the reacted cysteine. PMID:17964835

  6. High voltage power transistor development

    NASA Technical Reports Server (NTRS)

    Hower, P. L.

    1981-01-01

    Design considerations, fabrication procedures, and methods of evaluation for high-voltage power-transistor development are discussed. Technique improvements such as controlling the electric field at the surface and perserving lifetimes in the collector region which have advanced the state of the art in high-voltage transistors are discussed. These improvements can be applied directly to the development of 1200 volt, 200 ampere transistors.

  7. Strain-optic voltage monitor wherein strain causes a change in the optical absorption of a crystalline material

    DOEpatents

    Weiss, Jonathan D.

    1997-01-01

    A voltage monitor which uses the shift in absorption edge of crystalline material to measure strain resulting from electric field-induced deformation of piezoelectric or electrostrictive material, providing a simple and accurate means for measuring voltage applied either by direct contact with the crystalline material or by subjecting the material to an electric field.

  8. Pulsed source ion implantation apparatus and method

    DOEpatents

    Leung, K.N.

    1996-09-24

    A new pulsed plasma-immersion ion-implantation apparatus that implants ions in large irregularly shaped objects to controllable depth without overheating the target, minimizing voltage breakdown, and using a constant electrical bias applied to the target. Instead of pulsing the voltage applied to the target, the plasma source, for example a tungsten filament or a RF antenna, is pulsed. Both electrically conducting and insulating targets can be implanted. 16 figs.

  9. Utilizing Microelectromechanical Systems (MEMS) Micro-Shutter Designs for Adaptive Coded Aperture Imaging (ACAI) Technologies

    DTIC Science & Technology

    2009-03-01

    52 Figure 4-1: Applied voltage versus deflection curve for Poly1/Poly2 stacked 300-μm single hot-arm actuator (shown on right...58 Figure 4-2: Applied voltage versus deflection curve for Poly1/Poly2 stacked 300-μm double hot-arm actuator (shown on...61 Figure 4-5: Deflection vs. power curves for an individual wedge from

  10. Capacitance-voltage measurement in memory devices using ferroelectric polymer

    NASA Astrophysics Data System (ADS)

    Nguyen, Chien A.; Lee, Pooi See

    2006-01-01

    Application of thin polymer film as storing mean for non-volatile memory devices is investigated. Capacitance-voltage (C-V) measurement of metal-ferroelectric-metal device using ferroelectric copolymer P(VDF-TrFE) as dielectric layer shows stable 'butter-fly' curve. The two peaks in C-V measurement corresponding to the largest capacitance are coincidental at the coercive voltages that give rise to zero polarization in the polarization hysteresis measurement. By comparing data of C-V and P-E measurement, a correlation between two types of hysteresis is established in which it reveals simultaneous electrical processes occurring inside the device. These processes are caused by the response of irreversible and reversible polarization to the applied electric field that can be used to present a memory window. The memory effect of ferroelectric copolymer is further demonstrated for fabricating polymeric non-volatile memory devices using metal-ferroelectric-insulator-semiconductor structure (MFIS). By applying different sweeping voltages at the gate, bidirectional flat-band voltage shift is observed in the ferroelectric capacitor. The asymmetrical shift after negative sweeping is resulted from charge accumulation at the surface of Si substrate caused by the dipole direction in the polymer layer. The effect is reversed for positive voltage sweeping.

  11. Incorporating voltage security into the planning, operation and monitoring of restructured electric energy markets

    NASA Astrophysics Data System (ADS)

    Nair, Nirmal-Kumar

    As open access market principles are applied to power systems, significant changes are happening in their planning, operation and control. In the emerging marketplace, systems are operating under higher loading conditions as markets focus greater attention to operating costs than stability and security margins. Since operating stability is a basic requirement for any power system, there is need for newer tools to ensure stability and security margins being strictly enforced in the competitive marketplace. This dissertation investigates issues associated with incorporating voltage security into the unbundled operating environment of electricity markets. It includes addressing voltage security in the monitoring, operational and planning horizons of restructured power system. This dissertation presents a new decomposition procedure to estimate voltage security usage by transactions. The procedure follows physical law and uses an index that can be monitored knowing the state of the system. The expression derived is based on composite market coordination models that have both PoolCo and OpCo transactions, in a shared stressed transmission grid. Our procedure is able to equitably distinguish the impacts of individual transactions on voltage stability, at load buses, in a simple and fast manner. This dissertation formulates a new voltage stability constrained optimal power flow (VSCOPF) using a simple voltage security index. In modern planning, composite power system reliability analysis that encompasses both adequacy and security issues is being developed. We have illustrated the applicability of our VSCOPF into composite reliability analysis. This dissertation also delves into the various applications of voltage security index. Increasingly, FACT devices are being used in restructured markets to mitigate a variety of operational problems. Their control effects on voltage security would be demonstrated using our VSCOPF procedure. Further, this dissertation investigates the application of steady state voltage stability index to detect potential dynamic voltage collapse. Finally, this dissertation examines developments in representation, standardization, communication and exchange of power system data. Power system data is the key input to all analytical engines for system operation, monitoring and control. Data exchange and dissemination could impact voltage security evaluation and therefore needs to be critically examined.

  12. Generation of ozone by pulsed corona discharge over water surface in hybrid gas liquid electrical discharge reactor

    NASA Astrophysics Data System (ADS)

    Lukes, Petr; Clupek, Martin; Babicky, Vaclav; Janda, Vaclav; Sunka, Pavel

    2005-02-01

    Ozone formation by a pulse positive corona discharge generated in the gas phase between a planar high voltage electrode made from reticulated vitreous carbon and a water surface with an immersed ground stainless steel plate electrode was investigated under various operating conditions. The effects of gas flow rate (0.5-3 litre min-1), discharge gap spacing (2.5-10 mm), applied input power (2-45 W) and gas composition (oxygen containing argon or nitrogen) on ozone production were determined. Ozone concentration increased with increasing power input and with increasing discharge gap. The production of ozone was significantly affected by the presence of water vapour formed through vaporization of water at the gas-liquid interface by the action of the gas phase discharge. The highest energy efficiency for ozone production was obtained using high voltage pulses of approximately 150 ns duration in Ar/O2 mixtures with the maximum efficiency (energy yield) of 23 g kW h-1 for 40% argon content.

  13. Low-temperature formation of c-axis-oriented aluminum nitride thin films by plasma-assisted reactive pulsed-DC magnetron sputtering

    NASA Astrophysics Data System (ADS)

    Takenaka, Kosuke; Satake, Yoshikatsu; Uchida, Giichiro; Setsuhara, Yuichi

    2018-01-01

    The low-temperature formation of c-axis-oriented aluminum nitride thin films was demonstrated by plasma-assisted reactive pulsed-DC magnetron sputtering. The effects of the duty cycle at the pulsed-DC voltage applied to the Al target on the properties of AlN films formed via inductively coupled plasma (ICP)-enhanced pulsed-DC magnetron sputtering deposition were investigated. With decreasing duty cycle at the target voltage, the peak intensity of AlN(0002) increased linearly. The surface roughness of AlN films decreased since there was an increase in film density owing to the impact of energetic ions on the films together with the enhancement of nitriding associated with the relative increase in N radical flux. The improvement of both the crystallinity and surface morphology of AlN films at low temperatures is considered to be caused by the difference between the relative flux values of ions and sputtered atoms.

  14. Separations of corticosteroids using electrochemically modulated liquid chromatography: Selectivity enhancements at a porous graphitic carbon stationary phase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ting, E.Y.; Porter, M.D.

    Electrochemically modulated liquid chromatography has been applied to the separation of a mixture of structurally similar corticosteroids (i.e., prednisone, prednisolone, cortisone, and hydrocortisone) using a porous graphitic carbon stationary phase. Changes in the voltage applied to the column markedly affected the efficiency as well as the elution order of the separation, with the mixture fully resolved at large negative values of applied potential. Mechanistic aspects in terms of the influence of changes in the applied voltage on the extent of the interactions between these analytes and the stationary phase are briefly discussed. 19 refs., 2 figs.

  15. Highly sensitive, self-powered and wearable electronic skin based on pressure-sensitive nanofiber woven fabric sensor.

    PubMed

    Zhou, Yuman; He, Jianxin; Wang, Hongbo; Qi, Kun; Nan, Nan; You, Xiaolu; Shao, Weili; Wang, Lidan; Ding, Bin; Cui, Shizhong

    2017-10-11

    The wearable electronic skin with high sensitivity and self-power has shown increasing prospects for applications such as human health monitoring, robotic skin, and intelligent electronic products. In this work, we introduced and demonstrated a design of highly sensitive, self-powered, and wearable electronic skin based on a pressure-sensitive nanofiber woven fabric sensor fabricated by weaving PVDF electrospun yarns of nanofibers coated with PEDOT. Particularly, the nanofiber woven fabric sensor with multi-leveled hierarchical structure, which significantly induced the change in contact area under ultra-low load, showed combined superiority of high sensitivity (18.376 kPa -1 , at ~100 Pa), wide pressure range (0.002-10 kPa), fast response time (15 ms) and better durability (7500 cycles). More importantly, an open-circuit voltage signal of the PPNWF pressure sensor was obtained through applying periodic pressure of 10 kPa, and the output open-circuit voltage exhibited a distinct switching behavior to the applied pressure, indicating the wearable nanofiber woven fabric sensor could be self-powered under an applied pressure. Furthermore, we demonstrated the potential application of this wearable nanofiber woven fabric sensor in electronic skin for health monitoring, human motion detection, and muscle tremor detection.

  16. Ion detection device and method with compressing ion-beam shutter

    DOEpatents

    Sperline, Roger P [Tucson, AZ

    2009-05-26

    An ion detection device, method and computer readable medium storing instructions for applying voltages to shutter elements of the detection device to compress ions in a volume defined by the shutter elements and to output the compressed ions to a collector. The ion detection device has a chamber having an inlet and receives ions through the inlet, a shutter provided in the chamber opposite the inlet and configured to allow or prevent the ions to pass the shutter, the shutter having first and second shutter elements, a collector provided in the chamber opposite the shutter and configured to collect ions passed through the shutter, and a processing unit electrically connected to the first and second shutter elements. The processing unit applies, during a first predetermined time interval, a first voltage to the first shutter element and a second voltage to the second shutter element, the second voltage being lower than the first voltage such that ions from the inlet enter a volume defined by the first and second shutter elements, and during a second predetermined time interval, a third voltage to the first shutter element, higher than the first voltage, and a fourth voltage to the second shutter element, the third voltage being higher than the fourth voltage such that ions that entered the volume are compressed as the ions exit the volume and new ions coming from the inlet are prevented from entering the volume. The processing unit is electrically connected to the collector and configured to detect the compressed ions based at least on a current received from the collector and produced by the ions collected by the collector.

  17. New Insights into the Operating Voltage of Aqueous Supercapacitors.

    PubMed

    Yu, Minghao; Lu, Yongzhuang; Zheng, Haibing; Lu, Xihong

    2018-03-12

    The main limitation of aqueous supercapacitors (SCs) lies in their narrow operating voltages, especially when compared with organic SCs. Fundamental understanding of factors relevant to the operating voltage helps providing guidance for the assembly of high-voltage aqueous SCs. In this regard, this concept analyzes the deciding factors for the operating voltage of aqueous SCs. Strategies applied to expand the operating voltage are summarized and discussed from the aspects of electrolyte, electrode, and asymmetric structure. Dynamic factors associated with water electrolysis and maximally using the available potential ranges of electrodes are particularly emphasized. Finally, other promising approaches that have not been explored and their challenges are also elaborated, hoping to provide more insights for the design of high-voltage aqueous SCs. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Effect of Voltage and Flow Rate Electrospinning Parameters on Polyacrylonitrile Electrospun Fibers

    NASA Astrophysics Data System (ADS)

    Bakar, S. S. S.; Fong, K. C.; Eleyas, A.; Nazeri, M. F. M.

    2018-03-01

    Currently, electrospinning is a very famous technique and widely used for forming polymer nanofibers. In this paper, the Polyacrylonitrile (PAN) nanofibers were prepared in concentration of 10wt% with varied processing parameters that can affect the properties of PAN fiber in term of fiber diameter and electrical conductivity was presented. Voltage of 10, 15 and 20 kV with PAN flow rate of 1 electrospun PAN fibers were then undergo pyrolysis at 800°C for 30 minutes. The resultant PAN nanofibers were then analysed by SEM, XRD and four point probe test after pyrolysis process. SEM image show continuos uniform and smooth surface fibrous structure of electrospun PAN fibers with average diameter of 1.81 μm. The fiber morphology is controlled by manipulating the processing parameters of electrospinning process. The results showed that the resistance of electrospun PAN fibers decreases as the processing parameter changes by increasing the applied voltage and flow rate of electrospinning.

  19. Thin film electroluminescent cells on the basis of Ce-doped CaGa2S4 and SrGa2S4 prepared by flash evaporation method

    NASA Astrophysics Data System (ADS)

    Gambarov, E.; Bayramov, A.; Kato, A.; Iida, S.

    2006-09-01

    Ce-doped CaGa2S4 and SrGa2S4 thin film electroluminescent (TFEL) devices were prepared for the first time on the basis of films deposited by flash evaporation method. Significant crystallization, stoichiometry improvement of the films and increase of photoluminescence intensity were found after annealing in H2S and O2 gas stream. EL spectra of the cells exhibited the characteristic double-band emission similar to that seen for Ce3+ activated CaGa2S4 and SrGa2S4 films under photon excitation. Applied voltage and frequency dependences of the electroluminescence were studied. Low voltage operation as low as 20 V was observed for these cells. Luminance of about 4 cd/m2 at 100 V operating voltage with 2.5 kHz frequency was achieved for the TFEL cell with films annealed in O2 gas stream.

  20. Temporal resistance variation of the second generation HTS tape during superconducting-to-normal state transition.

    PubMed

    Malginov, Vladimir A; Malginov, Andrey V; Fleishman, Leonid S

    2013-01-01

    The quench process in high-temperature superconducting (HTS) wires plays an important role in superconducting power devices, such as fault current limiters, magnets, cables, etc. The superconducting device should survive after the overheating due to quench. We studied the evolution of the resistance of the YBCO tape wire during the quench process with 1 ms time resolution for various excitation voltages. The resistive normal zone was found to be located in a domain of about 1-4 cm long. The normal state nucleation begins in 40-60 ms after voltage is applied across the HTS tape. In subsequent 200-300 ms other normal state regions appear. The normal domain heating continues in the following 5-10s that results in a factor of 2-3 increase of its resistance. Formation of the normal domain during the quench process follows the same stages for different excitation voltages. Characteristic domain sizes, lifetimes and temperatures are determined for all stages.

Top