Protection and synergism by recombinant fowl pox vaccines expressing multiple genes from Marek's disease virus.

PubMed

Lee, Lucy E; Witter, R L; Reddy, S M; Wu, P; Yanagida, N; Yoshida, S

2003-01-01

Recombinant fowl poxviruses (rFPVs) were constructed to express genes from serotype 1 Marek's disease virus (MDV) coding for glycoproteins B, E, I, H, and UL32 (gB1, gE, gI, gH, and UL32). An additional rFPV was constructed to contain four MDV genes (gB1, gE, gI, and UL32). These rFPVs were evaluated for their ability to protect maternal antibody-positive chickens against challenge with highly virulent MDV isolates. The protection induced by a single rFPV/gB1 (42%) confirmed our previous finding. The protection induced by rFPV/gI (43%), rFPV/gB1UL32 (46%), rFPV/gB1gEgI (72%), and rFPV/gB1gEgIUL32 (70%) contributed to additional knowledge on MDV genes involved in protective immunity. In contrast, the rFPV containing gE, gH, or UL32 did not induce significant protection compared with turkey herpesvirus (HVT). Levels of protection by rFPV/gB1 and rFPV/gl were comparable with that of HVT. Only gB1 and gI conferred synergism in rFPV containing these two genes. Protection by both rFPV/gB1gEgI (72%) and rFPV/gB1gEgIUL32(70%) against Marek's disease was significantly enhanced compared with a single gB1 or gI gene (40%). This protective synergism between gB1 and gI in rFPVs may be the basis for better protection when bivalent vaccines between serotypes 2 and 3 were used. When rFPV/gB1gIgEUL32 + HVT were used as vaccine against Md5 challenge, the protection was significantly enhanced (94%). This synergism between rFPV/gB1gIgEUL32 and HVT indicates additional genes yet to be discovered in HVT may be responsible for the enhancement.

rBCG30-Induced Immunity and Cross-Protection against Mycobacterium leprae Challenge Are Enhanced by Boosting with the Mycobacterium tuberculosis 30-Kilodalton Antigen 85B

PubMed Central

Gillis, Thomas P.; Tullius, Michael V.

2014-01-01

Leprosy remains a major global health problem and typically occurs in regions in which tuberculosis is endemic. Vaccines are needed that protect against both infections and do so better than the suboptimal Mycobacterium bovis BCG vaccine. Here, we evaluated rBCG30, a vaccine previously demonstrated to induce protection superior to that of BCG against Mycobacterium tuberculosis and Mycobacterium bovis challenge in animal models, for efficacy against Mycobacterium leprae challenge in a murine model of leprosy. rBCG30 overexpresses the M. tuberculosis 30-kDa major secretory protein antigen 85B, which is 85% homologous with the M. leprae homolog (r30ML). Mice were sham immunized or immunized intradermally with BCG or rBCG30 and challenged 2.5 months later by injection of viable M. leprae into each hind footpad. After 7 months, vaccine efficacy was assessed by enumerating the M. leprae bacteria per footpad. Both BCG and rBCG30 induced significant protection against M. leprae challenge. In the one experiment in which a comparison between BCG and rBCG30 was feasible, rBCG30 induced significantly greater protection than did BCG. Immunization of mice with purified M. tuberculosis or M. leprae antigen 85B also induced protection against M. leprae challenge but less so than BCG or rBCG30. Notably, boosting rBCG30 with M. tuberculosis antigen 85B significantly enhanced r30ML-specific immune responses, substantially more so than boosting BCG, and significantly augmented protection against M. leprae challenge. Thus, rBCG30, a vaccine that induces improved protection against M. tuberculosis, induces cross-protection against M. leprae that is comparable or potentially superior to that induced by BCG, and boosting rBCG30 with antigen 85B further enhances immune responses and protective efficacy. PMID:25001602

rBCG30-induced immunity and cross-protection against Mycobacterium leprae challenge are enhanced by boosting with the Mycobacterium tuberculosis 30-kilodalton antigen 85B.

PubMed

Gillis, Thomas P; Tullius, Michael V; Horwitz, Marcus A

2014-09-01

Leprosy remains a major global health problem and typically occurs in regions in which tuberculosis is endemic. Vaccines are needed that protect against both infections and do so better than the suboptimal Mycobacterium bovis BCG vaccine. Here, we evaluated rBCG30, a vaccine previously demonstrated to induce protection superior to that of BCG against Mycobacterium tuberculosis and Mycobacterium bovis challenge in animal models, for efficacy against Mycobacterium leprae challenge in a murine model of leprosy. rBCG30 overexpresses the M. tuberculosis 30-kDa major secretory protein antigen 85B, which is 85% homologous with the M. leprae homolog (r30ML). Mice were sham immunized or immunized intradermally with BCG or rBCG30 and challenged 2.5 months later by injection of viable M. leprae into each hind footpad. After 7 months, vaccine efficacy was assessed by enumerating the M. leprae bacteria per footpad. Both BCG and rBCG30 induced significant protection against M. leprae challenge. In the one experiment in which a comparison between BCG and rBCG30 was feasible, rBCG30 induced significantly greater protection than did BCG. Immunization of mice with purified M. tuberculosis or M. leprae antigen 85B also induced protection against M. leprae challenge but less so than BCG or rBCG30. Notably, boosting rBCG30 with M. tuberculosis antigen 85B significantly enhanced r30ML-specific immune responses, substantially more so than boosting BCG, and significantly augmented protection against M. leprae challenge. Thus, rBCG30, a vaccine that induces improved protection against M. tuberculosis, induces cross-protection against M. leprae that is comparable or potentially superior to that induced by BCG, and boosting rBCG30 with antigen 85B further enhances immune responses and protective efficacy. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Protective and therapeutic effects of an extract mixture of alder tree, labiate herb, milk thistle green bean-rice bran fermentation, and turnip against ethanol-induced toxicity in the rat

PubMed Central

Baek, Min-Won; Seok, Seung-Hyeok; Lee, Hui-Young; Kim, Dong Jae; Lee, Byoung-Hee; Ahn, Young-Tae; Lim, Kwang-Sei; Huh, Chul-Sung

2008-01-01

An herbal extract mixture and yogurt added to the herbal extract mixture were tested for their protective and therapeutic effects on ethanol-induced liver injury. The herbal extract mixture, yogurt and commercial drugs were used for treatment for two weeks prior to administering a single oral dose of ethanol (3 g/kg body weight). The herbal extract mixture and yogurt added to the herbal extract mixture were found to provide protection against ethanol-induced toxicity comparable to the commercial drug treatment, according to the serum and histopathological analysis. It was also shown that co-treatment with herbal extract mixture and yogurt against a triple oral dose of ethanol (2 g/kg body weight, over one week) provided protection against ethanol toxicity. After the initial set of experiments, the herbal extract mixture and yogurt treatments were extended for three more weeks. When compared to the positive control, further treatment with both the herbal extract and yogurt significantly reduced liver injury and resulted in a lower grade of lipid deposition. PMID:18296886

Supplementation of H1N1pdm09 split vaccine with heterologous tandem repeat M2e5x virus-like particles confers improved cross-protection in ferrets.

PubMed

Music, Nedzad; Reber, Adrian J; Kim, Min-Chul; York, Ian A; Kang, Sang-Moo

2016-01-20

Current influenza vaccines induce strain-specific immunity to the highly variable hemagglutinin (HA) protein. It is therefore a high priority to develop vaccines that induce broadly cross-protective immunity to different strains of influenza. Since influenza A M2 proteins are highly conserved among different strains, five tandem repeats of the extracellular peptide of M2 in a membrane-anchored form on virus-like particles (VLPs) have been suggested to be a promising candidate for universal influenza vaccine. In this study, ferrets were intramuscularly immunized with 2009 H1N1 split HA vaccine ("Split") alone, influenza split vaccine supplemented with M2e5x VLP ("Split+M2e5x"), M2e5x VLP alone ("M2e5x"), or mock immunized. Vaccine efficacy was measured serologically and by protection against a serologically distinct viral challenge. Ferrets immunized with Split+M2e5x induced HA strain specific and conserved M2e immunity. Supplementation of M2e5x VLP to split vaccination significantly increased the immunogenicity of split vaccine compared to split alone. The Split+M2e5x ferret group showed evidence of cross-reactive protection, including faster recovery from weight loss, and reduced inflammation, as inferred from changes in peripheral leukocyte subsets, compared to mock-immunized animals. In addition, ferrets immunized with Split+M2e5x shed lower viral nasal-wash titers than the other groups. Ferrets immunized with M2e5x alone also show some protective effects, while those immunized with split vaccine alone induced no protective effects compared to mock-immunized ferrets. These studies suggest that supplementation of split vaccine with M2e5x-VLP may provide broader and improved cross-protection than split vaccine alone. Published by Elsevier Ltd.

Supplementation of H1N1pdm09 split vaccine with heterologous tandem repeat M2e5x virus-like particles confers improved cross-protection in ferrets

PubMed Central

Music, Nedzad; Reber, Adrian J.; Kim, Min-Chul; York, Ian A.; Kang, Sang-Moo

2015-01-01

Current influenza vaccines induce strain-specific immunity to the highly variable hemagglutinin (HA) protein. It is therefore a high priority to develop vaccines that induce broadly cross-protective immunity to different strains of influenza. Since influenza A M2 proteins are highly conserved among different strains, five tandem repeats of the extracellular peptide of M2 in a membrane-anchored form on virus-like particles (VLPs) have been suggested to be a promising candidate for universal influenza vaccine. In this study, ferrets were intramuscularly immunized with 2009 H1N1 split HA vaccine (“Split”) alone, influenza split vaccine supplemented with M2e5x VLP (“Split+M2e5x”), M2e5x VLP alone (“M2e5x”), or mock immunized. Vaccine efficacy was measured serologically and by protection against a serologically distinct viral challenge. Ferrets immunized with Split+M2e5x induced HA strain specific and conserved M2e immunity. Supplementation of M2e5x VLP to split vaccination significantly increased the immunogenicity of split vaccine compared to split alone. The Split+M2e5x ferret group showed evidence of cross-reactive protection, including faster recovery from weight loss, and reduced inflammation, as inferred from changes in peripheral leukocyte subsets, compared to mock-immunized animals. In addition, ferrets immunized with Split+M2e5x shed lower viral nasal-wash titers than the other groups. Ferrets immunized with M2e5x alone also show some protective effects, while those immunized with split vaccine alone induced no protective effects compared to mock-immunized ferrets. These studies suggest that supplementation of split vaccine with M2e5x-VLP may provide broader and improved cross-protection than split vaccine alone. PMID:26709639

Ovariectomized Highly Fit Rats Are Protected against Diet-Induced Insulin Resistance.

PubMed

Park, Young-Min; Kanaley, Jill A; Zidon, Terese M; Welly, Rebecca J; Scroggins, Rebecca J; Britton, Steven L; Koch, Lauren G; Thyfault, John P; Booth, Frank W; Padilla, Jaume; Vieira-Potter, Victoria J

2016-07-01

In the absence of exercise training, rats selectively bred for high intrinsic aerobic capacity (high-capacity running (HCR)) are protected against ovariectomy (OVX)-induced insulin resistance (IR) and obesity compared with those bred for low intrinsic aerobic capacity (low-capacity running (LCR)). This study determined whether OVX HCR rats remain protected with exposure to high-fat diet (HFD) compared with OVX LCR rats. Female HCR and LCR rats (n = 36; age, 27-33 wk) underwent OVX and were randomized to a standard chow diet (NC, 5% kcal fat) or HFD (45% kcal fat) ad libitum for 11 wk. Total energy expenditure, resting energy expenditure, spontaneous physical activity (SPA), and glucose tolerance were assessed midway, whereas fasting circulating metabolic markers, body composition, adipose tissue distribution, and skeletal muscle adenosine monophosphate-activated protein kinase (AMPK), and mitochondrial markers were assessed at sacrifice. Both HCR and LCR rats experienced HFD-induced increases in total and visceral adiposity after OVX. Despite similar gains in adiposity, HCR rats were protected from HFD-induced IR and reduced total energy expenditure observed in LCR rats (P < 0.05). This metabolic protection was likely attributed to a compensatory increase in SPA and associated preservation of skeletal muscle AMPK activity in HCR; however, HFD significantly reduced SPA and AMPK activity in LCR (P < 0.05). In both lines, HFD reduced citrate synthase activity, gene expression of markers of mitochondrial biogenesis (tFAM, NRF1, and PGC-1α), and protein levels of mitochondrial oxidative phosphorylation complexes I, II, IV, and V in skeletal muscle (all P < 0.05). After OVX, HCR and LCR rats differentially respond to HFD such that HCR increase while LCR decrease SPA. This "physical activity compensation" likely confers protection from HFD-induced IR and reduced energy expenditure in HCR rats.

Protective effects of naringin against gp120-induced injury mediated by P2X7 receptors in BV2 microglial cells.

PubMed

Chen, Q; Hu, J; Qin, S S; Liu, C L; Wu, H; Wang, J R; Lu, X M; Wang, J; Chen, G Q; Liu, Y; Liu, B Y; Xu, C S; Liang, S D

2016-05-13

This study was aimed at exploring the effects of P2X7 receptors on gp120-induced injury and naringin's protective effects against gp120-induced injury in BV2 microglia. BV2 microglia injury model was established by gp120 treatment and MTS assay was used to verify whether naringin has a cell-protective effect against gp120-induced injury. Changes in P2X7 receptor expression were assayed using RT-PCR, qPCR, and western blot. Results showed that the ODs of the Ctrl, gp120, gp120+naringin, and gp120+BBG groups were 0.91 ± 0.10, 0.71 ± 0.09, 0.83 ± 0.10, and 0.83 ± 0.10, respectively. Compared to the control group, the gp120 group showed a significantly decreased cell survival rate. Cell survival rates of the gp120+naringin group increased significantly compared to those of the gp120 group, while no difference was observed when compared to the gp120+BBG group. The relative P2X7 mRNA expression levels in the Ctrl, gp120, gp120+naringin, and gp120+BBG groups were 0.73 ± 0.06, 1.05 ± 0.06, 0.78 ± 0.05, and 0.81 ± 0.04, respectively. The corresponding P2X7 protein expression levels were 0.46 ± 0.04, 0.79 ± 0.04, 0.38 ± 0.07, and 0.42 ± 0.06. P2X7 mRNA and protein expression in the gp120 group increased significantly compared to those in the control group, and declined in the gp120+naringin group compared to those in the gp120 group. Therefore, P2X7 receptors might be involved in gp120-induced injury in BV2 microglia, and naringin might play a protective role by inhibiting the up-regulated expression of P2X7 receptors.

Establishment of a methodology for investigating protectants against ethanol-induced hepatotoxicity.

PubMed

Ruan, Xueqing; Shen, Chong; Meng, Qin

2010-05-01

Ethanol-induced liver injury has been extensively reported in clinic, but still lacks an efficient in vitro platform for investigating its hepatotoxicity and protectants. This study aimed to establish a methodology on the culture conditions regarding the sealability against evaporation of ethanol, culture medium and 2D/3D culture of hepatocytes. Based on the experimental findings, it was indicated that the ethanol evaporation from culture plates was a severe problem reducing its toxicity in hepatocyte. According to the detected ethanol toxic response marked by reduced cell viability, 3D cultured hepatocytes in gel entrapment were suggested to be better than 2D hepatocyte in monolayer, but the cultures in either William's Medium E or DMEM exhibited comparable sensitivity to ethanol toxicity. Subsequently, 3D cultured hepatocytes with Parafilm sealing were systematically illustrated to well reflect the ethanol-induced lipid accumulation, reactive oxygen species/malondialdehyde generation, glutathione depletion and cytochrome 2E1 induction. Finally, such hepatocyte models were proposed as a platform for screening of herbal component against ethanol hepatotoxicity. Nano-silibinin, for the first time, found to perform significant protection against ethanol-induced hepatotoxicity while silibinin in normal particles could not inhibit such toxicity. This protection of nano-silibinin might relate to its improved bioavailability compared to normal insoluble silibinin and could act as an anti-oxidative and anti-steatosis agent against ethanol-induced hepatotoxicity. Copyright (c) 2010. Published by Elsevier Ltd.

Protective effect of rare earth against oxidative stress under ultraviolet-B radiation.

PubMed

Wang, Lihong; Huang, Xiaohua; Zhou, Qing

2009-04-01

The effects of lanthanum (III) (La(III)) in protecting soybean leaves against oxidative stress induced by ultraviolet-B (UV-B) radiation were investigated. The increase in contents of hydrogen peroxide (H(2)O(2)) and superoxide (O2*-) due to UV-B radiation suggested oxidative stress. The increase in the content of malondialdehyde (MDA) and the decrease in the index of unsaturated fatty acid (IUFA) indicated oxidative damage on cell membrane induced by UV-B radiation. La(III) partially reversed UV-B-radiation-induced damage of plant growth. The reduction in the contents of H(2)O(2), O2*-, and MDA and increase in the content of IUFA, compared with UV-B treatment, also indicated that La(III) alleviated the oxidative damage induced by UV-B radiation. The increase in the activities of superoxide dismutase and peroxidase and the contents of ascorbate, carotenoids, and flavonoids were observed in soybean leaves with La(III) + UV-B treatment, compared with UV-B treatment. Our data suggested that La(III) could protect soybean plants from UV-B-radiation-induced oxidative stress by reacting with reactive oxygen species directly or by improving the defense system of plants.

Ameliorative Effect of Chronic Supplementation of Protocatechuic Acid Alone and in Combination with Ascorbic Acid in Aniline Hydrochloride Induced Spleen Toxicity in Rats.

PubMed

Khairnar, Upasana; Upaganlawar, Aman; Upasani, Chandrashekhar

2016-01-01

Background. Present study was designed to evaluate the protective effects of protocatechuic acid alone and in combination with ascorbic acid in aniline hydrochloride induced spleen toxicity in rats. Materials and Methods. Male Wistar rats of either sex (200-250 g) were used and divided into different groups. Spleen toxicity was induced by aniline hydrochloride (100 ppm) in drinking water for a period of 28 days. Treatment group received protocatechuic acid (40 mg/kg/day, p.o.), ascorbic acid (40 mg/kg/day, p.o.), and combination of protocatechuic acid (20 mg/kg/day, p.o.) and ascorbic acid (20 mg/kg/day, p.o.) followed by aniline hydrochloride. At the end of treatment period serum and tissue parameters were evaluated. Result. Rats supplemented with aniline hydrochloride showed a significant alteration in body weight, spleen weight, feed consumption, water intake, hematological parameters (haemoglobin content, red blood cells, white blood cells, and total iron content), tissue parameters (lipid peroxidation, reduced glutathione, and nitric oxide content), and membrane bound phosphatase (ATPase) compared to control group. Histopathology of aniline hydrochloride induced spleen showed significant damage compared to control rats. Treatment with protocatechuic acid along with ascorbic acid showed better protection as compared to protocatechuic acid or ascorbic acid alone in aniline hydrochloride induced spleen toxicity. Conclusion. Treatment with protocatechuic acid and ascorbic acid in combination showed significant protection in aniline hydrochloride induced splenic toxicity in rats.

Near infrared radiation protects against oxygen-glucose deprivation-induced neurotoxicity by down-regulating neuronal nitric oxide synthase (nNOS) activity in vitro.

PubMed

Yu, Zhanyang; Li, Zhaoyu; Liu, Ning; Jizhang, Yunneng; McCarthy, Thomas J; Tedford, Clark E; Lo, Eng H; Wang, Xiaoying

2015-06-01

Near infrared radiation (NIR) has been shown to be neuroprotective against neurological diseases including stroke and brain trauma, but the underlying mechanisms remain poorly understood. In the current study we aimed to investigate the hypothesis that NIR may protect neurons by attenuating oxygen-glucose deprivation (OGD)-induced nitric oxide (NO) production and modulating cell survival/death signaling. Primary mouse cortical neurons were subjected to 4 h OGD and NIR was applied at 2 h reoxygenation. OGD significantly increased NO level in primary neurons compared to normal control, which was significantly ameliorated by NIR at 5 and 30 min post-NIR. Neither OGD nor NIR significantly changed neuronal nitric oxide synthase (nNOS) mRNA or total protein levels compared to control groups. However, OGD significantly increased nNOS activity compared to normal control, and this effect was significantly diminished by NIR. Moreover, NIR significantly ameliorated the neuronal death induced by S-Nitroso-N-acetyl-DL-penicillamine (SNAP), a NO donor. Finally, NIR significantly rescued OGD-induced suppression of p-Akt and Bcl-2 expression, and attenuated OGD-induced upregulation of Bax, BAD and caspase-3 activation. These results suggest NIR may protect against OGD at least partially through reducing NO production by down-regulating nNOS activity, and modulating cell survival/death signaling.

Vaccine-Induced Immunogenicity and Protection Against Pneumocystis Pneumonia in a Nonhuman Primate Model of HIV and Pneumocystis Coinfection

PubMed Central

Kling, Heather M.; Norris, Karen A.

2016-01-01

Background. The ubiquitous opportunistic pathogen Pneumocystis jirovecii causes pneumonia in immunocompromised individuals, including human immunodeficiency virus (HIV)–infected individuals, and pulmonary colonization with P. jirovecii is believed to be a cofactor in the development of chronic obstructive pulmonary disease. There is no vaccine for P. jirovecii; however, most adults are seropositive, indicating natural immune priming to this pathogen. We have shown that humoral response to a recombinant subunit of the P. jirovecii protease kexin (KEX1) correlates with protection from P. jirovecii colonization and pneumonia. Methods. Here we evaluated the immunogenicity and protective capacity of the recombinant KEX1 peptide vaccine in a preclinical, nonhuman primate model of HIV-induced immunosuppression and Pneumocystis coinfection. Results. Immunization with KEX1 induced a robust humoral response remained at protective levels despite chronic simian immunodeficiency virus/HIV–induced immunosuppression. KEX1-immunized macaques were protected from Pneumocystis pneumonia, compared with mock-immunized animals (P = .047), following immunosuppression and subsequent natural, airborne exposure to Pneumocystis. Conclusions. These data support the concept that stimulation of preexisting immunological memory to Pneumocystis with a recombinant KEX1 vaccine prior to immunosuppression induces durable memory responses and protection in the context of chronic, complex immunosuppression. PMID:26823337

Unraveling the mechanism of neuroprotection of curcumin in arsenic induced cholinergic dysfunctions in rats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srivastava, Pranay; Yadav, Rajesh S.; Department of Crimnology and Forensic Science, Harisingh Gour University, Sagar 470 003

Earlier, we found that arsenic induced cholinergic deficits in rat brain could be protected by curcumin. In continuation to this, the present study is focused to unravel the molecular mechanisms associated with the protective efficacy of curcumin in arsenic induced cholinergic deficits. Exposure to arsenic (20 mg/kg body weight, p.o) for 28 days in rats resulted to decrease the expression of CHRM2 receptor gene associated with mitochondrial dysfunctions as evident by decrease in the mitochondrial membrane potential, activity of mitochondrial complexes and enhanced apoptosis both in the frontal cortex and hippocampus in comparison to controls. The ultrastructural images of arsenicmore » exposed rats, assessed by transmission electron microscope, exhibited loss of myelin sheath and distorted cristae in the mitochondria both in the frontal cortex and hippocampus as compared to controls. Simultaneous treatment with arsenic (20 mg/kg body weight, p.o) and curcumin (100 mg/kg body weight, p.o) for 28 days in rats was found to protect arsenic induced changes in the mitochondrial membrane potential and activity of mitochondrial complexes both in frontal cortex and hippocampus. Alterations in the expression of pro- and anti-apoptotic proteins and ultrastructural damage in the frontal cortex and hippocampus following arsenic exposure were also protected in rats simultaneously treated with arsenic and curcumin. The data of the present study reveal that curcumin could protect arsenic induced cholinergic deficits by modulating the expression of pro- and anti-apoptotic proteins in the brain. More interestingly, arsenic induced functional and ultrastructural changes in the brain mitochondria were also protected by curcumin. - Highlights: • Neuroprotective mechanism of curcumin in arsenic induced cholinergic deficits studied • Curcumin protected arsenic induced enhanced expression of stress markers in rat brain • Arsenic compromised mitochondrial electron transport chain protected by curcumin • Functional and structural changes in mitochondria by arsenic protected by curcumin.« less

Protective effects of Mangifera indica L. extract, mangiferin and selected antioxidants against TPA-induced biomolecules oxidation and peritoneal macrophage activation in mice.

PubMed

Sánchez, G M; Re, L; Giuliani, A; Núñez-Sellés, A J; Davison, G P; León-Fernández, O S

2000-12-01

We compared the protective abilities of Mangifera indica L. stem bark extract (Vimang) 50-250 mgkg(-1), mangiferin 50 mgkg(-1), vitamin C 100 mgkg(-1), vitamin E 100 mgkg(-1)and beta -carotene 50 mgkg(-1)against the 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced oxidative damage in serum, liver, brain as well as in the hyper-production of reactive oxygen species (ROS) by peritoneal macrophages. The treatment of mice with Vimang, vitamin E and mangiferin reduced the TPA-induced production of ROS by the peritoneal macrophages by 70, 17 and 44%, respectively. Similarly, the H(2)O(2)levels were reduced by 55-73, 37 and 40%, respectively, when compared to the control group. The TPA-induced sulfhydryl group loss in liver homogenates was attenuated by all the tested antioxidants. Vimang, mangiferin, vitamin C plus E and beta -carotene decreased TPA-induced DNA fragmentation by 46-52, 35, 42 and 17%, respectively, in hepatic tissues, and by 29-34, 22, 41 and 17%, in brain tissues. Similar results were observed in respect to lipid peroxidation in serum, in hepatic mitochondria and microsomes, and in brain homogenate supernatants. Vimang exhibited a dose-dependent inhibition of TPA-induced biomolecule oxidation and of H(2)O(2)production by peritoneal macrophages. Even if Vimang, as well as other antioxidants, provided significant protection against TPA-induced oxidative damage, the former lead to better protection when compared with the other antioxidants at the used doses. Furthermore, the results indicated that Vimang is bioavailable for some vital target organs, including liver and brain tissues, peritoneal exudate cells and serum. Therefore, we conclude that Vimang could be useful to prevent the production of ROS and the oxidative tissue damages in vivo. Copyright 2000 Academic Press.

Normal Cellular Prion Protein Protects against Manganese-induced Oxidative Stress and Apoptotic Cell Death

PubMed Central

Choi, Christopher J.; Anantharam, Vellareddy; Saetveit, Nathan J.; Houk, Robert. S.; Kanthasamy, Arthi; Kanthasamy, Anumantha G.

2012-01-01

The normal prion protein is abundantly expressed in the CNS, but its biological function remains unclear. The prion protein has octapeptide repeat regions that bind to several divalent metals, suggesting that the prion proteins may alter the toxic effect of environmental neurotoxic metals. In the present study, we systematically examined whether prion protein modifies the neurotoxicity of manganese (Mn) by comparing the effect of Mn on mouse neural cells expressing prion protein (PrPC -cells) and prion-knockout (PrPKO -cells). Exposure to Mn (10 μM-1 mM) for 24 hr produced a dose-dependent cytotoxic response in both PrPC -cells and PrPKO -cells. Interestingly, PrPC -cells (EC50 117.6μM) were more resistant to Mn-induced cytotoxicity, as compared to PrPKO -cells (EC50 59.9μM), suggesting a protective role for PrPC against Mn neurotoxicity. Analysis of intracellular Mn levels showed less Mn accumulation in PrPC -cells as compared to PrPKO -cells. Furthermore, Mn-induced mitochondrial depolarization and ROS generation were significantly attenuated in PrPC -cells as compared to PrPKO -cells. Measurement of antioxidant status revealed similar basal levels of glutathione (GSH) in PrPC -cells and PrPKO -cells; however, Mn treatment caused greater depletion of GSH in PrPKO -cells. Mn-induced mitochondrial depolarization and ROS production were followed by time- and dose-dependent activation of the apoptotic cell death cascade involving caspase-9 and -3. Notably, DNA fragmentation induced by both Mn treatment and oxidative stress-inducer hydrogen peroxide (100μM) was significantly suppressed in PrPC -cells as compared to PrPKO -cells. Together, these results demonstrate that prion protein interferes with divalent metal Mn uptake and protects against Mn-induced oxidative stress and apoptotic cell death. PMID:17483122

Parkin regulates mitophagy and mitochondrial function to protect against alcohol-induced liver injury and steatosis in mice.

PubMed

Williams, Jessica A; Ni, Hong-Min; Ding, Yifeng; Ding, Wen-Xing

2015-09-01

Alcoholic liver disease claims two million lives per year. We previously reported that autophagy protected against alcohol-induced liver injury and steatosis by removing damaged mitochondria. However, the mechanisms for removal of these mitochondria are unknown. Parkin is an evolutionarily conserved E3 ligase that is recruited to damaged mitochondria to initiate ubiquitination of mitochondrial outer membrane proteins and subsequent mitochondrial degradation by mitophagy. In addition to its role in mitophagy, Parkin has been shown to have other roles in maintaining mitochondrial function. We investigated whether Parkin protected against alcohol-induced liver injury and steatosis using wild-type (WT) and Parkin knockout (KO) mice treated with alcohol by the acute-binge and Gao-binge (chronic plus acute-binge) models. We found that Parkin protected against liver injury in both alcohol models, likely because of Parkin's role in maintaining a population of healthy mitochondria. Alcohol caused greater mitochondrial damage and oxidative stress in Parkin KO livers compared with WT livers. After alcohol treatment, Parkin KO mice had severely swollen and damaged mitochondria that lacked cristae, which were not seen in WT mice. Furthermore, Parkin KO mice had decreased mitophagy, β-oxidation, mitochondrial respiration, and cytochrome c oxidase activity after acute alcohol treatment compared with WT mice. Interestingly, liver mitochondria seemed able to adapt to alcohol treatment, but Parkin KO mouse liver mitochondria had less capacity to adapt to Gao-binge treatment compared with WT mouse liver mitochondria. Overall, our findings indicate that Parkin is an important mediator of protection against alcohol-induced mitochondrial damage, steatosis, and liver injury. Copyright © 2015 the American Physiological Society.

Creatine phosphate disodium salt protects against Dox-induced cardiotoxicity by increasing calumenin.

PubMed

Wang, Yu; Sun, Ying; Guo, Xin; Fu, Yao; Long, Jie; Wei, Cheng-Xi; Zhao, Ming

2018-06-01

Inhibiting endoplasmic reticulum stress (ERS)-induced apoptosis may be a new therapeutic target in cardiovascular diseases. Creatine phosphate disodium salt (CP) has been reported to have cardiovascular protective effect, but its effects on ERS are unknown. The aim of this study was to identify the mechanism by which CP exerts its cardioprotection in doxorubicin (Dox)-induced cardiomyocytes injury. In our study, neonatal rats cardiomyocytes (NRC) was randomly divided into control group, model group, and treatment group. The cell viability and apoptosis were detected. grp78, grp94, and calumenin of the each group were monitored. To investigate the role of calumenin, Dox-induced ERS was compared in control and down-regulated calumenin cardiomyocytes. Our results showed that CP decreased Dox-induced apoptosis and relieved ERS. We found calumenin increased in Dox-induced apoptosis with CP. ERS effector C/EBP homologous protein was down-regulated by CP and it was influenced by calumenin. CP could protect NRC by inhibiting ERS, this mechanisms may be associated with its increasing of calumenin.

Protective effects of platinum nanoparticles against UV-light-induced epidermal inflammation.

PubMed

Yoshihisa, Yoko; Honda, Ayumi; Zhao, Qing-Li; Makino, Teruhiko; Abe, Riichiro; Matsui, Kotaro; Shimizu, Hiroshi; Miyamoto, Yusei; Kondo, Takashi; Shimizu, Tadamichi

2010-11-01

Intracellular reactive oxygen species (ROS) and apoptosis play important roles in the ultraviolet (UV)-induced inflammatory responses in the skin. Metal nanoparticles have been developed to increase the catalytic activity of metals, which is because of the large surface area of smaller particles. Platinum nanoparticles (nano-Pt) protected by poly acrylic acid were manufactured by reduction with ethanol. A marked increase in ROS production was observed in UV-treated HaCaT keratinocytes cell lines, while a decrease in ROS production was observed in nano-Pt-treated cells. Pretreatment of the cells with nano-Pt also caused a significant inhibition of UVB- and UVC-induced apoptosis. Furthermore, we found that mice treated with nano-Pt gel prior to UV irradiation showed significant inhibition of UVB-induced inflammation and UVA-induced photoallergy compared to UV-irradiated control mice. These results suggest that nano-Pt effectively protects against UV-induced inflammation by decreasing ROS production and inhibiting apoptosis in keratinocytes. © 2010 John Wiley & Sons A/S.

Active immunity induced by passive IgG post-exposure protection against ricin.

PubMed

Hu, Charles Chen; Yin, Junfei; Chau, Damon; Cherwonogrodzky, John W; Hu, Wei-Gang

2014-01-21

Therapeutic antibodies can confer an instant protection against biothreat agents when administered. In this study, intact IgG and F(ab')2 from goat anti-ricin hyperimmune sera were compared for the protection against lethal ricin mediated intoxication. Similar ricin-binding affinities and neutralizing activities in vitro were observed between IgG and F(ab')2 when compared at the same molar concentration. In a murine ricin intoxication model, both IgG and F(ab')2 could rescue 100% of the mice by one dose (3 nmol) administration of antibodies 1 hour after 5 × LD50 ricin challenge. Nine days later, when the rescued mice received a second ricin challenge (5 × LD50), only the IgG-treated mice survived; the F(ab')2-treated mice did not. The experimental design excluded the possibility of residual goat IgG responsible for the protection against the second ricin challenge. Results confirmed that the active immunity against ricin in mice was induced quickly following the passive delivery of a single dose of goat IgG post-exposure. Furthermore, it was demonstrated that the induced active immunity against ricin in mice lasted at least 5 months. Therefore, passive IgG therapy not only provides immediate protection to the victim after ricin exposure, but also elicits an active immunity against ricin that subsequently results in long term protection.

Active Immunity Induced by Passive IgG Post-Exposure Protection against Ricin

PubMed Central

Hu, Charles Chen; Yin, Junfei; Chau, Damon; Cherwonogrodzky, John W.; Hu, Wei-Gang

2014-01-01

Therapeutic antibodies can confer an instant protection against biothreat agents when administered. In this study, intact IgG and F(ab’)2 from goat anti-ricin hyperimmune sera were compared for the protection against lethal ricin mediated intoxication. Similar ricin-binding affinities and neutralizing activities in vitro were observed between IgG and F(ab’)2 when compared at the same molar concentration. In a murine ricin intoxication model, both IgG and F(ab’)2 could rescue 100% of the mice by one dose (3 nmol) administration of antibodies 1 hour after 5 × LD50 ricin challenge. Nine days later, when the rescued mice received a second ricin challenge (5 × LD50), only the IgG-treated mice survived; the F(ab’)2-treated mice did not. The experimental design excluded the possibility of residual goat IgG responsible for the protection against the second ricin challenge. Results confirmed that the active immunity against ricin in mice was induced quickly following the passive delivery of a single dose of goat IgG post-exposure. Furthermore, it was demonstrated that the induced active immunity against ricin in mice lasted at least 5 months. Therefore, passive IgG therapy not only provides immediate protection to the victim after ricin exposure, but also elicits an active immunity against ricin that subsequently results in long term protection. PMID:24451844

Protective effects of a novel sea buckthorn wine on oxidative stress and hypercholesterolemia.

PubMed

Negi, Bharti; Kaur, Rajdeep; Dey, Gargi

2013-02-01

We developed a novel sea buckthorn wine containing significant in vitro free radical-scavenging activity. High-performance liquid chromatographic analysis of the sea buckthorn wine revealed that it contains high rutin, myricetin and quercetin levels compared to Cabernet Shiraz wine. In this study, we evaluated the protective effects of sea buckthorn wine against phorone-induced oxidative stress and high-cholesterol diet induced hypercholesterolemia in male LACA mice. Oral administration of sea buckthorn wine increased the redox ratio accompanied by reduction of oxidized glutathione levels leading to attenuation of phorone-induced oxidative stress. Furthermore, the sea buckthorn wine supplementation reduced hepatic lipid peroxidation and increased the superoxide dismutase activity indicating improved resistance to oxidative stress. In addition, high-cholesterol-fed mice administered with sea buckthorn wine exhibited a 197% increase in the HDL-C/LDL-C ratio compared to high-cholesterol diet treated mice. These studies provide important evidence that sea buckthorn wine exerts protective effects against oxidative stress and hypercholesterolemia.

Inactivation of kupffer cells by gadolinium chloride protects murine liver from radiation-induced apoptosis.

PubMed

Du, Shi-Suo; Qiang, Min; Zeng, Zhao-Chong; Ke, Ai-Wu; Ji, Yuan; Zhang, Zheng-Yu; Zeng, Hai-Ying; Liu, Zhongshan

2010-03-15

To determine whether the inhibition of Kupffer cells before radiotherapy (RT) would protect hepatocytes from radiation-induced apoptosis. A single 30-Gy fraction was administered to the upper abdomen of Sprague-Dawley rats. The Kupffer cell inhibitor gadolinium chloride (GdCl3; 10 mg/kg body weight) was intravenously injected 24 h before RT. The rats were divided into four groups: group 1, sham RT plus saline (control group); group 2, sham RT plus GdCl3; group 3, RT plus saline; and group 4, RT plus GdCl3. Liver tissue was collected for measurement of apoptotic cytokine expression and evaluation of radiation-induced liver toxicity by analysis of liver enzyme activities, hepatocyte micronucleus formation, apoptosis, and histologic staining. The expression of interleukin-1beta, interleukin-6, and tumor necrosis factor-alpha was significantly attenuated in group 4 compared with group 3 at 2, 6, 24, and 48 h after injection (p <0.05). At early points after RT, the rats in group 4 exhibited significantly lower levels of liver enzyme activity, apoptotic response, and hepatocyte micronucleus formation compared with those in group 3. Selective inactivation of Kupffer cells with GdCl3 reduced radiation-induced cytokine production and protected the liver against acute radiation-induced damage. Copyright 2010 Elsevier Inc. All rights reserved.

Vaccine-Induced Immunogenicity and Protection Against Pneumocystis Pneumonia in a Nonhuman Primate Model of HIV and Pneumocystis Coinfection.

PubMed

Kling, Heather M; Norris, Karen A

2016-05-15

The ubiquitous opportunistic pathogen Pneumocystis jirovecii causes pneumonia in immunocompromised individuals, including human immunodeficiency virus (HIV)-infected individuals, and pulmonary colonization with P. jirovecii is believed to be a cofactor in the development of chronic obstructive pulmonary disease. There is no vaccine for P. jirovecii; however, most adults are seropositive, indicating natural immune priming to this pathogen. We have shown that humoral response to a recombinant subunit of the P. jirovecii protease kexin (KEX1) correlates with protection from P. jirovecii colonization and pneumonia. Here we evaluated the immunogenicity and protective capacity of the recombinant KEX1 peptide vaccine in a preclinical, nonhuman primate model of HIV-induced immunosuppression and Pneumocystis coinfection. Immunization with KEX1 induced a robust humoral response remained at protective levels despite chronic simian immunodeficiency virus/HIV-induced immunosuppression. KEX1-immunized macaques were protected from Pneumocystis pneumonia, compared with mock-immunized animals (P= .047), following immunosuppression and subsequent natural, airborne exposure to Pneumocystis These data support the concept that stimulation of preexisting immunological memory to Pneumocystis with a recombinant KEX1 vaccine prior to immunosuppression induces durable memory responses and protection in the context of chronic, complex immunosuppression. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Pulmonary delivery of influenza vaccine formulations in cotton rats: site of deposition plays a minor role in the protective efficacy against clinical isolate of H1N1pdm virus.

PubMed

Bhide, Yoshita; Tomar, Jasmine; Dong, Wei; de Vries-Idema, Jacqueline; Frijlink, Henderik W; Huckriede, Anke; Hinrichs, Wouter L J

2018-11-01

Administration of influenza vaccines to the lungs could be an attractive alternative to conventional parenteral administration. In this study, we investigated the deposition site of pulmonary delivered liquid and powder influenza vaccine formulations and its relation to their immunogenicity and protective efficacy. In vivo deposition studies in cotton rats revealed that, the powder formulation was mainly deposited in the trachea ( ∼ 65%) whereas the liquid was homogenously distributed throughout the lungs ( ∼ 96%). In addition, only 60% of the antigen in the powder formulation was deposited in the respiratory tract with respect to the liquid formulation. Immunogenicity studies showed that pulmonary delivered liquid and powder influenza formulations induced robust systemic and mucosal immune responses (significantly higher by liquids than by powders). When challenged with a clinical isolate of homologous H1N1pdm virus, all animals pulmonary administered with placebo had detectable virus in their lungs one day post challenge. In contrast, none of the vaccinated animals had detectable lung virus titers, except for two out of eight animals from the powder immunized group. Also, pulmonary vaccinated animals showed no or little signs of infection like increase in breathing frequency or weight loss upon challenge as compared to animals from the negative control group. In conclusion, immune responses induced by liquid formulation were significantly higher than responses induced by powder formulation, but the overall protective efficacy of both formulations was comparable. Thus, pulmonary immunization is capable of inducing protective immunity and the site of antigen deposition seems to be of minor relevance in inducing protection.

A study of Semen Strychni-induced renal injury and herb-herb interaction of Radix Glycyrrhizae extract and/or Rhizoma Ligustici extract on the comparative toxicokinetics of strychnine and brucine in rats.

PubMed

Gu, Liqiang; Wang, Xiaofan; Liu, Zhenzhen; Ju, Ping; Zhang, Lunhui; Zhang, Yuanyuan; Ma, Bingjie; Bi, Kaishun; Chen, Xiaohui

2014-06-01

Recently, the renal injury caused by Semen strychni and its major toxic constituents, strychnine and brucine, was reported in many clinical cases. Hence, this study was conducted to investigate the renal injury induced by Semen Strychni and the protective effects of Radix Glycyrrhizae and Rhizoma Ligustici. The protective mechanisms were related to the comparative toxicokinetics of strychnine and brucine. Serum and urine uric acid and creatinine were used as renal function markers to evaluate the condition of kidney, and renal injury was directly reflected by histopathological changes. Compared with rats in blank group and protective herb groups, rats in Semen Strychni high-dose group showed significant differences in the results of renal function markers, and various glomerular and tubular degenerations were found in the histopathological study. The decreased AUC (only strychnine) and Cmax, the increased Tmax by Radix Glycyrrhizae and the decreased T1/2 by Radix Glycyrrhizae and Rhizoma Ligustici were found in model groups. Results indicated that high dose of Semen Strychni might induce renal injury. Radix Glycyrrhizae and Rhizoma Ligustici might work together and have effects on the elimination of strychnine and brucine. The protective effects of Radix Glycyrrhizae might also be explained by the slow absorption of the alkaloids. Copyright © 2014 Elsevier Ltd. All rights reserved.

Oral delivery of prolyl hydroxylase inhibitor: AKB-4924 promotes localized mucosal healing in a mouse model of colitis.

PubMed

Marks, Ellen; Goggins, Bridie J; Cardona, Jocelle; Cole, Siobhan; Minahan, Kyra; Mateer, Sean; Walker, Marjorie M; Shalwitz, Robert; Keely, Simon

2015-02-01

Pharmacological induction of hypoxia-inducible factor (HIF), a global transcriptional regulator of the hypoxic response, by prolyl hydroxylase inhibitors (PHDi) is protective in murine models of colitis, and epithelial cells are critical for the observed therapeutic efficacy. Because systemic HIF activation may lead to potentially negative off-target effects, we hypothesized that targeting epithelial HIF through oral delivery of PHDi would be sufficient to protect against colitis in a mouse model. Using a chemically induced trinitrobenzene sulfonic acid murine model of colitis, we compared the efficacy of oral and intraperitoneal (i.p.) delivery of the PHDi; AKB-4924 in preventing colitis, as measured by endoscopy, histology, barrier integrity, and immune profiling. Furthermore, we measured potential off-target effects, examining HIF and HIF target genes in the heart and kidney, as well as erythropoietin and hematocrit levels. Oral administration of AKB-4924 exhibited mucosal protection comparable i.p. dosing. Oral delivery of PHDi led to reduced colonic epithelial HIF stabilization compared with i.p. delivery, but this was still sufficient to induce transcription of downstream HIF targets. Furthermore, oral delivery of PHDi led to reduced stabilization of HIF and activation of HIF targets in extraintestinal organs. Oral delivery of PHDi therapies to this intestinal mucosa protects against colitis in animal models and represents a potential therapeutic strategy for inflammatory bowel disease, which also precludes unwanted extraintestinal effects.

Live Attenuated B. pertussis as a Single-Dose Nasal Vaccine against Whooping Cough

PubMed Central

Mielcarek, Nathalie; Debrie, Anne-Sophie; Raze, Dominique; Bertout, Julie; Rouanet, Carine; Younes, Amena Ben; Creusy, Colette; Engle, Jacquelyn; Goldman, William E; Locht, Camille

2006-01-01

Pertussis is still among the principal causes of death worldwide, and its incidence is increasing even in countries with high vaccine coverage. Although all age groups are susceptible, it is most severe in infants too young to be protected by currently available vaccines. To induce strong protective immunity in neonates, we have developed BPZE1, a live attenuated Bordetella pertussis strain to be given as a single-dose nasal vaccine in early life. BPZE1 was developed by the genetic inactivation or removal of three major toxins. In mice, BPZE1 was highly attenuated, yet able to colonize the respiratory tract and to induce strong protective immunity after a single nasal administration. Protection against B. pertussis was comparable to that induced by two injections of acellular vaccine (aPV) in adult mice, but was significantly better than two administrations of aPV in infant mice. Moreover, BPZE1 protected against Bordetella parapertussis infection, whereas aPV did not. BPZE1 is thus an attractive vaccine candidate to protect against whooping cough by nasal, needle-free administration early in life, possibly at birth. PMID:16839199

Protective immunity against Trypanosoma cruzi provided by oral immunization with Phytomonas serpens: role of nitric oxide.

PubMed

Pinge-Filho, P; Peron, J P S; de Moura, T R; Menolli, R A; Graça, V K; Estevão, D; Tadokoro, C E; Jankevicius, J V; Rizzo, L V

2005-01-31

We have previously demonstrated that Phytomonas serpens, a tomato parasite, shares antigens with Trypanosoma cruzi, the protozoa that causes Chagas' disease. These antigens are recognized by human sera and induce protective immunity in Balb/c mice. In the present study, inducible nitric oxide synthase (iNOS) knockout (KO) mice and C57BL/6 mice treated with the nitric oxide inhibitor, aminoguanidine (AG, 50 mg kg(-1)) infected with T. cruzi, were used to demonstrate the role of nitric oxide (NO) to host protection against T. cruzi infection achieved by oral immunization with live P. serpens. A reduction in parasitaemia and an increase in survival were observed in C57BL/6 infected mice and previously immunized with P. serpens, when compared to non-immunized mice. iNOS (KO) mice immunized and C57BL/6 immunized and treated with AG presented parasitaemia and mortality rates comparable to those of infected and non-immunized mice. By itself, immunization with P. serpens did not induce inflammation in the myocardium, but C57BL/6 mice so immunized showed fewer amastigotes nests in the heart following an acute T. cruzi infection than those in non-immunized mice. These results suggest that protective immunity against T. cruzi infection induced by immunization with P. serpens is dependent upon enhanced NO production during the acute phase of T. cruzi infection.

Oxidative Stress Response Induced by Butachlor in Zebrafish Embryo/Larvae: The Protective Effect of Vitamin C.

PubMed

Xiang, Qingqing; Xu, Bofan; Ding, Yilun; Liu, Xiaoyi; Zhou, Ying; Ahmad, Farooq

2018-02-01

The widespread contamination and persistence of the herbicide butachlor in the environment resulted in the exposure of non-target organisms. The present study investigated the toxicity effect of butachlor (1-15 µmol/L) and the protective effect of vitamin C (VC) against butachlor-induced toxicity in zebrafish. It was found that butachlor significantly increased the mortality and malformation rates in a dose-dependent manner, which caused elevation in reactive oxygen species (ROS) and malondialdehyde (MDA) after 72 h exposure. Compared with butachlor treatment group, the protective effect of VC against butachlor-induced toxicity were observed after adding 40, 80 mg/L VC respectively. VC significantly decreased the mortality, malformation rates, ROS, MDA, and normalized antioxidant enzymes activities of zebrafish after 72 h exposure. The result shows VC has mitigative effect on butachlor-induced toxicity and it can be used as an effective antioxidant in aquaculture.

Live Attenuated Leishmania donovani Centrin Knock Out Parasites Generate Non-inferior Protective Immune Response in Aged Mice against Visceral Leishmaniasis.

PubMed

Bhattacharya, Parna; Dey, Ranadhir; Dagur, Pradeep K; Joshi, Amritanshu B; Ismail, Nevien; Gannavaram, Sreenivas; Debrabant, Alain; Akue, Adovi D; KuKuruga, Mark A; Selvapandiyan, Angamuthu; McCoy, John Philip; Nakhasi, Hira L

2016-08-01

Visceral leishmaniasis (VL) caused by the protozoan parasite Leishmania donovani causes severe disease. Age appears to be critical in determining the clinical outcome of VL and at present there is no effective vaccine available against VL for any age group. Previously, we showed that genetically modified live attenuated L. donovani parasites (LdCen-/-) induced a strong protective innate and adaptive immune response in young mice. In this study we analyzed LdCen-/- parasite mediated modulation of innate and adaptive immune response in aged mice (18 months) and compared to young (2 months) mice. Analysis of innate immune response in bone marrow derived dendritic cells (BMDCs) from both young and aged mice upon infection with LdCen-/- parasites, showed significant enhancement of innate effector responses, which consequently augmented CD4+ Th1 cell effector function compared to LdWT infected BMDCs in vitro. Similarly, parasitized splenic dendritic cells from LdCen-/- infected young and aged mice also revealed induction of proinflammatory cytokines (IL-12, IL-6, IFN-γ and TNF) and subsequent down regulation of anti-inflammatory cytokine (IL-10) genes compared to LdWT infected mice. We also evaluated in vivo protection of the LdCen-/- immunized young and aged mice against virulent L. donovani challenge. Immunization with LdCen-/- induced higher IgG2a antibodies, lymphoproliferative response, pro- and anti-inflammatory cytokine responses and stimulated splenocytes for heightened leishmanicidal activity associated with nitric oxide production in young and aged mice. Furthermore, upon virulent L. donovani challenge, LdCen-/- immunized mice from both age groups displayed multifunctional Th1-type CD4 and cytotoxic CD8 T cells correlating to a significantly reduced parasite burden in the spleen and liver compared to naïve mice. It is interesting to note that even though there was no difference in the LdCen-/- induced innate response in dendritic cells between aged and young mice; the adaptive response specifically in terms of T cell and B cell activation in aged animals was reduced compared to young mice which correlated with less protection in old mice compared to young mice. Taken together, LdCen-/- immunization induced a significant but diminished host protective response in aged mice after challenge with virulent L. donovani parasites compared to young mice.

Live Attenuated Leishmania donovani Centrin Knock Out Parasites Generate Non-inferior Protective Immune Response in Aged Mice against Visceral Leishmaniasis

PubMed Central

Bhattacharya, Parna; Dey, Ranadhir; Dagur, Pradeep K.; Joshi, Amritanshu B.; Ismail, Nevien; Gannavaram, Sreenivas; Debrabant, Alain; Akue, Adovi D.; KuKuruga, Mark A.; Selvapandiyan, Angamuthu; McCoy, John Philip; Nakhasi, Hira L.

2016-01-01

Background Visceral leishmaniasis (VL) caused by the protozoan parasite Leishmania donovani causes severe disease. Age appears to be critical in determining the clinical outcome of VL and at present there is no effective vaccine available against VL for any age group. Previously, we showed that genetically modified live attenuated L. donovani parasites (LdCen-/-) induced a strong protective innate and adaptive immune response in young mice. In this study we analyzed LdCen-/- parasite mediated modulation of innate and adaptive immune response in aged mice (18 months) and compared to young (2 months) mice. Methodology Analysis of innate immune response in bone marrow derived dendritic cells (BMDCs) from both young and aged mice upon infection with LdCen-/- parasites, showed significant enhancement of innate effector responses, which consequently augmented CD4+ Th1 cell effector function compared to LdWT infected BMDCs in vitro. Similarly, parasitized splenic dendritic cells from LdCen-/- infected young and aged mice also revealed induction of proinflammatory cytokines (IL-12, IL-6, IFN-γ and TNF) and subsequent down regulation of anti-inflammatory cytokine (IL-10) genes compared to LdWT infected mice. We also evaluated in vivo protection of the LdCen-/- immunized young and aged mice against virulent L. donovani challenge. Immunization with LdCen-/- induced higher IgG2a antibodies, lymphoproliferative response, pro- and anti-inflammatory cytokine responses and stimulated splenocytes for heightened leishmanicidal activity associated with nitric oxide production in young and aged mice. Furthermore, upon virulent L. donovani challenge, LdCen-/- immunized mice from both age groups displayed multifunctional Th1-type CD4 and cytotoxic CD8 T cells correlating to a significantly reduced parasite burden in the spleen and liver compared to naïve mice. It is interesting to note that even though there was no difference in the LdCen-/- induced innate response in dendritic cells between aged and young mice; the adaptive response specifically in terms of T cell and B cell activation in aged animals was reduced compared to young mice which correlated with less protection in old mice compared to young mice. Conclusions Taken together, LdCen-/- immunization induced a significant but diminished host protective response in aged mice after challenge with virulent L. donovani parasites compared to young mice. PMID:27580076

Immune signatures of protective spleen memory CD8 T cells.

PubMed

Brinza, Lilia; Djebali, Sophia; Tomkowiak, Martine; Mafille, Julien; Loiseau, Céline; Jouve, Pierre-Emmanuel; de Bernard, Simon; Buffat, Laurent; Lina, Bruno; Ottmann, Michèle; Rosa-Calatrava, Manuel; Schicklin, Stéphane; Bonnefoy, Nathalie; Lauvau, Grégoire; Grau, Morgan; Wencker, Mélanie; Arpin, Christophe; Walzer, Thierry; Leverrier, Yann; Marvel, Jacqueline

2016-11-24

Memory CD8 T lymphocyte populations are remarkably heterogeneous and differ in their ability to protect the host. In order to identify the whole range of qualities uniquely associated with protective memory cells we compared the gene expression signatures of two qualities of memory CD8 T cells sharing the same antigenic-specificity: protective (Influenza-induced, Flu-TM) and non-protective (peptide-induced, TIM) spleen memory CD8 T cells. Although Flu-TM and TIM express classical phenotypic memory markers and are polyfunctional, only Flu-TM protects against a lethal viral challenge. Protective memory CD8 T cells express a unique set of genes involved in migration and survival that correlate with their unique capacity to rapidly migrate within the infected lung parenchyma in response to influenza infection. We also enlighten a new set of poised genes expressed by protective cells that is strongly enriched in cytokines and chemokines such as Ccl1, Ccl9 and Gm-csf. CCL1 and GM-CSF genes are also poised in human memory CD8 T cells. These immune signatures are also induced by two other pathogens (vaccinia virus and Listeria monocytogenes). The immune signatures associated with immune protection were identified on circulating cells, i.e. those that are easily accessible for immuno-monitoring and could help predict vaccines efficacy.

Nuclear aggregates of polyamines in a radiation-induced DNA damage model.

PubMed

Iacomino, Giuseppe; Picariello, Gianluca; Stillitano, Ilaria; D'Agostino, Luciano

2014-02-01

Polyamines (PA) are believed to protect DNA minimizing the effect of radiation damage either by inducing DNA compaction and aggregation or acting as scavengers of free radicals. Using an in vitro pDNA double strand breakage assay based on gel electrophoretic mobility, we compared the protective capability of PA against γ-radiation with that of compounds generated by the supramolecular self-assembly of nuclear polyamines and phosphates, named Nuclear Aggregates of Polyamines (NAPs). Both unassembled PA and in vitro produced NAPs (ivNAPs) were ineffective in conferring pDNA protection at the sub-mM concentration. Single PA showed an appreciable protective effect only at high (mM) concentrations. However, concentrations of spermine (4+) within a critical range (0.481 mM) induced pDNA precipitation, an event that was not observed with NAPs-pDNA interaction. We conclude that the interaction of individual PA is ineffective to assure DNA protection, simultaneously preserving the flexibility and charge density of the double strand. Furthermore, data obtained by testing polyamine and ivNAPS with the current radiation-induced DNA damage model support the concept that PA-phosphate aggregates are the only forms through which PA interact with DNA. Copyright © 2013 Elsevier Ltd. All rights reserved.

The protective effect of pentoxifylline versus silymarin on the pancreas through increasing adenosine by CD39 in a rat model of liver cirrhosis: Pharmacological, biochemical and histological study.

PubMed

Mohamed, Doaa I; Nabih, Enas S; El-Waseef, Dalia A A; El-Kharashi, Omnyah A; Abd El Samad, Abeer A

2018-04-20

Impaired glucose homoeostasis due to insulin resistance and decrease sensitivity of pancreatic β-cells is a feature of liver disease and results into hepatogenous diabetes. Decrease expression of CD39 was linked to inflammation and occurrence of diabetes. Therefore, we performed this study to explore the protective effect of pentoxifylline (PTX) and silymarin administration on the β-cells of the pancreas in a rat model of thioacetamide induced liver cirrhosis. Biochemical, histological and immunohistochemistry studies of the liver and pancreas were performed and provided an evidence on the protective effect of PTX to pancreatic β-cells compared to silymarin. Also, silymarin induced a significant improvement of liver cirrhosis compared to PTX. In conclusion, the potential protective effect of PTX against β-cells deterioration could be attributed to increasing pancreatic CD39 expression and the subsequent increase of adenosine. Copyright © 2018 Elsevier B.V. All rights reserved.

Comparing the effects of mitochondrial targeted and localized antioxidants with cellular antioxidants in human skin cells exposed to UVA and hydrogen peroxide.

PubMed

Oyewole, Anne O; Wilmot, Marie-Claire; Fowler, Mark; Birch-Machin, Mark A

2014-01-01

Skin cancer and aging are linked to increased cellular reactive oxygen species (ROS), particularly following exposure to ultraviolet A (UVA) in sunlight. As mitochondria are the main source of cellular ROS, this study compared the protective effects of mitochondria-targeted and -localized antioxidants (MitoQ and tiron, respectively) with cellular antioxidants against oxidative stress-induced [UVA and hydrogen peroxide (H2O2)] mitochondrial DNA (mtDNA) damage in human dermal fibroblasts. With the use of a long quantitative PCR assay, tiron (EC50 10 mM) was found to confer complete (100%) protection (P<0.001) against both UVA- and H2O2-induced mtDNA damage, whereas MitoQ (EC50 750 nM) provided less protection (17 and 32%, respectively; P<0.05). This particular protective effect of tiron was greater than a range of cellular antioxidants investigated. The nuclear factor erythroid 2-related factor 2 (Nrf2) signaling pathway provides cellular protection against oxidative stress. An ELISA assay for the Nrf2 target gene heme oxygenase-1 (HO-1) and studies using Nrf2 small interfering RNA both indicated that tiron's mode of action was Nrf2 independent. The comet assay showed that tiron's protective effect against H2O2-induced nuclear DNA damage was greater than the cellular antioxidants and MitoQ (P<0.001). This study provides a platform to investigate molecules with similar structure to tiron as potent and clinically relevant antioxidants.

Comparative analysis of the immune responses induced by native versus recombinant versions of the ASP-based vaccine against the bovine intestinal parasite Cooperia oncophora.

PubMed

González-Hernández, Ana; Borloo, Jimmy; Peelaers, Iris; Casaert, Stijn; Leclercq, Georges; Claerebout, Edwin; Geldhof, Peter

2018-01-01

The protective capacities of a native double-domain activation-associated secreted protein (ndd-ASP)-based vaccine against the cattle intestinal nematode Cooperia oncophora has previously been demonstrated. However, protection analysis upon vaccination with a recombinantly produced antigen has never been performed. Therefore, the aim of the current study was to test the protective potential of a Pichia-produced double-domain ASP (pdd-ASP)-based vaccine against C. oncophora. Additionally, we aimed to compare the cellular and humoral mechanisms underlying the vaccine-induced responses by the native (ndd-ASP) and recombinant vaccines. Immunisation of cattle with the native C. oncophora vaccine conferred significant levels of protection after an experimental challenge infection, whereas the recombinant vaccine did not. Moreover, vaccination with ndd-ASP resulted in a higher proliferation of CD4-T cells both systemically and in the small intestinal mucosa when compared with animals vaccinated with the recombinant antigen. In terms of humoral response, although both native and recombinant vaccines induced similar levels of antibodies, animals vaccinated with the native vaccine were able to raise antibodies with greater specificity towards ndd-ASP in comparison with antibodies raised by vaccination with the recombinant vaccine, suggesting a differential immune recognition towards the ndd-ASP and pdd-ASP. Finally, the observation that animals displaying antibodies with higher percentages of recognition towards ndd-ASP also exhibited the lowest egg counts suggests a potential relationship between antibody specificity and protection. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Intranasal adenovirus-vectored vaccine for induction of long-lasting humoral immunity-mediated broad protection against influenza in mice.

PubMed

Kim, Eun Hye; Park, Hae-Jung; Han, Gye-Yeong; Song, Man-Ki; Pereboev, Alexander; Hong, Jeong S; Chang, Jun; Byun, Young-Ho; Seong, Baik Lin; Nguyen, Huan H

2014-09-01

Influenza vaccines aimed at inducing antibody (Ab) responses against viral surface hemagglutinin (HA) and neuraminidase (NA) provide sterile immunity to infection with the same subtypes. Vaccines targeting viral conserved determinants shared by the influenza A viruses (IAV) offer heterosubtypic immunity (HSI), a broad protection against different subtypes. We proposed that vaccines targeting both HA and the conserved ectodomain of matrix protein 2 (M2e) would provide protection against infection with the same subtype and also HSI against other subtypes. We report here that single intranasal immunization with a recombinant adenovirus (rAd) vector encoding both HA of H5 virus and M2e (rAdH5/M2e) induced significant HA- and M2e-specific Ab responses, along with protection against heterosubtypic challenge in mice. The protection is superior compared to that induced by rAd vector encoding either HA (rAdH5), or M2e (rAdM2e). While protection against homotypic H5 virus is primarily mediated by virus-neutralizing Abs, the cross-protection is associated with Abs directed to conserved stalk HA and M2e that seem to have an additive effect. Consistently, adoptive transfer of antisera induced by rAdH5/M2e provided the best protection against heterosubtypic challenge compared to that provided by antisera derived from mice immunized with rAdH5 or rAdM2e. These results support the development of rAd-vectored vaccines encoding both H5 and M2e as universal vaccines against different IAV subtypes. Current licensed influenza vaccines provide protection limited to the infection with same virus strains; therefore, the composition of influenza vaccines has to be revised every year. We have developed a new universal influenza vaccine that is highly efficient in induction of long-lasting cross-protection against different influenza virus strains. The cross-protection is associated with a high level of vaccine-induced antibodies against the conserved stalk domain of influenza virus hemagglutinin and the ectodomain of matrix protein. The vaccine could be used to stimulate cross-protective antibodies for the prevention and treatment of influenza with immediate effect for individuals who fail to respond to or receive the vaccine in due time. The vaccine offers a new tool to control influenza outbreaks, including pandemics. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Demineralization of resin-sealed enamel by soft drinks in a clinically relevant pH cycling model.

PubMed

Bartels, Agata A; Evans, Carla A; Viana, Grace; Bedran-Russo, Ana K

2016-04-01

To compare the in vitro protective effect of orthodontic sealants on the enamel demineralization under a soft drink-induced erosive challenge. The facial surfaces of bovine incisors were sectioned into 5 mm x 4 mm x 4 mm enamel blocks. Specimens were randomly assigned to three surface protection measures: control (exposed enamel), coating with Transbond XT (unfilled resin primer), or coating with Opal Seal (filled and fluoride releasing primer). Thermocycling was used to simulate aging. The specimens were pH cycled through an acidic buffer, test beverage and a neutral buffer for a total of 7 days. Test beverages included water, Diet Mountain Dew, and Coke Classic. Quantitative light-induced fluorescence (QLF) images were taken at baseline and after aging. Final QLF images were taken to evaluate the demineralization of enamel. Data were analyzed statistically using a two-way ANOVA to compare the interaction between enamel surface protection and beverages as well as one-way ANOVA to compare surface protection and the test beverage levels. A statistically significant interaction was found between the surface protected groups and the test beverage groups (P < 0.05). Statistically significant differences were found among the test beverage groups (P < 0.05) and among the surface protection groups (P < 0.05). Coke Classic went through the sealant layer resulting in high enamel demineralization. Enamel coating with Opal Seal significantly reduced the erosive attack of beverages.

The impact of homologous recombination repair deficiency on depleted uranium clastogenicity in Chinese hamster ovary cells: XRCC3 protects cells from chromosome aberrations, but increases chromosome fragmentation.

PubMed

Holmes, Amie L; Joyce, Kellie; Xie, Hong; Falank, Carolyne; Hinz, John M; Wise, John Pierce

2014-04-01

Depleted uranium (DU) is extensively used in both industry and military applications. The potential for civilian and military personnel exposure to DU is rising, but there are limited data on the potential health hazards of DU exposure. Previous laboratory research indicates DU is a potential carcinogen, but epidemiological studies remain inconclusive. DU is genotoxic, inducing DNA double strand breaks, chromosome damage and mutations, but the mechanisms of genotoxicity or repair pathways involved in protecting cells against DU-induced damage remain unknown. The purpose of this study was to investigate the effects of homologous recombination repair deficiency on DU-induced genotoxicity using RAD51D and XRCC3-deficient Chinese hamster ovary (CHO) cell lines. Cells deficient in XRCC3 (irs1SF) exhibited similar cytotoxicity after DU exposure compared to wild-type (AA8) and XRCC3-complemented (1SFwt8) cells, but DU induced more break-type and fusion-type lesions in XRCC3-deficient cells compared to wild-type and XRCC3-complemented cells. Surprisingly, loss of RAD51D did not affect DU-induced cytotoxicity or genotoxicity. DU induced selective X-chromosome fragmentation irrespective of RAD51D status, but loss of XRCC3 nearly eliminated fragmentation observed after DU exposure in wild-type and XRCC3-complemented cells. Thus, XRCC3, but not RAD51D, protects cells from DU-induced breaks and fusions and also plays a role in DU-induced chromosome fragmentation. Copyright © 2014 Elsevier B.V. All rights reserved.

Repeated Nrf2 stimulation using sulforaphane protects fibroblasts from ionizing radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mathew, Sherin T.; Bergström, Petra; Hammarsten, Ola, E-mail: ola.hammarsten@clinchem.gu.se

2014-05-01

Most of the cytotoxicity induced by ionizing radiation is mediated by radical-induced DNA double-strand breaks. Cellular protection from free radicals can be stimulated several fold by sulforaphane-mediated activation of the transcription factor Nrf2 that regulates more than 50 genes involved in the detoxification of reactive substances and radicals. Here, we report that repeated sulforaphane treatment increases radioresistance in primary human skin fibroblasts. Cells were either treated with sulforaphane for four hours once or with four-hour treatments repeatedly for three consecutive days prior to radiation exposure. Fibroblasts exposed to repeated-sulforaphane treatment showed a more pronounced dose-dependent induction of Nrf2-regulated mRNA andmore » reduced amount of radiation-induced free radicals compared with cells treated once with sulforaphane. In addition, radiation- induced DNA double-strand breaks measured by gamma-H2AX foci were attenuated following repeated sulforaphane treatment. As a result, cellular protection from ionizing radiation measured by the 5-ethynyl-2′-deoxyuridine (EdU) assay was increased, specifically in cells exposed to repeated sulforaphane treatment. Sulforaphane treatment was unable to protect Nrf2 knockout mouse embryonic fibroblasts, indicating that the sulforaphane-induced radioprotection was Nrf2-dependent. Moreover, radioprotection by repeated sulforaphane treatment was dose-dependent with an optimal effect at 10 uM, whereas both lower and higher concentrations resulted in lower levels of radioprotection. Our data indicate that the Nrf2 system can be trained to provide further protection from radical damage. - Highlights: • Repeated treatment with sulforaphane protects fibroblasts from ionizing radiation • Repeated sulforaphane treatment attenuates radiation induced ROS and DNA damage • Sulforaphane mediated protection is Nrf2 dependent.« less

Metabolic Fingerprint of PS3-Induced Resistance of Grapevine Leaves against Plasmopara viticola Revealed Differences in Elicitor-Triggered Defenses

PubMed Central

Adrian, Marielle; Lucio, Marianna; Roullier-Gall, Chloé; Héloir, Marie-Claire; Trouvelot, Sophie; Daire, Xavier; Kanawati, Basem; Lemaître-Guillier, Christelle; Poinssot, Benoît; Gougeon, Régis; Schmitt-Kopplin, Philippe

2017-01-01

Induction of plant resistance against pathogens by defense elicitors constitutes an attractive strategy to reduce the use of fungicides in crop protection. However, all elicitors do not systematically confer protection against pathogens. Elicitor-induced resistance (IR) thus merits to be further characterized in order to understand what makes an elicitor efficient. In this study, the oligosaccharidic defense elicitors H13 and PS3, respectively, ineffective and effective to trigger resistance of grapevine leaves against downy mildew, were used to compare their effect on the global leaf metabolism. Ultra high resolution mass spectrometry (FT-ICR-MS) analysis allowed us to obtain and compare the specific metabolic fingerprint induced by each elicitor and to characterize the associated metabolic pathways. Moreover, erythritol phosphate was identified as a putative marker of elicitor-IR. PMID:28261225

Occupational noise-induced hearing loss in Indian steel industry workers: an exploratory study.

PubMed

Singh, Lakhwinder Pal; Bhardwaj, Arvind; Deepak, Kishore Kumar

2013-04-01

The present study focused on exploring the current level of hearing protection and subsequently determined the prevalence of occupational noise-induced hearing loss among casting and forging industry workers. The casting and forging industry provides employment to a significant portion of the population. The level of hearing protection was assessed through questionnaire survey of 572 workers. Out of these workers, 165 and another control group of 57 participants were assessed by formal audiometry. Audiometric tests were conducted at frequencies of 1.0 KHz to 8.0 KHz.The occurrence of hearing loss was determined on the basis of a hearing threshold level with a low fence of 25 dB. Student's test and ANOVA were used to compare the various groups; a p value < .05 was considered statistically significant. More than 90% of the workers sampled showed significant hearing loss at medium and high frequencies. The analyses revealed a higher prevalence of significant hearing loss among the forging workers compared with the workers associated with the other activities. The workers of the Indian steel industry are highly exposed to occupational noise. The majority of workers are not protected from noise-induced hearing loss. There is a need to provide special ear protectors for workers engaged in forging. A complete hearing protection program, including training, audiometry, job rotation, and the use of hearing protection devices, needs to be introduced.

Protective effect of N-acetylcysteine against ethanol-induced gastric ulcer: A pharmacological assessment in mice

PubMed Central

Jaccob, Ausama Ayoob

2015-01-01

Aim: Since there is an increasing need for gastric ulcer therapies with optimum benefit-risk profile. This study was conducted to investigate gastro-protective effects of N-acetylcysteine (NAC) against ethanol-induced gastric ulcer models in mice. Materials and Methods: A total of 41 mice were allocated into six groups consisted of 7 mice each. Groups 1 (normal control) and 2 (ulcer control) received distilled water at a dose of 10 ml/kg, groups 3, 4 and 5 were given NAC at doses 100, 300 and 500 mg/kg, respectively, and the 6th group received ranitidine (50 mg/kg). All drugs administered orally once daily for 7 days, on the 8th day absolute ethanol (7 ml/kg) was administrated orally to all mice to induce the acute ulcer except normal control group. Then 3 h after, all animals were sacrificed then consequently the stomachs were excised for examination. Results: NAC administration at the tested doses showed a dose-related potent gastro-protective effect with significant increase in curative ratio, PH of gastric juice and mucus content viscosity seen with the highest dose of NAC and it is comparable with that observed in ranitidine group. Conclusion: The present findings demonstrate that, oral NAC shows significant gastro-protective effects comparable to ranitidine confirmed by anti-secretory, cytoprotective, histological and biochemical data, but the molecular mechanisms behind such protection are complex. PMID:26401392

Centella asiatica Leaf Extract Protects Against Indomethacin-Induced Gastric Mucosal Injury in Rats.

PubMed

Zheng, Hong-Mei; Choi, Myung-Joo; Kim, Jae Min; Cha, Kyung Hoi; Lee, Kye Wan; Park, Yu Hwa; Hong, Soon-Sun; Lee, Don Haeng

2016-01-01

The present study evaluated the protective effect of Centella asiatica (gotu kola) leaf extract (CAE) against indomethacin (IND)-induced gastric mucosal injury in rats. Gastric mucosal injury was induced by the oral administration of IND to the rats after a 24 h fast. CAE (50 or 250 mg/kg) or lansoprazole (a reference drug) was orally administrated 30 min before the IND administration, and 5 h later, the stomachs were removed to quantify the lesions. Orally administered CAE significantly reduced IND-induced gastric injury. The histopathological observations (hematoxylin-eosin and Periodic acid-Schiff staining) confirmed the protection against gastric mucosal injury. Also, CAE decreased the malondialdehyde content compared to the control group. Moreover, pretreatment with CAE resulted in a significant reduction in the elevated expression of tumor necrosis factor, Cyclooxygenase (COX)-2, and inducible nitric oxide synthase. These results suggested that CAE possesses gastroprotective effects against IND-induced gastric mucosal injury, which could be attributed to its ability to inhibit lipid peroxidation and stimulate gastric mucus secretion in the rat gastric mucosa.

Zingiber officinale Roscoe ameliorates anticancer antibiotic doxorubicin-induced acute cardiotoxicity in rat.

PubMed

Ajith, Thekkuttuparambil Ananthanarayanan; Hema, Unnikrishnan; Aswathi, Sreedharan

2016-07-01

Oxidative stress (OS) has been suggested in the cardiotoxicity induced by anticancer antibiotic doxorubicin (DXN). The cardioprotective effects of aqueous ethanol extract of Zingiber officinale was evaluated against DXN-induced acute cardiac damage in rat. The results of the study demonstrated that Z. officinale significantly and dose dependently protected the cardiotoxicity induced by DXN. The activities of serum glutamate oxaloacetate transaminase and serum lactate dehydrogenase activity in the DXN alone treated group of animals were significantly (p<0.01) elevated when compared to normal animals. The activities were reduced in the Z. officinale (200 and 400 mg/kg, p.o) plus DXN treated groups. The cardiac malondialdehyde was elevated in the DXN alone treated group and declined significantly in the Z. officinale (400 mg/kg) plus DXN treated group. The results concluded that aqueous ethanol extract of Z. officinale ameliorated DXN-induced cardiotoxicity. The protection can be ascribed to the free radical scavenging activity of Z. officinale. This protective effect may suggest the adjuvant role of Z. officinale against OS induced by cancer chemotherapeutants, which warrant further research. © 2016 Old City Publishing, Inc.

Nicotinamide riboside, a form of vitamin B3, protects against excitotoxicity-induced axonal degeneration.

PubMed

Vaur, Pauline; Brugg, Bernard; Mericskay, Mathias; Li, Zhenlin; Schmidt, Mark S; Vivien, Denis; Orset, Cyrille; Jacotot, Etienne; Brenner, Charles; Duplus, Eric

2017-12-01

NAD + depletion is a common phenomenon in neurodegenerative pathologies. Excitotoxicity occurs in multiple neurologic disorders and NAD + was shown to prevent neuronal degeneration in this process through mechanisms that remained to be determined. The activity of nicotinamide riboside (NR) in neuroprotective models and the recent description of extracellular conversion of NAD + to NR prompted us to probe the effects of NAD + and NR in protection against excitotoxicity. Here, we show that intracortical administration of NR but not NAD + reduces brain damage induced by NMDA injection. Using cortical neurons, we found that provision of extracellular NR delays NMDA-induced axonal degeneration (AxD) much more strongly than extracellular NAD + Moreover, the stronger effect of NR compared to NAD + depends of axonal stress since in AxD induced by pharmacological inhibition of nicotinamide salvage, both NAD + and NR prevent neuronal death and AxD in a manner that depends on internalization of NR. Taken together, our findings demonstrate that NR is a better neuroprotective agent than NAD + in excitotoxicity-induced AxD and that axonal protection involves defending intracellular NAD + homeostasis.-Vaur, P., Brugg, B., Mericskay, M., Li, Z., Schmidt, M. S., Vivien, D., Orset, C., Jacotot, E., Brenner, C., Duplus, E. Nicotinamide riboside, a form of vitamin B 3 , protects against excitotoxicity-induced axonal degeneration. © FASEB.

Comparison of the immunogenicity and protection against bovine tuberculosis following immunization by BCG-priming and boosting with adenovirus or protein based vaccines.

PubMed

Dean, G; Whelan, A; Clifford, D; Salguero, F J; Xing, Z; Gilbert, S; McShane, H; Hewinson, R G; Vordermeier, M; Villarreal-Ramos, B

2014-03-05

There is a requirement for vaccines or vaccination strategies that confer better protection against TB than the current live attenuated Mycobacterium bovis Bacillus Calmette-Guerin (BCG) vaccine for use in cattle. Boosting with recombinant viral vectors expressing mycobacterial proteins, such as Ag85A, has shown a degree of promise as a strategy for improving on the protection afforded by BCG. Experiments in small animal models have indicated that broadening the immune response to include mycobacterial antigens other than Ag85A, such as Rv0288, induced by boosting with Ad5 constructs has a direct effect on the protection afforded against TB. Here, we compared the immunogenicity and protection against challenge with M. bovis afforded by boosting BCG-vaccinated cattle with a human type 5 (Ad5)-based vaccine expressing the mycobacterial antigens Ag85A (Ad5-85A); or Ag85A, Rv0251, Rv0287 and Rv0288 (Ad5-TBF); or with protein TBF emulsified in adjuvant (Adj-TBF). Boosting with TBF broaden the immune response. The kinetics of Ad5-TBF and Adj-TBF were shown to be different, with effector T cell responses from the latter developing more slowly but being more durable than those induced by Ad5-TBF. No increase in protection compared to BCG alone was afforded by Ad5-TBF or Adj-TBF by gross pathology or bacteriology. Using histopathology, as a novel parameter of protection, we show that boosting BCG vaccinated cattle with Ad5-85A induced significantly better protection than BCG alone. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Mechanism of protection of transepithelial barrier function by Lactobacillus salivarius: strain dependence and attenuation by bacteriocin production.

PubMed

Miyauchi, Eiji; O'Callaghan, John; Buttó, Ludovica F; Hurley, Gráinne; Melgar, Silvia; Tanabe, Soichi; Shanahan, Fergus; Nally, Kenneth; O'Toole, Paul W

2012-11-01

Enhanced barrier function is one mechanism whereby commensals and probiotic bacteria limit translocation of foreign antigens or pathogens in the gut. However, barrier protection is not exhibited by all probiotic or commensals and the strain-specific molecules involved remain to be clarified. We evaluated the effects of 33 individual Lactobacillus salivarius strains on the hydrogen peroxide (H(2)O(2))-induced barrier impairment in human epithelial Caco-2 cells. These strains showed markedly different effects on H(2)O(2)-induced reduction in transepithelial resistance (TER). The effective strains such as UCC118 and CCUG38008 attenuated H(2)O(2)-induced disassembly and relocalization of tight junction proteins, but the ineffective strain AH43324 did not. Strains UCC118 and CCUG38008 induced phosphorylation of extracellular signal-regulated kinase (ERK) in Caco-2 cells, and the ERK inhibitor U0126 attenuated the barrier-protecting effect of these strains. In contrast, the AH43324 strain induced phosphorylation of Akt and p38, which was associated with an absence of a protective effect. Global transcriptome analysis of UCC118 and AH43324 revealed that some genes in a bacteriocin gene cluster were upregulated in AH43324 under TER assay conditions. A bacteriocin-negative UCC118 mutant displayed significantly greater suppressive effect on H(2)O(2)-induced reduction in TER compared with wild-type UCC118. The wild-type strain augmented H(2)O(2)-induced phosphorylation of Akt and p38, whereas a bacteriocin-negative UCC118 mutant did not. These observations indicate that L. salivarius strains are widely divergent in their capacity for barrier protection, and this is underpinned by differences in the activation of intracellular signaling pathways. Furthermore, bacteriocin production appears to have an attenuating influence on lactobacillus-mediated barrier protection.

Methamphetamine-induced hyperthermia and dopaminergic neurotoxicity in mice: pharmacological profile of protective and nonprotective agents.

PubMed

Albers, D S; Sonsalla, P K

1995-12-01

Neurotoxic doses of methamphetamine (METH) can cause hyperthermia in experimental animals. Damage sustained to dopaminergic nerve terminals by this stimulant can be reduced by environmental cooling or by pharmacological manipulation which attenuates the hyperthermia. Many pharmacological agents with very diverse actions protect against METH-induced neuropathology. Several of these compounds, as well as drugs which do not protect, were investigated to determine if there was a relationship between protection and METH-induced hyperthermia. Mice received METH with or without concurrent administration of other drugs and core (i.e., colonic) temperature was monitored during treatment. The animals were sacrificed > or = 5 days later and neostriatal tyrosine hydroxylase activity and dopamine were measured. Core temperature was significantly elevated (> or = 2 degrees C) in mice treated with doses of METH which produced > or = 90% losses in striatal dopamine but not in mice less severally affected (only 50% loss of dopamine). Concurrent treatment of mice with METH and pharmacological agents which protected partially or completely from METH-induced toxicity also prevented the hyperthermic response (i.e., dopamine receptor antagonists, fenfluramine, dizocilpine, alpha-methyl-p-tyrosine, phenytoin, aminooxyacetic acid and propranol). These findings are consistent with the hypothesis that the hyperthermia produced by METH contributes to its neuropathology. However, studies with reserpine, a compound which dramatically lowers core temperature, demonstrated that hyperthermia per se is not a requirement for METH-induced neurotoxicity. Although core temperature was elevated in reserpinized mice treated with METH as compared with reserpinized control mice, their temperatures remained significantly lower than in nonreserpinized control mice. However, the hypothermic state produced in the reserpinized mice did not provide protection from METH-induced toxicity. These data demonstrate that hyperthermia per se contributes to but is not solely responsible for the METH-induced neuropathology.

Indole-3-carbinol protects against cisplatin-induced acute nephrotoxicity: role of calcitonin gene-related peptide and insulin-like growth factor-1.

PubMed

El-Naga, Reem N; Mahran, Yasmen F

2016-07-15

Nephrotoxicity associated with the clinical use of the anticancer drug cisplatin is a limiting problem. Thus, searching for new protective measures is required. Indole-3-carbinol is a powerful anti-oxidant, anti-inflammatory and anti-tumor agent. The present study aimed to investigate the potential protective effect of indole-3-carbinol against cisplatin-induced acute nephrotoxicity in rats. Rats were pre-treated with 20 mg/kg indole-3-carbinol orally before giving cisplatin (7 mg/kg). Cisplatin-induced acute nephrotoxicity was demonstrated where relative kidney weight, BUN and serum creatinine were significantly increased. Increased oxidative stress was evident in cisplatin group where GSH and SOD tissue levels were significantly depleted. Also, lipid peroxidation and NOX-1 were increased as compared to the control. Additionally, renal expression of pro-inflammatory mediators was induced by cisplatin. Cisplatin-induced cell death was shown by increased caspase-3 and decreased expression of EGF, IGF-1 and IGF-1 receptor. Nephrotoxicity, oxidative stress, inflammation and apoptotic effects induced by cisplatin were significantly ameliorated by indole-3-carbinol pre-treatment. Besides, the role of CGRP in cisplatin-induced nephrotoxicity was explored. Furthermore, cisplatin cytotoxic activity was significantly enhanced by indole-3-carbinol pre-treatment in vitro. In conclusion, indole-3-carbinol provides protection against cisplatin-induced nephrotoxicity. Also, reduced expression of CGRP may play a role in the pathogenesis of cisplatin-induced renal injury.

Indole-3-carbinol protects against cisplatin-induced acute nephrotoxicity: role of calcitonin gene-related peptide and insulin-like growth factor-1

PubMed Central

El-Naga, Reem N.; Mahran, Yasmen F.

2016-01-01

Nephrotoxicity associated with the clinical use of the anticancer drug cisplatin is a limiting problem. Thus, searching for new protective measures is required. Indole-3-carbinol is a powerful anti-oxidant, anti-inflammatory and anti-tumor agent. The present study aimed to investigate the potential protective effect of indole-3-carbinol against cisplatin-induced acute nephrotoxicity in rats. Rats were pre-treated with 20 mg/kg indole-3-carbinol orally before giving cisplatin (7 mg/kg). Cisplatin-induced acute nephrotoxicity was demonstrated where relative kidney weight, BUN and serum creatinine were significantly increased. Increased oxidative stress was evident in cisplatin group where GSH and SOD tissue levels were significantly depleted. Also, lipid peroxidation and NOX-1 were increased as compared to the control. Additionally, renal expression of pro-inflammatory mediators was induced by cisplatin. Cisplatin-induced cell death was shown by increased caspase-3 and decreased expression of EGF, IGF-1 and IGF-1 receptor. Nephrotoxicity, oxidative stress, inflammation and apoptotic effects induced by cisplatin were significantly ameliorated by indole-3-carbinol pre-treatment. Besides, the role of CGRP in cisplatin-induced nephrotoxicity was explored. Furthermore, cisplatin cytotoxic activity was significantly enhanced by indole-3-carbinol pre-treatment in vitro. In conclusion, indole-3-carbinol provides protection against cisplatin-induced nephrotoxicity. Also, reduced expression of CGRP may play a role in the pathogenesis of cisplatin-induced renal injury. PMID:27417335

Tualang Honey Protects against BPA-Induced Morphological Abnormalities and Disruption of ERα, ERβ, and C3 mRNA and Protein Expressions in the Uterus of Rats

PubMed Central

Mohamad Zaid, Siti Sarah; Kassim, Normadiah M.; Othman, Shatrah

2015-01-01

Bisphenol A (BPA) is an endocrine disrupting chemical (EDC) that can disrupt the normal functions of the reproductive system. The objective of the study is to investigate the potential protective effects of Tualang honey against BPA-induced uterine toxicity in pubertal rats. The rats were administered with BPA by oral gavage over a period of six weeks. Uterine toxicity in BPA-exposed rats was determined by the degree of the morphological abnormalities, increased lipid peroxidation, and dysregulated expression and distribution of ERα, ERβ, and C3 as compared to the control rats. Concurrent treatment of rats with BPA and Tualang honey significantly improved the uterine morphological abnormalities, reduced lipid peroxidation, and normalized ERα, ERβ, and C3 expressions and distribution. There were no abnormal changes observed in rats treated with Tualang honey alone, comparable with the control rats. In conclusion, Tualang honey has potential roles in protecting the uterus from BPA-induced toxicity, possibly accounted for by its phytochemical properties. PMID:26788107

Topical application of spent coffee ground extracts protects skin from ultraviolet B-induced photoaging in hairless mice.

PubMed

Choi, Hyeon-Son; Park, Eu Ddeum; Park, Yooheon; Han, Sung Hee; Hong, Ki Bae; Suh, Hyung Joo

2016-06-08

The aim of this study was to evaluate the protective effect of spent coffee ground (SCG) on ultraviolet (UV) B-induced photoaging in hairless mice. The oil fraction (OSCG) and ethanol extract (ESCG) of SCG were prepared from SCG. OSCG contained a much higher level of caffeine (547.32 ± 1.68 μg mg(-1)) when compared to the sum of its chlorogenic acid derivatives (∼119 μg mg(-1)), and pyrazines were the major aromatic compounds in OSCG. OSCG effectively inhibited the UVB-induced increase in intracellular reactive oxygen species in HaCaT cells. Topical application of OSCG or ESCG significantly reduced the UVB-induced wrinkle formation in mice dorsal skin. The combined application of OSCG and ESCG (OEH) led to a decrease in the wrinkle area by over 35% when compared with the UVB-treated control (UVBC). Epidermal thickness was also reduced by 40%. This result was connected to the significant reduction in transdermal water loss (27%) and erythema formation (48%) that result from UVB irradiation. Polarization-sensitive optical coherence tomography (PS-OCT) and antibody-based histological analyses showed that OSCG and ESCG effectively suppressed the UVB-induced decrease in collagen content. The level of type 1 collagen (COL1) in the OEH group was enhanced by around 40% compared with the UVB control group (UVBC). This was attributed to the down-regulation of matrix metalloproteinases (MMP2, 9, and 13), which are known to be responsible for collagen destruction. Our results indicate that topical treatment with OSCG/ESCG protects mouse skin from UVB-induced photoaging by down-regulating MMPs; therefore, suggesting the potential of SCG extracts as a topical anti-photoaging agent.

Protective effects of cultured and fermented ginseng extracts against scopolamine-induced memory loss in a mouse model.

PubMed

Han, Song-Hee; Kim, Sung-June; Yun, Young Won; Nam, Sang Yoon; Lee, Hu-Jang; Lee, Beom-Jun

2018-03-01

This study was performed to investigate the effect of a concentrate of fermented wild ginseng root culture (HLJG0701) on memory improvement in the scopolamine (SPL)-induced memory-deficient mouse model. Eight-week-old male ICR mice were used to evaluate the protective effect of HLJG0701 against the SPL-induced memory loss animal model. The Morris water maze test, which measures hippocampus-dependent learning ability, and the Y-maze test, a short-term memory assessment test, were performed and related markers were analyzed. HLJG0701-treated groups displayed significantly reduced acetylcholinesterase activity and increased acetylcholine level compared with the SPL-administered group (SPL-G) ( P <0.05). In the Y-maze test, the spontaneous alternation in al HLJG0711-treated groups was significantly increased compared with that in SPL-G ( P <0.05). In the Morris water maze test, the escape latency and time spent in the target quadrant in all HLJG0701-treated groups were significantly decreased and increased, respectively, compared with those in SPL-G ( P <0.05). In addition, the brain-derived neurotrophic factor level in groups treated with HLJG0701 300 and 600 mg/kg body weight was significantly increased compared with that in SPL-G ( P <0.05). These results suggest that the HLJG0701 may protect against memory loss by inhibiting acetylcholinesterase activity and preventing acetylcholine deficiency.

RGD capsid modification enhances mucosal protective immunity of a non-human primate adenovirus vector expressing Pseudomonas aeruginosa OprF

PubMed Central

Krause, A; Whu, W Z; Qiu, J; Wafadari, D; Hackett, N R; Sharma, A; Crystal, R G; Worgall, S

2013-01-01

Replication-deficient adenoviral (Ad) vectors of non-human serotypes can serve as Ad vaccine platforms to circumvent pre-existing anti-human Ad immunity. We found previously that, in addition to that feature, a non-human primate-based AdC7 vector expressing outer membrane protein F of P. aeruginosa (AdC7OprF) was more potent in inducing lung mucosal and protective immunity compared to a human Ad5-based vector. In this study we analysed if genetic modification of the AdC7 fibre to display an integrin-binding arginine–glycine–aspartic acid (RGD) sequence can further enhance lung mucosal immunogenicity of AdC7OprF. Intratracheal immunization of mice with either AdC7OprF.RGD or AdC7OprF induced robust serum levels of anti-OprF immunoglobulin (Ig)G up to 12 weeks that were higher compared to immunization with the human vectors Ad5OprF or Ad5OprF.RGD. OprF-specific cellular responses in lung T cells isolated from mice immunized with AdC7OprF.RGD and AdC7OprF were similar for T helper type 1 (Th1) [interferon (IFN)-γ in CD8+ and interleukin (IL)-12 in CD4+], Th2 (IL-4, IL-5 and IL-13 in CD4+) and Th17 (IL-17 in CD4+). Interestingly, AdC7OprF.RGD induced more robust protective immunity against pulmonary infection with P. aeruginosa compared to AdC7OprF or the control Ad5 vectors. The enhanced protective immunity induced by AdC7OprF.RGD was maintained in the absence of alveolar macrophages (AM) or CD1d natural killer T cells. Together, the data suggest that addition of RGD to the fibre of an AdC7-based vaccine is useful to enhance its mucosal protective immunogenicity. PMID:23607394

Liposomes containing monophosphoryl lipid A and QS-21 serve as an effective adjuvant for soluble circumsporozoite protein malaria vaccine FMP013.

PubMed

Genito, Christopher J; Beck, Zoltan; Phares, Timothy W; Kalle, Fanta; Limbach, Keith J; Stefaniak, Maureen E; Patterson, Noelle B; Bergmann-Leitner, Elke S; Waters, Norman C; Matyas, Gary R; Alving, Carl R; Dutta, Sheetij

2017-07-05

Malaria caused by Plasmodium falciparum continues to threaten millions of people living in the tropical parts of the world. A vaccine that confers sterile and life-long protection remains elusive despite more than 30years of effort and resources invested in solving this problem. Antibodies to a malaria vaccine candidate circumsporozoite protein (CSP) can block invasion and can protect humans against malaria. We have manufactured the Falciparum Malaria Protein-013 (FMP013) vaccine based on the nearly full-length P. falciparum CSP 3D7 strain sequence. We report here immunogenicity and challenge data on FMP013 antigen in C57BL/6 mice formulated with two novel adjuvants of the Army Liposome Formulation (ALF) series and a commercially available adjuvant Montanide ISA 720 (Montanide) as a control. ALF is a liposomal adjuvant containing a synthetic monophosphoryl lipid A (3D-PHAD®). In our study, FMP013 was adjuvanted with ALF alone, ALF containing aluminum hydroxide (ALFA) or ALF containing QS-21 (ALFQ). Adjuvants ALF and ALFA induced similar antibody titers and protection against transgenic parasite challenge that were comparable to Montanide. ALFQ was superior to the other three adjuvants as it induced higher antibody titers with improved boosting after the third immunization, higher serum IgG2c titers, and enhanced protection. FMP013+ALFQ also augmented the numbers of splenic germinal center-derived activated B-cells and antibody secreting cells compared to Montanide. Further, FMP013+ALFQ induced antigen-specific IFN-γ ELISPOT activity, CD4 + T-cells and a T H 1-biased cytokine profile. These results demonstrate that soluble CSP can induce a potent and sterile protective immune response when formulated with the QS-21 containing adjuvant ALFQ. Comparative mouse immunogenicity data presented here were used as the progression criteria for an ongoing non-human primate study and a regulatory toxicology study in preparation for a controlled human malaria infection (CHMI) trial. Published by Elsevier Ltd.

Walnut extracts protect cultured microglia against LPS-induced neurotoxicity via modulation of intracellular calcium concentration

USDA-ARS?s Scientific Manuscript database

Walnuts are rich in omega-3 fatty acids, alpha-linolenic acid (ALA) and linoleic acid (LA), as compared to other edible plants. Previously, our laboratory had demonstrated that dietary walnut supplementation in aged animals enhanced protective signaling pathways, altered membrane microstructures, an...

Loss of long term protection with the inclusion of HIV pol to a DNA vaccine encoding gag.

PubMed

Garrod, Tamsin J; Gargett, Tessa; Yu, Wenbo; Major, Lee; Burrell, Christopher J; Wesselingh, Steven; Suhrbier, Andreas; Grubor-Bauk, Branka; Gowans, Eric J

2014-11-04

Traditional vaccine strategies that induce antibody responses have failed to protect against HIV infection in clinical trials, and thus cell-mediated immunity is now an additional criterion. Recent clinical trials that aimed to induce strong T cell responses failed to do so. Therefore, to enhance induction of protective T cell responses, it is crucial that the optimum antigen combination is chosen. Limited research has been performed into the number of antigens selected for an HIV vaccine. This study aimed to compare DNA vaccines encoding either a single HIV antigen or a combination of two antigens, using intradermal vaccination of C57BL/6 mice. Immune assays were performed on splenocytes, and in vivo protection was examined by challenge with a chimeric virus, EcoHIV, able to infect mouse but not human leukocytes, at 10 days (short term) and 60 days (long term) post final vaccination. At 60 days there was significantly lower frequency of induced antigen-specific CD8(+) T cells in the spleens of pCMVgag-pol-vaccinated mice compared with mice which received pCMVgag only. Most importantly, short term viral control of EcoHIV was similar for pCMVgag and pCMVgag-pol-vaccinated mice at day 10, but only the pCMVgag-vaccinated significantly controlled EcoHIV at day 60 compared with pCMV-vaccinated mice, showing that control was reduced with the inclusion of the HIV pol gene. Copyright © 2014 Elsevier B.V. All rights reserved.

GENO PROTECTIVE AND ANTI-APOPTOTIC EFFECT OF GREEN TEA AGAINST PERINATAL LIPOPOLYSACCHARIDE-EXPOSURE INDUCED LIVER TOXICITY IN RAT NEWBORNS

PubMed Central

Allam, Ahmed A.; Gabr, Sami A.; Ajarem, Jamaan; Alghadir, Ahmad H.; Sekar, Revathi; Chow, Billy KC

2017-01-01

Background: This study aims to examine the protective effect of green tea on the disturbances in oxidative stress and apoptosis related factors, mostly produced due to perinatal lipopolysaccharide (LPS) exposure, that subsequently induces liver cell damage. Materials and Methods: Anti-free radical, Antioxidant, scavenging, geno-protective, and antiapoptotic activity of aqueous green tea extract (AGTE) were assessed against LPS-induced hepatic dysfunction in newborn-rats. AGTE at doses of 100 & 200 mg/kg was orally administered daily to rat dams, during gestation and lactation. Results: AGTE was observed to exhibit protective effects by significantly attenuating LPS-induced alterations in serum AST, ALT, bilirubin, and albumin levels. Significant increase in the total antioxidant capacity (TAC), DNA contents, and reduction in nitric oxide (NO) levels were observed in AGTE treated rats comparing LPS-toxicated ones. Additionally, AGTE treatment significantly down-regulated apoptotic markers and this effect was directly correlated to the degree of hepatic fibrosis. The possible mechanisms of the potential therapeutic-liver protective effect of AGTE could be due to free radical scavenging potential and antiapoptotic properties caused by the presence of antioxidant polyphenolic components in AGTE. Conclusion: We thereby propose, based on our findings, that the anti-free radical and anti-apoptotic inducing properties of AGTE active constituents attribute to its functional efficacy as anti-fibrotic agent. PMID:28573233

Selection of the Optimal Herbal Compositions of Red Clover and Pomegranate According to Their Protective Effect against Climacteric Symptoms in Ovariectomized Mice.

PubMed

Kang, Su Jin; Choi, Beom Rak; Kim, Seung Hee; Yi, Hae Yeon; Park, Hye Rim; Song, Chang Hyun; Ku, Sae Kwang; Lee, Young Joon

2016-07-23

This study aimed to ascertain the optimal range of red clover dry extracts (RC) and dried pomegranate concentrate powder (PCP) to induce anti-climacteric effects. Thus, the dose ranges showing protective effect of mixed formulae consisting of RC and PCP were examined in ovariectomized mice. At 28 days after bilateral ovariectomy (OVX), mixed herbal compositions (RC:PCP = 1:1, 1:2, 1:4, 1:8, 2:1, 4:1, and 8:1) were administered orally, at 120 mg/kg once daily for 84 days. We evaluated that RC and PCP mixture attenuate OVX-caused obesity, hyperlipidemia, hepatic steatosis, and osteoporosis. Compared to OVX-induced control mice, body weight and abdominal fat weight in OVX-induced mice were significantly decreased, concomitantly with increase of uterus weight by RC:PCP mixture. Additionally, significant increases in serum estradiol levels were observed in all RC:PCP-treated mice. RC:PCP mixture also showed protective effect against OVX-induced hyperlipidemia, hepatic steatosis. Total body and femur mean bone mineral density (BMD), osteocalcin, bALP contents were effectively increased by RC:PCP mixture. Taken together, RC:PCP mixture (2:1, 1:1, and 4:1) has remarkable protective effects against the changes induced by OVX. In particular, RC:PCP mixture (2:1) shows the strongest effect and may be considered as a potential protective agent against climacteric symptoms.

Selection of the Optimal Herbal Compositions of Red Clover and Pomegranate According to Their Protective Effect against Climacteric Symptoms in Ovariectomized Mice

PubMed Central

Kang, Su Jin; Choi, Beom Rak; Kim, Seung Hee; Yi, Hae Yeon; Park, Hye Rim; Song, Chang Hyun; Ku, Sae Kwang; Lee, Young Joon

2016-01-01

This study aimed to ascertain the optimal range of red clover dry extracts (RC) and dried pomegranate concentrate powder (PCP) to induce anti-climacteric effects. Thus, the dose ranges showing protective effect of mixed formulae consisting of RC and PCP were examined in ovariectomized mice. At 28 days after bilateral ovariectomy (OVX), mixed herbal compositions (RC:PCP = 1:1, 1:2, 1:4, 1:8, 2:1, 4:1, and 8:1) were administered orally, at 120 mg/kg once daily for 84 days. We evaluated that RC and PCP mixture attenuate OVX-caused obesity, hyperlipidemia, hepatic steatosis, and osteoporosis. Compared to OVX-induced control mice, body weight and abdominal fat weight in OVX-induced mice were significantly decreased, concomitantly with increase of uterus weight by RC:PCP mixture. Additionally, significant increases in serum estradiol levels were observed in all RC:PCP-treated mice. RC:PCP mixture also showed protective effect against OVX-induced hyperlipidemia, hepatic steatosis. Total body and femur mean bone mineral density (BMD), osteocalcin, bALP contents were effectively increased by RC:PCP mixture. Taken together, RC:PCP mixture (2:1, 1:1, and 4:1) has remarkable protective effects against the changes induced by OVX. In particular, RC:PCP mixture (2:1) shows the strongest effect and may be considered as a potential protective agent against climacteric symptoms. PMID:27455321

Protective effect of Carica papaya L leaf extract against alcohol induced acute gastric damage and blood oxidative stress in rats.

PubMed

Indran, M; Mahmood, A A; Kuppusamy, U R

2008-09-01

The effects of Carica papaya leaf (CPL) aqueous extract on alcohol induced acute gastric damage and the immediate blood oxidative stress level were studied in rats. The results showed that gastric ulcer index was significantly reduced in rats pretreated with CPL extract as compared with alcohol treated controls. The in vitro studies using 2,2-Diphenyl-1-Picryl-Hydrazyl (DPPH) assay showed strong antioxidant nature of CPL extract. Biochemical analysis indicated that the acute alcohol induced damage is reflected in the alterations of blood oxidative indices and CPL extract offered some protection with reduction in plasma lipid peroxidation level and increased erythrocyte glutathione peroxidase activity. Carica papaya leaf may potentially serve as a good therapeutic agent for protection against gastric ulcer and oxidative stress.

Protective effect of dietary potassium against cardiovascular damage in salt-sensitive hypertension: possible role of its antioxidant action.

PubMed

Ando, Katsuyuki; Matsui, Hiromitsu; Fujita, Megumi; Fujita, Toshiro

2010-01-01

It is well known that high salt intake induces hypertension and cardiovascular damage, while dietary potassium supplementation counteracts these harmful effects. Actually, the protective effect of potassium is strengthened with excess salt as compared with salt depletion. Although the precise mechanisms have not been fully elucidated, in our previous reports, the antihypertensive effect of dietary potassium was accompanied by sympathetic nerve inhibition in salt-sensitive hypertension. Also, potassium supplement suppressed salt-induced insulin resistance. These effects of dietary potassium can explain its cardio- and vasculo-protective action in addition to the potassium supplementation induced decreased salt-induced rise in blood pressure. On the other hand, salt-sensitive hypertension is associated with reactive oxygen species (ROS) overproduction. Moreover, sympathoexcitation can be induced by central ROS upregulation and insulin resistance can be caused by ROS excess in the target organs of insulin, such as skeletal muscle. Conversely, the seemingly different actions of potassium can be explained by the antioxidant effect of dietary potassium; in our recent studies, potassium supplementation inhibits salt-induced progress of cardiac diastolic dysfunction and vascular neointima formation by cuff placement around arteries, associated with the inhibition of regional ROS overproduction, in salt-sensitive hypertension. Thus, it is possible that dietary potassium protects against salt-induced cardiovascular damage by the reduction of ROS generation and by central sympatholytic action and amelioration of insulin resistance induced through its antioxidant effect.

In vivo Studies on the Protective Effect of Propolis on Doxorubicin-Induced Toxicity in Liver of Male Rats.

PubMed

Singla, Shivani; Kumar, Neelima R; Kaur, Jaspreet

2014-05-01

Since anticancer drugs are to be administered for long durations of time and are associated with systemic toxicities, the present studies were conducted to evaluate the protective potential of honey bee propolis against a widely used anticancer drug, doxorubicin (DXR) induced toxicity and oxidative damage in liver tissues of rats. Sixteen male Sprague Dawley rats, weighing between 200-220 g, were used and were divided into four equal groups. Propolis was given orally to rats [250 mg/kg body weight (bw) for 14 consecutive days] and DXR [25 mg/kg bw; intraperitoneally (i.p) was administered on 12(th), 13(th) and 14(th) day of the experiment. All the animals were sacrificed on day 15(th) day by decapitation. Blood and tissue samples were collected for measurement of toxicity and oxidative damage parameters (enzymatic assays and biochemical estimations). Administration of DXR for 3 days at a cumulative dose of 25 mg/kg bw, induced toxicity and oxidative stress in rats as significantly decreased activity of catalase (CAT), superoxide dismutase (SOD), glutathione-S-transferase (GST), glutathione peroxidase (GSH-Px) and glutathione reductase (GR) were observed in rat liver supernatants when compared to control group. Increased activity of serum glutamic pyruvic transaminase (SGPT) and serum glutamic oxaloacetic transaminase (SGOT) was obtained in DXR administered rats. Also there are significantly increased levels of lipid peroxides (measured as malondialdehyde formation) and significantly decreased level of glutathione (GSH) in doxorubicin treated rat liver supernatants as compared to healthy controls. On the other hand, administration of animals with propolis prior to DXR treatment led to significant modulation of the oxidative damage related parameters in liver and hepatotoxicity parameters in blood, when compared to doxorubicin treated group. However results were still not comparable to control group or only propolis group indicating partial protection by propolis at the concentration used against anticancer drug toxicity. Propolis extract was found to have a protective effect against doxorubicin-induced toxicity in rat liver though it was still not normalized. It can be concluded that propolis provides partial protection from toxicity of anticancer drug.

Immunization of Pigs by DNA Prime and Recombinant Vaccinia Virus Boost To Identify and Rank African Swine Fever Virus Immunogenic and Protective Proteins

PubMed Central

2018-01-01

ABSTRACT African swine fever virus (ASFV) causes an acute hemorrhagic fever in domestic pigs, with high socioeconomic impact. No vaccine is available, limiting options for control. Although live attenuated ASFV can induce up to 100% protection against lethal challenge, little is known of the antigens which induce this protective response. To identify additional ASFV immunogenic and potentially protective antigens, we cloned 47 viral genes in individual plasmids for gene vaccination and in recombinant vaccinia viruses. These antigens were selected to include proteins with different functions and timing of expression. Pools of up to 22 antigens were delivered by DNA prime and recombinant vaccinia virus boost to groups of pigs. Responses of immune lymphocytes from pigs to individual recombinant proteins and to ASFV were measured by interferon gamma enzyme-linked immunosorbent spot (ELISpot) assays to identify a subset of the antigens that consistently induced the highest responses. All 47 antigens were then delivered to pigs by DNA prime and recombinant vaccinia virus boost, and pigs were challenged with a lethal dose of ASFV isolate Georgia 2007/1. Although pigs developed clinical and pathological signs consistent with acute ASFV, viral genome levels were significantly reduced in blood and several lymph tissues in those pigs immunized with vectors expressing ASFV antigens compared with the levels in control pigs. IMPORTANCE The lack of a vaccine limits the options to control African swine fever. Advances have been made in the development of genetically modified live attenuated ASFV that can induce protection against challenge. However, there may be safety issues relating to the use of these in the field. There is little information about ASFV antigens that can induce a protective immune response against challenge. We carried out a large screen of 30% of ASFV antigens by delivering individual genes in different pools to pigs by DNA immunization prime and recombinant vaccinia virus boost. The responses in immunized pigs to these individual antigens were compared to identify the most immunogenic. Lethal challenge of pigs immunized with a pool of antigens resulted in reduced levels of virus in blood and lymph tissues compared to those in pigs immunized with control vectors. Novel immunogenic ASFV proteins have been identified for further testing as vaccine candidates. PMID:29386289

Immunization of Pigs by DNA Prime and Recombinant Vaccinia Virus Boost To Identify and Rank African Swine Fever Virus Immunogenic and Protective Proteins.

PubMed

Jancovich, James K; Chapman, Dave; Hansen, Debra T; Robida, Mark D; Loskutov, Andrey; Craciunescu, Felicia; Borovkov, Alex; Kibler, Karen; Goatley, Lynnette; King, Katherine; Netherton, Christopher L; Taylor, Geraldine; Jacobs, Bertram; Sykes, Kathryn; Dixon, Linda K

2018-04-15

African swine fever virus (ASFV) causes an acute hemorrhagic fever in domestic pigs, with high socioeconomic impact. No vaccine is available, limiting options for control. Although live attenuated ASFV can induce up to 100% protection against lethal challenge, little is known of the antigens which induce this protective response. To identify additional ASFV immunogenic and potentially protective antigens, we cloned 47 viral genes in individual plasmids for gene vaccination and in recombinant vaccinia viruses. These antigens were selected to include proteins with different functions and timing of expression. Pools of up to 22 antigens were delivered by DNA prime and recombinant vaccinia virus boost to groups of pigs. Responses of immune lymphocytes from pigs to individual recombinant proteins and to ASFV were measured by interferon gamma enzyme-linked immunosorbent spot (ELISpot) assays to identify a subset of the antigens that consistently induced the highest responses. All 47 antigens were then delivered to pigs by DNA prime and recombinant vaccinia virus boost, and pigs were challenged with a lethal dose of ASFV isolate Georgia 2007/1. Although pigs developed clinical and pathological signs consistent with acute ASFV, viral genome levels were significantly reduced in blood and several lymph tissues in those pigs immunized with vectors expressing ASFV antigens compared with the levels in control pigs. IMPORTANCE The lack of a vaccine limits the options to control African swine fever. Advances have been made in the development of genetically modified live attenuated ASFV that can induce protection against challenge. However, there may be safety issues relating to the use of these in the field. There is little information about ASFV antigens that can induce a protective immune response against challenge. We carried out a large screen of 30% of ASFV antigens by delivering individual genes in different pools to pigs by DNA immunization prime and recombinant vaccinia virus boost. The responses in immunized pigs to these individual antigens were compared to identify the most immunogenic. Lethal challenge of pigs immunized with a pool of antigens resulted in reduced levels of virus in blood and lymph tissues compared to those in pigs immunized with control vectors. Novel immunogenic ASFV proteins have been identified for further testing as vaccine candidates. Copyright © 2018 Jancovich et al.

Immunization with M2e-Displaying T7 Bacteriophage Nanoparticles Protects against Influenza A Virus Challenge

PubMed Central

Hashemi, Hamidreza; Pouyanfard, Somayeh; Bandehpour, Mojgan; Noroozbabaei, Zahra; Kazemi, Bahram; Saelens, Xavier; Mokhtari-Azad, Talat

2012-01-01

Considering the emergence of highly pathogenic influenza viruses and threat of worldwide pandemics, there is an urgent need to develop broadly-protective influenza vaccines. In this study, we demonstrate the potential of T7 bacteriophage-based nanoparticles with genetically fused ectodomain of influenza A virus M2 protein (T7-M2e) as a candidate universal flu vaccine. Immunization of mice with non-adjuvanted T7-M2e elicited M2e-specific serum antibody responses that were similar in magnitude to those elicited by M2e peptide administered in Freund’s adjuvant. Comparable IgG responses directed against T7 phage capsomers were induced following vaccination with wild type T7 or T7-M2e. T7-M2e immunization induced balanced amounts of IgG1 and IgG2a antibodies and these antibodies specifically recognized native M2 on the surface of influenza A virus-infected mammalian cells. The frequency of IFN-γ-secreting T cells induced by T7-M2e nanoparticles was comparable to those elicited by M2e peptide emulsified in Freund’s adjuvant. Emulsification of T7-M2e nanoparticles in Freund’s adjuvant, however, induced a significantly stronger T cell response. Furthermore, T7-M2e-immunized mice were protected against lethal challenge with an H1N1 or an H3N2 virus, implying the induction of hetero-subtypic immunity in our mouse model. T7-M2e-immunized mice displayed considerable weight loss and had significantly reduced viral load in their lungs compared to controls. We conclude that display of M2e on the surface of T7 phage nanoparticles offers an efficient and economical opportunity to induce cross-protective M2e-based immunity against influenza A. PMID:23029232

Role of pirenoxine in the effects of catalin on in vitro ultraviolet-induced lens protein turbidity and selenite-induced cataractogenesis in vivo

PubMed Central

Hu, Chao-Chien; Liao, Jiahn-Haur; Hsu, Kuang-Yang; Lin, I-Lin; Tsai, Ming-Hsuan; Wu, Wen-Hsin; Wei, Tzu-Tang; Huang, Yi-Shiang; Chiu, Shih-Jiuan; Chen, Hsiang-Yin; Wu, Shih-Hsiung

2011-01-01

Purpose In this study, we investigated the biochemical pharmacology of pirenoxine (PRX) and catalin under in vitro selenite/calcium- and ultraviolet (UV)-induced lens protein turbidity challenges. The systemic effects of catalin were determined using a selenite-induced cataractogenesis rat model. Methods In vitro cataractogenesis assay systems (including UVB/C photo-oxidation of lens crystallins, calpain-induced proteolysis, and selenite/calcium-induced turbidity of lens crystallin solutions) were used to screen the activity of PRX and catalin eye drop solutions. Turbidity was identified as the optical density measured using spectroscopy at 405 nm. We also determined the in vivo effects of catalin on cataract severity in a selenite-induced cataract rat model. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS–PAGE) was applied to analyze the integrity of crystallin samples. Results PRX at 1,000 μM significantly delayed UVC-induced turbidity formation compared to controls after 4 h of UVC exposure (p<0.05), but not in groups incubated with PRX concentrations of <1,000 μM. Results were further confirmed by SDS–PAGE. The absolute γ-crystallin turbidity induced by 4 h of UVC exposure was ameliorated in the presence of catalin equivalent to 1~100 μM PRX in a concentration-dependent manner. Samples with catalin-formulated vehicle only (CataV) and those containing PRX equivalent to 100 μM had a similar protective effect after 4 h of UVC exposure compared to the controls (p<0.05). PRX at 0.03, 0.1, and 0.3 μM significantly delayed 10 mM selenite- and calcium-induced turbidity formation compared to controls on days 0~4 (p<0.05). Catalin (equivalent to 32, 80, and 100 μM PRX) had an initial protective effect against selenite-induced lens protein turbidity on day 1 (p<0.05). Subcutaneous pretreatment with catalin (5 mg/kg) also statistically decreased the mean cataract scores in selenite-induced cataract rats on post-induction day 3 compared to the controls (1.3±0.2 versus 2.4±0.4; p<0.05). However, catalin (equivalent to up to 100 μM PRX) did not inhibit calpain-induced proteolysis activated by calcium, and neither did 100 μM PRX. Conclusions PRX at micromolar levels ameliorated selenite- and calcium-induced lens protein turbidity but required millimolar levels to protect against UVC irradiation. The observed inhibition of UVC-induced turbidity of lens crystallins by catalin at micromolar concentrations may have been a result of the catalin-formulated vehicle. Transient protection by catalin against selenite-induced turbidity of crystallin solutions in vitro was supported by the ameliorated cataract scores in the early stage of cataractogenesis in vivo by subcutaneously administered catalin. PRX could not inhibit calpain-induced proteolysis activated by calcium or catalin itself, and may be detrimental to crystallins under UVB exposure. Further studies on formulation modifications of catalin and recommended doses of PRX to optimize clinical efficacy by cataract type are warranted. PMID:21850160

Role of pirenoxine in the effects of catalin on in vitro ultraviolet-induced lens protein turbidity and selenite-induced cataractogenesis in vivo.

PubMed

Hu, Chao-Chien; Liao, Jiahn-Haur; Hsu, Kuang-Yang; Lin, I-Lin; Tsai, Ming-Hsuan; Wu, Wen-Hsin; Wei, Tzu-Tang; Huang, Yi-Shiang; Chiu, Shih-Jiuan; Chen, Hsiang-Yin; Wu, Shih-Hsiung; Wu, Tzu-Hua

2011-01-01

In this study, we investigated the biochemical pharmacology of pirenoxine (PRX) and catalin under in vitro selenite/calcium- and ultraviolet (UV)-induced lens protein turbidity challenges. The systemic effects of catalin were determined using a selenite-induced cataractogenesis rat model. In vitro cataractogenesis assay systems (including UVB/C photo-oxidation of lens crystallins, calpain-induced proteolysis, and selenite/calcium-induced turbidity of lens crystallin solutions) were used to screen the activity of PRX and catalin eye drop solutions. Turbidity was identified as the optical density measured using spectroscopy at 405 nm. We also determined the in vivo effects of catalin on cataract severity in a selenite-induced cataract rat model. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was applied to analyze the integrity of crystallin samples. PRX at 1,000 μM significantly delayed UVC-induced turbidity formation compared to controls after 4 h of UVC exposure (p<0.05), but not in groups incubated with PRX concentrations of <1,000 μM. Results were further confirmed by SDS-PAGE. The absolute γ-crystallin turbidity induced by 4 h of UVC exposure was ameliorated in the presence of catalin equivalent to 1~100 μM PRX in a concentration-dependent manner. Samples with catalin-formulated vehicle only (CataV) and those containing PRX equivalent to 100 μM had a similar protective effect after 4 h of UVC exposure compared to the controls (p<0.05). PRX at 0.03, 0.1, and 0.3 μM significantly delayed 10 mM selenite- and calcium-induced turbidity formation compared to controls on days 0~4 (p<0.05). Catalin (equivalent to 32, 80, and 100 μM PRX) had an initial protective effect against selenite-induced lens protein turbidity on day 1 (p<0.05). Subcutaneous pretreatment with catalin (5 mg/kg) also statistically decreased the mean cataract scores in selenite-induced cataract rats on post-induction day 3 compared to the controls (1.3±0.2 versus 2.4±0.4; p<0.05). However, catalin (equivalent to up to 100 μM PRX) did not inhibit calpain-induced proteolysis activated by calcium, and neither did 100 μM PRX. PRX at micromolar levels ameliorated selenite- and calcium-induced lens protein turbidity but required millimolar levels to protect against UVC irradiation. The observed inhibition of UVC-induced turbidity of lens crystallins by catalin at micromolar concentrations may have been a result of the catalin-formulated vehicle. Transient protection by catalin against selenite-induced turbidity of crystallin solutions in vitro was supported by the ameliorated cataract scores in the early stage of cataractogenesis in vivo by subcutaneously administered catalin. PRX could not inhibit calpain-induced proteolysis activated by calcium or catalin itself, and may be detrimental to crystallins under UVB exposure. Further studies on formulation modifications of catalin and recommended doses of PRX to optimize clinical efficacy by cataract type are warranted.

Alpha-synuclein functions in the nucleus to protect against hydroxyurea-induced replication stress in yeast

PubMed Central

Liu, Xianpeng; Lee, Yong Joo; Liou, Liang-Chun; Ren, Qun; Zhang, Zhaojie; Wang, Shaoxiao; Witt, Stephan N.

2011-01-01

Hydroxyurea (HU) inhibits ribonucleotide reductase (RNR), which catalyzes the rate-limiting synthesis of deoxyribonucleotides for DNA replication. HU is used to treat HIV, sickle-cell anemia and some cancers. We found that, compared with vector control cells, low levels of alpha-synuclein (α-syn) protect S. cerevisiae cells from the growth inhibition and reactive oxygen species (ROS) accumulation induced by HU. Analysis of this effect using different α-syn mutants revealed that the α-syn protein functions in the nucleus and not the cytoplasm to modulate S-phase checkpoint responses: α-syn up-regulates histone acetylation and RNR levels, maintains helicase minichromosome maintenance protein complexes (Mcm2–7) on chromatin and inhibits HU-induced ROS accumulation. Strikingly, when residues 2–10 or 96–140 are deleted, this protective function of α-syn in the nucleus is abolished. Understanding the mechanism by which α-syn protects against HU could expand our knowledge of the normal function of this neuronal protein. PMID:21642386

The IL23R R381Q Gene Variant Protects against Immune-Mediated Diseases by Impairing IL-23-Induced Th17 Effector Response in Humans

PubMed Central

Di Meglio, Paola; Di Cesare, Antonella; Laggner, Ute; Chu, Chung-Ching; Napolitano, Luca; Villanova, Federica; Tosi, Isabella; Capon, Francesca; Trembath, Richard C.; Peris, Ketty; Nestle, Frank O.

2011-01-01

IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A) and common (G) allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies. PMID:21364948

The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

PubMed

Di Meglio, Paola; Di Cesare, Antonella; Laggner, Ute; Chu, Chung-Ching; Napolitano, Luca; Villanova, Federica; Tosi, Isabella; Capon, Francesca; Trembath, Richard C; Peris, Ketty; Nestle, Frank O

2011-02-22

IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A) and common (G) allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

Fat-Specific DsbA-L Overexpression Promotes Adiponectin Multimerization and Protects Mice From Diet-Induced Obesity and Insulin Resistance

PubMed Central

Liu, Meilian; Xiang, Ruihua; Wilk, Sarah Ann; Zhang, Ning; Sloane, Lauren B.; Azarnoush, Kian; Zhou, Lijun; Chen, Hongzhi; Xiang, Guangda; Walter, Christi A.; Austad, Steven N.; Musi, Nicolas; DeFronzo, Ralph A.; Asmis, Reto; Scherer, Philipp E.; Dong, Lily Q.; Liu, Feng

2012-01-01

The antidiabetic and antiatherosclerotic effects of adiponectin make it a desirable drug target for the treatment of metabolic and cardiovascular diseases. However, the adiponectin-based drug development approach turns out to be difficult due to extremely high serum levels of this adipokine. On the other hand, a significant correlation between adiponectin multimerization and its insulin-sensitizing effects has been demonstrated, suggesting a promising alternative therapeutic strategy. Here we show that transgenic mice overexpressing disulfide bond A oxidoreductase-like protein in fat (fDsbA-L) exhibited increased levels of total and the high-molecular-weight form of adiponectin compared with wild-type (WT) littermates. The fDsbA-L mice also displayed resistance to diet-induced obesity, insulin resistance, and hepatic steatosis compared with WT control mice. The protective effects of DsbA-L overexpression on diet-induced insulin resistance, but not increased body weight and fat cell size, were significantly decreased in adiponectin-deficient fDsbA-L mice (fDsbA-L/Ad−/−). In addition, the fDsbA-L/Ad−/− mice displayed greater activity and energy expenditure compared with adiponectin knockout mice under a high-fat diet. Taken together, our results demonstrate that DsbA-L protects mice from diet-induced obesity and insulin resistance through adiponectin-dependent and independent mechanisms. In addition, upregulation of DsbA-L could be an effective therapeutic approach for the treatment of obesity and its associated metabolic disorders. PMID:22807031

Glycemic control protects against trabecular bone microarchitectural damage in a juvenile male rat model of streptozotocin-induced diabetes.

PubMed

de Oliveira, Guilherme José Pimentel Lopes; Basso, Túlio Luiz Durigan; Fontanari, Lucas Amaral; Faloni, Ana Paula de Souza; Marcantonio, Élcio; Orrico, Silvana Regina Perez

2017-08-01

To determine which features of the bone microarchitecture are affected by established diabetes mellitus (DM) and the effectiveness of glycemic control in the protection of bone tissue. Sixty juvenile Wistar male rats were divided into three groups of 20 animals: a control group (C) that included healthy animals, a diabetic group (D) that included animals with induced diabetes, and a controlled diabetic group (CD) that included animals with induced diabetes that were treated with insulin. The animals were euthanized at the periods of 6 and 8 weeks after the induction of diabetes (10 animals per group/period). Vertebral L4 specimens were submitted to μCT analysis to assess the following parameters of the bone microarchitecture: bone volume fraction (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular spacing (Tb.Sp). The D group exhibited lower values of BV/TV (%) and numbers of trabeculae compared with the C group at 6 and 8 weeks and compared with the CD group at 8 weeks. The CD group exhibited higher trabecular thickness values compared with the D group at 8 weeks. There were no differences between the groups regarding the spaces between the trabeculae. Induced diabetes affected the microarchitecture of the trabecular bone of the vertebrae by reducing the values of the majority of the parameters in relation to those of the control group. Glycemic control with insulin appears to protect bones from the effects of the hyperglycemia.

Protective effects of parecoxib on rat primary astrocytes from oxidative stress induced by hydrogen peroxide* #

PubMed Central

Ling, Yun-zhi; Li, Xiao-hong; Yu, Li; Zhang, Ye; Liang, Qi-sheng; Yang, Xiao-di; Wang, Hong-tao

2016-01-01

Objective: To investigate the protective effects of parecoxib from oxidative stress induced by hydrogen peroxide (H2O2) in rat astrocytes in vitro. Methods: All experiments included 4 groups: (1) negative control (NC) group, without any treatment; (2) H2O2 treatment group, 100 μmol/L H2O2 treatment for 24 h; (3) and (4) parecoxib pretreatment groups, 80 and 160 μmol/L parecoxib treatment for 24 h, respectively, and then treated with 100 μmol/L H2O2. Several indices were investigated, and the expressions of Bax, Bcl-2, and brain-derived neurotrophic factor (BDNF) were quantified. Results: Compared to the NC group, exposure to H2O2 resulted in significant morphological changes, which could be reversed by pretreatment of parecoxib. In addition, H2O2 treatment led to loss of viability (P=0.026) and increased intracellular reactive oxygen species (ROS) levels (P<0.001), and induced apoptosis (P<0.01) in the primary astrocytes relative to the NC group. However, in the parecoxib pretreatment groups, all the above changes reversed significantly (P<0.05) as compared to the H2O2 treatment group, and were nearly unchanged when compared to the NC group. Mechanical investigation showed that dysregulated Bax, Bcl-2, and BDNF could be implicated in these changes. Conclusions: Our results indicated that parecoxib provided a protective effect from oxidative stress induced by exposure to H2O2. PMID:27604861

Protective effects of parecoxib on rat primary astrocytes from oxidative stress induced by hydrogen peroxide.

PubMed

Ling, Yun-Zhi; Li, Xiao-Hong; Yu, Li; Zhang, Ye; Liang, Qi-Sheng; Yang, Xiao-di; Wang, Hong-Tao

2016-09-01

To investigate the protective effects of parecoxib from oxidative stress induced by hydrogen peroxide (H2O2) in rat astrocytes in vitro. All experiments included 4 groups: (1) negative control (NC) group, without any treatment; (2) H2O2 treatment group, 100 μmol/L H2O2 treatment for 24 h; (3) and (4) parecoxib pretreatment groups, 80 and 160 μmol/L parecoxib treatment for 24 h, respectively, and then treated with 100 μmol/L H2O2. Several indices were investigated, and the expressions of Bax, Bcl-2, and brain-derived neurotrophic factor (BDNF) were quantified. Compared to the NC group, exposure to H2O2 resulted in significant morphological changes, which could be reversed by pretreatment of parecoxib. In addition, H2O2 treatment led to loss of viability (P=0.026) and increased intracellular reactive oxygen species (ROS) levels (P<0.001), and induced apoptosis (P<0.01) in the primary astrocytes relative to the NC group. However, in the parecoxib pretreatment groups, all the above changes reversed significantly (P<0.05) as compared to the H2O2 treatment group, and were nearly unchanged when compared to the NC group. Mechanical investigation showed that dysregulated Bax, Bcl-2, and BDNF could be implicated in these changes. Our results indicated that parecoxib provided a protective effect from oxidative stress induced by exposure to H2O2.

Pitavastatin attenuates AGEs-induced mitophagy via inhibition of ROS generation in the mitochondria of cardiomyocytes.

PubMed

Zha, Zhimin; Wang, Junhong; Li, Shiling; Guo, Yan

2017-11-01

This study aimed to investigate whether pitavastatin protected against injury induced by advanced glycation end products products (AGEs) in neonatal rat cardiomyocytes, and to examine the underlying mechanisms. Cardiomyocytes of neonatal rats were incubated for 48 hours with AGEs (100mg/mL), receptor for advanced glycation end products (RAGE), antibody (1 mg/mL) and pitavastatin (600 ng/mL). The levels of p62 and beclin1 were determined by Western blotting. Mitochondrial membrane potential (DYm) and the generation of reactive oxygen species (ROS) were measured through the JC-1 and DCFH-DA. In the AGEs group, the expression of beclin1 was remarkably increased compared to the control group, while the expression of p62 was significantly decreased. AGEs also markedly decreasedDYm and significantly increased ROS compared with the control group. After treatment with RAGE antibody or pitavastatin, the level of beclin1 was markedly decreased compared with the AGEs group, but the level of p62 was remarkably increased. In the AGEs+ RAGE antibody group and AGEs+ pitavastatin group,DYm was significantly increased and ROS was remarkably decreased compared with the AGEs group. In conclusion, AGEs-RAGE may induce autophagy of cardiomyocytes by generation of ROS and pitavastatin could protect against AGEs-induced injury against cardiomyocytes.

Edaravone Protected Human Brain Microvascular Endothelial Cells from Methylglyoxal-Induced Injury by Inhibiting AGEs/RAGE/Oxidative Stress

PubMed Central

Li, Wenlu; Xu, Hongjiao; Hu, Yangmin; He, Ping; Ni, Zhenzhen; Xu, Huimin; Zhang, Zhongmiao; Dai, Haibin

2013-01-01

Subjects with diabetes experience an increased risk of cerebrovascular disease and stroke compared with nondiabetic age-matched individuals. Increased formation of reactive physiological dicarbonyl compound methylglyoxal (MGO) seems to be implicated in the development of diabetic vascular complication due to its protein glycation and oxidative stress effect. Edaravone, a novel radical scavenger, has been reported to display the advantageous effects on ischemic stroke both in animals and clinical trials; however, little is known about whether edaravone has protective effects on diabetic cerebrovascular injury. Using cultured human brain microvascular endothelial cells (HBMEC), protective effects of edaravone on MGO and MGO enhancing oxygen-glucose deprivation (OGD) induced injury were investigated. Cell injury was measured by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) formation, cell account, lactate dehydrogenase (LDH) release and Rhodamine 123 staining. Advanced glycation end-products (AGEs) formation and receptor for advanced glycation end-products (RAGE) expression were measured by western blotting. Cellular oxidative stress was measured by reactive oxygen species (ROS) release. Treatment of MGO for 24 h significantly induced HBMEC injury, which was inhibited by pretreatment of edaravone from 10–100 µmol/l. What’s more, treatment of MGO enhanced AGEs accumulation, RAGE expression and ROS release in the cultured HBMEC, which were inhibited by 100 µmol/l edaravone. Finally, treatment of MGO for 24 h and then followed by 3 h OGD insult significantly enhanced cell injury when compared with OGD insult only, which was also protected by 100 µmol/l edaravone. Thus, edaravone protected HBMEC from MGO and MGO enhancing OGD-induced injury by inhibiting AGEs/RAGE/oxidative stress. PMID:24098758

β-Cell protection and antidiabetic activities of Crassocephalum crepidioides (Asteraceae) Benth. S. Moore extract against alloxan-induced oxidative stress via regulation of apoptosis and reactive oxygen species (ROS).

PubMed

Bahar, Entaz; Akter, Kazi-Marjahan; Lee, Geum-Hwa; Lee, Hwa-Young; Rashid, Harun-Or; Choi, Min-Kyung; Bhattarai, Kashi Raj; Hossain, Mir Mohammad Monir; Ara, Joushan; Mazumder, Kishor; Raihan, Obayed; Chae, Han-Jung; Yoon, Hyonok

2017-03-29

Medicinal plants are becoming more popular in the treatment of various diseases because of the adverse effects of the current therapy, especially antioxidant plant components such as phenols and flavonoids have a protective role against oxidative stress-induced degenerative diseases like diabetes. Thus, the purpose of this study was to investigate β-cell protection and antidiabetic activities of Crassocephalum crepidioides (Asteraceae) Benth. S. Moore. The in-vitro study was conducted by the pancreatic β-cell culture and α-amylase inhibition technique which includes two methods, namely starch-iodine method and 3,5-dinitrosalicylic acid (DNSA) method. On the other hand, the in-vivo study was performed by oral glucose tolerance test (OGTT) method and alloxan-induced diabetes method by using Wistar albino rat. At the end pancreatic specimens were removed and processed for histopathological study. The plant extract showed significant (*p < 0.05, **p < 0.01) effect on hyperglycemia as compared to standard (Gliclazide) in OGTT. The plant extract showed efficient protection activity of pancreatic β-cell from cell death in INS-1 cell line by significantly reduced (*p < 0.05, **p < 0.01) the levels alloxan-induced apoptosis and intracellular reactive oxygen species (ROS) accumulation. In addition, the plant extract showed a significant (*p < 0.05, **p < 0.01) effect on hyperglycemia by increases in percent of β-cells present in each islet (45% - 60%) compared to the diabetic group. The result showed that C. crepidioides had β-cell protection and antidiabetic activities in pancreatic β-cell culture and Wistar albino rat.

Protective effects of edaravone combined puerarin on inhalation lung injury induced by black gunpowder smog.

PubMed

Wang, Zhengguan; Li, Ruibing; Liu, Yifan; Liu, Xiaoting; Chen, Wenyan; Xu, Shumin; Guo, Yuni; Duan, Jinyang; Chen, Yihong; Wang, Chengbin

2015-05-01

The present study aimed to investigate the combined effects of puerarin with edaravone on inhalation lung injury induced by black gunpowder smog. Male Wistar rats were divided into five groups (control group, edaravone group, puerarin group, edaravone combined with puerarin group and inhalation group). The severity of pulmonary injuries was evaluated after inducing acute lung injury. Arterial blood gas, inflammatory cytokines, biochemical, parameters, cell counting, W/D weight ratio and histopathology were analyzed. Results in lung tissues, either edaravone or puerarin treatment alone showed significant protective effects against neutrophil infiltration and tissue injury, as demonstrated by myeloperoxidase activity and histopathological analysis (all p<0.05). In addition, combined treatment with both edaravone and puerarin demonstrated additive protective effects on smog-induced lung injury, compared with single treatment. Combination of edaravone and puerarin shows promise as a new treatment option for acute lung injury/acute respiratory distress syndrome patients. Copyright © 2015 Elsevier B.V. All rights reserved.

Protective effect of U74500A on phorbol myristate acetate-induced acute lung injury.

PubMed

Chu, Shi-Jye; Chang, Deh-Ming; Wang, David; Lin, Hen-I; Lin, Shih-Hua; Hsu, Kang

2004-08-01

1. The present study was designed to determine whether U74500A could ameliorate acute lung injury (ALI) induced by phorbol myristate acetate (PMA) in our rat isolated lung model compared with any amelioration induced by dimethylthiourea (DMTU), superoxide dismutase (SOD) and catalase. 2. Acute lung injury was induced successfully by PMA during 60 min of observation. At 2 microg/kg, PMA elicited a significant increase in microvascular permeability (measured using the capillary filtration coefficient Kfc), lung weight gain, the lung weight/bodyweight ratio, pulmonary arterial pressure and protein concentration of the bronchoalveolar lavage fluid. 3. Pretreatment with 1.5 mg/kg U74500A significantly attenuated ALI; there was no significant increase in any parameters measured, except for pulmonary arterial pressure. The protective effect of U74500A was approximately the same as that of 600 mg/kg DMTU. However, 6000 U/kg SOD, 50,000 U/kg catalase and 6000 U/kg SOD + 50,000 U/kg catalase had no protective effect. 4. These experimental data suggest that U74500A significantly ameliorates ALI induced by PMA in rats.

Characterization of antigenic determinants in ApxIIA exotoxin capable of inducing protective immunity to Actinobacillus pleuropneumoniae challenge.

PubMed

Seo, Ki-Weon; Kim, Dong-Heon; Kim, Ah Hyun; Yoo, Han-Sang; Lee, Kyung-Yeol; Jang, Yong-Suk

2011-01-01

Actinobacillus pleuropneumoniae is the causative agent of porcine pleuropneumonia. Among the virulence factors of the pathogen, ApxIIA, a bacterial exotoxin, is expressed by many serotypes and presents a plausible target for vaccine development. We characterized the region within ApxIIA that induces a protective immune response against bacterial infection using mouse challenge model. Recombinant proteins spanning the length of ApxIIA were produced and antiserum to the full-length ApxIIA was induced in mice. This antiserum recognized fragments #2, #3 and #5 with high binding specificity, but showed poor recognition for fragments #1 and #4. Of the antisera induced in mice by injection of each fragments, only the antiserum to fragment #4 failed to efficiently recognize the full-length antigen, although the individual antisera recognized their cognate antigens with almost equal efficiency. The protective potency of the immunogenic proteins against a challenge injection of bacteria in vivo correlated well with the antibody titer. Fragment #5 induced the highest level of protective activity, comparable to that by the full-length protein. These results support the use of fragment #5 to produce a vaccine against A. pleuropneumoniae challenge, since the small antigen peptide is easier to handle than is the full-length protein and can be expressed efficiently in heterologous expression systems.

Microbiota regulate the ability of lung dendritic cells to induce IgA class-switch recombination and generate protective gastrointestinal immune responses

PubMed Central

Ruane, Darren; Chorny, Alejo; Lee, Haekyung; Faith, Jeremiah; Pandey, Gaurav; Shan, Meimei; Simchoni, Noa; Rahman, Adeeb; Garg, Aakash; Weinstein, Erica G.; Oropallo, Michael; Gaylord, Michelle; Ungaro, Ryan; Cunningham-Rundles, Charlotte; Alexandropoulos, Konstantina; Mucida, Daniel; Merad, Miriam; Cerutti, Andrea

2016-01-01

Protective immunoglobulin A (IgA) responses to oral antigens are usually orchestrated by gut dendritic cells (DCs). Here, we show that lung CD103+ and CD24+CD11b+ DCs induced IgA class-switch recombination (CSR) by activating B cells through T cell–dependent or –independent pathways. Compared with lung DCs (LDC), lung CD64+ macrophages had decreased expression of B cell activation genes and induced significantly less IgA production. Microbial stimuli, acting through Toll-like receptors, induced transforming growth factor-β (TGF-β) production by LDCs and exerted a profound influence on LDC-mediated IgA CSR. After intranasal immunization with inactive cholera toxin (CT), LDCs stimulated retinoic acid–dependent up-regulation of α4β7 and CCR9 gut-homing receptors on local IgA-expressing B cells. Migration of these B cells to the gut resulted in IgA-mediated protection against an oral challenge with active CT. However, in germ-free mice, the levels of LDC-induced, CT–specific IgA in the gut are significantly reduced. Herein, we demonstrate an unexpected role of the microbiota in modulating the protective efficacy of intranasal vaccination through their effect on the IgA class-switching function of LDCs. PMID:26712806

Lithospermic acid B protects beta-cells from cytokine-induced apoptosis by alleviating apoptotic pathways and activating anti-apoptotic pathways of Nrf2-HO-1 and Sirt1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Byung-Wan; Chun, Sung Wan; Kim, Soo Hyun

2011-04-01

Lithospermic acid B (LAB) has been reported to protect OLETF rats, an established type 2 diabetic animal model, from the development of diabetes-related vascular complications. We investigated whether magnesium lithospermate B (LAB) has a protective role under cytokine-induced apoptosis in INS-1 cells in vitro and whether it slows the development of diabetes in OLETF rats in vivo. Pretreatment with 50 {mu}M LAB significantly reduced the 1000 U/mL INF-{gamma} and 100 U/mL IL-1{beta}-induced INS-1 cell death. LAB significantly alleviated cytokine-induced phosphorylations of p38 and JNK in accordance with a decrease in cleaved caspase-3 activity in beta-cells. LAB also protected against themore » cytokine-induced caspase-3 apoptotic pathway via significant activation of Nrf2-HO (heme-oxigenase)-1 and Sirt1 expression. OLETF rats treated with 40 mg/kg/day LAB showed a significant improvement in glucose tolerance compared to untreated OLETF control rats in vivo. Our results suggest that the cytoprotective effects of LAB on pancreatic {beta}-cells are related with both alleviating apoptotic pathways and activating anti-apoptotic pathways of Nrf2-HO-1 and Sirt1.« less

Poly(ADP-ribose) polymerase-1 protects from oxidative stress induced endothelial dysfunction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gebhard, Catherine; Staehli, Barbara E.; Zurich Center for Integrative Human Physiology

2011-11-04

Highlights: Black-Right-Pointing-Pointer The nuclear enzyme PARP-1 is a downstream effector of oxidative stress. Black-Right-Pointing-Pointer PARP-1 protects from oxidative stress induced endothelial dysfunction. Black-Right-Pointing-Pointer This effect is mediated through inhibition of vasoconstrictor prostanoid production. Black-Right-Pointing-Pointer Thus, PARP-1 may play a protective role as antioxidant defense mechanism. -- Abstract: Background: Generation of reactive oxygen species (ROS) is a key feature of vascular disease. Activation of the nuclear enzyme poly (adenosine diphosphate [ADP]-ribose) polymerase-1 (PARP-1) is a downstream effector of oxidative stress. Methods: PARP-1(-/-) and PARP-1(+/+) mice were injected with paraquat (PQ; 10 mg/kg i.p.) to induce intracellular oxidative stress. Aortic rings weremore » suspended in organ chambers for isometric tension recording to analyze vascular function. Results: PQ treatment markedly impaired endothelium-dependent relaxations to acetylcholine in PARP-1(-/-), but not PARP-1(+/+) mice (p < 0.0001). Maximal relaxation was 45% in PQ treated PARP-1(-/-) mice compared to 79% in PARP-1(+/+) mice. In contrast, endothelium-independent relaxations to sodium nitroprusside (SNP) were not altered. After PQ treatment, L-NAME enhanced contractions to norepinephrine by 2.0-fold in PARP-1(-/-) mice, and those to acetylcholine by 3.3-fold, respectively, as compared to PARP-1(+/+) mice. PEG-superoxide dismutase (SOD) and PEG-catalase prevented the effect of PQ on endothelium-dependent relaxations to acetylcholine in PARP-1(-/-) mice (p < 0.001 vs. PQ treated PARP-1(+/+) mice. Indomethacin restored endothelium-dependent relaxations to acetylcholine in PQ treated PARP-1(-/-) mice (p < 0.05 vs. PQ treated PARP-1(+/+). Conclusion: PARP-1 protects from acute intracellular oxidative stress induced endothelial dysfunction by inhibiting ROS induced production of vasoconstrictor prostanoids.« less

Protective effects of ascorbic acid and garlic extract against lead-induced apoptosis in developing rat hippocampus.

PubMed

Ebrahimzadeh-Bideskan, Ali-Reza; Hami, Javad; Alipour, Fatemeh; Haghir, Hossein; Fazel, Ali-Reza; Sadeghi, Akram

2016-10-01

Lead exposure has negative effects on developing nervous system and induces apoptosis in newly generated neurons. Natural antioxidants (i.e. Ascorbic acid and Garlic) might protect against lead-induced neuronal cell damage. The aim of the present study was to investigate the protective effects of Ascorbic acid and Garlic administration during pregnancy and lactation on lead-induced apoptosis in rat developing hippocampus. Timed pregnant Wistar rats were administrated with Lead (1500 ppm) via drinking water (Pb group) or lead plus Ascorbic acid (Pb + AA Group, 500 mg/kg, IP), or lead plus Garlic Extract (Pb + G Group, 1 ml garlic juice/100 g BW, via Gavage) from early gestation (GD 0) until postnatal day 50 (PN 50). At the end of experiments, the pups' brains were carefully dissected. To identify neuronal death, the brain sections were stained with TUNEL assay. Mean of blood and brain lead levels increased significantly in Pb group comparing to other studied groups (P < 0.01). There was significant reduction in blood and brain lead level in Pb + AA and Pb + G groups when compared to those of Pb group (P < 0.01). The mean number of TUNEL positive cells in the CA1, CA3, and DG was significantly lower in the groups treated by either Ascorbic acid or Garlic (P < 0.05). Administration of Ascorbic acid and Garlic during pregnancy and lactation protect against lead-induced neuronal cell apoptosis in the hippocampus of rat pups partially via the reduction of Pb concentration in the blood and in the brain.

The protective effect of royal jelly on chronic lambda-cyhalothrin toxicity: serum biochemical parameters, lipid peroxidation, and genotoxic and histopathological alterations in swiss albino mice.

PubMed

Cavuşoğlu, Kültiğin; Yapar, Kürşad; Oruç, Ertan; Yalçın, Emine

2011-10-01

The present study was undertaken to investigate the protective effect of royal jelly (RJ) against toxicity induced by a synthetic pyrethroid insecticide, lambda-cyhalothrin (LCT), in Swiss albino mice. Animals were randomly divided into six groups of six animals each. The control group received distilled water alone, whereas mice in the treatment groups received RJ alone (100 or 250 mg/kg of body weight), LCT alone (668 ppm), or RJ+LCT for 21 days. All mice (100%) survived until the end of experiment and were sacrificed at the end of 24 hours. Blood, bone marrow, and liver and kidney tissues were analyzed for aspartate aminotransferase (AST), alanine aminotransferase (ALT), blood urea nitrogen (BUN), creatinine, malondialdehyde (MDA), and reduced glutathione (GSH) levels and micronucleus (MN) frequency, chromosomal aberrations (CAs), and pathological damages. Serum AST, ALT, BUN, and creatinine levels were elevated in mice treated with LCT alone compared with the other tested groups (P<.05). LCT-induced oxidative damage caused a significant decrease in GSH levels and a significant rise in MDA levels of liver and kidney tissues. LCT alone-treated mice presented higher frequencies (P<.05) of MNs, CAs, and abnormal metaphases compared with the controls; moreover, the mitotic index was lower than in controls (P<.05). Oral treatment with RJ significantly ameliorated the indices of hepatotoxicity, nephrotoxicity, lipid peroxidation, and genotoxicity induced by LCT. Both doses of RJ tested provided significant protection against LCT-induced toxicity, and its strongest effect was observed at the dose level of 250 mg/kg of body weight. In vivo results suggest that RJ is a potent antioxidant against LCT-induced toxicity, and its protective effect is dose dependent.

Protective effects of melatonin against 12C6+ beam irradiation-induced oxidative stress and DNA injury in the mouse brain

NASA Astrophysics Data System (ADS)

Wu, Z. H.; Zhang, H.; Wang, X. Y.; Yang, R.; Liu, B.; Liu, Y.; Zhao, W. P.; Feng, H. Y.; Xue, L. G.; Hao, J. F.; Niu, B. T.; Wang, Z. H.

2012-01-01

The purpose of this experiment was to estimate the protective effects of melatonin against radiation-induced brain damages in mice induced by heavy ion beams. Kun-Ming mice were randomly divided into five groups: normal control group, irradiation control group, and three different doses of melatonin (5, 10, and 20 mg/kg, i.p.) treated groups. Apart from the normal control group, the other four groups were exposed to whole-body 4.0 Gy carbon ion beam irradiation (approximately 0.5 Gy/min) after i.p. administration of normal saline or melatonin 1 h before irradiation. The oxidative redox status of brain tissue was assessed by measurement of malondiadehyde (MDA) levels, total superoxide dismutase (T-SOD), cytosolic superoxide dismutase (Cu/ZnSOD, SOD1) and mitochondrial superoxide dismutase (MnSOD, SOD2) activities at 8 h after irradiation. DNA damages were determined using the Comet assay and apoptosis and cell cycle distribution were detected by flow cytometric analyses. A dramatic dose-dependent decrease in MDA levels, tail moment, rates of tailing cells, and apoptosis, and a dose-dependent increase in T-SOD and SOD2 activities, in brain tissues in the melatonin-treated groups were detected compared with the irradiation only group. Furthermore, flow cytometric analysis demonstrated that the percentage of brain cells in the G0/G1 phase decreased significantly, while those in the S and G2/M stage increased dramatically, with mice pretreated with melatonin compared to the irradiation control group. These data indicate that melatonin has protective effects against irradiation-induced brain injury, and that its underlying protective mechanisms may relate to modulation of oxidative stress induced by heavy ionirradiation.

CP7_E2alf oral vaccination confers partial protection against early classical swine fever virus challenge and interferes with pathogeny-related cytokine responses

PubMed Central

2013-01-01

The conventional C-strain vaccine induces early protection against classical swine fever (CSF), but infected animals cannot be distinguished from vaccinated animals. The CP7_E2alf marker vaccine, a pestivirus chimera, could be a suitable substitute for C-strain vaccine to control CSF outbreaks. In this study, single oral applications of CP7_E2alf and C-strain vaccines were compared for their efficacy to induce protection against a CSF virus (CSFV) challenge with the moderately virulent Bas-Rhin isolate, in pigs as early as two days post-immunization. This work emphasizes the powerful potential of CP7_E2alf vaccine administered orally by a rapid onset of partial protection similar to that induced by the C-strain vaccine. Furthermore, our results revealed that both vaccinations attenuated the effects induced by CSFV on production of the pig major acute phase protein (PigMAP), IFN-α, IL-12, IL-10, and TGF-β1 cytokines. By this interference, several cytokines that may play a role in the pathogeny induced by moderately virulent CSFV strains were revealed. New hypotheses concerning the role of each of these cytokines in CSFV pathogeny are discussed. Our results also show that oral vaccination with either vaccine (CP7_E2alf or C-strain) enhanced CSFV–specific IgG2 production, compared to infection alone. Interestingly, despite the similar antibody profiles displayed by both vaccines post-challenge, the production of CSFV-specific IgG1 and neutralizing antibodies without challenge was lower with CP7_E2alf vaccination than with C-strain vaccination, suggesting a slight difference in the balance of adaptive immune responses between these vaccines. PMID:23398967

Characterization and storage of malaria antigens: Localization and chemical characterization of Plasmodium knowlesi schizont antigens

PubMed Central

Deans, J. A.; Cohen, S.

1979-01-01

The identification of malarial antigens that induce protective immunity could provide a rational basis for developing an effective antimalarial vaccine as well as specific serodiagnostic tests indicative of clinical immune status. Since protective immunity is probably induced by stage-dependent rather than stage-independent antigens, the antigenic composition of different stages of Plasmodium knowlesi has been compared, and a limited chemical characterization undertaken. This information should provide some insight into the types of preparative procedure appropriate for the purification of functionally important malarial antigens. PMID:120777

Attenuation of doxorubicin-induced cardiotoxicity by esculetin through modulation of Bmi-1 expression.

PubMed

Xu, Fan; Li, Xiao; Liu, Lanfang; Xiao, Xu; Zhang, Li; Zhang, Shenglin; Lin, Pingping; Wang, Xiaojie; Wang, Yongwei; Li, Qingshan

2017-09-01

The protective effects and mechanisms of esculetin on doxorubicin (DOX)-induced injury of H9c2 cells were investigated. H9c2 cells were cultured and the logarithmic growth phase of the cells was divided into a control group, a DOX group and an esculetin + DOX group. Cell viability was detected by MTT assay. Annexin V-PI (AV-PI) double staining flow cytometry was carried out to detect cell apoptosis. Intracellular reactive oxygen species (ROS) were detected by flow cytometry. Transmission electron microscope (TEM) was used to evaluate cell ultrastructure. Cleaved caspase-3, cleaved PARP, Bcl-2, Bid and Bmi-1 proteins levels were investigated by western blot analysis. Bmi-1 siRNA was used to detect the role of Bmi-1 in the protective effects of esculetin against DOX-induced toxicity in H9c2 cells. The MTT and AV-PI double staining results showed that esculetin significantly increased H9c2 cell viability. Compared with the control group, the levels of cleaved caspase-3, cleaved PARP, Bid and ROS levels were significantly decreased, but the expression of Bcl-2 and Bmi-1 were significantly increased in the esculetin + DOX group. TEM showed that the cell structure of the mitochondria was protected by esculetin. The results of Bmi-1 siRNA showed that esculetin could protect DOX-induced cardiotoxicity by modulating Bmi-1 expression. Esculetin can protect DOX-induced cardiotoxicity and the effects may be attributable to modulation of Bmi-1 expression, provoking intracellular ROS accumulation, protecting the structure of mitochondria and reducing cell apoptosis.

Role of TRPA1 in acute cardiopulmonary toxicity of inhaled acrolein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Conklin, Daniel J., E-mail: dj.conklin@louisville.

Acrolein is a highly toxic, volatile, unsaturated aldehyde generated during incomplete combustion as in tobacco smoke and indoor fires. Because the transient receptor potential ankyrin 1 (TRPA1) channel mediates tobacco smoke-induced lung injury, we assessed its role in high-level acrolein-induced toxicity in mice. Acrolein (100–275 ppm, 10–30 min) caused upper airway epithelial sloughing, bradypnea and oral gasping, hypothermia, cardiac depression and mortality. Male wild-type mice (WT, C57BL/6; 5–52 weeks) were significantly more sensitive to high-level acrolein than age-matched, female WT mice. Both male and female TRPA1-null mice were more sensitive to acrolein-induced mortality than age- and sex-matched WT mice. Acroleinmore » exposure increased lung weight:body weight ratios and lung albumin and decreased plasma albumin to a greater extent in TRPA1-null than in WT mice. Lung and plasma protein-acrolein adducts were not increased in acrolein-exposed TRPA1-null mice compared with WT mice. To assess TRPA1-dependent protective mechanisms, respiratory parameters were monitored by telemetry. TRPA1-null mice had a slower onset of breathing rate suppression (‘respiratory braking’) than WT mice suggesting TRPA1 mediates this protective response. Surprisingly, WT male mice treated either with a TRPA1 antagonist (HC030031; 200 mg/kg) alone or with combined TRPA1 (100 mg/kg) and TRPV1 (capsazepine, 10 mg/kg) antagonists at 30 min post-acrolein exposure (i.e., “real world” delay in treatment) were significantly protected from acrolein-induced mortality. These data show TRPA1 protects against high-level acrolein-induced toxicity in a sex-dependent manner. Post-exposure TRPA1 antagonism also protected against acrolein-induced mortality attesting to a complex role of TRPA1 in cardiopulmonary injury. - Highlights: • TRPA1 protects mice against toxicity and mortality of inhaled high-level acrolein. • TRPA1 protection against inhaled high-level acrolein is sex-dependent in mice. • Age (5–52 weeks old) was not a determinant of acrolein-induced mortality in mice. • TRPA1 antagonist is protective after inhaled high-level acrolein in male mice.« less

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

PubMed Central

Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

2001-01-01

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

Sickness behavior induced by endotoxin can be mitigated by the dietary soluble fiber, pectin, through up-regulation of IL-4 and Th2 polarization

PubMed Central

Sherry, Christina L.; Kim, Stephanie S.; Dilger, Ryan N.; Bauer, Laura L.; Moon, Morgan L.; Tapping, Richard I.; Fahey, George C.; Tappenden, Kelly A.; Freund, Gregory G.

2010-01-01

Peripheral activation of the immune system by infectious agents triggers the brain-cytokine system causing sickness behaviors which profoundly impact well-being. Dietary fiber is a beneficial foodstuff that, from a gastrointestinal tract perspective, exists in both insoluble and soluble forms. We show that a diet rich in soluble fiber protects mice from endotoxin-induced sickness behavior by polarizing mice Th2 when compared to a diet containing only insoluble fiber. Mice fed soluble fiber became less sick and recovered faster from endotoxin-induced sickness behaviors than mice fed insoluble fiber. In response to intraperitoneal endotoxin, mice fed soluble fiber had up-regulated IL-1RA and reduced IL-1βand TNF-αin the brain as compared to mice fed insoluble fiber. Importantly, mice fed soluble fiber had a basal increase in IL-4 in the ileum and spleen which was absent in MyD88 knockout mice. Con A stimulated splenocytes from mice fed soluble fiber showed increased IL-4 and IL-5 and decreased IL-2, IL-12 and IFN-γwhen compared to mice fed insoluble fiber. Likewise, endotoxin-stimulated macrophages from mice fed soluble fiber demonstrated decreased IL-1β, TNF-α, IFN-γ, IL-12 and nitrate and increased IL-1RA, arginase 1 and Ym1 when compared to mice fed insoluble fiber. Finally, the behavioral protection afforded by feeding mice soluble fiber was reduced in IL-4 knockout mice, as was the impact of soluble fiber on Con A stimulated splenocytes and endotoxin activated macrophages. These data show that a diet rich in soluble fiber protects against endotoxin-induced sickness behavior by polarizing mice Th2 and promoting alternative activation of macrophages. PMID:20138982

Repeated Nrf2 stimulation using sulforaphane protects fibroblasts from ionizing radiation.

PubMed

Mathew, Sherin T; Bergström, Petra; Hammarsten, Ola

2014-05-01

Most of the cytotoxicity induced by ionizing radiation is mediated by radical-induced DNA double-strand breaks. Cellular protection from free radicals can be stimulated several fold by sulforaphane-mediated activation of the transcription factor Nrf2 that regulates more than 50 genes involved in the detoxification of reactive substances and radicals. Here, we report that repeated sulforaphane treatment increases radioresistance in primary human skin fibroblasts. Cells were either treated with sulforaphane for four hours once or with four-hour treatments repeatedly for three consecutive days prior to radiation exposure. Fibroblasts exposed to repeated-sulforaphane treatment showed a more pronounced dose-dependent induction of Nrf2-regulated mRNA and reduced amount of radiation-induced free radicals compared with cells treated once with sulforaphane. In addition, radiation- induced DNA double-strand breaks measured by gamma-H2AX foci were attenuated following repeated sulforaphane treatment. As a result, cellular protection from ionizing radiation measured by the 5-ethynyl-2'-deoxyuridine (EdU) assay was increased, specifically in cells exposed to repeated sulforaphane treatment. Sulforaphane treatment was unable to protect Nrf2 knockout mouse embryonic fibroblasts, indicating that the sulforaphane-induced radioprotection was Nrf2-dependent. Moreover, radioprotection by repeated sulforaphane treatment was dose-dependent with an optimal effect at 10 uM, whereas both lower and higher concentrations resulted in lower levels of radioprotection. Our data indicate that the Nrf2 system can be trained to provide further protection from radical damage. Copyright © 2014 Elsevier Inc. All rights reserved.

Amelioration of radiation-induced hematopoietic and gastrointestinal damage by Ex-RAD® in mice

PubMed Central

Ghosh, Sanchita P.; Kulkarni, Shilpa; Perkins, Michael W.; Hieber, Kevin; Pessu, Roli L.; Gambles, Kristen; Maniar, Manoj; Kao, Tzu-Cheg; Seed, Thomas M.; Kumar, K. Sree

2012-01-01

The aim of the present study was to assess recovery from hematopoietic and gastrointestinal damage by Ex-RAD®, also known as ON01210.Na (4-carboxystyryl-4-chlorobenzylsulfone, sodium salt), after total body radiation. In our previous study, we reported that Ex-RAD, a small-molecule radioprotectant, enhances survival of mice exposed to gamma radiation, and prevents radiation-induced apoptosis as measured by the inhibition of radiation-induced protein 53 (p53) expression in cultured cells. We have expanded this study to determine best effective dose, dose-reduction factor (DRF), hematological and gastrointestinal protection, and in vivo inhibition of p53 signaling. A total of 500 mg/kg of Ex-RAD administered at 24 h and 15 min before radiation resulted in a DRF of 1.16. Ex-RAD ameliorated radiation-induced hematopoietic damage as monitored by the accelerated recovery of peripheral blood cells, and protection of granulocyte macrophage colony-forming units (GM-CFU) in bone marrow. Western blot analysis on spleen indicated that Ex-RAD treatment inhibited p53 phosphorylation. Ex-RAD treatment reduces terminal deoxynucleotidyl transferase mediated dUTP nick end labeling assay (TUNEL)-positive cells in jejunum compared with vehicle-treated mice after radiation injury. Finally, Ex-RAD preserved intestinal crypt cells compared with the vehicle control at 13 and 14 Gy. The results demonstrated that Ex-RAD ameliorates radiation-induced peripheral blood cell depletion, promotes bone marrow recovery, reduces p53 signaling in spleen and protects intestine from radiation injury. PMID:22843617

Protective effect of Allium neapolitanum Cyr. versus Allium sativum L. on acute ethanol-induced oxidative stress in rat liver.

PubMed

Nencini, Cristina; Franchi, Gian Gabriele; Cavallo, Federica; Micheli, Lucia

2010-04-01

This study investigated the protective effect of Allium neapolitanum Cyr., a spontaneous species of the Italian flora, compared with garlic (Allium sativum L.) on liver injury induced by ethanol in rats. Male albino Wistar rats were orally treated with fresh Allium homogenates (leaves or bulbs, 250 mg/kg) daily for 5 days, whereas controls received vehicle only. At the end of the experimental 5-day period, the animals received an acute ethanol dose (6 mL/kg, i.p.) 2 hours before the last Allium administration and were sacrificed 6 hours after ethanol administration. The activities of catalase (CAT), superoxide dismutase (SOD), and glutathione reductase (GR) and the levels of malondialdehyde (MDA), ascorbic acid (AA), and reduced (GSH) and oxidized glutathione in liver tissue were determined. Administration of both Allium species for 5 days (leaves or bulbs) led to no statistical variation of nonenzymatic parameters versus the control group; otherwise Allium treatment caused an increase of GSH and AA levels compared with the ethanol group and a diminution of MDA levels, showing in addition that A. neapolitanum bulb had the best protective effect. Regarding to enzymatic parameters, GR and CAT activities were enhanced significantly compared with the ethanol group, whereas SOD activity showed a trend different from other parameters estimated. However, the treatment with both Allium species followed by acute ethanol administration reestablished the nonenzymatic parameters similar to control values and enhanced the activities of the enzymes measured. These results suggest that fresh Allium homogenates (leaves or bulbs) possess antioxidant properties and provide protection against ethanol-induced liver injury.

Protective effects of Korean red ginseng against radiation-induced apoptosis in human HaCaT keratinocytes

PubMed Central

Chang, Jae Won; Park, Keun Hyung; HWANG, Hye Sook; Shin, Yoo Seob; Oh, Young-Taek; Kim, Chul-Ho

2014-01-01

Radiation-induced oral mucositis is a dose-limiting toxic side effect for patients with head and neck cancer. Numerous attempts at improving radiation-induced oral mucositis have not produced a qualified treatment. Ginseng polysaccharide has multiple immunoprotective effects. Our aim was to investigate the effectiveness of Korean red ginseng (KRG) on radiation-induced damage in the human keratinocyte cell line HaCaT and in an in vivo zebrafish model. Radiation inhibited HaCaT cell proliferation and migration in a cell viability assay and wound healing assay, respectively. KRG protected against these effects. KRG attenuated the radiation-induced embryotoxicity in the zebrafish model. Irradiation of HaCaT cells caused apoptosis and changes in mitochondrial membrane potential (MMP). KRG inhibited the radiation-induced apoptosis and intracellular generation of reactive oxygen species (ROS), and stabilized the radiation-induced loss of MMP. Western blots revealed KRG-mediated reduced expression of ataxia telangiectasia mutated protein (ATM), p53, c-Jun N-terminal kinase (JNK), p38 and cleaved caspase-3, compared with their significant increase after radiation treatment. The collective results suggest that KRG protects HaCaT cells by blocking ROS generation, inhibiting changes in MMP, and inhibiting the caspase, ATM, p38 and JNK pathways. PMID:24078877

Protective effects of Korean red ginseng against radiation-induced apoptosis in human HaCaT keratinocytes.

PubMed

Chang, Jae Won; Park, Keun Hyung; Hwang, Hye Sook; Shin, Yoo Seob; Oh, Young-Taek; Kim, Chul-Ho

2014-03-01

Radiation-induced oral mucositis is a dose-limiting toxic side effect for patients with head and neck cancer. Numerous attempts at improving radiation-induced oral mucositis have not produced a qualified treatment. Ginseng polysaccharide has multiple immunoprotective effects. Our aim was to investigate the effectiveness of Korean red ginseng (KRG) on radiation-induced damage in the human keratinocyte cell line HaCaT and in an in vivo zebrafish model. Radiation inhibited HaCaT cell proliferation and migration in a cell viability assay and wound healing assay, respectively. KRG protected against these effects. KRG attenuated the radiation-induced embryotoxicity in the zebrafish model. Irradiation of HaCaT cells caused apoptosis and changes in mitochondrial membrane potential (MMP). KRG inhibited the radiation-induced apoptosis and intracellular generation of reactive oxygen species (ROS), and stabilized the radiation-induced loss of MMP. Western blots revealed KRG-mediated reduced expression of ataxia telangiectasia mutated protein (ATM), p53, c-Jun N-terminal kinase (JNK), p38 and cleaved caspase-3, compared with their significant increase after radiation treatment. The collective results suggest that KRG protects HaCaT cells by blocking ROS generation, inhibiting changes in MMP, and inhibiting the caspase, ATM, p38 and JNK pathways.

Tissue Specific Expression Of Sprouty1 In Mice Protects Against High Fat Diet Induced Fat Accumulation, Bone Loss, And Metabolic Dysfunction

PubMed Central

Urs, Sumithra; Henderson, Terry; Le, Phuong; Rosen, Clifford J.; Liaw, Lucy

2012-01-01

We recently characterized Sprouty1 (Spry1), a growth factor signaling inhibitor as a regulator of marrow progenitor cells promoting osteoblast differentiation at the expense of adipocytes. Adipose tissue specific Spry1 expression in mice resulted in increased bone mass and reduced body fat while conditional knockout of Spry1 had the opposite effect with decreased bone and increased body fat. Because Spry1 suppresses normal fat development, we tested the hypothesis that Spry1 expression prevents high fat diet-induced obesity, bone loss, and associated lipid abnormalities and demonstrate that Spry1 has a long-term protective effect on mice fed a high caloric diet. We studied diet-induced obesity in mice with fatty acid binding promoter (aP2)-driven expression or conditional knockout of Spry1 in adipocytes. Phenotyping was performed by whole body dual-energy X-ray absorptiometry, microCT, histology and blood analysis. In conditional Spry1 null mice, high fat diet increased body fat by 40%, impaired glucose regulation, and led to liver steatosis. However, over-expression of Spry1 led to 35% lower body fat, reduced bone loss, and normal metabolic function compared to single transgenics. This protective phenotype was associated with decreased circulating insulin (70%) and leptin (54%) compared to controls on a high fat diet. Additionally, Spry1 expression decreased adipose tissue inflammation by 45%. We show that conditional Spry1 expression in adipose tissue protects against high fat diet-induced obesity and associated bone loss. PMID:22142492

Tissue-specific expression of Sprouty1 in mice protects against high-fat diet-induced fat accumulation, bone loss and metabolic dysfunction.

PubMed

Urs, Sumithra; Henderson, Terry; Le, Phuong; Rosen, Clifford J; Liaw, Lucy

2012-09-28

We recently characterised Sprouty1 (Spry1), a growth factor signalling inhibitor as a regulator of marrow progenitor cells promoting osteoblast differentiation at the expense of adipocytes. Adipose tissue-specific Spry1 expression in mice resulted in increased bone mass and reduced body fat, while conditional knockout of Spry1 had the opposite effect with decreased bone mass and increased body fat. Because Spry1 suppresses normal fat development, we tested the hypothesis that Spry1 expression prevents high-fat diet-induced obesity, bone loss and associated lipid abnormalities, and demonstrate that Spry1 has a long-term protective effect on mice fed a high-energy diet. We studied diet-induced obesity in mice with fatty acid binding promoter-driven expression or conditional knockout of Spry1 in adipocytes. Phenotyping was performed by whole-body dual-energy X-ray absorptiometry, microCT, histology and blood analysis. In conditional Spry1-null mice, a high-fat diet increased body fat by 40 %, impaired glucose regulation and led to liver steatosis. However, overexpression of Spry1 led to 35 % (P < 0·05) lower body fat, reduced bone loss and normal metabolic function compared with single transgenics. This protective phenotype was associated with decreased circulating insulin (70 %) and leptin (54 %; P < 0·005) compared with controls on a high-fat diet. Additionally, Spry1 expression decreased adipose tissue inflammation by 45 %. We show that conditional Spry1 expression in adipose tissue protects against high-fat diet-induced obesity and associated bone loss.

Dietary honey and ginseng protect against carbon tetrachloride-induced hepatonephrotoxicity in rats.

PubMed

El Denshary, Ezzeldeen S; Al-Gahazali, Mohammad A; Mannaa, Fathia A; Salem, Hesham A; Hassan, Nabila S; Abdel-Wahhab, Mosaad A

2012-11-01

Liver diseases are amongst the most serious health problems in the world today and hepatocellular carcinoma is one of the world's deadliest cancers. The aim of the current study was to evaluate the protective effect of sider honey and/or Korean ginseng extract (KGE) against carbon tetrachloride (CCl(4))-induced hepato-nephrotoxicity in rat. Eighty male Sprague-Dawley (SD) rats were allocated into different groups and over a 4-week period, they orally received honey and/or KGE or were treated either with CCl(4) alone (100 mg/kg b.w) or with CCl(4) after a pretreatment period with honey, KGE or a combination of both. Clinical, clinico-pathological and histopathological evaluations were done and CCl(4)-treated groups were compared with rats receiving no treatment and with rats given honey, KGE or a combination of these substances. The results indicated that oral administration of CCl(4) induced severe hepatic and kidney injury associated with oxidative stress. The combined treatment with CCl(4) plus honey and/or KGE resulted in a significant improvement in all evaluated parameters. This improvement was prominent in the group receiving CCl(4) after combined pretreatment with honey and KGE. Animals receiving honey and/or KGE (without CCl(4)-treatment) were comparable to the control untreated group. It could be concluded that honey and KGE protect SD rats against the severe CCl(4)-induced hepatic and renal toxic effects. Our results suggest that the protective activity of honey and KGE may have been related to their antioxidant properties. Copyright © 2011 Elsevier GmbH. All rights reserved.

Protective effect of 4-coumaric acid from UVB ray damage in the rabbit eye.

PubMed

Lodovici, Maura; Caldini, Silvia; Morbidelli, Lucia; Akpan, Victor; Ziche, Marina; Dolara, Piero

2009-01-08

UV-induced oxidation damage seems to play a major role in a number of specific pathological conditions of intraocular tissues, such as cataract formation and retinal degeneration. Therefore, antioxidant and/or scavenger compounds might protect the eyes from UV-induced cellular damage. We previously reported that 4-coumaric acid (4-CA) is able to protect rabbit corneal-derived cells (SIRC) from UVB-induced oxidation damage. In this study we evaluated the protective effect of 4-CA against UVB-induced cell damage in rabbit cornea in vivo. Twelve male New Zealand albino rabbits were used; four rabbits were used as a control and received vehicle in one eye and 4-CA acid in the contralateral eye; eight rabbits were exposed to UVB rays (79.2mJ/cm(2)) and three days before to UV exposure each animal received 1 drop/day of vehicle in one eye and 1 drop/day of vehicle containing 4-CA (164ng) in the contralateral eye. Corneal and sclera tissues were removed and 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) levels were measured. Superoxide dismutase (SOD) and xanthine oxidase (XO) activities were determined in aqueous humour. UVB-induced vessel hyper-reactivity was strongly reduced at 4 and 24h after UVB exposure after local treatment with 4-CA, 8-oxodGuo levels, a marker of oxidative DNA damage, were significantly increased (P<0.05) in sclera and cornea by UVB irradiation, but when 4-CA was administered to the conjunctiva in a buffered solution once a day for 3d before and 6d after UVB exposure, levels of 8-oxodGuo were similar to controls and significantly reduced (P<0.05) compared to UVB-treated corneas. XO activity in the aqueous humour was significantly increased. The administration of 4-CA for 3d before and 6d after UVB irradiation induced a small but significant (P<0.05) reduction of XO compared with control eyes. Our results indicate that the administration of 4-CA protects eye tissues, thus reducing the harmful effect of UVB radiation at low concentration, probably through its free radical scavenging and antioxidant properties. Therefore, 4-CA may be useful in protecting the eye from free radical damage following UVB exposure from sunlight, UV lamps and welding torches.

Evaluation of the Hepato and Nephron-Protective Effect of a Polyherbal Mixture using Wistar Albino Rats

PubMed Central

Adebesin, Olumide Adedapo; Okpuzor, Joy

2014-01-01

Aim: A polyherbal formulation prepared from a mixture of leaves of Gongronema latifolia, Ocimum gratissimum and Vernonia amygdalina (GOV) was evaluated for hepato-nephro protective properties against acetaminophen-induced toxicity in Wistar albino rats. Materials and Methods: Normal Wistar albino rats were orally treated with different doses of GOV extract (2, 4 and 8 g/kg b. wt), distilled water and some standard hepatoprotective drugs such as Liv 52 and silymarin for 14 days. However, a day prior to the 14th day, 3 g/kg body weight dose of Acetaminophen (APAP) was administered p.o. 1h before GOV and the standard drugs to induce hepatic and renal damage. The normal control was setup which received only distilled water. The serum levels of liver marker enzymes, biochemical analytes, antioxidant enzymes and hematological parameters were monitored. Results: The results showed that pretreatment of experimental animals with a different doses of the polyherbal formulation dose dependently caused a significant (p≤0.05) increase in the levels of most of the measured hematological parameters but significantly (p≤0.05) reduced the levels of MCV and monocytes when compared to the APAP induced toxin control group. Rats pretreated with GOV exhibited significant (p < 0.05) increase in serum levels of ALP, ALT, AST, GGT, LDH, Cholesterol, Triglycerides, Urea and a subsequent decrease in Albumin, Creatine and Total protein when compared to the normal rats. This trend in enzyme and biochemical analytes levels were significantly (p < 0.05) reversed when compared to toxin control group. GOV significantly (p < 0.05) and dose dependently increased the serum, kidney and hepatic CAT, GPx, GSH, GST, SOD and total protein activity in APAP induced damage in rats compared to the toxin control groups. Conclusion: The data from this study suggest that the polyherbal formulation possess hepato and nephron-protective potential against acetaminophen induced hepatotoxicity in rats, thus providing scientific rationale for its use in traditional medicine for the treatment of liver diseases. PMID:25121002

Study of the protective effect of dexamethasone on cisplatin-induced ototoxicity in rats.

PubMed

Capelo, Isabelle Oliveira Jatai; Batista, Avner Marcos Alves; Brito, Yuri Neyson Ferreira; Diniz, Krissia Braga; Brito, Gerly Anne de Castro; Freitas, Marcos Rabelo de

2017-10-01

To evaluate the ability of dexamethasone to protect against cisplatin (CDDP)-induced ototoxicity. Male Wistar rats were divided into the following three groups: 1) Control (C): 6 animals received intraperitoneal (IP) saline solution, 8 ml/kg/day for four days; 2) C + CDDP: 11 animals received 8 ml/kg/day of IP saline and, 90 min after saline administration, 8 mg/kg/day of IP CDDP for four days; and 3) DEXA15 + CDDP: 11 animals received IP dexamethasone 15 mg/kg/day and, 90 min after dexamethasone administration, received 8 mg/kg/day of IP CDDP for four days. It was found that dexamethasone did not protect against weight loss in CDDP-exposed animals. The mortality rate was comparable with that previously reported in the literature. The auditory threshold of animals in the DEXA15 + CDDP group was not significantly altered after exposure to CDDP. The stria vascularis of animals in the DEXA15 + CDDP group was partially preserved after CDDP exposure. Dexamethasone at the dose of 15 mg/kg/day partially protected against CDDP-induced ototoxicity, based on functional evaluation by brainstem evoked response audiontry (BERA) and morphological evaluation by optical microscopy. However, dexamethasone did not protect against systemic toxicity.

Stress-induced thermotolerance of ventilatory motor pattern generation in the locust, Locusta migratoria.

PubMed

Newman, Amy E M; Foerster, Melody; Shoemaker, Kelly L; Robertson, R Meldrum

2003-11-01

Ventilation is a crucial motor activity that provides organisms with an adequate circulation of respiratory gases. For animals that exist in harsh environments, an important goal is to protect ventilation under extreme conditions. Heat shock, anoxia, and cold shock are environmental stresses that have previously been shown to trigger protective responses. We used the locust to examine stress-induced thermotolerance by monitoring the ability of the central nervous system to generate ventilatory motor patterns during a subsequent heat exposure. Preparations from pre-stressed animals had an increased incidence of motor pattern recovery following heat-induced failure, however, prior stress did not alter the characteristics of the ventilatory motor pattern. During constant heat exposure at sub-lethal temperatures, we observed a protective effect of heat shock pre-treatment. Serotonin application had similar effects on motor patterns when compared to prior heat shock. These studies are consistent with previous studies that indicate prior exposure to extreme temperatures and hypoxia can protect neural operation against high temperature stress. They further suggest that the protective mechanism is a time-dependent process best revealed during prolonged exposure to extreme temperatures and is mediated by a neuromodulator such as serotonin.

In vivo antigenotoxic activity of watercress juice (Nasturtium officinale) against induced DNA damage.

PubMed

Casanova, Natalia A; Ariagno, Julia I; López Nigro, Marcela M; Mendeluk, Gabriela R; de los A Gette, María; Petenatti, Elisa; Palaoro, Luis A; Carballo, Marta A

2013-09-01

The present study was carried out to investigate the genotoxicity as well as possible protective activity against damage induced by cyclophosphamide (CP) of the aqueous juice of watercress (Nasturtium officinale, W.T. Aiton) in vivo. Male and female Swiss mice 7-8 weeks old (N = 48) were treated by gavage with 1 g kg(-1) body weight and 0.5 g kg(-1) body weight of watercress juice during 15 consecutive days. Genotoxicity and its possible protective effect were tested by the comet assay in peripheral blood cells and the micronucleus test in bone marrow. In addition, biopsies of the bladder, epididymis and testicles of mice were performed to extend the experimental design. Watercress juice per se did not induce genetic damage according to the comet assay and micronucleus study, exhibiting a protective activity against CP (P < 0.05 and P < 0.001, respectively). The comparative analysis of bladder histological changes obtained in the watercress plus CP group against those treated with CP alone suggests a probable protective effect. Further studies are needed in order to establish the protective role of watercress juice against DNA damage. Copyright © 2012 John Wiley & Sons, Ltd.

Autophagy activation, not peroxisome proliferator-activated receptor γ coactivator 1α, may mediate exercise-induced improvements in glucose handling during diet-induced obesity.

PubMed

Rosa-Caldwell, Megan E; Brown, Jacob L; Lee, David E; Blackwell, Thomas A; Turner, Kyle W; Brown, Lemuel A; Perry, Richard A; Haynie, Wesley S; Washington, Tyrone A; Greene, Nicholas P

2017-09-01

What is the central question of this study? What are the individual and combined effects of muscle-specific peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α) overexpression and physical activity during high-fat feeding on glucose and exercise tolerance? What is the main finding and its importance? Our main finding is that muscle-specific PGC-1α overexpression provides no protection against lipid-overload pathologies nor does it enhance exercise adaptations. Instead, physical activity, regardless of PGC-1α content, protects against high-fat diet-induced detriments. Activation of muscle autophagy was correlated with exercise protection, suggesting that autophagy might be a mediating factor for exercise-induced protection from lipid overload. The prevalence of glucose intolerance is alarmingly high. Efforts to promote mitochondrial biogenesis through peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α) to mitigate glucose intolerance have been controversial. However, physical activity remains a primary means to alleviate the condition. The aim of this study was to determine the combined effects of muscle-specific overexpression of PGC-1α and physical activity on glucose handling during diet-induced obesity. Wild-type (WT, ∼20) and PGC-1α muscle transgenic (MCK-PGC-1α, ∼20) mice were given a Western diet (WD) at 8 weeks age and allowed to consume food ab libitum throughout the study. At 12 weeks of age, all animals were divided into sedentary (SED) or voluntary wheel running (VWR) interventions. At 7, 11 and 15 weeks of age, animals underwent glucose tolerance tests (GTT) and graded exercise tests (GXT). At 16 weeks of age, tissues were collected. At 11 weeks, the MCK-PGC-1α animals had 50% greater glucose tolerance integrated area under the curve compared with WT. However, at 15 weeks, SED animals also had greater GTT integrated area under the curve compared with VWR, regardless of genotype; furthermore, SED animals demonstrated reduced exercise capacity compared with earlier time points, which was not seen in VWR animals. Voluntary distance run per day was correlated with GTT in VWR-WT, but not VWR-MCK-PGC-1α mice. Voluntary wheel running and genotype independently resulted in a greater LC3II/LC3I ratio, suggesting enhanced autophagosome formation, which was correlated with exercise-induced improvements in GTT. In conclusion, artificially increasing mitochondrial content does not protect from lipid-induced pathologies nor does it augment exercise adaptations. Physical activity ameliorates the effects of lipid overload-induced glucose intolerance, an effect that appears to be related to enhanced activation of autophagy. © 2017 The Authors. Experimental Physiology © 2017 The Physiological Society.

Phytol-based novel adjuvants in vaccine formulation: 2. Assessment of efficacy in the induction of protective immune responses to lethal bacterial infections in mice.

PubMed

Lim, So-Yon; Bauermeister, Adam; Kjonaas, Richard A; Ghosh, Swapan K

2006-10-23

Adjuvants are known to significantly enhance vaccine efficacy. However, commercial adjuvants often have limited use because of toxicity in humans. The objective of this study was to determine the comparative effectiveness of a diterpene alcohol, phytol and its hydrogenated derivative PHIS-01, relative to incomplete Freund's adjuvant (IFA), a commonly used adjuvant in augmenting protective immunity in mice against E. coli and S. aureus, and in terms of inflammatory cytokines. Vaccines, consisting of heat-attenuated E. coli or S. aureus and either of the two phytol-based adjuvants or IFA, were tested in female BALB/c mice. The vaccines were administered intraperitoneally at 10-day intervals. The efficacy of the phytol and PHIS-01, as compared to IFA, was assessed by ELISA in terms of anti-bacterial antibody and inflammatory cytokines. We also examined the ability of the vaccines to induce specific protective immunity by challenging mice with different doses of live bacteria. IFA, phytol, and PHIS-01 were equally efficient in evoking anti-E. coli antibody response and in providing protective immunity against live E. coli challenges. In contrast, the antibody response to S. aureus was significant when PHIS-01 was used as the adjuvant. However, in terms of the ability to induce protective immunity, phytol was most effective against S. aureus. Moreover, during challenges with live E. coli and S. aureus immune mice produced much less IL-6, the mediators of fatal septic shock syndromes. Our results show that vaccine formulations containing phytol and PHIS-01 as adjuvants confer a robust and protective immunity against both Gram-negative and Gram-positive bacteria without inducing adverse inflammatory cytokine due to IL-6.

CYSTEAMINE PROTECTION OF GRASSHOPPER CHROMOSOMES FROM X-RAY-INDUCED ABERRATIONS UNDER AEROBIC AND ANAEROBIC CONDTIONS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ray-Chaudhuri, S.P.; Chaudhuri, J.P.; Chatterjee, S.

1962-10-01

The effect of cysteamine pre-treatment on the frequency of x-ray-induced chromosome aberrations was determined under both aerobic and anaerobic conditions by counting the dicentric bridges in the first division meiotic anaphase of the grasshopper, Gesonula punctifrons. Under aerobic conditions in the cysteamine- treated animals 20.73% bridges were scored as compared with 30 to 90% in the controls. Under anaerobic conditions the scores were 5.35% and 8.22% in the treated and controls, respectively. Thus the degree of protection by cysteamine under both aerobic and anaerobic conditions was found to be more or less the same. The possible mode of protection ismore » discussed. (auth)« less

Effects of vitamin E on lead-induced impairments in hippocampal synaptic plasticity.

PubMed

Salehi, Iraj; Karamian, Ruhollah; Komaki, Alireza; Tahmasebi, Lida; Taheri, Masoumeh; Nazari, Masoumeh; Shahidi, Siamak; Sarihi, Abdolrahman

2015-12-10

Lead (Pb) exposure during development is associated with impaired cognitive function and long-term potentiation (LTP). Vitamin E (VE) is an antioxidant that could have protective effects against Pb intoxication. In this study, we examined the protective effects of vitamin E against Pb-induced LTP impairments. Forty-six adult male Wistar rats were randomly divided into 6 treatment groups: (1) control; (2) Pb exposure; (3) VE; (4) Pb +VE; (5) Pb exposure followed by VE 2 months after exposure; (6) VE followed by Pb exposure 1 month after treatment. Rats were exposed to Pb through daily consumption of Pb-contaminated distilled water; VE was administered by daily gavage for 3 months. After this period, the population spike (PS) amplitudes and the slopes of excitatory postsynaptic potentials (EPSPs) were measured in the dentate gyrus (DG) area of the hippocampus in adult rats in response to electrical stimulation applied to the perforant pathway in vivo. Blood samples were also collected to evaluate malondialdehyde (MDA) levels, total antioxidant capacity (TAC), and total oxidant status (TOS). Biochemical analyses demonstrated significant increases in plasma MDA and TOS levels in the Pb-exposed group compared to the control group. VE-protected groups revealed significant increases in TAC levels. Our results demonstrate that Pb decreased EPSP slopes and PS amplitudes compared to the control group, whereas VE increased these parameters compared to the control group. Co-administration of VE with Pb exposure inhibited Pb-induced effects. These findings suggest that VE via its antioxidant activity reverses Pb-induced impairments of synaptic plasticity in the DG. Copyright © 2015 Elsevier B.V. All rights reserved.

The protective role of the immunomodulator AS101 against chemotherapy-induced alopecia studies on human and animal models.

PubMed

Sredni, B; Xu, R H; Albeck, M; Gafter, U; Gal, R; Shani, A; Tichler, T; Shapira, J; Bruderman, I; Catane, R; Kaufman, B; Whisnant, J K; Mettinger, K L; Kalechman, Y

1996-01-03

The immunomodulator AS101 has been demonstrated to exhibit radioprotective and chemoprotective effects in mice. Following phase-I studies, preliminary results from phase-II clinical trials on non-small-cell-lung-cancer patients showed a reduction in the severity of alopecia in patients treated with AS101 in combination with chemotherapy. To further substantiate these findings, the present study was extended to include 58 patients treated either with the optimal dose of 3 mg/m2 AS101 combined with carboplatin and VP-16, or with chemotherapy alone. As compared with patients treated with chemotherapy alone, there was a significant decrease in the level of alopecia in patients receiving the combined therapy. The newly developed rat model was used to elucidate the protective mechanism involved in this effect. We show that significant prevention of chemotherapy-induced alopecia is obtained in rats treated with Ara-C combined with AS101, administered i.p. or s.c. or applied topically to the dorsal skin. We show that this protection by AS101 is mediated by macrophage-derived factors induced by AS101. Protection by AS101 can be ascribed, at least in part, to IL-1, since treatment of rats with IL-1 RA largely abrogated the protective effect of AS101. Moreover, we demonstrate that in humans there is an inverse correlation between the grade of alopecia and the increase in IL-1 alpha. In addition, protection by AS101 could be related to PGE2 secretion, since injection of indomethacin before treatment with AS101 and Ara-C partly abrogated the protective effect of AS101. To assess the ability of AS101 to protect against chemotherapy-induced alopecia, phase-II clinical trials have been initiated with cancer patients suffering from various malignancies.

Protective Effects of Black Rice Extracts on Oxidative Stress Induced by tert-Butyl Hydroperoxide in HepG2 Cells

PubMed Central

Lee, Seon-Mi; Choi, Youngmin; Sung, Jeehye; Kim, Younghwa; Jeong, Heon-Sang; Lee, Junsoo

2014-01-01

Black rice contains many biologically active compounds. The aim of this study was to investigate the protective effects of black rice extracts (whole grain extract, WGE and rice bran extract, RBE) on tert-butyl hydroperoxide (TBHP)-induced oxidative injury in HepG2 cells. Cellular reactive oxygen species (ROS), antioxidant enzyme activities, malondialdehyde (MDA) and glutathione (GSH) concentrations were evaluated as biomarkers of cellular oxidative status. Cells pretreated with 50 and 100 μg/mL of WGE or RBE were more resistant to oxidative stress in a dose-dependent manner. The highest WGE and BRE concentrations enhanced GSH concentrations and modulated antioxidant enzyme activities (glutathione reductase, glutathione-S-transferase, catalase, and superoxide dismutase) compared to TBHP-treated cells. Cells treated with RBE showed higher protective effect compared to cells treated with WGE against oxidative insult. Black rice extracts attenuated oxidative insult by inhibiting cellular ROS and MDA increase and by modulating antioxidant enzyme activities in HepG2 cells. PMID:25580401

The micronucleus assay in mammalian cells in vitro to assess health benefits of various phytochemicals.

PubMed

Meschini, Roberta; Berni, Andrea; Filippi, Silvia; Pepe, Gaetano; Grossi, Maria Rosaria; Natarajan, Adayapalam T; Palitti, Fabrizio

2015-11-01

We evaluated the protective effects of Gentiana lutea extracts (GLEx) and 6-Gingerol (6-G) on clastogenicity of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and 7,12-dimethylbenz(α) anthracene (DMBA) in vitro on HepG2 cells using the frequencies of induced micronuclei (MN) as the end point. Pre-, post- and simultaneous treatments with GLEx or 6-G and the carcinogens were carried out. Both GLEx post- and simultaneous treatments reduced the frequencies of MN induced by MNNG and DMBA. Probably this effect is due to an increase of cytostasis and a physico-chemical interaction between GLEx and DMBA under simultaneous treatment. Pre- and simultaneous treatments with 6-G significantly reduced the yield of MNNG-induced micronuclei without affecting % of cytostasis. Simultaneous treatment with 6-G plus DMBA resulted in reduction in the frequency of MN and an increase in cytotoxicity compared to sample treated alone with DMBA, whereas a post-treatment, caused a significant decrease in the yield of MN compared with DMBA alone without any cytotoxic effect. These results are compared with our earlier data obtained in the same system with other phytochemicals. It is concluded that for a critical evaluation of the protective effects of phytochemicals, both the influence on the induced MN and induced cytostasis have to be considered. Copyright © 2015 Elsevier B.V. All rights reserved.

G protein-coupled receptor kinase-2-deficient mice are protected from dextran sodium sulfate-induced acute colitis.

PubMed

Steury, Michael D; Kang, Ho Jun; Lee, Taehyung; Lucas, Peter C; McCabe, Laura R; Parameswaran, Narayanan

2018-06-01

G protein-coupled receptor kinase 2 (GRK2) is a serine/threonine kinase and plays a key role in different disease processes. Previously, we showed that GRK2 knockdown enhances wound healing in colonic epithelial cells. Therefore, we hypothesized that ablation of GRK2 would protect mice from dextran sodium sulfate (DSS)-induced acute colitis. To test this, we administered DSS to wild-type (GRK2 +/+ ) and GRK2 heterozygous (GRK +/- ) mice in their drinking water for 7 days. As predicted, GRK2 +/- mice were protected from colitis as demonstrated by decreased weight loss (20% loss in GRK2 +/+ vs. 11% loss in GRK2 +/- ). lower disease activity index (GRK2 +/+ 9.1 vs GRK2 +/- 4.1), and increased colon lengths (GRK2 +/+ 4.7 cm vs GRK2 +/- 5.3 cm). To examine the mechanisms by which GRK2 +/- mice are protected from colitis, we investigated expression of inflammatory genes in the colon as well as immune cell profiles in colonic lamina propria, mesenteric lymph node, and in bone marrow. Our results did not reveal differences in immune cell profiles between the two genotypes. However, expression of inflammatory genes was significantly decreased in DSS-treated GRK2 +/- mice compared with GRK2 +/+ . To understand the mechanisms, we generated myeloid-specific GRK2 knockout mice and subjected them to DSS-induced colitis. Similar to whole body GRK2 heterozygous knockout mice, myeloid-specific knockout of GRK2 was sufficient for the protection from DSS-induced colitis. Together our results indicate that deficiency of GRK2 protects mice from DSS-induced colitis and further suggests that the mechanism of this effect is likely via GRK2 regulation of inflammatory genes in the myeloid cells.

Toll-like Receptor 4 Signaling Confers Cardiac Protection Against Ischemic Injury via Inducible Nitric Oxide Synthase- and Soluble Guanylate Cyclase-dependent Mechanisms

PubMed Central

Wang, E; Feng, Yan; Zhang, Ming; Zou, Lin; Li, Yan; Buys, Emmanuel S.; Huang, Peigen; Brouckaert, Peter; Chao, Wei

2011-01-01

Background Prior administration of a small dose of lipopolysaccharide confers a cardiac protection against ischemia-reperfusion injury. However, the signaling mechanisms that control the protection are incompletely understood. We tested the hypothesis that TLR4 mediates the ability of lipopolysaccharide to protect against cardiac ischemia-reperfusion injury through distinct intracellular pathways involving myeloid differentiation factor 88 (MyD88), TIR-domain-containing adaptor protein inducing interferon-β–mediated transcription-factor (Trif), inducible nitric-oxide synthase (iNOS), and soluble guanylate cyclase (sGC). Methods Wild-type mice and the genetically modified mice, i.e., TLR4-deficient (TLR4-def), TLR2 knockout (TLR2−/−), MyD88−/−, Trif−/−, iNOS−/−, and sGCα1−/−, were treated with normal saline or 0.1 mg/kg of lipopolysaccharide, intraperitoneally. Twenty-four hours later, isolated hearts were perfused in a Langendorff apparatus and subsequently subjected to 30 min of global ischemia and reperfusion for up to 60 min. Left ventricular function and myocardial infarction sizes were examined. Results Compared to saline-treated mice, lipopolysaccharide-treated mice had markedly improved left ventricular developed pressure and dP/dtmax (P < 0.01) and reduced MI sizes (37.2 ± 3.4% vs. 19.8 ± 4.9%, P < 0.01) after ischemia-reperfusion. The cardiac protective effect of lipopolysaccharide was abolished in the TLR4-def and MyD88−/− mice, but remained intact in TLR2−/− or Trif−/− mice. iNOS−/− mice or wild-type mice treated with the iNOS inhibitor 1400W failed to respond to the TLR4-induced nitric oxide production and were not protected by the lipopolysaccharide preconditioning. While sGC 1−/− mice had robust nitric oxide production in response to lipopolysaccharide, they were not protected by the TLR4-elicited cardiac protection. Conclusions TLR4 activation confers a potent cardiac protection against ischemia-reperfusion injury via a MyD88-dependent, but Trif-independent mechanism. iNOS/sGC are essential for the TLR4-induced cardiac protection. PMID:21270629

Protective effects of nicergoline against hydrogen peroxide toxicity in rat neuronal cell line.

PubMed

Iwata, E; Miyazaki, I; Asanuma, M; Iida, A; Ogawa, N

1998-07-17

We examined the effects of nicergoline on hydrogen peroxide (H2O2)-induced neurotoxicity in cultured rat neuronal cell line (B50). H2O2 induced death of B50 cells in a dose-dependent manner. The H2O2-induced neuronal cell death was significantly decreased in B50 cells maintained in the presence of nicergoline. We compared the levels of antioxidants (glutathione, catalase and superoxide dismutase) in nicergoline-treated and untreated B50 cells. Lipid peroxidation products (thiobarbituric acid reactive substances, TBARS) levels were also measured. Cultures treated with nicergoline had higher levels of catalase activity. TBARS level was significantly lower in nicergoline-treated cells than in untreated cells. Our results suggest that nicergoline may induce the up-regulation of intracellular antioxidant defences and protect the neuronal cells against oxidative stress.

O-Linked β-N-Acetylglucosamine Modification of A20 Enhances the Inhibition of NF-κB (Nuclear Factor-κB) Activation and Elicits Vascular Protection After Acute Endoluminal Arterial Injury.

PubMed

Yao, Dan; Xu, Lijuan; Xu, Oufan; Li, Rujun; Chen, Mingxing; Shen, Hui; Zhu, Huajiang; Zhang, Fengyi; Yao, Deshang; Chen, Yiu-Fai; Oparil, Suzanne; Zhang, Zhengang; Gong, Kaizheng

2018-06-01

Recently, we have demonstrated that acute glucosamine-induced augmentation of protein O-linked β-N-acetylglucosamine (O-GlcNAc) levels inhibits inflammation in isolated vascular smooth muscle cells and neointimal formation in a rat model of carotid injury by interfering with NF-κB (nuclear factor-κB) signaling. However, the specific molecular target for O-GlcNAcylation that is responsible for glucosamine-induced vascular protection remains unclear. In this study, we test the hypothesis that increased A20 (also known as TNFAIP3 [tumor necrosis factor α-induced protein 3]) O-GlcNAcylation is required for glucosamine-mediated inhibition of inflammation and vascular protection. In cultured rat vascular smooth muscle cells, both glucosamine and the selective O-linked N-acetylglucosaminidase inhibitor thiamet G significantly increased A20 O-GlcNAcylation. Thiamet G treatment did not increase A20 protein expression but did significantly enhance binding to TAX1BP1 (Tax1-binding protein 1), a key regulatory protein for A20 activity. Adenovirus-mediated A20 overexpression further enhanced the effects of thiamet G on prevention of TNF-α (tumor necrosis factor-α)-induced IκB (inhibitor of κB) degradation, p65 phosphorylation, and increases in DNA-binding activity. A20 overexpression enhanced the inhibitory effects of thiamet G on TNF-α-induced proinflammatory cytokine expression and vascular smooth muscle cell migration and proliferation, whereas silencing endogenous A20 by transfection of specific A20 shRNA significantly attenuated these inhibitory effects. In balloon-injured rat carotid arteries, glucosamine treatment markedly inhibited neointimal formation and p65 activation compared with vehicle treatment. Adenoviral delivery of A20 shRNA to the injured arteries dramatically reduced balloon injury-induced A20 expression and inflammatory response compared with scramble shRNA and completely abolished the vascular protection of glucosamine. These results suggest that O-GlcNAcylation of A20 plays a key role in the negative regulation of NF-κB signaling cascades in TNF-α-treated vascular smooth muscle cells in culture and in acutely injured arteries, thus protecting against inflammation-induced vascular injury. © 2018 American Heart Association, Inc.

Roads to the development of improved pertussis vaccines paved by immunology

PubMed Central

Brummelman, Jolanda; Wilk, Mieszko M.; Han, Wanda G.H.; van Els, Cécile A.C.M.; Mills, Kingston H.G.

2015-01-01

Current acellular pertussis vaccines have various shortcomings, which may contribute to their suboptimal efficacy and waning immunity in vaccinated populations. This calls for the development of new pertussis vaccines capable of inducing long-lived protective immunity. Immunization with whole cell pertussis vaccines and natural infection with Bordetella pertussis induce distinct and more protective immune responses when compared with immunization with acellular pertussis vaccines. Therefore, the immune responses induced with whole cell vaccine or after infection can be used as a benchmark for the development of third-generation vaccines against pertussis. Here, we review the literature on the immunology of B. pertussis infection and vaccination and discuss the lessons learned that will help in the design of improved pertussis vaccines. PMID:26347400

Global Proteome Changes in the Rat Diaphragm Induced by Endurance Exercise Training.

PubMed

Sollanek, Kurt J; Burniston, Jatin G; Kavazis, Andreas N; Morton, Aaron B; Wiggs, Michael P; Ahn, Bumsoo; Smuder, Ashley J; Powers, Scott K

2017-01-01

Mechanical ventilation (MV) is a life-saving intervention for many critically ill patients. Unfortunately, prolonged MV results in the rapid development of diaphragmatic atrophy and weakness. Importantly, endurance exercise training results in a diaphragmatic phenotype that is protected against ventilator-induced diaphragmatic atrophy and weakness. The mechanisms responsible for this exercise-induced protection against ventilator-induced diaphragmatic atrophy remain unknown. Therefore, to investigate exercise-induced changes in diaphragm muscle proteins, we compared the diaphragmatic proteome from sedentary and exercise-trained rats. Specifically, using label-free liquid chromatography-mass spectrometry, we performed a proteomics analysis of both soluble proteins and mitochondrial proteins isolated from diaphragm muscle. The total number of diaphragm proteins profiled in the soluble protein fraction and mitochondrial protein fraction were 813 and 732, respectively. Endurance exercise training significantly (P<0.05, FDR <10%) altered the abundance of 70 proteins in the soluble diaphragm proteome and 25 proteins of the mitochondrial proteome. In particular, key cytoprotective proteins that increased in relative abundance following exercise training included mitochondrial fission process 1 (Mtfp1; MTP18), 3-mercaptopyruvate sulfurtransferase (3MPST), microsomal glutathione S-transferase 3 (Mgst3; GST-III), and heat shock protein 70 kDa protein 1A/1B (HSP70). While these proteins are known to be cytoprotective in several cell types, the cyto-protective roles of these proteins have yet to be fully elucidated in diaphragm muscle fibers. Based upon these important findings, future experiments can now determine which of these diaphragmatic proteins are sufficient and/or required to promote exercise-induced protection against inactivity-induced muscle atrophy.

A Burkholderia pseudomallei Outer Membrane Vesicle Vaccine Provides Cross Protection against Inhalational Glanders in Mice and Non-Human Primates.

PubMed

Baker, Sarah M; Davitt, Christopher J H; Motyka, Natalya; Kikendall, Nicole L; Russell-Lodrigue, Kasi; Roy, Chad J; Morici, Lisa A

2017-12-09

Burkholderia mallei is a Gram-negative, non-motile, facultative intracellular bacillus and the causative agent of glanders, a highly contagious zoonotic disease. B. mallei is naturally resistant to multiple antibiotics and there is concern for its potential use as a bioweapon, making the development of a vaccine against B. mallei of critical importance. We have previously demonstrated that immunization with multivalent outer membrane vesicles (OMV) derived from B. pseudomallei provide significant protection against pneumonic melioidosis. Given that many virulence determinants are highly conserved between the two species, we sought to determine if the B. pseudomallei OMV vaccine could cross-protect against B. mallei . We immunized C57Bl/6 mice and rhesus macaques with B. pseudomallei OMVs and subsequently challenged animals with aerosolized B. mallei . Immunization with B. pseudomallei OMVs significantly protected mice against B. mallei and the protection observed was comparable to that achieved with a live attenuated vaccine. OMV immunization induced the production of B.mallei- specific serum IgG and a mixed Th1/Th17 CD4 and CD8 T cell response in mice. Additionally, immunization of rhesus macaques with B. pseudomallei OMVs provided protection against glanders and induced B.mallei -specific serum IgG in non-human primates. These results demonstrate the ability of the multivalent OMV vaccine platform to elicit cross-protection against closely-related intracellular pathogens and to induce robust humoral and cellular immune responses against shared protective antigens.

A Burkholderia pseudomallei Outer Membrane Vesicle Vaccine Provides Cross Protection against Inhalational Glanders in Mice and Non-Human Primates

PubMed Central

Davitt, Christopher J. H.; Motyka, Natalya; Kikendall, Nicole L.; Roy, Chad J.

2017-01-01

Burkholderia mallei is a Gram-negative, non-motile, facultative intracellular bacillus and the causative agent of glanders, a highly contagious zoonotic disease. B. mallei is naturally resistant to multiple antibiotics and there is concern for its potential use as a bioweapon, making the development of a vaccine against B. mallei of critical importance. We have previously demonstrated that immunization with multivalent outer membrane vesicles (OMV) derived from B. pseudomallei provide significant protection against pneumonic melioidosis. Given that many virulence determinants are highly conserved between the two species, we sought to determine if the B. pseudomallei OMV vaccine could cross-protect against B. mallei. We immunized C57Bl/6 mice and rhesus macaques with B. pseudomallei OMVs and subsequently challenged animals with aerosolized B. mallei. Immunization with B. pseudomallei OMVs significantly protected mice against B. mallei and the protection observed was comparable to that achieved with a live attenuated vaccine. OMV immunization induced the production of B.mallei-specific serum IgG and a mixed Th1/Th17 CD4 and CD8 T cell response in mice. Additionally, immunization of rhesus macaques with B. pseudomallei OMVs provided protection against glanders and induced B.mallei-specific serum IgG in non-human primates. These results demonstrate the ability of the multivalent OMV vaccine platform to elicit cross-protection against closely-related intracellular pathogens and to induce robust humoral and cellular immune responses against shared protective antigens. PMID:29232837

Role of TRPA1 in acute cardiopulmonary toxicity of inhaled acrolein.

PubMed

Conklin, Daniel J; Haberzettl, Petra; Jagatheesan, Ganapathy; Kong, Maiying; Hoyle, Gary W

2017-06-01

Acrolein is a highly toxic, volatile, unsaturated aldehyde generated during incomplete combustion as in tobacco smoke and indoor fires. Because the transient receptor potential ankyrin 1 (TRPA1) channel mediates tobacco smoke-induced lung injury, we assessed its role in high-level acrolein-induced toxicity in mice. Acrolein (100-275ppm, 10-30min) caused upper airway epithelial sloughing, bradypnea and oral gasping, hypothermia, cardiac depression and mortality. Male wild-type mice (WT, C57BL/6; 5-52weeks) were significantly more sensitive to high-level acrolein than age-matched, female WT mice. Both male and female TRPA1-null mice were more sensitive to acrolein-induced mortality than age- and sex-matched WT mice. Acrolein exposure increased lung weight:body weight ratios and lung albumin and decreased plasma albumin to a greater extent in TRPA1-null than in WT mice. Lung and plasma protein-acrolein adducts were not increased in acrolein-exposed TRPA1-null mice compared with WT mice. To assess TRPA1-dependent protective mechanisms, respiratory parameters were monitored by telemetry. TRPA1-null mice had a slower onset of breathing rate suppression ('respiratory braking') than WT mice suggesting TRPA1 mediates this protective response. Surprisingly, WT male mice treated either with a TRPA1 antagonist (HC030031; 200mg/kg) alone or with combined TRPA1 (100mg/kg) and TRPV1 (capsazepine, 10mg/kg) antagonists at 30min post-acrolein exposure (i.e., "real world" delay in treatment) were significantly protected from acrolein-induced mortality. These data show TRPA1 protects against high-level acrolein-induced toxicity in a sex-dependent manner. Post-exposure TRPA1 antagonism also protected against acrolein-induced mortality attesting to a complex role of TRPA1 in cardiopulmonary injury. Copyright © 2016 Elsevier Inc. All rights reserved.

Nullification of aspirin induced gastrotoxicity and hepatotoxicity by prior administration of wheat germ oil in Mus musculus: histopathological, ultrastructural and molecular studies.

PubMed

Mohamed, H R H; Hamad, S R

2017-08-30

Aspirin (acetyl salicylic acid) is used worldwide to treat various inflammatory conditions and prevent cardiovascular disease, along with reducing the risk of cancer. However, administration of aspirin causes toxic effects, especially in the stomach and liver. Thus, our study examined the protective effect of wheat germ oil on aspirin-induced toxicity in the stomach and liver tissues of Swiss albino mice. Administration of wheat germ oil before aspirin has restored normal hepatic and gastric tissue architecture and DNA integrity has become better than that of a negative health control group compared with the aspirin only treated group. The elevated gastric nitric oxide content in the aspirin only treated group was significantly decreased by wheat germ oil prior administration as a result of reduced the expression of inducible nitric synthase and increased the expression of endothelial nitric oxide synthase compared to their expression in the aspirin administered group. Wheat germ oil pre-administration significantly reduced the level of malondialdehyde, increased the level of glutathione and catalase and superoxide dismutase activities compared with those in aspirin only treated group. We conclude that wheat germ oil has a potential protective effect against aspirin induced gastro- and hepato-toxicity because of its free radical scavenging ability.

α-Lipoic acid protects against cholecystokinin-induced acute pancreatitis in rats

PubMed Central

Park, Sung-Joo; Seo, Sang-Wan; Choi, Ok-Sun; Park, Cheung-Seog

2005-01-01

AIM: α-Lipoic acid (ALA) has been used as an antioxidant. The aim of this study was to investigate the effect of α-lipoic acid on cholecystokinin (CCK)-octapeptide induced acute pancreatitis in rats. METHODS: ALA at 1 mg/kg was intra-peritoneally injected, followed by 75 μg/kg CCK-octapeptide injected thrice subcutaneously after 1, 3, and 5 h. This whole procedure was repeated for 5 d. We checked the pancreatic weight/body weight ratio, the secretion of pro-inflammatory cytokines and the levels of lipase, amylase of serum. Repeated CCK octapeptide treatment resulted in typical laboratory and morphological changes of experimentally induced pancreatitis. RESULTS: ALA significantly decreased the pancreatic weight/body weight ratio and serum amylase and lipase in CCK octapeptide-induced acute pancreatitis. However, the secretion of IL-1β, IL-6, and TNF-α were comparable in CCK octapeptide-induced acute pancreatitis. CONCLUSION: ALA may have a protective effect against CCK octapeptide-induced acute pancreatitis. PMID:16097064

Radio protective effect of black mulberry extract on radiation-induced damage in bone marrow cells and liver in the rat

NASA Astrophysics Data System (ADS)

Ghasemnezhad Targhi, Reza; Homayoun, Mansour; Mansouri, Somaieh; Soukhtanloo, Mohammad; Soleymanifard, Shokouhozaman; Seghatoleslam, Masoumeh

2017-01-01

Ionizing radiation by producing free radicals induces tissue oxidative stress and has clastogenic and cytotoxic effects. The radio protective effect of black mulberry extract (BME) has been investigated on liver tissue and bone marrow cells in the rat. Intraperitoneal (ip) administration of 200 mg/kg BME three days before and three days after 3 Gy and 6 Gy gamma irradiation significantly reduced the frequencies of micro nucleated polychromatic erythrocytes (MnPCEs) and micro nucleated norm chromatic erythrocyte (MnNCEs) and increased PCE/PCE+NCE ratio in rat bone marrow compared to the non-treated irradiated groups. Moreover, this concentration of BME extract decreased the level of malondialdehyde (MDA) and superoxide dismutase (SOD), as well as enhanced the total thiol content and catalase activity in rat's liver compared to the non-treated irradiated groups. It seems that BME extract with antioxidant activity reduced the genotoxicity and cytotoxicity induced by gamma irradiation in bone marrow cells and liver in the rat.

Structure-dependent efficacy of infectious bursal disease virus (IBDV) recombinant vaccines.

PubMed

Martinez-Torrecuadrada, Jorge L; Saubi, Narciís; Pagès-Manté, Albert; Castón, José R; Espuña, Enric; Casal, J Ignacio

2003-07-04

The immunogenicity and protective capability of several baculovirus-expressed infectious bursal disease virus (IBDV)-derived assemblies as VP2 capsids, VPX tubules and polyprotein (PP)-derived mixed structures, were tested. Four-week-old chickens were immunised subcutaneously with one dose of each particulate antigen. VP2 icosahedral capsids induced the highest neutralising response, followed by PP-derived structures and then VPX tubules. All vaccinated animals were protected when challenged with a very virulent IBDV (vvIBDV) isolate, however the degree of protection is directly correlated with the levels of neutralising antibodies. VP2 capsids elicited stronger protective immunity than tubular structures and 3 micrograms of them were sufficient to confer a total protection comparable to that induced by an inactivated vaccine. Therefore, VP2 capsids represent a suitable candidate recombinant vaccine instead of virus-like particles (VLPs) for IBDV infections. Our results also provide clear evidence that the recombinant IBDV-derived antigens are structure-dependent in order to be efficient as vaccine components.

Structure-dependent efficacy of infectious bursal disease virus (IBDV) recombinant vaccines.

PubMed

Martinez-Torrecuadrada, Jorge L; Saubi, Narcis; Pagès-Manté, Albert; Castón, José R; Espuña, Enric; Casal, J Ignacio

2003-05-16

The immunogenicity and protective capability of several baculovirus-expressed infectious bursal disease virus (IBDV)-derived assemblies as VP2 capsids, VPX tubules and polyprotein (PP)-derived mixed structures, were tested. Four-week-old chickens were immunised subcutaneously with one dose of each particulate antigen. VP2 icosahedral capsids induced the highest neutralising response, followed by PP-derived structures and then VPX tubules. All vaccinated animals were protected when challenged with a very virulent IBDV (vvIBDV) isolate, however the degree of protection is directly correlated with the levels of neutralising antibodies. VP2 capsids elicited stronger protective immunity than tubular structures and 3& mgr;g of them were sufficient to confer a total protection comparable to that induced by an inactivated vaccine. Therefore, VP2 capsids represent a suitable candidate recombinant vaccine instead of virus-like particles (VLPs) for IBDV infections. Our results also provide clear evidence that the recombinant IBDV-derived antigens are structure-dependent in order to be efficient as vaccine components.

PPAR agonist-mediated protection against HIV Tat-induced cerebrovascular toxicity is enhanced in MMP-9-deficient mice

PubMed Central

Huang, Wen; Chen, Lei; Zhang, Bei; Park, Minseon; Toborek, Michal

2014-01-01

The strategies to protect against the disrupted blood–brain barrier (BBB) in HIV-1 infection are not well developed. Therefore, we investigated the potential of peroxisome proliferator-activated receptor (PPAR) agonists to prevent enhanced BBB permeability induced by HIV-1-specific protein Tat. Exposure to Tat via the internal carotid artery (ICA) disrupted permeability across the BBB; however, this effect was attenuated in mice treated with fenofibrate (PPARα agonist) or rosiglitazone (PPARγ agonist). In contrast, exposure to GW9662 (PPARγ antagonist) exacerbated Tat-induced disruption of the BBB integrity. Increased BBB permeability was associated with decreased tight junction (TJ) protein expression and activation of ERK1/2 and Akt in brain microvessels; these effects were attenuated by cotreatment with fenofibrate but not with rosiglitazone. Importantly, both PPAR agonists also protected against Tat-induced astrogliosis and neuronal loss. Because disruption of TJ integrity has been linked to matrix metalloproteinase (MMP) activity, we also evaluated Tat-induced effects in MMP-9-deficient mice. Tat-induced cerebrovascular toxicity, astrogliosis, and neuronal loss were less pronounced in MMP-9-deficient mice as compared with wild-type controls and were further attenuated by PPAR agonists. These results indicate that enhancing PPAR activity combined with targeting MMPs may provide effective therapeutic strategies in brain infection by HIV-1. PMID:24424383

Comparative protective effect of hawthorn berry hydroalcoholic extract, atorvastatin, and mesalamine on experimentally induced colitis in rats.

PubMed

Malekinejad, Hassan; Shafie-Irannejad, Vahid; Hobbenaghi, Rahim; Tabatabaie, Seyed Hamed; Moshtaghion, Seyed-Mehdi

2013-07-01

The protective effect of hydroalcoholic extract of hawthorn berries (HBE) on acetic acid (AA)-induced colitis in rats was investigated. Forty-two Wistar rats were divided into seven groups, including control and test groups (n=6). The control animals received saline, and the test animals were treated with saline (sham group), mesalamine (50 mg/kg; M group), atorvastatin (20 mg/kg; A group), HBE (100 mg/kg; H group), mesalamine and HBE (HM group), or atorvastatin plus HBE (HA group), 3 days before and a week after colitis induction. Colitis was induced by administration of 1 mL AA (4%) via a polyethylene catheter intrarectally. High-performance liquid chromatography analyses showed that HBE contained 0.13% and 0.5% oleanolic acid and ursolic acid, respectively. Elevated myeloperoxidase activity and lipid peroxidation were attenuated in the HA group. The H and HM groups showed marked reductions in colitis-induced decreases in total thiol molecules and body weight. The histopathological studies revealed that HBE decreased colitis-induced edema and infiltration of neutrophils. Our data suggest the anti-inflammatory and antioxidant effects of HBE and atorvastatin protect against AA-induced colitis. The anti-inflammatory effect of HBE may be attributable to its ability to decrease myeloperoxidase activity as a biomarker of neutrophil infiltration.

N-acetylcysteine protects melanocytes against oxidative stress/damage and delays onset of UV-induced melanoma in mice

PubMed Central

Cotter, Murray A.; Thomas, Joshua; Cassidy, Pamela; Robinette, Kyle; Jenkins, Noah; Scott, R. Florell; Leachman, Sancy; Samlowski, Wolfram E.; Grossman, Douglas

2008-01-01

UV radiation is the major environmental risk factor for melanoma and a potent inducer of oxidative stress, which is implicated in the pathogenesis of several malignancies. We evaluated whether the thiol antioxidant N-acetylcysteine (NAC) could protect melanocytes from UV-induced oxidative stress/damage in vitro and from UV-induced melanoma in vivo. In melan-a cells, a mouse melanocyte line, NAC (1–10 mM) conferred protection from several UV-induced oxidative sequelae including production of intracellular peroxide, formation of the signature oxidative DNA lesion 8-oxoguanine (8-OG), and depletion of free reduced thiols (primarily glutathione). Mice transgenic for hepatocyte growth factor and Survivin, previously shown to develop melanoma following a single neonatal dose of UV irradiation, were administered NAC (7 mg/ml, mother’s drinking water) transplacentally and through nursing until two weeks after birth. Delivery of NAC in this manner reduced thiol depletion and blocked formation of 8-OG in skin following neonatal UV treatment. Mean onset of UV-induced melanocytic tumors was significantly delayed in NAC-treated compared to control mice (21 vs. 14 weeks, p=0.0003). Our data highlight the potential importance of oxidative stress in the pathogenesis of melanoma, and suggest that NAC may be useful as a chemopreventive agent. PMID:17908992

Obeticholic acid protects mice against lipopolysaccharide-induced liver injury and inflammation.

PubMed

Xiong, Xi; Ren, Yuqian; Cui, Yun; Li, Rui; Wang, Chunxia; Zhang, Yucai

2017-12-01

Cholestasis, as a main manifestation, induces liver injury during sepsis. The farnesoid X receptor (FXR) plays an important role in regulating bile acid homeostasis. Whether FXR activation by its agonist obeticholic acid (OCA) is contributed to improve sepsis-induced liver injury remains unknown. The aim of the present study was to investigate the effect of OCA on lipopolysaccharide (LPS)-induced acute liver injury in mice. 8-week old male C57BL/6J mice were randomly divided into control group, LPS group, oral OCA group and LPS plus oral OCA (LPS + OCA) group. The serum and livers were collected for further analysis. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bile acid (TBA) and total bilirubin (TBIL) were measured at indicated time after LPS administration. Liver sections were stained with hematoxylin & eosin (H&E). Orally OCA pretreatment stimulated the expression of FXR and BSEP in livers and protected mice from LPS-induced hepatocyte apoptosis and inflammatory infiltration. Consistently, LPS-induced higher serum levels of ALT, AST, TBA and TBIL were significantly reversed by OCA administration. Meanwhile, the mRNA levels of interleukin 1β (IL-1β), tumor necrosis factor α (TNF-α) and IL-6 were decreased in livers of mice in LPS + OCA group compared with LPS group. Further investigation indicated that the higher expression of ATF4 and LC3II/I were associated with the protective effect of OCA on LPS-induced liver injury. Orally OCA pretreatment protects mice from LPS-induced liver injury possibly contributed by improved bile acid homeostasis, decreased inflammatory factors and ATF4-mediated autophagy activity in hepatocytes. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

IgG2 Antibodies against a Clinical Grade Plasmodium falciparum CSP Vaccine Antigen Associate with Protection against Transgenic Sporozoite Challenge in Mice

PubMed Central

Schwenk, Robert; Nikki, Jennifer; Rein, Lisa; Spaccapelo, Roberta; Crisanti, Andrea; Wightman, Paul D.; Ockenhouse, Christian F.; Dutta, Sheetij

2014-01-01

The availability of a highly purified and well characterized circumsporozoite protein (CSP) is essential to improve upon the partial success of recombinant CSP-based malaria vaccine candidates. Soluble, near full-length, Plasmodium falciparum CSP vaccine antigen (CS/D) was produced in E. coli under bio-production conditions that comply with current Good Manufacturing Practices (cGMP). A mouse immunogenicity study was conducted using a stable oil-in-water emulsion (SE) of CS/D in combination with the Toll-Like Receptor 4 (TLR4) agonist Glucopyranosyl Lipid A (GLA/SE), or one of two TLR7/8 agonists: R848 (un-conjugated) or 3M-051 (covalently conjugated). Compared to Alum and SE, GLA/SE induced higher CS/D specific antibody response in Balb/c mice. Subclass analysis showed higher IgG2:IgG1 ratio of GLA/SE induced antibodies as compared to Alum and SE. TLR synergy was not observed when soluble R848 was mixed with GLA/SE. Antibody response of 3M051 formulations in Balb/c was similar to GLA/SE, except for the higher IgG2:IgG1 ratio and a trend towards higher T cell responses in 3M051 containing groups. However, no synergistic enhancement of antibody and T cell response was evident when 3M051 conjugate was mixed with GLA/SE. In C57Bl/6 mice, CS/D adjuvanted with 3M051/SE or GLA/SE induced higher CSP repeat specific titers compared to SE. While, 3M051 induced antibodies had high IgG2c:IgG1 ratio, GLA/SE promoted high levels of both IgG1 and IgG2c. GLA/SE also induced more potent T-cell responses compared to SE in two independent C57/BL6 vaccination studies, suggesting a balanced and productive TH1/TH2 response. GLA and 3M-051 similarly enhanced the protective efficacy of CS/D against challenge with a transgenic P. berghei parasite and most importantly, high levels of cytophilic IgG2 antibodies were associated with protection in this model. Our data indicated that the cGMP-grade, soluble CS/D antigen combined with the TLR4-containing adjuvant GLA/SE warrants further evaluation for protective responses in humans. PMID:25343487

Fisetin and luteolin protect human retinal pigment epithelial cells from oxidative stress-induced cell death and regulate inflammation

PubMed Central

Hytti, Maria; Piippo, Niina; Korhonen, Eveliina; Honkakoski, Paavo; Kaarniranta, Kai; Kauppinen, Anu

2015-01-01

Degeneration of retinal pigment epithelial (RPE) cells is a clinical hallmark of age-related macular degeneration (AMD), the leading cause of blindness among aged people in the Western world. Both inflammation and oxidative stress are known to play vital roles in the development of this disease. Here, we assess the ability of fisetin and luteolin, to protect ARPE-19 cells from oxidative stress-induced cell death and to decrease intracellular inflammation. We also compare the growth and reactivity of human ARPE-19 cells in serum-free and serum-containing conditions. The absence of serum in the culture medium did not prevent ARPE-19 cells from reaching full confluency but caused an increased sensitivity to oxidative stress-induced cell death. Both fisetin and luteolin protected ARPE-19 cells from oxidative stress-induced cell death. They also significantly decreased the release of pro-inflammatory cytokines into the culture medium. The decrease in inflammation was associated with reduced activation of MAPKs and CREB, but was not linked to NF- κB or SIRT1. The ability of fisetin and luteolin to protect and repair stressed RPE cells even after the oxidative insult make them attractive in the search for treatments for AMD. PMID:26619957

Heat stress protects against mechanical ventilation-induced diaphragmatic atrophy.

PubMed

Ichinoseki-Sekine, Noriko; Yoshihara, Toshinori; Kakigi, Ryo; Sugiura, Takao; Powers, Scott K; Naito, Hisashi

2014-09-01

Mechanical ventilation (MV) is a life-saving intervention in patients who are incapable of maintaining adequate pulmonary gas exchange due to respiratory failure or other disorders. However, prolonged MV is associated with the development of respiratory muscle weakness. We hypothesized that a single exposure to whole body heat stress would increase diaphragm expression of heat shock protein 72 (HSP72) and that this treatment would protect against MV-induced diaphragmatic atrophy. Adult male Wistar rats (n = 38) were randomly assigned to one of four groups: an acutely anesthetized control group (CON) with no MV; 12-h controlled MV group (CMV); 1-h whole body heat stress (HS); or 1-h whole body heat stress 24 h prior to 12-h controlled MV (HSMV). Compared with CON animals, diaphragmatic HSP72 expression increased significantly in the HS and HSMV groups (P < 0.05). Prolonged MV resulted in significant atrophy of type I, type IIa, and type IIx fibers in the costal diaphragm (P < 0.05). Whole body heat stress attenuated this effect. In contrast, heat stress did not protect against MV-induced diaphragm contractile dysfunction. The mechanisms responsible for this heat stress-induced protection remain unclear but may be linked to increased expression of HSP72 in the diaphragm. Copyright © 2014 the American Physiological Society.

Protective Effect of Anthocyanins Extract from Blueberry on TNBS-Induced IBD Model of Mice

PubMed Central

Wu, Lin-Hua; Xu, Zeng-Lai; Dong, Di; He, Shan-An; Yu, Hong

2011-01-01

This study was carried out to evaluate the protective effect of anthocyanins extract of blueberry on trinitrobenzene sulfonic acid (TNBS)-induced inflammatory bowel disease (IBD) model of mice. The study employed female C57BL/6 mice (n = 50), and colitis was induced by intracolonic injection of 0.5 mg of TNBS dissolved in 50% ethanol–phosphate buffered solution. The mice were divided into five groups (n = 10): vehicle, TNBS control and anthocyanins groups that received different doses of anthocyanins extract (10, 20 and 40 mg kg−1) daily for 6 days. Both increase in body weight and diarrhea symptoms were monitored each day. After 6 days, the animals were killed, and the following parameters were assessed: colon length, morphological score, histological score and biochemical assay (NO, myeloperoxidase (MPO), interleukin (IL)-12, IL-10, tumor necrosis factor (TNF)-α and interferon (IFN)-γ). The results showed that the anthocyanins extract of blueberry rendered strong protection against TNBS-induced colonic damage at a dosage of 40 mg kg−1. When compared with the control, anthocyanins extract significantly prevented loss of body weight and ameliorated the scores of diarrhea, morphology and histology. Treatment with anthocyanins extract restored IL-10 excretion, as well as caused reduction in the levels of NO, MPO, IL-12, TNF-α and IFN-γ. Our research revealed the protective effect of anthocyanins extract from blueberry on TNBS-induced experimental colitis in mice, as well as examined whether high levels of dietary blueberries would lower the risk or have protective effects on human IBD, which may require further investigation. PMID:21785630

Hyperoside protects against hypoxia/reoxygenation induced injury in cardiomyocytes by suppressing the Bnip3 expression.

PubMed

Xiao, Rui; Xiang, An-Li; Pang, Hong-Bo; Liu, Ke-Qiang

2017-09-20

Role of hyperoside in protecting cardiomyocytes from ischemia/reperfusion induced injury has been proved. However, possible protecting mechanisms remain unclear. To fix the problem, an essential pro-apoptotic protein Bnip3 was studied in our experiments. Neonatal rat cardiomyocytes were used and submitted to hypoxia for 8h followed by reoxygenation for 2h to simulate the ischemia/reperfusion injury. Hypoxia/reoxygenation(H/R) induced damage to cardiomyocytes and the protective effect of hyperoside were examined by means of MTT assay. H/R-induced apoptosis was assessed by Terminal-deoxynucleoitidyl Transferase Mediated Nick End Labeling(TUNEL) and DNA Ladder assay. mRNA expression of Bnip3 was determined by use of quantitative real-time reverse transcription polymerase chain reaction assay. Protein levels of Bnip3, Bax, Bcl-2 and cleaved caspase-3 were examined using western-blot assay. Our results showed that H/R caused great damage to cardiomyocytes, upregulated the protein expressions of Bnip3, Bax, cleaved caspase3, and decreased the expression of the anti-apoptotic protein of Bcl-2. Whereas, compared with the H/R group, a decrease in activities of Bnip3, Bax, cleaved caspase3, and a promoting expression of Bcl-2 were detected in the H/R goup pretreated with hyperoside. It was concluded in our study that H/R-induced apoptotic effect in cardiomyocytes could be attenuated by hyperoside, and the protective role of hyperoside, if not completely, could be partly through the suppression of the pro-apoptotic gene Bnip3. Copyright © 2017 Elsevier B.V. All rights reserved.

Central Memory CD4+ T Cells Are Responsible for the Recombinant Bacillus Calmette-Guérin ΔureC::hly Vaccine's Superior Protection Against Tuberculosis

PubMed Central

Vogelzang, Alexis; Perdomo, Carolina; Zedler, Ulrike; Kuhlmann, Stefanie; Hurwitz, Robert; Gengenbacher, Martin; Kaufmann, Stefan H. E.

2014-01-01

Bacillus Calmette-Guérin (BCG) has been used for vaccination against tuberculosis for nearly a century. Here, we analyze immunity induced by a live tuberculosis vaccine candidate, recombinant BCG ΔureC::hly vaccine (rBCG), with proven preclinical and clinical safety and immunogenicity. We pursue in-depth analysis of the endogenous mycobacteria-specific CD4+ T-cell population, comparing the more efficacious rBCG with canonical BCG to determine which T-cell memory responses are prerequisites for superior protection against tuberculosis. rBCG induced higher numbers and proportions of antigen-specific memory CD4+ T cells than BCG, with a CXCR5+CCR7+ phenotype and low expression of the effector transcription factors T-bet and Bcl-6. We found that the superior protection of rBCG, compared with BCG, correlated with higher proportions and numbers of these central memory T cells and of T follicular helper cells associated with specific antibody responses. Adoptive transfer of mycobacteria-specific central memory T cells validated their critical role in protection against pulmonary tuberculosis. PMID:24943726

A Comparative Analysis of the Photo-Protective Effects of Soy Isoflavones in Their Aglycone and Glucoside Forms

PubMed Central

Iovine, Barbara; Iannella, Maria Luigia; Gasparri, Franco; Giannini, Valentina; Monfrecola, Giuseppe; Bevilacqua, Maria Assunta

2012-01-01

Isoflavones exist in nature predominantly as glucosides such as daidzin or genistin and are rarely found in their corresponding aglycone forms daidzein and genistein. The metabolism and absorption of isoflavones ingested with food is well documented, but little is known about their use as topical photo-protective agents. The aim of this study was to investigate in a comparative analysis the photo-protective effects of isoflavones in both their aglycone and glucoside forms. In human skin fibroblasts irradiated with 60 mJ/cm2 ultraviolet B (UVB), we measured the expression levels of COX-2 and Gadd45, which are involved in inflammation and DNA repair, respectively. We also determined the cellular response to UVB-induced DNA damage using the comet assay. Our findings suggest that both the isoflavone glucosides at a specific concentration and combination with an aglycone mixture exerted an anti-inflammatory and photo-protective effect that prevented 41% and 71% of UVB-induced DNA damage, respectively. The advantages of using either isoflavone glucosides or an aglycone mixture in applications in the field of dermatology will depend on their properties and their different potential uses. PMID:23211668

The effect of different adjuvants on immune parameters and protection following vaccination of sheep with a larval-specific antigen of the gastrointestinal nematode, Haemonchus contortus.

PubMed

Piedrafita, David; Preston, Sarah; Kemp, Joanna; de Veer, Michael; Sherrard, Jayne; Kraska, Troy; Elhay, Martin; Meeusen, Els

2013-01-01

It has recently been recognised that vaccine adjuvants play a critical role in directing the nature of a vaccine induced effector response. In the present study, several adjuvants were evaluated for their ability to protect sheep after field vaccination with the larval-specific Haemonchus contortus antigen, HcsL3. Using a suboptimal antigen dose, aluminium adjuvant was shown to reduce the cumulative faecal egg counts (cFEC) and worm burden by 23% and 25% respectively, in agreement with a previous study. The addition of Quil A to the aluminium-adjuvanted vaccine brought cFEC back to control levels. Vaccination with the adjuvant DEAE-dextran almost doubled the protection compared to the aluminium-adjuvanted vaccine resulting in 40% and 41% reduction in cFEC and worm counts compared to controls. Examination of skin responses following i.d. injection of exsheathed L3, revealed that cFEC was negatively correlated with wheal size and tissue eosinophils for the DEAE-dextran and aluminium-adjuvanted groups respectively. These studies have for the first time shown the potential of DEAE-dextran adjuvant for helminth vaccines, and discovered significant cellular correlates of vaccine-induced protection.

Coordinate expression of AOS genes and JA accumulation: JA is not required for initiation of closing layer in wound healing tubers

USDA-ARS?s Scientific Manuscript database

Wounding induces a series of coordinated physiological responses essential for protection and healing of the damaged tissue. Wound-induced formation of jasmonic acid (JA) is important in defense responses in leaves, but comparatively little is known about the induction of JA biosynthesis and its ro...

Leishmania mexicana Gp63 cDNA Using Gene Gun Induced Higher Immunity to L. mexicana Infection Compared to Soluble Leishmania Antigen in BALB/C

PubMed Central

Rezvan, H; Rees, R; Ali, SA

2011-01-01

Background Leishmaniasis is a worldwide disease prevalent in tropical and sub tropical countries. Many attempts have been made and different strategies have been approached to develop a potent vaccine against Leishmania. DNA immunisation is a method, which is shown to be effective in Leishmania vaccination. Leishmania Soluble Antigen (SLA) has also recently been used Leishmania vaccination. Methods The immunity generated by SLA and L. mexicana gp63 cDNA was compared in groups of 6 mice, which were statistically analysed by student t- test with the P-value of 0.05. SLA was administered by two different methods; intramuscular injection and injection of dendritic cells (DCs) loaded with SLA. L. mexicana gp63 cDNA was administered by the gene gun. Results Immunisation of BALB/c mice with L. mexicana gp63 resulted in high levels of Th1-type immune response and cytotoxic T lymphocytes (CTL) activity, which were accompanied with protection induced by the immunisation against L. mexicana infection. In contrast, administration of SLA, produced a mixed Th1/Th2-type immune responses as well as a high level of CTL activity but did not protect mice from the infection. Conclusion The results indicate higher protection by DNA immunisation using L. mexicana gp63 cDNA compared to SLA, which is accompanied by a high level of Th1 immune response. However, the CTL activity does not necessarily correlate with the protection induced by the vaccine. Also, gene gun immunisation is a potential approach in Leishmania vaccination. These findings would be helpful in opening new windows in Leishmania vaccine research. PMID:22347315

The Immunomodulatory Role of Adjuvants in Vaccines Formulated with the Recombinant Antigens Ov-103 and Ov-RAL-2 against Onchocerca volvulus in Mice.

PubMed

Hess, Jessica A; Zhan, Bin; Torigian, April R; Patton, John B; Petrovsky, Nikolai; Zhan, Tingting; Bottazzi, Maria Elena; Hotez, Peter J; Klei, Thomas R; Lustigman, Sara; Abraham, David

2016-07-01

In some regions in Africa, elimination of onchocerciasis may be possible with mass drug administration, although there is concern based on several factors that onchocerciasis cannot be eliminated solely through this approach. A vaccine against Onchocerca volvulus would provide a critical tool for the ultimate elimination of this infection. Previous studies have demonstrated that immunization of mice with Ov-103 and Ov-RAL-2, when formulated with alum, induced protective immunity. It was hypothesized that the levels of protective immunity induced with the two recombinant antigens formulated with alum would be improved by formulation with other adjuvants known to enhance different types of antigen-specific immune responses. Immunizing mice with Ov-103 and Ov-RAL-2 in conjunction with alum, Advax 2 and MF59 induced significant levels of larval killing and host protection. The immune response was biased towards Th2 with all three of the adjuvants, with IgG1 the dominant antibody. Improved larval killing and host protection was observed in mice immunized with co-administered Ov-103 and Ov-RAL-2 in conjunction with each of the three adjuvants as compared to single immunizations. Antigen-specific antibody titers were significantly increased in mice immunized concurrently with the two antigens. Based on chemokine levels, it appears that neutrophils and eosinophils participate in the protective immune response induced by Ov-103, and macrophages and neutrophils participate in immunity induced by Ov-RAL-2. The mechanism of protective immunity induced by Ov-103 and Ov-RAL-2, with the adjuvants alum, Advax 2 and MF59, appears to be multifactorial with roles for cytokines, chemokines, antibody and specific effector cells. The vaccines developed in this study have the potential of reducing the morbidity associated with onchocerciasis in humans.

Evaluation of Brucella abortus Phosphoglucomutase (pgm) Mutant as a New Live Rough-Phenotype Vaccine

PubMed Central

Ugalde, Juan Esteban; Comerci, Diego José; Leguizamón, M. Susana; Ugalde, Rodolfo Augusto

2003-01-01

Brucella abortus S19 is the vaccine most frequently used against bovine brucellosis. Although it induces good protection levels, it cannot be administered to pregnant cattle, revaccination is not advised due to interference in the discrimination between infected and vaccinated animals during immune-screening procedures, and the vaccine is virulent for humans. Due to these reasons, there is a continuous search for new bovine vaccine candidates that may confer protection levels comparable to those conferred by S19 but without its disadvantages. A previous study characterized the phenotype associated with the phosphoglucomutase (pgm) gene disruption in Brucella abortus S2308, as well as the possible role for the smooth lipopolysaccharide (LPS) in virulence and intracellular multiplication in HeLa cells (J. E. Ugalde, C. Czibener, M. F. Feldman, and R. A. Ugalde, Infect. Immun. 68:5716-5723, 2000). In this report, we analyze the protection, proliferative response, and cytokine production induced in BALB/c mice by a Δpgm deletion strain. We show that this strain synthesizes O antigen with a size of approximately 45 kDa but is rough. This is due to the fact that the Δpgm strain is unable to assemble the O side chain in the complete LPS. Vaccination with the Δpgm strain induced protection levels comparable to those induced by S19 and generated a proliferative splenocyte response and a cytokine profile typical of a Th1 response. On the other hand, we were unable to detect a specific anti-O-antigen antibody response by using the fluorescence polarization assay. In view of these results, the possibility that the Δpgm mutant could be used as a vaccination strain is discussed. PMID:14573645

Hypoglycaemic and Tissue-Protective Effects of the Aqueous Extract of Persea Americana Seeds on Alloxan-Induced Albino Rats

PubMed Central

EZEJIOFOR, Anthonet Ndidi; OKORIE, Abednego; ORISAKWE, Orish Ebere

2013-01-01

Background: The tissue-protective potential of Persea americana necessitated a look into the histopathological effects of the plant extract on the pancreas, liver, and kidneys. This study was conceived and designed based on the gaps in the research that has been performed and what is known about the plant. The hypoglycaemic and tissue-protective effects of hot aqueous Persea americana (avocado pear) seed extracts on alloxan-induced albino rats were investigated. Methods: Persea americana seeds were extracted using hot water, and different concentrations of the extract were prepared. The effects of different concentrations (20, 30, 40 g/L) of the hot aqueous P. americana seed extract on alloxan-induced Wistar albino rats were compared with those of a reference drug, glibenclamide. The glucose level of the rats was measured daily, and the weight of the animal was monitored on a weekly basis for 21 days. The oral glucose tolerance test (OGTT) was performed at 0, 30, 60, 90 and 120 minutes, and the histopathologies of the liver, kidneys, and pancreas were investigated. Phytochemical analysis of P. americana seed extracts indicated the presence of glycosides, tannins, saponins, carbohydrates, flavonoids, and alkaloids. Results: The results showed that the extract possessed a significant hypoglycaemic (P < 0.05) effect and reversed the histopathological damage that occurred in alloxan-induced diabetic rats, comparable to the effects glibenclamide. The seeds of P. americana also had anti-diabetic and protective effects on some rat tissues such as the pancreas, kidneys, and liver. Conclusion: In conclusion, the present study provides a pharmacological basis for the folkloric use of the hot-water extract of P. americana seeds in the management of diabetes mellitus. PMID:24643349

Hypoglycaemic and tissue-protective effects of the aqueous extract of persea americana seeds on alloxan-induced albino rats.

PubMed

Ezejiofor, Anthonet Ndidi; Okorie, Abednego; Orisakwe, Orish Ebere

2013-10-01

The tissue-protective potential of Persea americana necessitated a look into the histopathological effects of the plant extract on the pancreas, liver, and kidneys. This study was conceived and designed based on the gaps in the research that has been performed and what is known about the plant. The hypoglycaemic and tissue-protective effects of hot aqueous Persea americana (avocado pear) seed extracts on alloxan-induced albino rats were investigated. Persea americana seeds were extracted using hot water, and different concentrations of the extract were prepared. The effects of different concentrations (20, 30, 40 g/L) of the hot aqueous P. americana seed extract on alloxan-induced Wistar albino rats were compared with those of a reference drug, glibenclamide. The glucose level of the rats was measured daily, and the weight of the animal was monitored on a weekly basis for 21 days. The oral glucose tolerance test (OGTT) was performed at 0, 30, 60, 90 and 120 minutes, and the histopathologies of the liver, kidneys, and pancreas were investigated. Phytochemical analysis of P. americana seed extracts indicated the presence of glycosides, tannins, saponins, carbohydrates, flavonoids, and alkaloids. The results showed that the extract possessed a significant hypoglycaemic (P < 0.05) effect and reversed the histopathological damage that occurred in alloxan-induced diabetic rats, comparable to the effects glibenclamide. The seeds of P. americana also had anti-diabetic and protective effects on some rat tissues such as the pancreas, kidneys, and liver. In conclusion, the present study provides a pharmacological basis for the folkloric use of the hot-water extract of P. americana seeds in the management of diabetes mellitus.

Mechanistic Study on Triptorelin Action in Protecting From 5-FU-Induced Ovarian Damage in Rats.

PubMed

Wang, Ying; Tian, Xiaoyu; Liang, Lingxia; Wang, Yan; Wang, Ruifang; Cheng, Xiaolin; Yan, Zhen; Chen, Yawei; Qi, Pengwei

2014-01-01

Triptorelin, a kind of GnRH agonist, is widely used in the treatment of hormone-responsive cancers in the clinic. This study aimed to discover the underlying mechanism of triptorelin in protection from 5-fluorouracil (5-FU)-induced ovarian damage in Sprague-Dawley rats. In the present study, after using 5-FU to induce ovarian damage in rats, body weight and wet ovaries were weighed, the levels of estradiol (E2), follicle-stimulating hormone (FSH), and anti-Müllerian hormone (AMH) in blood were detected, and the expression of Bcl-2, Bax, and NF-κB was determined. It suggested that, compared to the control, body weight gain, the ratio of ovarian wet weight to body weight, primary follicle numbers, and the levels of AMH were significantly decreased, while the concentration of E2 and FSH was heavily increased following 5-FU administration. In contrast, after coadministration of triptorelin with 5-FU, the ratio of ovarian wet weight to body weight and the levels of AMH were significantly increased, whereas the level of E2 and FSH was decreased significantly when compared with the 5-FU group. Furthermore, at indicated times, 5-FU led to the reduced Bcl-2 and NF-κB expression and increased Bax expression while triptorelin plus 5-FU increased Bcl-2 and NF-κB expression and decreased Bax expression. It was indicated that triptorelin could protect rats from 5-FU-induced ovarian damage by modulation of hormones, Bcl-2, Bax, and NF-κB. These results might highlight the mechanism of triptorelin as a protective agent in clinical chemotherapy for ovarian damage.

Isoflurane produces sustained cardiac protection after ischemia-reperfusion injury in mice.

PubMed

Tsutsumi, Yasuo M; Patel, Hemal H; Lai, N Chin; Takahashi, Toshiyuki; Head, Brian P; Roth, David M

2006-03-01

Isoflurane reduces myocardial ischemia-reperfusion injury within hours to days of reperfusion. Whether isoflurane produces sustained cardiac protection has never been examined. The authors studied isoflurane-induced cardiac protection in the intact mouse after 2 h and 2 weeks of reperfusion and determined the dependence of this protection on adenosine triphosphate-dependent potassium channels and the relevance of this protection to myocardial function and apoptosis. Mice were randomly assigned to receive oxygen or isoflurane for 30 min with 15 min of washout. Some mice received mitochondrial (5-hydroxydecanoic acid) or sarcolemmal (HMR-1098) adenosine triphosphate-dependent potassium channel blockers with or without isoflurane. Mice were then subjected to a 30-min coronary artery occlusion followed by 2 h or 2 weeks of reperfusion. Infarct size was determined at 2 h and 2 weeks of reperfusion. Cardiac function and apoptosis were determined 2 weeks after reperfusion. Isoflurane did not change hemodynamics. Isoflurane reduced infarct size after reperfusion when compared with the control groups (27.7 +/- 6.3 vs. 41.7 +/- 6.4% at 2 h and 19.6 +/- 5.9 vs. 28.8 +/- 9.0% at 2 weeks). Previous administration of 5-hydroxydecanoic acid, but not HMR-1098, abolished isoflurane-induced cardiac protection. At 2 weeks, left ventricular end-diastolic diameter was decreased significantly and end-systolic pressure and maximum and minimum dP/dt were improved by isoflurane. Isoflurane-treated mice subjected to ischemia and 2 weeks of reperfusion showed less expression of proapoptotic genes, significantly decreased expression of cleaved caspase-3, and significantly decreased deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end labeling-positive nuclei compared with the control group. Cardiac protection induced by isoflurane against necrotic and apoptotic cell death is associated with an acute memory period that is sustained and functionally relevant 2 weeks after ischemia-reperfusion injury in mice in vivo.

Citrus bergamia Risso & Poiteau juice protects against renal injury of diet-induced hypercholesterolemia in rats.

PubMed

Trovato, Ada; Taviano, Maria F; Pergolizzi, Simona; Campolo, Loredana; De Pasquale, Rita; Miceli, Natalizia

2010-04-01

The present study was designed to evaluate the protective effect of treatment with Citrus bergamia juice (1 mL/day, for 30 days) against hypercholesterolemic diet-induced renal injury in rat.C. bergamia juice provoked a significant reduction in the plasma levels of cholesterol, triglycerides and LDL, and an increase in HDL levels, versus hyperlipidemic controls (p < 0.05). Plasma creatinine levels, measured to assess renal glomerular function, did not change compared with hyperlipidemic controls (0.37 +/- 0.11 mg/dL and 0.32 +/- 0.10 mg/dL, respectively). Moreover, in vivo lipid peroxidation was measured in kidney homogenate; C. bergamia juice administration significantly decreased MDA levels elevations compared with hyperlipidemic controls (4.10 +/- 0.10 nmol/mg protein and 4.78 +/- 0.15 nmol/mg protein, respectively).Histological observations of the kidney supported the biochemical data and indicated a protective effect of C. bergamia juice on the development of renal damage in hypercholesterolemic rats.The antioxidant potential of C. bergamia juice was examined in two in vitro systems: in the DPPH test the juice showed a noticeable effect on scavenging free radicals (IC(50) = 25.01 +/- 0.70 +/-L); in the reducing power assay it showed a strong activity, too (1.44 +/- 0.01 ASE/mL).These findings suggest that C. bergamia juice has a protective role in hypercholesterolemic diet-induced renal damage, which may be attributed to its antioxidant properties. Copyright (c) 2009 John Wiley & Sons, Ltd.

Immunogenicity and protective efficacy of the Mycobacterium tuberculosis fadD26 mutant

PubMed Central

Infante, E; Aguilar, L D; Gicquel, B; Pando, R Hernandez

2005-01-01

The Mycobacterium tuberculosis fadD26 mutant has impaired synthesis of phthiocerol dimycocerosates (DIM) and is attenuated in BALB/c mice. Survival analysis following direct intratracheal infection confirmed the attenuation: 60% survival at 4 months post-infection versus 100% mortality at 9 weeks post-infection with the wild-type strain. The fadD26 mutant induced less pneumonia and larger DTH reactions. It induced lower but progressive production of interferon (IFN)-γ, interleukin (IL)-4 and tumour necrosis factor (TNF)-α. Used as a subcutaneous vaccine 60 days before intratracheal challenge with a hypervirulent strain of M. tuberculosis (Beijing code 9501000), the mutant induced a higher level of protection than did Bacille Calmette–Guérin (BCG). Seventy per cent of the mice vaccinated with the fadD26 mutant survived at 16 weeks after challenge compared to 30% of those vaccinated with BCG. Similarly, there was less tissue damage (pneumonia) and lower colony-forming units (CFU) in the mice vaccinated with the fadD26 mutant compared to the findings in mice vaccinated with BCG. These data suggest that DIM synthesis is important for the pathogenicity of M. tuberculosis, and that inactivation of DIM synthesis can increase the immunogenicity of live vaccines, and increase their ability to protect against tuberculosis. PMID:15958066

Protective effects of hydroxytyrosol on gentamicin induced nephrotoxicity in mice.

PubMed

Chashmi, Nooshin Ahmadian; Emadi, Sarvenaz; Khastar, Hossein

2017-01-22

Gentamicin (GM) is an effective and common antibiotic against severe gram-negative infections. However, its nephrotoxic action has limited the extent of its use. The aim of this study was to investigate the protective effects of hydroxytyrosol (HT) on gentamicin induced nephrotoxicity in mice. Male mice (n = 27) were randomly assigned to three groups: (1) Sham, (2) GM (100 mg/kg for 7 days) (3) GM + HT (2 mg/kg BW; gastric gavages, for 7 days). 24-h urine samples were collected on day 8 and then animal were anesthetized. The blood and kidney tissue samples were collected. Gentamicin led to increase in plasma BUN and creatinine, fractional excretion of sodium and potassium and decrease in creatinine clearance and urine flow rate. SOD and GSH levels were reduced and MDA was increased in the GM group compared with the sham group. In GM + HT group, plasma BUN and creatinine, fractional excretion of Na, creatinine clearance and urine flow rate were decreased in contrast to GM group. Increase in SOD and GSH activity and decrease in MDA compared to GM group were seen. Findings suggest that HT partly protected the kidneys from gentamicin induced nephrotoxicity and it is partly due to antioxidant effect of HT. Copyright © 2016 Elsevier Inc. All rights reserved.

High Glutathione and Glutathione Peroxidase-2 Levels Mediate Cell-Type-Specific DNA Damage Protection in Human Induced Pluripotent Stem Cells

PubMed Central

Dannenmann, Benjamin; Lehle, Simon; Hildebrand, Dominic G.; Kübler, Ayline; Grondona, Paula; Schmid, Vera; Holzer, Katharina; Fröschl, Mirjam; Essmann, Frank; Rothfuss, Oliver; Schulze-Osthoff, Klaus

2015-01-01

Summary Pluripotent stem cells must strictly maintain genomic integrity to prevent transmission of mutations. In human induced pluripotent stem cells (iPSCs), we found that genome surveillance is achieved via two ways, namely, a hypersensitivity to apoptosis and a very low accumulation of DNA lesions. The low apoptosis threshold was mediated by constitutive p53 expression and a marked upregulation of proapoptotic p53 target genes of the BCL-2 family, ensuring the efficient iPSC removal upon genotoxic insults. Intriguingly, despite the elevated apoptosis sensitivity, both mitochondrial and nuclear DNA lesions induced by genotoxins were less frequent in iPSCs compared to fibroblasts. Gene profiling identified that mRNA expression of several antioxidant proteins was considerably upregulated in iPSCs. Knockdown of glutathione peroxidase-2 and depletion of glutathione impaired protection against DNA lesions. Thus, iPSCs ensure genomic integrity through enhanced apoptosis induction and increased antioxidant defense, contributing to protection against DNA damage. PMID:25937369

Protection from SARS coronavirus conferred by live measles vaccine expressing the spike glycoprotein.

PubMed

Escriou, Nicolas; Callendret, Benoît; Lorin, Valérie; Combredet, Chantal; Marianneau, Philippe; Février, Michèle; Tangy, Frédéric

2014-03-01

The recent identification of a novel human coronavirus responsible of a SARS-like illness in the Middle-East a decade after the SARS pandemic, demonstrates that reemergence of a SARS-like coronavirus from an animal reservoir remains a credible threat. Because SARS is contracted by aerosolized contamination of the respiratory tract, a vaccine inducing mucosal long-term protection would be an asset to control new epidemics. To this aim, we generated live attenuated recombinant measles vaccine (MV) candidates expressing either the membrane-anchored SARS-CoV spike (S) protein or its secreted soluble ectodomain (Ssol). In mice susceptible to measles virus, recombinant MV expressing the anchored full-length S induced the highest titers of neutralizing antibodies and fully protected immunized animals from intranasal infectious challenge with SARS-CoV. As compared to immunization with adjuvanted recombinant Ssol protein, recombinant MV induced stronger and Th1-biased responses, a hallmark of live attenuated viruses and a highly desirable feature for an antiviral vaccine. Copyright © 2014 Elsevier Inc. All rights reserved.

Protective effect of ferulic acid on cisplatin induced nephrotoxicity in rats.

PubMed

Bami, Erliasa; Ozakpınar, Ozlem Bingol; Ozdemir-Kumral, Zarife Nigar; Köroglu, Kutay; Ercan, Feriha; Cirakli, Zeynep; Sekerler, Turgut; Izzettin, Fikret Vehbi; Sancar, Mesut; Okuyan, Betul

2017-09-01

This study aims to determine the potential protective effects of ferulic acid against cisplatin-induced nephrotoxicity and to compare its effect with curcumin, a well-known protective agent against cisplatin- induced toxicity in rats. Administration of cisplatin resulted in high BUN (Blood Urea Nitrogen), creatinine, MDA (Malondialdehyde), MPO (Myeloperoxidase), TOS (Total Oxidative Status), PtNT (Protein Nitrotyrosine) levels (p<0.05). Histological observations showed abnormal morphology of kidney; in addition with appearance of TUNEL positive cells indicating apoptosis in cisplatin administered group. HO-1 (Heme Oxygenase-1) levels measured by RT-PCR (Real Time Polymerase Chain Reaction), and TAS (Total Antioxidative Status) revealed antioxidant depletion due to cisplatin toxicity in animals (p<0.05). All parameters showed improvement in groups treated with ferulic acid (p<0.05). Ferulic acid treatment was found significant in preventing oxidative stress, increasing antioxidative status and regaining histological parameters to normal, indicating nephroprotective and antioxidant effects of this phenolic compound. Copyright © 2017 Elsevier B.V. All rights reserved.

Induced resistance to infection of lobsters Homarus americanus by Aerococcus viridans (var.) homari, the bacterium causing gaffkemia.

PubMed

Stewart, James E; Arie, B; Marks, L J

2004-12-13

A vaccine composed of steam sterilized (autoclaved) cells of a virulent strain of Aerococcus viridans (var.) homari was effective in protecting lobsters Homarus americanus against gaffkemia. At 15 degrees C the heat-killed vaccines (HKV) at concentrations between 1 and 5 x 10(7) particles kg(-1) lobster body wt induced maximal protection in induction periods ranging from 7 to 11 d. Protection was substantial over the course of a 30 d post-induction trial period. Spring-caught lobsters (i.e. those more fully rehabilitated following ecdysis) gained more protection (LD50 = 1.9 x 10(4)) from the vaccination than did those caught in the late fall-early winter period (lobsters that were not yet fully recovered from ecdysis) (LD50 = 3.2 x 10(3)). The protection offered by the HK vaccine was comparable to that induced by a vaccine produced by incubating the pathogen with low concentrations (2 pg ml(-1)) of the antibiotic vancomycin. The bacterins produced by both methods exhibited similar new properties: (1) agglutination at low titres by lobster hemolymph serum, suggesting an impaired capsule layer, and (2) increased permeability to the large Alcian Blue molecule. With both vaccines, the protection may be a direct result of increased exposure to intact bacterial cell structures by the lobster defences, an exposure which otherwise would be prevented by an intact capsule.

The volatile anesthetic isoflurane induces ecto-5′-nucleotidase (CD73) to protect against renal ischemia and reperfusion injury

PubMed Central

Kim, Mihwa; Ham, Ahrom; Kim, Joo Yun; Brown, Kevin M.; D’Agati, Vivette D.; Lee, H. Thomas

2013-01-01

The volatile anesthetic isoflurane protects against renal ischemia and reperfusion injury by releasing renal tubular TGF-β1. Since adenosine is a powerful cytoprotective molecule, we tested whether TGF-β1 generated by isoflurane induces renal tubular ecto-5′-nucleotidase (CD73) and adenosine to protect against renal ischemia and reperfusion injury. Isoflurane induced new CD73 synthesis and increased adenosine generation in cultured kidney proximal tubule cells and in mouse kidney. Moreover, a TGF-β1 neutralizing antibody prevented isoflurane-mediated induction of CD73 activity. Mice anesthetized with isoflurane after renal ischemia and reperfusion had significantly reduced plasma creatinine and decreased renal tubular necrosis, neutrophil infiltration and apoptosis compared to pentobarbital-anesthetized mice. Isoflurane failed to protect against renal ischemia and reperfusion injury in CD73 deficient mice, in mice pretreated with a selective CD73 inhibitor or mice treated with an adenosine receptor antagonist. The TGF-β1 neutralizing antibody or the CD73 inhibitor attenuated isoflurane-mediated protection against HK-2 cell apoptosis. Thus, isoflurane causes TGF-β1-dependent induction of renal tubular CD73 and adenosine generation to protect against renal ischemia and reperfusion injury. Modulation of this pathway may have important therapeutic implications to reduce morbidity and mortality arising from ischemic acute kidney injury. PMID:23423261

The protective effects of naringin against 5-fluorouracil-induced hepatotoxicity and nephrotoxicity in rats.

PubMed

Gelen, Volkan; Şengül, Emin; Yıldırım, Serkan; Atila, Gözde

2018-04-01

5-fluorouracil-induced (5-FU), an anticarcinogenic agent, is reported to have side-effects that include hepatotoxicity and nephrotoxicity. The study objective was to investigate the protective effects of naringin on 5-FU-induced hepatotoxicity and nephrotoxicity. Thirty rodents were assigned to three groups. The control group received 1 ml of intragastric distilled water for 14 days. The 5-FU group received 1 ml of distilled water for 14 days as a placebo. On day 9, this same group received a 20 mg/kg dose of 5-FU administered intraperitoneally(IP) for a further five days. The naringin+5-FU group received a 100 mg/kg dose of naringin (IP) for 14 days. On day 9, 20 mg/kg of 5-FU was administered (IP) to this group for a further five days. On day 15, the rats were decapitated, and blood and renal and hepatic tissues were taken. It was determined that serum creatinine, BUN, AST, ALT, ALP, and LDH levels, as well as cytokine levels in the liver and kidney tissues were significantly elevated in the 5-FU group, compared to the control group. The comparative values were similar in the control and naringin+5-FU groups. When the liver tissue was examined histopathologically, in the control group it was found to be normal in structure. However, necrosis was observed in the hepatocytes of the pericentric region in the 5-FU group. 8-OHdG cell density was significantly elevated in the 5-FU group, compared to the control and naringin+5-FU groups. Naringin was observed to have a protective effect on 5-FU-induced liver and kidney damage.

The protective effects of naringin against 5-fluorouracil-induced hepatotoxicity and nephrotoxicity in rats

PubMed Central

Gelen, Volkan; Şengül, Emin; Yıldırım, Serkan; Atila, Gözde

2018-01-01

Objective(s): 5-fluorouracil-induced (5-FU), an anticarcinogenic agent, is reported to have side-effects that include hepatotoxicity and nephrotoxicity. The study objective was to investigate the protective effects of naringin on 5-FU-induced hepatotoxicity and nephrotoxicity. Materials and Methods: Thirty rodents were assigned to three groups. The control group received 1 ml of intragastric distilled water for 14 days. The 5-FU group received 1 ml of distilled water for 14 days as a placebo. On day 9, this same group received a 20 mg/kg dose of 5-FU administered intraperitoneally(IP) for a further five days. The naringin+5-FU group received a 100 mg/kg dose of naringin (IP) for 14 days. On day 9, 20 mg/kg of 5-FU was administered (IP) to this group for a further five days. On day 15, the rats were decapitated, and blood and renal and hepatic tissues were taken. Results: It was determined that serum creatinine, BUN, AST, ALT, ALP, and LDH levels, as well as cytokine levels in the liver and kidney tissues were significantly elevated in the 5-FU group, compared to the control group. The comparative values were similar in the control and naringin+5-FU groups. When the liver tissue was examined histopathologically, in the control group it was found to be normal in structure. However, necrosis was observed in the hepatocytes of the pericentric region in the 5-FU group. 8-OHdG cell density was significantly elevated in the 5-FU group, compared to the control and naringin+5-FU groups. Conclusion: Naringin was observed to have a protective effect on 5-FU-induced liver and kidney damage. PMID:29796225

Adjuvanting a Simian Immunodeficiency Virus Vaccine with Toll-Like Receptor Ligands Encapsulated in Nanoparticles Induces Persistent Antibody Responses and Enhanced Protection in TRIM5α Restrictive Macaques.

PubMed

Kasturi, Sudhir Pai; Kozlowski, Pamela A; Nakaya, Helder I; Burger, Matheus C; Russo, Pedro; Pham, Mathew; Kovalenkov, Yevgeniy; Silveira, Eduardo L V; Havenar-Daughton, Colin; Burton, Samantha L; Kilgore, Katie M; Johnson, Mathew J; Nabi, Rafiq; Legere, Traci; Sher, Zarpheen Jinnah; Chen, Xuemin; Amara, Rama R; Hunter, Eric; Bosinger, Steven E; Spearman, Paul; Crotty, Shane; Villinger, Francois; Derdeyn, Cynthia A; Wrammert, Jens; Pulendran, Bali

2017-02-15

Our previous work has shown that antigens adjuvanted with ligands specific for Toll-like receptor 4 (TLR4) and TLR7/8 encapsulated in poly(lactic-co-glycolic) acid (PLGA)-based nanoparticles (NPs) induce robust and durable immune responses in mice and macaques. We investigated the efficacy of these NP adjuvants in inducing protective immunity against simian immunodeficiency virus (SIV). Rhesus macaques (RMs) were immunized with NPs containing TLR4 and TLR7/8 agonists mixed with soluble recombinant SIVmac239-derived envelope (Env) gp140 and Gag p55 (protein) or with virus-like particles (VLPs) containing SIVmac239 Env and Gag. NP-adjuvanted vaccines induced robust innate responses, antigen-specific antibody responses of a greater magnitude and persistence, and enhanced plasmablast responses compared to those achieved with alum-adjuvanted vaccines. NP-adjuvanted vaccines induced antigen-specific, long-lived plasma cells (LLPCs), which persisted in the bone marrow for several months after vaccination. NP-adjuvanted vaccines induced immune responses that were associated with enhanced protection against repeated low-dose, intravaginal challenges with heterologous SIVsmE660 in animals that carried TRIM5α restrictive alleles. The protection induced by immunization with protein-NP correlated with the prechallenge titers of Env-specific IgG antibodies in serum and vaginal secretions. However, no such correlate was apparent for immunization with VLP-NP or alum as the adjuvant. Transcriptional profiling of peripheral blood mononuclear cells isolated within the first few hours to days after primary vaccination revealed that NP-adjuvanted vaccines induced a molecular signature similar to that induced by the live attenuated yellow fever viral vaccine. This systems approach identified early blood transcriptional signatures that correlate with Env-specific antibody responses in vaginal secretions and protection against infection. These results demonstrate the adjuvanticity of the NP adjuvant in inducing persistent and protective antibody responses against SIV in RMs with implications for the design of vaccines against human immunodeficiency virus (HIV). The results of the RV144 HIV vaccine trial, which demonstrated a rapid waning of protective immunity with time, have underscored the need to develop strategies to enhance the durability of protective immune responses. Our recent work in mice has highlighted the capacity of nanoparticle-encapsulated TLR ligands (NP) to induce potent and durable antibody responses that last a lifetime in mice. In the present study, we evaluated the ability of these NP adjuvants to promote robust and durable protective immune responses against SIV in nonhuman primates. Our results demonstrate that immunization of rhesus macaques with NP adjuvants mixed with soluble SIV Env or a virus-like particle form of Env (VLP) induces potent and durable Env-specific antibody responses in the serum and in vaginal secretions. These responses were superior to those induced by alum adjuvant, and they resulted in enhanced protection against a low-dose intravaginal challenge with a heterologous strain of SIV in animals with TRIM5a restrictive alleles. These results highlight the potential for such NP TLR L adjuvants in promoting robust and durable antibody responses against HIV in the next generation of HIV immunogens currently being developed. Copyright © 2017 American Society for Microbiology.

Cinnamon extract ameliorates ionizing radiation-induced cellular injury in rats.

PubMed

Azab, Khaled Sh; Mostafa, Abdel-Halem A; Ali, Ehab M M; Abdel-Aziz, Mohamed A S

2011-11-01

The present study aimed to investigate the protective role of cinnamon extract against inflammatory and oxidative injuries in gamma irradiated rats. Rats were subjected to fractionated doses of gamma radiation. Cinnamon extract were daily administrated before starting irradiation and continued after radiation exposure. The results obtained revealed that the administration of cinnamon extract to irradiated rats significantly ameliorated the changes induced in liver antioxidant system; catalase, superoxide dismutase and glutathione peroxidase activities as well as reduced glutathione concentration. The liver's lipid peroxidation and protein oxidation indices were significantly decreased when compared with their equivalent values in irradiated rats. Furthermore, the changes induces in xanthine oxidoreductase system were significantly diminished. In addition, the changes in liver nitric oxide contents, serum tumor necrosis factor alpha and C-reactive protein levels were markedly improved. In conclusion, the administration of cinnamon extract might provide substantial protection against radiation-induced oxidative and inflammatory damages. Copyright © 2011 Elsevier Inc. All rights reserved.

DNA Vaccines - A Modern Gimmick or a Boon to Vaccinology?

PubMed

Manickan, Elanchezhiyan; Karem, Kevin L; Rouse, Barry T

2017-01-01

The reports in 1993 that naked DNA encoding viral genes conferred protective immunity came as a surprise to most vaccinologists. This review analyses the expanding number of examples where plasmid DNA induces immune responses. Issues such as the type of immunity induced, mechanisms of immune protection, and how DNA vaccines compare with other approaches are emphasized. Additional issues discussed include the likely means by which DNA vaccines induce CTL, how the potency and type of immunity induced can be modified, and whether DNA vaccines represent a practical means of manipulating unwanted immune response occurring during immunoinflammatory diseases. It seems doubtful if DNA vaccines will replace currently effective vaccines, but they may prove useful for prophylactic use against some agents that at present lack an effective vaccine. DNA vaccines promise to be valuable to manipulate the immune response in situations where responses to agents are inappropriate or ineffective.

Radio-protective effect of cinnamic acid, a phenolic phytochemical, on genomic instability induced by X-rays in human blood lymphocytes in vitro.

PubMed

Cinkilic, Nilufer; Tüzün, Ece; Çetintaş, Sibel Kahraman; Vatan, Özgür; Yılmaz, Dilek; Çavaş, Tolga; Tunç, Sema; Özkan, Lütfi; Bilaloğlu, Rahmi

2014-08-01

The present study was designed to determine the protective activity of cinnamic acid against induction by X-rays of genomic instability in normal human blood lymphocytes. This radio-protective activity was assessed by use of the cytokinesis-block micronucleus test and the alkaline comet assay, with human blood lymphocytes isolated from two healthy donors. A Siemens Mevatron MD2 (Siemens AG, USA, 1994) linear accelerator was used for the irradiation with 1 or 2 Gy. Treatment of the lymphocytes with cinnamic acid prior to irradiation reduced the number of micronuclei when compared with that in control samples. Treatment with cinnamic acid without irradiation did not increase the number of micronuclei and did not show a cytostatic effect in the lymphocytes. The results of the alkaline comet assay revealed that cinnamic acid reduces the DNA damage induced by X-rays, showing a significant radio-protective effect. Cinnamic acid decreased the frequency of irradiation-induced micronuclei by 16-55% and reduced DNA breakage by 17-50%, as determined by the alkaline comet assay. Cinnamic acid may thus act as a radio-protective compound, and future studies may focus on elucidating the mechanism by which cinnamic acid offers radioprotection. Copyright © 2014 Elsevier B.V. All rights reserved.

Protective Effects of Thymoquinone and Melatonin on Intestinal Ischemia–reperfusion Injury

PubMed Central

Tas, Ufuk; Ayan, Murat; Sogut, Erkan; Kuloglu, Tuncay; Uysal, Murat; Tanriverdi, Halil I.; Senel, Ufuk; Ozyurt, Birsen; Sarsilmaz, Mustafa

2015-01-01

Background/Aim: In the present study, we aimed to compare the potential protective effects of thymoquinone and melatonin by using equivalent dose, on oxidative stress-induced ischemia–reperfusion (IR) injury in the intestinal tissue of rats. Materials and Methods: The study was performed using 32 male Wistar–Albino rats (weighing 180–200 g) randomly divided into four groups: Group I, sham group; Group II, IR group; Group III, IR with melatonin group; and Group IV, IR with thymoquinone group. After laparotomy, ischemia and reperfusion were performed for 60 and 120 min, respectively, on all the groups. Intestinal tissue sections were stained using routine histological methods and examined under the light microscope. In addition, the sections were immunohistochemically stained using the TUNEL method for determination of apoptosis. Superoxide dismutase (SOD) activity, glutathione peroxidase (GSH-Px) activity, and malondialdehyde (MDA) levels in the intestinal tissue were also measured. Results: The IR group had significantly elevated tissue SOD activity, GSH-Px activity, and MDA levels compared with the sham group. Administration of thymoquinone and melatonin efficiently reduced these increases. Statistically significant number of apoptotic cells was observed in the intestinal tissue of IR group rats compared with the sham group. Treatment with thymoquinone and melatonin markedly reduced the number of apoptotic cells. Conclusion The effects of melatonin and thymoquinone on IR-induced oxidative stress in rat intestines were similar. Our findings suggest that melatonin and thymoquinone protect against IR-induced injury to intestinal tissues. PMID:26458854

Effects of neuroactive steroids on cochlear hair cell death induced by gentamicin.

PubMed

Nakamagoe, Mariko; Tabuchi, Keiji; Nishimura, Bungo; Hara, Akira

2011-12-11

As neuroactive steroids, sex steroid hormones have non-reproductive effects. We previously reported that 17β-estradiol (βE2) had protective effects against gentamicin (GM) ototoxicity in the cochlea. In the present study, we examined whether the protective action of βE2 on GM ototoxicity is mediated by the estrogen receptor (ER) and whether other estrogens (17α-estradiol (αE2), estrone (E1), and estriol (E3)) and other neuroactive steroids, dehydroepiandrosterone (DHEA) and progesterone (P), have similar protective effects. The basal turn of the organ of Corti was dissected from Sprague-Dawley rats and cultured in a medium containing 100 μM GM for 48h. The effects of βE2 and ICI 182,780, a selective ER antagonist, were examined. In addition, the effects of other estrogens, DHEA and P were tested using this culture system. Loss of outer hair cells induced by GM exposure was compared among groups. βE2 exhibited a protective effect against GM ototoxicity, but its protective effect was antagonized by ICI 182,780. αE2, E1, and E3 also protected hair cells against gentamicin ototoxicity. DHEA showed a protective effect; however, the addition of ICI 182,780 did not affect hair cell loss. P did not have any effect on GM-induced outer hair cell death. The present findings suggest that estrogens and DHEA are protective agents against GM ototoxicity. The results of the ER antagonist study also suggest that the protective action of βE2 is mediated via ER but that of DHEA is not related to its conversion to estrogen and binding to ER. Further studies on neuroactive steroids may lead to new insights regarding cochlear protection. Copyright © 2011 Elsevier Inc. All rights reserved.

Possible involvement of GABAergic mechanism in protective effect of melatonin against sleep deprivation-induced behaviour modification and oxidative damage in mice.

PubMed

Kumar, Anil; Singh, Anant

2009-08-01

Sleep is an important physiological process responsible for the maintenance of physical, mental and emotional health of a living being. Sleep deprivation is considered risky for several pathological diseases such as anxiety and motor and cognitive dysfunctions. Sleep deprivation has recently been reported to cause oxidative damage. This study has been designed to explore the possible involvement of the GABAergic mechanism in protective effects of melatonin against 72-h sleep deprivation-induced behaviour modification and oxidative damage in mice. Mice were sleep-deprived for a period of 72 h using the grid over water suspended method. Animals were divided into groups of 6-8 animals each. Melatonin (5 and 10 mg/kg), flumazenil (0.5 mg/kg), picrotoxin (0.5 mg/kg) and muscimol (0.05 mg/kg) were administered for 5 days starting 2 days before 72-h sleep deprivation. Various behavioural tests (plus maze, zero maze, mirror chamber, actophotometer) and body weight assessment followed by oxidative stress parameters (malondialdehyde level, glutathione, catalase, nitrite and protein) were carried out. The 72-h sleep deprivation caused significant anxiety-like behaviour, weight loss, impaired locomotor activity and oxidative damage as compared with naïve (without sleep deprivation). Treatment with melatonin (5 mg/kg and 10 mg/kg, ip) significantly improved locomotor activity, weight loss and antianxiety effect as compared with control (sleep-deprived). Biochemically, melatonin treatment significantly restored reduced glutathione, catalase activity, attenuated lipid peroxidation and nitrite level as compared with control animals (72-h sleep-deprived). Flumazenil (0.5 mg/kg) and picrotoxin (0.5 mg/kg) pretreatments with a lower dose of melatonin (5 mg/kg) significantly antagonized the protective effect of melatonin. However, muscimol (0.05 mg/kg) pretreatment with melatonin (5 mg/kg, ip) potentiated the protective effect of melatonin which was significant as compared with their effect per se. This study suggests that GABAergic modulation is involved in the protective action of melatonin against sleep deprivation-induced anxiety-like behaviour and associated oxidative damage.

Progesterone protects normative anxiety-like responding among ovariectomized female mice that conditionally express the HIV-1 regulatory protein, Tat, in the CNS.

PubMed

Paris, Jason J; Fenwick, Jason; McLaughlin, Jay P

2014-05-01

Increased anxiety is co-morbid with human immunodeficiency virus (HIV) infection. Actions of the neurotoxic HIV-1 regulatory protein, Tat, may contribute to affective dysfunction. We hypothesized that Tat expression would increase anxiety-like behavior of female GT-tg bigenic mice that express HIV-1 Tat protein in the brain in a doxycycline-dependent manner. Furthermore, given reports that HIV-induced anxiety may occur at lower rates among women, and that the neurotoxic effects of Tat are ameliorated by sex steroids in vitro, we hypothesized that 17β-estradiol and/or progesterone would ameliorate Tat-induced anxiety-like effects. Among naturally-cycling proestrous and diestrous mice, Tat-induction via 7days of doxycycline treatment significantly increased anxiety-like responding in an open field, elevated plus maze and a marble-burying task, compared to treatment with saline. Proestrous mice demonstrated less anxiety-like behavior than diestrous mice in the open field and elevated plus maze, but these effects did not significantly interact with Tat-induction. Among ovariectomized mice, doxycycline-induced Tat protein significantly increased anxiety-like behavior in an elevated plus maze and a marble burying task compared to saline-treated mice, but not an open field (where anxiety-like responding was already maximal). Co-administration of progesterone (4mg/kg), but not 17β-estradiol (0.09mg/kg), with doxycycline significantly ameliorated anxiety-like responding in the elevated plus maze and marble burying tasks. When administered together, 17β-estradiol partially antagonized the protective effects of progesterone on Tat-induced anxiety-like behavior. These findings support evidence of steroid-protection over HIV-1 proteins, and extend them by demonstrating the protective capacity of progesterone on Tat-induced anxiety-like behavior of ovariectomized female mice. Copyright © 2014 Elsevier Inc. All rights reserved.

Gemfibrozil pretreatment proved protection against acute restraint stress-induced changes in the male rats' hippocampus.

PubMed

Khalaj, Leila; Nejad, Sara Chavoshi; Mohammadi, Marzieh; Zadeh, Sadaf Sarraf; Pour, Marieh Hossein; Ahmadiani, Abolhassan; Khodagholi, Fariba; Ashabi, Ghorbangol; Alamdary, Shabnam Zeighamy; Samami, Elham

2013-08-21

Stress predisposes the brain to various neuropathological disorders. Fibrates like gemfibrozil, commonly used for hyperlipidemia, have not yet been examined for their protective/deteriorative potential against restraint stress-induced disturbances. Pretreatment of rats with a range of gemfibrozil concentrations showed significant protection against stress consequences at 90 mg/kg of gemfibrozil, as it resulted in the highest level of antioxidant defense system potentiation among other doses. It also reduced plasma corticosterone compared with the stressed animals. Administration of gemfibrozil (90 mg/kg) before stress induction was able to significantly induce the protein levels of some protective factors including hemeoxygenase-1 (HO-1) and NAD(P)H dehydrogenase quinone-1 (NQO-1) in the antioxidant nuclear factor erythroid-derived 2-like 2 (Nrf-2) pathway, as well as mitochondrial pro-survival proteins, including peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) and nuclear respiratory factor 1 (NRF-1). In parallel, the level of cleaved caspase-3 and apoptosis-inducing factor (AIF), two proteins involved in apoptotic cell death, and the number of damaged neurons detected in hematoxylin-eosin (H&E) stained hippocampus sections were suppressed in the presence of gemfibrozil. Herein, although gemfibrozil demonstrated protection against the restraint stress, considering its dose and context-dependent effects reported in the previous studies, as well as its common application in clinic, further investigations are essential to unravel its exact beneficial/deleterious effects in various neuronal contexts. Copyright © 2013 Elsevier B.V. All rights reserved.

Antioxidant and protective effect of inulin and catechin grafted inulin against CCl4-induced liver injury.

PubMed

Liu, Jun; Lu, Jian-feng; Wen, Xiao-yuan; Kan, Juan; Jin, Chang-hai

2015-01-01

In this study, the antioxidant activity and hepatoprotective effect of inulin and catechin grafted inulin (catechin-g-inulin) against carbon tetrachloride (CCl4)-induced acute liver injury were investigated. Results showed that both inulin and catechin-g-inulin had moderate scavenging activity on superoxide radical, hydroxyl radical and H2O2, as well as lipid peroxidation inhibition effect. The antioxidant activity decreased in the order of Vc > catechin >catechin-g-inulin > inulin. Administration of inulin and catechin-g-inulin could significantly reduce the elevated levels of serum aspartate transaminase, alanine transaminase and alkaline phosphatase as compared to CCl4 treatment group. Moreover, inulin and catechin-g-inulin significantly increased the levels of hepatic superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase, glutathione and total antioxidant capacity, whereas markedly decreased the malondialdehyde level when compared with CCl4 treatment group. Notably, catechin-g-inulin showed higher hepatoprotective effect than inulin. In addition, the hepatoprotective effect of catechin-g-inulin was comparable to positive standard of silymarin. Our results suggested that catechin-g-inulin had potent antioxidant activity and potential protective effect against CCl4-induced acute liver injury. Copyright © 2014 Elsevier B.V. All rights reserved.

Anti-inflammatory and anti-oxidative effects of alpha-lipoic acid in experimentally induced acute otitis media.

PubMed

Tatar, A; Korkmaz, M; Yayla, M; Gozeler, M S; Mutlu, V; Halici, Z; Uslu, H; Korkmaz, H; Selli, J

2016-07-01

To investigate the anti-inflammatory, anti-oxidative and tissue protective effects, as well as the potential therapeutic role, of alpha-lipoic acid in experimentally induced acute otitis media. Twenty-five guinea pigs were assigned to one of five groups: a control (non-otitis) group, and otitis-induced groups treated with saline, penicillin G, alpha-lipoic acid, or alpha-lipoic acid plus penicillin G. Tissue samples were histologically analysed, and oxidative parameters in tissue samples were measured and compared between groups. The epithelial integrity was better preserved, and histological signs of inflammation and secretory metaplasia were decreased, in all groups compared to the saline treated otitis group. In the alpha-lipoic acid plus penicillin G treated otitis group, epithelial integrity was well preserved and histological findings of inflammation were significantly decreased compared to the saline, penicillin G and alpha-lipoic acid treated otitis groups. The most favourable oxidative parameters were observed in the control group, followed by the alpha-lipoic acid plus penicillin G treated otitis group. Alpha-lipoic acid, with its antioxidant, anti-inflammatory and tissue protective properties, may decrease the clinical sequelae and morbidity associated with acute otitis media.

Methamphetamine generates peroxynitrite and produces dopaminergic neurotoxicity in mice: protective effects of peroxynitrite decomposition catalyst.

PubMed

Imam, S Z; Crow, J P; Newport, G D; Islam, F; Slikker, W; Ali, S F

1999-08-07

Methamphetamine (METH)-induced dopaminergic neurotoxicity is believed to be produced by oxidative stress and free radical generation. The present study was undertaken to investigate if METH generates peroxynitrite and produces dopaminergic neurotoxicity. We also investigated if this generation of peroxynitrite can be blocked by a selective peroxynitrite decomposition catalyst, 5, 10,15, 20-tetrakis(N-methyl-4'-pyridyl)porphyrinato iron III (FeTMPyP) and protect against METH-induced dopaminergic neurotoxicity. Administration of METH resulted in the significant formation of 3-nitrotyrosine (3-NT), an in vivo marker of peroxynitrite generation, in the striatum and also caused a significant increase in the body temperature. METH injection also caused a significant decrease in the concentration of dopamine (DA), 3, 4-dihydroxyphenylacetic acid (DOPAC), and homovanillic acid (HVA) by 76%, 53% and 40%, respectively, in the striatum compared with the control group. Treatment with FeTMPyP blocked the formation of 3-NT by 66% when compared with the METH group. FeTMPyP treatment also provided significant protection against the METH-induced hyperthermia and depletion of DA, DOPAC and HVA. Administration of FeTMPyP alone neither resulted in 3-NT formation nor had any significant effect on DA or its metabolite concentrations. These findings indicate that peroxynitrite plays a role in METH-induced dopaminergic neurotoxicity and also suggests that peroxynitrite decomposition catalysts may be beneficial for the management of psychostimulant abuse. Copyright 1999 Published by Elsevier Science B.V.

The neuronal nitric oxide synthase inhibitor, 7-nitroindazole, protects against methamphetamine-induced neurotoxicity in vivo.

PubMed

Itzhak, Y; Ali, S F

1996-10-01

The present study was undertaken to investigate whether the relatively selective neuronal nitric oxide synthase (NOS) inhibitor, 7-nitroindazole (7-NI), protects against methamphetamine (METH)-induced neurotoxicity. Male Swiss Webster mice received the following treatments (i.p.; q 3 h x 3): (a) vehicle/saline, (b) 7-NI (25 mg/kg)/saline, (c) vehicle/METH (5 mg/kg), and (d) 7-NI (25 mg/kg)/METH (5 mg/kg). On the second day, groups (a) and (b) received two vehicle injections, and groups (c) and (d) received two 7-NI injections (25 mg/kg, each). Administration of vehicle/METH resulted in 68, 44, and 55% decreases in the concentration of dopamine, 3,4-dihydroxyphenylacetic acid, and homovanillic acid, respectively, and a 48% decrease in the number of [3H]mazindol binding sites in the striatum compared with control values. Treatment with 7-NI (group d) provided full protection against the depletion of dopamine and its metabolites and the loss of dopamine transporter binding sites. Administration of 7-NI/saline (group b) affected neither the tissue concentration of dopamine and its metabolites nor the binding parameters of [3H] mazindol compared with control values. 7-NI had no significant effect on animals' body temperature, and it did not affect METH-induced hyperthermia. These findings indicate a role for nitric oxide in methamphetamine-induced neurotoxicity and also suggest that blockade of NOS may be beneficial for the management of Parkinson's disease.

Antioxidant activity and protective effect of Clitoria ternatea flower extract on testicular damage induced by ketoconazole in rats.

PubMed

Iamsaard, Sitthichai; Burawat, Jaturon; Kanla, Pipatpong; Arun, Supatcharee; Sukhorum, Wannisa; Sripanidkulchai, Bungorn; Uabundit, Nongnut; Wattathorn, Jintanaporn; Hipkaeo, Wiphawi; Fongmoon, Duriya; Kondo, Hisatake

2014-06-01

Ketoconazole (KET), an antifungal drug, has adverse effects on the male reproductive system. Pre-treatments with antioxidant plant against testicular damage induced by KET are required. The flowers of Clitoria ternatea (CT) are proven to have hepatoprotective potential. However, the protective effect on KET-induced testicular damage has not been reported. To investigate the protective effect of CT flower extracts with antioxidant activity on male reproductive parameters including sperm concentration, serum testosterone level, histopathology of the testis, and testicular tyrosine phosphorylation levels in rats induced with KET. The antioxidant activity of CT flower extracts was determined using 2,2-diphenyl-1-picrylhydrazyl (DPPH) and ferric reducing antioxidant power (FRAP) assays. Male rats were treated with CT flower extracts (10, 50, or 100 mg/kg BW) or distilled water via a gastric tube for 28 d (preventive period: Days 1-21) and induced by KET (100 mg/kg BW) via intraperitoneal injection for 7 d (induction period: Days 22-28). After the experiment, all animals were examined for the weights of the testis, epididymis plus vas deferens and seminal vesicle, serum testosterone levels, sperm concentration, histological structures and diameter of testis, and testicular tyrosine phosphorylation levels by immunoblotting. The CT flower extracts had capabilities for DPPH scavenging and high reducing power. At 100 mg/kg BW, the extract had no toxic effects on the male reproductive system. Significantly, in CT+KET groups, CT flower extracts (50 and 100 mg/kg BW) alleviated the reduction of reproductive organ weight parameters, testosterone levels, and sperm concentration. In addition, CT flower extracts gave protection from testicular damage in KET-induced rats. Moreover, in the CT100+KET group, CT flower extracts significantly enhanced the expression of a testicular 50-kDa tyrosine phosphorylated protein compared with that of other groups. C. ternatea flower extracts possessing antioxidant activity are not harmful to the male reproductive system and can protect against testicular damage in KET-induced rats.

Agmatine protects Müller cells from high-concentration glucose-induced cell damage via N-methyl-D-aspartic acid receptor inhibition

PubMed Central

HAN, NING; YU, LI; SONG, ZHIDU; LUO, LIFU; WU, YAZHEN

2015-01-01

Neural injury is associated with the development of diabetic retinopathy. Müller cells provide structural and metabolic support for retinal neurons. High glucose concentrations are known to induce Müller cell activity. Agmatine is an endogenous polyamine, which is enzymatically formed in the mammalian brain and has exhibited neuroprotective effects in a number of experimental models. The aims of the present study were to investigate whether agmatine protects Müller cells from glucose-induced damage and to explore the mechanisms underlying this process. Lactate dehydrogenase activity and tumor necrosis factor-α mRNA expression were significantly reduced in Müller cells exposed to a high glucose concentration, following agmatine treatment, compared with cells not treated with agmatine. In addition, agmatine treatment inhibited glucose-induced Müller cell apoptosis, which was associated with the regulation of Bax and Bcl-2 expression. Agmatine treatment suppressed glucose-induced phosphorylation of mitogen-activated protein kinase (MAPK) protein in Müller cells. The present study demonstrated that the protective effects of agmatine on Müller cells were inhibited by N-methyl-D-aspartic acid (NMDA). The results of the present study suggested that agmatine treatment protects Müller cells from high-concentration glucose-induced cell damage. The underlying mechanisms may relate to the anti-inflammatory and antiapoptotic effects of agmatine, as well as to the inhibition of the MAPK pathway, via NMDA receptor suppression. Agmatine may be of use in the development of novel therapeutic approaches for patients with diabetic retinopathy. PMID:25816073

Agmatine protects Müller cells from high-concentration glucose-induced cell damage via N-methyl-D-aspartic acid receptor inhibition.

PubMed

Han, Ning; Yu, Li; Song, Zhidu; Luo, Lifu; Wu, Yazhen

2015-07-01

Neural injury is associated with the development of diabetic retinopathy. Müller cells provide structural and metabolic support for retinal neurons. High glucose concentrations are known to induce Müller cell activity. Agmatine is an endogenous polyamine, which is enzymatically formed in the mammalian brain and has exhibited neuroprotective effects in a number of experimental models. The aims of the present study were to investigate whether agmatine protects Müller cells from glucose-induced damage and to explore the mechanisms underlying this process. Lactate dehydrogenase activity and tumor necrosis factor-α mRNA expression were significantly reduced in Müller cells exposed to a high glucose concentration, following agmatine treatment, compared with cells not treated with agmatine. In addition, agmatine treatment inhibited glucose-induced Müller cell apoptosis, which was associated with the regulation of Bax and Bcl-2 expression. Agmatine treatment suppressed glucose-induced phosphorylation of mitogen-activated protein kinase (MAPK) protein in Müller cells. The present study demonstrated that the protective effects of agmatine on Müller cells were inhibited by N-methyl-D-aspartic acid (NMDA). The results of the present study suggested that agmatine treatment protects Müller cells from high-concentration glucose-induced cell damage. The underlying mechanisms may relate to the anti-inflammatory and antiapoptotic effects of agmatine, as well as to the inhibition of the MAPK pathway, via NMDA receptor suppression. Agmatine may be of use in the development of novel therapeutic approaches for patients with diabetic retinopathy.

Moderate acute intake of de-alcoholized red wine, but not alcohol, is protective against radiation-induced DNA damage ex vivo -- results of a comparative in vivo intervention study in younger men.

PubMed

Greenrod, W; Stockley, C S; Burcham, P; Abbey, M; Fenech, M

2005-12-11

Moderate intake of wine is associated with reduced risk of cardiovascular disease and possibly cancer however it remains unclear whether the potential health benefits of wine intake are due to alcohol or the non-alcoholic fraction of wine. We therefore tested the hypothesis that the non-alcoholic fraction of wine protects against genome damage induced by oxidative stress in a crossover intervention study involving six young adult males aged 21-26 years. The participants adhered to a low plant phenolic compound diet for 48 h prior to consuming 300 mL of complete red wine, de-alcoholized red wine or ethanol on separate occasions 1 week apart. Blood samples were collected 0.5, 1.0 and 2.0 h after beverage consumption. Baseline and radiation-induced genome damage was measured using the cytokinesis-block micronucleus assay and total plasma catechin concentration was measured. Consumption of de-alcoholized red wine significantly decreased the gamma radiation-induced DNA damage at 1 and 2 h post-consumption by 20%. In contrast alcohol tended to increase radiation-induced genome damage and complete wine protected against radiation-induced genome damage relative to alcohol. The observed effects were only weakly correlated with the concentration of total plasma catechin (R=-0.23). These preliminary data suggest that only the non-alcoholic fraction of red wine protects DNA from oxidative damage but this effect cannot be explained solely by plasma catechin.

Creatine affords protection against glutamate-induced nitrosative and oxidative stress.

PubMed

Cunha, Mauricio P; Lieberknecht, Vicente; Ramos-Hryb, Ana Belén; Olescowicz, Gislaine; Ludka, Fabiana K; Tasca, Carla I; Gabilan, Nelson H; Rodrigues, Ana Lúcia S

2016-05-01

Creatine has been reported to exert beneficial effects in several neurodegenerative diseases in which glutamatergic excitotoxicity and oxidative stress play an etiological role. The purpose of this study was to investigate the protective effects of creatine, as compared to the N-Methyl-d-Aspartate (NMDA) receptor antagonist dizocilpine (MK-801), against glutamate or hydrogen peroxide (H2O2)-induced injury in human neuroblastoma SH-SY5Y cells. Exposure of cells to glutamate (60-80 mM) or H2O2 (200-300 μM) for 24 h decreased cellular viability and increased dichlorofluorescein (DCF) fluorescence (indicative of increased reactive oxygen species, ROS) and nitric oxide (NO) production (assessed by mono-nitrogen oxides, NOx, levels). Creatine (1-10 mM) or MK-801 (0.1-10 μM) reduced glutamate- and H2O2-induced toxicity. The protective effect of creatine against glutamate-induced toxicity involves its antioxidant effect, since creatine, similar to MK-801, prevented the increase on DCF fluorescence induced by glutamate or H2O2. Furthermore, creatine or MK-801 blocked glutamate- and H2O2-induced increases in NOx levels. In another set of experiments, the repeated, but not acute, administration of creatine (300 mg/kg, po) in mice prevented the decreases on cellular viability and mitochondrial membrane potential (assessed by tetramethylrhodamine ethyl ester, TMRE, probe) of hippocampal slices incubated with glutamate (10 mM). Creatine concentration-dependent decreased the amount of nitrite formed in the reaction of oxygen with NO produced from sodium nitroprusside solution, suggesting that its protective effect against glutamate or H2O2-induced toxicity might be due to its scavenger activity. Overall, the results suggest that creatine may be useful as adjuvant therapy for neurodegenerative disease treatments. Copyright © 2016 Elsevier Ltd. All rights reserved.

In vitro protective effects of an aqueous extract of Clitoria ternatea L. flower against hydrogen peroxide-induced cytotoxicity and UV-induced mtDNA damage in human keratinocytes.

PubMed

Zakaria, N N A; Okello, E J; Howes, M-J; Birch-Machin, M A; Bowman, A

2018-06-01

The traditional practice of eating the flowers of Clitoria ternatea L. or drinking their infusion as herbal tea in some of the Asian countries is believed to promote a younger skin complexion and defend against skin aging. This study was conducted to investigate the protective effect of C. ternatea flower water extract (CTW) against hydrogen peroxide-induced cytotoxicity and ultraviolet (UV)-induced mitochondrial DNA (mtDNA) damage in human keratinocytes. The protective effect against hydrogen peroxide-induced cytotoxicity was determined by 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium assay, and mtDNA damage induced by UV was determined by polymerase chain reaction. Preincubation of HaCaT with 100, 250, and 500 μg/ml CTW reduced cytotoxicity effects of H 2 O 2 compared with control (H 2 O 2 alone). CTW also significantly reduced mtDNA damage in UV-exposed HaCaT (p < .05). CTW was chemically-characterized using high resolution liquid chromatography-mass spectrometry. The main compounds detected were assigned as anthocyanins derived from delphinidin, including polyacylated ternatins, and flavonol glycosides derived from quercetin and kaempferol. These results demonstrated the protective effects of C. ternatea flower extracts that contain polyacylated anthocyanins and flavonol glycosides as major constituents, against H 2 O 2 and UV-induced oxidative stress on skin cells, and may provide some explanation for the putative traditional and cosmetic uses of C. ternatea flower against skin aging. Copyright © 2018 John Wiley & Sons, Ltd.

l-N-acetylcysteine protects outer hair cells against TNFα initiated ototoxicity in vitro.

PubMed

Tillinger, Joshua A; Gupta, Chhavi; Ila, Kadri; Ahmed, Jamal; Mittal, Jeenu; Van De Water, Thomas R; Eshraghi, Adrien A

2018-08-01

The present study is aimed at determining the efficacy and exploring the mechanisms by which l-N-acetylcysteine (l-NAC) provides protection against tumor necrosis factor-alpha (TNFα)-induced oxidative stress damage and hair cell loss in 3-day-old rat organ of Corti (OC) explants. Previous work has demonstrated a high level of oxidative stress in TNFα-challenged OC explants. TNFα can potentially play a significant role in hair cell loss following an insult to the inner ear. l-NAC has shown to provide effective protection against noise-induced hearing loss in laboratory animals but mechanisms of this otoprotective effect are not well-defined. Rat OC explants were exposed to either: (1) saline control (N = 12); (2) TNFα (2 μg/ml, N = 12); (3) TNFα+l-NAC (5 mM, N = 12); (4) TNFα+l-NAC (10 mM, N = 12); or (5) l-NAC (10 mM, N = 12). Outer hair cell (OHC) density, levels of reactive oxygen species (ROS), lipid peroxidation of cell membranes, gluthathione activity, and mitochondrial viability were assayed. l-NAC (5 and 10 mM) provided protection for OHCs from ototoxic level of TNFα in OC explants. Groups treated with TNFα+l-NAC (5 mM) showed a highly significant reduction of both ROS (p < 0.01) and 4-hydroxy-2-nonenal immunostaining (p < 0.001) compared to TNFα-challenged explants. Total glutathione levels were low in TNFα-challenged explants compared to control and TNFα+l-NAC (5 mM) treated explants (p < 0.001). l-NAC is a promising treatment for protecting auditory HCs from TNFα-induced oxidative stress and subsequent loss via programmed cell death.

Long-term high-fat feeding induces greater fat storage in mice lacking UCP3.

PubMed

Costford, Sheila R; Chaudhry, Shehla N; Crawford, Sean A; Salkhordeh, Mahmoud; Harper, Mary-Ellen

2008-11-01

Uncoupling protein-3 (UCP3) is a mitochondrial inner-membrane protein highly expressed in skeletal muscle. While UCP3's function is still unknown, it has been hypothesized to act as a fatty acid (FA) anion exporter, protecting mitochondria against lipid peroxidation and/or facilitating FA oxidation. The aim of this study was to determine the effects of long-term feeding of a 45% fat diet on whole body indicators of muscle metabolism in congenic C57BL/6 mice that were either lacking UCP3 (Ucp3(-/-)) or had a transgenically induced approximately twofold increase in UCP3 levels (UCP3tg). Mice were fed the high-fat (HF) diet for a period of either 4 or 8 mo immediately following weaning. After long-term HF feeding, UCP3tg mice weighed an average of 15% less than wild-type mice (P < 0.05) and were 20% less metabolically efficient than both wild-type and Ucp3(-/-) mice (P < 0.01). Additionally, wild-type mice had 21% lower, whereas UCP3tg mice had 36% lower, levels of adiposity compared with Ucp3(-/-) mice (P < 0.05 and P < 0.001, respectively), indicating a protective effect of UCP3 against fat gain. No differences in whole body oxygen consumption were detected following long-term HF feeding. Glucose and insulin tolerance tests revealed that both the UCP3tg and Ucp3(-/-) mice were more glucose tolerant and insulin sensitive compared with wild-type mice after short-term HF feeding, but this protection was not maintained in the long term. Findings indicate that UCP3 is involved in protection from fat gain induced by long-term HF feeding, but not in protection from insulin resistance.

Polysensitivity in delayed cutaneous adverse drug reactions to macrolides, clindamycin, and pristinamycin: clinical history and patch testing.

PubMed

El Khoury, M; Assier, H; Gener, G; Paul, M; Haddad, C; Chosidow, O; Wolkenstein, P; Ingen-Housz-Oro, S

2018-05-10

Although they have different biochemical structures, macrolides, lincosamides (including clindamycin) and streptogramins (including pristinamycin) share a similar mechanism of action on Gram-positive bacteria and are grouped into the MLS family. 1 Cross-allergies induced by drugs of similar mechanism of action but different chemical structure (polysensitivity) are poorly described. Our objectives were to investigate the possibility of polysensitivity among MLS antibiotics, and to compare the value of patch tests (PTs) in MLS-induced delayed-cutaneous adverse drug reactions (D-CADRs). This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

The platelet-activating factor acetylhydrolase gene derived from Trichoderma harzianum induces maize resistance to Curvularia lunata through the jasmonic acid signaling pathway.

PubMed

Yu, Chuanjin; Fan, Lili; Gao, Jinxin; Wang, Meng; Wu, Qiong; Tang, Jun; Li, Yaqian; Chen, Jie

2015-01-01

Platelet-activating factor acetylhydrolase (PAF-AH) derived from Trichoderma harzianum was upregulated by the interaction of T. harzianum with maize roots or the foliar pathogen Curvularia lunata. PAF-AH was associated with chitinase and cellulase expressions, but especially with chitinase, because its activity in the KO40 transformant (PAF-AH disruption transformant) was lower, compared with the wild-type strain T28. The result demonstrated that the colonization of maize roots by T. harzianum induced systemic protection of leaves inoculated with C. lunata. Such protection was associated with the expression of inducible jasmonic acid pathway-related genes. Moreover, the data from liquid chromatography-mass spectrometry confirmed that the concentration of jasmonic acid in maize leaves was associated with the expression level of defense-related genes, suggesting that PAF-AH induced resistance to the foliar pathogen. Our findings showed that PAF-AH had an important function in inducing systemic resistance to maize leaf spot pathogen.

Chitosan nanoparticles from marine squid protect liver cells against N-diethylnitrosoamine-induced hepatocellular carcinoma.

PubMed

Subhapradha, Namasivayam; Shanmugam, Vairamani; Shanmugam, Annaian

2017-09-01

Rationale of this study was framed to investigate the protective effect and anti-cancer property of nanoparticles based on chitosan isolated from squid, Sepioteuthis lessoniana, on hepatic cells in N-Nitrosodiethylamine-induced hepatocellular carcinoma in rats. The results conferred that the chitosan nanoparticle supplementation had a protective effect on liver cells by reducing the levels of marker enzymes and bilirubin and thus increasing the albumin levels. The level of reduced glutathione, ascorbic acid and α-tocopherol significantly increased in both post- and pre-treatment with chitosan nanoparticles. The levels of antioxidant enzymes were enhanced and lipid peroxidation products were diminished while treating nitrosodiethylamine-induced hepatocellular carcinoma with chitosan nanoparticles. Supplementation of chitosan nanoparticles had potent anti-hyperlipidemic property that was evidenced by monitoring the serum lipid levels and its components. Animals pre-treated with chitosan nanoparticles along with nitrosodiethylamine showed a significant reduction in the total cholesterol and triglycerides levels with increase in the levels of phospholipids and free fatty acids. Chitosan nanoparticles treated rats showed significant increment in high-density lipoprotein cholesterol and reduction in low-density lipoprotein and very low-density lipoprotein cholesterol when compared with levels in nitrosodiethylamine-induced hepatocellular carcinoma. Nitrosodiethylamine-induced carcinoma changes on circulation and hepatic antioxidant defense mechanism were regulated by chitosan nanoparticles, concluding that the chitosan nanoparticles have a potent protective effect on liver cells which might be due to its robust antioxidant and anti-lipidemic property. Copyright © 2017 Elsevier Ltd. All rights reserved.

Berberine inhibits macrophage M1 polarization via AKT1/SOCS1/NF-κB signaling pathway to protect against DSS-induced colitis.

PubMed

Liu, Yunxin; Liu, Xiang; Hua, Weiwei; Wei, Qingyan; Fang, Xianjun; Zhao, Zheng; Ge, Chun; Liu, Chao; Chen, Chen; Tao, Yifu; Zhu, Yubing

2018-04-01

Berberine has been reported to have protective effects in colitis treatment. However, the detailed mechanisms remain unclear. Herein, we demonstrated that berberine could protect against dextran sulfate sodium (DSS)-induced colitis in mice by regulating macrophage polarization. In the colitis mouse model, berberine ameliorated DSS-induced colon shortening and colon tissue injury. Moreover, berberine-treated mice showed significant reduction in the disease activity index (DAI), pro-inflammatory cytokines expression and macrophages infiltration compared with the DSS-treated mice. Notably, berberine significantly reduced the percentage of M1 macrophages. In vitro analysis also confirmed the inhibitory effects of berberine on macrophages M1 polarization in RAW267.4 cells. Further investigation showed that berberine promoted AKT1 expression in mRNA and protein level. Silence of AKT1 abolished the inhibitory effect of berberine on macrophages M1 polarization. The berberine-induced AKT1 expression promoted suppressers of cytokine signaling (SOCS1) activation, which inhibited nuclear factor-kappa B (NF-κB) phosphorylation. In addition, we also found that berberine activated AKT1/SOCS1 signaling pathway but inhibited p65 phosphorylation in macrophages in vivo. Therefore, we concluded that berberine played a regulatory role in macrophages M1 polarization in DSS-induced colitis via AKT1/SOCS1/NF-κB signaling pathway. This unexpected property of berberine may provide a potential explanation for its protective effects in colitis treatment. Copyright © 2018 Elsevier B.V. All rights reserved.

Functions that Protect Escherichia coli from Tightly Bound DNA-Protein Complexes Created by Mutant EcoRII Methyltransferase.

PubMed

Henderson, Morgan L; Kreuzer, Kenneth N

2015-01-01

Expression of mutant EcoRII methyltransferase protein (M.EcoRII-C186A) in Escherichia coli leads to tightly bound DNA-protein complexes (TBCs), located sporadically on the chromosome rather than in tandem arrays. The mechanisms behind the lethality induced by such sporadic TBCs are not well studied, nor is it clear whether very tight binding but non-covalent complexes are processed in the same way as covalent DNA-protein crosslinks (DPCs). Using 2D gel electrophoresis, we found that TBCs induced by M.EcoRII-C186A block replication forks in vivo. Specific bubble molecules were detected as spots on the 2D gel, only when M.EcoRII-C186A was induced, and a mutation that eliminates a specific EcoRII methylation site led to disappearance of the corresponding spot. We also performed a candidate gene screen for mutants that are hypersensitive to TBCs induced by M.EcoRII-C186A. We found several gene products necessary for protection against these TBCs that are known to also protect against DPCs induced with wild-type M.EcoRII (after 5-azacytidine incorporation): RecA, RecBC, RecG, RuvABC, UvrD, FtsK, XerCD and SsrA (tmRNA). In contrast, the RecFOR pathway and Rep helicase are needed for protection against TBCs but not DPCs induced by M.EcoRII. We propose that stalled fork processing by RecFOR and RecA promotes release of tightly bound (but non-covalent) blocking proteins, perhaps by licensing Rep helicase-driven dissociation of the blocking M.EcoRII-C186A. Our studies also argued against the involvement of several proteins that might be expected to protect against TBCs. We took the opportunity to directly compare the sensitivity of all tested mutants to two quinolone antibiotics, which target bacterial type II topoisomerases and induce a unique form of DPC. We uncovered rep, ftsK and xerCD as novel quinolone hypersensitive mutants, and also obtained evidence against the involvement of a number of functions that might be expected to protect against quinolones.

Phoenix dactylifera protects against oxidative stress and hepatic injury induced by paracetamol intoxication in rats.

PubMed

Salem, Gamal A; Shaban, Ahmed; Diab, Hussain A; Elsaghayer, Wesam A; Mjedib, Manal D; Hnesh, Aomassad M; Sahu, Ravi P

2018-05-16

The current studies were sought to determine effects of antioxidant potential of aqueous and methanolic extracts of Phoenix dactylifera leaves (PLAE and PLME) against the widely-used analgesic paracetamol (PCM) induced hepatotoxicity. Groups of rats were treated with or without PCM (1500 mg/kg), PLAE and PLME (300 mg/kg) and n-acetylcysteine (NAC, 50 mg/kg) followed by assessments of liver function tests, oxidative stress, antioxidant defenses, and hepatotoxicity. We observed that PCM significantly elevated serum liver markers, aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP), gamma glutamyl transferase (GGT), and bilirubin compared to control (untreated) group. These PCM-induced effects were associated with oxidative stress as demonstrated by increased levels of malondialdehyde (MDA) and reduced levels of hepatic antioxidant enzymes, glutathione peroxidase (GPx), catalase (CAT), and superoxide dismutase (SOD). Pretreatment of PLME decreased ALT and AST by 78.2% and tissue MDA by 54.1%, and increased hepatic GPx (3.5 folds), CAT (7 folds) and SOD (2.5 folds) compared to PCM group. These PLME-mediated effects were comparable to NAC pretreatment. Histological analysis demonstrates that PLME conserved hepatic tissues against lesions such as inflammation, centrilobular necrosis, and hemorrhages induced by PCM. In contrast, PLAE-mediated effects were less effective in reducing levels of liver function enzymes, oxidative stress, and liver histopathological profiles, and restoring antioxidant defenses against PCM-induced intoxication. These findings indicate that PLME exerts protective effects against PCM-induced hepatotoxicity via scavenging free radicals and restoring hepatic antioxidant enzymes. Thus, PLME and its bioactive components could further be evaluated for their pharmacological properties against drug-induced deleterious effects. Copyright © 2018. Published by Elsevier Masson SAS.

[Protective effects of Fufangdengzhanhua dripping pill on apoptosis induced by glutamate in cultured primary hippocampal neurons of rats].

PubMed

Wang, Lijun; Wan, Lei

2010-03-01

To explore the protective effects and the inhibited mechanism of Fufangdengzhanhua dripping pill (FDD) on the apoptosis induced by glutamate (Glu) of cultured primary hippocampal neurons of rats. By the seropharmacological method, we obtained the drug-contained serum. The primary hippocampal neurons of rat cerebrum were cultured for 10 days, then exposed to 500 micromol x L(-1) glutamate acid (Glu) for 20 minutes to build the model. The 5% drug-contained sera which included normal, model, 0.05 g x kg(-1) nimodipine (Nim), 5.00 g x kg(-1) FDD and 1.25 g x kg(-1) FDD were added to the nutrient solution of cultured neurons. In this study, we observed the following indexes: the viability of cultured primary hippocampal neurons by MTT assay, the injured cell morphological changes with fluorescence microscope by using Hoechst 33342 & Propicium Iodide (PI) staining, intracellular Ca2+ concentration and the percentage of apoptosis by flow cytometry. When the hippocampal neurons were exposed to Glu, the cells were seriously damaged: nuclei were shrunken and cloven and the apoptosis body and the viability of cultured primary hippocampal neurons were decreased dramatically compared with the control. The FDD (5.00, 1.25 g x kg(-1)) and Nim could prevent the above changes Glu-induced. The necrosis rates and the percentage of cellular apoptosis of cultured hippocampal neurons pretreated with the serum of containing FDD decreased significantly and the number of surviving cells was increased significantly compared with model. Intracellular Ca2+ concentration Glu-induced were increased markedly compared with the control and the FDD (5.00, 1.25 g x kg(-1)) could prevent the above changes . FDD has protective effects on the apoptosis induced by glutamate (Glu) of cultured primary hippocampal neurons of rats, which possibly is related to reducing the intracellular Ca2+.

Stabilization of Influenza Vaccine Enhances Protection by Microneedle Delivery in the Mouse Skin

PubMed Central

Yoo, Dae-Goon; Compans, Richard W.; Prausnitz, Mark R.; Kang, Sang-Moo

2009-01-01

Background Simple and effective vaccine administration is particularly important for annually recommended influenza vaccination. We hypothesized that vaccine delivery to the skin using a patch containing vaccine-coated microneedles could be an attractive approach to improve influenza vaccination compliance and efficacy. Methodology/Principal Findings Solid microneedle arrays coated with inactivated influenza vaccine were prepared for simple vaccine delivery to the skin. However, the stability of the influenza vaccine, as measured by hemagglutination activity, was found to be significantly damaged during microneedle coating. The addition of trehalose to the microneedle coating formulation retained hemagglutination activity, indicating stabilization of the coated influenza vaccine. For both intramuscular and microneedle skin immunization, delivery of un-stabilized vaccine yielded weaker protective immune responses including viral neutralizing antibodies, protective efficacies, and recall immune responses to influenza virus. Immunization using un-stabilized vaccine also shifted the pattern of antibody isotypes compared to the stabilized vaccine. Importantly, a single microneedle-based vaccination using stabilized influenza vaccine was found to be superior to intramuscular immunization in controlling virus replication as well as in inducing rapid recall immune responses post challenge. Conclusions/Significance The functional integrity of hemagglutinin is associated with inducing improved protective immunity against influenza. Simple microneedle influenza vaccination in the skin produced superior protection compared to conventional intramuscular immunization. This approach is likely to be applicable to other vaccines too. PMID:19779615

Free phenolic acids from the seaweed Halimeda monile with antioxidant effect protecting against liver injury.

PubMed

Mancini-Filho, Jorge; Novoa, Alexis Vidal; González, Ana Elsa Batista; de Andrade-Wartha, Elma Regina S; de O e Silva, Ana Mara; Pinto, José Ricardo; Mancini, Dalva Assunção Portari

2009-01-01

Phenolic compounds are found in seaweed species together with other substances presenting antioxidant activity. The objective of this work was to evaluate the antioxidant activity of the free phenolic acids (FPA) fraction from the seaweed Halimeda monile, and its activity to protect the expression of hepatic enzymes in rats, under experimental CCl4 injury. The antioxidant activity was measured by the DPPH method. The FPA fraction (80 mg/kg, p.o.) was administered during 20 consecutive days to rats. The peroxidation was performed by thiobarbituric acid reactive substances (TBARS). The SOD and CAT enzymatic expressions were measured by RT/PCR. The histology technique was used to evaluate liver injuries. The expression of both, CAT and SOD genes, was more preserved by FPA. Only partial injury could be observed by histology in the liver of rats receiving FPA as compared with the control group; and CCl4 administration induced 60% more peroxidation as compared with the rats receiving FPA. These data suggest that FPA could modulate the antioxidant enzymes and oxidative status in the liver through protection against adverse effects induced by chemical agents.

Staphylococcus aureus Membrane-Derived Vesicles Promote Bacterial Virulence and Confer Protective Immunity in Murine Infection Models.

PubMed

Askarian, Fatemeh; Lapek, John D; Dongre, Mitesh; Tsai, Chih-Ming; Kumaraswamy, Monika; Kousha, Armin; Valderrama, J Andrés; Ludviksen, Judith A; Cavanagh, Jorunn P; Uchiyama, Satoshi; Mollnes, Tom E; Gonzalez, David J; Wai, Sun N; Nizet, Victor; Johannessen, Mona

2018-01-01

Staphylococcus aureus produces membrane-derived vesicles (MVs), which share functional properties to outer membrane vesicles. Atomic force microscopy revealed that S. aureus -derived MVs are associated with the bacterial surface or released into the surrounding environment depending on bacterial growth conditions. By using a comparative proteomic approach, a total of 131 and 617 proteins were identified in MVs isolated from S. aureus grown in Luria-Bertani and brain-heart infusion broth, respectively. Purified S. aureus MVs derived from the bacteria grown in either media induced comparable levels of cytotoxicity and neutrophil-activation. Administration of exogenous MVs increased the resistance of S. aureus to killing by whole blood or purified human neutrophils ex vivo and increased S. aureus survival in vivo . Finally, immunization of mice with S. aureus -derived MVs induced production of IgM, total IgG, IgG1, IgG2a, and IgG2b resulting in protection against subcutaneous and systemic S. aureus infection. Collectively, our results suggest S. aureus MVs can influence bacterial-host interactions during systemic infections and provide protective immunity in murine models of infection.

Epigenetic modifiers reduce inflammation and modulate macrophage phenotype during endotoxemia-induced acute lung injury

PubMed Central

Thangavel, Jayakumar; Samanta, Saheli; Rajasingh, Sheeja; Barani, Bahar; Xuan, Yu-Ting; Dawn, Buddhadeb; Rajasingh, Johnson

2015-01-01

ABSTRACT Acute lung injury (ALI) during sepsis is characterized by bilateral alveolar infiltrates, lung edema and respiratory failure. Here, we examined the efficacy the DNA methyl transferase (DNMT) inhibitor 5-Aza 2-deoxycytidine (Aza), the histone deacetylase (HDAC) inhibitor Trichostatin A (TSA), as well as the combination therapy of Aza and TSA (Aza+TSA) provides in the protection of ALI. In LPS-induced mouse ALI, post-treatment with a single dose of Aza+TSA showed substantial attenuation of adverse lung histopathological changes and inflammation. Importantly, these protective effects were due to substantial macrophage phenotypic changes observed in LPS-stimulated macrophages treated with Aza+TSA as compared with untreated LPS-induced macrophages or LPS-stimulated macrophages treated with either drug alone. Further, we observed significantly lower levels of pro-inflammatory molecules and higher levels of anti-inflammatory molecules in LPS-induced macrophages treated with Aza+TSA than in LPS-induced macrophages treated with either drug alone. The protection was ascribed to dual effects by an inhibition of MAPK–HuR–TNF and activation of STAT3–Bcl2 pathways. Combinatorial treatment with Aza+TSA reduces inflammation and promotes an anti-inflammatory M2 macrophage phenotype in ALI, and has a therapeutic potential for patients with sepsis. PMID:26116574

Glutathione and antioxidant enzymes serve complementary roles in protecting activated hepatic stellate cells against hydrogen peroxide-induced cell death.

PubMed

Dunning, Sandra; Ur Rehman, Atta; Tiebosch, Marjolein H; Hannivoort, Rebekka A; Haijer, Floris W; Woudenberg, Jannes; van den Heuvel, Fiona A J; Buist-Homan, Manon; Faber, Klaas Nico; Moshage, Han

2013-12-01

In chronic liver disease, hepatic stellate cells (HSCs) are activated, highly proliferative and produce excessive amounts of extracellular matrix, leading to liver fibrosis. Elevated levels of toxic reactive oxygen species (ROS) produced during chronic liver injury have been implicated in this activation process. Therefore, activated hepatic stellate cells need to harbor highly effective anti-oxidants to protect against the toxic effects of ROS. To investigate the protective mechanisms of activated HSCs against ROS-induced toxicity. Culture-activated rat HSCs were exposed to hydrogen peroxide. Necrosis and apoptosis were determined by Sytox Green or acridine orange staining, respectively. The hydrogen peroxide detoxifying enzymes catalase and glutathione-peroxidase (GPx) were inhibited using 3-amino-1,2,4-triazole and mercaptosuccinic acid, respectively. The anti-oxidant glutathione was depleted by L-buthionine-sulfoximine and repleted with the GSH-analogue GSH-monoethylester (GSH-MEE). Upon activation, HSCs increase their cellular glutathione content and GPx expression, while MnSOD (both at mRNA and protein level) and catalase (at the protein level, but not at the mRNA level) decreased. Hydrogen peroxide did not induce cell death in activated HSCs. Glutathione depletion increased the sensitivity of HSCs to hydrogen peroxide, resulting in 35% and 75% necrotic cells at 0.2 and 1mmol/L hydrogen peroxide, respectively. The sensitizing effect was abolished by GSH-MEE. Inhibition of catalase or GPx significantly increased hydrogen peroxide-induced apoptosis, which was not reversed by GSH-MEE. Activated HSCs have increased ROS-detoxifying capacity compared to quiescent HSCs. Glutathione levels increase during HSC activation and protect against ROS-induced necrosis, whereas hydrogen peroxide-detoxifying enzymes protect against apoptotic cell death. © 2013.

Subcutaneous administration of a 10-fold-lower dose of a commercial human tuberculosis vaccine, Mycobacterium bovis bacillus Calmette-Guerin Danish, induced levels of protection against bovine tuberculosis and responses in the tuberculin intradermal test similar to those induced by a standard cattle dose.

PubMed

Buddle, Bryce M; Hewinson, R Glyn; Vordermeier, H Martin; Wedlock, D Neil

2013-10-01

Vaccination of cattle with a commercial human tuberculosis (TB) vaccine, Mycobacterium bovis bacillus Calmette-Guérin (BCG) Danish, at a dose equivalent to 5 human doses of BCG has protected these animals against TB in field and experimental trials. There is interest in determining whether a 10-fold-lower dose could still protect cattle but not induce a tuberculin intradermal test response. Two groups of calves (n = 9/group) were vaccinated subcutaneously with a lyophilized BCG Danish vaccine containing either 0.5 (1 × 10(5) to 4 × 10(5) CFU) or 5 (1 × 10(6) to 4 × 10(6) CFU) human doses of BCG Danish, with an additional group of 10 calves serving as nonvaccinated controls. Fifteen weeks after vaccination, these animals were challenged intratracheally with 5 × 10(3) CFU of virulent M. bovis and another 15 weeks later were slaughtered and examined for the presence of tuberculous lesions. Vaccination of the calves with either 0.5 or 5 equivalent human doses of BCG Danish induced similar levels of protection against challenge with M. bovis, with both groups showing significant reductions in the pathological and microbiological parameters compared to those for the the control group (P < 0.05). Vaccination with either of the two BCG doses induced similar numbers of animals responding to the tuberculin intradermal test at 11 weeks postvaccination. Vaccination with a 0.5 equivalent human dose of a commercial lyophilized BCG vaccine can protect cattle against challenge with M. bovis.

Loss of hypoxia-inducible factor 2 alpha in the lung alveolar epithelium of mice leads to enhanced eosinophilic inflammation in cobalt-induced lung injury.

PubMed

Proper, Steven P; Saini, Yogesh; Greenwood, Krista K; Bramble, Lori A; Downing, Nathaniel J; Harkema, Jack R; Lapres, John J

2014-02-01

Hard metal lung disease (HMLD) is an occupational lung disease specific to inhalation of cobalt-containing particles whose mechanism is largely unknown. Cobalt is a known hypoxia mimic and stabilizer of the alpha subunits of hypoxia-inducible factors (HIFs). Previous work revealed that though HIF1α contrib utes to cobalt toxicity in vitro, loss of HIF1α in the alveolar epithelial cells does not provide in vivo protection from cobalt-induced lung inflammation. HIF1α and HIF2α show unique tissue expression profiles, and HIF2α is known to be the predominant HIF mRNA isoform in the adult lung. Thus, if HIF2α activation by cobalt contributes to pathophysiology of HMLD, we hypothesized that loss of HIF2α in lung epithelium would provide protection from cobalt-induced inflammation. Mice with HIF2α-deficiency in Club and alveolar type II epithelial cells (ATIIs) (HIF2α(Δ/Δ)) were exposed to cobalt (60 µg/day) or saline using a subacute occupational exposure model. Bronchoalveolar lavage cellularity, cytokines, qRT-PCR, and histopathology were analyzed. Results show that loss of HIF2α leads to enhanced eosinophilic inflammation and increased goblet cell metaplasia. Additionally, control mice demonstrated a mild recovery from cobalt-induced lung injury compared with HIF2α(Δ/Δ) mice, suggesting a role for epithelial HIF2α in repair mechanisms. The expression of important cytokines, such as interleukin (IL)-5 and IL-10, displayed significant differences following cobalt exposure when HIF2α(Δ/Δ) and control mice were compared. In summary, our data suggest that although loss of HIF2α does not afford protection from cobalt-induced lung inflammation, epithelial HIF2α signaling does play an important role in modulating the inflammatory and repair response in the lung.

Protective effects of phenolics rich extract of ginger against Aflatoxin B1-induced oxidative stress and hepatotoxicity.

PubMed

A V, Vipin; K, Raksha Rao; Kurrey, Nawneet Kumar; K A, Anu Appaiah; G, Venkateswaran

2017-07-01

Aflatoxin B 1 (AFB 1 ) is one of the predominant mycotoxin contaminant in food and feed, causing oxidative stress and hepatotoxicity. Ginger phenolics have been reported for its antioxidant potential and hepatoprotective activity. The present study investigated the protective effects of phenolics rich ginger extract (GE) against AFB 1 induced oxidative stress and hepatotoxicity, in vitro and in vivo. The phenolic acid profiles of GE showed 6-gingerol and 6-shogaol as predominant components. Pretreatment of HepG2 cells with GE significantly inhibited the production of intracellular reactive oxygen species (ROS), DNA strand break, and cytotoxicity induced by AFB 1 . A comparable effect was observed in in vivo. Male Wistar rats were orally treated with GE (100 and 250mg/kg) daily, with the administration of AFB 1 (200μg/kg) every alternative day for 28days. Treatment with GE significantly reduced AFB 1 induced toxicity on the serum markers of liver damage. In addition, GE also showed significant hepatoprotective effect by reducing the lipid peroxidation and by enhancing the antioxidant enzymes activities. These results combined with liver histopathological observations indicated that GE has potential protective effect against AFB 1 induced hepatotoxicity. Additionally, administration of GE up-regulated Nrf2/HO-1 pathway, which further proved the efficiency of GE to inhibit AFB 1 induced hepatotoxicity. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Comparative Protective Effect of Hawthorn Berry Hydroalcoholic Extract, Atorvastatin, and Mesalamine on Experimentally Induced Colitis in Rats

PubMed Central

Shafie-Irannejad, Vahid; Hobbenaghi, Rahim; Tabatabaie, Seyed Hamed; Moshtaghion, Seyed-Mehdi

2013-01-01

Abstract The protective effect of hydroalcoholic extract of hawthorn berries (HBE) on acetic acid (AA)–induced colitis in rats was investigated. Forty-two Wistar rats were divided into seven groups, including control and test groups (n=6). The control animals received saline, and the test animals were treated with saline (sham group), mesalamine (50 mg/kg; M group), atorvastatin (20 mg/kg; A group), HBE (100 mg/kg; H group), mesalamine and HBE (HM group), or atorvastatin plus HBE (HA group), 3 days before and a week after colitis induction. Colitis was induced by administration of 1 mL AA (4%) via a polyethylene catheter intrarectally. High-performance liquid chromatography analyses showed that HBE contained 0.13% and 0.5% oleanolic acid and ursolic acid, respectively. Elevated myeloperoxidase activity and lipid peroxidation were attenuated in the HA group. The H and HM groups showed marked reductions in colitis-induced decreases in total thiol molecules and body weight. The histopathological studies revealed that HBE decreased colitis-induced edema and infiltration of neutrophils. Our data suggest the anti-inflammatory and antioxidant effects of HBE and atorvastatin protect against AA-induced colitis. The anti-inflammatory effect of HBE may be attributable to its ability to decrease myeloperoxidase activity as a biomarker of neutrophil infiltration. PMID:23875899

Omega-3 polyunsaturated fatty acids alleviate hepatic steatosis-induced inflammation through Sirt1-mediated nuclear translocation of NF-κB p65 subunit in hepatocytes of large yellow croaker (Larmichthys crocea).

PubMed

Wang, Tianjiao; Yang, Bo; Ji, Renlei; Xu, Wei; Mai, Kangsen; Ai, Qinghui

2017-12-01

Hepatic steatosis induced inflammation is becoming increasingly prevalent in farmed fish. This study was conducted to investigate the protective effects of omega-3 polyunsaturated fatty acids (ω-3 PUFAs) against hepatic steatosis-induced inflammation and its potential molecular mechanisms in hepatocyte of large yellow croaker (Larmichthys crocea). We found that the hepatic steatosis-induced inflammation was relieved by ω-3 PUFAs, meanwhile, the Sirt1 activity and transcript expression was increased by ω-3 PUFAs. The increased Sirt1 activity can decrease the hepatic steatosis-induced inflammation. The protective effects of ω-3 PUFAs against hepatic steatosis-induced inflammation was reversed by the treatment with Sirt1 inhibitor EX-527. The nuclear translocation of nuclear transcription factor kappa-B (NF-κB) p65 was significantly decreased after ω-3 PUFAs treatments compared to the palmitic acid stimulation group. The ω-3 PUFAs induced cytoplasm translocation of NF-κB p65 was reversed by EX-527. Together, ω-3 PUFAs alleviate hepatic steatosis-induced inflammation through Sirt1-mediated nuclear translocation of NF-κB p65 subunit in hepatocytes of large yellow croaker. The present study provides important insight into the mechanisms of the protective effects of ω-3 PUFAs, providing theory bases for alleviating the hepatic steatosis induced inflammation of farmed fish, thereby offering great benefits to the aquaculture industry and fish consumers. Copyright © 2017. Published by Elsevier Ltd.

Transcutaneous immunization with a novel imiquimod nanoemulsion induces superior T cell responses and virus protection.

PubMed

Lopez, Pamela Aranda; Denny, Mark; Hartmann, Ann-Kathrin; Alflen, Astrid; Probst, Hans Christian; von Stebut, Esther; Tenzer, Stefan; Schild, Hansjörg; Stassen, Michael; Langguth, Peter; Radsak, Markus P

2017-09-01

Transcutaneous immunization (TCI) is a novel vaccination strategy utilizing the skin associated lymphatic tissue to induce immune responses. TCI using a cytotoxic T lymphocyte (CTL) epitope and the Toll-like receptor 7 (TLR7) agonist imiquimod mounts strong CTL responses by activation and maturation of skin-derived dendritic cells (DCs) and their migration to lymph nodes. However, TCI based on the commercial formulation Aldara only induces transient CTL responses that needs further improvement for the induction of durable therapeutic immune responses. Therefore we aimed to develop a novel imiquimod solid nanoemulsion (IMI-Sol) for TCI with superior vaccination properties suited to induce high quality T cell responses for enhanced protection against infections. TCI was performed by applying a MHC class I or II restricted epitope along with IMI-Sol or Aldara (each containing 5% Imiquimod) on the shaved dorsum of C57BL/6, IL-1R, Myd88, Tlr7 or Ccr7 deficient mice. T cell responses as well as DC migration upon TCI were subsequently analyzed by flow cytometry. To determine in vivo efficacy of TCI induced immune responses, CTL responses and frequency of peptide specific T cells were evaluated on day 8 or 35 post vaccination and protection in a lymphocytic choriomeningitis virus (LCMV) infection model was assessed. TCI with the imiquimod formulation IMI-Sol displayed equal skin penetration of imiquimod compared to Aldara, but elicited superior CD8 + as well as CD4 + T cell responses. The induction of T-cell responses induced by IMI-Sol TCI was dependent on the TLR7/MyD88 pathway and independent of IL-1R. IMI-Sol TCI activated skin-derived DCs in skin-draining lymph nodes more efficiently compared to Aldara leading to enhanced protection in a LCMV infection model. Our data demonstrate that IMI-Sol TCI can overcome current limitations of previous imiquimod based TCI approaches opening new perspectives for transcutaneous vaccination strategies and allowing the use of this enhanced cutaneous drug-delivery system to be tailored for the improved prevention and treatment of infectious diseases and cancers. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

Impairment of Atg5-Dependent Autophagic Flux Promotes Paraquat- and MPP+-Induced Apoptosis But Not Rotenone or 6-Hydroxydopamine Toxicity

PubMed Central

Franco, Rodrigo

2013-01-01

Controversial reports on the role of autophagy as a survival or cell death mechanism in dopaminergic cell death induced by parkinsonian toxins exist. We investigated the alterations in autophagic flux and the role of autophagy protein 5 (Atg5)-dependent autophagy in dopaminergic cell death induced by parkinsonian toxins. Dopaminergic cell death induced by the mitochondrial complex I inhibitors 1-methyl-4-phenylpyridinium (MPP+) and rotenone, the pesticide paraquat, and the dopamine analog 6-hydroxydopamine (6-OHDA) was paralleled by increased autophagosome accumulation. However, when compared with basal autophagy levels using chloroquine, autophagosome accumulation was a result of impaired autophagic flux. Only 6-OHDA induced an increase in autophagosome formation. Overexpression of a dominant negative form of Atg5 increased paraquat- and MPP+-induced cell death. Stimulation of mammalian target of rapamycin (mTOR)-dependent signaling protected against cell death induced by paraquat, whereas MPP+-induced toxicity was enhanced by wortmannin, a phosphoinositide 3-kinase class III inhibitor, rapamycin, and trehalose, an mTOR-independent autophagy activator. Modulation of autophagy by either pharmacological or genetic approaches had no effect on rotenone or 6-OHDA toxicity. Cell death induced by parkinsonian neurotoxins was inhibited by the pan caspase inhibitor (Z-VAD), but only caspase-3 inhibition was able to decrease MPP+-induced cell death. Finally, inhibition of the lysosomal hydrolases, cathepsins, increased the toxicity by paraquat and MPP+, supporting a protective role of Atg5-dependent autophagy and lysosomes degradation pathways on dopaminegic cell death. These results demonstrate that in dopaminergic cells, Atg5-dependent autophagy acts as a protective mechanism during apoptotic cell death induced by paraquat and MPP+ but not during rotenone or 6-OHDA toxicity. PMID:23997112

Leishmania infantum FML pulsed-dendritic cells induce a protective immune response in murine visceral leishmaniasis.

PubMed

Foroughi-Parvar, Faeze; Hatam, Gholam-Reza; Sarkari, Bahador; Kamali-Sarvestani, Eskandar

2015-01-01

To investigate the efficacy of FML loaded dendritic cells (DCs) in protection against visceral leishmaniasis. Mice were immunized with FML- or soluble Leishmania antigen-loaded DCs as well as FML or soluble Leishmania antigen in saponin and challenged with parasite. The levels of cytokines before and after challenge were detected by ELISA. Parasite burden (total Leishman-Donovan unit) was determined after parasite challenge. FML-saponin induced the highest IFN-γ/IL-4 ratio among vaccinated groups, though this ratio was higher in FML-loaded DCs group subsequent to challenge with Leishmania infantum. Moreover, the greatest reduction in parasite number was detected in mice vaccinated with FML-loaded DCs compared with phosphate-buffered saline-treated mice (p = 0.002). FML-loaded DCs are one of the promising tools for protection against murine visceral leishmaniasis.

Total Leishmania antigens with Poly(I:C) induce Th1 protective response.

PubMed

Sanchez, M V; Eliçabe, R J; Di Genaro, M S; Germanó, M J; Gea, S; García Bustos, M F; Salomón, M C; Scodeller, E A; Cargnelutti, D E

2017-11-01

Our proposal was to develop a vaccine based on total Leishmania antigens (TLA) adjuvanted with polyinosinic-polycytidylic acid [Poly(I:C)] able to induce a Th1 response which can provide protection against Leishmania infection. Mice were vaccinated with two doses of TLA-Poly(I:C) administered by subcutaneous route at 3-week interval. Humoral and cellular immune responses induced by the immunization were measured. The protective efficacy of the vaccine was evaluated by challenging mice with infective promastigotes of Leishmania (Leishmania) amazonensis into the footpad. Mice vaccinated with TLA-Poly(I:C) showed a high anti-Leishmania IgG titre, as well as increased IgG1 and IgG2a subclass titres compared with mice vaccinated with the TLA alone. The high IgG2a indicated a Th1 bias response induced by the TLA-Poly(I:C) immunization. Accordingly, the cellular immune response elicited by the formulation was characterized by an increased production of IFN-γ and no significant production of IL-4. The TLA-Poly(I:C) immunization elicited good protection, which was associated with decreased footpad swelling, a lower parasite load and a reduced histopathological alteration in the footpad. Our findings demonstrate a promising vaccine against cutaneous leishmaniasis that is relatively economic and easy to develop and which should be taken into account for preventing leishmaniasis in developing countries. © 2017 John Wiley & Sons Ltd.

Dietary supplementation with omega-3 polyunsaturated fatty acid-rich oils protects against visible-light-induced retinal damage in vivo.

PubMed

Deng, Qianchun; Wang, Yong; Wang, Chengtao; Ji, Baoping; Cong, Renhuai; Zhao, Lei; Chen, Peng; Zang, Xixi; Lu, Feng; Han, Fei; Huang, Fenghong

2018-04-25

The effects of administering omega-3 (ω-3) polyunsaturated fatty acid (PUFA)-rich oils on visible-light-induced retinal damage were investigated in rabbits. The mole percentages of α-linolenic acid in sea buckthorn berry oil, sea buckthorn oil (SO), sea buckthorn seed oil and flaxseed oil (FO) were 2.12%, 12.98%, 31.56% and 55.41%, respectively. Algal oil (AO) contains 33.34% docosahexaenoic acid. SO has the highest total phenolic content (63.42 ± 0.59 mg SAE per 100 g) amongst these oils. The administration of SO, FO and AO provided structural and functional protection to the retina. In the retina, we observed a significant increase in the levels of DHA in the AO group compared with the normal group. The mechanism of retinal protection by SO, FO and AO involves up-regulating the expression of nuclear factor erythroid-2 related factor 2 and haem oxygenase-1. The levels of interleukin-1 β, tumour necrosis factor-alpha, interleukin-8, and cyclooxygenase 2 in the retina were significantly reduced with AO treatment. The administration of AO resulted in the down-regulation of nuclear factor kappa B mRNA expression. In addition, the treatment with AO significantly attenuated the light-induced apoptosis and angiogenesis in the retina. These results suggest that dietary ω-3 PUFA-rich oils protect against visible-light-induced retinal damage.

A Cultivated Form of a Red Seaweed (Chondrus crispus), Suppresses β-Amyloid-Induced Paralysis in Caenorhabditis elegans.

PubMed

Sangha, Jatinder Singh; Wally, Owen; Banskota, Arjun H; Stefanova, Roumiana; Hafting, Jeff T; Critchley, Alan T; Prithiviraj, Balakrishnan

2015-10-20

We report here the protective effects of a methanol extract from a cultivated strain of the red seaweed, Chondrus crispus, against β-amyloid-induced toxicity, in a transgenic Caenorhabditis elegans, expressing human Aβ1-42 gene. The methanol extract of C. crispus (CCE), delayed β-amyloid-induced paralysis, whereas the water extract (CCW) was not effective. The CCE treatment did not affect the transcript abundance of amy1; however, Western blot analysis revealed a significant decrease of Aβ species, as compared to untreated worms. The transcript abundance of stress response genes; sod3, hsp16.2 and skn1 increased in CCE-treated worms. Bioassay guided fractionation of the CCE yielded a fraction enriched in monogalactosyl diacylglycerols (MGDG) that significantly delayed the onset of β-amyloid-induced paralysis. Taken together, these results suggested that the cultivated strain of C. crispus, whilst providing dietary nutritional value, may also have significant protective effects against β-amyloid-induced toxicity in C. elegans, partly through reduced β-amyloid species, up-regulation of stress induced genes and reduced accumulation of reactive oxygen species (ROS).

Comparative analysis of protective effects of curcumin, curcumin-β-cyclodextrin nanoparticle and nanoliposomal curcumin on unsymmetrical dimethyl hydrazine poisoning in mice

PubMed Central

Li, Wei; Zhou, Mengzhou; Xu, Ning; Hu, Yong; Wang, Chao; Li, Deyuan; Liu, Liegang; Li, Dongsheng

2016-01-01

ABSTRACT The aim of this study was to compare the protective effects of curcumin, curcumin-β-cyclodextrin nanoparticle curcumin (BCD-CUR) and nanoliposomal curcumin (NLC) on unsymmetrical dimethylhydrazine (UDMH) induced poison in mice. Curcumin, BCD-CUR, and NLC were prepared and their properties of zeta potential, particle size, encapsulation efficiency, and loading capacity were characterized. Eighty-eight male ICR mice on normal chow diet were randomly divided into 11 groups, and intraperitoneally injected with UDMH alone, or together with different doses of curcumin, BCD-CUR or NLC daily for up to 10 d. Enzyme activities of serum alanine transaminase (ALT), aspartate aminotransferase (AST), and lactate dehydrogenase (LDH) were analyzed by fully-automatic analyzer and neurotransmitter levels were determined with high performance liquid chromatography (HPLC). 150 mg/kg curcumin treatment alone significantly reduced levels of serum ALT and LDH that were induced by UDMH and markedly increased level of γ-amino butyric acid (GABA) that were reduced by UDMH in the hippocampus. 150 mg/kg BCD-CUR not only decreased significantly the increase of ALT, LDH and glutamate (Glu) but also recovered levels of AST and GABA. 150 mg/kg NLC recovered profoundly levels of AST and GABA while decreased remarkably the UDMH induced increase of ALT, LDH, Glu and 5-hydroxytryptamine (5-HT). In addition, treatments with all tested doses of NLC significantly reduced the UMDH induced dopamine (DA), the monoamine neurotransmitter. NLC had more profound protective effects against liver and central nervous system injury induced by UDMH than a suspension of BCD-CUR or curcumin did in mice. PMID:27710431

A Proteinaceous Elicitor Sm1 from the Beneficial Fungus Trichoderma virens Is Required for Induced Systemic Resistance in Maize1[W

PubMed Central

Djonović, Slavica; Vargas, Walter A.; Kolomiets, Michael V.; Horndeski, Michelle; Wiest, Aric; Kenerley, Charles M.

2007-01-01

We have previously shown that the beneficial filamentous fungus Trichoderma virens secretes the highly effective hydrophobin-like elicitor Sm1 that induces systemic disease resistance in the dicot cotton (Gossypium hirsutum). In this study we tested whether colonization of roots by T. virens can induce systemic protection against a foliar pathogen in the monocot maize (Zea mays), and we further demonstrated the importance of Sm1 during maize-fungal interactions using a functional genomics approach. Maize seedlings were inoculated with T. virens Gv29-8 wild type and transformants in which SM1 was disrupted or constitutively overexpressed in a hydroponic system or in soil-grown maize seedlings challenged with the pathogen Colletotrichum graminicola. We show that similar to dicot plants, colonization of maize roots by T. virens induces systemic protection of the leaves inoculated with C. graminicola. This protection was associated with notable induction of jasmonic acid- and green leaf volatile-biosynthetic genes. Neither deletion nor overexpression of SM1 affected normal growth or development of T. virens, conidial germination, production of gliotoxin, hyphal coiling, hydrophobicity, or the ability to colonize maize roots. Plant bioassays showed that maize grown with SM1-deletion strains exhibited the same levels of systemic protection as non-Trichoderma-treated plants. Moreover, deletion and overexpression of SM1 resulted in significantly reduced and enhanced levels of disease protection, respectively, compared to the wild type. These data together indicate that T. virens is able to effectively activate systemic disease protection in maize and that the functional Sm1 elicitor is required for this activity. PMID:17885089

Effect of ozone oxidative preconditioning in preventing early radiation-induced lung injury in rats

PubMed Central

Bakkal, B.H.; Gultekin, F.A.; Guven, B.; Turkcu, U.O.; Bektas, S.; Can, M.

2013-01-01

Ionizing radiation causes its biological effects mainly through oxidative damage induced by reactive oxygen species. Previous studies showed that ozone oxidative preconditioning attenuated pathophysiological events mediated by reactive oxygen species. As inhalation of ozone induces lung injury, the aim of this study was to examine whether ozone oxidative preconditioning potentiates or attenuates the effects of irradiation on the lung. Rats were subjected to total body irradiation, with or without treatment with ozone oxidative preconditioning (0.72 mg/kg). Serum proinflammatory cytokine levels, oxidative damage markers, and histopathological analysis were compared at 6 and 72 h after total body irradiation. Irradiation significantly increased lung malondialdehyde levels as an end-product of lipoperoxidation. Irradiation also significantly decreased lung superoxide dismutase activity, which is an indicator of the generation of oxidative stress and an early protective response to oxidative damage. Ozone oxidative preconditioning plus irradiation significantly decreased malondialdehyde levels and increased the activity of superoxide dismutase, which might indicate protection of the lung from radiation-induced lung injury. Serum tumor necrosis factor alpha and interleukin-1 beta levels, which increased significantly following total body irradiation, were decreased with ozone oxidative preconditioning. Moreover, ozone oxidative preconditioning was able to ameliorate radiation-induced lung injury assessed by histopathological evaluation. In conclusion, ozone oxidative preconditioning, repeated low-dose intraperitoneal administration of ozone, did not exacerbate radiation-induced lung injury, and, on the contrary, it provided protection against radiation-induced lung damage. PMID:23969972

Broadly protective anti-hemagglutinin stalk antibodies induced by live attenuated influenza vaccine expressing chimeric hemagglutinin.

PubMed

Isakova-Sivak, Irina; Korenkov, Daniil; Smolonogina, Tatiana; Kotomina, Tatiana; Donina, Svetlana; Matyushenko, Victoria; Mezhenskaya, Daria; Krammer, Florian; Rudenko, Larisa

2018-05-01

The development of influenza vaccines that can provide broad protection against all drifted seasonal virus variants, zoonotic infections and emerging pandemic strains, has been a priority for two decades. Here we propose a strategy of inducing broadly-reactive anti-stalk antibody by sequential immunizations with live attenuated influenza vaccines (LAIVs) expressing chimeric HAs (cHAs). These vaccines are designed to contain identical hemagglutinin stalk domains from H1N1 virus but antigenically unrelated globular head domains from avian influenza virus subtypes H5, H8 and H9. Mouse experiments demonstrated enhanced cross-protection of cHA-containing LAIVs compared to the relevant vaccine viruses expressing natural HAs, and this enhanced protection was driven by stalk-HA-reactive IgG antibodies. The establishment of fully functional cross-protective immunity after two doses of cHA LAIV vaccination in naïve animals suggests that a similar effect might be expected after a single cHA LAIV dose in primed individuals, or after two to three doses in naïve children. Copyright © 2018 Elsevier Inc. All rights reserved.

Fetal asphyctic preconditioning modulates the acute cytokine response thereby protecting against perinatal asphyxia in neonatal rats.

PubMed

Vlassaks, Evi; Strackx, Eveline; Vles, Johan Sh; Nikiforou, Maria; Martinez-Martinez, Pilar; Kramer, Boris W; Gavilanes, Antonio Wd

2013-01-26

Perinatal asphyxia (PA) is a major cause of brain damage and neurodevelopmental impairment in infants. Recent investigations have shown that experimental sublethal fetal asphyxia (FA preconditioning) protects against a subsequent more severe asphyctic insult at birth. The molecular mechanisms of this protection have, however, not been elucidated. Evidence implicates that inflammatory cytokines play a protective role in the induction of ischemic tolerance in the adult brain. Accordingly, we hypothesize that FA preconditioning leads to changes in the fetal cytokine response, thereby protecting the newborn against a subsequent asphyctic insult. In rats, FA preconditioning was induced at embryonic day 17 by clamping the uterine vasculature for 30 min. At term birth, global PA was induced by placing the uterine horns, containing the pups, in a saline bath for 19 min. We assessed, at different time points after FA and PA, mRNA and protein expression of several cytokines and related receptor mRNA levels in total hemispheres of fetal and neonatal brains. Additionally, we measured pSTAT3/STAT3 levels to investigate cellular responses to these cytokines. Prenatally, FA induced acute downregulation in IL-1β, TNF-α and IL-10 mRNA levels. At 96 h post FA, IL-6 mRNA and IL-10 protein expression were increased in FA brains compared with controls. Two hours after birth, all proinflammatory cytokines and pSTAT3/STAT3 levels decreased in pups that experienced FA and/or PA. Interestingly, IL-10 and IL-6 mRNA levels increased after PA. When pups were FA preconditioned, however, IL-10 and IL-6 mRNA levels were comparable to those in controls. FA leads to prenatal changes in the neuroinflammatory response. This modulation of the cytokine response probably results in the protective inflammatory phenotype seen when combining FA and PA and may have significant implications for preventing post-asphyctic perinatal encephalopathy.

Fetal asphyctic preconditioning modulates the acute cytokine response thereby protecting against perinatal asphyxia in neonatal rats

PubMed Central

2013-01-01

Background Perinatal asphyxia (PA) is a major cause of brain damage and neurodevelopmental impairment in infants. Recent investigations have shown that experimental sublethal fetal asphyxia (FA preconditioning) protects against a subsequent more severe asphyctic insult at birth. The molecular mechanisms of this protection have, however, not been elucidated. Evidence implicates that inflammatory cytokines play a protective role in the induction of ischemic tolerance in the adult brain. Accordingly, we hypothesize that FA preconditioning leads to changes in the fetal cytokine response, thereby protecting the newborn against a subsequent asphyctic insult. Methods In rats, FA preconditioning was induced at embryonic day 17 by clamping the uterine vasculature for 30 min. At term birth, global PA was induced by placing the uterine horns, containing the pups, in a saline bath for 19 min. We assessed, at different time points after FA and PA, mRNA and protein expression of several cytokines and related receptor mRNA levels in total hemispheres of fetal and neonatal brains. Additionally, we measured pSTAT3/STAT3 levels to investigate cellular responses to these cytokines. Results Prenatally, FA induced acute downregulation in IL-1β, TNF-α and IL-10 mRNA levels. At 96 h post FA, IL-6 mRNA and IL-10 protein expression were increased in FA brains compared with controls. Two hours after birth, all proinflammatory cytokines and pSTAT3/STAT3 levels decreased in pups that experienced FA and/or PA. Interestingly, IL-10 and IL-6 mRNA levels increased after PA. When pups were FA preconditioned, however, IL-10 and IL-6 mRNA levels were comparable to those in controls. Conclusions FA leads to prenatal changes in the neuroinflammatory response. This modulation of the cytokine response probably results in the protective inflammatory phenotype seen when combining FA and PA and may have significant implications for preventing post-asphyctic perinatal encephalopathy. PMID:23351591

The Effect of Different Adjuvants on Immune Parameters and Protection following Vaccination of Sheep with a Larval-Specific Antigen of the Gastrointestinal Nematode, Haemonchus contortus

PubMed Central

Piedrafita, David; Preston, Sarah; Kemp, Joanna; de Veer, Michael; Sherrard, Jayne; Kraska, Troy; Elhay, Martin; Meeusen, Els

2013-01-01

It has recently been recognised that vaccine adjuvants play a critical role in directing the nature of a vaccine induced effector response. In the present study, several adjuvants were evaluated for their ability to protect sheep after field vaccination with the larval-specific Haemonchus contortus antigen, HcsL3. Using a suboptimal antigen dose, aluminium adjuvant was shown to reduce the cumulative faecal egg counts (cFEC) and worm burden by 23% and 25% respectively, in agreement with a previous study. The addition of Quil A to the aluminium-adjuvanted vaccine brought cFEC back to control levels. Vaccination with the adjuvant DEAE-dextran almost doubled the protection compared to the aluminium-adjuvanted vaccine resulting in 40% and 41% reduction in cFEC and worm counts compared to controls. Examination of skin responses following i.d. injection of exsheathed L3, revealed that cFEC was negatively correlated with wheal size and tissue eosinophils for the DEAE-dextran and aluminium-adjuvanted groups respectively. These studies have for the first time shown the potential of DEAE-dextran adjuvant for helminth vaccines, and discovered significant cellular correlates of vaccine-induced protection. PMID:24205209

The Protective Effect of Hydroalcoholic Extract of Zingiber officinale Roscoe (Ginger) on Ethanol-Induced Reproductive Toxicity in Male Rats.

PubMed

Akbari, Abolfazl; Nasiri, Khadijeh; Heydari, Mojtaba; Mosavat, Seyed Hamdollah; Iraji, Aida

2017-10-01

This study was conducted to evaluate the prophylactic effect of ginger extract on ethanol-induced reproductive toxicity in male rats. Twenty-eight adult male Sprague-Dawley rats were randomly divided into 4 groups and treated daily for 28 days as follows: control, control-ginger (1 g/kg of body weight [BW]/day by gavage), ethanol group (ethanol 4 g/kg of BW/day by gavage), and ginger-ethanol group. At the end of the experiment, all the rats were sacrificed and their testes were removed and used for measurement of the total homocysteine (tHcy), trace elements, antioxidant enzymes activity, and malondialdehyde (MDA). The results in the ethanol group indicate that ethanol decreased antioxidant enzymes activity and increased MDA and tHcy compared with the control groups ( P < .05). In ginger-ethanol group, ginger improved antioxidant enzymes activity and reduced tHcy and MDA compared to ethanol group ( P < .05). It can be concluded that ginger protects the ethanol-induced testicular damage and improves the hormonal levels, trace elements, antioxidant enzymes activity, and decreases tHcy and MDA.

Hypercapnic acidosis attenuates ventilation-induced lung injury by a nuclear factor-κB-dependent mechanism.

PubMed

Contreras, Maya; Ansari, Bilal; Curley, Gerard; Higgins, Brendan D; Hassett, Patrick; O'Toole, Daniel; Laffey, John G

2012-09-01

Hypercapnic acidosis protects against ventilation-induced lung injury. We wished to determine whether the beneficial effects of hypercapnic acidosis in reducing stretch-induced injury were mediated via inhibition of nuclear factor-κB, a key transcriptional regulator in inflammation, injury, and repair. Prospective randomized animal study. University research laboratory. Adult male Sprague-Dawley rats. In separate experimental series, the potential for hypercapnic acidosis to attenuate moderate and severe ventilation-induced lung injury was determined. In each series, following induction of anesthesia and tracheostomy, Sprague-Dawley rats were randomized to (normocapnia; FICO2 0.00) or (hypercapnic acidosis; FICO2 0.05), subjected to high stretch ventilation, and the severity of lung injury and indices of activation of the nuclear factor-κB pathway were assessed. Subsequent in vitro experiments examined the potential for hypercapnic acidosis to reduce pulmonary epithelial inflammation and injury induced by cyclic mechanical stretch. The role of the nuclear factor-κB pathway in hypercapnic acidosis-mediated protection from stretch injury was then determined. Hypercapnic acidosis attenuated moderate and severe ventilation-induced lung injury, as evidenced by improved oxygenation, compliance, and reduced histologic injury compared to normocapnic conditions. Hypercapnic acidosis reduced indices of inflammation such as interleukin-6 and bronchoalveolar lavage neutrophil infiltration. Hypercapnic acidosis reduced the decrement of the nuclear factor-κB inhibitor IκBα and reduced the generation of cytokine-induced neutrophil chemoattractant-1. Hypercapnic acidosis reduced cyclic mechanical stretch-induced nuclear factor-κB activation, reduced interleukin-8 production, and decreased epithelial injury and cell death compared to normocapnia. Hypercapnic acidosis attenuated ventilation-induced lung injury independent of injury severity and decreased mechanical stretch-induced epithelial injury and death, via a nuclear factor-κB-dependent mechanism.

Ischemia/reperfusion-induced injury of forebrain mitochondria and protection by ascorbate.

PubMed

Sciamanna, M A; Lee, C P

1993-09-01

Complete, reversible forebrain ischemia was induced with a seven-vessel occlusion rat model. Previous studies of ischemic (M. A. Sciamanna, J. Zinkel, A. Y. Fabi, and C. P. Lee, 1992, Biochim. Biophys. Acta 1134, 223-232) rat brain mitochondria (RBM) showed that ischemia of 30 min caused an approximately 60% decrease in State 3 respiratory rates with both succinate and NAD-linked substrates and also in energy-linked Ca2+ transport. No significant change was seen in the State 4 rates. The inhibition of respiration could be prevented by EGTA or ruthenium red. In this paper it is shown that reperfusion (5 h) following ischemia (30 min) further impaired RBM respiratory activities (succinate and NAD-linked substrates). The presence of EGTA or ruthenium red in the assay medium did not protect against ischemia/reperfusion-induced injury. The effects of ascorbate, an oxygen radical scavenger, were studied. RBM isolated from ascorbate-treated animals (0.8 mg ascorbate/kg body weight) after ischemia (30 min) alone showed only a slight increase in State 3 (approximately 25%) and a decrease in State 4 (approximately 20%) activities with succinate, when compared to untreated 30-min ischemic animals, whereas, with glutamate+malate little or no effect was seen. The respiratory activities of RBM from ascorbate-treated, ischemic/reperfused (30 min/5 h) rats were restored to approximately 65% of controls levels. Ascorbate protection was dose-dependent with maximum protection at 0.8 mg ascorbate/kg body weight of rat. The k of succinate oxidase-supported Ca2+ uptake also returned to 62% of control values. Protection by ascorbate was most effective when administered prior to the onset of ischemia and provided partial protection when administered after the onset of reperfusion. These results suggest that ischemia-induced injury is primarily mediated by disruption of cellular Ca2+ homeostasis, and reperfusion-induced injury by peroxidative events.

Influence of repetitive UVA stimulation on skin protection capacity and antioxidant efficacy.

PubMed

Rohr, Mathias; Rieger, Ingrid; Jain, Anil; Schrader, Andreas

2011-01-01

Topically applied antioxidants (AOs) are widely used in cosmetic products - especially in day and sun care - to help reduce oxidative stress caused by exogenous influences such as ultraviolet (UV) radiation. Despite several advances in recent years, little is known about the duration of protective effects by application of topical AOs, AO protection capacity (APC) or the activation of an endogenous protection capacity (EPC). By measuring oxidative-stress-induced photon emission of human skin in vivo with the ICL-S method (induced chemiluminescence of human skin), the protective effect of daily AO treatment for 2 weeks was examined on 4 consecutive days after treatment. UVA-dose-independent effects were investigated by decay curve intersection point analysis. In addition, chemiluminescence signal integration was used to investigate the influence of different UVA doses for stimulation on the determined APC as well as the modulation of the EPC by repetitive UVA stimulation both forming the skin protection capacity (SPC). The SPC showed a strong dependency on the UVA dose used for stimulation. AO pretreatment was more effective against lower UVA doses. Over the course of 4 days, the AO-induced SPC did not change significantly for a given UVA dose. Analyzing the decay curve intersection point for 2 different UVA doses, however, revealed a decrease in SPC with time. In addition, we found that a repetitive UVA irradiation of 1 J/cm(2) caused a statistically significant protective effect against UVA irradiation by stimulation of endogenous mechanisms. Topically supplemented AOs provide a protective effect against oxidative stress for at least 3 days, supporting their widespread use in cosmetic products. Especially their interaction with cutaneous protective mechanisms should be investigated in more detail for maximal protection, as endogenous defense mechanisms are already triggered by 2 low-dose UVA irradiations within 24 h. In summary, the in vivo measurement of UVA-induced cutaneous chemiluminescence permits the UVA-dose-independent determination of the AO efficacy for better comparability of the results while also taking endogenous defense mechanisms into account. Copyright © 2011 S. Karger AG, Basel.

Pancreatic protective and hypoglycemic effects of Vitex agnus-castus L. fruit hydroalcoholic extract in D-galactose-induced aging mouse model

PubMed Central

Ahangarpour, Akram; Oroojan, Ali Akbar; Khorsandi, Layasadat; Najimi, Seyedeh Asma

2017-01-01

D-galactose induces pancreatic disorder along with aging mouse model. Vitex agnus-castus (VAC) has potential pancreatic protective effect. Hence, this study was designed to evaluate the hypoglycemic and pancreas protective effects of VAC hydroalcoholic extract in D-galactose-induced aging female mice. In the present experimental study, 72 adult female Naval Medical Research Institute (NMRI) mice (weighing 30–35 g) were divided into 6 groups of control, VAC hydroalcoholic extract, D-galactose, D-galactose + VAC hydroalcoholic extract, aged, aged + VAC hydroalcoholic extract. The aged model was prepared by subcutaneous injection of D-galactose for 45 days and, VAC hydroalcoholic extract was gavaged twice a day in the last 7 days. 24 h after the last drug and extract administrations, serum samples and pancreatic tissues were removed to evaluate experimental and histological determinations. Serum glucose level decreased in VAC, D-galactose and, aged-treated groups compared to the control (P < 0.05). Insulin level increased in VAC and decreased in D-galactose and aged VAC-treated mice compared to the control (P < 0.05). Homeostasis model assessment-estimated insulin resistance (HOMA-IR) increased in D-galactose, aging, and VAC hydroalcoholic extract groups (P < 0.05) and, administration of VAC hydroalcoholic extract improved HOMA-IR in D-galactose and aging treated animals. Despite the size of pancreatic islets decreased in aged and D-galactose groups, VAC administration recovered it. Present data showed that VAC hydroalcoholic extract has hypoglycemic and pancreatic protective effects in natural aged and aging model mice. PMID:28515766

Pancreatic protective and hypoglycemic effects of Vitex agnus-castus L. fruit hydroalcoholic extract in D-galactose-induced aging mouse model.

PubMed

Ahangarpour, Akram; Oroojan, Ali Akbar; Khorsandi, Layasadat; Najimi, Seyedeh Asma

2017-04-01

D-galactose induces pancreatic disorder along with aging mouse model. Vitex agnus-castus (VAC) has potential pancreatic protective effect. Hence, this study was designed to evaluate the hypoglycemic and pancreas protective effects of VAC hydroalcoholic extract in D-galactose-induced aging female mice. In the present experimental study, 72 adult female Naval Medical Research Institute (NMRI) mice (weighing 30-35 g) were divided into 6 groups of control, VAC hydroalcoholic extract, D-galactose, D-galactose + VAC hydroalcoholic extract, aged, aged + VAC hydroalcoholic extract. The aged model was prepared by subcutaneous injection of D-galactose for 45 days and, VAC hydroalcoholic extract was gavaged twice a day in the last 7 days. 24 h after the last drug and extract administrations, serum samples and pancreatic tissues were removed to evaluate experimental and histological determinations. Serum glucose level decreased in VAC, D-galactose and, aged-treated groups compared to the control ( P < 0.05). Insulin level increased in VAC and decreased in D-galactose and aged VAC-treated mice compared to the control ( P < 0.05). Homeostasis model assessment-estimated insulin resistance (HOMA-IR) increased in D-galactose, aging, and VAC hydroalcoholic extract groups ( P < 0.05) and, administration of VAC hydroalcoholic extract improved HOMA-IR in D-galactose and aging treated animals. Despite the size of pancreatic islets decreased in aged and D-galactose groups, VAC administration recovered it. Present data showed that VAC hydroalcoholic extract has hypoglycemic and pancreatic protective effects in natural aged and aging model mice.

Moringa oleifera Lam. seed extract prevents fat diet induced oxidative stress in mice and protects liver cell-nuclei from hydroxyl radical mediated damage.

PubMed

Das, Nilanjan; Ganguli, Debdutta; Dey, Sanjit

2015-12-01

High fat diet (HFD) prompts metabolic pattern inducing reactive oxygen species (ROS) production in mitochondria thereby triggering multitude of chronic disorders in human. Antioxidants from plant sources may be an imperative remedy against this disorder. However, it requires scientific validation. In this study, we explored if (i) Moringa oleifera seed extract (MoSE) can neutralize ROS generated in HFD fed mice; (ii) protect cell-nuclei damage developed by Fenton reaction in vitro. Swiss mice were fed with HFD to develop oxidative stress model (HFD group). Other groups were control, seed extract alone treated, and MoSE simultaneously (HS) treated. Treatment period was of 15 days. Antioxidant enzymes with tissue nitrite content (TNC) and lipid peroxidation (LPO) were estimated from liver homogenate. HS group showed significantly higher (P < 0.05) superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), reduced glutathione (GSH) activity, and ferric reducing antioxidant power (FRAP) compared to only HFD fed group. Further, TNC and LPO decreased significantly (P < 0.05) in HS group compared to HFD fed group. MoSE also protected hepatocytes nuclei from the hydroxyl radicals generated by Fenton reaction. MoSE was found to be polyphenol rich with potent reducing power, free radicals and hydroxyl radicals scavenging activity. Thus, MoSE exhibited robust antioxidant prospective to neutralize ROS developed in HFD fed mice and also protected the nuclei damage from hydroxyl radicals. Hence, it can be used as herbal medication against HFD induced ROS mediated disorders.

Overexpression of the muscle-specific protein, melusin, protects from cardiac ischemia/reperfusion injury.

PubMed

Penna, Claudia; Brancaccio, Mara; Tullio, Francesca; Rubinetto, Cristina; Perrelli, Maria-Giulia; Angotti, Carmelina; Pagliaro, Pasquale; Tarone, Guido

2014-07-01

Melusin is a muscle-specific protein which interacts with β1 integrin cytoplasmic domain and acts as chaperone protein. Its overexpression induces improved resistance to cardiac overload delaying left ventricle dilation and reducing the occurrence of heart failure. Here, we investigated possible protective effect of melusin overexpression against acute ischemia/reperfusion (I/R) injury with or without Postconditioning cardioprotective maneuvers. Melusin transgenic (Mel-TG) mice hearts were subjected to 30-min global ischemia followed by 60-min reperfusion. Interestingly, infarct size was reduced in Mel-TG mice hearts compared to wild-type (WT) hearts (40.3 ± 3.5 % Mel-TG vs. 59.5 ± 3.8 % WT hearts; n = 11 animals/group; P < 0.05). The melusin protective effect was also demonstrated by measuring LDH release, which was 50 % lower in Mel-TG compared to WT. Mel-TG hearts had a higher baseline level of AKT, ERK1/2 and GSK3β phosphorylation, and displayed increased phospho-kinases level after I/R compared to WT mice. Post-ischemic Mel-TG hearts displayed also increased levels of the anti-apoptotic factor phospho-BAD. Importantly, pharmacological inhibition of PI3K/AKT (Wortmannin) and ERK1/2 (U0126) pathways abrogated the melusin protective effect. Notably, HSP90, a chaperone known to protect heart from I/R injury, showed high levels of expression in the heart of Mel-TG mice suggesting a possible collaboration of this molecule with AKT/ERK/GSK3β pathways in the melusin-induced protection. Postconditioning, known to activate AKT/ERK/GSK3β pathways, significantly reduced IS and LDH release in WT hearts, but had no additive protective effects in Mel-TG hearts. These findings implicate melusin as an enhancer of AKT and ERK pathways and as a novel player in cardioprotection from I/R injury.

Parthenolide Selectively Sensitizes Prostate Tumor Tissue to Radiotherapy while Protecting Healthy Tissues In Vivo.

PubMed

Morel, Katherine L; Ormsby, Rebecca J; Bezak, Eva; Sweeney, Christopher J; Sykes, Pamela J

2017-05-01

Radiotherapy is widely used in cancer treatment, however the benefits can be limited by radiation-induced damage to neighboring normal tissues. Parthenolide (PTL) exhibits anti-inflammatory and anti-tumor properties and selectively induces radiosensitivity in prostate cancer cell lines, while protecting primary prostate epithelial cell lines from radiation-induced damage. Low doses of radiation have also been shown to protect from subsequent high-dose-radiation-induced apoptosis as well as DNA damage. These properties of PTL and low-dose radiation could be used to improve radiotherapy by killing more tumor cells and less normal cells. Sixteen-week-old male Transgenic Adenocarcinoma of the Mouse Prostate (TRAMP) and C57BL/6J mice were treated with PTL (40 mg/kg), dimethylaminoparthenolide (DMAPT, a PTL analogue with increased bioavailability) (100 mg/kg), or vehicle control three times over one week prior to combinations of low (10 mGy) and high (6 Gy) doses of whole-body X-irradiation. Tissues were analyzed for apoptosis at a range of time points up to 72 h postirradiation. Both PTL and DMAPT protected normal tissues, but not prostate tumor tissues, from a significant proportion of high-dose-radiation-induced apoptosis. DMAPT provided superior protection compared to PTL in normal dorsolateral prostate (71.7% reduction, P = 0.026), spleen (48.2% reduction, P = 0.0001) and colorectal tissue (38.0% reduction, P = 0.0002), and doubled radiation-induced apoptosis in TRAMP prostate tumor tissue (101.3% increase, P = 0.039). Both drugs induced the greatest radiosensitivity in TRAMP prostate tissue in areas with higher grade prostatic intraepithelial neoplasia (PIN) lesions. A 10 mGy dose delivered 3 h prior to a 6 Gy dose induced a radioadaptive apoptosis response in normal C57Bl/6J prostate (28.4% reduction, P = 0.045) and normal TRAMP spleen (13.6% reduction, P = 0.047), however the low-dose-adaptive radioprotection did not significantly add to the PTL/DMAPT-induced protection in normal tissues, nor did it affect tumor kill. These results support the use of the more bioavailable DMAPT and low-dose radiation, alone or in combination as useful radioprotectors of normal tissues to alleviate radiotherapy-induced side-effects in patients. The enhanced radiosensitisation in prostate tissues displaying high-grade PIN suggests that DMAPT also holds promise for targeted therapy of advanced prostate cancer, which may go on to become metastatic. The redox mechanisms involved in the differential radioprotection observed here suggest that increased radiotherapy efficacy by DMAPT is more broadly applicable to a range of cancer types.

Vascular calcification abrogates the nicorandil mediated cardio-protection in ischemia reperfusion injury of rat heart.

PubMed

Ravindran, Sriram; Murali, Jeyashri; Amirthalingam, Sunil Kumar; Gopalakrishnan, Senthilkumar; Kurian, Gino A

2017-02-01

The present study was aimed to determine the efficacy of nicorandil in treating cardiac reperfusion injury with an underlying co-morbidity of vascular calcification (VC). Adenine diet was used to induce VC in Wistar rat and the heart was isolated to induce global ischemia reperfusion (IR) by Langendorff method, with and without the nicorandil (7.5mg/kg) pre-treatment and compared with those fed on normal diet. The adenine-treated rats displayed abnormal ECG changes and altered mitochondrial integrity compared to a normal rat heart. These hearts, when subjected to IR increased the infarct size, cardiac injury (measured by lactate dehydrogenase and creatine kinase activity in the coronary perfusate) and significantly altered the hemodynamics compared to the normal perfused heart. Nicorandil pretreatment in rat fed on normal diet enhanced the hemodynamics significantly (P<0.05) along with a substantial reduction in the mitochondrial dysfunction (measured by high ADP to oxygen consumption ratio, respiratory control ratio, enzyme activities and less swelling behavior) when subjected to IR. However, this cardio-protective effect of nicorandil was absent in rat heart with underlying calcification. Our results suggest that, the protective effect of nicorandil, a known mitochondrial ATP linked K + channel opener, against myocardial reperfusion injury was confined to normal rat heart. Copyright © 2017 Elsevier Inc. All rights reserved.

Protective effects of TES trioleate, an inhibitor of phospholipase A2, on reactive oxygen species and UVA-induced cell damage.

PubMed

Park, Soo Nam; Kim, Moon Jin; Ha, Ji Hoon; Lee, Nan Hee; Park, Jino; Lee, Jiwon; Kim, Dukha; Yoon, Chulsoo

2016-11-01

2-[Tris(oleoyloxymethyl)methylamino]-1-ethane sulfonic acid (TES trioleate) is an inhibitor of phospholipase A 2 (PLA2), which hydrolyzes cell membrane phospholipids to produce arachidonic acid (AA) and lysophospholipids (LysoPLs). Here, we investigated the protective effects of TES trioleate on cell damage caused by ultraviolet A (UVA) light and reactive oxygen species (ROS). Pre-incubation with 250-1000μM TES trioleate resulted in concentration-dependent protection from UVA-induced damage in HaCaT cells. Additionally, 25-1000μM TES trioleate provided protection against H 2 O 2 in a concentration-dependent manner. In human erythrocytes treated with 1 O 2 , 10-100μM TES trioleate showed concentration-dependent protective effects, similar to but stronger than the controls, 4-BPB and lipophilic antioxidant (+)-α-tocopherol at 100μM. TES trioleate did not have detectable radical scavenging activity. Moreover, compared with (+)-α-tocopherol and rutin, TES trioleate showed low ROS scavenging activity. Thus, although TES trioleate showed cell protective effects against UVA, H 2 O 2 , and 1 O 2 -induced damages, these effects were not caused by the scavenging ability of the radical or ROS. Finally, pretreatment of HaCaT cells and human erythrocytes with l-α-lysophosphatidylcholine produced by PLA2 promoted increased cell damage at low concentrations. Thus, the protective effects of TES trioleate on cellular damage by UVA and ROS may be associated with inhibition of PLA2-dependent cell damage rather than ROS scavenging. Copyright © 2016. Published by Elsevier B.V.

Preventive rather than therapeutic treatment with high fiber diet attenuates clinical and inflammatory markers of acute and chronic DSS-induced colitis in mice.

PubMed

Silveira, Ana Letícia Malheiros; Ferreira, Adaliene Versiani Matos; de Oliveira, Marina Chaves; Rachid, Milene Alvarenga; da Cunha Sousa, Larissa Fonseca; Dos Santos Martins, Flaviano; Gomes-Santos, Ana Cristina; Vieira, Angelica Thomaz; Teixeira, Mauro Martins

2017-02-01

Inflammatory bowel diseases (IBDs) are chronic inflammatory disorders with important impact on global health. Prebiotic and probiotic strategies are thought to be useful in the context of experimental IBD. Here, we compared the effects of preventive versus therapeutic treatment with a high fiber diet (prebiotic) in combination or not with Bifidobacterium longum (probiotic) in a murine model of chronic colitis. Colitis was induced by adding dextran sulfate sodium (DSS) to drinking water for 6 days (acute colitis) or for 5 cycles of DSS (chronic colitis). Administration of the high fiber diet protected from acute colitis. Protection was optimal when diet was started 20 days prior to DSS. A 5-day pretreatment with acetate, a short-chain fatty acid, provided partial protection against acute colitis. In chronic colitis, pretreatment with the high fiber diet attenuated clinical and inflammatory parameters of disease. However, when the treatment with the high fiber diet started after disease had been established, overall protection was minimal. Similarly, delayed treatment with acetate or B. longum did not provide any protection even when the probiotic was associated with the high fiber diet. Preventive use of a high fiber diet or acetate clearly protects mice against acute and chronic damage induced by DSS in mice. However, protection is lost when therapies are initiated after disease has been established. These results suggest that any therapy aimed at modifying the gut environment (e.g., prebiotic or probiotic strategies) should be given early in the course of disease.

Nitric oxide protects murine embryonic liver cells (BNL CL.2) from cytotoxicity induced by glucose deprivation.

PubMed

Pae, H O; Kim, H G; Paik, Y S; Paik, S G; Kim, Y M; Oh, G S; Chung, H T

2000-03-01

We investigated the protective effects of nitric oxide on cell death of murine embryonic liver cells (BNL CL.2) after glucose deprivation. Endogenous nitric oxide production by BNL CL.2 cells was induced by 6 hr pretreatment with interferon-gamma and lipopolysaccharide. We used sodium nitroprusside and S-nitroso-L-glutathione as exogenous nitric oxide-generating compounds. All agents were used at doses that did not show direct cytotoxicity as measured by crystal violet staining assay. In the BNL CL.2 cells, the viability dropped very steeply after 24 hr incubation with glucose-free media. Endogenous nitric oxide produced by treatment of the cells with interferon-gamma and lipopolysaccharide protected the cells from glucose deprivation-induced cytotoxicity, but did not protect them in the presence of the nitric oxide synthesis inhibitor, N(G)-monomethyl-L-arginine. Exogenous nitric oxide protected the cells from glucose deprivation-induced cytotoxicity in a concentration-dependent manner. Cytoprotection by nitric oxide donors was abolished by the use of nitric oxide scavenger, 2-phenyl-4,4,5,5,-tetramethylimidazole, but not by the soluble guanosine cyclase inhibitor, 1H-[1,2,4]oxadiazole[4,3-a]quinoxalin-1-one. In addition, cytoprotective effects comparable to endogenous or exogenous nitric oxide were not observed when the cells were incubated with dibutyl guanosine 3',5'-cyclic monophosphate. Based upon these results, we suggest that nitric oxide may enhance the cell survival of BNL CL.2 cells after glucose deprivation via a guanosine 3',5'-cyclic monophosphate-independent pathway.

Hamamelitannin from Hamamelis virginiana inhibits the tumour necrosis factor-alpha (TNF)-induced endothelial cell death in vitro.

PubMed

Habtemariam, Solomon

2002-01-01

The tumour necrosis factor-alpha (TNF) inhibitory activity of hamamelitannin from Hamamelis virginiana was investigated by assessing the TNF-mediated EAhy926 endothelial cell death and adhesiveness to monocytes. Treatment of the cells by TNF (25 ng/ml) and actinomycin D (0.1ng/ml) resulted in significant DNA fragmentation (34+/-0.6, n=4) and cytotoxicity (97+/-4.5%, n=6) following treatment for 8 and 24h, respectively. One to 100 microM concentrations of hamamelitannin inhibited the TNF-mediated endothelial cell death and DNA fragmentation in a dose-dependent manner. One hundred % protection against TNF-induced DNA fragmentation and cytotoxicity was obtained for hamamelitannin concentrations higher than 10 microM. The protective effect of hamamelitannin was comparable with that of a related compound epigallocatechin gallate while gallic acid was a weak protective agent (<40% protection). EAhy926 endothelial cells upregulated (by 4- to 7-fold) the surface expression of intercellular adhesion molecule-1 (ICAM-1) and adhesiveness to monocytic U937 cells after treatment with TNF (0.5ng/ml) for 6 or 24h. Concentrations (1-100 microM) of hamamelitannin that inhibited the TNF-mediated cell death and DNA fragmentation, however, failed to inhibit the TNF-induced ICAM-1 expression and EAhy926 cell adhesiveness to U937 cells. Thus, hamamelitannin inhibits the TNF-mediated endothelial cell death without altering the TNF-induced upregulation of endothelial adhesiveness. The observed anti-TNF activity of hamamelitannin may explain the antihamorrhaegic use of H. virginiana in traditional medicine and its claimed use as a protective agent for UV radiation.

Inhibition of N-methyl-D-aspartate receptors increases paraoxon-induced apoptosis in cultured neurons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu Xuan; Tian Feng; Okagaki, Peter

2005-10-01

Organophosphorus (OP) compounds, used as insecticides and chemical warfare agents, are potent neurotoxins. We examined the neurotoxic effect of paraoxon (O,O-diethyl O-p-nitrophenyl phosphate), an organophosphate compound, and the role of NMDA receptors as a mechanism of action in cultured cerebellar granule cells. Paraoxon is neurotoxic to cultured rat cerebellar granule cells in a time- and concentration-dependent manner. Cerebellar granule cells are less sensitive to the neurotoxic effects of paraoxon on day in vitro (DIV) 4 than neurons treated on DIV 8. Surprisingly, the N-methyl-D-aspartate (NMDA) receptor antagonist, MK-801, enhances paraoxon-mediated neurotoxicity suggesting that NMDA receptors may play a protective role.more » Pretreatment with a subtoxic concentration of N-methyl-D-aspartate (NMDA) [100 {mu}M] protects about 40% of the vulnerable neurons that would otherwise die from paraoxon-induced neurotoxicity. Moreover, addition of a neuroprotective concentration of NMDA 3 h after treatment with paraoxon provides the same level of protection. Because paraoxon-mediated neuronal cell death is time-dependent, we hypothesized that apoptosis may be involved. Paraoxon increases apoptosis about 10-fold compared to basal levels. The broad-spectrum caspase inhibitor (Boc-D-FMK) and the caspase-9-specific inhibitor (Z-LEHD-FMK) protect against paraoxon-mediated apoptosis, paraoxon-stimulated caspase-3 activity and neuronal cell death. MK-801 increases, whereas NMDA blocks paraoxon-induced apoptosis and paraoxon-stimulated caspase-3 activity. These results suggest that activation of NMDA receptors protect neurons against paraoxon-induced neurotoxicity by blocking apoptosis initiated by paraoxon.« less

Melatonin protects against the pathological cardiac hypertrophy induced by transverse aortic constriction through activating PGC-1β: In vivo and in vitro studies.

PubMed

Zhai, Mengen; Liu, Zhenhua; Zhang, Bin; Jing, Lin; Li, Buying; Li, Kaifeng; Chen, Xiuju; Zhang, Meng; Yu, Bo; Ren, Kai; Yang, Yang; Yi, Wei; Yang, Jian; Liu, Jincheng; Yi, Dinghua; Liang, Hongliang; Jin, Zhenxiao; Reiter, Russel J; Duan, Weixun; Yu, Shiqiang

2017-10-01

Melatonin, a circadian molecule secreted by the pineal gland, confers a protective role against cardiac hypertrophy induced by hyperthyroidism, chronic hypoxia, and isoproterenol. However, its role against pressure overload-induced cardiac hypertrophy and the underlying mechanisms remains elusive. In this study, we investigated the pharmacological effects of melatonin on pathological cardiac hypertrophy induced by transverse aortic constriction (TAC). Male C57BL/6 mice underwent TAC or sham surgery at day 0 and were then treated with melatonin (20 mg/kg/day, via drinking water) for 4 or 8 weeks. The 8-week survival rate following TAC surgery was significantly increased by melatonin. Melatonin treatment for 8 weeks markedly ameliorated cardiac hypertrophy. Compared with the TAC group, melatonin treatment for both 4 and 8 weeks reduced pulmonary congestion, upregulated the expression level of α-myosin heavy chain, downregulated the expression level of β-myosin heavy chain and atrial natriuretic peptide, and attenuated the degree of cardiac fibrosis. In addition, melatonin treatment slowed the deterioration of cardiac contractile function caused by pressure overload. These effects of melatonin were accompanied by a significant upregulation in the expression of peroxisome proliferator-activated receptor-gamma co-activator-1 beta (PGC-1β) and the inhibition of oxidative stress. In vitro studies showed that melatonin also protects against angiotensin II-induced cardiomyocyte hypertrophy and oxidative stress, which were largely abolished by knocking down the expression of PGC-1β using small interfering RNA. In summary, our results demonstrate that melatonin protects against pathological cardiac hypertrophy induced by pressure overload through activating PGC-1β. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Protective effects of amifostine and cyclooxygenase-1 inhibitor against normal human epidermal keratinocyte toxicity induced by methotrexate and 5-fluorouracil.

PubMed

Maiguma, Takayoshi; Kaji, Hiroaki; Makino, Kazutaka; Teshima, Daisuke

2009-07-01

Our study aimed to find more effective protective agents against mucosa toxicity induced by methotrexate and 5-fluorouracil. We focused on the relationship between oral mucositis and keratinocyte injury and examined methotrexate and 5-fluorouracil-induced cytotoxicity in normal human epidermal keratinocyte cell lines. Cell viability and superoxide radical activity were measured based on converting WST-1 (4-[3-(4-indophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzen disulfonate) to a water-soluble formazan dye. DNA synthesis by 5-bromo-2'-deoxyuridine incorporation was measured as an indirect parameter of cell proliferation. Allopurinol and amifostine were used as the radical scavengers. l-glutamine was used as a mucosa-protective agent. A cyclooxygenase inhibitor interrupting the production of hydroxyl radicals in the arachidonic acid cascade was also examined. 5-fluorouracil and methotrexate caused cytotoxicity due to the activation of intracellular superoxide radicals specifically on normal human epidermal keratinocytes. From the electron spin resonance study, it was found that allopurinol was a superoxide radical scavenger, while amifostine was hydroxyl radical scavenger. Allopurinol showed no effect on the cytotoxicity due to 5-fluorouracil and methotrexate. The cell injury induced by methotrexate was restored by amifostine. However, the cell injury induced by 5-fluorouracil was markedly recovered by a selective cyclooxygenase-1 inhibitor compared to amifostine. It was suggested that amifostine and cyclooxygenase-1 inhibitor could be useful protective agents against methotrexate and 5-fluorouracil chemotherapeutic toxicity. Additionally, this in vitro cell injury model using normal human epidermal keratinocytes may be useful for understanding the pathophysiology of oral mucositis induced by chemotherapeutic agents.

Protective effects of vitamin E and Cornus mas fruit extract on methotrexate-induced cytotoxicity in sperms of adult mice.

PubMed

Zarei, Leila; Sadrkhanlou, Rajabali; Shahrooz, Rasoul; Malekinejad, Hassan; Eilkhanizadeh, Behroz; Ahmadi, Abbas

2014-01-01

This study was aimed to assess the protective effects of Cornus mas fruit extract (CMFE) and vitamin E (Vit E) on sperm quality parameters in the methotrexate (MTX)-treated mice. Forty-eight young adult male mice (8-12 weeks) were randomly divided into six groups including control and test groups. The control group received normal saline orally , and the test groups were treated MTX (20 mg kg(-1), ip, once weekly), MTX + CMFE (250 mg kg(-1)), MTX + CMFE (500 mg kg(-1)), MTX + CMFE (1000 mg kg(-1)), and MTX + Vit E (100 IU kg(-1), po) for 35 consecutive days. On day 35, after euthanasia the epididymal sperms were isolated. Then the total mean sperm count, sperm viability and motility were determined. The total antioxidant capacity (TAOC) of all experimental groups were also evaluated. The MTX-treated animals showed a significant changes in all parameters of sperm quality assessment compared to the control group. Both Vit E and CMFE were able to protect from MTX-induced effects on sperm maturity and DNA damage. Co-administration of MTX and CMFE and/or Vit E resulted in protection from MTX-reduced TAOC. In conclusion, these data suggested that MTX administration could adversely affect the sperm quality. Moreover, the protective effect of Vit E and CMFE on MTX-induced sperm toxicity was also documented.

Targeted Overexpression of Inducible 6-Phosphofructo-2-kinase in Adipose Tissue Increases Fat Deposition but Protects against Diet-induced Insulin Resistance and Inflammatory Responses*

PubMed Central

Huo, Yuqing; Guo, Xin; Li, Honggui; Xu, Hang; Halim, Vera; Zhang, Weiyu; Wang, Huan; Fan, Yang-Yi; Ong, Kuok Teong; Woo, Shih-Lung; Chapkin, Robert S.; Mashek, Douglas G.; Chen, Yanming; Dong, Hui; Lu, Fuer; Wei, Lai; Wu, Chaodong

2012-01-01

Increasing evidence demonstrates the dissociation of fat deposition, the inflammatory response, and insulin resistance in the development of obesity-related metabolic diseases. As a regulatory enzyme of glycolysis, inducible 6-phosphofructo-2-kinase (iPFK2, encoded by PFKFB3) protects against diet-induced adipose tissue inflammatory response and systemic insulin resistance independently of adiposity. Using aP2-PFKFB3 transgenic (Tg) mice, we explored the ability of targeted adipocyte PFKFB3/iPFK2 overexpression to modulate diet-induced inflammatory responses and insulin resistance arising from fat deposition in both adipose and liver tissues. Compared with wild-type littermates (controls) on a high fat diet (HFD), Tg mice exhibited increased adiposity, decreased adipose inflammatory response, and improved insulin sensitivity. In a parallel pattern, HFD-fed Tg mice showed increased hepatic steatosis, decreased liver inflammatory response, and improved liver insulin sensitivity compared with controls. In both adipose and liver tissues, increased fat deposition was associated with lipid profile alterations characterized by an increase in palmitoleate. Additionally, plasma lipid profiles also displayed an increase in palmitoleate in HFD-Tg mice compared with controls. In cultured 3T3-L1 adipocytes, overexpression of PFKFB3/iPFK2 recapitulated metabolic and inflammatory changes observed in adipose tissue of Tg mice. Upon treatment with conditioned medium from iPFK2-overexpressing adipocytes, mouse primary hepatocytes displayed metabolic and inflammatory responses that were similar to those observed in livers of Tg mice. Together, these data demonstrate a unique role for PFKFB3/iPFK2 in adipocytes with regard to diet-induced inflammatory responses in both adipose and liver tissues. PMID:22556414

Interleukin-18 gene deletion protects against sepsis-induced cardiac dysfunction by inhibiting PP2A activity.

PubMed

Okuhara, Yoshitaka; Yokoe, Shunichi; Iwasaku, Toshihiro; Eguchi, Akiyo; Nishimura, Koichi; Li, Wen; Oboshi, Makiko; Naito, Yoshiro; Mano, Toshiaki; Asahi, Michio; Okamura, Haruki; Masuyama, Tohru; Hirotani, Shinichi

2017-09-15

Interleukin-18 (IL-18) neutralization protects against lipopolysaccharide (LPS)-induced injuries, including myocardial dysfunction. However, the mechanism is yet to be fully elucidated. The aim of the present study was to determine whether IL-18 gene deletion prevents sepsis-induced cardiac dysfunction and to elucidate the potential mechanisms underlying IL-18-mediated cardiotoxicity by LPS. Ten-week-old male wild-type (WT) and IL-18 knockout (IL-18 KO) mice were intraperitoneally administered LPS. Serial echocardiography showed better systolic pump function and less left ventricular (LV) dilatation in LPS-treated IL-18 KO mice compared with those in LPS-treated WT mice. LPS treatment significantly decreased the levels of phospholamban (PLN) and Akt phosphorylation in WT mice compared with those in saline-treated WT mice, while the LPS-induced decrease in the phosphorylation levels was attenuated in IL-18 KO mice compared with that in WT mice. IL-18 gene deletion also attenuated an LPS-induced increase of type 2 protein phosphatase 2A (PP2A) activity, a molecule that dephosphorylates PLN and Akt. There was no difference in type 1 protein phosphatase (PP1) activity. To address whether IL-18 affects PLN and Akt phosphorylation via PP2A activation in cardiomyocytes, rat neonatal cardiac myocytes were cultured and stimulated using 100ng/ml of recombinant rat IL-18. Exogenous IL-18 decreased the level of PLN and Akt phosphorylation in cardiomyocytes. PP2A activity but not PP1 activity was increased by IL-18 stimulation in cardiomyocytes. IL-18 plays a pivotal role in advancing sepsis-induced cardiac dysfunction, and the mechanisms underlying IL-18-mediated cardiotoxicity potentially involve the regulation of PLN and Akt phosphorylation through PP2A activity. Copyright © 2017 Elsevier B.V. All rights reserved.

Anti-inflammatory agents and monoHER protect against DOX-induced cardiotoxicity and accumulation of CML in mice

PubMed Central

Bruynzeel, A M E; Abou El Hassan, M A; Schalkwijk, C; Berkhof, J; Bast, A; Niessen, H W M; van der Vijgh, W J F

2007-01-01

Cardiac damage is the major limiting factor for the clinical use of doxorubicin (DOX). Preclinical studies indicate that inflammatory effects may be involved in DOX-induced cardiotoxicity. Nɛ-(carboxymethyl) lysine (CML) is suggested to be generated subsequent to oxidative stress, including inflammation. Therefore, the aim of this study was to investigate whether CML increased in the heart after DOX and whether anti-inflammatory agents reduced this effect in addition to their possible protection on DOX-induced cardiotoxicity. These effects were compared with those of the potential cardioprotector 7-monohydroxyethylrutoside (monoHER). BALB/c mice were treated with saline, DOX alone or DOX preceded by ketoprofen (KP), dexamethasone (DEX) or monoHER. Cardiac damage was evaluated according to Billingham. Nɛ-(carboxymethyl) lysine was quantified immunohistochemically. Compared to saline, a 21.6-fold increase of damaged cardiomyocytes was observed in mice treated with DOX (P<0.001). Addition of KP, DEX or monoHER before DOX significantly reduced the mean ratio of abnormal cardiomyocytes in comparison to mice treated with DOX alone (P⩽0.02). In addition, DOX induced a significant increase in the number of CML-stained intramyocardial vessels per mm2 (P=0.001) and also in the intensity of CML staining (P=0.001) compared with the saline-treated group. Nɛ-(carboxymethyl) lysine positivity was significantly reduced (P⩽0.01) by DOX-DEX, DOX-KP and DOX-monoHER. These results confirm that inflammation plays a role in DOX-induced cardiotoxicity, which is strengthened by the observed DOX-induced accumulation of CML, which can be reduced by anti-inflammatory agents and monoHER. PMID:17325706

Olive leaf extracts protect cardiomyocytes against 4-hydroxynonenal-induced toxicity in vitro: comparison with oleuropein, hydroxytyrosol, and quercetin.

PubMed

Bali, Elif Burcu; Ergin, Volkan; Rackova, Lucia; Bayraktar, Oğuz; Küçükboyaci, Nurgün; Karasu, Çimen

2014-08-01

Olive (Olea europaea) leaf, an important traditional herbal medicine, displays cardioprotection that may be related to the cellular redox modulating effects of its polyphenolic constituents. This study was undertaken to investigate the protective effect of the ethanolic and methanolic extracts of olive leaves compared to the effects of oleuropein, hydroxytyrosol, and quercetin as a positive standard in a carbonyl compound (4-hydroxynonenal)-induced model of oxidative damage to rat cardiomyocytes (H9c2). Cell viability was detected by the MTT assay; reactive oxygen species production was assessed by the 2',7'-dichlorodihydrofluorescein diacetate method, and the mitochondrial membrane potential was determined using a JC-1 dye kit. Phospho-Hsp27 (Ser82), phospho-MAPKAPK-2 (Thr334), phospho-c-Jun (Ser73), cleaved-caspase-3 (cl-CASP3) (Asp175), and phospho-SAPK/JNK (Thr183/Tyr185) were measured by Western blotting. The ethanolic and methanolic extracts of olive leaves inhibited 4-hydroxynonenal-induced apoptosis, characterized by increased reactive oxygen species production, impaired viability (LD50: 25 µM), mitochondrial dysfunction, and activation of pro-apoptotic cl-CASP3. The ethanolic and methanolic extracts of olive leaves also inhibited 4-hydroxynonenal-induced phosphorylation of stress-activated transcription factors, and the effects of extracts on p-SAPK/JNK, p-Hsp27, and p-MAPKAPK-2 were found to be concentration-dependent and comparable with oleuropein, hydroxytyrosol, and quercetin. While the methanolic extract downregulated 4-hydroxynonenal-induced p-MAPKAPK-2 and p-c-Jun more than the ethanolic extract, it exerted a less inhibitory effect than the ethanolic extract on 4-hydroxynonenal-induced p-SAPK/JNK and p-Hsp27. cl-CASP3 and p-Hsp27 were attenuated, especially by quercetin. Experiments showed a predominant reactive oxygen species inhibitory and mitochondrial protecting ability at a concentration of 1-10 µg/mL of each extract, oleuropein, hydroxytyrosol, and quercetin. The ethanolic extract of olive leaves, which contains larger amounts of oleuropein, hydroxytyrosol, verbascoside, luteolin, and quercetin (by HPLC) than the methanolic one, has more protecting ability on cardiomyocyte viability than the methanolic extract or each phenolic compound against 4-hydroxynonenal-induced carbonyl stress and toxicity. Georg Thieme Verlag KG Stuttgart · New York.

The ability of lens alpha crystallin to protect against heat-induced aggregation is age-dependent

NASA Technical Reports Server (NTRS)

Horwitz, J.; Emmons, T.; Takemoto, L.; Spooner, B. S. (Principal Investigator)

1992-01-01

Alpha crystallin was prepared from newborn and aged bovine lenses. SDS-PAGE and tryptic peptide mapping demonstrated that both preparations contained only the alpha-A and alpha-B chains, with no significant contamination of other crystallins. Compared with alpha crystallin from the aged lens, alpha crystallin from the newborn lens was much more effective in the inhibition of beta L crystallin denaturation and precipitation induced in vitro by heat. Together, these results demonstrate that during the aging process, the alpha crystallins lose their ability to protect against protein denaturation, consistent with the hypothesis that the alpha crystallins play an important role in the maintenance of protein native structure in the intact lens.

Antioxidant mechanism is involved in the gastroprotective effects of ozonized sunflower oil in ethanol-induced ulcers in rats.

PubMed

Zamora Rodríguez, Zullyt B; González Alvarez, Ricardo; Guanche, Dailén; Merino, Nelson; Hernández Rosales, Frank; Menéndez Cepero, Silvia; Alonso González, Yaima; Schulz, Siegfried

2007-01-01

This research was performed in order to determine the potential protective effects of ozonized sunflower oil (OSO) in the injury of rat gastric mucosa induced by absolute ethanol and as well as to elucidate the role of reactive oxygen species (ROS), lipid peroxidation, and some important constituents of antioxidant defense such as superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and catalase (CAT) in these effects. OSO was administered to rats intragastrically by a cannula and it was applied during four days to animals. The doses of OSO administered daily to each group of rats were 4, 12, and 24 mg/kg, respectively, and one hour after the last treatment, absolute ethanol (1 mL/200 mg body weight) was administered. Our results showed that gastric ulcer index was significantly reduced in rats pretreated with OSO as compared with ethanol-treated controls. However, in rats pretreated with OSO, no significant reduction of TBARS content in gastric mucosa was found as compared to those rats treated with ethanol alone. In contrast, SOD and GSH-Px activities were significantly increased in gastric mucosa of OSO-pretreated rats with respect to those treated with ethanol alone. In summary, our results demonstrate that OSO pretreatment exerts protective effects in ethanol-induced gastric ulcers in rats. Furthermore, these results provide evidence that these protective effects of OSO are mediated at least partially by stimulation of some important antioxidant enzymes such as SOD and GSH-Px, which are scavengers of ROS and therefore prevent gastric injury induced by them.

Antioxidant Mechanism is Involved in the Gastroprotective Effects of Ozonized Sunflower Oil in Ethanol-Induced Ulcers in Rats

PubMed Central

Rodríguez, Zullyt B. Zamora; Álvarez, Ricardo González; Guanche, Dailén; Merino, Nelson; Rosales, Frank Hernández; Cepero, Silvia Menéndez; González, Yaima Alonso; Schulz, Siegfried

2007-01-01

This research was performed in order to determine the potential protective effects of ozonized sunflower oil (OSO) in the injury of rat gastric mucosa induced by absolute ethanol and as well as to elucidate the role of reactive oxygen species (ROS), lipid peroxidation, and some important constituents of antioxidant defense such as superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and catalase (CAT) in these effects. OSO was administered to rats intragastrically by a cannula and it was applied during four days to animals. The doses of OSO administered daily to each group of rats were 4, 12, and 24 mg/kg, respectively, and one hour after the last treatment, absolute ethanol (1 mL/200 mg body weight) was administered. Our results showed that gastric ulcer index was significantly reduced in rats pretreated with OSO as compared with ethanol-treated controls. However, in rats pretreated with OSO, no significant reduction of TBARS content in gastric mucosa was found as compared to those rats treated with ethanol alone. In contrast, SOD and GSH-Px activities were significantly increased in gastric mucosa of OSO-pretreated rats with respect to those treated with ethanol alone. In summary, our results demonstrate that OSO pretreatment exerts protective effects in ethanol-induced gastric ulcers in rats. Furthermore, these results provide evidence that these protective effects of OSO are mediated at least partially by stimulation of some important antioxidant enzymes such as SOD and GSH-Px, which are scavengers of ROS and therefore prevent gastric injury induced by them. PMID:17497036

NYVAC vector modified by C7L viral gene insertion improves T cell immune responses and effectiveness against leishmaniasis.

PubMed

Sánchez-Sampedro, L; Mejías-Pérez, E; S Sorzano, Carlos Óscar; Nájera, J L; Esteban, M

2016-07-15

The NYVAC poxvirus vector is used as vaccine candidate for HIV and other diseases, although there is only limited experimental information on its immunogenicity and effectiveness for use against human pathogens. Here we defined the selective advantage of NYVAC vectors in a mouse model by comparing the immune responses and protection induced by vectors that express the LACK (Leishmania-activated C-kinase antigen), alone or with insertion of the viral host range gene C7L that allows the virus to replicate in human cells. Using DNA prime/virus boost protocols, we show that replication-competent NYVAC-LACK that expresses C7L (NYVAC-LACK-C7L) induced higher-magnitude polyfunctional CD8(+) and CD4(+) primary adaptive and effector memory T cell responses (IFNγ, TNFα, IL-2, CD107a) to LACK antigen than non-replicating NYVAC-LACK. Compared to NYVAC-LACK, the NYVAC-LACK-C7L-induced CD8(+) T cell population also showed higher proliferation when stimulated with LACK antigen. After a challenge by subcutaneous Leishmania major metacyclic promastigotes, NYVAC-LACK-C7L-vaccinated mouse groups showed greater protection than the NYVAC-LACK-vaccinated group. Our results indicate that the type and potency of immune responses induced by LACK-expressing NYVAC vectors is improved by insertion of the C7L gene, and that a replication-competent vector as a vaccine renders greater protection against a human pathogen than a non-replicating vector. Copyright © 2016 Elsevier B.V. All rights reserved.

Protective effect of mitochondrial-targeted antioxidant MitoQ against iron ion 56Fe radiation induced brain injury in mice.

PubMed

Gan, Lu; Wang, Zhenhua; Si, Jing; Zhou, Rong; Sun, Chao; Liu, Yang; Ye, Yancheng; Zhang, Yanshan; Liu, Zhiyuan; Zhang, Hong

2018-02-15

Exposure to iron ion 56 Fe radiation (IR) during space missions poses a significant risk to the central nervous system and radiation exposure is intimately linked to the production of reactive oxygen species (ROS). MitoQ is a mitochondria-targeted antioxidant that has been shown to decrease oxidative damage and lower mitochondrial ROS in a number of animal models. Therefore, the present study aimed to investigate role of the mitochondrial targeted antioxidant MitoQ against 56 Fe particle irradiation-induced oxidative damage and mitochondria dysfunction in the mouse brains. Increased ROS levels were observed in mouse brains after IR compared with the control group. Enhanced ROS production leads to disruption of cellular antioxidant defense systems, mitochondrial respiration dysfunction, altered mitochondria dynamics and increased release of cytochrome c (cyto c) from mitochondria into cytosol resulting in apoptotic cell death. MitoQ reduced IR-induced oxidative stress (decreased ROS production and increased SOD, CAT activities) with decreased lipid peroxidation as well as reduced protein and DNA oxidation. MitoQ also protected mitochondrial respiration after IR. In addition, MitoQ increased the expression of mitofusin2 (Mfn2) and optic atrophy gene1 (OPA1), and decreased the expression of dynamic-like protein (Drp1). MitoQ also suppressed mitochondrial DNA damage, cyto c release, and caspase-3 activity in IR-treated mice compared to the control group. These results demonstrate that MitoQ may protect against IR-induced brain injury. Copyright © 2018 Elsevier Inc. All rights reserved.

Synthetic Lignan Secoisolariciresinol Diglucoside (LGM2605) Reduces Asbestos-Induced Cytotoxicity in an Nrf2-Dependent and -Independent Manner.

PubMed

Pietrofesa, Ralph A; Chatterjee, Shampa; Park, Kyewon; Arguiri, Evguenia; Albelda, Steven M; Christofidou-Solomidou, Melpo

2018-03-02

Asbestos exposure triggers inflammatory processes associated with oxidative stress and tissue damage linked to malignancy. LGM2605 is the synthetic lignan secoisolariciresinol diglucoside (SDG) with free radical scavenging, antioxidant, and anti-inflammatory properties in diverse inflammatory cell and mouse models, including exposure to asbestos fibers. Nuclear factor-E2 related factor 2 (Nrf2) activation and boosting of endogenous tissue defenses were associated with the protective action of LGM2605 from asbestos-induced cellular damage. To elucidate the role of Nrf2 induction by LGM2605 in protection from asbestos-induced cellular damage, we evaluated LGM2605 in asbestos-exposed macrophages from wild-type (WT) and Nrf2 disrupted (Nrf2 - / - ) mice. Cells were pretreated with LGM2605 (50 µM and 100 µM) and exposed to asbestos fibers (20 µg/cm²) and evaluated 8 h and 24 h later for inflammasome activation, secreted cytokine levels (interleukin-1β (IL-1β), interleukin-18 (IL-18), interleukin-6 (IL-6), and tumor necrosis factor alpha (TNFα)), cytotoxicity and cell death, nitrosative stress, and Nrf2-regulated enzyme levels. Asbestos exposure induced robust oxidative and nitrosative stress, cell death and cytotoxicity, which were equally mitigated by LGM2605. Inflammasome activation was significantly attenuated in Nrf2 -/- macrophages compared to WT, and the protective action of LGM2605 was seen only in WT cells. In conclusion, in a cell model of asbestos-induced toxicity, LGM2605 acts via protective mechanisms that may not involve Nrf2 activation.

Synthetic Lignan Secoisolariciresinol Diglucoside (LGM2605) Reduces Asbestos-Induced Cytotoxicity in an Nrf2-Dependent and -Independent Manner

PubMed Central

Pietrofesa, Ralph A.; Chatterjee, Shampa; Park, Kyewon; Arguiri, Evguenia; Albelda, Steven M.; Christofidou-Solomidou, Melpo

2018-01-01

Asbestos exposure triggers inflammatory processes associated with oxidative stress and tissue damage linked to malignancy. LGM2605 is the synthetic lignan secoisolariciresinol diglucoside (SDG) with free radical scavenging, antioxidant, and anti-inflammatory properties in diverse inflammatory cell and mouse models, including exposure to asbestos fibers. Nuclear factor-E2 related factor 2 (Nrf2) activation and boosting of endogenous tissue defenses were associated with the protective action of LGM2605 from asbestos-induced cellular damage. To elucidate the role of Nrf2 induction by LGM2605 in protection from asbestos-induced cellular damage, we evaluated LGM2605 in asbestos-exposed macrophages from wild-type (WT) and Nrf2 disrupted (Nrf2−/−) mice. Cells were pretreated with LGM2605 (50 µM and 100 µM) and exposed to asbestos fibers (20 µg/cm2) and evaluated 8 h and 24 h later for inflammasome activation, secreted cytokine levels (interleukin-1β (IL-1β), interleukin-18 (IL-18), interleukin-6 (IL-6), and tumor necrosis factor alpha (TNFα)), cytotoxicity and cell death, nitrosative stress, and Nrf2-regulated enzyme levels. Asbestos exposure induced robust oxidative and nitrosative stress, cell death and cytotoxicity, which were equally mitigated by LGM2605. Inflammasome activation was significantly attenuated in Nrf2−/− macrophages compared to WT, and the protective action of LGM2605 was seen only in WT cells. In conclusion, in a cell model of asbestos-induced toxicity, LGM2605 acts via protective mechanisms that may not involve Nrf2 activation. PMID:29498660

Epigallocatechin-3-gallate (EGCG) protects skin cells from ionizing radiation via heme oxygenase-1 (HO-1) overexpression.

PubMed

Zhu, Wei; Xu, Jing; Ge, Yangyang; Cao, Han; Ge, Xin; Luo, Judong; Xue, Jiao; Yang, Hongying; Zhang, Shuyu; Cao, Jianping

2014-11-01

Epigallocatechin-3-gallate (EGCG), the major polyphenolic constituent of green tea, is a potent antioxidant and free radical scavenger that may have therapeutic applications for the treatment of many disorders. Radiation therapy is widely used for the treatment of various types of cancers; however, radiation-induced skin injury remains a serious concern. EGCG has not yet been reported as protecting skin cells against ionizing radiation. In the present study, we investigated whether EGCG confers cytoprotection against ionizing radiation. We found that, compared with the control, pretreatment with EGCG significantly enhanced the viability of human skin cells that were irradiated with X-rays, and decreased apoptosis induced by X-ray irradiation. Mito-Tracker assay showed that EGCG suppressed the damage to mitochondria induced by ionizing radiation via upregulation of SOD2. Reactive oxygen species (ROS) in HaCaT cells were significantly reduced when pretreated with EGCG before irradiation. Radiation-induced γH2AX foci, which are representative of DNA double-strand breaks, were decreased by pretreatment with EGCG. Furthermore, EGCG induced the expression of the cytoprotective molecule heme oxygenase-1 (HO-1) in a dose-dependent manner via transcriptional activation. HO-1 knockdown or treatment with the HO-1 inhibitor tin protoporphyrin (SnPPIX) reversed the protective role of EGCG, indicating an important role for HO-1. These results suggest that EGCG offers a new strategy for protecting skin against ionizing radiation. © The Author 2014. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

DNA vaccines encoding proteins from wild-type and attenuated canine distemper virus protect equally well against wild-type virus challenge.

PubMed

Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete

2012-10-01

Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.

Adaptive governance and institutional strategies for climate-induced community relocations in Alaska.

PubMed

Bronen, Robin; Chapin, F Stuart

2013-06-04

This article presents governance and institutional strategies for climate-induced community relocations. In Alaska, repeated extreme weather events coupled with climate change-induced coastal erosion impact the habitability of entire communities. Community residents and government agencies concur that relocation is the only adaptation strategy that can protect lives and infrastructure. Community relocation stretches the financial and institutional capacity of existing governance institutions. Based on a comparative analysis of three Alaskan communities, Kivalina, Newtok, and Shishmaref, which have chosen to relocate, we examine the institutional constraints to relocation in the United States. We identify policy changes and components of a toolkit that can facilitate community-based adaptation when environmental events threaten people's lives and protection in place is not possible. Policy changes include amendment of the Stafford Act to include gradual geophysical processes, such as erosion, in the statutory definition of disaster and the creation of an adaptive governance framework to allow communities a continuum of responses from protection in place to community relocation. Key components of the toolkit are local leadership and integration of social and ecological well-being into adaptation planning.

Novel trans-Ferulic Acid Derivatives Containing a Chalcone Moiety as Potential Activator for Plant Resistance Induction.

PubMed

Gan, Xiuhai; Hu, Deyu; Wang, Yanjiao; Yu, Lu; Song, Baoan

2017-06-07

A series of novel trans-ferulic acid derivatives containing a chalcone moiety were designed and synthesized to induce plant resistance. Antiviral activities of the compounds were evaluated. Bioassay results demonstrated that compounds F3, F6, F17, and F27 showed remarkable curative, protective, and inactivating activities against tobacco mosaic virus (TMV). With a 50% effective concentration (EC 50 ) value of 98.78 μg mL -1 , compound F27 exhibited the best protective activity compared with trans-ferulic acid (328.6 μg mL -1 ), dufulin (385.6 μg mL -1 ), and ningnanmycin (241.3 μg mL -1 ). This protective ability was associated with potentiation of defense-related enzyme activity and activation of photosynthesis of tobacco at an early stage. This notion was confirmed by up-regulated expression of stress responses and photosynthesis regulating proteins. This work revealed that F27 can induce resistance and enhance plant tolerance to TMV infection. Hence, F27 can be considered as a novel activator for inducing plant resistance.

Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies.

PubMed

Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent; Pertoldi, Cino; Blixenkrone-Møller, Merete

2015-03-10

Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits with CDV DNA vaccines. Virus neutralising (VN) antibody responses were induced in mink kits vaccinated with a plasmid encoding the haemaglutinin protein (H) of CDV (n=5, pCDV-H) or a combination of the H, fusion (F) and nucleoprotein (N) of CDV (n=5, pCDV-HFN). These DNA vaccinated kits were protected against virulent experimental infection with field strains of CDV. The pCDV-H was more efficient in inducing protective immunity in the presence of maternal antibodies compared to the pCDV-HFN. The results show that DNA vaccination with the pCDV-H or pCDV-HFN (n=4) only given once at 5 days of age induces virus specific immune response in neonatal mink and protection against virulent CDV exposure later in life. Copyright © 2015 Elsevier Ltd. All rights reserved.

Noise Levels Associated With New York City's Mass Transit Systems

PubMed Central

Gershon, Robyn R. M.; Zeltser, Marina; Canton, Allison; Akram, Muhammad

2009-01-01

Objectives. We measured noise levels associated with various forms of mass transit and compared them to exposure guidelines designed to protect against noise-induced hearing loss. Methods. We used noise dosimetry to measure time-integrated noise levels in a representative sample of New York City mass transit systems (subways, buses, ferries, tramway, and commuter railways) aboard transit vehicles and at vehicle boarding platforms or terminals during June and July 2007. Results. Of the transit types evaluated, subway cars and platforms had the highest associated equivalent continuous average (Leq) and maximum noise levels. All transit types had Leq levels appreciably above 70 A-weighted decibels, the threshold at which noise-induced hearing loss is considered possible. Conclusions. Mass transit noise exposure has the potential to exceed limits recommended by the World Health Organization and the US Environmental Protection Agency and thus cause noise-induced hearing loss among riders of all forms of mass transit given sufficient exposure durations. Environmental noise–control efforts in mass transit and, in cases in which controls are infeasible, the use of personal hearing protection would benefit the ridership's hearing health. PMID:19542046

Sequestosome1/p62 protects mouse embryonic fibroblasts against low-dose methylercury-induced cytotoxicity and is involved in clearance of ubiquitinated proteins.

PubMed

Takanezawa, Yasukazu; Nakamura, Ryosuke; Harada, Ryohei; Sone, Yuka; Uraguchi, Shimpei; Kiyono, Masako

2017-12-01

Methylmercury (MeHg) is a widely distributed environmental pollutant that causes a series of cytotoxic effects. However, molecular mechanisms underlying MeHg toxicity are not fully understood. Here, we report that sequestosome1/p62 protects mouse embryonic fibroblasts (MEFs) against low-dose MeHg cytotoxicity via clearance of MeHg-induced ubiquitinated proteins. p62 mRNA and protein expression in MEFs were temporally induced by MeHg exposure p62-deficient MEFs exhibited higher sensitivity to MeHg exposure compared to their wild-type (WT) counterparts. An earlier and higher level of accumulation of ubiquitinated proteins was detected in p62-deficient cells compared with WT MEFs. Confocal microscopy revealed that p62 and ubiquitinated proteins co-localized in the perinuclear region of MEFs following MeHg treatment. Further analysis of MEFs revealed that ubiquitinated proteins co-localized with LC3-positive puncta upon co-treatment with MeHg and chloroquine, an autophagy inhibitor. In contrast, there was minimal co-localization in p62-deficient MEFs. The present study, for the first time, examined the expression and distribution of p62 and ubiquitinated proteins in cells exposed to low-dose MeHg. Our findings suggest that p62 is crucial for cytoprotection against MeHg-induced toxicity and is required for MeHg-induced ubiquitinated protein clearance.

Attenuation of stress-induced gastric lesions by lansoprazole, PD-136450 and ranitidine in rats.

PubMed

Chandranath, S I; Bastaki, S M A; D'Souza, A; Adem, A; Singh, J

2011-03-01

Combining restraint with cold temperature (4°C) consistently induces gastric ulceration in rats after 3.5 h. The cold restraint-stress (CRS) method provides a suitable model for acute ulcer investigations. This study compares the antiulcer activities of lansoprazole (a proton pump inhibitor), PD-136450 (CCK(2)/gastrin receptor antagonist) and ranitidine (histamine H(2) receptor antagonist) on CRS-induced gastric ulcers in rats. The results have shown that lansoprazole, which is a potent anti-secretory agent, provides complete protection in this model of ulcer formation. The use of indomethacin pretreatment to inhibit the prostaglandin (PG) synthesis and N(G)-nitro L-arginine methyl ester (L-NAME) pretreatment to inhibit nitric oxide synthase did not alter the lansoprazole-induced inhibition of ulcer index obtained in the untreated Wistar rats indicating that these two systems were not involved in the activation of lansoprazole. PD-136450, an effective anti-secretory agent against gastrin- but not dimaprit-induced stimulation, evoked a dose-dependent inhibition of CRS-induced gastric ulcers. The results show that both PG and nitric oxide pathways can influence the inhibitory effect of PD-136450 against CRS-induced gastric ulcer. The antiulcer activities of both lansoprazole and PD-136450 were compared to that of ranitidine. The results showed that ranitidine was more potent than lansoprazole and PD-136450 in inhibiting CRS-induced gastric ulcers and its effect was shown to be influenced by PG as well as nitric oxide synthase. The results of this study have demonstrated that although lansoprazole, PD-136450 and ranitidine were protective against CRS-induced gastric ulcers, the antiulcer activities of PD-136450 and ranitidine involved both PG and nitric oxide pathways, while lansoprazole acted independently of these two systems during CRS.

NOX2 Deficiency Protects Against Streptozotocin-Induced β-Cell Destruction and Development of Diabetes in Mice

PubMed Central

Xiang, Fu-Li; Lu, Xiangru; Strutt, Brenda; Hill, David J.; Feng, Qingping

2010-01-01

OBJECTIVE The role of NOX2-containing NADPH oxidase in the development of diabetes is not fully understood. We hypothesized that NOX2 deficiency decreases reactive oxygen species (ROS) production and immune response and protects against streptozotocin (STZ)-induced β-cell destruction and development of diabetes in mice. RESEARCH DESIGN AND METHODS Five groups of mice—wild-type (WT), NOX2−/−, WT treated with apocynin, and WT adoptively transferred with NOX2−/− or WT splenocytes—were treated with multiple-low-dose STZ. Blood glucose and insulin levels were monitored, and an intraperitoneal glucose tolerance test was performed. Isolated WT and NOX2−/− pancreatic islets were treated with cytokines for 48 h. RESULTS Significantly lower blood glucose levels, higher insulin levels, and better glucose tolerance was observed in NOX2−/− mice and in WT mice adoptively transferred with NOX2−/− splenocytes compared with the respective control groups after STZ treatment. Compared with WT, β-cell apoptosis, as determined by TUNEL staining, and insulitis were significantly decreased, whereas β-cell mass was significantly increased in NOX2−/− mice. In response to cytokine stimulation, ROS production was significantly decreased, and insulin secretion was preserved in NOX2−/− compared with WT islets. Furthermore, proinflammatory cytokine release induced by concanavalin A was significantly decreased in NOX2−/− compared with WT splenocytes. CONCLUSIONS NOX2 deficiency decreases β-cell destruction and preserves islet function in STZ-induced diabetes by reducing ROS production, immune response, and β-cell apoptosis. PMID:20627937

Protective effects of sildenafil citrate administration on cisplatin-induced ovarian damage in rats.

PubMed

Taskin, Mine Islimye; Yay, Arzu; Adali, Ertan; Balcioglu, Esra; Inceboz, Umit

2015-04-01

The aim of this study is to evaluate the effects of sildenafil citrate on cisplatin-induced ovarian toxicity. Thirty-two female rats were divided into four groups. Group 1: saline control; group 2: cisplatin; group 3: sildenafil citrate; and group 4: cisplatin plus sildenafil citrate group. In groups 2 and 4, the rats were injected with 5 mg/kg cisplatin intraperitoneally (i.p.). In groups 3 and 4, the rats were injected with 1.4 mg/kg sildenafil citrate i.p. The ovaries were removed two weeks later in all groups. Histopathologic examination, follicle counting and classification were performed. The expression of anti-Müllerian hormone (AMH) was detected immunohistochemically in the ovarian tissues. Sildenafil alleviated cisplatin-induced histopathological changes in the ovarian tissue. Primordial, secondary and tertiary follicles were diminished in group 2 compared with group 1 (p < 0.05). Pretreatment with sildenafil citrate preserved primordial follicle count in group 4 compared with group 2, and the difference was statistically significant (p < 0.05). According to our results, immunoreactivity intensity of AMH was lower in group 2 compared with group 1 (92.4 ± 3.97 versus 88.8 ± 1.77) but not significantly, whereas immunoreactivity intensity of AMH was higher in group 4 compared with group 2 (88.8 ± 1.77 versus 94.1 ± 2.36; p < 0.05). Our results demonstrated that pretreatment with sildenafil citrate is beneficial for protecting the ovaries from cisplatin-induced damage. Sildenafil citrate can be a choice for fertility preservation.

Rapamycin protects against paraquat-induced pulmonary fibrosis: Activation of Nrf2 signaling pathway.

PubMed

Xu, Yiheng; Tai, Wenlin; Qu, Xiaoyuan; Wu, Wenjuan; Li, ZhenKun; Deng, Shuhao; Vongphouttha, Chanthasone; Dong, Zhaoxing

2017-08-19

Paraquat (PQ) is a widely used herbicide indeveloping countries worldwide, and pulmonary fibrosis is one of the most typical features of PQ poisoning. The molecular mechanism of PQ toxicity especially how to treat PQ-induced pulmonary fibrosis is still largely unknown. In animal model of pulmonary fibrosis, we used HE staining, western blotting assay and Real-time PCR assay to analyze the effects of rapamycin on the PQ-induced epithelial mesenchymal transition (EMT). We found that PQ induced the pulmonary fibrosis using HE staining and Masson's staining, and up-regulated the activity of HYP and the mRNA expressions of Collagen I and III (COL-1and COL-3) in pulmonary tissues. We also found that rapamycin down-regulated the mesenchymal cell marker Vimentin and up-regulated the epithelial cell marker E-cadherin both in mRNA and protein levels compared with PQ group. And the EMT associated transcription factor Snail was decreased by rapamycin treatment compared with PQ group. And PQ decreased the Nrf2 expression both in mRNA and protein levels, and rapamycin inhibited these effects of PQ. SFN, a activator of Nrf2, could inhibit the EMT and the expression of Snail. And knockdowon of Nrf2 could abolish the inhibitory effects of rapamycin of PQ-induced EMT. In conclusion, rapamycin protects against paraquat-induced pulmonary fibrosis by activation of Nrf2 signaling pathway. Copyright © 2017 Elsevier Inc. All rights reserved.

Protective effects and mechanisms of curcumin on podophyllotoxin toxicity in vitro and in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Juan; Dai, Cai-Xia; Sun, Hua

2012-12-01

Podophyllotoxin (POD) is a naturally occurring lignan with pronounced antineoplastic and antiviral properties. POD binds to tubulin and prevents the formation of mitotic spindle. Although cases of overdose or accidental ingestion are quite often, no specific therapy is currently available to treat the POD intoxication. In the current investigation, the protective effects and mechanisms of curcumin (CUR) on podophyllotoxin toxicity were evaluated in vitro and in vivo. The results showed that CUR could protect POD-induced cytotoxicity by recovering the G2/M arrest and decrease the changes of membrane potential and microtubule structure in Vero cells. A significant decrease of mortality ratesmore » was observed in Swiss mice treated by intragastrical administration of POD + CUR as compared with POD alone. The POD + CUR group also exhibited decreases in plasma transaminases, alkaline phosphatase, lactate dehydrogenase, plasma urea, creatinine and malondialdehyde level but elevated superoxide dismutase and glutathione levels as compared to the POD group. Histological examination of the liver and kidney demonstrated less morphological changes in the treatment of POD + CUR as compared with POD alone. The mechanism of the protective effects might be due to the competitive binding of CUR with POD in the same colchicines binding site as revealed by the tubulin polymerization assay and the molecular docking analysis, and the antioxidant activity against the oxidative stress induced by POD. In summary, both in vitro and in vivo data indicated the promising role of CUR as a protective agent against the POD poisoning. Highlights: ► A potential antidote to treat the podophyllotoxin (POD) intoxication is found. ► Curcumin showed promising effects against POD poisoning in vitro and in vivo. ► The mechanisms lie in the antioxidant activity and competitive binding with tubulin.« less

Comparison of the protective effect of formoterol and of salmeterol against exercise-induced bronchospasm when given immediately before a cycloergometric test.

PubMed

Ferrari, Marcello; Segattini, Carlo; Zanon, Roberto; Bertaiola, Mariano; Balestreri, Filippo; Brotto, Emanuele; Lo Cascio, Vincenzo

2002-01-01

Salmeterol and formoterol, two long-acting beta(2)-adrenergic agonists, have been shown to be effective against exercise-induced bronchospasm (EIB) several hours after inhalation, but no study has yet compared their protective effect immediately after administration. To compare the protective effect of inhaled formoterol and salmeterol against EIB immediately and 4 h after administration. Double-blind, two-period cross-over study of 11 EIB-positive asthmatic subjects (mean age 21.2 years) administered formoterol 24 microg and salmeterol 50 microg by means of metered-dose inhalers (MDIs) on 2 days separated by an interval of 72 h; the subjects performed two cycloergometric exercise tests immediately and 4 h after dosing. Forced expiratory volume (FEV(1)) measurements were made before and at the end of exercise, and then after 3, 5, 10, 15, 20, 25 and 30 min. The maximum percentage decrease in FEV(1) in the 30 min following exercise was considered. Immediately after drug administration, but not 4 h later, formoterol provided significantly better protection against EIB than salmeterol (p = 0.02). The number of formoterol-treated subjects protected against EIB (i.e. with a <15% decrease in FEV(1) after treatment) was 10/11 after the first exercise test and 7/8 after the second; the corresponding figures after salmeterol treatment were 5/11 and 7/8. Our results show that formoterol inhaled via an MDI is effective in preventing EIB as early as within a few minutes of administration, whereas salmeterol does not offer any appreciable protection. On the contrary, the protective effect of the two drugs is clinically equivalent 4 h after administration. Copyright 2002 S. Karger AG, Basel

Protective effect of [6]-gingerol on the ethanol-induced teratogenesis of cultured mouse embryos.

PubMed

Yon, Jung-Min; Baek, In-Jeoung; Lee, Se-Ra; Kim, Mi-Ra; Hong, Jin Tae; Yong, Hwanyul; Lee, Beom Jun; Yun, Young Won; Nam, Sang-Yoon

2012-01-01

Excessive ethanol consumption during pregnancy causes fetal alcohol syndrome. We investigated the effect of [6]-gingerol on ethanol-induced embryotoxicity using a whole embryo culture system. The morphological changes of embryos and the gene expression patterns of the antioxidant enzymes cytosolic glutathione peroxidase (cGPx), cytoplasmic Cu/Zn superoxide dismutase (SOD1), and Mn-SOD (SOD2), and SOD activity were examined in the cultured mouse embryos exposed to ethanol (5 μL/3 mL) and/or [6]-gingerol (1×10(-8) or 1×10(-7) μg/mL) for 2 days. In ethanol-exposed embryos, the standard morphological score of embryos was significantly decreased compared with those of the control (vehicle) group. However, cotreatment of embryos with [6]-gingerol and ethanol significantly improved all of the developmental parameters except crownrump length and head length, compared with those of the ethanol alone group. The mRNA expression levels of cGPx and SOD2, not SOD1, were decreased consistently, SOD activity were significantly decreased compared with the control group. However, the decreases in mRNA levels of antioxidant enzymes and SOD activity were significantly restored to the control levels by [6]-gingerol supplement. These results indicate that [6]-gingerol has a protective effect against ethanol-induced teratogenicity during mouse embryogenesis.

Effects of losartan on experimental varicocele-induced testicular germ cell apoptosis.

PubMed

Bolat, D; Oltulu, F; Uysal, A; Kose, T; Gunlusoy, B; Yigitturk, G; Turk, N S; Turan, T

2016-09-01

To investigate the potential protective effects of losartan on varicocele-induced germ cell apoptosis, 24 adult male Sprague Dawley rats were divided into three groups: a sham operation was performed in SHAM group, and experimental left varicocele was created in VAR and VAR + LOS groups. Additionally, in VAR + LOS group, losartan was administered for 30 days starting on the day of surgery. At the end of 30 days, all animals were sacrificed and left orchiectomy was performed. Testicular injury and spermatogenesis were evaluated according to Johnsen scoring system. To assess the nitrosative stress, immunohistochemical staining for endothelial nitric oxide synthase was used and evaluated by H-score and apoptotic index (AI) of germ cells was analysed by TUNEL method. A significant decrease in the mean Johnsen score (JS) was observed in VAR group compared with SHAM (p < .001). The mean H-score and AI were significantly higher in VAR group compared with SHAM (p < .001). After losartan administration, mean JS was significantly increased (p < .001) and mean H-score and AI were significantly decreased compared with VAR group (p < .001 and .01, respectively). Findings of this suggest that losartan acts as a potent protective agent against varicocele-induced germ cell apoptosis. © 2016 Blackwell Verlag GmbH.

Acidic polysaccharide of Panax ginseng as a defense against small intestinal damage by whole-body gamma irradiation of mice.

PubMed

Park, Eunjin; Hwang, Insun; Song, Jie-Young; Jee, Youngheun

2011-01-01

An acidic polysaccharide of Panax ginseng (APG), ginsan, has been reported to protect the hematopoietic system by increasing the number of bone marrow cells and spleen cells. Therefore, we evaluated the ability of APG to protect mice from radiation-induced damage of the small intestine. APG treatment caused the lengthening of villi and a numerical increase of crypt cells in the small intestine at 3.5 days after 7Gy irradiation compared to irradiated, non-treated controls. In addition, APG significantly inhibited irradiation-induced apoptosis by decreasing the amount of pro-apoptotic p53 and Bax as well as augmenting that of anti-apoptotic Bcl-2 at 24h after irradiation. These results indicate that APG might be a useful adjunct to therapeutic irradiation as a protective agent for the gastrointestinal tract of cancer patients. Copyright © 2009 Elsevier GmbH. All rights reserved.

Protective effect of soybeans as protein source in the diet against cadmium-aorta redox and morphological alteration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pérez Díaz, Matías F.F.; Acosta, Mariano; Mohamed, Fabián H.

We investigated the effects of cadmium exposition on thoracic aorta redox status and morphology, and the putative protective effect of soybeans in the diet. Male Wistar rats were separated into 6 groups: 3 fed with a diet containing casein and 3 containing soybeans, as protein source. Within each protein group, one was given tap water (control) and the other two tap water containing 15 and 100 ppm of Cd{sup 2+}, respectively, for two months. In rats fed with casein diet, 15 ppm of Cd induced an increase of thiobarbituric acid-reactive substances (TBARS), and of the catalase (CAT) and glutathione peroxidasemore » (GPx) activities, which were even higher with 100 ppm of Cd{sup 2+}, in aorta. Also, 100 ppm Cd{sup 2+} exposure increased superoxide dismutase (CuZnSOD) activity; CAT, GPX, SOD, Nrf2 and metallothioneine II mRNA expressions and CAT, GPx and NOX-2 protein levels, compared with control. Aorta endothelial and cytoplasmic alterations were observed. However, with the soybeans diet, 15 and 100 ppm of Cd{sup 2+} did not modify TBARS levels; CAT, GPX and Nrf2 mRNA expressions; CAT, GPx and NOX-2 protein; and the aorta morphology, compared with control. The soybean diet attenuates the redox changes and protects against morphological alterations induced, in a dose-dependent way, by Cd in aorta. - Highlights: • Under casein diet, 100 ppm Cd{sup 2+} in drinking water induces oxidative stress in aorta. • Under casein diet, 100 ppm Cd{sup 2+} increases Nrf2, MT II and NOX2 expressions in aorta. • Under casein diet, 100 ppm Cd{sup 2+} induces morphological changes in rat aorta. • The soybean diet attenuates the redox changes induced by Cd in rat aorta. • The soybean diet attenuates morphological alterations induced by Cd in rat aorta.« less

Protective Effect of Highly Polymeric A-Type Proanthocyanidins from Seed Shells of Japanese Horse Chestnut (Aesculus turbinata BLUME) against Light-Induced Oxidative Damage in Rat Retina

PubMed Central

Ishihara, Tomoe; Kaidzu, Sachiko; Kimura, Hideto; Koyama, Yasurou; Matsuoka, Yotaro

2018-01-01

Retinal tissue is exposed to oxidative stress caused by visible light. Light-damaged rat used in age-related macular degeneration (AMD) studies clarified that antioxidants decrease retinal light damage. Albino rats were exposed to 5000 Lux light for 12 h with oral administration of the polyphenolic compounds fraction (PF) from the seed shells of Japanese horse chestnut (30 mg/kg, 100 mg/kg, and 300 mg/kg body weight: BW). To evaluate the protective effects against light damage, electroretinograms (ERGs), the outer nuclear layer (ONL) thickness, the antioxidant activity of plasma, oxidized retinal lipids, and the detection of apoptosis were examined. To reveal their active compounds, PF were separated into an A-type proanthocyanidin (PAF) and a flavonol O-glycosides fraction. The protective effects of these fractions against light damage were compared by measuring the thickness of the ERGs and ONL. Compared with the negative control, the PF group (100 mg/kg and 300 mg/kg BW) significantly suppressed the decrease of the ERG amplitudes and ONL thickness. PF (300 mg/kg BW) induced the elevation of in vivo antioxidant activity, and the suppression of retinal lipid oxidation. PF administration also suppressed apoptotic cell death. The protective effects against light damage were attributable to the antioxidant activity of PAF. The light-induced damage of retinas was protected by oral administration of PF and PAF. Taken together, these compounds are potentially useful for the prevention of the disease caused by light exposure. Highlights: The protective effects of retinal damage by light exposure were evaluated using polyphenolic compounds from the seed shells of Japanese horse chestnut (Aesculus turbinata BLUME) as an antioxidant. Decreases in the electroretinographic amplitude and outer nuclear layer thickness were suppressed by the polyphenolic compounds of the seed shells. Polyphenolic compounds from the seed shells of Japanese horse chestnut inhibited the oxidation of retinal lipids. Highly polymeric A-type proanthocyanidin from the seed shells protected the rat retina from light exposure damage by inhibiting oxidative stress and apoptotic mechanisms. PMID:29748512

Protective Effect of Highly Polymeric A-Type Proanthocyanidins from Seed Shells of Japanese Horse Chestnut (Aesculus turbinata BLUME) against Light-Induced Oxidative Damage in Rat Retina.

PubMed

Ishihara, Tomoe; Kaidzu, Sachiko; Kimura, Hideto; Koyama, Yasurou; Matsuoka, Yotaro; Ohira, Akihiro

2018-05-10

Retinal tissue is exposed to oxidative stress caused by visible light. Light-damaged rat used in age-related macular degeneration (AMD) studies clarified that antioxidants decrease retinal light damage. Albino rats were exposed to 5000 Lux light for 12 h with oral administration of the polyphenolic compounds fraction (PF) from the seed shells of Japanese horse chestnut (30 mg/kg, 100 mg/kg, and 300 mg/kg body weight: BW). To evaluate the protective effects against light damage, electroretinograms (ERGs), the outer nuclear layer (ONL) thickness, the antioxidant activity of plasma, oxidized retinal lipids, and the detection of apoptosis were examined. To reveal their active compounds, PF were separated into an A-type proanthocyanidin (PAF) and a flavonol O -glycosides fraction. The protective effects of these fractions against light damage were compared by measuring the thickness of the ERGs and ONL. Compared with the negative control, the PF group (100 mg/kg and 300 mg/kg BW) significantly suppressed the decrease of the ERG amplitudes and ONL thickness. PF (300 mg/kg BW) induced the elevation of in vivo antioxidant activity, and the suppression of retinal lipid oxidation. PF administration also suppressed apoptotic cell death. The protective effects against light damage were attributable to the antioxidant activity of PAF. The light-induced damage of retinas was protected by oral administration of PF and PAF. Taken together, these compounds are potentially useful for the prevention of the disease caused by light exposure. The protective effects of retinal damage by light exposure were evaluated using polyphenolic compounds from the seed shells of Japanese horse chestnut ( Aesculus turbinata BLUME) as an antioxidant. Decreases in the electroretinographic amplitude and outer nuclear layer thickness were suppressed by the polyphenolic compounds of the seed shells. Polyphenolic compounds from the seed shells of Japanese horse chestnut inhibited the oxidation of retinal lipids. Highly polymeric A-type proanthocyanidin from the seed shells protected the rat retina from light exposure damage by inhibiting oxidative stress and apoptotic mechanisms.

Hepatoprotective effects of setarud against carbon tetrachloride-induced liver injury in rats.

PubMed

Khorshid, Hamid Reza Khorram; Azonov, Jahan A; Novitsky, Yury A; Farzamfar, Bardia; Shahhosseiny, Mohammad Hassan

2008-01-01

To assess the hepatoprotective activity of a new herbal drug "setarud" in experimental liver fibrosis, 48 male Wistar rats were divided into four groups: controls, carbon tetrachloride (CCl4) group, and two treatment groups that received CCl4 and setarud at doses of 0.02 or 0.04 g/Kg/day for 30 days. Body weight gain, biochemical liver tests, bile flow rate and composition, and changes in liver morphology in the four groups were studied. CCl4 administration led to morphological and biochemical evidence of liver injury as compared to untreated controls. Setarud administration led to significant protection against CCl4-induced changes in body weight gain, liver morphology, bile flow and concentration. It was also associated with significantly lower serum liver enzyme levels (p<0.01), higher serum albumin level, and reduced increase in narcotic-induced sleeping time. Thus, setarud showed protective activity against CCl4-induced hepatotoxicity in rats. Further studies of its efficacy in liver disease are warranted.

Radiation-induced transmethylation and transsulfuration in the system DNA-methionine

NASA Astrophysics Data System (ADS)

Köhnlein, W.; Merwitz, O.; Ohneseit, P.

Evidence is presented for the radiation-induced transmethylation and transsulfuration in a DNA-methionine model system. The extent of such alkylation of DNA is found to be comparable with that of alkylating agents. Therefore, both processes could be initial steps in radiation carcinogenesis. The protective effect of methionine on DNA strand breaks, due to scavenging of OH radicals, causes the formation of methyl and thiyl radicals.

Perilla Oil Has Similar Protective Effects of Fish Oil on High-Fat Diet-Induced Nonalcoholic Fatty Liver Disease and Gut Dysbiosis.

PubMed

Tian, Yu; Wang, Hualin; Yuan, Fahu; Li, Na; Huang, Qiang; He, Lei; Wang, Limei; Liu, Zhiguo

2016-01-01

Nonalcoholic fatty liver disease (NAFLD) is the most prevalent chronic liver disease in developed countries. Recent studies indicated that the modification of gut microbiota plays an important role in the progression from simple steatosis to steatohepatitis. Epidemiological studies have demonstrated consumption of fish oil or perilla oil rich in n-3 polyunsaturated fatty acids (PUFAs) protects against NAFLD. However, the underlying mechanisms remain unclear. In the present study, we adopted 16s rRNA amplicon sequencing technique to investigate the impacts of fish oil and perilla oil on gut microbiomes modification in rats with high-fat diet- (HFD-) induced NAFLD. Both fish oil and perilla oil ameliorated HFD-induced hepatic steatosis and inflammation. In comparison with the low-fat control diet, HFD feeding significantly reduced the relative abundance of Gram-positive bacteria in the gut, which was slightly reversed by either fish oil or perilla oil. Additionally, fish oil and perilla oil consumption abrogated the elevated abundance of Prevotella and Escherichia in the gut from HFD fed animals. Interestingly, the relative abundance of antiobese Akkermansia was remarkably increased only in animals fed fish oil compared with HFD group. In conclusion, compared with fish oil, perilla oil has similar but slightly weaker potency against HFD-induced NAFLD and gut dysbiosis.

Protective Effect of Ethanolic Extract of Tabernaemontana divaricata (L.) R. Br. against DEN and Fe NTA Induced Liver Necrosis in Wistar Albino Rats

PubMed Central

2014-01-01

This study is an attempt to evaluate the hepatoprotective activity of Tabernaemontana divaricata against DEN and Fe NTA induced liver necrosis in rats. Ethanolic extract of the whole plant of Tabernaemontana divaricata at doses of 200 and 400 mg/kg body weight and 5-fluorouracil (standard drug) was orally administered to male Wistar Albino rats once daily for 24 weeks, simultaneously treated with the carcinogen DEN and Fe NTA. In simultaneously treated animals, the plant extract significantly decreased the levels of uric acid, bilirubin, AST, ALT, and ALP in serum and increased the levels of liver marker enzymes in liver. Treatment with the extracts resulted in a significant increase in the levels of antioxidants accompanied by a marked reduction in the levels of malondialdehyde when compared to DEN and Fe NTA treated group. When compared with 200 mg/kg bw rats, 400 mg/kg bw rats and 5-fluorouracil treated rats showed better results in all the parameters. The histopathological studies confirmed the protective effects of extract against DEN and Fe NTA induced liver necrosis. Thus, it could be concluded that the use of Tabernaemontana divaricata extract in the treatment of carcinogen induced hepatic necrosis. PMID:25136566

In vitro assessment of six aspiration catheters using a distal protection filter.

PubMed

Fujimura, Tatsuhiro; Okamura, Takayuki; Ando, Miyuki; Uchida, Kousuke; Tone, Takashi; Yonezawa, Fumio; Yano, Masafumi

2016-01-01

We assessed performance of 6 aspiration catheters for distal embolization using a distal protection filter in an in vitro experiment. In acute myocardial infarction, a distal protection filter is used for lesions likely to induce a distal embolism. Which aspiration cathether is most effective when used with a distal protection filter remains still unclear. A 0.5-cm3 bolus of gelatin as a model of stagnant pools of coronary plaque debris was captured in the distal protection filter and aspirated by 6 aspiration catheters. We measured and compared the length of the suspended embolus matter. Among the 6 catheters evaluated, the use of the Export Advance catheter (Medtronic) resulted in significantly shorter lengths of the suspended embolus matter compared to the use of the TVAC II (Nipro), Thrombuster III SL (Kaneka), and Rebirth Pro (Goodman) catheters (p < 0.01). The residual embolus matter in all cases had drained distally to the distal protection filter when the filter was retrieved. The use of the Export Advance catheter showed better performance using a distal protection filter in this in vitro experiment, and its use might be more effective in preventing distal embolisms in combination with a distal protection filter.

Nephroprotective Effect of Bauhinia tomentosa Linn against Cisplatin-Induced Renal Damage.

PubMed

Kannan, Narayanan; Sakthivel, Kunnathur Murugesan; Guruvayoorappan, Chandrasekaran

2016-01-01

Cisplatin (CP) is an important chemotherapeutic drug used for the treatment of a wide variety of solid tumors. However, clinical use of CP has been limited due to its adverse effect of nephrotoxicity. In the present study, we evaluate the nephroprotective effect of Bauhinia tomentosa against CP-induced renal damage in rats. Administration of methonolic extract of B. tomentosa (250 mg/kg b.w.) results in a significant increase in antioxidant enzymes including superoxide dismutase (SOD), glutathione (GSH), and catalase (CAT). Furthermore, treatment with B. tomentosa increased body weight and relative organ weight when compared with that of the CP-induced control group. Moreover, treatment with B. tomentosa extract significantly decreased lipid peroxidation(LPO), serum urea, and creatinine when compared with the CP-induced control group. Thus, the present study highlights the potential role of B. tomentosa and its use as a new protective strategy against CP-induced nephrotoxicity.

A Japanese Encephalitis Virus Vaccine Inducing Antibodies Strongly Enhancing In Vitro Infection Is Protective in Pigs

PubMed Central

García-Nicolás, Obdulio; Ricklin, Meret E.; Liniger, Matthias; Vielle, Nathalie J.; Python, Sylvie; Souque, Philippe; Charneau, Pierre; Summerfield, Artur

2017-01-01

The Japanese encephalitis virus (JEV) is responsible for zoonotic severe viral encephalitis transmitted by Culex mosquitoes. Although birds are reservoirs, pigs play a role as amplifying hosts, and are affected in particular through reproductive failure. Here, we show that a lentiviral JEV vector, expressing JEV prM and E proteins (TRIP/JEV.prME), but not JEV infection induces strong antibody-dependent enhancement (ADE) activities for infection of macrophages. Such antibodies strongly promoted infection via Fc receptors. ADE was found at both neutralizing and non-neutralizing serum dilutions. Nevertheless, in vivo JEV challenge of pigs demonstrated comparable protection induced by the TRIP/JEV.prME vaccine or heterologous JEV infection. Thus, either ADE antibodies cause no harm in the presence of neutralizing antibodies or may even have protective effects in vivo in pigs. Additionally, we found that both pre-infected and vaccinated pigs were not fully protected as low levels of viral RNA were found in lymphoid and nervous system tissue in some animals. Strikingly, the virus from the pre-infection persisted in the tonsils throughout the experiment. Finally, despite the vaccination challenge, viral RNA was detected in the oronasal swabs in all vaccinated pigs. These latter data are relevant when JEV vaccination is employed in pigs. PMID:28531165

Electrochemically Reduced Water Protects Neural Cells from Oxidative Damage

PubMed Central

Hamasaki, Takeki; Kinjo, Tomoya; Nakamichi, Noboru; Teruya, Kiichiro; Kabayama, Shigeru

2014-01-01

Aging-related neurodegenerative disorders are closely associated with mitochondrial dysfunction and oxidative stresses and their incidence tends to increase with aging. Brain is the most vulnerable to reactive species generated by a higher rate of oxygen consumption and glucose utilization compared to other organs. Electrochemically reduced water (ERW) was demonstrated to scavenge reactive oxygen species (ROS) in several cell types. In the present study, the protective effect of ERW against hydrogen peroxide (H2O2) and nitric oxide (NO) was investigated in several rodent neuronal cell lines and primary cells. ERW was found to significantly suppress H2O2 (50–200 μM) induced PC12 and SFME cell deaths. ERW scavenged intracellular ROS and exhibited a protective effect against neuronal network damage caused by 200 μM H2O2 in N1E-115 cells. ERW significantly suppressed NO-induced cytotoxicity in PC12 cells despite the fact that it did not have the ability to scavenge intracellular NO. ERW significantly suppressed both glutamate induced Ca2+ influx and the resulting cytotoxicity in primary cells. These results collectively demonstrated for the first time that ERW protects several types of neuronal cells by scavenging ROS because of the presence of hydrogen and platinum nanoparticles dissolved in ERW. PMID:25383141

Genetic immunization based on the ubiquitin-fusion degradation pathway against Trypanosoma cruzi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chou, Bin; Department of Parasitology, Graduate School of Medical Science, Kyushu University, Fukuoka 812-8582; Hiromatsu, Kenji, E-mail: khiromatsu@fukuoka-u.ac.jp

2010-02-12

Cytotoxic CD8{sup +} T cells are particularly important to the development of protective immunity against the intracellular protozoan parasite, Trypanosoma cruzi, the etiological agent of Chagas disease. We have developed a new effective strategy of genetic immunization by activating CD8{sup +} T cells through the ubiquitin-fusion degradation (UFD) pathway. We constructed expression plasmids encoding the amastigote surface protein-2 (ASP-2) of T. cruzi. To induce the UFD pathway, a chimeric gene encoding ubiquitin fused to ASP-2 (pUB-ASP-2) was constructed. Mice immunized with pUB-ASP-2 presented lower parasitemia and longer survival period, compared with mice immunized with pASP-2 alone. Depletion of CD8{sup +}more » T cells abolished protection against T. cruzi in mice immunized with pUB-ASP-2 while depletion of CD4{sup +} T cells did not influence the effective immunity. Mice deficient in LMP2 or LMP7, subunits of immunoproteasomes, were not able to develop protective immunity induced. These results suggest that ubiquitin-fused antigens expressed in antigen-presenting cells were effectively degraded via the UFD pathway, and subsequently activated CD8{sup +} T cells. Consequently, immunization with pUB-ASP-2 was able to induce potent protective immunity against infection of T. cruzi.« less

Momordica charantia polysaccharides mitigate the progression of STZ induced diabetic nephropathy in rats.

PubMed

Raish, Mohammad; Ahmad, Ajaz; Jan, Basit L; Alkharfy, Khalid M; Ansari, Mushtaq Ahmad; Mohsin, Kazi; Jenoobi, Fahad Al; Al-Mohizea, Abdullah

2016-10-01

Diabetic nephropathy (DN) has become a primary cause of end-stage kidney disease. Several complex dynamics converge together to accelerate the advancement of DN. The present investigation was postulated to explore the mechanism of reno-protective nature of Momordica Charantia polysaccharides (MCP) by evaluating the anti-hyperglycemic, anti-lipidemic as well as markers for oxidative stress and antioxidant proficiency in streptozotocin (STZ)-induced diabetic rats. The oral administration of MCP showed a significant normalization in the levels of kidney function test in the STZ-induced diabetic rats. The levels of blood urea nitrogen (BUN), urea protein and creatinine increased by 316.58%, 195.14% and 800.97% respectively, in STZ-induced diabetic rats when compared with normal rats. MCP treatment also illustrated a significant improvement in glutathione peroxidase, superoxide dismutase and catalase levels, with a significant decline in MDA in diabetic kidneys. Immunoblots of heme-oxygenase 1 (HO-1) and Nrf2 of MCP treated diabetic rats showed a significant up-regulation of HO-1 and Nrf2 protein. Histological and ultra-structural observations also reveal that MCP efficiently protects the kidneys from hyperglycemia-mediated oxidative damage. These findings illustrate that the reno-protective nature of MCP mitigates the progression of STZ induced DN in rats by suppression of oxidative stress and amelioration of the HO-1/Nrf2 pathway. Copyright © 2016 Elsevier B.V. All rights reserved.

Endogeous sulfur dioxide protects against oleic acid-induced acute lung injury in association with inhibition of oxidative stress in rats.

PubMed

Chen, Siyao; Zheng, Saijun; Liu, Zhiwei; Tang, Chaoshu; Zhao, Bin; Du, Junbao; Jin, Hongfang

2015-02-01

The role of endogenous sulfur dioxide (SO2), an efficient gasotransmitter maintaining homeostasis, in the development of acute lung injury (ALI) remains unidentified. We aimed to investigate the role of endogenous SO2 in the pathogenesis of ALI. An oleic acid (OA)-induced ALI rat model was established. Endogenous SO2 levels, lung injury, oxidative stress markers and apoptosis were examined. OA-induced ALI rats showed a markedly downregulated endogenous SO2/aspartate aminotransferase 1 (AAT1)/AAT2 pathway and severe lung injury. Chemical colorimetry assays demonstrated upregulated reactive oxygen species generation and downregulated antioxidant capacity in OA-induced ALI rats. However, SO2 increased endogenous SO2 levels, protected against oxidative stress and alleviated ALI. Moreover, compared with OA-treated cells, in human alveolar epithelial cells SO2 downregulated O2(-) and OH(-) generation. In contrast, L-aspartic acid-β-hydroxamate (HDX, Sigma-Aldrich Corporation), an inhibitor of endogenous SO2 generating enzyme, promoted free radical generation, upregulated poly (ADP-ribose) polymerase expression, activated caspase-3, as well as promoted cell apoptosis. Importantly, apoptosis could be inhibited by the free radical scavengers glutathione (GSH) and N-acetyl-L-cysteine (NAC). The results suggest that SO2/AAT1/AAT2 pathway might protect against the development of OA-induced ALI by inhibiting oxidative stress.

Ticagrelor protects against AngII-induced endothelial dysfunction by alleviating endoplasmic reticulum stress.

PubMed

Wang, Xiaoyu; Han, Xuejie; Li, Minghui; Han, Yu; Zhang, Yun; Zhao, Shiqi; Li, Yue

2018-05-16

Ticagrelor has been reported to decrease cardiovascular mortality compared with clopidogrel. This benefit cannot be fully explained by the more efficient platelet inhibition. Many studies demonstrated that ticagrelor improved endothelial function, leaving the mechanism elusive though. The present study aims to investigate whether ticagrelor protects against endothelial dysfunction induced by angiotensinII (AngII) through alleviating endoplasmic reticulum (ER) stress. Male Sprague Dawley rats were infused with AngII or vehicle and administrated with ticagrelor or vehicle for 14 days. Reactive oxygen species (ROS) was detected. Aortas from normal mice were incubated with endoplasmic reticulum stress inducer tunicamycin with or without ticagrelor. Vasorecactivity was measured on wire myography. Rat aortic endothelial cells (RAECs) were pretreated with ticagrelor followed by AngII or tunicamycin. Endothelial nitric oxide synthase (eNOS) phosphorylation and ER stress markers were determined by western blotting. Impaired endothelial function, induction of ER stress, reduced eNOS phosphorylation and elevated ROS generation was restored by ticagrelor treatment in vivo. In addition, tunicamycin induced endothelial dysfunction was improved by ticagrelor. In vitro, the induction of ER stress and inhibited eNOS phosphorylation in REACs exposed to AngII as well as tunicamycin was reversed by co-culturing with ticagrelor. In conclusion, ticagrelor protects against AngII-induced endothelial dysfunction via alleviating ER stress. Copyright © 2017. Published by Elsevier Inc.

Protective effect of δ-amyrone against ethanol-induced gastric ulcer in mice.

PubMed

Li, Weifeng; Yao, Huan; Niu, Xiaofeng; Wang, Yu; Zhang, Hailin; Li, Huani; Mu, Qingli

2015-06-01

The purpose of this study is to examine the protective effect of δ-amyrone on ethanol-induced gastric ulcer in mice. The mice intragastric administration 75% (0.5 mL/100g) ethanol was pretreated with δ-amyrone (4 and 8 mg/kg) and cimetidine (100 mg/kg) or vehicles in different experimental groups for a continuous three-day, and animals were euthanized 3h after ethanol ingestion. The gastric lesions were significantly attenuated by δ-amyrone (4 and 8 mg/kg) as compared to the ulcer control group. Pre-treatment with δ-amyrone prevented the myeloperoxidase (MPO) activity, production of nitric oxide (NO) in serum, expression of inducible nitric oxide synthase (iNOS) and nuclear factor kappa B (NF-κB) p65 protein expression. Analysis of cytokines in gastric tissue and serum of ethanol-induced mice showed the levels of tumor necrosis factor-alpha (TNF-α) and interleukin-6 (IL-6) were decreased by δ-amyrone in response to NF-κB p65. These results suggested that δ-amyrone exerts its protective effect on experimental gastric ulcer by inhibiting NF-κB signaling pathways, which subsequently reduces overproduction of the inducible enzymes iNOS and suppresses the release of the inflammatory factors TNF-α, IL-6 and NO. Thus, δ-amyrone shows promise as a therapeutic agent in experimental gastric ulcer. Copyright © 2014 Elsevier GmbH. All rights reserved.

The protective effect of pomegranate extract against cisplatin toxicity in rat liver and kidney tissue.

PubMed

Bakır, Salih; Yazgan, Ümit Can; İbiloğlu, İbrahim; Elbey, Bilal; Kızıl, Murat; Kelle, Mustafa

2015-01-01

The purpose of this study was to perform a histopathological investigation, at the light microscopy level, of the protective effects of pomegranate extract in cisplatin-induced liver and kidney damage in rats. Twenty-eight adult male Wistar albino rats were randomly divided into four groups of seven animals: Group 1: Control; Group 2: Treated for 10 consecutive days by gavage with pomegranate juice (2 ml/kg/day); Group 3: Injected intraperitoneally with cisplatin (8 mg/kg body weight, single dose) onset of the day 5, and Group 4: Treated by gavage with pomegranate juice 10 days before and after a single injection of cisplatin onset of the day 5. After 10 days, the animals were sacrificed and their kidneys and liver tissue samples were removed from each animal after experimental procedures. Cisplatin-induced renal and hepatic toxicity and the effect of pomegranate juice were evaluated by histopatological examinations. In the kidney tissue, pomegranate juice significantly ameliorated cisplatin-induced structural alterations when compared with the cisplatin alone group. But in the liver tissue, although pomegranate juice attenuated the cisplatin-induced toxicity only in two rats, significant improvement was not observed. In conclusion, these results demonstrate that the anti-oxidant pomegranate juice might have a protective effect against cisplatin-induced toxicity in rat kidney, but not in liver. Pomegranate juice could be beneficial as a dietary supplement in patients receiving chemotherapy medications.

Homologous Recombination Repair Protects Against Particulate Chromate-induced Chromosome Instability in Chinese Hamster Cells

PubMed Central

Stackpole, Megan M.; Wise, Sandra S.; Duzevik, Eliza Grlickova; Munroe, Ray C.; Thompson, W. Douglas; Thacker, John; Thompson, Larry H.; Hinz, John M.; Wise, John Pierce

2008-01-01

Particulate hexavalent chromium [Cr(VI)] compounds are well-established human carcinogens. Cr(VI)-induced tumors are characterized by chromosomal instability (CIN); however, the mechanisms of this effect are unknown. We investigated the hypothesis that homologous recombination (HR) repair of DNA double strand breaks protect cells from Cr(VI)-induced CIN by focusing on the XRCC3 and RAD51C genes, which play an important role in cellular resistance to DNA double strand breaks. We used Chinese hamster cells defective in each HR gene (irs3 for RAD51C and irs1SF for XRCC3) and compared with their wildtype parental and cDNA-complemented controls. We found that the intracellular Cr ion levels varied among the cell lines after particulate chromate treatment. Importantly, accounting for differences in Cr ion levels, we discovered that XRCC3 and RAD51C cells treated with lead chromate had increased cytotoxicity and chromosomal aberrations, relative to wild-type and cDNA-complimented cells. We also observed the emergence of high levels of chromatid exchanges in the two mutant cell lines. For example, 1 ug/cm2 lead chromate induced 20 and 32 exchanges in XRCC3- and RAD51C-deficient cells, respectively, whereas no exchanges were detected in the wildtype and cDNA-complemented cells. These observations suggest that HR protects cells from Cr(VI)-induced CIN, consistent with the ability of particulate Cr(VI) to induce double strand breaks. PMID:17662313

Protective effect of Lagerstroemia speciosa against dextran sulfate sodium induced ulcerative colitis in C57BL/6 mice.

PubMed

Chaudhary, Ghanshyam; Mahajan, Umesh B; Goyal, Sameer N; Ojha, Shreesh; Patil, Chandragouda R; Subramanya, Sandeep B

2017-01-01

The protective effect of methanolic extract of Lagerstroemia speciosaleaves (LS) was evaluated against dextran sulfate sodium (DSS) induced ulcerative colitis in C57BL/6 mice. The administration of DSS (2.5% in drinking water ad libitum) in C57BL/6 mice induced ulcerative colitis in 7 days. The LS was orally administered for 7 days at daily doses of 100 and 200 mg/kg. At the end of 7 days of treatment the animals were sacrificed, colonic tissues were removed and processed for further analysis of oxidative stress, and histopathology. In DSS treated mice the oxidative stress markers were elevated compared to controls. There was also significant reduction in the anti-oxidant defense levels marked by reduced cellular glutathione, catalase, and superoxide dismutase. The DSS-induced damage to the colon epithelium was evident from a significant increase in the lipid peroxidation. The histology of colon sections revealed inflammatory changes and marked impairment in the integrity of the mucosal lining with inflammatory changes. Both the doses of LS significantly prevented DSS-induced inflammatory and ulcerative damages of the colon, reduced lipid peroxidation and also restored the levels of innate antioxidants in the colon tissue. These findings indicate the protective effects of LS against the DSS-induced inflammatory and oxidative damage in the mouse colon. Further investigation involving bioactivity guided fractionation of the LS can yield potent constituent which may have a significant role in the treatment of inflammatory bowel disease and ulcerative colitis.

Simultaneous ultrasound-assisted water extraction and β-cyclodextrin encapsulation of polyphenols from Mangifera indica stem bark in counteracting TNFα-induced endothelial dysfunction.

PubMed

Mura, Marzia; Palmieri, Daniela; Garella, Davide; Di Stilo, Antonella; Perego, Patrizia; Cravotto, Giancarlo; Palombo, Domenico

2015-01-01

This study proposes an alternative technique to prevent heat degradation induced by classic procedures of bioactive compound extraction, comparing classical maceration/decoction in hot water of polyphenols from Mango (Mangifera indica L.) (MI) with ultrasound-assisted extraction (UAE) in a water solution of β-cyclodextrin (β-CD) at room temperature and testing their biological activity on TNFα-induced endothelial dysfunction. Both extracts counteracted TNFα effects on EAhy926 cells, down-modulating interleukin-6, interleukin-8, cyclooxygenase-2 and intracellular adhesion molecule-1, while increasing endothelial nitric oxide synthase levels. β-CD extract showed higher efficacy in improving endothelial function. These effects were abolished after pre-treatment with the oestrogen receptor inhibitor ICI1182,780. Moreover, the β-CD extract induced Akt activation and completely abolished the TNFα-induced p38MAPK phosphorylation. UAE and β-CD encapsulation provide an efficient extraction protocol that increases polyphenol bioavailability. Polyphenols from MI play a protective role on endothelial cells and may be further considered as oestrogen-like molecules with vascular protective properties.

Protein S is protective in pulmonary fibrosis.

PubMed

Urawa, M; Kobayashi, T; D'Alessandro-Gabazza, C N; Fujimoto, H; Toda, M; Roeen, Z; Hinneh, J A; Yasuma, T; Takei, Y; Taguchi, O; Gabazza, E C

2016-08-01

Essentials Epithelial cell apoptosis is critical in the pathogenesis of idiopathic pulmonary fibrosis. Protein S, a circulating anticoagulant, inhibited apoptosis of lung epithelial cells. Overexpression of protein S in lung cells reduced bleomycin-induced pulmonary fibrosis. Intranasal therapy with exogenous protein S ameliorated bleomycin-induced pulmonary fibrosis. Background Pulmonary fibrosis is the terminal stage of interstitial lung diseases, some of them being incurable and of unknown etiology. Apoptosis plays a critical role in lung fibrogenesis. Protein S is a plasma anticoagulant with potent antiapoptotic activity. The role of protein S in pulmonary fibrosis is unknown. Objectives To evaluate the clinical relevance of protein S and its protective role in pulmonary fibrosis. Methods and Results The circulating level of protein S was measured in patients with pulmonary fibrosis and controls by the use of enzyme immunoassays. Pulmonary fibrosis was induced with bleomycin in transgenic mice overexpressing human protein S and wild-type mice, and exogenous protein S or vehicle was administered to wild-type mice; fibrosis was then compared in both models. Patients with pulmonary fibrosis had reduced circulating levels of protein S as compared with controls. Inflammatory changes, the levels of profibrotic cytokines, fibrosis score, hydroxyproline content in the lungs and oxygen desaturation were significantly reduced in protein S-transgenic mice as compared with wild-type mice. Wild-type mice treated with exogenous protein S showed significant decreases in the levels of inflammatory and profibrotic markers and fibrosis in the lungs as compared with untreated control mice. After bleomycin infusion, mice overexpressing human protein S showed significantly low caspase-3 activity, enhanced expression of antiapoptotic molecules and enhanced Akt and Axl kinase phosphorylation as compared with wild-type counterparts. Protein S also inhibited apoptosis of alveolar epithelial cells in vitro. Conclusions These observations suggest clinical relevance and a protective role of protein S in pulmonary fibrosis. © 2016 International Society on Thrombosis and Haemostasis.

Protective effect of ginsenosides Rk3 and Rh4 on cisplatin-induced acute kidney injury in vitro and in vivo.

PubMed

Baek, Seung-Hoon; Shin, Byong-Kyu; Kim, Nam Jae; Chang, Sun-Young; Park, Jeong Hill

2017-07-01

Nephrotoxicity is the major side effect in cisplatin chemotherapy. Previously, we reported that the ginsenosides Rk3 and Rh4 reduced cisplatin toxicity on porcine renal proximal epithelial tubular cells (LLC-PK1). Here, we aimed to evaluate the protective effect of ginsenosides Rk3 and Rh4 on kidney function and elucidate their antioxidant effect using in vitro and in vivo models of cisplatin-induced acute renal failure. An enriched mixture of ginsenosides Rk3 and Rh4 (KG-KH; 49.3% and 43.1%, respectively) was purified from sun ginseng (heat processed Panax ginseng ). Cytotoxicity was induced by treatment of 20μM cisplatin to LLC-PK1 cells and rat model of acute renal failure was generated by single intraperitoneal injection of 5 mg/kg cisplatin. Protective effects were assessed by determining cell viability, reactive oxygen species generation, blood urea nitrogen, serum creatinine, antioxidant enzyme activity, and histopathological examination. The in vitro assay demonstrated that KG-KH (50 μg/mL) significantly increased cell viability (4.6-fold), superoxide dismutase activity (2.8-fold), and glutathione reductase activity (1.5-fold), but reduced reactive oxygen species generation (56%) compared to cisplatin control cells. KG-KH (6 mg/kg, per os ) also significantly inhibited renal edema (87% kidney index) and dysfunction (71.4% blood urea nitrogen, 67.4% creatinine) compared to cisplatin control rats. Of note, KG-KH significantly recovered the kidney levels of catalase (1.2-fold) and superoxide dismutase (1.5-fold). Considering the oxidative injury as an early trigger of cisplatin nephrotoxicity, our findings suggest that ginsenosides Rk3 and Rh4 protect the kidney from cisplatin-induced oxidative injury and help to recover renal function by restoring intrinsic antioxidant defenses.

IL-17 receptor A signaling is protective in infection-stimulated periapical bone destruction.

PubMed

AlShwaimi, Emad; Berggreen, Ellen; Furusho, Hisako; Rossall, Jonathan Caleb; Dobeck, Justine; Yoganathan, Subbiah; Stashenko, Philip; Sasaki, Hajime

2013-08-15

IL-17 is a pleiotropic cytokine produced by Th17 T cells that induces a myriad of proinflammatory mediators. However, different models of inflammation report opposite functional roles of IL-17 signal in terms of its effects on bone destruction. In this study we determined the role of IL-17RA signal in bone resorption stimulated by dentoalveolar infections. Infrabony resorptive lesions were induced by surgical pulp exposure and microbial infection of mouse molar teeth. IL-17 was strongly induced in periapical tissues in wild-type (WT) mice by 7 d after the infection but was not expressed in uninfected mice. Dentoalveolar infections of IL-17RA knockout (KO) mice demonstrated significantly increased bone destruction and more abscess formation in the apical area compared with WT mice. Infected IL-17RA KO mice exhibited significantly increased neutrophils and macrophages compared with the WT littermates at day 21, suggesting a failure of transition from acute to chronic inflammation in the IL-17RA KO mice. The expression of IL-1 (both α and β isoforms) and MIP2 were significantly upregulated in the IL-17RA KO compared with WT mice at day 21 postinfection. The development of periapical lesions in IL-17RA KO mice was significantly attenuated by neutralization of IL-1β and MIP2. Taken together, these results demonstrate that IL-17RA signal seems to be protective against infection-induced periapical inflammation and bone destruction via suppression of neutrophil and mononuclear inflammation.

Host protective ASP-based vaccine against the parasitic nematode Ostertagia ostertagi triggers NK cell activation and mixed IgG1-IgG2 response.

PubMed

González-Hernández, Ana; Van Coppernolle, Stefanie; Borloo, Jimmy; Van Meulder, Frederik; Paerewijck, Oonagh; Peelaers, Iris; Leclercq, Georges; Claerebout, Edwin; Geldhof, Peter

2016-07-11

The mucus-dwelling parasite Ostertagia ostertagi is one of the most important gastrointestinal nematodes in cattle. Our group has previously demonstrated the protective capacity of a vaccine against this parasite based on a native activation-associated secreted protein ASP1 (nASP) in combination with the saponin adjuvant QuilA. The aim of the current study was to analyse the effect of both antigen and adjuvant on the cellular and humoral vaccine-induced immune responses by comparing the native ASP to a recombinant version expressed in Pichia pastoris (pASP) and replacing QuilA by Al(OH)3. Immunization of cattle with the protective nASP+QuilA vaccine was associated with antigen-induced proliferation of natural killer (NK) cells combined with IFN-γ secretion and the induction of a mixed IgG1/IgG2 antibody response. ASP-specific activation and proliferation of NK cells was also observed in mice following the same vaccination regime. Replacing QuilA by Al(OH)3 or nASP by pASP significantly decreased the capacity of the vaccines to trigger both NK cell activation and antibody responses and failed to induce protection against a challenge infection. Reduction of the structurally anchoring disulphide bonds of the nASP completely abolished its ability to induce NK cell activation and antibody responses, highlighting the importance of protein conformation for the immunostimulatory activity.

Aspirin upregulates αB-Crystallin to protect the myocardium against heat stress in broiler chickens

PubMed Central

Tang, Shu; Yin, Bin; Song, Erbao; Chen, Hongbo; Cheng, Yanfen; Zhang, Xiaohui; Bao, Endong; Hartung, Joerg

2016-01-01

We established in vivo and in vitro models to investigate the role of αB-Crystallin (CryAB) and assess the ability of aspirin (ASA) to protect the myocardium during prolonged heat stress. Thirty-day-old chickens were divided into three groups (n = 90): heat stress (HS, 40±1 °C); ASA(−)HS(+), 1 mg/kg ASA orally 2 h before heat stress; and ASA(+)HS(−), pretreated with aspirin, no heat stress (25 °C). Hearts were excised after 0, 1, 2, 3, 5, 7, 10, 15 and 24 h. Heat stress increased body temperature, though the ASA(−)HS(+) group had significantly higher temperatures than the ASA(+)HS(+) group at all time points. Compared to ASA(+)HS(+), the ASA(−)HS(+) group displayed increased sensitivity to heat stress. Pathological analysis revealed the ASA (+)HS(+) myocardium showed less severe changes (narrowed, chaotic fibers; fewer necrotic cells) than the ASA(−)HS(+) group (bleeding and extensive cell death). In vitro, ASA-pretreatment significantly increased primary chicken myocardial cell survival during heat stress. ELISAs indicated ASA induced CryAB in vivo to protect against heat stress-induced myocardial damage, but ASA did not induce CryAB in primary chicken myocardial cells. The mechanisms by which ASA induces the expression of CryAB in vivo and protects the myocardium during heat stress merit further research. PMID:27857180

Methyl helicterate protects against CCl4-induced liver injury in rats by inhibiting oxidative stress, NF-κB activation, Fas/FasL pathway and cytochrome P4502E1 level.

PubMed

Lin, Xing; Huang, Renbin; Zhang, Shijun; Zheng, Li; Wei, Ling; He, Min; Zhou, Yan; Zhuo, Lang; Huang, Quanfang

2012-10-01

This study was designed to investigate the protective effects of the methyl helicterate (MH) isolated from Helicteres angustifolia L. against CCl4-induced hepatotoxicities in rats. Liver injury was induced in rats by the administration of CCl4 twice a week for 8 weeks. Compared with the CCl4 group, MH significantly decreased the activities of ALT, AST and ALP in the serum and increased the activities of SOD, GSH-Px and GSH-Rd in the liver. Moreover, the content of hepatic MDA was reduced. Histological findings also confirmed the anti-hepatotoxic characterisation. In addition, MH significantly inhibited the proinflammatory mediators, such as PGE2, iNOS, COX-2, IL-6, TNF-α and myeloperoxidase (MPO). Further investigation showed that the inhibitory effect of MH on the proinflammatory cytokines was associated with the downregulation of NF-κB. Besides, MH also markedly decreased the levels of Fas/FasL protein expression and the activities of caspase-3/8, as well as the activity of cytochrome P4502E1 (CYP2E1). In brief, the protective effect of MH against CCl4-induced hepatic injury may rely on its ability to reduce oxidative stress, suppress inflammatory responses, protect against Fas/FasL-mediated apoptosis and block CYP2El-mediated CCl4 bioactivation. Copyright © 2012 Elsevier Ltd. All rights reserved.

A phase II randomized placebo-controlled trial of oral N-acetylcysteine for protection of melanocytic nevi against UV-induced oxidative stress in vivo

PubMed Central

Cassidy, Pamela B.; Liu, Tong; Florell, Scott R.; Honeggar, Matthew; Leachman, Sancy A.; Boucher, Kenneth M.; Grossman, Douglas

2016-01-01

Oxidative stress plays a role in UV-induced melanoma, which may arise from melanocytic nevi. We investigated whether oral administration of the antioxidant N-acetylcysteine (NAC) could protect nevi from oxidative stress in vivo in the setting of acute UV exposure. The minimal erythemal dose (MED) was determined for 100 patients at increased risk for melanoma. Patients were randomized to receive a single dose (1200 mg) of NAC or placebo, in double-blind fashion, and then one nevus was irradiated (1–2 MED) using a solar simulator. One day later, the MED was re-determined and the irradiated nevus and a control un-irradiated nevus were removed for histologic analysis and examination of biomarkers of NAC metabolism and UV-induced oxidative stress. Increased expression of 8-oxoguanine, thioredoxin reductase-1, and γ-glutamylcysteine synthase modifier subunit were consistently seen in UV-treated compared to unirradiated nevi. However, no significant differences were observed in these UV-induced changes or in the pre- and post-intervention MED between those patients receiving NAC vs. placebo. Similarly, no significant differences were observed in UV-induced changes between subjects with germline wild-type vs. loss of function mutations in the melanocortin-1 receptor. Nevi showed similar changes of UV-induced oxidative stress in an open-label post-trial study in 10 patients who received NAC 3 h before nevus irradiation. Thus a single oral dose of NAC did not effectively protect nevi from UV-induced oxidative stress under the conditions examined. PMID:27920018

Protective Role of Mitochondrial Peroxiredoxin III against UVB-Induced Apoptosis of Epidermal Keratinocytes.

PubMed

Baek, Jin Young; Park, Sujin; Park, Jiyoung; Jang, Ji Yong; Wang, Su Bin; Kim, Sin Ri; Woo, Hyun Ae; Lim, Kyung Min; Chang, Tong-Shin

2017-06-01

UVB light induces generation of reactive oxygen species, ultimately leading to skin cell damage. Mitochondria are a major source of reactive oxygen species in UVB-irradiated skin cells, with increased levels of mitochondrial reactive oxygen species having been implicated in keratinocyte apoptosis. Peroxiredoxin III (PrxIII) is the most abundant and potent H 2 O 2 -removing enzyme in the mitochondria of most cell types. Here, the protective role of PrxIII against UVB-induced apoptosis of epidermal keratinocytes was investigated. Mitochondrial H 2 O 2 levels were differentiated from other types of ROS using mitochondria-specific fluorescent H 2 O 2 indicators. Upon UVB irradiation, PrxIII-knockdown HaCaT human keratinocytes and PrxIII-deficient (PrxIII -/- ) mouse primary keratinocytes exhibited enhanced accumulation of mitochondrial H 2 O 2 compared with PrxIII-expressing controls. Keratinocytes lacking PrxIII were subsequently sensitized to apoptosis through mitochondrial membrane potential loss, cardiolipin oxidation, cytochrome c release, and caspase activation. Increased UVB-induced epidermal tissue damage in PrxIII -/- mice was attributable to increased caspase-dependent keratinocyte apoptosis. Our findings show that mitochondrial H 2 O 2 is a key mediator in UVB-induced apoptosis of keratinocytes and that PrxIII plays a critical role in protecting epidermal keratinocytes against UVB-induced apoptosis through eliminating mitochondrial H 2 O 2 . These findings support the concept that reinforcing mitochondrial PrxIII defenses may help prevent UVB-induced skin damage such as inflammation, sunburn, and photoaging. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Tauroursodeoxycholic acid attenuates gentamicin-induced cochlear hair cell death in vitro.

PubMed

Jia, Zhanwei; He, Qiang; Shan, Chunguang; Li, Fengyi

2018-09-15

Gentamycin is one of the most clinically used aminoglycoside antibiotics which induce intrinsic apoptosis of hair cells. Tauroursodeoxycholic acid (TUDCA) is known as safe cell-protective agent in disorders associated with apoptosis. We aimed to investigate the protective effects of TUDCA against gentamicin-induced ototoxicity. House Ear Institute-Organ of Corti 1(HEI-OC1) cells and explanted cochlear tissue were treated with gentamicin and TUDCA, followed by serial analyses including cell viability assay, hair cell staining, qPCR, ELISA and western blotting to determine the cell damage by the parameters relevant to cell apoptosis and endoplasmic reticulum stress. TUDCA significantly attenuated gentamicin-induced cell damage in cultured HEI-OC1 cells and explanted cochlear hair cells. TUDCA alleviated gentamicin-induced cell apoptosis, supported by the decreased Bax/Bcl2 ratio compared with that of gentamicin treated alone. TUDCA decreased gentamicin-induced nitric oxide production and protein nitration in both models. In addition, TUDCA suppressed gentamicin-induced endoplasmic reticulum stress as reflected by inversing the expression levels of Binding immunoglobulin protein (Bip), CCAAT/-enhancer-binding protein homologous protein (CHOP) and Caspase 3. TUDCA attenuated gentamicin-induced hair cell death by inhibiting protein nitration activation and ER stress, providing new insights into the new potential therapies for sensorineural deafness. Copyright © 2018 Elsevier B.V. All rights reserved.

Role of Nigella sativa and Its Constituent Thymoquinone on Chemotherapy-Induced Nephrotoxicity: Evidences from Experimental Animal Studies

PubMed Central

Cascella, Marco; Palma, Giuseppe; Barbieri, Antonio; Bimonte, Sabrina; Amruthraj, Nagoth Joseph; Muzio, Maria Rosaria; del Vecchio, Vitale; Rea, Domenica; Falco, Michela; Luciano, Antonio; Arra, Claudio; Cuomo, Arturo

2017-01-01

Background: Most chemotherapeutic drugs are known to cause nephrotoxicity. Therefore, new strategies have been considered to prevent chemotherapy-induced nephrotoxicity. It is of note that Nigella sativa (NS), or its isolated compound Thymoquinone (TQ), has a potential role in combating chemotherapy-induced nephrotoxicity. AIM: To analyze and report the outcome of experimental animal studies on the protective effects of NS/TQ on chemotherapy-associated kidney complications. Design: Standard systematic review and narrative synthesis. Data Sources: MEDLINE, EMBASE databases were searched for relevant articles published up to March 2017. Additionally, a manual search was performed. Criteria for a study’s inclusion were: conducted in animals, systematic reviews and meta-analysis, containing data on nephroprotective effects of NS/TQ compared to a placebo or other substance. All strains and genders were included. Results: The database search yielded 71 studies, of which 12 (cisplatin-induced nephrotoxicity 8; methotrexate-induced nephrotoxicity 1; doxorubicin-induced nephrotoxicity 2; ifosfamide-induced nephrotoxicity 1) were included in this review. Conclusions: Experimental animal studies showed the protective effect of NS, or TQ, on chemotherapy-induced nephrotoxicity. These effects are caused by decreasing lipid peroxidation and increasing activity of antioxidant enzymes in renal tissue of chemotherapy-treated animals. PMID:28629150

Protein glutathionylation protects wheat (Triticum aestivum Var. Sonalika) against Fusarium induced oxidative stress.

PubMed

Mohapatra, Subhalaxmi; Mittra, Bhabatosh

2016-12-01

Fusarium induced oxidative stress could be recovered by reversible protein oxidative modification through the process of glutathionylation in co-stressed (low-dose (50 μM) Cd 2+ pre-treatment followed by Fusarium inoculation) wheat seedlings. Co-stressed seedlings showed low disease severity index as compared to Fusarium infected seedlings. A reduced level of hydrogen peroxide (H 2 O 2 ) and carbonyl contents due to irreversible protein oxidation were observed in co-stressed seedlings as compared to Fusarium infected seedlings. Further, a comparative biochemical assay showed an enhanced glutathione content in co-stressed tissues as compared to Fusarium infected tissues. In an investigation, reduced glutathione pre-coated agarose gel beads were used to pull down proteins having affinity with GSH. Fructose-1, 6-bisphosphate aldolase and 3-Phosphoglycerate kinase were observed to be co-existed in co-stressed seedlings when analysed by LC-MS/MS after being processed through protein-pull assay. Co-stressed tissues showed an enhanced free protein thiol content as compared to Fusarium infected tissues. The ratio of free thiol to thiol disulfides was also observed to be increased in co-stressed tissues as compared to Fusarium infected tissues. In contrast, the quantitative assay by Ellman's reagent and qualitative analysis by diagonal gel electrophoresis showed enhanced protein thiol disulfides in Fusarium infected tissues as compared to co-stressed tissues. Further, glutaredoxin, responsible for the reverse reduction of proteins was observed to be enhanced in co-stressed tissues as compared to Fusarium infected tissues. Thus, a low dose Cd 2+ triggered glutathionylation is suggestive of offering tolerance against Fusarium induced oxidative stress and protects target proteins from irreversible modification and permanent damage in wheat. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Gastroprotective effect of kefir on ulcer induced in irradiated rats.

PubMed

Fahmy, Hanan A; Ismail, Amel F M

2015-03-01

The current study was designed to investigate the protective effect of kefir milk on ethanol-induced gastric ulcers in γ-irradiated rats. The results of the present study revealed that treatment with γ-irradiation and/or ethanol showed a significant increase in ulcers number, total acidity, peptic, H(+)K(+)ATPase, MMP-2 and MMP-9 activities and MDA level, which were accompanied by a significant decrease in the mucus content, the stomach GSH level, the GSH-Px activity and DNA damage. Pre-treatment with kefir milk exert significant improvement in all the tested parameters. Kefir milk exerts comparable effect to that of the antiulcer drug ranitidine. In conclusion, the present study revealed that oral administration of kefir milk prevents ethanol-induced gastric ulcer in γ-irradiated rats that could attribute to its antioxidant, anti-apoptotic and radio-protective activities. Copyright © 2015 Elsevier B.V. All rights reserved.

Effects of collagen and collagen hydrolysate from jellyfish (Rhopilema esculentum) on mice skin photoaging induced by UV irradiation.

PubMed

Zhuang, Yongliang; Hou, Hu; Zhao, Xue; Zhang, Zhaohui; Li, Bafang

2009-08-01

Collagen (JC) was extracted from jellyfish (Rhopilema esculentum) and hydrolyzed to prepare collagen hydrolysate (JCH). The protective effects of JC and JCH against UV-induced damages to mice skin were evaluated and compared in this article. JC and JCH could alleviate the UV-induced abnormal changes of antioxidative indicators, including the superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and catalase (CAT) activities and the contents of glutathione (GSH) and malondiaidehyde (MDA). JC and JCH could protect skin lipid and collagen from the UV radiation damages. Furthermore, the changes of total ceramide and glycosaminoglycan in skin were recovered significantly by JC and JCH. The action mechanisms mainly involved the antioxidative properties and the repairing to endogenous collagen synthesis of JC and JCH in vivo. JCH with the lower molecular weight showed much higher effects than JC. The results indicated that JCH was a novel antiphotoaging agent from natural resources.

Biogenic concrete protection driven by the formate oxidation by Methylocystis parvus OBBP.

PubMed

Ganendra, Giovanni; Wang, Jianyun; Ramos, Jose A; Derluyn, Hannelore; Rahier, Hubert; Cnudde, Veerle; Ho, Adrian; Boon, Nico

2015-01-01

The effectiveness of Microbiologically Induced Carbonate Precipitation (MICP) from the formate oxidation by Methylocystis parvus OBBP as an alternative process for concrete protection was investigated. MICP was induced on Autoclaved Aerated Concrete (AAC), the model material, by immersing the material in 10(9) M. parvus cells mL(-1) containing 5 g L(-1) of calcium formate. A 2 days immersion of the material gave the maximum weight increase of the specimens (38 ± 19 mg) and this was likely due to the deposition of calcium carbonate, biomass, and unconverted calcium formate. The solid deposition mainly occurred in the micropores of the specimen, close to the outer surface. A significantly lower water absorption was observed in the bacterially treated specimens compared to the non-treated ones (up to 2.92 ± 0.91 kg m(-2)) and this could be attributed to the solid deposition. However, the sonication test demonstrated that the bacterial treatment did not give a consolidating effect to the material. Overall, compared to the currently employed urea hydrolysis process, the formate-based MICP by M. parvus offers a more environmentally friendly approach for the biotechnological application to protect concrete.

Biogenic concrete protection driven by the formate oxidation by Methylocystis parvus OBBP

PubMed Central

Ganendra, Giovanni; Wang, Jianyun; Ramos, Jose A.; Derluyn, Hannelore; Rahier, Hubert; Cnudde, Veerle; Ho, Adrian; Boon, Nico

2015-01-01

The effectiveness of Microbiologically Induced Carbonate Precipitation (MICP) from the formate oxidation by Methylocystis parvus OBBP as an alternative process for concrete protection was investigated. MICP was induced on Autoclaved Aerated Concrete (AAC), the model material, by immersing the material in 109 M. parvus cells mL−1 containing 5 g L−1 of calcium formate. A 2 days immersion of the material gave the maximum weight increase of the specimens (38 ± 19 mg) and this was likely due to the deposition of calcium carbonate, biomass, and unconverted calcium formate. The solid deposition mainly occurred in the micropores of the specimen, close to the outer surface. A significantly lower water absorption was observed in the bacterially treated specimens compared to the non-treated ones (up to 2.92 ± 0.91 kg m−2) and this could be attributed to the solid deposition. However, the sonication test demonstrated that the bacterial treatment did not give a consolidating effect to the material. Overall, compared to the currently employed urea hydrolysis process, the formate-based MICP by M. parvus offers a more environmentally friendly approach for the biotechnological application to protect concrete. PMID:26284061

Induction and Subversion of Human Protective Immunity: Contrasting Influenza and Respiratory Syncytial Virus

PubMed Central

Ascough, Stephanie; Paterson, Suzanna; Chiu, Christopher

2018-01-01

Respiratory syncytial virus (RSV) and influenza are among the most important causes of severe respiratory disease worldwide. Despite the clinical need, barriers to developing reliably effective vaccines against these viruses have remained firmly in place for decades. Overcoming these hurdles requires better understanding of human immunity and the strategies by which these pathogens evade it. Although superficially similar, the virology and host response to RSV and influenza are strikingly distinct. Influenza induces robust strain-specific immunity following natural infection, although protection by current vaccines is short-lived. In contrast, even strain-specific protection is incomplete after RSV and there are currently no licensed RSV vaccines. Although animal models have been critical for developing a fundamental understanding of antiviral immunity, extrapolating to human disease has been problematic. It is only with recent translational advances (such as controlled human infection models and high-dimensional technologies) that the mechanisms responsible for differences in protection against RSV compared to influenza have begun to be elucidated in the human context. Influenza infection elicits high-affinity IgA in the respiratory tract and virus-specific IgG, which correlates with protection. Long-lived influenza-specific T cells have also been shown to ameliorate disease. This robust immunity promotes rapid emergence of antigenic variants leading to immune escape. RSV differs markedly, as reinfection with similar strains occurs despite natural infection inducing high levels of antibody against conserved antigens. The immunomodulatory mechanisms of RSV are thus highly effective in inhibiting long-term protection, with disturbance of type I interferon signaling, antigen presentation and chemokine-induced inflammation possibly all contributing. These lead to widespread effects on adaptive immunity with impaired B cell memory and reduced T cell generation and functionality. Here, we discuss the differences in clinical outcome and immune response following influenza and RSV. Specifically, we focus on differences in their recognition by innate immunity; the strategies used by each virus to evade these early immune responses; and effects across the innate-adaptive interface that may prevent long-lived memory generation. Thus, by comparing these globally important pathogens, we highlight mechanisms by which optimal antiviral immunity may be better induced and discuss the potential for these insights to inform novel vaccines. PMID:29552008

Seasonally-induced alterations of some facial signs in Caucasian women and their changes induced by a daily application of a photo-protective product.

PubMed

Flament, F; Gautier, B; Benize, A-M; Charbonneau, A; Cassier, M

2017-12-01

These were two-fold: (i) to assess the possible changes in some facial signs induced in a 6-month period by the periodical shift from winter to summer in Caucasian women and (ii) to appraise the preventive effects of a strong photo-protective product. The facial signs of two cohorts of French women (N= 40 and 42), of comparable ages were graded between winter to summer. One group was left unprotected whereas the other daily applied a strong photo-protective product for 6 months. Facial signs (structural and pigmentation-related) were graded in blind by a panel of 12 experts from photographs taken under standard conditions. A global and focused analysis of the skin colour or dark spots, when present, was carried out through spectro-radiometry under diffuse and standardized visible light, using the L*, a*, b* referential system. The unprotected group showed significant changes in summer as compared to winter on 10 facial signs (two-third of the studied signs) that presented an increased severity, of variable respective amplitude. Five signs among the 10 were particularly and significantly affected by the seasonal transition, of an amplitude above the precision of the grading scale. Three of these five signs concerned structural elements (wrinkles), the two others being related to vascular disorders (redness). These season-induced alterations appear efficiently reduced in the photo-protected group. The colour of the facial skin then appears more homogeneous, less red, less dull, all criteria being quantified by the L*, a*, b* referential system. The comparison with a previous work carried out on Chinese women, through a similar protocol, shows that the photo-protective product brings, in Caucasian women, a more important effect upon structural and vascular features than upon pigmentation disorders, inversely to the results previously observed in Chinese women. The alterations in some facial signs occurring in a 6-month period between winter and summer are confirmed in Caucasian women, mostly related to structural (wrinkles) and vascular elements. Such changes appear alleviated or prevented by daily applications of a strong sun photo-protective product. © 2017 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

C-Phycocyanin Confers Protection against Oxalate-Mediated Oxidative Stress and Mitochondrial Dysfunctions in MDCK Cells

PubMed Central

Farooq, Shukkur M.; Boppana, Nithin B.; Asokan, Devarajan; Sekaran, Shamala D.; Shankar, Esaki M.; Li, Chunying; Gopal, Kaliappan; Bakar, Sazaly A.; Karthik, Harve S.; Ebrahim, Abdul S.

2014-01-01

Oxalate toxicity is mediated through generation of reactive oxygen species (ROS) via a process that is partly dependent on mitochondrial dysfunction. Here, we investigated whether C-phycocyanin (CP) could protect against oxidative stress-mediated intracellular damage triggered by oxalate in MDCK cells. DCFDA, a fluorescence-based probe and hexanoyl-lysine adduct (HEL), an oxidative stress marker were used to investigate the effect of CP on oxalate-induced ROS production and membrane lipid peroxidation (LPO). The role of CP against oxalate-induced oxidative stress was studied by the evaluation of mitochondrial membrane potential by JC1 fluorescein staining, quantification of ATP synthesis and stress-induced MAP kinases (JNK/SAPK and ERK1/2). Our results revealed that oxalate-induced cells show markedly increased ROS levels and HEL protein expression that were significantly decreased following pre-treatment with CP. Further, JC1 staining showed that CP pre-treatment conferred significant protection from mitochondrial membrane permeability and increased ATP production in CP-treated cells than oxalate-alone-treated cells. In addition, CP treated cells significantly decreased the expression of phosphorylated JNK/SAPK and ERK1/2 as compared to oxalate-alone-treated cells. We concluded that CP could be used as a potential free radical-scavenging therapeutic strategy against oxidative stress-associated diseases including urolithiasis. PMID:24691130

The protective effect of ebselen on radiocontrast-induced nephrotoxicity.

PubMed

Ozgur, Tumay; Tutanc, Murat; Zararsiz, Ismail; Motor, Sedat; Ozturk, Oktay Hasan; Yaldiz, Mehmet; Kurtgoz, Ozgur Yildirim

2012-01-01

Radiocontrast-induced nephropathy has become one of the most important causes of renal acute failure. The most effective management of reducing the incidence of contrast nephropathy is to understand and prevent its causes. We aimed to investigate the protective role of ebselen against radiocontrast-induced nephrotoxicity in terms of tissue oxidant/antioxidant parameters and light microscopy in rats. Albino Wistar rats were randomly separated into four groups. The Group 1 rats were treated with sodium chloride as the control group, Group 2 with radiocontrast, Group 3 with radiocontrast plus ebselen, and Group 4 with ebselen alone. After 24 h, the animals over the experimental period were euthanized and blood samples were analyzed for blood urea nitrogen (BUN) and serum creatinine (Cr) levels. Kidney sections were analyzed for malondialdehyde (MDA) levels and superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px) activities, as well as histopathological changes. In the radiocontrast group, BUN, MDA, and GSH-Px levels increased while SOD activity decreased compared with the control group. These decays were improved by ebselen administration in the radiocontrast group. Significant histological deteriorations were observed in the radiocontrast group. We noted improvement in the histologic findings with ebselen administration. These results indicate that ebselen might produce a protective mechanism against radiocontrast-induced nephrotoxicity.

Protective effect of hawthorn extract against genotoxicity induced by methyl methanesulfonate in human lymphocytes.

PubMed

Hosseinimehr, Seyed Jalal; Azadbakht, Mohammad; Tanha, Mohammad; Mahmodzadeh, Aziz; Mohammadifar, Sohila

2011-05-01

The preventive effect of hawthorn (Crataegus microphylla) fruit extract against genotoxicity induced by methyl methanesulfonate (MMS) has been investigated in human cultured blood lymphocytes. Peripheral blood samples were collected from human volunteers at 0 (10 minutes before), and at 1 and 2 hours after a single oral ingestion of 1 g hawthorn powder extract. At each time point, the whole blood was treated in vitro with MMS (200 µmol) at 24 hours after cell culture, and then the lymphocytes were cultured with mitogenic stimulation to determine the micronuclei in cytokinesis-blocked binucleated cells. The lymphocytes treated with hawthorn and MMS to exhibit a significant decreasing in the incidence of micronucleated binucleated cells, as compared with similarly MMS-treated lymphocytes from blood samples collected at 0 hour. The maximum protection and decreasing in frequency of micronuclei (36%) was observed at 1 hour after ingestion of hawthorn extract. The high performance liquid chromatography (HPLC) analysis showed that hawthorn contained chlorogenic acid, epicatechin and hyperoside. It is obvious that hawthorn, particularly flavonoids constituents with antioxidative activity, reduced the oxidative stress and genotoxicity induced by toxic compounds. This set of data may have an important application for the protection of human lymphocyte from the genetic damage and side effects induced by chemicals hazardous in people.

Cross-protection against Salmonella enteritidis infection in mice. III. Delayed hypersensitivity reaction and clearance of the challenge organism.

PubMed

Padmanaban, V D; Mittal, K R

1979-01-01

Mice were immunized with live vaccines and with live vaccines with complete adjuvant incorporating Salmonella enteritidis, Salmonella typhi-murium, Salmonella gallinarum or Salmonella pullorum. On the 21st day after vacination, the hypersensitivity reactions elicited by the mice to extracts of the challenge organism (S. enteritidis 5694 SMR) were assessed. The degree of delayed hypersensitivity reaction was compared with the level of protection induced by the vaccine. The role in protection of delayed hypersensitivity is discussed. Clearance of the challenge organism from the liver of previously vaccinated and unvaccinated mice was assessed quantitatively.

Nicotinamide riboside attenuates alcohol induced liver injuries via activation of SirT1/PGC-1α/mitochondrial biosynthesis pathway.

PubMed

Wang, Sufan; Wan, Ting; Ye, Mingtong; Qiu, Yun; Pei, Lei; Jiang, Rui; Pang, Nengzhi; Huang, Yuanling; Liang, Baoxia; Ling, Wenhua; Lin, Xiaojun; Zhang, Zhenfeng; Yang, Lili

2018-07-01

Nicotinamide riboside (NR) is a nicotinamide adenine dinucleotide (NAD + ) precursor which is present in foods such as milk and beer. It was reported that NR can prevent obesity, increase longevity, and promote liver regeneration. However, whether NR can prevent ethanol-induced liver injuries is not known. This study aimed to explore the effect of NR on ethanol induced liver injuries and the underlying mechanisms. We fed C57BL/6 J mice with Lieber-DeCarli ethanol liquid diet with or without 400 mg/kg·bw NR for 16 days. Liver injuries and SirT1-PGC-1α-mitochondrial function were analyzed. In in vitro experiments, HepG2 cells (CYP2E1 over-expressing cells) were incubated with ethanol ± 0.5 mmol/L NR. Lipid accumulation and mitochondrial function were compared. SirT1 knockdown in HepG2 cells were further applied to confirm the role of SirT1 in the protection of NR on lipid accumulation. We found that ethanol significantly decreased the expression and activity of hepatic SirT1 and induced abnormal expression of enzymes of lipid metabolism in mice. Both in vivo and in vitro experiments showed that NR activated SirT1 through increasing NAD + levels, decreased oxidative stress, increased deacetylation of PGC-1α and mitochondrial function. In SirT1 knockdown HepG2 cells, NR lost its ability in enhancing mitochondrial function, and its protection against lipid accumulation induced by ethanol. NR can protect against ethanol induced liver injuries via replenishing NAD + , reducing oxidative stress, and activating SirT1-PGC-1α-mitochondrial biosynthesis. Our data indicate that SirT1 plays an important role in the protection of NR against lipid accumulation and mitochondrial dysfunctions induced by ethanol. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Viral booster vaccines improve Mycobacterium bovis BCG-induced protection against bovine tuberculosis.

PubMed

Vordermeier, H Martin; Villarreal-Ramos, Bernardo; Cockle, Paul J; McAulay, Martin; Rhodes, Shelley G; Thacker, Tyler; Gilbert, Sarah C; McShane, Helen; Hill, Adrian V S; Xing, Zhou; Hewinson, R Glyn

2009-08-01

Previous work with small-animal laboratory models of tuberculosis has shown that vaccination strategies based on heterologous prime-boost protocols using Mycobacterium bovis bacillus Calmette-Guérin (BCG) to prime and modified vaccinia virus Ankara strain (MVA85A) or recombinant attenuated adenoviruses (Ad85A) expressing the mycobacterial antigen Ag85A to boost may increase the protective efficacy of BCG. Here we report the first efficacy data on using these vaccines in cattle, a natural target species of tuberculous infection. Protection was determined by measuring development of disease as an end point after M. bovis challenge. Either Ad85A or MVA85A boosting resulted in protection superior to that given by BCG alone: boosting BCG with MVA85A or Ad85A induced significant reduction in pathology in four/eight parameters assessed, while BCG vaccination alone did so in only one parameter studied. Protection was particularly evident in the lungs of vaccinated animals (median lung scores for naïve and BCG-, BCG/MVA85A-, and BCG/Ad85A-vaccinated animals were 10.5, 5, 2.5, and 0, respectively). The bacterial loads in lymph node tissues were also reduced after viral boosting of BCG-vaccinated calves compared to those in BCG-only-vaccinated animals. Analysis of vaccine-induced immunity identified memory responses measured by cultured enzyme-linked immunospot assay as well as in vitro interleukin-17 production as predictors of vaccination success, as both responses, measured before challenge, correlated positively with the degree of protection. Therefore, this study provides evidence of improved protection against tuberculosis by viral booster vaccination in a natural target species and has prioritized potential correlates of vaccine efficacy for further evaluation. These findings also have implications for human tuberculosis vaccine development.

Galactose-1-phosphate uridyltransferase (GalT), an in vivo-induced antigen of Actinobacillus pleuropneumoniae serovar 5b strain L20, provided immunoprotection against serovar 1 strain MS71.

PubMed

Zhang, Fei; Zhao, Qin; Quan, Keji; Zhu, Zhuang; Yang, Yusheng; Wen, Xintian; Chang, Yung-Fu; Huang, Xiaobo; Wu, Rui; Wen, Yiping; Yan, Qigui; Huang, Yong; Ma, Xiaoping; Han, Xinfeng; Cao, Sanjie

2018-01-01

GALT is an important antigen of Actinobacillus pleuropneumoniae (APP), which was shown to provide partial protection against APP infection in a previous study in our lab. The main purpose of the present study is to investigate GALT induced cross-protection between different APP serotypes and elucidate key mechanisms of the immune response to GALT antigenic stimulation. Bioinformatic analysis demonstrated that galT is a highly conserved gene in APP, widely distributed across multiple pathogenic strains. Homologies between any two strains ranges from 78.9% to 100% regarding the galT locus. Indirect enzyme-linked immunosorbent assay (ELISA) confirmed that GALT specific antibodies could not be induced by inactivated APP L20 or MS71 whole cell bacterin preparations. A recombinant fusion GALT protein derived from APP L20, however has proven to be an effective cross-protective antigen against APP sevorar 1 MS71 (50%, 4/8) and APP sevorar 5b L20 (75%, 6/8). Histopathological examinations have confirmed that recombinant GALT vaccinated animals showed less severe pathological signs in lung tissues than negative controls after APP challenge. Immunohistochemical (IHC) analysis indicated that the infiltration of neutrophils in the negative group is significantly increased compared with that in the normal control (P<0.001) and that in surviving animals is decreased compared to the negative group. Anti-GALT antibodies were shown to mediate phagocytosis of neutrophils. After interaction with anti-GALT antibodies, survival rate of APP challenged vaccinated animals was significantly reduced (P<0.001). This study demonstrated that GALT is an effective cross-protective antigen, which could be used as a potential vaccine candidate against multiple APP serotypes.

Protective Efficacy of Coccidial Common Antigen Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) against Challenge with Three Eimeria Species

PubMed Central

Tian, Lu; Li, Wenyu; Huang, Xinmei; Tian, Di; Liu, Jianhua; Yang, Xinchao; Liu, Lianrui; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui; Song, Xiaokai

2017-01-01

Coccidiosis is an intestinal disorder of poultry and often caused by simultaneous infections of several Eimeria species. GAPDH is one of the immunogenic common antigens among Eimeria tenella, E. acervulina, and E. maxima identified in our previous study. The present study was performed to further evaluate its immunogenicity and protective efficacy. The genes of GAPDH cloned from E. acervulina and E. maxima were named as EaGAPDH and EmGAPDH, respectively. The immunogenicity of recombinant proteins of EaGAPDH and EmGAPDH were analyzed by Western blot. The transcription and expression of pVAX-EaGAPDH and pVAX-EmGAPDH in the injected muscles were detected by reverse transcription PCR (RT-PCR) and Western blot, respectively. GAPDH-induced changes of T lymphocytes subpopulation, cytokines production, and antibody were determined using flow cytometry, quantitative real-time PCR (qPCR), and ELISA, respectively. Finally, the protective efficacies of pVAX-EaGAPDH and pVAX-EmGAPDH were evaluated by vaccination and challenge experiments. The results revealed that the recombinant GAPDH proteins reacted with the corresponding chicken antisera. The EaGAPDH genes were successfully transcribed and expressed in the injected muscles. Vaccination with pVAX-EaGAPDH and pVAX-EmGAPDH significantly increased the proportion of CD4+ and CD8+ T lymphocytes, the cytokines productions of IFN-γ, IL-2, IL-4 et al., and IgG antibody levels compared to controls. The vaccination increased the weight gains, decreased the oocyst outputs, alleviate the enteric lesions compared to controls, and induced moderate anti-coccidial index (ACI). In conclusion, the coccidial common antigen of GAPDH induced significant humoral and cellular immune response and effective protection against E. tenella, E. acervulina, E. maxima, and mixed infection of the three Eimeria species. PMID:28769877

Galantamine and carbon monoxide protect brain microvascular endothelial cells by heme oxygenase-1 induction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakao, Atsunori; Thomas E Starzl Transplantation Institute, University of Pittsburgh Medical Center, Pittsburgh, PA 15213; Kaczorowski, David J.

2008-03-14

Galantamine, a reversible inhibitor of acetylcholine esterase (AChE), is a novel drug treatment for mild to moderate Alzheimer's disease and vascular dementia. Interestingly, it has been suggested that galantamine treatment is associated with more clinical benefit in patients with mild-to-moderate Alzheimer disease compared to other AChE inhibitors. We hypothesized that the protective effects of galantamine would involve induction of the protective gene, heme oxygenase-1 (HO-1), in addition to enhancement of the cholinergic system. Brain microvascular endothelial cells (mvECs) were isolated from spontaneous hypertensive rats. Galantamine significantly reduced H{sub 2}O{sub 2}-induced cell death of mvECs in association with HO-1 induction. Thesemore » protective effects were completely reversed by nuclear factor-{kappa}B (NF-{kappa}B) inhibition or HO inhibition. Furthermore, galantamine failed to induce HO-1 in mvECs which lack inducible nitric oxide synthase (iNOS), supplementation of a nitric oxide (NO) donor or iNOS gene transfection on iNOS-deficient mvECs resulted in HO-1 induction with galantamine. These data suggest that the protective effects of galantamine require NF-{kappa}B activation and iNOS expression, in addition to HO-1. Likewise, carbon monoxide (CO), one of the byproducts of HO, up-regulated HO-1 and protected mvECs from oxidative stress in a similar manner. Our data demonstrate that galantamine mediates cytoprotective effects on mvECs through induction HO-1. This pharmacological action of galantamine may, at least in part, account for the superior clinical efficacy of galantamine in vascular dementia and Alzheimer disease.« less

[HPLC specific chromatogram spectrum-effect relationship for Shuanghuanglian on MDCK cell injury induced by influenza A virus (H1N1)].

PubMed

Liu, Ting; Wang, Hai-dan; Di, Liu-qing; Kang, An; Zhao, Xiao-li; Zhu, Xuan-xuan; Li, Jun-song

2015-11-01

To establish HPLC specific chromatogram and its correlation with the protection effect of Shuanghuanglian on MDCK (Madin-Darby canine kidney) cell injury induced by influenza A virus( H1N1). Nine recipes of Shuanghuanglian based on the official prescription were prepared according to orthogonal test for HPLC analysis and MDCK cells protection experiment separately (cytopathic effect (CPE) method was used for observing the virus infectivity and MTT staining results were used as the determining indexes for drug concentration selection and analyzing cell viability). The results suggested that all the other Shuang-Huang-Lian recipes except recipe1 demonstrate protecting effect on MDCK cell injury induced by influenza A virus (P < 0.01, P < 0.001). Stepwise regression analysis was used for analyzing the relationships between HPLC fingerprint and the protecting effect of Shuanghuanglian on influenza A virus induced MDCK cell injury. Peak 2, 3, 6, 8 and 12 were found to be strongly related with anti-influenza A virus efficacy. Stepwise regression analysis of recipes data and efficacy data showed that Lonicerae Japonicae Flos and Forsythiae Fructus were positively associated with the protecting effect of cells injury. From HPLC fingerprints, we found that peak 2, 3, 12 were from Lonicerae Japonicae Flos and peak 6, 8 were from Forsythiae Fructus. Four peaks were identified through comparing the retention time between the standard and Shuanghuanglian recipes, and they were chlorogenicacid, cryptochlorogenic acid, forsythoside B and 3,4-dicaffeoylquinic acid respectively. Caffeic acid derivatives in Lonicerae Japonicae Flos and Forsythiae Fructus were found to be greatly correlated with anti-influenza A virus efficacy and maybe the substance basis of Shuanghuanglian.

Irisin protects against endothelial injury and ameliorates atherosclerosis in apolipoprotein E-Null diabetic mice.

PubMed

Lu, Junyan; Xiang, Guangda; Liu, Min; Mei, Wen; Xiang, Lin; Dong, Jing

2015-12-01

The circulating irisin increases energy expenditure and improves insulin resistance in mice and humans. The improvement of insulin resistance ameliorates atherosclerosis. Therefore, we hypothesized that irisin alleviates atherosclerosis in diabetes. Endothelial function was measured by acetylcholine-induced endothelium-dependent vasodilation using aortic rings in apolipoprotein E-Null (apoE(-/-)) streptozotocin-induced diabetic mice. Atherosclerotic lesion was evaluated by plaque area and inflammatory response in aortas. In addition, the endothelium-protective effects of irisin were also further investigated in primary human umbilical vein endothelial cells (HUVECs) in vitro. The in vivo experiments showed that irisin treatment significantly improved endothelial dysfunction, decreased endothelial apoptosis, and predominantly decreased atherosclerotic plaque area of both en face and cross sections when compared with normal saline-treated diabetic mice. Moreover, the infiltrating macrophages and T lymphocytes within plaque and the mRNA expression levels of inflammatory cytokines in aortas were also significantly reduced by irisin treatment in mice. The in vitro experiments revealed that irisin inhibited high glucose-induced apoptosis, oxidative stress and increased antioxidant enzymes expression in HUVECs, and pretreatment with LY294002, l-NAME, AMPK-siRNA or eNOS-siRNA, attenuated the protection of irisin on HUVECs apoptosis induced by high glucose. In addition, the in vivo and in vitro experiments showed that irisin increased the phosphorylation of AMPK, Akt and eNOS in aortas and cultured HUVECs. The present study indicates that systemic administration of irisin may be protected against endothelial injury and ameliorated atherosclerosis in apoE(-/-) diabetic mice. The endothelium-protective action of irisin was through activation of AMPK-PI3K-Akt-eNOS signaling pathway. Irisin could be therapeutic for atherosclerotic vascular diseases in diabetes. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

The potential benefits of nicaraven to protect against radiation-induced injury in hematopoietic stem/progenitor cells with relative low dose exposures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ali, Haytham; Department of Medical Physiology and Cell Biology, Qena Faculty of Medicine, South Valley University; Galal, Omima

Highlights: • Nicaraven mitigated the radiation-induced reduction of c-kit{sup +} stem cells. • Nicaraven enhanced the function of hematopoietic stem/progenitor cells. • Complex mechanisms involved in the protection of nicaraven to radiation injury. - Abstract: Nicaraven, a hydroxyl radical-specific scavenger has been demonstrated to attenuate radiation injury in hematopoietic stem cells with 5 Gy γ-ray exposures. We explored the effect and related mechanisms of nicaraven for protecting radiation injury induced by sequential exposures to a relatively lower dose γ-ray. C57BL/6 mice were given nicaraven or placebo within 30 min before exposure to 50 mGy γ-ray daily for 30 days inmore » sequences (cumulative dose of 1.5 Gy). Mice were victimized 24 h after the last radiation exposure, and the number, function and oxidative stress of hematopoietic stem cells were quantitatively estimated. We also compared the gene expression in these purified stem cells from mice received nicaraven and placebo treatment. Nicaraven increased the number of c-kit{sup +} stem/progenitor cells in bone marrow and peripheral blood, with a recovery rate around 60–90% of age-matched non-irradiated healthy mice. The potency of colony forming from hematopoietic stem/progenitor cells as indicator of function was completely protected with nicaraven treatment. Furthermore, nicaraven treatment changed the expression of many genes associated to DNA repair, inflammatory response, and immunomodulation in c-kit{sup +} stem/progenitor cells. Nicaraven effectively protected against damages of hematopoietic stem/progenitor cells induced by sequential exposures to a relatively low dose radiation, via complex mechanisms.« less

The mitochondrially targeted antioxidant MitoQ protects the intestinal barrier by ameliorating mitochondrial DNA damage via the Nrf2/ARE signaling pathway.

PubMed

Hu, Qiongyuan; Ren, Jianan; Li, Guanwei; Wu, Jie; Wu, Xiuwen; Wang, Gefei; Gu, Guosheng; Ren, Huajian; Hong, Zhiwu; Li, Jieshou

2018-03-14

Disruption of the mucosal barrier following intestinal ischemia reperfusion (I/R) is life threatening in clinical practice. Mitochondrial dysfunction and oxidative stress significantly contribute to the early phase of I/R injury and amplify the inflammatory response. MitoQ is a mitochondrially targeted antioxidant that exerts protective effects following I/R injury. In the present study, we aimed to determine whether and how MitoQ protects intestinal epithelial cells (IECs) from I/R injury. In both in vivo and in vitro studies, we found that MitoQ pretreatment downregulated I/R-induced oxidative stress and stabilized the intestinal barrier, as evidenced by MitoQ-treated I/R mice exhibiting attenuated intestinal hyperpermeability, inflammatory response, epithelial apoptosis, and tight junction damage compared to controls. Mechanistically, I/R elevated mitochondrial 8-hydroxyguanine content, reduced mitochondrial DNA (mtDNA) copy number and mRNA transcription levels, and induced mitochondrial disruption in IECs. However, MitoQ pretreatment dramatically inhibited these deleterious effects. mtDNA depletion alone was sufficient to induce apoptosis and mitochondrial dysfunction of IECs. Mitochondrial transcription factor A (TFAM), a key activator of mitochondrial transcription, was significantly reduced during I/R injury, a phenomenon that was prevented by MitoQ treatment. Furthermore, we observed that thee protective properties of MitoQ were affected by upregulation of cellular antioxidant genes, including HO-1, NQO-1, and γ-GCLC. Transfection with Nrf2 siRNA in IECs exposed to hypoxia/reperfusion conditions partially blocked the effects of MitoQ on mtDNA damage and mitochondrial oxidative stress. In conclusion, our data suggest that MitoQ exerts protective effect on I/R-induced intestinal barrier dysfunction.

The Volatile Anesthetic Isoflurane Increases Endothelial Adenosine Generation via Microparticle Ecto-5′-Nucleotidase (CD73) Release

PubMed Central

Kim, Mihwa; Ham, Ahrom; Kim, Katelyn Yu-Mi; Brown, Kevin M.; Lee, H. Thomas

2014-01-01

Endothelial dysfunction is common in acute and chronic organ injury. Isoflurane is a widely used halogenated volatile anesthetic during the perioperative period and protects against endothelial cell death and inflammation. In this study, we tested whether isoflurane induces endothelial ecto-5′-nucleotidase (CD73) and cytoprotective adenosine generation to protect against endothelial cell injury. Clinically relevant concentrations of isoflurane induced CD73 activity and increased adenosine generation in cultured human umbilical vein or mouse glomerular endothelial cells. Surprisingly, isoflurane-mediated induction of endothelial CD73 activity occurred within 1 hr and without synthesizing new CD73. We determined that isoflurane rapidly increased CD73 containing endothelial microparticles into the cell culture media. Indeed, microparticles isolated from isoflurane-treated endothelial cells had significantly higher CD73 activity as well as increased CD73 protein. In vivo, plasma from mice anesthetized with isoflurane had significantly higher endothelial cell-derived CD144+ CD73+ microparticles and had increased microparticle CD73 activity compared to plasma from pentobarbital-anesthetized mice. Supporting a critical role of CD73 in isoflurane-mediated endothelial protection, a selective CD73 inhibitor (APCP) prevented isoflurane-induced protection against human endothelial cell inflammation and apoptosis. In addition, isoflurane activated endothelial cells Rho kinase evidenced by myosin phosphatase target subunit-1 and myosin light chain phosphorylation. Furthermore, isoflurane-induced release of CD73 containing microparticles was significantly attenuated by a selective Rho kinase inhibitor (Y27632). Taken together, we conclude that the volatile anesthetic isoflurane causes Rho kinase-mediated release of endothelial microparticles containing preformed CD73 and increase adenosine generation to protect against endothelial apoptosis and inflammation. PMID:24945528

Antihypoxic activities of Eryngium caucasicum and Urtica dioica.

PubMed

Khalili, M; Dehdar, T; Hamedi, F; Ebrahimzadeh, M A; Karami, M

2015-09-01

Urtica dioica and Eryngium spp. have been used in traditional medicine for many years. In spite of many works, nothing is known about their protective effect against hypoxia-induced lethality. Protective effects of U. dioica (UD) aerial parts and E. caucasicum (EC) inflorescence against hypoxia-induced lethality in mice were evaluated by three experimental models of hypoxia, asphyctic, haemic and circulatory. Statistically significant protective activities were established in some doses of extracts in three models. Antihypoxic activity was especially pronounced in polyphenol fractions in asphyctic model. EC polyphenol fraction at 400 mg/kg prolonged survival time (48.80 ± 4.86, p < 0.001) which was comparable with that of phenytoin (p > 0.05). It was the most effective extract in circulatory model, too. It prolonged survival time significantly respect to control group (p < 0.001). UD extracts protected the mice but the response was not dose-dependent. In haemic model, extracts of EP significantly and dose dependently prolonged survival time as compared to control group (p < 0.001). At 600 mg/kg, EP was the most effective one, being capable of keeping the mice alive for 12.71 ± 0.75 min. Only the concentration of 300 mg/kg of UD was effective (p < 0.001). Extracts showed remarkable antihypoxic effects. Pharmacological effects may be attributed to the presence of polyphenols in the extracts.

Synthetic Protection Short Interfering RNA Screen Reveals Glyburide as a Novel Radioprotector

PubMed Central

Jiang, Jianfei; McDonald, Peter R.; Dixon, Tracy M.; Franicola, Darcy; Zhang, Xichen; Nie, Suhua; Epperly, Laura D.; Huang, Zhentai; Kagan, Valerian E.; Lazo, John S.; Epperly, Michael W.; Greenberger, Joel S.

2009-01-01

To assist in screening existing drugs for use as potential radioprotectors, we used a human unbiased 16,560 short interfering RNA (siRNA) library targeting the druggable genome. We performed a synthetic protection screen that was designed to identify genes that, when silenced, protected human glioblastoma T98G cells from γ-radiation-induced cell death. We identified 116 candidate protective genes, then identified 10 small molecule inhibitors of 13 of these candidate gene products and tested their radioprotective effects. Glyburide, a clinically used second-generation hypoglycemic drug, effectively decreased radiation-induced cell death in several cell lines including T98G, glioblastoma U-87 MG, and normal lung epithelial BEAS-2B and in primary cultures of astrocytes. Glyburide significantly increased the survival of 32D cl3 murine hematopoietic progenitor cells when administrated before irradiation. Glyburide was radioprotective in vivo (90% of C57BL/6NHsd female mice pretreated with 10 mg/kg glyburide survived 9.5 Gy total-body irradiation compared to 42% of irradiated controls, P = 0.0249). These results demonstrate the power of unbiased siRNA synthetic protection screening with a druggable genome library to identify new radioprotectors. PMID:19772462

Sulforaphane prevents microcystin-LR-induced oxidative damage and apoptosis in BALB/c mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun Xiaoyun; Mi Lixin; Liu Jin

2011-08-15

Microcystins (MCs), the products of blooming algae Microcystis, are waterborne environmental toxins that have been implicated in the development of liver cancer, necrosis, and even fatal intrahepatic bleeding. Alternative protective approaches in addition to complete removal of MCs in drinking water are urgently needed. In our previous work, we found that sulforaphane (SFN) protects against microcystin-LR (MC-LR)-induced cytotoxicity by activating the NF-E2-related factor 2 (Nrf2)-mediated defensive response in human hepatoma (HepG2) and NIH 3T3 cells. The purpose of this study was to investigate and confirm efficacy the SFN-induced multi-mechanistic defense system against MC-induced hepatotoxicity in an animal model. We reportmore » that SFN protected against MC-LR-induced liver damage and animal death at a nontoxic and physiologically relevant dose in BALB/c mice. The protection by SFN included activities of anti-cytochrome P450 induction, anti-oxidation, anti-inflammation, and anti-apoptosis. Our results suggest that SFN may protect mice against MC-induced hepatotoxicity. This raises the possibility of a similar protective effect in human populations, particularly in developing countries where freshwaters are polluted by blooming algae. - Graphical abstract: Display Omitted Research Highlights: > SFN protected against MC-LR-induced liver damage and animal death in BALB/c mice. > The dose of SFN is at a nontoxic and physiologically relevant dose. > The protection included activities of anti-oxidation, anti-inflammation, and anti-apoptosis. > SFN may protect mice against MC-induced hepatotoxicity.« less

DNA Dosimetry Assessment for Sunscreen Genotoxic Photoprotection

PubMed Central

Schuch, André Passaglia; Lago, Juliana Carvalhães; Yagura, Teiti; Menck, Carlos Frederico Martins

2012-01-01

Background Due to the increase of solar ultraviolet radiation (UV) incidence over the last few decades, the use of sunscreen has been widely adopted for skin protection. However, considering the high efficiency of sunlight-induced DNA lesions, it is critical to improve upon the current approaches that are used to evaluate protection factors. An alternative approach to evaluate the photoprotection provided by sunscreens against daily UV radiation-induced DNA damage is provided by the systematic use of a DNA dosimeter. Methodology/Principal Findings The Sun Protection Factor for DNA (DNA-SPF) is calculated by using specific DNA repair enzymes, and it is defined as the capacity for inhibiting the generation of cyclobutane pyrimidine dimers (CPD) and oxidised DNA bases compared with unprotected control samples. Five different commercial brands of sunscreen were initially evaluated, and further studies extended the analysis to include 17 other products representing various formulations and Sun Protection Factors (SPF). Overall, all of the commercial brands of SPF 30 sunscreens provided sufficient protection against simulated sunlight genotoxicity. In addition, this DNA biosensor was useful for rapidly screening the biological protection properties of the various sunscreen formulations. Conclusions/Significance The application of the DNA dosimeter is demonstrated as an alternative, complementary, and reliable method for the quantification of sunscreen photoprotection at the level of DNA damage. PMID:22768281

Caffeic acid phenethyl ester protects kidneys against acetylsalicylic acid toxicity in rats.

PubMed

Bozkurt, Yasar; Bozkurt, Mehtap; Turkçu, Gul; Sancaktutar, Ahmet Ali; Soylemez, Haluk; Penbegul, Necmettin; Atar, Murat; Bodakcı, Mehmet Nuri; Hatipoglu, Namık Kemal; Yuksel, Hatice; Kıbrıslı, Erkan; Yavuz, Celal

2012-01-01

The aim of this study was to investigate the protective effect of caffeic acid phenethyl ester (CAPE) on acetylsalicylic acid (ASA)-induced renal damage in rats. A total of 40 rats were randomly divided into five groups, with eight rats in each group-group 1: control, not receiving any medication; group 2: ASA (50 mg/kg/day); group 3: ASA (50 mg/kg/day) + CAPE (20 μg/kg/day); group 4: ASA (100 mg/kg/day); and group 5: ASA (100 mg/kg/day) + CAPE (20 μg/kg/day). ASA and CAPE were given via orogastric gavage for 5 days. The total oxidant status (TOS), total antioxidant capacity (TAC), and paraoxonase-1 (PON-1) activity of the blood samples and kidney tissues were determined. Histopathological examinations of the kidneys were performed using light microscopic methods. The TOS level in the serum of rats and kidney tissues given ASA (groups 2 and 4) significantly increased, but the levels of TAC and PON-1 in these tissues significantly decreased in group 4 when compared with the control rats (p < 0.05). The levels of TAC and PON-1 in the kidney tissues increased and the levels of TOS decreased in the CAPE treatment groups (groups 3 and 5) when compared with the rats in the no CAPE treatment groups (groups 2 and 4). The PON-1, TAC, and TOS values reverted to normal levels in group 5 when compared to group 4 (p < 0.05). These results were supported by histopathological observation. Oxidative stress plays an important role in ASA-induced nephrotoxicity, and CAPE may protect against ASA-induced nephrotoxicity in rats.

Long term protection after immunization with P. berghei sporozoites correlates with sustained IFNγ responses of hepatic CD8+ memory T cells.

PubMed

Nganou-Makamdop, Krystelle; van Gemert, Geert-Jan; Arens, Theo; Hermsen, Cornelus C; Sauerwein, Robert W

2012-01-01

Protection against P. berghei malaria can successfully be induced in mice by immunization with both radiation attenuated sporozoites (RAS) arresting early during liver stage development, or sporozoites combined with chloroquine chemoprophylaxis (CPS), resulting in complete intra-hepatic parasite development before killing of blood-stages by chloroquine takes place. We assessed the longevity of protective cellular immune responses by RAS and CPS P. berghei immunization of C57BL/6j mice. Strong effector and memory (T(EM)) CD8+ T cell responses were induced predominantly in the liver of both RAS and CPS immunized mice while CD4+ T cells with memory phenotype remained at base line levels. Compared to unprotected naïve mice, we found high sporozoite-specific IFNγ ex vivo responses that associated with induced levels of in vivo CD8+ T(EM) cells in the liver but not spleen. Long term evaluation over a period of 9 months showed a decline of malaria-specific IFNγ responses in RAS and CPS mice that significantly correlated with loss of protection (r(2) = 0.60, p<0.0001). The reducing IFNγ response by hepatic memory CD8+ T cells could be boosted by re-exposure to wild-type sporozoites. Our data show that sustainable protection against malaria associates with distinct intra-hepatic immune responses characterized by strong IFNγ producing CD8+ memory T cells.

Ameliorative effect of propolis on the cadmium-induced reproductive toxicity in male albino rats.

PubMed

Çilenk, Kübra Tuğçe; Öztürk, İsmet; Sönmez, Mehmet Fatih

2016-10-01

Propolis is a potent antioxidant and a free radical scavenger. The present study aimed to investigate protective effects of propolis extract on cadmium-induced testicular damage, apoptosis, HIF-1α expression and toxicity in rat's testis tissue. A total of 32 male rats were equally divided into four study groups namely, control, Cd (1mg/kg/day), Cd+propolis (50mg/kg/day) and propolis. The rats were decapitated under ketamine anesthesia and their testes tissues were removed. Serum testosterone, tissue malondialdehyde and HIF-1α levels, HIF-1α expression, apoptosis and histopathological damage scores were then compared. In the Cd group, the diameters of seminiferous tubules, tubular biopsy score of Johnsen and serum testosterone levels were decreased compared control group, but tissue HIF-1α and tissue MDA levels was higher than control group. The immunoreactivity of HIF-1α and the number of apoptotic cells were increased in Cd group. Furthermore, the propolis treated group showed an improved histological appearance in the Cd group. Thus, the results suggest that propolis acts as a potent protective agent against Cd-induced testicular toxicity in rats. Copyright © 2016 Elsevier Inc. All rights reserved.

Suppressive effects of chlorophyllin on mutagen-induced umu C gene expression in Salmonella typhimurium (TA 1535/pSK 1002) and tumor promoter-dependent ornithine decarboxylase induction in BALB/c 3T3 fibroblast cells.

PubMed

Okai, Y; Higashi-Okai, K; Yano, Y; Otani, S

1996-08-01

The potentially protective role of chlorophyllin, the sodium and copper salt of chlorophyll a against the initiation and promotion stages in carcinogenesis was studied by in vitro short-term assays. Chlorophyllin showed a dose-dependent suppressive effect on 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indol (Trp-P-1)-induced umu C gene expression of Salmonella typhimurium (TA 1535/pSK 1002) in the presence of metabolizing enzyme mixture. The similar inhibitory effect of chlorophyllin was detected in mitomycin C (MMC)-dependent umu C gene expression in the absence of metabolizing enzyme mixture. Furthermore chlorophyllin also exhibited a dose-dependent inhibition on 12-O-tetradecanoyl-phorbol-13-acetate (TPA)-induced ornithine decarboxylase (ODC) activity of 3T3 fibroblast cells at the same concentrations. However, when chlorophyll a isolated from Japanese tea leaves was applied on the same assay systems as a comparative experiment, chlorophyll a showed much weaker activity compared with that of chlorophyllin. The significance of this finding is discussed from the viewpoint of the protective role of chlorophyllin against carcinogenesis.

Hydrogen sulfide replacement therapy protects the vascular endothelium in hyperglycemia by preserving mitochondrial function.

PubMed

Suzuki, Kunihiro; Olah, Gabor; Modis, Katalin; Coletta, Ciro; Kulp, Gabriella; Gerö, Domokos; Szoleczky, Petra; Chang, Tuanjie; Zhou, Zongmin; Wu, Lingyun; Wang, Rui; Papapetropoulos, Andreas; Szabo, Csaba

2011-08-16

The goal of the present studies was to investigate the role of changes in hydrogen sulfide (H(2)S) homeostasis in the pathogenesis of hyperglycemic endothelial dysfunction. Exposure of bEnd3 microvascular endothelial cells to elevated extracellular glucose (in vitro "hyperglycemia") induced the mitochondrial formation of reactive oxygen species (ROS), which resulted in an increased consumption of endogenous and exogenous H(2)S. Replacement of H(2)S or overexpression of the H(2)S-producing enzyme cystathionine-γ-lyase (CSE) attenuated the hyperglycemia-induced enhancement of ROS formation, attenuated nuclear DNA injury, reduced the activation of the nuclear enzyme poly(ADP-ribose) polymerase, and improved cellular viability. In vitro hyperglycemia resulted in a switch from oxidative phosphorylation to glycolysis, an effect that was partially corrected by H(2)S supplementation. Exposure of isolated vascular rings to high glucose in vitro induced an impairment of endothelium-dependent relaxations, which was prevented by CSE overexpression or H(2)S supplementation. siRNA silencing of CSE exacerbated ROS production in hyperglycemic endothelial cells. Vascular rings from CSE(-/-) mice exhibited an accelerated impairment of endothelium-dependent relaxations in response to in vitro hyperglycemia, compared with wild-type controls. Streptozotocin-induced diabetes in rats resulted in a decrease in the circulating level of H(2)S; replacement of H(2)S protected from the development of endothelial dysfunction ex vivo. In conclusion, endogenously produced H(2)S protects against the development of hyperglycemia-induced endothelial dysfunction. We hypothesize that, in hyperglycemic endothelial cells, mitochondrial ROS production and increased H(2)S catabolism form a positive feed-forward cycle. H(2)S replacement protects against these alterations, resulting in reduced ROS formation, improved endothelial metabolic state, and maintenance of normal endothelial function.

The protective effect of supplemental calcium on colonic permeability depends on a calcium phosphate-induced increase in luminal buffering capacity.

PubMed

Schepens, Marloes A A; ten Bruggencate, Sandra J M; Schonewille, Arjan J; Brummer, Robert-Jan M; van der Meer, Roelof; Bovee-Oudenhoven, Ingeborg M J

2012-04-01

An increased intestinal permeability is associated with several diseases. Previously, we have shown that dietary Ca decreases colonic permeability in rats. This might be explained by a calcium-phosphate-induced increase in luminal buffering capacity, which protects against an acidic pH due to microbial fermentation. Therefore, we investigated whether dietary phosphate is a co-player in the effect of Ca on permeability. Rats were fed a humanised low-Ca diet, or a similar diet supplemented with Ca and containing either high, medium or low phosphate concentrations. Chromium-EDTA was added as an inert dietary intestinal permeability marker. After dietary adaptation, short-chain fructo-oligosaccharides (scFOS) were added to all diets to stimulate fermentation, acidify the colonic contents and induce an increase in permeability. Dietary Ca prevented the scFOS-induced increase in intestinal permeability in rats fed medium- and high-phosphate diets but not in those fed the low-phosphate diet. This was associated with higher faecal water cytotoxicity and higher caecal lactate levels in the latter group. Moreover, food intake and body weight during scFOS supplementation were adversely affected by the low-phosphate diet. Importantly, luminal buffering capacity was higher in rats fed the medium- and high-phosphate diets compared with those fed the low-phosphate diet. The protective effect of dietary Ca on intestinal permeability is impaired if dietary phosphate is low. This is associated with a calcium phosphate-induced increase in luminal buffering capacity. Dragging phosphate into the colon and thereby increasing the colonic phosphate concentration is at least part of the mechanism behind the protective effect of Ca on intestinal permeability.

Fungal β-glucan, a Dectin-1 ligand, promotes protection from Type 1 Diabetes by inducing regulatory innate immune response1

PubMed Central

Karumuthil-Melethil, Subha; Gudi, Radhika; Johnson, Benjamin M.; Perez, Nicolas; Vasu, Chenthamarakshan

2014-01-01

Beta-glucans (β-glucans) are naturally occurring polysaccharides in cereal grains, mushrooms, algae, or microbes including bacteria, fungi, and yeast. Immune cells recognize these β-glucans through a cell surface pathogen recognition receptor (PRR) called Dectin-1. Studies using β-glucans and other Dectin-1 binding components have demonstrated the potential of these agents in activating the immune cells for cancer treatment and controlling infections. Here, we show that the β-glucan from Saccharomyces cerevisiae induces the expression of immune regulatory cytokines (IL-10, TGF-β1 and IL-2) and a tolerogenic enzyme (Indoleamine 2, 3-dioxygenase; IDO) in bone marrow derived DCs (BM DCs) as well as spleen cells. These properties can be exploited to modulate autoimmunity in non-obese diabetic (NOD) mouse model of type 1 diabetes (T1D). Treatment of pre-diabetic NOD mice with low dose β-glucan resulted in a profound delay in hyperglycemia and this protection was associated with increase in the frequencies of Foxp3-, LAP-, and GARP-positive T cells. Upon antigen presentation, β-glucan-exposed DCs induced a significant increase in Foxp3− and LAP− positive T cells in in vitro cultures. Further, systemic co-administration of β-glucan plus pancreatic β-cell-Ag resulted in an enhanced protection of NOD mice from T1D as compared to treatment with β-glucan alone. These observations demonstrate that the innate immune response induced by low dose β-glucan is regulatory in nature and can be exploited to modulate T cell response to β-cell-Ag for inducing an effective protection from T1D. PMID:25143443

Histopathological and in vivo evidence of regucalcin as a protective molecule in mammary gland carcinogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marques, Ricardo; Vaz, Cátia V.; Maia, Cláudio J.

Regucalcin (RGN) is a calcium-binding protein, which has been shown to be underexpressed in cancer cases. This study aimed to determine the association of RGN expression with clinicopathological parameters of human breast cancer. In addition, the role of RGN in malignancy of mammary gland using transgenic rats overexpressing the protein (Tg-RGN) was investigated. Wild-type (Wt) and Tg-RGN rats were treated with 7,12-dimethylbenz[α]anthracene (DMBA). Carcinogen-induced tumors were histologically classified and the Ki67 proliferation index was estimated. Immunohistochemistry analysis showed that RGN immunoreactivity was negatively correlated with the histological grade of breast infiltrating ductal carcinoma suggesting that progression of breast cancer ismore » associated with loss of RGN. Tg-RGN rats displayed lower incidence of carcinogen-induced mammary gland tumors, as well as lower incidence of invasive forms. Moreover, higher proliferation was observed in non-invasive tumors of Wt animals comparatively with Tg-RGN. Overexpression of RGN was associated with diminished expression of cell-cycle inhibitors and increased expression of apoptosis inducers. Augmented activity of apoptosis effector caspase-3 was found in the mammary gland of Tg-RGN. RGN overexpression protected from carcinogen-induced mammary gland tumor development and was linked with reduced proliferation and increased apoptosis. These findings indicated the protective role of RGN in the carcinogenesis of mammary gland. - Highlights: • RGN immunoreactivity was negatively correlated with breast cancer differentiation. • Transgenic overexpression of RGN diminished incidence of carcinogen-induced tumors. • Transgenic overexpression of RGN restricted proliferation and fostered apoptosis. • RGN has a protective role in the carcinogenesis of mammary gland.« less

Vagus nerve contributes to the development of steatohepatitis and obesity in phosphatidylethanolamine N-methyltransferase deficient mice.

PubMed

Gao, Xia; van der Veen, Jelske N; Zhu, Linfu; Chaba, Todd; Ordoñez, Marta; Lingrell, Susanne; Koonen, Debby P Y; Dyck, Jason R B; Gomez-Muñoz, Antonio; Vance, Dennis E; Jacobs, René L

2015-04-01

Phosphatidylethanolamine N-methyltransferase (PEMT), a liver enriched enzyme, is responsible for approximately one third of hepatic phosphatidylcholine biosynthesis. When fed a high-fat diet (HFD), Pemt(-/-) mice are protected from HF-induced obesity; however, they develop steatohepatitis. The vagus nerve relays signals between liver and brain that regulate peripheral adiposity and pancreas function. Here we explore a possible role of the hepatic branch of the vagus nerve in the development of diet induced obesity and steatohepatitis in Pemt(-/-) mice. 8-week old Pemt(-/-) and Pemt(+/+) mice were subjected to hepatic vagotomy (HV) or capsaicin treatment, which selectively disrupts afferent nerves, and were compared to sham-operated or vehicle-treatment, respectively. After surgery, mice were fed a HFD for 10 weeks. HV abolished the protection against the HFD-induced obesity and glucose intolerance in Pemt(-/-) mice. HV normalized phospholipid content and prevented steatohepatitis in Pemt(-/-) mice. Moreover, HV increased the hepatic anti-inflammatory cytokine interleukin-10, reduced chemokine monocyte chemotactic protein-1 and the ER stress marker C/EBP homologous protein. Furthermore, HV normalized the expression of mitochondrial electron transport chain proteins and of proteins involved in fatty acid synthesis, acetyl-CoA carboxylase and fatty acid synthase in Pemt(-/-) mice. However, disruption of the hepatic afferent vagus nerve by capsaicin failed to reverse either the protection against the HFD-induced obesity or the development of HF-induced steatohepatitis in Pemt(-/-) mice. Neuronal signals via the hepatic vagus nerve contribute to the development of steatohepatitis and protection against obesity in HFD fed Pemt(-/-) mice. Copyright © 2014 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Protective mechanism of turmeric (Curcuma longa) on carbofuran-induced hematological and hepatic toxicities in a rat model.

PubMed

Hossen, Md Sakib; Tanvir, E M; Prince, Maruf Billah; Paul, Sudip; Saha, Moumoni; Ali, Md Yousuf; Gan, Siew Hua; Khalil, Md Ibrahim; Karim, Nurul

2017-12-01

Turmeric (Curcuma longa L. [Zingiberaceae]) is used in the treatment of a variety of conditions including pesticide-induced toxicity. The study reports the antioxidant properties and the protective effects of turmeric against carbofuran (CF)-induced toxicity in rats. The antioxidant potential was determined by using free radicals scavenging activity and ferric reducing antioxidant power values. Male Wistar rats were randomly divided into four groups, designated as control, turmeric (100 mg/kg/day), CF (1 mg/kg/day) and turmeric (100 mg/kg/day) + CF (1 mg/kg/day) treatments. All of the doses were administered orally for 28 consecutive days. The biological activity of the turmeric and CF was determined by using several standard biochemical methods. Turmeric contains high concentrations of polyphenols (8.97 ± 0.15 g GAEs), flavonoids (5.46 ± 0.29 g CEs), ascorbic acid (0.06 ± 0.00 mg AEs) and FRAP value (1972.66 ± 104.78 μM Fe 2+ ) per 100 g of sample. Oral administration of CF caused significant changes in some of the blood indices, such as, mean corpuscular volume, corpuscular hemoglobin, white blood cell, platelet distribution width and induced severe hepatic injuries associated with oxidative stress, as observed by the significantly higher lipid peroxidation (LPO) levels when compared to control, while the activities of cellular antioxidant enzymes (including superoxide dismutase and glutathione peroxidase) were significantly suppressed in the liver tissue. Turmeric supplementation could protect against CF-induced hematological perturbations and hepatic injuries in rats, plausibly by the up-regulation of antioxidant enzymes and inhibition of LPO to confer the protective effect.

Avirulent Marek’s Disease Virus Type 1 Strain 814 Vectored Vaccine Expressing Avian Influenza (AI) Virus H5 Haemagglutinin Induced Better Protection Than Turkey Herpesvirus Vectored AI Vaccine

PubMed Central

Cui, Xianlan; Zhao, Yan; Shi, Xingming; Li, Qiaoling; Yan, Shuai; Gao, Ming; Wang, Mei; Liu, Changjun; Wang, Yunfeng

2013-01-01

Background Herpesvirus of turkey (HVT) as a vector to express the haemagglutinin (HA) of avian influenza virus (AIV) H5 was developed and its protection against lethal Marek’s disease virus (MDV) and highly pathogenic AIV (HPAIV) challenges was evaluated previously. It is well-known that avirulemt MDV type 1 vaccines are more effective than HVT in prevention of lethal MDV infection. To further increase protective efficacy against HPAIV and lethal MDV, a recombinant MDV type 1 strain 814 was developed to express HA gene of HPAIV H5N1. Methodology/Principal Findings A recombinant MDV-1 strain 814 expressing HA gene of HPAIV H5N1 virus A/goose/Guangdong/3/96 at the US2 site (rMDV-HA) was developed under the control of a human CMV immediate-early promoter. The HA expression in the rMDV-HA was tested by immunofluorescence and Western blot analyses, and in vitro and in vivo growth properties of rMDV-HA were also analyzed. Furthermore, we evaluated and compared the protective immunity of rMDV-HA and previously constructed rHVT-HA against HPAIV and lethal MDV. Vaccination of chickens with rMDV-HA induced 80% protection against HPAIV, which was better than the protection rate by rHVT-HA (66.7%). In the animal study with MDV challenge, chickens immunized with rMDV-HA were completely protected against virulent MDV strain J-1 whereas rHVT-HA only induced 80% protection with the same challenge dose. Conclusions/Significance The rMDV-HA vaccine was more effective than rHVT-HA vaccine for protection against lethal MDV and HPAIV challenges. Therefore, avirulent MDV type 1 vaccine is a better vector than HVT for development of a recombinant live virus vaccine against virulent MDV and HPAIV in poultry. PMID:23301062

Recombinant lactobacillus expressing G protein of spring viremia of carp virus (SVCV) combined with ORF81 protein of koi herpesvirus (KHV): A promising way to induce protective immunity against SVCV and KHV infection in cyprinid fish via oral vaccination.

PubMed

Cui, Li-Chun; Guan, Xue-Ting; Liu, Zhong-Mei; Tian, Chang-Yong; Xu, Yi-Gang

2015-06-17

Spring viremia of carp virus (SVCV) and koi herpesvirus (KHV) are highly contagious and pathogenic to cyprinid fish, causing enormous economic losses in aquaculture. Although DNA vaccines reported in recent years could induce protective immune responses in carps against these viruses via injection, there are a number of consequences and uncertainties related to DNA vaccination. Therefore, more effective and practical method to induce protective immunity such as oral administration would be highly desirable. In this study, we investigated the utilities of a genetically engineered Lactobacillus plantarum (L. plantarum) coexpressing glycoprotein (G) of SVCV and ORF81 protein of KHV as oral vaccine to induce protective immunity in carps via oral vaccination. The surface-displayed recombinant plasmid pYG-G-ORF81 was electroporated into L. plantarum, giving rise to LP/pYG-G-ORF81, where expression and localization of G-ORF81 fusion protein from the LP/pYG-G-ORF81 was identified by SDS-PAGE, Western blotting and immunofluorescence assay. Bait feed particles containing the LP/pYG-G-ORF81 were used as vaccine to immunize carps via gastrointestinal route. Compared to control groups, the carps orally immunized with the LP/pYG-G-ORF81 were induced significant levels of immunoglobulin M (IgM), and its immunogenicity was confirmed by viral loads reduction detected by PCR assay after virus challenge followed by an effective protection rate 71% in vaccinated carps and 53% in vaccinated koi until at days 65 post challenge, respectively. Our study here demonstrates, for the first time, the ability of recombinant L. plantarum as oral vaccine against SVCV and KHV infection in carps, suggesting a practical multivalent strategy for the control of spring viremia of carp and koi herpesvirus disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

Combined effects of vitamin E and omega-3 fatty acids on protecting ambient PM2.5-induced cardiovascular injury in rats.

PubMed

Du, Xihao; Jiang, Shuo; Bo, Liang; Liu, Jie; Zeng, Xuejiao; Xie, Yuquan; He, Qing; Ye, Xingwang; Song, Weiming; Zhao, Jinzhuo

2017-04-01

This study aims to observe whether the combined treatment with vitamin E (vit E) and omega-3 polyunsaturated fatty acids (Ω-3 FA) could prevent the fine particulate matter (PM 2.5 )-induced cardiovascular injury through alleviating inflammation and oxidative stress. At the same time, the appropriate combination dosage of vit E and Ω-3 FA was explored to find an optimized protective dose to protect the injury induced by PM 2.5 . The SD rats were pretreated with different concentration of vit E and Ω-3 FA separately or jointly. Then the rats were exposed to ambient PM 2.5 by intratracheal instillation for three times. The expression of tumor necrosis factor α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6) in serum and supernatant of cardiac tissue were detected by ELISA kits. The levels of malondialdehyde (MDA), superoxide Dismutase (SOD) and glutathione-peroxidase (GSH-Px) in myocardium and the level of MDA in serum were measured. Meanwhile, the cardiac injury was evaluated by histopathological examination. Compared with the severe injury of rats in PM 2.5 exposure group, the rats in vit E or Ω-3 FA-pretreated groups had a slighter injury in heart. Meanwhile, pretreatment with vit E or Ω-3 FA induced a significantly alleviation of the inflammatory cytokines (TNF-α, IL-1β, IL-6) and the elevation of the anti-oxidative activity especially in the rats pretreated with combined vit E and Ω-3 FA. In addition, the combined protecting effects of vit E and Ω-3 FA showed a dose-dependent manner. Supplementation with vit E and Ω-3 FA could protect the PM 2.5 -induced injury, and the combination of vit E and Ω-3 FA might produce more effective effects than the separate nutrient did. Copyright © 2017 Elsevier Ltd. All rights reserved.

Air bubbles and hemolysis of blood samples during transport by pneumatic tube systems.

PubMed

Mullins, Garrett R; Bruns, David E

2017-10-01

Transport of blood samples through pneumatic tube systems (PTSs) generates air bubbles in transported blood samples and, with increasing duration of transport, the appearance of hemolysis. We investigated the role of air-bubble formation in PTS-induced hemolysis. Air was introduced into blood samples for 0, 1, 3 or 5min to form air bubbles. Hemolysis in the blood was assessed by (H)-index, lactate dehydrogenase (LD) and potassium in plasma. In an effort to prevent PTS-induced hemolysis, blood sample tubes were completely filled, to prevent air bubble formation, and compared with partially filled samples after PTS transport. We also compared hemolysis in anticoagulated vs clotted blood subjected to PTS transport. As with transport through PTSs, the duration of air bubble formation in blood by a gentle stream of air predicted the extent of hemolysis as measured by H-index (p<0.01), LD (p<0.01), and potassium (p<0.02) in plasma. Removing air space in a blood sample prevented bubble formation and fully protected the blood from PTS-induced hemolysis (p<0.02 vs conventionally filled collection tube). Clotted blood developed less foaming during PTS transport and was partially protected from hemolysis vs anticoagulated blood as indicated by lower LD (p<0.03) in serum than in plasma after PTS sample transport. Prevention of air bubble formation in blood samples during PTS transport protects samples from hemolysis. Copyright © 2017 Elsevier B.V. All rights reserved.

Intranasal immunization with novel EspA-Tir-M fusion protein induces protective immunity against enterohemorrhagic Escherichia coli O157:H7 challenge in mice.

PubMed

Lin, Ruqin; Zhu, Bo; Zhang, Yiduo; Bai, Yang; Zhi, Fachao; Long, Beiguo; Li, Yawen; Wu, Yuhua; Wu, Xianbo; Fan, Hongying

2017-04-01

Enterohemorrhagic Escherichia coli (EHEC) O157:H7 causes hemorrhagic colitis and hemolytic uremic syndrome in humans. Due to the risks associated with antibiotic treatment against EHEC O157:H7 infection, vaccines represent a promising method for prevention of EHEC O157:H7 infection. Therefore, we constructed the novel bivalent antigen EspA-Tir-M as a candidate EHEC O157:H7 subunit vaccine. We then evaluated the immunogenicity of this novel EHEC O157:H7 subunit vaccine. Immune responses to the fusion protein administered by intranasal and subcutaneous routes were compared in mice. Results showed higher levels of specific mucosal and systemic antibody responses induced by intranasal as compared to subcutaneous immunization. Intranasal immunization enhanced the concentration of interleukin-4, interleukin-10, and interferon-γ, while subcutaneous immunization enhanced only the latter two. In addition, intranasal immunization protected against EHEC O157:H7 colonization and infection in mice at a rate of 90%.Histopathological analysis revealed that vaccination reduced colon damage, especially when administered intranasally. In contrast, subcutaneous immunization elicited a weak immune response and exhibited a low protection rate. These findings demonstrate that intranasal immunization with the fusion protein induces both humoral and cellular immune (Th1/Th2) responses in mice. The novel EspA-Tir-M novel fusion protein therefore represents a promising subunit vaccine against EHEC O157:H7 infection. Copyright © 2017 Elsevier Ltd. All rights reserved.

Pre- and post-treatments with escitalopram protect against experimental ischemic neuronal damage via regulation of BDNF expression and oxidative stress.

PubMed

Lee, Choong Hyun; Park, Joon Ha; Yoo, Ki-Yeon; Choi, Jung Hoon; Hwang, In Koo; Ryu, Pan Dong; Kim, Do-Hoon; Kwon, Young-Guen; Kim, Young-Myeong; Won, Moo-Ho

2011-06-01

Selective serotonin re-uptake inhibitors (SSRI) have been widely used in treatment of major depression because of their efficacy, safety, and tolerability. Escitalopram, an SSRI, is known to decrease oxidative stress in chronic stress animal models. In the present study, we examined the neuroprotective effects of pre- and post-treatments with 20 mg/kg and 30 mg/kg escitalopram in the gerbil hippocampal CA1 region (CA1) after transient cerebral ischemia. Pre-treatment with escitalopram protected against ischemia-induced neuronal death in the CA1 after ischemia/reperfusion (I/R). Post-treatment with 30 mg/kg, not 20 mg/kg, escitalopram had a neuroprotective effect against ischemic damage. In addition, 20 mg/kg pre- and 30 mg/kg post-treatments with escitalopram increased brain-derived neurotrophic factor (BDNF) protein levels in the ischemic CA1 compared to vehicle-treated ischemia animals. In addition, 20 mg/kg pre- and 30 mg/kg post-treatments with escitalopram reduced microglia activation and decreased 4-hydroxy-2-nonenal and Cu,Zn-superoxide dismutase immunoreactivity and their levels in the ischemic CA1 compared to vehicle-treated ischemia animals after transient cerebral ischemia. In conclusion, these results indicated that pre- and post-treatments with escitalopram can protect against ischemia-induced neuronal death in the CA1 induced by transient cerebral ischemic damage by increase of BDNF as well as decrease of microglia activation and oxidative stress. Copyright © 2011 Elsevier Inc. All rights reserved.

A diet containing whey protein, glutamine, and TGFbeta modulates gut protein metabolism during chemotherapy-induced mucositis in rats.

PubMed

Boukhettala, Nabile; Ibrahim, Ayman; Claeyssens, Sophie; Faure, Magali; Le Pessot, Florence; Vuichoud, Jacques; Lavoinne, Alain; Breuillé, Denis; Déchelotte, Pierre; Coëffier, Moïse

2010-08-01

Mucositis, a common side effect of chemotherapy, is characterized by compromised digestive function, barrier integrity and immune competence. Our aim was to evaluate the impact of a specifically designed diet Clinutren Protect (CP), which contains whey proteins, TGFbeta-rich casein, and free glutamine, on mucositis in rats. Mucositis was induced by three consecutive injections (day 0, day 1, day 2) of methotrexate (2.5 mg/kg). Rats had free access to CP or placebo diets from days -7 to 9. In the placebo diet, whey proteins and TGFbeta-rich casein were replaced by TGFbeta-free casein and glutamine by alanine. Intestinal parameters were assessed at day 3 and 9. Values, expressed as mean +/- SEM, were compared using two-way ANOVA. At day 3, villus height was markedly decreased in the placebo (296 +/- 11 microm) and CP groups (360 +/- 10 microm) compared with controls (464 +/- 27 microm), but more markedly in the placebo as compared to CP group. The intestinal damage score was also reduced in the CP compared with the placebo group. Glutathione content increased in the CP compared with the placebo group (2.2 +/- 0.2 vs. 1.7 +/- 0.2 micromol/g tissue). Gut protein metabolism was more affected in the placebo than in the CP group. The fractional synthesis rate was decreased in the placebo group (93.8 +/- 4.9%/day) compared with controls (121.5 +/- 12.1, P < 0.05), but not in the CP group (106.0 +/- 13.1). In addition, at day 9, rats exhibited improved body weight and food intake recovery in the CP compared to the placebo group. Clinutren Protect feeding reduces intestinal injury in the acute phase of methotrexate-induced mucositis in rats and improves recovery.

O-mannosylation of the Mycobacterium tuberculosis Adhesin Apa Is Crucial for T Cell Antigenicity during Infection but Is Expendable for Protection

PubMed Central

Dobos, Karen M.; Lucas, Megan; Spencer, John S.; Fang, Sunan; McDonald, Melissa A.; Pohl, Jan; Birkness, Kristin; Chamcha, Venkateswarlu; Ramirez, Melissa V.; Plikaytis, Bonnie B.; Posey, James E.; Amara, Rama Rao

2013-01-01

Glycosylation is the most abundant post-translational polypeptide chain modification in nature. Although carbohydrate modification of protein antigens from many microbial pathogens constitutes important components of B cell epitopes, the role in T cell immunity is not completely understood. Here, using ELISPOT and polychromatic flow cytometry, we show that O-mannosylation of the adhesin, Apa, of Mycobacterium tuberculosis (Mtb) is crucial for its T cell antigenicity in humans and mice after infection. However, subunit vaccination with both mannosylated and non-mannosylated Apa induced a comparable magnitude and quality of T cell response and imparted similar levels of protection against Mtb challenge in mice. Both forms equally improved waning BCG vaccine-induced protection in elderly mice after subunit boosting. Thus, O-mannosylation of Apa is required for antigenicity but appears to be dispensable for its immunogenicity and protective efficacy in mice. These results have implications for the development of subunit vaccines using post-translationally modified proteins such as glycoproteins against infectious diseases like tuberculosis. PMID:24130497

O-mannosylation of the Mycobacterium tuberculosis adhesin Apa is crucial for T cell antigenicity during infection but is expendable for protection.

PubMed

Nandakumar, Subhadra; Kannanganat, Sunil; Dobos, Karen M; Lucas, Megan; Spencer, John S; Fang, Sunan; McDonald, Melissa A; Pohl, Jan; Birkness, Kristin; Chamcha, Venkateswarlu; Ramirez, Melissa V; Plikaytis, Bonnie B; Posey, James E; Amara, Rama Rao; Sable, Suraj B

2013-01-01

Glycosylation is the most abundant post-translational polypeptide chain modification in nature. Although carbohydrate modification of protein antigens from many microbial pathogens constitutes important components of B cell epitopes, the role in T cell immunity is not completely understood. Here, using ELISPOT and polychromatic flow cytometry, we show that O-mannosylation of the adhesin, Apa, of Mycobacterium tuberculosis (Mtb) is crucial for its T cell antigenicity in humans and mice after infection. However, subunit vaccination with both mannosylated and non-mannosylated Apa induced a comparable magnitude and quality of T cell response and imparted similar levels of protection against Mtb challenge in mice. Both forms equally improved waning BCG vaccine-induced protection in elderly mice after subunit boosting. Thus, O-mannosylation of Apa is required for antigenicity but appears to be dispensable for its immunogenicity and protective efficacy in mice. These results have implications for the development of subunit vaccines using post-translationally modified proteins such as glycoproteins against infectious diseases like tuberculosis.

Protective Role of Comfrey Leave Extracts on UV-induced Zebrafish Fin Damage

PubMed Central

Cheng, Chien-Chung; Chou, Chi-Yuan; Chang, Yao-Chin; Wang, Hsuan-Wen; Wen, Chi-Chung; Chen, Yau-Hung

2014-01-01

In zebrafish, UV exposure leads to fin malformation phenotypes including fin reduction or absence. The present study evaluated UV-protective activities of comfrey leaves extracts in a zebrafish model by recording fin morphological changes. Chemopreventive effects of comfrey leave extracts were evaluated using Kaplan-Meier analysis and Cox proportional hazards regression. The results showed that (1) the mean times of return to normal fin in the UV+comfrey (50 and 100 ppm) groups were 3.43 and 2.86 days and were quicker compared with that in the UV only group (4.21 days); (2) zebrafish fins in the UV+comfrey (50 and 100 ppm) groups were 2.05 and 3.25 times more likely to return to normal than those in the UV only group; and (3) comfrey leave extracts had UV-absorbance abilities and significantly reduced ROS production in UV-exposed zebrafish embryos, which may attenuate UV-mediated apoptosis. In conclusion, comfrey leaves extracts may have the potential to be developed as UV-protective agents to protect zebrafish embryos from UV-induced damage. PMID:25352712

Agaricus blazei Murill as an efficient hepatoprotective and antioxidant agent against CCl4-induced liver injury in rats

PubMed Central

Al-Dbass, Abeer M.; Al- Daihan, Sooad K.; Bhat, Ramesa Shafi

2012-01-01

Agaricus blazei Murill is one of the very popular edible medicinal mushrooms. The present study investigated the protective effect of this biologically active mushroom on the tissue peroxidative damage and abnormal antioxidant levels in carbon tetrachloride induced hepatotoxicity in male albino rats. Male albino rats of Sprague–Dawley strain weighting (120–150 g) were categorized into five groups. The first group served as the normal control, the second and the third groups were treated with Agaricus blazei Mushroom extract and carbon tetrachloride dose, respectively. Fourth group (protective group) was first treated with Agaricus blazei Mushroom extract followed by carbon tetrachloride treatment and fifth (therapeutic group) with carbon tetrachloride first followed by Agaricus blazei Mushroom treatment. The wet fruiting bodies of mushroom Agaricus blazei Murill, crushed and suspended in distilled water was administered orally to the treated groups of male albino rats. The activities of various enzymes (aspartate and alanine transaminase, lactate dehydrogenase, glutathione reductase), levels of non-enzymatic antioxidants (glutathione, vitamin C, vitamin E) and level of lipid peroxidation (malondialdehyde) were determined in the serum of all the experimental animals. Decrease in all the enzymes and non-enzymatic antioxidant, along with an increase in the lipid peroxidative index (malondialdehyde) was found in all the carbon tetrachloride treated rats as compared with normal controls. Also increase level of non-enzymatic antioxidant along with the decrease level in malondialdehyde was found in all experimental animals which were treated with Agaricus blazei Mushroom extract as compared with normal controls. The findings indicate that the extract of Agaricus blazei Murill can protect the liver against carbon tetrachloride induced oxidative damage in rats and is an efficient hepatoprotective and antioxidant agent against carbon tetrachloride induced liver injury. PMID:23961190

Agaricus blazei Murill as an efficient hepatoprotective and antioxidant agent against CCl4-induced liver injury in rats.

PubMed

Al-Dbass, Abeer M; Al-Daihan, Sooad K; Bhat, Ramesa Shafi

2012-07-01

Agaricus blazei Murill is one of the very popular edible medicinal mushrooms. The present study investigated the protective effect of this biologically active mushroom on the tissue peroxidative damage and abnormal antioxidant levels in carbon tetrachloride induced hepatotoxicity in male albino rats. Male albino rats of Sprague-Dawley strain weighting (120-150 g) were categorized into five groups. The first group served as the normal control, the second and the third groups were treated with Agaricus blazei Mushroom extract and carbon tetrachloride dose, respectively. Fourth group (protective group) was first treated with Agaricus blazei Mushroom extract followed by carbon tetrachloride treatment and fifth (therapeutic group) with carbon tetrachloride first followed by Agaricus blazei Mushroom treatment. The wet fruiting bodies of mushroom Agaricus blazei Murill, crushed and suspended in distilled water was administered orally to the treated groups of male albino rats. The activities of various enzymes (aspartate and alanine transaminase, lactate dehydrogenase, glutathione reductase), levels of non-enzymatic antioxidants (glutathione, vitamin C, vitamin E) and level of lipid peroxidation (malondialdehyde) were determined in the serum of all the experimental animals. Decrease in all the enzymes and non-enzymatic antioxidant, along with an increase in the lipid peroxidative index (malondialdehyde) was found in all the carbon tetrachloride treated rats as compared with normal controls. Also increase level of non-enzymatic antioxidant along with the decrease level in malondialdehyde was found in all experimental animals which were treated with Agaricus blazei Mushroom extract as compared with normal controls. The findings indicate that the extract of Agaricus blazei Murill can protect the liver against carbon tetrachloride induced oxidative damage in rats and is an efficient hepatoprotective and antioxidant agent against carbon tetrachloride induced liver injury.

The Destabilization of Protected Soil Organic Carbon Following Experimental Drought at the Pore and Core scale

NASA Astrophysics Data System (ADS)

Smith, A. P.; Bond-Lamberty, B. P.; Tfaily, M. M.; Todd-Brown, K. E.; Bailey, V. L.

2015-12-01

The movement of water and solutes through the pore matrix controls the distribution and transformation of carbon (C) in soils. Thus, a change in the hydrologic connectivity, such as increased saturation, disturbance or drought, may alter C mineralization and greenhouse gas (GHG) fluxes to the atmosphere. While these processes occur at the pore scale, they are often investigated at coarser scale. This project investigates pore- and core-scale soil C dynamics with varying hydrologic factors (simulated precipitation, groundwater-led saturation, and drought) to assess how climate-change induced shifts in hydrologic connectivity influences the destabilization of protected C in soils. Surface soil cores (0-15 cm depth) were collected from the Disney Wilderness Preserve, Florida, USA where water dynamics, particularly water table rise and fall, appear to exert a strong control on the emissions of GHGs and the persistence of soil organic matter in these soils. We measured CO2 and CH4 from soils allowed to freely imbibe water from below to a steady state starting from either field moist conditions or following experimental drought. Parallel treatments included the addition of similar quantities of water from above to simulate precipitation. Overall respiration increased in soil cores subjected to drought compared to field moist cores independent of wetting type. Cumulative CH4 production was higher in drought-induced soils, especially in the soils subjected to experimental groundwater-led saturation. Overall, the more C (from CO2 and CH4) was lost in drought-induced soils compared to field moist cores. Our results indicate that future drought events could have profound effects on the destabilization of protected C, especially in groundwater-fed soils. Our next steps focus on how to accurately capture drought-induced C destabilization mechanisms in earth system models.

Alpha-Tocopherol Supplementation Restricts Aluminium- and Ethanol-Induced Oxidative Damage in Rat Brain but Fails to Protect Against Neurobehavioral Damage.

PubMed

Nayak, Prasunpriya; Sharma, Shiv Bhushan; Chowdary, N V S

2018-04-05

The concurrent presence of oxidative stress (OS) and aluminium exposure is an inducer of neurodegenerative changes. Aluminium can augment OS in a pro-oxidant dominant condition. Antioxidative property of α-tocopherol may be useful in restricting these degenerative changes in the brain. OS parameters are tested in frontal cortex (FC), hippocampus (HC), and cerebellum (CL) of α-tocopherol-supplemented (5 IU/day) male Wistar rats exposed to aluminium (10 mg Al/Kg/day; "Al"), ethanol (0.6 g ethanol/Kg/day; "Et"), and both ("Al-Et") and vehicle-treated control ("C") for 4 weeks. The α-tocopherol supplementation restricted regional alterations of reduced glutathione, superoxide dismutase, catalase, and glutathione peroxidase. Accordingly, the regional superoxide and peroxide handling capacities (SPHC) also remain unaltered. Al-Et group demonstrated significant elevation in the lipid peroxidation level in FC and CL regions compared to the group C; similar elevations in lipid peroxidation were noted in all the tested brain regions of Al group. Likewise, declines in glutathione reductase activity were noted in HC (versus Et group) and CL (versus Al and Et groups) of Al-Et group. Interestingly, changes in behavioral patterns of all the treatment groups are comparable while differing from that of the control group. Significant difference with group C is observed during first through fourth weeks, third to fourth weeks, and second to third weeks in terms of spontaneous motor activity, Rota Rod performance, and Hebb-Williams maze performance, respectively. Hence, the current dose and duration of α-tocopherol supplementation failed to provide full protection against the aluminium-induced neurodegeneration; nevertheless, it could provide only partial protection toward aluminium-induced augmentation of OS in specific brain regions.

Human dendritic cell DC-SIGN and TLR-2 mediate complementary immune regulatory activities in response to Lactobacillus rhamnosus JB-1.

PubMed

Konieczna, Patrycja; Schiavi, Elisa; Ziegler, Mario; Groeger, David; Healy, Selena; Grant, Ray; O'Mahony, Liam

2015-01-01

The microbiota is required for optimal host development and ongoing immune homeostasis. Lactobacilli are common inhabitants of the mammalian large intestine and immunoregulatory effects have been described for certain, but not all, strains. The mechanisms underpinning these protective effects are beginning to be elucidated. One such protective organism is Lactobacillus rhamnosus JB-1 (Lb. rhamnosus JB-1). Lb. murinus has no such anti-inflammatory protective effects and was used as a comparator organism. Human monocyte-derived dendritic cells (MDDCs) were co-incubated with bacteria and analysed over time for bacterial adhesion and intracellular processing, costimulatory molecule expression, cytokine secretion and induction of lymphocyte polarization. Neutralising antibodies were utilized to identify the responsible MDDC receptors. Lb. rhamnosus JB-1 adhered to MDDCs, but internalization and intracellular processing was significantly delayed, compared to Lb. murinus which was rapidly internalized and processed. Lb. murinus induced CD80 and CD86 expression, accompanied by high levels of cytokine secretion, while Lb. rhamnosus JB-1 was a poor inducer of costimulatory molecule expression and cytokine secretion. Lb. rhamnosus JB-1 primed MDDCs induced Foxp3 expression in autologous lymphocytes, while Lb. murinus primed MDDCs induced Foxp3, T-bet and Ror-γt expression. DC-SIGN was required for Lb. rhamnosus JB-1 adhesion and influenced IL-12 secretion, while TLR-2 influenced IL-10 and IL-12 secretion. Here we demonstrate that the delayed kinetics of bacterial processing by MDDCs correlates with MDDC activation and stimulation of lymphocytes. Thus, inhibition or delay of intracellular processing may be a novel strategy by which certain commensals may avoid the induction of proinflammatory responses.

Human Dendritic Cell DC-SIGN and TLR-2 Mediate Complementary Immune Regulatory Activities in Response to Lactobacillus rhamnosus JB-1

PubMed Central

Konieczna, Patrycja; Schiavi, Elisa; Ziegler, Mario; Groeger, David; Healy, Selena; Grant, Ray; O’Mahony, Liam

2015-01-01

The microbiota is required for optimal host development and ongoing immune homeostasis. Lactobacilli are common inhabitants of the mammalian large intestine and immunoregulatory effects have been described for certain, but not all, strains. The mechanisms underpinning these protective effects are beginning to be elucidated. One such protective organism is Lactobacillus rhamnosus JB-1 (Lb. rhamnosus JB-1). Lb. murinus has no such anti-inflammatory protective effects and was used as a comparator organism. Human monocyte-derived dendritic cells (MDDCs) were co-incubated with bacteria and analysed over time for bacterial adhesion and intracellular processing, costimulatory molecule expression, cytokine secretion and induction of lymphocyte polarization. Neutralising antibodies were utilized to identify the responsible MDDC receptors. Lb. rhamnosus JB-1 adhered to MDDCs, but internalization and intracellular processing was significantly delayed, compared to Lb. murinus which was rapidly internalized and processed. Lb. murinus induced CD80 and CD86 expression, accompanied by high levels of cytokine secretion, while Lb. rhamnosus JB-1 was a poor inducer of costimulatory molecule expression and cytokine secretion. Lb. rhamnosus JB-1 primed MDDCs induced Foxp3 expression in autologous lymphocytes, while Lb. murinus primed MDDCs induced Foxp3, T-bet and Ror-γt expression. DC-SIGN was required for Lb. rhamnosus JB-1 adhesion and influenced IL-12 secretion, while TLR-2 influenced IL-10 and IL-12 secretion. Here we demonstrate that the delayed kinetics of bacterial processing by MDDCs correlates with MDDC activation and stimulation of lymphocytes. Thus, inhibition or delay of intracellular processing may be a novel strategy by which certain commensals may avoid the induction of proinflammatory responses. PMID:25816321

Immunologic evaluation of 10 different adjuvants for use in vaccines for chickens against highly pathogenic avian influenza virus.

PubMed

Lone, Nazir Ahmed; Spackman, Erica; Kapczynski, Darrell

2017-06-08

Avian influenza viruses (AIV) are a threat to poultry production worldwide. Vaccination is utilized as a component of control programs for both high pathogenicity (HP) and low pathogenicity (LP) AIV. Over 95% of all AIV vaccine used in poultry are inactivated, adjuvanted products. To identify the best formulations for chickens, vaccines were prepared with beta-propiolactone (BPL) inactivated A/British Columbia/314514-1/2004 H7N3 LP AIV using ten commercially available or experimental adjuvants. Each vaccine formulation was evaluated for immunogenicity in chickens. Challenge studies with an antigenically homologous strain of HPAIV were conducted to compare protection against mortality and measure reductions in virus levels in oral swabs. The four best adjuvants from the studies with BPL inactivated antigen were selected and tested identically, but with vaccines prepared from formalin inactivated virus. Mineral and vegetable oil based adjuvants generally induced the highest antibody titers with 100% seroconversion by 3weeks post vaccination. Chitosan induced positive antibody titers in 100% of the chickens, but the titers were significantly lower than those of most of the oil based adjuvants. Antibody levels from calcium phosphate and alginate adjuvanted groups were similar to those of non-adjuvanted virus. All groups that received adjuvanted vaccines induced similar levels of protection against mortality (0-20%) except the groups vaccinated with calcium phosphate adjuvanted vaccines, where mortality was similar (70%) to groups that received non-adjuvanted inactivated virus or no vaccine (60-100% mortality). Virus shedding in oral swabs was variable among the treatment groups. Formalin inactivated vaccine induced similar antibody titers and protection against challenge compared to BPL inactivated vaccine groups. These studies support the use of oil adjuvanted vaccines for use in the poultry industry for control for AIV. Published by Elsevier Ltd.

The effects of lycopene on DNA damage and oxidative stress on indomethacin-induced gastric ulcer in rats.

PubMed

Boyacioglu, Murat; Kum, Cavit; Sekkin, Selim; Yalinkilinc, Hande Sultan; Avci, Hamdi; Epikmen, Erkmen Tugrul; Karademir, Umit

2016-04-01

Lycopene, the main antioxidant compound present in tomatoes, has high singlet oxygen- and peroxyl radicals-quenching ability, resulting in protection against oxidative damage in aerobic cell. Indomethacin is a nonsteroidal anti-inflammatory drug, and can promote oxidative damage in gastric tissue. The aim of this study was to investigate the protective effects of lycopene on an indomethacin-induced gastric ulcer model. A total of 42 adult male Wistar rats were divided into six groups of seven animals as follows: control, indomethacin, lansoprazole, lycopene 10 mg/kg, lycopene 50 mg/kg and lycopene 100 mg/kg. Gastric ulcers were induced by oral administration of indomethacin, after which the differing doses of lycopene were administered by oral gavage. The efficacy of lycopene was compared with lansoprazole. DNA damage of lymphocytes was measured by comet assay. Activities of superoxide dismutase, catalase and myeloperoxidase, as well as malondialdehyde and glutathione levels were determined in stomach tissue. This tissue was also taken for pathological investigations. The TUNEL method was used to detect apoptotic cells in paraffin sections. The results showed that 100 mg/kg lycopene administration significantly decreased % Tail DNA and Mean Tail Moment in the gastric ulcer group, compared with the other treatment groups. This same dose of lycopene also significantly decreased high malondialdehyde level and myeloperoxidase activity, and increased the activity of antioxidant enzymes (with the exception of catalase) in tissue. Apoptosis rates in the stomachs of the rats correlated with the biochemical and histopathological findings. These results indicated that lycopene might have a protective effect against indomethacin-induced gastric ulcer and oxidative stress in rats. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

Protocol of a randomized controlled trial of hearing protection interventions for farm operators.

PubMed

McCullagh, Marjorie C; Ronis, David L

2015-04-18

Hearing loss and tinnitus are prevalent in America, and noise-induced hearing loss is a leading cause of hearing loss. Noise-induced hearing loss has negative impact on quality of life, physical and emotional functioning, social life, and employment. In addition, noise-induced hearing loss results in heavy social and economic burdens on families and communities from all ethnic and socioeconomic groups. Farmers are a group that is particularly high risk for noise-induced hearing loss, and is underserved by programs designed to limit that risk. They are among the most noise-exposed group of workers, and experience the second highest prevalence of noise-induced hearing loss among all occupational categories. In agriculture, 1.5 million workers (43.3%) report exposure to hazardous noise. Although use of hearing protection devices (HPDs) would protect them from noise-induced hearing loss, use among farmers is low. The purpose of this project is to compare the effectiveness of several approaches to influencing hearing protector use. Approaches include: a) an interactive, predictors-based intervention delivered via the Internet; b) a static informational web site; and c) a mailed sampler of hearing protectors. The goals are to further develop an intervention to promote farmers' use of HPDs, and compare the effectiveness of the interventions delivered in various combinations. Participants will include 701 farmers. Sites will be affiliates of a major farmer organization. Data will be collected at baseline, 6, and 12 months. A random intercept mixed model will be used to explore the fixed effects of the three NIHL prevention interventions over time while adjusting for age and gender. This project will involve a partnership between the University of Michigan and a major farmer organization to accomplish project aims. Results of this study will be used to inform future research-to-practice studies to increase hearing protector use. Increased use of hearing protectors is expected to reduce rates of noise-induced hearing loss and other negative effects of high noise exposure, and improve quality of life in this high-risk and underserved group. Clinicaltrials.gov NCT01454895 Registered 14 October, 2011.

Mucosal BCG Vaccination Induces Protective Lung-Resident Memory T Cell Populations against Tuberculosis

PubMed Central

Perdomo, Carolina; Zedler, Ulrike; Kühl, Anja A.; Lozza, Laura; Saikali, Philippe; Sander, Leif E.; Vogelzang, Alexis; Kupz, Andreas

2016-01-01

ABSTRACT Mycobacterium bovis Bacille Calmette-Guérin (BCG) is the only licensed vaccine against tuberculosis (TB), yet its moderate efficacy against pulmonary TB calls for improved vaccination strategies. Mucosal BCG vaccination generates superior protection against TB in animal models; however, the mechanisms of protection remain elusive. Tissue-resident memory T (TRM) cells have been implicated in protective immune responses against viral infections, but the role of TRM cells following mycobacterial infection is unknown. Using a mouse model of TB, we compared protection and lung cellular infiltrates of parenteral and mucosal BCG vaccination. Adoptive transfer and gene expression analyses of lung airway cells were performed to determine the protective capacities and phenotypes of different memory T cell subsets. In comparison to subcutaneous vaccination, intratracheal and intranasal BCG vaccination generated T effector memory and TRM cells in the lung, as defined by surface marker phenotype. Adoptive mucosal transfer of these airway-resident memory T cells into naive mice mediated protection against TB. Whereas airway-resident memory CD4+ T cells displayed a mixture of effector and regulatory phenotype, airway-resident memory CD8+ T cells displayed prototypical TRM features. Our data demonstrate a key role for mucosal vaccination-induced airway-resident T cells in the host defense against pulmonary TB. These results have direct implications for the design of refined vaccination strategies. PMID:27879332

Mycobacterium indicus pranii as a booster vaccine enhances BCG induced immunity and confers higher protection in animal models of tuberculosis.

PubMed

Saqib, Mohd; Khatri, Rahul; Singh, Bindu; Gupta, Ananya; Kumar, Arvind; Bhaskar, Sangeeta

2016-12-01

BCG, the only approved vaccine protects against severe form of childhood tuberculosis but its protective efficacy wanes in adolescence. BCG has reduced the incidence of infant TB considerably in endemic areas; therefore prime-boost strategy is the most realistic measure for control of tuberculosis in near future. Mycobacterium indicus pranii (MIP) shares significant antigenic repertoire with Mtb and BCG and has been shown to impart significant protection in animal models of tuberculosis. In this study, MIP was given as a booster to BCG vaccine which enhanced the BCG mediated immune response, resulting in higher protection. MIP booster via aerosol route was found to be more effective in protection than subcutaneous route of booster immunization. Pro-inflammatory cytokines like IFN-γ, IL-12 and IL-17 were induced at higher level in infected lungs of 'BCG-MIP' group both at mRNA expression level and in secretory form when compared with 'only BCG' group. BCG-MIP groups had increased frequency of multifunctional T cells with high MFI for IFN-γ and TNF-α in Mtb infected mice. Our data demonstrate for the first time, potential application of MIP as a booster to BCG vaccine for efficient protection against tuberculosis. This could be very cost effective strategy for efficient control of tuberculosis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Prior exposure to repeated immobilization or chronic unpredictable stress protects from some negative sequels of an acute immobilization.

PubMed

Pastor-Ciurana, Jordi; Rabasa, Cristina; Ortega-Sánchez, Juan A; Sanchís-Ollè, Maria; Gabriel-Salazar, Marina; Ginesta, Marta; Belda, Xavier; Daviu, Núria; Nadal, Roser; Armario, Antonio

2014-05-15

Exposure to chronic unpredictable stress (CUS) is gaining acceptance as a putative animal model of depression. However, there is evidence that chronic exposure to stress can offer non-specific stress protection from some effects of acute superimposed stressors. We then compared in adult male rats the protection afforded by prior exposure to CUS with the one offered by repeated immobilization on boards (IMO) regarding some of the negative consequences of an acute exposure to IMO. Repeated exposure to IMO protected from the negative consequences of an acute IMO on activity in an open-field, saccharin intake and body weight gain. Active coping during IMO (struggling) was markedly reduced by repeated exposure to the same stressor, but it was not affected by a prior history of CUS, suggesting that our CUS protocol does not appear to impair active coping responses. CUS exposure itself caused a strong reduction of activity in the open-field but appeared to protect from the hypo-activity induced by acute IMO. Moreover, prior CUS offered partial protection from acute IMO-induced reduction of saccharin intake and body weight gain. It can be concluded that a prior history of CUS protects from some of the negative consequences of exposure to a novel severe stressor, suggesting the development of partial cross-adaptation whose precise mechanisms remain to be studied. Copyright © 2014 Elsevier B.V. All rights reserved.

Expression of HSP72 in the gastric mucosa is regulated by gastric acid in rats-Correlation of HSP72 expression with mucosal protection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wada, Isao; Otaka, Michiro; Jin, Mario

2006-10-20

Background and aim: The real mechanism of adaptive cytoprotection in the gastric mucosa is not well established. In the present study, we investigated the effect of acid suppressing agents on a 72-kDa heat shock protein (HSP72) expression, which is known as endogenous cytoprotective factor, in the gastric mucosa. Also, the association of gastric mucosal protective function against HCl-challenge was compared between HSP72-induced and -reduced group. Materials and methods: Expression of HSP72 was measured by Western blotting in the gastric mucosa before and after administration of famotidine or omeprazole. The gastric mucosal protective function against 0.6 N HCl was compared betweenmore » control group and HSP72-reduced group. Also, the effect of increased expression of gastric HSP72 by additional administration of zinc sulfate or zinc L-carnosine, which is known as HSP72-inducer, on mucosal protective function was studied. Results: HSP72 expression in the gastric mucosa was reduced by acid suppressing agents. The lowest expression level of HSP72 was observed 12 h (famotidine, H2-receptor antagonist) or 48 h (omeprazole, proton pump inhibitor) after administration. The gastric mucosal protective ability against 0.6 N HCl was also reduced when HSP72 expression was decreased by famotidine or omeprazole. This phenomenon was reversed by HSP72 induction by additional administration of zinc derivatives. Conclusion: Our results might indicate that the expression of HSP72 in the gastric mucosa is physiologically regulated by gastric acid, and that HSP72 induction could be important in view of mucosal protection especially when HSP72 expression is reduced by administration of acid suppressing agents such as proton pump inhibitor or H2 receptor antagonist.« less

Heterologous live infectious bronchitis virus vaccination in day-old commercial broiler chicks: clinical signs, ciliary health, immune responses and protection against variant infectious bronchitis viruses.

PubMed

Awad, Faez; Hutton, Sally; Forrester, Anne; Baylis, Matthew; Ganapathy, Kannan

2016-01-01

Groups of one-day-old broiler chicks were vaccinated via the oculo-nasal route with different live infectious bronchitis virus (IBV) vaccines: Massachusetts (Mass), 793B, D274 or Arkansas (Ark). Clinical signs and gross lesions were evaluated. Five chicks from each group were humanely killed at intervals and their tracheas collected for ciliary activity assessment and for the detection of CD4+, CD8+ and IgA-bearing B cells by immunohistochemistry (IHC). Blood samples were collected at intervals for the detection of anti-IBV antibodies. At 21 days post-vaccination (dpv), protection conferred by different vaccination regimes against virulent M41, QX and 793B was assessed. All vaccination programmes were able to induce high levels of CD4+, CD8+ and IgA-bearing B cells in the trachea. Significantly higher levels of CD4+ and CD8+ expression were observed in the Mass2 + 793B2-vaccinated group compared to the other groups (subscripts indicate different manufacturers). Protection studies showed that the group of chicks vaccinated with Mass2 + 793B2 produced 92% ciliary protection against QX challenge; compared to 53%, 68% and 73% ciliary protection against the same challenge virus by Mass1 + D274, Mass1 + 793B1 and Mass3 + Ark, respectively. All vaccination programmes produced more than 85% ciliary protection against M41 and 793B challenges. It appears that the variable levels of protection provided by different heterologous live IBV vaccinations are dependent on the levels of local tracheal immunity induced by the respective vaccine combination. The Mass2 + 793B2 group showed the worst clinical signs, higher mortality and severe lesions following vaccination, but had the highest tracheal immune responses and demonstrated the best protection against all three challenge viruses.

Farnesoid X receptor regulates forkhead Box O3a activation in ethanol-induced autophagy and hepatotoxicity

PubMed Central

Manley, Sharon; Ni, Hong-Min; Williams, Jessica A.; Kong, Bo; DiTacchio, Luciano; Guo, Grace; Ding, Wen-Xing

2014-01-01

Alcoholic liver disease encompasses a wide spectrum of pathogenesis including steatosis, fibrosis, cirrhosis, and alcoholic steatohepatitis. Autophagy is a lysosomal degradation process that degrades cellular proteins and damaged/excess organelles, and serves as a protective mechanism in response to various stresses. Acute alcohol treatment induces autophagy via FoxO3a-mediated autophagy gene expression and protects against alcohol-induced steatosis and liver injury in mice. Farnesoid X Receptor (FXR) is a nuclear receptor that regulates cellular bile acid homeostasis. In the present study, wild type and FXR knockout (KO) mice were treated with acute ethanol for 16 h. We found that ethanol treated-FXR KO mice had exacerbated hepatotoxicity and steatosis compared to wild type mice. Furthermore, we found that ethanol treatment had decreased expression of various essential autophagy genes and several other FoxO3 target genes in FXR KO mice compared with wild type mice. Mechanistically, we did not find a direct interaction between FXR and FoxO3. Ethanol-treated FXR KO mice had increased Akt activation, increased phosphorylation of FoxO3 resulting in decreased FoxO3a nuclear retention and DNA binding. Furthermore, ethanol treatment induced hepatic mitochondrial spheroid formation in FXR KO mice but not in wild type mice, which may serve as a compensatory alternative pathway to remove ethanol-induced damaged mitochondria in FXR KO mice. These results suggest that lack of FXR impaired FoxO3a-mediated autophagy and in turn exacerbated alcohol-induced liver injury. PMID:25460735

A comparative study of baby immature and adult shoots of Aloe vera on UVB-induced skin photoaging in vitro.

PubMed

Hwang, Eunson; Kim, Su Hyeon; Lee, Sarah; Lee, Choong Hwan; Do, Seon-Gil; Kim, Jinwan; Kim, Sun Yeou

2013-12-01

Ultraviolet (UV) irradiation induces photo-damage of the skin, which in turn causes depletion of the dermal extracellular matrix and chronic alterations in skin structure. Skin wrinkle formations are associated with collagen synthesis and matrix metalloproteinase (MMP) expression. The production of type I procollagen is regulated by transforming growth factor-β1 (TGF-β1) expression; the activation of MMP is also correlated with an increase of interleukin-6 (IL-6). Aloe barbadensis M. (Aloe vera) is widely used in cosmetic and pharmaceutical products. In this study, we examined whether baby aloe shoot extract (BAE, immature aloe extract), which is from the one-month-old shoots of Aloe vera, and adult aloe shoot extract (AE), which is from the four-month-old shoots of Aloe vera, have a protective effect on UVB-induced skin photoaging in normal human dermal fibroblasts (NHDFs). The effects of BAE and AE on UVB-induced photoaging were tested by measuring the levels of reactive oxygen species, MMP-1, MMP-3, IL-6, type I procollagen, and TGF-β1 after UVB irradiation. We found that NHDF cells treated with BAE after UVB-irradiation suppressed MMP-1, MMP-3, and IL-6 levels compared to the AE-treated cells. Furthermore, BAE treatment elevated type I procollagen and TGF-β1 levels. Our results suggest that BAE may potentially protect the skin from UVB-induced damage more than AE. Copyright © 2013 John Wiley & Sons, Ltd.

Hawthorn ethanolic extracts with triterpenoids and flavonoids exert hepatoprotective effects and suppress the hypercholesterolemia-induced oxidative stress in rats.

PubMed

Rezaei-Golmisheh, Ali; Malekinejad, Hassan; Asri-Rezaei, Siamak; Farshid, Amir Abbas; Akbari, Peyman

2015-07-01

The current study was aimed to determine the bioactive constituents and biological effects of the Crataegus monogyna ethanolic extracts from bark, leaves and berries on hypercholesterolemia. Oleanolic acid, ursolic acid, quercetin and lupeol concentrations were quantified by HPLC. Total phenol content and radical scavenging activity of extracts were also measured. The hypocholesterolemic, antioxidant, and hepatoprotective effects of the extracts were examined in hypercholesterolemic rats and compared with orlistat. The highest phenol content, oleanolic acid, quercetin and lupeol levels and free radical scavenging potency were found in the bark extract, and the highest ursolic acid level was found in the berries extract. Orlistat and extracts significantly (P<0.05) lowered the hypercholesterolemia-increased serum level of hepatic enzymes and lipid peroxidation level. Hawthorn's extracts protected from hepatic thiol depletion and improved the lipid profile and hepatic damages. Data suggested that hawthorn's extracts are able to protect from hypercholesterolemia-induced oxidative stress and hepatic injuries. Moreover, the hypocholesterolemic effect of extracts was found comparable to orlistat.

Comparison of immunogenicity and persistence between inactivated hepatitis A vaccine Healive® and Havrix® among children: A 5-year follow-up study.

PubMed

Yu, Chengkai; Song, Yufei; Qi, Yangyang; Li, Chanjuan; Jiang, Zhiwei; Li, Chen; Zhang, Wei; Wang, Ling; Xia, Jielai

2016-10-02

Inactivated vaccines for hepatitis A virus (HAV) infection are widely used in China. Mass vaccination programs drive the need for data on long-term persistence of vaccine-induced protection. A prospective, randomized, open-label clinical trial was conducted to compare geometric mean concentrations (GMCs) and seroconversion rates (SRs) of anti-HAV antibody elicited by the inactivated vaccines Healive and Havrix for 5 y post immunization, in which 400 healthy children were randomly assigned in a 3:1 ratio to receive 2 doses of Healive or Havrix at 0 and 6 month. Anti-HAV antibody concentration was detected by microparticle enzyme immunoassay (MEIA) during the study. Furthermore, an attempt was made to predict persistence of protective immunogenicity by using a suitable statistical model. The GMCs were significantly higher after vaccination with Healive than after Havrix as comparator vaccine at 1, 6, 7, 18, 30, 42, 54 and 66 month (P < 0.01) with the peak point at 7 month (3427.2 mIU/ml for Healive and 1441.9 mIU/ml for Comparator). Similarly significant differences of SRs were found between the 2 groups at 1 and 6 month (P < 0.01). Afterwards, the SRs of both groups reached 100% at 7 month and did not decline until 66 month(99.1% for Healive and 97.5% for Comparator). A linear mixed model with a change point at 18 month(Model 3) was found to be suitable to predict persistence of protective immunogenicity induced by vaccines. It was estimated that the duration of protection for Healive was at least 20 y with a lower limit of GMC 95% confidence interval (CI) no less than 20 mIU/mL. Compared with Havrix, the new preservative-free inactivated hepatitis A vaccine (Healive) in 2 doses showed better persistence of antibody concentrations for 5 y after full-course immunization among children and the persistence of protective immunogenicity was estimated for at least 20 y.

Cathelicidin Signaling via the Toll-Like Receptor Protects Against Colitis in Mice

PubMed Central

Koon, Hon Wai; Shih, David Quan; Chen, Jeremy; Bakirtzi, Kyriaki; Hing, Tressia C; Law, Ivy; Ho, Samantha; Ichikawa, Ryan; Zhao, Dezheng; Xu, Hua; Gallo, Richard; Dempsey, Paul; Cheng, Genhong; Targan, Stephan R; Pothoulakis, Charalabos

2011-01-01

Background & Aims Cathelicidin (encoded by Camp) is an anti-microbial peptide in the innate immune system. We examined whether macrophages express cathelicidin in colons of mice with experimental colitis and patients with inflammatory bowel disease; we investigated its signaling mechanisms. Methods Quantitative, real-time, reverse transcription PCR, bacterial 16S PCR, immunofluorescence, and small interfering (si)RNA analyses were performed. Colitis was induced in mice using sodium dextran sulfate (DSS); levels of cathelicidin were measured in human primary monocytes. Results Expression of cathelicidin increased in the inflamed colonic mucosa of mice with DSS-induced colitis, compared with controls. Cathelicidin expression localized to mucosal macrophages in inflamed colon tissues of patients and mice. Exposure of human primary monocytes to E coli DNA induced expression of Camp mRNA, which required signaling by ERK; expression was reduced by siRNAs against toll-like receptor (TLR)9 and MyD88. Intracolonic administration of bacterial DNA to wild-type mice induced expression of cathelicidin in colons of control mice and mice with DSS-induced colitis. Colon expression of cathelicidin was significantly reduced in TLR9 −/− mice with DSS-induced colitis. Compared with wild-type mice, Camp −/− mice developed a more severe form of DSS-induced colitis, particularly after intracolonic administration of E coli DNA. Expression of cathelicidin from bone marrow-derived immune cells regulated DSS induction of colitis in transplantation studies in mice. Conclusions Cathelicidin protects against colitis induction in mice. Increased expression of cathelicidin in monocytes and experimental models of colitis involves activation of TLR9–ERK signaling by bacterial DNA. This pathway might be involved in pathogenesis of ulcerative colitis. PMID:21762664

IFN-ε protects primary macrophages against HIV infection.

PubMed

Tasker, Carley; Subbian, Selvakumar; Gao, Pan; Couret, Jennifer; Levine, Carly; Ghanny, Saleena; Soteropoulos, Patricia; Zhao, Xilin; Landau, Nathaniel; Lu, Wuyuan; Chang, Theresa L

2016-12-08

IFN-ε is a unique type I IFN that is not induced by pattern recognition response elements. IFN-ε is constitutively expressed in mucosal tissues, including the female genital mucosa. Although the direct antiviral activity of IFN-ε was thought to be weak compared with IFN-α, IFN-ε controls Chlamydia muridarum and herpes simplex virus 2 in mice, possibly through modulation of immune response. We show here that IFN-ε induces an antiviral state in human macrophages that blocks HIV-1 replication. IFN-ε had little or no protective effect in activated CD4 + T cells or transformed cell lines unless activated CD4 + T cells were infected with replication-competent HIV-1 at a low MOI. The block to HIV infection of macrophages was maximal after 24 hours of treatment and was reversible. IFN-ε acted on early stages of the HIV life cycle, including viral entry, reverse transcription, and nuclear import. The protection did not appear to operate through known type I IFN-induced HIV host restriction factors, such as APOBEC3A and SAMHD1. IFN-ε-stimulated immune mediators and pathways had the signature of type I IFNs but were distinct from IFN-α in macrophages. IFN-ε induced significant phagocytosis and ROS, which contributed to the block to HIV replication. These findings indicate that IFN-ε induces an antiviral state in macrophages that is mediated by different factors than those induced by IFN-α. Understanding the mechanism of IFN-ε-mediated HIV inhibition through immune modulation has implications for prevention.

IFN-ε protects primary macrophages against HIV infection

PubMed Central

Tasker, Carley; Subbian, Selvakumar; Gao, Pan; Couret, Jennifer; Levine, Carly; Ghanny, Saleena; Soteropoulos, Patricia; Zhao, Xilin; Landau, Nathaniel; Lu, Wuyuan

2016-01-01

IFN-ε is a unique type I IFN that is not induced by pattern recognition response elements. IFN-ε is constitutively expressed in mucosal tissues, including the female genital mucosa. Although the direct antiviral activity of IFN-ε was thought to be weak compared with IFN-α, IFN-ε controls Chlamydia muridarum and herpes simplex virus 2 in mice, possibly through modulation of immune response. We show here that IFN-ε induces an antiviral state in human macrophages that blocks HIV-1 replication. IFN-ε had little or no protective effect in activated CD4+ T cells or transformed cell lines unless activated CD4+ T cells were infected with replication-competent HIV-1 at a low MOI. The block to HIV infection of macrophages was maximal after 24 hours of treatment and was reversible. IFN-ε acted on early stages of the HIV life cycle, including viral entry, reverse transcription, and nuclear import. The protection did not appear to operate through known type I IFN-induced HIV host restriction factors, such as APOBEC3A and SAMHD1. IFN-ε–stimulated immune mediators and pathways had the signature of type I IFNs but were distinct from IFN-α in macrophages. IFN-ε induced significant phagocytosis and ROS, which contributed to the block to HIV replication. These findings indicate that IFN-ε induces an antiviral state in macrophages that is mediated by different factors than those induced by IFN-α. Understanding the mechanism of IFN-ε–mediated HIV inhibition through immune modulation has implications for prevention. PMID:27942584

Downregulation of Lysyl Oxidase Protects Retinal Endothelial Cells From High Glucose-Induced Apoptosis.

PubMed

Kim, Dongjoon; Mecham, Robert P; Trackman, Philip C; Roy, Sayon

2017-05-01

To investigate the effect of reducing high glucose (HG)-induced lysyl oxidase (LOX) overexpression and increased activity on retinal endothelial cell apoptosis. Rat retinal endothelial cells (RRECs) were grown in normal (N) or HG (30 mM glucose) medium for 7 days. In parallel, RRECs were grown in HG medium and transfected with LOX small interfering RNA (siRNA), scrambled siRNA as control, or exposed to β-aminopropionitrile (BAPN), a LOX inhibitor. LOX expression, AKT activation, and caspase-3 activity were determined by Western blot (WB) analysis and apoptosis by differential dye staining assay. Moreover, to determine whether diabetes-induced LOX overexpression alters AKT activation and promotes apoptosis, changes in LOX expression, AKT phosphorylation, caspase-3 activation, and Bax expression were assessed in retinas of streptozotocin (STZ)-induced diabetic mice and LOX heterozygous knockout (LOX+/-) mice. WB analysis indicated significant LOX overexpression and reduced AKT activation under HG condition in RRECs. Interestingly, when cells grown in HG were transfected with LOX siRNA or exposed to BAPN, the number of apoptotic cells was significantly decreased concomitant with increased AKT phosphorylation. Diabetic mouse retinas exhibited LOX overexpression, decreased AKT phosphorylation, and increased Bax and caspase-3 activation compared to values in nondiabetic mice. In LOX+/- mice, reduced LOX levels were observed with increased AKT activity, and reduced Bax and caspase-3 activity. Furthermore, decreased levels of LOX in the LOX+/- mice was protective against diabetes-induced apoptosis. Findings from this study indicate that preventing LOX overexpression may be protective against HG-induced apoptosis in retinal vascular cells associated with diabetic retinopathy.

The magnitude of local immunity in the lungs of mice induced by live attenuated influenza vaccines is determined by local viral replication and induction of cytokines.

PubMed

Lau, Yuk-Fai; Santos, Celia; Torres-Vélez, Fernando J; Subbarao, Kanta

2011-01-01

While live attenuated influenza vaccines (LAIVs) have been shown to be efficacious and have been licensed for human use, the surface glycoproteins hemagglutinin (HA) and neuraminidase (NA) have to be updated for optimal protective efficacy. Little is known about the effect of different HA and NA proteins on the immunogenicity of LAIVs developed using the same backbone. A panel of LAIVs that share the internal protein genes, with unique HA and NA gene segments from different influenza subtypes, was rescued by reverse genetics, and a comparative study of immune responses induced by these vaccines was conducted in mice. The results suggest that the magnitude of lung immunity, including pulmonary IgA antibody and memory CD8(+) T lymphocytes, induced by the vaccines depends on the replication efficiency of the LAIVs, as well as the induction of cytokines/chemokines in the lungs. However, these factors are not important in determining systemic immunity such as serum antibody titers and memory CD8(+) T cells in the spleen. A qualitative analysis of immune responses induced by a single dose of an H5N1 LAIV revealed that the vaccine induced robust systemic and mucosal immunity in mice. In addition, antibodies and memory lymphocytes established in the lungs following vaccination were required for protection against lethal challenge with homologous and heterologous H5N1 viruses. Our results highlight the different requirements for inducing systemic and lung immunity that can be explored for the development of pulmonary immunity for protection against respiratory pathogens.

Protective effect of quercetin and/or l-arginine against nano-zinc oxide-induced cardiotoxicity in rats

NASA Astrophysics Data System (ADS)

Faddah, L. M.; Baky, Nayira A. Abdel; Mohamed, Azza M.; Al-Rasheed, Nouf M.; Al-Rasheed, Nawal M.

2013-04-01

The aim of this study was to investigate the protective role of quercetin and/or l-arginine against the cardiotoxic potency of zinc oxide nanoparticle (ZnO-NP)-induced cardiac infarction. ZnO-NPs (50 nm) were administered orally at either 600 mg or 1 g/kg body weight for 5 consecutive days. The results revealed that co-administration of quercetin and/or l-arginine (each 200 mg/kg body weight) daily for 3 weeks to rats intoxicated by either of the two doses markedly ameliorated increases in serum markers of cardiac infarction, including troponin T, creatine kinase-MB, and myoglobin, as well as increases in proinflammatory biomarkers, including tumor necrosis factor-α, interleukin-6, and C-reactive protein, compared with intoxicated, untreated rats. Each agent alone or in combination also successfully modulated the alterations in serum vascular endothelial growth factor, cardiac calcium concentration, and oxidative DNA damage as well as the increase in the apoptosis marker caspase 3 of cardiac tissue in response to ZnO-NP toxicity. In conclusion, early treatment with quercetin and l-arginine may protect cardiac tissue from infarction induced by the toxic effects of ZnO-NPs.

Total antioxidant and oxidant status of plasma and renal tissue of cisplatin-induced nephrotoxic rats: protection by floral extracts of Calendula officinalis Linn.

PubMed

Verma, Pawan Kumar; Raina, Rajinder; Sultana, Mudasir; Singh, Maninder; Kumar, Pawan

2016-01-01

The present study was aimed to determine the total antioxidant status (TAS), total oxidant status (TOS) and oxidative stress index (OSI) of plasma and renal tissue in cisplatin (cDDP) induced nephrotoxic rats and its protection by treatments with floral extracts of Calendula officinalis Linn. Treatment with cDDP elevated (p < 0.05) the levels of blood urea nitrogen, creatinine (CR), TOS, OSI and malondialdehyde (MDA) but lowered (p < 0.05) total plasma proteins, TAS, total thiols (TTH), blood glutathione (GSH) and antioxidant enzymes compared to the control group. Pre- and post-treatments of ethanolic floral extract of C. officinalis along with cDDP restored (p > 0.05) CR, albumin, TOS, GSH and activities of antioxidant enzymes in blood and renal tissue. Ethanolic extract treatments reduced (p < 0.05) MDA level in renal tissue without restoring the erythrocyte MDA level following cDDP treatment. These observations were further supported by the histopathological findings in renal tissue. Observations of the present study have shown that treatments with ethanolic floral extract of C. officinalis protect cDDP induced nephrotoxicity by restoring antioxidant system of the renal tissue.

Roles of Alum and Monophosphoryl Lipid A Adjuvants in Overcoming CD4+ T Cell Deficiency to Induce Isotype-Switched IgG Antibody Responses and Protection by T-Dependent Influenza Vaccine

PubMed Central

Ko, Eun-Ju; Lee, Young-Tae; Kim, Ki-Hye; Lee, Youri; Jung, Yu-Jin; Kim, Min-Chul; Lee, Yu-Na; Kang, Taeuk; Kang, Sang-Moo

2016-01-01

Vaccine adjuvant effects in CD4 deficient condition largely remain unknown. We investigated the roles of combined monophosphoryl lipid A (MPL) and Alum adjuvant (MPL+Alum) in inducing immunity after immunization of CD4-knockout (CD4KO) and wild-type (WT) mice with T-dependent influenza vaccine. MPL+Alum adjuvant mediated IgG isotype-switched antibodies, IgG secreting cell responses, and protection in CD4KO mice, which were comparable to those in WT mice. In contrast, Alum adjuvant effects were dependent on CD4+ T cells. MPL+Alum adjuvant was effective in recruiting monocytes and neutrophils as well as in protecting macrophages from alum-mediated cell loss at the injection site in CD4KO mice. MPL+Alum appeared to attenuate MPL-induced inflammatory responses in WT mice, likely improving the safety. Additional studies in CD4-depleted WT mice and MHCII KO mice suggest that MHCII positive antigen presenting cells contribute to providing alternative B cell help in CD4 deficient condition in the context of MPL+Alum adjuvanted vaccination. PMID:27881702

Inactivated rotavirus vaccine induces protective immunity in gnotobiotic piglets.

PubMed

Wang, Yuhuan; Azevedo, Marli; Saif, Linda J; Gentsch, Jon R; Glass, Roger I; Jiang, Baoming

2010-07-26

Live oral rotavirus vaccines that are effective in middle and high income countries have been much less immunogenic and effective among infants in resource-limited settings. Several hypotheses might explain this difference, including neutralization of the vaccine by high levels of maternal antibody in serum and breast milk, severe malnutrition, and interference by other flora and viruses in the gut. We have pursued development of an alternative parenteral rotavirus vaccine with the goal of inducing comparable levels of immunogenicity and efficacy in populations throughout the world regardless of their income levels. In the present study, we assessed the immunogenicity and protection of a candidate inactivated rotavirus vaccine (IRV), the human strain CDC-9 (G1P[8]) formulated with aluminum phosphate, against rotavirus infection in gnotobiotic piglets. Three doses of IRV induced high titers of rotavirus-specific IgG and neutralizing activity in the sera of gnotobiotic piglets and protection against shedding of rotavirus antigen following oral challenge with a homologous virulent human strain Wa (G1P[8]). Our findings demonstrate the proof of concept for an IRV in a large animal model and provide evidence and justification for further clinical development as an alternative candidate vaccine. Published by Elsevier Ltd.

Nanoencapsulation of rice bran oil increases its protective effects against UVB radiation-induced skin injury in mice.

PubMed

Rigo, Lucas Almeida; da Silva, Cássia Regina; de Oliveira, Sara Marchesan; Cabreira, Thaíssa Nunes; de Bona da Silva, Cristiane; Ferreira, Juliano; Beck, Ruy Carlos Ruver

2015-06-01

Excessive UV-B radiation by sunlight produces inflammatory and oxidative damage of skin, which can lead to sunburn, photoaging, and cancer. This study evaluated whether nanoencapsulation improves the protective effects of rice bran oil against UVB radiation-induced skin damage in mice. Lipid-core nanocapsules containing rice bran oil were prepared, and had mean size around 200 nm, negative zeta potential (∼-9 mV), and low polydispersity index (<0.20). In order to allow application on the skin, a hydrogel containing the nanoencapsulated rice bran oil was prepared. This formulation was able to prevent ear edema induced by UVB irradiation by 60 ± 9%, when compared with a hydrogel containing LNC prepared with a mixture of medium chain triglycerides instead of rice bran oil. Protein carbonylation levels (biomarker of oxidative stress) and NF-κB nuclear translocation (biomarker of pro-inflammatory and carcinogenesis response) were reduced (81% and 87%, respectively) in animals treated with the hydrogel containing the nanoencapsulated rice bran oil. These in vivo results demonstrate the beneficial effects of nanoencapsulation to improve the protective properties of rice bran oil on skin damage caused by UVB exposure. Copyright © 2015 Elsevier B.V. All rights reserved.

A comparative study on radioprotective effect of N-acetylcysteine against 12C6+ ion versus X-rays

NASA Astrophysics Data System (ADS)

Liu, Yang; Zhang, Hong; Zhang, Luwei

Purpose: The aim of this study was to evaluate the different protective efficacy of N-acetylcysteine (NAC, 200 mg/kg dose) against 12C6+ ion (4 Gy) and X-rays (4 Gy) - induced damage in vivo model. Method: Kung-Ming female mice were divided into six groups, each composed of twelve animals: control group, two irradiation groups, and two NAC-treated groups, as well as NAC alone-treated group. An acute study was carried out to determine alterations in the oxidative stress (malondialdehyde level) using with colorimetric method and cell apoptosis measuring by flow cytometry as well as DNA-single strand break analyzing by comet assay at 2h after irradiation in mouse liver. Results: Compared with respective irradiation group, NAC can significantly ameliorate injury induced by two types of ionizing irradiation, which marked by the decrease of malondialdehyde level, and the reduction of apoptosis cells percentage and DNA damage. But the greater efficacy of NAC was prominently observed to inhibit the damage induced by X-rays, suggesting that NAC-mediated protective effect is more advisable to X-rays than 12C6+ ion irradiation. Moreover, NAC treatment alone did not result in any damage as compared to the control group. Conclusion: NAC may merit development as a potential radioprotective agent. Furthermore, NAC might exert its best effort to respond X rays-caused damage.

Protective effect of latex of Calotropis procera in Freund's Complete Adjuvant induced monoarthritis.

PubMed

Kumar, V L; Roy, S

2009-01-01

The protective effect of latex of Calotropis procera in Freund's Complete Adjuvant (FCA) induced monoarticular arthritis was evaluated in rats. Arthritis was induced by a single intra-articular injection of 0.1 mL of 0.1% FCA in the right ankle joint. The effect of dried latex (DL, 200 and 400 mg/kg) and its methanol extract (MeDL, 50 and 500 mg/kg) following oral administration was evaluated on joint inflammation, hyperalgesia, locomotor function and histology at the time of peak inflammation. The effects of DL and MeDL were compared with antiinflammatory drugs phenylbutazone (100 mg/kg), prednisolone (20 mg/kg), rofecoxib (20 and 100 mg/kg) and immuno-suppressant methotrexate (0.3 mg/kg). Daily oral administration of DL and its methanol extract (MeDL) produced a significant reduction in joint inflammation (about 50% and 80% inhibition) and associated hyperalgesia. The antihyperalgesic effect of MeDL was comparable to that of rofecoxib. Both DL and MeDL produced a marked improvement in the motility and stair climbing ability of the rats. The histological analysis of the arthritic joint also revealed significant reduction in oedema and cellular infiltration by MeDL that was comparable to that of rofecoxib. Thus, our study suggests that the latex of C. procera has the potential to be used as an antiarthritic agent. Copyright 2008 John Wiley & Sons, Ltd.

Protective effects of oleuropein against renal injury oxidative damage in alloxan-induced diabetic rats; a histological and biochemical study.

PubMed

Ahmadvand, Hassan; Shahsavari, Gholamreza; Tavafi, Majid; Bagheri, Shahrokh; Moradkhani, Mohamad Reza; Kkorramabadi, Reza Mohammadrezaei; Khosravi, Peyman; Jafari, Maryam; Zahabi, Khadije; Eftekhar, Reza; Soleimaninejad, Maryam; Moghadam, Sanaz

2017-07-01

Oleuropein is a potent antioxidant and free-radical scavenger with antiinflammatory properties. In the present study, we evaluated the protective effects of oleuropein on myeloperoxidase (MPO) activity, nitrite, urea, creatinine and glomerulosclerosis in alloxan-induced type 1 diabetic rats. Thirty Sprague-Dawley male rats were randomly divided into 3 groups: group 1 as control; group 2 as untreated diabetic; and group 3 as treated with oleuropein 15 mg/kg i.p daily. Diabetes was induced in the second and third groups by subcutaneous alloxan injection. After 48 days, the animals were anaesthetized and then the livers and kidneys were removed immediately and used fresh or kept frozen until MPO activity analysis. Blood samples were also collected before sacrificing to measure nitrite, urea, and creatinine. Kidney paraffin sections were prepared to estimate glomerular volume, leukocyte infiltration, and glomerulosclerosis. Oleuropein significantly decreased leukocyte infiltration and glomerulosclerosis in the treated group compared with the diabetic untreated group. Oleuropein significantly decreased the levels of urea, nitrite, and creatinine in the treated group compared with the diabetic untreated group. Moreover, oleuropein significantly decreased MPO activity in the treated group compared with the diabetic untreated group. Oleuropein has antioxidative and antiatherogenic activities and exerts beneficial effects on inflammation and kidney function test and decreases diabetic complication in diabetic rats.

The FGF-2-triggered protection of cardiac subsarcolemmal mitochondria from calcium overload is mitochondrial connexin 43-dependent.

PubMed

Srisakuldee, Wattamon; Makazan, Zhanna; Nickel, Barbara E; Zhang, Feixiong; Thliveris, James A; Pasumarthi, Kishore B S; Kardami, Elissavet

2014-07-01

Fibroblast growth factor 2 (FGF-2) protects the heart from ischaemia- and reperfusion-induced cell death by a mechanism linked to protein kinase C (PKC)ε-mediated connexin 43 (Cx43) phosphorylation. Cx43 localizes predominantly to gap junctions, but has also been detected at subsarcolemmal (SSM), but not interfibrillar (IFM), mitochondria, where it is considered important for cardioprotection. We have now examined the effect of FGF-2 administration to the heart on resistance to calcium-induced permeability transition (mPTP) of isolated SSM vs. IFM suspensions, in relation to mitochondrial PKCε/Cx43 levels, phosphorylation, and the presence of peptide Gap27, a Cx43 channel blocker. FGF-2 perfusion increased resistance to calcium-induced mPTP in SSM and IFM suspensions by 2.9- and 1.7-fold, respectively, compared with their counterparts from vehicle-perfused hearts, assessed spectrophotometrically as cyclosporine A-inhibitable swelling. The salutary effect of FGF-2 was lost in SSM, but not in IFM, in the presence of Gap27. FGF-2 perfusion increased relative levels of PKCε, phospho(p) PKCε, and Tom-20 translocase in SSM and IFM, and of Cx43 in SSM. Phospho-serine (pS) 262- and pS368-Cx43 showed a 30- and 8-fold increase, respectively, in SSM from FGF-2-treated, compared with untreated, hearts. Stimulation of control SSM with phorbol 12-myristate 13-acetate (PMA), a PKC activator, increased both calcium tolerance and mitochondrial Cx43 phosphorylation at S262 and S368. The PMA-induced phosphorylation of mitochondrial Cx43 was prevented by εV1-2, a PKCε-inhibiting peptide. SSM are more responsive than IFM to FGF-2-triggered protection from calcium-induced mPTP, by a mitochondrial Cx43 channel-mediated pathway, associated with mitochondrial Cx43 phosphorylation at PKCε target sites. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.

Retino-protective effect of Bucida buceras against oxidative stress induced by H2O2 in human retinal pigment epithelial cells line.

PubMed

Iloki-Assanga, Simon Bernard; Lewis-Luján, Lidianys María; Fernández-Angulo, Daniela; Gil-Salido, Armida Andrea; Lara-Espinoza, Claudia Lizeth; Rubio-Pino, José Luis

2015-07-29

Reactive Oxygen Species (ROS) impair the physiological functions of Retinal Pigment Epithelial (RPE) cells, which are known as one major cause of age-related macular degeneration and retinopathy diseases. The purpose of this study is to explore the cytoprotective effects of the antioxidant Bucida buceras extract in co-treatment with hydrogen peroxide (H2O2) delivery as a single addition or with continuous generation using glucose oxidase (GOx) in ARPE-19 cell cultures. The mechanism of Bucida buceras extract is believed to be associated with their antioxidant capacity to protect cells against oxidative stress. A comparative oxidative stress H2O2-induced was performed by addition and enzymatic generation using glucose oxidase on human retinal pigment epithelial cells line. H2O2-induced injury was measured by toxic effects (cell death and apoptotic pathway) and intracellular redox status: glutathione (GSH), antioxidant enzymes (catalase and glutathione peroxidase) and reducing power (FRAP). The retino-protective effect of co-treatment with Bucida buceras extract on H2O2-induced human RPE cell injury was investigated by cell death (MTT assay) and oxidative stress biomarkers (H2O2, GSH, CAT, GPx and FRAP). Bucida buceras L. extract is believed to be associated with the ability to prevent cellular oxidative stress. When added as a pulse, H2O2 is rapidly depleted and the cytotoxicity analyses show that cells can tolerate short exposure to high peroxide doses delivered as a pulse but are susceptible to lower chronic doses. Co-treatment with Bucida buceras was able to protect the cells against H2O2-induced injury. In addition to preventing cell death treatment with antioxidant plant could also reverse the significant decrease in GSH level, catalase activity and reducing power caused by H2O2. These findings suggest that Bucida buceras could protect RPE against ocular pathogenesis associated with oxidative stress induced by H2O2-delivered by addition and enzymatic generation.

Therapeutic inducers of the HSP70/HSP110 protect mice against traumatic brain injury.

PubMed

Eroglu, Binnur; Kimbler, Donald E; Pang, Junfeng; Choi, Justin; Moskophidis, Demetrius; Yanasak, Nathan; Dhandapani, Krishnan M; Mivechi, Nahid F

2014-09-01

Traumatic brain injury (TBI) induces severe harm and disability in many accident victims and combat-related activities. The heat-shock proteins Hsp70/Hsp110 protect cells against death and ischemic damage. In this study, we used mice deficient in Hsp110 or Hsp70 to examine their potential requirement following TBI. Data indicate that loss of Hsp110 or Hsp70 increases brain injury and death of neurons. One of the mechanisms underlying the increased cell death observed in the absence of Hsp110 and Hsp70 following TBI is the increased expression of reactive oxygen species-induced p53 target genes Pig1, Pig8, and Pig12. To examine whether drugs that increase the levels of Hsp70/Hsp110 can protect cells against TBI, we subjected mice to TBI and administered Celastrol or BGP-15. In contrast to Hsp110- or Hsp70i-deficient mice that were not protected following TBI and Celastrol treatment, there was a significant improvement of wild-type mice following administration of these drugs during the first week following TBI. In addition, assessment of neurological injury shows significant improvement in contextual and cued fear conditioning tests and beam balance in wild-type mice that were treated with Celastrol or BGP-15 following TBI compared to TBI-treated mice. These studies indicate a significant role of Hsp70/Hsp110 in neuronal survival following TBI and the beneficial effects of Hsp70/Hsp110 inducers toward reducing the pathological consequences of TBI. Our data indicate that loss of Hsp110 or Hsp70 in mice increases brain injury following TBI. (a) One of the mechanisms underlying the increased cell death observed in the absence of these Hsps following TBI is the increased expression of ROS-induced p53 target genes known as Pigs. In addition, (b) using drugs (Celastrol or BGP-15) to increase Hsp70/Hsp110 levels protect cells against TBI, suggesting the beneficial effects of Hsp70/Hsp110 inducers to reduce the pathological consequences of TBI. © 2014 International Society for Neurochemistry.

Corneal protection with high-molecular-weight hyaluronan against in vitro and in vivo sodium lauryl sulfate-induced toxic effects.

PubMed

Pauloin, Thierry; Dutot, Mélody; Liang, Hong; Chavinier, Emilie; Warnet, Jean-Michel; Rat, Patrice

2009-10-01

The aim of this study was to investigate high-molecular-weight hyaluronan (HA-HMW) corneal protection against sodium lauryl sulfate (SLS)-induced toxic effects with in vitro and in vivo experimental approaches. In vitro experiments consisted of a human corneal epithelial cell line incubated with HA-HMW, rinsed, and incubated with SLS. Cell viability, oxidative stress, chromatin condensation, caspase-3, -8, -9, and P2X7 cell death receptor activation, interleukin-6, and interleukin-8 production were investigated. In vivo experiments consisted of 36 New Zealand white rabbits treated for 3 days, 3 times per day, with HA-HMW or phosphate-buffered salt solution. At day 4, eyes were treated with SLS. Clinical observation and in vivo confocal microscopy using the Rostock Cornea Module of the Heidelberg Retina Tomograph-II were performed to evaluate and to compare SLS-induced toxicity between eyes treated with HA-HMW and eyes treated with phosphate-buffered salt solution. In vitro data indicate that exposure of human corneal epithelial cells to HA-HMW significantly decreased SLS-induced oxidative stress, apoptosis, and inflammation cytokine production. In vivo data indicate that SLS cornea injuries, characterized by damaged corneal epithelium, damaged anterior stroma, and inflammatory infiltrations, were attenuated with HA-HMW treatment. A good correlation was seen between in vitro and in vivo findings showing that HA-HMW decreases SLS-induced toxic effects and protects cornea.

Protective Effect of Korean Red Ginseng against Aflatoxin B1-Induced Hepatotoxicity in Rat

PubMed Central

Kim, Yong-Seong; Kim, Yong-Hoon; Noh, Jung-Ran; Cho, Eun-Sang; Park, Jong-Ho; Son, Hwa-Young

2011-01-01

Korean red ginseng (KRG), the steamed root of Panax ginseng Meyer, has a variety of biological properties, including anti-inflammatory, antioxidant and anticancer effects. Aflatoxin B1 (AFB1) produced by the Aspergillus spp. causes acute hepatotoxicity by lipid peroxidation and oxidative DNA damage, and induces liver carcinoma in humans and laboratory animals. This study was performed to examine the protective effects of KRG against hepatotoxicity induced by AFB1 using liver-specific serum marker analysis, histopathology, and terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling. In addition, to elucidate the possible mechanism of hepatoprotective effects, superoxide dismutase, catalase, glutathione peroxidase, and malondialdehyde were analyzed. Rats were treated with 250 mg/kg of KRG (KRG group) or saline (AFB1 group) for 4 weeks and then received 150 μg/kg of AFB1 intraperitoneally for 3 days. Rats were sacrificed at 12 h, 24 h, 48 h, 72 h, or 1 wk after AFB1 treatment. In the KRG pre-treatment group, serum alanine aminotransferase, aspartate aminotransferase, and malondialdehyde levels were low, but superoxide dismutase, catalase, and glutathione peroxidase activities were high as compared to the AFB1 alone group. Histopathologically, AFB1 treatment induced necrosis and apoptosis in hepatocytes, and led to inflammatory cells infiltration in the liver. KRG pre-treatment ameliorated these changes. These results indicate that KRG may have protective effects against hepatotoxicity induced by AFB1 that involve the antioxidant properties of KRG. PMID:23717067

Protective effect of alpha glucosyl hesperidin (G-hesperidin) on chronic vanadium induced testicular toxicity and sperm nuclear DNA damage in male Sprague Dawley rats.

PubMed

Vijaya Bharathi, B; Jaya Prakash, G; Krishna, K M; Ravi Krishna, C H; Sivanarayana, T; Madan, K; Rama Raju, G A; Annapurna, A

2015-06-01

The study was conducted to evaluate the vanadium-induced testicular toxicity and its effect on sperm parameters, sperm nuclear DNA damage and histological alterations in Sprague Dawley rats and to assess the protective effect of G-hesperidin against this damage. Treatment of rats with vanadium at a dose of 1 mg kg bw(-1) for 90 days resulted in significant reduction in serum testosterone levels, sperm count and motility. Further, a parallel increase in abnormal sperm morphology and adverse histopathological changes in testis was also associated with vanadium administration when compared to normal control. Moreover, sperm chromatin dispersion assay revealed that vanadium induces sperm nuclear DNA fragmentation. A marked increase in testicular malondialdehyde levels and decreased activity of antioxidant enzymes such as superoxide dismutase and catalase indicates vanadium-induced oxidative stress. Co-administration of G-hesperidin at a dose of 25 and 50 mg kg bw(-1) significantly attenuated the sperm parameters and histological changes by restoring the antioxidant levels in rat testis. These results suggested that vanadium exposure caused reduced bioavailability of androgens to the tissue and increased free radical formation, thereby causing structural and functional changes in spermatozoa. G-hesperidin exhibited antioxidant effect by protecting the rat testis against vanadium-induced oxidative damage, further ensures antioxidant potential of bioflavonoids. © 2014 Blackwell Verlag GmbH.

Prophylaxis with Bacopa monnieri attenuates acrylamide induced neurotoxicity and oxidative damage via elevated antioxidant function.

PubMed

Shinomol, George Kunnel; Raghunath, Narayanareddy; Bharath, Muchukunte Mukunda Srinivas; Muralidhara

2013-03-01

Acrylamide (ACR) is a water-soluble, vinyl monomer that has multiple chemical and industrial applications. Exposure to ACR causes neuropathy and associated neurological defects including gait abnormalities and skeletal muscle weakness, due to impaired neurotransmitter release and eventual neurodegeneration. Using in vivo and in vitro models, we examined whether oxidative events are involved in ACR-mediated neurotoxicity and whether these could be prevented by natural plant extracts. Administration (i.p.) of ACR in mice (40 mg/kg bw/ d for 5d) induced significant oxidative damage in the brain cortex and liver as evidenced by elevated lipid peroxidation, reactive oxygen species and protein carbonyls. This was associated with lowered antioxidant activities including antioxidant enzymes (catalase, glutathione-s-transferase) and reduced glutathione (GSH) compared to untreated controls. Similarly, exposure of N27 neuronal cells in culture to ACR (1-5 mM) caused dose-dependent neuronal death and lowered GSH. Interestingly, dietary supplementation with the leaf powder of Bacopa monnieri (BM) (which possesses neuroprotective properties and nootropic activity) in mice for 30 days offered significant protection against ACR toxicity and oxidative damage in vivo. Similarly, pretreatment with BM protected the N27 cells against ACR-induced cell death and associated oxidative damage. Co-treatment and pre-treatment of Drosophila melanogaster with BM extract protected against ACR-induced locomotor dysfunction and GSH depletion. We infer that BM displays prophylactic effects against ACR induced oxidative damage and neurotoxicity with potential therapeutic application in human pathology associated with neuropathy.

Piperine Enhances the Protective Effect of Curcumin Against 3-NP Induced Neurotoxicity: Possible Neurotransmitters Modulation Mechanism.

PubMed

Singh, Shamsher; Jamwal, Sumit; Kumar, Puneet

2015-08-01

3-Nitropropionic acid (3-NP) is a fungal toxin well established model used for inducing symptoms of Huntington's disease. Curcumin a natural polyphenol has been reported to possess neuroprotective activity by decreasing oxidative stress. The aim of present study was to investigate neuroprotective effect of curcumin with piperine (bioavailability enhancer) against 3-NP induced neurotoxicity in rats. Administration of 3-NP (10 mg/kg for 21 days) showed loss in body weight, declined motor function and changes in biochemical (LPO, nitrite and glutathione level), neuroinflammatory (TNF-α and IL-1β level) and neurochemical (DA, NE, 5-HT, DOPAC, 5-HIAA and HVA). Chronic treatment with curcumin (25 and 50 mg/kg) and curcumin (25 mg/kg) with piperine (2.5 mg/kg) once daily for 21 days prior to 3-NP administration. All the behavioral parameters were studied at 1st, 7th, 14th, and 21st day. On 22nd day all the animals was scarified and striatum was separated. Curcumin alone and combination (25 mg/kg) with piperine (2.5 mg/kg) showed beneficial effect against 3-NP induced motor deficit, biochemical and neurochemical abnormalities in rats. Piperine (2.5 mg/kg) with curcumin (25 mg/kg) significantly enhances its protective effect as compared with curcumin alone treated group. The results of the present study indicate that protective effect of curcumin potentiated in the presence of piperine (bioavailability enhancer) against 3-NP-induced behavioral and molecular alteration.

Nrf2 inhibits oxaliplatin-induced peripheral neuropathy via protection of mitochondrial function.

PubMed

Yang, Yang; Luo, Lan; Cai, Xueting; Fang, Yuan; Wang, Jiaqi; Chen, Gang; Yang, Jie; Zhou, Qian; Sun, Xiaoyan; Cheng, Xiaolan; Yan, Huaijiang; Lu, Wuguang; Hu, Chunping; Cao, Peng

2018-05-20

Oxaliplatin-induced peripheral neuropathy (OIPN) is a severe, dose-limiting toxicity associated with cancer chemotherapy. The efficacy of antioxidant administration in OIPN is debatable, as the promising preliminary results obtained with a number of antioxidants have not been confirmed in larger clinical trials. Besides its antioxidant activity, the transcription factor, nuclear factor-erythroid 2 (NF-E2) p45-related factor 2 (Nrf2) plays a crucial role in the maintenance of mitochondrial homeostasis, and mitochondrial dysfunction is a key contributor to OIPN. Here, we have investigated the protective properties of Nrf2 in OIPN. Nrf2 -/- mice displayed severe mechanical allodynia and cold sensitivity and thus experienced increased peripheral nervous system injury compared to Nrf2 +/+ mice. Furthermore, Nrf2 knockout aggravated oxaliplatin-induced reactive oxygen species production, decreased the mitochondrial membrane potential, led to abnormal intracellular calcium levels, and induced cytochrome c-related apoptosis and overexpression of the TRP protein family. Sulforaphane-induced activation of the Nrf2 signaling pathway alleviated morphological alterations, mitochondrial dysfunction in dorsal root ganglion neurons, and nociceptive sensations in mice. Our findings reveal that Nrf2 may play a critical role in ameliorating OIPN, through protection of mitochondrial function by alleviating oxidative stress and inhibiting TRP protein family expression. This suggests that pharmacological or therapeutic activation of Nrf2 may be used to prevent or slow down the progression of OIPN. Copyright © 2018 Elsevier Inc. All rights reserved.

4-Phenylbutyrate Inhibits Tunicamycin-Induced Acute Kidney Injury via CHOP/GADD153 Repression

PubMed Central

Carlisle, Rachel E.; Brimble, Elise; Werner, Kaitlyn E.; Cruz, Gaile L.; Ask, Kjetil; Ingram, Alistair J.; Dickhout, Jeffrey G.

2014-01-01

Different forms of acute kidney injury (AKI) have been associated with endoplasmic reticulum (ER) stress; these include AKI caused by acetaminophen, antibiotics, cisplatin, and radiocontrast. Tunicamycin (TM) is a nucleoside antibiotic known to induce ER stress and is a commonly used inducer of AKI. 4-phenylbutyrate (4-PBA) is an FDA approved substance used in children who suffer from urea cycle disorders. 4-PBA acts as an ER stress inhibitor by aiding in protein folding at the molecular level and preventing misfolded protein aggregation. The main objective of this study was to determine if 4-PBA could protect from AKI induced by ER stress, as typified by the TM-model, and what mechanism(s) of 4-PBA's action were responsible for protection. C57BL/6 mice were treated with saline, TM or TM plus 4-PBA. 4-PBA partially protected the anatomic segment most susceptible to damage, the outer medullary stripe, from TM-induced AKI. In vitro work showed that 4-PBA protected human proximal tubular cells from apoptosis and TM-induced CHOP expression, an ER stress inducible proapoptotic gene. Further, immunofluorescent staining in the animal model found similar protection by 4-PBA from CHOP nuclear translocation in the tubular epithelium of the medulla. This was accompanied by a reduction in apoptosis and GRP78 expression. CHOP−/− mice were protected from TM-induced AKI. The protective effects of 4-PBA extended to the ultrastructural integrity of proximal tubule cells in the outer medulla. When taken together, these results indicate that 4-PBA acts as an ER stress inhibitor, to partially protect the kidney from TM-induced AKI through the repression of ER stress-induced CHOP expression. PMID:24416259

Human Adipose-Derived Mesenchymal Stem Cells Respond to Short-Term Hypoxia by Secreting Factors Beneficial for Human Islets In Vitro and Potentiate Antidiabetic Effect In Vivo

PubMed Central

Schive, Simen W.; Mirlashari, Mohammad Reza; Hasvold, Grete; Wang, Mengyu; Josefsen, Dag; Gullestad, Hans Petter; Korsgren, Olle; Foss, Aksel; Kvalheim, Gunnar; Scholz, Hanne

2017-01-01

Adipose-derived mesenchymal stem cells (ASCs) release factors beneficial for islets in vitro and protect against hyperglycemia in rodent models of diabetes. Oxygen tension has been shown to induce metabolic changes and alter ASCs’ release of soluble factors. The effects of hypoxia on the antidiabetic properties of ASCs have not been explored. To investigate this, we incubated human ASCs for 48 h in 21% (normoxia) or 1% O2 (hypoxia) and compared viability, cell growth, surface markers, differentiation capability, and soluble factors in the conditioned media (CM). Human islets were exposed to CM from ASCs incubated in either normoxia or hypoxia, and islet function and apoptosis after culture with or without proinflammatory cytokines were measured. To test hypoxic preconditioned ASCs’ islet protective effects in vivo, ASCs were incubated for 48 h in normoxia or hypoxia before being injected into Balb/c Rag 1–/– immunodeficient mice with streptozotocin-induced insulitis. Progression of diabetes and insulin content of pancreas were measured. We found that incubation in hypoxia was well tolerated by ASCs and that levels of VEGF-A, FGF-2, and bNGF were elevated in CM from ASCs incubated in hypoxia compared to normoxia, while levels of HGF, IL-8, and CXCL1 were reduced. CM from ASCs incubated in hypoxia significantly improved human islet function and reduced apoptosis after culture, and reduced cytokine-induced apoptosis. In our mouse model, pancreas insulin content was higher in both groups receiving ASCs compared to control, but the mice receiving preconditioned ASCs had lower random and fasting blood glucose, as well as improved oral glucose tolerance compared to untreated mice. In conclusion, our in vitro results indicate that the islet protective potential of ASCs improves in hypoxia, and we give insight into factors involved in this. Finally we show that hypoxic preconditioning potentiates ASCs’ antidiabetic effect in vivo. PMID:28713640

Polyanhydride nanovaccine against swine influenza virus in pigs.

PubMed

Dhakal, Santosh; Goodman, Jonathan; Bondra, Kathryn; Lakshmanappa, Yashavanth S; Hiremath, Jagadish; Shyu, Duan-Liang; Ouyang, Kang; Kang, Kyung-Il; Krakowka, Steven; Wannemuehler, Michael J; Won Lee, Chang; Narasimhan, Balaji; Renukaradhya, Gourapura J

2017-02-22

We have recently demonstrated the effectiveness of an influenza A virus (IAV) subunit vaccine based on biodegradable polyanhydride nanoparticles delivery in mice. In the present study, we evaluated the efficacy of ∼200nm polyanhydride nanoparticles encapsulating inactivated swine influenza A virus (SwIAV) as a vaccine to induce protective immunity against a heterologous IAV challenge in pigs. Nursery pigs were vaccinated intranasally twice with inactivated SwIAV H1N2 (KAg) or polyanhydride nanoparticle-encapsulated KAg (KAg nanovaccine), and efficacy was evaluated against a heterologous zoonotic virulent SwIAV H1N1 challenge. Pigs were monitored for fever daily. Local and systemic antibody responses, antigen-specific proliferation of peripheral blood mononuclear cells, gross and microscopic lung lesions, and virus load in the respiratory tract were compared among the groups of animals. Our pre-challenge results indicated that KAg nanovaccine induced virus-specific lymphocyte proliferation and increased the frequency of CD4 + CD8αα + T helper and CD8 + cytotoxic T cells in peripheral blood mononuclear cells. KAg nanovaccine-immunized pigs were protected from fever following SwIAV challenge. In addition, pigs immunized with the KAg nanovaccine presented with lower viral antigens in lung sections and had 6 to 8-fold reduction in nasal shedding of SwIAV four days post-challenge compared to control animals. Immunologically, increased IFN-γ secreting T lymphocyte populations against both the vaccine and challenge viruses were detected in KAg nanovaccine-immunized pigs compared to the animals immunized with KAg alone. However, in the KAg nanovaccine-immunized pigs, hemagglutination inhibition, IgG and IgA antibody responses, and virus neutralization titers were comparable to that in the animals immunized with KAg alone. Overall, our data indicated that intranasal delivery of polyanhydride-based SwIAV nanovaccine augmented antigen-specific cellular immune response in pigs, with promise to induce cross-protective immunity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Protective effects of melittin on transforming growth factor-{beta}1 injury to hepatocytes via anti-apoptotic mechanism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Woo-Ram; Park, Ji-Hyun; Kim, Kyung-Hyun

Melittin is a cationic, hemolytic peptide that is the main toxic component in the venom of the honey bee (Apis mellifera). Melittin has multiple effects, including anti-bacterial, anti-viral and anti-inflammatory, in various cell types. However, the anti-apoptotic mechanisms of melittin have not been fully elucidated in hepatocytes. Apoptosis contributes to liver inflammation and fibrosis. Knowledge of the apoptotic mechanisms is important to develop new and effective therapies for treatment of cirrhosis, portal hypertension, liver cancer, and other liver diseases. In the present study, we investigated the anti-apoptotic effect of melittin on transforming growth factor (TGF)-{beta}1-induced apoptosis in hepatocytes. TGF-{beta}1-treated hepatocytesmore » were exposed to low doses (0.5 and 1 {mu}g/mL) and high dose (2 {mu}g/mL) of melittin. The low doses significantly protected these cells from DNA damage in TGF-{beta}1-induced apoptosis compared to the high dose. Also, melittin suppressed TGF-{beta}1-induced apoptotic activation of the Bcl-2 family and caspase family of proteins, which resulted in the inhibition of poly-ADP-ribose polymerase (PARP) cleavage. These results demonstrate that TGF-{beta}1 induces hepatocyte apoptosis and that an optimal dose of melittin exerts anti-apoptotic effects against TGF-{beta}1-induced injury to hepatocytes via the mitochondrial pathway. These results suggest that an optimal dose of melittin can serve to protect cells against TGF-{beta}1-mediated injury. - Highlights: > We investigated the anti-apoptotic effect of melittin on TGF-{beta}1-induced hepatocyte. > TGF-{beta}1 induces hepatocyte apoptosis. > TGF-{beta}1-treated hepatocytes were exposed to low doses and high dose of melittin. > Optimal dose of melittin exerts anti-apoptotic effects to hepatocytes.« less

Oral Administration of Ginseng Ameliorates Cyclosporine-Induced Pancreatic Injury in an Experimental Mouse Model

PubMed Central

Lim, Sun Woo; Doh, Kyoung Chan; Jin, Long; Piao, Shang Guo; Heo, Seong Beom; Zheng, Yu Fen; Bae, Soo Kyung; Chung, Byung Ha; Yang, Chul Woo

2013-01-01

Background This study was performed to investigate whether ginseng has a protective effect in an experimental mouse model of cyclosporine-induced pancreatic injury. Methods Mice were treated with cyclosporine (30 mg/kg/day, subcutaneously) and Korean red ginseng extract (0.2 or 0.4 g/kg/day, oral gavage) for 4 weeks while on a 0.01% salt diet. The effect of ginseng on cyclosporine-induced pancreatic islet dysfunction was investigated by an intraperitoneal glucose tolerance test and measurements of serum insulin level, β cell area, macrophage infiltration, and apoptosis. Using an in vitro model, we further examined the effect of ginseng on a cyclosporine-treated insulin-secreting cell line. Oxidative stress was measured by the concentration of 8-hydroxy-2′-deoxyguanosine in serum, tissue sections, and culture media. Results Four weeks of cyclosporine treatment increased blood glucose levels and decreased insulin levels, but cotreatment with ginseng ameliorated the cyclosporine-induced glucose intolerance and hyperglycemia. Pancreatic β cell area was also greater with ginseng cotreatment compared with cyclosporine monotherapy. The production of proinflammatory molecules, such as induced nitric oxide synthase and cytokines, and the level of apoptotic cell death also decreased in pancreatic β cell with ginseng treatment. Consistent with the in vivo results, the in vitro study showed that the addition of ginseng protected against cyclosporine-induced cytotoxicity, inflammation, and apoptotic cell death. These in vivo and in vitro changes were accompanied by decreases in the levels of 8-hydroxy-2′-deoxyguanosine in pancreatic β cell in tissue section, serum, and culture media during cotreatment of ginseng with cyclosporine. Conclusions The results of our in vivo and in vitro studies demonstrate that ginseng has a protective effect against cyclosporine-induced pancreatic β cell injury via reducing oxidative stress. PMID:24009697

A Phase II Randomized Placebo-Controlled Trial of Oral N-acetylcysteine for Protection of Melanocytic Nevi against UV-Induced Oxidative Stress In Vivo.

PubMed

Cassidy, Pamela B; Liu, Tong; Florell, Scott R; Honeggar, Matthew; Leachman, Sancy A; Boucher, Kenneth M; Grossman, Douglas

2017-01-01

Oxidative stress plays a role in UV-induced melanoma, which may arise from melanocytic nevi. We investigated whether oral administration of the antioxidant N-acetylcysteine (NAC) could protect nevi from oxidative stress in vivo in the setting of acute UV exposure. The minimal erythemal dose (MED) was determined for 100 patients at increased risk for melanoma. Patients were randomized to receive a single dose (1,200 mg) of NAC or placebo, in double-blind fashion, and then one nevus was irradiated (1-2 MED) using a solar simulator. One day later, the MED was redetermined and the irradiated nevus and a control unirradiated nevus were removed for histologic analysis and examination of biomarkers of NAC metabolism and UV-induced oxidative stress. Increased expression of 8-oxoguanine, thioredoxin reductase-1, and γ-glutamylcysteine synthase modifier subunit were consistently seen in UV-treated compared with unirradiated nevi. However, no significant differences were observed in these UV-induced changes or in the pre- and postintervention MED between those patients receiving NAC versus placebo. Similarly, no significant differences were observed in UV-induced changes between subjects with germline wild-type versus loss-of-function mutations in the melanocortin-1 receptor. Nevi showed similar changes of UV-induced oxidative stress in an open-label post-trial study in 10 patients who received NAC 3 hours before nevus irradiation. Thus, a single oral dose of NAC did not effectively protect nevi from UV-induced oxidative stress under the conditions examined. Cancer Prev Res; 10(1); 36-44. ©2016 AACR. ©2016 American Association for Cancer Research.

[Protective effect of compound bismuth and magnesium granules on aspirin-induced gastric mucosal injury in rats].

PubMed

Mu, F H; Hu, F L; Wei, H; Zhang, Y Y; Yang, G B; Lei, X Y; Yang, Y P; Sun, W N; Cui, M H

2016-02-01

To investigate the protective effect of compound bismuth and magnesium granules on aspirin-induced gastric mucosal injury in rats and its possible mechanism. Acute gastric mucosal injury model was developed with intraperitoneal injection of aspirin in Wistar rats. The rats were divided into normal control group, injury group, sucralfate protection group, compound bismuth and magnesium granules protection group and its herbal components protection group(each group 12 rats). In the protection groups, drugs as mentioned above were administered by gavage before treated with intraperitoneal injection of aspirin. To evaluate the extent of gastric mucosal injury and the protective effect of drugs, gastric mucosal lesion index, gastric mucosal blood flow, content of gastric mucosal hexosamine, prostaglandins (PG), nitric oxide(NO), tumor necrosis factor (TNF), and interleukin (IL) -1, 2, 8 were measured in each group, and histological changes were observed by gross as well as under microscope and electron microscope. Contents of hexosamine, NO, and PG in all the protection groups were significantly higher than those in the injury group (all P<0.01), and content of NO in the compound bismuth and magnesium granules group was significantly higher than that in the sucralfate group ((11.29±0.51) vs(10.80±0.36)nmol/ml, P<0.05). The gastric mucosal lesion index, contents of TNF, and IL-1, 2, 8 were significantly lower in all the protection groups than in the injury group (all P<0.01), and contents of IL-2 and IL-8 in the compound bismuth and magnesium granules group were significantly lower than those in the sucralfate group ((328.17±6.56) vs(340.23±8.05)pg/ml, P<0.01; (170.82±7.31) vs(179.31±7.80)pg/ml, P<0.05). Tissue injury and inflammatory reaction in all the protection groups were obviously mitigated compared with the injury group. Compound bismuth and magnesium granules and its herbal components may have significant protective effect on aspirin-induced gastric mucosal injury.

Perilla Oil Has Similar Protective Effects of Fish Oil on High-Fat Diet-Induced Nonalcoholic Fatty Liver Disease and Gut Dysbiosis

PubMed Central

Tian, Yu; Wang, Hualin; Yuan, Fahu; Li, Na; Huang, Qiang; He, Lei; Wang, Limei

2016-01-01

Nonalcoholic fatty liver disease (NAFLD) is the most prevalent chronic liver disease in developed countries. Recent studies indicated that the modification of gut microbiota plays an important role in the progression from simple steatosis to steatohepatitis. Epidemiological studies have demonstrated consumption of fish oil or perilla oil rich in n-3 polyunsaturated fatty acids (PUFAs) protects against NAFLD. However, the underlying mechanisms remain unclear. In the present study, we adopted 16s rRNA amplicon sequencing technique to investigate the impacts of fish oil and perilla oil on gut microbiomes modification in rats with high-fat diet- (HFD-) induced NAFLD. Both fish oil and perilla oil ameliorated HFD-induced hepatic steatosis and inflammation. In comparison with the low-fat control diet, HFD feeding significantly reduced the relative abundance of Gram-positive bacteria in the gut, which was slightly reversed by either fish oil or perilla oil. Additionally, fish oil and perilla oil consumption abrogated the elevated abundance of Prevotella and Escherichia in the gut from HFD fed animals. Interestingly, the relative abundance of antiobese Akkermansia was remarkably increased only in animals fed fish oil compared with HFD group. In conclusion, compared with fish oil, perilla oil has similar but slightly weaker potency against HFD-induced NAFLD and gut dysbiosis. PMID:27051672

Effect of leaf extracts of Taraxacum officinale on CCl4 induced hepatotoxicity in rats, in vivo study.

PubMed

Gulfraz, Muhammad; Ahamd, Dawood; Ahmad, Muhammad Sheeraz; Qureshi, Rehmatullah; Mahmood, Raja Tahir; Jabeen, Nyla; Abbasi, Kashif Sarfraz

2014-07-01

Taraxacum officinale L is a medicinal plant, which has enormous medicinal values against various types of liver disorders and it has traditionally been used for the treatment of liver problems by people from the South East Asia. Previously we have screened the crude methanolic extract of T. officinale against cytotoxicity induced by CCl4. Present study was designed to compare the protective effect of ethanolic and n-hexane extract of leaves in carbon tetrachloride (CCl4) induced liver toxicity in rats. The extract (200 mg/kg and 400mg/kg body weight) along with silymarin (100 mg/kg) a standard drug was administered to experimental animals. It was observed that ethanolic plant extract has significantly reduced the negative effect of CCl4 as compared to n-hexane extract and effect of extract was increased with increasing dose level. Although both leaf extracts decreased the concentration of TBARS, H2O2 and nitrite contents which enhance due to CCl4 toxicity but effect was higher in ethanolic extract. The results clearly indicated that Taraxacum officinale ethanolic leaves extract has better protective effect against CCl4 induced liver tissues toxicity. This claim was also supported by histopathological results obtained during this study and this might be due to presence of various polar phytochemicals that might be more prevent in this extract.

Immunity Elicited by an Experimental Vaccine Based on Recombinant Flagellin-Porcine Circovirus Type 2 Cap Fusion Protein in Piglets

PubMed Central

Wang, Jing; Wei, Li; Quan, Rong; Yang, Jiayu; Yan, Xu; Li, Zixuan; She, Ruiping; Hu, Fengjiao; Liu, Jue

2016-01-01

In a recent study, we reported that a recombinant protein from fusion expression of flagellin to porcine circovirus type 2 (PCV2) Cap induced robust humoral and cell-mediated immunity that afforded full protection for PCV2 infection using BALB/c mice. Here, we further evaluated the immunogenicity and protection of the recombinant protein using specific pathogen free (SPF) pigs. Twenty-five 3-week-old piglets without passively acquired immunity were divided into 5 groups. All piglets except negative controls were challenged with a virulent PCV2 at 21 days after booster vaccination and necropsied at 21 days post-challenge. Vaccination of piglets with the recombinant protein without adjuvant induced strong humoral and cellular immune responses as observed by high levels of PCV2-specific IgG antibodies and neutralizing antibodies, as well as frequencies of PCV2-specific IFN-γ-secreting cells that conferred good protection against PCV2 challenge, with significant reduced PCV2 viremia, mild lesions, low PCV2 antigen-positive cells, as well as improved body weight gain, comparable to piglets vaccinated with a commercial PCV2 subunit vaccine. These results further demonstrated that the recombinant flagellin-Cap fusion protein is capable of inducing solid protective humoral and cellular immunity when administered to pigs, thereby becoming an effective PCV2 vaccine candidate for control of PCV2 infection. PMID:26848967

Nutrient-Enhanced Diet Reduces Noise-Induced Damage to the Inner Ear and Hearing Loss

PubMed Central

Le Prell, C. G.; Gagnon, P. M; Bennett, D. C.; Ohlemiller, K. K.

2011-01-01

Oxidative stress has been broadly implicated as a cause of cell death and neural degeneration in multiple disease conditions; however, the evidence for successful intervention with dietary antioxidant manipulations has been mixed. In this study, we investigated the potential for protection of cells in the inner ear using a dietary supplement with multiple antioxidant components, selected for their potential interactive effectiveness. Protection against permanent threshold shift (PTS) was observed in CBA/J mice maintained on a diet supplemented with a combination of β-carotene, vitamins C and E, and magnesium when compared to PTS in control mice maintained on a nutritionally complete control diet. Although hair cell survival was not enhanced, noise-induced loss of Type II fibrocytes in the lateral wall was significantly reduced (p<0.05), and there was a trend towards less noise-induced loss in strial cell density in animals maintained on the supplemented diet. Taken together, our data suggest that pre-noise oral treatment with the high-nutrient diet can protect cells in the inner ear and reduce PTS in mice. Demonstration of functional and morphological preservation of cells in the inner ear with oral administration of this antioxidant supplemented diet supports the possibility of translation to human patients, and suggests an opportunity to evaluate antioxidant protection in mouse models of oxidative stress-related disease and pathology. PMID:21708355

Protective effects of epigallocatechin gallate (EGCG) on streptozotocin-induced diabetic nephropathy in mice.

PubMed

Yoon, Sang Pil; Maeng, Young Hee; Hong, Ran; Lee, Byung Rai; Kim, Chong Gue; Kim, Hyun Lee; Chung, Jong Hoon; Shin, Byung Chul

2014-10-01

There is increasing evidence suggesting that antioxidants in green tea extracts may protect kidneys on the progression of end-stage renal disease. We investigated the protective impacts of (-)-epigallocatechin 3-O-gallate (EGCG) against streptozotocin (STZ)-induced diabetic nephropathy in mice. The mice were divided into 5 groups (n=10 per group): control (saline, i.p.), STZ (200mg/kg, i.p.), EGCG50 (50mg/kg, S.Q.), EGCG100 (100mg/kg, S.Q.), and EGCG200 (200mg/kg, S.Q.). Animals were sacrificed at scheduled times after EGCG administration and then quantitative and qualitative analysis were performed. Compared with the control group, the STZ group showed an increase in levels of blood glucose, blood urea nitrogen, creatinine and urine protein amounts with a decrease in body weight. All the above parameters were significantly reversed with EGCG treatment, especially in the EGCG100 group. After STZ injection, there was a mesangial proliferation with increased renal osteopontin accumulation and its protein expression in the glomeruli and the proximal tubules. Mice kidneys after EGCG-treatment showed a reduced expression of above parameters and relatively improved histopathological findings. These results indicated that EGCG 100mg/kg might provide an effective protection against STZ-induced diabetic nephropathy in mice by osteopontin suppression. Copyright © 2014 Elsevier GmbH. All rights reserved.

Protective effects of Labisia pumila var. alata on biochemical and histopathological alterations of cardiac muscle cells in isoproterenol-induced myocardial infarction rats.

PubMed

Dianita, Roza; Jantan, Ibrahim; Amran, Athirah Z; Jalil, Juriyati

2015-03-16

The study was designed to evaluate the cardioprotective effects of the standardized aqueous and 80% ethanol extracts of Labisia pumila var. alata (LPva) in isoproterenol (ISO)-induced myocardial infarction (MI) in rats. The extracts were administered to Wistar rats orally for 28 days with three doses (100, 200 and 400 mg/kg of body weight) prior to ISO (85 mg/kg)-induced MI in two doses on day 29 and 30. The sera and hearts were collected for biochemical and histopathological analysis after the rats were sacrificed 48 h after the first induction. The main components of the extracts, gallic acid, alkylresorcinols and flavonoids were identified and quantitatively analyzed in the extracts by using a validated reversed phase HPLC method. The extracts showed significant protective effects as pretreated rats showed a significant dose-dependent decrease (p < 0.05) in cardiac enzyme activities, i.e., cardiac troponin I (cTnI), creatine kinase MB isoenzyme (CK-MB), lactate dehydrogenase (LDH), alanine transaminase (ALT) and aspartate transaminase (AST), when compared with ISO-control rats. There were significant rises (p < 0.05) in the activity of oxidase enzymes, i.e., glutathione peroxide (GPx), catalase (CAT) and superoxide dismutase (SOD) of the pretreated rats, when compared with ISO-control group. Histopathological examination showed an improvement in membrane cell integrity in pre-treated rats compared to untreated rats. The major components of LPva extracts can be used as their biomarkers and contributed to the cardioprotective effects against ISO-induced MI rats.

Cyclosporine A regulate oxidative stress-induced apoptosis in cardiomyocytes: mechanisms via ROS generation, iNOS and Hsp70

PubMed Central

Chen, Huei-Wen; Chien, Chiang-Ting; Yu, Sung-Liang; Lee, Yuan-Teh; Chen, Wen-Jone

2002-01-01

Previous study suggested that cyclosporine A (CsA) could partially reduce ischaemia/reperfusion-induced injury in isolated heart, but the mechanism was still unclear. In this study, the possible mechanisms of cyclosporine A in regulating oxidative stress-induced cardiomyocyte apoptosis were examined. Morphological (cell shrinkage, apoptotic body formation, and DNA fragmentation) and biochemical (annexin-V staining for exposed phosphatidylserine residues) evidences showed that both hydrogen peroxide (H2O2) and hypoxia/reoxygenation could induce apoptotic change in the embryonal rat heart myoblast-derived cells (H9c2). These effects were inhibited by pre-treatment with CsA at concentration of 0.01–1.0 μM for 24 h, but were increased with 10.0 μM CsA. While examining the mechanisms of CsA in protecting cardiomyocyte apoptosis, we found that the collapse of mitochondria membrane potential (ΔΨm) induced by oxidative stress was partially reversed by CsA (0.01–1.0 μM). Compared to the control, CSA at the concentration of 0.1 and 10.0 μM significantly increased the level of intracellular reactive oxygen species (ROS) to 117.2±12.4% and 234.4±9.3%, respectively. Co-incubating with the antioxidant, ascorbic acid (10.0 μM), could partially reduce the protective effect of CsA (0.01–1.0 μM) and the toxic effect of 10.0 μM CsA. Pre-treatment with CsA at concentration of 0.01–1.0 μM for 24 h produced up-regulation of heat shock protein 70 (Hsp 70), inducible nitric oxide synthase (iNOS) and also induced NO production, indicating that these factors might be associated with the cell protective effects of CsA. These results suggest that CsA could protect the oxidative stress-induced cardiomyocyte apoptosis not only by preventing the loss of ΔΨm in mitochondria, but also through ROS generation, Hsp70, and iNOS up-regulation. PMID:12411407

Hyperoxia-induced ciliary loss and oxidative damage in an in vitro bovine model: The protective role of antioxidant vitamins E and C

DOE Office of Scientific and Technical Information (OSTI.GOV)

Al-Shmgani, Hanady S.; Moate, Roy M.; Sneyd, J. Robert

2012-12-14

Highlights: Black-Right-Pointing-Pointer A new bovine bronchial model for studying hyperoxia-induced cilia loss is presented. Black-Right-Pointing-Pointer Hyperoxia-induced cilia loss was associated with increased sloughing of cells. Black-Right-Pointing-Pointer Hyperoxia led to higher epithelial glutathione levels, evidence of oxidative stress. Black-Right-Pointing-Pointer Hyperoxia led to increased DNA damage (Comet), and lipid peroxidation (TBARS). Black-Right-Pointing-Pointer Vitamins C and E partially protected against hyperoxia-induced cilia loss. -- Abstract: Although elevated oxygen fraction is used in intensive care units around the world, pathological changes in pulmonary tissue have been shown to occur with prolonged exposure to hyperoxia. In this work a bovine bronchus culture model has beenmore » successfully used to evaluate the effects of hyperoxia on ciliated epithelium in vitro. Samples were cultured using an air interface method and exposed to normoxia, 21% O{sub 2} or hyperoxia, 95% O{sub 2}. Cilial coverage was assessed using scanning electron microscopy (SEM). Tissue damage (lactate dehydrogenase, LDH, in the medium), lipid peroxidation (thiobarbituric acid reactive substances, TBARS), DNA damage (comet assay), protein oxidation (OxyBlot kit) and antioxidant status (total glutathione) were used to assess whether the hyperoxia caused significant oxidative stress. Hyperoxia caused a time-dependent decline (t{sub Vulgar-Fraction-One-Half} = 3.4 d compared to 37.1 d under normoxia) in cilial coverage (P < 0.0001). This was associated with a significant increase in the number of cells (2.80 {+-} 0.27 Multiplication-Sign 10{sup 6} compared to 1.97 {+-} 0.23 Multiplication-Sign 10{sup 6} ml{sup -1} after 6 d), many apparently intact, in the medium (P < 0.05); LDH release (1.06 {+-} 0.29 compared to 0.83 {+-} 0.36 {mu}mol min{sup -1} g{sup -1} after 6 d; P < 0.001); lipid peroxidation (352 {+-} 16 versus 247 {+-} 11 {mu}mol MDA g{sup -1} for hyperoxia and normoxia, respectively); % tail DNA (18.7 {+-} 2.2 versus 11.1 {+-} 1.5); protein carbonyls (P < 0.05); and total glutathione (229 {+-} 20 {mu}mol g{sup -1} versus 189 {+-} 15 {mu}mol g{sup -1}). Vitamins E (10{sup -7} M) and C (10{sup -6} or 10{sup -7} M) alone or in combination (10{sup -7} M and 10{sup -6} M, respectively) had a significant protective effect on the hyperoxia-induced reduction in percentage cilial coverage (P < 0.05). In conclusion, hyperoxia caused damage to cultured bovine bronchial epithelium and denudation of cilia. The antioxidant vitamins E and C significantly protected against hyperoxia-induced cilia loss.« less

Protective effect of hexane and ethanol extract of piper longum L. On gentamicin-induced hair cell loss in neonatal cultures.

PubMed

Yadav, Mukesh Kumar; Choi, June; Song, Jae-Jun

2014-03-01

Gentamicin (GM) is a commonly used aminoglycoside antibiotic that generates free oxygen radicals within the inner ear, which can cause vestibulo-cochlear toxicity and permanent damage to the sensory hair cells and neurons. Piper longum L. (PL) is a well-known spice and traditional medicine in Asia and Pacific islands, which has been reported to exhibit a wide spectrum of activity, including antioxidant activity. In this study, we evaluated the effect of hexane:ethanol (2:8) PL extract (subfraction of PL [SPL] extract) on GM-induced hair cell loss in basal, middle and apical regions in a neonatal cochlea cultures. The protective effects of SPL extract were measured by phalloidin staining of cultures from postnatal day 2-3 mice with GM-induced hair cell loss. The anti-apoptosis activity of SPL extract was measured using double labeling by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) and myosin-7a staining. The radical-scavenging activity of SPL extract was assessed using the 1,1-diphenyl-2-picrylhydrazyl (DPPH) assay. SPL extract at a concentration of 1 µg/mL significantly inhibited GM-induced hair cell loss at basal and middle region of cochlea, while 5 µg/mL was effective against apical region hair cell loss. The protective effect of SPL extract was concentration dependent and hair cells retained their stereocilia in explants treated with SPL extract prior to treatment with 0.3 mM GM. SPL extract decreased GM-induced apoptosis of hair cells as assessed by TUNEL staining. The outer hair and inner hair counts were not decreased in SPL extract treated groups in compare to GM treated explants. Additionally, SPL extract showed concentration dependent radical scavenging activity in a DPPH assay. An anti-apoptosis effect and potent radical scavenger activity of SPL extract protects from GM-induced hair cell loss at basal, middle and apical regions in neonatal cochlea cultures.

Evaluation of edaravone against radiation-induced oral mucositis in mice.

PubMed

Nakajima, Noriko; Watanabe, Shinichi; Kiyoi, Takeshi; Tanaka, Akihiro; Suemaru, Katsuya; Araki, Hiroaki

2015-03-01

Oral mucositis induced by radiotherapy for cancers of the head and neck reduce the quality of life of patients. However, effective therapeutic agents are lacking. Symptomatic treatment involves local anesthesia and analgesia. We focused on the antioxidant effects of edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one; Radicut(®)). Oral mucositis was induced on the tongue tips of mice using a single dose of X-rays (20 Gy). To evaluate the protective effect of edaravone (30 and 300 mg/kg), administration was carried out 30 min before irradiation. Survival, oral mucositis score, myeloperoxidase activity, and levels of 2-Thiobarbituric acid reactive substances were measured, and all were improved compared with those of control mice. A significant difference was not found in terms of survival due to edaravone. Histopathologic findings also highlighted the beneficial features of edaravone. Edaravone reduced the production of reactive oxygen species. These findings suggest that the protective effect of edaravone against radiation-induced oral mucositis is through an antioxidant effect. Copyright © 2015 Japanese Pharmacological Society. Production and hosting by Elsevier B.V. All rights reserved.

Chlorogenic acid protects against aluminium-induced cytotoxicity through chelation and antioxidant actions in primary hippocampal neuronal cells.

PubMed

Wang, Xiaomei; Fan, Xinguang; Yuan, Shuzhi; Jiao, Wenxiao; Liu, Bangdi; Cao, Jiankang; Jiang, Weibo

2017-08-01

Chlorogenic acid (CGA), a major polyphenolic component of many plants, displays antioxidant and neuroprotective properties in neurodegenerative diseases. To investigate whether CGA may influence aluminium (Al) induced cytotoxicity, aluminium chloride (50 μM Al) was administered in primary hippocampal neuronal cells presupplemented with CGA (10, 50 and 100 μM). Our study shows that the exposure to Al caused cell death, Al 3+ accumulation, reactive oxygen species generation and mitochondrial damage in cells. The administration of CGA (50 μM) increased cell viability by 37.5%, decreased the levels of Al 3+ by 26.0%, together with significantly weakening the oxidative damage compared with Al treatment alone. CGA protected neurons against Al-induced oxidative stress by increasing the expression of nuclear factor-E2-related factor 2 and its target phase 2 enzymes. The administration of CGA remarkably promoted the activities of superoxide dismutase, catalase, glutathione peroxidase, glutathione S-transferase, creatine kinase and acetylcholinesterase and attenuated the rate of ATP hydrolysis. Our finding shows that CGA has neuroprotective effects against Al-induced cytotoxicity by chelation and antioxidant activation.

Study on patient-induced radioactivity during proton treatment in hengjian proton medical facility.

PubMed

Wu, Qingbiao; Wang, Qingbin; Liang, Tianjiao; Zhang, Gang; Ma, Yinglin; Chen, Yu; Ye, Rong; Liu, Qiongyao; Wang, Yufei; Wang, Huaibao

2016-09-01

At present, increasingly more proton medical facilities have been established globally for better curative effect and less side effect in tumor treatment. Compared with electron and photon, proton delivers more energy and dose at its end of range (Bragg peak), and has less lateral scattering for its much larger mass. However, proton is much easier to produce neutron and induced radioactivity, which makes radiation protection for proton accelerators more difficult than for electron accelerators. This study focuses on the problem of patient-induced radioactivity during proton treatment, which has been ignored for years. However, we confirmed it is a vital factor for radiation protection to both patient escort and positioning technician, by FLUKA's simulation and activation formula calculation of Hengjian Proton Medical Facility (HJPMF), whose energy ranges from 130 to 230MeV. Furthermore, new formulas for calculating the activity buildup process of periodic irradiation were derived and used to study the relationship between saturation degree and half-life of nuclides. Finally, suggestions are put forward to lessen the radiation hazard from patient-induced radioactivity. Copyright © 2016 Elsevier Ltd. All rights reserved.

Vidarabine, an Anti-Herpes Virus Agent, Protects Against the Development of Heart Failure With Relatively Mild Side-Effects on Cardiac Function in a Canine Model of Pacing-Induced Dilated Cardiomyopathy.

PubMed

Nakamura, Takashi; Fujita, Takayuki; Kishimura, Megumi; Suita, Kenji; Hidaka, Yuko; Cai, Wenqian; Umemura, Masanari; Yokoyama, Utako; Uechi, Masami; Ishikawa, Yoshihiro

2016-11-25

In heart failure patients, chronic hyperactivation of sympathetic signaling is known to exacerbate cardiac dysfunction. In this study, the cardioprotective effect of vidarabine, an anti-herpes virus agent, which we identified as a cardiac adenylyl cyclase inhibitor, in dogs with pacing-induced dilated cardiomyopathy (DCM) was evaluated. In addition, the adverse effects of vidarabine on basal cardiac function was compared to those of the β-blocker, carvedilol.Methods and Results:Vidarabine and carvedilol attenuated the development of pacing-induced systolic dysfunction significantly and with equal effectiveness. Both agents also inhibited the development of cardiac apoptosis and fibrosis and reduced the Na + -Ca 2+ exchanger-1 protein level in the heart. Importantly, carvedilol significantly enlarged the left ventricle and atrium; vidarabine, in contrast, did not. Vidarabine-treated dogs maintained cardiac response to β-AR stimulation better than carvedilol-treated dogs did. Vidarabine may protect against pacing-induced DCM with less suppression of basal cardiac function than carvedilol in a dog model. (Circ J 2016; 80: 2496-2505).

Protective effect of embelin from Embelia ribes Burm. against transient global ischemia-induced brain damage in rats.

PubMed

Thippeswamy, B S; Nagakannan, P; Shivasharan, B D; Mahendran, S; Veerapur, V P; Badami, S

2011-11-01

Embelia ribes is being used in Indian traditional herbal medicine for the treatment of mental disorders and as brain tonic. The present study was designed to investigate the protective effects of embelin from E. ribes on global ischemia/reperfusion-induced brain injury in rats. Transient global ischemia was induced by occluding bilateral common carotid arteries for 30 min followed by 24-h reperfusion. Neurological functions were measured using sensorimotor tests. Ischemia/reperfusion-induced neuronal injury was assessed by cerebral infarct area, biochemical and histopathological examination. Pretreatment of embelin (25 and 50 mg/kg, p.o.) significantly increased locomotor activity and hanging latency time and decreased beam walking latency when compared with ischemic control. The treatment also reduced significantly the lipid peroxidation and increased the total thiol content and glutathione-S-transferase activity in brain homogenates. The decreased cerebral infarction area in embelin-treated groups and histopathological observations confirmed the above findings. These observations suggested that embelin is a neuroprotective agent and may prove to be useful adjunct in the treatment of stroke.

Myricetin protects against diet-induced obesity and ameliorates oxidative stress in C57BL/6 mice.

PubMed

Su, Hong-Ming; Feng, Li-Na; Zheng, Xiao-Dong; Chen, Wei

2016-06-01

Myricetin is a naturally occurring antioxidant commonly found in various plants. However, little information is available with respect to its direct anti-obesity effects. This study was undertaken to investigate the effect of myricetin on high-fat diet (HFD)-induced obesity in C57BL/6 mice. Administration of myricetin dramatically reduced the body weight of diet-induced obese mice compared with solely HFD-induced mice. Several parameters related to obesity including serum glucose, triglyceride, and cholesterol were significantly decreased in myricetin-treated mice. Moreover, obesity-associated oxidative stress (glutathione peroxidase (GPX) activity, total antioxidant capacity (T-AOC), and malondialdehyde (MDA)) and inflammation (tumor necrosis factor-α (TNF-α)) were ameliorated in myricetin-treated mice. Further investigation revealed that the protective effect of myricetin against HFD-induced obesity in mice appeared to be partially mediated through the down-regulation of mRNA expression of adipogenic transcription factors peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer-binding protein α (C/EBPα), and lipogenic transcription factor sterol regulatory element-binding protein 1c (SREBP-1c). Consumption of myricetin may help to prevent obesity and obesity-related metabolic complications.

Protection of human keratinocytes from UVB-induced inflammation using root extract of Lithospermum erythrorhizon.

PubMed

Ishida, Takahiro; Sakaguchi, Ikuyo

2007-05-01

UVB irradiation is an important inducer of biological changes in skin and can activate inflammatory reactions and apoptotic pathways, leading to skin damage. A root extract of Lithospermum erythrorhizon (SK), which has naphthoquinone pigments containing shikonin and shikonin derivatives, is known for its anti-inflammatory, anti-bacterial, and anti-tumor activity, and for its scavenging of reactive oxygen species. However, the effect of SK against UV damage is not clear. The aim of this study was to evaluate the efficacy of SK against UVB induced damage in normal human epidermal keratinocytes (NHEK). UVB-irradiated NHEK showed decreased cell viability, increased production of interleukin (IL)-1alpha, IL-6, IL-8, and tumor necrosis factor-alpha, and induced apoptosis. In an apoptosis pathway assay, UVB-irradiated NHEK showed increased caspase-3 activity, p53 and its phosphorylation at serine 15 compared with non-irradiated cells. All these effects induced by UVB irradiation were clearly inhibited by treatment with SK before and after UVB irradiation for 24 h. It is suggested that SK can protect epidermal cells against harmful effects of UVB irradiation and that SK treatment is probably beneficial for photoprotection of the skin.

Myricetin protects against diet-induced obesity and ameliorates oxidative stress in C57BL/6 mice*

PubMed Central

Su, Hong-ming; Feng, Li-na; Zheng, Xiao-dong; Chen, Wei

2016-01-01

Background: Myricetin is a naturally occurring antioxidant commonly found in various plants. However, little information is available with respect to its direct anti-obesity effects. Objective: This study was undertaken to investigate the effect of myricetin on high-fat diet (HFD)-induced obesity in C57BL/6 mice. Results: Administration of myricetin dramatically reduced the body weight of diet-induced obese mice compared with solely HFD-induced mice. Several parameters related to obesity including serum glucose, triglyceride, and cholesterol were significantly decreased in myricetin-treated mice. Moreover, obesity-associated oxidative stress (glutathione peroxidase (GPX) activity, total antioxidant capacity (T-AOC), and malondialdehyde (MDA)) and inflammation (tumor necrosis factor-α (TNF-α)) were ameliorated in myricetin-treated mice. Further investigation revealed that the protective effect of myricetin against HFD-induced obesity in mice appeared to be partially mediated through the down-regulation of mRNA expression of adipogenic transcription factors peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer-binding protein α (C/EBPα), and lipogenic transcription factor sterol regulatory element-binding protein 1c (SREBP-1c). Conclusions: Consumption of myricetin may help to prevent obesity and obesity-related metabolic complications. PMID:27256677

Reduction of the Ganglioside Binding Activity of the Tetanus Toxin HC Fragment Destroys Immunogenicity: Implications for Development of Novel Tetanus Vaccines

PubMed Central

Qazi, Omar; Sesardic, Dorothea; Tierney, Robert; Söderbäck, Zahra; Crane, Dennis; Bolgiano, Barbara; Fairweather, Neil

2006-01-01

In this study, the immunogenicities of the nontoxic HC fragment of tetanus toxin and derivatives lacking ganglioside binding activity were compared with that of tetanus toxoid after subcutaneous immunization of mice. Wild-type HC (HCWT) protein and tetanus toxoid both elicited strong antibody responses against toxoid and HC antigens and provided complete protection against toxin challenge. Mutants of HC containing deletions essential for ganglioside binding elicited lower responses than HCWT. HCM115, containing two amino acid substitutions within the ganglioside binding site, provided reduced protection against tetanus toxin challenge compared with HCWT, consistent with lower anti-HC and anti-toxoid antibody titers. Circular-dichroism spectroscopy and intrinsic fluorescence spectroscopy showed minimal structural perturbation in HCM115. We conclude that the presence of the ganglioside binding site within HC may be essential for induction of a fully protective anti-tetanus response comparable to that induced by tetanus toxoid by subcutaneous injection. PMID:16861677

Esculetin-induced protection of human hepatoma HepG2 cells against hydrogen peroxide is associated with the Nrf2-dependent induction of the NAD(P)H: Quinone oxidoreductase 1 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Subramaniam, Sudhakar R.; Ellis, Elizabeth M., E-mail: elizabeth.ellis@strath.ac.uk

Esculetin (6,7-dihydroxy coumarin), is a potent antioxidant that is present in several plant species. The aim of this study was to investigate the mechanism of protection of esculetin in human hepatoma HepG2 cells against reactive oxygen species (ROS) induced by hydrogen peroxide. Cell viability, cell integrity, intracellular glutathione levels, generation of reactive oxygen species and expression of antioxidant enzymes were used as markers to measure cellular oxidative stress and response to ROS. The protective effect of esculetin was compared to a well-characterized chemoprotective compound quercetin. Pre-treatment of HepG2 cells with sub-lethal (10-25 {mu}M) esculetin for 8 h prevented cell deathmore » and maintained cell integrity following exposure to 0.9 mM hydrogen peroxide. An increase in the generation of ROS following hydrogen peroxide treatment was significantly attenuated by 8 h pre-treatment with esculetin. In addition, esculetin ameliorated the decrease in intracellular glutathione caused by hydrogen peroxide exposure. Moreover, treatment with 25 {mu}M esculetin for 8 h increased the expression of NAD(P)H: quinone oxidoreductase (NQO1) at both protein and mRNA levels significantly, by 12-fold and 15-fold, respectively. Esculetin treatment also increased nuclear accumulation of Nrf2 by 8-fold indicating that increased NQO1 expression is Nrf2-mediated. These results indicate that esculetin protects human hepatoma HepG2 cells from hydrogen peroxide induced oxidative injury and that this protection is provided through the induction of protective enzymes as part of an adaptive response mediated by Nrf2 nuclear accumulation.« less

Protective role of c-Jun N-terminal kinase 2 in acetaminophen-induced liver injury

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bourdi, Mohammed; Korrapati, Midhun C.; Chakraborty, Mala

2008-09-12

Recent studies in mice suggest that stress-activated c-Jun N-terminal protein kinase 2 (JNK2) plays a pathologic role in acetaminophen (APAP)-induced liver injury (AILI), a major cause of acute liver failure (ALF). In contrast, we present evidence that JNK2 can have a protective role against AILI. When male C57BL/6J wild type (WT) and JNK2{sup -/-} mice were treated with 300 mg APAP/kg, 90% of JNK2{sup -/-} mice died of ALF compared to 20% of WT mice within 48 h. The high susceptibility of JNK2{sup -/-} mice to AILI appears to be due in part to deficiencies in hepatocyte proliferation and repair.more » Therefore, our findings are consistent with JNK2 signaling playing a protective role in AILI and further suggest that the use of JNK inhibitors as a potential treatment for AILI, as has been recommended by other investigators, should be reconsidered.« less

Candida albicans morphology and dendritic cell subsets determine T helper cell differentiation

PubMed Central

Gerami-Nejad, Maryam; Kumamoto, Yosuke; Mohammed, Javed A.; Jarrett, Elizabeth; Drummond, Rebecca A.; Zurawski, Sandra M.; Zurawski, Gerard; Berman, Judith; Iwasaki, Akiko; Brown, Gordon D.; Kaplan, Daniel H.

2015-01-01

Summary Candida albicans is a dimorphic fungus responsible for chronic mucocutaneous and systemic infections. Mucocutaneous immunity to C. albicans requires T helper-17 (Th17) cell differentiation that is thought to depend on recognition of filamentous C. albicans. Systemic immunity is considered T cell independent. Using a murine skin infection model, we compared T helper cell responses to yeast and filamentous C. albicans, We found that only yeast induced Th17 cell responses through a mechanism that required Dectin-1 mediated expression of interleukin-6 (IL-6) by Langerhans cells. Filamentous forms induced Th1 without Th17 cell responses due to the absence of Dectin-1 ligation. Notably, Th17 cell responses provided protection against cutaneous infection while Th1 cell responses provided protection against systemic infection. Thus, C. albicans morphology drives distinct T helper cell responses that provide tissue specific protection. These findings provide insight into compartmentalization of Th responses, C. albicans pathogenesis and have critical implications for vaccine strategies. PMID:25680275

Measured occupational solar UVR exposures of lifeguards in pool settings.

PubMed

Gies, Peter; Glanz, Karen; O'Riordan, David; Elliott, Tom; Nehl, Eric

2009-08-01

The aim of this study was to measure ultraviolet radiation (UVR) exposures of lifeguards in pool settings and evaluate their personal UVR protective practices. Lifeguards (n = 168) wore UVR sensitive polysulfone (PS) film badges in wrist bracelets on 2 days and completed a survey and diary covering sun protection use. Analyses were used to describe sun exposure and sun protection practices, to compare UVR exposure across locations, and to compare findings with recommended threshold limits for occupational exposure. The measured UVR exposures varied with location, ranging from high median UVR exposures of 6.2 standard erythemal doses (SEDs) to the lowest median of 1.7 SEDs. More than 74% of the lifeguards' PS badges showed UVR above recommended threshold limits for occupational exposure. Thirty-nine percent received more than four times the limit and 65% of cases were sufficient to induce sunburn. The most common protective behaviors were wearing sunglasses and using sunscreen, but sun protection was often inadequate. At-risk individuals were exposed to high levels of UVR in excess of occupational limits and though appropriate types of sun protection were used, it was not used consistently and more than 50% of lifeguards reported being sunburnt at least twice during the previous year.

Betanin attenuates carbon tetrachloride (CCl4)-induced liver injury in common carp (Cyprinus carpio L.).

PubMed

Han, Junyan; Gao, Cheng; Yang, Shaobin; Wang, Jun; Tan, Dehong

2014-06-01

This study investigates the protective effect of betanin against liver injury induced by carbon tetrachloride (CCl4) in common carp (Cyprinus carpio L.). The fish were treated with 1, 2, and 4 % betanin in fodder throughout the experiment. After 20 days of treatment, the fish were intraperitoneally injected with 20 % (v/v in peanut oil) CCl4 at a volume of 0.5 mL/kg body weight. The fish were killed 3 days after CCl4 intoxication, and then, histological and biochemical assays were performed. Results showed that CCl4-induced liver CYP2E1 activity, oxidative stress, and injury, as indicated by the depleted glycogen storage, increased serum aspartate aminotransferase (AST)/alanine aminotransferase (ALT) activities and liver histological damage. Compared with the CCl4 control group, the betanin-treated groups exhibited reduced CYP2E1 activity, decreased malondialdehyde level, increased liver antioxidative capacity (increased glutathione level and superoxide dismutase and catalase activities), increased liver glycogen storage, and reduced serum AST/ALT activities, with significant differences in the 2 and 4 % groups (p < 0.05). Histological assay further confirmed the protective effect of betanin. In conclusion, betanin attenuates CCl4-induced liver damage in common carp. Moreover, the inhibition of CYP2E1 activity and oxidative stress may have significant roles in the protective effect of betanin.

Protective effects of a topical antioxidant complex containing vitamins C and E and ferulic acid against ultraviolet irradiation-induced photodamage in Chinese women.

PubMed

Wu, Yan; Zheng, Xin; Xu, Xue-Gang; Li, Yuan-Hong; Wang, Bin; Gao, Xing-Hua; Chen, Hong-Duo; Yatskayer, Margarita; Oresajo, Christian

2013-04-01

The objective of the study was to investigate whether a topical antioxidant complex containing vitamins C and E and ferulic acid can protect solar-simulated ultraviolet irradiation (ssUVR)-induced acute photodamage in human skin. Twelve healthy female Chinese subjects were enrolled in this study. Four unexposed sites on dorsal skin were marked for the experiment. The products containing antioxidant complex and vehicle were applied onto 2 sites, respectively, for 4 consecutive days. On day 4, the antioxidant complex-treated site, the vehicle-treated site, and the untreated site (positive control) received ssUVR (5 times the minimal erythema dose). The fourth site (negative control) received neither ssUVR nor treatment. Digital photographs were taken, and skin color was measured pre- and postirradiation. Skin biopsies were obtained 24 hours after exposure to ssUVR, for hematoxylin and eosin and immunohistochemical staining. A single, 5 times the minimal erythema dose of ssUVR substantially induced large amounts of sunburn cell formation, thymine dimer formation, overexpression of p53 protein, and depletion of CD1a+ Langerhans cells. The antioxidant complex containing vitamins C and E and ferulic acid conferred significant protection against biological events compared with other irradiated sites. A topical antioxidant complex containing vitamins C and E and ferulic acid has potential photoprotective effects against ssUVR-induced acute photodamage in human skin.

Protective Effect of Amphipterygium adstringens Extract on Dextran Sulphate Sodium-Induced Ulcerative Colitis in Mice

PubMed Central

Rodriguez-Canales, Mario; Jimenez-Rivas, Ruben; Canales-Martinez, Maria Margarita; Garcia-Lopez, Ana Judith; Rivera-Yañez, Nelly; Nieto-Yañez, Oscar; Ledesma-Soto, Yadira; Sanchez-Torres, Luvia Enid; Rodriguez-Sosa, Miriam; Terrazas, Luis Ignacio

2016-01-01

Amphipterygium adstringens is an endemic species in Mexico commonly known as “cuachalalate.” Healers to treat gastritis, gastric ulcers, and gastrointestinal cancer have traditionally used the bark. We investigated the effects of alcoholic extract of A. adstringens (AaEE) in DSS-induced colitis in mice. The protective effect of AaEE was determined at 200 mg/kg by oral gavage for 10 days. We determine the effect of AaEE on clinical features (disease activity index), antioxidants, anti-inflammatory, and immunomodulatory activities in relation to the activity of SOD, CAT, and GPx, levels of proinflammatory cytokines, and changes both macroscopic and microscopic of the colonic mucosa. AaEE significantly reduced the inflammation of colon and significantly increased SOD and GPx activities. AaEE also significantly decreased TNF-α, IFN-γ, and IL-1β cytokine levels compared to DSS-treated mice and reduced both infiltration of inflammatory cells and the mucosal damage in colon. The results suggested the protective potential of AaEE in DSS-induced colitis and this might be attributed to its phytochemicals compounds that have been found to induce a wide spectrum of activities such as reduction in oxidative stress, suppression of inflammation, modulating numerous signal transduction pathways, and induction of apoptosis. The findings of this study suggest that AaEE has substantial potential for the treatment of inflammatory colitis. PMID:27635116

Nitric oxide protects carbon assimilation process of watermelon from boron-induced oxidative injury.

PubMed

Farag, Mohamed; Najeeb, Ullah; Yang, Jinghua; Hu, Zhongyuan; Fang, Zhang Ming

2017-02-01

Nitric oxide (NO) mediates plant response to a variety of abiotic stresses; however, limited information is available on its effect on boron (B)-stressed watermelon plants. The present study investigates the mechanism through which NO protects watermelon seedlings from B deficiency and toxicity stresses. Five days old watermelon seedlings were exposed to B (0, 0.5 and 10 mg L -1 ) alone or with 75 μmole of NO donor sodium nitroprusside (SNP) for 30 days. Both low and high B concentrations in the media altered nutrient accumulation and impaired various physiological processes of watermelon seedlings, leading to a significant reduction in biomass production. The plants exposed to B deficient or toxic concentrations had 66 and 69% lower shoot dry weight, respectively compared with optimum B levels. B toxicity-induced growth inhibition of watermelon seedlings was associated with high B translocation to shoot tissues, which caused lipid membrane peroxidation (12% increase) and chlorophyll destruction (25% reduction). In contrast, B deficiency accelerated generation of reactive oxygen species (ROS), specifically OH -1 and induced cellular oxidative injury. Exogenously applied SNP promoted leaf chlorophyll, photosynthesis and consequently biomass production in B-stressed watermelon seedlings by reducing B accumulation, lipid membrane peroxidation and ROS generation. It also activated antioxidant enzymes such as SOD, POD and APX, and protected the seedlings from ROS-induced cellular burst. Copyright © 2016. Published by Elsevier Masson SAS.

The nuclear factor (erythroid-derived 2)-like 2 (NRF2) antioxidant response promotes melanocyte viability and reduces toxicity of the vitiligo-inducing phenol monobenzone.

PubMed

Arowojolu, Omotayo A; Orlow, Seth J; Elbuluk, Nada; Manga, Prashiela

2017-07-01

Vitiligo, characterised by progressive melanocyte death, can be initiated by exposure to vitiligo-inducing phenols (VIPs). VIPs generate oxidative stress in melanocytes and activate the master antioxidant regulator NRF2. While NRF2-regulated antioxidants are reported to protect melanocytes from oxidative stress, the role of NRF2 in the melanocyte response to monobenzone, a clinically relevant VIP, has not been characterised. We hypothesised that activation of NRF2 may protect melanocytes from monobenzone-induced toxicity. We observed that knockdown of NRF2 or NRF2-regulated antioxidants NQO1 and PRDX6 reduced melanocyte viability, but not viability of keratinocytes and fibroblasts, suggesting that melanocytes were preferentially dependent upon NRF2 activity for growth compared to other cutaneous cells. Furthermore, melanocytes activated the NRF2 response following monobenzone exposure and constitutive NRF2 activation reduced monobenzone toxicity, supporting NRF2's role in the melanocyte stress response. In contrast, melanocytes from individuals with vitiligo (vitiligo melanocytes) did not activate the NRF2 response as efficiently. Dimethyl fumarate-mediated NRF2 activation protected normal and vitiligo melanocytes against monobenzone-induced toxicity. Given the contribution of oxidant-antioxidant imbalance in vitiligo, modulation of this pathway may be of therapeutic interest. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Ginger Treatment Ameliorates Alcohol-induced Myocardial Damage by Suppression of Hyperlipidemia and Cardiac Biomarkers in Rats.

PubMed

Subbaiah, Ganjikunta Venkata; Mallikarjuna, Korivi; Shanmugam, Bhasha; Ravi, Sahukari; Taj, Patan Usnan; Reddy, Kesireddy Sathyavelu

2017-01-01

Alcohol-induced hyperlipidemia is positively correlated with cardiovascular diseases. Several herbal extracts have been reported to protect the cardiac injury and suppress the hyperlipidemia. However, the effect of ginger extracts on alcohol-induced hyperlipidemia and associated myocardial damage remains unclear. This study investigated the cardio-protective properties of ginger ethanolic extract (Gt) against alcohol-induced myocardial damage, and further distinguished the association between hyperlipidemia and occurrence of myocardial damage in rats. Twenty four Wistar male albino rats (250 ± 20 g) were divided into four groups including, Normal control (NC) (0.9% NaCl), Ginger treated (Gt) (200 mg/Kg b.w.), Alcohol treated (At) (20% of 6g/kg b.w. alcohol), and Alcohol along with Ginger treatment (At+Gt). In this study, lipid profiles such as fatty acids, triglycerides, total cholesterol, phospholipids, low density lipoprotein and high density lipoproteins, and cardiac biomarkers, including LDH, AST, CK-MB, cTn-T and cTn-I were examined in rats. Furthermore, histopathological studies were also conducted. We found that alcohol-induced myocardial damage was associated with increased lipid profile except high density lipoprotein in alcohol treated (20%, 6g/kg b.w.) rats compared with control. Ginger treatment significantly reduced the alcohol-induced lipid profiles except high density lipoproteins. Furthermore, elevated cardiac biomarkers activity with alcohol intoxication was substantially suppressed by ginger treatment. In addition, ginger treatment for 7-weeks significantly minimized the alcohol-induced myocardial damage. Our results concluded that ginger could protect alcohol-induced myocardial damage by suppression of hyperlipidemia and cardiac biomarkers. Ginger extract could alleviate the myocardial injury partially due to the suppression of circulating FFAs and TG levels.Increased circulating cholesterol, LDL and phospholipids with alcohol intake were substantially suppressed by ginger treatmentAlcohol, induced an increase in cardiac damage biomarkers, CK-MB, cTn-T and cTn-I were remarkably suppressed by ginger treatmentPerformed histopathological studies by transmission electron microscopy and light microscopy shows additional convincing evidence on ginger cardio-protective effects. The drastic changes were rehabilitated in cardiac tissue by ginger treatment may be it acts as a good antioxidant and possessing hypolipidemic activity.Collectively, our findings confirm hypothesis that ginger has cardio protective potential through suppression of hyperlipidemia, preserving the tissue damage bio markers, cardiac biomarkers in plasma and preservation of histoarchitecture of myocytes. Abbreviations used: Gt: Ginger Ethanolic Extract; NC: Normal Control; At: Alcohol treated; MI: Myocardial Infarction.

Protective effect of nuclear factor E2-related factor 2 on inflammatory cytokine response to brominated diphenyl ether-47 in the HTR-8/SVneo human first trimester extravillous trophoblast cell line.

PubMed

Park, Hae-Ryung; Loch-Caruso, Rita

2014-11-15

Polybrominated diphenyl ethers (PBDEs) are widely used flame retardants, and BDE-47 is a prevalent PBDE congener detected in human tissues. Exposure to PBDEs has been linked to adverse pregnancy outcomes in humans. Although the underlying mechanisms of adverse birth outcomes are poorly understood, critical roles for oxidative stress and inflammation are implicated. The present study investigated antioxidant responses in a human extravillous trophoblast cell line, HTR-8/SVneo, and examined the role of nuclear factor E2-related factor 2 (Nrf2), an antioxidative transcription factor, in BDE-47-induced inflammatory responses in the cells. Treatment of HTR-8/SVneo cells with 5, 10, 15, and 20μM BDE-47 for 24h increased intracellular glutathione (GSH) levels compared to solvent control. Treatment of HTR-8/SVneo cells with 20μM BDE-47 for 24h induced the antioxidant response element (ARE) activity, indicating Nrf2 transactivation by BDE-47 treatment, and resulted in differential expression of redox-sensitive genes compared to solvent control. Pretreatment with tert-butyl hydroquinone (tBHQ) or sulforaphane, known Nrf2 inducers, reduced BDE-47-stimulated IL-6 release with increased ARE reporter activity, reduced nuclear factor kappa B (NF-κB) reporter activity, increased GSH production, and stimulated expression of antioxidant genes compared to non-Nrf2 inducer pretreated groups, suggesting that Nrf2 may play a protective role against BDE-47-mediated inflammatory responses in HTR-8/SVneo cells. These results suggest that Nrf2 activation significantly attenuated BDE-47-induced IL-6 release by augmentation of cellular antioxidative system via upregulation of Nrf2 signaling pathways, and that Nrf2 induction may be a potential therapeutic target to reduce adverse pregnancy outcomes associated with toxicant-induced oxidative stress and inflammation. Copyright © 2014 Elsevier Inc. All rights reserved.

Aryl Hydrocarbon Receptor Protects Lungs from Cockroach Allergen-Induced Inflammation by Modulating Mesenchymal Stem Cells.

PubMed

Xu, Ting; Zhou, Yufeng; Qiu, Lipeng; Do, Danh C; Zhao, Yilin; Cui, Zhuang; Wang, Heng; Liu, Xiaopeng; Saradna, Arjun; Cao, Xu; Wan, Mei; Gao, Peisong

2015-12-15

Exposure to cockroach allergen leads to allergic sensitization and increased risk of developing asthma. Aryl hydrocarbon receptor (AhR), a receptor for many common environmental contaminants, can sense not only environmental pollutants but also microbial insults. Mesenchymal stem cells (MSCs) are multipotent progenitor cells with the capacity to modulate immune responses. In this study, we investigated whether AhR can sense cockroach allergens and modulate allergen-induced lung inflammation through MSCs. We found that cockroach allergen-treated AhR-deficient (AhR(-/-)) mice showed exacerbation of lung inflammation when compared with wild-type (WT) mice. In contrast, 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), an AhR agonist, significantly suppressed allergen-induced mouse lung inflammation. MSCs were significantly reduced in cockroach allergen-challenged AhR(-/-) mice as compared with WT mice, but increased in cockroach allergen-challenged WT mice when treated with TCDD. Moreover, MSCs express AhR, and AhR signaling can be activated by cockroach allergen with increased expression of its downstream genes cyp1a1 and cyp1b1. Furthermore, we tracked the migration of i.v.-injected GFP(+) MSCs and found that cockroach allergen-challenged AhR(-/-) mice displayed less migration of MSCs to the lungs compared with WT. The AhR-mediated MSC migration was further verified by an in vitro Transwell migration assay. Epithelial conditioned medium prepared from cockroach extract-challenged epithelial cells significantly induced MSC migration, which was further enhanced by TCDD. The administration of MSCs significantly attenuated cockroach allergen-induced inflammation, which was abolished by TGF-β1-neutralizing Ab. These results suggest that AhR plays an important role in protecting lungs from allergen-induced inflammation by modulating MSC recruitment and their immune-suppressive activity. Copyright © 2015 by The American Association of Immunologists, Inc.

A randomized study to assess the efficacy of herbal product to prevent cisplatin-induced nephrotoxicity in a rat model.

PubMed

Kucuk, Eyup Veli; Bindayi, Ahmet; Mese, Meral; Gulcu Bulmus, Funda; Parmaksiz, Ergun; Cetinel, Ali Cihangir; Bicik Bahcebasi, Zerrin; Sarica, Kemal

2017-10-03

This study aimed to investigate the protective effect and antioxidant activity of an herbal product that made from multiple plants in a rat model of kidney dysfunction induced by intraperitoneal cisplatin. Twenty-four rats were divided into four different groups namely: Group 1 - control healthy animals without any specific medication, Group 2 - Herbal product only 5 mg/kg, Group 3 - cisplatin only and Group 4 - Herbal product 5 mg/kg + cisplatin. Evaluation of our findings demonstrated a significant (p = 0.017) reduction in Catalase activities and a significant increase (p = 0.001) in renal tissue Malondialdehyde levels in cisplatin- treated rats when compared with the control group. Also, Glutathion and Glutathione peroxidase content revealed significant (p = 0.031) reduction in renal tissues of cisplatintreated rats compared with the control group. Pre-treatment of rats with the herbal product ameliorated these cisplatininduced changes of the antioxidant enzymes. No statistically significant changes were demonstrated in Superoxide dismutase activities in the tissue specimens of any group. This potent antioxidant herbal medicine was found to have potential antioxidant activity, which may in turn to be effective in the protection of kidney tissue resulting from cisplatin application. Therefore, much attention should be given to the possible role of natural dietary antioxidants for protecting the kidney.

Protective effect of Opuntia ficus indica f. inermis prickly pear juice upon ethanol-induced damages in rat erythrocytes.

PubMed

Alimi, Hichem; Hfaeidh, Najla; Bouoni, Zouhour; Sakly, Mohsen; Ben Rhouma, Khémais

2012-05-01

Juice from the fruit of the cactus Opuntia ficus indica is claimed to possess several health-beneficial properties. The present study was carried out to determine whether O. ficus indica f. inermis fruit extract might have a protective effect upon physiological and morphological damages inflicted to erythrocytes membrane by chronic ethanol poisoning, per os, in rat. Chemical analysis of the extract revealed the presence of polyphenols, flavonoids, ascorbic acid, carotenoids, and betalains. Ethanol administration (3 g/kg b.w, per day for 90 days) induced an increase of malondialdehyde (MDA) and carbonylated proteins levels and a decrease of glutathione (GSH) level in erythrocyte. Ethanol administration also reduced the scavenging activity in plasma and enhanced erythrocytes hemolysis, as compared to control rats. In addition, ethanol intake increased the erythrocyte shape index by +895.5% and decreased the erythrocyte diameter by -61.53% as compared to controls. In animals also given prickly pear juice during the same experimental period, the studied parameters were much less shifted. This protective effect was found to be dose-dependent. It is likely that the beneficial effect of the extract is due to the high content of antioxidant compounds. Copyright © 2012 Elsevier Inc. All rights reserved.

A Comparative Study of Cyclic Oxidation and Sulfates-Induced Hot Corrosion Behavior of Arc-Sprayed Ni-Cr-Ti Coatings at Moderate Temperatures

NASA Astrophysics Data System (ADS)

Guo, Wenmin; Wu, Yuping; Zhang, Jianfeng; Hong, Sheng; Chen, Liyan; Qin, Yujiao

2015-06-01

The cyclic oxidation and sulfates-induced hot corrosion behaviors of a Ni-43Cr-0.3Ti arc-sprayed coating at 550-750 °C were characterized and compared in this study. In general, all the oxidation and hot corrosion kinetic curves of the coating followed a parabolic law, i.e., the weight of the specimens showed a rapid growth initially and then reached the gradual state. However, the initial stage of the hot corrosion process was approximately two times longer than that of the oxidation process, indicating a longer preparation time required for the formation of a protective scale in the former process. At 650 °C, the parabolic rate constant for the hot corrosion was 7.2 × 10-12 g2/(cm4·s), approximately 1.7 times higher than that for the oxidation at the same temperature. The lower parabolic rate constant for the oxidation was mainly attributed to the formation of a protective oxide scale on the surface of corroded specimens, which was composed of a mixture of NiO, Cr2O3, and NiCr2O4. However, as the liquid molten salts emerged during the hot corrosion, these protective oxides would be dissolved and the coating was corrupted acceleratedly.

Effects of ovariectomy and intrinsic aerobic capacity on tissue-specific insulin sensitivity

PubMed Central

Park, Young-Min; Rector, R. Scott; Thyfault, John P.; Zidon, Terese M.; Padilla, Jaume; Welly, Rebecca J.; Meers, Grace M.; Morris, Matthew E.; Britton, Steven L.; Koch, Lauren G.; Booth, Frank W.; Kanaley, Jill A.

2015-01-01

High-capacity running (HCR) rats are protected against the early (i.e., ∼11 wk postsurgery) development of ovariectomy (OVX)-induced insulin resistance (IR) compared with low-capacity running (LCR) rats. The purpose of this study was to utilize the hyperinsulinemic euglycemic clamp to determine whether 1) HCR rats remain protected from OVX-induced IR when the time following OVX is extended to 27 wk and 2) tissue-specific glucose uptake differences are responsible for the protection in HCR rats under sedentary conditions. Female HCR and LCR rats (n = 40; aged ∼22 wk) randomly received either OVX or sham (SHM) surgeries and then underwent the clamp 27 wk following surgeries. [3-3H]glucose was used to determine glucose clearance, whereas 2-[14C]deoxyglucose (2-DG) was used to assess glucose uptake in skeletal muscle, brown adipose tissue (BAT), subcutaneous white adipose tissue (WAT), and visceral WAT. OVX decreased the glucose infusion rate and glucose clearance in both lines, but HCR had better insulin sensitivity than LCR (P < 0.05). In both lines, OVX significantly reduced glucose uptake in soleus and gastrocnemius muscles; however, HCR showed ∼40% greater gastrocnemius glucose uptake compared with LCR (P < 0.05). HCR also exhibited greater glucose uptake in BAT and visceral WAT compared with LCR (P < 0.05), yet these tissues were not affected by OVX in either line. In conclusion, OVX impairs insulin sensitivity in both HCR and LCR rats, likely driven by impairments in insulin-mediated skeletal muscle glucose uptake. HCR rats have greater skeletal muscle, BAT, and WAT insulin-mediated glucose uptake, which may aid in protection against OVX-associated insulin resistance. PMID:26646101

Plasma Rich in Growth Factors Enhances Wound Healing and Protects from Photo-oxidative Stress in Dermal Fibroblasts and 3D Skin Models.

PubMed

Anitua, Eduardo; Pino, Ander; Jaen, Pedro; Orive, Gorka

2016-01-01

Optimal skin repair has been a desired goal for many researchers. Recently, plasma rich in growth factors (PRGF) has gained importance in dermatology proving it is beneficial effects in wound healing and cutaneous regeneration. The anti-fibrotic, pro-contractile and photo-protective effect of PRGF on dermal fibroblasts and 3D skin models has been evaluated. The effect against TGFβ1 induced myofibroblast differentiation was tested. Cell contractile activity over collagen gel matrices was analyzed and the effect against UV derived photo-oxidative stress was assessed. The effectiveness of PRGF obtained from young aged and middle aged donors was compared. Furthermore, 3D organotypic skin explants were used as human skin models with the aim of analyzing ex vivo cutaneous preventive and regenerative photo-protection after UV exposure. TGFβ1 induced myofibroblast levels decreased significantly after treatment with PRGF while the contractile activity increased compared to the control group. After UV irradiation, cell survival was promoted while apoptotic and ROS levels were noticeably reduced. Photo-exposed 3D explants showed higher levels of metabolic activity and lower levels of necrosis, cell damage, irritation and ROS formation when treated with PRGF. The histological integrity and connective tissue fibers showed lower signals of photodamage among PRGF injected skin models. No significant differences for the assessed biological outcomes were observed when PRGF obtained from young aged and middle aged donors were compared. These findings suggest that this autologous approach might be useful for antifibrotic wound healing and provide an effective protection against sun derived photo-oxidative stress regardless the age of the patient.

Relative Contribution of Th1 and Th17 Cells in Adaptive Immunity to Bordetella pertussis: Towards the Rational Design of an Improved Acellular Pertussis Vaccine

PubMed Central

Ross, Pádraig J.; Allen, Aideen C.; Walsh, Kevin; Misiak, Alicja; Lavelle, Ed C.; McLoughlin, Rachel M.; Mills, Kingston H. G.

2013-01-01

Whooping cough caused by Bordetella pertussis is a re-emerging infectious disease despite the introduction of safer acellular pertussis vaccines (Pa). One explanation for this is that Pa are less protective than the more reactogenic whole cell pertussis vaccines (Pw) that they replaced. Although Pa induce potent antibody responses, and protection has been found to be associated with high concentrations of circulating IgG against vaccine antigens, it has not been firmly established that host protection induced with this vaccine is mediated solely by humoral immunity. The aim of this study was to examine the relative contribution of Th1 and Th17 cells in host immunity to infection with B. pertussis and in immunity induced by immunization with Pw and Pa and to use this information to help rationally design a more effective Pa. Our findings demonstrate that Th1 and Th17 both function in protective immunity induced by infection with B. pertussis or immunization with Pw. In contrast, a current licensed Pa, administered with alum as the adjuvant, induced Th2 and Th17 cells, but weak Th1 responses. We found that IL-1 signalling played a central role in protective immunity induced with alum-adsorbed Pa and this was associated with the induction of Th17 cells. Pa generated strong antibody and Th2 responses, but was fully protective in IL-4-defective mice, suggesting that Th2 cells were dispensable. In contrast, Pa failed to confer protective immunity in IL-17A-defective mice. Bacterial clearance mediated by Pa-induced Th17 cells was associated with cell recruitment to the lungs after challenge. Finally, protective immunity induced by an experimental Pa could be enhanced by substituting alum with a TLR agonist that induces Th1 cells. Our findings demonstrate that alum promotes protective immunity through IL-1β-induced IL-17A production, but also reveal that optimum protection against B. pertussis requires induction of Th1, but not Th2 cells. PMID:23592988

Differential gene expression during early embryonic development in diapause and non-diapause eggs of multivoltine silkworm Bombyx mori.

PubMed

Ponnuvel, Kangayam M; Murthy, Geetha N; Awasthi, Arvind K; Rao, Guruprasad; Vijayaprakash, Nanjappa B

2010-11-01

Quantification of the differential expression of metabolic enzyme and heat-shock protein genes (Hsp) during early embryogenesis in diapause and non-diapause eggs of the silkworm B. mori was carried out by semi-quantitative RT-PCR. Data analysis revealed that, the phosphofructokinase (PFK) expression started at a higher level in the early stage (6 h after oviposition) in non-diapause eggs, while in diapause induced eggs, it started at a lower level. However, the PFK gene expression in diapause eggs was comparatively higher than in non-diapause eggs. PFK facilitates use of carbohydrate reserves. The lower level of PFK gene expression in the early stage of diapause induced eggs but comparatively higher level of expression than in non-diapause eggs is due to enzyme inactivation via protein phosphorylation during early embryogenesis followed by de-phosphorylation in later stage. The sorbitol dehydrogenase-2 (SDH-2) gene was down regulated in diapause induced eggs up to 24 h and its expression levels in diapause induced eggs coincided with that of PFK gene at 48h in non-diapause eggs. During carbohydrate metabolism, there is an initial temporary accumulation of sorbitol which acts as protectant. The down regulation of SDH-2 gene during the first 24 hours in diapause induced eggs was due to the requirement of sorbitol as protectant. However, since the diapause process culminates by 48 h, the SDH-2 gene expression increased and coincided with that of PFK gene expression. The trehalase (Tre) gene expression was at a lower level in diapause induced eggs compared to non-diapausing eggs. The induction of Tre activity is to regulate uptake and use of sugar by the tissues. The non-diapause eggs revealed maximum expression of GPase gene with major fluctuations as well as an overall higher expression compared to diapause induced eggs. The diapause process requires less energy source which reflects lower activity of the gene. Heat shock protein (Hsp) genes (Hsp20.4, 40, 70, and 90) revealed differential levels of expression in both the eggs at all stages of embryonic development. The present study thus provides an overview of the differential expression levels of metabolic enzyme and Hsp genes in non-diapause and diapause induced eggs of multivoltine silkworm B. mori within 48 h after oviposition, confirming the major role of in early embryogenesis.

Light-Induced Retinopathy: Young Age Protects more than Ocular Pigmentation.

PubMed

Polosa, Anna; Bessaklia, Hyba; Lachapelle, Pierre

2017-06-01

The purpose of this study was to compare the efficacy that ocular melanin confers in protecting the retina of juvenile and adult rats exposed to a bright luminous environment. Juvenile (JLE) and adult (ALE) Long-Evans pigmented rats were thus exposed to a bright cyclic light (10,000lux; white light) from postnatal day 14-28 or for 6 consecutive days, respectively. Flash electroretinograms (ERG) and retinal histology were performed at different predetermined ages, post-light exposure. Despite a significant reduction in ERG responses immediately following light exposure, with time, retinal function fully recovered in JLE compared to a 54% recovery for the ALE. In ALE, we noted a region of the supero-temporal quadrant that was highly vulnerable to light damage. This region was also devoid of melanin granules prior to the light exposure. This melanin-free zone increased in size in the days that followed the end of exposure, a process that was accompanied by the gradual degeneration of the thus uncovered photoreceptors. In contrast, melanin and photoreceptor losses were minimal in JLE. Our results suggest that the light-induced photoreceptor degeneration in ALE would be secondary to the initial destruction of the RPE and ensuing loss of melanin protection. In contrast, the melanin granules of JLE appear to be significantly more resistant to light damage, a characteristic that would explain the higher resistance of JLE photoreceptors to light damage. Our results would thus suggest that the efficacy of ocular melanin protection against light damage declines with age.

Protective effect of dammarane sapogenins against chemotherapy-induced myelosuppression in mice.

PubMed

Yang, Yanyan; Xu, Shuping; Xu, Qiuxia; Liu, Xinmin; Gao, Yue; Steinmetz, Andre; Wang, Ning; Wang, Tianshan; Qiu, Guosong

2011-06-01

Chemotherapy is the most common way to treat malignancies, but myelosuppression, one of its common side-effects, is a formidable problem. The present study described the protective role of dammarane sapogenins (DS), an active fraction from oriental ginseng, on myelosuppression induced by cyclophosphamide (CP) in mice. DS was orally administered at different dosages (37.5, 75, and 150 mg/kg) for 10 d after CP administration (200 mg/kg intraperitoneally). The results showed that DS increased the number of white blood cells (WBC) on day 3 and day 7 (P < 0.05), such that WBC levels were increased by 105.7 ± 29.5% at 75 mg/kg of DS on day 3 (P < 0.05, compared with the CP group). Similar results were observed in red blood cells and platelets in DS-treated groups. The colony-forming assay demonstrated that the depressed numbers of CFU-GM (colony-forming unit-granulocyte and macrophage), CFU-E (colony-forming unit-erythroid), BFU-E (burst-forming unit-erythroid), CFU-Meg (colony-forming unit-megakaryocyte) and CFU-GEMM (colony-forming unit-granulocyte, -erythrocyte, -monocyte and -megakaryocyte) induced by CP were significantly reversed after DS treatment. Moreover, the ameliorative effect of DS on myelosuppression was also observed in the femur by hematoxylin/eosin staining. In DS-treated groups, ConA-induced splenocyte proliferation was enhanced significantly at all the doses (37.5, 75, 150 mg/kg) on day 3 at the rate of 50.3 ± 8.0%, 77.6 ± 8.5% and 44.5 ± 8.4%, respectively, while lipopolysaccharide-induced proliferation was increased mainly on day 7 (P < 0.01), with an increased rate of 39.8 ± 5.6%, 34.9 ± 6.6% and 38.3 ± 7.3%, respectively. The thymus index was also markedly increased by 70.4% and 36.6% at 75 mg/kg on days 3 and 7, respectively, as compared with the CP group. In summary, DS has a protective function against CP-induced myelosuppression. Its mechanism might be related to stimulating hematopoiesis recovery, as well as enhancing the immunological function.

Chlamydial Pre-Infection Protects from Subsequent Herpes Simplex Virus-2 Challenge in a Murine Vaginal Super-Infection Model

PubMed Central

Slade, Jessica; Hall, Jennifer V.; Kintner, Jennifer; Schoborg, Robert V.

2016-01-01

Chlamydia trachomatis and Herpes Simplex Virus-2 (HSV-2) genital tract co-infections have been reported in humans and studied in vitro but the clinical consequences are unknown. Limited epidemiologic evidence suggests that these co-infections could be more severe than single infections of either pathogen, but the host-pathogen interactions during co-infection remain uncharacterized. To determine whether disease progression and/or pathogen shedding differs between singly-infected and super-infected animals, we developed an in vivo super-infection model in which female BALB/c mice were vaginally infected with Chlamydia muridarum (Cm) followed later by HSV-2. Pre-infection with Chlamydia 3 or 9 days prior to HSV-2 super-infection conferred significant protection from HSV-2-induced neurologic disease and significantly reduced viral recovery compared to HSV-2 singly-infected controls. Neither protection from mortality nor reduced viral recovery were observed when mice were i) super-infected with HSV-2 on day 27 post Cm; ii) infected with UV-irradiated Cm and super-infected with HSV-2; or iii) azithromycin-treated prior to HSV-2 super-infection. Therefore, protection from HSV-2-induced disease requires active infection with viable chlamydiae and is not observed after chlamydial shedding ceases, either naturally or due to antibiotic treatment. Thus, Chlamydia-induced protection is transient and requires the continued presence of chlamydiae or their components. These data demonstrate that chlamydial pre-infection can alter progression of subsequent HSV-2 infection, with implications for HSV-2 transmission from co-infected humans. PMID:26726882

Comparison of selected canine vaccines for their ability to induce protective immunity against canine parvovirus infection.

PubMed

Larson, L J; Schultz, R D

1997-04-01

To compare the ability of 6 commercially available multicomponent canine vaccines to stimulate antibody production in pups with variable amounts of maternally derived canine parvovirus (CPV) antibody and to induce protective immunity against challenge exposure. Sixty-three 5- to 6-week-old Beagle pups with passively acquired CPV antibody titer between 1: 20 and 1:320. 9 pups were assigned to each of 6 vaccine groups and 1 control group. Eight pups in each group were inoculated with vaccine or saline solution twice, with 3 weeks between administrations. The ninth pup served as an uninoculated contact control. Serum samples were obtained weekly and tested for CPV antibody by hemagglutination-inhibition assay. All pups were challenge exposed with virulent CPV-2a and CPV-2b at 14 to 15 weeks of age. 3 of the vaccines failed to provide protective immunity against challenge exposure because all pups in these groups became infected and most died. A fourth vaccine protected against death, but not infection and disease. Two of the 6 vaccines induced an immune response that was protective against infection and disease. Substantial differences existed among commercial vaccines available in 1994 in their ability to immunize pups with maternally derived CPV antibody. These differences caused many vaccinated pups to be susceptible to CPV disease for variable periods because some vaccines failed to immunize. Importantly, all 4 of the vaccines that performed poorly have recently been replaced by more effective products so that the 6 vaccines now perform similarly.

CD4+ T-Cell- and Gamma Interferon-Dependent Protection against Murine Malaria by Immunization with Linear Synthetic Peptides from a Plasmodium yoelii 17-Kilodalton Hepatocyte Erythrocyte Protein

PubMed Central

Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.

1999-01-01

Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206

Vaccine protection of chickens against antigenically diverse H5 highly pathogenic avian influenza isolates with a live HVT vector vaccine expressing the influenza hemagglutinin gene derived from a clade 2.2 avian influenza virus.

PubMed

Kapczynski, Darrell R; Esaki, Motoyuki; Dorsey, Kristi M; Jiang, Haijun; Jackwood, Mark; Moraes, Mauro; Gardin, Yannick

2015-02-25

Vaccination is an important tool in the protection of poultry against avian influenza (AI). For field use, the overwhelming majority of AI vaccines produced are inactivated whole virus formulated into an oil emulsion. However, recombinant vectored vaccines are gaining use for their ability to induce protection against heterologous isolates and ability to overcome maternal antibody interference. In these studies, we compared protection of chickens provided by a turkey herpesvirus (HVT) vector vaccine expressing the hemagglutinin (HA) gene from a clade 2.2 H5N1 strain (A/swan/Hungary/4999/2006) against homologous H5N1 as well as heterologous H5N1 and H5N2 highly pathogenic (HP) AI challenge. The results demonstrated all vaccinated birds were protected from clinical signs of disease and mortality following homologous challenge. In addition, oral and cloacal swabs taken from challenged birds demonstrated that vaccinated birds had lower incidence and titers of viral shedding compared to sham-vaccinated birds. Following heterologous H5N1 or H5N2 HPAI challenge, 80-95% of birds receiving the HVT vector AI vaccine at day of age survived challenge with fewer birds shedding virus after challenge than sham vaccinated birds. In vitro cytotoxicity analysis demonstrated that splenic T lymphocytes from HVT-vector-AI vaccinated chickens recognized MHC-matched target cells infected with H5, as well as H6, H7, or H9 AI virus. Taken together, these studies provide support for the use of HVT vector vaccines expressing HA to protect poultry against multiple lineages of HPAI, and that both humoral and cellular immunity induced by live vaccines likely contributes to protection. Published by Elsevier Ltd.

[Experimental study on the chitosan-DNA vaccines against campylobacter jejuni invasion].

PubMed

Zheng, Hui; Cai, Fang-cheng; Zhong, Min; Deng, Bing; Li, Xin; Zhang, Xiao-ping

2007-09-01

The immunogenicity and protective efficacy of an experimental Campylobacter jejuni (C. jejuni) chitosan-DNA vaccines were evaluated in mice. The chitosan-DNA vaccines were prepared by embedding pcDNA3.1(+)-cadF and pcDNA3.1(+)-peblA with chitosan respectively. BALB/c mice were intranasally immunized in a four-dose primary series (7 d intervals) at doses of 60 microg chitosan-DNA vaccines each time. The comparative immunogenicities of nine formulations were assessed on the basis of the generation of antigen-specific antibodies in serum and intestinal secretions. Mice were attacked repeatedly through intragastric administration of C. jejuni HS:19 at the 8th week after the immunization and protective efficacy was determined by detecting the degrees of protection afforded against C. jejuni invaded. The mice immunized with chitosan-DNA vaccines have generated high levels of IgA and IgG from the sera and IgA from the intestinal secretions and the P/N value went up to 20.58, 30.13 and 6.87 respectively. Meanwhile, the expression of intestinal SIgA increased correspondingly. Moreover the chitosan-DNA vaccines induced strongest level of protection in BALB/c mice against challenge with C. jejuni HS:19 strain and the protective efficacies was 93.70. The results of this study indicate that the chitosan-DNA vaccines could induce significant protective immunity against C. jejuni challenge in the mice model.

Evaluation of recombinant adenovirus vaccines based on glycoprotein D and truncated UL25 against herpes simplex virus type 2 in mice.

PubMed

Liu, Wei; Zhou, Yan; Wang, Ziyan; Zhang, Zeqiang; Wang, Qizhi; Su, Weiheng; Chen, Yan; Zhang, Yan; Gao, Feng; Jiang, Chunlai; Kong, Wei

2017-05-01

The high prevalence of herpes simplex virus 2 (HSV-2) infections in humans necessitates the development of a safe and effective vaccine that will need to induce vigorous T-cell responses to control viral infection and transmission. We designed rAd-gD2, rAd-gD2ΔUL25, and rAd-ΔUL25 to investigate whether recombinant replication-defective adenoviruses vaccine could induce specific T-cell responses and protect mice against intravaginal HSV-2 challenge compared with FI-HSV-2. In the present study, recombinant adenovirus-based HSV-2 showed higher reductions in mortality and stronger antigen-specific T-cell responses compared with FI-HSV-2 and the severity of genital lesions in mice immunized with rAd-gD2ΔUL25 was significantly decreased by eliciting IFN-γ-secreting T-cell responses compared with rAd-gD2 and rAd-ΔUL25 groups. Our results demonstrated the immunogenicity and protective efficacy of recombinant adenovirus vaccines in acute HSV-2 infection following intravaginal challenge in mice. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Radioprotective Role in Lung of the Flaxseed Lignan Complex Enriched in the Phenolic Secoisolariciresinol Diglucoside (SDG)

PubMed Central

Christofidou-Solomidou, Melpo; Tyagi, Sonia; Pietrofesa, Ralph; Dukes, Floyd; Arguiri, Evguenia; Turowski, Jason; Grieshaber, Philip A.; Solomides, Charalambos C.; Cengel, Keith A.

2012-01-01

While dietary wholegrain Flaxseed (FS) has potent anti-inflammatory, anti-fibrotic and antioxidant properties in murine models of acute and chronic lung injury, the main bioactive ingredient that contributes to these protective effects remains unknown. This study evaluated the lignan complex of FS (FLC) enriched in secoisolariciresinol diglucoside with respect to lung radioprotective and tumor radiosensitizing efficacy using a mouse model of thoracic radiation-induced pneumonopathy. C57/Bl6 mice were fed 0% FS, 10% FS, 10% FLC or 20% FLC for 3 weeks, then irradiated with a single fraction (13.5 Gy) of X-ray radiation treatment (XRT). Mouse survival was monitored for 4 months after irradiation and inflammatory lung parameters were evaluated in bronchoalveolar lavage (BAL) fluid. Gene and protein levels of protective antioxidant and phase II enzymes were evaluated in lung tissue using qPCR and protein levels were verified by immunoblotting. Prolonged administration of the FLC diet was well tolerated and was not associated with any toxicity. Importantly, comparable to the whole grain 10% FS diet, irradiated mice fed 10% and 20% FLC diets displayed improved survival. Improved hemodynamic measurements were also recorded in irradiated mice fed 10% FS or 10% FLC diet compared to irradiated 0% FS fed mice. Flaxseed lignan complex diet also attenuated polymorphonuclear infiltration and overall lung inflammation to levels comparable to those in nonirradiated mice. Flaxseed lignan complex, similarly to FS, up-regulated gene expression as well as protein levels of protective antioxidant enzymes such as heme oxygenase-1 (HO-1) and NAD(P)H quinone oxidoreductase 1 (NQO1). Dietary FLC induced radiosensitizing effects in our murine model of metastatic lung cancer. Importantly, protection of normal tissue does not thwart tumor cell death by radiation treatment. The dietary lignan complex of FS, mainly consisting of the phenolic secoisolariciresinol, is protective against radiation pneumonopathy in vivo while not hindering the tumoricidal effects of radiotherapy. PMID:23106213

Vaccination of cattle with Mycobacterium bovis BCG by a combination of systemic and oral routes.

PubMed

Buddle, Bryce M; Denis, Michel; Aldwell, Frank E; Martin Vordermeier, H; Glyn Hewinson, R; Neil Wedlock, D

2008-11-01

Mycobacterium bovis bacille Calmette-Guérin (BCG) vaccine delivered to calves by the subcutaneous (s.c.) or by the oral route in a formulated lipid matrix has been previously shown to induce similar levels of protection against bovine tuberculosis. The current study was aimed at determining whether a combination of delivering BCG by s.c. and oral routes would enhance levels of protection, compared to only one route of vaccination. Forty calves were randomly divided into four groups (10/group). Calves were vaccinated with 10(6)colony forming units (CFU) of BCG Pasteur by the s.c. route or orally with 10(9)CFU BCG incorporated into a lipid formulation. One group received a combination of BCG administered by both the s.c. and oral routes and a non-vaccinated group served as a control. The two groups of calves that received s.c. BCG produced strong IFN-gamma responses in whole blood cultures stimulated with bovine purified protein derivative (PPD) 3 weeks after vaccination. Cattle vaccinated just with oral BCG in a lipid matrix produced a strong IFN-gamma response 8 weeks after vaccination, and peaking at 11 weeks after vaccination. All calves were challenged by the intratracheal route with M. bovis 15 weeks after vaccination and were euthanized and necropsied to assess protection at 17 weeks following challenge. BCG given s.c. or orally induced significant and comparable levels of protection against the virulent challenge. Vaccination of cattle by a combination of s.c./oral routes did not enhance protection beyond that achieved by s.c. or oral vaccination alone. We conclude that vaccination of cattle with BCG by a combination of routes has no beneficial additive effects, compared to a single s.c. administration of BCG or BCG given orally in a lipid formulation.

Radioprotective role in lung of the flaxseed lignan complex enriched in the phenolic secoisolariciresinol diglucoside (SDG).

PubMed

Christofidou-Solomidou, Melpo; Tyagi, Sonia; Pietrofesa, Ralph; Dukes, Floyd; Arguiri, Evguenia; Turowski, Jason; Grieshaber, Philip A; Solomides, Charalambos C; Cengel, Keith A

2012-12-01

While dietary wholegrain Flaxseed (FS) has potent anti-inflammatory, anti-fibrotic and antioxidant properties in murine models of acute and chronic lung injury, the main bioactive ingredient that contributes to these protective effects remains unknown. This study evaluated the lignan complex of FS (FLC) enriched in secoisolariciresinol diglucoside with respect to lung radioprotective and tumor radiosensitizing efficacy using a mouse model of thoracic radiation-induced pneumonopathy. C57/Bl6 mice were fed 0% FS, 10% FS, 10% FLC or 20% FLC for 3 weeks, then irradiated with a single fraction (13.5 Gy) of X-ray radiation treatment (XRT). Mouse survival was monitored for 4 months after irradiation and inflammatory lung parameters were evaluated in bronchoalveolar lavage (BAL) fluid. Gene and protein levels of protective antioxidant and phase II enzymes were evaluated in lung tissue using qPCR and protein levels were verified by immunoblotting. Prolonged administration of the FLC diet was well tolerated and was not associated with any toxicity. Importantly, comparable to the whole grain 10% FS diet, irradiated mice fed 10% and 20% FLC diets displayed improved survival. Improved hemodynamic measurements were also recorded in irradiated mice fed 10% FS or 10% FLC diet compared to irradiated 0% FS fed mice. Flaxseed lignan complex diet also attenuated polymorphonuclear infiltration and overall lung inflammation to levels comparable to those in nonirradiated mice. Flaxseed lignan complex, similarly to FS, up-regulated gene expression as well as protein levels of protective antioxidant enzymes such as heme oxygenase-1 (HO-1) and NAD(P)H quinone oxidoreductase 1 (NQO1). Dietary FLC induced radiosensitizing effects in our murine model of metastatic lung cancer. Importantly, protection of normal tissue does not thwart tumor cell death by radiation treatment. The dietary lignan complex of FS, mainly consisting of the phenolic secoisolariciresinol, is protective against radiation pneumonopathy in vivo while not hindering the tumoricidal effects of radiotherapy.

Identical genomic footprints of the adenovirus EIIa promoter are detected before and after EIa induction.

PubMed Central

Devaux, B; Albrecht, G; Kedinger, C

1987-01-01

Genomic DNase I footprinting was used to compare specific protein binding to the adenovirus type 5 early, EIa-inducible, EIIa promoter. Identical protection patterns of the promoter region were observed whether EIIa transcription was undetectable or fully induced. These results suggest that EIa-mediated transcriptional induction does not increase binding of limiting transcription factors to the promoter but rather that transactivation results from the proper interactions between factors already bound to their cognate sequences. Images PMID:2963956

Dietary Approaches to Protect Against Eye Blast Induced Oxidative Stress and Vision Loss

DTIC Science & Technology

2016-11-01

supplementation of antioxidants and antioxidant enzymes. The ultimate goal of this study was to identify a dietary intervention that could protect...AWARD NUMBER: W81XWH-15-1-0096 TITLE: Dietary Approaches to Protect Against Eye Blast-Induced Oxidative Stress and Vision Loss PRINCIPAL...TITLE AND SUBTITLE 5a. CONTRACT NUMBER Dietary Approaches to Protect Against Eye Blast-Induced Oxidative Stress and Vision Loss 5b. GRANT NUMBER

Neuroprotective Effect of a New Synthetic Aspirin-decursinol Adduct in Experimental Animal Models of Ischemic Stroke

PubMed Central

Shin, Bich Na; Ahn, Ji Hyeon; Kim, In Hye; Lee, Jae-Chul; Yoo, Ki-Yeon; Hwang, In Koo; Choi, Jung Hoon; Park, Jeong Ho; Lee, Yun Lyul; Suh, Hong-Won; Jun, Jong-Gab; Kwon, Young-Guen; Kim, Young-Myeong; Kwon, Seung-Hae; Her, Song; Kim, Jin Su; Hyun, Byung-Hwa; Kim, Chul-Kyu; Cho, Jun Hwi; Lee, Choong Hyun; Won, Moo-Ho

2013-01-01

Stroke is the second leading cause of death. Experimental animal models of cerebral ischemia are widely used for researching mechanisms of ischemic damage and developing new drugs for the prevention and treatment of stroke. The present study aimed to comparatively investigate neuroprotective effects of aspirin (ASA), decursinol (DA) and new synthetic aspirin-decursinol adduct (ASA-DA) against transient focal and global cerebral ischemic damage. We found that treatment with 20 mg/kg, not 10 mg/kg, ASA-DA protected against ischemia-induced neuronal death after transient focal and global ischemic damage, and its neuroprotective effect was much better than that of ASA or DA alone. In addition, 20 mg/kg ASA-DA treatment reduced the ischemia-induced gliosis and maintained antioxidants levels in the corresponding injury regions. In brief, ASA-DA, a new synthetic drug, dramatically protected neurons from ischemic damage, and neuroprotective effects of ASA-DA may be closely related to the attenuation of ischemia-induced gliosis and maintenance of antioxidants. PMID:24073226

A study on effects of glutathione s-transferase from silkworm on CCL4-induced mouse liver injury.

PubMed

Yan, Hui; Gui, Zhongzheng; Wang, Bochu

2011-01-01

To assess the hepatoprotective activity of Glutathione S-transferase(GSTsw), extracted and purified from silkworm, in experimental acute mice liver injury and explore mechanisms. Mice were divided into five groups: control group, carbon tetrachloride (CCl4) group, and three treatment groups that received CCl4 and GSTsw at doses of 0.083 mg•g(-1), 0.0415 mg•g(-1) and 0.0207 mg•g(-1) for 3 days. ALT in serum, GST, SOD and T-AOC in liver tissue homogenate, and changes in liver pathology in the five groups were studied. CCl4 administration led to pathological and biochemical evidence of liver injury as compared to untreated controls. GSTsw administration led to significant protection against CCl4-induced changes in liver pathology. It was also associatedwith significantly lower serum ALT levels, higher GST-SOD and T-AOC level in live tissue homogenate. Thus, GSTsw showed protective activity against CCl4-induced hepatotoxicity in mice.

Neuroprotective effect of a new synthetic aspirin-decursinol adduct in experimental animal models of ischemic stroke.

PubMed

Yan, Bing Chun; Park, Joon Ha; Shin, Bich Na; Ahn, Ji Hyeon; Kim, In Hye; Lee, Jae-Chul; Yoo, Ki-Yeon; Hwang, In Koo; Choi, Jung Hoon; Park, Jeong Ho; Lee, Yun Lyul; Suh, Hong-Won; Jun, Jong-Gab; Kwon, Young-Guen; Kim, Young-Myeong; Kwon, Seung-Hae; Her, Song; Kim, Jin Su; Hyun, Byung-Hwa; Kim, Chul-Kyu; Cho, Jun Hwi; Lee, Choong Hyun; Won, Moo-Ho

2013-01-01

Stroke is the second leading cause of death. Experimental animal models of cerebral ischemia are widely used for researching mechanisms of ischemic damage and developing new drugs for the prevention and treatment of stroke. The present study aimed to comparatively investigate neuroprotective effects of aspirin (ASA), decursinol (DA) and new synthetic aspirin-decursinol adduct (ASA-DA) against transient focal and global cerebral ischemic damage. We found that treatment with 20 mg/kg, not 10 mg/kg, ASA-DA protected against ischemia-induced neuronal death after transient focal and global ischemic damage, and its neuroprotective effect was much better than that of ASA or DA alone. In addition, 20 mg/kg ASA-DA treatment reduced the ischemia-induced gliosis and maintained antioxidants levels in the corresponding injury regions. In brief, ASA-DA, a new synthetic drug, dramatically protected neurons from ischemic damage, and neuroprotective effects of ASA-DA may be closely related to the attenuation of ischemia-induced gliosis and maintenance of antioxidants.

Protective effects of the dietary supplementation of turmeric (Curcuma longa L.) on sodium arsenite-induced biochemical perturbation in mice.

PubMed

Karim, Md Rezaul; Haque, Abedul; Islam, Khairul; Ali, Nurshad; Salam, Kazi Abdus; Saud, Zahangir Alam; Hossain, Ekhtear; Fajol, Abul; Akhand, Anwarul Azim; Himeno, Seiichiro; Hossain, Khaled

2010-12-01

The present study was undertaken to evaluate the protective effect of turmeric powder on arsenic toxicity through mice model. Swiss albino male mice were divided into four groups. The first group was used as control, while groups 2, 3, and 4 were treated with turmeric powder (T, 50 mg/kg body weight/day), sodium arsenite (Sa, 10 mg/kg body weight/day) and turmeric plus Sa (T+Sa), respectively. Results showed that oral administration of Sa reduced the weight gain of the mice compared to the control group and food supplementation of turmeric prevented the reduction of weight gain. Turmeric abrogated the Sa-induced elevation of serum urea, glucose, triglyceride (TG) level and alanine aminotransferase (ALT) activity except the activity of alkaline phosphatase (ALP). Turmeric also prevented the Sa-induced perturbation of serum butyryl cholinesterase activity (BChE). Therefore, ameliorating effect of turmeric on Sa-treated mice suggested the future application of turmeric to reduce or to prevent arsenic toxicity in human.

Protective effect of hydroxytyrosol and its metabolite homovanillic alcohol on H(2)O(2) induced lipid peroxidation in renal tubular epithelial cells.

PubMed

Deiana, Monica; Incani, Alessandra; Rosa, Antonella; Corona, Giulia; Atzeri, Angela; Loru, Debora; Paola Melis, M; Assunta Dessì, M

2008-09-01

We investigated the capacity of hydroxytyrosol (HT), 3,4-dihydroxyphenylethanol, and homovanillic alcohol (HVA), 4-hydroxy-3-methoxy-phenylethanol, to inhibit H(2)O(2) induced oxidative damage in LLC-PK1, a porcine kidney epithelial cell line, studying the effect of H(2)O(2) on specific cell membrane lipid targets, unsaturated fatty acids and cholesterol. Exposure to H(2)O(2) induced a significant increase of the level of MDA together with a disruption of the membrane structure, with the loss of unsaturated fatty acids, cholesterol and alpha-tocopherol, and the formation of fatty acids hydroperoxides and 7-ketocholesterol. Pretreatment with HT protected renal cells from oxidative damage: the level of membrane lipids was preserved and there was no significant detection of oxidation products. HVA exerted a comparable activity, thus both HT and HVA were able to prevent in renal cells the lipid peroxidation process that plays a central role in tubular cell injury.

Molecular chaperone properties of the high molecular weight aggregate from aged lens

NASA Technical Reports Server (NTRS)

Takemoto, L.; Boyle, D.; Spooner, B. S. (Principal Investigator)

1994-01-01

The high molecular weight aggregate (HMWA) fraction was isolated from the water soluble proteins of aged bovine lenses. Its composition and ability to inhibit heat-induced denaturation and aggregation were compared with the lower molecular weight, oligomeric fraction of alpha isolated from the same lens. Although the major components of both fractions were the alpha-A and alpha-B chains, the HMWA fraction possessed a decreased ability to protect other proteins against heat-induced denaturation and aggregation. Immunoelectron microscopy of both fractions demonstrated that alpha particles from the HMWA fraction contained increased amounts of beta and gamma crystallins, bound to a central region of the supramolecular complex. Together, these results demonstrate that alpha crystallins found in the HMWA fraction possess a decreased ability to protect against heat-induced denaturation and aggregation, and suggest that at least part of this decrease could be due to the increased presence of beta and gamma crystallins complexed to the putative chaperone receptor site of the alpha particles.

Biological and analytical characterization of two extracts from Valeriana officinalis.

PubMed

Circosta, Clara; De Pasquale, Rita; Samperi, Stefania; Pino, Annalisa; Occhiuto, Francesco

2007-06-13

The anticoronaryspastic and antibronchospastic activities of ethanolic and aqueous extracts of Valeriana officinalis L. roots were investigated in anaesthetized guinea-pigs and the results were correlated with the qualitative/quantitative chemical composition of the extracts in order to account for some of the common uses of this plant. The protective effects of orally administered ethanolic and aqueous extracts (50, 100 and 200 mg/kg) were evaluated against pitressin-induced coronary spasm and pressor response in guinea-pigs and were compared with those of nifedipine. Furthermore, the protective effects against histamine-induced and Oleaceae antigen challenge-induced bronchospasm were evaluated. Finally, the two valerian extracts were analytically characterized by qualitative and quantitative chromatographic analysis. The results showed that the two valeriana extracts possessed significant anticoronaryspastic, antihypertensive and antibronchospastic properties. These were similar to those exhibited by nifedipine and are due to the structural features of the active principles they contain. This study justifies the traditional use of this plant in the treatment of some respiratory and cardiovascular disorders.

Interaction of Vimang (Mangifera indica L. extract) with Fe(III) improves its antioxidant and cytoprotecting activity.

PubMed

Pardo-Andreu, Gilberto L; Sánchez-Baldoquín, Carlos; Avila-González, Rizette; Yamamoto, Edgar T Suzuki; Revilla, Andrés; Uyemura, Sérgio Akira; Naal, Zeki; Delgado, René; Curti, Carlos

2006-11-01

A standard aqueous stem bark extract from selected species of Mangifera indica L. (Anacardiaceae)--Vimang, whose major polyphenolic component is mangiferin, displays potent in vitro and in vivo antioxidant activity. The present study provides evidence that the Vimang-Fe(III) mixture is more effective at scavenging 2,2-diphenyl-1-picrylhydrazyl (DPPH) and superoxide radicals, as well as in protecting against t-butyl hydroperoxide-induced mitochondrial lipid peroxidation and hypoxia/reoxygenation-induced hepatocytes injury, compared to Vimang alone. Voltammetric assays demonstrated that Vimang, in line with the high mangiferin content of the extract, behaves electrochemically like mangiferin, as well as interacts with Fe(III) in close similarity with mangiferin's interaction with the cation. These results justify the high efficiency of Vimang as an agent protecting from iron-induced oxidative damage. We propose Vimang as a potential therapy against the deleterious action of reactive oxygen species generated during iron-overload, such as that occurring in diseases like beta-thalassemia, Friedreich's ataxia and haemochromatosis.

Protective Effect of Ocimum basilicum Essential Oil Against Acetic Acid-Induced Colitis in Rats.

PubMed

Rashidian, Amir; Roohi, Parnia; Mehrzadi, Saeed; Ghannadi, Ali Reza; Minaiyan, Mohsen

2016-10-01

Ocimum basilicum L has been traditionally used for the treatment of inflammatory bowel disease in Iran. This study investigates the ameliorative effect of Ocimum basilicum essential oil on an acetic acid-induced colitis model in rats. Ocimum basilicum essential oil with 2 doses (200 and 400 μL/kg) significantly ameliorated wet weight/length ratio of colonic tissue compared to the control group. Higher doses of essential oil (200 and 400 μL/kg) significantly reduced ulcer severity, ulcer area, and ulcer index. On the other hand, histological examination revealed the diminution of total colitis index as a marker for inflammatory cell infiltration in the colonic segments of rats treated with Ocimum basilicum essential oil (200 and 400 μL/kg). The increased level of myeloperoxidase was significantly decreased after the treatment with the essential oil (200 and 400 μL/kg). These results suggest that Ocimum basilicum exhibits protective effect against acetic acid-induced colitis. © The Author(s) 2015.

PREFERENTIAL SECRETION OF INDUCIBLE HSP70 BY VITILIGO MELANOCYTES UNDER STRESS

PubMed Central

Mosenson, Jeffrey A.; Flood, Kelsey; Klarquist, Jared; Eby, Jonathan M.; Koshoffer, Amy; Boissy, Raymond E.; Overbeck, Andreas; C.Tung, Rebecca; Poole, I. Caroline Le

2014-01-01

SUMMARY Inducible HSP70 (HSP70i) chaperones peptides from stressed cells, protecting them from apoptosis. Upon extracellular release, HSP70i serves an adjuvant function, enhancing immune responses to bound peptides. We questioned whether HSP70i differentially protects control and vitiligo melanocytes from stress and subsequent immune responses. We compared expression of HSP70i in skin samples, evaluated the viability of primary vitiligo and control melanocytes exposed to bleaching phenols, and measured secreted HSP70i. We determined whether HSP70i traffics to melanosomes to contact immunogenic proteins by cell fractionation, western blotting, electron microscopy and confocal microscopy. Viability of vitiligo and control melanocytes was equally affected under stress. However, vitiligo melanocytes secreted increased amounts of HSP70i in response to MBEH, corroborating with aberrant HSP70i expression in patient skin. Intracellular HSP70i colocalized with melanosomes, and more so in response to MBEH in vitiligo melanocytes. Thus whereas either agent is cytotoxic to melanocytes, MBEH preferentially induces immune responses to melanocytes. PMID:24354861

Adenovirus vector-induced immune responses in nonhuman primates: responses to prime boost regimens.

PubMed

Tatsis, Nia; Lasaro, Marcio O; Lin, Shih-Wen; Haut, Larissa H; Xiang, Zhi Q; Zhou, Dongming; Dimenna, Lauren; Li, Hua; Bian, Ang; Abdulla, Sarah; Li, Yan; Giles-Davis, Wynetta; Engram, Jessica; Ratcliffe, Sarah J; Silvestri, Guido; Ertl, Hildegund C; Betts, Michael R

2009-05-15

In the phase IIb STEP trial an HIV-1 vaccine based on adenovirus (Ad) vectors of the human serotype 5 (AdHu5) not only failed to induce protection but also increased susceptibility to HIV-1 infection in individuals with preexisting neutralizing Abs against AdHu5. The mechanisms underlying the increased HIV-1 acquisition rates have not yet been elucidated. Furthermore, it remains unclear if the lack of the vaccine's efficacy reflects a failure of the concept of T cell-mediated protection against HIV-1 or a product failure of the vaccine. Here, we compared two vaccine regimens based on sequential use of AdHu5 vectors or two different chimpanzee-derived Ad vectors in rhesus macaques that were AdHu5 seropositive or seronegative at the onset of vaccination. Our results show that heterologous booster immunizations with the chimpanzee-derived Ad vectors induced higher T and B cell responses than did repeated immunizations with the AdHu5 vector, especially in AdHu5-preexposed macaques.

Protective effect of Hibiscus sabdariffa against serum/glucose deprivation-induced PC12 cells injury

PubMed Central

Bakhtiari, Elham; Hosseini, Azar; Mousavi, Seyed Hadi

2015-01-01

Objectives: Findings natural products with antioxidant and antiapoptotic properties has been one of the interesting challenges in the search for the treatment of neurodegenerative diseases including ischemic stroke. Serum/glucose deprivation (SGD) has been used as a model for the understanding of the molecular mechanisms of neuronal damage during ischemia in vitro and for the expansion of neuroprotective drugs against ischemia-induced brain injury. Recent studies showed that Hibiscus sabdariffa exert pharmacological actions such as potent antioxidant. Therefore, in this study we investigated the protective effect of extract of H. sabdariffa against SGD-induced PC12 cells injury. Materials and Methods: Cells were pretreated with different concentrations of H. sabdariffa extract (HSE) for 2 hr, and then exposed to SGD condition for 6, 12 and 18 hr. Results: SGD caused a major reduction in cell viability after 6, 12, and 18 hr as compared with control cells (p< 0.001). Pretreatment with HSE (30-500 𝜇g/mL) significantly increased cell viability following SGD insult for 6, 12 and 18 hr. A significant increase in cell apoptosis was seen in cells under SGD condition after 12hr as compared with control cells (p< 0.001). Pretreatment with HSE significantly decreased cell apoptosis subsequent SGD conditionafter12hr at concentration of 60, 125 and 250. Conclusion: These data showed that HSE had a protective property under SGD condition in PC12 cells, suggesting that H. sabdariffa has the potential to be used as a new therapeutic approach for neurodegenerative disorders. PMID:26101756

Molecular mechanisms underlying the protective effects of hydrogen-saturated saline on noise-induced hearing loss.

PubMed

Chen, Liwei; Han, Mingkun; Lu, Yan; Chen, Daishi; Sun, Xuejun; Yang, Shiming; Sun, Wei; Yu, Ning; Zhai, Suoqiang

2017-10-01

This study aimed to explore the molecular mechanism of the protective effects of hydrogen-saturated saline on NIHL. Guinea pigs were divided into three groups: hydrogen-saturated saline; normal saline; and control. For saline administration, the guinea pigs were given daily abdominal injections 3 d before and 1 h before noise exposure. ABR were tested to examine cochlear physiology changes. The changes of 8-hydroxy-desoxyguanosine (8-HOdG), interleukin-1 (IL-1), interleukin-6 (IL-6), interleukin-10 (IL-10), tumor necrosis factor-α (TNF-α), intercellular cell adhesion molecule-1 (ICAM-1) and high mobility group box-1 protein (HMGB1) in the cochlea were also examined. The results showed that pre-treatment with hydrogen-saturated saline could significantly attenuate noise-induced hearing loss. The concentration of 8-HOdG was also significantly decreased in the hydrogen-saturated saline group compared with the normal saline group. After noise exposure, the concentrations of IL-1, IL-6, TNF-α, and ICAM-1 in the cochlea of guinea pigs in the hydrogen-saturated saline group were dramatically reduced compared to those in the normal saline group. The concentrations of HMGB-1 and IL-10 in the hydrogen-saturated saline group were significantly higher than in those in the normal saline group immediately and at 7 d after noise exposure. This study revealed for the first time the protective effects of hydrogen-saturated saline on noise-induced hearing loss (NIHL) are related to both the anti-oxidative activity and anti-inflammatory activity.

A prime-boost immunization regimen based on a simian adenovirus 36 vectored multi-stage malaria vaccine induces protective immunity in mice.

PubMed

Fonseca, Jairo A; McCaffery, Jessica N; Kashentseva, Elena; Singh, Balwan; Dmitriev, Igor P; Curiel, David T; Moreno, Alberto

2017-05-31

Malaria remains a considerable burden on public health. In 2015, the WHO estimates there were 212 million malaria cases causing nearly 429,000 deaths globally. A highly effective malaria vaccine is needed to reduce the burden of this disease. We have developed an experimental vaccine candidate (PyCMP) based on pre-erythrocytic (CSP) and erythrocytic (MSP1) stage antigens derived from the rodent malaria parasite P. yoelii. Our protein-based vaccine construct induces protective antibodies and CD4 + T cell responses. Based on evidence that viral vectors increase CD8 + T cell-mediated immunity, we also have tested heterologous prime-boost immunization regimens that included human adenovirus serotype 5 vector (Ad5), obtaining protective CD8 + T cell responses. While Ad5 is commonly used for vaccine studies, the high prevalence of pre-existing immunity to Ad5 severely compromises its utility. Here, we report the use of the novel simian adenovirus 36 (SAd36) as a candidate for a vectored malaria vaccine since this virus is not known to infect humans, and it is not neutralized by anti-Ad5 antibodies. Our study shows that the recombinant SAd36PyCMP can enhance specific CD8 + T cell response and elicit similar antibody titers when compared to an immunization regimen including the recombinant Ad5PyCMP. The robust immune responses induced by SAd36PyCMP are translated into a lower parasite load following P. yoelii infectious challenge when compared to mice immunized with Ad5PyCMP. Copyright © 2017 Elsevier Ltd. All rights reserved.

Deciphering the protective role of spermidine against saline-alkaline stress at physiological and proteomic levels in tomato.

PubMed

Zhang, Yi; Zhang, Hao; Zou, Zhi-Rong; Liu, Yi; Hu, Xiao-Hui

2015-02-01

In this research, the protective effect of spermidine (Spd) in mitigating saline-alkaline stress in tomato (Solanum lycopersicum L.) at physiological and proteomic levels were examined. The results showed that saline-alkaline stress induced accumulation of H2O2 and O2(-*), and increased the activities of antioxidase (SOD, CAT, and POD). Spermidine efficiently alleviated the inhibitory role of saline-alkaline on plant growth and inhibited saline-alkaline stress-induced H2O2 and O2(-*) accumulation. Proteomics investigations of the leaves of tomato seedlings, responding to a 75 mM saline-alkaline solution and 0.25 mM Spd, were performed. Maps of the proteome of leaf extracts were obtained by two-dimensional gel electrophoresis. An average of 49, 47 and 34 spots, which appeared repeatedly and that significantly altered the relative amounts of polypeptides by more than twofold, were detected for seedlings treated with saline-alkaline solution (S) compared to normal solution (CK), saline-alkaline plus spermidine (MS) compared to CK, or S versus MS, respectively. Thirty-nine of these proteins were identified by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry and were classified into five functional categories, including energy and metabolism, signal transduction, amino acid metabolism, protein metabolism, and stress-defense response. Proteomics analysis coupled with bioinformatics indicated that Spd treatment helps tomato seedlings combat saline-alkaline stress by modulating the defense mechanism of plants and activating cellular detoxification, which protect plants from oxidative damage induced by saline-alkaline stress. Copyright © 2014 Elsevier Ltd. All rights reserved.

The efficacy and safety of irsogladine maleate in nonsteroidal anti-inflammatory drug or aspirin-induced peptic ulcer and gastritis.

PubMed

Shim, Ki-Nam; Kim, Jin Il; Kim, Nayoung; Kim, Sang Gyun; Jo, Yun Ju; Hong, Su Jin; Shin, Jeong Eun; Kim, Gwang Ha; Park, Kyung Sik; Choi, Suck Chei; Kwon, Joong Goo; Kim, Jie-Hyun; Kim, Hyun Jin; Kim, Ji Won

2018-06-01

Irsogladine maleate, an enhancer of gastric mucosal protective factors, has demonstrated its efficacy for various gastric mucosal injuries. The aim of this study was to evaluate the efficacy and safety of irsogladine for prevention of nonsteroidal anti-inflammatory drugs (NSAIDs) or aspirin-induced peptic ulcer and gastritis. In this multicenter, randomized, double-blind, exploratory clinical trial, 100 patients over 50 years of age who needed continuous NSAIDs or aspirin for more than 8 weeks were randomly assigned to either test group (irsogladine maleate 2 mg, twice daily, 39 patients for full analysis) or placebo group (37 patients for full analysis). Primary outcomes were incidence of peptic ulcer and ratio of modified Lanza score (MLS) 2 to 4. Secondary outcome was the number of acute erosions confirmed by endoscopy at 8 weeks. Adverse effects were also compared. There were no significant differences in gastric protective effects between test and placebo groups. However, two cases of peptic ulcer in the placebo group but none in the test group were observed. These two cases of peptic ulcer were Helicobacter pylori-negative. In addition, H. pylori-negative group showed significant changes in MLS score (p = 0.0247) and edema score (p = 0.0154) after the treatment compared to those before treatment in the test group. There was no significant difference in adverse events between the two groups. The efficacy of irsogladine maleate was found in H. pylori-negative group, suggesting its potential as a protective agent against NSAIDs or aspirin-induced peptic ulcer and gastritis.

Minocycline attenuates streptomycin-induced cochlear hair cell death by inhibiting protein nitration and poly (ADP-ribose) polymerase activation.

PubMed

Wang, Ping; Li, Haonan; Yu, Shuyuan; Jin, Peng; Hassan, Abdurahman; Du, Bo

2017-08-24

This study aimed to elucidate the protective effect of minocycline against streptomycin-induced damage of cochlear hair cells and its mechanism. Cochlear membranes were isolated from newborn Wistar rats and randomly divided into control, 500μmol/L streptomycin, 100μmol/L minocycline, and streptomycin and minocycline treatment groups. Hair cell survival was analyzed by detecting the expression of 3-nitrotyrosine (3-NT) in cochlear hair cells by immunofluorescence and an enzyme-linked immunosorbent assay. Expression of 3-NT and inducible nitric oxide synthase (iNOS), and poly (ADP-Ribose) polymerase (PARP) and caspase-3 activation were evaluated by western blotting. The results demonstrated hair cell loss at 24h after streptomycin treatment. No change was found in supporting cells of the cochleae. Minocycline pretreatment improved hair cell survival and significantly reduced the expression of iNOS and 3-NT in cochlear tissues compared with the streptomycin treatment group. PARP and caspase-3 activation was increased in the streptomycin treatment group compared with the control group, and pretreatment with minocycline decreased cleaved PARP and activated caspase-3 expression. Minocycline protected cochlear hair cells from injury caused by streptomycin in vitro. The mechanism underlying the protective effect may be associated with the inhibition of excessive formation of nitric oxide, reduction of the nitration stress reaction, and inhibition of PARP and caspase-3 activation in cochlear hair cells. Combined minocycline therapy can be applied to patients requiring streptomycin treatment. Copyright © 2017. Published by Elsevier B.V.

Protective effects of recombinant human brain natriuretic peptide against LPS-Induced acute lung injury in dogs.

PubMed

Song, Zhi; Cui, Yan; Ding, Mu-Zi; Jin, Hong-Xu; Gao, Yan

2013-11-01

Acute lung injury (ALI) is a common component of systemic inflammatory disease without more effective treatments. However, recent studies have demonstrated that the recombinant human brain natriuretic peptide (rhBNP) has anti-inflammatory effects. Therefore, we found that rhBNP could prevent lipopolysaccharide (LPS)-induced acute lung injury in a dog model. Dogs were injected with LPS and subjected to continuous intravenous infusion (CIV) of saline solution or rhBNP. We detected the protective effects of rhBNP by histological examination and determination of serum cytokine levels and lung myeloperoxidase (MPO) activity and malondialdehyde (MDA) activity. Histological examination indicated marked inflammation, edema and hemorrhage in lung tissue taken 12h after rhBNP treatment compared with tissue from dogs which received saline treatment after LPS injection. LPS injection induced cytokine (IL-6 and TNF-α) secretion and lung MPO and MDA activities, which were also attenuated by rhBNP treatment. Inductions of IL-6 and TNF-α were significantly attenuated in the L-rhBNP and the H-rhBNP groups. The ratios of the L-rhBNP group and H-rhBNP group were lower than that in the lung injury group. Furthermore, MPO and MDA activities were significantly lower in the H-rhBNP group compared to those in the LI group. Our data indicate that rhBNP treatment may exert protective effects and may be associated with adjusting endogenous antioxidant enzymes. Thus, rhBNP may be considered as a therapeutic agent for various clinical conditions involving lung injury by sepsis. Copyright © 2013 Elsevier B.V. All rights reserved.

Neurotrophic and antioxidant effects of silymarin comparable to 4-methylcatechol in protection against gentamicin-induced ototoxicity in guinea pigs.

PubMed

Draz, Eman I; Abdin, Amany A; Sarhan, Naglaa I; Gabr, Takwa A

2015-04-01

Despite that gentamicin is a very effective aminoglycoside, its potential ototoxicity which is of irreversible nature makes a challenge and limitation for its use. This study was designed to investigate possible neurotrophic and antioxidant effects of silymarin comparable to 4-methylcatechol in protection against gentamicin-induced ototoxicity. Twenty pigmented guinea pigs were divided into four equal groups, where group I served as normal control group. The other groups received gentamicin (120 mg/kg/day, ip) for 19 days where group II given vehicle of 1% CMC, group III and group IV were pre-treated 2h before gentamicin by 4-methylcatechol (10 μg/kg, ip) and silymarin (100mg/kg, oral gavage), respectively. The main findings indicated that silymarin exhibited restoration of nerve growth factor (NGF) levels and increased tropomyosin-related kinase receptors-A (Trk-A) m-RNA expression in cochlear tissue and preservation of hair cells of organ of Corti by scanning electron microscopy (SEM) with significant decrease in auditory brainstem response (ABR) threshold compared to 4-methylcatechol. Only silymarin caused significant amelioration in oxidative stress state by reducing malondialdehyde (MDA) levels and increasing catalase activity. Silymarin exerts superiority over 4-methylcatechol when recommended as protective agent against gentamicin ototoxicity based on its efficient neurotrophic and antioxidant activities. Copyright © 2014 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Antidepressant Imipramine Protects Bupivacaine-Induced Neurotoxicity in Dorsal Root Ganglion Neurons Through Coactivation of TrkA and TrkB.

PubMed

Guo, Jianrong; Wang, Huan; Tao, Qiang; Sun, Shiyu; Liu, Li; Zhang, Jianping; Yang, Dawei

2017-11-01

In our work, we used an in vitro culture model to investigate whether antidepressant imipramine (Ip) may protect bupivacaine (Bv)-induced neurotoxicity in mouse dorsal root ganglion (DRG). Adult mouse DRG was treated with 5 mM Bv in vitro to induce neurotoxicity. DRG was then pre-treated with Ip, prior to Bv, to examine its effects on protecting Bv-induced DRG apoptosis and neurite degeneration. Ip-induced dynamic changes in Trk receptors, including TrkA/B/C and phosphor (p-)TrkA/B/C, were examined by qPCR and Western blot. TrkA and TrkB were inhibited by siRNAs to further investigate their functional role in Ip- and Bv-treated DRG. Ip protected Bv-induced apoptosis and neurite loss in DRG. Ip did not alter TrkA/B/C expressions, whereas significantly augmented protein productions of p-TrkA and p-TrkB, but not p-TrkC. SiRNA-mediated TrkA or TrkB downregulation inhibited Trk receptors, and reduced p-TrkA and p-TrkB in DRG. TrkA or TrkB downregulation alone had no effect on Ip-induced protection in Bv-injured DRG. However, co-inhibition of TrkA and TrkB significantly ameliorated the protective effect of Ip on Bv-induced apoptosis and neurite loss in DRG. Imipramine protected bupivacaine-induced neurotoxicity in DRG, likely via the co-activation of TrkA and TrkB signaling pathways. J. Cell. Biochem. 118: 3960-3967, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Aged garlic extract protects against methotrexate-induced apoptotic cell injury of IEC-6 cells.

PubMed

Horie, Toshiharu; Li, Tiesong; Ito, Kousei; Sumi, Shin-ichiro; Fuwa, Toru

2006-03-01

Gastrointestinal toxicity is one of the most serious side effects of methotrexate (MTX) treatment. The side effects often disrupt the cancer chemotherapy. We previously reported that aged garlic extract (AGE) protects the small intestine of rats from MTX-induced damage. In this study, the protection of AGE against MTX-induced damage of IEC-6 cells originating from the rat jejunum crypt was investigated. MTX decreased the viability of IEC-6 cells, but this effect was prevented by AGE (0.5%). The MTX-induced apoptosis of IEC-6 cells was depressed by AGE. These results indicated that AGE protects IEC-6 cells from the MTX-induced damage. AGE may be useful in cancer chemotherapy with MTX because it reduces MTX-induced intestinal damage.

Protective effect of ALDH2 against cyclophosphamide-induced acute hepatotoxicity via attenuating oxidative stress and reactive aldehydes.

PubMed

Zhai, Xiaoxuan; Zhang, Zhenxiao; Liu, Wenwen; Liu, Baoshan; Zhang, Rui; Wang, Wenjun; Zheng, Wen; Xu, Feng; Wang, Jiali; Chen, Yuguo

2018-04-30

Cyclophosphamide (CY) is a widely used chemotherapeutic agent that is associated with severe side effects, such as hepatotoxicity and nephrotoxicity. However, the extent, mechanisms and potential prevention and treatment strategies of CY-induced acute hepatotoxicity and nephrotoxicity are largely unknown. In this study, we determined the existence and extent of CY-induced acute hepatotoxicity and nephrotoxicity, and demonstrated the effect of ALDH2 on CY-induced acute tissue toxicity and related mechanisms. Adult male C57BL/6J (wide-type, WT) and ALDH2 -/- (KO) mice were divided into four groups: WT, WT + CY, KO + CY and WT + CY + Alda-1. Biochemical analysis showed that plasma ALT was increased by 35.8% in KO + CY group and decreased by 21.1% in WT + CY + Alda-1 group compared to WT + CY group (P < 0.05, respectively). However, there was no significant difference among WT, WT + CY and KO + CY groups regarding plasma renal marker enzymes, including blood urea nitrogen (BUN), creatinine and cystatin C (CysC). Levels of reactive oxygen species (ROS) and toxic aldehydes (acrolein, 4-hydroxynonenol and malondialdehyde) were increased significantly in KO + CY group and decreased significantly in WT + CY + Alda-1 group compared to WT + CY group (P < 0.05, respectively). These findings demonstrate that CY could induce acute hepatotoxicity without nephrotoxicity, and ALDH2 plays a protective role in CY-induced acute hepatotoxicity. The underlying mechanisms are associated with attenuating oxidative stress and detoxifying reactive aldehydes. Copyright © 2018 Elsevier Inc. All rights reserved.

Physicians involved in the care of patients with high risk of skin cancer should be trained regarding sun protection measures: evidence from a cross sectional study.

PubMed

Thomas, M; Rioual, E; Adamski, H; Roguedas, A-M; Misery, L; Michel, M; Chastel, F; Schmutz, J-L; Aubin, F; Marguery, M-C; Meyer, N

2011-01-01

Knowledge, regarding sun protection, is essential to change behaviour and to reduce sun exposure of patients at risk for skin cancer. Patient education regarding appropriate or sun protection measures, is a priority to reduce skin cancer incidence. The aim of this study was to evaluate the knowledge about sun protection and the recommendations given in a population of non-dermatologists physicians involved in the care of patients at high risk of skin cancer. This study is a cross-sectional study. Physicians were e-mailed an anonymous questionnaire evaluating the knowledge about risk factors for skin cancer, sun protection and about the role of the physician in providing sun protection recommendations. Of the responders, 71.4% considered that the risk of skin cancer of their patients was increased when compared with the general population. All the responders knew that UV-radiations can contribute to induce skin cancers and 71.4% of them declared having adequate knowledge about sun protection measures. A proportion of 64.2% of them declared that they were able to give sun protection advices: using sunscreens (97.8%), wearing covering clothes (95.5%), performing regular medical skin examination (91.1%), to avoid direct sunlight exposure (77.8%), avoiding outdoor activities in the hottest midday hours (73.3%) and practising progressive exposure (44.4%). Non-dermatologist physicians reported a correct knowledge of UV-induced skin cancer risk factors. The majority of responders displayed adequate knowledge of sun protection measures and declared providing patients with sun protection recommendation on a regular basis. Several errors persisted. © 2010 The Authors. Journal of the European Academy of Dermatology and Venereology © 2010 European Academy of Dermatology and Venereology.

Lysophosphatidic acid rescues bone mesenchymal stem cells from hydrogen peroxide-induced apoptosis.

PubMed

Wang, Xian-Yun; Fan, Xue-Song; Cai, Lin; Liu, Si; Cong, Xiang-Feng; Chen, Xi

2015-03-01

The increase of reactive oxygen species in infracted heart significantly reduces the survival of donor mesenchymal stem cells, thereby attenuating the therapeutic efficacy for myocardial infarction. In our previous study, we demonstrated that lysophosphatidic acid (LPA) protects bone marrow-derived mesenchymal stem cells (BMSCs) against hypoxia and serum deprivation-induced apoptosis. However, whether LPA protects BMSCs from H2O2-induced apoptosis was not examined. In this study, we report that H2O2 induces rat BMSC apoptosis whereas LPA pre-treatment effectively protects BMSCs from H2O2-induced apoptosis. LPA protection of BMSC from the induced apoptosis is mediated mostly through LPA3 receptor. Furthermore, we found that membrane G protein Gi2 and Gi3 are involved in LPA-elicited anti-apoptotic effects through activation of ERK1/2- and PI3 K-pathways. Additionally, H2O2 increases levels of type II of light chain 3B (LC3B II), an autophagy marker, and H2O2-induced autophagy thus protected BMSCs from apoptosis. LPA further increases the expression of LC3B II in the presence of H2O2. In contrast, autophagy flux inhibitor bafilomycin A1 has no effect on LPA's protection of BMSC from H2O2-induced apoptosis. Taken together, our data suggest that LPA rescues H2O2-induced apoptosis mainly by interacting with Gi-coupled LPA3, resulting activation of the ERK1/2- and PI3 K/AKT-pathways and inhibition caspase-3 cleavage, and LPA protection of BMSCs against the apoptosis is independent of it induced autophagy.

Involvement of endogenous cholecystokinin and somatostatin in gastroprotection induced by intraduodenal fat.

PubMed

Brzozowski, T; Konturek, P C; Konturek, S J; Kwiecién, S; Pajdo, R; Brzozowska, I; Hahn, E G

1998-01-01

Duodenal fat such as oleate is known to influence gut functions by release of cholecystokinin (CCK), but the contribution of CCK endogenously released by duodenal fat or by diversion of pancreatic juice from the duodenum in the mechanism of mucosal integrity and gastroprotection has been little studied. This study was designed to compare the effect of CCK-8 and intraduodenal (i.d.) instillation of sodium oleate, or diversion of the pancreatic biliary secretions that are known to release CCK, on the gastric mucosal lesions induced by topical application of 100% ethanol or acidified aspirin (ASA) in rats with or without the pretreatment with a CCK-A receptor antagonist, loxiglumide, or with L-365,260 to block CCK-B receptors. In addition, the effect of suppression of prostaglandin (PG) biosynthesis by indomethacin (5 mg/kg i.p.), inhibition of nitric oxide (NO)-synthase by L-NAME (5 mg/kg i.v.), or blockade of sensory nerves by capsaicin (125 mg/kg s.c.) on the protective activity of sodium oleate was determined. Sodium oleate (50-200 mM i.d.), or diversion of pancreatic juice from the duodenum for 3 h that produced significant rise in plasma CCK levels, significantly reduced gastric lesions induced by 100% ethanol to an extent similar to that induced by exogenous CCK-8 (5 nmol/kg s.c.). The protective effect of oleate or diversion of pancreatic juice was accompanied by an increase in gastric blood flow (GBF). Both protection and accompanying hyperemia were completely abolished by blockade of CCK-A receptors with loxiglumide, whereas L-365,260, an antagonist of CCK-B receptors, had no effect. Oleate given i.d. significantly attenuated acidified ASA-induced gastric lesions and gastric secretion while increasing the luminal concentration of somatostatin. These effects were significantly reduced by loxiglumide but not by L-365,260. In contrast, CCK-8, which stimulated gastric acid secretion, failed to affect the lesions induced by acidified ASA and the decrease in the GBF produced by this ulcerogen. Indomethacin, which suppressed PG generation by approximately 90%, failed to influence the protective activity of oleate or CCK-8 against ethanol-induced lesions, whereas L-NAME, vagotomy, or sensory denervation significantly attenuated this protection and accompanying hyperemia. Addition to L-NAME of L-arginine, but not D-arginine, restored the protective and hyperemic effects of CCK-8 and duodenal oleate against gastric lesions induced by ethanol or acidified ASA. We conclude that endogenous CCK released by oleate or diversion of pancreatic secretion exerts a potent gastroprotective action on the stomach involving predominantly CCK-A receptors and depending on vagal activity, and hyperemia mediated by NO and sensory nerves but unrelated to acid secretory effects and endogenous PG.

Estrogen Receptor Alpha Expression in Podocytes Mediates Protection against Apoptosis In-Vitro and In-Vivo

PubMed Central

Kummer, Sebastian; Jeruschke, Stefanie; Wegerich, Lara Vanessa; Peters, Andrea; Lehmann, Petra; Seibt, Annette; Mueller, Friederike; Koleganova, Nadezda; Halbenz, Elisabeth; Schmitt, Claus Peter; Bettendorf, Markus; Mayatepek, Ertan; Gross-Weissmann, Marie-Luise; Oh, Jun

2011-01-01

Context/Objective Epidemiological studies have demonstrated that women have a significantly better prognosis in chronic renal diseases compared to men. This suggests critical influences of gender hormones on glomerular structure and function. We examined potential direct protective effects of estradiol on podocytes. Methods Expression of estrogen receptor alpha (ERα) was examined in podocytes in vitro and in vivo. Receptor localization was shown using Western blot of separated nuclear and cytoplasmatic protein fractions. Podocytes were treated with Puromycin aminonucleoside (PAN, apoptosis induction), estradiol, or both in combination. Apoptotic cells were detected with Hoechst nuclear staining and Annexin-FITC flow cytometry. To visualize mitochondrial membrane potential depolarization as an indicator for apoptosis, cells were stained with tetramethyl rhodamine methylester (TMRM). Estradiol-induced phosphorylation of ERK1/2 and p38 MAPK was examined by Western blot. Glomeruli of ERα knock-out mice and wild-type controls were analysed by histomorphometry and immunohistochemistry. Results ERα was consistently expressed in human and murine podocytes. Estradiol stimulated ERα protein expression, reduced PAN-induced apoptosis in vitro by 26.5±24.6% or 56.6±5.9% (flow cytometry or Hoechst-staining, respectively; both p<0.05), and restored PAN-induced mitochondrial membrane potential depolarization. Estradiol enhanced ERK1/2 phosphorylation. In ERα knockout mice, podocyte number was reduced compared to controls (female/male: 80/86 vs. 132/135 podocytes per glomerulus, p<0.05). Podocyte volume was enhanced in ERα knockout mice (female/male: 429/371 µm3 vs. 264/223 µm3 in controls, p<0.05). Tgfβ1 and collagen type IV expression were increased in knockout mice, indicating glomerular damage. Conclusions Podocytes express ERα, whose activation leads to a significant protection against experimentally induced apoptosis. Possible underlying mechanisms include stabilization of mitochondrial membrane potential and activation of MAPK signalling. Characteristic morphological changes indicating glomerulopathy in ERα knock-out mice support the in vivo relevance of the ERα for podocyte viability and function. Thus, our findings provide a novel model for the protective influence of female gender on chronic glomerular diseases. PMID:22096576

Irradiated esophageal cells are protected from radiation-induced recombination by MnSOD gene therapy.

PubMed

Niu, Yunyun; Wang, Hong; Wiktor-Brown, Dominika; Rugo, Rebecca; Shen, Hongmei; Huq, M Saiful; Engelward, Bevin; Epperly, Michael; Greenberger, Joel S

2010-04-01

Radiation-induced DNA damage is a precursor to mutagenesis and cytotoxicity. During radiotherapy, exposure of healthy tissues can lead to severe side effects. We explored the potential of mitochondrial SOD (MnSOD) gene therapy to protect esophageal, pancreatic and bone marrow cells from radiation-induced genomic instability. Specifically, we measured the frequency of homologous recombination (HR) at an integrated transgene in the Fluorescent Yellow Direct Repeat (FYDR) mice, in which an HR event can give rise to a fluorescent signal. Mitochondrial SOD plasmid/liposome complex (MnSOD-PL) was administered to esophageal cells 24 h prior to 29 Gy upper-body irradiation. Single cell suspensions from FYDR, positive control FYDR-REC, and negative control C57BL/6NHsd (wild-type) mouse esophagus, pancreas and bone marrow were evaluated by flow cytometry. Radiation induced a statistically significant increase in HR 7 days after irradiation compared to unirradiated FYDR mice. MnSOD-PL significantly reduced the induction of HR by radiation at day 7 and also reduced the level of HR in the pancreas. Irradiation of the femur and tibial marrow with 8 Gy also induced a significant increase in HR at 7 days. Radioprotection by intraesophageal administration of MnSOD-PL was correlated with a reduced level of radiation-induced HR in esophageal cells. These results demonstrate the efficacy of MnSOD-PL for suppressing radiation-induced HR in vivo.

Protective role of Cynodon dactylon in ameliorating the aluminium-induced neurotoxicity in rat brain regions.

PubMed

Sumathi, Thangarajan; Shobana, Chandrasekar; Kumari, Balasubramanian Rathina; Nandhini, Devarajulu Nisha

2011-12-01

Cynodon dactylon (Poaceae) is a creeping grass used as a traditional ayurvedic medicine in India. Aluminium-induced neurotoxicity is well known and different salts of aluminium have been reported to accelerate damage to biomolecules like lipids, proteins and nucleic acids. The objective of the present study was to investigate whether the aqueous extract of C. dactylon (AECD) could potentially prevent aluminium-induced neurotoxicity in the cerebral cortex, hippocampus and cerebellum of the rat brain. Male albino rats were administered with AlCl(3) at a dose of 4.2 mg/kg/day i.p. for 4 weeks. Experimental rats were given C. dactylon extract in two different doses of 300 mg and 750 mg/keg/day orally 1 h prior to the AlCl(3) administration for 4 weeks. At the end of the experiments, antioxidant status and activities of ATPases in cerebral cortex, hippocampus and cerebellum of rat brain were measured. Aluminium administration significantly decreased the level of GSH and the activities of SOD, GPx, GST, Na(+)/K(+) ATPase, and Mg(2+) ATPase and increased the level of lipid peroxidation (LPO) in all the brain regions when compared with control rats. Pre-treatment with AECD at a dose of 750 mg/kg b.w increased the antioxidant status and activities of membrane-bound enzymes (Na(+)/K(+) ATPase and Mg(2+) ATPase) and also decreased the level of LPO significantly, when compared with aluminium-induced rats. The results of this study indicated that AECD has potential to protect the various brain regions from aluminium-induced neurotoxicity.

Vitamin E deficiency enhances pulmonary inflammatory response and oxidative stress induced by single-walled carbon nanotubes in C57BL/6 mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shvedova, Anna A.; Kisin, Elena R.; Murray, Ashley R.

2007-06-15

Exposure of mice to single-walled carbon nanotubes (SWCNTs) induces an unusually robust pulmonary inflammatory response with an early onset of fibrosis, which is accompanied by oxidative stress and antioxidant depletion. The role of specific components of the antioxidant protective system, specifically vitamin E, the major lipid-soluble antioxidant, in the SWCNT-induced reactions has not been characterized. We used C57BL/6 mice, maintained on vitamin E-sufficient or vitamin E-deficient diets, to explore and compare the pulmonary inflammatory reactions to aspired SWCNTs. The vitamin E-deficient diet caused a 90-fold depletion of {alpha}-tocopherol in the lung tissue and resulted in a significant decline of othermore » antioxidants (GSH, ascorbate) as well as accumulation of lipid peroxidation products. A greater decrease of pulmonary antioxidants was detected in SWCNT-treated vitamin E-deficient mice as compared to controls. Lowered levels of antioxidants in vitamin E-deficient mice were associated with a higher sensitivity to SWCNT-induced acute inflammation (total number of inflammatory cells, number of polymorphonuclear leukocytes, released LDH, total protein content and levels of pro-inflammatory cytokines, TNF-{alpha} and IL-6) and enhanced profibrotic responses (elevation of TGF-{beta} and collagen deposition). Exposure to SWCNTs markedly shifted the ratio of cleaved to full-length extracellular superoxide dismutase (EC-SOD). Given that pulmonary levels of vitamin E can be manipulated through diet, its effects on SWCNT-induced inflammation may be of practical importance in optimizing protective strategies.« less

Dietary supplementation with Agaricus blazei murill extract prevents diet-induced obesity and insulin resistance in rats.

PubMed

Vincent, Mylène; Philippe, Erwann; Everard, Amandine; Kassis, Nadim; Rouch, Claude; Denom, Jessica; Takeda, Yorihiko; Uchiyama, Shoji; Delzenne, Nathalie M; Cani, Patrice D; Migrenne, Stéphanie; Magnan, Christophe

2013-03-01

Dietary supplement may potentially help to fight obesity and other metabolic disorders such as insulin-resistance and low-grade inflammation. The present study aimed to test whether supplementation with Agaricus blazei murill (ABM) extract could have an effect on diet-induced obesity in rats. Wistar rats were fed with control diet (CD) or high-fat diet (HF) and either with or without supplemented ABM for 20 weeks. HF diet-induced body weight gain and increased fat mass compared to CD. In addition HF-fed rats developed hyperleptinemia and insulinemia as well as insulin resistance and glucose intolerance. In HF-fed rats, visceral adipose tissue also expressed biomarkers of inflammation. ABM supplementation in HF rats had a protective effect against body weight gain and all study related disorders. This was not due to decreased food intake which remained significantly higher in HF rats whether supplemented with ABM or not compared to control. There was also no change in gut microbiota composition in HF supplemented with ABM. Interestingly, ABM supplementation induced an increase in both energy expenditure and locomotor activity which could partially explain its protective effect against diet-induced obesity. In addition a decrease in pancreatic lipase activity is also observed in jejunum of ABM-treated rats suggesting a decrease in lipid absorption. Taken together these data highlight a role for ABM to prevent body weight gain and related disorders in peripheral targets independently of effect in food intake in central nervous system. Copyright © 2012 The Obesity Society.

Hepatoprotective role of Ricinus communis leaf extract against d-galactosamine induced acute hepatitis in albino rats.

PubMed

Babu, Pappithi Ramesh; Bhuvaneswar, Cherukupalle; Sandeep, Gandham; Ramaiah, Chintha Venkata; Rajendra, Wudayagiri

2017-04-01

Ricinus communis (RC) is a traditional medicinal plant which has been used by Chenchu and Yerukula tribes for treating their liver ailments. The present work is aimed to explore the hepatoprotective efficacy of Ricinus communis against d-galactosamine (D-GalN) induced hepatitis rat model and its therapeutic potential compared with standard drug, silymarin (100mg/kg.bw). In vitro antioxidant activity of Methanolic extract of Ricinus communis leaves (MERCL) was assayed through DPPH and H 2 O 2 free radical scavenging activity. Qualitative and quantitative analysis of MERCL using HPLC, demonstrated that Rutin was found to be predominant bioactive compound in the extract. Hepatitis was induced by treating the rats with D-GalN at a single intraperitoneal dose of 800mg/kg.bw. Serum markers viz, Alanine aminotransferase (ALT), Aspartate aminotransferase (AST), Alkaline phosphatase (ALP) and Malondialdehyde (MDA) levels were significantly increased and the activity levels of antioxidant enzymes such as Superoxide dismutase (SOD),Catalase (CAT), Glutathione reductase (GR), Glutathione peroxidase (GPx), non-enzymatic antioxidant Glutathione (GSH) levels were decreased in the liver of hepatitis induced rats when compared to controls. Pre and post treatment with MERCL significantly altered the enzyme activities, GSH and MDA to normal levels. Histopathological observations also showed protective and curative effects of MERCL against D-GalN intoxication. These results demonstrated that MERCL significantly protected the liver from d-galactosamine induced hepatitis, improved the curative effect in the liver and hence, MERCL can be used as a potent hepatoprotective drug in future. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

The effect of air permeability characteristics of protective garments on the induced physiological strain under exercise-heat stress.

PubMed

Epstein, Yoram; Heled, Yuval; Ketko, Itay; Muginshtein, Jeni; Yanovich, Ran; Druyan, Amit; Moran, Daniel S

2013-08-01

The high values of thermal resistance (Rct) and/or vapor resistance (Ret) of chemical protective clothing (CPC) induce a considerable thermal stress. The present study compared the physiological strain induced by CPCs and evaluates the relative importance of the fabrics' Rct, Ret, and air permeability in determining heat strain. Twelve young (20-30 years) healthy, heat-acclimated male subjects were exposed fully encapsulated for 3h daily to an exercise-heat stress (35°C and 30% relative humidity, walking on a motor-driven treadmill at a pace of 5 km h(1) and a 4% inclination, in a work-rest cycle of 45 min work and 15 min rest). Two bipack CPCs (PC1 and PC2) were tested and the results were compared with those attained by two control suits-a standard cotton military BDU (CO1) and an impermeable material suit (CO2). The physiological burden imposed by the two bilayer garments was within the boundaries set by the control conditions. Overall, PC2 induced a lower strain, which was closer to CO1, whereas PC1 was closer to CO2. Air permeability of the PC2 cloth was almost three times higher than that of PC1, enabling a better heat dissipation and consequently a lower physiological strain. Furthermore, air permeability characteristic of the fabrics, which is associated with its construction and weave, significantly correlated with the physiological strain, whereas the correlation with Rct, Ret, and weight was poor. The results emphasize the importance of air permeability in reducing the physiological strain induced by CPCs.

Protective Role of Grape Seed Proanthocyanidins Against Ccl4 Induced Acute Liver Injury in Mice.

PubMed

Zou, Jinfa; Qi, Fengjie; Ye, Liping; Yao, Suyan

2016-03-17

We investigated the effect of grape seed proanthocyanidins (GSPs) on carbon tetrachloride (CCl4)-induced acute liver injury. Sixty SPF KM mice were randomly divided into 6 groups: the control group, CCl4-model group, bifendate group (DDB group), and low-, moderate-, and high-dose GSP groups. The following parameters were measured: serum levels of alanine aminotransferase (ALT); aspartate aminotransferase (AST); tumor necrosis factor (TNF)-α; interleukin-6 (IL-6); high-mobility group box (HMGB)-1; body weight; liver, spleen, and thymus indexes; superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activity; HMGB1 mRNA; malondialdehyde (MDA) content; hepatocyte proliferation; and changes in liver histology. Compared to the CCl4-model group, decreases in liver index and increases in thymus index significantly increased SOD and GSH-Px activities and reduced MDA content, and higher hepatocyte proliferative activity was found in all GSP dose groups and the DDB group (all P<0.001). Compared with the CCl4-model group, serum TNF-α and IL-6 levels and HMGB 1 mRNA and protein expressions decreased significantly in the high GSP dose group (all P<0.05). Our results provide strong evidence that administration of GSPs might confer significant protection against CCl4-induced acute liver injury in mice.

Honey feeding protects kidney against cisplatin nephrotoxicity through suppression of inflammation.

PubMed

Hamad, Rania; Jayakumar, Calpurnia; Ranganathan, Punithavathi; Mohamed, Riyaz; El-Hamamy, Mahmoud M I; Dessouki, Amina A; Ibrahim, Abdelazim; Ramesh, Ganesan

2015-08-01

Cisplatin is a highly effective chemotherapeutic drug used to treat a wide variety of solid tumors. However, its use was limited due its dose-limiting toxicity to the kidney. Currently, there are no therapies available to treat or prevent cisplatin nephrotoxicity. Honey is a naturally occurring complex liquid and widely used in traditional Ayurvedic medicine to treat many illnesses. However, its effect on cisplatin nephrotoxicity is unknown. To determine the role of honey in cisplatin nephrotoxicity, animals were pretreated orally for a week and then cisplatin was administered. Honey feeding was continued for another 3 days. Our results show that animals with cisplatin-induced kidney dysfunction, as determined by increased serum creatinine, which received honey feeding had less kidney dysfunction. Improved kidney function was associated with better preservation of kidney morphology in honey-treated group as compared to the cisplatin alone-treated group. Interestingly, honey feeding significantly reduced cisplatin-induced tubular epithelial cell death, immune infiltration into the kidney as well as cytokine and chemokine expression and excretion as compared to cisplatin treated animals. Western blot analysis shows that cisplatin-induced increase in phosphorylation of NFkB was completely suppressed with honey feeding. In conclusion, honey feeding protects the kidney against cisplatin nephrotoxicity through suppression of inflammation and NFkB activation. © 2015 Wiley Publishing Asia Pty Ltd.

Honey feeding protects kidney against cisplatin nephrotoxicity through suppression of inflammation

PubMed Central

Hamad, Rania; Jayakumar, Calpurnia; Ranganathan, Punithavathi; Mohamed, Riyaz; El-Hamamy, Mahmoud Mohamed Ismail; Dessouki, Amina A.; Ibrahim, Abdelazim; Ramesh, Ganesan

2016-01-01

Cisplatin is a highly effective chemotherapeutic drug used to treat a wide variety of solid tumors. However, its use was limited due its dose limiting toxicity to the kidney. Currently, there are no therapies available to treat or prevent cisplatin nephrotoxicity. Honey is a naturally occurring complex liquid and widely used in traditional Ayurvedic medicine to treat many illnesses. However, its effect on cisplatin nephrotoxicity is unknown. To determine the role of honey in cisplatin nephrotoxicity, animals were pretreated orally for a week and then cisplatin was administered. Honey feeding was continued for another three days. Our results show that cisplatin-induced kidney dysfunction as determined by increased serum creatinine. Animals which received honey feeding had less kidney dysfunction. Improved kidney function was associated with better preservation of kidney morphology in honey treated group as compared to cisplatin treated group. Interestingly, honey feeding significantly reduced cisplatin-induced tubular epithelial cell death, immune infiltration into the kidney as well as cytokine and chemokine expression and excretion as compared to cisplatin treated animals. Western blot analysis shows that cisplatin-induced increase in phosphorylation of NFkB was completely suppressed with honey feeding. In conclusion, honey feeding protects the kidney against cisplatin nephrotoxicity through suppression of inflammation and NFkB activation. PMID:26041312

CCL2 is induced by chemotherapy and protects prostate cancer cells from docetaxel - induced cytotoxicity

PubMed Central

Qian, David Z.; Rademacher, Brooks L.S.; Pittsenbarger, Janet; Huang, Chung-Ying; Myrthue, Anne; Higano, Celestia S.; Garzotto, Mark; Nelson, Peter S.; Beer, Tomasz M.

2010-01-01

Background Metastatic prostate cancer is either inherently resistant to chemotherapy or rapidly acquires this phenotype after chemotherapy exposure. In this study, we identified a docetaxel-induced resistance mechanism centered on CCL2. Methods we compared the gene expression profiles in individual human prostate cancer specimens before and after exposure to chemotherapy collected from previously untreated patients who participated in a clinical trial of preoperative chemotherapy. Subsequently, we used the gain- and loss- of function approach in vitro to identify a potential mechanism underlying chemotherapy resistance. Results Among the molecular signatures associated with treatment, several genes that regulate the inflammatory response and chemokine activity were upregulated including a significant increase in transcripts encoding the CC chemokine CCL2. Docetaxel increased CCL2 expression in prostate cancer cell lines in vitro. CCL2 specific siRNA inhibited LNCaP and LAPC4 cell proliferation and enhanced the growth inhibitory effect of low-dose docetaxel. In contrast, overexpression of CCL2 or recombinant CCL2 protein stimulated prostate cancer cell proliferation and rescued cells from docetaxel-induced cytotoxicity. This protective effect of CCL2 was associated with activation of the ERK/MAP kinase and PI3K/AKT, inhibition of docetaxel-induced Bcl2 phosphorylation at serine 70, phosphorylation of Bad, and activation of caspase-3. The addition of a PI3K/AKT inhibitor Ly294002 reversed the CCL2 protection, and was additive to docetaxel induced toxicity. Conclusion These results support a mechanism of chemotherapy resistance mediated by cellular stress responses involving the induction of CCL2 expression, and suggest that inhibiting CCL2 activity could enhance therapeutic responses to taxane-based therapy. PMID:19866475

Potentiated Interaction between Ineffective Doses of Budesonide and Formoterol to Control the Inhaled Cadmium-Induced Up-Regulation of Metalloproteinases and Acute Pulmonary Inflammation in Rats

PubMed Central

Zhang, Wenhui; Zhi, Jianming; Cui, Yongyao; Zhang, Fan; Habyarimana, Adélite; Cambier, Carole; Gustin, Pascal

2014-01-01

The anti-inflammatory properties of glucocorticoids are well known but their protective effects exerted with a low potency against heavy metals-induced pulmonary inflammation remain unclear. In this study, a model of acute pulmonary inflammation induced by a single inhalation of cadmium in male Sprague-Dawley rats was used to investigate whether formoterol can improve the anti-inflammatory effects of budesonide. The cadmium-related inflammatory responses, including matrix metalloproteinase-9 (MMP-9) activity, were evaluated. Compared to the values obtained in rats exposed to cadmium, pretreatment of inhaled budesonide (0.5 mg/15 ml) elicited a significant decrease in total cell and neutrophil counts in bronchoalveolar lavage fluid (BALF) associated with a significant reduction of MMP-9 activity which was highly correlated with the number of inflammatory cells in BALF. Additionally, cadmium-induced lung injuries characterized by inflammatory cell infiltration within alveoli and the interstitium were attenuated by the pre-treatment of budesonide. Though the low concentration of budesonide (0.25 mg/15 ml) exerted a very limited inhibitory effects in the present rat model, its combination with an inefficient concentration of formoterol (0.5 mg/30 ml) showed an enhanced inhibitory effect on neutrophil and total cell counts as well as on the histological lung injuries associated with a potentiation of inhibition on the MMP-9 activity. In conclusion, high concentration of budesonide alone could partially protect the lungs against cadmium exposure induced-acute neutrophilic pulmonary inflammation via the inhibition of MMP-9 activity. The combination with formoterol could enhance the protective effects of both drugs, suggesting a new therapeutic strategy for the treatment of heavy metals-induced lung diseases. PMID:25313925

Investigating the protective effects of aged garlic extract on cyclosporin-induced nephrotoxicity in rats.

PubMed

Wongmekiat, Orawan; Thamprasert, Kamthorn

2005-10-01

Cyclosporin A (CsA) nephrotoxicity has been described in solid organ recipients and in the patients who were treated for autoimmune diseases. Reactive oxygen species-induced oxidative stress and lipid peroxidations are implicated in the pathophysiology of CsA-induced renal injury. Aged garlic extract (AGE) has been reported to exhibit potent antioxidative and free radical scavenging abilities in various disease conditions. The present study was designed to investigate whether AGE could possibly have a protective effect against nephrotoxicity induced by CsA. Male Wistar rats were treated orally with CsA (50 mg/kg/day), CsA + AGE (0.25, 0.5, 1, and 2 g/kg/day started 3 days before the first dose of CsA), or the vehicle of CsA for a period of 10 days. Blood urea nitrogen, serum creatinine, creatinine clearance, and renal histopathological changes were evaluated after 24 h of the last treatment. CsA caused an increase in blood urea nitrogen and serum creatinine by 117 and 100%, respectively, whereas it decreased creatinine clearance by 78% compared with the vehicle-treated rats (all P < 0.001). AGE treatment (0.5, 1 and 2 g/kg) significantly protected animals against CsA-induced biochemical changes, albeit blood urea nitrogen and creatinine clearance in the 0.5 g/kg AGE treated-animals were only partially restored. Kidney sections taken from CsA-treated rats showed severe vacuolations and tubular necrosis. These histopathological changes were markedly improved by pretreatment of rats with AGE at the dose of 0.5--2 g/kg. The results indicate that AGE ameliorates renal dysfunction and morphological changes induced by CsA, and imply that it could be a beneficial remedy for attenuating the CsA nephrotoxicity.

Protective effect of dietary potassium against vascular injury in salt-sensitive hypertension.

PubMed

Kido, Makiko; Ando, Katsuyuki; Onozato, Maristela L; Tojo, Akihiro; Yoshikawa, Masahiro; Ogita, Teruhiko; Fujita, Toshiro

2008-02-01

Hypertensive cardiovascular damage is accelerated by salt loading but counteracted by dietary potassium supplementation. We suggested recently that antioxidant actions of potassium contribute to protection against salt-induced cardiac dysfunction. Therefore, we examined whether potassium supplementation ameliorated cuff-induced vascular injury in salt-sensitive hypertension via suppression of oxidative stress. Four-week-old Dahl salt-sensitive rats were fed a normal-salt (0.3% NaCl), high-salt (8% NaCl), or high-salt plus high-potassium (8% KCl) diet for 5 weeks, and some of the rats fed a high-salt diet were also given antioxidants. One week after the start of the treatments, a silicone cuff was implanted around the femoral artery. Examination revealed increased cuff-induced neointimal proliferation with adventitial macrophage infiltration in arteries from salt-loaded Dahl salt-sensitive rats compared with that in arteries from non-salt-loaded animals (intima/media ratio: 0.471+/-0.070 versus 0.302+/-0.037; P<0.05), associated with regional superoxide overproduction and reduced nicotinamide-adenine dinucleotide phosphate oxidase activation and mRNA overexpression. On the other hand, simultaneous potassium supplementation attenuated salt-induced neointimal hyperplasia (intima/media ratio: 0.205+/-0.012; P<0.001), adventitial macrophage infiltration, superoxide overproduction, and reduced nicotinamide-adenine dinucleotide phosphate oxidase activation and overexpression. Antioxidants, which decrease vascular oxidative stress, also reduced neointima formation induced by salt excess. In conclusion, high-potassium diets seems to have a protective effect against the development of vascular damage induced by salt loading mediated, at least in part, through suppression of the production of reactive oxygen species probably generated by reduced nicotinamide-adenine dinucleotide phosphate oxidase.

Lycium barbarum Polysaccharides Protect Rat Corneal Epithelial Cells against Ultraviolet B-Induced Apoptosis by Attenuating the Mitochondrial Pathway and Inhibiting JNK Phosphorylation.

PubMed

Du, Shaobo; Han, Biao; Li, Kang; Zhang, Xuan; Sha, Xueli; Gao, Lan

2017-01-01

Lycium barbarum polysaccharides (LBPs) have been shown to play a key role in protecting the eyes by reducing the apoptosis induced by certain types of damage. However, it is not known whether LBPs can protect damaged corneal cells from apoptosis. Moreover, no reports have focused on the role of LBPs in guarding against ultraviolet B- (UVB-) induced apoptosis. The present study aimed to investigate the protective effect and underlying mechanism of LBPs against UVB-induced apoptosis in rat corneal epithelial (RCE) cells. The results showed that LBPs significantly prevented the loss of cell viability and inhibited cell apoptosis induced by UVB in RCE cells. LBPs also inhibited UVB-induced loss of mitochondrial membrane potential, downregulation of Bcl-2 , and upregulation of Bax and caspase-3. Finally, LBPs attenuated the phosphorylation of c-Jun NH 2 -terminal kinase (JNK) triggered by UVB. In summary, LBPs protect RCE cells against UVB-induced damage and apoptosis, and the underlying mechanism involves the attenuation of the mitochondrial apoptosis pathway and the inhibition of JNK phosphorylation.

Attenuation of 2,3,7,8-tetrachlorodibenzo-p-dioxin toxicity by resveratrol: a comparative study with different routes of administration.

PubMed

Ishida, Takumi; Takeda, Tomoki; Koga, Takayuki; Yahata, Masahiro; Ike, Ayako; Kuramoto, Chihiro; Taketoh, Junko; Hashiguchi, Isamu; Akamine, Akifumi; Ishii, Yuji; Yamada, Hideyuki

2009-05-01

The activation of aryl hydrocarbon receptor with 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) is known to be antagonized by co-treatment with resveratrol. However, such a protective effect has been suggested from studies using subcutaneous injection of this polyphenol. To evaluate the practical usefulness of resveratrol, this study examined the protective effect of oral resveratrol on the sub-acute toxic effects of TCDD in C57BL/6J mice. A TCDD-induced wasting syndrome was not alleviated by treating mice for 28 d with oral resveratrol. However, subcutaneous injection of resveratrol for 5 d significantly improved the symptoms. Neither oral nor subcutaneous administration of resveratrol alleviated TCDD-induced hepatomegaly and thymic atrophy. Steatosis produced by TCDD was markedly counteracted by co-treatment with oral resveratrol, whereas resveratrol injected subcutaneously had no effect. The reason for the lack of protective effect via the latter dosing route was assumed to be due to the minor accumulation of hepatic lipids 5 d after TCDD treatment. To clarify the mechanisms, the activity of ethoxyresorufin O-deethylase and the content of thiobarbituric acid-reactive substances in the liver were measured. Both indices increased by TCDD treatment were significantly suppressed by subcutaneous injection of resveratrol. In contrast, oral resveratrol failed to rescue them. In agreement with the greater protective effects of subcutaneously-injected resveratrol, pharmacokinetic studies indicated that the area under the curve extrapolated to infinity (AUC(infinity)) was 8.2-times greater following subcutaneous injection compared with oral administration. These data suggest that 1) oral resveratrol is attractive candidate as an agent capable of combating dioxin toxicity and 2) increasing the bioavailability of this polyphenol enhances its protective effect.

CETP Expression Protects Female Mice from Obesity-Induced Decline in Exercise Capacity.

PubMed

Cappel, David A; Lantier, Louise; Palmisano, Brian T; Wasserman, David H; Stafford, John M

2015-01-01

Pharmacological approaches to reduce obesity have not resulted in dramatic reductions in the risk of coronary heart disease (CHD). Exercise, in contrast, reduces CHD risk even in the setting of obesity. Cholesteryl Ester Transfer Protein (CETP) is a lipid transfer protein that shuttles lipids between serum lipoproteins and tissues. There are sexual-dimorphisms in the effects of CETP in humans. Mice naturally lack CETP, but we previously reported that transgenic expression of CETP increases muscle glycolysis in fasting and protects against insulin resistance with high-fat diet (HFD) feeding in female but not male mice. Since glycolysis provides an important energy source for working muscle, we aimed to define if CETP expression protects against the decline in exercise capacity associated with obesity. We measured exercise capacity in female mice that were fed a chow diet and then switched to a HFD. There was no difference in exercise capacity between lean, chow-fed CETP female mice and their non-transgenic littermates. Female CETP transgenic mice were relatively protected against the decline in exercise capacity caused by obesity compared to WT. Despite gaining similar fat mass after 6 weeks of HFD-feeding, female CETP mice showed a nearly two-fold increase in run distance compared to WT. After an additional 6 weeks of HFD-feeding, mice were subjected to a final exercise bout and muscle mitochondria were isolated. We found that improved exercise capacity in CETP mice corresponded with increased muscle mitochondrial oxidative capacity, and increased expression of peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α). These results suggest that CETP can protect against the obesity-induced impairment in exercise capacity and may be a target to improve exercise capacity in the context of obesity.

CETP Expression Protects Female Mice from Obesity-Induced Decline in Exercise Capacity

PubMed Central

Cappel, David A.; Lantier, Louise; Palmisano, Brian T.; Wasserman, David H.; Stafford, John M.

2015-01-01

Pharmacological approaches to reduce obesity have not resulted in dramatic reductions in the risk of coronary heart disease (CHD). Exercise, in contrast, reduces CHD risk even in the setting of obesity. Cholesteryl Ester Transfer Protein (CETP) is a lipid transfer protein that shuttles lipids between serum lipoproteins and tissues. There are sexual-dimorphisms in the effects of CETP in humans. Mice naturally lack CETP, but we previously reported that transgenic expression of CETP increases muscle glycolysis in fasting and protects against insulin resistance with high-fat diet (HFD) feeding in female but not male mice. Since glycolysis provides an important energy source for working muscle, we aimed to define if CETP expression protects against the decline in exercise capacity associated with obesity. We measured exercise capacity in female mice that were fed a chow diet and then switched to a HFD. There was no difference in exercise capacity between lean, chow-fed CETP female mice and their non-transgenic littermates. Female CETP transgenic mice were relatively protected against the decline in exercise capacity caused by obesity compared to WT. Despite gaining similar fat mass after 6 weeks of HFD-feeding, female CETP mice showed a nearly two-fold increase in run distance compared to WT. After an additional 6 weeks of HFD-feeding, mice were subjected to a final exercise bout and muscle mitochondria were isolated. We found that improved exercise capacity in CETP mice corresponded with increased muscle mitochondrial oxidative capacity, and increased expression of peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α). These results suggest that CETP can protect against the obesity-induced impairment in exercise capacity and may be a target to improve exercise capacity in the context of obesity. PMID:26313355

Cardio-protection of ultrafine granular powder for Salvia miltiorrhiza Bunge against myocardial infarction.

PubMed

Wang, Linlin; Li, Yuanmin; Deng, Wen; Dong, Zhihui; Li, Xue; Liu, Dan; Zhao, Lijie; Fu, Weiguo; Cho, Kenka; Niu, Huaying; Guo, Dean; Cheng, Jinle; Jiang, Baohong

2018-08-10

Myocardial infarction (MI) is considered as the major inducer to the morbidity and mortality related to coronary occlusion. Salvia miltiorrhiza Bunge is widely applied in the clinic for the prevention and treatment of heart diseases. The preparation of traditional herb decoction (THD) is not only time consuming but also difficult to keep uniform for every time. New usage form of Salvia miltiorrhiza Bunge with characteristics of convenience, uniform and efficiency is needed. The aims of present study were to investigate the cardio-protection of ultrafine granular powder (UGP) of Salvia miltiorrhiza Bunge; and further compare the characteristics of UGP with THD. MI was induced by ligation of the left anterior descending coronary artery near the main pulmonary artery. Cardio-protection of UGP or THD was evaluated based on two sets of experiments, one was acute myocardial infarction (AMI) through 7 days preventive administration, and the other one was chronic cardiac remodeling through 28 days therapeutic administration. Hemodynamic measurement was conducted to evaluate heart function and histopathological detection was used to evaluate heart structure. No significant improvement of heart structure and function was detected for preventive administration of UGP or THD on AMI rats. While, more significant improvements on left ventricular systolic and diastolic function were detected with therapeutic treatment with 0.81 g/kg UGP than same dose of THD on rats against chronic cardiac remodeling. Both UGP and THD showed the protective effects on heart structure, especially against fibrosis with long-term therapeutic treatment. As a new usage form of Salvia miltiorrhiza Bunge, UGP showed significant cardio-protection against myocardial remodeling with therapeutic treatment. Comparing with THD, UGP also holds the advantages of uniform, convenience and efficiency. Copyright © 2018 Elsevier B.V. All rights reserved.

Status epilepticus induction has prolonged effects on the efficacy of antiepileptic drugs in the 6-Hz seizure model.

PubMed

Leclercq, Karine; Kaminski, Rafal M

2015-08-01

Several factors may influence the efficacy of antiepileptic drugs (AEDs) in patients with epilepsy, and treatment resistance could be related to genetics, neuronal network alterations, and modification of drug transporters or targets. Consequently, preclinical models used for the identification of potential new, more efficacious AEDs should reflect at least a few of these factors. Previous studies indicate that induction of status epilepticus (SE) may alter drug efficacy and that this effect could be long-lasting. In this context, we wanted to assess the protective effects of mechanistically diverse AEDs in mice subjected to pilocarpine-induced SE in another seizure model. We first determined seizure thresholds in mice subjected to pilocarpine-induced SE in the 6-Hz model, 2 weeks and 8 weeks following SE. We then evaluated the protective effects of mechanistically diverse AEDs in post-SE and control animals. No major differences in 6-Hz seizure susceptibility were observed between control groups, while the seizure threshold of pilocarpine mice at 8 weeks after SE was higher than at 2 weeks and higher than in control groups. Treatment with AEDs revealed major differences in drug response depending on their mechanism of action. Diazepam produced a dose-dependent protection against 6-Hz seizures in control and pilocarpine mice, both at 2 weeks and 8 weeks after SE, but with a more pronounced increase in potency in post-SE animals at 2 weeks. Levetiracetam induced a potent and dose-dependent protection in pilocarpine mice, 2 weeks after SE, while its protective effects were observed only at much higher doses in control mice. Its potency decreased in post-SE mice at 8 weeks and was very limited (30% protection at the highest tested dose) in the control group. Carbamazepine induced a dose-dependent protection at 2 weeks in control mice but only limited effect (50% at the highest tested dose) in pilocarpine mice. Its efficacy deeply decreased in post-SE mice at 8 weeks after SE. Perampanel and phenytoin showed almost comparable protective effects in all groups of mice. These experiments confirm that prior SE may have an impact on both potency and efficacy of AEDs and indicate that this effect may be dependent on the underlying epileptogenic processes. This article is part of a Special Issue entitled "Status Epilepticus". Copyright © 2015 Elsevier Inc. All rights reserved.

Ghrelin ameliorates acute lung injury induced by oleic acid via inhibition of endoplasmic reticulum stress.

PubMed

Tian, Xiuli; Liu, Zhijun; Yu, Ting; Yang, Haitao; Feng, Linlin

2018-03-01

Acute lung injury (ALI) is associated with excessive mortality and lacks appropriate therapy. Ghrelin is a novel peptide that protects the lung against ALI. This study aimed to investigate whether endoplasmic reticulum stress (ERS) mediates the protective effect of ghrelin on ALI. We used a rat oleic acid (OA)-induced ALI model. Pulmonary impairment was detected by hematoxylin and eosin (HE) staining, lung mechanics, wet/dry weight ratio, and arterial blood gas analysis. Plasma and lung content of ghrelin was examined by ELISA, and mRNA expression was measured by quantitative real-time PCR. Protein levels were detected by western blot. Rats with OA treatment showed significant pulmonary injury, edema, inflammatory cellular infiltration, cytokine release, hypoxia and CO 2 retention as compared with controls. Plasma and pulmonary content of ghrelin was reduced in rats with ALI, and mRNA expression was downregulated. Ghrelin (10nmol/kg) treatment ameliorated the above symptoms, but treatment with the ghrelin antagonists D-Lys 3 GHRP-6 (1μmol/kg) and JMV 2959 (6mg/kg) exacerbated the symptoms. ERS induced by OA was prevented by ghrelin and augmented by ghrelin antagonist treatment. The ERS inducer, tunicamycin (Tm) prevented the ameliorative effect of ghrelin on ALI. The decreased ratio of p-Akt and Akt induced by OA was improved by ghrelin treatment, and was further exacerbated by ghrelin antagonists. Ghrelin protects against ALI by inhibiting ERS. These results provide a new target for prevention and therapy of ALI. Copyright © 2017 Elsevier Inc. All rights reserved.

Attenuated Escherichia coli strains expressing the colonization factor antigen I (CFA/I) and a detoxified heat-labile enterotoxin (LThK63) enhance clearance of ETEC from the lungs of mice and protect mice from intestinal ETEC colonization and LT-induced fluid accumulation.

PubMed

Byrd, Wyatt; Boedeker, Edgar C

2013-03-15

Although enterotoxigenic Escherichia coli (ETEC) infections are important causes of infantile and traveler's diarrhea there is no licensed vaccine available for those at-risk. Our goal is to develop a safe, live attenuated ETEC vaccine. We used an attenuated E. coli strain (O157:H7, Δ-intimin, Stx1-neg, Stx2-neg) as a vector (ZCR533) to prepare two vaccine strains, one strain expressing colonization factor antigen I (ZCR533-CFA/I) and one strain expressing CFA/I and a detoxified heat-labile enterotoxin (ZCR533-CFA/I+LThK63) to deliver ETEC antigens to mucosal sites in BALB/c mice. Following intranasal and intragastric immunization with the vaccine strains, serum IgG and IgA antibodies were measured to the CFA/I antigen, however, only serum IgG antibodies were detected to the heat-labile enterotoxin. Intranasal administration of the vaccine strains induced respiratory and intestinal antibody responses to the CFA/I and LT antigens, while intragastric administration induced only intestinal antibody responses with no respiratory antibodies detected to the CFA/I and LT antigens. Mice immunized intranasally with the vaccine strains showed enhanced clearance of wild-type (wt) ETEC bacteria from the lungs. Mice immunized intranasally and intragastrically with the vaccine strains were protected from intestinal colonization following oral challenge with ETEC wt bacteria. Mice immunized intragastrically with the ZCR533-CFA/I+LThK63 vaccine strain had less fluid accumulate in their intestine following challenge with ETEC wt bacteria or with purified LT as compared to the sham mice indicating that the immunized mice were protected from LT-induced intestinal fluid accumulation. Thus, mice intragastrically immunized with the ZCR533-CFA/I+LThK63 vaccine strain were able to effectively neutralize the activity of the LT enterotoxin. However, no difference in intestinal fluid accumulation was detected in the mice immunized intranasally with the vaccine strain as compared to the sham mice as the immunized mice induced insufficient intestinal anti-LT antibody to neutralize the activity of the enterotoxin. These results show that our ETEC vaccine induced serum and mucosal antibody responses to CFA/I and LT after mucosal administration which then acted to protect the immunized mice against lung and intestinal colonization, as well as, intestinal fluid accumulation. Copyright © 2012 Elsevier B.V. All rights reserved.

Ebolavirus Glycoprotein Fc Fusion Protein Protects Guinea Pigs against Lethal Challenge.

PubMed

Konduru, Krishnamurthy; Shurtleff, Amy C; Bradfute, Steven B; Nakamura, Siham; Bavari, Sina; Kaplan, Gerardo

2016-01-01

Ebola virus (EBOV), a member of the Filoviridae that can cause severe hemorrhagic fever in humans and nonhuman primates, poses a significant threat to the public health. Currently, there are no licensed vaccines or therapeutics to prevent and treat EBOV infection. Several vaccines based on the EBOV glycoprotein (GP) are under development, including vectored, virus-like particles, and protein-based subunit vaccines. We previously demonstrated that a subunit vaccine containing the extracellular domain of the Ebola ebolavirus (EBOV) GP fused to the Fc fragment of human IgG1 (EBOVgp-Fc) protected mice against EBOV lethal challenge. Here, we show that the EBOVgp-Fc vaccine formulated with QS-21, alum, or polyinosinic-polycytidylic acid-poly-L-lysine carboxymethylcellulose (poly-ICLC) adjuvants induced strong humoral immune responses in guinea pigs. The vaccinated animals developed anti-GP total antibody titers of approximately 105-106 and neutralizing antibody titers of approximately 103 as assessed by a BSL-2 neutralization assay based on vesicular stomatitis virus (VSV) pseudotypes. The poly-ICLC formulated EBOVgp-Fc vaccine protected all the guinea pigs against EBOV lethal challenge performed under BSL-4 conditions whereas the same vaccine formulated with QS-21 or alum only induced partial protection. Vaccination with a mucin-deleted EBOVgp-Fc construct formulated with QS-21 adjuvant did not have a significant effect in anti-GP antibody levels and protection against EBOV lethal challenge compared to the full-length GP construct. The bulk of the humoral response induced by the EBOVgp-Fc vaccine was directed against epitopes outside the EBOV mucin region. Our findings indicate that different adjuvants can eliciting varying levels of protection against lethal EBOV challenge in guinea pigs vaccinated with EBOVgp-Fc, and suggest that levels of total anti-GP antibodies elicit by protein-based GP subunit vaccines do not correlate with protection. Our data further support the development of Fc fusions of GP as a candidate vaccine for human use.

Ebolavirus Glycoprotein Fc Fusion Protein Protects Guinea Pigs against Lethal Challenge

DOE PAGES

Konduru, Krishnamurthy; Shurtleff, Amy C.; Bradfute, Steven B.; ...

2016-09-13

Ebola virus (EBOV), a member of the Filoviridae that can cause severe hemorrhagic fever in humans and nonhuman primates, poses a significant threat to the public health. Currently, there are no licensed vaccines or therapeutics to prevent and treat EBOV infection. Several vaccines based on the EBOV glycoprotein (GP) are under development, including vectored, virus-like particles, and protein-based subunit vaccines. We previously demonstrated that a subunit vaccine containing the extracellular domain of the Ebola ebolavirus (EBOV) GP fused to the Fc fragment of human IgG1 (EBOVgp-Fc) protected mice against EBOV lethal challenge. Here, we show that the EBOVgp-Fc vaccine formulatedmore » with QS-21, alum, or polyinosinic-polycytidylic acid-poly-L-lysine carboxymethylcellulose (poly-ICLC) adjuvants induced strong humoral immune responses in guinea pigs. The vaccinated animals developed anti-GP total antibody titers of approximately 10 5–10 6 and neutralizing antibody titers of approximately 10 3 as assessed by a BSL-2 neutralization assay based on vesicular stomatitis virus (VSV) pseudotypes. The poly-ICLC formulated EBOVgp-Fc vaccine protected all the guinea pigs against EBOV lethal challenge performed under BSL-4 conditions whereas the same vaccine formulated with QS-21 or alum only induced partial protection. Vaccination with a mucin-deletedEBOVgp-Fc construct formulated with QS-21 adjuvant did not have a significant effect in anti-GP antibody levels and protection against EBOV lethal challenge compared to the full-lengthGP construct. The bulk of the humoral response induced by the EBOVgp-Fc vaccine was directed against epitopes outside the EBOV mucin region. Our findings indicate that different adjuvants can eliciting varying levels of protection against lethal EBOV challenge in guinea pigs vaccinated with EBOVgp-Fc,and suggest that levels of total anti-GP antibodies elicit by protein-based GP subunit vaccines do not correlate with protection. In conclusion, our data further support the development of Fc fusions of GP as a candidate vaccine for human use.« less

Ebolavirus Glycoprotein Fc Fusion Protein Protects Guinea Pigs against Lethal Challenge

PubMed Central

Konduru, Krishnamurthy; Shurtleff, Amy C.; Bradfute, Steven B.; Nakamura, Siham; Bavari, Sina; Kaplan, Gerardo

2016-01-01

Ebola virus (EBOV), a member of the Filoviridae that can cause severe hemorrhagic fever in humans and nonhuman primates, poses a significant threat to the public health. Currently, there are no licensed vaccines or therapeutics to prevent and treat EBOV infection. Several vaccines based on the EBOV glycoprotein (GP) are under development, including vectored, virus-like particles, and protein-based subunit vaccines. We previously demonstrated that a subunit vaccine containing the extracellular domain of the Ebola ebolavirus (EBOV) GP fused to the Fc fragment of human IgG1 (EBOVgp-Fc) protected mice against EBOV lethal challenge. Here, we show that the EBOVgp-Fc vaccine formulated with QS-21, alum, or polyinosinic-polycytidylic acid-poly-L-lysine carboxymethylcellulose (poly-ICLC) adjuvants induced strong humoral immune responses in guinea pigs. The vaccinated animals developed anti-GP total antibody titers of approximately 105−106 and neutralizing antibody titers of approximately 103 as assessed by a BSL-2 neutralization assay based on vesicular stomatitis virus (VSV) pseudotypes. The poly-ICLC formulated EBOVgp-Fc vaccine protected all the guinea pigs against EBOV lethal challenge performed under BSL-4 conditions whereas the same vaccine formulated with QS-21 or alum only induced partial protection. Vaccination with a mucin-deleted EBOVgp-Fc construct formulated with QS-21 adjuvant did not have a significant effect in anti-GP antibody levels and protection against EBOV lethal challenge compared to the full-length GP construct. The bulk of the humoral response induced by the EBOVgp-Fc vaccine was directed against epitopes outside the EBOV mucin region. Our findings indicate that different adjuvants can eliciting varying levels of protection against lethal EBOV challenge in guinea pigs vaccinated with EBOVgp-Fc, and suggest that levels of total anti-GP antibodies elicit by protein-based GP subunit vaccines do not correlate with protection. Our data further support the development of Fc fusions of GP as a candidate vaccine for human use. PMID:27622456

Protective Vaccination against Blood-Stage Malaria of Plasmodium chabaudi: Differential Gene Expression in the Liver of Balb/c Mice toward the End of Crisis Phase

PubMed Central

Al-Quraishy, Saleh A.; Dkhil, Mohamed A.; Abdel-Baki, Abdel-Azeem A.; Delic, Denis; Wunderlich, Frank

2016-01-01

Protective vaccination induces self-healing of otherwise fatal blood-stage malaria of Plasmodium chabaudi in female Balb/c mice. To trace processes critically involved in self-healing, the liver, an effector against blood-stage malaria, is analyzed for possible changes of its transcriptome in vaccination-protected in comparison to non-protected mice toward the end of the crisis phase. Gene expression microarray analyses reveal that vaccination does not affect constitutive expression of mRNA and lincRNA. However, malaria induces significant (p < 0.01) differences in hepatic gene and lincRNA expression in vaccination-protected vs. non-vaccinated mice toward the end of crisis phase. In vaccination-protected mice, infections induce up-regulations of 276 genes and 40 lincRNAs and down-regulations of 200 genes and 43 lincRNAs, respectively, by >3-fold as compared to the corresponding constitutive expressions. Massive up-regulations, partly by >100-fold, are found for genes as RhD, Add2, Ank1, Ermap, and Slc4a, which encode proteins of erythrocytic surface membranes, and as Gata1 and Gfi1b, which encode transcription factors involved in erythrocytic development. Also, Cldn13 previously predicted to be expressed on erythroblast surfaces is up-regulated by >200-fold, though claudins are known as main constituents of tight junctions acting as paracellular barriers between epithelial cells. Other genes are up-regulated by <100- and >10-fold, which can be subgrouped in genes encoding proteins known to be involved in mitosis, in cell cycle regulation, and in DNA repair. Our data suggest that protective vaccination enables the liver to respond to P. chabaudi infections with accelerated regeneration and extramedullary erythropoiesis during crisis, which contributes to survival of otherwise lethal blood-stage malaria. PMID:27471498

Ebolavirus Glycoprotein Fc Fusion Protein Protects Guinea Pigs against Lethal Challenge

DOE Office of Scientific and Technical Information (OSTI.GOV)

Konduru, Krishnamurthy; Shurtleff, Amy C.; Bradfute, Steven B.

Ebola virus (EBOV), a member of the Filoviridae that can cause severe hemorrhagic fever in humans and nonhuman primates, poses a significant threat to the public health. Currently, there are no licensed vaccines or therapeutics to prevent and treat EBOV infection. Several vaccines based on the EBOV glycoprotein (GP) are under development, including vectored, virus-like particles, and protein-based subunit vaccines. We previously demonstrated that a subunit vaccine containing the extracellular domain of the Ebola ebolavirus (EBOV) GP fused to the Fc fragment of human IgG1 (EBOVgp-Fc) protected mice against EBOV lethal challenge. Here, we show that the EBOVgp-Fc vaccine formulatedmore » with QS-21, alum, or polyinosinic-polycytidylic acid-poly-L-lysine carboxymethylcellulose (poly-ICLC) adjuvants induced strong humoral immune responses in guinea pigs. The vaccinated animals developed anti-GP total antibody titers of approximately 10 5–10 6 and neutralizing antibody titers of approximately 10 3 as assessed by a BSL-2 neutralization assay based on vesicular stomatitis virus (VSV) pseudotypes. The poly-ICLC formulated EBOVgp-Fc vaccine protected all the guinea pigs against EBOV lethal challenge performed under BSL-4 conditions whereas the same vaccine formulated with QS-21 or alum only induced partial protection. Vaccination with a mucin-deletedEBOVgp-Fc construct formulated with QS-21 adjuvant did not have a significant effect in anti-GP antibody levels and protection against EBOV lethal challenge compared to the full-lengthGP construct. The bulk of the humoral response induced by the EBOVgp-Fc vaccine was directed against epitopes outside the EBOV mucin region. Our findings indicate that different adjuvants can eliciting varying levels of protection against lethal EBOV challenge in guinea pigs vaccinated with EBOVgp-Fc,and suggest that levels of total anti-GP antibodies elicit by protein-based GP subunit vaccines do not correlate with protection. In conclusion, our data further support the development of Fc fusions of GP as a candidate vaccine for human use.« less

Comparison between conventional protective mechanical ventilation and high-frequency oscillatory ventilation associated with the prone position.

PubMed

Fioretto, José Roberto; Klefens, Susiane Oliveira; Pires, Rafaelle Fernandes; Kurokawa, Cilmery Suemi; Carpi, Mario Ferreira; Bonatto, Rossano César; Moraes, Marcos Aurélio; Ronchi, Carlos Fernando

2017-01-01

To compare the effects of high-frequency oscillatory ventilation and conventional protective mechanical ventilation associated with the prone position on oxygenation, histology and pulmonary oxidative damage in an experimental model of acute lung injury. Forty-five rabbits with tracheostomy and vascular access were underwent mechanical ventilation. Acute lung injury was induced by tracheal infusion of warm saline. Three experimental groups were formed: healthy animals + conventional protective mechanical ventilation, supine position (Control Group; n = 15); animals with acute lung injury + conventional protective mechanical ventilation, prone position (CMVG; n = 15); and animals with acute lung injury + high-frequency oscillatory ventilation, prone position (HFOG; n = 15). Ten minutes after the beginning of the specific ventilation of each group, arterial gasometry was collected, with this timepoint being called time zero, after which the animal was placed in prone position and remained in this position for 4 hours. Oxidative stress was evaluated by the total antioxidant performance assay. Pulmonary tissue injury was determined by histopathological score. The level of significance was 5%. Both groups with acute lung injury showed worsening of oxygenation after induction of injury compared with the Control Group. After 4 hours, there was a significant improvement in oxygenation in the HFOG group compared with CMVG. Analysis of total antioxidant performance in plasma showed greater protection in HFOG. HFOG had a lower histopathological lesion score in lung tissue than CMVG. High-frequency oscillatory ventilation, associated with prone position, improves oxygenation and attenuates oxidative damage and histopathological lung injury compared with conventional protective mechanical ventilation.