Sample records for induce consistent t-cell

  1. Thymus function in drug-induced lupus.

    PubMed

    Rubin, R L; Salomon, D R; Guerrero, R S

    2001-01-01

    Autoimmunity develops when a lupus-inducing drug is introduced into the thymus of normal mice, but the relevance of this model to the human disorder is unclear in part because it is widely assumed that the thymus is non-functional in the adult. We compared thymus function in 10 patients with symptomatic procainamide-induced lupus to that in 13 asymptomatic patients who only developed drug-induced autoantibodies. T cell output from the thymus was quantified using a competitive polymerase chain reaction that detects T cell receptor DNA excision circles in peripheral blood lymphocytes. Despite the advanced age of the patient population under study, newly generated T cells were detected in all subjects. Although there was no overall quantitative difference between the symptomatic and asymptomatic patients, we found a positive correlation between the level of T cell receptor excision circles in peripheral lymphocytes and serum IgG anti-chromatin antibody activity in patients with drug-induced lupus. The association between autoantibodies and nascent peripheral T cells supports the requirement for T cells in autoantibody production. Our observations are consistent with findings in mice in which autoreactive T cells derived from drug-induced abnormalities in T cell development in the thymus.

  2. Low Antigen Dose in Adjuvant-Based Vaccination Selectively Induces CD4 T Cells with Enhanced Functional Avidity and Protective Efficacy

    PubMed Central

    Wang, Yichuan; Solaymani-Mohammadi, Shahram; Frey, Blake; Kulkarni, Shweta; Andersen, Peter; Agger, Else Marie; Sui, Yongjun

    2017-01-01

    T cells with high functional avidity can sense and respond to low levels of cognate Ag, a characteristic that is associated with more potent responses against tumors and many infections, including HIV. Although an important determinant of T cell efficacy, it has proven difficult to selectively induce T cells of high functional avidity through vaccination. Attempts to induce high-avidity T cells by low-dose in vivo vaccination failed because this strategy simply gave no response. Instead, selective induction of high-avidity T cells has required in vitro culturing of specific T cells with low Ag concentrations. In this study, we combined low vaccine Ag doses with a novel potent cationic liposomal adjuvant, cationic adjuvant formulation 09, consisting of dimethyldioctadecylammonium liposomes incorporating two immunomodulators (monomycolyl glycerol analog and polyinosinic-polycytidylic acid) that efficiently induces CD4 Th cells, as well as cross-primes CD8 CTL responses. We show that vaccination with low Ag dose selectively primes CD4 T cells of higher functional avidity, whereas CD8 T cell functional avidity was unrelated to vaccine dose in mice. Importantly, CD4 T cells of higher functional avidity induced by low-dose vaccinations showed higher cytokine release per cell and lower inhibitory receptor expression (PD-1, CTLA-4, and the apoptosis-inducing Fas death receptor) compared with their lower-avidity CD4 counterparts. Notably, increased functional CD4 T cell avidity improved antiviral efficacy of CD8 T cells. These data suggest that potent adjuvants, such as cationic adjuvant formulation 09, render low-dose vaccination a feasible and promising approach for generating high-avidity T cells through vaccination. PMID:28348274

  3. Comparative phenotypic and functional analysis of migratory dendritic cell subsets from human oral mucosa and skin

    PubMed Central

    van de Ven, Rieneke; Thon, Maria; Gibbs, Susan; de Gruijl, Tanja D.

    2017-01-01

    Antigen exposure to oral mucosa is generally thought to lead to immune tolerance induction. However, very little is known about the subset composition and function of dendritic cells (DC) migrating from human oral mucosa. Here we show that migratory DC from healthy human gingival explants consist of the same phenotypic subsets in the same frequency distribution as DC migrating from human skin. The gingival CD1a+ Langerhans cell and interstitial DC subsets lacked CXCR4 expression in contrast to their cutaneous counterparts, pointing to different migration mechanisms, consistent with previous observations in constructed skin and gingival equivalents. Remarkably, without any exogenous conditioning, gingival explants released higher levels of inflammatory cytokines than human skin explants, resulting in higher DC migration rates and a superior ability of migrated DC to prime allogeneic T cells and to induce type-1 effector T cell differentiation. From these observations we conclude that rather than an intrinsic ability to induce T cell tolerance, DC migrating from oral mucosa may have a propensity to induce effector T cell immunity and maintain a high state of alert against possible pathogenic intruders in the steady state. These findings may have implications for oral immunization strategies. PMID:28704477

  4. An inducible caspase 9 safety switch for T-cell therapy

    PubMed Central

    Straathof, Karin C.; Pulè, Martin A.; Yotnda, Patricia; Dotti, Gianpietro; Vanin, Elio F.; Brenner, Malcolm K.; Heslop, Helen E.; Spencer, David M.; Rooney, Cliona M.

    2005-01-01

    The efficacy of adoptive T-cell therapy as treatment for malignancies may be enhanced by genetic modification of infused cells. However, oncogenic events due to vector/transgene integration, and toxicities due to the infused cells themselves, have tempered enthusiasm. A safe and efficient means of removing aberrant cells in vivo would ameliorate these concerns. We describe a “safety switch” that can be stably and efficiently expressed in human T cells without impairing phenotype, function, or antigen specificity. This reagent is based on a modified human caspase 9 fused to a human FK506 binding protein (FKBP) to allow conditional dimerization using a small molecule pharmaceutical. A single 10-nM dose of synthetic dimerizer drug induces apoptosis in 99% of transduced cells selected for high transgene expression in vitro and in vivo. This system has several advantages over currently available suicide genes. First, it consists of human gene products with low potential immunogenicity. Second, administration of dimerizer drug has no effects other than the selective elimination of transduced T cells. Third, inducible caspase 9 maintains function in T cells overexpressing antiapoptotic molecules. These characteristics favor incorporation of inducible caspase 9 as a safety feature in human T-cell therapies. PMID:15728125

  5. Depletion of CD8 Memory T Cells for Induction of Tolerance of a Previously Transplanted Kidney Allograft

    PubMed Central

    Koyama, I.; Nadazdin, O.; Boskovic, S.; Ochiai, T.; Smith, R. N.; Sykes, M.; Sogawa, H.; Murakami, T.; Strom, T. B.; Colvin, R. B.; Sachs, D. H.; Benichou, G.; Cosimi, A. B.; Kawai, T.

    2013-01-01

    Heterologous immunologic memory has been considered a potent barrier to tolerance induction in primates. Induction of such tolerance for a previously transplanted organ may be more difficult, because specific memory cells can be induced and activated by a transplanted organ. In the current study, we attempted to induce tolerance to a previously transplanted kidney allograft in nonhuman primates. The conditioning regimen consisted of low dose total body irradiation, thymic irradiation, antithymocyte globulin, and anti- CD154 antibody followed by a brief course of a calcineurin inhibitor. This regimen had been shown to induce mixed chimerism and allograft tolerance when kidney transplantation (KTx) and donor bone marrow transplantation (DBMT) were simultaneously performed. However, the same regimen failed to induce mixed chimerism when delayed DBMT was performed after KTx. We found that significant levels of memory T cells remained after conditioning, despite effective depletion of naïve T cells. By adding humanized anti-CD8 monoclonal antibody (cM-T807), CD8 memory T cells were effectively depleted and these recipients successfully achieved mixed chimerism and tolerance. The current studies provide ‘proof of principle’ that the mixed chimerism approach can induce renal allograft tolerance, even late after organ transplantation if memory T-cell function is adequately controlled. PMID:17286617

  6. TLR4- and TRIF-dependent stimulation of B lymphocytes by peptide liposomes enables T cell-independent isotype switch in mice.

    PubMed

    Pihlgren, Maria; Silva, Alberto B; Madani, Rime; Giriens, Valérie; Waeckerle-Men, Ying; Fettelschoss, Antonia; Hickman, David T; López-Deber, María Pilar; Ndao, Dorin Mlaki; Vukicevic, Marija; Buccarello, Anna Lucia; Gafner, Valérie; Chuard, Nathalie; Reis, Pedro; Piorkowska, Kasia; Pfeifer, Andrea; Kündig, Thomas M; Muhs, Andreas; Johansen, Pål

    2013-01-03

    Immunoglobulin class switching from IgM to IgG in response to peptides is generally T cell-dependent and vaccination in T cell-deficient individuals is inefficient. We show that a vaccine consisting of a dense array of peptides on liposomes induced peptide-specific IgG responses totally independent of T-cell help. Independency was confirmed in mice lacking T cells and in mice deficient for MHC class II, CD40L, and CD28. The IgG titers were high, long-lived, and comparable with titers obtained in wild-type animals, and the antibody response was associated with germinal center formation, expression of activation-induced cytidine deaminase, and affinity maturation. The T cell-independent (TI) IgG response was strictly dependent on ligation of TLR4 receptors on B cells, and concomitant TLR4 and cognate B-cell receptor stimulation was required on a single-cell level. Surprisingly, the IgG class switch was mediated by TIR-domain-containing adapter inducing interferon-β (TRIF), but not by MyD88. This study demonstrates that peptides can induce TI isotype switching when antigen and TLR ligand are assembled and appropriately presented directly to B lymphocytes. A TI vaccine could enable efficient prophylactic and therapeutic vaccination of patients with T-cell deficiencies and find application in diseases where induction of T-cell responses contraindicates vaccination, for example, in Alzheimer disease.

  7. Sepsis-induced alteration in T-cell Ca(2+) signaling in neonatal rats.

    PubMed

    Alattar, M H; Ravindranath, T M; Choudhry, M A; Muraskas, J K; Namak, S Y; Dallal, O; Sayeed, M M

    2001-01-01

    Sepsis-induced suppression in T-cell proliferation follows deranged Ca(2+) signaling in adult rats. In preliminary studies, we observed suppression in T-cell proliferation in septic neonatal rats as well. In this study, we assessed splenic T-cell cytosolic Ca(2+) concentration, [Ca(2+)](i), as its elevation plays an important role in T-cell proliferation. Also, we investigated the role of PGE(2) in sepsis-related changes in T-cell [Ca(2+)](i) in animals pretreated with cyclooxygenase-1 (COX-1) inhibitor (resveratrol) and cyclooxygenase-2 (COX-2) inhibitor (NS-398). Sepsis was induced in 15-day-old rat pups by intraperitoneal implantation of fecal pellets containing Escherichia coli and Bacteroides fragilis. The sham group consisted of pups implanted with sterile fecal pellets. Septic and sham pups were sacrificed 24 h after implantation and their spleens were removed. The spleens from sham and septic pups, along with spleens from unoperated control pups, were processed for single cell suspensions, and T cells were isolated using nylon wool columns. Fura-2 fluorophotometry was employed for the measurement of [Ca(2+)](i) (in nM units) in T cells stimulated with concanavalin A (ConA). Our results show that ConA-mediated T-cell [Ca(2+)](i) response is significantly suppressed in septic neonatal rats. Pretreatment of pups with COX-2, but not COX-1 inhibitor, prevented the decrease in the [Ca(2+)](i) response. These findings suggest that PGE(2) might induce the attenuation in T-cell Ca(2+) signaling during sepsis in neonatal rats. Copyright 2001 S. Karger AG, Basel

  8. Comparable polyfunctionality of ectromelia virus- and vaccinia virus-specific murine T cells despite markedly different in vivo replication and pathogenicity.

    PubMed

    Hersperger, Adam R; Siciliano, Nicholas A; Eisenlohr, Laurence C

    2012-07-01

    Vaccinia virus (VACV) stimulates long-term immunity against highly pathogenic orthopoxvirus infection of humans (smallpox) and mice (mousepox [ectromelia virus {ECTV}]) despite the lack of a natural host-pathogen relationship with either of these species. Previous research revealed that VACV is able to induce polyfunctional CD8(+) T-cell responses after immunization of humans. However, the degree to which the functional profile of T cells induced by VACV is similar to that generated during natural poxvirus infection remains unknown. In this study, we monitored virus-specific T-cell responses following the dermal infection of C57BL/6 mice with ECTV or VACV. Using polychromatic flow cytometry, we measured levels of degranulation, cytokine expression (gamma interferon [IFN-γ], tumor necrosis factor alpha [TNF-α], and interleukin-2 [IL-2]), and the cytolytic mediator granzyme B. We observed that the functional capacities of T cells induced by VACV and ECTV were of a similar quality in spite of the markedly different replication abilities and pathogenic outcomes of these viruses. In general, a significant fraction (≥50%) of all T-cell responses were positive for at least three functions both during acute infection and into the memory phase. In vivo killing assays revealed that CD8(+) T cells specific for both viruses were equally cytolytic (∼80% target cell lysis after 4 h), consistent with the similar levels of granzyme B and degranulation detected among these cells. Collectively, these data provide a mechanism to explain the ability of VACV to induce protective T-cell responses against pathogenic poxviruses in their natural hosts and provide further support for the use of VACV as a vaccine platform able to induce polyfunctional T cells.

  9. CD4+CD62L+ Central Memory T Cells Can Be Converted to Foxp3+ T Cells

    PubMed Central

    Zhang, Xiaolong; Chang Li, Xian; Xiao, Xiang; Sun, Rui; Tian, Zhigang; Wei, Haiming

    2013-01-01

    The peripheral Foxp3+ Treg pool consists of naturally arising Treg (nTreg) and adaptive Treg cells (iTreg). It is well known that naive CD4+ T cells can be readily converted to Foxp3+ iTreg in vitro, and memory CD4+ T cells are resistant to conversion. In this study, we investigated the induction of Foxp3+ T cells from various CD4+ T-cell subsets in human peripheral blood. Though naive CD4+ T cells were readily converted to Foxp3+ T cells with TGF-β and IL-2 treatment in vitro, such Foxp3+ T cells did not express the memory marker CD45RO as do Foxp3+ T cells induced in the peripheral blood of Hepatitis B Virus (HBV) patients. Interestingly, a subset of human memory CD4+ T cells, defined as CD62L+ central memory T cells, could be induced by TGF-β to differentiate into Foxp3+ T cells. It is well known that Foxp3+ T cells derived from human CD4+CD25- T cells in vitro are lack suppressive functions. Our data about the suppressive functions of CD4+CD62L+ central memory T cell-derived Foxp3+ T cells support this conception, and an epigenetic analysis of these cells showed a similar methylation pattern in the FOXP3 Treg-specific demethylated region as the naive CD4+ T cell-derived Foxp3+ T cells. But further research showed that mouse CD4+ central memory T cells also could be induced to differentiate into Foxp3+ T cells, such Foxp3+ T cells could suppress the proliferation of effector T cells. Thus, our study identified CD4+CD62L+ central memory T cells as a novel potential source of iTreg. PMID:24155942

  10. Adoptive transfer of murine T cells expressing a chimeric-PD1-Dap10 receptor as an immunotherapy for lymphoma.

    PubMed

    Lynch, Adam; Hawk, William; Nylen, Emily; Ober, Sean; Autin, Pierre; Barber, Amorette

    2017-11-01

    Adoptive transfer of T cells is a promising cancer therapy and expression of chimeric antigen receptors can enhance tumour recognition and T-cell effector functions. The programmed death protein 1 (PD1) receptor is a prospective target for a chimeric antigen receptor because PD1 ligands are expressed on many cancer types, including lymphoma. Therefore, we developed a murine chimeric PD1 receptor (chPD1) consisting of the PD1 extracellular domain fused to the cytoplasmic domain of CD3ζ. Additionally, chimeric antigen receptor therapies use various co-stimulatory domains to enhance efficacy. Hence, the inclusion of a Dap10 or CD28 co-stimulatory domain in the chPD1 receptor was compared to determine which domain induced optimal anti-tumour immunity in a mouse model of lymphoma. The chPD1 T cells secreted pro-inflammatory cytokines and lysed RMA lymphoma cells. Adoptive transfer of chPD1 T cells significantly reduced established tumours and led to tumour-free survival in lymphoma-bearing mice. When comparing chPD1 receptors containing a Dap10 or CD28 domain, both receptors induced secretion of pro-inflammatory cytokines; however, chPD1-CD28 T cells also secreted anti-inflammatory cytokines whereas chPD1-Dap10 T cells did not. Additionally, chPD1-Dap10 induced a central memory T-cell phenotype compared with chPD1-CD28, which induced an effector memory phenotype. The chPD1-Dap10 T cells also had enhanced in vivo persistence and anti-tumour efficacy compared with chPD1-CD28 T cells. Therefore, adoptive transfer of chPD1 T cells could be a novel therapy for lymphoma and inclusion of the Dap10 co-stimulatory domain in chimeric antigen receptors may induce a preferential cytokine profile and T-cell differentiation phenotype for anti-tumour therapies. © 2017 John Wiley & Sons Ltd.

  11. The Effects of TLR Activation on T-Cell Development and Differentiation

    PubMed Central

    Jin, Bo; Sun, Tao; Yu, Xiao-Hong; Yang, Ying-Xiang; Yeo, Anthony E. T.

    2012-01-01

    Invading pathogens have unique molecular signatures that are recognized by Toll-like receptors (TLRs) resulting in either activation of antigen-presenting cells (APCs) and/or costimulation of T cells inducing both innate and adaptive immunity. TLRs are also involved in T-cell development and can reprogram Treg cells to become helper cells. T cells consist of various subsets, that is, Th1, Th2, Th17, T follicular helper (Tfh), cytotoxic T lymphocytes (CTLs), regulatory T cells (Treg) and these originate from thymic progenitor thymocytes. T-cell receptor (TCR) activation in distinct T-cell subsets with different TLRs results in differing outcomes, for example, activation of TLR4 expressed in T cells promotes suppressive function of regulatory T cells (Treg), while activation of TLR6 expressed in T cells abrogates Treg function. The current state of knowledge of regarding TLR-mediated T-cell development and differentiation is reviewed. PMID:22737174

  12. GM-CSF-Induced Regulatory T cells Selectively Inhibit Anti-Acetylcholine Receptor-Specific Immune Responses in Experimental Myasthenia Gravis

    PubMed Central

    Sheng, Jian Rong; Muthusamy, Thiruppathi; Prabahakar, Bellur S.; Meriggioli, Matthew N.

    2011-01-01

    We and others have demonstrated the ability of granulocyte-macrophage colony-stimulating factor (GM-CSF) to suppress autoimmunity by increasing the number of CD4+CD25+ regulatory T cells (Tregs). In the current study, we have explored the critical role of induced antigen specific Tregs in the therapeutic effects of GM-CSF in murine experimental autoimmune myasthenia gravis (EAMG). Specifically, we show that Tregs from GM-CSF treated EAMG mice (GM-CSF/AChR-induced-Tregs) adoptively transferred into animals with EAMG suppressed clinical disease more potently than equal numbers of Tregs from either GM-CSF untreated EAMG mice or healthy mice treated with GM-CSF. In addition, GM-CSF/AChR-induced-Tregs selectively suppressed antigen specific T cell proliferation induced by AChR relative to that induced by an irrelevant self antigen, (thyroglobulin) and failed to significantly alter T cell proliferation in response to an exogenous antigen (ovalbumin). These results are consistent with the hypothesized mechanism of action of GM-CSF involving the mobilization of tolerogenic dendritic cell precursors which, upon antigen (AChR) capture, suppress the anti-AChR immune response through the induction/expansion of AChR-specific Tregs. PMID:22099723

  13. Antibody induced CD4 down-modulation of T cells is site-specifically mediated by CD64+ cells

    PubMed Central

    Vogel, Stephanie; Grabski, Elena; Buschjäger, Daniela; Klawonn, Frank; Döring, Marius; Wang, Junxi; Fletcher, Erika; Bechmann, Ingo; Witte, Torsten; Durisin, Martin; Schraven, Burkhart; Mangsbo, Sara M.; Schönfeld, Kurt; Czeloth, Niklas; Kalinke, Ulrich

    2015-01-01

    Treatment of PBMC with the CD4-specific mAb BT-061 induces CD4 down-modulation of T cells. Here we report that addition of BT-061 to purified T cells did not confer this effect, whereas incubation of T cells in BT-061 coated wells restored CD4 down-modulation. These results implied that Fcγ receptor mediated cell-cell interactions played a role. In consistence with this hypothesis PBMC depleted of CD64+ monocytes did not confer CD4 down-modulation of BT-061 decorated T cells. Strikingly, CD4 down-modulation was observed in BT-061 treated synovial fluid punctuated from patients’ inflamed joints that comprised enhanced numbers of CD64+ cells. In contrast, in a circulating whole blood system injection of BT-061 did not induce CD4 down-modulation, due to CD64 saturation by serum IgG. Similarly, tonsil derived mononuclear cells devoid of CD64+ cells did not show CD4 down-modulation, whereas addition of blood derived monocytes restored the effect. Thus, the interaction of BT-061 decorated T cells with CD64+ cells is needed for CD4 down-modulation, implying that in patients BT-061 would primarily induce CD4 down-modulation at inflammatory sites. These results highlight the need not only to examine the interaction of a given mAb with single FcγR, but also the immunological environment that is appropriate to support such interactions. PMID:26670584

  14. Metronomic cyclophosphamide eradicates large implanted GL261 gliomas by activating antitumor Cd8+ T-cell responses and immune memory

    PubMed Central

    Wu, Junjie; Waxman, David J

    2015-01-01

    Cancer chemotherapy using cytotoxic drugs can induce immunogenic tumor cell death; however, dosing regimens and schedules that enable single-agent chemotherapy to induce adaptive immune-dependent ablation of large, established tumors with activation of long-term immune memory have not been identified. Here, we investigate this issue in a syngeneic, implanted GL261 glioma model in immune-competent mice given cyclophosphamide on a 6-day repeating metronomic schedule. Two cycles of metronomic cyclophosphamide treatment induced sustained upregulation of tumor-associated CD8+ cytotoxic T lymphocyte (CTL) cells, natural killer (NK) cells, macrophages, and other immune cells. Expression of CTL- and NK–cell-shared effectors peaked on Day 6, and then declined by Day 9 after the second cyclophosphamide injection and correlated inversely with the expression of the regulatory T cell (Treg) marker Foxp3. Sustained tumor regression leading to tumor ablation was achieved after several cyclophosphamide treatment cycles. Tumor ablation required CD8+ T cells, as shown by immunodepletion studies, and was associated with immunity to re-challenge with GL261 glioma cells, but not B16-F10 melanoma or Lewis lung carcinoma cells. Rejection of GL261 tumor re-challenge was associated with elevated CTLs in blood and increased CTL infiltration in tumors, consistent with the induction of long-term, specific CD8+ T-cell anti-GL261 tumor memory. Co-depletion of CD8+ T cells and NK cells did not inhibit tumor regression beyond CD8+ T-cell depletion alone, suggesting that the metronomic cyclophosphamide-activated NK cells function via CD8a+ T cells. Taken together, these findings provide proof-of-concept that single-agent chemotherapy delivered on an optimized metronomic schedule can eradicate large, established tumors and induce long-term immune memory. PMID:26137402

  15. IL-15 signaling promotes adoptive effector T-cell survival and memory formation in irradiation-induced lymphopenia.

    PubMed

    Xu, Aizhang; Bhanumathy, Kalpana Kalyanasundaram; Wu, Jie; Ye, Zhenmin; Freywald, Andrew; Leary, Scot C; Li, Rongxiu; Xiang, Jim

    2016-01-01

    Lymphopenia promotes naïve T-cell homeostatic proliferation and adoptive effector T-cell survival and memory formation. IL-7 plays a critical role in homeostatic proliferation, survival and memory formation of naïve T-cells in lymphopenia, and its underlying molecular mechanism has also been well studied. However, the mechanism for adoptively transferred effector T-cell survival and memory formation is not fully understood. Here, we transferred in vitro-activated transgenic OT-I CD8(+) effector T-cells into irradiation (600 rads)-induced lymphopenic C57BL/6, IL-7 knockout (KO) and IL-15 KO mice, and investigated the survival and memory formation of transferred T-cells in lymphopenia. We demonstrate that transferred T-cells prolong their survival and enhance their memory in lymphopenic mice, in a manner that depends on IL-15 signaling, but not IL-7. We determine that in vitro stimulation of naïve or effector T-cells with IL-7 and IL-15 reduces IL-7Rα, and increases and/or maintains IL-15Rβ expression, respectively. Consistent with these findings, the expression of IL-7Rα and IL-15Rβ is down- and up-regulated, respectively, in vivo on transferred T-cells in an early phase post T-cell transfer in lymphopenia. We further show that in vitro IL-15 restimulation-induced memory T-cells (compared to IL-2 restimulation-induced effector T-cells) and in vivo transferred T-cells in irradiated IL-15-sufficient C57BL/6 mice (compared to IL-15-deficient IL-15 KO mice) have increased mitochondrial content, but less NADH and lower mitochondrial potential (ΔΨm), and demonstrate greater phosphorylation of signal transducers and activators of transcription-5 (STAT5) and Unc-51-like kinase-1 (ULK1), and higher expression of B-cell leukemia/lymphoma-2 (Bcl2) and memory-, autophagy- and mitochondrial biogenesis-related molecules. Irradiation-induced lymphopenia promotes effector T-cell survival via IL-15 signaling the STAT5/Bcl2 pathway, enhances T-cell memory formation via IL-15 activation of the forkhead-box family of transcription factor (FOXO)/eomesodermin (Eomes) memory and ULK1/autophagy-related gene-7 (ATG7) autophagy pathways, and via IL-15 activation of the mitochondrial remodeling. Our data thus identify some important targets to consider when designing potent adoptive T-cell immunotherapies of cancer.

  16. Role of TGF-β1 and nitric oxide in the bystander response of irradiated glioma cells

    PubMed Central

    Shao, C; Folkard, M; Prise, KM

    2010-01-01

    The radiation-induced bystander effect (RIBE) increases the probability of cellular response and therefore has important implications for cancer risk assessment following low-dose irradiation and for the likelihood of secondary cancers after radiotherapy. However, our knowledge of bystander signaling factors, especially those having long half-lives, is still limited. The present study found that, when a fraction of cells within a glioblastoma population were individually irradiated with helium ions from a particle microbeam, the yield of micronuclei (MN) in the nontargeted cells was increased, but these bystander MN were eliminated by treating the cells with either aminoguanidine (an inhibitor of inducible nitric oxide (NO) synthase) or anti-transforming growth factor β1 (anti-TGF-β1), indicating that NO and TGF-β1 are involved in the RIBE. Intracellular NO was detected in the bystander cells, and additional TGF-β1 was detected in the medium from irradiated T98G cells, but it was diminished by aminoguanidine. Consistent with this, an NO donor, diethylamine nitric oxide (DEANO), induced TGF-β1 generation in T98G cells. Conversely, treatment of cells with recombinant TGF-β1 could also induce NO and MN in T98G cells. Treatment of T98G cells with anti-TGF-β1 inhibited the NO production when only 1% of cells were targeted, but not when 100% of cells were targeted. Our results indicate that, downstream of radiation-induced NO, TGF-β1 can be released from targeted T98G cells and plays a key role as a signaling factor in the RIBE by further inducing free radicals and DNA damage in the nontargeted bystander cells. PMID:17621264

  17. Immunostimulatory Activity of the Cytokine-Based Biologic, IRX-2, on Human Papillomavirus-Exposed Langerhans Cells

    PubMed Central

    Da Silva, Diane M.; Woodham, Andrew W.; Naylor, Paul H.; Egan, James E.; Berinstein, Neil L.

    2016-01-01

    Langerhans cells (LCs) are the antigen-presenting cells of the epithelial layer and are responsible for initiating immune responses against skin and mucosa-invading viruses. Human papillomavirus (HPV)-mediated suppression of LC function is a crucial mechanism of HPV immune evasion, which can lead to persistent infection and development of several human cancers, including cervical, anal, and head and neck cancers. The cell-derived cytokine-based biologic, IRX-2, consists of multiple well-defined cytokines and is broadly active on various immune cell subsets. In this study, we investigated primary human LC activation after exposure to HPV16, followed by treatment with IRX-2 in vitro, and evaluated their subsequent ability to induce HPV16-specific T cells. In contrast to its activity on dendritic cells, HPV16 alone is not sufficient to induce phenotypic and functional activation of LCs. However, IRX-2 induces a significant upregulation of antigen presentation and costimulatory molecules, T helper 1 (Th1)-associated cytokine release, and chemokine-directed migration of LCs pre-exposed to HPV16. Furthermore, LCs treated with IRX-2 after HPV16 exposure induced CD8+ T-cell responses against specific HLA-A*0201-binding HPV16 T-cell epitopes. The present study suggests that IRX-2 is an attractive immunomodulator for assisting the immune response in eradication of HPV-infected cells, thereby potentially preventing HPV-induced cancers. PMID:26653678

  18. Immunostimulatory Activity of the Cytokine-Based Biologic, IRX-2, on Human Papillomavirus-Exposed Langerhans Cells.

    PubMed

    Da Silva, Diane M; Woodham, Andrew W; Naylor, Paul H; Egan, James E; Berinstein, Neil L; Kast, W Martin

    2016-05-01

    Langerhans cells (LCs) are the antigen-presenting cells of the epithelial layer and are responsible for initiating immune responses against skin and mucosa-invading viruses. Human papillomavirus (HPV)-mediated suppression of LC function is a crucial mechanism of HPV immune evasion, which can lead to persistent infection and development of several human cancers, including cervical, anal, and head and neck cancers. The cell-derived cytokine-based biologic, IRX-2, consists of multiple well-defined cytokines and is broadly active on various immune cell subsets. In this study, we investigated primary human LC activation after exposure to HPV16, followed by treatment with IRX-2 in vitro, and evaluated their subsequent ability to induce HPV16-specific T cells. In contrast to its activity on dendritic cells, HPV16 alone is not sufficient to induce phenotypic and functional activation of LCs. However, IRX-2 induces a significant upregulation of antigen presentation and costimulatory molecules, T helper 1 (Th1)-associated cytokine release, and chemokine-directed migration of LCs pre-exposed to HPV16. Furthermore, LCs treated with IRX-2 after HPV16 exposure induced CD8(+) T-cell responses against specific HLA-A*0201-binding HPV16 T-cell epitopes. The present study suggests that IRX-2 is an attractive immunomodulator for assisting the immune response in eradication of HPV-infected cells, thereby potentially preventing HPV-induced cancers.

  19. Topical resiquimod can induce disease regression and enhance T-cell effector functions in cutaneous T-cell lymphoma.

    PubMed

    Rook, Alain H; Gelfand, Joel M; Gelfand, Joel C; Wysocka, Maria; Troxel, Andrea B; Benoit, Bernice; Surber, Christian; Elenitsas, Rosalie; Buchanan, Marie A; Leahy, Deborah S; Watanabe, Rei; Kirsch, Ilan R; Kim, Ellen J; Clark, Rachael A

    2015-09-17

    Early-stage cutaneous T-cell lymphoma (CTCL) is a skin-limited lymphoma with no cure aside from stem cell transplantation. Twelve patients with stage IA-IIA CTCL were treated in a phase 1 trial of 0.03% and 0.06% topical resiquimod gel, a Toll-like receptor 7/8 agonist. Treated lesions significantly improved in 75% of patients and 30% had clearing of all treated lesions. Resiquimod also induced regression of untreated lesions. Ninety-two percent of patients had more than a 50% improvement in body surface area involvement by the modified Severity-Weighted Assessment Tool analysis and 2 patients experienced complete clearing of disease. Four of 5 patients with folliculotropic disease also improved significantly. Adverse effects were minor and largely skin limited. T-cell receptor sequencing and flow cytometry studies of T cells from treated lesions demonstrated decreased clonal malignant T cells in 90% of patients and complete eradication of malignant T cells in 30%. High responses were associated with recruitment and expansion of benign T-cell clones in treated skin, increased skin T-cell effector functions, and a trend toward increased natural killer cell functions. In patients with complete or near eradication of malignant T cells, residual clinical inflammation was associated with cytokine production by benign T cells. Fifty percent of patients had increased activation of circulating dendritic cells, consistent with a systemic response to therapy. In summary, topical resiquimod is safe and effective in early-stage CTCL and the first topical therapy to our knowledge that can induce clearance of untreated lesions and complete remissions in some patients. This trial was registered at www.clinicaltrials.gov as #NCT813320. © 2015 by The American Society of Hematology.

  20. Prophylactic and therapeutic vaccination with carrier-bound Bet v 1 peptides lacking allergen-specific T cell epitopes reduces Bet v 1-specific T cell responses via blocking antibodies in a murine model for birch pollen allergy.

    PubMed

    Linhart, B; Narayanan, M; Focke-Tejkl, M; Wrba, F; Vrtala, S; Valenta, R

    2014-02-01

    Vaccines consisting of allergen-derived peptides lacking IgE reactivity and allergen-specific T cell epitopes bound to allergen-unrelated carrier molecules have been suggested as candidates for allergen-specific immunotherapy. To study whether prophylactic and therapeutic vaccination with carrier-bound peptides from the major birch pollen allergen Bet v 1 lacking allergen-specific T cell epitopes has influence on Bet v 1-specific T cell responses. Three Bet v 1-derived peptides, devoid of Bet v 1-specific T cell epitopes, were coupled to KLH and adsorbed to aluminium hydroxide to obtain a Bet v 1-specific allergy vaccine. Groups of BALB/c mice were immunized with the peptide vaccine before or after sensitization to Bet v 1. Bet v 1- and peptide-specific antibody responses were analysed by ELISA. T cell and cytokine responses to Bet v 1, KLH, and the peptides were studied in proliferation assays. The effects of peptide-specific and allergen-specific antibodies on T cell responses and allergic lung inflammation were studied using specific antibodies. Prophylactic and therapeutic vaccination with carrier-bound Bet v 1 peptides induced a Bet v 1-specific IgG antibody response without priming/boosting of Bet v 1-specific T cells. Prophylactic and therapeutic vaccination of mice with the peptide vaccine induced Bet v 1-specific antibodies which suppressed Bet v 1-specific T cell responses and allergic lung inflammation. Vaccination with carrier-bound allergen-derived peptides lacking allergen-specific T cell epitopes induces allergen-specific IgG antibodies which suppress allergen-specific T cell responses and allergic lung inflammation. © 2013 John Wiley & Sons Ltd.

  1. Enhanced Vaccine-Induced CD8+ T Cell Responses to Malaria Antigen ME-TRAP by Fusion to MHC Class II Invariant Chain

    PubMed Central

    Spencer, Alexandra J.; Cottingham, Matthew G.; Jenks, Jennifer A.; Longley, Rhea J.; Capone, Stefania; Colloca, Stefano; Folgori, Antonella; Cortese, Riccardo; Nicosia, Alfredo; Bregu, Migena; Hill, Adrian V. S.

    2014-01-01

    The orthodox role of the invariant chain (CD74; Ii) is in antigen presentation to CD4+ T cells, but enhanced CD8+ T cells responses have been reported after vaccination with vectored viral vaccines encoding a fusion of Ii to the antigen of interest. In this study we assessed whether fusion of the malarial antigen, ME-TRAP, to Ii could increase the vaccine-induced CD8+ T cell response. Following single or heterologous prime-boost vaccination of mice with a recombinant chimpanzee adenovirus vector, ChAd63, or recombinant modified vaccinia virus Ankara (MVA), higher frequencies of antigen-specific CD4+ and CD8+ T cells were observed, with the largest increases observed following a ChAd63-MVA heterologous prime-boost regimen. Studies in non-human primates confirmed the ability of Ii-fusion to augment the T cell response, where a 4-fold increase was maintained up to 11 weeks after the MVA boost. Of the numerous different approaches explored to increase vectored vaccine induced immunogenicity over the years, fusion to the invariant chain showed a consistent enhancement in CD8+ T cell responses across different animal species and may therefore find application in the development of vaccines against human malaria and other diseases where high levels of cell-mediated immunity are required. PMID:24945248

  2. The clerodane diterpene casearin J induces apoptosis of T-ALL cells through SERCA inhibition, oxidative stress, and interference with Notch1 signaling

    PubMed Central

    De Ford, C; Heidersdorf, B; Haun, F; Murillo, R; Friedrich, T; Borner, C; Merfort, I

    2016-01-01

    T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive hematologic malignancy that preferentially affects children and adolescents. Over 50% of human T-ALLs possess activating mutations of Notch1. The clerodane diterpene casearin J (CJ) is a natural product that inhibits the sarcoendoplasmatic reticulum calcium ATPase (SERCA) pump and induces cell death in leukemia cells, but the molecular mechanism of cytotoxicity remains poorly understood. Here we show that owing to SERCA pump inhibition, CJ induces depletion of the endoplasmic reticulum calcium pools, oxidative stress, and apoptosis via the intrinsic signaling pathway. Moreover, Notch1 signaling is reduced in T-ALL cells with auto-activating mutations in the HD-domain of Notch1, but not in cells that do not depend on Notch1 signaling. CJ also provoked a slight activation of NF-κB, and consistent with this notion a combined treatment of CJ and the NF-κB inhibitor parthenolide (Pt) led to a remarkable synergistic cell death in T-ALL cells. Altogether, our data support the concept that inhibition of the SERCA pump may be a novel strategy for the treatment of T-ALL with HD-domain-mutant Notch1 receptors and that additional treatment with the NF-κB inhibitor parthenolide may have further therapeutic benefits. PMID:26821066

  3. Effect of Vaginal Immunization with HIVgp140 and HSP70 on HIV-1 Replication and Innate and T Cell Adaptive Immunity in Women

    PubMed Central

    Lewis, David J. M.; Wang, Yufei; Huo, Zhiming; Giemza, Raphaela; Babaahmady, Kaboutar; Rahman, Durdana; Shattock, Robin J.; Singh, Mahavir

    2014-01-01

    ABSTRACT The international effort to prevent HIV-1 infection by vaccination has failed to develop an effective vaccine. The aim of this vaccine trial in women was to administer by the vaginal mucosal route a vaccine consisting of HIV-1 gp140 linked to the chaperone 70-kDa heat shock protein (HSP70). The primary objective was to determine the safety of the vaccine. The secondary objective was to examine HIV-1 infectivity ex vivo and innate and adaptive immunity to HIV-1. Protocol-defined female volunteers were recruited. HIV-1 CN54gp140 linked to HSP70 was administered by the vaginal route. Significant adverse reactions were not detected. HIV-1 was significantly inhibited ex vivo in postimmunization CD4+ T cells compared with preimmunization CD4+ T cells. The innate antiviral restrictive factor APOBEC3G was significantly upregulated, as were CC chemokines which induce downregulation of CCR5 in CD4+ T cells. Indeed, a significant inverse correlation between the proportion of CCR5+ T cells and the concentration of CCL-3 or CCL-5 was found. Importantly, the upregulation of APOBEC3G showed a significant inverse correlation, whereas CCR5 exhibited a trend to correlate with inhibition of HIV-1 infection (r = 0.51). Furthermore, specific CD4+ and CD8+ T cell proliferative responses were significantly increased and CD4+ T cells showed a trend to have an inverse correlation with the viral load (r = −0.60). However, HIVgp140-specific IgG or IgA antibodies were not detected. The results provide proof of concept that an innate mechanism consisting of CC chemokines, APOBEC3G, and adaptive immunity by CD4 and CD8 T cells might be involved in controlling HIV-1 infectivity following vaginal mucosal immunization in women. (This study has been registered at ClinicalTrials.gov under registration no. NCT01285141.) IMPORTANCE Vaginal immunization of women with a vaccine consisting of HIVgp140 linked to the 70-kDa heat shock protein (HSP70) elicited ex vivo significant inhibition of HIV-1 replication in postimmunization CD4+ T cells compared with that in preimmunization peripheral blood mononuclear cells. There were no significant adverse events. The vaccine induced the significant upregulation of CC chemokines and the downmodulation of CCR5 expression in CD4+ T cells, as well as an inverse correlation between them. Furthermore, the level of CCR5 expression was directly correlated with the viral load, consistent with the protective mechanism in which a decrease in CCR5 molecules on CD4+ T cells decreases HIV-1 envelope binding. Expression of the antiviral restriction factor APOBEC3G was inversely correlated with the viral load, suggesting that it may inhibit intracellular HIV-1 replication. Both CD4+ and CD8+ T cells showed HIVgp140- and HSP70-specific proliferation. A strong inverse correlation between the proportion of CC chemokine-modulated CCR5-expressing CD4+ T cells and the stimulation of CD4+ or CD8+ T cell proliferation by HIVgp140 was found, demonstrating a significant interaction between innate and adaptive immunity. This is the first clinical trial of vaginal immunization in women using only HIVgp140 and HSP70 administered by the mucosal route (3 times) in which a dual innate protective mechanism was induced and enhanced by significant adaptive CD4+ and CD8+ T cell proliferative responses. PMID:25008917

  4. Effect of vaginal immunization with HIVgp140 and HSP70 on HIV-1 replication and innate and T cell adaptive immunity in women.

    PubMed

    Lewis, David J M; Wang, Yufei; Huo, Zhiming; Giemza, Raphaela; Babaahmady, Kaboutar; Rahman, Durdana; Shattock, Robin J; Singh, Mahavir; Lehner, Thomas

    2014-10-01

    The international effort to prevent HIV-1 infection by vaccination has failed to develop an effective vaccine. The aim of this vaccine trial in women was to administer by the vaginal mucosal route a vaccine consisting of HIV-1 gp140 linked to the chaperone 70-kDa heat shock protein (HSP70). The primary objective was to determine the safety of the vaccine. The secondary objective was to examine HIV-1 infectivity ex vivo and innate and adaptive immunity to HIV-1. Protocol-defined female volunteers were recruited. HIV-1 CN54gp140 linked to HSP70 was administered by the vaginal route. Significant adverse reactions were not detected. HIV-1 was significantly inhibited ex vivo in postimmunization CD4(+) T cells compared with preimmunization CD4(+) T cells. The innate antiviral restrictive factor APOBEC3G was significantly upregulated, as were CC chemokines which induce downregulation of CCR5 in CD4(+) T cells. Indeed, a significant inverse correlation between the proportion of CCR5(+) T cells and the concentration of CCL-3 or CCL-5 was found. Importantly, the upregulation of APOBEC3G showed a significant inverse correlation, whereas CCR5 exhibited a trend to correlate with inhibition of HIV-1 infection (r = 0.51). Furthermore, specific CD4(+) and CD8(+) T cell proliferative responses were significantly increased and CD4(+) T cells showed a trend to have an inverse correlation with the viral load (r = -0.60). However, HIVgp140-specific IgG or IgA antibodies were not detected. The results provide proof of concept that an innate mechanism consisting of CC chemokines, APOBEC3G, and adaptive immunity by CD4 and CD8 T cells might be involved in controlling HIV-1 infectivity following vaginal mucosal immunization in women. (This study has been registered at ClinicalTrials.gov under registration no. NCT01285141.) Importance: Vaginal immunization of women with a vaccine consisting of HIVgp140 linked to the 70-kDa heat shock protein (HSP70) elicited ex vivo significant inhibition of HIV-1 replication in postimmunization CD4(+) T cells compared with that in preimmunization peripheral blood mononuclear cells. There were no significant adverse events. The vaccine induced the significant upregulation of CC chemokines and the downmodulation of CCR5 expression in CD4(+) T cells, as well as an inverse correlation between them. Furthermore, the level of CCR5 expression was directly correlated with the viral load, consistent with the protective mechanism in which a decrease in CCR5 molecules on CD4(+) T cells decreases HIV-1 envelope binding. Expression of the antiviral restriction factor APOBEC3G was inversely correlated with the viral load, suggesting that it may inhibit intracellular HIV-1 replication. Both CD4(+) and CD8(+) T cells showed HIVgp140- and HSP70-specific proliferation. A strong inverse correlation between the proportion of CC chemokine-modulated CCR5-expressing CD4(+) T cells and the stimulation of CD4(+) or CD8(+) T cell proliferation by HIVgp140 was found, demonstrating a significant interaction between innate and adaptive immunity. This is the first clinical trial of vaginal immunization in women using only HIVgp140 and HSP70 administered by the mucosal route (3 times) in which a dual innate protective mechanism was induced and enhanced by significant adaptive CD4(+) and CD8(+) T cell proliferative responses. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  5. Differential effects of arsenic on intracellular free calcium levels and the proliferative response of murine mitogen-stimulated lymphocytes.

    PubMed

    Goytia-Acevedo, Raquel C; Cebrian, Mariano E; Calderon-Aranda, Emma S

    2003-08-01

    This study examined the effects of sodium arsenite treatment on free [Ca(2+)]i and cell death in mitogen-activated murine lymphocytes. The main findings of this study were that simultaneous sodium arsenite treatment inhibited PHA- but not Con A-induced T cell proliferation, induced a higher increase in free [Ca(2+)]i and an early increase in the proportion of dead cells in PHA than in Con A activated cells. Sodium arsenite pre-treatment reduced both PHA- and Con A-induced T-cell proliferation. Phorbol myristate ester (PMA) did not prevent the inhibitory effects of both sodium arsenite treatments, suggesting that sodium arsenite did not significantly decreased PKC activation or that its effects occurred on events parallel to PKC activation. Both PHA and Con A increased free [Ca(2+)]i after stimulation, yet the effect was more pronounced in mitogen-activated cells simultaneously treated with sodium arsenite and particularly in those activated with PHA. The increase in free [Ca(2+)]i was in agreement with the early cell death induced by sodium arsenite in PHA-activated cells, a finding consistent with the inhibitory effects on PHA-induced proliferation. Sodium arsenite-induced cell death occurred faster in PHA-activated cells. Further studies are needed to ascertain the relationships between the effects of sodium arsenite on free [Ca(2+)]i levels and the type of cell death induced by sodium arsenite and their relevance for the proliferative response of T cells.

  6. Heterologous prime-boost regimens with a recombinant chimpanzee adenoviral vector and adjuvanted F4 protein elicit polyfunctional HIV-1-specific T-Cell responses in macaques.

    PubMed

    Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald

    2015-01-01

    HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN ('A'), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 ('P'), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques. Besides, adenoviral vector priming modulated the cytokine-expression profile of the protein-induced CD4+ T cells. Each regimen induced HIV-1-specific T-cell responses in systemic/local tissues in mice. This suggests that prime-boost regimens combining adjuvanted protein and low-seroprevalent chimpanzee adenoviral vectors represent an attractive vaccination strategy for clinical evaluation.

  7. Heterologous Prime-Boost Regimens with a Recombinant Chimpanzee Adenoviral Vector and Adjuvanted F4 Protein Elicit Polyfunctional HIV-1-Specific T-Cell Responses in Macaques

    PubMed Central

    Lorin, Clarisse; Vanloubbeeck, Yannick; Baudart, Sébastien; Ska, Michaël; Bayat, Babak; Brauers, Geoffroy; Clarinval, Géraldine; Donner, Marie-Noëlle; Marchand, Martine; Koutsoukos, Marguerite; Mettens, Pascal; Cohen, Joe; Voss, Gerald

    2015-01-01

    HIV-1-specific CD4+ and CD8+ T lymphocytes are important for HIV-1 replication control. F4/AS01 consists of F4 recombinant fusion protein (containing clade B Gag/p24, Pol/RT, Nef and Gag/p17) formulated in AS01 Adjuvant System, and was shown to induce F4-specific polyfunctional CD4+ T-cell responses in humans. While replication-incompetent recombinant HIV-1/SIV antigen-expressing human adenoviral vectors can elicit high-frequency antigen-specific CD8+ T-cell responses, their use is hampered by widespread pre-existing immunity to human serotypes. Non-human adenovirus serotypes associated with lower prevalence may offer an alternative strategy. We evaluated the immunogenicity of AdC7-GRN (‘A’), a recombinant chimpanzee adenovirus type 7 vector expressing clade B Gag, RT and Nef, and F4/AS01 (‘P’), when delivered intramuscularly in homologous (PP or AA) and heterologous (AAPP or PPAA) prime-boost regimens, in macaques and mice. Vaccine-induced HIV-1-antigen-specific T cells in peripheral blood (macaques), liver, spleen, and intestinal and genital mucosa (mice) were characterized by intracellular cytokine staining. Vaccine-specific IgG antibodies (macaques) were detected using ELISA. In macaques, only the heterologous prime-boost regimens induced polyfunctional, persistent and balanced CD4+ and CD8+ T-cell responses specific to each HIV-1 vaccine antigen. AdC7-GRN priming increased the polyfunctionality of F4/AS01-induced CD4+ T cells. Approximately 50% of AdC7-GRN-induced memory CD8+ T cells exhibited an effector-memory phenotype. HIV-1-specific antibodies were detected with each regimen. In mice, antigen-specific CD4+ and CD8+ T-cell responses were detected in the mucosal and systemic anatomical compartments assessed. When administered in heterologous prime-boost regimens, AdC7-GRN and F4/AS01 candidate vaccines acted complementarily in inducing potent and persistent peripheral blood HIV-1-specific CD4+ and CD8+ T-cell responses and antibodies in macaques. Besides, adenoviral vector priming modulated the cytokine-expression profile of the protein-induced CD4+ T cells. Each regimen induced HIV-1-specific T-cell responses in systemic/local tissues in mice. This suggests that prime-boost regimens combining adjuvanted protein and low-seroprevalent chimpanzee adenoviral vectors represent an attractive vaccination strategy for clinical evaluation. PMID:25856308

  8. Generation of mature T cells from human hematopoietic stem and progenitor cells in artificial thymic organoids.

    PubMed

    Seet, Christopher S; He, Chongbin; Bethune, Michael T; Li, Suwen; Chick, Brent; Gschweng, Eric H; Zhu, Yuhua; Kim, Kenneth; Kohn, Donald B; Baltimore, David; Crooks, Gay M; Montel-Hagen, Amélie

    2017-05-01

    Studies of human T cell development require robust model systems that recapitulate the full span of thymopoiesis, from hematopoietic stem and progenitor cells (HSPCs) through to mature T cells. Existing in vitro models induce T cell commitment from human HSPCs; however, differentiation into mature CD3 + TCR-αβ + single-positive CD8 + or CD4 + cells is limited. We describe here a serum-free, artificial thymic organoid (ATO) system that supports efficient and reproducible in vitro differentiation and positive selection of conventional human T cells from all sources of HSPCs. ATO-derived T cells exhibited mature naive phenotypes, a diverse T cell receptor (TCR) repertoire and TCR-dependent function. ATOs initiated with TCR-engineered HSPCs produced T cells with antigen-specific cytotoxicity and near-complete lack of endogenous TCR Vβ expression, consistent with allelic exclusion of Vβ-encoding loci. ATOs provide a robust tool for studying human T cell differentiation and for the future development of stem-cell-based engineered T cell therapies.

  9. A novel respiratory syncytial virus (RSV) F subunit vaccine adjuvanted with GLA-SE elicits robust protective TH1-type humoral and cellular immunity in rodent models.

    PubMed

    Lambert, Stacie L; Aslam, Shahin; Stillman, Elizabeth; MacPhail, Mia; Nelson, Christine; Ro, Bodrey; Sweetwood, Rosemary; Lei, Yuk Man; Woo, Jennifer C; Tang, Roderick S

    2015-01-01

    Illness associated with Respiratory Syncytial Virus (RSV) remains an unmet medical need in both full-term infants and older adults. The fusion glycoprotein (F) of RSV, which plays a key role in RSV infection and is a target of neutralizing antibodies, is an attractive vaccine target for inducing RSV-specific immunity. BALB/c mice and cotton rats, two well-characterized rodent models of RSV infection, were used to evaluate the immunogenicity of intramuscularly administered RSV vaccine candidates consisting of purified soluble F (sF) protein formulated with TLR4 agonist glucopyranosyl lipid A (GLA), stable emulsion (SE), GLA-SE, or alum adjuvants. Protection from RSV challenge, serum RSV neutralizing responses, and anti-F IgG responses were induced by all of the tested adjuvanted RSV sF vaccine formulations. However, only RSV sF + GLA-SE induced robust F-specific TH1-biased humoral and cellular responses. In mice, these F-specific cellular responses include both CD4 and CD8 T cells, with F-specific polyfunctional CD8 T cells that traffic to the mouse lung following RSV challenge. This RSV sF + GLA-SE vaccine formulation can also induce robust RSV neutralizing titers and prime IFNγ-producing T cell responses in Sprague Dawley rats. These studies indicate that a protein subunit vaccine consisting of RSV sF + GLA-SE can induce robust neutralizing antibody and T cell responses to RSV, enhancing viral clearance via a TH1 immune-mediated mechanism. This vaccine may benefit older populations at risk for RSV disease.

  10. A Lipopeptide Facilitate Induction of Mycobacterium leprae Killing in Host Cells

    PubMed Central

    Maeda, Yumi; Tamura, Toshiki; Fukutomi, Yasuo; Mukai, Tetsu; Kai, Masanori; Makino, Masahiko

    2011-01-01

    Little is known of the direct microbicidal activity of T cells in leprosy, so a lipopeptide consisting of the N-terminal 13 amino acids lipopeptide (LipoK) of a 33-kD lipoprotein of Mycobacterium leprae, was synthesized. LipoK activated M. leprae infected human dendritic cells (DCs) to induce the production of IL-12. These activated DCs stimulated autologous CD4+ or CD8+ T cells towards type 1 immune response by inducing interferon-gamma secretion. T cell proliferation was also evident from the CFSE labeling of target CD4+ or CD8+ T cells. The direct microbicidal activity of T cells in the control of M. leprae multiplication is not well understood. The present study showed significant production of granulysin, granzyme B and perforin from these activated CD4+ and CD8+ T cells when stimulated with LipoK activated, M. leprae infected DCs. Assessment of the viability of M. leprae in DCs indicated LipoK mediated T cell-dependent killing of M. leprae. Remarkably, granulysin as well as granzyme B could directly kill M. leprae in vitro. Our results provide evidence that LipoK could facilitate M. leprae killing through the production of effector molecules granulysin and granzyme B in T cells. PMID:22132248

  11. Raman spectrum reveals the cell cycle arrest of Triptolide-induced leukemic T-lymphocytes apoptosis

    NASA Astrophysics Data System (ADS)

    Zhang, Daosen; Feng, Yanyan; Zhang, Qinnan; Su, Xin; Lu, Xiaoxu; Liu, Shengde; Zhong, Liyun

    2015-04-01

    Triptolide (TPL), a traditional Chinese medicine extract, possesses anti-inflammatory and anti-tumor properties. Though some research results have implicated that Triptolide (TPL) can be utilized in the treatment of leukemia, it remains controversial about the mechanism of TPL-induced leukemic T-lymphocytes apoptosis. In this study, combining Raman spectroscopic data, principal component analysis (PCA) and atomic force microscopy (AFM) imaging, both the biochemical changes and morphological changes during TPL-induced cell apoptosis were presented. In contrast, the corresponding data during Daunorubicin (DNR)-induced cell apoptosis was also exhibited. The obtained results showed that Raman spectral changes during TPL-induced cell apoptosis were greatly different from DNR-induced cell apoptosis in the early stage of apoptosis but revealed the high similarity in the late stage of apoptosis. Moreover, above Raman spectral changes were respectively consistent with the morphological changes of different stages during TPL-induced apoptosis or DNR-induced apoptosis, including membrane shrinkage and blebbing, chromatin condensation and the formation of apoptotic bodies. Importantly, it was found that Raman spectral changes with TPL-induced apoptosis or DNR-induced apoptosis were respectively related with the cell cycle G1 phase arrest or G1 and S phase arrest.

  12. Microbiota promotes systemic T-cell survival through suppression of an apoptotic factor

    PubMed Central

    Petersen, Charisse; Novis, Camille L.; Kubinak, Jason L.; Bell, Rickesha; Stephens, W. Zac; Lane, Thomas E.; Fujinami, Robert S.; Bosque, Alberto; O’Connell, Ryan M.; Round, June L.

    2017-01-01

    Symbiotic microbes impact the severity of a variety of diseases through regulation of T-cell development. However, little is known regarding the molecular mechanisms by which this is accomplished. Here we report that a secreted factor, Erdr1, is regulated by the microbiota to control T-cell apoptosis. Erdr1 expression was identified by transcriptome analysis to be elevated in splenic T cells from germfree and antibiotic-treated mice. Suppression of Erdr1 depends on detection of circulating microbial products by Toll-like receptors on T cells, and this regulation is conserved in human T cells. Erdr1 was found to function as an autocrine factor to induce apoptosis through caspase 3. Consistent with elevated levels of Erdr1, germfree mice have increased splenic T-cell apoptosis. RNA sequencing of Erdr1-overexpressing cells identified the up-regulation of genes involved in Fas-mediated cell death, and Erdr1 fails to induce apoptosis in Fas-deficient cells. Importantly, forced changes in Erdr1 expression levels dictate the survival of auto-reactive T cells and the clinical outcome of neuro-inflammatory autoimmune disease. Cellular survival is a fundamental feature regulating appropriate immune responses. We have identified a mechanism whereby the host integrates signals from the microbiota to control T-cell apoptosis, making regulation of Erdr1 a potential therapeutic target for autoimmune disease. PMID:28487480

  13. Generation of mature T cells from human hematopoietic stem/progenitor cells in artificial thymic organoids

    PubMed Central

    Seet, Christopher S.; He, Chongbin; Bethune, Michael T.; Li, Suwen; Chick, Brent; Gschweng, Eric H.; Zhu, Yuhua; Kim, Kenneth; Kohn, Donald B.; Baltimore, David; Crooks, Gay M.; Montel-Hagen, Amélie

    2017-01-01

    Studies of human T cell development require robust model systems that recapitulate the full span of thymopoiesis, from hematopoietic stem and progenitor cells (HSPCs) through to mature T cells. Existing in vitro models induce T cell commitment from human HSPCs; however, differentiation into mature CD3+TCRab+ single positive (SP) CD8+ or CD4+ cells is limited. We describe here a serum-free, artificial thymic organoid (ATO) system that supports highly efficient and reproducible in vitro differentiation and positive selection of conventional human T cells from all sources of HSPCs. ATO-derived T cells exhibited mature naïve phenotypes, a diverse TCR repertoire, and TCR-dependent function. ATOs initiated with TCR-engineered HSPCs produced T cells with antigen specific cytotoxicity and near complete lack of endogenous TCR Vβ expression, consistent with allelic exclusion of Vβ loci. ATOs provide a robust tool for studying human T cell development and stem cell based approaches to engineered T cell therapies. PMID:28369043

  14. IL-15 induces CD8+ T cells to acquire functional NK receptors capable of modulating cytotoxicity and cytokine secretion.

    PubMed

    Correia, Margareta P; Costa, Alexandra V; Uhrberg, Markus; Cardoso, Elsa M; Arosa, Fernando A

    2011-05-01

    During the last years several authors have described a small population of CD8+ T cells expressing NK receptors (NKRs). Although their origin remains largely unknown, we have recently demonstrated that IL-15 is capable of inducing NKR expression in purified human CD8+CD56- T cells. In this study we show that IL-15-driven NKR induction in CD8+ T cells was linked with CD56 de novo acquisition, consistent with an effector-memory phenotype, increased anti-apoptotic levels, high granzyme B/perforin expression and with the ability of displaying in vitro NK-like cytotoxicity. Interestingly, dissection of NKR functional outcome in IL-15-cultured CD8+ T cells revealed: (i) that NKG2D cross-linking was able per se to upregulate degranulation levels and (ii) that KIR and NKG2A cross-linking upregulated secretion of cytokines such as IFN-γ, TNF-α, IL-1β and IL-10. These results suggest that IL-15 is capable of differentiating CD8+ T cells into NK-like T cells displaying a regulatory phenotype. Copyright © 2010 Elsevier GmbH. All rights reserved.

  15. Identification of Natural RORγ Ligands that Regulate the Development of Lymphoid Cells

    PubMed Central

    Santori, Fabio R.; Huang, Pengxiang; van de Pavert, Serge A.; Douglass, Eugene F.; Leaver, David J.; Haubrich, Brad A.; Keber, Rok; Lorbek, Gregor; Konijn, Tanja; Rosales, Brittany N.; Horvat, Simon; Rozman, Damjana; Rahier, Alain; Mebius, Reina E.; Rastinejad, Fraydoon; Nes, W. David; Littman, Dan R.

    2015-01-01

    SUMMARY Mice deficient in the nuclear hormone receptor RORγt have defective development of thymocytes, lymphoid organs, Th17 cells and type 3 innate lymphoid cells. RORγt binds to oxysterols derived from cholesterol catabolism but it is not clear whether these are its natural ligands. Here, we show that sterol lipids are necessary and sufficient to drive RORγt-dependent transcription. We combined overexpression, RNA interference and genetic deletion of metabolic enzymes to study RORγ-dependent transcription. Our results are consistent with the RORγt ligand(s) being a cholesterol biosynthetic intermediate (CBI) downstream of lanosterol and upstream of zymosterol. Analysis of lipids bound to RORγ identified molecules with molecular weights consistent with CBIs. Furthermore, CBIs stabilized the RORγ ligand-binding domain and induced co-activator recruitment. Genetic deletion of metabolic enzymes upstream of the RORγt-ligand(s) affected the development of lymph nodes and Th17 cells. Our data suggest that CBIs play a role in lymphocyte development potentially through regulation of RORγt. PMID:25651181

  16. A Convenient Model of Severe, High Incidence Autoimmune Gastritis Caused by Polyclonal Effector T Cells and without Perturbation of Regulatory T Cells

    PubMed Central

    Tu, Eric; Ang, Desmond K. Y.; Hogan, Thea V.; Read, Simon; Chia, Cheryl P. Z.; Gleeson, Paul A.; van Driel, Ian R.

    2011-01-01

    Autoimmune gastritis results from the breakdown of T cell tolerance to the gastric H+/K+ ATPase. The gastric H+/K+ ATPase is responsible for the acidification of gastric juice and consists of an α subunit (H/Kα) and a β subunit (H/Kβ). Here we show that CD4+ T cells from H/Kα-deficient mice (H/Kα−/−) are highly pathogenic and autoimmune gastritis can be induced in sublethally irradiated wildtype mice by adoptive transfer of unfractionated CD4+ T cells from H/Kα−/− mice. All recipient mice consistently developed the most severe form of autoimmune gastritis 8 weeks after the transfer, featuring hypertrophy of the gastric mucosa, complete depletion of the parietal and zymogenic cells, and presence of autoantibodies to H+/K+ ATPase in the serum. Furthermore, we demonstrated that the disease significantly affected stomach weight and stomach pH of recipient mice. Depletion of parietal cells in this disease model required the presence of both H/Kα and H/Kβ since transfer of H/Kα−/− CD4+ T cells did not result in depletion of parietal cells in H/Kα−/− or H/Kβ−/− recipient mice. The consistency of disease severity, the use of polyclonal T cells and a specific T cell response to the gastric autoantigen make this an ideal disease model for the study of many aspects of organ-specific autoimmunity including prevention and treatment of the disease. PMID:22096532

  17. RasGRP1 regulates antigen-induced developmental programming by naive CD8 T cells.

    PubMed

    Priatel, John J; Chen, Xiaoxi; Huang, Yu-Hsuan; Chow, Michael T; Zenewicz, Lauren A; Coughlin, Jason J; Shen, Hao; Stone, James C; Tan, Rusung; Teh, Hung Sia

    2010-01-15

    Ag encounter by naive CD8 T cells initiates a developmental program consisting of cellular proliferation, changes in gene expression, and the formation of effector and memory T cells. The strength and duration of TCR signaling are known to be important parameters regulating the differentiation of naive CD8 T cells, although the molecular signals arbitrating these processes remain poorly defined. The Ras-guanyl nucleotide exchange factor RasGRP1 has been shown to transduce TCR-mediated signals critically required for the maturation of developing thymocytes. To elucidate the role of RasGRP1 in CD8 T cell differentiation, in vitro and in vivo experiments were performed with 2C TCR transgenic CD8 T cells lacking RasGRP1. In this study, we report that RasGRP1 regulates the threshold of T cell activation and Ag-induced expansion, at least in part, through the regulation of IL-2 production. Moreover, RasGRP1(-/-) 2C CD8 T cells exhibit an anergic phenotype in response to cognate Ag stimulation that is partially reversible upon the addition of exogenous IL-2. By contrast, the capacity of IL-2/IL-2R interactions to mediate Ras activation and CD8 T cell expansion and differentiation appears to be largely RasGRP1-independent. Collectively, our results demonstrate that RasGRP1 plays a selective role in T cell signaling, controlling the initiation and duration of CD8 T cell immune responses.

  18. RTS,S/AS01E Malaria Vaccine Induces Memory and Polyfunctional T Cell Responses in a Pediatric African Phase III Trial.

    PubMed

    Moncunill, Gemma; De Rosa, Stephen C; Ayestaran, Aintzane; Nhabomba, Augusto J; Mpina, Maximillian; Cohen, Kristen W; Jairoce, Chenjerai; Rutishauser, Tobias; Campo, Joseph J; Harezlak, Jaroslaw; Sanz, Héctor; Díez-Padrisa, Núria; Williams, Nana Aba; Morris, Daryl; Aponte, John J; Valim, Clarissa; Daubenberger, Claudia; Dobaño, Carlota; McElrath, M Juliana

    2017-01-01

    Comprehensive assessment of cellular responses to the RTS,S/AS01E vaccine is needed to understand potential correlates and ultimately mechanisms of protection against malaria disease. Cellular responses recognizing the RTS,S/AS01E-containing circumsporozoite protein (CSP) and Hepatitis B surface antigen (HBsAg) were assessed before and 1 month after primary vaccination by intracellular cytokine staining and 16-color flow cytometry in 105 RTS,S/AS01-vaccinated and 74 rabies-vaccinated participants (controls) in a pediatric phase III trial in Africa. RTS,S/AS01E-vaccinated children had significantly higher frequencies of CSP- and HBsAg-specific CD4 + T cells producing IL-2, TNF-α, and CD40L and HBsAg-specific CD4 + T producing IFN-γ and IL-17 than baseline and the control group. Vaccine-induced responses were identified in both central and effector memory (EM) compartments. EM CD4 + T cells expressing IL-4 and IL-21 were detected recognizing both vaccine antigens. Consistently higher response rates to both antigens in RTS,S/AS01E-vaccinated than comparator-vaccinated children were observed. RTS,S/AS01E induced polyfunctional CSP- and HBsAg-specific CD4 + T cells, with a greater degree of polyfunctionality in HBsAg responses. In conclusion, RTS,S/AS01E vaccine induces T cells of higher functional heterogeneity and polyfunctionality than previously characterized. Responses detected in memory CD4 + T cell compartments may provide correlates of RTS,S/AS01-induced immunity and duration of protection in future correlates of immunity studies.

  19. Effector CD4+ T cells recognize intravascular antigen presented by patrolling monocytes.

    PubMed

    Westhorpe, Clare L V; Norman, M Ursula; Hall, Pam; Snelgrove, Sarah L; Finsterbusch, Michaela; Li, Anqi; Lo, Camden; Tan, Zhe Hao; Li, Songhui; Nilsson, Susan K; Kitching, A Richard; Hickey, Michael J

    2018-02-21

    Although effector CD4 + T cells readily respond to antigen outside the vasculature, how they respond to intravascular antigens is unknown. Here we show the process of intravascular antigen recognition using intravital multiphoton microscopy of glomeruli. CD4 + T cells undergo intravascular migration within uninflamed glomeruli. Similarly, while MHCII is not expressed by intrinsic glomerular cells, intravascular MHCII-expressing immune cells patrol glomerular capillaries, interacting with CD4 + T cells. Following intravascular deposition of antigen in glomeruli, effector CD4 + T-cell responses, including NFAT1 nuclear translocation and decreased migration, are consistent with antigen recognition. Of the MHCII + immune cells adherent in glomerular capillaries, only monocytes are retained for prolonged durations. These cells can also induce T-cell proliferation in vitro. Moreover, monocyte depletion reduces CD4 + T-cell-dependent glomerular inflammation. These findings indicate that MHCII + monocytes patrolling the glomerular microvasculature can present intravascular antigen to CD4 + T cells within glomerular capillaries, leading to antigen-dependent inflammation.

  20. Blockade of the interaction of leukotriene b4 with its receptor prevents development of autoimmune uveitis.

    PubMed

    Liao, Tianjiang; Ke, Yan; Shao, Wen-Hai; Haribabu, Bodduluri; Kaplan, Henry J; Sun, Deming; Shao, Hui

    2006-04-01

    To investigate the role of leukotriene B4 (LTB4) and its receptor BLT1 in the pathogenesis of mouse uveitis. Experimental autoimmune uveitis (EAU) was induced in B10RIII mice by immunization of interphotoreceptor retinoid binding protein (IRBP; peptide sequence 161-180) or in C57BL/6 (B6) mice by transfer of activated T cells specific for IRBP1-20. The animals were then treated with and without the BLT1 receptor antagonist, CP105696, at the disease onset after immunization or at day 0 or day 6 after T-cell transfer. EAU was also induced in wild-type B6 (WT) and BLT1-deficient (BLT1-/-) mice by reciprocal transfer of the T cells from B6 to BLT1-deficient mice and vise versa. Clinical signs of inflammation and ocular histology were compared. The chemotactic activity of LTB4 on naïve and IRBP-specific autoreactive T cells as well as effector leukocytes was examined. The treatment of CP105696, greatly reduced the intensity of ongoing disease. IRBP1-20-specific T cells derived from wild-type B6 mice induced only mild uveitis in syngeneic BLT1-deficient mice and that IRBP1-20-specific T cells derived from BLT1-/- mice induced milder disease in wild-type B6 mice than those derived from wild-type B6 mice, suggesting that expression of the LTB4 receptor on both activated autoreactive T cells and effector leukocytes was necessary for ocular inflammation to occur. Consistent with these data, transfer of autoreactive T cells from B6 mice to 5-lipoxygenase-deficient (5-LO-/-) mice, which have a functional defect in LTB4 expression, also failed to induce uveitis in the recipient mice. The results demonstrate a critical role for LTB4 in ocular inflammation and in the development and progression of EAU and suggest a new potential target for therapeutic intervention in this disease.

  1. Red blood cells upregulate cytoprotective proteins and the labile iron pool in dividing human T cells despite a reduction in oxidative stress.

    PubMed

    Fonseca, Ana Mafalda; Pereira, Carlos F; Porto, Graça; Arosa, Fernando A

    2003-12-01

    We have recently reported that red blood cells (RBC) promote T cell growth and survival by inhibiting activation-induced T cell death. In the present study, we have examined parameters of oxidative stress and intracellular iron in activated T cells and correlated these data with the expression of ferritin, heme oxygenase-1 (HO-1), and the transferrin receptor CD71. T cells growing in the presence of RBC had reduced levels of reactive oxygen species (ROS) and oxidatively modified proteins, suggesting that RBC efficiently counteracted ROS production on the activated T cells. Flow cytometry and immunodetection demonstrated that T cells dividing in the presence of RBC had increased levels of intracellular ferritin rich in L-subunits and HO-1 along with a downmodulation in CD71 expression. Finally, using the fluorescent iron indicator calcein and flow cytometry analysis, we were able to show that a relative amount of the labile iron pool (LIP) was upregulated in T cells growing in the presence of RBC. These findings are consistent with a typical response to iron overload. However, neither heme compounds nor ferric iron reproduced the levels of expansion and survival of T cells induced by intact RBC. Altogether, these data suggest that RBC inhibit apoptosis of activated T cells by a combination of ROS scavenging and upregulation of cytoprotective proteins such as ferritin and HO-1, which may counteract a possible toxic effect of the increased intracellular free iron.

  2. A Novel Respiratory Syncytial Virus (RSV) F Subunit Vaccine Adjuvanted with GLA-SE Elicits Robust Protective TH1-Type Humoral and Cellular Immunity In Rodent Models

    PubMed Central

    Lambert, Stacie L.; Aslam, Shahin; Stillman, Elizabeth; MacPhail, Mia; Nelson, Christine; Ro, Bodrey; Sweetwood, Rosemary; Lei, Yuk Man; Woo, Jennifer C.; Tang, Roderick S.

    2015-01-01

    Background Illness associated with Respiratory Syncytial Virus (RSV) remains an unmet medical need in both full-term infants and older adults. The fusion glycoprotein (F) of RSV, which plays a key role in RSV infection and is a target of neutralizing antibodies, is an attractive vaccine target for inducing RSV-specific immunity. Methodology and Principal Findings BALB/c mice and cotton rats, two well-characterized rodent models of RSV infection, were used to evaluate the immunogenicity of intramuscularly administered RSV vaccine candidates consisting of purified soluble F (sF) protein formulated with TLR4 agonist glucopyranosyl lipid A (GLA), stable emulsion (SE), GLA-SE, or alum adjuvants. Protection from RSV challenge, serum RSV neutralizing responses, and anti-F IgG responses were induced by all of the tested adjuvanted RSV sF vaccine formulations. However, only RSV sF + GLA-SE induced robust F-specific TH1-biased humoral and cellular responses. In mice, these F-specific cellular responses include both CD4 and CD8 T cells, with F-specific polyfunctional CD8 T cells that traffic to the mouse lung following RSV challenge. This RSV sF + GLA-SE vaccine formulation can also induce robust RSV neutralizing titers and prime IFNγ-producing T cell responses in Sprague Dawley rats. Conclusions/Significance These studies indicate that a protein subunit vaccine consisting of RSV sF + GLA-SE can induce robust neutralizing antibody and T cell responses to RSV, enhancing viral clearance via a TH1 immune-mediated mechanism. This vaccine may benefit older populations at risk for RSV disease. PMID:25793508

  3. Zoledronic acid causes γδ T cells to target monocytes and down-modulate inflammatory homing

    PubMed Central

    Fowler, Daniel W; Copier, John; Dalgleish, Angus G; Bodman-Smith, Mark D

    2014-01-01

    Zoledronic acid (ZA) is a potential immunotherapy for cancer because it can induce potent γδ T-cell-mediated anti-tumour responses. Clinical trials are testing the efficacy of intravenous ZA in cancer patients; however, the effects of systemic ZA on the activation and migration of peripheral γδ T cells remain poorly understood. We found that γδ T cells within ZA-treated peripheral blood mononuclear cells were degranulating, as shown by up-regulated expression of CD107a/b. Degranulation was monocyte dependent because CD107a/b expression was markedly reduced in the absence of CD14+ cells. Consistent with monocyte-induced degranulation, we observed γδ T-cell-dependent induction of monocyte apoptosis, as shown by phosphatidylserine expression on monocytes and decreased percentages of monocytes in culture. Despite the prevailing paradigm that ZA promotes tumour homing in γδ T cells, we observed down-modulation of their tumour homing capacity, as shown by decreased expression of the inflammatory chemokine receptors CCR5 and CXCR3, and reduced migration towards the inflammatory chemokine CCL5. Taken together our data suggest that ZA causes γδ T cells to target monocytes and down-modulate the migratory programme required for inflammatory homing. This study provides novel insight into how γδ T cells interact with monocytes and the possible implications of systemic use of ZA in cancer. PMID:24912747

  4. Both cladribine and alemtuzumab may effect MS via B-cell depletion.

    PubMed

    Baker, David; Herrod, Samuel S; Alvarez-Gonzalez, Cesar; Zalewski, Lukasz; Albor, Christo; Schmierer, Klaus

    2017-07-01

    To understand the efficacy of cladribine (CLAD) treatment in MS through analysis of lymphocyte subsets collected, but not reported, in the pivotal phase III trials of cladribine and alemtuzumab induction therapies. The regulatory submissions of the CLAD Tablets Treating Multiple Sclerosis Orally (CLARITY) (NCT00213135) cladribine and Comparison of Alemtuzumab and Rebif Efficacy in Multiple Sclerosis, study one (CARE-MS I) (NCT00530348) alemtuzumab trials were obtained from the European Medicine Agency through Freedom of Information requests. Data were extracted and statistically analyzed. Either dose of cladribine (3.5 mg/kg; 5.25 mg/kg) tested in CLARITY reduced the annualized relapse rate to 0.16-0.18 over 96 weeks, and both doses were similarly effective in reducing the risk of MRI lesions and disability. Surprisingly, however, T-cell depletion was rather modest. Cladribine 3.5 mg/kg depleted CD4 + cells by 40%-45% and CD8 + cells by 15%-30%, whereas alemtuzumab suppressed CD4 + cells by 70%-95% and CD8 + cells by 47%-55%. However, either dose of cladribine induced 70%-90% CD19 + B-cell depletion, similar to alemtuzumab (90%). CD19 + cells slowly repopulated to 15%-25% of baseline before cladribine redosing. However, alemtuzumab induced hyperrepopulation of CD19 + B cells 6-12 months after infusion, which probably forms the substrate for B-cell autoimmunities associated with alemtuzumab. Cladribine induced only modest depletion of T cells, which may not be consistent with a marked influence on MS, based on previous CD4 + T-cell depletion studies. The therapeutic drug-response relationship with cladribine is more consistent with lasting B-cell depletion and, coupled with the success seen with monoclonal CD20 + depletion, suggests that B-cell suppression could be the major direct mechanism of action.

  5. Distinct Roles for CXCR6(+) and CXCR6(-) CD4(+) T Cells in the Pathogenesis of Chronic Colitis.

    PubMed

    Mandai, Yasushi; Takahashi, Daisuke; Hase, Koji; Obata, Yuuki; Furusawa, Yukihiro; Ebisawa, Masashi; Nakagawa, Tomoo; Sato, Toru; Katsuno, Tatsuro; Saito, Yasushi; Shimaoka, Takeshi; Yokosuka, Osamu; Yokote, Kotaro; Ohno, Hiroshi

    2013-01-01

    CD4(+) T cells play a central role in the development of inflammatory bowel disease (IBD) via high-level production of effector cytokines such as IFN-γ and TNF-α. To better characterize the colitogenic CD4(+) T cells, we examined their expression of CXCR6, a chemokine receptor that is expressed by T cells upon activation and is upregulated in several inflammatory diseases. We found that 80% of colonic lamina propria CD4(+) T cells expressed CXCR6 in the CD45RB(high) T cell-transferred colitis model. CXCR6 expression was similarly upregulated in inflamed mucosa of patients with Crohn's disease. Although surface marker analysis demonstrated that both CXCR6(+) and CXCR6(-) CD4(+) T-cell subsets consist of the cells with effector and effector-memory cells, the more cells in the CXCR6(+) subset produced IFN-γ and TNF-α compared to CXCR6(-) subset, and only the CXCR6(+) subset produced IL-17A. Nevertheless, adoptive retransfer of lamina propria CXCR6(+) T cells into Rag1 (-/-) recipients failed to induce the disease due to limited expansion of the transferred cells. By contrast, retransfer of CXCR6(-) cells evoked colitis similar to that observed in CD4(+)CD45RB(high) T cell-transferred mice, and resulted in their conversion into CXCR6(+) cells. Collectively, these observations suggest that the CXCR6(+)CD4(+) T-cell subset consists of terminally differentiated effector cells that serve as the major source of effector cytokines in the inflamed tissue, whereas CXCR6(-)CD4(+) T-cell subset serves as a colitogenic memory compartment that retains the ability to proliferate and differentiate into CXCR6(+)CD4(+) T cells.

  6. Distinct Roles for CXCR6+ and CXCR6− CD4+ T Cells in the Pathogenesis of Chronic Colitis

    PubMed Central

    Hase, Koji; Obata, Yuuki; Furusawa, Yukihiro; Ebisawa, Masashi; Nakagawa, Tomoo; Sato, Toru; Katsuno, Tatsuro; Saito, Yasushi; Shimaoka, Takeshi; Yokosuka, Osamu; Yokote, Kotaro; Ohno, Hiroshi

    2013-01-01

    CD4+ T cells play a central role in the development of inflammatory bowel disease (IBD) via high-level production of effector cytokines such as IFN-γ and TNF-α. To better characterize the colitogenic CD4+ T cells, we examined their expression of CXCR6, a chemokine receptor that is expressed by T cells upon activation and is upregulated in several inflammatory diseases. We found that 80% of colonic lamina propria CD4+ T cells expressed CXCR6 in the CD45RBhigh T cell-transferred colitis model. CXCR6 expression was similarly upregulated in inflamed mucosa of patients with Crohn’s disease. Although surface marker analysis demonstrated that both CXCR6+ and CXCR6− CD4+ T-cell subsets consist of the cells with effector and effector-memory cells, the more cells in the CXCR6+ subset produced IFN-γ and TNF-α compared to CXCR6− subset, and only the CXCR6+ subset produced IL-17A. Nevertheless, adoptive retransfer of lamina propria CXCR6+ T cells into Rag1 −/− recipients failed to induce the disease due to limited expansion of the transferred cells. By contrast, retransfer of CXCR6− cells evoked colitis similar to that observed in CD4+CD45RBhigh T cell-transferred mice, and resulted in their conversion into CXCR6+ cells. Collectively, these observations suggest that the CXCR6+CD4+ T-cell subset consists of terminally differentiated effector cells that serve as the major source of effector cytokines in the inflamed tissue, whereas CXCR6−CD4+ T-cell subset serves as a colitogenic memory compartment that retains the ability to proliferate and differentiate into CXCR6+CD4+ T cells. PMID:23840334

  7. Synergistic inhibition of cancer cell proliferation with a combination of δ-tocotrienol and ferulic acid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eitsuka, Takahiro, E-mail: eitsuka@nupals.ac.jp; Tatewaki, Naoto; Nishida, Hiroshi

    2014-10-24

    Highlights: • δ-Tocotrienol (δ-T3) and ferulic acid (FA) synergistically inhibit cancer cell growth. • The combination of δ-T3 and FA induces G1 arrest by up-regulating p21. • The synergy is attributed to an increase in the cellular concentration of δ-T3 by FA. - Abstract: Rice bran consists of many functional compounds and thus much attention has been focused on the health benefits of its components. Here, we investigated the synergistic inhibitory effects of its components, particularly δ-tocotrienol (δ-T3) and ferulic acid (FA), against the proliferation of an array of cancer cells, including DU-145 (prostate cancer), MCF-7 (breast cancer), and PANC-1more » (pancreatic cancer) cells. The combination of δ-T3 and FA markedly reduced cell proliferation relative to δ-T3 alone, and FA had no effect when used alone. Although δ-T3 induced G1 arrest by up-regulating p21 in PANC-1 cells, more cells accumulated in G1 phase with the combination of δ-T3 and FA. This synergistic effect was attributed to an increase in the cellular concentration of δ-T3 by FA. Our results suggest that the combination of δ-T3 and FA may present a new strategy for cancer prevention and therapy.« less

  8. Chimeric antigen receptor T cells targeting Fc μ receptor selectively eliminate CLL cells while sparing healthy B cells.

    PubMed

    Faitschuk, Elena; Hombach, Andreas A; Frenzel, Lukas P; Wendtner, Clemens-Martin; Abken, Hinrich

    2016-09-29

    Adoptive cell therapy of chronic lymphocytic leukemia (CLL) with chimeric antigen receptor (CAR)-modified T cells targeting CD19 induced lasting remission of this refractory disease in a number of patients. However, the treatment is associated with prolonged "on-target off-tumor" toxicities due to the targeted elimination of healthy B cells demanding more selectivity in targeting CLL cells. We identified the immunoglobulin M Fc receptor (FcμR), also known as the Fas apoptotic inhibitory molecule-3 or TOSO, as a target for a more selective treatment of CLL by CAR T cells. FcμR is highly and consistently expressed by CLL cells; only minor levels are detected on healthy B cells or other hematopoietic cells. T cells with a CAR specific for FcμR efficiently responded toward CLL cells, released a panel of proinflammatory cytokines and lytic factors, like soluble FasL and granzyme B, and eliminated the leukemic cells. In contrast to CD19 CAR T cells, anti-FcμR CAR T cells did not attack healthy B cells. T cells with anti-FcμR CAR delayed outgrowth of Mec-1-induced leukemia in a xenograft mouse model. T cells from CLL patients in various stages of the disease, modified by the anti-FcμR CAR, purged their autologous CLL cells in vitro without reducing the number of healthy B cells, which is the case with anti-CD19 CAR T cells. Compared with the currently used therapies, the data strongly imply a superior therapeutic index of anti-FcμR CAR T cells for the treatment of CLL. © 2016 by The American Society of Hematology.

  9. One base pair change abolishes the T cell-restricted activity of a kB-like proto-enhancer element from the interleukin 2 promoter.

    PubMed Central

    Briegel, K; Hentsch, B; Pfeuffer, I; Serfling, E

    1991-01-01

    The inducible, T cell-specific enhancers of murine and human Interleukin 2 (Il-2) genes contain the kB-like sequence GGGATTTCACC as an essential cis-acting enhancer motif. When cloned in multiple copies this so-called TCEd (distal T cell element) acts as an inducible proto-enhancer element in E14 T lymphoma cells, but not in HeLa cells. In extracts of induced, Il-2 secreting El4 cells three individual protein factors bind to TCEd DNA. The binding of the most prominent factor, named TCF-1 (T cell factor 1), is correlated with the proto-enhancer activity of TCEd. TCF-1 consists of two polypeptides of about 50 kD and 105 kD; the former seems to be related to the 50 kD polypeptide of NF-kB. Purified NF-kB is also able to bind to the TCEd, but TCF-1 binds stronger than NF-kB to TCEd DNA. The conversion of the TCEd to a 'perfect' NF-kB binding site leads to a tighter binding of NF-kB to TCEd DNA and, as a functional consequence, to the activity of the 'converted' TCEd motifs in HeLa cells. Thus, the substitution of the underlined A residue to a C within the GGGATTTCACC motif abolishes its T cell-restricted activity and leads to its functioning in both El4 cells and HeLa cells. These results indicate that lymphocyte-specific factors binding to the TCEd are involved in the control of T cell specific-transcription of the Il-2 gene. Images PMID:1945879

  10. Ex vivo tetramer staining and cell surface phenotyping for early activation markers CD38 and HLA-DR to enumerate and characterize malaria antigen-specific CD8+ T-cells induced in human volunteers immunized with a Plasmodium falciparum adenovirus-vectored malaria vaccine expressing AMA1.

    PubMed

    Schwenk, Robert; Banania, Glenna; Epstein, Judy; Kim, Yohan; Peters, Bjoern; Belmonte, Maria; Ganeshan, Harini; Huang, Jun; Reyes, Sharina; Stryhn, Anette; Ockenhouse, Christian F; Buus, Soren; Richie, Thomas L; Sedegah, Martha

    2013-10-29

    Malaria is responsible for up to a 600,000 deaths per year; conveying an urgent need for the development of a malaria vaccine. Studies with whole sporozoite vaccines in mice and non-human primates have shown that sporozoite-induced CD8+ T cells targeting liver stage antigens can mediate sterile protection. There is a need for a direct method to identify and phenotype malaria vaccine-induced CD8+ T cells in humans. Fluorochrome-labelled tetramers consisting of appropriate MHC class I molecules in complex with predicted binding peptides derived from Plasmodium falciparum AMA-1 were used to label ex vivo AMA-1 epitope specific CD8+ T cells from research subjects responding strongly to immunization with the NMRC-M3V-Ad-PfCA (adenovirus-vectored) malaria vaccine. The identification of these CD8+ T cells on the basis of their expression of early activation markers was also investigated. Analyses by flow cytometry demonstrated that two of the six tetramers tested: TLDEMRHFY: HLA-A*01:01 and NEVVVKEEY: HLA-B*18:01, labelled tetramer-specific CD8+ T cells from two HLA-A*01:01 volunteers and one HLA-B*18:01 volunteer, respectively. By contrast, post-immune CD8+ T cells from all six of the immunized volunteers exhibited enhanced expression of the CD38 and HLA-DRhi early activation markers. For the three volunteers with positive tetramer staining, the early activation phenotype positive cells included essentially all of the tetramer positive, malaria epitope- specific CD8+ T cells suggesting that the early activation phenotype could identify all malaria vaccine-induced CD8+ T cells without prior knowledge of their exact epitope specificity. The results demonstrated that class I tetramers can identify ex vivo malaria vaccine antigen-specific CD8+ T cells and could therefore be used to determine their frequency, cell surface phenotype and transcription factor usage. The results also demonstrated that vaccine antigen-specific CD8+ T cells could be identified by activation markers without prior knowledge of their antigen-specificity, using a subunit vaccine for proof-of-concept. Whether, whole parasite or adjuvanted protein vaccines will also induce {CD38 and HLA-DRhi}+ CD8+ T cell populations reflective of the antigen-specific response will the subject of future investigations.

  11. The mechanism of thioacetamide-induced apoptosis in the L37 albumin-SV40 T-antigen transgenic rat hepatocyte-derived cell line occurs without DNA fragmentation.

    PubMed

    Bulera, S J; Sattler, C A; Gast, W L; Heath, S; Festerling, T A; Pitot, H C

    1998-10-01

    The hepatotoxicant thioacetamide (TH) has classically been used as a model to study hepatic necrosis; however, recent studies have shown that TH can also induce apoptosis. In this report we demonstrate that 2.68+/-0.54% of the albumin-SV40 T-antigen transgenic rat hepatocytes undergo TH-induced apoptosis, a level comparable to other in vivo models of liver apoptosis. In addition, TH could induce apoptosis and necrosis in the L37 albumin-SV40 T-antigen transgenic rat liver-derived cell line. Examination of dying L37 cells treated with 100 mM TH by electron microscopy revealed distinct morphological characteristics that could be attributed to apoptosis. Quantitation of apoptosis by FACS analysis 24 h after treatment with 100 mM TH revealed that 81.3+/-1.6% of the cells were undergoing apoptosis. In contrast, when L37 cells were treated with 250 mM TH, cells exhibited characteristics consistent with necrotic cell death. DNA fragmentation ladders were produced by growth factor withdrawal-induced apoptosis; however, in 100 mM TH-induced apoptosis, DNA fragmentation ladders were not observed. Analysis of endonuclease activity in L37 cells revealed that the enzymes were not inactivated in the presence of 100 mM TH. The data presented in this report indicate that the L37 cell line could be used to study the mechanism of TH-induced apoptosis that was not mediated through a mechanism requiring DNA fragmentation.

  12. T cell ignorance is bliss: T cells are not tolerized by Langerhans cells presenting human papillomavirus antigens in the absence of costimulation.

    PubMed

    Woodham, Andrew W; Yan, Lisa; Skeate, Joseph G; van der Veen, Daniel; Brand, Heike H; Wong, Michael K; Da Silva, Diane M; Kast, W Martin

    2016-12-01

    Human papillomavirus type 16 (HPV16) infections are intra-epithelial, and thus, HPV16 is known to interact with Langerhans cells (LCs), the resident epithelial antigen-presenting cells (APCs). The current paradigm for APC-mediated induction of T cell anergy is through delivery of T cell receptor signals via peptides on MHC molecules (signal 1), but without costimulation (signal 2). We previously demonstrated that LCs exposed to HPV16 in vitro present HPV antigens to T cells without costimulation, but it remained uncertain if such T cells would remain ignorant, become anergic, or in the case of CD4+ T cells, differentiate into Tregs. Here we demonstrate that Tregs were not induced by LCs presenting only signal 1, and through a series of in vitro immunizations show that CD8 + T cells receiving signal 1 + 2 from LCs weeks after consistently receiving signal 1 are capable of robust effector functions. Importantly, this indicates that T cells are not tolerized but instead remain ignorant to HPV, and are activated given the proper signals.

  13. Chimeric Antigen Receptor-Engineered T Cells for Immunotherapy of Cancer

    PubMed Central

    Cartellieri, Marc; Bachmann, Michael; Feldmann, Anja; Bippes, Claudia; Stamova, Slava; Wehner, Rebekka; Temme, Achim; Schmitz, Marc

    2010-01-01

    CD4+ and CD8+ T lymphocytes are powerful components of adaptive immunity, which essentially contribute to the elimination of tumors. Due to their cytotoxic capacity, T cells emerged as attractive candidates for specific immunotherapy of cancer. A promising approach is the genetic modification of T cells with chimeric antigen receptors (CARs). First generation CARs consist of a binding moiety specifically recognizing a tumor cell surface antigen and a lymphocyte activating signaling chain. The CAR-mediated recognition induces cytokine production and tumor-directed cytotoxicity of T cells. Second and third generation CARs include signal sequences from various costimulatory molecules resulting in enhanced T-cell persistence and sustained antitumor reaction. Clinical trials revealed that the adoptive transfer of T cells engineered with first generation CARs represents a feasible concept for the induction of clinical responses in some tumor patients. However, further improvement is required, which may be achieved by second or third generation CAR-engrafted T cells. PMID:20467460

  14. Functional heterogeneity of memory B lymphocytes: in vivo analysis of TD-primed B cells responsive to secondary stimulation with TD and TI antigens.

    PubMed

    Rennick, D M; Morrow, P R; Benjamini, E

    1983-08-01

    The functional heterogeneity of memory B cells induced by a single determinant, consisting of a decapeptide representing amino acid residues 103-112 of tobacco mosaic virus protein (TMVP), was analyzed. Decapeptide specific antibodies were elicited in mice adoptively transferred with TMVP-immune spleen cells when challenged with TMVP, decapeptide conjugated to succinylated human gamma-globulin (SHGG), or decapeptide conjugated to Brucella abortus (BA). Whereas secondary stimulation by either TMVP or decapeptide-SHGG was dependent on appropriately primed T cells, stimulation by decapeptide-BA was independent of conventional T cell help. Furthermore, memory B cells responsive to TMVP (TD), decapeptide-SHGG (TD), or decapeptide-BA (TI. 1 prototype) were shown to consist of overlapping populations because adoptive recipients of TMVP-primed cells challenged simultaneously with TD and TI decapeptide antigens did not result in a higher antibody response than that elicited by one of the TD antigens injected alone. However, decapeptide-BA consistently induced a smaller antidecapeptide response than either TMVP or decapeptide-SHGG. This suggested that only a fraction of the memory B cell population which was activated by the original priming antigen (thymus-dependent) was also responsive to secondary in vivo stimulation by the priming hapten conjugated to Brucella abortus. Detailed analyses of the antibodies induced in the recipients of TMVP-immune spleen cells after secondary challenge with either TMVP, decapeptide-SHGG, or decapeptide-BA failed to distinguish between the responsive memory B cells; the antidecapeptide antibodies induced by all three immunogens shared the same fine specificities and immunoglobulin isotype composition. These data are viewed as further evidence that subsets of TD-primed B cells, which may display differential sensitivity to cross-stimulation with TD and TI forms of the antigen, represent distinct stages of memory B cell maturation within a common B cell lineage. In support of this conclusion, we establish a developmental relationship between TI and/or TD responsive decapeptide memory B cell in the following communication.

  15. AML1/ETO induces self-renewal in hematopoietic progenitor cells via the Groucho-related amino-terminal AES protein.

    PubMed

    Steffen, Björn; Knop, Markus; Bergholz, Ulla; Vakhrusheva, Olesya; Rode, Miriam; Köhler, Gabriele; Henrichs, Marcel-Philipp; Bulk, Etmar; Hehn, Sina; Stehling, Martin; Dugas, Martin; Bäumer, Nicole; Tschanter, Petra; Brandts, Christian; Koschmieder, Steffen; Berdel, Wolfgang E; Serve, Hubert; Stocking, Carol; Müller-Tidow, Carsten

    2011-04-21

    The most frequent translocation t(8;21) in acute myeloid leukemia (AML) generates the chimeric AML1/ETO protein, which blocks differentiation and induces self-renewal in hematopoietic progenitor cells. The underlying mechanisms mediating AML1/ETO-induced self-renewal are largely unknown. Using expression microarray analysis, we identified the Groucho-related amino-terminal enhancer of split (AES) as a consistently up-regulated AML1/ETO target. Elevated levels of AES mRNA and protein were confirmed in AML1/ETO-expressing leukemia cells, as well as in other AML specimens. High expression of AES mRNA or protein was associated with improved survival of AML patients, even in the absence of t(8;21). On a functional level, knockdown of AES by RNAi in AML1/ETO-expressing cell lines inhibited colony formation. Similarly, self-renewal induced by AML1/ETO in primary murine progenitors was inhibited when AES was decreased or absent. High levels of AES expression enhanced formation of immature colonies, serial replating capacity of primary cells, and colony formation in colony-forming unit-spleen assays. These findings establish AES as a novel AML1/ETO-induced target gene that plays an important role in the self-renewal phenotype of t(8;21)-positive AML.

  16. Characterization of mutagen-activated cellular oncogenes that confer anchorage independence to human fibroblasts and tumorigenicity to NIH 3T3 cells: Sequence analysis of an enzymatically amplified mutant HRAS allele

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stevens, C.W.; Manoharan, T.H.; Fahl, W.E.

    1988-06-01

    Treatment of diploid human fibroblasts with an alkylating mutagen has been shown to induce stable, anchorage-independent cell populations at frequencies consistent with an activating mutation. After treatment of human foreskin fibroblasts with the mutagen benzo({alpha})pyrene ({plus minus})anti-7,8-dihydrodiol 9,10-epoxide and selection in soft agar, 17 anchorage-independent clones were isolated and expanded, and their cellular DNA was used to cotransfect NIH 3T3 cells along with pSV2neo. DNA from 11 of the 17 clones induced multiple NIH 3T3 cell tumors in recipient nude mice. Southern blot analyses showed the presence of human Alu repetitive sequences in all of the NIH 3T3 tumor cellmore » DNAs. Intact, human HRAS sequences were observed in 2 of the 11 tumor groups, whereas no hybridization was detected when human KRAS or NRAS probes were used. Slow-migrating ras p21 proteins, consistent with codon 12 mutations, were observed in the same two NIH 3T3 tumor cell groups that contained the human HRAS bands. Genomic DNA from one of these two human anchorage-independent cell populations (clone 21A) was used to enzymatically amplify a portion of exon 1 of the HRAS gene. The results demonstrate that exposure of normal human cells to a common environmental mutagen yields HRAS GC {yields} TA codon 12 transversions that have been commonly observed in human tumors.« less

  17. A transduced living hyaline cartilage graft releasing transgenic stromal cell-derived factor-1 inducing endogenous stem cell homing in vivo.

    PubMed

    Zhang, Feng; Leong, Wenyan; Su, Kai; Fang, Yu; Wang, Dong-An

    2013-05-01

    Stromal cell-derived factor-1 (SDF-1), also known as a homing factor, is a potent chemokine that activates and directs mobilization, migration, and retention of certain cell species via systemic circulation. The responding homing cells largely consist of activated stem cells, so that, in case of tissue lesions, such SDF-1-induced cell migration may execute recruitment of endogenous stem cells to perform autoreparation and compensatory regeneration in situ. In this study, a recombinant adenoviral vector carrying SDF-1 transgene was constructed and applied to transduce a novel scaffold-free living hyaline cartilage graft (SDF-t-LhCG). As an engineered transgenic living tissue, SDF-t-LhCG is capable of continuously producing and releasing SDF-1 in vitro and in vivo. The in vitro trials were examined with ELISA, while the in vivo trials were subsequently performed via a subcutaneous implantation of SDF-t-LhCG in a nude mouse model, followed by series of biochemical and biological analyses. The results indicate that transgenic SDF-1 enhanced the presence of this chemokine in mouse's circulation system; in consequence, SDF-1-induced activation and recruitment of endogenous stem cells were also augmented in both peripheral blood and SDF-t-LhCG implant per se. These results were obtained via flow cytometry analyses on mouse blood samples and implanted SDF-t-LhCG samples, indicating an upregulation of the CXCR4(+)(SDF-1 receptor) cell population, accompanied by upregulation of the CD34(+), CD44(+), and Sca-1(+) cell populations as well as a downregulation of the CD11b(+) cell population. With the supply of SDF-1-recruited endogenous stem cells, enhanced chondrogenesis was observed in SDF-t-LhCG implants in situ.

  18. Superoxide produced by Kupffer cells is an essential effector in concanavalin A-induced hepatitis in mice.

    PubMed

    Nakashima, Hiroyuki; Kinoshita, Manabu; Nakashima, Masahiro; Habu, Yoshiko; Shono, Satoshi; Uchida, Takefumi; Shinomiya, Nariyoshi; Seki, Shuhji

    2008-12-01

    Although concanavalin A (Con-A)-induced experimental hepatitis is thought to be induced by activated T cells, natural killer T (NKT) cells, and cytokines, precise mechanisms are still unknown. In the current study, we investigated the roles of Kupffer cells, NKT cells, FasL, tumor necrosis factor (TNF), and superoxide in Con-A hepatitis in C57BL/6 mice. Removal of Kupffer cells using gadolinium chloride (GdCl(3)) from the liver completely inhibited Con-A hepatitis, whereas increased serum TNF and IFN-gamma levels were not inhibited at all. Unexpectedly, anti-FasL antibody pretreatment did not inhibit Con-A hepatitis, whereas it inhibited hepatic injury induced by a synthetic ligand of NKT cells, alpha-galactosylceramide. Furthermore, GdCl(3) pretreatment changed neither the activation-induced down-regulation of NK1.1 antigens as well as T cell receptors of NKT cells nor the increased expression of the CD69 activation antigen of hepatic T cells. CD68(+) Kupffer cells greatly increased in proportion in the early phase after Con-A injection; this increase was abrogated by GdCl(3) pretreatment. Anti-TNF antibody (Ab) pretreatment did not inhibit the increase of Kupffer cells, but it effectively suppressed superoxide/reactive oxygen production from Kupffer cells and the resulting hepatic injury. Conversely, depletion of NKT cells in mice by NK1.1 Ab pretreatment did suppress both the increase of CD68(+) Kupffer cells and Con-A hepatitis. Consistently, the diminution of oxygen radicals produced by Kupffer cells by use of free radical scavengers greatly inhibited Con-A hepatitis without suppressing cytokine production. However, adoptive transfer experiments also indicate that a close interaction/cooperation of Kupffer cells with NKT cells is essential for Con-A hepatitis. Superoxide produced by Kupffer cells may be the essential effector in Con-A hepatitis, and TNF and NKT cells support their activation and superoxide production.

  19. Anti-diabetic potential of the essential oil of Pinus koraiensis leaves toward streptozotocin-treated mice and HIT-T15 pancreatic β cells.

    PubMed

    Joo, Hye-Eun; Lee, Hyo-Jung; Sohn, Eun Jung; Lee, Min-Ho; Ko, Hyun-Suk; Jeong, Soo-Jin; Lee, Hyo-Jeong; Kim, Sung-Hoon

    2013-01-01

    The metabolic syndrome creates risk factors for coronary heart disease, diabetes, fatty liver, obesity and several cancers. Our group has already reported that the essential oil from leaves of Pinus koraiensis SIEB (EOPK) exerted antihyperlipidemic effects by upregulating the low-density lipoprotein receptor and inhibiting acyl-coenzyme A, cholesterol acyltransferases. We evaluated in the current study the anti-diabetic effects of EOPK on mice with streptozotocin (STZ)-induced type I diabetes and on HIT-T15 pancreatic β cells. EOPK significantly protected HIT-T15 cells from STZ-induced cytotoxicity and reduced the blood glucose level in STZ-induced diabetic mice when compared with the untreated control. EOPK consistently and significantly suppressed the α-amylase activity in a dose-dependent manner and enhanced the expression of insulin at the mRNA level in STZ-treated HIT-T15 cells, while the expression of insulin was attenuated. EOPK also significantly abrogated the population of reactive oxygen species when compared to the untreated control in STZ-treated HIT-T15 cells. Furthermore, EOPK significantly reduce nitric oxide production, suppressed the phosphorylation of endothelial nitric oxide (NO) synthase and suppressed the production of vascular endothelial growth factor (VEGF) in STZ-treated HIT-T15 cells, implying its potential application to diabetic retinopathy. Overall, our findings suggest that EOPK had hypoglycemic potential by inhibiting reactive oxygene species (ROS), endothelial NO synthase (eNOS) and VEGF in STZ-treated mice and HIT-T15 pancreatic β cells as a potent anti-diabetic agent.

  20. iNKT cell cytotoxic responses control T-lymphoma growth in vitro and in vivo

    PubMed Central

    Bassiri, Hamid; Das, Rupali; Guan, Peng; Barrett, David M.; Brennan, Patrick J.; Banerjee, Pinaki P.; Wiener, Susan J.; Orange, Jordan S.; Brenner, Michael B.; Grupp, Stephan A.; Nichols, Kim E.

    2013-01-01

    Invariant natural killer T (iNKT) cells comprise a lineage of CD1d-restricted glycolipid-reactive T lymphocytes with important roles in host immunity to cancer. iNKT cells indirectly participate in antitumor responses by inducing dendritic cell maturation and producing cytokines that promote tumor clearance by CD8+ T and NK cells. Although iNKT cells thereby act as potent cellular adjuvants, it is less clear whether they directly control the growth of tumors. To gain insights into the direct contribution of iNKT cells to tumor immune surveillance, we developed in vitro and in vivo systems to selectively examine the antitumor activity of iNKT cells in the absence of other cytolytic effectors. Using the EL4 T-lymphoma cell line as a model, we find that iNKT cells exert robust and specific lysis of tumor cells in vitro in a manner that is differentially-induced by iNKT cell agonists of varying TCR affinities, such as OCH, α-galactosyl ceramide and PBS44. In vitro blockade of CD1d-mediated lipid antigen presentation, disruption of T cell receptor (TCR) signaling, or loss of perforin expression significantly reduce iNKT cell killing. Consistent with these findings, iNKT cell reconstitution of T, B, and NK cell-deficient mice slows EL4 growth in vivo via TCR-CD1d and perforin-dependent mechanisms. Together, these observations establish that iNKT cells are sufficient to control the growth of T-lymphoma in vitro and in vivo. They also suggest that the induction of iNKT cell cytotoxic responses in situ might serve as a more effective strategy to prevent and/or treat CD1d+ cancers, such as T-lymphoma. PMID:24563871

  1. iNKT cell cytotoxic responses control T-lymphoma growth in vitro and in vivo .

    PubMed

    Bassiri, Hamid; Das, Rupali; Guan, Peng; Barrett, David M; Brennan, Patrick J; Banerjee, Pinaki P; Wiener, Susan J; Orange, Jordan S; Brenner, Michael B; Grupp, Stephan A; Nichols, Kim E

    2014-01-01

    Invariant natural killer T (iNKT) cells comprise a lineage of CD1d-restricted glycolipid-reactive T lymphocytes with important roles in host immunity to cancer. iNKT cells indirectly participate in antitumor responses by inducing dendritic cell maturation and producing cytokines that promote tumor clearance by CD8+ T and NK cells. Although iNKT cells thereby act as potent cellular adjuvants, it is less clear whether they directly control the growth of tumors. To gain insights into the direct contribution of iNKT cells to tumor immune surveillance, we developed in vitro and in vivo systems to selectively examine the antitumor activity of iNKT cells in the absence of other cytolytic effectors. Using the EL4 T-lymphoma cell line as a model, we found that iNKT cells exert robust and specific lysis of tumor cells in vitro in a manner that is differentially induced by iNKT cell agonists of varying T-cell receptor (TCR) affinities, such as OCH, α-galactosyl ceramide, and PBS44. In vitro blockade of CD1d-mediated lipid antigen presentation, disruption of TCR signaling, or loss of perforin expression significantly reduce iNKT cell killing. Consistent with these findings, iNKT cell reconstitution of T, B, and NK cell–deficient mice slows EL4 growth in vivo via TCR-CD1d and perforin-dependent mechanisms. Together, these observations establish that iNKT cells are sufficient to control the growth of T lymphoma in vitro and in vivo. They also suggest that the induction of iNKT cell cytotoxic responses in situ might serve as a more effective strategy to prevent and/or treat CD1d+ cancers, such as T lymphoma. ©2013 AACR.

  2. Selenium Polysaccharide SPMP-2a from Pleurotus geesteranus Alleviates H2O2-Induced Oxidative Damage in HaCaT Cells

    PubMed Central

    Zhou, Cheng; Huang, Shoucheng

    2017-01-01

    Selenium- (Se-) enriched polysaccharide SPMP-2a was extracted and purified from Pleurotus geesteranus. SPMP-2a is a white flocculent polysaccharide and soluble in water, with a molecular weight of 3.32 × 104 Da. Fourier transform infrared spectroscopy spectral analysis indicated that it belongs to an acid Se polysaccharide with α-D-glucopyranoside bond. The effects of Se polysaccharide SPMP-2a in P. geesteranus against hydrogen peroxide- (H2O2-) induced oxidative damage in human keratinocytes (HaCaT) cells were evaluated further. Reduced cell viability and elevated apoptotic rates in H2O2-treated HaCaT cells were proven by MTT and flow cytometry assays. Hoechst 33342 staining revealed chromatin condensations in the nuclei of HaCaT cells. However, with the addition of SPMP-2a, cell viability improved, nuclear condensation declined, and cell apoptotic rates dropped significantly. Ultrastructural observation consistently revealed that treatments with SPMP-2a reduced the number of swollen and vacuolar mitochondria in the H2O2-treated cells compared with the controls. Furthermore, SPMP-2a increased the superoxide dismutase (SOD) and catalase (CAT) activities and reduced reactive oxygen species (ROS) content. Western blot analysis showed that SPMP-2a treatment effectively increased B-cell lymphoma 2 (Bcl-2) protein expression. Therefore, SPMP-2a could improve cellular antioxidant enzyme activities, reduce ROS levels, and increase Bcl-2 protein expression levels, thereby reducing cell apoptosis and protecting HaCaT cells from H2O2-induced oxidative damage. PMID:28293636

  3. Migration speed and directionality switch of normal epithelial cells after TGF-β1-induced EMT (tEMT) on micro-structured polydimethylsiloxane (PDMS) substrates with variations in stiffness and topographic patterning.

    PubMed

    Wu, Tsung-Hsien; Li, Chia-Hui; Tang, Ming-Jer; Liang, Jen-I; Chen, Chia-Hsin; Yeh, Ming-Long

    2013-10-01

    The epithelial to mesenchymal transition (EMT) involves several physiological and pathological phenomena and endows cells with invasive and migratory properties. However, the effects of substrate stiffness and topography on the migration of cells before or after transforming growth factor-β1 (TGF-β1)-induced EMT (tEMT) are unknown. Herein, we seed control or tEMT NMuMG cells on the 2D patterns consisted of 1 μm or 5 μm line-widths and groove or cone patterns on either 2 MPa (1.96 ± 0.48 MPa) or 4 MPa (3.70 ± 0.74 MPa) polydimethylsiloxane (PDMS) substrates. After tEMT, the increased expression of α-SMA with vinculin in focal adhesion (FA) sites led to an acceleration of tEMT cell motility. On the 2 MPa substrate, the most influenced substrate was the 1 μm, cone-patterned substrate, where the tEMT cells' motility decelerated by 0.13 μm/min (36% slower than the cells on groove pattern). However, on the 5 μm, groove-patterned substrate, where the tEMT cells demonstrated the most rapid motility relative to the control cells, with an increment of 0.18 μm/min (100%). Among the different physical cues from substrate, the cone pattern could impede the migration speed of tEMT cells. Furthermore, we recommend the groove-patterned with a 5 μm line-width substrate as a useful tool to differentiate control and tEMT cells by migration speed.

  4. A novel immunization method to induce cytotoxic T-lymphocyte responses (CTL) against plasmid-encoded herpes simplex virus type-1 glycoprotein D.

    PubMed

    Cruz, P E; Khalil, P L; Dryden, T D; Chiou, H C; Fink, P S; Berberich, S J; Bigley, N J

    1999-03-05

    DNA molecules complexed with an asialoglycoprotein-polycation conjugate, consisting of asialoorosomucoid (ASOR) coupled to poly-L-lysine, can enter hepatocytes which bear receptors for ASOR. We used this receptor-mediated DNA delivery system to deliver plasmid DNA encoding glycoprotein D (gD) of herpes simplex virus type 1 to ASOR-positive cells. Maximum expression of gD protein was seen at 3 days after injection of this preparation in approximately 13% of cells from BALB/c mice [hepatocytes from mice injected intravenously (i.v.) or peritoneal exudate cells from mice injected intraperitoneally (i.p.)]. In comparison with mice injected with either the plasmid vector alone or the gD-containing plasmid uncomplexed to ASOR, mice immunized with gD-containing plasmid complexed with ASOR-poly-L-lysine induced marked antigen-specific CTL responses. BALB/c mice immunized with gD-DNA developed a T-cell-mediated CTL response against target cells expressing gD and MHC class II glycoproteins, but not against cells expressing only gD and MHC class I molecules. In C3H mice, gD-DNA induced a T-cell-mediated CTL response against target cells expressing gD and class I MHC molecules. Serum anti-gD antibody in low titers were produced in both strains of mice. DNA complexed with ASOR-poly-L-lysine induced CTL responses in mice.

  5. Release of active TGF-β1 from the latent TGF-β1/GARP complex on T regulatory cells is mediated by integrin β8.

    PubMed

    Edwards, Justin P; Thornton, Angela M; Shevach, Ethan M

    2014-09-15

    Activated T regulatory cells (Tregs) express latent TGF-β1 on their cell surface bound to GARP. Although integrins have been implicated in mediating the release of active TGF-β1 from the complex of latent TGF-β1 and latent TGF-β1 binding protein, their role in processing latent TGF-β1 from the latent TGF-β1/GARP complex is unclear. Mouse CD4(+)Foxp3(+) Treg, but not CD4(+)Foxp3(-) T cells, expressed integrin β8 (Itgb8) as detected by quantitative RT-PCR. Itgb8 expression was a marker of thymically derived (t)Treg, because it could not be detected on Foxp3(+)Helios(-) Tregs or on Foxp3(+) T cells induced in vitro. Tregs from Itgb8 conditional knockouts exhibited normal suppressor function in vitro and in vivo in a model of colitis but failed to provide TGF-β1 to drive Th17 or induced Treg differentiation in vitro. In addition, Itgb8 knockout Tregs expressed higher levels of latent TGF-β1 on their cell surface consistent with defective processing. Thus, integrin αvβ8 is a marker of tTregs and functions in a cell intrinsic manner in mediating the processing of latent TGF-β1 from the latent TGF-β1/GARP complex on the surface of tTregs.

  6. A Rapid-Response Humoral Vaccine Platform Exploiting Pre-Existing Non-Cognate Populations of Anti-Vaccine or Anti-Viral CD4+ T Helper Cells to Confirm B Cell Activation.

    PubMed

    Hills, Thomas; Jakeman, Phillip G; Carlisle, Robert C; Klenerman, Paul; Seymour, Leonard W; Cawood, Ryan

    2016-01-01

    The need for CD4+ T cell responses to arise de novo following vaccination can limit the speed of B cell responses. Populations of pre-existing vaccine-induced or anti-viral CD4+ T cells recognising distinct antigens could be exploited to overcome this limitation. We hypothesise that liposomal vaccine particles encapsulating epitopes that are recognised, after processing and B cell MHCII presentation, by pre-existing CD4+ T cells will exploit this pre-existing T cell help and result in improved antibody responses to distinct target antigens displayed on the particle surface. Liposomal vaccine particles were engineered to display the malaria circumsporozoite (CSP) antigen on their surface, with helper CD4+ epitopes from distinct vaccine or viral antigens contained within the particle core, ensuring the B cell response is raised but focused against CSP. In vivo vaccination studies were then conducted in C57Bl/6 mice as models of either vaccine-induced pre-existing CD4+ T cell immunity (using ovalbumin-OVA) or virus-induced pre-existing CD4+ T cell immunity (murine cytomegalovirus-MCMV). Following the establishment of pre-existing by vaccination (OVA in the adjuvant TiterMax® Gold) or infection with MCMV, mice were administered CSP-coated liposomal vaccines containing the relevant OVA or MCMV core CD4+ T cell epitopes. In mice with pre-existing anti-OVA CD4+ T cell immunity, these vaccine particles elicited rapid, high-titre, isotype-switched CSP-specific antibody responses-consistent with the involvement of anti-OVA T helper cells in confirming activation of anti-CSP B cells. Responses were further improved by entrapping TLR9 agonists, combining humoral vaccination signals 'one', 'two' and 'three' within one particle. Herpes viruses can establish chronic infection and elicit significant, persistent cellular immune responses. We then demonstrate that this principle can be extended to re-purpose pre-existing anti-MCMV immunity to enhance anti-CSP vaccine responses-the first description of a strategy to specifically exploit anti-cytomegalovirus immunity to augment vaccination against a target antigen.

  7. Niclosamide, an anti-helminthic molecule, downregulates the retroviral oncoprotein Tax and pro-survival Bcl-2 proteins in HTLV-1-transformed T lymphocytes

    PubMed Central

    Chen, Li; Liu, Xin; Belani, Chandra; Cheng, Hua

    2015-01-01

    Adult T cell leukemia and lymphoma (ATL) is a highly aggressive form of hematological malignancy and is caused by chronic infection of human T cell leukemia virus type 1 (HTLV-1). The viral genome encodes an oncogenic protein, Tax, which plays a key role in transactivating viral gene transcription and in deregulating cellular oncogenic signaling to promote survival, proliferation and transformation of virally infected T cells. Hence, Tax is a desirable therapeutic target, particularly at early stage of HTLV-1-mediated oncogenesis. We here show that niclosamide, an anti-helminthic molecule, induced apoptosis of HTLV-1-transformed T cells. Niclosamide facilitated degradation of the Tax protein in proteasome. Consistent with niclosamide-mediated Tax degradation, this compound inhibited activities of MAPK/ERK1/2 and IκB kinases. In addition, niclosamide downregulated Stat3 and pro-survival Bcl-2 family members such as Mcl-1 and repressed the viral gene transcription of HTLV-1 through induction of Tax degradation. Since Tax, Stat3 and Mcl-1 are crucial molecules for promoting survival and growth of HTLV-1-transformed T cells, our findings demonstrate a novel mechanism of niclosamide in inducing Tax degradation and downregulating various cellular pro-survival molecules, thereby promoting apoptosis of HTLV-1-associated leukemia cells. PMID:26116531

  8. Polyfunctional response by ImmTAC (IMCgp100) redirected CD8+ and CD4+ T cells.

    PubMed

    Boudousquie, Caroline; Bossi, Giovanna; Hurst, Jacob M; Rygiel, Karolina A; Jakobsen, Bent K; Hassan, Namir J

    2017-11-01

    The success of immune system-based cancer therapies depends on a broad immune response engaging a range of effector cells and mechanisms. Immune mobilizing monoclonal T cell receptors (TCRs) against cancer (ImmTAC™ molecules: fusion proteins consisting of a soluble, affinity enhanced TCR and an anti-CD3 scFv antibody) were previously shown to redirect CD8 + and CD4 + T cells against tumours. Here we present evidence that IMCgp100 (ImmTAC recognizing a peptide derived from the melanoma-specific protein, gp100, presented by HLA-A*0201) efficiently redirects and activates effector and memory cells from both CD8 + and CD4 + repertoires. Using isolated subpopulations of T cells, we find that both terminally differentiated and effector memory CD8 + T cells redirected by IMCgp100 are potent killers of melanoma cells. Furthermore, CD4 + effector memory T cells elicit potent cytotoxic activity leading to melanoma cell killing upon redirection by IMCgp100. The majority of T cell subsets belonging to both the CD8 + and CD4 + repertoires secrete key pro-inflammatory cytokines (tumour necrosis factor-α, interferon-γ, interleukin-6) and chemokines (macrophage inflammatory protein-1α-β, interferon-γ-inducible protein-10, monocyte chemoattractant protein-1). At an individual cell level, IMCgp100-redirected T cells display a polyfunctional phenotype, which is a hallmark of a potent anti-cancer response. This study demonstrates that IMCgp100 induces broad immune responses that extend beyond the induction of CD8 + T cell-mediated cytotoxicity. These findings are of particular importance because IMCgp100 is currently undergoing clinical trials as a single agent or in combination with check point inhibitors for patients with malignant melanoma. © 2017 The Authors. Immunology Published by John Wiley & Sons Ltd.

  9. T-kininogen can either induce or inhibit proliferation in Balb/c 3T3 fibroblasts, depending on the route of administration.

    PubMed

    Aravena, M; Pérez, C; Pérez, V; Acuña-Castillo, C; Gómez, C; Leiva-Salcedo, E; Nishimura, S; Sabaj, V; Walter, R; Sierra, F

    2005-03-01

    T-kininogen (T-KG) is a precursor of T-kinin, the most abundant kinin in rat serum, and also acts as a strong and specific cysteine proteinase inhibitor. Its expression is strongly induced during aging in rats, and expression of T-KG in Balb/c 3T3 fibroblasts results in inhibition of cell proliferation. However, T-KG is a serum protein produced primarily in the liver, and thus, most cells are only exposed to the protein from the outside. To test the effect of T-KG on fibroblasts exposed to exogenous T-KG, we purified the protein from the serum of K-kininogen-deficient Katholiek rats. In contrast to the results obtained by transfection, exposure of Balb/c 3T3 fibroblasts to exogenously added T-KG leads to a dose-dependent increase in [3H]-thymidine incorporation. This response does not require kinin receptors, but it is clearly mediated by activation of the ERK pathway. As a control, we repeated the transfection experiments, using a different promoter. The results are consistent with our published data showing that, under these circumstances, T-KG inhibits cell proliferation. We conclude that T-KG exerts opposite effects on fibroblast proliferation, depending exclusively on the way that it is administered to the cells (transfection versus exogenous addition).

  10. The basis of distinctive IL-2- and IL-15-dependent signaling: weak CD122-dependent signaling favors CD8+ T central-memory cell survival but not T effector-memory cell development.

    PubMed

    Castro, Iris; Yu, Aixin; Dee, Michael J; Malek, Thomas R

    2011-11-15

    Recent work suggests that IL-2 and IL-15 induce distinctive levels of signaling through common receptor subunits and that such varied signaling directs the fate of Ag-activated CD8(+) T cells. In this study, we directly examined proximal signaling by IL-2 and IL-15 and CD8(+) T cell primary and memory responses as a consequence of varied CD122-dependent signaling. Initially, IL-2 and IL-15 induced similar p-STAT5 and p-S6 activation, but these activities were only sustained by IL-2. Transient IL-15-dependent signaling is due to limited expression of IL-15Rα. To investigate the outcome of varied CD122 signaling for CD8(+) T cell responses in vivo, OT-I T cells were used from mouse models where CD122 signals were attenuated by mutations within the cytoplasmic tail of CD122 or intrinsic survival function was provided in the absence of CD122 expression by transgenic Bcl-2. In the absence of CD122 signaling, generally normal primary response occurred, but the primed CD8(+) T cells were not maintained. In marked contrast, weak CD122 signaling supported development and survival of T central-memory (T(CM)) but not T effector-memory (T(EM)) cells. Transgenic expression of Bcl-2 in CD122(-/-) CD8(+) T cells also supported the survival and persistence of T(CM) cells but did not rescue T(EM) development. These data indicate that weak CD122 signals readily support T(CM) development largely through providing survival signals. However, stronger signals, independent of Bcl-2, are required for T(EM) development. Our findings are consistent with a model whereby low, intermediate, and high CD122 signaling support T(CM) memory survival, T(EM) programming, and terminal T effector cell differentiation, respectively.

  11. Proteomic-based identification of Apg-2 as a therapeutic target for chronic myeloid leukemia.

    PubMed

    Li, Yajuan; Chen, Xi; Shi, Meng; Wang, Haixia; Cao, Weixi; Wang, Xiaozhong; Li, Chunli; Feng, Wenli

    2013-12-01

    The oncogenic BCR/ABL tyrosine kinase induces constitutive enhanced "spontaneous" DNA damage and unfaithful repair in Philadelphia chromosome positive leukemia cells. Here, we investigated the changes of protein profile in H2O2-induced DNA damage/repair in BaF3-MIGR1 and BaF3-BCR/ABL cells through a proteomic strategy consisting of two-dimensional gel electrophoresis (2-DE) coupled with MALDI-TOF mass spectrometry. In total, 41 spots were differentially expressed and 13 proteins were identified with further MS analysis. Two essential proteins, Proto-oncogene tyrosine-protein kinase ABL1 (c-ABL) and Heat shock 70kDa protein 4 (Apg-2), were confirmed by Western blot and showed consistent changes with proteomic results. Moreover, functional analysis demonstrated that inhibition of Apg-2 not only decreased cell proliferation, but also induced cell apoptosis in BCR/ABL positive cells (BaF3-BCR/ABL, BaF3-BCR/ABL(T315I)). We also proved that Apg-2 inhibition aggravated H2O2 induced damage in BCR/ABL positive cells, and enhanced the sensitivity of BaF3-BCR/ABL(T315I) to STI571. Taken together, the findings in this work provide us with some clues to a better understanding of the molecular mechanisms underlying BCR/ABL in the DNA damage/repair processes and demonstrated that Apg-2 would be a valid target for anti-leukemia drug development. © 2013.

  12. Potent Immune Modulation by MEDI6383, an Engineered Human OX40 Ligand IgG4P Fc Fusion Protein.

    PubMed

    Oberst, Michael D; Augé, Catherine; Morris, Chad; Kentner, Stacy; Mulgrew, Kathy; McGlinchey, Kelly; Hair, James; Hanabuchi, Shino; Du, Qun; Damschroder, Melissa; Feng, Hui; Eck, Steven; Buss, Nicholas; de Haan, Lolke; Pierce, Andrew J; Park, Haesun; Sylwester, Andrew; Axthelm, Michael K; Picker, Louis; Morris, Nicholas P; Weinberg, Andrew; Hammond, Scott A

    2018-05-01

    Ligation of OX40 (CD134, TNFRSF4) on activated T cells by its natural ligand (OX40L, CD252, TNFSF4) enhances cellular survival, proliferation, and effector functions such as cytokine release and cellular cytotoxicity. We engineered a recombinant human OX40L IgG4P Fc fusion protein termed MEDI6383 that assembles into a hexameric structure and exerts potent agonist activity following engagement of OX40. MEDI6383 displayed solution-phase agonist activity that was enhanced when the fusion protein was clustered by Fc gamma receptors (FcγRs) on the surface of adjacent cells. The resulting costimulation of OX40 on T cells induced NFκB promoter activity in OX40-expressing T cells and induced Th1-type cytokine production, proliferation, and resistance to regulatory T cell (Treg)-mediated suppression. MEDI6383 enhanced the cytolytic activity of tumor-reactive T cells and reduced tumor growth in the context of an alloreactive human T cell:tumor cell admix model in immunocompromised mice. Consistent with the role of OX40 costimulation in the expansion of memory T cells, MEDI6383 administered to healthy nonhuman primates elicited peripheral blood CD4 and CD8 central and effector memory T-cell proliferation as well as B-cell proliferation. Together, these results suggest that OX40 agonism has the potential to enhance antitumor immunity in human malignancies. Mol Cancer Ther; 17(5); 1024-38. ©2018 AACR . ©2018 American Association for Cancer Research.

  13. Identification of a FOXP3+CD3+CD56+ population with immunosuppressive function in cancer tissues of human hepatocellular carcinoma

    PubMed Central

    Li, Xiaofeng; Peng, Jirun; Pang, Yanli; Yu, Sen; Yu, Xin; Chen, Pengcheng; Wang, Wenzhen; Han, Wenling; Zhang, Jun; Yin, Yanhui; Zhang, Yu

    2015-01-01

    The liver resident lymphoid population is featured by the presence of a large number of CD3+CD56+ cells referred as natural T cells. In human hepatocellular carcinoma (HCC) patients, the natural T cells were found to be sharply decreased in tumor (5.871 ± 3.553%) versus non-tumor (14.02 ± 6.151%) tissues. More intriguingly, a substantial fraction of the natural T cells (22.76 ± 18.61%) assumed FOXP3 expression. These FOXP3-expressing CD3+CD56+ cells lost the expression of IFN-γ and perforin, which are critical for the effector function of natural T cells. On the other hand, they acquired surface expression of CD25 and CTLA-4 typically found in regulatory T (Treg) cells. Consistent with the phenotypic conversion, they imposed an inhibitory effect on anti-CD3-induced proliferation of naive T cells. Further studies demonstrated that transforming growth factor β1 (TGF-β1) could effectively induce FOXP3 expression in CD3+CD56+ cells and the cells were thus endowed with a potent immunosuppressive capacity. Finally, Kaplan-Meier analysis revealed that the relative abundance of FOXP3-expressing CD3+CD56+ cells in tumor tissues was significantly correlated with the survival of HCC patients. In conclusion, the present study identified a new type of regulatory immune cells whose emergence in liver cancer tissues may contribute to tumor progression. PMID:26437631

  14. CD8+ T cells induce thyroid epithelial cell hyperplasia and fibrosis.

    PubMed

    Yu, Shiguang; Fang, Yujiang; Sharav, Tumenjargal; Sharp, Gordon C; Braley-Mullen, Helen

    2011-02-15

    CD8(+) T cells can be important effector cells in autoimmune inflammation, generally because they can damage target cells by cytotoxicity. This study shows that activated CD8(+) T cells induce thyroid epithelial cell hyperplasia and proliferation and fibrosis in IFN-γ(-/-) NOD.H-2h4 SCID mice in the absence of CD4(+) T cells. Because CD8(+) T cells induce proliferation rather than cytotoxicity of target cells, these results describe a novel function for CD8(+) T cells in autoimmune disease. In contrast to the ability of purified CD8(+) T cells to induce thyrocyte proliferation, CD4(+) T cells or CD8 T cell-depleted splenocytes induced only mild thyroid lesions in SCID recipients. T cells in both spleens and thyroids highly produce TNF-α. TNF-α promotes proliferation of thyrocytes in vitro, and anti-TNF-α inhibits development of thyroid epithelial cell hyperplasia and proliferation in SCID recipients of IFN-γ(-/-) splenocytes. This suggests that targeting CD8(+) T cells and/or TNF-α may be effective for treating epithelial cell hyperplasia and fibrosis.

  15. Regulation of dendritic cell function through toll-like receptors.

    PubMed

    Kaisho, Tsuneyasu; Akira, Shizuo

    2003-12-01

    Higher animals establish host defense by orchestrating innate and adaptive immunity. This is mediated by professional antigen presenting cells, i.e. dendritic cells (DCs). DCs can incorporate pathogens, produce a variety of cytokines, maturate, and present pathogen-derived peptides to T cells, thereby inducing T cell activation and differentiation. These responses are triggered by microbial recognition through type I transmembrane proteins, Toll-like receptors (TLRs) on DCs. TLRs consist of ten members and each TLR is involved in recognizing a variety of microorganism-derived molecular structures. TLR ligands include cell wall components, proteins, nucleic acids, and synthetic chemical compounds, all of which can activate DCs as immune adjuvants.

  16. Capsiate Inhibits DNFB-Induced Atopic Dermatitis in NC/Nga Mice through Mast Cell and CD4+ T-Cell Inactivation.

    PubMed

    Lee, Ji H; Lee, Yun S; Lee, Eun-Jung; Lee, Ji H; Kim, Tae-Yoon

    2015-08-01

    Capsaicin has many biological effects, such as antioxidant, anticancer, and antiangiogenic effects, but it is rarely used because of its high pungency. Capsiate, a nonpungent capsaicin analog, also has multiple biological effects, similar to those of capsaicin, but does not cause irritation. However, the effect of capsiate on allergic responses and immune cells has not been well studied. In this study, we investigated the effect of capsiate on atopic dermatitis, mouse CD4+ T cells, and mast cell activation. Capsiate inhibited DNFB-induced atopic dermatitis in NC/Nga mice. Topical treatment with capsiate suppressed serum IgE levels and cytokine and chemokine expression in the skin of DNFB-treated NC/Nga mice. In addition, it suppressed the activation of CD4+ T cells and mast cells, which are implicated in allergic diseases. Capsiate inhibited the differentiation of naïve CD4+ T cells into T helper type 1 (Th1), Th2, and Th17 cells. Treatment with capsiate inhibited the expression of pro-inflammatory cytokines and degranulation from activated bone marrow-derived mast cells through the inhibition of extracellular signal-regulated kinase signal pathways. Consistent with these results, treatment with capsiate inhibited passive cutaneous anaphylaxis. Taken together, our results suggest that capsiate might be a good candidate molecule for the treatment of allergic diseases such as atopic dermatitis.

  17. CD8+ T Cells Induce Fatal Brainstem Pathology during Cerebral Malaria via Luminal Antigen-Specific Engagement of Brain Vasculature

    PubMed Central

    Swanson, Phillip A.; Hart, Geoffrey T.; Russo, Matthew V.; Nayak, Debasis; Yazew, Takele; Peña, Mirna; Khan, Shahid M.; Pierce, Susan K.; McGavern, Dorian B.

    2016-01-01

    Cerebral malaria (CM) is a severe complication of Plasmodium falciparum infection that results in thousands of deaths each year, mostly in African children. The in vivo mechanisms underlying this fatal condition are not entirely understood. Using the animal model of experimental cerebral malaria (ECM), we sought mechanistic insights into the pathogenesis of CM. Fatal disease was associated with alterations in tight junction proteins, vascular breakdown in the meninges / parenchyma, edema, and ultimately neuronal cell death in the brainstem, which is consistent with cerebral herniation as a cause of death. At the peak of ECM, we revealed using intravital two-photon microscopy that myelomonocytic cells and parasite-specific CD8+ T cells associated primarily with the luminal surface of CNS blood vessels. Myelomonocytic cells participated in the removal of parasitized red blood cells (pRBCs) from cerebral blood vessels, but were not required for the disease. Interestingly, the majority of disease-inducing parasite-specific CD8+ T cells interacted with the lumen of brain vascular endothelial cells (ECs), where they were observed surveying, dividing, and arresting in a cognate peptide-MHC I dependent manner. These activities were critically dependent on IFN-γ, which was responsible for activating cerebrovascular ECs to upregulate adhesion and antigen-presenting molecules. Importantly, parasite-specific CD8+ T cell interactions with cerebral vessels were impaired in chimeric mice rendered unable to present EC antigens on MHC I, and these mice were in turn resistant to fatal brainstem pathology. Moreover, anti-adhesion molecule (LFA-1 / VLA-4) therapy prevented fatal disease by rapidly displacing luminal CD8+ T cells from cerebrovascular ECs without affecting extravascular T cells. These in vivo data demonstrate that parasite-specific CD8+ T cell-induced fatal vascular breakdown and subsequent neuronal death during ECM is associated with luminal, antigen-dependent interactions with cerebrovasculature. PMID:27907215

  18. Autologous CLL cell vaccination early after transplant induces leukemia-specific T cells.

    PubMed

    Burkhardt, Ute E; Hainz, Ursula; Stevenson, Kristen; Goldstein, Natalie R; Pasek, Mildred; Naito, Masayasu; Wu, Di; Ho, Vincent T; Alonso, Anselmo; Hammond, Naa Norkor; Wong, Jessica; Sievers, Quinlan L; Brusic, Ana; McDonough, Sean M; Zeng, Wanyong; Perrin, Ann; Brown, Jennifer R; Canning, Christine M; Koreth, John; Cutler, Corey; Armand, Philippe; Neuberg, Donna; Lee, Jeng-Shin; Antin, Joseph H; Mulligan, Richard C; Sasada, Tetsuro; Ritz, Jerome; Soiffer, Robert J; Dranoff, Glenn; Alyea, Edwin P; Wu, Catherine J

    2013-09-01

    Patients with advanced hematologic malignancies remain at risk for relapse following reduced-intensity conditioning (RIC) allogeneic hematopoietic stem cell transplantation (allo-HSCT). We conducted a prospective clinical trial to test whether vaccination with whole leukemia cells early after transplantation facilitates the expansion of leukemia-reactive T cells and thereby enhances antitumor immunity. We enrolled 22 patients with advanced chronic lymphocytic leukemia (CLL), 18 of whom received up to 6 vaccines initiated between days 30 and 45 after transplantation. Each vaccine consisted of irradiated autologous tumor cells admixed with GM-CSF-secreting bystander cells. Serial patient PBMC samples following transplantation were collected, and the impact of vaccination on T cell activity was evaluated. At a median follow-up of 2.9 (range, 1-4) years, the estimated 2-year progression-free and overall survival rates of vaccinated subjects were 82% (95% CI, 54%-94%) and 88% (95% CI, 59%-97%), respectively. Although vaccination only had a modest impact on recovering T cell numbers, CD8+ T cells from vaccinated patients consistently reacted against autologous tumor, but not alloantigen-bearing recipient cells with increased secretion of the effector cytokine IFN-γ, unlike T cells from nonvaccinated CLL patients undergoing allo-HSCT. Further analysis confirmed that 17% (range, 13%-33%) of CD8+ T cell clones isolated from 4 vaccinated patients by limiting dilution of bulk tumor-reactive T cells solely reacted against CLL-associated antigens. Our studies suggest that autologous tumor cell vaccination is an effective strategy to advance long-term leukemia control following allo-HSCT. Clinicaltrials.gov NCT00442130. NCI (5R21CA115043-2), NHLBI (5R01HL103532-03), and Leukemia and Lymphoma Society Translational Research Program.

  19. Cancer immunotherapy and immunological memory.

    PubMed

    Murata, Kenji; Tsukahara, Tomohide; Torigoe, Toshihiko

    2016-01-01

    Human immunological memory is the key distinguishing hallmark of the adaptive immune system and plays an important role in the prevention of morbidity and the severity of infection. The differentiation system of T cell memory has been clarified using mouse models. However, the human T cell memory system has great diversity induced by natural antigens derived from many pathogens and tumor cells throughout life, and profoundly differs from the mouse memory system constructed using artificial antigens and transgenic T cells. We believe that only human studies can elucidate the human immune system. The importance of immunological memory in cancer immunotherapy has been pointed out, and the trafficking properties and long-lasting anti-tumor capacity of memory T cells play a crucial role in the control of malignant tumors. Adoptive cell transfer of less differentiated T cells has consistently demonstrated superior anti-tumor capacity relative to more differentiated T cells. Therefore, a human T cell population with the characteristics of stem cell memory is thought to be attractive for peptide vaccination and adoptive cell transfer. A novel human memory T cell population that we have identified is closer to the naive state than previous memory T cells in the T cell differentiation lineage, and has the characteristics of stem-like chemoresistance. Here we introduce this novel population and describe the fundamentals of immunological memory in cancer immunotherapy.

  20. A PKA survival pathway inhibited by DPT-PKI, a new specific cell permeable PKA inhibitor, is induced by T. annulata in parasitized B-lymphocytes.

    PubMed

    Guergnon, Julien; Dessauge, Frederic; Traincard, François; Cayla, Xavier; Rebollo, Angelita; Bost, Pierre Etienne; Langsley, Gordon; Garcia, Alphonse

    2006-08-01

    T. annulata, an intracellular pathogenic parasite of the Aplicomplexa protozoan family infects bovine B-lymphocytes and macrophages. Parasitized cells that become transformed survive and proliferate independently of exogenous growth factors. In the present study, we used the isogenic non parasitized BL3 and parasitized TBL3 B cell lines, as a model to evaluate the contribution of two-major PI3-K- and PKA-dependent anti-apoptotic pathways in the survival of T. annulata parasitized B lymphocytes. We found that T. annulata increases PKA activity, induces over-expression of the catalytic subunit and down-regulates the pro-survival phosphorylation state of Akt/PKB. Consistent with a role of PKA activation in survival, two pharmacological inhibitors H89 and KT5720 ablate PKA-dependent survival of parasitized cells. To specifically inhibit PKA pro-survival pathways we linked the DPTsh1 peptide shuttle sequence to PKI(5-24) and we generated DPT-PKI, a cell permeable PKI. DPT-PKI specifically inhibited PKA activity in bovine cell extracts and, as expected, also inhibited the PKA-dependent survival of T. annulata parasitized TBL3 cells. Thus, parasite-dependent constitutive activation of PKA in TBL3 cells generates an anti-apoptotic pathway that can protect T. annulata-infected B cells from apoptosis. These results also indicate that DPT-PKI could be a powerful tool to inhibit PKA pathways in other cell types.

  1. T-Cell Artificial Focal Triggering Tools: Linking Surface Interactions with Cell Response

    PubMed Central

    Carpentier, Benoît; Pierobon, Paolo; Hivroz, Claire; Henry, Nelly

    2009-01-01

    T-cell activation is a key event in the immune system, involving the interaction of several receptor ligand pairs in a complex intercellular contact that forms between T-cell and antigen-presenting cells. Molecular components implicated in contact formation have been identified, but the mechanism of activation and the link between molecular interactions and cell response remain poorly understood due to the complexity and dynamics exhibited by whole cell-cell conjugates. Here we demonstrate that simplified model colloids grafted so as to target appropriate cell receptors can be efficiently used to explore the relationship of receptor engagement to the T-cell response. Using immortalized Jurkat T cells, we monitored both binding and activation events, as seen by changes in the intracellular calcium concentration. Our experimental strategy used flow cytometry analysis to follow the short time scale cell response in populations of thousands of cells. We targeted both T-cell receptor CD3 (TCR/CD3) and leukocyte-function-associated antigen (LFA-1) alone or in combination. We showed that specific engagement of TCR/CD3 with a single particle induced a transient calcium signal, confirming previous results and validating our approach. By decreasing anti-CD3 particle density, we showed that contact nucleation was the most crucial and determining step in the cell-particle interaction under dynamic conditions, due to shear stress produced by hydrodynamic flow. Introduction of LFA-1 adhesion molecule ligands at the surface of the particle overcame this limitation and elucidated the low TCR/CD3 ligand density regime. Despite their simplicity, model colloids induced relevant biological responses which consistently echoed whole cell behavior. We thus concluded that this biophysical approach provides useful tools for investigating initial events in T-cell activation, and should enable the design of intelligent artificial systems for adoptive immunotherapy. PMID:19274104

  2. Protective effects of anethole dithiolethione against oxidative stress-induced cytotoxicity in human Jurkat T cells.

    PubMed

    Khanna, S; Sen, C K; Roy, S; Christen, M O; Packer, L

    1998-07-01

    The protective effects of anethole dithiolethione (ADT) against H2O2- or 4-hydroxynonenal (HNE)-induced cytotoxicity in human Jurkat T cells were investigated. Jurkat T cells were pretreated with ADT (10-50 microM) for 18 hr and then challenged with H202 or HNE for up to 4 hr. Cytotoxicity was assessed by measuring: 1) leakage of lactate dehydrogenase from cells to medium; and 2) exclusion of the DNA intercalating fluorescent probe propidium iodide by viable cells. Pretreatment of cells with ADT (10 or 25 microM) for 18 hr significantly protected cells against H202- or HNE-induced cytotoxicity. Treatment of cells with ADT (10-50 microM) for 72 hr significantly increased the activities of catalase and glutathione reductase. The maximum effect of ADT treatment on the activity of these enzymes was observed when cells were treated with 25 microM of ADT for 72 hr. A significant increase in cellular GSH was observed in cells that were treated with ADT for 72 hr. Using monobromobimane as a thiol probe, we consistently observed that cells pretreated for 18 hr with ADT (25 or 50 microM) had also increased total thiol content. Exposure of Jurkat T cells to H202 or HNE resulted in a time-dependent decrease in cellular GSH. ADT (10-50 microM, 18 hr) pretreatment circumvented H202-dependent lowering of cellular GSH. In conclusion, ADT proved to be a potent cytoprotective thiol antioxidant with multifaceted mechanisms of action, suggesting that the drug has a remarkable therapeutic potential.

  3. Association of T-Zone Reticular Networks and Conduits with Ectopic Lymphoid Tissues in Mice and Humans

    PubMed Central

    Link, Alexander; Hardie, Debbie L.; Favre, Stéphanie; Britschgi, Mirjam R.; Adams, David H.; Sixt, Michael; Cyster, Jason G.; Buckley, Christopher D.; Luther, Sanjiv A.

    2011-01-01

    Ectopic or tertiary lymphoid tissues (TLTs) are often induced at sites of chronic inflammation. They typically contain various hematopoietic cell types, high endothelial venules, and follicular dendritic cells; and are organized in lymph node–like structures. Although fibroblastic stromal cells may play a role in TLT induction and persistence, they have remained poorly defined. Herein, we report that TLTs arising during inflammation in mice and humans in a variety of tissues (eg, pancreas, kidney, liver, and salivary gland) contain stromal cell networks consisting of podoplanin+ T-zone fibroblastic reticular cells (TRCs), distinct from follicular dendritic cells. Similar to lymph nodes, TRCs were present throughout T-cell–rich areas and had dendritic cells associated with them. They expressed lymphotoxin (LT) β receptor (LTβR), produced CCL21, and formed a functional conduit system. In rat insulin promoter–CXCL13–transgenic pancreas, the maintenance of TRC networks and conduits was partially dependent on LTβR and on lymphoid tissue inducer cells expressing LTβR ligands. In conclusion, TRCs and conduits are hallmarks of secondary lymphoid organs and of well-developed TLTs, in both mice and humans, and are likely to act as important scaffold and organizer cells of the T-cell–rich zone. PMID:21435450

  4. The complex pathophysiology of acquired aplastic anaemia

    PubMed Central

    Zeng, Y; Katsanis, E

    2015-01-01

    Immune-mediated destruction of haematopoietic stem/progenitor cells (HSPCs) plays a central role in the pathophysiology of acquired aplastic anaemia (aAA). Dysregulated CD8+ cytotoxic T cells, CD4+ T cells including T helper type 1 (Th1), Th2, regulatory T cells and Th17 cells, natural killer (NK) cells and NK T cells, along with the abnormal production of cytokines including interferon (IFN)-γ, tumour necrosis factor (TNF)-α and transforming growth factor (TGF)-β, induce apoptosis of HSPCs, constituting a consistent and defining feature of severe aAA. Alterations in the polymorphisms of TGF-β, IFN-γ and TNF-α genes, as well as certain human leucocyte antigen (HLA) alleles, may account for the propensity to immune-mediated killing of HSPCs and/or ineffective haematopoiesis. Although the inciting autoantigens remain elusive, autoantibodies are often detected in the serum. In addition, recent studies provide genetic and molecular evidence that intrinsic and/or secondary deficits in HSPCs and bone marrow mesenchymal stem cells may underlie the development of bone marrow failure. PMID:25683099

  5. Successful Vaccination Induces Multifunctional Memory T-Cell Precursors Associated with Early Control of Hepatitis C Virus

    PubMed Central

    Park, Su-Hyung; Shin, Eui-Cheol; Capone, Stefania; Caggiari, Laura; De Re, Valli; Nicosia, Alfredo; Folgori, Antonella; Rehermann, Barbara

    2012-01-01

    Background & Aims T cells are an important component for development of a vaccine against hepatitis C virus (HCV), but little is known about the features of successful vaccine-induced T cells. Methods We compared the phenotype, function, and kinetics of vaccine-induced and infection-induced T cells in chimpanzees with HCV infection using multicolor flow cytometry and real-time PCR. Results In chimpanzees successfully vaccinated with recombinant adenovirus and DNA against HCV NS3-NS5, HCV-specific T cells appeared earlier, maintained better functionality, and persisted at higher frequencies, for a longer time after HCV-challenge, than those of mock-vaccinated chimpanzees. Vaccine-induced T cells displayed higher levels of CD127, a marker of memory precursors, and lower levels of programmed death (PD)-1 than infection-induced T cells. Vaccine-induced, but not infection-induced T cells, were multifunctional; their ability to secrete interferon-γ and tumor necrosis factor-α correlated with early expression of CD127 but not PD-1. Based on a comparison of vaccine-induced and infection-induced T cells from the same chimpanzee, the CD127+ memory precursor phenotype was induced by the vaccine itself, rather than by low viremia. In contrast, PD-1 induction correlated with viremia, and levels of intrahepatic PD-1, PD-L1, and 2,5-OAS-1 mRNAs correlated with peak titers of HCV. Conclusions Compared with infection, vaccination induced HCV-specific CD127+ T cells with high functionality that persisted at higher levels for a longer time. Control of viremia prevented upregulation of PD-1 on T cells, and induction of PD-1, PD-L1, and 2,5-OAS-1 in the liver. Early development of a memory T-cell phenotype and, via control of viremia, attenuation of the inhibitory PD1–PD-L1 pathway might be necessary components of successful vaccine-induced protection against HCV. PMID:22705008

  6. Tissue-Specific Autoregulation of the stat3 Gene and Its Role in Interleukin-6-Induced Survival Signals in T Cells

    PubMed Central

    Narimatsu, Masahiro; Maeda, Hisoka; Itoh, Shousaku; Atsumi, Toru; Ohtani, Takuya; Nishida, Keigo; Itoh, Motoyuki; Kamimura, Daisuke; Park, Sung-Joo; Mizuno, Katsunori; Miyazaki, Jun-ichi; Hibi, Masahiko; Ishihara, Katsuhiko; Nakajima, Koichi; Hirano, Toshio

    2001-01-01

    Signal transducer and activator of transcription 3 (STAT3) mediates signals of various growth factors and cytokines, including interleukin-6 (IL-6). In certain IL-6-responsive cell lines, the stat3 gene is autoregulated by STAT3 through a composite IL-6 response element in its promoter that contains a STAT3-binding element (SBE) and a cyclic AMP-responsive element. To reveal the nature and roles of the stat3 autoregulation in vivo, we generated mice that harbor a mutation in the SBE (stat3mSBE). The intact SBE was crucial for IL-6-induced stat3 gene activation in the spleen, especially in the red pulp region, the kidney, and both mature and immature T lymphocytes. The SBE was not required, however, for IL-6-induced stat3 gene activation in hepatocytes. T lymphocytes from the stat3mSBE/mSBE mice were more susceptible to apoptosis despite the presence of IL-6 than those from wild-type mice. Consistent with this, IL-6-dependent activation of the Pim-1 and junB genes, direct target genes for STAT3, was attenuated in T lymphocytes of the stat3mSBE/mSBE mice. Thus, the tissue-specific autoregulation of the stat3 gene operates in vivo and plays a role in IL-6-induced antiapoptotic signaling in T cells. PMID:11533249

  7. Putative oncogene Brachyury (T) is essential to specify cell fate but dispensable for notochord progenitor proliferation and EMT.

    PubMed

    Zhu, Jianjian; Kwan, Kin Ming; Mackem, Susan

    2016-04-05

    The transcription factor Brachyury (T) gene is expressed throughout primary mesoderm (primitive streak and notochord) during early embryonic development and has been strongly implicated in the genesis of chordoma, a sarcoma of notochord cell origin. Additionally, T expression has been found in and proposed to play a role in promoting epithelial-mesenchymal transition (EMT) in various other types of human tumors. However, the role of T in normal mammalian notochord development and function is still not well-understood. We have generated an inducible knockdown model to efficiently and selectively deplete T from notochord in mouse embryos. In combination with genetic lineage tracing, we show that T function is essential for maintaining notochord cell fate and function. Progenitors adopt predominantly a neural fate in the absence of T, consistent with an origin from a common chordoneural progenitor. However, T function is dispensable for progenitor cell survival, proliferation, and EMT, which has implications for the therapeutic targeting of T in chordoma and other cancers.

  8. Putative oncogene Brachyury (T) is essential to specify cell fate but dispensable for notochord progenitor proliferation and EMT

    PubMed Central

    Zhu, Jianjian; Kwan, Kin Ming; Mackem, Susan

    2016-01-01

    The transcription factor Brachyury (T) gene is expressed throughout primary mesoderm (primitive streak and notochord) during early embryonic development and has been strongly implicated in the genesis of chordoma, a sarcoma of notochord cell origin. Additionally, T expression has been found in and proposed to play a role in promoting epithelial–mesenchymal transition (EMT) in various other types of human tumors. However, the role of T in normal mammalian notochord development and function is still not well-understood. We have generated an inducible knockdown model to efficiently and selectively deplete T from notochord in mouse embryos. In combination with genetic lineage tracing, we show that T function is essential for maintaining notochord cell fate and function. Progenitors adopt predominantly a neural fate in the absence of T, consistent with an origin from a common chordoneural progenitor. However, T function is dispensable for progenitor cell survival, proliferation, and EMT, which has implications for the therapeutic targeting of T in chordoma and other cancers. PMID:27006501

  9. Critical role for perforin and Fas-dependent killing of dendritic cells in the control of inflammation

    PubMed Central

    Felix, Kumar

    2012-01-01

    After stimulation of antigen-specific T cells, dendritic cell (DCs) are susceptible to killing by these activated T cells that involve perforin and Fas-dependent mechanisms. Fas-dependent DC apoptosis has been shown to limit DC accumulation and prevent the development of autoimmunity. However, a role for perforin in the maintenance of DC homeostasis for immune regulation remains to be determined. Here we show that perforin deficiency in mice, together with the deletion of Fas in DCs (perforin−/−DC-Fas−/−), led to DC accumulation, uncontrolled T-cell activation, and IFN-γ production by CD8+ T cells, resulting in the development of lethal hemophagocytic lymphohistiocytosis. Consistently, adoptive transfer of Fas−/− DCs induced over-activation and IFN-γ production in perforin−/− CD8+ T cells. Neutralization of IFN-γ prevented the spreading of inflammatory responses to different cell types and protected the survival of perforin−/−DC-Fas−/− mice. Our data suggest that perforin and Fas synergize in the maintenance of DC homeostasis to limit T cell activation, and prevent the initiation of an inflammatory cascade. PMID:22042696

  10. Western and Chinese antirheumatic drug-induced T cell apoptotic DNA damage uses different caspase cascades and is independent of Fas/Fas ligand interaction.

    PubMed

    Lai, J H; Ho, L J; Lu, K C; Chang, D M; Shaio, M F; Han, S H

    2001-06-01

    Spontaneous or therapeutic induction of T cell apoptosis plays a critical role in establishing transplantation tolerance and maintaining remission of autoimmune diseases. We investigated the mechanisms of apoptosis induced by Chinese and Western antirheumatic drugs (ARDs) in human T cells. We found that hydroxychloroquine, Tripterygium wilfordii hook F, and tetrandrine (Tet), but not methotrexate, at therapeutic concentrations can cause T cell death. In addition, Tet selectively killed T cells, especially activated T cells. Although ARD-induced cytotoxicity was mediated through apoptotic mechanisms, Fas/Fas ligand interaction was not required. We further demonstrated that the processes of phosphatidylserine externalization and DNA damage along the ARD-induced T cell apoptotic pathway could operate independently, and that selective inhibition of DNA damage by caspase inhibitors did not prevent T cells from undergoing cell death. Moreover, we found that Tet- and Tripterygium wilfordii hook F-induced T cell DNA damage required caspase-3 activity, and hydroxychloroquine-induced T cell DNA damage was mediated through a caspase-3- and caspase-8-independent, but Z-Asp-Glu-Val-Asp-fluomethyl ketone-sensitive, signaling pathway. Finally, the observation that ARD-induced activation of caspase-3 in both Fas-sensitive and Fas-resistant Jurkat T cells indicates that Fas/Fas ligand interaction plays no role in ARD-induced T cell apoptosis. Our observations provide new information about the complex apoptotic mechanisms of ARDs, and have implications for combining Western and Chinese ARDs that have different immunomodulatory mechanisms in the therapy of autoimmune diseases and transplantation rejection.

  11. Alpha-Particle-Induced Complex Chromosome Exchanges Transmitted through Extra-Thymic Lymphopoiesis In Vitro Show Evidence of Emerging Genomic Instability

    PubMed Central

    Sumption, Natalia; Goodhead, Dudley T.; Anderson, Rhona M.

    2015-01-01

    Human exposure to high-linear energy transfer α-particles includes environmental (e.g. radon gas and its decay progeny), medical (e.g. radiopharmaceuticals) and occupational (nuclear industry) sources. The associated health risks of α-particle exposure for lung cancer are well documented however the risk estimates for leukaemia remain uncertain. To further our understanding of α-particle effects in target cells for leukaemogenesis and also to seek general markers of individual exposure to α-particles, this study assessed the transmission of chromosomal damage initially-induced in human haemopoietic stem and progenitor cells after exposure to high-LET α-particles. Cells surviving exposure were differentiated into mature T-cells by extra-thymic T-cell differentiation in vitro. Multiplex fluorescence in situ hybridisation (M-FISH) analysis of naïve T-cell populations showed the occurrence of stable (clonal) complex chromosome aberrations consistent with those that are characteristically induced in spherical cells by the traversal of a single α-particle track. Additionally, complex chromosome exchanges were observed in the progeny of irradiated mature T-cell populations. In addition to this, newly arising de novo chromosome aberrations were detected in cells which possessed clonal markers of α-particle exposure and also in cells which did not show any evidence of previous exposure, suggesting ongoing genomic instability in these populations. Our findings support the usefulness and reliability of employing complex chromosome exchanges as indicators of past or ongoing exposure to high-LET radiation and demonstrate the potential applicability to evaluate health risks associated with α-particle exposure. PMID:26252014

  12. Niclosamide, an anti-helminthic molecule, downregulates the retroviral oncoprotein Tax and pro-survival Bcl-2 proteins in HTLV-1-transformed T lymphocytes.

    PubMed

    Xiang, Di; Yuan, Yunsheng; Chen, Li; Liu, Xin; Belani, Chandra; Cheng, Hua

    2015-08-14

    Adult T cell leukemia and lymphoma (ATL) is a highly aggressive form of hematological malignancy and is caused by chronic infection of human T cell leukemia virus type 1 (HTLV-1). The viral genome encodes an oncogenic protein, Tax, which plays a key role in transactivating viral gene transcription and in deregulating cellular oncogenic signaling to promote survival, proliferation and transformation of virally infected T cells. Hence, Tax is a desirable therapeutic target, particularly at early stage of HTLV-1-mediated oncogenesis. We here show that niclosamide, an anti-helminthic molecule, induced apoptosis of HTLV-1-transformed T cells. Niclosamide facilitated degradation of the Tax protein in proteasome. Consistent with niclosamide-mediated Tax degradation, this compound inhibited activities of MAPK/ERK1/2 and IκB kinases. In addition, niclosamide downregulated Stat3 and pro-survival Bcl-2 family members such as Mcl-1 and repressed the viral gene transcription of HTLV-1 through induction of Tax degradation. Since Tax, Stat3 and Mcl-1 are crucial molecules for promoting survival and growth of HTLV-1-transformed T cells, our findings demonstrate a novel mechanism of niclosamide in inducing Tax degradation and downregulating various cellular pro-survival molecules, thereby promoting apoptosis of HTLV-1-associated leukemia cells. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Lytic and latent antigens of the human gammaherpesviruses Kaposi's sarcoma-associated herpesvirus and Epstein-Barr virus induce T-cell responses with similar functional properties and memory phenotypes.

    PubMed

    Bihl, Florian; Narayan, Murli; Chisholm, John V; Henry, Leah M; Suscovich, Todd J; Brown, Elizabeth E; Welzel, Tania M; Kaufmann, Daniel E; Zaman, Tauheed M; Dollard, Sheila; Martin, Jeff N; Wang, Fred; Scadden, David T; Kaye, Kenneth M; Brander, Christian

    2007-05-01

    The cellular immunity against Kaposi's sarcoma-associated herpesvirus (KSHV) is poorly characterized and has not been compared to T-cell responses against other human herpesviruses. Here, novel and dominant targets of KSHV-specific cellular immunity are identified and compared to T cells specific for lytic and latent antigens in a second human gammaherpesvirus, Epstein-Barr virus. The data identify a novel HLA-B57- and HLA-B58-restricted epitope in the Orf57 protein and show consistently close parallels in immune phenotypes and functional response patterns between cells targeting lytic or latent KSHV- and EBV-encoded antigens, suggesting common mechanisms in the induction of these responses.

  14. CD8+ T-cell immunosurveillance constrains lymphoid pre-metastatic myeloid cell accumulation

    PubMed Central

    Li, Wenzhao; Deng, Jiehui; Herrmann, Andreas; Priceman, Saul J.; Liang, Wei; Shen, Shudan; Pal, Sumanta K.; Hoon, Dave S.B.; Yu, Hua

    2014-01-01

    Increasing evidence suggests that pre-metastatic niches, consisting mainly of myeloid cells, provide microenvironment critical for cancer cell recruitment and survival to facilitate metastasis. While CD8+ T cells exert immunosurveillance in primary human tumors, whether they can exert similar effects on myeloid cells in the pre-metastatic environment is unknown. Here, we show that CD8+ T cells are capable of constraining pre-metastatic myeloid cell accumulation by inducing myeloid cell apoptosis in C57BL/6 mice. Antigen-specific CD8+ T-cell cytotoxicity against myeloid cells in pre-metastatic lymph nodes is compromised by Stat3. We demonstrate here that Stat3 ablation in myeloid cells leads to CD8+ T-cell activation and increased levels of IFN-γ and granzyme B in the pre-metastatic environment. Furthermore, Stat3 negatively regulates soluble antigen cross-presentation by myeloid cells to CD8+ T cells in the pre-metastatic niche. Importantly, in tumor-free lymph nodes of melanoma patients, infiltration of activated CD8+ T cells inversely correlates with STAT3 activity, which is associated with a decrease in number of myeloid cells. Our study suggested a novel role for CD8+ T cells in constraining myeloid cell activity through direct killing in the pre-metastatic environment, and the therapeutic potential by targeting Stat3 in myeloid cells to improve CD8+ T-cell immunosurveillance against metastasis. PMID:25310972

  15. Prevention and reversal of experimental autoimmune thyroiditis (EAT) in mice by administration of anti-L3T4 monoclonal antibody at different stages of disease development.

    PubMed

    Stull, S J; Kyriakos, M; Sharp, G C; Braley-Mullen, H

    1988-11-01

    Experimental autoimmune thyroiditis (EAT) can be induced in CBA/J mice following the transfer of spleen cells from mouse thyroglobulin (MTg)-sensitized donors that have been activated in vitro with MTg. Since L3T4+ T cells are required to transfer EAT in this model, the present study was undertaken to assess the effectiveness of the anti-L3T4 monoclonal antibody (mAb) GK1.5 in preventing or arresting the development of EAT. Spleen cells from mice given mAb GK1.5 prior to sensitization with MTg and adjuvant could not transfer EAT to normal recipients and cells from these mice did not proliferate in vitro to MTg. Donor mice given GK1.5 before immunization did not develop anti-MTg autoantibody and recipients of cells from such mice also produced little anti-MTg. GK1.5 could also prevent the proliferation and activation of sensitized effector cell precursors when added to in vitro cultures. When a single injection of mAb GK1.5 was given to recipients of in vitro-activated spleen cells, EAT was reduced whether the mAb was given prior to cell transfer or as late as 19 days after cell transfer. Whereas the incidence and severity of EAT was consistently reduced by injecting recipient mice with GK1.5, the same mice generally had no reduction in anti-MTg autoantibody. Since EAT is consistently induced in control recipients by 14-19 days after cell transfer, the ability of mAb GK1.5 to inhibit EAT when injected 14 or 19 days after cell transfer indicates that a single injection of the mAb GK1.5 can cause reversal of the histopathologic lesions of EAT in mice. These studies further establish the important role of L3T4+ T cells in the pathogenesis of EAT in mice and also suggest that therapy with an appropriate mAb may be an effective treatment for certain autoimmune diseases even when the therapy is initiated late in the course of the disease.

  16. Thyroid hormone affects secretory activity and uncoupling protein-3 expression in rat harderian gland.

    PubMed

    Chieffi Baccari, Gabriella; Monteforte, Rossella; de Lange, Pieter; Raucci, Franca; Farina, Paola; Lanni, Antonia

    2004-07-01

    The effects of T(3) administration on the rat Harderian gland were examined at morphological, biochemical, and molecular levels. T(3) induced hypertrophy of the two cell types (A and B) present in the glandular epithelium. In type A cells, the hypertrophy was mainly due to an increase in the size of the lipid compartment. The acinar lumina were filled with lipoproteic substances, and the cells often showed an olocrine secretory pattern. In type B cells, the hypertrophy largely consisted of a marked proliferation of mitochondria endowed with tightly packed cristae, the mitochondrial number being nearly doubled (from 62 to 101/100 microm(2)). Although the average area of individual mitochondria decreased by about 50%, the total area of the mitochondrial compartment increased by about 80% (from 11 to 19/100 microm(2)). This could be ascribed to T(3)-induced mitochondrial proliferation. The morphological and morphometric data correlated well with our biochemical results, which indicated that mitochondrial respiratory activity is increased in hyperthyroid rats. T(3), by influencing the metabolic function of the mitochondrial compartment, induces lipogenesis and the release of secretory product by type A cells. Mitochondrial uncoupling proteins 2 and 3 were expressed at both mRNA and protein levels in the euthyroid rat Harderian gland. T(3) treatment increased the mRNA levels of both uncoupling protein 2 (UCP2) and UCP3, but the protein level only of UCP3. A possible role for these proteins in the Harderian gland is discussed.

  17. IL-10 Producing B Cells Ability to Induce Regulatory T Cells Is Maintained in Rheumatoid Arthritis

    PubMed Central

    Mielle, Julie; Audo, Rachel; Hahne, Michael; Macia, Laurence; Combe, Bernard; Morel, Jacques; Daien, Claire

    2018-01-01

    Despite growing evidence highlighting the relevance of increasing IL-10-producing B cells (B10+cells) in autoimmune diseases, their functions in patients are still unknown. The aim of this study was to evaluate the functions of CpG-induced B10+ cells isolated from healthy controls (HC) and rheumatoid arthritis (RA) patients, on naïve T cell differentiation. We demonstrated that CpG-induced B10+ cells from HC drove naïve T cell differentiation toward regulatory T cells (Treg cells) and IL-10-producing T cells (Tr1) through IL-10 secretion and cellular contacts. B10+ cells from HC did not decrease T helper 1 (Th1) nor and tumor necrosis factor α producing T cell (TNFα+ T cell) differentiation. We showed that in RA, B10+ cells could also induce Treg cells and Tr1 from naïve T cells. Contrary to HC, B10+ cells from RA patients increased naïve T cell conversion into Th1. Interestingly, PD-L2, a programmed death-1 (PD-1) ligand that inhibits PD-L1 and promotes Th1 differentiation, was overexpressed on RA B10+ cells compared to HC B10+ cells. Together, our findings showed that CpG-induced B10+ cells may be used to increase Treg cells in patients with RA. However, CpG may not be the most adequate stimuli as CpG-induced B10+ cells also increased inflammatory T cells in those patients. PMID:29774031

  18. Distinct susceptibility of HIV vaccine vector-induced CD4 T cells to HIV infection

    PubMed Central

    Niu, Qingli; Hou, Wei; Churchyard, Gavin; Nitayaphan, Sorachai; Pitisuthithum, Punnee; Rerks-Ngarm, Supachai; Franchini, Genoveffa

    2018-01-01

    The concerns raised from adenovirus 5 (Ad5)-based HIV vaccine clinical trials, where excess HIV infections were observed in some vaccine recipients, have highlighted the importance of understanding host responses to vaccine vectors and the HIV susceptibility of vector-specific CD4 T cells in HIV vaccination. Our recent study reported that human Ad5-specific CD4 T cells induced by Ad5 vaccination (RV156A trial) are susceptible to HIV. Here we further investigated the HIV susceptibility of vector-specific CD4 T cells induced by ALVAC, a canarypox viral vector tested in the Thai trial RV144, as compared to Ad5 vector-specific CD4 T cells in the HVTN204 trial. We showed that while Ad5 vector-specific CD4 T cells were readily susceptible to HIV, ALVAC-specific CD4 T cells in RV144 PBMC were substantially less susceptible to both R5 and X4 HIV in vitro. The lower HIV susceptibility of ALVAC-specific CD4 T cells was associated with the reduced surface expression of HIV entry co-receptors CCR5 and CXCR4 on these cells. Phenotypic analyses identified that ALVAC-specific CD4 T cells displayed a strong Th1 phenotype, producing higher levels of IFN-γ and CCL4 (MIP-1β) but little IL-17. Of interest, ALVAC and Ad5 vectors induced distinct profiles of vector-specific CD8 vs. CD4 T-cell proliferative responses in PBMC, with ALVAC preferentially inducing CD8 T-cell proliferation, while Ad5 vector induced CD4 T-cell proliferation. Depletion of ALVAC-, but not Ad5-, induced CD8 T cells in PBMC led to a modest increase in HIV infection of vector-specific CD4 T cells, suggesting a role of ALVAC-specific CD8 T cells in protecting ALVAC-specific CD4 T cells from HIV. Taken together, our data provide strong evidence for distinct HIV susceptibility of CD4 T cells induced by different vaccine vectors and highlight the importance of better evaluating anti-vector responses in HIV vaccination. PMID:29474461

  19. CHARACTERIZATION OF NORMAL HUMAN LUNG LYMPHOCYTES AND INTERLEUKIN-2-INDUCED LUNG T CELL LINES

    EPA Science Inventory

    Lymphocytes from the lower respiratory tract were obtained by bronchoalveolar lavage of healthy, non-smoking individuals. arious monoclonal antibodies characterizing activated T cells, helper-inducer and suppressor-inducer T cell subsets, and naive versus memory cells were used t...

  20. Walnut Polyphenol Extract Attenuates Immunotoxicity Induced by 4-Pentylphenol and 3-methyl-4-nitrophenol in Murine Splenic Lymphocyte.

    PubMed

    Yang, Lubing; Ma, Sihui; Han, Yu; Wang, Yuhan; Guo, Yan; Weng, Qiang; Xu, Meiyu

    2016-05-12

    4-pentylphenol (PP) and 3-methyl-4-nitrophenol (PNMC), two important components of vehicle emissions, have been shown to confer toxicity in splenocytes. Certain natural products, such as those derived from walnuts, exhibit a range of antioxidative, antitumor, and anti-inflammatory properties. Here, we investigated the effects of walnut polyphenol extract (WPE) on immunotoxicity induced by PP and PNMC in murine splenic lymphocytes. Treatment with WPE was shown to significantly enhance proliferation of splenocytes exposed to PP or PNMC, characterized by increases in the percentages of splenic T lymphocytes (CD3+ T cells) and T cell subsets (CD4+ and CD8+ T cells), as well as the production of T cell-related cytokines and granzymes (interleukin-2, interleukin-4, and granzyme-B) in cells exposed to PP or PNMC. These effects were associated with a decrease in oxidative stress, as evidenced by changes in OH, SOD, GSH-Px, and MDA levels. The total phenolic content of WPE was 34,800 ± 200 mg gallic acid equivalents/100 g, consisting of at least 16 unique phenols, including ellagitannins, quercetin, valoneic acid dilactone, and gallic acid. Taken together, these results suggest that walnut polyphenols significantly attenuated PP and PNMC-mediated immunotoxicity and improved immune function by inhibiting oxidative stress.

  1. Walnut Polyphenol Extract Attenuates Immunotoxicity Induced by 4-Pentylphenol and 3-methyl-4-nitrophenol in Murine Splenic Lymphocyte

    PubMed Central

    Yang, Lubing; Ma, Sihui; Han, Yu; Wang, Yuhan; Guo, Yan; Weng, Qiang; Xu, Meiyu

    2016-01-01

    4-pentylphenol (PP) and 3-methyl-4-nitrophenol (PNMC), two important components of vehicle emissions, have been shown to confer toxicity in splenocytes. Certain natural products, such as those derived from walnuts, exhibit a range of antioxidative, antitumor, and anti-inflammatory properties. Here, we investigated the effects of walnut polyphenol extract (WPE) on immunotoxicity induced by PP and PNMC in murine splenic lymphocytes. Treatment with WPE was shown to significantly enhance proliferation of splenocytes exposed to PP or PNMC, characterized by increases in the percentages of splenic T lymphocytes (CD3+ T cells) and T cell subsets (CD4+ and CD8+ T cells), as well as the production of T cell-related cytokines and granzymes (interleukin-2, interleukin-4, and granzyme-B) in cells exposed to PP or PNMC. These effects were associated with a decrease in oxidative stress, as evidenced by changes in OH, SOD, GSH-Px, and MDA levels. The total phenolic content of WPE was 34,800 ± 200 mg gallic acid equivalents/100 g, consisting of at least 16 unique phenols, including ellagitannins, quercetin, valoneic acid dilactone, and gallic acid. Taken together, these results suggest that walnut polyphenols significantly attenuated PP and PNMC-mediated immunotoxicity and improved immune function by inhibiting oxidative stress. PMID:27187455

  2. Innate Effector-Memory T-Cell Activation Regulates Post-Thrombotic Vein Wall Inflammation and Thrombus Resolution.

    PubMed

    Luther, Natascha; Shahneh, Fatemeh; Brähler, Melanie; Krebs, Franziska; Jäckel, Sven; Subramaniam, Saravanan; Stanger, Christian; Schönfelder, Tanja; Kleis-Fischer, Bettina; Reinhardt, Christoph; Probst, Hans Christian; Wenzel, Philip; Schäfer, Katrin; Becker, Christian

    2016-12-09

    Immune cells play an important role during the generation and resolution of thrombosis. T cells are powerful regulators of immune and nonimmune cell function, however, their role in sterile inflammation in venous thrombosis has not been systematically examined. This study investigated the recruitment, activation, and inflammatory activity of T cells in deep vein thrombosis and its consequences for venous thrombus resolution. CD4 + and CD8 + T cells infiltrate the thrombus and vein wall rapidly on deep vein thrombosis induction and remain in the tissue throughout the thrombus resolution. In the vein wall, recruited T cells largely consist of effector-memory T (T EM ) cells. Using T-cell receptor transgenic reporter mice, we demonstrate that deep vein thrombosis-recruited T EM receive an immediate antigen-independent activation and produce IFN-γ (interferon) in situ. Mapping inflammatory conditions in the thrombotic vein, we identify a set of deep vein thrombosis upregulated cytokines and chemokines that synergize to induce antigen-independent IFN-γ production in CD4 + and CD8 + T EM cells. Reducing the number of T EM cells through a depletion recovery procedure, we show that intravenous T EM activation determines neutrophil and monocyte recruitment and delays thrombus neovascularization and resolution. Examining T-cell recruitment in human venous stasis, we show that superficial varicose veins preferentially contain activated memory T cells. T EM orchestrate the inflammatory response in venous thrombosis affecting thrombus resolution. © 2016 American Heart Association, Inc.

  3. Conventional CD4+ T cells present bacterial antigens to induce cytotoxic and memory CD8+ T cell responses.

    PubMed

    Cruz-Adalia, Aránzazu; Ramirez-Santiago, Guillermo; Osuna-Pérez, Jesús; Torres-Torresano, Mónica; Zorita, Virgina; Martínez-Riaño, Ana; Boccasavia, Viola; Borroto, Aldo; Martínez Del Hoyo, Gloria; González-Granado, José María; Alarcón, Balbino; Sánchez-Madrid, Francisco; Veiga, Esteban

    2017-11-17

    Bacterial phagocytosis and antigen cross-presentation to activate CD8 + T cells are principal functions of professional antigen presenting cells. However, conventional CD4 + T cells also capture and kill bacteria from infected dendritic cells in a process termed transphagocytosis (also known as transinfection). Here, we show that transphagocytic T cells present bacterial antigens to naive CD8 + T cells, which proliferate and become cytotoxic in response. CD4 + T-cell-mediated antigen presentation also occurs in vivo in the course of infection, and induces the generation of central memory CD8 + T cells with low PD-1 expression. Moreover, transphagocytic CD4 + T cells induce protective anti-tumour immune responses by priming CD8 + T cells, highlighting the potential of CD4 + T cells as a tool for cancer immunotherapy.

  4. Progressive increase of glucose transporter-3 (GLUT-3) expression in estrogen-induced breast carcinogenesis.

    PubMed

    Kocdor, M A; Kocdor, H; Pereira, J S; Vanegas, J E; Russo, I H; Russo, J

    2013-01-01

    Increased glucose uptake and glycolysis are main metabolic characteristics of malignant cells. A family of glucose transporters (GLUTs) facilitates glucose movement across the plasma membranes in a tumor-specific manner. Glucose transporter-1 (GLUT-1), GLUT-3 and recently GLUT-12, have been previously shown in breast cancer cells and are found to be associated with poor prognosis. In addition, it has been shown that estrogen plays critical roles in GLUT regulation, however, the stage-specific GLUT regulation of mammary carcinogenesis is unclear. GLUT expression patterns were investigated in an in vitro-in vivo progressive, estrogen-induced, mammary carcinogenesis model which consisted of four cell lines, with same genetic background. In this model, different stages of tumor initiation and progression are represented, MCF-10F being the normal stage, E2 cells the transformed stage by estrogen, C5 cells, the invasive stage, and T4 cells the tumorigenic stage. In addition, loss of ductulogenesis and solid mass formation in collagen matrix and invasiveness of the cells were counted. Real time PCR showed that GLUT1 expression was downregulated in MCF10F after treatment with 17β-estradiol (E2), and in the invasive cell type (C5), but not in the tumor cells (T4), which had no changes compared to MCF10F. C5 and T4 cells showed the highest rate of GLUT-3 expression. These cells were also found to be associated with loss of ductulogenesis, solid mass formation and higher invasive capacity, whereas, GLUT-12 was downregulated in C5 and T4 cells. Estrogen-induced malignant transformation is associated with remarkable and progressive GLUT-3 expression, GLUT-1 re-expression at further stages, as well as GLUT-12 downregulation.

  5. Transient CDK4/6 inhibition protects hematopoietic stem cells from chemotherapy-induced exhaustion.

    PubMed

    He, Shenghui; Roberts, Patrick J; Sorrentino, Jessica A; Bisi, John E; Storrie-White, Hannah; Tiessen, Renger G; Makhuli, Karenann M; Wargin, William A; Tadema, Henko; van Hoogdalem, Ewoud-Jan; Strum, Jay C; Malik, Rajesh; Sharpless, Norman E

    2017-04-26

    Conventional cytotoxic chemotherapy is highly effective in certain cancers but causes dose-limiting damage to normal proliferating cells, especially hematopoietic stem and progenitor cells (HSPCs). Serial exposure to cytotoxics causes a long-term hematopoietic compromise ("exhaustion"), which limits the use of chemotherapy and success of cancer therapy. We show that the coadministration of G1T28 (trilaciclib), which is a small-molecule inhibitor of cyclin-dependent kinases 4 and 6 (CDK4/6), contemporaneously with cytotoxic chemotherapy protects murine hematopoietic stem cells (HSCs) from chemotherapy-induced exhaustion in a serial 5-fluorouracil treatment model. Consistent with a cell-intrinsic effect, we show directly preserved HSC function resulting in a more rapid recovery of peripheral blood counts, enhanced serial transplantation capacity, and reduced myeloid skewing. When administered to healthy human volunteers, G1T28 demonstrated excellent in vivo pharmacology and transiently inhibited bone marrow (BM) HSPC proliferation. These findings suggest that the combination of CDK4/6 inhibitors with cytotoxic chemotherapy should provide a means to attenuate therapy-induced BM exhaustion in patients with cancer. Copyright © 2017, American Association for the Advancement of Science.

  6. Changes in the expression of potassium channels during mouse T cell development

    PubMed Central

    1986-01-01

    In this report we have combined the whole-cell electrophysiological recording technique with flow microfluorometry to isolate phenotypically defined thymocytes and T lymphocytes. Results obtained showed that J11d-/Lyt-2-/L3T4- cells express none or very few delayed rectifier K+ channels, whereas most other Lyt-2-/L3T4- cells, as well as typical cortical thymocytes (Lyt-2+/L3T4+), do express K+ channels. Mature (Lyt-2+/L3T4- or Lyt-2-/L3T4+) thymocytes, which are heterogeneous for J11d expression, were also found to be heterogeneous for K+ channel expression. Consistent with this finding was the observation that the cortisone-resistant subpopulation of thymocytes, which express low levels of J11d, were enriched for cells expressing low levels of K+ channels. Mature phenotype peripheral T lymphocytes expressed very low levels of K+ channels, but upon activation with Con A were found to express high levels of K+ channels. The results suggest that K+ channel expression in T cells is developmentally regulated. Increased expression of the channel is induced in response to mitogenic signals throughout the T cell lineage. Expression of the channel, therefore, serves as a useful marker in defining steps in the T cell differentiation pathway. PMID:2431091

  7. Viremic HIV Infected Individuals with High CD4 T Cells and Functional Envelope Proteins Show Anti-gp41 Antibodies with Unique Specificity and Function

    PubMed Central

    Curriu, Marta; Fausther-Bovendo, Hughes; Pernas, María; Massanella, Marta; Carrillo, Jorge; Cabrera, Cecilia; López-Galíndez, Cecilio; Clotet, Bonaventura; Debré, Patrice; Vieillard, Vincent; Blanco, Julià

    2012-01-01

    Background CD4 T-cell decay is variable among HIV-infected individuals. In exceptional cases, CD4 T-cell counts remain stable despite high plasma viremia. HIV envelope glycoprotein (Env) properties, namely tropism, fusion or the ability to induce the NK ligand NKp44L, or host factors that modulate Env cytopathic mechanisms may be modified in such situation. Methods We identified untreated HIV-infected individuals showing non-cytopathic replication (VL>10,000 copies/mL and CD4 T-cell decay<50 cells/µL/year, Viremic Non Progressors, VNP) or rapid progression (CD4 T-cells<350 cells/µL within three years post-infection, RP). We isolated full-length Env clones and analyzed their functions (tropism, fusion activity and capacity to induce NKp44L expression on CD4 cells). Anti-Env humoral responses were also analyzed. Results Env clones isolated from VNP or RP individuals showed no major phenotypic differences. The percentage of functional clones was similar in both groups. All clones tested were CCR5-tropic and showed comparable expression and fusogenic activity. Moreover, no differences were observed in their capacity to induce NKp44L expression on CD4 T cells from healthy donors through the 3S epitope of gp41. In contrast, anti- Env antibodies showed clear functional differences: plasma from VNPs had significantly higher capacity than RPs to block NKp44L induction by autologous viruses. Consistently, CD4 T-cells isolated from VNPs showed undetectable NKp44L expression and specific antibodies against a variable region flanking the highly conserved 3S epitope were identified in plasma samples from these patients. Conversely, despite continuous antigen stimulation, VNPs were unable to mount a broad neutralizing response against HIV. Conclusions Env functions (fusion and induction of NKp44L) were similar in viremic patients with slow or rapid progression to AIDS. However, differences in humoral responses against gp41 epitopes nearby 3S sequence may contribute to the lack of CD4 T cell decay in VNPs by blocking the induction of NKp44L by gp41. PMID:22312424

  8. Therapeutic effect of the natural compounds baicalein and baicalin on autoimmune diseases.

    PubMed

    Xu, Jian; Liu, Jinlong; Yue, Guolin; Sun, Mingqiang; Li, Jinliang; Xiu, Xia; Gao, Zhenzhong

    2018-05-23

    A series of natural compounds have been implicated to be useful in regulating the pathogenesis of various autoimmune diseases. The present study demonstrated that the Scutellariae radix compounds baicalein and baicalin may serve as drugs for the treatment of autoimmune diseases, including rheumatoid arthritis and inflammatory bowel disease. Following the administration of baicalein and baicalin in vivo, T cell‑mediated autoimmune diseases in the mouse model were profoundly ameliorated: In the collagen‑induced arthritis model (CIA), the severity of the disease was reduced by baicalein and, consistently, baicalein was demonstrated to suppress T cell proliferation in CIA mice. In the dextran sodium sulfate (DSS)‑induced colitis model, the disease was attenuated by baicalin, and baicalin promoted colon epithelial cell (CEC) proliferation in vitro. The present study further revealed that the mRNA expression of signal transducer and activator of transcription (STAT)3 and STAT4 in the tyrosine‑protein kinase JAK‑STAT signaling pathway in T cells was downregulated by baicalein, contributing to its regulation of T cell proliferation. However, in the DSS model, the STAT4 transcription in CECs, which are the target cells of activated T cells in the gut, was downregulated by baicalin, suggesting that baicalein and baicalin mediated similar STAT expression in different cell types in autoimmune diseases. In conclusion, the similarly structured compounds baicalein and baicalin selectively exhibited therapeutic effects on autoimmune diseases by regulating cell proliferation and STAT gene expression, albeit in different cell types.

  9. IL-17 Induction by ArtinM is Due to Stimulation of IL-23 and IL-1 Release and/or Interaction with CD3 in CD4+ T Cells.

    PubMed

    da Silva, Thiago Aparecido; Mariano, Vania Sammartino; Sardinha-Silva, Aline; de Souza, Maria Aparecida; Mineo, Tiago Wilson Patriarca; Roque-Barreira, Maria Cristina

    2016-01-01

    ArtinM is a D-mannose-binding lectin extracted from the seeds of Artocarpus heterophyllus that interacts with TLR2 N-glycans and activates antigen-presenting cells (APCs), as manifested by IL-12 production. In vivo ArtinM administration induces Th1 immunity and confers protection against infection with several intracellular pathogens. In the murine model of Candida albicans infection, it was verified that, in addition to Th1, ArtinM induces Th17 immunity manifested by high IL-17 levels in the treated animals. Herein, we investigated the mechanisms accounting for the ArtinM-induced IL-17 production. We found that ArtinM stimulates the IL-17 production by spleen cells in BALB/c or C57BL/6 mice, a response that was significantly reduced in the absence of IL-23, MyD88, or IL-1R. Furthermore, we showed that ArtinM directly induced the IL-23 mRNA expression and the IL-1 production by macrophages. Consistently, in cell suspensions depleted of macrophages, the IL-17 production stimulated by ArtinM was reduced by 53% and the exogenous IL-23 acted synergistically with ArtinM in promoting IL-17 production by spleen cell suspensions. We verified that the absence of IL-23, IL-1R, or MyD88 inhibited, but did not block, the IL-17 production by ArtinM-stimulated spleen cells. Therefore, we investigated whether ArtinM exerts a direct effect on CD4+ T cells in promoting IL-17 production. Indeed, spleen cell suspensions depleted of CD4+ T cells responded to ArtinM with very low levels of IL-17 release. Likewise, isolated CD4+ T cells under ArtinM stimulus augmented the expression of TGF-β mRNA and released high levels of IL-17. Considering the observed synergism between IL-23 and ArtinM, we used cells from IL-23 KO mice to assess the direct effect of lectin on CD4+ T cells. We verified that ArtinM increased the IL-17 production significantly, a response that was inhibited when the CD4+ T cells were pre-incubated with anti-CD3 antibody. In conclusion, ArtinM stimulates the production of IL-17 by CD4+ T cells in two major ways: (I) through the induction of IL-23 and IL-1 by APCs and (II) through the direct interaction with CD3 on the CD4+ T cells. This study contributes to elucidation of mechanisms accounting for the property of ArtinM in inducing Th17 immunity and opens new perspectives in designing strategies for modulating immunity by using carbohydrate recognition agents.

  10. IL-17 Induction by ArtinM is Due to Stimulation of IL-23 and IL-1 Release and/or Interaction with CD3 in CD4+ T Cells

    PubMed Central

    da Silva, Thiago Aparecido; Mariano, Vania Sammartino; Sardinha-Silva, Aline; de Souza, Maria Aparecida; Mineo, Tiago Wilson Patriarca; Roque-Barreira, Maria Cristina

    2016-01-01

    ArtinM is a D-mannose-binding lectin extracted from the seeds of Artocarpus heterophyllus that interacts with TLR2 N-glycans and activates antigen-presenting cells (APCs), as manifested by IL-12 production. In vivo ArtinM administration induces Th1 immunity and confers protection against infection with several intracellular pathogens. In the murine model of Candida albicans infection, it was verified that, in addition to Th1, ArtinM induces Th17 immunity manifested by high IL-17 levels in the treated animals. Herein, we investigated the mechanisms accounting for the ArtinM-induced IL-17 production. We found that ArtinM stimulates the IL-17 production by spleen cells in BALB/c or C57BL/6 mice, a response that was significantly reduced in the absence of IL-23, MyD88, or IL-1R. Furthermore, we showed that ArtinM directly induced the IL-23 mRNA expression and the IL-1 production by macrophages. Consistently, in cell suspensions depleted of macrophages, the IL-17 production stimulated by ArtinM was reduced by 53% and the exogenous IL-23 acted synergistically with ArtinM in promoting IL-17 production by spleen cell suspensions. We verified that the absence of IL-23, IL-1R, or MyD88 inhibited, but did not block, the IL-17 production by ArtinM-stimulated spleen cells. Therefore, we investigated whether ArtinM exerts a direct effect on CD4+ T cells in promoting IL-17 production. Indeed, spleen cell suspensions depleted of CD4+ T cells responded to ArtinM with very low levels of IL-17 release. Likewise, isolated CD4+ T cells under ArtinM stimulus augmented the expression of TGF-β mRNA and released high levels of IL-17. Considering the observed synergism between IL-23 and ArtinM, we used cells from IL-23 KO mice to assess the direct effect of lectin on CD4+ T cells. We verified that ArtinM increased the IL-17 production significantly, a response that was inhibited when the CD4+ T cells were pre-incubated with anti-CD3 antibody. In conclusion, ArtinM stimulates the production of IL-17 by CD4+ T cells in two major ways: (I) through the induction of IL-23 and IL-1 by APCs and (II) through the direct interaction with CD3 on the CD4+ T cells. This study contributes to elucidation of mechanisms accounting for the property of ArtinM in inducing Th17 immunity and opens new perspectives in designing strategies for modulating immunity by using carbohydrate recognition agents. PMID:26901413

  11. Decoy receptor 3 suppresses TLR2-mediated B cell activation by targeting NF-κB.

    PubMed

    Huang, Zi-Ming; Kang, Jhi-Kai; Chen, Chih-Yu; Tseng, Tz-Hau; Chang, Chien-Wen; Chang, Yung-Chi; Tai, Shyh-Kuan; Hsieh, Shie-Liang; Leu, Chuen-Miin

    2012-06-15

    Decoy receptor 3 (DcR3) is a soluble protein in the TNFR superfamily. Its known ligands include Fas ligand, homologous to lymphotoxin, showing inducible expression, and competing with HSV glycoprotein D for herpes virus entry mediator, a receptor expressed by T lymphocytes, TNF-like molecule 1A, and heparan sulfate proteoglycans. DcR3 has been reported to modulate the functions of T cells, dendritic cells, and macrophages; however, its role in regulating B cell activation is largely unknown. In this study, we found that the DcR3.Fc fusion protein bound to human and mouse B cells and suppressed the activation of B cells. DcR3.Fc attenuated Staphylococcus aureus, IgM-, Pam(3)CSK(4)-, and LPS-mediated B cell proliferation but did not affect cytokine-induced B cell growth. In the presence of these mitogens, DcR3.Fc did not induce B cell apoptosis, suggesting that DcR3 may inhibit the signal(s) important for B cell activation. Because the combination of Fas.Fc, LT-βR.Fc (homologous to lymphotoxin, showing inducible expression, and competing with HSV glycoprotein D for herpes virus entry mediator, a receptor expressed by T lymphocytes receptor), and DR3.Fc (TNF-like molecule 1A receptor) did not suppress B cell proliferation and because the biological effect of DcR3.Fc on B cells was not blocked by heparin, we hypothesize that a novel ligand(s) of DcR3 mediates its inhibitory activity on B cells. Moreover, we found that TLR2-stimulated NF-κB p65 activation and NF-κB-driven luciferase activity were attenuated by DcR3.Fc. The TLR2-induced cytokine production by B cells was consistently reduced by DcR3. These results imply that DcR3 may regulate B cell activation by suppressing the activation of NF-κB.

  12. Dendritic cells induce antigen-specific regulatory T cells that prevent graft versus host disease and persist in mice

    PubMed Central

    Olds, Peter; Park, Andrew; Schlesinger, Sarah J.

    2011-01-01

    Foxp3+ regulatory T cells (T reg cells) effectively suppress immunity, but it is not determined if antigen-induced T reg cells (iT reg cells) are able to persist under conditions of inflammation and to stably express the transcription factor Foxp3. We used spleen cells to stimulate the mixed leukocyte reaction (MLR) in the presence of transforming growth factor β (TGF-β) and retinoic acid. We found that the CD11chigh dendritic cell fraction was the most potent at inducing high numbers of alloreactive Foxp3+ cells. The induced CD4+CD25+Foxp3+ cells appeared after extensive proliferation. When purified from the MLR, iT reg cells suppressed both primary and secondary MLR in vitro in an antigen-specific manner. After transfer into allogeneic mice, iT reg cells persisted for 6 mo and prevented graft versus host disease (GVHD) caused by co-transferred CD45RBhi T cells. Similar findings were made when iT reg cells were transferred after onset of GVHD. The CNS2 intronic sequence of the Foxp3 gene in the persisting iT reg cells was as demethylated as the corresponding sequence of naturally occurring T reg cells. These results indicate that induced Foxp3+ T reg cells, after proliferating and differentiating into antigen-specific suppressive T cells, can persist for long periods while suppressing a powerful inflammatory disease. PMID:22084406

  13. Downregulation of proapoptotic Bim augments IL-2-independent T-cell transformation by human T-cell leukemia virus type-1 Tax

    PubMed Central

    Higuchi, Masaya; Takahashi, Masahiko; Tanaka, Yuetsu; Fujii, Masahiro

    2014-01-01

    Human T-cell leukemia virus type 1 (HTLV-1), an etiological agent of adult T-cell leukemia, immortalizes and transforms primary human T cells in vitro in both an interleukin (IL)-2-dependent and IL-2-independent manner. Expression of the HTLV-1 oncoprotein Tax transforms the growth of the mouse T-cell line CTLL-2 from being IL-2-dependent to IL-2-independent. Withdrawal of IL-2 from normal activated T cells induces apoptosis, which is mediated through the inducible expression of several proapoptotic proteins, including Bim. In this study, we found that Tax protects IL-2-depleted T cells against Bim-induced apoptosis. Withdrawal of IL-2 from CTLL-2 cells induced a prominent increase in the level of Bim protein in CTLL-2 cells, but not in Tax-transformed CTLL-2 cells. This inhibition of Bim in Tax-transformed CTLL-2 cells was mediated by two mechanisms: downregulation of Bim mRNA and posttranscriptional reduction of Bim protein. Transient expression of Tax in CTLL-2 cells also inhibited IL-2 depletion–induced expression of Bim, however, this decrease in Bim protein expression was not due to downregulation of Bim mRNA, thus indicating that Bim mRNA downregulation in Tax-transformed CTLL-2 occurs only after long-term expression of Tax. Transient expression of Tax in CTLL-2 cells also induced Erk activation, however, this was not involved in the reduction of Bim protein. Knockdown of Bim expression in CTLL-2 cells augmented Tax-induced IL-2-independent transformation. HTLV-1 infection of human T cells also reduced their levels of Bim protein, and restoring Bim expression in HTLV-1-infected cells reduced their proliferation by inducing apoptosis. Taken together, these results indicate that Tax-induced downregulation of Bim in HTLV-1-infected T cells promotes their IL-2-independent growth, thereby supporting the persistence of HTLV-1 infection in vivo. PMID:25175936

  14. Prime, Shock, and Kill: Priming CD4 T Cells from HIV Patients with a BCL-2 Antagonist before HIV Reactivation Reduces HIV Reservoir Size

    PubMed Central

    Cummins, Nathan W.; Sainski, Amy M.; Dai, Haiming; Natesampillai, Sekar; Pang, Yuan-Ping; Bren, Gary D.; de Araujo Correia, Maria Cristina Miranda; Sampath, Rahul; Rizza, Stacey A.; O'Brien, Daniel; Yao, Joseph D.

    2016-01-01

    ABSTRACT Understanding how some HIV-infected cells resist the cytotoxicity of HIV replication is crucial to enabling HIV cure efforts. HIV killing of CD4 T cells that replicate HIV can involve HIV protease-mediated cleavage of procaspase 8 to generate a fragment (Casp8p41) that directly binds and activates the mitochondrial proapoptotic protein BAK. Here, we demonstrate that Casp8p41 also binds with nanomolar affinity to the antiapoptotic protein Bcl-2, which sequesters Casp8p41 and prevents apoptosis. Further, we show that central memory CD4 T cells (TCM) from HIV-infected individuals have heightened expression of BCL-2 relative to procaspase 8, possibly explaining the persistence of HIV-infected TCM despite generation of Casp8p41. Consistent with this hypothesis, the selective BCL-2 antagonist venetoclax induced minimal killing of uninfected CD4 T cells but markedly increased the death of CD4 T cells and diminished cell-associated HIV DNA when CD4 T cells from antiretroviral therapy (ART)-suppressed HIV patients were induced with αCD3/αCD28 to reactivate HIV ex vivo. Thus, priming CD4 T cells from ART suppressed HIV patients with a BCL-2 antagonist, followed by HIV reactivation, achieves reductions in cell-associated HIV DNA, whereas HIV reactivation alone does not. IMPORTANCE HIV infection is incurable due to a long-lived reservoir of HIV+ memory CD4 T cells, and no clinically relevant interventions have been identified that reduce the number of these HIV DNA-containing cells. Since postintegration HIV replication can result in HIV protease generation of Casp8p41, which activates BAK, causing infected CD4 T cell death, we sought to determine whether this occurs in memory CD4 T cells. Here, we demonstrate that memory CD4 T cells can generate Casp8p41 and yet are intrinsically resistant to death induced by diverse stimuli, including Casp8p41. Furthermore, BCL-2 expression is relatively increased in these cells and directly binds and inhibits Casp8p41's proapoptotic effects. Antagonizing BCL-2 with venetoclax derepresses this antagonism, resulting in death, preferentially in HIV DNA containing cells, since only these cells generate Casp8p41. Thus, BCL-2 antagonism is a clinically relevant intervention with the potential to reduce HIV reservoir size in patients. PMID:26842479

  15. Formalin-Inactivated Coxiella burnetii Phase I Vaccine-Induced Protection Depends on B Cells To Produce Protective IgM and IgG

    PubMed Central

    Peng, Ying; Schoenlaub, Laura; Elliott, Alexandra; Mitchell, William; Zhang, Yan

    2013-01-01

    To further understand the mechanisms of formalin-inactivated Coxiella burnetii phase I (PI) vaccine (PIV)-induced protection, we examined if B cell, T cell, CD4+ T cell, or CD8+ T cell deficiency in mice significantly affects the ability of PIV to confer protection against a C. burnetii infection. Interestingly, compared to wild-type (WT) mice, PIV conferred comparable levels of protection in CD4+ T cell- or CD8+ T cell-deficient mice and partial protection in T cell-deficient mice but did not provide measurable protection in B cell-deficient mice. These results suggest that PIV-induced protection depends on B cells. In addition, anti-PI-specific IgM was the major detectable antibody (Ab) in immune sera from PIV-vaccinated CD4+ T cell-deficient mice, and passive transfer of immune sera from PIV-vaccinated CD4+ T cell-deficient mice conferred significant protection. These results suggest that T cell-independent anti-PI-specific IgM may contribute to PIV-induced protection. Our results also suggested that PIV-induced protection may not depend on complement activation and Fc receptor-mediated effector functions. Furthermore, our results demonstrated that both IgM and IgG from PIV-vaccinated WT mouse sera were able to inhibit C. burnetii infection in vivo, but only IgM from PIV-vaccinated CD4+ T cell-deficient mouse sera inhibited C. burnetii infection. Collectively, these findings suggest that PIV-induced protection depends on B cells to produce protective IgM and IgG and that T cell-independent anti-PI-specific IgM may play a critical role in PIV-induced protection against C. burnetii infection. PMID:23545296

  16. Recombination-activating gene 1 (Rag1)-deficient mice with severe combined immunodeficiency treated with lentiviral gene therapy demonstrate autoimmune Omenn-like syndrome.

    PubMed

    van Til, Niek P; Sarwari, Roya; Visser, Trudi P; Hauer, Julia; Lagresle-Peyrou, Chantal; van der Velden, Guus; Malshetty, Vidyasagar; Cortes, Patricia; Jollet, Arnaud; Danos, Olivier; Cassani, Barbara; Zhang, Fang; Thrasher, Adrian J; Fontana, Elena; Poliani, Pietro L; Cavazzana, Marina; Verstegen, Monique M A; Villa, Anna; Wagemaker, Gerard

    2014-04-01

    Recombination-activating gene 1 (RAG1) deficiency results in severe combined immunodeficiency (SCID) caused by a complete lack of T and B lymphocytes. If untreated, patients succumb to recurrent infections. We sought to develop lentiviral gene therapy for RAG1-induced SCID and to test its safety. Constructs containing the viral spleen-focus-forming virus (SF), ubiquitous promoters, or cell type-restricted promoters driving sequence-optimized RAG1 were compared for efficacy and safety in sublethally preconditioned Rag1(-/-) mice undergoing transplantation with transduced bone marrow progenitors. Peripheral blood CD3(+) T-cell reconstitution was achieved with SF, ubiquitous promoters, and cell type-restricted promoters but 3- to 18-fold lower than that seen in wild-type mice, and with a compromised CD4(+)/CD8(+) ratio. Mitogen-mediated T-cell responses and T cell-dependent and T cell-independent B-cell responses were not restored, and T-cell receptor patterns were skewed. Reconstitution of mature peripheral blood B cells was approximately 20-fold less for the SF vector than in wild-type mice and often not detectable with the other promoters, and plasma immunoglobulin levels were abnormal. Two months after transplantation, gene therapy-treated mice had rashes with cellular tissue infiltrates, activated peripheral blood CD44(+)CD69(+) T cells, high plasma IgE levels, antibodies against double-stranded DNA, and increased B cell-activating factor levels. Only rather high SF vector copy numbers could boost T- and B-cell reconstitution, but mRNA expression levels during T- and B-cell progenitor stages consistently remained less than wild-type levels. These results underline that further development is required for improved expression to successfully treat patients with RAG1-induced SCID while maintaining low vector copy numbers and minimizing potential risks, including autoimmune reactions resembling Omenn syndrome. Copyright © 2013 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  17. Vaccination with dendritic cells pulsed with hepatitis C pseudo particles induces specific immune responses in mice

    PubMed Central

    Weigand, Kilian; Voigt, Franziska; Encke, Jens; Hoyler, Birgit; Stremmel, Wolfgang; Eisenbach, Christoph

    2012-01-01

    AIM: To explore dendritic cells (DCs) multiple functions in immune modulation. METHODS: We used bone-marrow derived dendritic cells from BALB/c mice pulsed with pseudo particles from the hepatitis C virus to vaccinate naive BALB/c mice. Hepatitis C virus (HCV) pseudo particles consist of the genotype 1b derived envelope proteins E1 and E2, covering a non-HCV core structure. Thus, not a single epitope, but the whole “viral surface” induces immunogenicity. For vaccination, mature and activated DC were injected subcutaneously twice. RESULTS: Humoral and cellular immune responses measured by enzyme-linked immunosorbent assay and interferon-gamma enzyme-linked immunosorbent spot test showed antibody production as well as T-cells directed against HCV. Furthermore, T-cell responses confirmed two highly immunogenic regions in E1 and E2 outside the hypervariable region 1. CONCLUSION: Our results indicate dendritic cells as a promising vaccination model for HCV infection that should be evaluated further. PMID:22371638

  18. Hsp70 enhances presentation of FMDV antigen to bovine CD4+ T cells in vitro

    PubMed Central

    McLaughlin, Kerry; Seago, Julian; Robinson, Lucy; Kelly, Charles; Charleston, Bryan

    2010-01-01

    Foot-and-mouth disease virus (FMDV) is the causative agent of a highly contagious acute vesicular disease affecting cloven-hoofed animals, including cattle, sheep and pigs. The current vaccine induces a rapid humoral response, but the duration of the protective antibody response is variable, possibly associated with a variable specific CD4+ T cell response. We investigated the use of heat shock protein 70 (Hsp70) as a molecular chaperone to target viral antigen to the Major Histocompatibility Complex (MHC) class II pathway of antigen presenting cells and generate enhanced MHC II-restricted CD4+ T cell responses in cattle. Monocytes and CD4+ T cells from FMDV vaccinated cattle were stimulated in vitro with complexes of Hsp70 and FMDV peptide, or peptide alone. Hsp70 was found to consistently improve the presentation of a 25-mer FMDV peptide to CD4+ T cells, as measured by T cell proliferation. Complex formation was required for the enhanced effects and Hsp70 alone did not stimulate proliferation. This study provides further evidence that Hsp70:peptide complexes can enhance antigen-specific CD4+ T cell responses in vitro for an important pathogen of livestock. PMID:20167197

  19. Bispecific light T-cell engagers for gene-based immunotherapy of epidermal growth factor receptor (EGFR)-positive malignancies.

    PubMed

    Mølgaard, Kasper; Harwood, Seandean L; Compte, Marta; Merino, Nekane; Bonet, Jaume; Alvarez-Cienfuegos, Ana; Mikkelsen, Kasper; Nuñez-Prado, Natalia; Alvarez-Mendez, Ana; Sanz, Laura; Blanco, Francisco J; Alvarez-Vallina, Luis

    2018-06-04

    The recruitment of T-cells by bispecific antibodies secreted from adoptively transferred, gene-modified autologous cells has shown satisfactory results in preclinical cancer models. Even so, the approach's translation into the clinic will require incremental improvements to its efficacy and reduction of its toxicity. Here, we characterized a tandem T-cell recruiting bispecific antibody intended to benefit gene-based immunotherapy approaches, which we call the light T-cell engager (LiTE), consisting of an EGFR-specific single-domain V HH antibody fused to a CD3-specific scFv. We generated two LiTEs with the anti-EGFR V HH and the anti-CD3 scFv arranged in both possible orders. Both constructs were well expressed in mammalian cells as highly homogenous monomers in solution with molecular weights of 43 and 41 kDa, respectively. In situ secreted LiTEs bound the cognate antigens of both parental antibodies and triggered the specific cytolysis of EGFR-expressing cancer cells without inducing T-cell activation and cytotoxicity spontaneously or against EGFR-negative cells. Light T-cell engagers are, therefore, suitable for future applications in gene-based immunotherapy approaches.

  20. Profound CD4+/CCR5+ T cell expansion is induced by CD8+ lymphocyte depletion but does not account for accelerated SIV pathogenesis.

    PubMed

    Okoye, Afam; Park, Haesun; Rohankhedkar, Mukta; Coyne-Johnson, Lia; Lum, Richard; Walker, Joshua M; Planer, Shannon L; Legasse, Alfred W; Sylwester, Andrew W; Piatak, Michael; Lifson, Jeffrey D; Sodora, Donald L; Villinger, Francois; Axthelm, Michael K; Schmitz, Joern E; Picker, Louis J

    2009-07-06

    Depletion of CD8(+) lymphocytes during acute simian immunodeficiency virus (SIV) infection of rhesus macaques (RMs) results in irreversible prolongation of peak-level viral replication and rapid disease progression, consistent with a major role for CD8(+) lymphocytes in determining postacute-phase viral replication set points. However, we report that CD8(+) lymphocyte depletion is also associated with a dramatic induction of proliferation among CD4(+) effector memory T (T(EM)) cells and, to a lesser extent, transitional memory T (T(TrM)) cells, raising the question of whether an increased availability of optimal (activated/proliferating), CD4(+)/CCR5(+) SIV "target" cells contributes to this accelerated pathogenesis. In keeping with this, depletion of CD8(+) lymphocytes in SIV(-) RMs led to a sustained increase in the number of potential CD4(+) SIV targets, whereas such depletion in acute SIV infection led to increased target cell consumption. However, we found that the excess CD4(+) T(EM) cell proliferation of CD8(+) lymphocyte-depleted, acutely SIV-infected RMs was completely inhibited by interleukin (IL)-15 neutralization, and that this inhibition did not abrogate the rapidly progressive infection in these RMs. Moreover, although administration of IL-15 during acute infection induced robust CD4(+) T(EM) and T(TrM) cell proliferation, it did not recapitulate the viral dynamics of CD8(+) lymphocyte depletion. These data suggest that CD8(+) lymphocyte function has a larger impact on the outcome of acute SIV infection than the number and/or activation status of target cells available for infection and viral production.

  1. Illegitimate V(D)J recombination-mediated deletions in Notch1 and Bcl11b are not sufficient for extensive clonal expansion and show minimal age or sex bias in frequency or junctional processing

    PubMed Central

    Champagne, Devin P.; Shockett, Penny E.

    2014-01-01

    Illegitimate V(D)J recombination at oncogenes and tumor suppressor genes is implicated in formation of several T cell malignancies. Notch1 and Bcl11b, genes involved in developing T cell specification, selection, proliferation, and survival, were previously shown to contain hotspots for deletional illegitimate V(D)J recombination associated with radiation-induced thymic lymphoma. Interestingly, these deletions were also observed in wild-type animals. In this study, we conducted frequency, clonality, and junctional processing analyses of Notch1 and Bcl11b deletions during mouse development and compared results to published analyses of authentic V(D)J rearrangements at the T cell receptor beta (TCRβ) locus and illegitimate V(D)J deletions observed at the human, nonimmune HPRT1 locus not involved in T cell malignancies. We detect deletions in Notch1 and Bcl11b in thymic and splenic T cell populations, consistent with cells bearing deletions in the circulating lymphocyte pool. Deletions in thymus can occur in utero, increase in frequency between fetal and postnatal stages, are detected at all ages examined between fetal and 7 months, exhibit only limited clonality (contrasting with previous results in radiation-sensitive mouse strains), and consistent with previous reports are more frequent in Bcl11b, partially explained by relatively high Recombination Signal Information Content (RIC) scores. Deletion junctions in Bcl11b exhibit greater germline nucleotide loss, while in Notch1 palindromic (P) nucleotides are more abundant, although average P nucleotide length is similar for both genes and consistent with results at the TCRβ locus. Non-templated (N) nucleotide insertions appear to increase between fetal and postnatal stages for Notch1, consistent with normal terminal deoxynucleotidyl transferase (TdT) activity; however, neonatal Bcl11b junctions contain elevated levels of N insertions. Finally, contrasting with results at the HPRT1 locus, we find no obvious age or gender bias in junctional processing, and inverted repeats at recessed coding ends (Pr nucleotides) correspond mostly to single-base additions consistent with normal TdT activity. PMID:24530429

  2. The complex pathophysiology of acquired aplastic anaemia.

    PubMed

    Zeng, Y; Katsanis, E

    2015-06-01

    Immune-mediated destruction of haematopoietic stem/progenitor cells (HSPCs) plays a central role in the pathophysiology of acquired aplastic anaemia (aAA). Dysregulated CD8(+) cytotoxic T cells, CD4(+) T cells including T helper type 1 (Th1), Th2, regulatory T cells and Th17 cells, natural killer (NK) cells and NK T cells, along with the abnormal production of cytokines including interferon (IFN)-γ, tumour necrosis factor (TNF)-α and transforming growth factor (TGF)-β, induce apoptosis of HSPCs, constituting a consistent and defining feature of severe aAA. Alterations in the polymorphisms of TGF-β, IFN-γ and TNF-α genes, as well as certain human leucocyte antigen (HLA) alleles, may account for the propensity to immune-mediated killing of HSPCs and/or ineffective haematopoiesis. Although the inciting autoantigens remain elusive, autoantibodies are often detected in the serum. In addition, recent studies provide genetic and molecular evidence that intrinsic and/or secondary deficits in HSPCs and bone marrow mesenchymal stem cells may underlie the development of bone marrow failure. © 2015 British Society for Immunology.

  3. Niclosamide, an anti-helminthic molecule, downregulates the retroviral oncoprotein Tax and pro-survival Bcl-2 proteins in HTLV-1-transformed T lymphocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiang, Di; Yuan, Yunsheng; Engineering Research Center of Cell and Therapeutic Antibody, Ministry of Education, School of Pharmacy, Shanghai Jiao Tong University, Shanghai

    Adult T cell leukemia and lymphoma (ATL) is a highly aggressive form of hematological malignancy and is caused by chronic infection of human T cell leukemia virus type 1 (HTLV-1). The viral genome encodes an oncogenic protein, Tax, which plays a key role in transactivating viral gene transcription and in deregulating cellular oncogenic signaling to promote survival, proliferation and transformation of virally infected T cells. Hence, Tax is a desirable therapeutic target, particularly at early stage of HTLV-1-mediated oncogenesis. We here show that niclosamide, an anti-helminthic molecule, induced apoptosis of HTLV-1-transformed T cells. Niclosamide facilitated degradation of the Tax proteinmore » in proteasome. Consistent with niclosamide-mediated Tax degradation, this compound inhibited activities of MAPK/ERK1/2 and IκB kinases. In addition, niclosamide downregulated Stat3 and pro-survival Bcl-2 family members such as Mcl-1 and repressed the viral gene transcription of HTLV-1 through induction of Tax degradation. Since Tax, Stat3 and Mcl-1 are crucial molecules for promoting survival and growth of HTLV-1-transformed T cells, our findings demonstrate a novel mechanism of niclosamide in inducing Tax degradation and downregulating various cellular pro-survival molecules, thereby promoting apoptosis of HTLV-1-associated leukemia cells. - Highlights: • Niclosamide is a promising therapeutic candidate for adult T cell leukemia. • Niclosamide employs a novel mechanism through proteasomal degradation of Tax. • Niclosamide downregulates certain cellular pro-survival molecules.« less

  4. pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana

    PubMed Central

    2017-01-01

    The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. PMID:27856772

  5. Montanide, Poly I:C and nanoparticle based vaccines promote differential suppressor and effector cell expansion: a study of induction of CD8 T cells to a minimal Plasmodium berghei epitope.

    PubMed

    Wilson, Kirsty L; Xiang, Sue D; Plebanski, Magdalena

    2015-01-01

    The development of practical and flexible vaccines to target liver stage malaria parasites would benefit from an ability to induce high levels of CD8 T cells to minimal peptide epitopes. Herein we compare different adjuvant and carrier systems in a murine model for induction of interferon gamma (IFN-γ) producing CD8 T cells to the minimal immuno-dominant peptide epitope from the circumsporozoite protein (CSP) of Plasmodium berghei, pb9 (SYIPSAEKI, referred to as KI). Two pro-inflammatory adjuvants, Montanide and Poly I:C, and a non-classical, non-inflammatory nanoparticle based carrier (polystyrene nanoparticles, PSNPs), were compared side-by-side for their ability to induce potentially protective CD8 T cell responses after two immunizations. KI in Montanide (Montanide + KI) or covalently conjugated to PSNPs (PSNPs-KI) induced such high responses, whereas adjuvanting with Poly I:C or PSNPs without conjugation was ineffective. This result was consistent with an observed induction of an immunosuppressed environment by Poly I:C in the draining lymph node (dLN) 48 h post injection, which was reflected by increased frequencies of myeloid derived suppressor cells (MDSCs) and a proportion of inflammation reactive regulatory T cells (Treg) expressing the tumor necrosis factor receptor 2 (TNFR2), as well as decreased dendritic cell (DC) maturation. The other inflammatory adjuvant, Montanide, also promoted proportional increases in the TNFR2(+) Treg subpopulation, but not MDSCs, in the dLN. By contrast, injection with non-inflammatory PSNPs did not cause these changes. Induction of high CD8 T cell responses, using minimal peptide epitopes, can be achieved by non-inflammatory carrier nanoparticles, which in contrast to some conventional inflammatory adjuvants, do not expand either MDSCs or inflammation reactive Tregs at the site of priming.

  6. AhR activation increases IL-2 production by alloreactive CD4+ T cells initiating the differentiation of mucosal-homing Tim3+ Lag3+ Tr1 cells.

    PubMed

    Ehrlich, Allison K; Pennington, Jamie M; Tilton, Susan; Wang, Xisheng; Marshall, Nikki B; Rohlman, Diana; Funatake, Castle; Punj, Sumit; O'Donnell, Edmond; Yu, Zhen; Kolluri, Siva K; Kerkvliet, Nancy I

    2017-11-01

    Activation of the aryl hydrocarbon receptor (AhR) by immunosuppressive ligands promotes the development of regulatory T (Treg) cells. Although AhR-induced Foxp3 + Treg cells have been well studied, much less is known about the development and fate of AhR-induced Type 1 Treg (AhR-Tr1) cells. In the current study, we identified the unique transcriptional and functional changes in murine CD4 + T cells that accompany the differentiation of AhR-Tr1 cells during the CD4 + T-cell-dependent phase of an allospecific cytotoxic T lymphocyte (allo-CTL) response. AhR activation increased the expression of genes involved in T-cell activation, immune regulation and chemotaxis, as well as a global downregulation of genes involved in cell cycling.  Increased IL-2 production was responsible for the early AhR-Tr1 activation phenotype previously characterized as CD25 + CTLA4 + GITR + on day 2. The AhR-Tr1 phenotype was further defined by the coexpression of the immunoregulatory receptors Lag3 and Tim3 and non-overlapping expression of CCR4 and CCR9. Consistent with the increased expression of CCR9, real-time imaging showed enhanced migration of AhR-Tr1 cells to the lamina propria of the small intestine and colon. The discovery of mucosal imprinting of AhR-Tr1 cells provides an additional mechanism by which therapeutic AhR ligands can control immunopathology. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Regulation of dendritic cell function through Toll-like receptors.

    PubMed

    Kaisho, Tsuneyasu; Akira, Shizuo

    2003-06-01

    Higher animals establish host defense by orchestrating innate and adaptive immunity. This is mediated by professional antigen presenting cells, i.e. dendritic cells (DCs). DCs can incorporate pathogens, produce a variety of cytokines, maturate, and present pathogen-derived peptides to T cells, thereby inducing T cell activation and differentiation. These responses are triggered by microbial recognition through type I transmembrane proteins, Toll-like receptors (TLRs) on DCs. TLRs consist of ten members and each TLR is involved in recognizing a variety of microorganism-derived molecular structures. TLR ligands include cell wall components, proteins, nucleic acids, and synthetic chemical compounds, all of which can activate DCs as immune adjuvants. Each TLR can activate DCs in a similar, but distinct manner. For example, TLRs can be divided into subgroups according to their type I interferon (IFN) inducing ability. TLR2 cannot induce IFN-alpha or IFN-beta, but TLR4 can lead to IFN-beta production. Meanwhile, TLR3, TLR7, and TLR9 can induce both IFN-alpha and IFN-beta. Recent evidences suggest that cytoplamic adapters for TLRs are especially crucial for this functional heterogeneity. Clarifying how DC function is regulated by TLRs should provide us with critical information for manipulating the host defense against a variety of diseases.

  8. Lytic and Latent Antigens of the Human Gammaherpesviruses Kaposi's Sarcoma-Associated Herpesvirus and Epstein-Barr Virus Induce T-Cell Responses with Similar Functional Properties and Memory Phenotypes▿

    PubMed Central

    Bihl, Florian; Narayan, Murli; Chisholm, John V.; Henry, Leah M.; Suscovich, Todd J.; Brown, Elizabeth E.; Welzel, Tania M.; Kaufmann, Daniel E.; Zaman, Tauheed M.; Dollard, Sheila; Martin, Jeff N.; Wang, Fred; Scadden, David T.; Kaye, Kenneth M.; Brander, Christian

    2007-01-01

    The cellular immunity against Kaposi's sarcoma-associated herpesvirus (KSHV) is poorly characterized and has not been compared to T-cell responses against other human herpesviruses. Here, novel and dominant targets of KSHV-specific cellular immunity are identified and compared to T cells specific for lytic and latent antigens in a second human gammaherpesvirus, Epstein-Barr virus. The data identify a novel HLA-B57- and HLA-B58-restricted epitope in the Orf57 protein and show consistently close parallels in immune phenotypes and functional response patterns between cells targeting lytic or latent KSHV- and EBV-encoded antigens, suggesting common mechanisms in the induction of these responses. PMID:17329344

  9. Genetic correction of tauopathy phenotypes in neurons derived from human induced pluripotent stem cells.

    PubMed

    Fong, Helen; Wang, Chengzhong; Knoferle, Johanna; Walker, David; Balestra, Maureen E; Tong, Leslie M; Leung, Laura; Ring, Karen L; Seeley, William W; Karydas, Anna; Kshirsagar, Mihir A; Boxer, Adam L; Kosik, Kenneth S; Miller, Bruce L; Huang, Yadong

    2013-01-01

    Tauopathies represent a group of neurodegenerative disorders characterized by the accumulation of pathological TAU protein in brains. We report a human neuronal model of tauopathy derived from induced pluripotent stem cells (iPSCs) carrying a TAU-A152T mutation. Using zinc-finger nuclease-mediated gene editing, we generated two isogenic iPSC lines: one with the mutation corrected, and another with the homozygous mutation engineered. The A152T mutation increased TAU fragmentation and phosphorylation, leading to neurodegeneration and especially axonal degeneration. These cellular phenotypes were consistent with those observed in a patient with TAU-A152T. Upon mutation correction, normal neuronal and axonal morphologies were restored, accompanied by decreases in TAU fragmentation and phosphorylation, whereas the severity of tauopathy was intensified in neurons with the homozygous mutation. These isogenic TAU-iPSC lines represent a critical advancement toward the accurate modeling and mechanistic study of tauopathies with human neurons and will be invaluable for drug-screening efforts and future cell-based therapies.

  10. Immune responses induced by T-cell vaccination in patients with rheumatoid arthritis

    PubMed Central

    Ivanova, Irina; Seledtsova, Galina; Mamaev, Sergey; Shishkov, Alexey; Seledtsov, Viktor

    2014-01-01

    Patients with rheumatoid arthritis (RA) were treated with a cellular vaccine, which consisted of autologous collagen-reactive T-cells. This study showed that antigen-specific proliferative activity of the peripheral blood mononuclear cells was significantly downregulated after T-cell vaccination in RA patients. T-cell vaccination resulted in a statistically significant decrease in plasma IFNγ levels and a concomitant increase in IL-4 levels in treated patients. Accordingly, following T-cell vaccination the number of IFNγ-producing CD4+ and CD8+ T-cells was decreased by 1.6–1.8-fold, which was paralleled by 1.7-fold increases in IL-4-producing CD4+ T-cells. In addition, the present study showed 5–7-fold increase in the CD8+CD45RO+CD62L– effector memory T-cells and central memory T-cells (both CD4+ CD45RO+CD62L+ T-cells and CD8+CD45RO+CD62L+ T-cells) in RA patients, as compared with healthy individuals. We observed significant reduction in CD4+ and CD8+ central memory T-cells, as well as reduction in CD8+ effector memory T-cells in vaccinated patients in the course of the treatment. We also demonstrated that CD4+CD25+FoxP3+ regulatory T-cell levels were significantly up-regulated in the peripheral blood of RA patients following T-cell vaccination. However, CD4+CD25-FoxP3+ Т-cell levels did not significantly change during the entire T-cell vaccination course. In conclusion, the T-cell immunotherapy regimen used resulted in the clinical improvement, which was achieved in 87% patients. PMID:24633313

  11. Merkel Cell Polyomavirus Small T Antigen Induces Cancer and Embryonic Merkel Cell Proliferation in a Transgenic Mouse Model.

    PubMed

    Shuda, Masahiro; Guastafierro, Anna; Geng, Xuehui; Shuda, Yoko; Ostrowski, Stephen M; Lukianov, Stefan; Jenkins, Frank J; Honda, Kord; Maricich, Stephen M; Moore, Patrick S; Chang, Yuan

    2015-01-01

    Merkel cell polyomavirus (MCV) causes the majority of human Merkel cell carcinomas (MCC) and encodes a small T (sT) antigen that transforms immortalized rodent fibroblasts in vitro. To develop a mouse model for MCV sT-induced carcinogenesis, we generated transgenic mice with a flox-stop-flox MCV sT sequence homologously recombined at the ROSA locus (ROSAsT), allowing Cre-mediated, conditional MCV sT expression. Standard tamoxifen (TMX) administration to adult UbcCreERT2; ROSAsT mice, in which Cre is ubiquitously expressed, resulted in MCV sT expression in multiple organs that was uniformly lethal within 5 days. Conversely, most adult UbcCreERT2; ROSAsT mice survived low-dose tamoxifen administration but developed ear lobe dermal hyperkeratosis and hypergranulosis. Simultaneous MCV sT expression and conditional homozygous p53 deletion generated multi-focal, poorly-differentiated, highly anaplastic tumors in the spleens and livers of mice after 60 days of TMX treatment. Mouse embryonic fibroblasts from these mice induced to express MCV sT exhibited anchorage-independent cell growth. To examine Merkel cell pathology, MCV sT expression was also induced during mid-embryogenesis in Merkel cells of Atoh1CreERT2/+; ROSAsT mice, which lead to significantly increased Merkel cell numbers in touch domes at late embryonic ages that normalized postnatally. Tamoxifen administration to adult Atoh1CreERT2/+; ROSAsT and Atoh1CreERT2/+; ROSAsT; p53flox/flox mice had no effects on Merkel cell numbers and did not induce tumor formation. Taken together, these results show that MCV sT stimulates progenitor Merkel cell proliferation in embryonic mice and is a bona fide viral oncoprotein that induces full cancer cell transformation in the p53-null setting.

  12. Immunization with apical membrane antigen 1 confers sterile infection-blocking immunity against Plasmodium sporozoite challenge in a rodent model.

    PubMed

    Schussek, Sophie; Trieu, Angela; Apte, Simon H; Sidney, John; Sette, Alessandro; Doolan, Denise L

    2013-10-01

    Apical membrane antigen 1 (AMA-1) is a leading blood-stage malaria vaccine candidate. Consistent with a key role in erythrocytic invasion, AMA-1-specific antibodies have been implicated in AMA-1-induced protective immunity. AMA-1 is also expressed in sporozoites and in mature liver schizonts where it may be a target of protective cell-mediated immunity. Here, we demonstrate for the first time that immunization with AMA-1 can induce sterile infection-blocking immunity against Plasmodium sporozoite challenge in 80% of immunized mice. Significantly higher levels of gamma interferon (IFN-γ)/interleukin-2 (IL-2)/tumor necrosis factor (TNF) multifunctional T cells were noted in immunized mice than in control mice. We also report the first identification of minimal CD8(+) and CD4(+) T cell epitopes on Plasmodium yoelii AMA-1. These data establish AMA-1 as a target of both preerythrocytic- and erythrocytic-stage protective immune responses and validate vaccine approaches designed to induce both cellular and humoral immunity.

  13. Sodium-dependent phosphate cotransporters and phosphate-induced calcification of vascular smooth muscle cells: Redundant roles for PiT-1 and PiT-2

    PubMed Central

    Crouthamel, Matthew H.; Lau, Wei Ling; Leaf, Elizabeth M.; Chavkin, Nick; Wallingford, Mary C.; Peterson, Danielle F.; Li, Xianwu; Liu, Yonggang; Chin, Michael T.; Levi, Moshe; Giachelli, Cecilia M.

    2014-01-01

    Objective Elevated serum phosphate has emerged as a major risk factor for vascular calcification. The sodium-dependent phosphate cotransporter, PiT-1, was previously shown to be required for phosphate-induced osteogenic differentiation and calcification of cultured human VSMCs, but its importance in vascular calcification in vivo, as well as the potential role of its homologue, PiT-2, have not been determined. We investigated the in vivo requirement for PiT-1 in vascular calcification using a mouse model of chronic kidney disease, and the potential compensatory role of PiT-2 using in vitro knockdown and over-expression strategies. Approach and Results Mice with targeted deletion of PiT-1 in VSMCs were generated (PiT-1Δsm). PiT-1 mRNA levels were undetectable whereas PiT-2 mRNA levels were increased 2 fold in the vascular aortic media of PiT-1Δsm compared to PiT-1flox/flox control. When arterial medial calcification was induced in PiT-1Δsm and PiT-1flox/flox by chronic kidney disease followed by dietary phosphate loading, the degree of aortic calcification was not different between genotypes, suggesting compensation by PiT-2. Consistent with this possibility, VSMCs isolated from PiT-1Δsm mice had no PiT-1 mRNA expression, increased PiT-2 mRNA levels, and no difference in sodium-dependent phosphate uptake or phosphate-induced matrix calcification compared to PiT-1flox/flox VSMCs. Knockdown of PiT-2 decreased phosphate uptake and phosphate-induced calcification of PiT-1Δsm VSMCs. Furthermore, over-expression of PiT-2 restored these parameters in human PiT-1-deficient VSMCs. Conclusions PiT-2 can mediate phosphate uptake and calcification of VSMCs in the absence of PiT-1. Mechanistically, PiT-1 and PiT-2 appear to serve redundant roles in phosphate-induced calcification of vascular smooth muscle cells. PMID:23968976

  14. Disruption of TET2 promotes the therapeutic efficacy of CD19-targeted T cells.

    PubMed

    Fraietta, Joseph A; Nobles, Christopher L; Sammons, Morgan A; Lundh, Stefan; Carty, Shannon A; Reich, Tyler J; Cogdill, Alexandria P; Morrissette, Jennifer J D; DeNizio, Jamie E; Reddy, Shantan; Hwang, Young; Gohil, Mercy; Kulikovskaya, Irina; Nazimuddin, Farzana; Gupta, Minnal; Chen, Fang; Everett, John K; Alexander, Katherine A; Lin-Shiao, Enrique; Gee, Marvin H; Liu, Xiaojun; Young, Regina M; Ambrose, David; Wang, Yan; Xu, Jun; Jordan, Martha S; Marcucci, Katherine T; Levine, Bruce L; Garcia, K Christopher; Zhao, Yangbing; Kalos, Michael; Porter, David L; Kohli, Rahul M; Lacey, Simon F; Berger, Shelley L; Bushman, Frederic D; June, Carl H; Melenhorst, J Joseph

    2018-06-01

    Cancer immunotherapy based on genetically redirecting T cells has been used successfully to treat B cell malignancies 1-3 . In this strategy, the T cell genome is modified by integration of viral vectors or transposons encoding chimaeric antigen receptors (CARs) that direct tumour cell killing. However, this approach is often limited by the extent of expansion and persistence of CAR T cells 4,5 . Here we report mechanistic insights from studies of a patient with chronic lymphocytic leukaemia treated with CAR T cells targeting the CD19 protein. Following infusion of CAR T cells, anti-tumour activity was evident in the peripheral blood, lymph nodes and bone marrow; this activity was accompanied by complete remission. Unexpectedly, at the peak of the response, 94% of CAR T cells originated from a single clone in which lentiviral vector-mediated insertion of the CAR transgene disrupted the methylcytosine dioxygenase TET2 gene. Further analysis revealed a hypomorphic mutation in this patient's second TET2 allele. TET2-disrupted CAR T cells exhibited an epigenetic profile consistent with altered T cell differentiation and, at the peak of expansion, displayed a central memory phenotype. Experimental knockdown of TET2 recapitulated the potency-enhancing effect of TET2 dysfunction in this patient's CAR T cells. These findings suggest that the progeny of a single CAR T cell induced leukaemia remission and that TET2 modification may be useful for improving immunotherapies.

  15. T-cell involvement in drug-induced acute generalized exanthematous pustulosis

    PubMed Central

    Britschgi, Markus; Steiner, Urs C.; Schmid, Simone; Depta, Jan P.H.; Senti, Gabriela; Bircher, Andreas; Burkhart, Christoph; Yawalkar, Nikhil; Pichler, Werner J.

    2001-01-01

    Acute generalized exanthematous pustulosis (AGEP) is an uncommon eruption most often provoked by drugs, by acute infections with enteroviruses, or by mercury. It is characterized by acute, extensive formation of nonfollicular sterile pustules on erythematous background, fever, and peripheral blood leukocytosis. We present clinical and immunological data on four patients with this disease, which is caused by different drugs. An involvement of T cells could be implied by positive skin patch tests and lymphocyte transformation tests. Immunohistochemistry revealed a massive cell infiltrate consisting of neutrophils in pustules and T cells in the dermis and epidermis. Expression of the potent neutrophil-attracting chemokine IL-8 was elevated in keratinocytes and infiltrating mononuclear cells. Drug-specific T cells were generated from the blood and skin of three patients, and phenotypic characterization showed a heterogeneous distribution of CD4/CD8 phenotype and of T-cell receptor Vβ-expression. Analysis of cytokine/chemokine profiles revealed that IL-8 is produced significantly more by drug-specific T cells from patients with AGEP compared with drug-specific T cells from patients that had non-AGEP exanthemas. In conclusion, our data demonstrate the involvement of drug-specific T cells in the pathomechanism of this rather rare and peculiar form of drug allergy. In addition, they indicate that even in some neutrophil-rich inflammatory responses specific T cells are engaged and might orchestrate the immune reaction. PMID:11390425

  16. Role of interleukin 1 in antigen-specific T cell proliferation.

    PubMed

    Chu, E; Rosenwasser, L J; Dinarello, C A; Lareau, M; Geha, R S

    1984-03-01

    The role of interleukin 1 (IL 1) in human antigen-specific T cell proliferation was examined. Nylon wool-purified T cells proliferated in the presence of autologous monocytes (Mo.) pulsed for 18 h with tetanus toxoid (TT) antigen (Mo.TT). Irradiation of Mo.TT with ultraviolet (UV) light (72 J/m2) abolished their capacity to support T cell proliferation and drastically reduced their capacity to secrete IL 1 after stimulation with Staphylococcus albus. The defect in antigen presentation induced by UV irradiation of Mo.TT was reversed in a dose-dependent manner by the addition of two different preparations containing human interleukin 1 (IL 1). The first preparation consisted of supernatants of Mo. stimulated with Con A for 18 hr and in which Con A activity was blocked by alpha-D-methyl-mannoside (Mo.-Con A-Sup). The second preparation consisted of human IL 1 partially purified from supernatants of human peripheral blood mononuclear cells stimulated with S. albus. This IL 1 copurified with human leukocyte pyrogen (LP) and was termed IL 1/LP. Both IL 1-containing preparations enhanced the response of C57BL/6 mouse thymocytes to phytohemagglutinin. A rabbit antibody to human IL 1/LP inhibited the capacity of T cells to proliferate in response to Mo.TT and inhibited the capacity of Mo.-Con A-Sup to reconstitute the T cell response to UV-irradiated Mo.TT. IL 1/LP was not necessary for T cells to recognize the immunogenic moiety presented by Mo., because monolayers of UV-irradiated Mo.TT were equivalent to monolayers of unirradiated MO.TT in their capacity to adsorb TT-reactive T cells specifically. Furthermore, the addition of rabbit antibody to IL 1/LP did not interfere with the capacity of UV-irradiated Mo.TT to adsorb TT-reactive T cells. The results obtained in this study indicate that IL 1 is involved in optimal antigen-driven proliferation of human T lymphocytes.

  17. EBV induces persistent NF-κB activation and contributes to survival of EBV-positive neoplastic T- or NK-cells.

    PubMed

    Takada, Honami; Imadome, Ken-Ichi; Shibayama, Haruna; Yoshimori, Mayumi; Wang, Ludan; Saitoh, Yasunori; Uota, Shin; Yamaoka, Shoji; Koyama, Takatoshi; Shimizu, Norio; Yamamoto, Kouhei; Fujiwara, Shigeyoshi; Miura, Osamu; Arai, Ayako

    2017-01-01

    Epstein-Barr virus (EBV) has been detected in several T- and NK-cell neoplasms such as extranodal NK/T-cell lymphoma nasal type, aggressive NK-cell leukemia, EBV-positive peripheral T-cell lymphoma, systemic EBV-positive T-cell lymphoma of childhood, and chronic active EBV infection (CAEBV). However, how this virus contributes to lymphomagenesis in T or NK cells remains largely unknown. Here, we examined NF-κB activation in EBV-positive T or NK cell lines, SNT8, SNT15, SNT16, SNK6, and primary EBV-positive and clonally proliferating T/NK cells obtained from the peripheral blood of patients with CAEBV. Western blotting, electrophoretic mobility shift assays, and immunofluorescent staining revealed persistent NF-κB activation in EBV-infected cell lines and primary cells from patients. Furthermore, we investigated the role of EBV in infected T cells. We performed an in vitro infection assay using MOLT4 cells infected with EBV. The infection directly induced NF-κB activation, promoted survival, and inhibited etoposide-induced apoptosis in MOLT4 cells. The luciferase assay suggested that LMP1 mediated NF-κB activation in MOLT4 cells. IMD-0354, a specific inhibitor of NF-κB that suppresses NF-κB activation in cell lines, inhibited cell survival and induced apoptosis. These results indicate that EBV induces NF-κB-mediated survival signals in T and NK cells, and therefore, may contribute to the lymphomagenesis of these cells.

  18. EBV induces persistent NF-κB activation and contributes to survival of EBV-positive neoplastic T- or NK-cells

    PubMed Central

    Shibayama, Haruna; Yoshimori, Mayumi; Wang, Ludan; Saitoh, Yasunori; Uota, Shin; Yamaoka, Shoji; Koyama, Takatoshi; Shimizu, Norio; Yamamoto, Kouhei; Fujiwara, Shigeyoshi; Miura, Osamu

    2017-01-01

    Epstein–Barr virus (EBV) has been detected in several T- and NK-cell neoplasms such as extranodal NK/T-cell lymphoma nasal type, aggressive NK-cell leukemia, EBV-positive peripheral T-cell lymphoma, systemic EBV-positive T-cell lymphoma of childhood, and chronic active EBV infection (CAEBV). However, how this virus contributes to lymphomagenesis in T or NK cells remains largely unknown. Here, we examined NF-κB activation in EBV-positive T or NK cell lines, SNT8, SNT15, SNT16, SNK6, and primary EBV-positive and clonally proliferating T/NK cells obtained from the peripheral blood of patients with CAEBV. Western blotting, electrophoretic mobility shift assays, and immunofluorescent staining revealed persistent NF-κB activation in EBV-infected cell lines and primary cells from patients. Furthermore, we investigated the role of EBV in infected T cells. We performed an in vitro infection assay using MOLT4 cells infected with EBV. The infection directly induced NF-κB activation, promoted survival, and inhibited etoposide-induced apoptosis in MOLT4 cells. The luciferase assay suggested that LMP1 mediated NF-κB activation in MOLT4 cells. IMD-0354, a specific inhibitor of NF-κB that suppresses NF-κB activation in cell lines, inhibited cell survival and induced apoptosis. These results indicate that EBV induces NF-κB-mediated survival signals in T and NK cells, and therefore, may contribute to the lymphomagenesis of these cells. PMID:28346502

  19. Tolerance without clonal expansion: self-antigen-expressing B cells program self-reactive T cells for future deletion.

    PubMed

    Frommer, Friederike; Heinen, Tobias J A J; Wunderlich, F Thomas; Yogev, Nir; Buch, Thorsten; Roers, Axel; Bettelli, Estelle; Müller, Werner; Anderton, Stephen M; Waisman, Ari

    2008-10-15

    B cells have been shown in various animal models to induce immunological tolerance leading to reduced immune responses and protection from autoimmunity. We show that interaction of B cells with naive T cells results in T cell triggering accompanied by the expression of negative costimulatory molecules such as PD-1, CTLA-4, B and T lymphocyte attenuator, and CD5. Following interaction with B cells, T cells were not induced to proliferate, in a process that was dependent on their expression of PD-1 and CTLA-4, but not CD5. In contrast, the T cells became sensitive to Ag-induced cell death. Our results demonstrate that B cells participate in the homeostasis of the immune system by ablation of conventional self-reactive T cells.

  20. Armored CAR T-cells: utilizing cytokines and pro-inflammatory ligands to enhance CAR T-cell anti-tumour efficacy.

    PubMed

    Yeku, Oladapo O; Brentjens, Renier J

    2016-04-15

    Chimaeric antigen receptor (CAR) T-cells are T-cells that have been genetically modified to express an artificial construct consisting of a synthetic T-cell receptor (TCR) targeted to a predetermined antigen expressed on a tumour. Coupling the T-cell receptor to a CD3ζ signalling domain paved the way for first generation CAR T-cells that were efficacious against cluster of differentiation (CD)19-expressing B-cell malignancies. Optimization with additional signalling domains such as CD28 or 4-1BB in addition to CD3ζ provided T-cell activation signal 2 and further improved the efficacy and persistence of these second generation CAR T-cells. Third generation CAR T-cells which utilize two tandem costimulatory domains have also been reported. In this review, we discuss a different approach to optimization of CAR T-cells. Through additional genetic modifications, these resultant armored CAR T-cells are typically modified second generation CAR T-cells that have been further optimized to inducibly or constitutively secrete active cytokines or express ligands that further armor CAR T-cells to improve efficacy and persistence. The choice of the 'armor' agent is based on knowledge of the tumour microenvironment and the roles of other elements of the innate and adaptive immune system. Although there are several variants of armored CAR T-cells under investigation, here we focus on three unique approaches using interleukin-12 (IL-12), CD40L and 4-1BBL. These agents have been shown to further enhance CAR T-cell efficacy and persistence in the face of a hostile tumour microenvironment via different mechanisms. © 2016 Authors; published by Portland Press Limited.

  1. Armored CAR T-cells: utilizing cytokines and pro-inflammatory ligands to enhance CAR T-cell anti-tumour efficacy

    PubMed Central

    Yeku, Oladapo O.; Brentjens, Renier J.

    2017-01-01

    Chimaeric antigen receptor (CAR) T-cells are T-cells that have been genetically modified to express an artificial construct consisting of a synthetic T-cell receptor (TCR) targeted to a predetermined antigen expressed on a tumour. Coupling the T-cell receptor to a CD3ζ signalling domain paved the way for first generation CAR T-cells that were efficacious against cluster of differentiation (CD)19-expressing B-cell malignancies. Optimization with additional signalling domains such as CD28 or 4-1BB in addition to CD3ζ provided T-cell activation signal 2 and further improved the efficacy and persistence of these second generation CAR T-cells. Third generation CAR T-cells which utilize two tandem costimulatory domains have also been reported. In this review, we discuss a different approach to optimization of CAR T-cells. Through additional genetic modifications, these resultant armored CAR T-cells are typically modified second generation CAR T-cells that have been further optimized to inducibly or constitutively secrete active cytokines or express ligands that further armor CAR T-cells to improve efficacy and persistence. The choice of the ‘armor’ agent is based on knowledge of the tumour microenvironment and the roles of other elements of the innate and adaptive immune system. Although there are several variants of armored CAR T-cells under investigation, here we focus on three unique approaches using interleukin-12 (IL-12), CD40L and 4-1BBL. These agents have been shown to further enhance CAR T-cell efficacy and persistence in the face of a hostile tumour microenvironment via different mechanisms. PMID:27068948

  2. T-kininogen inhibits kinin-mediated activation of ERK in endothelial cells.

    PubMed

    Leiva-Salcedo, Elias; Perez, Viviana; Acuña-Castillo, Claudio; Walter, Robin; Sierra, Felipe

    2002-01-01

    Serum levels of T-kininogen increase dramatically as rats approach the end of their lifespan. Stable expression of the protein in Balb/c 3T3 fibroblasts leads to a dramatic inhibition of cell proliferation, as well as inhibition of the ERK signaling pathway. T-kininogen is a potent inhibitor of cysteine proteinases, and we have described that the inhibition of ERK activity occurs, at least in part, via stabilization of the MAP kinase phosphatase, MKP-1. Since fibroblasts are not a physiological target of T-kininogen, we have now purified the protein from rat serum, and used it to assess the effect of T-kininogen on endothelial cells. Adding purified T-kininogen to EAhy 926 hybridoma cells resulted in inhibition of basal ERK activity levels, as estimated using appropriate anti-phospho ERK antibodies. Furthermore, exogenously added T-kininogen inhibited the activation of the ERK pathway induced by either bradykinin or T-kinin. We conclude that the age-related increase in hepatic T-kininogen gene expression and serum levels of the protein could have dramatic consequences on endothelial cell physiology, both under steady state conditions, and after activation by cell-specific stimuli. Our results are consistent with T-kininogen being an important modulator of the senescent phenotype in vivo.

  3. CXCL16 and CXCR6 are upregulated in psoriasis and mediate cutaneous recruitment of human CD8+ T cells.

    PubMed

    Günther, Claudia; Carballido-Perrig, Nicole; Kaesler, Susanne; Carballido, José M; Biedermann, Tilo

    2012-03-01

    Psoriatic skin lesions are characterized by an inflammatory infiltrate, consisting of dendritic cells, monocytes, and both CD4(+) and CD8(+) T lymphocytes. Although the chemokines involved in the migration of CD4(+) T cells into psoriatic skin are well characterized, those regulating CD8(+) T-cell recruitment are less understood. We found that the percentages of peripheral blood CD8(+) T cells expressing CXCR6 were higher in psoriatic patients than in healthy or atopic individuals. In addition, CXCR6 expression in psoriatic patients was more abundant in the CD8(+) than in the CD4(+) T-cell compartment. CXCR6 mRNA expression was also stronger in skin CD8(+) T cells than in the corresponding blood-derived counterparts. Immunofluorescence analysis revealed profound upregulation of the CXCR6 ligand CXCL16 by monocytes, keratinocytes, and dendritic cells in psoriatic skin compared with healthy or atopic dermatitis skin. In line with this, CXCR6(+) CD8(+) T cells also were most prevalent in psoriatic skin. Furthermore, CXCL16 induced Ca(2+) influx and chemotactic migration of psoriatic skin-derived CD8(+) T cells in vitro. Most importantly, CXCL16 potently recruited human CD8(+) T cells to human skin grafts previously transplanted onto SCID mice in vivo. These investigations indicate that CXCL16-CXCR6 interactions mediate homing of CD8(+) T cells into human skin, and thereby contribute to psoriasis pathogenesis.

  4. Downregulation of proapoptotic Bim augments IL-2-independent T-cell transformation by human T-cell leukemia virus type-1 Tax.

    PubMed

    Higuchi, Masaya; Takahashi, Masahiko; Tanaka, Yuetsu; Fujii, Masahiro

    2014-12-01

    Human T-cell leukemia virus type 1 (HTLV-1), an etiological agent of adult T-cell leukemia, immortalizes and transforms primary human T cells in vitro in both an interleukin (IL)-2-dependent and IL-2-independent manner. Expression of the HTLV-1 oncoprotein Tax transforms the growth of the mouse T-cell line CTLL-2 from being IL-2-dependent to IL-2-independent. Withdrawal of IL-2 from normal activated T cells induces apoptosis, which is mediated through the inducible expression of several proapoptotic proteins, including Bim. In this study, we found that Tax protects IL-2-depleted T cells against Bim-induced apoptosis. Withdrawal of IL-2 from CTLL-2 cells induced a prominent increase in the level of Bim protein in CTLL-2 cells, but not in Tax-transformed CTLL-2 cells. This inhibition of Bim in Tax-transformed CTLL-2 cells was mediated by two mechanisms: downregulation of Bim mRNA and posttranscriptional reduction of Bim protein. Transient expression of Tax in CTLL-2 cells also inhibited IL-2 depletion-induced expression of Bim, however, this decrease in Bim protein expression was not due to downregulation of Bim mRNA, thus indicating that Bim mRNA downregulation in Tax-transformed CTLL-2 occurs only after long-term expression of Tax. Transient expression of Tax in CTLL-2 cells also induced Erk activation, however, this was not involved in the reduction of Bim protein. Knockdown of Bim expression in CTLL-2 cells augmented Tax-induced IL-2-independent transformation. HTLV-1 infection of human T cells also reduced their levels of Bim protein, and restoring Bim expression in HTLV-1-infected cells reduced their proliferation by inducing apoptosis. Taken together, these results indicate that Tax-induced downregulation of Bim in HTLV-1-infected T cells promotes their IL-2-independent growth, thereby supporting the persistence of HTLV-1 infection in vivo. © 2014 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  5. Hepatitis C Virus Induces Regulatory T Cells by Naturally Occurring Viral Variants to Suppress T Cell Responses

    PubMed Central

    Cusick, Matthew F.; Schiller, Jennifer J.; Gill, Joan C.; Eckels, David D.

    2011-01-01

    Regulatory T cell markers are increased in chronically infected individuals with the hepatitis C virus (HCV), but to date, the induction and maintenance of Tregs in HCV infection has not been clearly defined. In this paper, we demonstrate that naturally occurring viral variants suppress T cell responses to cognate NS3358-375 in an antigen-specific manner. Of four archetypal variants, S370P induced regulatory T cell markers in comparison to NS3358-375-stimulated CD4 T cells. Further, the addition of variant-specific CD4 T cells back into a polyclonal culture in a dose-dependent manner inhibited the T cell response. These results suggest that HCV is able to induce antigen-specific regulatory T cells to suppress the antiviral T cell response in an antigen-specific manner, thus contributing to a niche within the host that could be conducive to HCV persistence. PMID:21197453

  6. Dynamic Imaging of CD8(+) T cells and dendritic cells during infection with Toxoplasma gondii.

    PubMed

    John, Beena; Harris, Tajie H; Tait, Elia D; Wilson, Emma H; Gregg, Beth; Ng, Lai Guan; Mrass, Paulus; Roos, David S; Dzierszinski, Florence; Weninger, Wolfgang; Hunter, Christopher A

    2009-07-01

    To better understand the initiation of CD8(+) T cell responses during infection, the primary response to the intracellular parasite Toxoplasma gondii was characterized using 2-photon microscopy combined with an experimental system that allowed visualization of dendritic cells (DCs) and parasite specific CD8(+) T cells. Infection with T. gondii induced localization of both these populations to the sub-capsular/interfollicular region of the draining lymph node and DCs were required for the expansion of the T cells. Consistent with current models, in the presence of cognate antigen, the average velocity of CD8(+) T cells decreased. Unexpectedly, infection also resulted in modulation of the behavior of non-parasite specific T cells. This TCR-independent process correlated with the re-modeling of the lymph node micro-architecture and changes in expression of CCL21 and CCL3. Infection also resulted in sustained interactions between the DCs and CD8(+) T cells that were visualized only in the presence of cognate antigen and were limited to an early phase in the response. Infected DCs were rare within the lymph node during this time frame; however, DCs presenting the cognate antigen were detected. Together, these data provide novel insights into the earliest interaction between DCs and CD8(+) T cells and suggest that cross presentation by bystander DCs rather than infected DCs is an important route of antigen presentation during toxoplasmosis.

  7. Dynamic Imaging of CD8+ T Cells and Dendritic Cells during Infection with Toxoplasma gondii

    PubMed Central

    John, Beena; Harris, Tajie H.; Tait, Elia D.; Wilson, Emma H.; Gregg, Beth; Ng, Lai Guan; Mrass, Paulus; Roos, David S.; Dzierszinski, Florence; Weninger, Wolfgang; Hunter, Christopher A.

    2009-01-01

    To better understand the initiation of CD8+ T cell responses during infection, the primary response to the intracellular parasite Toxoplasma gondii was characterized using 2-photon microscopy combined with an experimental system that allowed visualization of dendritic cells (DCs) and parasite specific CD8+ T cells. Infection with T. gondii induced localization of both these populations to the sub-capsular/interfollicular region of the draining lymph node and DCs were required for the expansion of the T cells. Consistent with current models, in the presence of cognate antigen, the average velocity of CD8+ T cells decreased. Unexpectedly, infection also resulted in modulation of the behavior of non-parasite specific T cells. This TCR-independent process correlated with the re-modeling of the lymph node micro-architecture and changes in expression of CCL21 and CCL3. Infection also resulted in sustained interactions between the DCs and CD8+ T cells that were visualized only in the presence of cognate antigen and were limited to an early phase in the response. Infected DCs were rare within the lymph node during this time frame; however, DCs presenting the cognate antigen were detected. Together, these data provide novel insights into the earliest interaction between DCs and CD8+ T cells and suggest that cross presentation by bystander DCs rather than infected DCs is an important route of antigen presentation during toxoplasmosis. PMID:19578440

  8. Separation of concanavalin A-induced human suppressor and helper T cells by the autologous erythrocyte rosette technique.

    PubMed

    Sakane, T; Honda, M; Taniguchi, Y; Kotani, H

    1981-08-01

    Very few normal human peripheral blood T cells are capable of binding autologous erythrocytes to form rosettes, whereas in the T cell population activated by concanavalin A (Con A) the autorosette levels are markedly enhanced. Fractionation of the Con A-activated T cells with autologous erythrocytes into autorosetting and nonrosetting cells demonstrates that suppressor, but not helper, activity resides in the autorosetting population, whereas the reverse is true of the nonrosetting population. Both these activities are found to be Con A dependent. The Con A-induced human suppressor cells can be identified and separated from the Con A-induced human helper cells by the autorosette technique. Studies on the surface properties of autorosetting and nonrosetting T cells indicate that there is little correlation between the activated suppressor and helper T cell subsets defined by autorosette technique and either those defined by monoclonal antibodies (which are able to distinguish these subsets in the resting but not activated T cells) or those defined by Fc receptors. Since the autorosetting T cell population (which acts as suppressor cells) bears receptors for peanut agglutinin, the nature of Con A-induced human suppressor cells appears to be analogous to that of Con A-induced murine suppressor cells.

  9. Oligoclonal T cell receptor gene rearrangements in blood lymphocytes of patients with acute Epstein-Barr virus-induced infectious mononucleosis.

    PubMed Central

    Strickler, J G; Movahed, L A; Gajl-Peczalska, K J; Horwitz, C A; Brunning, R D; Weiss, L M

    1990-01-01

    Gene rearrangement studies were performed on blood lymphocytes from eight patients with acute Epstein-Barr virus-induced infectious mononucleosis. The diagnosis in each case was based on characteristic clinical, hematologic, and serologic findings. The blood lymphocytes in each patient consisted predominantly of CD8+ T cells. EBV DNA was detected in seven patients by Southern blot analysis (EBV Bam HI W probe, Bam HI). A germline configuration was found for the immunoglobulin heavy and light chain genes (JH probe, Bam HI and Eco RI; C kappa probe, Bam HI; and C lambda probe, Eco RI). T cell receptor gene rearrangements were detected with J gamma and J beta 1 + 2 probes. Using a J gamma probe with two different restriction enzymes (Bgl II and Eco RI), the blood from each patient showed several bands corresponding to the polyclonal pattern previously described in the blood of normal individuals. Using J beta 1 + 2 probes with two different restriction enzymes (Bgl II and Bam HI), each case showed from 3 to about 12 extragermline bands of varying intensity and in different locations from case to case. In addition, each case showed relative deletion of the J beta 1 germline band. This oligoclonal pattern of T cell receptor gene rearrangements has not been previously reported in benign or malignant T cell populations. Images PMID:2170451

  10. Mucosal Vaccination with Heterologous Viral Vectored Vaccine Targeting Subdominant SIV Accessory Antigens Strongly Inhibits Early Viral Replication.

    PubMed

    Xu, Huanbin; Andersson, Anne-Marie; Ragonnaud, Emeline; Boilesen, Ditte; Tolver, Anders; Jensen, Benjamin Anderschou Holbech; Blanchard, James L; Nicosia, Alfredo; Folgori, Antonella; Colloca, Stefano; Cortese, Riccardo; Thomsen, Allan Randrup; Christensen, Jan Pravsgaard; Veazey, Ronald S; Holst, Peter Johannes

    2017-04-01

    Conventional HIV T cell vaccine strategies have not been successful in containing acute peak viremia, nor in providing long-term control. We immunized rhesus macaques intramuscularly and rectally using a heterologous adenovirus vectored SIV vaccine regimen encoding normally weakly immunogenic tat, vif, rev and vpr antigens fused to the MHC class II associated invariant chain. Immunizations induced broad T cell responses in all vaccinees. Following up to 10 repeated low-dose intrarectal challenges, vaccinees suppressed early viral replication (P=0.01) and prevented the peak viremia in 5/6 animals. Despite consistently undetectable viremia in 2 out of 6 vaccinees, all animals showed evidence of infection induced immune responses indicating that infection had taken place. Vaccinees, with and without detectable viremia better preserved their rectal CD4+ T cell population and had reduced immune hyperactivation as measured by naïve T cell depletion, Ki-67 and PD-1 expression on T cells. These results indicate that vaccination towards SIV accessory antigens vaccine can provide a level of acute control of SIV replication with a suggestion of beneficial immunological consequences in infected animals of unknown long-term significance. In conclusion, our studies demonstrate that a vaccine encoding subdominant antigens not normally associated with virus control can exert a significant impact on acute peak viremia. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Emodin enhances cisplatin-induced cytotoxicity in human bladder cancer cells through ROS elevation and MRP1 downregulation.

    PubMed

    Li, Xinxing; Wang, Haolu; Wang, Juan; Chen, Yuying; Yin, Xiaobin; Shi, Guiying; Li, Hui; Hu, Zhiqian; Liang, Xiaowen

    2016-08-02

    Chemoresistance is one of the most leading causes for tumor progression and recurrence of bladder cancer. Reactive oxygen species (ROS) plays a key role in the chemosensitivity of cancer cells. In the present study, emodin (1,3,8-trihydroxy-6-methylanthraquinone) was applied as a ROS generator in combination with cisplatin in T24 and J82 human bladder cancer cells. Cell viability and apoptosis rate of different treatment groups were detected by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) and flow cytometry (FCM). The expression of transporters was measured at both the transcription and translation levels using PCR and western blotting. In vitro findings were confirmed by in vivo experiments using tumor-bearing mice. The expression of multidrug resistance-associated protein 1 (MRP1) in tumour tissue was measured using immunohistochemistry and side effects of the emodin/cisplatin co-treatment were investigated by histological examination. Emodin increased the cellular ROS level and effectively enhanced the cisplatin-induced cytotoxicity of T24 and J82 human bladder cancer cells through decreasing glutathione-cisplatin (GSH-cisplatin) conjugates. It blocked the chemoresistance of T24 and J82 cells to cisplatin through suppressing the expression of MRP1. This effect was specific in T24 and J82 cells but not in HCV-29 normal bladder epithelial cells. Consistent with in vitro experiments, emodin/cisplatin co-treatment increased the cell apoptosis and repressed the MRP1 expression in xenograft tumors, and without obvious systemic toxicity. This study revealed that emodin could increase the cisplatin-induced cytotoxicity against T24 and J82 cells via elevating the cellular ROS level and downregulating MRP1 expression. We suggest that emodin could serve as an effective adjuvant agent for the cisplatin-based chemotherapy of bladder cancer.

  12. Maturation of monocyte derived dendritic cells with OK432 boosts IL-12p70 secretion and conveys strong T-cell responses

    PubMed Central

    2011-01-01

    Background Design of tumour specific immunotherapies using the patients' own dendritic cells (DC) is a fast advancing scientific field. The functional qualities of the DC generated in vitro are critical, and today's gold standard for maturation is a cytokine cocktail consisting of IL-1β, IL-6, TNF-α and PGE2 generating cells lacking IL-12p70 production. OK432 is an immunotherapeutic agent derived from killed Streptococcus pyogenes that has been used clinically to treat malignant and benign neoplasms for decades. Methods In this study, we analysed the effects of OK432 on DC maturation, DC migration, cytokine and chemokine secretion as well as T-cell stimulatory capacity, and compared it to the cytokine cocktail alone and combinations of OK432 with the cytokine cocktail. Results OK432 induced a marked up-regulation of CD40 on the cell surface as well as a strong inflammatory response from the DC with significantly more secretion of 19 different cytokines and chemokines compared to the cytokine cocktail. Interestingly, secretion of IL-15 and IL-12p70 was detected at high concentrations after maturation of DC with OK432. However, the OK432 treated DC did not migrate as well as DC treated with cytokine cocktail in a transwell migration assay. During allogeneic T-cell stimulation OK432 treated DC induced proliferation of over 50 percent of CD4 and 30 percent of CD8 T-cells for more than two cell divisions, whereas cytokine cocktail treated DC induced proliferation of 12 and 11 percent of CD4 and CD8 T-cells, respectively. Conclusions The clinically approved compound OK432 has interesting properties that warrants its use in DC immunotherapy and should be considered as a potential immunomodulating agent in cancer immunotherapy. PMID:21208424

  13. Dimethyl fumarate–induced lymphopenia in MS due to differential T-cell subset apoptosis

    PubMed Central

    Ghadiri, Mahtab; Rezk, Ayman; Li, Rui; Evans, Ashley; Luessi, Felix; Zipp, Frauke; Giacomini, Paul S.; Antel, Jack

    2017-01-01

    Objective: To examine the mechanism underlying the preferential CD8+ vs CD4+ T-cell lymphopenia induced by dimethyl fumarate (DMF) treatment of MS. Methods: Total lymphocyte counts and comprehensive T-cell subset analyses were performed in high-quality samples obtained from patients with MS prior to and serially following DMF treatment initiation. Random coefficient mixed-effects analysis was used to model the trajectory of T-cell subset losses in vivo. Survival and apoptosis of distinct T-cell subsets were assessed following in vitro exposure to DMF. Results: Best-fit modeling indicated that the DMF-induced preferential reductions in CD8+ vs CD4+ T-cell counts nonetheless followed similar depletion kinetics, suggesting a similar rather than distinct mechanism involved in losses of both the CD8+ and CD4+ T cells. In vitro, DMF exposure resulted in dose-dependent reductions in T-cell survival, which were found to reflect apoptotic cell death. This DMF-induced apoptosis was greater for CD8+ vs CD4+, as well as for memory vs naive, and conventional vs regulatory T-cell subsets, a pattern which mirrored preferential T-cell subset losses that we observed during in vivo treatment of patients. Conclusions: Differential apoptosis mediated by DMF may underlie the preferential lymphopenia of distinct T-cell subsets, including CD8+ and memory T-cell subsets, seen in treated patients with MS. This differential susceptibility of distinct T-cell subsets to DMF-induced apoptosis may contribute to both the safety and efficacy profiles of DMF in patients with MS. PMID:28377940

  14. Placental Malaria-Associated Suppression of Parasite-Specific Immune Response in Neonates Has No Major Impact on Systemic CD4 T Cell Homeostasis ▿ †

    PubMed Central

    Soulard, Valérie; Amadoudji Zin, Martin; Fitting, Catherine; Ibitokou, Samad; Oesterholt, Mayke; Luty, Adrian J. F.; Perrin, René-Xavier; Massougbodji, Achille; Deloron, Philippe; Bandeira, Antonio; Fievet, Nadine

    2011-01-01

    In areas where Plasmodium falciparum is endemic, pregnancy is associated with accumulation of infected red blood cells (RBCs) in the placenta, a condition referred to as placental malaria (PM). Infants born to PM-positive mothers are at an increased risk of malaria, which is putatively related to the transplacental passage of parasite-derived antigens, with consequent tolerization of the fetal immune system. Here we addressed the impact of PM on the regulation of neonatal T cell responses. We found that the frequency of regulatory CD25+ CD127−/low Foxp3+ CD4+ T cells was significantly decreased in neonates born to mothers with high levels of P. falciparum-induced placental inflammation, consisting mainly of primigravid mothers. However, at the individual level, the ratio between regulatory and effector (CD25+ CD127+ Foxp3−) CD4+ T cells was unaffected by PM. In addition, parasite-induced CD4+ T cell activation and production of interleukin-6 (IL-6), tumor necrosis factor alpha (TNF-α), and IL-10 were strongly reduced in neonates born to PM-positive mothers. Thus, our results show that active PM at delivery is associated with a marked suppression of P. falciparum-specific cellular neonatal immune responses, affecting secretion of both pro- and anti-inflammatory cytokines. Additionally, our results suggest that, as in adults, effector and regulatory CD4+ T cell populations are tightly coregulated in all neonates, irrespective of the maternal infection status. PMID:21518782

  15. Strong Magnetic Field Induced Changes of Gene Expression in Arabidopsis

    NASA Astrophysics Data System (ADS)

    Paul, A.-L.; Ferl, R. J.; Klingenberg, B.; Brooks, J. S.; Morgan, A. N.; Yowtak, J.; Meisel, M. W.

    2005-07-01

    We review our studies of the biological impact of magnetic field strengths of up to 30 T on transgenic arabidopsis plants engineered with a stress response gene consisting of the alcohol dehydrogenase (Adh) gene promoter driving the β-glucuronidase (GUS) gene reporter. Field strengths in excess of 15 T induce expression of the Adh/GUS transgene in the roots and leaves. Microarray analyses indicate that such field strengths have a far reaching effect on the genome. Wide spread induction of stress-related genes and transcription factors, and a depression of genes associated with cell wall metabolism are prominent examples.

  16. Tumor-specific CD4+ T cells develop cytotoxic activity and eliminate virus-induced tumor cells in the absence of regulatory T cells.

    PubMed

    Akhmetzyanova, Ilseyar; Zelinskyy, Gennadiy; Schimmer, Simone; Brandau, Sven; Altenhoff, Petra; Sparwasser, Tim; Dittmer, Ulf

    2013-02-01

    The important role of tumor-specific cytotoxic CD8(+) T cells is well defined in the immune control of the tumors, but the role of effector CD4(+) T cells is poorly understood. In the current research, we have used a murine retrovirus-induced tumor cell line of C57BL/6 mouse origin, namely FBL-3 cells, as a model to study basic mechanisms of immunological control and escape during tumor formation. This study shows that tumor-specific CD4(+) T cells are able to protect against virus-induced tumor cells. We show here that there is an expansion of tumor-specific CD4(+) T cells producing cytokines and cytotoxic molecule granzyme B (GzmB) in the early phase of tumor growth. Importantly, we demonstrate that in vivo depletion of regulatory T cells (Tregs) and CD8(+) T cells in FBL-3-bearing DEREG transgenic mice augments IL-2 and GzmB production by CD4(+) T cells and increases FV-specific CD4(+) T-cell effector and cytotoxic responses leading to the complete tumor regression. Therefore, the capacity to reject tumor acquired by tumor-reactive CD4(+) T cells largely depends on the direct suppressive activity of Tregs. We suggest that a cytotoxic CD4(+) T-cell immune response may be induced to enhance resistance against oncovirus-associated tumors.

  17. T-bet expression by Th cells promotes type 1 inflammation but is dispensable for colitis.

    PubMed

    Zimmermann, J; Kühl, A A; Weber, M; Grün, J R; Löffler, J; Haftmann, C; Riedel, R; Maschmeyer, P; Lehmann, K; Westendorf, K; Mashreghi, M-F; Löhning, M; Mack, M; Radbruch, A; Chang, H D

    2016-11-01

    The transcription factor T-bet is highly expressed by Th cells isolated from the inflamed intestine of Crohn's disease patients, and has been regarded a critical driver of murine T cell-induced colitis. However, we show here that T-bet expression by Th cells is not required for the manifestation of T-cell-induced colitis in the presence of segmented filamentous bacteria and Helicobacter hepaticus. T-bet expression by Th cells controls their survival and localization, their repertoire of chemokine and chemokine receptor expression, the accumulation of monocytes and macrophages in the inflamed colon, and their differentiation to the M1 type, i.e., type 1 inflammation. Nevertheless, T-bet-deficient Th cells efficiently induce colitis, as reflected by weight loss, diarrhea, and colon histopathology. T-bet-deficient Th cells differentiate into Th1/17 cells, able to express IFN-γ and IL-17A upon restimulation. While neutralization of IL-17A exacerbated colitis induced by wild-type or T-bet-deficient Th cells, neutralization of IFN-γ completely abolished colitis.

  18. Probiotic Bifidobacterium breve induces IL-10-producing Tr1 cells in the colon.

    PubMed

    Jeon, Seong Gyu; Kayama, Hisako; Ueda, Yoshiyasu; Takahashi, Takuya; Asahara, Takashi; Tsuji, Hirokazu; Tsuji, Noriko M; Kiyono, Hiroshi; Ma, Ji Su; Kusu, Takashi; Okumura, Ryu; Hara, Hiromitsu; Yoshida, Hiroki; Yamamoto, Masahiro; Nomoto, Koji; Takeda, Kiyoshi

    2012-01-01

    Specific intestinal microbiota has been shown to induce Foxp3(+) regulatory T cell development. However, it remains unclear how development of another regulatory T cell subset, Tr1 cells, is regulated in the intestine. Here, we analyzed the role of two probiotic strains of intestinal bacteria, Lactobacillus casei and Bifidobacterium breve in T cell development in the intestine. B. breve, but not L. casei, induced development of IL-10-producing Tr1 cells that express cMaf, IL-21, and Ahr in the large intestine. Intestinal CD103(+) dendritic cells (DCs) mediated B. breve-induced development of IL-10-producing T cells. CD103(+) DCs from Il10(-/-), Tlr2(-/-), and Myd88(-/-) mice showed defective B. breve-induced Tr1 cell development. B. breve-treated CD103(+) DCs failed to induce IL-10 production from co-cultured Il27ra(-/-) T cells. B. breve treatment of Tlr2(-/-) mice did not increase IL-10-producing T cells in the colonic lamina propria. Thus, B. breve activates intestinal CD103(+) DCs to produce IL-10 and IL-27 via the TLR2/MyD88 pathway thereby inducing IL-10-producing Tr1 cells in the large intestine. Oral B. breve administration ameliorated colitis in immunocompromised mice given naïve CD4(+) T cells from wild-type mice, but not Il10(-/-) mice. These findings demonstrate that B. breve prevents intestinal inflammation through the induction of intestinal IL-10-producing Tr1 cells.

  19. A Single HIV-1 Cluster and a Skewed Immune Homeostasis Drive the Early Spread of HIV among Resting CD4+ Cell Subsets within One Month Post-Infection

    PubMed Central

    Avettand-Fenoël, Véronique; Nembot, Georges; Mélard, Adeline; Blanc, Catherine; Lascoux-Combe, Caroline; Slama, Laurence; Allegre, Thierry; Allavena, Clotilde; Yazdanpanah, Yazdan; Duvivier, Claudine; Katlama, Christine; Goujard, Cécile; Seksik, Bao Chau Phung; Leplatois, Anne; Molina, Jean-Michel; Meyer, Laurence; Autran, Brigitte; Rouzioux, Christine

    2013-01-01

    Optimizing therapeutic strategies for an HIV cure requires better understanding the characteristics of early HIV-1 spread among resting CD4+ cells within the first month of primary HIV-1 infection (PHI). We studied the immune distribution, diversity, and inducibility of total HIV-DNA among the following cell subsets: monocytes, peripheral blood activated and resting CD4 T cells, long-lived (naive [TN] and central-memory [TCM]) and short-lived (transitional-memory [TTM] and effector-memory cells [TEM]) resting CD4+T cells from 12 acutely-infected individuals recruited at a median 36 days from infection. Cells were sorted for total HIV-DNA quantification, phylogenetic analysis and inducibility, all studied in relation to activation status and cell signaling. One month post-infection, a single CCR5-restricted viral cluster was massively distributed in all resting CD4+ subsets from 88% subjects, while one subject showed a slight diversity. High levels of total HIV-DNA were measured among TN (median 3.4 log copies/million cells), although 10-fold less (p = 0.0005) than in equally infected TCM (4.5), TTM (4.7) and TEM (4.6) cells. CD3−CD4+ monocytes harbored a low viral burden (median 2.3 log copies/million cells), unlike equally infected resting and activated CD4+ T cells (4.5 log copies/million cells). The skewed repartition of resting CD4 subsets influenced their contribution to the pool of resting infected CD4+T cells, two thirds of which consisted of short-lived TTM and TEM subsets, whereas long-lived TN and TCM subsets contributed the balance. Each resting CD4 subset produced HIV in vitro after stimulation with anti-CD3/anti-CD28+IL-2 with kinetics and magnitude varying according to subset differentiation, while IL-7 preferentially induced virus production from long-lived resting TN cells. In conclusion, within a month of infection, a clonal HIV-1 cluster is massively distributed among resting CD4 T-cell subsets with a flexible inducibility, suggesting that subset activation and skewed immune homeostasis determine the conditions of viral dissemination and early establishment of the HIV reservoir. PMID:23691172

  20. Folic acid induces cell type-specific changes in the transcriptome of breast cancer cell lines: a proof-of-concept study.

    PubMed

    Price, R Jordan; Lillycrop, Karen A; Burdge, Graham C

    2016-01-01

    The effect of folic acid (FA) on breast cancer (BC) risk is uncertain. We hypothesised that this uncertainty may be due, in part, to differential effects of FA between BC cells with different phenotypes. To test this we investigated the effect of treatment with FA concentrations within the range of unmetabolised FA reported in humans on the expression of the transcriptome of non-transformed (MCF10A) and cancerous (MCF7 and Hs578T) BC cells. The total number of transcripts altered was: MCF10A, seventy-five (seventy up-regulated); MCF7, twenty-four (fourteen up-regulated); and Hs578T, 328 (156 up-regulated). Only the cancer-associated gene TAGLN was altered by FA in all three cell lines. In MCF10A and Hs578T cells, FA treatment decreased pathways associated with apoptosis, cell death and senescence, but increased those associated with cell proliferation. The folate transporters SLC19A1, SLC46A1 and FOLR1 were differentially expressed between cell lines tested. However, the level of expression was not altered by FA treatment. These findings suggest that physiological concentrations of FA can induce cell type-specific changes in gene regulation in a manner that is consistent with proliferative phenotype. This has implications for understanding the role of FA in BC risk. In addition, these findings support the suggestion that differences in gene expression induced by FA may involve differential activities of folate transporters. Together these findings indicate the need for further studies of the effect of FA on BC.

  1. Immunosuppressive Effects of Bryoria sp. (Lichen-Forming Fungus) Extracts via Inhibition of CD8+ T-Cell Proliferation and IL-2 Production in CD4+ T Cells.

    PubMed

    Hwang, Yun-Ho; Lee, Sung-Ju; Kang, Kyung-Yun; Hur, Jae-Seoun; Yee, Sung-Tae

    2017-06-28

    Lichen-forming fungi are known to have various biological activities, such as antioxidant, antimicrobial, antitumor, antiviral, anti-inflammation, and anti proliferative effects. However, the immunosuppressive effects of Bryoria sp. extract (BSE) have not previously been investigated. In this study, the inhibitory activity of BSE on the proliferation of CD8 + T cells and the mixed lymphocytes reaction (MLR) was evaluated in vitro. BSE was non-toxic in spleen cells and suppressed the growth of splenocytes induced by anti-CD3. The suppressed cell population in spleen cells consisted of CD8 + T cells and their proliferation was inhibited by the treatment with BSE. This extract significantly suppressed the IL-2 associated with T cell growth and IFN-γ as the CD8 + T cell marker. Furthermore, BSE reduced the expression of the IL-2 receptor alpha chain (IL-2Rα) on CD8 + T cells and CD86 on dendritic cells by acting as antigen-presenting cells. Finally, the MLR produced by the co-culture of C57BL/6 and MMC-treated BALB/c was suppressed by BSE. IL-2, IFN-γ, and CD69 on CD8 + T cells in MLR condition were inhibited by BSE. These results indicate that BSE inhibits the MLR via the suppression of IL-2Rα expression in CD8 + T cells. BSE has the potential to be developed as an anti-immunosuppression agent for organ transplants.

  2. CD22 Promotes B-1b Cell Responses to T Cell-Independent Type 2 Antigens.

    PubMed

    Haas, Karen M; Johnson, Kristen L; Phipps, James P; Do, Cardinal

    2018-03-01

    CD22 (Siglec-2) is a critical regulator of B cell activation and survival. CD22 -/- mice generate significantly impaired Ab responses to T cell-independent type 2 (TI-2) Ags, including haptenated Ficoll and pneumococcal polysaccharides, Ags that elicit poor T cell help and activate BCR signaling via multivalent epitope crosslinking. This has been proposed to be due to impaired marginal zone (MZ) B cell development/maintenance in CD22 -/- mice. However, mice expressing a mutant form of CD22 unable to bind sialic acid ligands generated normal TI-2 Ab responses, despite significantly reduced MZ B cells. Moreover, mice treated with CD22 ligand-binding blocking mAbs, which deplete MZ B cells, had little effect on TI-2 Ab responses. We therefore investigated the effects of CD22 deficiency on B-1b cells, an innate-like B cell population that plays a key role in TI-2 Ab responses. B-1b cells from CD22 -/- mice had impaired BCR-induced proliferation and significantly increased intracellular Ca 2+ concentration responses following BCR crosslinking. Ag-specific B-1b cell expansion and plasmablast differentiation following TI-2 Ag immunization was significantly impaired in CD22 -/- mice, consistent with reduced TI-2 Ab responses. We generated CD22 -/- mice with reduced CD19 levels (CD22 -/- CD19 +/- ) to test the hypothesis that augmented B-1b cell BCR signaling in CD22 -/- mice contributes to impaired TI-2 Ab responses. BCR-induced proliferation and intracellular Ca 2+ concentration responses were normalized in CD22 -/- CD19 +/- B-1b cells. Consistent with this, TI-2 Ag-specific B-1b cell expansion, plasmablast differentiation, survival, and Ab responses were rescued in CD22 -/- CD19 +/- mice. Thus, CD22 plays a critical role in regulating TI-2 Ab responses through regulating B-1b cell signaling thresholds. Copyright © 2018 by The American Association of Immunologists, Inc.

  3. Tumor dormancy and cell signaling: anti-mu-induced apoptosis in human B-lymphoma cells is not caused by an APO-1-APO-1 ligand interaction.

    PubMed Central

    Racila, E; Hsueh, R; Marches, R; Tucker, T F; Krammer, P H; Scheuermann, R H; Uhr, J W

    1996-01-01

    Signal transduction initiated by crosslinking of antigen-specific receptors on T- and B-lymphoma cells induces apoptosis. In T-lymphoma cells, such crosslinking results in upregulation of the APO-1 ligand, which then interacts with induced or constitutively expressed APO-1, thereby triggering apoptosis. Here we show that crosslinking the membrane immunoglobulin on human lymphoma cells (Daudi) (that constitutively express APO-1) does not induce synthesis of APO-1 ligand. Further, a noncytotoxic fragment of anti-APO-1 antibody that blocks T-cell-receptor-mediated apoptosis in T-lymphoma cells does not block anti-mu-induced apoptosis. Hence, in B-lymphoma cells, apoptosis induced by signaling via membrane IgM is not mediated by the APO-1 ligand. Images Fig. 2 Fig. 3 PMID:8700902

  4. Inability to induce consistent T-cell responses recognizing conserved regions within HIIV-1 antigens: a potential mechanism for lack of vaccine efficacy in the step study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Korber, Bette; Szinger, James

    2009-01-01

    T cell based vaccines are based upon the induction of CD8+ T cell memory responses that would be effective in inhibiting infection and subsequent replication of an infecting HIV-1 strain, a process that requires a high probability of matching the epitope induced by vaccination with the infecting viral strain. We compared the frequency and specificity of the CTL epitopes elicited by the replication defective AdS gag/pol/nef vaccine used in the STEP trial with the likelihood of encountering those epitopes among recently sequenced Clade B isolates of HIV-1. On average vaccination elicited only one epitope per gene. Importantly, the highly conservedmore » epitopes in gag, pol, and nef (> 80% of strains in the current collection of the Los Alamos database [www.hiv.lanl.gov]) were rarely elicited by vaccination. Moreover there was a statistically significant skewing of the T cell response to relative variable epitopes of each gene; only 20% of persons possessed > 3 T cell responses to epitopes likely to be found in circulating strains in the CladeB populations in which the Step trial was conducted. This inability to elicit T cell responses likely to be found in circulating viral strains is a likely factor in the lack of efficacy of the vaccine utilized in the STEP trial. Modeling of the epitope specific responses elicited by vaccination, we project that a median of 8-10 CD8+ T cell epitopes are required to provide >80% likelihood of eliciting at least 3 CD8+ T cell epitopes that would be found on a circulating population of viruses. Development of vaccine regimens which elicit either a greater breadth of responses or elicit responses to conserved regions of the HIV-1 genome are needed to fully evaluate the concept of whether induction of T cell immunity can alter HIV-1 in vivo.« less

  5. Suppression of T cell-induced osteoclast formation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karieb, Sahar; Fox, Simon W., E-mail: Simon.fox@plymouth.ac.uk

    2013-07-12

    Highlights: •Genistein and coumestrol prevent activated T cell induced osteoclast formation. •Anti-TNF neutralising antibodies prevent the pro-osteoclastic effect of activated T cells. •Phytoestrogens inhibit T cell derived TNF alpha and inflammatory cytokine production. •Phytoestrogens have a broader range of anti-osteoclastic actions than other anti-resorptives. -- Abstract: Inhibition of T cell derived cytokine production could help suppress osteoclast differentiation in inflammatory skeletal disorders. Bisphosphonates are typically prescribed to prevent inflammatory bone loss but are not tolerated by all patients and are associated with an increased risk of osteonecrosis of the jaw. In light of this other anti-resorptives such as phytoestrogens aremore » being considered. However the effect of phytoestrogens on T cell-induced osteoclast formation is unclear. The effect of genistein and coumestrol on activated T cell-induced osteoclastogenesis and cytokine production was therefore examined. Concentrations of genistein and coumestrol (10{sup −7} M) previously shown to directly inhibit osteoclast formation also suppressed the formation of TRAP positive osteoclast induced by con A activated T cells, which was dependent on inhibition of T cell derived TNF-α. While both reduced osteoclast formation their mechanism of action differed. The anti-osteoclastic effect of coumestrol was associated with a dual effect on con A induced T cell proliferation and activation; 10{sup −7} M coumestrol significantly reducing T cell number (0.36) and TNF-α (0.47), IL-1β (0.23) and IL-6 (0.35) expression, whereas genistein (10{sup −7} M) had no effect on T cell number but a more pronounced effect on T cell differentiation reducing expression of TNF-α (0.49), IL-1β (0.52), IL-6 (0.71) and RANKL (0.71). Phytoestrogens therefore prevent the pro-osteoclastic action of T cells suggesting they may have a role in the control of inflammatory bone loss.« less

  6. ML1419c peptide immunization induces Mycobacterium leprae-specific HLA-A*0201-restricted CTL in vivo with potential to kill live mycobacteria.

    PubMed

    Geluk, Annemieke; van den Eeden, Susan J F; Dijkman, Karin; Wilson, Louis; Kim, Hee Jin; Franken, Kees L M C; Spencer, John S; Pessolani, Maria C V; Pereira, Geraldo M B; Ottenhoff, Tom H M

    2011-08-01

    MHC class I-restricted CD8(+) T cells play an important role in protective immunity against mycobacteria. Previously, we showed that p113-121, derived from Mycobacterium leprae protein ML1419c, induced significant IFN-γ production by CD8(+) T cells in 90% of paucibacillary leprosy patients and in 80% of multibacillary patients' contacts, demonstrating induction of M. leprae-specific CD8(+) T cell immunity. In this work, we studied the in vivo role and functional profile of ML1419c p113-121-induced T cells in HLA-A*0201 transgenic mice. Immunization with 9mer or 30mer covering the p113-121 sequence combined with TLR9 agonist CpG induced HLA-A*0201-restricted, M. leprae-specific CD8(+) T cells as visualized by p113-121/HLA-A*0201 tetramers. Most CD8(+) T cells produced IFN-γ, but distinct IFN-γ(+)/TNF-α(+) populations were detected simultaneously with significant secretion of CXCL10/IFN-γ-induced protein 10, CXCL9/MIG, and VEGF. Strikingly, peptide immunization also induced high ML1419c-specific IgG levels, strongly suggesting that peptide-specific CD8(+) T cells provide help to B cells in vivo, as CD4(+) T cells were undetectable. An additional important characteristic of p113-121-specific CD8(+) T cells was their capacity for in vivo killing of p113-121-labeled, HLA-A*0201(+) splenocytes. The cytotoxic function of p113-121/HLA-A*0201-specific CD8(+) T cells extended into direct killing of splenocytes infected with live Mycobacterium smegmatis expressing ML1419c: both 9mer and 30mer induced CD8(+) T cells that reduced the number of ML1419c-expressing mycobacteria by 95%, whereas no reduction occurred using wild-type M. smegmatis. These data, combined with previous observations in Brazilian cohorts, show that ML1419c p113-121 induces potent CD8(+) T cells that provide protective immunity against M. leprae and B cell help for induction of specific IgG, suggesting its potential use in diagnostics and as a subunit (vaccine) for M. leprae infection.

  7. Reactive oxygen species-dependent necroptosis in Jurkat T cells induced by pathogenic free-living Naegleria fowleri.

    PubMed

    Song, K-J; Jang, Y S; Lee, Y A; Kim, K A; Lee, S K; Shin, M H

    2011-07-01

    Naegleria fowleri, a free-living amoeba, is the causative pathogen of primary amoebic meningoencephalitis in humans and experimental mice. N. fowleri is capable of destroying tissues and host cells through lytic necrosis. However, the mechanism by which N. fowleri induces host cell death is unknown. Electron microscopy indicated that incubation of Jurkat T cells with N. fowleri trophozoites induced necrotic morphology of the Jurkat T cells. N. fowleri also induced cytoskeletal protein cleavage, extensive poly (ADP-ribose) polymerase hydrolysis and lactate dehydrogenase (LDH) release. Although no activation of caspase-3 was observed in Jurkat T cells co-incubated with amoebae, intracellular reactive oxygen species (ROS) were strongly generated by NADPH oxidase (NOX). Pretreating cells with necroptosis inhibitor necrostatin-1 or NOX inhibitor diphenyleneiodonium chloride (DPI) strongly inhibited amoeba-induced ROS generation and Jurkat cell death, whereas pan-caspase inhibitor z-VAD-fmk did not. N. fowleri-derived secretory products (NfSP) strongly induced intracellular ROS generation and cell death. Necroptotic effects of NfSP were effectively inhibited by pretreating NfSP with proteinase K. Moreover, NfSP-induced LDH release and intracellular ROS accumulation were inhibited by pretreating Jurkat T cells with DPI or necrostatin-1. These results suggest that N. fowleri induces ROS-dependent necroptosis in Jurkat T cells. © 2011 Blackwell Publishing Ltd.

  8. Induction of Unconventional T Cells by a Mutant Mycobacterium bovis BCG Strain Formulated in Cationic Liposomes Correlates with Protection against Mycobacterium tuberculosis Infections of Immunocompromised Mice

    PubMed Central

    Yabe, Idalia; Morris, Sheldon; Cowley, Siobhan

    2016-01-01

    Earlier studies aimed at defining protective immunity induced by Mycobacterium bovis BCG immunization have largely focused on the induction of antituberculosis CD4+ and CD8+ T cell responses. Here we describe a vaccine consisting of a BCGΔmmaA4 deletion mutant formulated in dimethyl dioctadecyl-ammonium bromide (DDA) with d-(+)-trehalose 6,6′-dibehenate (TDB) (DDA/TDB) adjuvant (A4/Adj) that protected TCRδ−/− mice depleted of CD4+, CD8+, and NK1.1+ T cells against an aerosol challenge with M. tuberculosis. These mice were significantly protected relative to mice immunized with a nonadjuvanted BCGΔmmaA4 (BCG-A4) mutant and nonvaccinated controls at 2 months and 9 months postvaccination. In the absence of all T cells following treatment with anti-Thy1.2 antibody, the immunized mice lost the ability to control the infection. These results indicate that an unconventional T cell population was mediating protection in the absence of CD4+, CD8+, NK1.1+, and TCRγδ T cells and could exhibit memory. Focusing on CD4− CD8− double-negative (DN) T cells, we found that these cells accumulated in the lungs postchallenge significantly more in A4/Adj-immunized mice and induced significantly greater frequencies of pulmonary gamma interferon (IFN-γ)-producing cells than were seen in the nonvaccinated or nonadjuvanted BCG control groups. Moreover, pulmonary DN T cells from the A4/Adj group exhibited significantly higher IFN-γ integrated median fluorescence intensity (iMFI) values than were seen in the control groups. We also showed that enriched DN T cells from mice immunized with A4/Adj could control mycobacterial growth in vitro significantly better than naive whole-spleen cells. These results suggest that formulating BCG in DDA/TDB adjuvant confers superior protection in immunocompromised mice and likely involves the induction of long-lived memory DN T cells. PMID:27226281

  9. ZnT-1 enhances the activity and surface expression of T-type calcium channels through activation of Ras-ERK signaling.

    PubMed

    Mor, Merav; Beharier, Ofer; Levy, Shiri; Kahn, Joy; Dror, Shani; Blumenthal, Daniel; Gheber, Levi A; Peretz, Asher; Katz, Amos; Moran, Arie; Etzion, Yoram

    2012-07-15

    Zinc transporter-1 (ZnT-1) is a putative zinc transporter that confers cellular resistance from zinc toxicity. In addition, ZnT-1 has important regulatory functions, including inhibition of L-type calcium channels and activation of Raf-1 kinase. Here we studied the effects of ZnT-1 on the expression and function of T-type calcium channels. In Xenopus oocytes expressing voltage-gated calcium channel (CaV) 3.1 or CaV3.2, ZnT-1 enhanced the low-threshold calcium currents (I(caT)) to 182 ± 15 and 167.95 ± 9.27% of control, respectively (P < 0.005 for both channels). As expected, ZnT-1 also enhanced ERK phosphorylation. Coexpression of ZnT-1 and nonactive Raf-1 blocked the ZnT-1-mediated ERK phosphorylation and abolished the ZnT-1-induced augmentation of I(caT). In mammalian cells (Chinese hamster ovary), coexpression of CaV3.1 and ZnT-1 increased the I(caT) to 166.37 ± 6.37% compared with cells expressing CaV3.1 alone (P < 0.01). Interestingly, surface expression measurements using biotinylation or total internal reflection fluorescence microscopy indicated marked ZnT-1-induced enhancement of CaV3.1 surface expression. The MEK inhibitor PD-98059 abolished the ZnT-1-induced augmentation of surface expression of CaV3.1. In cultured murine cardiomyocytes (HL-1 cells), transient exposure to zinc, leading to enhanced ZnT-1 expression, also enhanced the surface expression of endogenous CaV3.1 channels. Consistently, in these cells, endothelin-1, a potent activator of Ras-ERK signaling, enhanced the surface expression of CaV3.1 channels in a PD-98059-sensitive manner. Our findings indicate that ZnT-1 enhances the activity of CaV3.1 and CaV3.2 through activation of Ras-ERK signaling. The augmentation of CaV3.1 currents by Ras-ERK activation is associated with enhanced trafficking of the channel to the plasma membrane.

  10. [Proliferation and IFN-gamma secretion of autologous T lymphocytes stimulated by myeloid leukemia cells induced with rhGM-CSF and rhIL-4].

    PubMed

    Xie, Yan-Hui; Chen, Qin-Fen; Xie, Yi; Xie, Hong

    2002-12-01

    To observe the proliferation of T lymphocytes stimulated by CML and AML cells which were induced by rhGM-CSF and rhIL-4, and the secretion of IFN-gamma from proliferated T lymphocytes, the expression of CD80, CD86 and HLA-DR on CML and AML cells induced by GM-CSF and IL-4 was assayed by flow cytometry in vitro. Then one-way mixed lymphocyte reaction was carried out, with induced leukemia cells as stimulating cells and auto-T lymphocytes as reactive cells. The secretion of IFN-gamma from T lymphocytes was determined by double antibody sandwich ELISA. The results showed that GM-CSF and IL-4 significantly upregulated the expression of CD80, CD86 and HLA-DR on CML cells and CD80 and CD86 on AML cells, which could stimulate the T lymphocyte proliferation and high secretion of IFN-gamma (in CML group) of autologous T lymphocytes. It is concluded that the CML and AML cells induced by GM-CSF and IL-4 have the ability to present tumor specific antigen to auto-T lymphocyte.

  11. Detecting T-cell reactivity to whole cell vaccines

    PubMed Central

    Brusic, Ana; Hainz, Ursula; Wadleigh, Martha; Neuberg, Donna; Su, Mei; Canning, Christine M.; DeAngelo, Daniel J.; Stone, Richard M.; Lee, Jeng-Shin; Mulligan, Richard C.; Ritz, Jerome; Dranoff, Glenn; Sasada, Tetsuro; Wu, Catherine J.

    2012-01-01

    BCR-ABL+ K562 cells hold clinical promise as a component of cancer vaccines, either as bystander cells genetically modified to express immunostimulatory molecules, or as a source of leukemia antigens. To develop a method for detecting T-cell reactivity against K562 cell-derived antigens in patients, we exploited the dendritic cell (DC)-mediated cross-presentation of proteins generated from apoptotic cells. We used UVB irradiation to consistently induce apoptosis of K562 cells, which were then fed to autologous DCs. These DCs were used to both stimulate and detect antigen-specific CD8+ T-cell reactivity. As proof-of-concept, we used cross-presented apoptotic influenza matrix protein-expressing K562 cells to elicit reactivity from matrix protein-reactive T cells. Likewise, we used this assay to detect increased anti-CML antigen T-cell reactivity in CML patients that attained long-lasting clinical remissions following immunotherapy (donor lymphocyte infusion), as well as in 2 of 3 CML patients vaccinated with lethally irradiated K562 cells that were modified to secrete high levels of granulocyte macrophage colony-stimulating factor (GM-CSF). This methodology can be readily adapted to examine the effects of other whole tumor cell-based vaccines, a scenario in which the precise tumor antigens that stimulate immune responses are unknown. PMID:23170257

  12. Reactive oxygen species mediate N-(4-hydroxyphenyl)retinamide-induced cell death in malignant T cells and are inhibited by the HTLV-I oncoprotein Tax.

    PubMed

    Darwiche, N; Abou-Lteif, G; Bazarbachi, A

    2007-02-01

    N-(4-hydroxyphenyl)retinamide (HPR) is a synthetic retinoid that inhibits growth of many human tumor cells, including those resistant to natural retinoids. HPR is an effective chemopreventive agent for prostate, cervix, breast, bladder, skin and lung cancers, and has shown promise for the treatment of neuroblastomas. We have previously shown that HPR inhibits proliferation and induces apoptosis of human T-cell lymphotropic virus type I (HTLV-I)-associated adult T-cell leukemia (ATL) and HTLV-I-negative malignant T cells, whereas no effect is observed on normal lymphocytes. In this report, we identified HPR-induced reactive oxygen species (ROS) generation as the key mediator of cell cycle arrest and apoptosis of malignant T cells. HPR treatment of HTLV-I-negative malignant T cells was associated with a rapid and progressive ROS accumulation. Pre-treatment with the antioxidants vitamin C and dithiothreitol inhibited ROS generation, prevented HPR-induced ceramide accumulation, cell cycle arrest, cytochrome c release, caspase-activation and apoptosis. Therefore, anti-oxidants protected malignant T cells from HPR-induced growth inhibition. The expression of the HTLV-I oncoprotein Tax abrogated HPR-induced ROS accumulation in HTLV-I-infected cells, which explains their lower sensitivity to HPR. Defining the mechanism of free radical induction by HPR may support a potential therapeutic role for this synthetic retinoid in ATL and HTLV-I-negative T-cell lymphomas.

  13. A cluster of coregulated genes determines TGF-β–induced regulatory T-cell (Treg) dysfunction in NOD mice

    PubMed Central

    D'Alise, Anna Morena; Ergun, Ayla; Hill, Jonathan A.; Mathis, Diane; Benoist, Christophe

    2011-01-01

    Foxp3+ regulatory T cells (Tregs) originate in the thymus, but the Treg phenotype can also be induced in peripheral lymphoid organs or in vitro by stimulation of conventional CD4+ T cells with IL-2 and TGF-β. There have been divergent reports on the suppressive capacity of these TGF-Treg cells. We find that TGF-Tregs derived from diabetes-prone NOD mice, although expressing normal Foxp3 levels, are uniquely defective in suppressive activity, whereas TGF-Tregs from control strains (B6g7) or ex vivo Tregs from NOD mice all function normally. Most Treg-typical transcripts were shared by NOD or B6g7 TGF-Tregs, except for a small group of differentially expressed genes, including genes relevant for suppressive activity (Lrrc32, Ctla4, and Cd73). Many of these transcripts form a coregulated cluster in a broader analysis of T-cell differentiation. The defect does not map to idd3 or idd5 regions. Whereas Treg cells from NOD mice are normal in spleen and lymph nodes, the NOD defect is observed in locations that have been tied to pathogenesis of diabetes (small intestine lamina propria and pancreatic lymph node). Thus, a genetic defect uniquely affects a specific Treg subpopulation in NOD mice, in a manner consistent with a role in determining diabetes susceptibility. PMID:21543717

  14. A cluster of coregulated genes determines TGF-beta-induced regulatory T-cell (Treg) dysfunction in NOD mice.

    PubMed

    D'Alise, Anna Morena; Ergun, Ayla; Hill, Jonathan A; Mathis, Diane; Benoist, Christophe

    2011-05-24

    Foxp3(+) regulatory T cells (Tregs) originate in the thymus, but the Treg phenotype can also be induced in peripheral lymphoid organs or in vitro by stimulation of conventional CD4(+) T cells with IL-2 and TGF-β. There have been divergent reports on the suppressive capacity of these TGF-Treg cells. We find that TGF-Tregs derived from diabetes-prone NOD mice, although expressing normal Foxp3 levels, are uniquely defective in suppressive activity, whereas TGF-Tregs from control strains (B6g7) or ex vivo Tregs from NOD mice all function normally. Most Treg-typical transcripts were shared by NOD or B6g7 TGF-Tregs, except for a small group of differentially expressed genes, including genes relevant for suppressive activity (Lrrc32, Ctla4, and Cd73). Many of these transcripts form a coregulated cluster in a broader analysis of T-cell differentiation. The defect does not map to idd3 or idd5 regions. Whereas Treg cells from NOD mice are normal in spleen and lymph nodes, the NOD defect is observed in locations that have been tied to pathogenesis of diabetes (small intestine lamina propria and pancreatic lymph node). Thus, a genetic defect uniquely affects a specific Treg subpopulation in NOD mice, in a manner consistent with a role in determining diabetes susceptibility.

  15. Weak vaccinia virus-induced NK cell regulation of CD4 T cells is associated with reduced NK cell differentiation and cytolytic activity.

    PubMed

    Hatfield, Steven D; Daniels, Keith A; O'Donnell, Carey L; Waggoner, Stephen N; Welsh, Raymond M

    2018-06-01

    Natural killer (NK) cells control antiviral adaptive immune responses in mice during some virus infections, but the universality of this phenomenon remains unknown. Lymphocytic choriomeningitis virus (LCMV) infection of mice triggered potent cytotoxic activity of NK cells (NK LCMV ) against activated CD4 T cells, tumor cells, and allogeneic lymphocytes. In contrast, NK cells activated by vaccinia virus (VACV) infection (NK VACV ) exhibited weaker cytolytic activity against each of these target cells. Relative to NK LCMV cells, NK VACV cells exhibited a more immature (CD11b - CD27 + ) phenotype, and lower expression levels of the activation marker CD69, cytotoxic effector molecules (perforin, granzyme B), and the transcription factor IRF4. NK VACV cells expressed higher levels of the inhibitory molecule NKG2A than NK LCMV cells. Consistent with this apparent lethargy, NK VACV cells only weakly constrained VACV-specific CD4 T-cell responses. This suggests that NK cell regulation of adaptive immunity, while universal, may be limited with viruses that poorly activate NK cells. Published by Elsevier Inc.

  16. Yersinia enterocolitica-Induced Interleukin-8 Secretion by Human Intestinal Epithelial Cells Depends on Cell Differentiation

    PubMed Central

    Schulte, Ralf; Autenrieth, Ingo B.

    1998-01-01

    In response to bacterial entry epithelial cells up-regulate expression and secretion of various proinflammatory cytokines, including interleukin-8 (IL-8). We studied Yersinia enterocolitica O:8-induced IL-8 secretion by intestinal epithelial cells as a function of cell differentiation. For this purpose, human T84 intestinal epithelial cells were grown on permeable supports, which led to the formation of tight monolayers of polarized intestinal epithelial cells. To analyze IL-8 secretion as a function of cell differentiation, T84 monolayers were infected from the apical or basolateral side at different stages of differentiation. Both virulent (plasmid-carrying) and nonvirulent (plasmid-cured) Y. enterocolitica strains invaded nondifferentiated T84 cells from the apical side. Yersinia invasion into T84 cells was followed by secretion of IL-8. After polarized differentiation of T84 cells Y. enterocolitica was no longer able to invade from the apical side or to induce IL-8 secretion by T84 cells. However, Y. enterocolitica invaded and induced IL-8 secretion by polarized T84 cells after infection from the basolateral side. Basolateral invasion required the presence of the Yersinia invasion locus, inv, suggesting β1 integrin-mediated cell invasion. After basolateral infection, Yersinia-induced IL-8 secretion was not strictly dependent on cell invasion. Thus, although the plasmid-carrying Y. enterocolitica strain did not significantly invade T84 cells, it induced significant IL-8 secretion. Taken together, these data show that Yersinia-triggered IL-8 secretion by intestinal epithelial cells depends on cell differentiation and might be induced by invasion as well as by basolateral adhesion, suggesting that invasion is not essential for triggering IL-8 production. Whether IL-8 secretion is involved in the pathogenesis of Yersinia-induced abscess formation in Peyer’s patch tissue remains to be shown. PMID:9488416

  17. Critical role of SAP in progression and reactivation but not maintenance of T cell-dependent humoral immunity.

    PubMed

    Zhong, Ming-Chao; Veillette, André

    2013-03-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is a small adaptor molecule mutated in X-linked lymphoproliferative disease, a human immunodeficiency. SAP plays a critical role in the initiation of T cell-dependent B cell responses leading to germinal center reaction, the production of high-affinity antibodies, and B cell memory. However, whether SAP has a role in these responses beyond their initiation is not known. It is important to address this matter not only for mechanistic reasons but also because blockade of the SAP pathway is being contemplated as a means to treat autoimmune diseases in humans. Using an inducibly SAP deficient mouse, we found that SAP was required not only for the initiation but also for the progression of primary T cell-driven B cell responses to haptens. It was also necessary for the reactivation of T cell-dependent B cell immunity during secondary immune responses. These activities consistently correlated with the requirement of SAP for full expression of the lineage commitment factor Bcl-6 in follicular T helper (T(FH)) cells. However, once memory B cells and long-lived antibody-secreting cells were established, SAP became dispensable for maintaining T cell-dependent B cell responses. Thus, SAP is pivotal for nearly all phases, but not for maintenance, of T cell-driven B cell humoral immunity. These findings may have implications for the treatment of immune disorders by targeting the SAP pathway.

  18. The cathepsin B inhibitor, z-FA-CMK is toxic and readily induced cell death in human T lymphocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liow, K.Y.; Chow, S.C., E-mail: chow.sek.chuen@monash.edu

    The cathepsin B inhibitor, benzyloxycarbonyl-phenylalanine-alanine-chloromethylketone (z-FA-CMK) was found to be toxic and readily induced cell death in the human T cell line, Jurkat, whereas two other analogs benzyloxycarbonyl-phenylalanine-alanine-fluoromethylketone (z-FA-FMK) and benzyloxycarbonyl-phenylalanine-alanine-diazomethylketone (z-FA-DMK) were not toxic. The toxicity of z-FA-CMK requires not only the CMK group, but also the presence of alanine in the P1 position and the benzyloxycarbonyl group at the N-terminal. Dose–response studies showed that lower concentrations of z-FA-CMK induced apoptosis in Jurkat T cells whereas higher concentrations induced necrosis. In z-FA-CMK-induced apoptosis, both initiator caspases (-8 and -9) and effector caspases (-3, -6 and -7) were processed tomore » their respective subunits in Jurkat T cells. However, only the pro-form of the initiator caspases were reduced in z-FA-CMK-induced necrosis and no respective subunits were apparent. The caspase inihibitor benzyloxycarbonyl-valine-alanine-aspartic acid-(O-methyl)-fluoromehylketone (z-VAD-FMK) inhibits apoptosis and caspase processing in Jurkat T cells treated with low concentration of z-FA-CMK but has no effect on z-FA-CMK-induced necrosis and the loss of initiator caspases. This suggests that the loss of initiator caspases in Jurkat T cells during z-FA-CMK-induced necrosis is not a caspase-dependent process. Taken together, we have demonstrated that z-FA-CMK is toxic to Jurkat T cells and induces apoptosis at low concentrations, while at higher concentrations the cells die of necrosis. - Highlights: • z-FA-CMK is toxic and induce cell death in the human T cells. • z-FA-CMK toxicity requires the CMK group, alanine and the benzyloxycarbonyl group. • z-FA-CMK induced apoptosis at low concentration and necrosis at high concentration.« less

  19. pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana.

    PubMed

    Tsutsui, Hiroki; Higashiyama, Tetsuya

    2017-01-01

    The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

  20. Plasmacytoid Dendritic Cells Suppress HIV-1 Replication but Contribute to HIV-1 Induced Immunopathogenesis in Humanized Mice

    PubMed Central

    Li, Guangming; Cheng, Menglan; Nunoya, Jun-ichi; Cheng, Liang; Guo, Haitao; Yu, Haisheng; Liu, Yong-jun; Su, Lishan; Zhang, Liguo

    2014-01-01

    The role of plasmacytoid dendritic cells (pDC) in human immunodeficiency virus type 1 (HIV-1) infection and pathogenesis remains unclear. HIV-1 infection in the humanized mouse model leads to persistent HIV-1 infection and immunopathogenesis, including type I interferons (IFN-I) induction, immune-activation and depletion of human leukocytes, including CD4 T cells. We developed a monoclonal antibody that specifically depletes human pDC in all lymphoid organs in humanized mice. When pDC were depleted prior to HIV-1 infection, the induction of IFN-I and interferon-stimulated genes (ISGs) were abolished during acute HIV-1 infection with either a highly pathogenic CCR5/CXCR4-dual tropic HIV-1 or a standard CCR5-tropic HIV-1 isolate. Consistent with the anti-viral role of IFN-I, HIV-1 replication was significantly up-regulated in pDC-depleted mice. Interestingly, the cell death induced by the highly pathogenic HIV-1 isolate was severely reduced in pDC-depleted mice. During chronic HIV-1 infection, depletion of pDC also severely reduced the induction of IFN-I and ISGs, associated with elevated HIV-1 replication. Surprisingly, HIV-1 induced depletion of human immune cells including T cells in lymphoid organs, but not the blood, was reduced in spite of the increased viral replication. The increased cell number in lymphoid organs was associated with a reduced level of HIV-induced cell death in human leukocytes including CD4 T cells. We conclude that pDC play opposing roles in suppressing HIV-1 replication and in promoting HIV-1 induced immunopathogenesis. These findings suggest that pDC-depletion and IFN-I blockade will provide novel strategies for treating those HIV-1 immune non-responsive patients with persistent immune activation despite effective anti-retrovirus treatment. PMID:25077616

  1. Inhibition of phosphoantigen-mediated gammadelta T-cell proliferation by CD4+ CD25+ FoxP3+ regulatory T cells.

    PubMed

    Kunzmann, Volker; Kimmel, Brigitte; Herrmann, Thomas; Einsele, Hermann; Wilhelm, Martin

    2009-02-01

    Tumour growth promotes the expansion of CD4(+) CD25(+) FoxP3(+) regulatory T cells (Tregs) which suppress various arms of immune responses and might therefore contribute to tumour immunosurveillance. In this study, we found an inverse correlation between circulating Treg frequencies and phosphoantigen-induced gammadelta T-cell proliferation in cancer patients, which prompted us to address the role of Tregs in controlling the gammadelta T-cell arm of innate immune responses. In vitro, human Treg-peripheral blood mononuclear cell (PBMC) co-cultures strongly inhibited phosphoantigen-induced proliferation of gammadelta T cells and depletion of Tregs restored the impaired phosphoantigen-induced gammadelta T-cell proliferation of cancer patients. Tregs did not suppress other effector functions of gammadelta T cells such as cytokine production or cytotoxicity. Our experiments indicate that Tregs do not mediate their suppressive activity via a cell-cell contact-dependent mechanism, but rather secrete a soluble non-proteinaceous factor, which is independent of known soluble factors interacting with amino acid depletion (e.g. arginase-diminished arginine and indolamine 2,3-dioxygenase-diminished tryptophan) or nitric oxide (NO) production. However, the proliferative activity of alphabeta T cells was not affected by this cell-cell contact-independent suppressive activity induced by Tregs. In conclusion, these findings indicate a potential new mechanism by which Tregs can specifically suppress gammadelta T cells and highlight the strategy of combining Treg inhibition with subsequent gammadelta T-cell activation to enhance gammadelta T cell-mediated immunotherapy.

  2. Human Atopic Dermatitis Skin-derived T Cells can Induce a Reaction in Mouse Keratinocytes in vivo.

    PubMed

    Martel, B C; Blom, L; Dyring-Andersen, B; Skov, L; Thestrup-Pedersen, K; Skov, S; Skak, K; Poulsen, L K

    2015-08-01

    In atopic dermatitis (AD), the inflammatory response between skin-infiltrating T cells and keratinocytes is fundamental to the development of chronic lesional eczema. The aim of this study was to investigate whether skin-derived T cells from AD patients could induce an inflammatory response in mice through keratinocyte activation and consequently cause the development of eczematous lesions. Punch biopsies of the lesional skin from AD patients were used to establish skin-derived T cell cultures, which were transferred to NOD.Cg-Prkd(scid) Il2rg(tm1Sug) /JicTac (NOG) mice. We found that the subcutaneous injection of the human AD skin-derived T cells resulted in the migration of the human T cells from subcutis to the papillary dermis followed by the development of erythema and oedema in the mouse skin. Furthermore, the human T cells induced a transient proliferative response in the mouse keratinocytes shown as increased numbers of Ki-67(+) keratinocytes and increased epidermal thickness. Out of six established AD skin-derived T cell cultures, two were superior at inducing a skin reaction in the mice, and these cultures were found to contain >10% CCR10(+) T cells compared to <2% for the other cultures. In comparison, blood-derived in vitro-differentiated Th2 cells only induced a weak response in a few of the mice. Thus, we conclude that human AD skin-derived T cells can induce a reaction in the mouse skin through the induction of a proliferative response in the mouse keratinocytes. © 2015 The Foundation for the Scandinavian Journal of Immunology.

  3. IL-21 sustains CD28 expression on IL-15-activated human naive CD8+ T cells.

    PubMed

    Alves, Nuno L; Arosa, Fernando A; van Lier, René A W

    2005-07-15

    Human naive CD8+ T cells are able to respond in an Ag-independent manner to IL-7 and IL-15. Whereas IL-7 largely maintains CD8+ T cells in a naive phenotype, IL-15 drives these cells to an effector phenotype characterized, among other features, by down-regulation of the costimulatory molecule CD28. We evaluated the influence of the CD4+ Th cell-derived common gamma-chain cytokine IL-21 on cytokine-induced naive CD8+ T cell activation. Stimulation with IL-21 did not induce division and only slightly increased IL-15-induced proliferation of naive CD8+ T cells. Strikingly, however, IL-15-induced down-modulation of CD28 was completely prevented by IL-21 at the protein and transcriptional level. Subsequent stimulation via combined TCR/CD3 and CD28 triggering led to a markedly higher production of IL-2 and IFN-gamma in IL-15/IL-21-stimulated cells compared with IL-15-stimulated T cells. Our data show that IL-21 modulates the phenotype of naive CD8+ T cells that have undergone IL-15 induced homeostatic proliferation and preserves their responsiveness to CD28 ligands.

  4. Peanut-specific type 1 regulatory T cells induced in vitro from allergic subjects are functionally impaired.

    PubMed

    Pellerin, Laurence; Jenks, Jennifer Anne; Chinthrajah, Sharon; Dominguez, Tina; Block, Whitney; Zhou, Xiaoying; Noshirvan, Arram; Gregori, Silvia; Roncarolo, Maria Grazia; Nadeau, Kari Christine; Bacchetta, Rosa

    2018-01-01

    Peanut allergy (PA) is a life-threatening condition that lacks regulator-approved treatment. Regulatory T type 1 (T R 1) cells are potent suppressors of immune responses and can be induced in vivo upon repeated antigen exposure or in vitro by using tolerogenic dendritic cells. Whether oral immunotherapy (OIT) leads to antigen-specific T R 1 cell induction has not been established. We sought to determine whether peanut-specific T R 1 cells can be generated in vitro from peripheral blood of patients with PA at baseline or during OIT and whether they are functional compared with peanut-specific T R 1 cells induced from healthy control (HC) subjects. Tolerogenic dendritic cells were differentiated in the presence of IL-10 from PBMCs of patients with PA and HC subjects pulsed with the main peanut allergens of Arachis hypogaea, Ara h 1 and 2, and used as antigen-presenting cells for autologous CD4 + T cells (CD4 + T cells coincubated with tolerogenic dendritic cells pulsed with the main peanut allergens [pea-T10 cells]). Pea-T10 cells were characterized by the presence of CD49b + lymphocyte-activation gene 3 (LAG3) + T R 1 cells, antigen-specific proliferative responses, and cytokine production. CD49b + LAG3 + T R 1 cells were induced in pea-T10 cells at comparable percentages from HC subjects and patients with PA. Despite their antigen specificity, pea-T10 cells of patients with PA with or without OIT, as compared with those of HC subjects, were not anergic and had high T H 2 cytokine production upon peanut-specific restimulation. Peanut-specific T R 1 cells can be induced from HC subjects and patients with PA, but those from patients with PA are functionally defective independent of OIT. The unfavorable T R 1/T H 2 ratio is discussed as a possible cause of PA T R 1 cell impairment. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  5. FAM13A is associated with non-small cell lung cancer (NSCLC) progression and controls tumor cell proliferation and survival

    PubMed Central

    Heim, Lisanne; Trump, Sonja; Mittler, Susanne; Sopel, Nina; Andreev, Katerina; Ferrazzi, Fulvia; Ekici, Arif B.; Rieker, Ralf; Springel, Rebekka; Assmann, Vera L.; Lechmann, Matthias; Koch, Sonja; Engelhardt, Marina; Trufa, Denis I.; Sirbu, Horia; Hartmann, Arndt; Finotto, Susetta

    2017-01-01

    ABSTRACT Genome-wide association studies (GWAS) associated Family with sequence similarity 13, member A (FAM13A) with non-small cell lung cancer (NSCLC) occurrence. Here, we found increased numbers of FAM13A protein expressing cells in the tumoral region of lung tissues from a cohort of patients with NSCLC. Moreover, FAM13A inversely correlated with CTLA4 but directly correlated with HIF1α levels in the control region of these patients. Consistently, FAM13A RhoGAP was found to be associated with T cell effector molecules like HIF1α and Tbet and was downregulated in immunosuppressive CD4+CD25+Foxp3+CTLA4+ T cells. TGFβ, a tumor suppressor factor, as well as siRNA to FAM13A, suppressed both isoforms of FAM13A and inhibited tumor cell proliferation. RNA-Seq analysis confirmed this finding. Moreover, siRNA to FAM13A induced TGFβ levels. Finally, in experimental tumor cell migration, FAM13A was induced and TGFβ accelerated this process by inducing cell migration, HIF1α, and the FAM13A RhoGAP isoform. Furthermore, siRNA to FAM13A inhibited tumor cell proliferation and induced cell migration without affecting HIF1α. In conclusion, FAM13A is involved in tumor cell proliferation and downstream of TGFβ and HIF1α, FAM13A RhoGAP is associated with Th1 gene expression and lung tumor cell migration. These findings identify FAM13A as key regulator of NSCLC growth and progression. PMID:28197372

  6. Drinking water disinfection byproduct iodoacetic acid induces tumorigenic transformation of NIH3T3 cells.

    PubMed

    Wei, Xiao; Wang, Shu; Zheng, Weiwei; Wang, Xia; Liu, Xiaolin; Jiang, Songhui; Pi, Jingbo; Zheng, Yuxin; He, Gengsheng; Qu, Weidong

    2013-06-04

    Iodoacetic acid (IAA) and iodoform (IF) are unregulated iodinated disinfection byproducts (DBPs) found in drinking water. Their presence in the drinking water of China has not been documented. Recently, the carcinogenic potential of IAA and IF has been a concern because of their mutagenicity in bacteria and genotoxicity in mammalian cells. Therefore, we measured their concentrations in Shanghai drinking water and assessed their cytotoxicity, genotoxicity, and ability to transform NIH3T3 cells to tumorigenic lines. The concentrations of IAA and IF in Shanghai drinking water varied between summer and winter with maximum winter levels of 2.18 μg/L IAA and 0.86 μg/L IF. IAA with a lethal concentration 50 (LC50) of 2.77 μM exhibited more potent cytotoxicity in NIH3T3 cells than IF (LC50 = 83.37 μM). IAA, but not IF, induced a concentration-dependent DNA damage measured by γ-H2AX staining and increased tail moment in single-cell gel electrophoresis. Neither IAA nor IF increased micronucleus frequency. Prolonged exposure of NIH3T3 cells to IAA increased the frequencies of transformed cells with anchorage-independent growth and agglutination with concanavalin A. IAA-transformed cells formed aggressive fibrosarcomas after inoculation into Balb/c nude mice. This study demonstrated that IAA has a biological activity that is consistent with a carcinogen and human exposure should be of concern.

  7. Probiotic Bifidobacterium breve Induces IL-10-Producing Tr1 Cells in the Colon

    PubMed Central

    Ueda, Yoshiyasu; Takahashi, Takuya; Asahara, Takashi; Tsuji, Hirokazu; Tsuji, Noriko M.; Kiyono, Hiroshi; Ma, Ji Su; Kusu, Takashi; Okumura, Ryu; Hara, Hiromitsu; Yoshida, Hiroki; Yamamoto, Masahiro; Nomoto, Koji; Takeda, Kiyoshi

    2012-01-01

    Specific intestinal microbiota has been shown to induce Foxp3+ regulatory T cell development. However, it remains unclear how development of another regulatory T cell subset, Tr1 cells, is regulated in the intestine. Here, we analyzed the role of two probiotic strains of intestinal bacteria, Lactobacillus casei and Bifidobacterium breve in T cell development in the intestine. B. breve, but not L. casei, induced development of IL-10-producing Tr1 cells that express cMaf, IL-21, and Ahr in the large intestine. Intestinal CD103+ dendritic cells (DCs) mediated B. breve-induced development of IL-10-producing T cells. CD103+ DCs from Il10 −/−, Tlr2 −/−, and Myd88 −/− mice showed defective B. breve-induced Tr1 cell development. B. breve-treated CD103+ DCs failed to induce IL-10 production from co-cultured Il27ra −/− T cells. B. breve treatment of Tlr2 −/− mice did not increase IL-10-producing T cells in the colonic lamina propria. Thus, B. breve activates intestinal CD103+ DCs to produce IL-10 and IL-27 via the TLR2/MyD88 pathway thereby inducing IL-10-producing Tr1 cells in the large intestine. Oral B. breve administration ameliorated colitis in immunocompromised mice given naïve CD4+ T cells from wild-type mice, but not Il10 −/− mice. These findings demonstrate that B. breve prevents intestinal inflammation through the induction of intestinal IL-10-producing Tr1 cells. PMID:22693446

  8. In vivo disruption of T cell development by expression of a dominant-negative polypeptide designed to abolish the SLP-76/Gads interaction.

    PubMed

    Jordan, Martha S; Maltzman, Jonathan S; Kliche, Stefanie; Shabason, Jacob; Smith, Jennifer E; Obstfeld, Amrom; Schraven, Burkhart; Koretzky, Gary A

    2007-10-01

    Multi-molecular complexes nucleated by adaptor proteins play a central role in signal transduction. In T cells, one central axis consists of the assembly of several signaling proteins linked together by the adaptors linker of activated T cells (LAT), Src homology 2 domain-containing leukocyte-specific phosphoprotein of 76 kDa (SLP-76), and Grb2-related adaptor downstream of Shc (Gads). Each of these adaptors has been shown to be important for normal T cell development, and their proper sub-cellular localization is critical for optimal function in cell lines. We previously demonstrated in Jurkat T cells and a rat basophilic leukemic cell line that expression of a 50-amino acid polypeptide identical to the site on SLP-76 that binds to Gads blocks proper localization of SLP-76 and SLP-76-dependent signaling events. Here we extend these studies to investigate the ability of this polypeptide to inhibit TCR-induced integrin activity in Jurkat cells and to inhibit in vivo thymocyte development and primary T cell function. These data provide evidence for the in vivo function of a dominant-negative peptide based upon the biology of SLP-76 action and suggest the possibility of therapeutic potential of targeting the SLP-76/Gads interaction.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Heon, Elise K.; Wulan, Hasi; Macdonald, Loch P.

    IL-15 has pivotal roles in the control of CD8{sup +} memory T cells and has been investigated as a therapeutic option in cancer therapy. Although IL-15 and IL-2 share many functions together, including the stimulation of CD8 T cell proliferation and IFN-γ production, the different in vivo roles of IL-15 and IL-2 have been increasingly recognized. Here, we explored the different effects of IL-15 and IL-2 on tumor-infiltrating (TI) T cells from resected breast tumors. We found that neither IL-2 nor IL-15 induced intratumoral CD8 T cell proliferation by itself, but after CD3/CD28-stimulation, IL-15 induced significantly higher proliferation than IL-2 duringmore » early time points, at day 2, day 3 and day 6. However, the IL-15-induced proliferation leveled off at day 9 and day 12, whereas IL-2 induced lower but progressive proliferation at each time point. Furthermore, IL-15 caused an early and robust increase of IFN-γ in the supernatant of TI cell cultures, which diminished at later time points, while the IL-2-induced IFN-γ production remained constant over time. In addition, the IL-15-costimulated CD8 T cells presented higher frequencies of apoptotic cells. The diminishing IL-15-induced response was possibly due to regulatory and/or exhaustion mechanisms. We did not observe increased IL-10 or PD-1 upregulation, but we have found an increase of Tim-3 upregulation on IL-15-, but not IL-2-stimulated cells. Blocking Tim-3 function using anti-Tim-3 antibodies resulted in increased IL-15-induced proliferation and IFN-γ production for a prolonged period of time, whereas adding Tim-3 ligand galectin 9 led to reduced proliferation and IFN-γ production. Our results suggest that IL-15 in combination of Tim-3 blocking antibodies could potentially act as an IL-2 alternative in tumor CD8 T cell expansion in vitro, a crucial step in adoptive T cell therapy. - Highlights: • We explored the effects of IL-15 and IL-2 on tumor-infiltrating (TI) T cells of breast cancer. • IL-15 and IL-2 had different kinetics in inducing TI CD8 T cell responses. • IL-15 induced stronger but shorter-lived TI CD8 T cell responses than IL-2. • IL-15, but not IL-2, caused upregulation of Tim-3 on TI CD8 T cells. • Blocking Tim-3 resulted in increased IL-15-induced proliferation and IFN-γ production in TI CD8 T cells.« less

  10. Peptide microarray profiling identifies phospholipase C gamma 1 (PLC-γ1) as a potential target for t(8;21) AML

    PubMed Central

    Mahmud, Hasan; Scherpen, Frank J.G.; de Boer, Tiny Meeuwsen; Lourens, Harm-Jan; Schoenherr, Caroline; Eder, Matthias; Scherr, Michaela; Guryev, Victor; De Bont, Eveline S.

    2017-01-01

    The t(8;21) (q22;q22) chromosomal translocation is one of the most frequent genetic alterations in acute myeloid leukemia (AML) which has a need for improved therapeutic strategies. We found PLC-γ1 as one of the highest phosphorylated peptides in t(8;21) AML samples compared to NBM or CN-AML in our previous peptide microarray. PLC-γ1 is known to play a role in cancer progression, however, the impact of PLC-γ1 in AML is currently unknown. Therefore, we aimed to study the functional role of PLC-γ1 by investigating the cellular growth, survival and its underlying mechanism in t(8;21) AML. In this study, PLC-γ1 expression was significantly higher in t(8;21) AML compared to other karyotypes. The PLC-γ1 protein expression was suppressed in AML1-ETO knock down cells indicating that it might induce kasumi-1 cell death. ShRNA-mediated PLC-γ1 knockdown in kasumi-1 cells significantly blocked cell growth, induced apoptosis and cell cycle arrest which was explained by the increased activation of apoptotic related and cell cycle regulatory protein expressions. Gene expression array analysis showed the up-regulation of apoptotic and DNA damage response genes together with the downregulation of cell growth, proliferation and differentiation genes in the PLC-γ1 suppressed kasumi-1 cells, consistent with the observed phenotypic effects. Importantly, PLC-γ1 suppressed kasumi-1 cells showed higher chemosensitivity to the chemotherapeutic drug treatments and lower cell proliferation upon hypoxic stress. Taken together, these in vitro finding strongly support an important role for PLC-γ1 in the survival of t(8;21) AML mimicking kasumi-1 cells and identify PLC-γ1 as a potential therapeutic target for t(8;21) AML treatment. PMID:28978037

  11. Collagen-induced arthritis in Dark Agouti rats as a model for study of immunological sexual dimorphisms in the human disease.

    PubMed

    Dimitrijević, Mirjana; Arsenović-Ranin, Nevena; Bufan, Biljana; Nacka-Aleksić, Mirjana; Macanović, Mirjana Lazarević; Milovanović, Petar; Đurić, Marija; Sopta, Jelena; Leposavić, Gordana

    2018-05-21

    Collagen-induced arthritis (CIA) is a frequently used animal model of rheumatoid arthritis, human autoimmune disease that exhibits clear sex bias in incidence and clinical course. Female Dark Agouti rats immunized for CIA showed also greater incidence and higher arthritic score than their male counterparts. The study investigated sex differences in mechanisms controlling the primary immune responses in draining lymph nodes (dLNs), as a factor contributing to this dimorphism. The higher frequencies of CD4 + CD25 + Foxp3- cells, presumably activated effector T (Teff) cells, and IL-17+, IFN-γ + and IL-17 + IFN-γ + T cells were found in female compared with male rat dLNs. However, the frequency of CD4 + CD25 + Foxp3+ T regulatory cells (Treg) did not differ between sexes. Thus, CD4+ Teff cells/Treg ratio, and IL-17+ T cells/Treg and IFN-γ + T cells/Treg ratios were higher in female than in male rats, and among them was found lower frequency of PD-1+ cells. This suggested less efficient control of (auto)immune Th1/Th17 cell responses in female rat dLNs. On the contrary, the frequency of IL-4+ T cells was lower in female than in male rat dLNs. Consistently, the ratio of serum levels of collagen-specific IgG2a (IFN-γ-dependent, with an important pathogenic role in CIA) and IgG1 (IL-4-dependent) was shifted towards IgG2a in female compared with male rats. As a whole, the study suggests that sexual dimorphism in the control of T cell activation/polarization could contribute to sex bias in the susceptibility to CIA. Moreover, the study advises the use of animals of both sexes in the preclinical testing of new drugs for rheumatoid arthritis. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. Activation of mouse liver natural killer cells and NK1.1(+) T cells by bacterial superantigen-primed Kupffer cells.

    PubMed

    Dobashi, H; Seki, S; Habu, Y; Ohkawa, T; Takeshita, S; Hiraide, H; Sekine, I

    1999-08-01

    Although bacterial superantigens have been well characterized as potent stimulators of T cells, their role in natural killer (NK)-type cells remains largely unknown. In the present study, we examined the effect of bacterial superantigens on mouse liver NK cells and NK1.1 Ag(+) (NK1(+)) T cells. C57BL/6 mice were intravenously injected with staphylococcal enterotoxin B (SEB) or streptococcal pyrogenic exotoxin A (SPE-A), and mononuclear cells (MNC) of various organs were obtained from mice 4 hours after being injected with superantigen. MNC were cultured for 48 hours, and interferon gamma (IFN-gamma) levels of supernatants were measured. The antitumor cytotoxicities of the liver and spleen MNC were also evaluated 24 hours after the mice were injected with superantigen. Liver MNC produced more IFN-gamma than did splenocytes, and peripheral blood and lung MNC did not produce any detectable IFN-gamma. In addition, liver MNC acquired a potent antitumor cytotoxicity by the SEB injection, and both NK cells and NK1(+)T cells but not cluster of differentiation (CD)8(+) T cells were responsible for the cytotoxicity as demonstrated by either in vivo or in vitro cell depletion experiments, and the NK-type cells were partly responsible for the increased serum IFN-gamma. Activation of liver NK-type cells was also supported by the fact that liver NK cells proportionally increased and NK1(+) T cells augmented their CD11a expressions after SEB injection. The pretreatment of mice with anti-IFN-gamma Ab and/or with anti-interleukin-12 (IL-12) Ab diminished the SEB-induced cytotoxicity of liver MNC. Furthermore, the in vivo depletion of Kupffer cells decreased the SEB-induced cytotoxicity of liver MNC. Consistent with these results, liver MNC stimulated with superantigens in the presence of Kupffer cells in vitro produced a greater amount of IFN-gamma than did the liver MNC without Kupffer cells or splenocytes. Our results suggest that bacterial superantigen-primed Kupffer cells produce IL-12 and other monokines, while also nonspecifically activating both NK cells and NK1(+) T cells to produce IFN-gamma.

  13. Activation of T cells recognizing self 60-kD heat shock protein can protect against experimental arthritis

    PubMed Central

    1995-01-01

    Lewis rats are susceptible to several forms of experimental arthritis- induced using heat-killed Mycobacterium tuberculosis (adjuvant arthritis, or AA), streptococcal cell walls, collagen type II, and the lipoidal amine CP20961. Prior immunization with the mycobacterial 65-kD heat shock protein (hsp65) was reported to protect against AA, and other athritis models not using M. tuberculosis, via a T cell-mediated mechanism. Hsp65 shares 48% amino acid identity with mammalian hsp60, which is expressed at elevated levels in inflamed synovia. Several studies have reported cross-reactive T cell recognition of mycobacterial hsp65 and self hsp60 in arthritic and normal individuals. We previously described nine major histocompatibility complex class II- restricted epitopes in mycobacterial hsp65 recognized by Lewis rat T cells. Of these only one, covering the 256-270 sequence, primed for cross-reactive T cell responses to the corresponding region of rat hsp60. Here we have tested each hsp65 epitope for protective activity by immunizing rats with synthetic peptides. A peptide containing the 256-270 epitope, which induced cross-reactive T cells, was the only one able to confer protection against AA. Similarly, administration of a T cell line specific for this epitope protected against AA. Preimmunization with the 256-270 epitope induced T cells that responded to heat-shocked syngeneic antigen-presenting cells, and also protected against CP20961-induced arthritis, indicating that activation of T cells, recognizing an epitope in self hsp60 can protect against arthritis induced without mycobacteria. Therefore, in contrast to the accepted concept that cross-reactive T cell recognition of foreign and self antigens might induce aggressive autoimmune disease, we propose that cross-reactivity between bacterial and self hsp60 might also be used to maintain a protective self-reactive T cell population. This discovery might have important implications for understanding T cell- mediated regulation of inflammation. PMID:7869052

  14. Telomerase Is Involved in IL-7-Mediated Differential Survival of Naive and Memory CD4+ T Cells1

    PubMed Central

    Yang, Yinhua; An, Jie; Weng, Nan-ping

    2008-01-01

    IL-7 plays an essential role in T cell maintenance and survival. The survival effect of IL-7 is thought to be mediated through regulation of Bcl2 family proteins. After a comparative analysis of IL-7-induced growth and cell death of human naive and memory CD4+ T cells, we observed that more memory CD4+ T cells underwent cell division and proceeded to apoptosis than naive cells in response to IL-7. However, IL-7-induced expressions of Bcl2 family members (Bcl2, Bcl-xL, Bax, and Bad) were similar between naive and memory cells. Instead, we found that IL-7 induced higher levels of telomerase activity in naive cells than in memory cells, and the levels of IL-7-induced telomerase activity had a significant inverse correlation with cell death in CD4+ T cells. Furthermore, we showed that reducing expression of telomerase reverse transcriptase and telomerase activity significantly increased cell death of IL-7-cultured CD4+ T cells. Together, these findings demonstrate that telomerase is involved in IL-7-mediated differential survival of naive and memory CD4+ T cells. PMID:18322183

  15. Sustained suppression by Foxp3+ regulatory T cells is vital for infectious transplantation tolerance

    PubMed Central

    Kendal, Adrian R.; Chen, Ye; Regateiro, Frederico S.; Ma, Jianbo; Adams, Elizabeth; Cobbold, Stephen P.; Hori, Shohei

    2011-01-01

    A paradigm shift in immunology has been the recent discovery of regulatory T cells (T reg cells), of which CD4+Foxp3+ cells are proven as essential to self-tolerance. Using transgenic B6.Foxp3hCD2 mice to isolate and ablate Foxp3+ T reg cells with an anti-hCD2 antibody, we show for the first time that CD4+Foxp3+ cells are crucial for infectious tolerance induced by nonablative anti–T cell antibodies. In tolerant animals, Foxp3+ T reg cells are constantly required to suppress effector T cells still capable of causing tissue damage. Tolerated tissue contains T cells that are capable of rejecting it, but are prevented from doing so by therapeutically induced Foxp3+ T reg cells. Finally, Foxp3+ cells have been confirmed as the critical missing link through which infectious tolerance operates in vivo. Peripherally induced Foxp3+ cells sustain tolerance by converting naive T cells into the next generation of Foxp3+ cells. Empowering Foxp3+ regulatory T cells in vivo offers a tractable route to avoid and correct tissue immunopathology. PMID:21875958

  16. Thiazolidinedione treatment and constitutive-PPARγ activation induces ectopic adipogenesis and promotes age-related thymic involution

    PubMed Central

    Youm, Yun-Hee; Yang, Hyunwon; Amin, Raj; Smith, Steven R.; Leff, Todd; Dixit, Vishwa Deep

    2010-01-01

    Age-related thymic involution is characterized by reduction in T cell production together with ectopic adipocyte development within the hematopoietic and thymic niches. PPARγ is required for adipocyte development, glucose homeostasis and is a target for several insulin-sensitizing drugs. Our prior studies showed that age-related elevation of PPARγ expression in thymic stromal cells is associated with thymic involution. Here, using clinically relevant pharmacological and genetic manipulations in mouse models, we provide evidence that activation of PPARγ leads to reduction in thymopoiesis. Treatment of aged mice with anti-hyperglycemic PPARγ-ligand class of Thiazolidinedione drug, Rosiglitazone caused robust thymic expression of classical pro-adipogenic transcripts. Rosiglitazone reduced thymic cellularity, lowered the naïve T cell number and T cell receptor excision circles (TRECs) indicative of compromised thymopoiesis. To directly investigate whether PPARγ activation induces thymic involution, we created transgenic mice with constitutive-active PPARγ (CA-PPARg) fusion protein in cells of adipogenic lineage. Importantly, CA-PPARγ transgene was expressed in thymus and in Fibroblast Specific Protein-1/S100A4 (FSP1+) cells, a marker of secondary mesenchymal cells. The CAPPARγ fusion protein mimicked the liganded PPARγ receptor and the transgenic mice displayed increased ectopic thymic adipogenesis and reduced thymopoiesis. Furthermore, the reduction in thymopoiesis in CA-PPARγ mice was associated with higher bone marrow adiposity and lower hematopoietic stem cell progenitor pool. Consistent with lower thymic output, CAPPARγ transgenic mice had restricted T cell receptor (TCR) repertoire diversity. Collectively, our data suggest that activation of PPARγ accelerates thymic aging and thymus-specific PPARγ antagonist may forestall age-related decline in T cell diversity. PMID:20374200

  17. Mycobacterium tuberculosis infection modulates adipose tissue biology

    PubMed Central

    Kühl, Anja A.; Kupz, Andreas; Vogelzang, Alexis; Mollenkopf, Hans-Joachim; Löwe, Delia; Bandermann, Silke; Dorhoi, Anca; Brinkmann, Volker

    2017-01-01

    Mycobacterium tuberculosis (Mtb) primarily resides in the lung but can also persist in extrapulmonary sites. Macrophages are considered the prime cellular habitat in all tissues. Here we demonstrate that Mtb resides inside adipocytes of fat tissue where it expresses stress-related genes. Moreover, perigonadal fat of Mtb-infected mice disseminated the infection when transferred to uninfected animals. Adipose tissue harbors leukocytes in addition to adipocytes and other cell types and we observed that Mtb infection induces changes in adipose tissue biology depending on stage of infection. Mice infected via aerosol showed infiltration of inducible nitric oxide synthase (iNOS) or arginase 1 (Arg1)-negative F4/80+ cells, despite recruitment of CD3+, CD4+ and CD8+ T cells. Gene expression analysis of adipose tissue of aerosol Mtb-infected mice provided evidence for upregulated expression of genes associated with T cells and NK cells at 28 days post-infection. Strikingly, IFN-γ-producing NK cells and Mtb-specific CD8+ T cells were identified in perigonadal fat, specifically CD8+CD44-CD69+ and CD8+CD44-CD103+ subpopulations. Gene expression analysis of these cells revealed that they expressed IFN-γ and the lectin-like receptor Klrg1 and down-regulated CD27 and CD62L, consistent with an effector phenotype of Mtb-specific CD8+ T cells. Sorted NK cells expressed higher abundance of Klrg1 upon infection, as well. Our results reveal the ability of Mtb to persist in adipose tissue in a stressed state, and that NK cells and Mtb-specific CD8+ T cells infiltrate infected adipose tissue where they produce IFN-γ and assume an effector phenotype. We conclude that adipose tissue is a potential niche for Mtb and that due to infection CD8+ T cells and NK cells are attracted to this tissue. PMID:29040326

  18. Chronically Elevated Levels of Short-Chain Fatty Acids Induce T Cell-Mediated Ureteritis and Hydronephrosis.

    PubMed

    Park, Jeongho; Goergen, Craig J; HogenEsch, Harm; Kim, Chang H

    2016-03-01

    Short-chain fatty acids (SCFAs) are major products of gut microbial fermentation and profoundly affect host health and disease. SCFAs generate IL-10(+) regulatory T cells, which may promote immune tolerance. However, SCFAs can also induce Th1 and Th17 cells upon immunological challenges and, therefore, also have the potential to induce inflammatory responses. Because of the seemingly paradoxical SCFA activities in regulating T cells, we investigated, in depth, the impact of elevated SCFA levels on T cells and tissue inflammation in mice. Orally administered SCFAs induced effector (Th1 and Th17) and regulatory T cells in ureter and kidney tissues, and they induced T cell-mediated ureteritis, leading to kidney hydronephrosis (hereafter called acetate-induced renal disease, or C2RD). Kidney hydronephrosis in C2RD was caused by ureteral obstruction, which was, in turn, induced by SCFA-induced inflammation in the ureteropelvic junction and proximal ureter. Oral administration of all major SCFAs, such as acetate, propionate, and butyrate, induced the disease. We found that C2RD development is dependent on mammalian target of rapamycin activation, T cell-derived inflammatory cytokines such as IFN-γ and IL-17, and gut microbiota. Young or male animals were more susceptible than old or female animals, respectively. However, SCFA receptor (GPR41 or GPR43) deficiency did not affect C2RD development. Thus, SCFAs, when systemically administered at levels higher than physiological levels, cause dysregulated T cell responses and tissue inflammation in the renal system. The results provide insights into the immunological and pathological effects of chronically elevated SCFAs. Copyright © 2016 by The American Association of Immunologists, Inc.

  19. Pannexin1 channels act downstream of P2X7 receptors in ATP-induced murine T-cell death

    PubMed Central

    Shoji, Kenji F; Sáez, Pablo J; Harcha, Paloma A; Aguila, Hector L; Sáez, Juan C

    2014-01-01

    Death of murine T cells induced by extracellular ATP is mainly triggered by activation of purinergic P2X7 receptors (P2X7Rs). However, a link between P2X7Rs and pannexin1 (Panx1) channels, which are non-selective, has been recently demonstrated in other cell types. In this work, we characterized the expression and cellular distribution of pannexin family members (Panxs 1, 2 and 3) in isolated T cells. Panx1 was the main pannexin family member clearly detected in both helper (CD4+) and cytotoxic (CD8+) T cells, whereas low levels of Panx2 were found in both T-cell subsets. Using pharmacological and genetic approaches, Panx1 channels were found to mediate most ATP-induced ethidium uptake since this was drastically reduced by Panx1 channel blockers (10Panx1, Probenecid and low carbenoxolone concentration) and absent in T cells derived from Panx1−/− mice. Moreover, electrophysiological measurements in wild-type CD4+ cells treated with ATP unitary current events and pharmacological sensitivity compatible with Panx1 channels were found. In addition, ATP release from T cells treated with 4Br-A23187, a calcium ionophore, was completely blocked with inhibitors of both connexin hemichannels and Panx1 channels. Panx1 channel blockers drastically reduced the ATP-induced T-cell mortality, indicating that Panx1 channels mediate the ATP-induced T-cell death. However, mortality was not reduced in T cells of Panx1−/− mice, in which levels of P2X7Rs and ATP-induced intracellular free Ca2+ responses were enhanced suggesting that P2X7Rs take over Panx1 channels lose-function in mediating the onset of cell death induced by extracellular ATP. PMID:24590064

  20. Trichomonas vaginalis Metalloproteinase Induces mTOR Cleavage of SiHa Cells

    PubMed Central

    Quan, Juan-Hua; Choi, In-Wook; Yang, Jung-Bo; Zhou, Wei; Cha, Guang-Ho; Zhou, Yu; Ryu, Jae-Sook

    2014-01-01

    Trichomonas vaginalis secretes a number of proteases which are suspected to be the cause of pathogenesis; however, little is understood how they manipulate host cells. The mammalian target of rapamycin (mTOR) regulates cell growth, cell proliferation, cell motility, cell survival, protein synthesis, and transcription. We detected various types of metalloproteinases including GP63 protein from T. vaginalis trophozoites, and T. vaginalis GP63 metalloproteinase was confirmed by sequencing and western blot. When SiHa cells were stimulated with live T. vaginalis, T. vaginalis excretory-secretory products (ESP) or T. vaginalis lysate, live T. vaginalis and T. vaginalis ESP induced the mTOR cleavage in both time- and parasite load-dependent manner, but T. vaginalis lysate did not. Pretreatment of T. vaginalis with a metalloproteinase inhibitor, 1,10-phenanthroline, completely disappeared the mTOR cleavage in SiHa cells. Collectively, T. vaginalis metallopeptidase induces host cell mTOR cleavage, which may be related to survival of the parasite. PMID:25548410

  1. Activation of human T-helper/inducer cell, T-cytotoxic/suppressor cell, B-cell, and natural killer (NK)-cells and induction of NK cell activity against K562 chronic myeloid leukemia cells with modified citrus pectin

    USDA-ARS?s Scientific Manuscript database

    Background Modified citrus pectin (MCP) is known for its anti-cancer effects and its ability to be absorbed and circulated in the human body. In this report we tested the ability of MCP to induce the activation of human blood lymphocyte subsets including T-helper/inducer cell, Tcytotoxic/suppres...

  2. Phosphorylation of AKT induced by phosphorylated Hsp27 confers the apoptosis-resistance in t-AUCB-treated glioblastoma cells in vitro.

    PubMed

    Li, Rujun; Li, Junyang; Sang, Dongping; Lan, Qing

    2015-01-01

    The aim of this study is to determine whether phosphorylation of AKT could be effected by t-AUCB-induced p-Hsp27 and whether p-AKT inhibition sensitizes glioblastoma cells to t-AUCB, and to evaluate the effects of simultaneous inhibition of p-Hsp27 and p-AKT on t-AUCB treated glioblastoma cells. Cell growth was detected using CCK-8 assay; Caspase-3 activity assay kits and flow cytometry were used in apoptosis analysis; Western blot analysis was used to detect p-Hsp27 and p-AKT levels; RNA interference using the siRNA oligos of Hsp27 was performed to knockdown gene expression of Hsp27. All data were analyzed by the Student-Newman-Keul's test. We demonstrated that t-AUCB treatment induces AKT phosphorylation by activating Hsp27 in U251 and LN443 cell lines. Inhibition of AKT phosphorylation by AKT inhibitor IV sensitizes glioblastoma cells to t-AUCB, strengthens t-AUCB suppressing cell growth and inducing cell apoptosis. We also found inhibiting both p-Hsp27 and p-AKT synergistically strengthen t-AUCB suppressing cell growth. Thus, p-AKT induced by p-Hsp27 confers the apoptosis-resistance in t-AUCB-treated glioblastoma cells. Targeting p-Hsp27 and/or p-AKT may be a potential effective strategy for the treatment of glioblastoma.

  3. Reverse engineering of TLX oncogenic transcriptional networks identifies RUNX1 as tumor suppressor in T-ALL.

    PubMed

    Della Gatta, Giusy; Palomero, Teresa; Perez-Garcia, Arianne; Ambesi-Impiombato, Alberto; Bansal, Mukesh; Carpenter, Zachary W; De Keersmaecker, Kim; Sole, Xavier; Xu, Luyao; Paietta, Elisabeth; Racevskis, Janis; Wiernik, Peter H; Rowe, Jacob M; Meijerink, Jules P; Califano, Andrea; Ferrando, Adolfo A

    2012-02-26

    The TLX1 and TLX3 transcription factor oncogenes have a key role in the pathogenesis of T cell acute lymphoblastic leukemia (T-ALL). Here we used reverse engineering of global transcriptional networks to decipher the oncogenic regulatory circuit controlled by TLX1 and TLX3. This systems biology analysis defined T cell leukemia homeobox 1 (TLX1) and TLX3 as master regulators of an oncogenic transcriptional circuit governing T-ALL. Notably, a network structure analysis of this hierarchical network identified RUNX1 as a key mediator of the T-ALL induced by TLX1 and TLX3 and predicted a tumor-suppressor role for RUNX1 in T cell transformation. Consistent with these results, we identified recurrent somatic loss-of-function mutations in RUNX1 in human T-ALL. Overall, these results place TLX1 and TLX3 at the top of an oncogenic transcriptional network controlling leukemia development, show the power of network analyses to identify key elements in the regulatory circuits governing human cancer and identify RUNX1 as a tumor-suppressor gene in T-ALL.

  4. An inducible knockout mouse to model the cell-autonomous role of PTEN in initiating endometrial, prostate and thyroid neoplasias.

    PubMed

    Mirantes, Cristina; Eritja, Núria; Dosil, Maria Alba; Santacana, Maria; Pallares, Judit; Gatius, Sónia; Bergadà, Laura; Maiques, Oscar; Matias-Guiu, Xavier; Dolcet, Xavier

    2013-05-01

    PTEN is one of the most frequently mutated tumor suppressor genes in human cancers. The role of PTEN in carcinogenesis has been validated by knockout mouse models. PTEN heterozygous mice develop neoplasms in multiple organs. Unfortunately, the embryonic lethality of biallelic excision of PTEN has inhibited the study of complete PTEN deletion in the development and progression of cancer. By crossing PTEN conditional knockout mice with transgenic mice expressing a tamoxifen-inducible Cre-ER(T) under the control of a chicken actin promoter, we have generated a tamoxifen-inducible mouse model that allows temporal control of PTEN deletion. Interestingly, administration of a single dose of tamoxifen resulted in PTEN deletion mainly in epithelial cells, but not in stromal, mesenchymal or hematopoietic cells. Using the mT/mG double-fluorescent Cre reporter mice, we demonstrate that epithelial-specific PTEN excision was caused by differential Cre activity among tissues and cells types. Tamoxifen-induced deletion of PTEN resulted in extremely rapid and consistent formation of endometrial in situ adenocarcinoma, prostate intraepithelial neoplasia and thyroid hyperplasia. We also analyzed the role of PTEN ablation in other epithelial cells, such as the tubular cells of the kidney, hepatocytes, colonic epithelial cells or bronchiolar epithelium, but those tissues did not exhibit neoplastic growth. Finally, to validate this model as a tool to assay the efficacy of anti-tumor drugs in PTEN deficiency, we administered the mTOR inhibitor everolimus to mice with induced PTEN deletion. Everolimus dramatically reduced the progression of endometrial proliferations and significantly reduced thyroid hyperplasia. This model could be a valuable tool to study the cell-autonomous mechanisms involved in PTEN-loss-induced carcinogenesis and provides a good platform to study the effect of anti-neoplastic drugs on PTEN-negative tumors.

  5. Evidence that Singlet Oxygen-induced Human T Helper Cell Apoptosis Is the Basic Mechanism of Ultraviolet-A Radiation Phototherapy

    PubMed Central

    Morita, Akimichi; Werfel, Thomas; Stege, Helger; Ahrens, Constanze; Karmann, Karin; Grewe, Markus; Grether-Beck, Susanne; Ruzicka, Thomas; Kapp, Alexander; Klotz, Lars-Oliver; Sies, Helmut; Krutmann, Jean

    1997-01-01

    Ultraviolet A (UVA) irradiation is effectively used to treat patients with atopic dermatitis and other T cell mediated, inflammatory skin diseases. In the present study, successful phototherapy of atopic dermatitis was found to result from UVA radiation-induced apoptosis in skin-infiltrating T helper cells, leading to T cell depletion from eczematous skin. In vitro, UVA radiation-induced human T helper cell apoptosis was mediated through the FAS/FAS-ligand system, which was activated in irradiated T cells as a consequence of singlet oxygen generation. These studies demonstrate that singlet oxygen is a potent trigger for the induction of human T cell apoptosis. They also identify singlet oxygen generation as a fundamental mechanism of action operative in phototherapy. PMID:9362536

  6. Umbilical Cord Tissue-Derived Mesenchymal Stem Cells Induce T Lymphocyte Apoptosis and Cell Cycle Arrest by Expression of Indoleamine 2, 3-Dioxygenase

    PubMed Central

    Li, Xiuying; Xu, Zhuo; Bai, Jinping; Yang, Shuyuan; Zhao, Shuli; Zhang, Yingjie; Chen, Xiaodong

    2016-01-01

    It has been reported that human mesenchymal stem cells are able to inhibit T lymphocyte activation; however, the discrepancy among different sources of MSCs is not well documented. In this study, we have compared the MSCs from bone marrow (BM), adipose tissue (AT), placenta (PL), and umbilical cord (UC) to determine which one displayed the most efficient immunosuppressive effects on phytohemagglutinin-induced T cell proliferation. Among them we found that hUC-MSC has the strongest effects on inhibiting T cell proliferation and is chosen to do the further study. We observed that T lymphocyte spontaneously released abundant IFN-γ. And IFN-γ secreted by T lymphocyte could induce the expression of indoleamine 2, 3-dioxygenase (IDO) in hUC-MSCs. IDO was previously reported to induce T lymphocyte apoptosis and cell cycle arrest in S phase. When cocultured with hUC-MSCs, T lymphocyte expression of caspase 3 was significantly increased, while Bcl2 and CDK4 mRNA expression decreased dramatically. Addition of 1-methyl tryptophan (1-MT), an IDO inhibitor, restored T lymphocyte proliferation, reduced apoptosis, and induced resumption of the cell cycle. In addition, the changes in caspase 3, CDK4, and Bcl2 expression were reversed by 1-MT. These findings demonstrate that hUC-MSCs induce T lymphocyte apoptosis and cell cycle arrest by expressing abundant IDO and provide an explanation for some of the immunomodulatory effects of MSCs. PMID:27418932

  7. Trichonomas vaginalis metalloproteinase induces apoptosis of SiHa cells through disrupting the Mcl-1/Bim and Bcl-xL/Bim complexes.

    PubMed

    Quan, Juan-Hua; Kang, Byung-Hun; Cha, Guang-Ho; Zhou, Wei; Koh, Young-Bok; Yang, Jung-Bo; Yoo, Heon-Jong; Lee, Min-A; Ryu, Jae-Sook; Noh, Heung-Tae; Kwon, Jaeyul; Lee, Young-Ha

    2014-01-01

    To elucidate the roles of metalloproteinases and the Bcl-2 family of proteins in Trichovaginalis. vaginalis-induced apoptosis in human cervical cancer cells (SiHa cells) and vaginal epithelial cells (MS74 cells), SiHa cells and MS74 cells were incubated with live T. vaginalis, T. vaginalis excretory and secretory products (ESP), and T. vaginalis lysates, either with or without the specific metalloproteinase inhibitor 1,10-phenanthroline (1,10-PT), and examined apoptotic events and Bcl-2 signaling. The live T. vaginalis and the T. vaginalis ESP induced the release of cytochrome c into the cytosol, the activation of caspase-3 and caspase-9, and the cleavage of PARP. Additionally, the live T. vaginalis, but not the T. vaginalis lysate, induced the cleavage of the proapoptotic Bim protein. The live T. vaginalis and the T. vaginalis ESP, but not the T. vaginalis lysate, induced the dose-dependent cleavage of the antiapoptotic Bcl-xL and Mcl-1 proteins and decreased the association levels of Bcl-xL/Bim and Mcl-1/Bim complexes. We performed gelatin zymography and casein-hydrolysis assays on the live T. vaginalis and the T. vaginalis ESP to identify the apoptosis-inducing factor. Both the live T. vaginalis and the ESP contained high levels of metalloproteinases, of which activities were significantly inhibited by 1,10-PT treatment. Furthermore, the 1,10-PT blocked the cleavage of Bcl-xL, Mcl-1, PARP, caspase-3, and caspase-9, as well as the release of cytochrome c into the cytosol, and it significantly increased the association levels of the Bcl-xL/Bim and Mcl-1/Bim protein complexes, returning them to normal levels. Our results demonstrate that T. vaginalis induces mitochondria-dependent apoptosis in SiHa cells through the dissociation of Bcl-xL/Bim and Mcl-1/Bim complexes and that the apoptosis is blocked by the metalloproteinase inhibitor 1,10-PT. These results expand our understanding of the role of metalloproteinases in T. vaginalis-induced apoptosis and the signaling pathway in trichomoniasis of the cervicovaginal epithelial cells.

  8. Trichonomas vaginalis Metalloproteinase Induces Apoptosis of SiHa Cells through Disrupting the Mcl-1/Bim and Bcl-xL/Bim Complexes

    PubMed Central

    Zhou, Wei; Koh, Young-Bok; Yang, Jung-Bo; Yoo, Heon-Jong; Lee, Min-A; Ryu, Jae-Sook; Noh, Heung-Tae; Kwon, Jaeyul; Lee, Young-Ha

    2014-01-01

    To elucidate the roles of metalloproteinases and the Bcl-2 family of proteins in Trichovaginalis. vaginalis-induced apoptosis in human cervical cancer cells (SiHa cells) and vaginal epithelial cells (MS74 cells), SiHa cells and MS74 cells were incubated with live T. vaginalis, T. vaginalis excretory and secretory products (ESP), and T. vaginalis lysates, either with or without the specific metalloproteinase inhibitor 1,10-phenanthroline (1,10-PT), and examined apoptotic events and Bcl-2 signaling. The live T. vaginalis and the T. vaginalis ESP induced the release of cytochrome c into the cytosol, the activation of caspase-3 and caspase-9, and the cleavage of PARP. Additionally, the live T. vaginalis, but not the T. vaginalis lysate, induced the cleavage of the proapoptotic Bim protein. The live T. vaginalis and the T. vaginalis ESP, but not the T. vaginalis lysate, induced the dose-dependent cleavage of the antiapoptotic Bcl-xL and Mcl-1 proteins and decreased the association levels of Bcl-xL/Bim and Mcl-1/Bim complexes. We performed gelatin zymography and casein-hydrolysis assays on the live T. vaginalis and the T. vaginalis ESP to identify the apoptosis-inducing factor. Both the live T. vaginalis and the ESP contained high levels of metalloproteinases, of which activities were significantly inhibited by 1,10-PT treatment. Furthermore, the 1,10-PT blocked the cleavage of Bcl-xL, Mcl-1, PARP, caspase-3, and caspase-9, as well as the release of cytochrome c into the cytosol, and it significantly increased the association levels of the Bcl-xL/Bim and Mcl-1/Bim protein complexes, returning them to normal levels. Our results demonstrate that T. vaginalis induces mitochondria-dependent apoptosis in SiHa cells through the dissociation of Bcl-xL/Bim and Mcl-1/Bim complexes and that the apoptosis is blocked by the metalloproteinase inhibitor 1,10-PT. These results expand our understanding of the role of metalloproteinases in T. vaginalis-induced apoptosis and the signaling pathway in trichomoniasis of the cervicovaginal epithelial cells. PMID:25343522

  9. TNF-α blockade induces IL-10 expression in human CD4+ T cells

    NASA Astrophysics Data System (ADS)

    Evans, Hayley G.; Roostalu, Urmas; Walter, Gina J.; Gullick, Nicola J.; Frederiksen, Klaus S.; Roberts, Ceri A.; Sumner, Jonathan; Baeten, Dominique L.; Gerwien, Jens G.; Cope, Andrew P.; Geissmann, Frederic; Kirkham, Bruce W.; Taams, Leonie S.

    2014-02-01

    IL-17+ CD4+ T (Th17) cells contribute to the pathogenesis of several human inflammatory diseases. Here we demonstrate that TNF inhibitor (TNFi) drugs induce the anti-inflammatory cytokine IL-10 in CD4+ T cells including IL-17+ CD4+ T cells. TNFi-mediated induction of IL-10 in IL-17+ CD4+ T cells is Treg-/Foxp3-independent, requires IL-10 and is overcome by IL-1β. TNFi-exposed IL-17+ CD4+ T cells are molecularly and functionally distinct, with a unique gene signature characterized by expression of IL10 and IKZF3 (encoding Aiolos). We show that Aiolos binds conserved regions in the IL10 locus in IL-17+ CD4+ T cells. Furthermore, IKZF3 and IL10 expression levels correlate in primary CD4+ T cells and Aiolos overexpression is sufficient to drive IL10 in these cells. Our data demonstrate that TNF-α blockade induces IL-10 in CD4+ T cells including Th17 cells and suggest a role for the transcription factor Aiolos in the regulation of IL-10 in CD4+ T cells.

  10. Tobacco-smoking induced GPR15-expressing T cells in blood do not indicate pulmonary damage.

    PubMed

    Bauer, Mario; Fink, Beate; Seyfarth, Hans-Jürgen; Wirtz, Hubert; Frille, Armin

    2017-11-28

    Recently, it was shown that chronic tobacco smoking evokes specific cellular and molecular changes in white blood cells by an excess of G protein-coupled receptor 15 (GPR15)-expressing T cells as well as a hypomethylation at DNA CpG site cg05575921 in granulocytes. In the present study, we aimed to clarify the general usefulness of these two biomarkers as putative signs of non-cancerous change in homeostasis of the lungs. In a clinical cohort consisting of 42 patients with chronic obstructive pulmonary disease (COPD), interstitial lung disease (ILD) and pneumonia and a control cohort of 123 volunteers, the content of GPR15-expressing blood cells as well as the degree of methylation at cg05575921 were analysed by flow-cytometry and pyrosequencing, respectively. Smoking behaviour was estimated by questionnaire and cotinine level in plasma. Never-smoking patients could be distinguished from former and current smokers by both the proportion of GPR15-expressing T cells as well as cg05575921 methylation in granulocytes, with 100% and 97% specificity and 100% sensitivity, respectively. However, both parameters were not affected by lung diseases. The degrees of both parameters were not changed neither in non-smoking nor smoking patients, compared to appropriate control cohorts of volunteers. The degree of GPR15-expressing cells among T cells as well as the methylation at cg05575921 in granulocytes in blood are both rather signs of tobacco-smoking induced systemic inflammation because they don't indicate specifically non-cancerous pathological changes in the lungs.

  11. Segregated Regulatory CD39+ CD4+ T Cell Function: TGF-β-Producing FoxP3− and IL-10-Producing FoxP3+ Cells Are Interdependent for Protection Against Collagen-Induced Arthritis1

    PubMed Central

    Kochetkova, Irina; Thornburg, Theresa; Callis, Gayle; Pascual, David W.

    2011-01-01

    Oral immunization with a Salmonella vaccine vector expressing enterotoxigenic E. coli colonization factor antigen I (CFA/I) can protect against collagen-induced arthritis (CIA) by dampening IL-17 and IFN-γ via enhanced IL-4, IL-10, and TGF-β. To identify the responsible regulatory CD4+ T cells making the host refractory to CIA, Salmonella-CFA/I induced CD39+CD4+ T cells with enhanced apyrase activity relative to Salmonella vector-immunized mice. Adoptive transfer of vaccine-induced CD39+CD4+ T cells into CIA mice conferred complete protection, while CD39−CD4+ T cells did not. Subsequent analysis of vaccinated FoxP3-GFP mice revealed the CD39+ T cells were composed of FoxP3-GFP− and FoxP3-GFP+ subpopulations. Although each adoptively transferred Salmonella-CFA/I-induced FoxP3− and FoxP3+CD39+CD4+ T cells could protect against CIA, each subset was not as efficacious as total CD39+CD4+ T cells, suggesting their interdependence for optimal protection. Cytokine analysis revealed FoxP3− CD39+CD4+ T cells produced TGF-β, and FoxP3+CD39+CD4+ T cells produced IL-10, showing a segregation of function. Moreover, donor FoxP3-GFP− CD4+ T cells converted to FoxP3-GFP+ CD39+CD4+ T cells in the recipients, showing plasticity of these regulatory T cells. TGF-β was found to be essential for protection since in vivo TGF-β neutralization reversed activation of cAMP-response element-binding protein (CREB) and reduced the development of CD39+CD4+ T cells. Thus, CD39 apyrase-expressing CD4+ T cells stimulated by Salmonella-CFA/I are composed of TGF-β-producing FoxP3− CD39+CD4+ T cells and support the stimulation of IL-10-producing FoxP3+ CD39+CD4+ T cells. PMID:21967895

  12. Evaluation of Anti-Toxoplasma gondii Effect of Ursolic Acid as a Novel Toxoplasmosis Inhibitor.

    PubMed

    Choi, Won Hyung; Lee, In Ah

    2018-05-09

    This study was carried out to evaluate the anti-parasitic effect of ursolic acid against Toxoplasma gondii ( T. gondii ) that induces toxoplasmosis, particularly in humans. The anti-parasitic effects of ursolic acid against T. gondii -infected cells and T. gondii were evaluated through different specific assays, including immunofluorescence staining and animal testing. Ursolic acid effectively inhibited the proliferation of T. gondii when compared with sulfadiazine, and consistently induced anti- T. gondii activity/effect. In particular, the formation of parasitophorous vacuole membrane (PVM) in host cells was markedly decreased after treating ursolic acid, which was effectively suppressed. Moreover, the survival rate of T. gondii was strongly inhibited in T. gondii group treated with ursolic acid, and then 50% inhibitory concentration (IC 50 ) against T. gondii was measured as 94.62 μg/mL. The T. gondii -infected mice treated with ursolic acid indicated the same survival rates and activity as the normal group. These results demonstrate that ursolic acid causes anti- T. gondii action and effect by strongly blocking the proliferation of T. gondii through the direct and the selective T. gondii -inhibitory ability as well as increases the survival of T. gondii -infected mice. This study shows that ursolic acid has the potential to be used as a promising anti- T. gondii candidate substance for developing effective anti-parasitic drugs.

  13. Critical Role of SAP in Progression and Reactivation but Not Maintenance of T Cell-Dependent Humoral Immunity

    PubMed Central

    2013-01-01

    Signaling lymphocytic activation molecule (SLAM)-associated protein (SAP) is a small adaptor molecule mutated in X-linked lymphoproliferative disease, a human immunodeficiency. SAP plays a critical role in the initiation of T cell-dependent B cell responses leading to germinal center reaction, the production of high-affinity antibodies, and B cell memory. However, whether SAP has a role in these responses beyond their initiation is not known. It is important to address this matter not only for mechanistic reasons but also because blockade of the SAP pathway is being contemplated as a means to treat autoimmune diseases in humans. Using an inducibly SAP deficient mouse, we found that SAP was required not only for the initiation but also for the progression of primary T cell-driven B cell responses to haptens. It was also necessary for the reactivation of T cell-dependent B cell immunity during secondary immune responses. These activities consistently correlated with the requirement of SAP for full expression of the lineage commitment factor Bcl-6 in follicular T helper (TFH) cells. However, once memory B cells and long-lived antibody-secreting cells were established, SAP became dispensable for maintaining T cell-dependent B cell responses. Thus, SAP is pivotal for nearly all phases, but not for maintenance, of T cell-driven B cell humoral immunity. These findings may have implications for the treatment of immune disorders by targeting the SAP pathway. PMID:23319045

  14. Loss of Roquin induces early death and immune deregulation but not autoimmunity.

    PubMed

    Bertossi, Arianna; Aichinger, Martin; Sansonetti, Paola; Lech, Maciej; Neff, Frauke; Pal, Martin; Wunderlich, F Thomas; Anders, Hans-Joachim; Klein, Ludger; Schmidt-Supprian, Marc

    2011-08-29

    The substitution of one amino acid in the Roquin protein by the sanroque mutation induces a dramatic autoimmune syndrome in mice. This is believed to occur through ectopic expression of inducible T cell co-stimulator (ICOS) and unrestrained differentiation of follicular T helper cells, which induce spontaneous germinal center reactions to self-antigens. In this study, we demonstrate that tissue-specific ablation of Roquin in T or B cells, in the entire hematopoietic system, or in epithelial cells of transplanted thymi did not cause autoimmunity. Loss of Roquin induced elevated expression of ICOS through T cell-intrinsic and -extrinsic mechanisms, which itself was not sufficient to break self-tolerance. Instead, ablation of Roquin in the hematopoietic system caused defined changes in immune homeostasis, including the expansion of macrophages, eosinophils, and T cell subsets, most dramatically CD8 effector-like T cells, through cell-autonomous and nonautonomous mechanisms. Germline Roquin deficiency led to perinatal lethality, which was partially rescued on the genetic background of an outbred strain. However, not even complete absence of Roquin resulted in overt self-reactivity, suggesting that the sanroque mutation induces autoimmunity through an as yet unknown mechanism. © 2011 Bertossi et al.

  15. CD4+ T-Cell- and Gamma Interferon-Dependent Protection against Murine Malaria by Immunization with Linear Synthetic Peptides from a Plasmodium yoelii 17-Kilodalton Hepatocyte Erythrocyte Protein

    PubMed Central

    Charoenvit, Yupin; Majam, Victoria Fallarme; Corradin, Giampietro; Sacci, John B.; Wang, Ruobing; Doolan, Denise L.; Jones, Trevor R.; Abot, Esteban; Patarroyo, Manuel E.; Guzman, Fanny; Hoffman, Stephen L.

    1999-01-01

    Most work on protective immunity against the pre-erythrocytic stages of malaria has focused on induction of antibodies that prevent sporozoite invasion of hepatocytes, and CD8+ T-cell responses that eliminate infected hepatocytes. We recently reported that immunization of A/J mice with an 18-amino-acid synthetic linear peptide from Plasmodium yoelii sporozoite surface protein 2 (SSP2) in TiterMax adjuvant induces sterile protection that is dependent on CD4+ T cells and gamma interferon (IFN-γ). We now report that immunization of inbred A/J mice and outbred CD1 mice with each of two linear synthetic peptides from the 17-kDa P. yoelii hepatocyte erythrocyte protein (HEP17) in the same adjuvant also induces protection against sporozoite challenge that is dependent on CD4+ T cells and IFN-γ. The SSP2 peptide and the two HEP17 peptides are recognized by B cells as well as T cells, and the protection induced by these peptides appears to be directed against the infected hepatocytes. In contrast to the peptide-induced protection, immunization of eight different strains of mice with radiation-attenuated sporozoites induces protection that is absolutely dependent on CD8+ T cells. Data represented here demonstrate that CD4+ T-cell-dependent protection can be induced by immunization with linear synthetic peptides. These studies therefore provide the foundation for an approach to pre-erythrocytic-stage malaria vaccine development, based on the induction of protective CD4+ T-cell responses, which will complement efforts to induce protective antibody and CD8+ T-cell responses. PMID:10531206

  16. Folate receptor 1 (FOLR1) targeted chimeric antigen receptor (CAR) T cells for the treatment of gastric cancer

    PubMed Central

    Pyo, Suhkneung; Kang, Chung Hyo; Lee, Chong Ock; Lee, Heung Kyoung; Choi, Sang Un; Park, Chi Hoon

    2018-01-01

    Gastric cancer is a malignancy that has a high mortality rate. Although progress has been made in the treatment of gastric cancer, many patients experience cancer recurrence and metastasis. Folate receptor 1 (FOLR1) is overexpressed on the cell surface in over one-third of gastric cancer patients, but rarely is expressed in normal tissue. This makes FOLR1 a potential target for chimeric antigen receptor (CAR) T cell immunotherapy, although the function of FOLR1 has not been elucidated. CAR are engineered fusion receptor composed of an antigen recognition region and signaling domains. T cells expressing CAR have specific activation and cytotoxic effects against cancer cells containing the target antigen. In this study, we generated a CAR that targets FOLR1 composed of a single-chain variable fragment (scFv) of FOLR1 antibody and signaling domains consisting of CD28 and CD3ζ. Both FOLR1-CAR KHYG-1, a natural killer cell line, and FOLR1-CAR T cells recognized FOLR1-positive gastric cancer cells in a MHC-independent manner and induced secretion of various cytokines and caused cell death. Conclusively, this is the first study to demonstrate that CAR KHYG-1/T cells targeting FOLR1 are effective against FOLR1-positive gastric cancer cells. PMID:29874279

  17. Engineering antigens for in situ erythrocyte binding induces T-cell deletion.

    PubMed

    Kontos, Stephan; Kourtis, Iraklis C; Dane, Karen Y; Hubbell, Jeffrey A

    2013-01-02

    Antigens derived from apoptotic cell debris can drive clonal T-cell deletion or anergy, and antigens chemically coupled ex vivo to apoptotic cell surfaces have been shown correspondingly to induce tolerance on infusion. Reasoning that a large number of erythrocytes become apoptotic (eryptotic) and are cleared each day, we engineered two different antigen constructs to target the antigen to erythrocyte cell surfaces after i.v. injection, one using a conjugate with an erythrocyte-binding peptide and another using a fusion with an antibody fragment, both targeting the erythrocyte-specific cell surface marker glycophorin A. Here, we show that erythrocyte-binding antigen is collected much more efficiently than free antigen by splenic and hepatic immune cell populations and hepatocytes, and that it induces antigen-specific deletional responses in CD4(+) and CD8(+) T cells. We further validated T-cell deletion driven by erythrocyte-binding antigens using a transgenic islet β cell-reactive CD4(+) T-cell adoptive transfer model of autoimmune type 1 diabetes: Treatment with the peptide antigen fused to an erythrocyte-binding antibody fragment completely prevented diabetes onset induced by the activated, autoreactive CD4(+) T cells. Thus, we report a translatable modular biomolecular approach with which to engineer antigens for targeted binding to erythrocyte cell surfaces to induce antigen-specific CD4(+) and CD8(+) T-cell deletion toward exogenous antigens and autoantigens.

  18. Involvement of tumour necrosis factor-α-related apoptosis-inducing ligand in enhanced cytotoxicity of lipopolysaccharide-stimulated dendritic cells to activated T cells

    PubMed Central

    Yu, Yizhi; Liu, Shuxun; Wang, Wenya; Song, Wengang; Zhang, Minghui; Zhang, Weiping; Qin, Zhihai; Cao, Xuetao

    2002-01-01

    Dendritic cells (DC) are potent antigen-presenting cells (APC) specialized in T-cell mediated immune responses, and also play critical roles in the homeostasis of T cells for controlling immune responses. In the present study, we demonstrated that during mouse bone-marrow-derived DC activation of ovalbumin (OVA)-specific Ia-kb-restricted T hybridoma cells, MF2.2D9 and OVA257–264-specific H-2kb-restricted RF33.70 T cells, respectively, both hybridomas undergo cell death, partially mediated via apoptotic ligand–tumour necrosis factor-α (TNF-α)-related apoptosis-inducing ligand (TRAIL). Lipopolysaccharide enhanced the cytotoxic effect on the two activated T hybridoma cells, which was correlated with up-regulation of TRAIL-expression on DC to some extent. The activation of caspase-3 in activated T hybridoma cells cocultured with DC contributed to the programmed cell death pathway T cells underwent. Therefore, our results show that activation-induced cell death of T hybridoma cells can be influenced by DC, suggesting that DC may be involved in elimination of activated T cells at the end of primary immune responses. PMID:12100718

  19. Involvement of tumour necrosis factor-alpha-related apoptosis-inducing ligand in enhanced cytotoxicity of lipopolysaccharide-stimulated dendritic cells to activated T cells.

    PubMed

    Yu, Yizhi; Liu, Shuxun; Wang, Wenya; Song, Wengang; Zhang, Minghui; Zhang, Weiping; Qin, Zhihai; Cao, Xuetao

    2002-07-01

    Dendritic cells (DC) are potent antigen-presenting cells (APC) specialized in T-cell mediated immune responses, and also play critical roles in the homeostasis of T cells for controlling immune responses. In the present study, we demonstrated that during mouse bone-marrow-derived DC activation of ovalbumin (OVA)-specific Ia-kb-restricted T hybridoma cells, MF2.2D9 and OVA257-264-specific H-2kb-restricted RF33.70 T cells, respectively, both hybridomas undergo cell death, partially mediated via apoptotic ligand-tumour necrosis factor-alpha (TNF-alpha)-related apoptosis-inducing ligand (TRAIL). Lipopolysaccharide enhanced the cytotoxic effect on the two activated T hybridoma cells, which was correlated with up-regulation of TRAIL-expression on DC to some extent. The activation of caspase-3 in activated T hybridoma cells cocultured with DC contributed to the programmed cell death pathway T cells underwent. Therefore, our results show that activation-induced cell death of T hybridoma cells can be influenced by DC, suggesting that DC may be involved in elimination of activated T cells at the end of primary immune responses.

  20. γδT cells but not αβT cells contribute to sepsis-induced white matter injury and motor abnormalities in mice.

    PubMed

    Zhang, Xiaoli; Rocha-Ferreira, Eridan; Li, Tao; Vontell, Regina; Jabin, Darakhshan; Hua, Sha; Zhou, Kai; Nazmi, Arshed; Albertsson, Anna-Maj; Sobotka, Kristina; Ek, Joakim; Thornton, Claire; Hagberg, Henrik; Mallard, Carina; Leavenworth, Jianmei W; Zhu, Changlian; Wang, Xiaoyang

    2017-12-20

    Infection and sepsis are associated with brain white matter injury in preterm infants and the subsequent development of cerebral palsy. In the present study, we used a neonatal mouse sepsis-induced white matter injury model to determine the contribution of different T cell subsets (αβT cells and γδT cells) to white matter injury and consequent behavioral changes. C57BL/6J wild-type (WT), T cell receptor (TCR) δ-deficient (Tcrd -/- , lacking γδT cells), and TCRα-deficient (Tcra -/- , lacking αβT cells) mice were administered with lipopolysaccharide (LPS) at postnatal day (PND) 2. Brain myelination was examined at PNDs 12, 26, and 60. Motor function and anxiety-like behavior were evaluated at PND 26 or 30 using DigiGait analysis and an elevated plus maze. White matter development was normal in Tcrd -/- and Tcrα -/- compared to WT mice. LPS exposure induced reductions in white matter tissue volume in WT and Tcrα -/- mice, but not in the Tcrd -/- mice, compared with the saline-treated groups. Neither LPS administration nor the T cell deficiency affected anxiety behavior in these mice as determined with the elevated plus maze. DigiGait analysis revealed motor function deficiency after LPS-induced sepsis in both WT and Tcrα -/- mice, but no such effect was observed in Tcrd -/- mice. Our results suggest that γδT cells but not αβT cells contribute to sepsis-induced white matter injury and subsequent motor function abnormalities in early life. Modulating the activity of γδT cells in the early stages of preterm white matter injury might represent a novel therapeutic strategy for the treatment of perinatal brain injury.

  1. Extremely Low-Frequency Electromagnetic Fields Cause G1 Phase Arrest through the Activation of the ATM-Chk2-p21 Pathway

    PubMed Central

    Huang, Chao-Ying; Chang, Cheng-Wei; Chen, Chaang-Ray; Chuang, Chun-Yu; Chiang, Chi-Shiun; Shu, Wun-Yi; Fan, Tai-Ching; Hsu, Ian C.

    2014-01-01

    In daily life, humans are exposed to the extremely low-frequency electromagnetic fields (ELF-EMFs) generated by electric appliances, and public concern is increasing regarding the biological effects of such exposure. Numerous studies have yielded inconsistent results regarding the biological effects of ELF-EMF exposure. Here we show that ELF-EMFs activate the ATM-Chk2-p21 pathway in HaCaT cells, inhibiting cell proliferation. To present well-founded results, we comprehensively evaluated the biological effects of ELF-EMFs at the transcriptional, protein, and cellular levels. Human HaCaT cells from an immortalized epidermal keratinocyte cell line were exposed to a 1.5 mT, 60 Hz ELF-EMF for 144 h. The ELF-EMF could cause G1 arrest and decrease colony formation. Protein expression experiments revealed that ELF-EMFs induced the activation of the ATM/Chk2 signaling cascades. In addition, the p21 protein, a regulator of cell cycle progression at G1 and G2/M, exhibited a higher level of expression in exposed HaCaT cells compared with the expression of sham-exposed cells. The ELF-EMF-induced G1 arrest was diminished when the CHK2 gene expression (which encodes checkpoint kinase 2; Chk2) was suppressed by specific small interfering RNA (siRNA). These findings indicate that ELF-EMFs activate the ATM-Chk2-p21 pathway in HaCaT cells, resulting in cell cycle arrest at the G1 phase. Based on the precise control of the ELF-EMF exposure and rigorous sham-exposure experiments, all transcriptional, protein, and cellular level experiments consistently supported the conclusion. This is the first study to confirm that a specific pathway is triggered by ELF-EMF exposure. PMID:25111195

  2. Co-administration of plasmid-encoded granulocyte-macrophage colony-stimulating factor increases human immunodeficiency virus-1 DNA vaccine-induced polyfunctional CD4+ T-cell responses

    PubMed Central

    Santana, Vinicius Canato; Almeida, Rafael Ribeiro; Ribeiro, Susan Pereira; Ferreira, Luís Carlos de Souza; Kalil, Jorge; Rosa, Daniela Santoro; Cunha-Neto, Edecio

    2015-01-01

    T-cell based vaccines against human immunodeficiency virus (HIV) generate specific responses that may limit both transmission and disease progression by controlling viral load. Broad, polyfunctional, and cytotoxic CD4+T-cell responses have been associated with control of simian immunodeficiency virus/HIV-1 replication, supporting the inclusion of CD4+ T-cell epitopes in vaccine formulations. Plasmid-encoded granulocyte-macrophage colony-stimulating factor (pGM-CSF) co-administration has been shown to induce potent CD4+ T-cell responses and to promote accelerated priming and increased migration of antigen-specific CD4+ T-cells. However, no study has shown whether co-immunisation with pGM-CSF enhances the number of vaccine-induced polyfunctional CD4+ T-cells. Our group has previously developed a DNA vaccine encoding conserved, multiple human leukocyte antigen (HLA)-DR binding HIV-1 subtype B peptides, which elicited broad, polyfunctional and long-lived CD4+ T-cell responses. Here, we show that pGM-CSF co-immunisation improved both magnitude and quality of vaccine-induced T-cell responses, particularly by increasing proliferating CD4+ T-cells that produce simultaneously interferon-γ, tumour necrosis factor-α and interleukin-2. Thus, we believe that the use of pGM-CSF may be helpful for vaccine strategies focused on the activation of anti-HIV CD4+ T-cell immunity. PMID:26602876

  3. Current Status of Gene Engineering Cell Therapeutics

    PubMed Central

    Saudemont, Aurore; Jespers, Laurent; Clay, Timothy

    2018-01-01

    Ex vivo manipulations of autologous patient’s cells or gene-engineered cell therapeutics have allowed the development of cell and gene therapy approaches to treat otherwise incurable diseases. These modalities of personalized medicine have already shown great promises including product commercialization for some rare diseases. The transfer of a chimeric antigen receptor or T cell receptor genes into autologous T cells has led to very promising outcomes for some cancers, and particularly for hematological malignancies. In addition, gene-engineered cell therapeutics are also being explored to induce tolerance and regulate inflammation. Here, we review the latest gene-engineered cell therapeutic approaches being currently explored to induce an efficient immune response against cancer cells or viruses by engineering T cells, natural killer cells, gamma delta T cells, or cytokine-induced killer cells and to modulate inflammation using regulatory T cells. PMID:29459866

  4. Humoral and cell-mediated immune responses after a booster dose of HBV vaccine in HIV-infected children, adolescents and young adults.

    PubMed

    Giacomet, Vania; Masetti, Michela; Nannini, Pilar; Forlanini, Federica; Clerici, Mario; Zuccotti, Gian Vincenzo; Trabattoni, Daria

    2018-01-01

    HBV vaccine induces protective antibodies only in 23-56% of HIV-infected children. The aim of our study is to evaluate the immunologic effects of a booster dose of HBV vaccine in HIV-infected youth. 53 young HIV-infected patients in whom HBV vaccination did not elicit protective Ab titers were enrolled. All patients were on ART with optimal immunological and viral response. All patients received a booster dose of HBV vaccine (HBVAXPRO 10 μg i.m.). HBV-specific Ab titer, viral load and CD4+ T cells were measured at baseline (T0), T1, T6 and T12 months. In a subgroup of 16 patients HBV-specific cell mediated immune responses were evaluated at baseline, at T1 and T6. The booster dose induced seroconversion in 51% of patients at T1, 57% at T6, and49% at T12; seroconversion rate was significantly correlated with CD4+T cells at T0 and to the CD4 nadir. The booster dose induced HBV-specific cell mediated immunity at T6 mainly in Responders (Rs): Effector Memory CD8+T cells, HBV-specific TNFα-, IFNγ-, granzyme secreting CD8+ T cells and IL2-secreting CD4+ T cells were significantly increased in Rs compared to T0. In Non Responders (NRs), HBV-specific IL2-secreting CD4+ T cells, Central and Effector Memory CD8+ T cells were the only parameters modified at T6. Seroconversion induced by a booster dose of vaccine correlates with the development of T cell immunological memory in HIV-infected patients who did not respond to the standard immunization. Alternate immunization schedules need to be considered in NRs.

  5. Signaling of the ITK (interleukin 2-inducible T cell kinase)-SYK (spleen tyrosine kinase) fusion kinase is dependent on adapter SLP-76 and on the adapter function of the kinases SYK and ZAP70.

    PubMed

    Hussain, Alamdar; Mohammad, Dara K; Gustafsson, Manuela O; Uslu, Merve; Hamasy, Abdulrahman; Nore, Beston F; Mohamed, Abdalla J; Smith, C I Edvard

    2013-03-08

    The inducible T cell kinase-spleen tyrosine kinase (ITK-SYK) oncogene consists of the Tec homology-pleckstrin homology domain of ITK and the kinase domain of SYK, and it is believed to be the cause of peripheral T cell lymphoma. We and others have recently demonstrated that this fusion protein is constitutively tyrosine-phosphorylated and is transforming both in vitro and in vivo. To gain a deeper insight into the molecular mechanism(s) underlying its activation and signaling, we mutated a total of eight tyrosines located in the SYK portion of the chimera into either phenylalanine or to the negatively charged glutamic acid. Although mutations in the interdomain-B region affected ITK-SYK kinase activity, they only modestly altered downstream signaling events. In contrast, mutations that were introduced in the kinase domain triggered severe impairment of downstream signaling. Moreover, we show here that SLP-76 is critical for ITK-SYK activation and is particularly required for the ITK-SYK-dependent phosphorylation of SYK activation loop tyrosines. In Jurkat cell lines, we demonstrate that expression of ITK-SYK fusion requires an intact SLP-76 function and significantly induces IL-2 secretion and CD69 expression. Furthermore, the SLP-76-mediated induction of IL-2 and CD69 could be further enhanced by SYK or ZAP-70, but it was independent of their kinase activity. Notably, ITK-SYK expression in SYF cells phosphorylates SLP-76 in the absence of SRC family kinases. Altogether, our data suggest that ITK-SYK exists in the active conformation state and is therefore capable of signaling without SRC family kinases or stimulation of the T cell receptor.

  6. Signaling of the ITK (Interleukin 2-inducible T Cell Kinase)-SYK (Spleen Tyrosine Kinase) Fusion Kinase Is Dependent on Adapter SLP-76 and on the Adapter Function of the Kinases SYK and ZAP70*

    PubMed Central

    Hussain, Alamdar; Mohammad, Dara K.; Gustafsson, Manuela O.; Uslu, Merve; Hamasy, Abdulrahman; Nore, Beston F.; Mohamed, Abdalla J.; Smith, C. I. Edvard

    2013-01-01

    The inducible T cell kinase-spleen tyrosine kinase (ITK-SYK) oncogene consists of the Tec homology-pleckstrin homology domain of ITK and the kinase domain of SYK, and it is believed to be the cause of peripheral T cell lymphoma. We and others have recently demonstrated that this fusion protein is constitutively tyrosine-phosphorylated and is transforming both in vitro and in vivo. To gain a deeper insight into the molecular mechanism(s) underlying its activation and signaling, we mutated a total of eight tyrosines located in the SYK portion of the chimera into either phenylalanine or to the negatively charged glutamic acid. Although mutations in the interdomain-B region affected ITK-SYK kinase activity, they only modestly altered downstream signaling events. In contrast, mutations that were introduced in the kinase domain triggered severe impairment of downstream signaling. Moreover, we show here that SLP-76 is critical for ITK-SYK activation and is particularly required for the ITK-SYK-dependent phosphorylation of SYK activation loop tyrosines. In Jurkat cell lines, we demonstrate that expression of ITK-SYK fusion requires an intact SLP-76 function and significantly induces IL-2 secretion and CD69 expression. Furthermore, the SLP-76-mediated induction of IL-2 and CD69 could be further enhanced by SYK or ZAP-70, but it was independent of their kinase activity. Notably, ITK-SYK expression in SYF cells phosphorylates SLP-76 in the absence of SRC family kinases. Altogether, our data suggest that ITK-SYK exists in the active conformation state and is therefore capable of signaling without SRC family kinases or stimulation of the T cell receptor. PMID:23293025

  7. The ΔfbpA attenuated candidate vaccine from Mycobacterium tuberculosis, H37Rv primes for a stronger T-bet dependent Th1 immunity in mice.

    PubMed

    Roche, Cherie M; Smith, Amanda; Lindsey, Devin R; Meher, Akshay; Schluns, Kimberly; Arora, Ashish; Armitige, Lisa Y; Jagannath, Chinnaswamy

    2011-12-01

    The ΔfbpA candidate vaccine derived from Mycobacterium tuberculosis (H37Rv) (Mtb) protects mice better than BCG against tuberculosis, and we investigated the hypothesis that ΔfbpA may induce a stronger Th1 immunity. Since T-bet transcription factor regulates Th1 immunity, mice infected with ΔfbpA, BCG vaccine and related mycobacteria were analyzed for T-bet positive T cells. Mouse dendritic cells (DCs) or macrophages were also pulsed with excretory-secreted antigens (ES; Antigen-85B, ESAT-6 and CFP10) and cocultured with T cells from immunized or naïve mice and tested for in vitro induction of T-bet and IFN-γ. In both models, ΔfbpA mutant induced a stronger response of T-bet(+)CD4 T cells, which correlated with an increased expansion of IFN-γ(+)CD4 T cells in vivo and in vitro. When DCs pulsed with ES antigens were allowed to stimulate T cells, ESAT-6 and CFP-10 failed to induce a recall expansion of T-bet(+)IFN-γ(+)CD4 T cells from BCG vaccinated mice. Thus, deletion of RD1 in BCG seems to reduce its ability to induce T-bet and induce stronger Th1 immunity. Finally, mice were vaccinated with ΔfbpA and BCG and challenged with virulent Mtb for evaluation of protection and T cell expansion. ΔfbpA vaccinated mice showed a rapid and stronger expansion of CD4(+)CXCR3(+) IFN-γ(+) T cells in the lungs of Mtb challenged mice, compared to those which had BCG vaccine. ΔfbpA immunized mice also showed a better decline of the Mtb bacterial counts of the lungs. Mtb derived ΔfbpA candidate vaccine therefore induces qualitatively better T-bet dependent Th1 immunity than BCG vaccine. Copyright © 2011 Elsevier Ltd. All rights reserved.

  8. Single blood transfusion induces the production of donor-specific alloantibodies and regulatory T cells mainly in the spleen

    PubMed Central

    Kitazawa, Yusuke; Sawanobori, Yasushi; Ueno, Takamasa; Ueha, Satoshi; Matsushima, Kouji; Matsuno, Kenjiro

    2018-01-01

    Abstract Donor-specific blood transfusion is known to induce alloresponses and lead to immunosuppression. We examined their underlying mechanisms by employing fully allogeneic rat combinations. Transfused recipients efficiently produced alloantibodies of the IgM and IgG subclasses directed against donor class I MHC. The recipients exhibited active expansion of CD4+ T cells and CD4+FOXP3+ regulatory T cells (Treg cells), followed by CD45R+ B cells and IgM+ or IgG subclass+ antibody-forming cells mainly in the spleen. From 1.5 days, the resident MHCII+CD103+ dendritic cells (DCs) in the splenic T-cell area, periarterial lymphocyte sheath, formed clusters with recipient BrdU+ or 5-ethynyl-2′-deoxyuridine+ cells, from which the proliferative response of CD4+ T cells originated peaking at 3–4 days. Transfusion-induced antibodies had donor passenger cell-depleting activity in vitro and in vivo and could suppress acute GvH disease caused by donor T cells. Furthermore, Treg cells significantly suppressed mixed leukocyte reactions in a donor-specific manner. In conclusion, single blood transfusion efficiently induced a helper T-cell-dependent anti-donor class I MHC antibody-forming cell response with immunoglobulin class switching, and a donor-specific Treg cell response mainly in the spleen, probably by way of the indirect allorecognition via resident DCs. These antibodies and Treg cells may be involved, at least partly, in the donor-specific transfusion-induced suppression of allograft rejection. PMID:29361165

  9. Cutaneous sarcoidosis successfully treated with alefacept.

    PubMed

    Garcia-Zuazaga, Jorge; Korman, Neil J

    2006-01-01

    Sarcoidosis is a systemic granulomatous disease of unknown etiology that affects multiple organ systems, including the pulmonary, lymphatic, skeletal, and integumentary systems. Improved understanding of the intrinsic immunology and molecular biology in sarcoidosis can be applied to the treatment of this disease. Alefacept is a human fusion protein consisting of the extracellular domain of leukocyte function-associated antigen 3 fused with the Fc portion of human immunoglobulin G1. It works by blocking the interaction between antigen-presenting cells and T cells to inhibit activation and by inducing apoptosis of CD4+ T cells. In this case report, we describe a 46-year-old patient with recalcitrant lupus pernio who was successfully treated with alefacept. To determine whether T-cell inhibition, specifically the use of alefacept, may be used to treat a patient with recalcitrant cutaneous sarcoidosis. Case report. There was a modest clinical improvement after 8 weeks of intramuscular injections of alefacept. This case report provides further evidence of successful treatment of sarcoidosis with biologic agents directed against T-lymphocyte activation.

  10. Simian virus 40 small t antigen is not required for the maintenance of transformation but may act as a promoter (cocarcinogen) during establishment of transformation in resting rat cells.

    PubMed Central

    Seif, R; Martin, R G

    1979-01-01

    Simian virus 40 deletion mutants affecting the 20,000-dalton (20K) t antigen and tsA mutants rendering the 90K T antigen temperature sensitive, as well as double mutants containing both mutations, induced host DNA synthesis in resting rat cells at the restrictive temperature. Nonetheless, the deletion mutants and double mutants did not induce transformation in resting cells even at the permissive temperature. On the other hand, the deletion mutants did induce full transformants when actively growing rat cells were infected; the transformants grew efficiently in agar and to high saturation densities on platic. The double mutants did not induce T-antigen-independent (temperature-insensitive) transformants which were shown previously to arise preferentially from resting cells. Thus, small t antigen was dispensable for the maintenance of the transformed phenotype in T-antigen-dependent rat transformants (transformants derived from growing cells) and may play a role in the establishment of T-antigen-independent transformants. We attempt to establish a parallel between transformation induced by chemical carcinogens and simian virus 40-induced transformation. Images PMID:229274

  11. Simian virus 40 small t antigen is not required for the maintenance of transformation but may act as a promoter (cocarcinogen) during establishment of transformation in resting rat cells.

    PubMed

    Seif, R; Martin, R G

    1979-12-01

    Simian virus 40 deletion mutants affecting the 20,000-dalton (20K) t antigen and tsA mutants rendering the 90K T antigen temperature sensitive, as well as double mutants containing both mutations, induced host DNA synthesis in resting rat cells at the restrictive temperature. Nonetheless, the deletion mutants and double mutants did not induce transformation in resting cells even at the permissive temperature. On the other hand, the deletion mutants did induce full transformants when actively growing rat cells were infected; the transformants grew efficiently in agar and to high saturation densities on platic. The double mutants did not induce T-antigen-independent (temperature-insensitive) transformants which were shown previously to arise preferentially from resting cells. Thus, small t antigen was dispensable for the maintenance of the transformed phenotype in T-antigen-dependent rat transformants (transformants derived from growing cells) and may play a role in the establishment of T-antigen-independent transformants. We attempt to establish a parallel between transformation induced by chemical carcinogens and simian virus 40-induced transformation.

  12. Administration of sulfosuccinimidyl-4-[N-maleimidomethyl] cyclohexane-1-carboxylate conjugated GP100{sub 25–33} peptide-coupled spleen cells effectively mounts antigen-specific immune response against mouse melanoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Xiaoli; Xia, Chang-Qing, E-mail: cqx65@yahoo.com; Department of Pathology, Immunology and Laboratory Medicine, University of Florida, Gainesville, FL32610

    It remains a top research priority to develop immunotherapeutic approaches to induce potent antigen-specific immune responses against tumors. However, in spite of some promising results, most strategies are ineffective because they generate low numbers of tumor-reactive cytotoxic T lymphocytes (CTLs). Here we designed a strategy to enhance antigen-specific immune response via administering sulfosuccinimidyl-4-[N-maleimidomethyl] cyclohexane-1-carboxylate (sulfo-SMCC)-conjugated melanoma tumor antigen GP100{sub 25–33} peptide-coupled syngeneic spleen cells in a mouse model of melanoma. We found that infusion of GP100{sub 25–33} peptide-coupled spleen cells significantly attenuated the growth of melanoma in prophylactic and therapeutic immunizations. Consistent with these findings, the adoptive transfer of spleenmore » cells from immunized mice to naïve syngeneic mice was able to transfer anti-tumor effect, suggesting that GP100{sub 25–33} peptide-specific immune response was induced. Further studies showed that, CD8+ T cell proliferation and the frequency of interferon (IFN)-γ-producing CD8+ T cells upon ex vivo stimulation by GP100{sub 25–33} were significantly increased compared to control groups. Tumor antigen, GP100{sub 25–23} specific immune response was also confirmed by ELISpot and GP100-tetramer assays. This approach is simple, easy-handled, and efficiently delivering antigens to lymphoid tissues. Our study offers an opportunity for clinically translating this approach into tumor immunotherapy. - Highlights: • Infusion of GP100{sub 25–33}-coupled spleen cells leads to potent anti-melanoma immunity. • GP100{sub 25–33}-coupled spleen cell treatment induces antigen-specific IFN-γ-producing CD8 T cells. • This approach takes advantage of homing nature of immune cells.« less

  13. Absence of PDGF-induced, PKC-independent c-fos expression in a chemically transformed C3H/10T1/2 cell clone.

    PubMed

    Vassbotn, F S; Skar, R; Holmsen, H; Lillehaug, J R

    1992-09-01

    The effect of platelet-derived growth factor (PDGF) on c-fos mRNA transcription was studied in the immortalized mouse embryo fibroblast C3H/10T1/2 Cl 8 (10T1/2) cells and the chemically transformed, tumorigenic subclone C3H/10T1/2 Cl 16 (Cl 16). In the 10T1/2 cells as well as the Cl 16 subclone, the dose-dependent PDGF stimulation of c-fos mRNA synthesis was similar in both logarithmically growing and confluent cultures. c-fos mRNA was induced severalfold by 12-O-tetradecanoylphorbol-13-acetate (TPA) in both 10T1/2 and Cl 16. Down-regulation of protein kinase C (PKC) activity by TPA pretreatment inhibited PDGF-stimulated c-fos mRNA expression in Cl 16 cells but did not affect this induction in the 10T1/2 cells. This inhibition was not a general phenomenon of 3-methylcholanthrene-mediated transformation of 10T1/2 cells since experiments with another transformed 10T1/2 cell clone, C3H/10T1/2 TPA 482, gave qualitatively the same results as the 10T1/2 cells. Receptor binding experiments showed that the nontransformed and transformed cells had a comparable number of PDGF receptors, 1.3 x 10(5) and 0.7 x 10(5) receptors per cell, respectively. Furthermore, cAMP-induced c-fos expression induced by forskolin is formerly shown to be independent of PKC down-regulation. In our experiments, forskolin induced c-fos expression in both clones. However, PKC down-regulation inhibited the forskolin-induced c-fos expression in Cl 16 cells. This apparently demonstrates cross talk between PKC and PKA in the c-fos induction pathway. The present results provide evidence for an impaired mechanism for activating c-fos expression through PKC-independent, PDGF-induced signal transduction in the chemically transformed Cl 16 fibroblasts compared to that in nontransformed 10T1/2 cells.

  14. The non-classical MAP kinase ERK3 controls T cell activation.

    PubMed

    Marquis, Miriam; Boulet, Salix; Mathien, Simon; Rousseau, Justine; Thébault, Paméla; Daudelin, Jean-François; Rooney, Julie; Turgeon, Benjamin; Beauchamp, Claudine; Meloche, Sylvain; Labrecque, Nathalie

    2014-01-01

    The classical mitogen-activated protein kinases (MAPKs) ERK1 and ERK2 are activated upon stimulation of cells with a broad range of extracellular signals (including antigens) allowing cellular responses to occur. ERK3 is an atypical member of the MAPK family with highest homology to ERK1/2. Therefore, we evaluated the role of ERK3 in mature T cell response. Mouse resting T cells do not transcribe ERK3 but its expression is induced in both CD4⁺ and CD8⁺ T cells following T cell receptor (TCR)-induced T cell activation. This induction of ERK3 expression in T lymphocytes requires activation of the classical MAPK ERK1 and ERK2. Moreover, ERK3 protein is phosphorylated and associates with MK5 in activated primary T cells. We show that ERK3-deficient T cells have a decreased proliferation rate and are impaired in cytokine secretion following in vitro stimulation with low dose of anti-CD3 antibodies. Our findings identify the atypical MAPK ERK3 as a new and important regulator of TCR-induced T cell activation.

  15. The Non-Classical MAP Kinase ERK3 Controls T Cell Activation

    PubMed Central

    Mathien, Simon; Rousseau, Justine; Thébault, Paméla; Daudelin, Jean-François; Rooney, Julie; Turgeon, Benjamin; Beauchamp, Claudine; Meloche, Sylvain; Labrecque, Nathalie

    2014-01-01

    The classical mitogen-activated protein kinases (MAPKs) ERK1 and ERK2 are activated upon stimulation of cells with a broad range of extracellular signals (including antigens) allowing cellular responses to occur. ERK3 is an atypical member of the MAPK family with highest homology to ERK1/2. Therefore, we evaluated the role of ERK3 in mature T cell response. Mouse resting T cells do not transcribe ERK3 but its expression is induced in both CD4+ and CD8+ T cells following T cell receptor (TCR)-induced T cell activation. This induction of ERK3 expression in T lymphocytes requires activation of the classical MAPK ERK1 and ERK2. Moreover, ERK3 protein is phosphorylated and associates with MK5 in activated primary T cells. We show that ERK3-deficient T cells have a decreased proliferation rate and are impaired in cytokine secretion following in vitro stimulation with low dose of anti-CD3 antibodies. Our findings identify the atypical MAPK ERK3 as a new and important regulator of TCR-induced T cell activation. PMID:24475167

  16. Pivotal Advance: Heme oxygenase 1 expression by human CD4+ T cells is not sufficient for their development of immunoregulatory capacity.

    PubMed

    Biburger, Markus; Theiner, Gabi; Schädle, Mirjam; Schuler, Gerold; Tiegs, Gisa

    2010-02-01

    HO-1 is the only inducible one of three isoenzymes that catalyzes the oxidative degradation of heme. HO-1 is inducible by various cellular stress factors and exerts cytoprotective and immunomodulatory effects. Recent publications demonstrated that HO-1 is constitutively expressed by CD4(+)CD25(+) T(regs) and induced in CD4(+)CD25(-) T cells upon FoxP3 transfection. Here, we investigated whether HO-1 was essential and sufficient for human T(regs) to exert immunosuppression in vitro. PGJ(2) induced pronounced expression of HO-1 in CD4(+)CD25(-) T cells without accompanying FoxP3 induction. Treatment of CD4(+)CD25(-) T cells with PGJ(2) decreased their proliferation, whereas the HO-1 inhibitor SnPP enhanced the proliferation of HO-1-expressing T(regs), suggesting that HO-1 may modulate the proliferative capacity of T lymphocytes. HO-1 modulation by SnPP treatment of T(regs) or PGJ(2) treatment of CD4(+)CD25(-) T cells neither suppressed nor induced immune-modulatory function in these cells, respectively, as measured by responder-cell proliferation and/or IL-2 production. In summary, these data suggest that HO-1 expression by T(regs) might contribute to their typical reluctance to proliferate but does not account independently for their suppressive functions.

  17. Modulation of surgical fibrosis by microbial zwitterionic polysaccharides

    NASA Astrophysics Data System (ADS)

    Ruiz-Perez, Begonia; Chung, Doo R.; Sharpe, Arlene H.; Yagita, Hideo; Kalka-Moll, Wiltrud M.; Sayegh, Mohamed H.; Kasper, Dennis L.; Tzianabos, Arthur O.

    2005-11-01

    Bacterial carbohydrates have long been considered T cell-independent antigens that primarily induce humoral immune responses. Recently, it has been demonstrated that bacterial capsules that possess a zwitterionic charge motif can activate CD4+ T cells after processing and presentation by antigen-presenting cells. Here we show that these zwitterionic polysaccharides can prevent T helper 1-mediated fibrosis by signaling for the release of IL-10 from CD4+ T cells in vivo. IL-10 production by these T cells and their ability to prevent fibrosis is controlled by the inducible costimulator (ICOS)-ICOS ligand pathway. These data demonstrate that the interaction of the zwitterionic polysaccharides with T cells results in modulation of surgical fibrosis in vivo and suggest a previously undescribed approach to "harnessing" T cell function to prevent inflammatory tissue disorders in humans. IL-10 | microbial polysaccharides | inducible costimulator

  18. Tolerogenic dendritic cells inhibit antiphospholipid syndrome derived effector/memory CD4⁺ T cell response to β2GPI.

    PubMed

    Torres-Aguilar, Honorio; Blank, Miri; Kivity, Shaye; Misgav, Mudi; Luboshitz, Jacob; Pierangeli, Silvia S; Shoenfeld, Yehuda

    2012-01-01

    The importance of β(2)-glycoprotein I (β(2)GPI)-specific CD4(+) T cells in the development of pathogenic processes in patients with antiphospholipid syndrome (APS) and APS mouse models is well established. Therefore, our objective is to manipulate the β2GPI specific CD4(+) T cells using tolerogenic dendritic cells (tDCs) to induce tolerance. We aim to evaluate the capability of tDCs to induce antigen-specific tolerance in effector/memory T cells from patients with APS and to elucidate the involved mechanism. DCs and tDCs were produced from patients with APS peripheral-blood-monocytes, using specific cytokines. β(2)GPI-specific tolerance induction was investigated by coculturing control DC (cDC) or tDC, β(2)GPI-loaded, with autologous effector/memory T cells, evaluating the proliferative response, phenotype, cytokines secretion, viability and regulatory T cells. Human monocyte-derived DCs treated with interleukin (IL)-10 and transforming growth factor β-1 (10/TGF-DC) induced β(2)GPI-specific-unresponsiveness in effector/memory CD4(+) T cells (46.5% ± 26.0 less proliferation) in 16 of 20 analysed patients with APS, without affecting the proliferative response to an unrelated candidin. In five analysed patients, 10/TGF-DC-stimulated T cells acquired an IL-2(low)interferon γ(low)IL-10(high) cytokine profile, with just a propensity to express higher numbers of Foxp3(+)CTLA-4(+) cells, but with an evident suppressive ability. In four of 10 analysed patients, 10/TGF-DC-stimulated T cell hyporesponsiveness could not be reverted and showed higher percentages of late apoptosis, p<0.02. The inherent tolerance induction resistance of activated T cells present during the development of autoimmune diseases has delayed the application of tDC as an alternative therapy. This study highlights the 10/TGF-DC feasibility to induce antigen-specific unresponsiveness in autoreactive T cells generated in patients with APS by inducing apoptosis or T cells with regulatory abilities.

  19. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  20. High Rate of Induction of Human Autologous Cytotoxic T Lymphocytes against Renal Carcinoma Cells Cultured with an Interleukin Cocktail

    PubMed Central

    Liu, Shu Qin; Kawai, Koji; Shiraiwa, Hiroshi; Hayashi, Hitoshi; Akaza, Hideyuki; Hashizaki, Kazuko; Shiba, Reiko; Saijo, Kaoru

    1998-01-01

    A high rate of induction (9 of 10 cases) of human autologous cytotoxic T lymphocytes (CTL) was achieved in vitro from peripheral blood mononuclear cells of renal carcinoma patients by applying an interleukin (IL)‐cocktail consisting of IL‐1, ‐2, ‐4, and ‐6. The CTL specifically lysed their own target carcinoma cells within 24 h but did not kill neighboring autologous normal kidney cells or allogeneic renal cancer cell lines. In the case of TUHR4TKB, for which autologous CTL were not induced, no expression of MHC class‐I molecules was observed on the surface of these carcinoma cells, although they were sensitive to autologous natural killer cells. The results imply that adoptive immunotherapy for metastasized renal carcinoma will be feasible with autologous CTL in combination with natural killer cells. PMID:9914789

  1. The pyrimidin analogue cyclopentenyl cytosine induces alloantigen-specific non-responsiveness of human T lymphocytes

    PubMed Central

    Nikolaeva, N; Bemelman, F J; Yong, S-L; Verschuur, A; van Lier, R A W; ten Berge, I J M

    2008-01-01

    Cyclopentenyl cytosine (CPEC) has been shown to induce apoptosis in human T lymphoblastic cell lines and T cells from leukaemia patients. In this study we have addressed the question of whether CPEC is able to decrease proliferation and effector functions of human alloresponsive T lymphocytes and induce T cell anergy. The proliferative capacity of human peripheral blood mononuclear cells in response to allogeneic stimulation was measured by 5,6-carboxy-succinimidyl-diacetate-fluorescein-ester staining. Flow cytometric analysis was performed using surface CD4, CD8, CD25, CD103 and intracellular perforin, granzyme A, granzyme B, caspase-3 and forkhead box P3 (FoxP3) markers. The in vivo immunosuppressive capacity was tested in a murine skin graft model. Addition of CPEC at a concentration of 20 nM strongly decreased the expansion and cytotoxicity of alloreactive T cells. Specific restimulation in the absence of CPEC showed that the cells became anergic. The drug induced caspase-dependent apoptosis of alloreactive T lymphocytes. Finally, CPEC increased the percentage of CD25high FoxP3+ CD4+ and CD103+ CD8+ T cells, and potentiated the effect of rapamycin in increasing the numbers of alloreactive regulatory T cells. Treatment with CPEC of CBA/CA mice transplanted with B10/Br skin grafts significantly prolonged graft survival. We conclude that CPEC inhibits proliferation and cytotoxicity of human alloreactive T cells and induces alloantigen non-responsiveness in vitro. PMID:18062797

  2. Thy1+IL-7+ lymphatic endothelial cells in iBALT provide a survival niche for memory T-helper cells in allergic airway inflammation

    PubMed Central

    Shinoda, Kenta; Hirahara, Kiyoshi; Iinuma, Tomohisa; Ichikawa, Tomomi; Suzuki, Akane S.; Sugaya, Kaoru; Tumes, Damon J.; Yamamoto, Heizaburo; Hara, Takahiro; Tani-ichi, Shizue; Ikuta, Koichi; Okamoto, Yoshitaka; Nakayama, Toshinori

    2016-01-01

    Memory CD4+ T helper (Th) cells are central to long-term protection against pathogens, but they can also be pathogenic and drive chronic inflammatory disorders. How these pathogenic memory Th cells are maintained, particularly at sites of local inflammation, remains unclear. We found that ectopic lymphoid-like structures called inducible bronchus-associated lymphoid tissue (iBALT) are formed during chronic allergic inflammation in the lung, and that memory-type pathogenic Th2 (Tpath2) cells capable of driving allergic inflammation are maintained within the iBALT structures. The maintenance of memory Th2 cells within iBALT is supported by Thy1+IL-7–producing lymphatic endothelial cells (LECs). The Thy1+IL-7–producing LECs express IL-33 and T-cell–attracting chemokines CCL21 and CCL19. Moreover, ectopic lymphoid structures consisting of memory CD4+ T cells and IL-7+IL-33+ LECs were found in nasal polyps of patients with eosinophilic chronic rhinosinusitis. Thus, Thy1+IL-7–producing LECs control chronic allergic airway inflammation by providing a survival niche for memory-type Tpath2 cells. PMID:27140620

  3. In situ induction of dendritic cell–based T cell tolerance in humanized mice and nonhuman primates

    PubMed Central

    Jung, Kyeong Cheon; Jeon, Yoon Kyung; Ban, Young Larn; Min, Hye Sook; Kim, Eun Ji; Kim, Ju Hyun; Kang, Byung Hyun; Bae, Youngmee; Yoon, Il-Hee; Kim, Yong-Hee; Lee, Jae-Il; Kim, Jung-Sik; Shin, Jun-Seop; Yang, Jaeseok; Kim, Sung Joo; Rostlund, Emily; Muller, William A.

    2011-01-01

    Induction of antigen-specific T cell tolerance would aid treatment of diverse immunological disorders and help prevent allograft rejection and graft versus host disease. In this study, we establish a method of inducing antigen-specific T cell tolerance in situ in diabetic humanized mice and Rhesus monkeys receiving porcine islet xenografts. Antigen-specific T cell tolerance is induced by administration of an antibody ligating a particular epitope on ICAM-1 (intercellular adhesion molecule 1). Antibody-mediated ligation of ICAM-1 on dendritic cells (DCs) led to the arrest of DCs in a semimature stage in vitro and in vivo. Ablation of DCs from mice completely abrogated anti–ICAM-1–induced antigen-specific T cell tolerance. T cell responses to unrelated antigens remained unaffected. In situ induction of DC-mediated T cell tolerance using this method may represent a potent therapeutic tool for preventing graft rejection. PMID:22025302

  4. T cell-replacing factor for glucocorticosteroid-induced immunoglobulin production. A unique steroid-dependent cytokine

    PubMed Central

    1983-01-01

    Glucocorticosteroids (GCS) added to otherwise unstimulated cultures of human peripheral blood mononuclear cells (PBMC) induce the synthesis and secretion of all classes of immunoglobulin. The magnitude of this response is similar to that seen with other polyclonal B cell activators such as pokeweed mitogen (PWM), and like that of PWM, the steroid effect is dependent on both T cells and monocytes. To determine the cellular target for GCS in these cultures, separated populations of T cells and non-T cells were preincubated with steroids and then recombined. No immunoglobulin was produced in any of these preincubation experiments. As a different approach to this question, supernatants were collected from various cell populations following stimulation with PWM, concanavalin A (Con A), phytohemagglutinin (PHA), alloantigens, or GCS. These supernatants were tested for their effects on GCS-induced Ig production by B cells. Supernatants from 3-d cultures of unstimulated, as well as GCS-treated, PBMC contained a T cell- replacing factor that permitted T-depleted PBMC to produce Ig upon steroid stimulation. This supernatant factor (TRF-S) could be produced in the absence of steroid stimulation, but both the factor and GCS were necessary for the induction of Ig synthesis. Production of the TRF-S required the presence of both T cells and adherent cells in culture and was found in the highest concentrations at 3-4 d of culture. Supernatants from cultures stimulated with PWM, PHA, Con A, and alloantigens did not contain detectable TRF-S activity, and TRF-S was unable to replace helper T cells for PWM-induced Ig production. TRF-S required the presence of adherent cells in the T cell-depleted responder population for its action. Further, it was effective in inducing Ig production along with GCS in the presence of a sufficient concentration of cyclosporin A to block all T cell helper activity for primary responses of PBMC to PWM or GCS. TRF-S was inactivated by trypsin treatment, heating to 56 degrees C, freezing, lyophilization, and storage at 4 degrees C for greater than 3 wk. Its molecular weight is probably 10,000 daltons or more, since TRF-S activity is not rapidly dialyzable. These experiments indicate that GCS-induced Ig production by human B cells does not require the presence of intact T cells in the cultures and therefore the steroids are not exerting their influence directly on T suppressor or T helper cells. Furthermore, they demonstrate a previously unrecognized cytokine that induces the differentiation of human B cells to Ig production in the presence of GCS. PMID:6605406

  5. Staphylococcus aureus infection of mice expands a population of memory γδ T cells that are protective against subsequent infection

    PubMed Central

    Murphy, Alison G.; O’Keeffe, Kate M.; Lalor, Stephen J.; Maher, Belinda M.; Mills, Kingston H. G.; McLoughlin, Rachel M.

    2014-01-01

    The development of vaccines against S. aureus has consistently failed in clinical trials, likely due to inefficient induction of cellular immunity. T cell-derived IL-17 is one of the few known correlates of anti-staphyloccoal immunity, conferring protection against S. aureus infections through its ability to promote phagocytic cell effector functions. A comprehensive understanding of the discrete T cell subsets critical for site-specific IL-17-mediated bacterial clearance will therefore be necessary to inform the development of vaccines that efficiently target cellular immunity. In this study, we have identified a population of CD44+CD27− memory γδ T cells, expanded upon infection of C57BL/6 mice with S. aureus, which produce high levels of IL-17 and mediate enhanced bacterial clearance upon re-infection with the bacterium. These cells are comprised largely of the Vγ4+ subset and accumulate at the site of infection subsequent to an initial Vγ1.1+ and Vγ2+ T cell response. Moreover, these Vγ4+ T cells are retained in the peritoneum and draining mediastinal lymph nodes for a prolonged period following bacterial clearance. In contrast to its critical requirement for γδ T cell activation during the primary infection, IL-1 signalling was dispensable for activation and expansion of memory γδ T cells upon re-exposure to S. aureus. Our findings demonstrate that a γδ T cell memory response can be induced upon exposure to S. aureus, in a fashion analogous to that associated with classical αβ T cells, and suggest that induction of IL-17-expressing γδ T cells may be an important property of a protective vaccine against S. aureus. PMID:24623128

  6. MyD88-dependent expansion of an immature GR-1+CD11b+ population induces T cell suppression and Th2 polarization in sepsis

    PubMed Central

    Delano, Matthew J.; Scumpia, Philip O.; Weinstein, Jason S.; Coco, Dominique; Nagaraj, Srinivas; Kelly-Scumpia, Kindra M.; O'Malley, Kerri A.; Wynn, James L.; Antonenko, Svetlana; Al-Quran, Samer Z.; Swan, Ryan; Chung, Chun-Shiang; Atkinson, Mark A.; Ramphal, Reuben; Gabrilovich, Dmitry I.; Reeves, Wesley H.; Ayala, Alfred; Phillips, Joseph; LaFace, Drake; Heyworth, Paul G.; Clare-Salzler, Michael; Moldawer, Lyle L.

    2007-01-01

    Polymicrobial sepsis alters the adaptive immune response and induces T cell suppression and Th2 immune polarization. We identify a GR-1+CD11b+ population whose numbers dramatically increase and remain elevated in the spleen, lymph nodes, and bone marrow during polymicrobial sepsis. Phenotypically, these cells are heterogeneous, immature, predominantly myeloid progenitors that express interleukin 10 and several other cytokines and chemokines. Splenic GR-1+ cells effectively suppress antigen-specific CD8+ T cell interferon (IFN) γ production but only modestly suppress antigen-specific and nonspecific CD4+ T cell proliferation. GR-1+ cell depletion in vivo prevents both the sepsis-induced augmentation of Th2 cell–dependent and depression of Th1 cell–dependent antibody production. Signaling through MyD88, but not Toll-like receptor 4, TIR domain–containing adaptor-inducing IFN-β, or the IFN-α/β receptor, is required for complete GR-1+CD11b+ expansion. GR-1+CD11b+ cells contribute to sepsis-induced T cell suppression and preferential Th2 polarization. PMID:17548519

  7. CD30 induction of human immunodeficiency virus gene transcription is mediated by TRAF2

    PubMed Central

    Tsitsikov, Erdyni N.; Wright, Dowain A.; Geha, Raif S.

    1997-01-01

    CD30 is a member of the tumor necrosis factor receptor (TNFR) superfamily expressed on activated T and B lymphocytes and natural killer cells. Ligation of CD30 was previously shown to induce NF-κB activation and HIV expression in chronically infected T lymphocytes. In this study, we report that two members of the TNFR-associated factor (TRAF) family of proteins, TRAF1 and TRAF2, independently bind to the intracellular domain of CD30 (CD30IC). Transient overexpression of TRAF2, but not TRAF1, induced NF-κB activation and HIV-1-long terminal repeat-driven transcription in the T cell line, KT3. Moreover, dominant negative mutants consisting of the TRAF domain of TRAF1 and TRAF2 inhibited CD30 induction of NF-κB activation and HIV-1 transcription. These results suggest that CD30 ligation may enhance the expression of HIV via TRAF-2-mediated activation of NF-κB. PMID:9037063

  8. Differential Requirements for T Cells in Viruslike Particle- and Rotavirus-Induced Protective Immunity▿

    PubMed Central

    Blutt, Sarah E.; Warfield, Kelly L.; Estes, Mary K.; Conner, Margaret E.

    2008-01-01

    Correlates of protection from rotavirus infection are controversial. We compared the roles of B and T lymphocytes in protective immunity induced either by intranasally administered nonreplicating viruslike particles or inactivated virus or by orally administered murine rotavirus. We found that protection induced by nonreplicating vaccines requires CD4+ T cells and CD40/CD40L. In contrast, T cells were not required for short-term protective immunity induced by infection, but both T-cell-dependent and -independent mechanisms contributed to long-term maintenance of protection. Our findings indicate that more than one marker of protective immunity exists and that these markers depend on the vaccine that is administered. PMID:18184712

  9. Ghrelin inhibits proliferation and increases T-type Ca{sup 2+} channel expression in PC-3 human prostate carcinoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Diaz-Lezama, Nundehui; Hernandez-Elvira, Mariana; Sandoval, Alejandro

    Research highlights: {yields} Ghrelin decreases prostate carcinoma PC-3 cells proliferation. {yields} Ghrelin favors apoptosis in PC-3 cells. {yields} Ghrelin increase in intracellular free Ca{sup 2+} levels in PC-3 cells. {yields} Grelin up-regulates expression of T-type Ca{sup 2+} channels in PC-3 cells. {yields} PC-3 cells express T-channels of the Ca{sub V}3.1 and Ca{sub V}3.2 subtype. -- Abstract: Ghrelin is a multifunctional peptide hormone with roles in growth hormone release, food intake and cell proliferation. With ghrelin now recognized as important in neoplastic processes, the aim of this report is to present findings from a series of in vitro studies evaluating themore » cellular mechanisms involved in ghrelin regulation of proliferation in the PC-3 human prostate carcinoma cells. The results showed that ghrelin significantly decreased proliferation and induced apoptosis. Consistent with a role in apoptosis, an increase in intracellular free Ca{sup 2+} levels was observed in the ghrelin-treated cells, which was accompanied by up-regulated expression of T-type voltage-gated Ca{sup 2+} channels. Interestingly, T-channel antagonists were able to prevent the effects of ghrelin on cell proliferation. These results suggest that ghrelin inhibits proliferation and may promote apoptosis by regulating T-type Ca{sup 2+} channel expression.« less

  10. Cord-Blood-Derived Mesenchymal Stromal Cells Downmodulate CD4+ T-Cell Activation by Inducing IL-10-Producing Th1 Cells

    PubMed Central

    Selleri, Silvia; Dieng, Mame Massar; Nicoletti, Simon; Louis, Isabelle; Beausejour, Christian; Le Deist, Françoise

    2013-01-01

    The mechanisms by which mesenchymal stromal cells (MSCs) induce immunomodulation are still poorly understood. In the current work, we show by a combination of polymerase chain reaction (PCR) array, flow cytometry, and multiplex cytokine data analysis that during the inhibition of an alloantigen-driven CD4+ T-cell response, MSCs induce a fraction of CD4+ T-cells to coexpress interferon-γ (IFNγ) and interleukin-10 (IL-10). This CD4+ IFNγ+ IL-10+ cell population shares properties with recently described T-cells originating from switched Th1 cells that start producing IL-10 and acquire a regulatory function. Here we report that IL-10-producing Th1 cells accumulated with time during T-cell stimulation in the presence of MSCs. Moreover, MSCs caused stimulated T-cells to downregulate the IFNγ receptor (IFNγR) without affecting IL-10 receptor expression. Further, the inhibitory effect of MSCs could be reversed by an anti-IFNγR-blocking antibody, indicating that IFNγ is one of the major players in MSC-induced T-cell suppression. Stimulated (and, to a lesser extent, resting) CD4+ T-cells treated with MSCs were able to inhibit the proliferation of autologous CD4+ T-cells, demonstrating their acquired regulatory properties. Altogether, our results suggest that the generation of IL-10-producing Th1 cells is one of the mechanisms by which MSCs can downmodulate an immune response. PMID:23167734

  11. In vitro effects of 4-hydroperoxycyclophosphamide on human immunoregulatory T subset function. I. Selective effects on lymphocyte function in T-B cell collaboration.

    PubMed

    Ozer, H; Cowens, J W; Colvin, M; Nussbaum-Blumenson, A; Sheedy, D

    1982-01-01

    The alkylating agent cyclophosphamide may suppress or enhance immune responses in vivo but is inactive in vitro unless metabolized by microsomal enzyme activation. 4-hydroperoxycyclophosphamide (4-HC) is a synthetic compound that is spontaneously converted in aqueous solution to the active metabolites. In this report, we examined the in vitro sensitivity of functional human T cell subsets to 4-HC in a polyclonal B cell differentiation assay and in the generation of mitogen-induced suppressor cells for effector B cell function. Con A-induced T suppression of B cell differentiation is completely abrogated by a 1-h pretreatment of T cells at very low concentrations of between 10(-2) and 20 nmol/ml, whereas inducer T cell function is sensitive only to concentrations in greater than 40 nmol/ml. The effects of 4-HC on suppressor T cells appear to occur at concentrations that do not result in DNA cross-linking or decreased blastogenesis. Con A-induced T suppressors are generated from within the OKT4+, OKT8- subset and are sensitive to low-dose 4-HC only before activation, whereas differentiated suppressor cells are resistant to concentrations in greater than 80 nmol/ml. Low-dose 4-HC pretreatment of the B cell population results in abrogation of immunoglobulin secretion when treated B cells are cocultured with unfractionated T cells, however, this effect is completely reversible if pretreated B cells are cocultured with T cells devoid of suppressor activity. These results demonstrate that human presuppressor cells for B-effector function differentiate in response to Con A from the OKT4+, OKT8- subset and are exquisitely sensitive to low concentrations of CYP whereas mature suppressor and inducer functions are resistant to all but very high concentrations in vitro. The differential sensitivity of functional T and B cell subsets to 4-HC in vitro can be a very useful probe in dissecting immunoregulatory interactions with man.

  12. Regulation of allergic airway inflammation by adoptive transfer of CD4+ T cells preferentially producing IL-10.

    PubMed

    Matsuda, Masaya; Doi, Kana; Tsutsumi, Tatsuya; Fujii, Shinya; Kishima, Maki; Nishimura, Kazuma; Kuroda, Ikue; Tanahashi, Yu; Yuasa, Rino; Kinjo, Toshihiko; Kuramoto, Nobuyuki; Mizutani, Nobuaki; Nabe, Takeshi

    2017-10-05

    Anti-inflammatory pharmacotherapy for asthma has mainly depended on the inhalation of glucocorticoids, which non-specifically suppress immune responses. If the anti-inflammatory cytokine interleukin (IL)-10 can be induced by a specific antigen, asthmatic airway inflammation could be suppressed when individuals are exposed to the antigen. The purpose of this study was to develop cellular immunotherapeutics for atopic diseases using IL-10-producing CD4 + T cells. Spleen cells isolated from ovalbumin (OVA)-sensitized mice were cultured with the antigen, OVA and growth factors, IL-21, IL-27 and TGF-β for 7 days. After the 7-day culture, the CD4 + T cells were purified using a murine CD4 magnetic beads system. When the induced CD4 + T cells were stimulated by OVA in the presence of antigen-presenting cells, IL-10 was preferentially produced in vitro. When CD4 + T cells were adoptively transferred to OVA-sensitized mice followed by intratracheal OVA challenges, IL-10 was preferentially produced in the serum and bronchoalveolar lavage fluid in vivo. IL-10 production coincided with the inhibition of eosinophilic airway inflammation and epithelial mucus plugging. Most of the IL-10-producing CD4 + T cells were negative for Foxp3 and GATA-3, transcription factors of naturally occurring regulatory T cells and Th2 cells, respectively, but double positive for LAG-3 and CD49b, surface markers of inducible regulatory T cells, Tr1 cells. Collectively, most of the induced IL-10-producing CD4 + T cells could be Tr1 cells, which respond to the antigen to produce IL-10, and effectively suppressed allergic airway inflammation. The induced Tr1 cells may be useful for antigen-specific cellular immunotherapy for atopic diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Structural Elements Recognized by Abacavir-Induced T Cells.

    PubMed

    Yerly, Daniel; Pompeu, Yuri Andreiw; Schutte, Ryan J; Eriksson, Klara K; Strhyn, Anette; Bracey, Austin W; Buus, Soren; Ostrov, David A

    2017-07-07

    Adverse drug reactions are one of the leading causes of morbidity and mortality in health care worldwide. Human leukocyte antigen (HLA) alleles have been strongly associated with drug hypersensitivities, and the causative drugs have been shown to stimulate specific T cells at the sites of autoimmune destruction. The structural elements recognized by drug-specific T cell receptors (TCRs) in vivo are poorly defined. Drug-stimulated T cells express TCRs specific for peptide/HLA complexes, but the characteristics of peptides (sequence, or endogenous or exogenous origin) presented in the context of small molecule drugs are not well studied. Using HLA-B*57:01 mediated hypersensitivity to abacavir as a model system, this study examines structural similarities of HLA presented peptides recognized by drug-specific TCRs. Using the crystal structure of HLA-B*57:01 complexed with abacavir and an immunogenic self peptide, VTTDIQVKV SPT5a 976-984, peptide side chains exhibiting flexibility and solvent exposure were identified as potential drug-specific T cell recognition motifs. Viral sequences with structural motifs similar to the immunogenic self peptide were identified. Abacavir-specific T cell clones were used to determine if virus peptides presented in the context of abacavir stimulate T cell responsiveness. An abacavir-specific T cell clone was stimulated by VTQQAQVRL, corresponding to HSV1/2 230-238, in the context of HLA-B*57:01. These data suggest the T cell polyclonal response to abacavir consists of multiple subsets, including T cells that recognize self peptide/HLA-B*57:01 complexes and crossreact with viral peptide/HLA-B*57:01 complexes due to similarity in TCR contact residues.

  14. Tolerance and Exhaustion: Defining Mechanisms of T cell Dysfunction

    PubMed Central

    Schietinger, Andrea; Greenberg, Philip D.

    2013-01-01

    CD8 T cell activation and differentiation is tightly controlled, and dependent on the context in which naïve T cells encounter antigen, can either result in functional memory or T cell dysfunction, including exhaustion, tolerance, anergy, or senescence. With the identification of phenotypic and functional traits shared in different settings of T cell dysfunction, distinctions between such dysfunctional `states' have become blurred. Here, we discuss distinct states of CD8 T cell dysfunction, with emphasis on (i) T cell tolerance to self-antigens (self-tolerance), (ii) T cell exhaustion during chronic infections, and (iii) tumor-induced T cell dysfunction. We highlight recent findings on cellular and molecular characteristics defining these states, cell-intrinsic regulatory mechanisms that induce and maintain them, and strategies that can lead to their reversal. PMID:24210163

  15. Blood CXCR3+ CD4 T Cells Are Enriched in Inducible Replication Competent HIV in Aviremic Antiretroviral Therapy-Treated Individuals

    PubMed Central

    Banga, Riddhima; Procopio, Francesco A.; Ruggiero, Alessandra; Noto, Alessandra; Ohmiti, Khalid; Cavassini, Matthias; Corpataux, Jean-Marc; Paxton, William A.; Pollakis, Georgios; Perreau, Matthieu

    2018-01-01

    We recently demonstrated that lymph nodes (LNs) PD-1+/T follicular helper (Tfh) cells from antiretroviral therapy (ART)-treated HIV-infected individuals were enriched in cells containing replication competent virus. However, the distribution of cells containing inducible replication competent virus has been only partially elucidated in blood memory CD4 T-cell populations including the Tfh cell counterpart circulating in blood (cTfh). In this context, we have investigated the distribution of (1) total HIV-infected cells and (2) cells containing replication competent and infectious virus within various blood and LN memory CD4 T-cell populations of conventional antiretroviral therapy (cART)-treated HIV-infected individuals. In the present study, we show that blood CXCR3-expressing memory CD4 T cells are enriched in cells containing inducible replication competent virus and contributed the most to the total pool of cells containing replication competent and infectious virus in blood. Interestingly, subsequent proviral sequence analysis did not indicate virus compartmentalization between blood and LN CD4 T-cell populations, suggesting dynamic interchanges between the two compartments. We then investigated whether the composition of blood HIV reservoir may reflect the polarization of LN CD4 T cells at the time of reservoir seeding and showed that LN PD-1+ CD4 T cells of viremic untreated HIV-infected individuals expressed significantly higher levels of CXCR3 as compared to CCR4 and/or CCR6, suggesting that blood CXCR3-expressing CD4 T cells may originate from LN PD-1+ CD4 T cells. Taken together, these results indicate that blood CXCR3-expressing CD4 T cells represent the major blood compartment containing inducible replication competent virus in treated aviremic HIV-infected individuals. PMID:29459864

  16. Blood CXCR3+ CD4 T Cells Are Enriched in Inducible Replication Competent HIV in Aviremic Antiretroviral Therapy-Treated Individuals.

    PubMed

    Banga, Riddhima; Procopio, Francesco A; Ruggiero, Alessandra; Noto, Alessandra; Ohmiti, Khalid; Cavassini, Matthias; Corpataux, Jean-Marc; Paxton, William A; Pollakis, Georgios; Perreau, Matthieu

    2018-01-01

    We recently demonstrated that lymph nodes (LNs) PD-1 + /T follicular helper (Tfh) cells from antiretroviral therapy (ART)-treated HIV-infected individuals were enriched in cells containing replication competent virus. However, the distribution of cells containing inducible replication competent virus has been only partially elucidated in blood memory CD4 T-cell populations including the Tfh cell counterpart circulating in blood (cTfh). In this context, we have investigated the distribution of (1) total HIV-infected cells and (2) cells containing replication competent and infectious virus within various blood and LN memory CD4 T-cell populations of conventional antiretroviral therapy (cART)-treated HIV-infected individuals. In the present study, we show that blood CXCR3-expressing memory CD4 T cells are enriched in cells containing inducible replication competent virus and contributed the most to the total pool of cells containing replication competent and infectious virus in blood. Interestingly, subsequent proviral sequence analysis did not indicate virus compartmentalization between blood and LN CD4 T-cell populations, suggesting dynamic interchanges between the two compartments. We then investigated whether the composition of blood HIV reservoir may reflect the polarization of LN CD4 T cells at the time of reservoir seeding and showed that LN PD-1 + CD4 T cells of viremic untreated HIV-infected individuals expressed significantly higher levels of CXCR3 as compared to CCR4 and/or CCR6, suggesting that blood CXCR3-expressing CD4 T cells may originate from LN PD-1 + CD4 T cells. Taken together, these results indicate that blood CXCR3-expressing CD4 T cells represent the major blood compartment containing inducible replication competent virus in treated aviremic HIV-infected individuals.

  17. Selective Destruction of Interleukin 23–Induced Expansion of a Major Antigen–Specific γδ T-Cell Subset in Patients With Tuberculosis

    PubMed Central

    Gu, Jin; Xiao, Heping; Liang, Shanshan; Yang, Enzhuo; Yang, Rui; Huang, Dan; Chen, Crystal; Wang, Feifei; Shen, Ling; Chen, Zheng W.

    2017-01-01

    Abstract A loss of antigen-specific T-cell responses due to defective cytokine signaling during infections has not been reported. We hypothesize that tuberculosis can destroy signaling effects of selective cytokine(s) and induce exhaustion of antigen-specific T cells. To test this hypothesis, mechanistic studies were performed to examine whether and how tuberculosis blocked interleukin 23 (IL-23) and interleukin 2 (IL-2) signaling effects on a major human γδ T-cell subpopulation, phosphoantigen HMBPP–specific Vγ2Vδ2 T cells. IL-23 and IL-2 significantly expanded HMBPP-stimulated Vγ2Vδ2 T cells from subjects with latent tuberculosis infection, and IL-2 synergized the effect of IL-23. IL-23–induced expansion of Vγ2Vδ2 T cells involved STAT3. Surprisingly, patients with tuberculosis exhibited a selective destruction of IL-23–induced expansion of these cells. The tuberculosis-driven destruction of IL-23 signaling coincided with decreases of expression and phosphorylation of STAT3. Interestingly, impairing of STAT3 was linked to marked increases in the microRNAs (miRNAs) hsa-miR-337-3p and hsa-miR-125b-5p in Vγ2Vδ2 T cells from patients with tuberculosis. Downregulation of hsa-miR-337-3p and hsa-miR-125b-5p by miRNA sponges improved IL-23–mediated expansion of Vγ2Vδ2 T cells and restored the ability of these cells to produce anti–tuberculosis cytokines. These results support our hypothesis that tuberculosis can selectively impair a cytokine effect while sparing another and can induce exhaustion of T cells in response to the respective cytokine. PMID:27789724

  18. T cells raised against allogeneic HLA-A2/CD20 kill primary follicular lymphoma and acute lymphoblastic leukemia cells.

    PubMed

    Abrahamsen, Ingerid Weum; Kjellevoll, Synneva; Greve-Isdahl, Margrethe; Mensali, Nadia; Wälchli, Sébastien; Kumari, Shraddha; Loland, Beate Fossum; Egeland, Torstein; Kolstad, Arne; Olweus, Johanna

    2012-04-15

    T cells mediating a graft-versus-leukemia/lymphoma effects without causing graft-versus-host disease would greatly improve the safety and applicability of hematopoietic stem cell transplantation. We recently demonstrated that highly peptide- and HLA-specific T cells can readily be generated against allogeneic HLA-A*02:01 in complex with a peptide from the B cell-restricted protein CD20. Here, we show that such CD20-specific T cells can easily be induced from naïve precursors in cord blood, demonstrating that they do not represent cross-reactive memory cells. The cells displayed high avidity and mediated potent cytotoxic effects on cells from patients with the CD20(pos) B cell malignancies follicular lymphoma (FL) and acute lymphoblastic leukemia (ALL). However, the cytotoxicity was consistently lower for cells from two of the ALL patients. The ALL cells that were less efficiently killed did not display lower surface expression of CD20 or HLA-A*02:01, or mutations in the CD20 sequence. Peptide pulsing fully restored the levels of cytotoxicity, indicating that they are indeed susceptible to T cell-mediated killing. Adoptive transfer of CD20-specific T cells to an HLA-A*02:01(pos) patient requires an HLA-A*02:01(neg) , but otherwise HLA identical, donor. A search clarified that donors meeting these criteria can be readily identified even for patients with rare haplotypes. The results bear further promise for the clinical utility of CD20-specific T cells in B cell malignancies. Copyright © 2011 UICC.

  19. Detailed analysis of Epstein–Barr virus-specific CD4+ and CD8+ T cell responses during infectious mononucleosis

    PubMed Central

    Scherrenburg, J; Piriou, E R W A N; Nanlohy, N M; van Baarle, D

    2008-01-01

    We studied simultaneously Epstein–Barr virus (EBV)-specific CD4+ and CD8+ T cell responses during and after infectious mononucleosis (IM), using a previously described 12-day stimulation protocol with EBNA1 or BZLF1 peptide pools. Effector function of EBV-specific T cells was determined after restimulation by measuring intracellular interferon-γ production. During IM, BZLF1-specifc CD4+ T cell responses were dominant compared with CD8+ T cell responses. EBNA1-specific CD4+ and CD8+ T cell responses were low and remained similar for 6 months. However, 6 months after IM, BZLF1-specific CD4+ T cell responses had declined, but CD8+ T cell responses had increased. At diagnosis, EBV-specific CD8+ T cells as studied by human leucocyte antigen class I tetramer staining comprised a tetramerbrightCD8bright population consisting mainly of CD27+ memory T cells and a tetramerdimCD8dim population consisting primarily of CD27- effector T cells. The remaining EBV-specific CD8+ T cell population 6 months after the diagnosis of IM consisted mainly of tetramerbrightCD8bright CD27+ T cells, suggesting preferential preservation of memory T cells after contraction of the EBV-specific T cell pool. PMID:18549439

  20. The Role of B Cells for in Vivo T Cell Responses to a Friend Virus-Induced Leukemia

    NASA Astrophysics Data System (ADS)

    Schultz, Kirk R.; Klarnet, Jay P.; Gieni, Randall S.; Hayglass, Kent T.; Greenberg, Philip D.

    1990-08-01

    B cells can function as antigen-presenting cells and accessory cells for T cell responses. This study evaluated the role of B cells in the induction of protective T cell immunity to a Friend murine leukemia virus (F-MuLV)-induced leukemia (FBL). B cell-deficient mice exhibited significantly reduced tumor-specific CD4^+ helper and CD8^+ cytotoxic T cell responses after priming with FBL or a recombinant vaccinia virus containing F-MuLV antigens. Moreover, these mice had diminished T cell responses to the vaccinia viral antigens. Tumor-primed T cells transferred into B cell-deficient mice effectively eradicated disseminated FBL. Thus, B cells appear necessary for efficient priming but not expression of tumor and viral T cell immunity.

  1. LPS-treated bone marrow-derived dendritic cells induce immune tolerance through modulating differentiation of CD4+ regulatory T cell subpopulations mediated by 3G11 and CD127.

    PubMed

    Zhou, Fang; Zhang, Guang-Xian; Rostami, Abdolmohamad

    2017-06-01

    Intravenous transfer of LPS-treated bone marrow-derived dendritic cells blocks development of autoimmunity induced by CD4 + T cells in vivo. However, cellular mechanisms of dendritic cell-mediated immune tolerance have not yet been fully elucidated. Here, we report that there are two new subpopulations of CD4 + CD25 + FoxP3 + GITR + regulatory T cells (CD127 + 3G11 + and CD127 + 3G11 - cells). LPS-treated dendritic cells facilitate development of CD4 + CD127 + 3G11 - regulatory T cells but inhibit that of CD4 + CD127 + 3G11 + regulatory T cells. LPS-induced tolerogenic dendritic cells may cause immune tolerance through modulating balance of different subsets of CD4 + regulatory T cells mediated by CD127 and 3G11. Our results imply a new potential cellular mechanism of dendritic cell-mediated immune tolerance.

  2. Inhibition of 12/15-Lipoxygenase Protects Against β-Cell Oxidative Stress and Glycemic Deterioration in Mouse Models of Type 1 Diabetes.

    PubMed

    Hernandez-Perez, Marimar; Chopra, Gaurav; Fine, Jonathan; Conteh, Abass M; Anderson, Ryan M; Linnemann, Amelia K; Benjamin, Chanelle; Nelson, Jennifer B; Benninger, Kara S; Nadler, Jerry L; Maloney, David J; Tersey, Sarah A; Mirmira, Raghavendra G

    2017-11-01

    Islet β-cell dysfunction and aggressive macrophage activity are early features in the pathogenesis of type 1 diabetes (T1D). 12/15-Lipoxygenase (12/15-LOX) is induced in β-cells and macrophages during T1D and produces proinflammatory lipids and lipid peroxides that exacerbate β-cell dysfunction and macrophage activity. Inhibition of 12/15-LOX provides a potential therapeutic approach to prevent glycemic deterioration in T1D. Two inhibitors recently identified by our groups through screening efforts, ML127 and ML351, have been shown to selectively target 12/15-LOX with high potency. Only ML351 exhibited no apparent toxicity across a range of concentrations in mouse islets, and molecular modeling has suggested reduced promiscuity of ML351 compared with ML127. In mouse islets, incubation with ML351 improved glucose-stimulated insulin secretion in the presence of proinflammatory cytokines and triggered gene expression pathways responsive to oxidative stress and cell death. Consistent with a role for 12/15-LOX in promoting oxidative stress, its chemical inhibition reduced production of reactive oxygen species in both mouse and human islets in vitro. In a streptozotocin-induced model of T1D in mice, ML351 prevented the development of diabetes, with coincident enhancement of nuclear Nrf2 in islet cells, reduced β-cell oxidative stress, and preservation of β-cell mass. In the nonobese diabetic mouse model of T1D, administration of ML351 during the prediabetic phase prevented dysglycemia, reduced β-cell oxidative stress, and increased the proportion of anti-inflammatory macrophages in insulitis. The data provide the first evidence to date that small molecules that target 12/15-LOX can prevent progression of β-cell dysfunction and glycemic deterioration in models of T1D. © 2017 by the American Diabetes Association.

  3. Apigenin inhibits the inducible expression of programmed death ligand 1 by human and mouse mammary carcinoma cells.

    PubMed

    Coombs, Melanie R Power; Harrison, Megan E; Hoskin, David W

    2016-10-01

    Programmed death ligand 1 (PD-L1) is expressed by many cancer cell types, as well as by activated T cells and antigen-presenting cells. Constitutive and inducible PD-L1 expression contributes to immune evasion by breast cancer (BC) cells. We show here that the dietary phytochemical apigenin inhibited interferon (IFN)-γ-induced PD-L1 upregulation by triple-negative MDA-MB-468 BC cells, HER2(+) SK-BR-3 BC cells, and 4T1 mouse mammary carcinoma cells, as well as human mammary epithelial cells, but did not affect constitutive PD-L1 expression by triple-negative MDA-MB-231 BC cells. IFN-β-induced expression of PD-L1 by MDA-MB-468 cells was also inhibited by apigenin. In addition, luteolin, the major metabolite of apigenin, inhibited IFN-γ-induced PD-L1 expression by MDA-MB-468 cells. Apigenin-mediated inhibition of IFN-γ-induced PD-L1 expression by MDA-MB-468 and 4T1 cells was associated with reduced phosphorylation of STAT1, which was early and transient at Tyr701 and sustained at Ser727. Apigenin-mediated inhibition of IFN-γ-induced PD-L1 expression by MDA-MB-468 cells also increased proliferation and interleukin-2 synthesis by PD-1-expressing Jurkat T cells that were co-cultured with MDA-MB-468 cells. Apigenin therefore has the potential to increase the vulnerability of BC cells to T cell-mediated anti-tumor immune responses. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. Attenuation of acute lung inflammation induced by cigarette smoke in CXCR3 knockout mice.

    PubMed

    Nie, Li; Xiang, Ruolan; Zhou, Weixun; Lu, Bao; Cheng, Deyun; Gao, Jinming

    2008-12-16

    CD8+ T cells may participate in cigarette smoke (CS) induced-lung inflammation in mice. CXCL10/IP-10 (IFNgamma-inducible protein 10) and CXCL9/Mig (monokine induced by IFN-gamma) are up-regulated in CS-induced lung injury and may attract T-cell recruitment to the lung. These chemokines together with CXCL11/ITAC (IFN-inducible T-cell alpha chemoattractant) are ligands for the chemokine receptor CXCR3 which is preferentially expressed chiefly in activated CD8+ T cells. The purpose of this investigation was to study the contribution of CXCR3 to acute lung inflammation induced by CS using CXCR3 knockout (KO) mice. Mice (n = 8 per group) were placed in a closed plastic box connected to a smoke generator and were exposed whole body to the tobacco smoke of five cigarettes four times a day for three days. Lung pathological changes, expression of inflammatory mediators in bronchoalveolar lavage (BAL) fluid and lungs at mRNA and protein levels, and lung infiltration of CD8+ T cells were compared between CXCR3-/- mice and wild type (WT) mice. Compared with the WT littermates, CXCR3 KO mice showed less CS-induced lung inflammation as evidenced by less infiltration of inflammatory cells in airways and lung tissue, particularly fewer CD8+ T cells, lower levels of IFNgamma and CXCR3 ligands (particularly CXCL10). Our findings show that CXCR3 is important in promoting CD8+ T cell recruitment and in initiating IFNgamma and CXCL10 release following CS exposure. CXCR3 may represent a promising therapeutic target for acute lung inflammation induced by CS.

  5. Attenuation of acute lung inflammation induced by cigarette smoke in CXCR3 knockout mice

    PubMed Central

    Nie, Li; Xiang, Ruolan; Zhou, Weixun; Lu, Bao; Cheng, Deyun; Gao, Jinming

    2008-01-01

    Background CD8+ T cells may participate in cigarette smoke (CS) induced-lung inflammation in mice. CXCL10/IP-10 (IFNγ-inducible protein 10) and CXCL9/Mig (monokine induced by IFN-γ) are up-regulated in CS-induced lung injury and may attract T-cell recruitment to the lung. These chemokines together with CXCL11/ITAC (IFN-inducible T-cell alpha chemoattractant) are ligands for the chemokine receptor CXCR3 which is preferentially expressed chiefly in activated CD8+ T cells. The purpose of this investigation was to study the contribution of CXCR3 to acute lung inflammation induced by CS using CXCR3 knockout (KO) mice. Methods Mice (n = 8 per group) were placed in a closed plastic box connected to a smoke generator and were exposed whole body to the tobacco smoke of five cigarettes four times a day for three days. Lung pathological changes, expression of inflammatory mediators in bronchoalveolar lavage (BAL) fluid and lungs at mRNA and protein levels, and lung infiltration of CD8+ T cells were compared between CXCR3-/- mice and wild type (WT) mice. Results Compared with the WT littermates, CXCR3 KO mice showed less CS-induced lung inflammation as evidenced by less infiltration of inflammatory cells in airways and lung tissue, particularly fewer CD8+ T cells, lower levels of IFNγ and CXCR3 ligands (particularly CXCL10). Conclusion Our findings show that CXCR3 is important in promoting CD8+ T cell recruitment and in initiating IFNγ and CXCL10 release following CS exposure. CXCR3 may represent a promising therapeutic target for acute lung inflammation induced by CS. PMID:19087279

  6. FRET detection of lymphocyte function–associated antigen-1 conformational extension

    PubMed Central

    Chigaev, Alexandre; Smagley, Yelena; Haynes, Mark K.; Ursu, Oleg; Bologa, Cristian G.; Halip, Liliana; Oprea, Tudor; Waller, Anna; Carter, Mark B.; Zhang, Yinan; Wang, Wei; Buranda, Tione; Sklar, Larry A.

    2015-01-01

    Lymphocyte function–associated antigen 1 (LFA-1, CD11a/CD18, αLβ2-integrin) and its ligands are essential for adhesion between T-cells and antigen-presenting cells, formation of the immunological synapse, and other immune cell interactions. LFA-1 function is regulated through conformational changes that include the modulation of ligand binding affinity and molecular extension. However, the relationship between molecular conformation and function is unclear. Here fluorescence resonance energy transfer (FRET) with new LFA-1–specific fluorescent probes showed that triggering of the pathway used for T-cell activation induced rapid unquenching of the FRET signal consistent with extension of the molecule. Analysis of the FRET quenching at rest revealed an unexpected result that can be interpreted as a previously unknown LFA-1 conformation. PMID:25378583

  7. Nonaminoglycoside compounds induce readthrough of nonsense mutations

    PubMed Central

    Damoiseaux, Robert; Nahas, Shareef; Gao, Kun; Hu, Hailiang; Pollard, Julianne M.; Goldstine, Jimena; Jung, Michael E.; Henning, Susanne M.; Bertoni, Carmen

    2009-01-01

    Large numbers of genetic disorders are caused by nonsense mutations for which compound-induced readthrough of premature termination codons (PTCs) might be exploited as a potential treatment strategy. We have successfully developed a sensitive and quantitative high-throughput screening (HTS) assay, protein transcription/translation (PTT)–enzyme-linked immunosorbent assay (ELISA), for identifying novel PTC-readthrough compounds using ataxia-telangiectasia (A-T) as a genetic disease model. This HTS PTT-ELISA assay is based on a coupled PTT that uses plasmid templates containing prototypic A-T mutated (ATM) mutations for HTS. The assay is luciferase independent. We screened ∼34,000 compounds and identified 12 low-molecular-mass nonaminoglycosides with potential PTC-readthrough activity. From these, two leading compounds consistently induced functional ATM protein in ATM-deficient cells containing disease-causing nonsense mutations, as demonstrated by direct measurement of ATM protein, restored ATM kinase activity, and colony survival assays for cellular radiosensitivity. The two compounds also demonstrated readthrough activity in mdx mouse myotube cells carrying a nonsense mutation and induced significant amounts of dystrophin protein. PMID:19770270

  8. Genome-wide RNA profiling of long-lasting stem cell-like memory CD8 T cells induced by Yellow Fever vaccination in humans.

    PubMed

    Fuertes Marraco, Silvia A; Soneson, Charlotte; Delorenzi, Mauro; Speiser, Daniel E

    2015-09-01

    The live-attenuated Yellow Fever (YF) vaccine YF-17D induces a broad and polyfunctional CD8 T cell response in humans. Recently, we identified a population of stem cell-like memory CD8 T cells induced by YF-17D that persists at stable frequency for at least 25 years after vaccination. The YF-17D is thus a model system of human CD8 T cell biology that furthermore allows to track and study long-lasting and antigen-specific human memory CD8 T cells. Here, we describe in detail the sample characteristics and preparation of a microarray dataset acquired for genome-wide gene expression profiling of long-lasting YF-specific stem cell-like memory CD8 T cells, compared to the reference CD8 T cell differentiation subsets from total CD8 T cells. We also describe the quality controls, annotations and exploratory analyses of the dataset. The microarray data is available from the Gene Expression Omnibus (GEO) public repository with accession number GSE65804.

  9. Transforming growth factor beta induced FoxP3+ regulatory T cells suppress Th1 mediated experimental colitis.

    PubMed

    Fantini, M C; Becker, C; Tubbe, I; Nikolaev, A; Lehr, H A; Galle, P; Neurath, M F

    2006-05-01

    The imbalance between effector and regulatory T cells plays a central role in the pathogenesis of inflammatory bowel diseases. In addition to the thymus, CD4+CD25+ regulatory T cells can be induced in the periphery from a population of CD25- T cells by treatment with transforming growth factor beta (TGF-beta). Here, we analysed the in vivo function of TGF-beta induced regulatory T (Ti-Treg) cells in experimental colitis. Ti-Treg cells were generated in cell culture in the presence or absence of TGF-beta and tested for their regulatory potential in experimental colitis using the CD4+CD62L+ T cell transfer model. Ti-Treg cells significantly suppressed Th1 mediated colitis on CD4+CD62L+ T cell transfer in vivo, as shown by high resolution endoscopy, histology, immunohistochemistry, and cytokine analysis. Further analysis of in vivo and in vitro expanded Ti-Treg cells showed that exogenous interleukin 2 (IL-2) was crucial for survival and expansion of these cells. Our data suggest that regulatory Ti-Treg cells expand by TGF-beta and exogenous IL-2 derived from effector T cells at the site of inflammation. In addition to Tr1 and thymic CD4+CD25+ T cells, peripheral Ti-Treg cells emerge as a class of regulatory T cells with therapeutic potential in T cell mediated chronic intestinal inflammation.

  10. CD4+CD25+ regulatory T cells suppress allograft rejection mediated by memory CD8+ T cells via a CD30-dependent mechanism.

    PubMed

    Dai, Zhenhua; Li, Qi; Wang, Yinong; Gao, Ge; Diggs, Lonnette S; Tellides, George; Lakkis, Fadi G

    2004-01-01

    CD4(+)CD25(+) regulatory T (Treg) cells suppress naive T cell responses, prevent autoimmunity, and delay allograft rejection. It is not known, however, whether Treg cells suppress allograft rejection mediated by memory T cells, as the latter mount faster and stronger immune responses than their naive counterparts. Here we show that antigen-induced, but not naive, Treg cells suppress allograft rejection mediated by memory CD8(+) T cells. Suppression was allospecific, as Treg cells induced by third-party antigens did not delay allograft rejection. In vivo and in vitro analyses revealed that the apoptosis of allospecific memory CD8(+) T cells is significantly increased in the presence of antigen-induced Treg cells, while their proliferation remains unaffected. Importantly, neither suppression of allograft rejection nor enhanced apoptosis of memory CD8(+) T cells was observed when Treg cells lacked CD30 or when CD30 ligand-CD30 interaction was blocked with anti-CD30 ligand Ab. This study therefore provides direct evidence that pathogenic memory T cells are amenable to suppression in an antigen-specific manner and identifies CD30 as a molecule that is critical for the regulation of memory T cell responses.

  11. CD4+CD25+ regulatory T cells suppress allograft rejection mediated by memory CD8+ T cells via a CD30-dependent mechanism

    PubMed Central

    Dai, Zhenhua; Li, Qi; Wang, Yinong; Gao, Ge; Diggs, Lonnette S.; Tellides, George; Lakkis, Fadi G.

    2004-01-01

    CD4+CD25+ regulatory T (Treg) cells suppress naive T cell responses, prevent autoimmunity, and delay allograft rejection. It is not known, however, whether Treg cells suppress allograft rejection mediated by memory T cells, as the latter mount faster and stronger immune responses than their naive counterparts. Here we show that antigen-induced, but not naive, Treg cells suppress allograft rejection mediated by memory CD8+ T cells. Suppression was allospecific, as Treg cells induced by third-party antigens did not delay allograft rejection. In vivo and in vitro analyses revealed that the apoptosis of allospecific memory CD8+ T cells is significantly increased in the presence of antigen-induced Treg cells, while their proliferation remains unaffected. Importantly, neither suppression of allograft rejection nor enhanced apoptosis of memory CD8+ T cells was observed when Treg cells lacked CD30 or when CD30 ligand–CD30 interaction was blocked with anti–CD30 ligand Ab. This study therefore provides direct evidence that pathogenic memory T cells are amenable to suppression in an antigen-specific manner and identifies CD30 as a molecule that is critical for the regulation of memory T cell responses. PMID:14722622

  12. Polarized type 2 alloreactive CD4+ and CD8+ donor T cells fail to induce experimental acute graft-versus-host disease.

    PubMed

    Krenger, W; Snyder, K M; Byon, J C; Falzarano, G; Ferrara, J L

    1995-07-15

    Acute graft-vs-host disease (GVHD) is thought to be mediated by alloreactive T cells with a type 1 cytokine phenotype. To prevent the development of acute GVHD, we have successfully polarized mature donor T cells toward a type 2 cytokine phenotype ex-vivo by incubating them with murine rIL-4 in a primary MLC. Polarized type 2 T cells were then transplanted with T cell-depleted bone marrow cells into irradiated recipients across either MHC class II (bm12-->C57BL/6) or class I (bm1-->C57BL/6) barriers, and the intensity of GVHD was measured by assessment of several in vitro and in vivo parameters. The injection of polarized type 2 T cells abrogated the mitogen-induced production of IFN-gamma by splenocytes from transplanted hosts on day 13 after bone marrow transplantation (BMT). Injection of polarized type 2 T cells failed to induce secretion of the effector phase cytokine TNF-alpha by splenocytes stimulated with LPS both in vitro and in vivo, and survival of transplanted mice after i.v. injection with LPS was significantly improved. Furthermore, cell-mixing experiments revealed that polarized type 2 T cells were able to inhibit type 1 cytokine responses induced by naive T cells after BMT. These data demonstrate that both polarized CD4+ and CD8+ type 2 alloreactive donor T cells can be generated in vitro from mature T cell populations. These cells function in vivo to inhibit type 1 T cell responses, and such inhibition attenuates the systemic morbidity of GVHD after BMT across both MHC class II or class I barriers in mice.

  13. CD47-ligation induced cell death in T-acute lymphoblastic leukemia.

    PubMed

    Leclair, Pascal; Liu, Chi-Chao; Monajemi, Mahdis; Reid, Gregor S; Sly, Laura M; Lim, Chinten James

    2018-05-10

    CD47 is a cell-surface marker well recognized for its anti-phagocytic functions. As such, an emerging avenue for targeted cancer therapies involves neutralizing the anti-phagocytic function using monoclonal antibodies (mAbs) to enhance tumour cell immunogenicity. A lesser known consequence of CD47 receptor ligation is the direct induction of tumour cell death. While several mAbs and their derivatives with this property have been studied, the best characterized is the commercially available mAb B6H12, which requires immobilization for induction of cell death. Here, we describe a commercially available mAb, CC2C6, which induces T-cell acute lymphoblastic leukemia (ALL) cell death in soluble form. Soluble CC2C6 induces CD47-dependent cell death in a manner consistent with immobilized B6H12, which is characterized by mitochondrial deficiencies but is independent of caspase activation. Titration studies indicated that CC2C6 shares a common CD47-epitope with B6H12. Importantly, CC2C6 retains the anti-phagocytic neutralizing function, thus possessing dual anti-tumour properties. Although CD47-ligation induced cell death occurs in a caspase-independent manner, CC2C6 was found to stimulate increases in Mcl-1 and NOXA levels, two Bcl-2 family proteins that govern the intrinsic apoptosis pathway. Further analysis revealed that the ratio of Mcl-1:NOXA were minimally altered for cells treated with CC2C6, in comparison to cells treated with agents that induced caspase-dependent apoptosis which alter this ratio in favour of NOXA. Finally, we found that CC2C6 can synergize with low dose chemotherapeutic agents that induce classical apoptosis, giving rise to the possibility of an effective combination treatment with reduced long-term sequelae associated with high-dose chemotherapies in childhood ALL.

  14. Evidence that shock-induced immune suppression is mediated by adrenal hormones and peripheral beta-adrenergic receptors.

    PubMed

    Cunnick, J E; Lysle, D T; Kucinski, B J; Rabin, B S

    1990-07-01

    Our previous work has demonstrated that presentations of mild foot-shock to Lewis rats induces a suppression of splenic and peripheral blood lymphocyte responses to nonspecific T-cell mitogens. The present study demonstrated that adrenalectomy prevented the shock-induced suppression of the mitogenic response of peripheral blood T-cells but did not attenuate the suppression of splenic T-cells. Conversely, the beta-adrenergic receptor antagonists, propranolol and nadolol, attenuated the shock-induced suppression of splenic T-cells in a dose-dependent manner but did not attenuate suppression of the blood mitogen response. These data indicate that distinct mechanisms mediate the shock-induced suppression of T-cell responsiveness to mitogens in the spleen and the peripheral blood. The results indicate that the peripheral release of catecholamines is responsible for splenic immune suppression and that adrenal hormones, which do not interact with beta-adrenergic receptors, are responsible for shock-induced suppression of blood mitogenic responses.

  15. Long-term protection against SHIV89.6P replication in HIV-1 Tat vaccinated cynomolgus monkeys.

    PubMed

    Maggiorella, Maria Teresa; Baroncelli, Silvia; Michelini, Zuleika; Fanales-Belasio, Emanuele; Moretti, Sonia; Sernicola, Leonardo; Cara, Andrea; Negri, Donatella R M; Buttò, Stefano; Fiorelli, Valeria; Tripiciano, Antonella; Scoglio, Arianna; Caputo, Antonella; Borsetti, Alessandra; Ridolfi, Barbara; Bona, Roberta; ten Haaft, Peter; Macchia, Iole; Leone, Pasqualina; Pavone-Cossut, Maria Rosaria; Nappi, Filomena; Ciccozzi, Massimo; Heeney, Jonathan; Titti, Fausto; Cafaro, Aurelio; Ensoli, Barbara

    2004-09-03

    Vaccination with a biologically active Tat protein or tat DNA contained infection with the highly pathogenic SHIV89.6P virus, preventing CD4 T-cell decline and disease onset. Here we show that protection was prolonged, since neither CD4 T-cell decline nor active virus replication was observed in all vaccinated animals that controlled virus replication up to week 104 after the challenge. In contrast, virus persisted and replicated in peripheral blood mononuclear cells and lymph nodes of infected animals, two of which died. Tat-specific antibody, CD4 and CD8 T-cell responses were high and stable only in the animals controlling the infection. In contrast, Gag-specific antibody production and CD4 and CD8 T-cell responses were consistently and persistently positive only in the monkeys that did not control primary virus replication. These results indicate that vaccination with Tat protein or DNA induced long-term memory Tat-specific immune responses and controlled primary infection at its early stages allowing a long-term containment of virus replication and spread in blood and tissues.

  16. Formulation of a mmaA4 Gene Deletion Mutant of Mycobacterium bovis BCG in Cationic Liposomes Significantly Enhances Protection against Tuberculosis

    PubMed Central

    Derrick, Steven C.; Dao, Dee; Yang, Amy; Kolibab, Kris; Jacobs, William R.; Morris, Sheldon L.

    2012-01-01

    A new vaccination strategy is urgently needed for improved control of the global tuberculosis (TB) epidemic. Using a mouse aerosol Mycobacterium tuberculosis challenge model, we investigated the protective efficacy of a mmaA4 gene deletion mutant of Mycobacterium bovis BCG (ΔmmaA4BCG) formulated in dimethyl dioctadecyl ammonium bromide (DDA) – D(+) trehalose 6,6 dibenenate (TDB) (DDA/TDB) adjuvant. In previous studies, deletion of the mmaA4 gene was shown to reduce the suppression of IL-12 production often seen after mycobacterial infections. While the non-adjuvanted ΔmmaA4BCG strain did not protect mice substantially better than conventional BCG against a tuberculous challenge in four protection experiments, the protective responses induced by the ΔmmaA4BCG vaccine formulated in DDA/TDB adjuvant was consistently increased relative to nonadjuvanted BCG controls. Furthermore, the ΔmmaA4BCG-DDA/TDB vaccine induced significantly higher frequencies of multifunctional (MFT) CD4 T cells expressing both IFNγ and TNFα (double positive) or IFNγ, TNFα and IL-2 (triple positive) than CD4 T cells derived from mice vaccinated with BCG. These MFT cells were characterized by having higher IFNγ and TNFα median fluorescence intensity (MFI) values than monofunctional CD4 T cells. Interestingly, both BCG/adjuvant and ΔmmaA4BCG/adjuvant formulations induced significantly higher frequencies of CD4 T cells expressing TNFα and IL-2 than nonadjuvanted BCG or ΔmmaA4BCG vaccines indicating that BCG/adjuvant mixtures may be more effective at inducing central memory T cells. Importantly, when either conventional BCG or the mutant were formulated in adjuvant and administered to SCID mice or immunocompromised mice depleted of IFNγ, significantly lower vaccine-derived mycobacterial CFU were detected relative to immunodeficient mice injected with non-adjuvanted BCG. Overall, these data suggest that immunization with the ΔmmaA4BCG/adjuvant formulation may be an effective, safe, and relatively inexpensive alternative to vaccination with conventional BCG. PMID:22442674

  17. Regulatory T cells ameliorate tissue plasminogen activator-induced brain haemorrhage after stroke.

    PubMed

    Mao, Leilei; Li, Peiying; Zhu, Wen; Cai, Wei; Liu, Zongjian; Wang, Yanling; Luo, Wenli; Stetler, Ruth A; Leak, Rehana K; Yu, Weifeng; Gao, Yanqin; Chen, Jun; Chen, Gang; Hu, Xiaoming

    2017-07-01

    Delayed thrombolytic treatment with recombinant tissue plasminogen activator (tPA) may exacerbate blood-brain barrier breakdown after ischaemic stroke and lead to lethal haemorrhagic transformation. The immune system is a dynamic modulator of stroke response, and excessive immune cell accumulation in the cerebral vasculature is associated with compromised integrity of the blood-brain barrier. We previously reported that regulatory T cells, which function to suppress excessive immune responses, ameliorated blood-brain barrier damage after cerebral ischaemia. This study assessed the impact of regulatory T cells in the context of tPA-induced brain haemorrhage and investigated the underlying mechanisms of action. The number of circulating regulatory T cells in stroke patients was dramatically reduced soon after stroke onset (84 acute ischaemic stroke patients with or without intravenous tPA treatment, compared to 115 age and gender-matched healthy controls). Although stroke patients without tPA treatment gradually repopulated the numbers of circulating regulatory T cells within the first 7 days after stroke, post-ischaemic tPA treatment led to sustained suppression of regulatory T cells in the blood. We then used the murine suture and embolic middle cerebral artery occlusion models of stroke to investigate the therapeutic potential of adoptive regulatory T cell transfer against tPA-induced haemorrhagic transformation. Delayed administration of tPA (10 mg/kg) resulted in haemorrhagic transformation in the ischaemic territory 1 day after ischaemia. When regulatory T cells (2 × 106/mouse) were intravenously administered immediately after delayed tPA treatment in ischaemic mice, haemorrhagic transformation was significantly decreased, and this was associated with improved sensorimotor functions. Blood-brain barrier disruption and tight junction damages were observed in the presence of delayed tPA after stroke, but were mitigated by regulatory T cell transfer. Mechanistic studies demonstrated that regulatory T cells completely abolished the tPA-induced elevation of MMP9 and CCL2 after stroke. Using MMP9 and CCL2 knockout mice, we discovered that both molecules partially contributed to the protective actions of regulatory T cells. In an in vitro endothelial cell-based model of the blood-brain barrier, we confirmed that regulatory T cells inhibited tPA-induced endothelial expression of CCL2 and preserved blood-brain barrier integrity after an ischaemic challenge. Lentivirus-mediated CCL2 knockdown in endothelial cells completely abolished the blood-brain barrier protective effect of regulatory T cells in vitro. Altogether, our studies suggest that regulatory T cell adoptive transfer may alleviate thrombolytic treatment-induced haemorrhage in stroke victims. Furthermore, regulatory T cell-afforded protection in the tPA-treated stroke model is mediated by two inhibitory mechanisms involving CCL2 and MMP9. Thus, regulatory T cell adoptive transfer may be useful as a cell-based therapy to improve the efficacy and safety of thrombolytic treatment for ischaemic stroke. © The Author (2017). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Sodium Lauryl Sulfate Stimulates the Generation of Reactive Oxygen Species through Interactions with Cell Membranes.

    PubMed

    Mizutani, Taeko; Mori, Ryota; Hirayama, Misaki; Sagawa, Yuki; Shimizu, Kenji; Okano, Yuri; Masaki, Hitoshi

    2016-12-01

    Sodium lauryl sulfate (SLS), a representative anionic surfactant, is well-known to induce rough skin following single or multiple topical applications. The mechanism by which SLS induces rough skin is thought to result from the disruption of skin moisture function consisting of NMF and epidermal lipids. However, a recent study demonstrated that topically applied SLS easily penetrates into the living cell layers of the epidermis, which suggests that physiological alterations of keratinocytes might cause the SLS-induced rough skin. This study was conducted to clarify the effects of SLS on keratinocytes to demonstrate the contribution of SLS to the induction of rough skin. In addition, the potentials of other widely used anionic surfactants to induce rough skin were evaluated. HaCaT keratinocytes treated with SLS had increased levels of intracellular ROS and IL-1α secretion. Application of SLS on the surface of a reconstructed epidermal equivalent also showed the increased generation of ROS. Further, SLS-treated cells showed an increase of intracellular calpain activity associated with the increase of intracellular Ca 2+ concentration. The increase of intracellular ROS was abolished by the addition of BAPTA-AM, a specific chelator of Ca 2+ . In addition, IL-1α also stimulated ROS generation by HaCaT keratinocytes. An ESR spin-labeling study demonstrated that SLS increased the fluidity of membranes of liposomes and cells. Together, those results indicate that SLS initially interacts with cell membranes, which results in the elevation of intracellular Ca 2+ influx. Ca 2+ stimulates the secretion of IL-1α due to the activation of calpain, and also increases ROS generation. IL-1α also stimulates ROS generation by HaCaT keratinocytes. We conclude from these results that the elevation of intracellular ROS levels is one of the causes of SLS-induced rough skin. Finally, among the other anionic surfactants tested, sodium lauryl phosphate has less potential to induce rough skin because of its lower generation of ROS.

  19. 3H-1,2-dithiole-3-thione protects retinal pigment epithelium cells against Ultra-violet radiation via activation of Akt-mTORC1-dependent Nrf2-HO-1 signaling.

    PubMed

    Li, Ke-Ran; Yang, Su-Qing; Gong, Yi-Qing; Yang, Hong; Li, Xiu-Miao; Zhao, Yu-Xia; Yao, Jin; Jiang, Qin; Cao, Cong

    2016-05-06

    Excessive UV radiation and reactive oxygen species (ROS) cause retinal pigment epithelium (RPE) cell injuries. Nrf2 regulates transcriptional activation of many anti-oxidant genes. Here, we tested the potential role of 3H-1,2-dithiole-3-thione (D3T) against UV or ROS damages in cultured RPE cells (both primary cells and ARPE-19 line). We showed that D3T significantly inhibited UV-/H2O2-induced RPE cell death and apoptosis. UV-stimulated ROS production was dramatically inhibited by D3T pretreatment. D3T induced Nrf2 phosphorylation in cultured RPE cells, causing Nrf2 disassociation with KEAP1 and its subsequent nuclear accumulation. This led to expression of antioxidant response elements (ARE)-dependent gene heme oxygenase-1 (HO-1). Nrf2-HO-1 activation was required for D3T-mediated cytoprotective effect. Nrf2 shRNA knockdown or S40T dominant negative mutation as well as the HO-1 inhibitor Zinc protoporphyrin (ZnPP) largely inhibited D3T's RPE cytoprotective effects against UV radiation. Yet, exogenous overexpression Nrf2 enhanced D3T's activity in RPE cells. Further studies showed that D3T activated Akt/mTORC1 in cultured RPE cells. Akt-mTORC1 inhibitors, or Akt1 knockdown by shRNA, not only inhibited D3T-induced Nrf2-HO-1 activation, but also abolished the RPE cytoprotective effects. In vivo, D3T intravitreal injection protected from light-induced retinal dysfunctions in mice. Thus, D3T protects RPE cells from UV-induced damages via activation of Akt-mTORC1-Nrf2-HO-1 signaling axis.

  20. T Regulatory Cell Induced Foxp3 Binds the IL2, IFNγ, and TNFα Promoters in Virus-Specific CD8+ T Cells from Feline Immunodeficiency Virus Infected Cats.

    PubMed

    Wang, Yan; Nag, Mukta; Tuohy, Joanne L; De Paris, Kristina; Fogle, Jonathan E

    2018-03-01

    Polyfunctional CD8 + T cells play a critical role in controlling viremia during AIDS lentiviral infections. However, for most HIV-infected individuals, virus-specific CD8 + T cells exhibit loss of polyfunctionality, including loss of IL2, TNFα, and IFNγ. Using the feline immunodeficiency virus (FIV) model for AIDS lentiviral persistence, our laboratory has demonstrated that FIV-activated Treg cells target CD8 + T cells, leading to a reduction in IL2 and IFNγ production. Furthermore, we have demonstrated that Treg cells induce expression of the repressive transcription factor, Foxp3, in CD8 + T cells. Based upon these findings, we asked if Treg-induced Foxp3 could bind to the IL2, TNFα, and IFNγ promoter regions in virus-specific CD8 + T cells. Following coculture with autologous Treg cells, we demonstrated decreased mRNA levels of IL2 and IFNγ at weeks 4 and 8 postinfection and decreased TNFα at week 4 postinfection in virus-specific CD8 + T cells. We also clearly demonstrated Treg cell-induced Foxp3 expression in virus-specific CD8 + T cells at weeks 1, 4, and 8 postinfection. Finally, we documented Foxp3 binding to the IL2, TNFα, and IFNγ promoters at 8 weeks and 6 months postinfection in virus-specific CD8 + T cells following Treg cell coculture. In summary, the results here clearly demonstrate that Foxp3 inhibits IL2, TNFα, and IFNγ transcription by binding to their promoter regions in lentivirus-specific CD8 + T cells. We believe this is the first description of this process during the course of AIDS lentiviral infection.

  1. Lyt-2+ cells. Requirements for concanavalin A-induced proliferation and interleukin 2 production.

    PubMed

    Kern, D E; Lachmann, L B; Greenberg, P D

    1987-11-01

    The requirements for inducing Lyt-2+ T cell proliferation in response to concanavalin A (Con A) were examined. Purified Lyt-2+ or L3T4+ spleen cells of C57BL/6 origin were stimulated with Con A and syngeneic macrophages (MO) in the presence of monoclonal antibodies to T cell markers or to polymorphic determinants on major histocompatibility complex molecules, and assessed for the ability to proliferate and to produce interleukin (IL) 2. alpha I-Ab failed to inhibit the Con A response of Lyt-2+ cells at dilutions that significantly inhibited the response of L3T4+ cells. In contrast, alphaKb/Db or alpha Lyt-2.2 specifically inhibited the response of Lyt-2+ cells, but not L3T4+ cells. The ability of alpha Kb/Db and of alpha Lyt-2.2 to inhibit the response of Lyt-2+ cells was dependent upon the concentration of Con A. These data demonstrate that optimal triggering of T cell subsets to proliferate and to produce IL-2 in response to Con A requires interactions with the appropriate restricting major histocompatibility complex molecule. The role of accessory cells in Lyt-2+ Con A-induced proliferation and IL-2 production was also investigated. Purified Lyt-2+ cells and purified L3T4+ cells failed to respond to Con A in the absence of MO. IL-1 reconstituted the response when MO were limiting, but failed to restore the response of either Lyt-2+ or L3T4+ cells when T cells were rigorously purified to remove all MO. These results demonstrate that triggering Lyt-2+ T cells, like L3T4+ T cells, requires accessory cells, and that this does not merely reflect a requirement for IL-1 production. Thus, Con A-induced proliferation and IL-2 production by Lyt-2+ T cells requires intimate contact with accessory cells and interactions dependent upon the class I-restricting element.

  2. Helicobacter pylori induces vascular endothelial growth factor production in gastric epithelial cells through hypoxia-inducible factor-1α-dependent pathway.

    PubMed

    Kang, Min-Jung; Song, Eun-Jung; Kim, Bo-Yeon; Kim, Dong-Jae; Park, Jong-Hwan

    2014-12-01

    Although Helicobacter pylori have been known to induce vascular endothelial growth factor (VEGF) production in gastric epithelial cells, the precise mechanism for cellular signaling is incompletely understood. In this study, we investigated the role of bacterial virulence factor and host cellular signaling in VEGF production of H. pylori-infected gastric epithelial cells. We evaluated production of VEGF, activation of nuclear factor nuclear factor-kappaB (NF-κB) and mitogen-activated protein kinases (MAPKs) and hypoxia-inducible factor-1α (HIF-1α) stabilization in gastric epithelial cells infected with H. pylori WT or isogenic mutants deficient in type IV secretion system (T4SS). H. pylori induced VEGF production in gastric epithelial cells via both T4SS-dependent and T4SS-independent pathways, although T4SS-independent pathway seems to be the dominant signaling. The inhibitor assay implicated that activation of NF-κB and MAPKs is dispensable for H. pylori-induced VEGF production in gastric epithelial cells. H. pylori led to HIF-1α stabilization in gastric epithelial cells independently of T4SS, NF-κB, and MAPKs, which was essential for VEGF production in these cells. N-acetyl-cysteine (NAC), a reactive oxygen species (ROS) inhibitor, treatment impaired H. pylori-induced HIF-1α stabilization and VEGF production in gastric epithelial cells. We defined the important role of ROS-HIF-1α axis in VEGF production of H. pylori-infected gastric epithelial cells, and bacterial T4SS has a minor role in H. pylori-induced VEGF production of gastric epithelial cells. © 2014 John Wiley & Sons Ltd.

  3. PKM2-dependent metabolic reprogramming in CD4+ T cells is crucial for hyperhomocysteinemia-accelerated atherosclerosis.

    PubMed

    Lü, Silin; Deng, Jiacheng; Liu, Huiying; Liu, Bo; Yang, Juan; Miao, Yutong; Li, Jing; Wang, Nan; Jiang, Changtao; Xu, Qingbo; Wang, Xian; Feng, Juan

    2018-06-01

    Inflammation mediated by activated T cells plays an important role in the initiation and progression of hyperhomocysteinemia (HHcy)-accelerated atherosclerosis in ApoE -/- mice. Homocysteine (Hcy) activates T cells to secrete proinflammatory cytokines, especially interferon (IFN)-γ; however, the precise mechanisms remain unclear. Metabolic reprogramming is critical for T cell inflammatory activation and effector functions. Our previous study demonstrated that Hcy regulates T cell mitochondrial reprogramming by enhancing endoplasmic reticulum (ER)-mitochondria coupling. In this study, we further explored the important role of glycolysis-mediated metabolic reprogramming in Hcy-activated CD4 + T cells. Mechanistically, Hcy-activated CD4 + T cell increased the protein expression and activity of pyruvate kinase muscle isozyme 2 (PKM2), the final rate-limiting enzyme in glycolysis, via the phosphatidylinositol 3-kinase/AKT/mechanistic target of rapamycin signaling pathway. Knockdown of PKM2 by small interfering RNA reduced Hcy-induced CD4 + T cell IFN-γ secretion. Furthermore, we generated T cell-specific PKM2 knockout mice by crossing LckCre transgenic mice with PKM2 fl/fl mice and observed that Hcy-induced glycolysis and oxidative phosphorylation were both diminished in PKM2-deficient CD4 + T cells with reduced glucose and lipid metabolites, and subsequently reduced IFN-γ secretion. T cell-depleted apolipoprotein E-deficient (ApoE -/- ) mice adoptively transferred with PKM2-deficient CD4 + T cells, compared to mice transferred with control cells, showed significantly decreased HHcy-accelerated early atherosclerotic lesion formation. In conclusion, this work indicates that the PKM2-dependent glycolytic-lipogenic axis, a novel mechanism of metabolic regulation, is crucial for HHcy-induced CD4 + T cell activation to accelerate early atherosclerosis in ApoE -/- mice. Metabolic reprogramming is crucial for Hcy-induced CD4 + T cell inflammatory activation. Hcy activates the glycolytic-lipogenic pathway in CD4 + T cells via PKM2. Targeting PKM2 attenuated HHcy-accelerated early atherosclerosis in ApoE -/- mice in vivo.

  4. Inhibition of murine splenic T lymphocyte proliferation by 2-deoxy-D-glucose-induced metabolic stress

    NASA Technical Reports Server (NTRS)

    Miller, E. S.; Klinger, J. C.; Akin, C.; Koebel, D. A.; Sonnenfeld, G.

    1994-01-01

    Female Swiss-Webster mice were injected with the glucose analogue 2-deoxy-D-glucose (2-DG), which when administered to rodents induces acute periods of metabolic stress. A single or multiple injections of 2-DG invoked a stress response, as evidenced by increases in serum corticosterone levels. The influence of this metabolic stressor on the blastogenic potential of splenic T lymphocytes was then examined. It was found that one, two, or three injections of 2-DG resulted in depressed T cell proliferative responses, with an attenuation of the effect occurring by the fifth injection. The 2-DG-induced inhibition of T cell proliferation was not attributable to 2-DG-induced cytolysis, as in vitro incubation of naive T cells with varying concentrations of 2-DG did not result in a reduction in cell number or viability, and flow cytometric analysis demonstrated that percentages of CD3, CD4, and CD8 splenic T cells were not altered as a result of 2-DG-induced stress. Incubating naive T cells in varying concentrations of 2-DG resulted in a dose-dependent inhibition of T cell blastogenic potential. Following in vivo exposure to 2-DG, T cell proliferation did not return to normal levels until 3 days after the cessation of 2-DG injections. Administering the beta-adrenergic receptor antagonist propranolol did not reverse the inhibited lymphoproliferation in 2-DG-treated mice. The inhibition in T cell proliferation was not observed, however, in mice that had been adrenalectomized or hypophysectomized and injected with 2-DG.(ABSTRACT TRUNCATED AT 250 WORDS).

  5. Attenuation of microglial RANTES by NEMO-binding domain peptide inhibits the infiltration of CD8(+) T cells in the nigra of hemiparkinsonian monkey.

    PubMed

    Roy, A; Mondal, S; Kordower, J H; Pahan, K

    2015-08-27

    Parkinson's disease (PD) is a progressive neurodegenerative disease characterized by the loss of dopaminergic (DA) neurons in the substantia nigra pars compacta (SNpc). Despite intense investigations, little is known about its pathological mediators. Here, we report the marked upregulation of RANTES (regulated on activation, normal T cell expressed and secreted) and eotaxin, chemokines that are involved in T cell trafficking, in the serum of hemiparkinsonian monkeys. Interestingly, 1-methyl-4-phenylpyridinium (MPP(+)), a Parkinsonian toxin, increased the expression of RANTES and eotaxin in mouse microglial cells. The presence of NF-κB binding sites in promoters of RANTES and eotaxin and down-regulation of these genes by NEMO-binding domain (NBD) peptide, selective inhibitor of induced NF-κB activation, in MPP(+)-stimulated microglial cells suggest that the activation of NF-κB plays an important role in the upregulation of these two chemokines. Consistently, serum enzyme-linked immuno assay (ELISA) and nigral immunohistochemistry further confirmed that these chemokines were strongly upregulated in MPTP-induced hemiparkinsonian monkeys and that treatment with NBD peptides effectively inhibited the level of these chemokines. Furthermore, the microglial upregulation of RANTES in the nigra of hemiparkinsonian monkeys could be involved in the altered adaptive immune response in the brain as we observed greater infiltration of CD8(+) T cells around the perivascular niche and deep brain parenchyma of hemiparkinsonian monkeys as compared to control. The treatment of hemiparkinsonian monkeys with NBD peptides decreased the microglial expression of RANTES and attenuated the infiltration of CD8(+) T cells in nigra. These results indicate the possible involvement of chemokine-dependent adaptive immune response in Parkinsonism. Copyright © 2015 IBRO. Published by Elsevier Ltd. All rights reserved.

  6. Significant role of Fas ligand-binding but defective Fas receptor (CD95) in lymph node hyperplasia composed of abnormal double-negative T cells

    PubMed Central

    Matsuzawa, Akio; Shimizu, Motomu; Takeda, Yasutaka; Nagase, Hisashi; Sayama, Kazutoshi; Kimura, Mikio

    2002-01-01

    The functional differences between two mutations of the Fas (CD95) locus, Faslpr (lpr) and Faslprcg (lprcg), were investigated using bone marrow (BM) transplantation on the C3H mouse background. Both lpr/lpr and lprcg/lprcg BM transferred caused lymph node (LN) hyperplasia in lpr/+ and lprcg/+ recipients, although it was clearly smaller than that in lpr/lpr and lprcg/lprcg recipients of lpr/lpr and lprcg/lprcg BM. In addition, both BM induced significantly larger LN hyperplasia in lprcg/+ than lpr/+ recipients. Appearance of CD4− CD8−[double negative (DN)] T cells in the periphery is the most consistent phenotype of Fas mutations. Importantly, the proportion of DN T cells was higher in larger LN hyperplasia in the order of lpr/+, lprcg/+ and lpr/lpr or lprcg/lprcg recipients. On the other hand, both lpr/lpr and lprcg/lprcg BM transferred into wild-type (+/+) mice caused marked LN atrophy. The former, but not the latter, induced wasting syndrome. Faslg1d (gld)-homozygous lpr/lpr BM transferred into +/+ mice elicited LN hyperplasia of the same extent as that in lpr/lpr mice transferred with lpr/lpr BM, but not wasting syndrome. Taken together with the fact that DN T cells massively express Fas ligand (FasL), this study implied that FasL overexpressed on DN cells may be involved in the accumulation of DN T cells in LN, LN atrophy and wasting syndrome, and that lprcg Fas, which can bind to Fas ligand but not transduce apoptosis signal into cells, may modulate these pathological conditions by interfering with the binding of FasL to Fas. PMID:12153509

  7. Elevated Cyclic AMP Levels in T Lymphocytes Transformed by Human T-Cell Lymphotropic Virus Type 1▿

    PubMed Central

    Kress, Andrea K.; Schneider, Grit; Pichler, Klemens; Kalmer, Martina; Fleckenstein, Bernhard; Grassmann, Ralph

    2010-01-01

    Human T-cell lymphotropic virus type 1 (HTLV-1), the cause of adult T-cell leukemia/lymphoma (ATLL), transforms CD4+ T cells to permanent growth through its transactivator Tax. HTLV-1-transformed cells share phenotypic properties with memory and regulatory T cells (T-reg). Murine T-reg-mediated suppression employs elevated cyclic AMP (cAMP) levels as a key regulator. This led us to determine cAMP levels in HTLV-1-transformed cells. We found elevated cAMP concentrations as a consistent feature of all HTLV-1-transformed cell lines, including in vitro-HTLV-1-transformed, Tax-transformed, and patient-derived cells. In transformed cells with conditional Tax expression, high cAMP levels coincided with the presence of Tax but were lost without it. However, transient ectopic expression of Tax alone was not sufficient to induce cAMP. We found specific downregulation of the cAMP-degrading phosphodiesterase 3B (PDE3B) in HTLV-1-transformed cells, which was independent of Tax in transient expression experiments. This is in line with the notion that PDE3B transcripts and cAMP levels are inversely correlated. Overexpression of PDE3B led to a decrease of cAMP in HTLV-1-transformed cells. Decreased expression of PDE3B was associated with inhibitory histone modifications at the PDE3B promoter and the PDE3B locus. In summary, Tax transformation and its continuous expression contribute to elevated cAMP levels, which may be regulated through PDE3B suppression. This shows that HTLV-1-transformed cells assume biological features of long-lived T-cell populations that potentially contribute to viral persistence. PMID:20573814

  8. Curcumin reverses T cell-mediated adaptive immune dysfunctions in tumor-bearing hosts.

    PubMed

    Bhattacharyya, Sankar; Md Sakib Hossain, Dewan; Mohanty, Suchismita; Sankar Sen, Gouri; Chattopadhyay, Sreya; Banerjee, Shuvomoy; Chakraborty, Juni; Das, Kaushik; Sarkar, Diptendra; Das, Tanya; Sa, Gaurisankar

    2010-07-01

    Immune dysfunction is well documented during tumor progression and likely contributes to tumor immune evasion. CD8(+) cytotoxic T lymphocytes (CTLs) are involved in antigen-specific tumor destruction and CD4(+) T cells are essential for helping this CD8(+) T cell-dependent tumor eradication. Tumors often target and inhibit T-cell function to escape from immune surveillance. This dysfunction includes loss of effector and memory T cells, bias towards type 2 cytokines and expansion of T regulatory (Treg) cells. Curcumin has previously been shown to have antitumor activity and some research has addressed the immunoprotective potential of this plant-derived polyphenol in tumor-bearing hosts. Here we examined the role of curcumin in the prevention of tumor-induced dysfunction of T cell-based immune responses. We observed severe loss of both effector and memory T-cell populations, downregulation of type 1 and upregulation of type 2 immune responses and decreased proliferation of effector T cells in the presence of tumors. Curcumin, in turn, prevented this loss of T cells, expanded central memory T cell (T(CM))/effector memory T cell (T(EM)) populations, reversed the type 2 immune bias and attenuated the tumor-induced inhibition of T-cell proliferation in tumor-bearing hosts. Further investigation revealed that tumor burden upregulated Treg cell populations and stimulated the production of the immunosuppressive cytokines transforming growth factor (TGF)-beta and IL-10 in these cells. Curcumin, however, inhibited the suppressive activity of Treg cells by downregulating the production of TGF-beta and IL-10 in these cells. More importantly, curcumin treatment enhanced the ability of effector T cells to kill cancer cells. Overall, our observations suggest that the unique properties of curcumin may be exploited for successful attenuation of tumor-induced suppression of cell-mediated immune responses.

  9. Homeostasis of naive and memory CD4+ T cells: IL-2 and IL-7 differentially regulate the balance between proliferation and Fas-mediated apoptosis.

    PubMed

    Jaleco, Sara; Swainson, Louise; Dardalhon, Valérie; Burjanadze, Maryam; Kinet, Sandrina; Taylor, Naomi

    2003-07-01

    Cytokines play a crucial role in the maintenance of polyclonal naive and memory T cell populations. It has previously been shown that ex vivo, the IL-7 cytokine induces the proliferation of naive recent thymic emigrants (RTE) isolated from umbilical cord blood but not mature adult-derived naive and memory human CD4(+) T cells. We find that the combination of IL-2 and IL-7 strongly promotes the proliferation of RTE, whereas adult CD4(+) T cells remain relatively unresponsive. Immunological activity is controlled by a balance between proliferation and apoptotic cell death. However, the relative contributions of IL-2 and IL-7 in regulating these processes in the absence of MHC/peptide signals are not known. Following exposure to either IL-2 or IL-7 alone, RTE, as well as mature naive and memory CD4(+) T cells, are rendered only minimally sensitive to Fas-mediated cell death. However, in the presence of the two cytokines, Fas engagement results in a high level of caspase-dependent apoptosis in both RTE as well as naive adult CD4(+) T cells. In contrast, equivalently treated memory CD4(+) T cells are significantly less sensitive to Fas-induced cell death. The increased susceptibility of RTE and naive CD4(+) T cells to Fas-induced apoptosis correlates with a significantly higher IL-2/IL-7-induced Fas expression on these T cell subsets than on memory CD4(+) T cells. Thus, IL-2 and IL-7 regulate homeostasis by modulating the equilibrium between proliferation and apoptotic cell death in RTE and mature naive and memory T cell subsets.

  10. Natural indoles, indole-3-carbinol and 3,3′-diindolymethane, inhibit T cell activation by staphylococcal enterotoxin B through epigenetic regulation involving HDAC expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Busbee, Philip B.; Nagarkatti, Mitzi; Nagarkatti, Prakash S., E-mail: prakash@mailbox.sc.edu

    2014-01-01

    Staphylococcal enterotoxin B (SEB) is a potent exotoxin produced by the Staphylococcus aureus. This toxin is classified as a superantigen because of its ability to directly bind with MHC-II class molecules followed by activation of a large proportion of T cells bearing specific Vβ-T cell receptors. Commonly associated with classic food poisoning, SEB has also been shown to induce toxic shock syndrome, and is also considered to be a potential biological warfare agent because it is easily aerosolized. In the present study, we assessed the ability of indole-3-carbinol (I3C) and one of its byproducts, 3,3′-diindolylmethane (DIM), found in cruciferous vegetables,more » to counteract the effects of SEB-induced activation of T cells in mice. Both I3C and DIM were found to decrease the activation, proliferation, and cytokine production by SEB-activated Vβ8{sup +} T cells in vitro and in vivo. Interestingly, inhibitors of histone deacetylase class I (HDAC-I), but not class II (HDAC-II), showed significant decrease in SEB-induced T cell activation and cytokine production, thereby suggesting that epigenetic modulation plays a critical role in the regulation of SEB-induced inflammation. In addition, I3C and DIM caused a decrease in HDAC-I but not HDAC-II in SEB-activated T cells, thereby suggesting that I3C and DIM may inhibit SEB-mediated T cell activation by acting as HDAC-I inhibitors. These studies not only suggest for the first time that plant-derived indoles are potent suppressors of SEB-induced T cell activation and cytokine storm but also that they may mediate these effects by acting as HDAC inhibitors. - Highlights: • I3C and DIM reduce SEB-induced T cell activation and inflammatory cytokines. • Inhibiting class I HDACs reduces T cell activation and inflammatory cytokines. • Inhibiting class II HDACs increases T cell activation and inflammatory cytokines. • I3C and DIM selectively reduce mRNA expression of class I HDACs. • Novel use and mechanism to counteract SEB with I3C and DIM.« less

  11. Oral Vaccination with Lipid-Formulated BCG Induces a Long-lived, Multifunctional CD4+ T Cell Memory Immune Response

    PubMed Central

    Ancelet, Lindsay R.; Aldwell, Frank E.; Rich, Fenella J.; Kirman, Joanna R.

    2012-01-01

    Oral delivery of BCG in a lipid formulation (Liporale™-BCG) targets delivery of viable bacilli to the mesenteric lymph nodes and confers protection against an aerosol Mycobacterium tuberculosis challenge. The magnitude, quality and duration of the effector and memory immune response induced by Liporale™-BCG vaccination is unknown. Therefore, we compared the effector and memory CD4+ T cell response in the spleen and lungs of mice vaccinated with Liporale™-BCG to the response induced by subcutaneous BCG vaccination. Liporale™-BCG vaccination induced a long-lived CD4+ T cell response, evident by the detection of effector CD4+ T cells in the lungs and a significant increase in the number of Ag85B tetramer-specific CD4+ T cells in the spleen up to 30 weeks post vaccination. Moreover, following polyclonal stimulation, Liporale™-BCG vaccination, but not s.c. BCG vaccination, induced a significant increase in both the percentage of CD4+ T cells in the lungs capable of producing IFNγ and the number of multifunctional CD4+ T cells in the lungs at 30 weeks post vaccination. These results demonstrate that orally delivered Liporale™-BCG vaccine induces a long-lived multifunctional immune response, and could therefore represent a practical and effective means of delivering novel BCG-based TB vaccines. PMID:23049885

  12. GAD-specific T cells are induced by GAD-alum treatment in Type-1 diabetes patients.

    PubMed

    Pihl, Mikael; Barcenilla, Hugo; Axelsson, Stina; Chéramy, Mikael; Åkerman, Linda; Johansson, Ingela; Ludvigsson, Johnny; Casas, Rosaura

    2017-03-01

    Administration of Glutamic Acid Decarboxylase (GAD) 65 formulated in aluminium hydroxide preserved insulin secretion in a phase II trial in recent onset Type 1 Diabetes. A subsequent European phase III trial was closed at 15months after failing to reach primary endpoint, but the majority of the Swedish patients completed the 21months follow-up. We studied the frequencies and phenotype of T cells, suppressive capacity of Tregs, GAD 65 -induced proliferation, and frequencies of T cells with a GAD 65 -specific TCR in Swedes participating in the trial. Stimulation with GAD 65 induced activated T cells and also cells with a suppressive phenotype. Activated GAD 65 -specific effector T cells were detected by tetramer staining while the frequency of GAD 65 -specific Treg was not affected by the treatment. Additional doses of GAD-alum increased frequencies of CD25 + CD127 + , but had no effect on CD25 hi CD127 lo . Our findings indicate that GAD-alum treatment primarily induced activated T cells. GAD 65 -specific cells were mainly of activated phenotype. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Exosomal cancer immunotherapy is independent of MHC molecules on exosomes.

    PubMed

    Hiltbrunner, Stefanie; Larssen, Pia; Eldh, Maria; Martinez-Bravo, Maria-Jose; Wagner, Arnika K; Karlsson, Mikael C I; Gabrielsson, Susanne

    2016-06-21

    Peptide-loaded exosomes are promising cancer treatment vehicles; however, moderate T cell responses in human clinical trials indicate a need to further understand exosome-induced immunity. We previously demonstrated that antigen-loaded exosomes carry whole protein antigens and require B cells for inducing antigen-specific T cells. Therefore, we investigated the relative importance of exosomal major histocompatibility complex (MHC) class I for the induction of antigen-specific T cell responses and tumour protection. We show that ovalbumin-loaded dendritic cell-derived exosomes from MHCI-/- mice induce antigen-specific T cells at the same magnitude as wild type exosomes. Furthermore, exosomes lacking MHC class I, as well as exosomes with both MHC class I and II mismatch, induced tumour infiltrating T cells and increased overall survival to the same extent as syngeneic exosomes in B16 melanoma. In conclusion, T cell responses are independent of exosomal MHC/peptide complexes if whole antigen is present. This establishes the prospective of using impersonalised exosomes, and will greatly increase the feasibility of designing exosome-based vaccines or therapeutic approaches in humans.

  14. T-Cell Mineralocorticoid Receptor Controls Blood Pressure by Regulating Interferon-Gamma.

    PubMed

    Sun, Xue-Nan; Li, Chao; Liu, Yuan; Du, Lin-Juan; Zeng, Meng-Ru; Zheng, Xiao-Jun; Zhang, Wu-Chang; Liu, Yan; Zhu, Mingjiang; Kong, Deping; Zhou, Li; Lu, Limin; Shen, Zhu-Xia; Yi, Yi; Du, Lili; Qin, Mu; Liu, Xu; Hua, Zichun; Sun, Shuyang; Yin, Huiyong; Zhou, Bin; Yu, Ying; Zhang, Zhiyuan; Duan, Sheng-Zhong

    2017-05-12

    Hypertension remains to be a global public health burden and demands novel intervention strategies such as targeting T cells and T-cell-derived cytokines. Mineralocorticoid receptor (MR) antagonists have been clinically used to treat hypertension. However, the function of T-cell MR in blood pressure (BP) regulation has not been elucidated. We aim to determine the role of T-cell MR in BP regulation and to explore the mechanism. Using T-cell MR knockout mouse in combination with angiotensin II-induced hypertensive mouse model, we demonstrated that MR deficiency in T cells strikingly decreased both systolic and diastolic BP and attenuated renal and vascular damage. Flow cytometric analysis showed that T-cell MR knockout mitigated angiotensin II-induced accumulation of interferon-gamma (IFN-γ)-producing T cells, particularly CD8 + population, in both kidneys and aortas. Similarly, eplerenone attenuated angiotensin II-induced elevation of BP and accumulation of IFN-γ-producing T cells in wild-type mice. In cultured CD8 + T cells, T-cell MR knockout suppressed IFN-γ expression whereas T-cell MR overexpression and aldosterone both enhanced IFN-γ expression. At the molecular level, MR interacted with NFAT1 (nuclear factor of activated T-cells 1) and activator protein-1 in T cells. Finally, T-cell MR overexpressing mice manifested more elevated BP compared with control mice after angiotensin II infusion and such difference was abolished by IFN-γ-neutralizing antibodies. MR may interact with NFAT1 and activator protein-1 to control IFN-γ in T cells and to regulate target organ damage and ultimately BP. Targeting MR in T cells specifically may be an effective novel approach for hypertension treatment. © 2017 American Heart Association, Inc.

  15. Chondrogenic Differentiation Increases Antidonor Immune Response to Allogeneic Mesenchymal Stem Cell Transplantation

    PubMed Central

    Ryan, Aideen E; Lohan, Paul; O'Flynn, Lisa; Treacy, Oliver; Chen, Xizhe; Coleman, Cynthia; Shaw, Georgina; Murphy, Mary; Barry, Frank; Griffin, Matthew D; Ritter, Thomas

    2014-01-01

    Allogeneic mesenchymal stem cells (allo-MSCs) have potent regenerative and immunosuppressive potential and are being investigated as a therapy for osteoarthritis; however, little is known about the immunological changes that occur in allo-MSCs after ex vivo induced or in vivo differentiation. Three-dimensional chondrogenic differentiation was induced in an alginate matrix, which served to immobilize and potentially protect MSCs at the site of implantation. We show that allogeneic differentiated MSCs lost the ability to inhibit T-cell proliferation in vitro, in association with reduced nitric oxide and prostaglandin E2 secretion. Differentiation altered immunogenicity as evidenced by induced proliferation of allogeneic T cells and increased susceptibility to cytotoxic lysis by allo-specific T cells. Undifferentiated or differentiated allo-MSCs were implanted subcutaneously, with and without alginate encapsulation. Increased CD3+ and CD68+ infiltration was evident in differentiated and splenocyte encapsulated implants only. Without encapsulation, increased local memory T-cell responses were detectable in recipients of undifferentiated and differentiated MSCs; however, only differentiated MSCs induced systemic memory T-cell responses. In recipients of encapsulated allogeneic cells, only differentiated allo-MSCs induced memory T-cell responses locally and systemically. Systemic alloimmune responses to differentiated MSCs indicate immunogenicity regardless of alginate encapsulation and may require immunosuppressive therapy for therapeutic use. PMID:24184966

  16. Generation of TCR-Expressing Innate Lymphoid-like Helper Cells that Induce Cytotoxic T Cell-Mediated Anti-leukemic Cell Response.

    PubMed

    Ueda, Norihiro; Uemura, Yasushi; Zhang, Rong; Kitayama, Shuichi; Iriguchi, Shoichi; Kawai, Yohei; Yasui, Yutaka; Tatsumi, Minako; Ueda, Tatsuki; Liu, Tian-Yi; Mizoro, Yasutaka; Okada, Chihiro; Watanabe, Akira; Nakanishi, Mahito; Senju, Satoru; Nishimura, Yasuharu; Kuzushima, Kiyotaka; Kiyoi, Hitoshi; Naoe, Tomoki; Kaneko, Shin

    2018-06-05

    CD4 + T helper (Th) cell activation is essential for inducing cytotoxic T lymphocyte (CTL) responses against malignancy. We reprogrammed a Th clone specific for chronic myelogenous leukemia (CML)-derived b3a2 peptide to pluripotency and re-differentiated the cells into original TCR-expressing T-lineage cells (iPS-T cells) with gene expression patterns resembling those of group 1 innate lymphoid cells. CD4 gene transduction into iPS-T cells enhanced b3a2 peptide-specific responses via b3a2 peptide-specific TCR. iPS-T cells upregulated CD40 ligand (CD40L) expression in response to interleukin-2 and interleukin-15. In the presence of Wilms tumor 1 (WT1) peptide, antigen-specific dendritic cells (DCs) conditioned by CD4-modified CD40L high iPS-T cells stimulated WT1-specific CTL priming, which eliminated WT1 peptide-expressing CML cells in vitro and in vivo. Thus, CD4 modification of CD40L high iPS-T cells generates innate lymphoid helper-like cells inducing bcr-abl-specific TCR signaling that mediates effectiveanti-leukemic CTL responses via DC maturation, showing potential for adjuvant immunotherapy against leukemia. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  17. Lipopolysaccharide Stimulates Butyric Acid-Induced Apoptosis in Human Peripheral Blood Mononuclear Cells

    PubMed Central

    Kurita-Ochiai, Tomoko; Fukushima, Kazuo; Ochiai, Kuniyasu

    1999-01-01

    We previously reported that butyric acid, an extracellular metabolite from periodontopathic bacteria, induced apoptosis in murine thymocytes, splenic T cells, and human Jurkat T cells. In this study, we examined the ability of butyric acid to induce apoptosis in peripheral blood mononuclear cells (PBMC) and the effect of bacterial lipopolysaccharide (LPS) on this apoptosis. Butyric acid significantly inhibited the anti-CD3 monoclonal antibody- and concanavalin A-induced proliferative responses in a dose-dependent fashion. This inhibition of PBMC growth by butyric acid depended on apoptosis in vitro. It was characterized by internucleosomal DNA digestion and revealed by gel electrophoresis followed by a colorimetric DNA fragmentation assay to occur in a concentration-dependent fashion. Butyric acid-induced PBMC apoptosis was accompanied by caspase-3 protease activity but not by caspase-1 protease activity. LPS potentiated butyric acid-induced PBMC apoptosis in a dose-dependent manner. Flow-cytometric analysis revealed that LPS increased the proportion of sub-G1 cells and the number of late-stage apoptotic cells induced by butyric acid. Annexin V binding experiments with fractionated subpopulations of PBMC in flow cytometory revealed that LPS accelerated the butyric acid-induced CD3+-T-cell apoptosis followed by similar levels of both CD4+- and CD8+-T-cell apoptosis. The addition of LPS to PBMC cultures did not cause DNA fragmentation, suggesting that LPS was unable to induce PBMC apoptosis directly. These data suggest that LPS, in combination with butyric acid, potentiates CD3+ PBMC T-cell apoptosis and plays a role in the apoptotic depletion of CD4+ and CD8+ cells. PMID:9864191

  18. Cytotoxicity Induced by a Redox-silent Analog of Tocotrienol in Human Mesothelioma H2452 Cell Line via Suppression of Cap-dependent Protein Translation.

    PubMed

    Sato, Ayami; Ueno, Haruka; Takase, Akari; Ando, Akira; Sekine, Yuko; Yano, Tomohiro

    2016-04-01

    De novo synthesis of proteins is regulated by cap-dependent protein translation. Aberrant activation of the translation is a hallmark of many cancer types including malignant mesothelioma (MM). We previously reported that a redox-silent analog of α-tocotrienol, 6-O-carboxypropyl-α-tocotrienol (T3E) induces potent cytotoxicity against human MM cells. However, the detailed mechanism of cytotoxicity of T3E remains unclear. In this study, we investigated if T3E induced potent cytotoxicity aganist MM cells. T3E reduced the formation of the cap-dependent translation complex and induced inactivation of oncogene from rat sarcoma virus (RAS). These events were associated with T3E cytotoxicity in MM cells. Furthermore, atorvastatin, an inhibitor of RAS function, had similar effects on MM cells. Moreover, 4EGI-1, a specific inhibitor of the cap-dependent translation complex, induced severe cytotoxicity in MM cells. Overall, T3E had a cytotoxic effect on MM cells via disruption of the activated cap-dependent translation complex through inactivation of RAS. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  19. Radiation-induced leukemia: Comparative studies in mouse and man

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haas, M.

    1991-01-01

    We now have a clear understanding of the mechanism by which radiation-induced (T-cell) leukemia occurs. In irradiated mice (radiation-induced thymic leukemia) and in man (acute lymphoblastic T-cell leukemia, T-ALL) the mechanism of leukemogenesis is surprisingly similar. Expressed in the most elementary terms, T-cell leukemia occurs when T-cell differentiation is inhibited by a mutation, and pre-T cells attempt but fail to differentiate in the thymus. Instead of leaving the thymus for the periphery as functional T-cells they continue to proliferate in the thymus. The proliferating pre- (pro-) T-cells constitute the (early) acute T-cell leukemia (A-TCL). This model for the mechanism ofmore » T-cell leukemogenesis accounts for all the properties of both murine and human A-TCL. Important support for the model has recently come from work by Ilan Kirsch and others, who have shown that mutations/deletions in the genes SCL (TAL), SIL, and LCK constitute primary events in the development of T-ALL, by inhibiting differentiation of thymic pre- (pro-) T-cells. This mechanism of T-cell leukemogenesis brings several specific questions into focus: How do early A-TCL cells progress to become potently tumorigenic and poorly treatable Is it feasible to genetically suppress early and/or progressed A-TCL cells What is the mechanism by which the differentiation-inhibited (leukemic) pre-T cells proliferate During the first grant year we have worked on aspects of all three questions.« less

  20. Targeting LAG-3 and PD-1 to Enhance T Cell Activation by Antigen-Presenting Cells

    PubMed Central

    Lichtenegger, Felix S.; Rothe, Maurine; Schnorfeil, Frauke M.; Deiser, Katrin; Krupka, Christina; Augsberger, Christian; Schlüter, Miriam; Neitz, Julia; Subklewe, Marion

    2018-01-01

    Immune checkpoint inhibition has been shown to successfully reactivate endogenous T cell responses directed against tumor-associated antigens, resulting in significantly prolonged overall survival in patients with various tumor entities. For malignancies with low endogenous immune responses, this approach has not shown a clear clinical benefit so far. Therapeutic vaccination, particularly dendritic cell (DC) vaccination, is a strategy to induce T cell responses. Interaction of DCs and T cells is dependent on receptor–ligand interactions of various immune checkpoints. In this study, we analyzed the influence of blocking antibodies targeting programmed cell death protein 1 (PD-1), HVEM, CD244, TIM-3, and lymphocyte activation gene 3 (LAG-3) on the proliferation and cytokine secretion of T cells after stimulation with autologous TLR-matured DCs. In this context, we found that LAG-3 blockade resulted in superior T cell activation compared to inhibition of other pathways, including PD-1/PD-L1. This result was consistent across different methods to measure T cell stimulation (proliferation, IFN-γ secretion), various stimulatory antigens (viral and bacterial peptide pool, specific viral antigen, specific tumor antigen), and seen for both CD4+ and CD8+ T cells. Only under conditions with a weak antigenic stimulus, particularly when combining antigen presentation by peripheral blood mononuclear cells with low concentrations of peptides, we observed the highest T cell stimulation with dual blockade of LAG-3 and PD-1 blockade. We conclude that priming of novel immune responses can be strongly enhanced by blockade of LAG-3 or dual blockade of LAG-3 and PD-1, depending on the strength of the antigenic stimulus. PMID:29535740

  1. Targeting LAG-3 and PD-1 to Enhance T Cell Activation by Antigen-Presenting Cells.

    PubMed

    Lichtenegger, Felix S; Rothe, Maurine; Schnorfeil, Frauke M; Deiser, Katrin; Krupka, Christina; Augsberger, Christian; Schlüter, Miriam; Neitz, Julia; Subklewe, Marion

    2018-01-01

    Immune checkpoint inhibition has been shown to successfully reactivate endogenous T cell responses directed against tumor-associated antigens, resulting in significantly prolonged overall survival in patients with various tumor entities. For malignancies with low endogenous immune responses, this approach has not shown a clear clinical benefit so far. Therapeutic vaccination, particularly dendritic cell (DC) vaccination, is a strategy to induce T cell responses. Interaction of DCs and T cells is dependent on receptor-ligand interactions of various immune checkpoints. In this study, we analyzed the influence of blocking antibodies targeting programmed cell death protein 1 (PD-1), HVEM, CD244, TIM-3, and lymphocyte activation gene 3 (LAG-3) on the proliferation and cytokine secretion of T cells after stimulation with autologous TLR-matured DCs. In this context, we found that LAG-3 blockade resulted in superior T cell activation compared to inhibition of other pathways, including PD-1/PD-L1. This result was consistent across different methods to measure T cell stimulation (proliferation, IFN-γ secretion), various stimulatory antigens (viral and bacterial peptide pool, specific viral antigen, specific tumor antigen), and seen for both CD4 + and CD8 + T cells. Only under conditions with a weak antigenic stimulus, particularly when combining antigen presentation by peripheral blood mononuclear cells with low concentrations of peptides, we observed the highest T cell stimulation with dual blockade of LAG-3 and PD-1 blockade. We conclude that priming of novel immune responses can be strongly enhanced by blockade of LAG-3 or dual blockade of LAG-3 and PD-1, depending on the strength of the antigenic stimulus.

  2. Type 2 innate lymphoid cell suppression by regulatory T cells attenuates airway hyperreactivity and requires inducible T-cell costimulator-inducible T-cell costimulator ligand interaction.

    PubMed

    Rigas, Diamanda; Lewis, Gavin; Aron, Jennifer L; Wang, Bowen; Banie, Homayon; Sankaranarayanan, Ishwarya; Galle-Treger, Lauriane; Maazi, Hadi; Lo, Richard; Freeman, Gordon J; Sharpe, Arlene H; Soroosh, Pejman; Akbari, Omid

    2017-05-01

    Atopic diseases, including asthma, exacerbate type 2 immune responses and involve a number of immune cell types, including regulatory T (Treg) cells and the emerging type 2 innate lymphoid cells (ILC2s). Although ILC2s are potent producers of type 2 cytokines, the regulation of ILC2 activation and function is not well understood. In the present study, for the first time, we evaluate how Treg cells interact with pulmonary ILC2s and control their function. ILC2s and Treg cells were evaluated by using in vitro suppression assays, cell-contact assays, and gene expression panels. Also, human ILC2s and Treg cells were adoptively transferred into NOD SCID γC-deficient mice, which were given isotype or anti-inducible T-cell costimulator ligand (ICOSL) antibodies and then challenged with IL-33 and assessed for airway hyperreactivity. We show that induced Treg cells, but not natural Treg cells, effectively suppress the production of the ILC2-driven proinflammatory cytokines IL-5 and IL-13 both in vitro and in vivo. Mechanistically, our data reveal the necessity of inducible T-cell costimulator (ICOS)-ICOS ligand cell contact for Treg cell-mediated ILC2 suppression alongside the suppressive cytokines TGF-β and IL-10. Using a translational approach, we then demonstrate that human induced Treg cells suppress syngeneic human ILC2s through ICOSL to control airway inflammation in a humanized ILC2 mouse model. These findings suggest that peripheral expansion of induced Treg cells can serve as a promising therapeutic target against ILC2-dependent asthma. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  3. Different TCR-induced T lymphocyte responses are potentiated by stiffness with variable sensitivity

    PubMed Central

    Saitakis, Michael; Dogniaux, Stéphanie; Goudot, Christel; Bufi, Nathalie; Asnacios, Sophie; Maurin, Mathieu; Randriamampita, Clotilde; Asnacios, Atef; Hivroz, Claire

    2017-01-01

    T cells are mechanosensitive but the effect of stiffness on their functions is still debated. We characterize herein how human primary CD4+ T cell functions are affected by stiffness within the physiological Young’s modulus range of 0.5 kPa to 100 kPa. Stiffness modulates T lymphocyte migration and morphological changes induced by TCR/CD3 triggering. Stiffness also increases TCR-induced immune system, metabolism and cell-cycle-related genes. Yet, upon TCR/CD3 stimulation, while cytokine production increases within a wide range of stiffness, from hundreds of Pa to hundreds of kPa, T cell metabolic properties and cell cycle progression are only increased by the highest stiffness tested (100 kPa). Finally, mechanical properties of adherent antigen-presenting cells modulate cytokine production by T cells. Together, these results reveal that T cells discriminate between the wide range of stiffness values found in the body and adapt their responses accordingly. DOI: http://dx.doi.org/10.7554/eLife.23190.001 PMID:28594327

  4. Arachidonic acid and lipoxinA4 attenuate streptozotocin-induced cytotoxicity to RIN5 F cells in vitro and type 1 and type 2 diabetes mellitus in vivo.

    PubMed

    Gundala, Naveen K V; Naidu, Vegi G M; Das, Undurti N

    2017-03-01

    The aim of this study was to observe whether polyunsaturated fatty acids (PUFAs) can protect rat insulinoma (RIN5 F) cells against streptozotocin (STZ)-induced apoptosis in vitro and type 1 diabetes mellitus (T1DM) and type 2 DM (T2DM) in vivo and if so, what would be the mechanism of this action. RIN5 F cells were used for the in vitro study, whereas the in vivo study was performed in Wistar rats. STZ was used to induce apoptosis of RIN5 F cells in vitro and T1- and T2DM in vivo. The effect of PUFAs: γ-linolenic acid (GLA), arachidonic acid (AA) of ω-6 series, and eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) of ω-3 series; cyclooxygenase (COX) and lipoxygenase (LOX) inhibitors and antiinflammatory metabolite of AA and DHA, lipoxin A4 (LXA4), and resolvin D2 and protectin, respectively against STZ-induced cytotoxicity to RIN5 F cells in vitro and LXA4 against T1- and T2DM in vivo was studied. Changes in the antioxidant content, lipid peroxides, nitric oxide, and expression of PDX1, P65, nuclear factor-κb (NF-κb), and IKB genes in STZ-treated RIN5 F cells in vitro and Nrf2, GLUT2, COX2, iNOS protein levels in the pancreatic tissue of T1- and T2DM and LPCLN2 (lipocalin 2), NF-κb, IKB I in adipose tissue of T2DM after LXA4 treatment were studied. Plasma glucose, insulin, and tumor necrosis factor (TNF)-α levels also were measured in STZ-induced T1- and T2DM Wistar rats. Among all PUFAs tested, AA and EPA are the most effective against STZ-induced cytotoxicity to RIN5 F cells in vitro. Neither COX nor LOX inhibitors blocked the cytoprotective action of AA in vitro and T1- and T2DM by STZ. LXA4 production by RIN5 F cells in vitro and plasma LXA4 levels in STZ-induced T1- and T2DM animals were decreased by STZ that reverted to normal after AA treatment. AA prevented both T1- and T2DM induced by STZ. Antiinflammatory metabolite of AA and LXA4 prevented both T1- and T2DM induced by STZ. The expression of Pdx1, NF-κb, IKB genes in the pancreas and plasma TNF-α levels in T1- and T2DM; Nrf2, Glut2, COX2, and iNOS proteins in pancreatic tissue of T1DM and LPCLN2, NF-κb, IKB I in adipose tissue of T2DM reverted to normal in LXA4-treated animals. Both AA and LXA4 prevented STZ-induced cytotoxicity to RIN5 F cells in vitro and T1- and T2DM in vivo, suggesting that these two bioactive lipids may function as antidiabetic molecules. AA is beneficial against STZ-induced cytotoxicity and T1- and T2DM by enhancing the production of LXA4. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Role of the glucocorticoid-induced TNFR-related protein (GITR)-GITR ligand pathway in innate and adaptive immunity.

    PubMed

    Azuma, Miyuki

    2010-01-01

    Glucocorticoid-induced TNF receptor-related protein (GITR) is expressed in regulatory T cells at high levels, but is also inducible in conventional effector T cells after activation. Initial studies using an agonistic anti- GITR mAb mislead this line of research with respect to the contribution of GITR stimulation on the function of regulatory T cells. In fact, GITR acts as a costimulatory receptor for both effector and regulatory T cells by enhancing effector and regulatory functions, respectively. Unlike other costimulatory ligands, GITR ligand (GITRL) expression on mature myeloid dendritic cells (DCs) is extremely limited and the GITR-GITRL pathway does not contribute markedly to direct interactions with T cells and antigen-presenting cells in the secondary lymphoid tissues. Rather, GITRL is constitutively expressed on parenchymal tissue cells and interacts with GITR expressed on tissue-infiltrating macrophages and DCs, or effector and regulatory T cells. Interactions with GITR and GITRL at local inflammatory sites induce site-specific production of cytokines and chemokines, resulting in control activation of tissue-infiltrating effector or regulatory cells and their migration. This review summarizes recent reports on the GITR-GITRL pathway, which controls both innate and adaptive immune responses.

  6. Hepatocyte‐induced CD4+ T cell alloresponse is associated with major histocompatibility complex class II up‐regulation on hepatocytes and suppressible by regulatory T cells

    PubMed Central

    DeTemple, Daphne E.; Oldhafer, Felix; Falk, Christine S.; Chen‐Wacker, Chen; Figueiredo, Constanca; Kleine, Moritz; Ramackers, Wolf; Timrott, Kai; Lehner, Frank; Klempnauer, Juergen; Bock, Michael

    2018-01-01

    Hepatocyte transplantation is a promising therapeutic approach for various liver diseases. Despite the liver's tolerogenic potential, early immune‐mediated loss of transplanted cells is observed, and longterm acceptance has not been achieved yet. Patients deemed tolerant after liver transplantation presented an increased frequency of regulatory T cells (Tregs), which therefore also might enable reduction of posttransplant cell loss and enhance longterm allograft acceptance. We hence characterized hepatocyte‐induced immune reactions and evaluated the immunomodulatory potential of Tregs applying mixed lymphocyte cultures and mixed lymphocyte hepatocyte cultures. These were set up using peripheral blood mononuclear cells and primary human hepatocytes, respectively. Polyclonally expanded CD4+CD25highCD127low Tregs were added to cocultures in single‐/trans‐well setups with/without supplementation of anti‐interferon γ (IFNγ) antibodies. Hepatocyte‐induced alloresponses were then analyzed by multicolor flow cytometry. Measurements indicated that T cell response upon stimulation was associated with IFNγ‐induced major histocompatibility complex (MHC) class II up‐regulation on hepatocytes and mediated by CD4+ T cells. An indirect route of antigen presentation could be ruled out by use of fragmented hepatocytes and culture supernatants of hepatocytes. Allospecific proliferation was accompanied by inflammatory cytokine secretion. CD8+ T cells showed early up‐regulation of CD69 despite lack of cell proliferation in the course of coculture. Supplementation of Tregs effectively abrogated hepatocyte‐induced alloresponses and was primarily cell contact dependent. In conclusion, human hepatocytes induce a CD4+ T cell alloresponse in vitro, which is associated with MHC class II up‐regulation on hepatocytes and is susceptible to suppression by Tregs. Liver Transplantation 24 407–419 2018 AASLD. PMID:29365365

  7. CD4+ T Cells Reactive to Enteric Bacterial Antigens in Spontaneously Colitic C3H/HeJBir Mice: Increased T Helper Cell Type 1 Response and Ability to Transfer Disease

    PubMed Central

    Cong, Yingzi; Brandwein, Steven L.; McCabe, Robert P.; Lazenby, A.; Birkenmeier, Edward H.; Sundberg, John P.; Elson, Charles O.

    1998-01-01

    C3H/HeJBir mice are a new substrain that spontaneously develop colitis early in life. This study was done to determine the T cell reactivity of C3H/HeJBir mice to candidate antigens that might be involved in their disease. C3H/HeJBir CD4+ T cells were strongly reactive to antigens of the enteric bacterial flora, but not to epithelial or food antigens. The stimulatory material in the enteric bacteria was trypsin sensitive and restricted by class II major histocompatibility complex molecules, but did not have the properties of a superantigen. The precursor frequency of interleuken (IL)-2–producing, bacterial-reactive CD4+ T cells in colitic mice was 1 out of 2,000 compared to 1 out of 20,000–25,000 in noncolitic control mice. These T cells produced predominately IL-2 and interferon γ, consistent with a T helper type 1 cell response and were present at 3–4 wk, the age of onset of the colitis. Adoptive transfer of bacterial-antigen–activated CD4+ T cells from colitic C3H/HeJBir but not from control C3H/HeJ mice into C3H/HeSnJ scid/scid recipients induced colitis. These data represent a direct demonstration that T cells reactive with conventional antigens of the enteric bacterial flora can mediate chronic inflammatory bowel disease. PMID:9500788

  8. Quantitative and qualitative features of heterologous virus-vector-induced antigen-specific CD8+ T cells against Trypanosoma cruzi infection.

    PubMed

    Takayama, Eiji; Ono, Takeshi; Carnero, Elena; Umemoto, Saori; Yamaguchi, Yoko; Kanayama, Atsuhiro; Oguma, Takemi; Takashima, Yasuhiro; Tadakuma, Takushi; García-Sastre, Adolfo; Miyahira, Yasushi

    2010-11-01

    We studied some aspects of the quantitative and qualitative features of heterologous recombinant (re) virus-vector-induced, antigen-specific CD8(+) T cells against Trypanosoma cruzi. We used three different, highly attenuated re-viruses, i.e., influenza virus, adenovirus and vaccinia virus, which all expressed a single, T. cruzi antigen-derived CD8(+) T-cell epitope. The use of two out of three vectors or the triple virus-vector vaccination regimen not only confirmed that the re-vaccinia virus, which was placed last in order for sequential immunisation, was an effective booster for the CD8(+) T-cell immunity in terms of the number of antigen-specific CD8(+) T cells, but also demonstrated that (i) the majority of cells exhibit the effector memory (T(EM)) phenotype, (ii) robustly secrete IFN-γ, (iii) express higher intensity of the CD122 molecule and (iv) present protective activity against T. cruzi infection. In contrast, placing the re-influenza virus last in sequential immunisation had a detrimental effect on the quantitative and qualitative features of CD8(+) T cells. The triple virus-vector vaccination was more effective at inducing a stronger CD8(+) T-cell immunity than using two re-viruses. The different quantitative and qualitative features of CD8(+) T cells induced by different immunisation regimens support the notion that the refinement of the best choice of multiple virus-vector combinations is indispensable for the induction of a maximum number of CD8(+) T cells of high quality. Copyright © 2010 Australian Society for Parasitology Inc. All rights reserved.

  9. CD147 and CD98 complex-mediated homotypic aggregation attenuates the CypA-induced chemotactic effect on Jurkat T cells.

    PubMed

    Guo, Na; Zhang, Kui; Lv, Minghua; Miao, Jinlin; Chen, Zhinan; Zhu, Ping

    2015-02-01

    Homotypic cell aggregation plays important roles in physiological and pathological processes, including embryogenesis, immune responses, angiogenesis, tumor cell invasion and metastasis. CD147 has been implicated in most of these phenomena, and it was identified as a T cell activation-associated antigen due to its obvious up-regulation in activated T cells. However, the explicit function and mechanism of CD147 in T cells have not been fully elucidated. In this study, large and compact aggregates were observed in Jurkat T cells after treatment with the specific CD147 monoclonal antibody HAb18 or after the expression of CD147 was silenced by RNA interference, which indicated an inhibitory effect of CD147 in T cell homotypic aggregation. Knocking down CD147 expression resulted in a significant decrease in CD98, along with prominent cell aggregation, similar to that treated by CD98 and CD147 monoclonal antibodies. Furthermore, decreased cell chemotactic activity was observed following CD147- and CD98-mediated cell aggregation, and increased aggregation was correlated with a decrease in the chemotactic ability of the Jurkat T cells, suggesting that CD147- and CD98-mediated homotypic cell aggregation plays a negative role in T cell chemotaxis. Our data also showed that p-ERK, p-ZAP70, p-CD3ζ and p-LCK were significantly decreased in the CD147- and CD98-knocked down Jurkat T cells, which suggested that decreased CD147- and/or CD98-induced homotypic T cell aggregation and aggregation-inhibited chemotaxis might be associated with these signaling pathways. A role for CD147 in cell aggregation and chemotaxis was further indicated in primary CD4(+) T cells. Similarly, low expression of CD147 in primary T cells induced prominent cell aggregation and this aggregation attenuated primary T cell chemotactic ability in response to CypA. Our results have demonstrated the correlation between homotypic cell aggregation and the chemotactic response of T cells to CypA, and these data indicate that CD147 and CD98 might play important roles in cyclophilin-induced cell migration. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. De novo design of peptide immunogens that mimic the coiled coil region of human T-cell leukemia virus type-1 glycoprotein 21 transmembrane subunit for induction of native protein reactive neutralizing antibodies.

    PubMed

    Sundaram, Roshni; Lynch, Marcus P; Rawale, Sharad V; Sun, Yiping; Kazanji, Mirdad; Kaumaya, Pravin T P

    2004-06-04

    Peptide vaccines able to induce high affinity and protective neutralizing antibodies must rely in part on the design of antigenic epitopes that mimic the three-dimensional structure of the corresponding region in the native protein. We describe the design, structural characterization, immunogenicity, and neutralizing potential of antibodies elicited by conformational peptides derived from the human T-cell leukemia virus type 1 (HTLV-1) gp21 envelope glycoprotein spanning residues 347-374. We used a novel template design and a unique synthetic approach to construct two peptides (WCCR2T and CCR2T) that would each assemble into a triple helical coiled coil conformation mimicking the gp21 crystal structure. The peptide B-cell epitopes were grafted onto the epsilon side chains of three lysyl residues on a template backbone construct consisting of the sequence acetyl-XGKGKGKGCONH2 (where X represents the tetanus toxoid promiscuous T cell epitope (TT) sequence 580-599). Leucine substitutions were introduced at the a and d positions of the CCR2T sequence to maximize helical character and stability as shown by circular dichroism and guanidinium hydrochloride studies. Serum from an HTLV-1-infected patient was able to recognize the selected epitopes by enzyme-linked immunosorbent assay (ELISA). Mice immunized with the wild-type sequence (WCCR2T) and the mutant sequence (CCR2T) elicited high antibody titers that were capable of recognizing the native protein as shown by flow cytometry and whole virus ELISA. Sera and purified antibodies from immunized mice were able to reduce the formation of syncytia induced by the envelope glycoprotein of HTLV-1, suggesting that antibodies directed against the coiled coil region of gp21 are capable of disrupting cell-cell fusion. Our results indicate that these peptides represent potential candidates for use in a peptide vaccine against HTLV-1.

  11. Ex vivo assessment of polyol coated-iron oxide nanoparticles for MRI diagnosis applications: toxicological and MRI contrast enhancement effects

    NASA Astrophysics Data System (ADS)

    Bomati-Miguel, Oscar; Miguel-Sancho, Nuria; Abasolo, Ibane; Candiota, Ana Paula; Roca, Alejandro G.; Acosta, Milena; Schwartz, Simó; Arus, Carles; Marquina, Clara; Martinez, Gema; Santamaria, Jesus

    2014-03-01

    Polyol synthesis is a promising method to obtain directly pharmaceutical grade colloidal dispersion of superparamagnetic iron oxide nanoparticles (SPIONs). Here, we study the biocompatibility and performance as T2-MRI contrast agents (CAs) of high quality magnetic colloidal dispersions (average hydrodynamic aggregate diameter of 16-27 nm) consisting of polyol-synthesized SPIONs (5 nm in mean particle size) coated with triethylene glycol (TEG) chains (TEG-SPIONs), which were subsequently functionalized to carboxyl-terminated meso-2-3-dimercaptosuccinic acid (DMSA) coated-iron oxide nanoparticles (DMSA-SPIONs). Standard MTT assays on HeLa, U87MG, and HepG2 cells revealed that colloidal dispersions of TEG-coated iron oxide nanoparticles did not induce any loss of cell viability after 3 days incubation with dose concentrations below 50 μg Fe/ml. However, after these nanoparticles were functionalized with DMSA molecules, an increase on their cytotoxicity was observed, so that particles bearing free terminal carboxyl groups on their surface were not cytotoxic only at low concentrations (<10 μg Fe/ml). Moreover, cell uptake assays on HeLa and U87MG and hemolysis tests have demonstrated that TEG-SPIONs and DMSA-SPIONs were well internalized by the cells and did not induce any adverse effect on the red blood cells at the tested concentrations. Finally, in vitro relaxivity measurements and post mortem MRI studies in mice indicated that both types of coated-iron oxide nanoparticles produced higher negative T2-MRI contrast enhancement than that measured for a similar commercial T2-MRI CAs consisting in dextran-coated ultra-small iron oxide nanoparticles (Ferumoxtran-10). In conclusion, the above attributes make both types of as synthesized coated-iron oxide nanoparticles, but especially DMSA-SPIONs, promising candidates as T2-MRI CAs for nanoparticle-enhanced MRI diagnosis applications.

  12. AKT/SGK-sensitive phosphorylation of GSK3 in the regulation of L-selectin and perforin expression as well as activation induced cell death of T-lymphocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhavsar, Shefalee K.; Merches, Katja; Bobbala, Diwakar

    2012-08-17

    Highlights: Black-Right-Pointing-Pointer Akt/SGK dependent phosphorylation of GSK3{alpha},{beta} regulates T lymphocytes. Black-Right-Pointing-Pointer T cells from mice expressing Akt/SGK insensitive GSK3{alpha},{beta} (gsk3{sup KI}) release less IL-2. Black-Right-Pointing-Pointer CD4{sup +} cells from gsk3{sup KI} mice express less CD62L. Black-Right-Pointing-Pointer CD8{sup +} cells from gsk3{sup KI} mice are relatively resistant to activation induced cell death. Black-Right-Pointing-Pointer Perforin expression is enhanced in gsk3{sup KI} T cells. -- Abstract: Survival and function of T-lymphocytes critically depends on phosphoinositide (PI) 3 kinase. PI3 kinase signaling includes the PKB/Akt and SGK dependent phosphorylation and thus inhibition of glycogen synthase kinase GSK3{alpha},{beta}. Lithium, a known unspecific GSK3 inhibitor protectsmore » against experimental autoimmune encephalomyelitis. The present study explored, whether Akt/SGK-dependent regulation of GSK3 activity is a determinant of T cell survival and function. Experiments were performed in mutant mice in which Akt/SGK-dependent GSK3{alpha},{beta} inhibition was disrupted by replacement of the serine residue in the respective SGK/Akt-phosphorylation consensus sequence by alanine (gsk3{sup KI}). T cells from gsk3{sup KI} mice were compared to T cells from corresponding wild type mice (gsk3{sup WT}). As a result, in gsk3{sup KI} CD4{sup +} cells surface CD62L (L-selectin) was significantly less abundant than in gsk3{sup WT} CD4{sup +} cells. Upon activation in vitro T cells from gsk3{sup KI} mice reacted with enhanced perforin production and reduced activation induced cell death. Cytokine production was rather reduced in gsk3{sup KI} T cells, suggesting that GSK3 induces effector function in CD8{sup +} T cells. In conclusion, PKB/Akt and SGK sensitive phosphorylation of GSK3{alpha},{beta} is a potent regulator of perforin expression and activation induced cell death in T lymphocytes.« less

  13. Icariside II activates EGFR-Akt-Nrf2 signaling and protects osteoblasts from dexamethasone.

    PubMed

    Liu, Weidong; Mao, Li; Ji, Feng; Chen, Fengli; Wang, Shouguo; Xie, Yue

    2017-01-10

    The potential effect of icariside II on dexamethasone-induced osteoblast cell damages was evaluated here. In MC3T3-E1 osteoblastic cells and the primary murine osteoblasts, co-treatment with icariside II dramatically attenuated dexamethasone- induced cell death and apoptosis. Icariside II activated Akt signaling, which is required for its actions in osteoblasts. Akt inhibitors (LY294002, perifosine and MK-2206) almost abolished icariside II-induced osteoblast cytoprotection against dexamethasone. Further studies showed that icariside II activated Nrf2 signaling, downstream of Akt, to inhibit dexamethasone-induced reactive oxygen species (ROS) production in MC3T3-E1 cells and primary osteoblasts. On the other hand, Nrf2 shRNA knockdown inhibited icariside II-induced anti-dexamethasone cytoprotection in MC3T3-E1 cells. Finally, we showed that icariside II induced heparin-binding EGF (HB-EGF) production and EGFR trans-activation in MC3T3-E1 cells. EGFR inhibition, via anti-HB-EGF antibody, EGFR inhibitor AG1478 or EGFR shRNA knockdown, almost blocked icariside II-induced Akt-Nrf2 activation in MC3T3-E1 cells. Collectively, we conclude that icariside II activates EGFR-Akt-Nrf2 signaling and protects osteoblasts from dexamethasone. Icariside II might have translational value for the treatment of dexamethasone-associated osteoporosis/osteonecrosis.

  14. CD49a promotes T-cell-mediated hepatitis by driving T helper 1 cytokine and interleukin-17 production

    PubMed Central

    Chen, Yonglin; Peng, Hui; Chen, Yongyan; Wei, Haiming; Sun, Rui; Tian, Zhigang

    2014-01-01

    It is becoming increasingly clear that the T-cell-mediated immune response is important in many diseases. In this study, we used concanavalin A (Con A) -induced hepatitis to investigate the role of CD49a in the molecular and cellular mechanism of the T-cell-mediated immune response. We found that CD49a−/− mice had significantly reduced levels of serum alanine aminotransferase and were protected from Con A-induced hepatitis. CD49a deficiency led to decreased production of interferon-γ (IFN-γ) and interleukin-17A (IL-17A) after Con A injection. Furthermore, we found that hepatic CD4+ T cells and invariant natural killer T cells up-regulated CD49a expression, along with enhanced activation after Con A injection, leading to production of inflammatory cytokines by these T cells. Blockade of CD49a in vivo ameliorated Con A-induced hepatitis with reduced production of IFN-γ and IL-17A. Hence, CD49a promoted Con A-induced hepatitis through enhancing inflammatory cytokine production (IFN-γ and IL-17A) by CD4+ T and invariant natural killer T cells. The protective effect of CD49a blockade antibody suggested a new target therapeutic molecule for intervention of T-cell-mediated liver injury. PMID:24164540

  15. CD28/B7 deficiency attenuates systolic overload-induced congestive heart failure, myocardial and pulmonary inflammation, and activated T-cell accumulation in the heart and lungs

    PubMed Central

    Wang, Huan; Kwak, Dongmin; Fassett, John; Hou, Lei; Xu, Xin; Burbach, Brandon J.; Thenappan, Thenappan; Xu, Yawei; Ge, Jun-bo; Shimizu, Yoji; Bache, Robert J.; Chen, Yingjie

    2017-01-01

    The inflammatory response regulates congestive heart failure (CHF) development. T-cell activation plays an important role in tissue inflammation. We postulate that CD28 or B7 deficiency inhibits T-cell activation and attenuates CHF development by reducing systemic, cardiac and pulmonary inflammation. We demonstrated that chronic pressure overload-induced end-stage CHF in mice is characterized by profound accumulation of activated effector T-cells (CD3+CD44high cells) in the lungs and a mild but significant increase of these cells in the heart. In knockout (KO) mice lacking either CD28 or B7, there was a dramatic reduction in the accumulation of activated effector T cells in both hearts and lungs of mice under control conditions and after transverse aortic constriction (TAC). CD28 or B7 KO significantly attenuated TAC-induced CHF development, as indicated by less increase of heart and lung weight, and less reduction of LV contractility. CD28 or B7 KO also significantly reduced TAC-induced CD45+ leukocyte, T-cell and macrophage infiltration in hearts and lungs, lowered pro-inflammatory cytokine expression (such as TNF-α and IL-1β) in lungs. Furthermore, CD28/B7 blockade by CTLA4-Ig treatment (250μg/mouse every 3 days) attenuated TAC-induced T cell activation, LV hypertrophy, and LV dysfunction. Our data indicate that CD28/B7 deficiency inhibits activated effector T-cell accumulation, reduces myocardial and pulmonary inflammation, and attenuates the development of CHF. Our findings suggest that strategies targeting T-cell activation may be useful in treating CHF. PMID:27432861

  16. Evidence for the opposing roles of different gamma delta T cell subsets in macrophage homeostasis.

    PubMed

    Tramonti, Daniela; Andrew, Elizabeth M; Rhodes, Kate; Newton, Darren J; Carding, Simon R

    2006-07-01

    To ensure invading pathogens are eliminated with minimal damage to host tissues it is essential that macrophage activation be tightly regulated. Previously we demonstrated that a subset of gammadelta T cells (Vgamma1(+)) contributes to resolving pathogen-induced immune responses by killing activated macrophages. However, the exaggerated macrophage response seen in infected Vgamma1(+) T cell-deficient mice suggests that gammadelta T cells play a broader role in macrophage homeostasis and other subsets might promote macrophage activation. Using a macrophage:gammadelta T cell co-culture system we have shown that gammadelta T cells increase the activity of macrophages activated in vivo by Listeria monocytogenes infection. In a dose-dependent manner, gammadelta T cells up-regulated production of cytokines (TNF-alpha, IL-6, IL-10) and chemokines (MIP-1alpha, MIP-1beta) by Listeria-elicited macrophages. The ability to increase macrophage cytokine production was prominent among Vgamma4(+) gammadelta T cells. Reciprocally, Vgamma4(+) gammadelta T cells were activated by Listeria-elicited macrophages, resulting in production of the anti-inflammatory cytokine, IL-10. gammadelta T cell adoptive transfer experiments showed that Vgamma4(+) T cells protected TCRdelta(-/-) mice against Listeria-induced liver injury and necrosis. These findings identify distinct and non-overlapping roles for gammadelta T cell subsets in regulating macrophage function during pathogen-induced immune responses.

  17. T-Cell Receptor- and CD28-induced Vav1 activity is required for the accumulation of primed T cells into antigenic tissue

    PubMed Central

    David, Rachel; Ma, Liang; Ivetic, Aleksandar; Takesono, Aya; Ridley, Anne J.; Chai, Jian-Guo; Tybulewicz, Victor; Marelli-Berg, Federica M.

    2016-01-01

    Localization of primed T cells to antigenic tissue is essential for the development of effective immunity. Together with tissue-selective homing molecules, T-cell receptor (TCR)- and CD28-mediated signals have been shown to promote transendothelial migration of specific T cells into non-lymphoid antigen-rich tissue tissue. However, the cellular and molecular requirements for T-cell accumulation to target tissue following their recruitment are largely undefined. The guanine nucleotide exchange factor (GEF) Vav1 has an integral role in coupling TCR and CD28 to signalling pathways that regulate T cell activation and migration. Here, we have investigated the contribution of TCR- and CD28-induced Vav1 activity to the trafficking and localization of primed HY-specific CD4+ T cells to antigenic sites. Severe migratory defects displayed by Vav1-/- T cells in vitro were fully compensated by a combination of shear flow and chemokines, leading to normal recruitment of Vav1-/- T cells in vivo. In contrast, Vav1-/- T-cell retention into antigen-rich tissue was severely impaired, reflecting their inability to engage in sustained TCR- and CD28-mediated interactions with tissue-resident antigen-presenting cells (APCs). This novel function of APC-induced, TCR- and CD28-mediated Vav1 activity in the regulation of effector T-cell immunity highlights its potential as a therapeutic target in T-cell-mediated tissue damage. PMID:19060239

  18. T lymphocyte recruitment by interleukin-8 (IL-8). IL-8-induced degranulation of neutrophils releases potent chemoattractants for human T lymphocytes both in vitro and in vivo.

    PubMed Central

    Taub, D D; Anver, M; Oppenheim, J J; Longo, D L; Murphy, W J

    1996-01-01

    IL-8 has been shown to be a human neutrophil and T cell chemoattractant in vitro. In an effort to assess the in vivo effects of IL-8 on human leukocyte migration, we examined the ability of rhIL-8 to induce human T cell infiltration using a human/mouse model in which SCID mice were administered human peripheral blood lymphocytes intraperitoneally, followed by subcutaneous injections of rhIL-8. rhIL-8 induced predominantly murine neutrophil accumulation by 4 h after administration while recombinant human macrophage inflammatory protein-1beta (rhMIP-1beta) induced both murine monocytes and human T cell infiltration during the same time period as determined by immunohistology. Interestingly, 72 h after chemokine administration, a marked human T cell infiltrate was observed in the IL-8 injection site suggesting that rhIL-8 may be acting indirectly possibly through a murine neutrophil-derived T cell chemoattractant. This hypothesis was confirmed using granulocyte-depleted SCID mice. Moreover, human neutrophils stimulated in vitro with IL-8 were found to release granule-derived factor(s) that induce in vitro T cell and monocyte chemotaxis and chemokinesis. This T cell and monocyte chemotactic activity was detected in extracts of both azurophilic and specific granules. Together, these results demonstrate that neutrophils store and release, upon stimulation with IL-8 or other neutrophil activators, chemoattractants that mediate T cell and monocyte accumulation at sites of inflammation. PMID:8621778

  19. Role of bone marrow-derived CD11c+ dendritic cells in systolic overload-induced left ventricular inflammation, fibrosis and hypertrophy.

    PubMed

    Wang, Huan; Kwak, Dongmin; Fassett, John; Liu, Xiaohong; Yao, Wu; Weng, Xinyu; Xu, Xin; Xu, Yawei; Bache, Robert J; Mueller, Daniel L; Chen, Yingjie

    2017-05-01

    Inflammatory responses play an important role in the development of left ventricular (LV) hypertrophy and dysfunction. Recent studies demonstrated that increased T-cell infiltration and T-cell activation contribute to LV hypertrophy and dysfunction. Dendritic cells (DCs) are professional antigen-presenting cells that orchestrate immune responses, especially by modulating T-cell function. In this study, we investigated the role of bone marrow-derived CD11c + DCs in transverse aortic constriction (TAC)-induced LV fibrosis and hypertrophy in mice. We observed that TAC increased the number of CD11c + cells and the percentage of CD11c + MHCII + (major histocompatibility complex class II molecule positive) DCs in the LV, spleen and peripheral blood in mice. Using bone marrow chimeras and an inducible CD11c + DC ablation model, we found that depletion of bone marrow-derived CD11c + DCs significantly attenuated LV fibrosis and hypertrophy in mice exposed to 24 weeks of moderate TAC. CD11c + DC ablation significantly reduced TAC-induced myocardial inflammation as indicated by reduced myocardial CD45 + cells, CD11b + cells, CD8 + T cells and activated effector CD8 + CD44 + T cells in LV tissues. Moreover, pulsing of autologous DCs with LV homogenates from TAC mice promoted T-cell proliferation. These data indicate that bone marrow-derived CD11c + DCs play a maladaptive role in hemodynamic overload-induced cardiac inflammation, hypertrophy and fibrosis through the presentation of cardiac self-antigens to T cells.

  20. Overexpression of GATA-3 in T cells accelerates dextran sulfate sodium-induced colitis.

    PubMed

    Okamura, Midori; Yoh, Keigyou; Ojima, Masami; Morito, Naoki; Takahashi, Satoru

    2014-01-01

    Ulcerative colitis (UC) is an inflammatory bowel disease, and its pathogenesis includes genetic, environmental, and immunological factors, such as T helper cells and their secreted cytokines. T helper cells are classified as Th1, Th2, and Th17 cells. However, it is unclear which T helper cells are important in UC. Dextran sulfate sodium (DSS)-induced colitis is a commonly used model of UC. In this study, we induced DSS colitis in Th1 dominant (T-bet transgenic (Tg)) mice, Th2 dominant (GATA-3 Tg) mice, and Th17 dominant (RORγt Tg) mice to elucidate the roles of T helper cell in DSS colitis. The results showed that GATA-3 Tg mice developed the most severe DSS colitis compared with the other groups. GATA-3 Tg mice showed a significant decreased in weight from day 1 to day 7, and an increased high score for the disease activity index compared with the other groups. Furthermore, GATA-3 Tg mice developed many ulcers in the colon, and many neutrophils and macrophages were detected on day 4 after DSS treatment. Measurement of GATA-3-induced cytokines demonstrated that IL-13 was highly expressed in the colon from DSS-induced GATA-3 Tg mice. In conclusion, GATA-3 overexpression in T-cells and IL-13 might play important roles in the development of DSS colitis.

  1. In Vitro T-Cell Generation From Adult, Embryonic, and Induced Pluripotent Stem Cells: Many Roads to One Destination.

    PubMed

    Smith, Michelle J; Webber, Beau R; Mohtashami, Mahmood; Stefanski, Heather E; Zúñiga-Pflücker, Juan Carlos; Blazar, Bruce R

    2015-11-01

    T lymphocytes are critical mediators of the adaptive immune system and have the capacity to serve as therapeutic agents in the areas of transplant and cancer immunotherapy. While T cells can be isolated and expanded from patients, T cells derived in vitro from both hematopoietic stem/progenitor cells (HSPCs) and human pluripotent stem cells (hPSCs) offer great potential advantages in generating a self-renewing source of T cells that can be readily genetically modified. T-cell differentiation in vivo is a complex process requiring tightly regulated signals; providing the correct signals in vitro to induce T-cell lineage commitment followed by their development into mature, functional, single positive T cells, is similarly complex. In this review, we discuss current methods for the in vitro derivation of T cells from murine and human HSPCs and hPSCs that use feeder-cell and feeder-cell-free systems. Furthermore, we explore their potential for adoption for use in T-cell-based therapies. © 2015 AlphaMed Press.

  2. ERAP1 overexpression in HPV-induced malignancies: A possible novel immune evasion mechanism.

    PubMed

    Steinbach, Alina; Winter, Jan; Reuschenbach, Miriam; Blatnik, Renata; Klevenz, Alexandra; Bertrand, Miriam; Hoppe, Stephanie; von Knebel Doeberitz, Magnus; Grabowska, Agnieszka K; Riemer, Angelika B

    2017-01-01

    Immune evasion of tumors poses a major challenge for immunotherapy. For human papillomavirus (HPV)-induced malignancies, multiple immune evasion mechanisms have been described, including altered expression of antigen processing machinery (APM) components. These changes can directly influence epitope presentation and thus T-cell responses against tumor cells. To date, the APM had not been studied systematically in a large array of HPV + tumor samples. Therefore in this study, systematic expression analysis of the APM was performed on the mRNA and protein level in a comprehensive collection of HPV16 + cell lines. Subsequently, HPV + cervical tissue samples were examined by immunohistochemistry. ERAP1 (endoplasmic reticulum aminopeptidase 1) was the only APM component consistently altered - namely overexpressed - in HPV16 + tumor cell lines. ERAP1 was also found to be overexpressed in cervical intraepithelial neoplasia and cervical cancer samples; expression levels were increasing with disease stage. On the functional level, the influence of ERAP1 expression levels on HPV16 E7-derived epitope presentation was investigated by mass spectrometry and in cytotoxicity assays with HPV16-specific T-cell lines. ERAP1 overexpression did not cause a complete destruction of any of the HPV epitopes analyzed, however, an influence of ERAP1 overexpression on the presentation levels of certain HPV epitopes could be demonstrated by HPV16-specific CD8 + T-cells. These showed enhanced killing toward HPV16 + CaSki cells whose ERAP1 expression had been attenuated to normal levels. ERAP1 overexpression may thus represent a novel immune evasion mechanism in HPV-induced malignancies, in cases when presentation of clinically relevant epitopes is reduced by overactivity of this peptidase.

  3. Gamma/delta T cells are the predominant source of interleukin-17 in affected joints in collagen-induced arthritis, but not in rheumatoid arthritis.

    PubMed

    Ito, Yoshinaga; Usui, Takashi; Kobayashi, Shio; Iguchi-Hashimoto, Mikiko; Ito, Hiromu; Yoshitomi, Hiroyuki; Nakamura, Takashi; Shimizu, Masakazu; Kawabata, Daisuke; Yukawa, Naoichiro; Hashimoto, Motomu; Sakaguchi, Noriko; Sakaguchi, Shimon; Yoshifuji, Hajime; Nojima, Takaki; Ohmura, Koichiro; Fujii, Takao; Mimori, Tsuneyo

    2009-08-01

    Although interleukin-17 (IL-17)-producing gamma/delta T cells were reported to play pathogenic roles in collagen-induced arthritis (CIA), their characteristics remain unknown. The aim of this study was to clarify whether gamma/delta T cells or CD4+ T cells are the predominant IL-17-producing cells, and to determine what stimulates gamma/delta T cells to secret IL-17 in mice with CIA. The involvement of IL-17-producing gamma/delta T cells in SKG mice with autoimmune arthritis and patients with rheumatoid arthritis (RA) was also investigated. IL-17-producing cells in the affected joints of mice with CIA were counted by intracellular cytokine staining during 6 distinct disease phases, and these cells were stimulated with various combinations of cytokines or specific antigens to determine the signaling requirements. Similar studies were performed using SKG mice with arthritis and patients with RA. Gamma/delta T cells were the predominant population in IL-17-producing cells in the swollen joints of mice with CIA, and the absolute numbers of these cells increased in parallel with disease activity. IL-17-producing gamma/delta T cells expressed CC chemokine receptor 6, were maintained by IL-23 but not by type II collagen in vitro, and were induced antigen independently in vivo. Furthermore, IL-17 production by gamma/delta T cells was induced by IL-1beta plus IL-23 independently of T cell receptor. In contrast to what was observed in mice with CIA, IL-17-producing gamma/delta T cells were nearly absent in the affected joints of SKG mice and patients with RA, and Th1 cells were predominant in the joints of patients with RA. Gamma/delta T cells were antigen independently stimulated by inflammation at affected joints and produced enhanced amounts of IL-17 to exacerbate arthritis in mice with CIA but not in SKG mice with arthritis or patients with RA.

  4. Loss of immunization-induced epitope-specific CD4 T-cell response following anaplasma marginale infection requires presence of the T-cell epitope on the pathogen and is not associated with an increase in lymphocytes

    USDA-ARS?s Scientific Manuscript database

    We have shown that in cattle previously immunized with outer membrane proteins, infection with Anaplasma marginale induces a functionally exhausted CD4 T-cell response to the A. marginale immunogen. Furthermore, T-cell responses following infection in nonimmunized cattle had a delayed onset and were...

  5. Immunization of mice with baculovirus-derived recombinant SV40 large tumour antigen induces protective tumour immunity to a lethal challenge with SV40-transformed cells.

    PubMed Central

    Shearer, M H; Bright, R K; Lanford, R E; Kennedy, R C

    1993-01-01

    In this study, we examined the humoral immune responses and in vivo tumour immunity induced by baculovirus recombinant simian virus 40 (SV40) large tumour antigen (rSV40 T-ag). BALB/c mice immunized with rSV40 T-ag produced antibody responses that recognized SV40 large tumour antigen (T-ag) by ELISA. Analysis of these anti-SV40 T-ag responses indicated that the antibodies recognized epitopes associated with both the carboxy and amino terminus of SV40 T-ag. This pattern of SV40 T-ag epitope recognition was similar to that observed in anti-SV40 T-ag responses induced by inoculation with irradiated SV40-transformed cells. Mice immunized with either rSV40 T-ag or with the inactivated transformed cells were protected from a subsequent in vivo lethal tumour challenge with live SV40-transformed cells. These studies suggest that humoral immune responses induced by rSV40 T-ag are similar in epitope specificity to that induced by inactivated SV40-transformed cells. In addition, recombinant tumour-specific antigens from papovaviruses, such as SV40, can be used to induce tumour immunity which protects from a subsequent lethal tumour challenge. This study may provide insight into the use of recombinant tumour antigens as putative tumour vaccines and in the development of active immunotherapeutic strategies for treating virus-induced cancers. PMID:7679059

  6. Trichomonas vaginalis α-Actinin 2 Modulates Host Immune Responses by Inducing Tolerogenic Dendritic Cells via IL-10 Production from Regulatory T Cells.

    PubMed

    Lee, Hye-Yeon; Kim, Juri; Ryu, Jae-Sook; Park, Soon-Jung

    2017-08-01

    Trichomonas vaginalis is a pathogen that triggers severe immune responses in hosts. T. vaginalis α-actinin 2, Tvα-actinin 2, has been used to diagnose trichomoniasis. This study was undertaken to examine the role of Tvα-actinin 2 as an antigenic molecule to induce immune responses from humans. Western blot analysis using anti-Tvα-actinin 2 antibodies indicated its presence in the secreted proteins of T. vaginalis. ELISA was employed to measure cytokine production by vaginal epithelial cells, prostate cells, mouse dendritic cells (DCs), or T cells stimulated with T. vaginalis or Tvα-actinin 2 protein. Both T. vaginalis and rTvα-actinin 2 induced cytokine production from epithelial cell lines, including IL-10. Moreover, CD4+CD25- regulatory T cells (Treg cells) incubated with rTvα-actinin 2-treated DCs produced high levels of IL-10. These data indicate that Tvα-actinin 2 modulates immune responses via IL-10 production by Treg cells.

  7. In vivo induction of a high-avidity, high-frequency cytotoxic T-lymphocyte response is associated with antiviral protective immunity.

    PubMed

    Sedlik, C; Dadaglio, G; Saron, M F; Deriaud, E; Rojas, M; Casal, S I; Leclerc, C

    2000-07-01

    Many approaches are currently being developed to deliver exogenous antigen into the major histocompatibility complex class I-restricted antigen pathway, leading to in vivo priming of CD8(+) cytotoxic T cells. One attractive possibility consists of targeting the antigen to phagocytic or macropinocytic antigen-presenting cells. In this study, we demonstrate that strong CD8(+) class I-restricted cytotoxic responses are induced upon intraperitoneal immunization of mice with different peptides, characterized as CD8(+) T-cell epitopes, bound to 1-microm synthetic latex microspheres and injected in the absence of adjuvant. The cytotoxic response induced against a lymphocytic choriomeningitis virus (LCMV) peptide linked to these microspheres was compared to the cytotoxic T-lymphocyte (CTL) response obtained upon immunization with the nonreplicative porcine parvovirus-like particles (PPV:VLP) carrying the same peptide (PPV:VLP-LCMV) previously described (C. Sedlik, M. F. Saron, J. Sarraseca, I. Casal, and C. Leclerc, Proc. Natl. Acad. Sci. USA 94:7503-7508, 1997). We show that the induction of specific CTL activity by peptides bound to microspheres requires CD4(+) T-cell help in contrast to the CTL response obtained with the peptide delivered by viral pseudoparticles. Furthermore, PPV:VLP are 100-fold more efficient than microspheres in generating a strong CTL response characterized by a high frequency of specific T cells of high avidity. Moreover, PPV:VLP-LCMV are able to protect mice against a lethal LCMV challenge whereas microspheres carrying the LCMV epitope fail to confer such protection. This study demonstrates the crucial involvement of the frequency and avidity of CTLs in conferring antiviral protective immunity and highlights the importance of considering these parameters when developing new vaccine strategies.

  8. In Vivo Induction of a High-Avidity, High-Frequency Cytotoxic T-Lymphocyte Response Is Associated with Antiviral Protective Immunity†

    PubMed Central

    Sedlik, C.; Dadaglio, G.; Saron, M. F.; Deriaud, E.; Rojas, M.; Casal, S. I.; Leclerc, C.

    2000-01-01

    Many approaches are currently being developed to deliver exogenous antigen into the major histocompatibility complex class I-restricted antigen pathway, leading to in vivo priming of CD8+ cytotoxic T cells. One attractive possibility consists of targeting the antigen to phagocytic or macropinocytic antigen-presenting cells. In this study, we demonstrate that strong CD8+ class I-restricted cytotoxic responses are induced upon intraperitoneal immunization of mice with different peptides, characterized as CD8+ T-cell epitopes, bound to 1-μm synthetic latex microspheres and injected in the absence of adjuvant. The cytotoxic response induced against a lymphocytic choriomeningitis virus (LCMV) peptide linked to these microspheres was compared to the cytotoxic T-lymphocyte (CTL) response obtained upon immunization with the nonreplicative porcine parvovirus-like particles (PPV:VLP) carrying the same peptide (PPV:VLP-LCMV) previously described (C. Sedlik, M. F. Saron, J. Sarraseca, I. Casal, and C. Leclerc, Proc. Natl. Acad. Sci. USA 94:7503–7508, 1997). We show that the induction of specific CTL activity by peptides bound to microspheres requires CD4+ T-cell help in contrast to the CTL response obtained with the peptide delivered by viral pseudoparticles. Furthermore, PPV:VLP are 100-fold more efficient than microspheres in generating a strong CTL response characterized by a high frequency of specific T cells of high avidity. Moreover, PPV:VLP-LCMV are able to protect mice against a lethal LCMV challenge whereas microspheres carrying the LCMV epitope fail to confer such protection. This study demonstrates the crucial involvement of the frequency and avidity of CTLs in conferring antiviral protective immunity and highlights the importance of considering these parameters when developing new vaccine strategies. PMID:10846055

  9. Animal models of allergen-induced tolerance in asthma: are T-regulatory-1 cells (Tr-1) the solution for T-helper-2 cells (Th-2) in asthma?

    PubMed

    Tournoy, K G; Hove, C; Grooten, J; Moerloose, K; Brusselle, G G; Joos, G F

    2006-01-01

    Non-specific anti-inflammatory medication is actually the treatment of choice for controlling the T-helper type 2 (Th-2) cell-driven airway inflammation in asthma. The induction of counterbalancing Th-1 cell clones, long considered a promising approach for immunotherapy, has failed to fulfil its promise because of potentially detrimental side-effects. This is therefore probably not a valid option for the treatment of asthma. With the increasing awareness that active immune mechanisms exist to control inflammatory responses, interest rises to investigate whether these can be exploited to control allergen-induced airway disease. The induction of antigen-specific T cells with suppressive characteristics (regulatory T cells) is therefore a potentially interesting approach. These regulatory T cells mediate tolerance in healthy, non-atopic individuals and have the potential of becoming an effective means of preventing allergen-induced airway inflammation and possibly of suppressing ongoing allergic immune responses. Here we review the available knowledge about allergen-induced suppressive immunity obtained from animal models taking into account the different developmental stages of allergic airway disease.

  10. Rapamycin has suppressive and stimulatory effects on human plasmacytoid dendritic cell functions

    PubMed Central

    Boor, P P C; Metselaar, H J; Mancham, S; van der Laan, L J W; Kwekkeboom, J

    2013-01-01

    Plasmacytoid dendritic cells (PDC) are involved in innate immunity by interferon (IFN)-α production, and in adaptive immunity by stimulating T cells and inducing generation of regulatory T cells (Treg). In this study we studied the effects of mammalian target of rapamycin (mTOR) inhibition by rapamycin, a commonly used immunosuppressive and anti-cancer drug, on innate and adaptive immune functions of human PDC. A clinically relevant concentration of rapamycin inhibited Toll-like receptor (TLR)-7-induced IFN-α secretion potently (−64%) but TLR-9-induced IFN-α secretion only slightly (−20%), while the same concentration suppressed proinflammatory cytokine production by TLR-7-activated and TLR-9-activated PDC with similar efficacy. Rapamycin inhibited the ability of both TLR-7-activated and TLR-9-activated PDC to stimulate production of IFN-γ and interleukin (IL)-10 by allogeneic T cells. Surprisingly, mTOR-inhibition enhanced the capacity of TLR-7-activated PDC to stimulate naive and memory T helper cell proliferation, which was caused by rapamycin-induced up-regulation of CD80 expression on PDC. Finally, rapamycin treatment of TLR-7-activated PDC enhanced their capacity to induce CD4+forkhead box protein 3 (FoxP3)+ regulatory T cells, but did not affect the generation of suppressive CD8+CD38+lymphocyte activation gene (LAG)-3+ Treg. In general, rapamycin inhibits innate and adaptive immune functions of TLR-stimulated human PDC, but enhances the ability of TLR-7-stimulated PDC to stimulate CD4+ T cell proliferation and induce CD4+FoxP3+ regulatory T cell generation. PMID:23968562

  11. Roles of lymphatic endothelial cells expressing peripheral tissue antigens in CD4 T-cell tolerance induction.

    PubMed

    Rouhani, Sherin J; Eccles, Jacob D; Riccardi, Priscila; Peske, J David; Tewalt, Eric F; Cohen, Jarish N; Liblau, Roland; Mäkinen, Taija; Engelhard, Victor H

    2015-04-10

    Lymphatic endothelial cells (LECs) directly express peripheral tissue antigens and induce CD8 T-cell deletional tolerance. LECs express MHC-II molecules, suggesting they might also tolerize CD4 T cells. We demonstrate that when β-galactosidase (β-gal) is expressed in LECs, β-gal-specific CD8 T cells undergo deletion via the PD-1/PD-L1 and LAG-3/MHC-II pathways. In contrast, LECs do not present endogenous β-gal in the context of MHC-II molecules to β-gal-specific CD4 T cells. Lack of presentation is independent of antigen localization, as membrane-bound haemagglutinin and I-Eα are also not presented by MHC-II molecules. LECs express invariant chain and cathepsin L, but not H2-M, suggesting that they cannot load endogenous antigenic peptides onto MHC-II molecules. Importantly, LECs transfer β-gal to dendritic cells, which subsequently present it to induce CD4 T-cell anergy. Therefore, LECs serve as an antigen reservoir for CD4 T-cell tolerance, and MHC-II molecules on LECs are used to induce CD8 T-cell tolerance via LAG-3.

  12. Roles of lymphatic endothelial cells expressing peripheral tissue antigens in CD4 T-cell tolerance induction

    PubMed Central

    Rouhani, Sherin J.; Eccles, Jacob D.; Riccardi, Priscila; Peske, J. David; Tewalt, Eric F.; Cohen, Jarish N.; Liblau, Roland; Mäkinen, Taija; Engelhard, Victor H.

    2015-01-01

    Lymphatic endothelial cells (LECs) directly express peripheral tissue antigens and induce CD8 T-cell deletional tolerance. LECs express MHC-II molecules, suggesting they might also tolerize CD4 T cells. We demonstrate that when β-galactosidase (β-gal) is expressed in LECs, β-gal-specific CD8 T cells undergo deletion via the PD-1/PD-L1 and LAG-3/MHC-II pathways. In contrast, LECs do not present endogenous β-gal in the context of MHC-II molecules to β-gal-specific CD4 T cells. Lack of presentation is independent of antigen localization, as membrane-bound haemagglutinin and I-Eα are also not presented by MHC-II molecules. LECs express invariant chain and cathepsin L, but not H2-M, suggesting that they cannot load endogenous antigenic peptides onto MHC-II molecules. Importantly, LECs transfer β-gal to dendritic cells, which subsequently present it to induce CD4 T-cell anergy. Therefore, LECs serve as an antigen reservoir for CD4 T-cell tolerance, and MHC-II molecules on LECs are used to induce CD8 T-cell tolerance via LAG-3. PMID:25857745

  13. Structural Elements Recognized by Abacavir-Induced T Cells

    PubMed Central

    Yerly, Daniel; Pompeu, Yuri Andreiw; Schutte, Ryan J.; Eriksson, Klara. K.; Strhyn, Anette; Bracey, Austin. W.; Buus, Soren; Ostrov, David A.

    2017-01-01

    Adverse drug reactions are one of the leading causes of morbidity and mortality in health care worldwide. Human leukocyte antigen (HLA) alleles have been strongly associated with drug hypersensitivities, and the causative drugs have been shown to stimulate specific T cells at the sites of autoimmune destruction. The structural elements recognized by drug-specific T cell receptors (TCRs) in vivo are poorly defined. Drug-stimulated T cells express TCRs specific for peptide/HLA complexes, but the characteristics of peptides (sequence, or endogenous or exogenous origin) presented in the context of small molecule drugs are not well studied. Using HLA-B*57:01 mediated hypersensitivity to abacavir as a model system, this study examines structural similarities of HLA presented peptides recognized by drug-specific TCRs. Using the crystal structure of HLA-B*57:01 complexed with abacavir and an immunogenic self peptide, VTTDIQVKV SPT5a 976–984, peptide side chains exhibiting flexibility and solvent exposure were identified as potential drug-specific T cell recognition motifs. Viral sequences with structural motifs similar to the immunogenic self peptide were identified. Abacavir-specific T cell clones were used to determine if virus peptides presented in the context of abacavir stimulate T cell responsiveness. An abacavir-specific T cell clone was stimulated by VTQQAQVRL, corresponding to HSV1/2 230–238, in the context of HLA-B*57:01. These data suggest the T cell polyclonal response to abacavir consists of multiple subsets, including T cells that recognize self peptide/HLA-B*57:01 complexes and crossreact with viral peptide/HLA-B*57:01 complexes due to similarity in TCR contact residues. PMID:28686208

  14. Pro-inflammatory effects of the Th1 chemokine CXCL10 in acquired aplastic anaemia.

    PubMed

    Li, Junhong; Ge, Meili; Lu, Shihong; Shi, Jun; Li, Xingxin; Wang, Min; Huang, Jinbo; Shao, Yingqi; Huang, Zhendong; Zhang, Jing; Nie, Neng; Zheng, Yizhou

    2017-06-01

    CXCL10/IFN-γ-induced protein 10 (IP-10) and its corresponding receptor CXCR3 have long been considered to be involved in the pathophysiology of type 1 T (Th1) cell-orientated autoimmune diseases. However, the exact role of CXCL10 in the pathogenesis of aplastic anaemia (AA) has not been thoroughly studied. The aim of our study was to evaluate the plasma level of CXCL10 and its effects on CD4 + T cell differentiation in AA. In our study, we found that an elevated plasma level of CXCL10 was negatively correlated with platelet, absolute neutrophil and reticulocyte counts, while it was positively correlated with the proportion of lymphocytes in white blood cells in AA patients. To confirm the pro-inflammatory effects of CXCL10 in AA, we isolated CD4 + T cells and evaluated the function of CXCL10 in CD4 + T cell differentiation. In vitro stimulation experiments further revealed the pro-inflammatory role of CXCL10 in AA, partially by promoting the secretion of interferon (IFN)-γ and IL-17. In addition, CXCL10 significantly skewed CD4 + T cell differentiation to Th1 cells and T helper 17 (Th17) cells in AA patients, while it inhibited the differentiation of type 2 T (Th2) cells only in controls. The mRNA expression of transcription factors representative of T cell differentiation was detected by RT-PCR. Consistently, our results showed that after CXCL10 treatment, the expression of T-bet and RORγt was significantly enhanced, while the expression of GATA3 was inhibited. In conclusion, our results indicated that CXCL10, a pro-inflammatory chemokine, might be involved in the abnormal immune response in AA. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Silymarin inhibits ultraviolet radiation-induced immune suppression through DNA repair-dependent activation of dendritic cells and stimulation of effector T cells

    PubMed Central

    Vaid, Mudit; Prasad, Ram; Singh, Tripti; Elmets, Craig A.; Xu, Hui; Katiyar, Santosh K.

    2013-01-01

    Silymarin inhibits UVB-induced immunosuppression in mouse skin. To identify the molecular mechanisms underlying this effect, we used an adoptive transfer approach in which dendritic cells (DCs) from the draining lymph nodes of donor mice that had been UVB-exposed and sensitized to 2,4,-dinitrofluorobenzene (DNFB) were transferred into naïve recipient mice. The contact hypersensitivity (CHS) response of the recipient mice to DNFB was then measured. When DCs were obtained from UVB-exposed donor mice that were not treated with silymarin, the CHS response was suppressed confirming the role of DCs in the UVB-induced immunosuppression. Silymarin treatment of UVB-exposed donor mice relieved this suppression of the CHS response in the recipients. Silymarin treatment was associated with rapid repair of UVB-induced cyclobutane pyrimidine dimers (CPDs) in DCs and silymarin treatment did not prevent UV-induced immunosuppression in XPA-deficient mice which are unable to repair UV-induced DNA damage. The CHS response in mice receiving DCs from silymarin-treated UV-exposed donor mice also was associated with enhanced secretion of Th1-type cytokines and stimulation of T cells. Adoptive transfer of T cells revealed that transfer of either CD8+ or CD4+ cells from silymarin-treated, UVB-exposed donors resulted in enhancement of the CHS response. Cell culture study showed enhanced secretion of IL-2 and IFNγ by CD8+ T cells, and reduced secretion of Th2 cytokines by CD4+ cells, obtained from silymarin-treated UVB-exposed mice. These data suggest that DNA repair-dependent functional activation of DCs, a reduction in CD4+ regulatory T-cell activity, and stimulation of CD8+ effector T cells contribute to silymarin-mediated inhibition of UVB-induced immunosuppression. PMID:23395695

  16. Mangiferin attenuates oxidative stress induced renal cell damage through activation of PI3K induced Akt and Nrf-2 mediated signaling pathways.

    PubMed

    Saha, Sukanya; Sadhukhan, Pritam; Sinha, Krishnendu; Agarwal, Namrata; Sil, Parames C

    2016-03-01

    Mangiferin is a polyphenolic xanthonoid with remarkable antioxidant activity. Oxidative stress plays the key role in tert-butyl hydroperoxide (tBHP) induced renal cell damage. In this scenario, we consider mangiferin, as a safe agent in tBHP induced renal cell death and rationalize its action systematically, in normal human kidney epithelial cells (NKE). NKE cells were exposed to 20 µM mangiferin for 2 h followed by 50 µM tBHP for 18 h. The effect on endogenous ROS production, antioxidant status (antioxidant enzymes and thiols), mitochondrial membrane potential, apoptotic signaling molecules, PI3K mediated signaling cascades and cell cycle progression were examined using various biochemical assays, FACS and immunoblot analyses. tBHP exposure damaged the NKE cells and decreased its viability. It also elevated the intracellular ROS and other oxidative stress-related biomarkers within the cells. However, mangiferin dose dependently, exhibited significant protection against this oxidative cellular damage. Mangiferin inhibited tBHP induced activation of different pro-apoptotic signals and thus protected the renal cells against mitochondrial permeabilization. Further, mangiferin enhanced the expression of cell proliferative signaling cascade molecules, Cyclin d1, NFκB and antioxidant molecules HO-1, SOD2, by PI3K/Akt dependent pathway. However, the inhibitor of PI3K abolished mangiferin's protective activity. Results show Mangiferin maintains the intracellular anti-oxidant status, induces the expression of PI3K and its downstream molecules and shields NKE cells against the tBHP induced cytotoxicity. Mangiferin can be indicated as a therapeutic agent in oxidative stress-mediated renal toxicity. This protective action of mangiferin primarily attributes to its potent antioxidant and antiapoptotic nature.

  17. Thyroid Hormone Induces Apoptosis in Primary Cell Cultures of Tadpole Intestine: Cell Type Specificity and Effects of Extracellular Matrix

    PubMed Central

    Su, Yuan; Shi, Yufang; Stolow, Melissa A.; Shi, Yun-Bo

    1997-01-01

    Thyroid hormone (T3 or 3,5,3′-triiodothyronine) plays a causative role during amphibian metamorphosis. To investigate how T3 induces some cells to die and others to proliferate and differentiate during this process, we have chosen the model system of intestinal remodeling, which involves apoptotic degeneration of larval epithelial cells and proliferation and differentiation of other cells, such as the fibroblasts and adult epithelial cells, to form the adult intestine. We have established in vitro culture conditions for intestinal epithelial cells and fibroblasts. With this system, we show that T3 can enhance the proliferation of both cell types. However, T3 also concurrently induces larval epithelial apoptosis, which can be inhibited by the extracellular matrix (ECM). Our studies with known inhibitors of mammalian cell death reveal both similarities and differences between amphibian and mammalian cell death. These, together with gene expression analysis, reveal that T3 appears to simultaneously induce different pathways that lead to specific gene regulation, proliferation, and apoptotic degeneration of the epithelial cells. Thus, our data provide an important molecular and cellular basis for the differential responses of different cell types to the endogenous T3 during metamorphosis and support a role of ECM during frog metamorphosis. PMID:9396758

  18. Fas/CD95 prevents autoimmunity independently of lipid raft localization and efficient apoptosis induction

    PubMed Central

    Cruz, Anthony C.; Ramaswamy, Madhu; Ouyang, Claudia; Klebanoff, Christopher A.; Sengupta, Prabuddha; Yamamoto, Tori N.; Meylan, Françoise; Thomas, Stacy K.; Richoz, Nathan; Eil, Robert; Price, Susan; Casellas, Rafael; Rao, V. Koneti; Lippincott-Schwartz, Jennifer; Restifo, Nicholas P.; Siegel, Richard M.

    2016-01-01

    Mutations affecting the apoptosis-inducing function of the Fas/CD95 TNF-family receptor result in autoimmune and lymphoproliferative disease. However, Fas can also costimulate T-cell activation and promote tumour cell growth and metastasis. Palmitoylation at a membrane proximal cysteine residue enables Fas to localize to lipid raft microdomains and induce apoptosis in cell lines. Here, we show that a palmitoylation-defective Fas C194V mutant is defective in inducing apoptosis in primary mouse T cells, B cells and dendritic cells, while retaining the ability to enhance naive T-cell differentiation. Despite inability to efficiently induce cell death, the Fas C194V receptor prevents the lymphoaccumulation and autoimmunity that develops in Fas-deficient mice. These findings indicate that induction of apoptosis through Fas is dependent on receptor palmitoylation in primary immune cells, and Fas may prevent autoimmunity by mechanisms other than inducing apoptosis. PMID:28008916

  19. Novel ISCOMs from Quillaja brasiliensis saponins induce mucosal and systemic antibody production, T-cell responses and improved antigen uptake.

    PubMed

    Cibulski, Samuel Paulo; Mourglia-Ettlin, Gustavo; Teixeira, Thais Fumaco; Quirici, Lenora; Roehe, Paulo Michel; Ferreira, Fernando; Silveira, Fernando

    2016-02-24

    In the last decades, significant efforts have been dedicated to the search for novel vaccine adjuvants. In this regard, saponins and its formulations as "immunostimulating complexes" (ISCOMs) have shown to be capable of stimulating potent humoral and cellular immune responses, enhanced cytokine production and activation of cytotoxic T cells. The immunological activity of ISCOMs formulated with a saponin fraction extracted from Quillaja brasiliensis (QB-90 fraction) as an alternative to classical ISCOMs based on Quil A(®) (IQA) is presented here. The ISCOMs prepared with QB-90, named IQB-90, typically consist of 40-50 nm, spherical, cage-like particles, built up by QB-90, cholesterol, phospholipids and antigen (ovalbumin, OVA). These nanoparticles were efficiently uptaken in vitro by murine bone marrow-derived dendritic cells. Subcutaneously inoculated IQB-90 induced strong serum antibody responses encompassing specific IgG1 and IgG2a, robust DTH reactions, significant T cell proliferation and increases in Th1 (IFN-γ and IL-2) cytokine responses. Intranasally delivered IQB-90 elicited serum IgG and IgG1, and mucosal IgA responses at distal systemic sites (nasal passages, large intestine and vaginal lumen). These results indicate that IQB-90 is a promising alternative to classic ISCOMs as vaccine adjuvants, capable of enhancing humoral and cellular immunity to levels comparable to those induced by ISCOMs manufactured with Quillaja saponaria saponins. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Limited Model Antigen Expression by Transgenic Fungi Induces Disparate Fates during Differentiation of Adoptively Transferred T Cell Receptor Transgenic CD4+ T Cells: Robust Activation and Proliferation with Weak Effector Function during Recall

    PubMed Central

    Ersland, Karen; Pick-Jacobs, John C.; Gern, Benjamin H.; Frye, Christopher A.; Sullivan, Thomas D.; Brennan, Meghan B.; Filutowicz, Hanna I.; O'Brien, Kevin; Korthauer, Keegan D.; Schultz-Cherry, Stacey; Klein, Bruce S.

    2012-01-01

    CD4+ T cells are the key players of vaccine resistance to fungi. The generation of effective T cell-based vaccines requires an understanding of how to induce and maintain CD4+ T cells and memory. The kinetics of fungal antigen (Ag)-specific CD4+ T cell memory development has not been studied due to the lack of any known protective epitopes and clonally restricted T cell subsets with complementary T cell receptors (TCRs). Here, we investigated the expansion and function of CD4+ T cell memory after vaccination with transgenic (Tg) Blastomyces dermatitidis yeasts that display a model Ag, Eα-mCherry (Eα-mCh). We report that Tg yeast led to Eα display on Ag-presenting cells and induced robust activation, proliferation, and expansion of adoptively transferred TEa cells in an Ag-specific manner. Despite robust priming by Eα-mCh yeast, antifungal TEa cells recruited and produced cytokines weakly during a recall response to the lung. The addition of exogenous Eα-red fluorescent protein (RFP) to the Eα-mCh yeast boosted the number of cytokine-producing TEa cells that migrated to the lung. Thus, model epitope expression on yeast enables the interrogation of Ag presentation to CD4+ T cells and primes Ag-specific T cell activation, proliferation, and expansion. However, the limited availability of model Ag expressed by Tg fungi during T cell priming blunts the downstream generation of effector and memory T cells. PMID:22124658

  1. Differences in the capacity of reovirus strains to induce apoptosis are determined by the viral attachment protein sigma 1.

    PubMed Central

    Tyler, K L; Squier, M K; Rodgers, S E; Schneider, B E; Oberhaus, S M; Grdina, T A; Cohen, J J; Dermody, T S

    1995-01-01

    Reoviruses are important models for studies of viral pathogenesis; however, the mechanisms by which these viruses produce cytopathic effects in infected cells have not been defined. In this report, we show that murine L929 (L) cells infected with prototype reovirus strains type 1 Lang (TIL) and type 3 Dearing (T3D) undergo apoptosis and that T3D induces apoptosis to a substantially greater extent than T1L. Using T1L x T3D reassortant viruses, we found that differences in the capacity of T1L and T3D to induce apoptosis are determined by the viral S1 gene segment, which encodes the viral attachment protein sigma 1 and the non-virion-associated protein sigma 1s. Apoptosis was induced by UV-inactivated, replication-incompetent reovirus virions, which do not contain sigma 1s and do not mediate its synthesis in infected cells. Additionally, T3D-induced apoptosis was inhibited by anti-reovirus monoclonal antibodies that inhibit T3D cell attachment and disassembly. These results indicate that sigma 1, rather than sigma 1s, is required for induction of apoptosis by the reovirus and suggest that interaction of virions with cell surface receptors is an essential step in this mechanism of cell killing. PMID:7474116

  2. Recombinant Yellow Fever Viruses Elicit CD8+ T Cell Responses and Protective Immunity against Trypanosoma cruzi

    PubMed Central

    Nogueira, Raquel Tayar; Nogueira, Alanderson Rocha; Pereira, Mirian Claudia Souza; Rodrigues, Maurício Martins; Neves, Patrícia Cristina da Costa; Galler, Ricardo; Bonaldo, Myrna Cristina

    2013-01-01

    Chagas’ disease is a major public health problem affecting nearly 10 million in Latin America. Despite several experimental vaccines have shown to be immunogenic and protective in mouse models, there is not a current vaccine being licensed for humans or in clinical trial against T. cruzi infection. Towards this goal, we used the backbone of Yellow Fever (YF) 17D virus, one of the most effective and well-established human vaccines, to express an immunogenic fragment derived from T. cruzi Amastigote Surface Protein 2 (ASP-2). The cDNA sequence of an ASP-2 fragment was inserted between E and NS1 genes of YF 17D virus through the construction of a recombinant heterologous cassette. The replication ability and genetic stability of recombinant YF virus (YF17D/ENS1/Tc) was confirmed for at least six passages in Vero cells. Immunogenicity studies showed that YF17D/ENS1/Tc virus elicited neutralizing antibodies and gamma interferon (IFN-γ) producing-cells against the YF virus. Also, it was able to prime a CD8+ T cell directed against the transgenic T. cruzi epitope (TEWETGQI) which expanded significantly as measured by T cell-specific production of IFN-γ before and after T. cruzi challenge. However, most important for the purposes of vaccine development was the fact that a more efficient protective response could be seen in mice challenged after vaccination with the YF viral formulation consisting of YF17D/ENS1/Tc and a YF17D recombinant virus expressing the TEWETGQI epitope at the NS2B-3 junction. The superior protective immunity observed might be due to an earlier priming of epitope-specific IFN-γ-producing T CD8+ cells induced by vaccination with this viral formulation. Our results suggest that the use of viral formulations consisting of a mixture of recombinant YF 17D viruses may be a promising strategy to elicit protective immune responses against pathogens, in general. PMID:23527169

  3. Recombinant yellow fever viruses elicit CD8+ T cell responses and protective immunity against Trypanosoma cruzi.

    PubMed

    Nogueira, Raquel Tayar; Nogueira, Alanderson Rocha; Pereira, Mirian Claudia Souza; Rodrigues, Maurício Martins; Neves, Patrícia Cristina da Costa; Galler, Ricardo; Bonaldo, Myrna Cristina

    2013-01-01

    Chagas' disease is a major public health problem affecting nearly 10 million in Latin America. Despite several experimental vaccines have shown to be immunogenic and protective in mouse models, there is not a current vaccine being licensed for humans or in clinical trial against T. cruzi infection. Towards this goal, we used the backbone of Yellow Fever (YF) 17D virus, one of the most effective and well-established human vaccines, to express an immunogenic fragment derived from T. cruzi Amastigote Surface Protein 2 (ASP-2). The cDNA sequence of an ASP-2 fragment was inserted between E and NS1 genes of YF 17D virus through the construction of a recombinant heterologous cassette. The replication ability and genetic stability of recombinant YF virus (YF17D/ENS1/Tc) was confirmed for at least six passages in Vero cells. Immunogenicity studies showed that YF17D/ENS1/Tc virus elicited neutralizing antibodies and gamma interferon (IFN-γ) producing-cells against the YF virus. Also, it was able to prime a CD8(+) T cell directed against the transgenic T. cruzi epitope (TEWETGQI) which expanded significantly as measured by T cell-specific production of IFN-γ before and after T. cruzi challenge. However, most important for the purposes of vaccine development was the fact that a more efficient protective response could be seen in mice challenged after vaccination with the YF viral formulation consisting of YF17D/ENS1/Tc and a YF17D recombinant virus expressing the TEWETGQI epitope at the NS2B-3 junction. The superior protective immunity observed might be due to an earlier priming of epitope-specific IFN-γ-producing T CD8(+) cells induced by vaccination with this viral formulation. Our results suggest that the use of viral formulations consisting of a mixture of recombinant YF 17D viruses may be a promising strategy to elicit protective immune responses against pathogens, in general.

  4. Contact-induced mitochondrial polarization supports HIV-1 virological synapse formation.

    PubMed

    Groppelli, Elisabetta; Starling, Shimona; Jolly, Clare

    2015-01-01

    Rapid HIV-1 spread between CD4 T lymphocytes occurs at retrovirus-induced immune cell contacts called virological synapses (VS). VS are associated with striking T cell polarization and localized virus budding at the site of contact that facilitates cell-cell spread. In addition to this, spatial clustering of organelles, including mitochondria, to the contact zone has been previously shown. However, whether cell-cell contact specifically induces dynamic T cell remodeling during VS formation and what regulates this process remain unclear. Here, we report that contact between an HIV-1-infected T cell and an uninfected target T cell specifically triggers polarization of mitochondria concomitant with recruitment of the major HIV-1 structural protein Gag to the site of cell-cell contact. Using fixed and live-cell imaging, we show that mitochondrial and Gag polarization in HIV-1-infected T cells occurs within minutes of contact with target T cells, requires the formation of stable cell-cell contacts, and is an active, calcium-dependent process. We also find that perturbation of mitochondrial polarization impairs cell-cell spread of HIV-1 at the VS. Taken together, these data suggest that HIV-1-infected T cells are able to sense and respond to contact with susceptible target cells and undergo dynamic cytoplasmic remodeling to create a synaptic environment that supports efficient HIV-1 VS formation between CD4 T lymphocytes. HIV-1 remains one of the major global health challenges of modern times. The capacity of HIV-1 to cause disease depends on the virus's ability to spread between immune cells, most notably CD4 T lymphocytes. Cell-cell transmission is the most efficient way of HIV-1 spread and occurs at the virological synapse (VS). The VS forms at the site of contact between an infected cell and an uninfected cell and is characterized by polarized assembly and budding of virions and clustering of cellular organelles, including mitochondria. Here, we show that cell-cell contact induces rapid recruitment of mitochondria to the contact site and that this supports efficient VS formation and consequently cell-cell spread. Additionally, we observed that cell-cell contact induces a mitochondrion-dependent increase in intracellular calcium, indicative of cellular signaling. Taken together, our data suggest that VS formation is a regulated process and thus a potential target to block HIV-1 cell-cell spread. Copyright © 2015, Groppelli et al.

  5. Growth hormone facilitates 5'-azacytidine-induced myogenic but inhibits 5'-azacytidine-induced adipogenic commitment in C3H10T1/2 mesenchymal stem cells.

    PubMed

    Jia, Dan; Zheng, Weijiang; Jiang, Honglin

    2018-06-01

    The C3H10T1/2 cells are considered mesenchymal stem cells (MSCs) because they can be induced to become the progenitor cells for myocytes, adipocytes, osteoblasts, and chondrocytes by the DNA methyltransferase inhibitor 5'-azacytidine. In this study, we determined the effect of growth hormone (GH) on the myogenic and adipogenic lineage commitment in C3H10T1/2 cells. The C3H10T1/2 cells were treated with recombinant bovine GH in the presence or absence of 5'-azacytidine for 4 days. The myogenic commitment in C3H10T1/2 cells was assessed by immunostaining them for MyoD, the marker for myoblasts, and by determining their capacity to differentiate into the multinucleated myotubes. The adipogenic commitment in C3H10T1/2 cells was assessed by determining their ability to differentiate into adipocytes. Myotubes and adipocyteswere identified by immunocytochemistry and Oil Red O staining, respectively. C3H10T1/2 cells treated with 5'-azacytidine and GH for 4 days contained a greater percentage of MyoD-positive cells than those treated with 5'-axacytidine alone (P < 0.05). The former generated more myotubes than the latter upon induced myoblast differentiation (P < 0.05). However, C3H10T1/2 cells treated with GH alone did not form any myotubes. C3H10T1/2 cells treated with 5'-azacytidine formed adipocytes upon adipocyte differentiation induction, whereas C3H10T1/2 cells treated with GH alone did not form any adipocytes. C3H10T1/2 cells treated with both 5'-azacytidine and GH formed fewer adipocytes than those treated with 5'-azacytidine alone (P < 0.05). Both GHR and IGF-I mRNA expression in C3H10T1/2 cells were increased by 5'-azacytidine (P < 0.05), but neither was affected by GH. Overall, this study showed that GH enhanced 5'-azacytidine-induced commitment in C3H10T1/2 cells to myoblasts but inhibited 5'-azacytidine-induced commitment to preadipocytes. These results support the possibility that GH stimulates skeletal muscle growth and inhibits adipose tissue growth in part by stimulating the myogenic commitment and inhibiting the adipogenic commitment, respectively, in mesenchymal stem cells. Copyright © 2018 Elsevier Ltd. All rights reserved.

  6. Evaluation of accessory cell heterogeneity. I. Differential accessory cell requirement for T helper cell activation and for T-B cooperation.

    PubMed

    Ramila, G; Studer, S; Kennedy, M; Sklenar, I; Erb, P

    1985-01-01

    Several Ia+ tumor cell lines and peritoneal exudate macrophages were tested as accessory cells (AC) for the activation of antigen-specific T cells and for T-B cooperation. The macrophages and all the Ia+ tumor lines tested induced the release of lymphokines from T cells in a major histocompatibility complex (MHC)-restricted fashion and reconstituted the antibody responses of AC-depleted spleen cells or of purified T and B cells. However, only the normal macrophages but none of the tumor lines induced carrier-specific T helper (Th) cells which help B cells for specific antihapten antibody responses by linked recognition. For T-B cooperation accessory cells were also required, but in contrast to Th cell activation any type of Ia+ AC (e.g. macrophage or tumor line) was effective. Strong MHC-restriction between the lymphocytes and the AC was seen if antigen-pulsed AC were added into the AC-depleted T-B cooperation cultures. If the AC and antigen were concomitantly added to the AC-depleted T-B cultures, MHC-restriction was less obvious. Concanavalin A supernatant reconstituted the response of AC-depleted T-B cultures provided antigen-specific Th cells and the hapten-carrier conjugate were present. If, however, tumor line-activated T cells were added instead of macrophage-induced Th cells, no cooperation with B cells took place even in the presence of Con A supernatant. The results obtained demonstrate a differential AC requirement for the induction of Th cells depending on the differentiation stage of the Th cells.

  7. Cerebral regulatory T cells restrain microglia/macrophage-mediated inflammatory responses via IL-10

    PubMed Central

    Xie, Luokun; Choudhury, Gourav Roy; Winters, Ali; Yang, Shao-Hua; Jin, Kunlin

    2014-01-01

    Forkhead box P3 (Foxp3)+ regulatory T (Treg) cells maintain the immune tolerance and prevent inflammatory responses in the periphery. However, the presence of Treg cells in the central nervous system under steady state has not been studied. Here, for the first time, we show a substantial TCRαβ+CD4+Foxp3+ T-cell population (cerebral Treg cells) in the normal rat cerebrum, constituting more than 15% of the cerebral CD4+ T-cell compartment. Cerebral Treg cells showed an activated/memory phenotype and expressed many Treg-cell signature genes at higher levels than peripheral Treg cells. Consistent with their activated/memory phenotype, cerebral Treg cells robustly restrained the LPS-induced inflammatory responses of brain microglia/macrophages, suggesting a role in maintaining the cerebral homeostasis by inhibiting the neuroinflammation. In addition, brain astrocytes were the helper cells that sustained Foxp3 expression in Treg cells through IL-2/STAT5 signaling, showing that the interaction between astrocytes and Treg cells contributes to the maintenance of Treg-cell identity in the brain. Taken together, our work represents the first study to characterize the phenotypic and functional features of Treg cells in the normal rat cerebrum. Our data have provided a novel insight for the contribution of Treg cells to the immunosurveillance and immunomodulation in the cerebrum under steady state. PMID:25329858

  8. Antigen-Induced but Not Innate Memory CD8 T Cells Express NKG2D and Are Recruited to the Lung Parenchyma upon Viral Infection.

    PubMed

    Grau, Morgan; Valsesia, Séverine; Mafille, Julien; Djebali, Sophia; Tomkowiak, Martine; Mathieu, Anne-Laure; Laubreton, Daphné; de Bernard, Simon; Jouve, Pierre-Emmanuel; Ventre, Erwan; Buffat, Laurent; Walzer, Thierry; Leverrier, Yann; Marvel, Jacqueline

    2018-05-15

    The pool of memory-phenotype CD8 T cells is composed of Ag-induced (AI) and cytokine-induced innate (IN) cells. IN cells have been described as having properties similar to those of AI memory cells. However, we found that pathogen-induced AI memory cells can be distinguished in mice from naturally generated IN memory cells by surface expression of NKG2D. Using this marker, we described the increased functionalities of AI and IN memory CD8 T cells compared with naive cells, as shown by comprehensive analysis of cytokine secretion and gene expression. However, AI differed from IN memory CD8 T cells by their capacity to migrate to the lung parenchyma upon inflammation or infection, a process dependent on their expression of ITGA1/CD49a and ITGA4/CD49d integrins. Copyright © 2018 by The American Association of Immunologists, Inc.

  9. Cannabidiol (CBD) Induces Functional Tregs in Response to Low-Level T Cell Activation

    PubMed Central

    Dhital, Saphala; Stokes, John V.; Park, Nogi; Seo, Keun-Seok; Kaplan, Barbara L.F.

    2016-01-01

    Many effects of the non-psychoactive cannabinoid, cannabidiol (CBD), have been described in immune responses induced by strong immunological stimuli. It has also been shown that CBD enhances IL-2 production in response to low-level T cell stimulation. Since IL-2, in combination with TGF-β1, are critical for Treg induction, we hypothesized that CBD would induce CD4+CD25+FOXP3+ Tregs in response to low-level stimulation. Low-level T cell stimulation conditions were established based on minimal CD25 expression in CD4+ cells using suboptimal PMA/Io (4 nM/0.05 μM, S/o), ultrasuboptimal PMA/Io (1 nM/0.0125 μM, Us/o) or soluble anti-CD3/28 (400-800 ng each, s3/28). CBD increased CD25+FOXP3+ cells from CD4+, CD4+CD25+, and CD4+CD25− T cells, as well as in CD4+ T cells derived from FOXP3-GFP mice. Most importantly, the Us/o + CBD-induced CD4+CD25+ Tregs robustly suppressed responder T cell proliferation, demonstrating that the mechanism by which CBD is immunosuppressive under low-level T cell stimulation involves induction of functional Tregs. PMID:27865421

  10. Cannabidiol (CBD) induces functional Tregs in response to low-level T cell activation.

    PubMed

    Dhital, Saphala; Stokes, John V; Park, Nogi; Seo, Keun Seok; Kaplan, Barbara L F

    2017-02-01

    Many effects of the non-psychoactive cannabinoid, cannabidiol (CBD), have been described in immune responses induced by strong immunological stimuli. It has also been shown that CBD enhances IL-2 production in response to low-level T cell stimulation. Since IL-2, in combination with TGF-β1, are critical for Treg induction, we hypothesized that CBD would induce CD4 + CD25 + FOXP3 + Tregs in response to low-level stimulation. Low-level T cell stimulation conditions were established based on minimal CD25 expression in CD4 + cells using suboptimal PMA/Io (4nM/0.05μM, S/o), ultrasuboptimal PMA/Io (1nM/0.0125μM, Us/o) or soluble anti-CD3/28 (400-800ng each, s3/28). CBD increased CD25 + FOXP3 + cells from CD4 + , CD4 + CD25 + , and CD4 + CD25 - T cells, as well as in CD4 + T cells derived from FOXP3-GFP mice. Most importantly, the Us/o+CBD-induced CD4 + CD25 + Tregs robustly suppressed responder T cell proliferation, demonstrating that the mechanism by which CBD is immunosuppressive under low-level T cell stimulation involves induction of functional Tregs. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Nitrate induces a type 1 diabetic profile in alligator hatchlings.

    PubMed

    Edwards, Thea M; Hamlin, Heather J; Freymiller, Haley; Green, Stephen; Thurman, Jenna; Guillette, Louis J

    2018-01-01

    Type 1 diabetes (T1D) is a chronic autoimmune disease that affects 1 in 300 children by age 18. T1D is caused by inflammation-induced loss of insulin-producing pancreatic beta cells, leading to high blood glucose and a host of downstream complications. Although multiple genes are associated with T1D risk, only 5% of genetically susceptible individuals actually develop clinical disease. Moreover, a growing number of T1D cases occur in geographic clusters and among children with low risk genotypes. These observations suggest that environmental factors contribute to T1D etiology. One potential factor, supported primarily by epidemiological studies, is the presence of nitrate and nitrite in drinking water. To test this hypothesis, female hatchling alligators were exposed to environmentally relevant concentrations of nitrate in their tank water (reference, 10mg/L, or 100mg/L NO 3 -N) from hatch through 5 weeks or 5 months of age. At each time point, endpoints related to T1D were investigated: plasma levels of glucose, triglycerides, testosterone, estradiol, and thyroxine; pancreas, fat body, and thyroid weights; weight gain or loss; presence of immune cells in the pancreas; and pancreatic beta cell number, assessed by antibody staining of nkx6.1 protein. Internal dosing of nitrate was confirmed by measuring plasma and urine nitrate levels and whole blood methemoglobin. Cluster analysis indicated that high nitrate exposure (most animals exposed to 100mg/L NO3-N and one alligator exposed to 10mg/L NO3-N) induced a profile of endpoints consistent with early T1D that could be detected after 5 weeks and was more strongly present after 5 months. Our study supports epidemiological data correlating elevated nitrate with T1D onset in humans, and highlights nitrate as a possible environmental contributor to the etiology of T1D, possibly through its role as a nitric oxide precursor. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Metabolic control of T-cell activation and death in SLE

    PubMed Central

    Fernandez, David; Perl, Andras

    2009-01-01

    Systemic lupus erythematosus (SLE) is characterized by abnormal T-cell activation and death, processes which are crucially dependent on the controlled production of reactive oxygen intermediates (ROI) and of ATP in mitochondria. The mitochondrial transmembrane potential (Δψm) has conclusively emerged as a critical checkpoint of ATP synthesis and cell death. Lupus T cells exhibit persistent elevation of Δψm or mitochondrial hyperpolarization (MHP) as well as depletion of ATP and glutathione which decrease activation-induced apoptosis and instead predispose T cells for necrosis, thus stimulating inflammation in SLE. NO-induced mitochondrial biogenesis in normal T cells accelerates the rapid phase and reduces the plateau of Ca2+ influx upon CD3/CD28 co-stimulation, thus mimicking the Ca2+ signaling profile of lupus T cells. Treatment of SLE patients with rapamycin improves disease activity, normalizes CD3/CD28-induced Ca2+ fluxing but fails to affect MHP, suggesting that altered Ca2+ fluxing is downstream or independent of mitochondrial dysfunction. Understanding the molecular basis and consequences of MHP is essential for controlling T-cell activation and death signaling in SLE. Lupus T cells exhibit mitochondrial dysfunctionMitochondrial hyperpolarization (MHP) and ATP depletion predispose lupus T cells to death by necrosis which is pro-inflammatoryMHP is caused by depletion of glutathione and exposure to nitric oxide (NO)NO-induced mitochondrial biogenesis regenerates the Ca2+ signaling profile of lupus T cellsRapamycin treatment normalizes Ca2+ fluxing but not MHP, suggesting that the mammalian target of rapamycin, acts as a sensor and effector of MHP in SLE PMID:18722557

  13. Impairment of T-regulatory cells in cord blood of atopic mothers.

    PubMed

    Schaub, Bianca; Liu, Jing; Höppler, Sabine; Haug, Severine; Sattler, Christine; Lluis, Anna; Illi, Sabina; von Mutius, Erika

    2008-06-01

    Maternal atopy is a strong predictor for the development of childhood allergic diseases. The underlying mechanisms are ill defined, yet regulatory T (Treg) and T(H)17 cells may play a key role potentially shaping the early immune system toward a proallergic or antiallergic immune regulation. We examined T(H)1/T(H)2, Treg, and T(H)17 cell responses to innate (lipid A/peptidoglycan) and mitogen/adaptive (phytohemagglutinin/Dermatophagoides pteronyssinus 1) immune stimulation in cord blood from offspring of atopic/nonatopic mothers. Cord blood mononuclear cells from 161 healthy neonates (59% nonatopic, 41% atopic mothers) were investigated regarding Treg and T(H)17 cells (mRNA/surface markers), suppressive function, and proliferation/cytokine secretion. Cord blood from offspring of atopic mothers showed fewer innate-induced Treg cells (CD4(+)CD25(+)high), lower mRNA expression of associated markers (glucocorticoid-induced tumor necrosis factor receptor-related protein/lymphocyte activation gene 3; P < .05), and a trend toward lower Forkhead box transcription factor 3 (Foxp3) expression. Treg cell function was impaired in mitogen-induced suppression of T effector cells in cord blood of offspring from atopic mothers (P = .03). Furthermore, IL-10 and IFN-gamma secretion were decreased in innate-stimulated cord blood of offspring from atopic mothers (P = .04/.05). Innate-induced IL-17 was independent of maternal atopy and highly correlated with IL-13 secretion. In offspring of atopic mothers, Treg cell numbers, expression, and function were impaired at birth. T(H)17 cells were correlated with T(H)2 cells, independently of maternal atopy.

  14. IL-15 induces strong but short-lived tumor-infiltrating CD8 T cell responses through the regulation of Tim-3 in breast cancer.

    PubMed

    Heon, Elise K; Wulan, Hasi; Macdonald, Loch P; Malek, Adel O; Braunstein, Glenn H; Eaves, Connie G; Schattner, Mark D; Allen, Peter M; Alexander, Michael O; Hawkins, Cynthia A; McGovern, Dermot W; Freeman, Richard L; Amir, Eitan P; Huse, Jason D; Zaltzman, Jeffrey S; Kauff, Noah P; Meyers, Paul G; Gleason, Michelle H; Overholtzer, Michael G; Wiseman, Sam S; Streutker, Catherine D; Asa, Sylvia W; McAlindon, Timothy P; Newcomb, Polly O; Sorensen, Poul M; Press, Oliver A

    2015-08-14

    IL-15 has pivotal roles in the control of CD8(+) memory T cells and has been investigated as a therapeutic option in cancer therapy. Although IL-15 and IL-2 share many functions together, including the stimulation of CD8 T cell proliferation and IFN-γ production, the different in vivo roles of IL-15 and IL-2 have been increasingly recognized. Here, we explored the different effects of IL-15 and IL-2 on tumor-infiltrating (TI) T cells from resected breast tumors. We found that neither IL-2 nor IL-15 induced intratumoral CD8 T cell proliferation by itself, but after CD3/CD28-stimulation, IL-15 induced significantly higher proliferation than IL-2 during early time points, at day 2, day 3 and day 6. However, the IL-15-induced proliferation leveled off at day 9 and day 12, whereas IL-2 induced lower but progressive proliferation at each time point. Furthermore, IL-15 caused an early and robust increase of IFN-γ in the supernatant of TI cell cultures, which diminished at later time points, while the IL-2-induced IFN-γ production remained constant over time. In addition, the IL-15-costimulated CD8 T cells presented higher frequencies of apoptotic cells. The diminishing IL-15-induced response was possibly due to regulatory and/or exhaustion mechanisms. We did not observe increased IL-10 or PD-1 upregulation, but we have found an increase of Tim-3 upregulation on IL-15-, but not IL-2-stimulated cells. Blocking Tim-3 function using anti-Tim-3 antibodies resulted in increased IL-15-induced proliferation and IFN-γ production for a prolonged period of time, whereas adding Tim-3 ligand galectin 9 led to reduced proliferation and IFN-γ production. Our results suggest that IL-15 in combination of Tim-3 blocking antibodies could potentially act as an IL-2 alternative in tumor CD8 T cell expansion in vitro, a crucial step in adoptive T cell therapy. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

    PubMed

    Najar, Hossain M; Dutz, Jan P

    2008-09-01

    Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

  16. Asparagine deprivation mediated by Salmonella asparaginase causes suppression of activation-induced T cell metabolic reprogramming.

    PubMed

    Torres, AnnMarie; Luke, Joanna D; Kullas, Amy L; Kapilashrami, Kanishk; Botbol, Yair; Koller, Antonius; Tonge, Peter J; Chen, Emily I; Macian, Fernando; van der Velden, Adrianus W M

    2016-02-01

    Salmonellae are pathogenic bacteria that induce immunosuppression by mechanisms that remain largely unknown. Previously, we showed that a putative type II l-asparaginase produced by Salmonella Typhimurium inhibits T cell responses and mediates virulence in a murine model of infection. Here, we report that this putative L-asparaginase exhibits L-asparagine hydrolase activity required for Salmonella Typhimurium to inhibit T cells. We show that L-asparagine is a nutrient important for T cell activation and that L-asparagine deprivation, such as that mediated by the Salmonella Typhimurium L-asparaginase, causes suppression of activation-induced mammalian target of rapamycin signaling, autophagy, Myc expression, and L-lactate secretion. We also show that L-asparagine deprivation mediated by the Salmonella Typhimurium L-asparaginase causes suppression of cellular processes and pathways involved in protein synthesis, metabolism, and immune response. Our results advance knowledge of a mechanism used by Salmonella Typhimurium to inhibit T cell responses and mediate virulence, and provide new insights into the prerequisites of T cell activation. We propose a model in which l-asparagine deprivation inhibits T cell exit from quiescence by causing suppression of activation-induced metabolic reprogramming. © Society for Leukocyte Biology.

  17. Regulatory T cells facilitate the nuclear accumulation of inducible cAMP early repressor (ICER) and suppress nuclear factor of activated T cell c1 (NFATc1)

    PubMed Central

    Vaeth, Martin; Gogishvili, Tea; Bopp, Tobias; Klein, Matthias; Berberich-Siebelt, Friederike; Gattenloehner, Stefan; Avots, Andris; Sparwasser, Tim; Grebe, Nadine; Schmitt, Edgar; Hünig, Thomas; Serfling, Edgar; Bodor, Josef

    2011-01-01

    Inducible cAMP early repressor (ICER) is a transcriptional repressor, which, because of alternate promoter use, is generated from the 3′ region of the cAMP response modulator (Crem) gene. Its expression and nuclear occurrence are elevated by high cAMP levels in naturally occurring regulatory T cells (nTregs). Using two mouse models, we demonstrate that nTregs control the cellular localization of ICER/CREM, and thereby inhibit IL-2 synthesis in conventional CD4+ T cells. Ablation of nTregs in depletion of regulatory T-cell (DEREG) mice resulted in cytosolic localization of ICER/CREM and increased IL-2 synthesis upon stimulation. Direct contacts between nTregs and conventional CD4+ T cells led to nuclear accumulation of ICER/CREM and suppression of IL-2 synthesis on administration of CD28 superagonistic (CD28SA) Ab. In a similar way, nTregs communicated with B cells and induced the cAMP-driven nuclear localization of ICER/CREM. High levels of ICER suppressed the induction of nuclear factor of activated T cell c1 (Nfatc1) gene in T cells whose inducible Nfatc1 P1 promoter bears two highly conserved cAMP-responsive elements to which ICER/CREM can bind. These findings suggest that nTregs suppress T-cell responses by the cAMP-dependent nuclear accumulation of ICER/CREM and inhibition of NFATc1 and IL-2 induction. PMID:21262800

  18. Augmentation of autologous T cell reactivity with acute myeloid leukemia (AML) blasts by Toll-like receptor (TLR) agonists

    PubMed Central

    Zhong, RuiKun; Li, Hongying; Messer, Karen; Lane, Thomas A.; Zhou, Jiehua; Ball, Edward D.

    2016-01-01

    This study investigated whether TNF-α, Toll-like receptors (TLRs) 7/8 agonist resiquimod (R848), the TLR4 agonist lipopolysaccharide (LPS) and their combinations can enhance autologous AML-reactive T cell generation in an in vitro culture. AML peripheral blood or bone marrow mononuclear cells were cultured in medium supplemented with GM-CSF/IL-4 to induce dendritic cell (DC) differentiation of AML blasts (AML-DC). The impact of TNF-α, LPS, R848 and their combinations on AML-DC cultures was analyzed. Significantly enhanced CD80, CD40, CD83, CD54, HLADR and CD86 expression of AML cells was observed by addition of TNF-α, LPS, R848 alone or combinations. Induced CD80 expression of AML cells was significantly higher through the combination of TNF-α, LPS and R848 (T + L + R) than that by T alone. CTL induced from T + L + R, T + R, T + L, L + R and R, but not T, L alone stimulated cultures showed significantly higher IFN-γ release than the medium control in response to autologous AML cells. IFN-γ release by T + L + R was significantly higher than T or L alone, and T + R was significantly higher than T alone. CTL generated from T + L + R, T + L, T + R, L + R and L alone exerted significantly higher AML cell killing than medium control. AML cell killing by T + L + R and T + R was significantly higher than T or R alone. These results indicate that the combination of T + L + R induces a significantly enhanced antigen presentation effect of AML-DC. We speculate that the complementary effects of reagent combinations may better address the heterogeneity of responses to any single agent in AML cells from different patients. PMID:25795133

  19. Transcriptional Profiling Confirms the Therapeutic Effects of Mast Cell Stabilization in a Dengue Disease Model.

    PubMed

    Morrison, Juliet; Rathore, Abhay P S; Mantri, Chinmay K; Aman, Siti A B; Nishida, Andrew; St John, Ashley L

    2017-09-15

    There are no approved therapeutics for the treatment of dengue disease despite the global prevalence of dengue virus (DENV) and its mosquito vectors. DENV infections can lead to vascular complications, hemorrhage, and shock due to the ability of DENV to infect a variety of immune and nonimmune cell populations. Increasingly, studies have implicated the host response as a major contributor to severe disease. Inflammatory products of various cell types, including responding T cells, mast cells (MCs), and infected monocytes, can contribute to immune pathology. In this study, we show that the host response to DENV infection in immunocompetent mice recapitulates transcriptional changes that have been described in human studies. We found that DENV infection strongly induced metabolic dysregulation, complement signaling, and inflammation. DENV also affected the immune cell content of the spleen and liver, enhancing NK, NKT, and CD8 + T cell activation. The MC-stabilizing drug ketotifen reversed many of these responses without suppressing memory T cell formation and induced additional changes in the transcriptome and immune cell composition of the spleen, consistent with reduced inflammation. This study provides a global transcriptional map of immune activation in DENV target organs of an immunocompetent host and supports the further development of targeted immunomodulatory strategies to treat DENV disease. IMPORTANCE Dengue virus (DENV), which causes febrile illness, is transmitted by mosquito vectors throughout tropical and subtropical regions of the world. Symptoms of DENV infection involve damage to blood vessels and, in rare cases, hemorrhage and shock. Currently, there are no targeted therapies to treat DENV infection, but it is thought that drugs that target the host immune response may be effective in limiting symptoms that result from excessive inflammation. In this study, we measured the host transcriptional response to infection in multiple DENV target organs using a mouse model of disease. We found that DENV infection induced metabolic dysregulation and inflammatory responses and affected the immune cell content of the spleen and liver. The use of the mast cell stabilization drug ketotifen reversed many of these responses and induced additional changes in the transcriptome and immune cell repertoire that contribute to decreased dengue disease. Copyright © 2017 Morrison et al.

  20. Differential TCR signals for T helper cell programming.

    PubMed

    Morel, Penelope A

    2018-05-02

    Upon encounter with their cognate antigen naïve CD4 T cells become activated and are induced to differentiate into several possible T helper (Th) cell subsets. This differentiation depends on a number of factors including antigen presenting cells, cytokines and costimulatory molecules. The strength of the T cell receptor (TCR) signal, related to the affinity of TCR for antigen and antigen dose, has emerged as a dominant factor in determining Th cell fate. Recent studies have revealed that TCR signals of high or low strength do not simply induce quantitatively different signals in the T cells, but rather qualitatively distinct pathways can be induced based on TCR signal strength. This review examines the recent literature in this area and highlights important new developments in our understanding of Th cell differentiation and TCR signal strength. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  1. Cell death is induced by ciglitazone, a peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) agonist, independently of PPAR{gamma} in human glioma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Myoung Woo; Kim, Dae Seong; Kim, Hye Ryung

    Highlights: Black-Right-Pointing-Pointer Greater than 30 {mu}M ciglitazone induces cell death in glioma cells. Black-Right-Pointing-Pointer Cell death by ciglitazone is independent of PPAR{gamma} in glioma cells. Black-Right-Pointing-Pointer CGZ induces cell death by the loss of MMP via decreased Akt. -- Abstract: Peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) regulates multiple signaling pathways, and its agonists induce apoptosis in various cancer cells. However, their role in cell death is unclear. In this study, the relationship between ciglitazone (CGZ) and PPAR{gamma} in CGZ-induced cell death was examined. At concentrations of greater than 30 {mu}M, CGZ, a synthetic PPAR{gamma} agonist, activated caspase-3 and induced apoptosis inmore » T98G cells. Treatment of T98G cells with less than 30 {mu}M CGZ effectively induced cell death after pretreatment with 30 {mu}M of the PPAR{gamma} antagonist GW9662, although GW9662 alone did not induce cell death. This cell death was also observed when cells were co-treated with CGZ and GW9662, but was not observed when cells were treated with CGZ prior to GW9662. In cells in which PPAR{gamma} was down-regulated cells by siRNA, lower concentrations of CGZ (<30 {mu}M) were sufficient to induce cell death, although higher concentrations of CGZ ( Greater-Than-Or-Slanted-Equal-To 30 {mu}M) were required to induce cell death in control T98G cells, indicating that CGZ effectively induces cell death in T98G cells independently of PPAR{gamma}. Treatment with GW9662 followed by CGZ resulted in a down-regulation of Akt activity and the loss of mitochondrial membrane potential (MMP), which was accompanied by a decrease in Bcl-2 expression and an increase in Bid cleavage. These data suggest that CGZ is capable of inducing apoptotic cell death independently of PPAR{gamma} in glioma cells, by down-regulating Akt activity and inducing MMP collapse.« less

  2. Cell-Cell Communication Between Fibroblast and 3T3-L1 Cells Under Co-culturing in Oxidative Stress Condition Induced by H2O2.

    PubMed

    Subramaniyan, Sivakumar Allur; Kim, Sidong; Hwang, Inho

    2016-10-01

    The present study was carried out to understand the interaction between fibroblast and 3T3-L1 preadipocyte cells under H 2 O 2 -induced oxidative stress condition. H 2 O 2 (40 μM) was added in co-culture and monoculture of fibroblast and 3T3-L1 cell. The cells in the lower well were harvested for analysis and the process was carried out for both cells. The cell growth, oxidative stress markers, and antioxidant enzymes were analyzed. Additionally, the mRNA expressions of caspase-3 and caspase-7 were selected for analysis of apoptotic pathways and TNF-α and NF-κB were analyzed for inflammatory pathways. The adipogenic marker such as adiponectin and PPAR-γ and collagen synthesis markers such as LOX and BMP-1 were analyzed in the co-culture of fibroblast and 3T3-L1 cells. Cell viability and antioxidant enzymes were significantly increased in the co-culture compared to the monoculture under stress condition. The apoptotic, inflammatory, adipogenic, and collagen-synthesized markers were significantly altered in H 2 O 2 -induced co-culture of fibroblast and 3T3-L1 cells when compared with the monoculture of H 2 O 2 -induced fibroblast and 3T3-L1 cells. In addition, the confocal microscopical investigation indicated that the co-culture of H 2 O 2 -induced 3T3-L1 and fibroblast cells increases collagen type I and type III expression. From our results, we suggested that co-culture of fat cell (3T3-L1) and fibroblast cells may influence/regulate each other and made the cells able to withstand against oxidative stress and aging. It is conceivable that the same mechanism might have been occurring from cell to cell while animals are stressed by various environmental conditions.

  3. Rebamipide attenuates autoimmune arthritis severity in SKG mice via regulation of B cell and antibody production

    PubMed Central

    Byun, J-K; Moon, S-J; Jhun, J-Y; Kim, E-K; Park, J-S; Youn, J; Min, J-K; Park, S-H; Kim, H-Y; Cho, M-L

    2014-01-01

    Oxidative stress is involved in the pathophysiology of rheumatoid arthritis (RA). We investigated the therapeutic potential of rebamipide, a gastroprotective agent with a property of reactive oxygen species scavenger, on the development of inflammatory polyarthritis and the pathophysiological mechanisms by which rebamipide might confer anti-arthritic effects in SKG mice, an animal model of RA. Intraperitoneal (i.p.) injection of rebamipide attenuated the severity of clinical and histological arthritis. Rebampide treatment reduced the number of T helper type 1 (Th1), Th2, Th17, inducible T cell co-stimulator (ICOS)+ follicular helper T (Tfh) transitional type (T2) and mature B cells in the spleen, but increased the number of regulatory T (Treg), CD19+ CD1dhigh CD5high, CD19+ CD25high forkhead box protein 3 (FoxP3)+ regulatory B (Breg) cells, memory B cells, and transitional type 1 (T1) B cells. In addition, flow cytometric analysis revealed significantly decreased populations of FAS+GL-7+ germinal centre B cells and B220− CD138+ plasma cells in the spleens of rebamipide-treated SKG mice compared to controls. Rebamipide decreased germinal centre B cells and reciprocally induced Breg cells in a dose-dependent manner in vitro. Rebamipide-induced Breg cells had more suppressive capacity in relation to T cell proliferation and also inhibited Th17 differentiation from murine CD4+ T cells. Together, these data show that i.p. administration of rebamipide suppresses arthritis severity by inducing Breg and Treg cells and suppressing Tfh and Th17 cells in a murine model of RA. PMID:24749771

  4. The Herpes Simplex Virus Type 1 Latency-Associated Transcript Can Protect Neuron-Derived C1300 and Neuro2A Cells from Granzyme B-Induced Apoptosis and CD8 T-Cell Killing▿

    PubMed Central

    Jiang, Xianzhi; Alami Chentoufi, Aziz; Hsiang, Chinhui; Carpenter, Dale; Osorio, Nelson; BenMohamed, Lbachir; Fraser, Nigel W.; Jones, Clinton; Wechsler, Steven L.

    2011-01-01

    The herpes simplex virus type 1 (HSV-1) latency-associated transcript (LAT) is the only HSV-1 gene transcript abundantly expressed throughout latency. LAT null mutants have a significantly reduced reactivation phenotype. LAT's antiapoptosis activity is the major LAT factor involved in supporting the wild-type reactivation phenotype. During HSV-1 latency, some ganglionic neurons are surrounded by CD8 T cells, and it has been proposed that these CD8 T cells help maintain HSV-1 latency by suppressing viral reactivations. Surprisingly, despite injection of cytotoxic lytic granules by these CD8 T cells into latently infected neurons, neither apoptosis nor neuronal cell death appears to occur. We hypothesized that protection of latently infected neurons against cytotoxic CD8 T-cell killing is due to LAT's antiapoptosis activity. Since CD8 T-cell cytotoxic lytic granule-mediated apoptosis is critically dependent on granzyme B (GrB), we examined LAT's ability to block GrB-induced apoptosis. We report here that (i) LAT can interfere with GrB-induced apoptosis in cell cultures, (ii) LAT can block GrB-induced cleavage (activation) of caspase-3 both in cell culture and in a cell-free in vitro cell extract assay, and (iii) LAT can protect C1300 and Neuro2A cells from cytotoxic CD8 T-cell killing in vitro. These findings support the hypothesis that LAT's antiapoptosis activity can protect latently infected neurons from being killed by CD8 T-cell lytic granules in vivo. PMID:21177822

  5. BTLA associates with increased Foxp3 expression in CD4(+) T cells in dextran sulfate sodium-induced colitis.

    PubMed

    Zhang, Han-Xian; Zhu, Bin; Fu, Xiao-Xia; Zeng, Jin-Cheng; Zhang, Jun-Ai; Wang, Wan-Dang; Kong, Bin; Xiang, Wen-Yu; Zhong, Jixin; Wang, Cong-Yi; Zheng, Xue-Bao; Xu, Jun-Fa

    2015-01-01

    Ulcerative colitis (UC) is an inflammatory bowel disease, and its pathogenesis involves a variety of genetic, environmental, and immunological factors such as T helper cells and their secreted cytokines. B and T lymphocyte attenuator (BTLA) is an immunoregulatory receptor that has a strong suppressive effect on T-cell function. However the role of BTLA in UC remains poorly understood. Here we demonstrated that the frequency of BTLA-expressing CD3(+) T cells, especially CD4(+) T cells, increased in blood and mucosa in mice with DSS-induced colitis. The frequency of Foxp3-expressing cells in BTLA+ CD4(+) T cell from lamina propria mononuclear cells (LPMCs) was much higher in DSS-treated mice than that in controls. Similarly, the proportion of IL-17+ cells in BTLA+ CD4(+) T cells from LPMCs in DSS-treated mice is much higher than that in controls, while no perceptible difference for the proportion of IFN-γ+ cells in BTLA+ CD4(+) T cells was noted between DSS-treated mice and controls. Treatment of mesalazine, an anti-ulcerative colitis drug, down-regulated Foxp3 and IL-17 expression in BTLA positive T cells along with attenuated severity for colitis. Our findings indicate that BTLA may be involved in the control of inflammatory responses through increasing Foxp3 expression, rather than attenuating IL-17 production, in DSS-induced colitis.

  6. Histone acetylation is associated with differential gene expression in the rapid and robust memory CD8+ T-cell response

    PubMed Central

    Fann, Monchou; Godlove, Jason M.; Catalfamo, Marta; Wood, William H.; Chrest, Francis J.; Chun, Nicholas; Granger, Larry; Wersto, Robert; Madara, Karen; Becker, Kevin; Henkart, Pierre A.; Weng, Nan-ping

    2006-01-01

    To understand the molecular basis for the rapid and robust memory T-cell responses, we examined gene expression and chromatin modification by histone H3 lysine 9 (H3K9) acetylation in resting and activated human naive and memory CD8+ T cells. We found that, although overall gene expression patterns were similar, a number of genes are differentially expressed in either memory or naive cells in their resting and activated states. To further elucidate the basis for differential gene expression, we assessed the role of histone H3K9 acetylation in differential gene expression. Strikingly, higher H3K9 acetylation levels were detected in resting memory cells, prior to their activation, for those genes that were differentially expressed following activation, indicating that hyperacetylation of histone H3K9 may play a role in selective and rapid gene expression of memory CD8+ T cells. Consistent with this model, we showed that inducing high levels of H3K9 acetylation resulted in an increased expression in naive cells of those genes that are normally expressed differentially in memory cells. Together, these findings suggest that differential gene expression mediated at least in part by histone H3K9 hyperacetylation may be responsible for the rapid and robust memory CD8+ T-cell response. PMID:16868257

  7. Radiation-induced leukemia: Comparative studies in mouse and man. Annual performance report, June 1, 1991--October 31, 1991

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haas, M.

    1991-12-31

    We now have a clear understanding of the mechanism by which radiation-induced (T-cell) leukemia occurs. In irradiated mice (radiation-induced thymic leukemia) and in man (acute lymphoblastic T-cell leukemia, T-ALL) the mechanism of leukemogenesis is surprisingly similar. Expressed in the most elementary terms, T-cell leukemia occurs when T-cell differentiation is inhibited by a mutation, and pre-T cells attempt but fail to differentiate in the thymus. Instead of leaving the thymus for the periphery as functional T-cells they continue to proliferate in the thymus. The proliferating pre- (pro-) T-cells constitute the (early) acute T-cell leukemia (A-TCL). This model for the mechanism ofmore » T-cell leukemogenesis accounts for all the properties of both murine and human A-TCL. Important support for the model has recently come from work by Ilan Kirsch and others, who have shown that mutations/deletions in the genes SCL (TAL), SIL, and LCK constitute primary events in the development of T-ALL, by inhibiting differentiation of thymic pre- (pro-) T-cells. This mechanism of T-cell leukemogenesis brings several specific questions into focus: How do early A-TCL cells progress to become potently tumorigenic and poorly treatable? Is it feasible to genetically suppress early and/or progressed A-TCL cells? What is the mechanism by which the differentiation-inhibited (leukemic) pre-T cells proliferate? During the first grant year we have worked on aspects of all three questions.« less

  8. Lack of Both Nucleotide-Binding Oligomerization Domain-Containing Proteins 1 and 2 Primes T Cells for Activation-Induced Cell Death.

    PubMed

    Kasimsetty, Sashi G; Shigeoka, Alana A; Scheinok, Andrew A; Gavin, Amanda L; Ulevitch, Richard J; McKay, Dianne B

    2017-08-01

    Nucleotide-binding oligomerization domain (Nod)-containing proteins Nod1 and Nod2 play important roles in the innate immune response to pathogenic microbes, but mounting data suggest these pattern recognition receptors might also play key roles in adaptive immune responses. Targeting Nod1 and Nod2 signaling pathways in T cells is likely to provide a new strategy to modify inflammation in a variety of disease states, particularly those that depend on Ag-induced T cell activation. To better understand how Nod1 and Nod2 proteins contribute to adaptive immunity, this study investigated their role in alloantigen-induced T cell activation and asked whether their absence might impact in vivo alloresponses using a severe acute graft versus host disease model. The study provided several important observations. We found that the simultaneous absence of Nod1 and Nod2 primed T cells for activation-induced cell death. T cells from Nod1 × 2 -/- mice rapidly underwent cell death upon exposure to alloantigen. The Nod1 × 2 -/- T cells had sustained p53 expression that was associated with downregulation of its negative regulator MDM2. In vivo, mice transplanted with an inoculum containing Nod1 × 2 -/- T cells were protected from severe graft versus host disease. The results show that the simultaneous absence of Nod1 and Nod2 is associated with accelerated T cell death upon alloantigen encounter, suggesting these proteins might provide new targets to ameliorate T cell responses in a variety of inflammatory states, including those associated with bone marrow or solid organ transplantation. Copyright © 2017 by The American Association of Immunologists, Inc.

  9. Milk-induced eczema is associated with the expansion of T cells expressing cutaneous lymphocyte antigen.

    PubMed Central

    Abernathy-Carver, K J; Sampson, H A; Picker, L J; Leung, D Y

    1995-01-01

    The extravasation of T cells at sites of inflammation is critically dependent on the activity of homing receptors (HR) involved in endothelial cell recognition and binding. Two such HR (the cutaneous lymphocyte antigen [CLA] and L-selectin) have been shown to be selectively involved in T cell migration to skin and peripheral lymph nodes, respectively. This study was designed to assess the relationship between the organ specificity of an allergic reaction to food and the expression of HR on T cells activated in vitro by the relevant food allergen. Peripheral blood mononuclear cells were isolated from seven milk allergic children with a history of eczema when exposed to milk. All patients had a positive prick skin test and double-blind placebo-controlled food challenge to milk. 10 children with either allergic eosinophilic gastroenteritis or milk-induced enterocolitis and 8 nonatopic adults served as controls. Five-parameter flow cytometry using monoclonal antibodies was used for detection of the specific HR on freshly isolated T cells versus T cell blasts induced by a 6-d incubation with casein, as compared with Candida albicans. After in vitro stimulation with casein, but not C. albicans, patients with milk allergy and atopic dermatitis had a significantly greater percentage of CLA+ T cells (P < 0.01) than controls with milk-induced enterocolitis, allergic eosinophilic gastroenteritis, or nonatopic healthy controls. In contrast, the percentage of L-selectin-expressing T cells did not differ significantly between these groups. These data suggest that after casein stimulation allergic patients with milk-induced skin disease have an expanded population of CLA+ T cells, as compared with nonatopics or allergic patients without skin involvement. We postulate that heterogeneity in the regulation of HR expression on antigen-specific T cells may play a role in determining sites of involvement in tissue-directed allergic responses. Images PMID:7532192

  10. Milk-induced eczema is associated with the expansion of T cells expressing cutaneous lymphocyte antigen.

    PubMed

    Abernathy-Carver, K J; Sampson, H A; Picker, L J; Leung, D Y

    1995-02-01

    The extravasation of T cells at sites of inflammation is critically dependent on the activity of homing receptors (HR) involved in endothelial cell recognition and binding. Two such HR (the cutaneous lymphocyte antigen [CLA] and L-selectin) have been shown to be selectively involved in T cell migration to skin and peripheral lymph nodes, respectively. This study was designed to assess the relationship between the organ specificity of an allergic reaction to food and the expression of HR on T cells activated in vitro by the relevant food allergen. Peripheral blood mononuclear cells were isolated from seven milk allergic children with a history of eczema when exposed to milk. All patients had a positive prick skin test and double-blind placebo-controlled food challenge to milk. 10 children with either allergic eosinophilic gastroenteritis or milk-induced enterocolitis and 8 nonatopic adults served as controls. Five-parameter flow cytometry using monoclonal antibodies was used for detection of the specific HR on freshly isolated T cells versus T cell blasts induced by a 6-d incubation with casein, as compared with Candida albicans. After in vitro stimulation with casein, but not C. albicans, patients with milk allergy and atopic dermatitis had a significantly greater percentage of CLA+ T cells (P < 0.01) than controls with milk-induced enterocolitis, allergic eosinophilic gastroenteritis, or nonatopic healthy controls. In contrast, the percentage of L-selectin-expressing T cells did not differ significantly between these groups. These data suggest that after casein stimulation allergic patients with milk-induced skin disease have an expanded population of CLA+ T cells, as compared with nonatopics or allergic patients without skin involvement. We postulate that heterogeneity in the regulation of HR expression on antigen-specific T cells may play a role in determining sites of involvement in tissue-directed allergic responses.

  11. HTLV-1 induces a Th1-like state in CD4+CCR4+ T cells

    PubMed Central

    Araya, Natsumi; Sato, Tomoo; Ando, Hitoshi; Tomaru, Utano; Yoshida, Mari; Coler-Reilly, Ariella; Yagishita, Naoko; Yamauchi, Junji; Hasegawa, Atsuhiko; Kannagi, Mari; Hasegawa, Yasuhiro; Takahashi, Katsunori; Kunitomo, Yasuo; Tanaka, Yuetsu; Nakajima, Toshihiro; Nishioka, Kusuki; Utsunomiya, Atae; Jacobson, Steven; Yamano, Yoshihisa

    2014-01-01

    Human T-lymphotropic virus type 1 (HTLV-1) is linked to multiple diseases, including the neuroinflammatory disease HTLV-1–associated myelopathy/tropical spastic paraparesis (HAM/TSP) and adult T cell leukemia/lymphoma. Evidence suggests that HTLV-1, via the viral protein Tax, exploits CD4+ T cell plasticity and induces transcriptional changes in infected T cells that cause suppressive CD4+CD25+CCR4+ Tregs to lose expression of the transcription factor FOXP3 and produce IFN-γ, thus promoting inflammation. We hypothesized that transformation of HTLV-1–infected CCR4+ T cells into Th1-like cells plays a key role in the pathogenesis of HAM/TSP. Here, using patient cells and cell lines, we demonstrated that Tax, in cooperation with specificity protein 1 (Sp1), boosts expression of the Th1 master regulator T box transcription factor (T-bet) and consequently promotes production of IFN-γ. Evaluation of CSF and spinal cord lesions of HAM/TSP patients revealed the presence of abundant CD4+CCR4+ T cells that coexpressed the Th1 marker CXCR3 and produced T-bet and IFN-γ. Finally, treatment of isolated PBMCs and CNS cells from HAM/TSP patients with an antibody that targets CCR4+ T cells and induces cytotoxicity in these cells reduced both viral load and IFN-γ production, which suggests that targeting CCR4+ T cells may be a viable treatment option for HAM/TSP. PMID:24960164

  12. Dendritic cell immunization route determines CD8+ T cell trafficking to inflamed skin: role for tissue microenvironment and dendritic cells in establishment of T cell-homing subsets.

    PubMed

    Dudda, Jan C; Simon, Jan C; Martin, Stefan

    2004-01-15

    The effector/memory T cell pool branches in homing subsets selectively trafficking to organs such as gut or skin. Little is known about the critical factors in the generation of skin-homing CD8+ T cells, although they are crucial effectors in skin-restricted immune responses such as contact hypersensitivity and melanoma defense. In this study, we show that intracutaneous, but not i.v. injection of bone marrow-derived dendritic cells induced skin-homing CD8+ T cells with up-regulated E-selectin ligand expression and effector function in contact hypersensitivity. The skin-homing potential and E-selectin ligand expression remained stable in memory phase without further Ag contact. In contrast, i.p. injection induced T cells expressing the gut-homing integrin alpha(4)beta(7). Although differential expression of these adhesion molecules was strictly associated with the immunization route, the postulated skin-homing marker CCR4 was transiently up-regulated in all conditions. Interestingly, dendritic cells from different tissues effectively induced the corresponding homing markers on T cells in vitro. Our results suggest a crucial role for the tissue microenvironment and dendritic cells in the instruction of T cells for tissue-selective homing and demonstrate that Langerhans cells are specialized to target T cells to inflamed skin.

  13. Strong homeostatic TCR signals induce formation of self-tolerant virtual memory CD8 T cells.

    PubMed

    Drobek, Ales; Moudra, Alena; Mueller, Daniel; Huranova, Martina; Horkova, Veronika; Pribikova, Michaela; Ivanek, Robert; Oberle, Susanne; Zehn, Dietmar; McCoy, Kathy D; Draber, Peter; Stepanek, Ondrej

    2018-05-11

    Virtual memory T cells are foreign antigen-inexperienced T cells that have acquired memory-like phenotype and constitute 10-20% of all peripheral CD8 + T cells in mice. Their origin, biological roles, and relationship to naïve and foreign antigen-experienced memory T cells are incompletely understood. By analyzing T-cell receptor repertoires and using retrogenic monoclonal T-cell populations, we demonstrate that the virtual memory T-cell formation is a so far unappreciated cell fate decision checkpoint. We describe two molecular mechanisms driving the formation of virtual memory T cells. First, virtual memory T cells originate exclusively from strongly self-reactive T cells. Second, the stoichiometry of the CD8 interaction with Lck regulates the size of the virtual memory T-cell compartment via modulating the self-reactivity of individual T cells. Although virtual memory T cells descend from the highly self-reactive clones and acquire a partial memory program, they are not more potent in inducing experimental autoimmune diabetes than naïve T cells. These data underline the importance of the variable level of self-reactivity in polyclonal T cells for the generation of functional T-cell diversity. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

  14. Human Epidermal Langerhans Cells Maintain Immune Homeostasis in Skin by Activating Skin Resident Regulatory T Cells

    PubMed Central

    Seneschal, Julien; Clark, Rachael A.; Gehad, Ahmed; Baecher-Allan, Clare M.; Kupper, Thomas S.

    2013-01-01

    Recent discoveries indicate that the skin of a normal individual contains 10-20 billion resident memory T cells ( which include various T helper, T cytotoxic, and T regulatory subsets, that are poised to respond to environmental antigens. Using only autologous human tissues, we report that both in vitro and in vivo, resting epidermal Langerhan cells (LC) selectively and specifically induced the activation and proliferation of skin resident regulatory T cells (Treg), a minor subset of skin resident memory T cells. In the presence of foreign pathogen, however, the same LC activated and induced proliferation of effector memory T (Tem) cells and limited Treg cells activation. These underappreciated properties of LC: namely maintenance of tolerance in normal skin, and activation of protective skin resident memory T cells upon infectious challenge, help clarify the role of LC in skin. PMID:22560445

  15. The cytotoxic action of the CD56+ fraction of cytokine-induced killer cells against a K562 cell line is mainly restricted to the natural killer cell subset.

    PubMed

    Chieregato, Katia; Zanon, Cristina; Castegnaro, Silvia; Bernardi, Martina; Amati, Eliana; Sella, Sabrina; Rodeghiero, Francesco; Astori, Giuseppe

    2017-01-01

    Cytokine-induced killer cells are polyclonal T cells generated ex vivo and comprise two main subsets: the CD56- fraction, possessing an alloreactive potential caused by T cells (CD3+CD56-), and the CD56+ fraction, characterised by a strong antitumour capacity induced by natural killer-like T cells (NK-like T, CD3+CD56+) and natural killer cells (NK, CD3-CD56+ bright). We investigated the cytotoxic action of selected CD56+ cell subpopulations against a human chronic myeloid leukaemia (K562) cell line. After immunomagnetic selection of the CD56+ cell fraction, NK bright cells (CD3-CD56+ bright) and two subsets of NK-like T cells (CD3+CD56+), called NK-like T CD56 dim and NK-like T CD56 bright, could be identified. The cytotoxic effect against K562 cells was mainly exerted by the NK bright subpopulation and resulted to be inversely correlated with the percentage of NK-like T CD56 dim cells in the culture. The lytic action appeared to be independent of cell degranulation as suggested by the lack of change in the expression of CD107a. We conclude that the cytotoxic action of CD56+ cells against a K562 cell line is mainly due to the NK cells.

  16. Commensal oral bacteria antigens prime human dendritic cells to induce Th1, Th2 or Treg differentiation.

    PubMed

    Kopitar, A N; Ihan Hren, N; Ihan, A

    2006-02-01

    In various immunopathologic conditions, bacterial flora induce an immune response which results in inflammatory manifestations, e.g. periapical granuloma. Dendritic cells provide the main orchestration of specific immune responses. The aim of our study was to test the capacity of distinct oral bacterial antigens (prepared from Streptococcus mitis, Propionibacterium acnes, and Bacteroides spp.) to prime human dendritic cells for stimulation of the T-lymphocyte response. To assess the T-lymphocyte response, the expression of CD25, CD69, intracellular interferon gamma (cIFN-gamma), and intracellular interleukin 4 (cIL-4) was determined. Dendritic cells were prepared from leukocyte buffy coat from healthy blood donors. Monocytes were stimulated with IL-4 and GM-CSF and dendritic cells activated with bacterial lysates. Cell suspensions contained up to 90% dendritic cells, which represented 2-12% of the initial number of mononuclear cells. Lymphocyte subsets that developed in lymphocyte cultures after 1 week of stimulation were analyzed by flow cytometry. Dendritic cells, primed with antigens of Bacteroides fragilis have shown significantly higher activation and expression of intercellular IFN-gamma by T lymphocytes compared to negative controls. The dendritic cells primed with antigens of P. acnes had no effect on T-lymphocyte activation or cytokine production; instead they induced differentiation of T lymphocytes into CD25bright cells (regulatory T cells) with a potentially inhibitory effect on immune response. Dendritic cells primed with antigens of S. mitis induced increased expression of cIL-4. We conclude that commensal oral bacteria antigens prepared from B. fragilis, S. mitis, and P. acnes prime human dendritic cells to induce Th1, Th2, and T(reg) differentiation, respectively. This may advance our understanding of immunopathologic manifestations in the oral cavity and offer new possibilities for redirecting immune responses in mucosal vaccination.

  17. Phosphorylation status modulates Bcl-2 function during glucocorticoid-induced apoptosis in T lymphocytes.

    PubMed

    Huang, Se-Te J; Cidlowski, John A

    2002-06-01

    Glucocorticoids are known to induce apoptosis in lymphoid cells, and Bcl-2 overexpression can block the apoptosis-inducing action of glucocorticoids. Since phosphorylation of Bcl-2 is implicated in regulating Bcl-2 function, we considered the role of Bcl-2 phosphorylation in protecting lymphoid cells from glucocorticoid-induced cell death. Five stably transfected cell lines of WEHI 7.1 cells expressing either wild-type Bcl-2 or alanine mutants of Bcl-2 at amino acids threonine 56, serine 70, threonine 74, or serine 87 were created. Expression of the mutant Bcl-2 proteins was documented by flow cytometry and Western blot analysis. Mutation of Bcl-2 on T56 and S87 eliminated the ability of Bcl-2 to inhibit glucocorticoid-induced cell shrinkage, mitochondrial depolarization, DNA fragmentation, and cell death. Mutation of T74 only partially impaired the ability of Bcl-2 to block glucocorticoid-induced apoptosis whereas mutation of S70 in Bcl-2 did not alter its ability to block glucocorticoid-induced apoptosis.

  18. T cell priming versus T cell tolerance induced by synthetic peptides

    PubMed Central

    1995-01-01

    It is well known that synthetic peptides are able to both induce and tolerize T cells. We have examined the parameters leading either to priming or tolerance of CD8+ cytotoxic T lymphocytes (CTL) in vivo with a major histocompatibility complex class I (H-2 Db) binding peptide derived from the glycoprotein (GP aa33-41) of lymphocytic choriomeningitis virus (LCMV). By varying dose, route, and frequency of LCMV GP peptide application, we found that a single local subcutaneous injection of 50-500 micrograms peptide emulsified in incomplete Freund's adjuvant protected mice against LCMV infection, whereas repetitive and systemic intraperitoneal application of the same dose caused tolerance of LCMV-specific CTL. The peptide-induced tolerance was transient in euthymic mice but permanent in thymectomized mice. These findings are relevant for a selective use of peptides as a therapeutic approach: peptide-induced priming of T cells for vaccination and peptide-mediated T cell tolerance for intervention in immunopathologies and autoimmune diseases. PMID:7540654

  19. Toxoplasma gondii-infected natural killer cells display a hypermotility phenotype in vivo.

    PubMed

    Ueno, Norikiyo; Lodoen, Melissa B; Hickey, Graeme L; Robey, Ellen A; Coombes, Janine L

    2015-01-01

    Toxoplasma gondii is a highly prevalent intracellular protozoan parasite that causes severe disease in congenitally infected or immunocompromised hosts. T. gondii is capable of invading immune cells and it has been suggested that the parasite harnesses the migratory pathways of these cells to spread through the body. Although in vitro evidence suggests that the parasite further enhances its spread by inducing a hypermotility phenotype in parasitized immune cells, in vivo evidence for this phenomenon is scarce. Here we use a physiologically relevant oral model of T. gondii infection, in conjunction with two-photon laser scanning microscopy, to address this issue. We found that a small proportion of natural killer (NK) cells in mesenteric lymph nodes contained parasites. Compared with uninfected 'bystander' NK cells, these infected NK cells showed faster, more directed and more persistent migratory behavior. Consistent with this, infected NK cells showed impaired spreading and clustering of the integrin, LFA-1, when exposed to plated ligands. Our results provide the first evidence for a hypermigratory phenotype in T. gondii-infected NK cells in vivo, providing an anatomical context for understanding how the parasite manipulates immune cell motility to spread through the host.

  20. Curcumin induces apoptotic cell death of activated human CD4+ T cells via increasing endoplasmic reticulum stress and mitochondrial dysfunction.

    PubMed

    Zheng, Min; Zhang, Qinggao; Joe, Yeonsoo; Lee, Bong Hee; Ryu, Do Gon; Kwon, Kang Beom; Ryter, Stefan W; Chung, Hun Taeg

    2013-03-01

    Curcumin, a natural polyphenolic antioxidant compound, exerts well-known anti-inflammatory and immunomodulatory effects, the latter which can influence the activation of immune cells including T cells. Furthermore, curcumin can inhibit the expression of pro-inflammatory cytokines and chemokines, through suppression of the NF-κB signaling pathway. The beneficial effects of curcumin in diseases such as arthritis, allergy, asthma, atherosclerosis, diabetes and cancer may be due to its immunomodulatory properties. We studied the potential of curcumin to modulate CD4+ T cells-mediated autoimmune disease, by examining the effects of this compound on human CD4+ lymphocyte activation. Stimulation of human T cells with PHA or CD3/CD28 induced IL-2 mRNA expression and activated the endoplasmic reticulum (ER) stress response. The treatment of T cells with curcumin induced the unfolded protein response (UPR) signaling pathway, initiated by the phosphorylation of PERK and IRE1. Furthermore, curcumin increased the expression of the ER stress associated transcriptional factors XBP-1, cleaved p50ATF6α and C/EBP homologous protein (CHOP) in human CD4+ and Jurkat T cells. In PHA-activated T cells, curcumin further enhanced PHA-induced CHOP expression and reduced the expression of the anti-apoptotic protein Bcl-2. Finally, curcumin treatment induced apoptotic cell death in activated T cells via eliciting an excessive ER stress response, which was reversed by the ER-stress inhibitor 4-phenylbutyric acid or transfection with CHOP-specific siRNA. These results suggest that curcumin can impact both ER stress and mitochondria functional pathways, and thereby could be used as a promising therapy in the context of Th1-mediated autoimmune diseases. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Inhibition of N-acetylglucosaminyltransferase V enhances the cetuximab-induced radiosensitivity of nasopharyngeal carcinoma cells likely through EGFR N-glycan alterations.

    PubMed

    Huang, Xiaomin; Liu, Ting; Wang, Qiongyao; Zhu, Weiliang; Meng, Hui; Guo, Linlang; Wei, Ting; Zhang, Jian

    2017-05-23

    N-acetylglucosaminyltransferase V (GnT-V), an enzyme that catalyses the formation of the N-linked β-1-6 branching of oligosaccharides, is related to the radiosensitivity of nasopharyngeal carcinoma (NPC). Cetuximab (C225) is an epidermal growth factor receptor (EGFR) inhibitor used as a radiosensitizer in the treatment of NPC. In this study, we used GnT-V as a molecular target to further sensitize cetuximab-treated NPC cells to radiation. The results from two NPC cell lines (CNE1 and CNE2) revealed that the silencing of GnT-V enhanced cetuximab-induced radiosensitivity by decreasing the β-1-6 branching of oligosaccharides on the EGFR. GnT-V down-regulation combined with cetuximab decreased the survival fraction, healing rate and cell viability and increased the apoptosis rate. Concomitantly, the combination of cetuximab and irradiation did not change the EGFR mRNA and protein levels and decreased the β-1-6 branching on the EGFR. Subsequently, we further explored the signalling downstream of EGF, particularly the PI3K/Akt signalling pathway, and discovered that treatment consisting of GnT-V down-regulation, irradiation and cetuximab was negatively correlated with phospho-Akt and phspho-PI3K. Finally, an in vivo experiment with radiotherapy revealed that the combination of GnT-V down-regulation and cetuximab decelerated tumour growth. In summary, our study demonstrated that the combination of decreased GnT-V activity and cetuximab enhanced NPC radiosensitivity, and the possible mechanism underlying this effect might involve the N-linked β1-6 branching of the EGFR. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  2. Excimer laser: a module of the alopecia areata common protocol.

    PubMed

    McMichael, Amy J

    2013-12-01

    Alopecia areata (AA) is an autoimmune condition characterized by T cell-mediated attack of the hair follicle. The inciting antigenic stimulus is unknown. A dense perbulbar lymphocytic infiltrate and reproducible immunologic abnormalities are hallmark features of the condition. The cellular infiltrate primarily consists of activated T lymphocytes and antigen-presenting Langerhans cells. The xenon chloride excimer laser emits its total energy at the wavelength of 308 nm and therefore is regarded as a "super-narrowband" UVB light source. Excimer laser treatment is highly effective in psoriasis, another T cell-mediated disorder that shares many immunologic features with AA. The excimer laser is superior in inducing T cell apoptosis in vitro compared with narrowband UVB, with paralleled improved clinical efficacy. The excimer laser has been used successfully in patients with AA. In this context, evaluation of the potential benefit of 308-nm excimer laser therapy in the treatment of AA is clinically warranted. Herein, the use of a common treatment protocol with a specifically designed module to study the outcome of excimer laser treatment on moderate-to-severe scalp AA in adults is described.

  3. Protein structure shapes immunodominance in the CD4 T cell response to yellow fever vaccination.

    PubMed

    Koblischke, Maximilian; Mackroth, Maria S; Schwaiger, Julia; Fae, Ingrid; Fischer, Gottfried; Stiasny, Karin; Heinz, Franz X; Aberle, Judith H

    2017-08-21

    The live attenuated yellow fever (YF) vaccine is a highly effective human vaccine and induces long-term protective neutralizing antibodies directed against the viral envelope protein E. The generation of such antibodies requires the help of CD4 T cells which recognize peptides derived from proteins in virus particles internalized and processed by E-specific B cells. The CD4 T helper cell response is restricted to few immunodominant epitopes, but the mechanisms of their selection are largely unknown. Here, we report that CD4 T cell responses elicited by the YF-17D vaccine are focused to hotspots of two helices of the viral capsid protein and to exposed strands and loops of E. We found that the locations of immunodominant epitopes within three-dimensional protein structures exhibit a high degree of overlap between YF virus and the structurally homologous flavivirus tick-borne encephalitis virus, although amino acid sequence identity of the epitope regions is only 15-45%. The restriction of epitopes to exposed E protein surfaces and their strikingly similar positioning within proteins of distantly related flaviviruses are consistent with a strong influence of protein structure that shapes CD4 T cell responses and provide leads for a rational design of immunogens for vaccination.

  4. Endothelial cell-derived microparticles induce plasmacytoid dendritic cell maturation: potential implications in inflammatory diseases.

    PubMed

    Angelot, Fanny; Seillès, Estelle; Biichlé, Sabeha; Berda, Yael; Gaugler, Béatrice; Plumas, Joel; Chaperot, Laurence; Dignat-George, Françoise; Tiberghien, Pierre; Saas, Philippe; Garnache-Ottou, Francine

    2009-11-01

    Increased circulating endothelial microparticles, resulting from vascular endothelium dysfunction, and plasmacytoid dendritic cell activation are both encountered in common inflammatory disorders. The aim of our study was to determine whether interactions between endothelial microparticles and plasmacytoid dendritic cells could contribute to such pathologies. Microparticles generated from endothelial cell lines, platelets or activated T cells were incubated with human plasmacytoid dendritic cells sorted from healthy donor blood or with monocyte-derived dendritic cells. Dendritic cell maturation was evaluated by flow cytometry, cytokine secretion as well as naive T-cell activation and polarization. Labeled microparticles were also used to study cellular interactions. Endothelial microparticles induced plasmacytoid dendritic cell maturation. In contrast, conventional dendritic cells were resistant to endothelial microparticle-induced maturation. In addition to upregulation of co-stimulatory molecules, endothelial microparticle-matured plasmacytoid dendritic cells secreted inflammatory cytokines (interleukins 6 and 8, but no interferon-alpha) and also induced allogeneic naive CD4(+) T cells to proliferate and to produce type 1 cytokines such as interferon-gamma and tumor necrosis factor-alpha. Endothelial microparticle endocytosis by plasmacytoid dendritic cells appeared to be required for plasmacytoid dendritic cell maturation. Importantly, the ability of endothelial microparticles to induce plasmacytoid dendritic cells to mature was specific as microparticles derived from activated T cells or platelets (the major source of circulating microparticules in healthy subjects) did not induce such plasmacytoid dendritic cell maturation. Our data show that endothelial microparticles specifically induce plasmacytoid dendritic cell maturation and production of inflammatory cytokines. This novel activation pathway may be implicated in various inflammatory disorders and endothelial microparticles could be an important immunmodulatory therapeutic target.

  5. Regulation of T Cell Differentiation and Alloimmunity by the Cyclin-Dependent Kinase Inhibitor p18ink4c

    PubMed Central

    Rowell, Emily A.; Wang, Liqing; Chunder, Neelanjana; Hancock, Wayne W.; Wells, Andrew D.

    2014-01-01

    Cellular proliferation in response to mitogenic stimuli is negatively regulated by the Cip/Kip and the Ink4 families of cyclin-dependent kinase (CDK) inhibitors. Several of these proteins are elevated in anergic T cells, suggesting a potential role in the induction or maintenance of tolerance. Our previous studies showed that p27kip1 is required for the induction of T cell anergy and transplantation tolerance by costimulatory blockade, but a role for Ink4 proteins in these processes has not been established. Here we show that CD4+ T cells from mice genetically deficient for p18ink4c divide more rapidly than wild-type cells in response to antigenic, costimulatory and growth factor signals. However, this gain of proliferative function was accompanied by a moderate increase in the rate of cell death, and was accompanied by an overall defect in the generation of alloreactive IFNγ-producing effector cells. Consistent with this, p18ink4c-deficient T cells were unable to induce graft-vs-host disease in vivo, and p18ink4c deficiency cooperated with costimulatory blockade to significantly increase the survival of fully mismatched allografts in a cardiac transplantation model. While both p18ink4c and p27kip1 act to restrict T cell proliferation, p18ink4c exerts an opposite effect from p27kip1 on alloimmunity and organ transplant rejection, most likely by sustaining T cell survival and the development of effector function. Our studies point to additional important links between the cell cycle machinery and the processes of T cell differentiation, survival and tolerance. PMID:24614758

  6. Weakly self-reactive T-cell clones can homeostatically expand when present at low numbers.

    PubMed

    Vrisekoop, Nienke; Artusa, Patricio; Monteiro, Joao P; Mandl, Judith N

    2017-01-01

    T-cell division is central to maintaining a stable T-cell pool in adults. It also enables T-cell expansion in neonates, and after depletion by chemotherapy, bone marrow transplantation, or infection. The same signals required for T-cell survival in lymphoreplete settings, IL-7 and T-cell receptor (TCR) interactions with self-peptide MHC (pMHC), induce division when T-cell numbers are low. The strength of reactivity for self-pMHC has been shown to correlate with the capacity of T cells to undergo lymphopenia-induced proliferation (LIP), in that weakly self-reactive T cells are unable to divide, implying that T-cell reconstitution would significantly skew the TCR repertoire toward TCRs with greater self-reactivity and thus compromise T-cell diversity. Here, we show that while CD4 + T cells with low self-pMHC reactivity experience more intense competition, they are able to divide when present at low enough cell numbers. Thus, at physiological precursor frequencies CD4 + T cells with low self-pMHC reactivity are able to contribute to the reconstitution of the T-cell pool. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Bacopa monnieri-Induced Protective Autophagy Inhibits Benzo[a]pyrene-Mediated Apoptosis.

    PubMed

    Das, Durgesh Nandini; Naik, Prajna Paramita; Nayak, Aditi; Panda, Prashanta Kumar; Mukhopadhyay, Subhadip; Sinha, Niharika; Bhutia, Sujit K

    2016-11-01

    Benzo[a]pyrene (B[a]P) is capable of inducing oxidative stress and cellular injuries leading to cell death and associates with a significant risk of cancer development. Prevention of B[a]P-induced cellular toxicity with herbal compound through regulation of mitochondrial oxidative stress might protect cell death and have therapeutic benefit to human health. In this study, we demonstrated the cytoprotective role of Bacopa monnieri (BM) against B[a]P-induced apoptosis through autophagy induction. Pretreatment with BM rescued the reduction in cell viability in B[a]P-treated human keratinocytes (HaCaT) cells indicating the cytoprotective potential of BM against B[a]P. Moreover, BM was found to inhibit B[a]P-mediated reactive oxygen species (ROS)-induced apoptosis activation in HaCaT cells. Furthermore, BM was found to preserve mitochondrial membrane potential and inhibited release of cytochrome c in B[a]P-treated HaCaT cells. Bacopa monnieri induced protective autophagy; we knocked down Beclin-1, and data showed that BM was unable to protect from B[a]P-induced mitochondrial ROS-mediated apoptosis in Beclin-1-deficient HaCaT cells. Moreover, we established that B[a]P-induced damaged mitochondria were found to colocalize and degraded within autolysosomes in order to protect HaCaT cells from mitochondrial injury. In conclusion, B[a]P-induced apoptosis was rescued by BM treatment and provided cytoprotection through Beclin-1-dependent autophagy activation. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  8. 6-gingerol inhibits rosiglitazone-induced adipogenesis in 3T3-L1 adipocytes.

    PubMed

    Tzeng, Thing-Fong; Chang, Chia Ju; Liu, I-Min

    2014-02-01

    We investigated the effects of 6-gingerol ((S)-5-hydroxy-1-(4-hydroxy-3-methoxyphenyl)-3-decanone) on the inhibition of rosiglitazone (RGZ)-induced adipogenesis in 3T3-L1 cells. The morphological changes were photographed based on staining lipid accumulation by Oil-Red O in RGZ (1 µmol/l)-treated 3T3-L1 cells without or with various concentrations of 6-gingerol on differentiation day 8. Quantitation of triglycerides content was performed in cells on day 8 after differentiation induction. Differentiated cells were lysed to detect mRNA and protein levels of adipocyte-specific transcription factors by real-time reverse transcription-polymerase chain reaction and Western blot analysis, respectively. 6-gingerol (50 µmol/l) effectively suppressed oil droplet accumulation and reduced the sizes of the droplets in RGZ-induced adipocyte differentiation in 3T3-L1 cells. The triglyceride accumulation induced by RGZ in differentiated 3T3-L1 cells was also reduced by 6-gingerol (50 µmol/l). Treatment of differentiated 3T3-L1 cells with 6-gingerol (50 µmol/l) antagonized RGZ-induced gene expression of peroxisome proliferator-activated receptor (PPAR)γ and CCAAT/enhancer-binding protein α. Additionally, the increased levels of mRNA and protein in adipocyte-specific fatty acid binding protein 4 and fatty acid synthase induced by RGZ in 3T3-L1 cells were decreased upon treatment with 6-gingerol. Our data suggests that 6-gingerol may be beneficial in obesity, by reducing adipogenesis partly through the down-regulating PPARγ activity. Copyright © 2013 John Wiley & Sons, Ltd.

  9. Human CD3+ T-Cells with the Anti-ERBB2 Chimeric Antigen Receptor Exhibit Efficient Targeting and Induce Apoptosis in ERBB2 Overexpressing Breast Cancer Cells

    PubMed Central

    Munisvaradass, Rusheni; Kumar, Suresh; Govindasamy, Chandramohan; Alnumair, Khalid S.; Mok, Pooi Ling

    2017-01-01

    Breast cancer is a common malignancy among women. The innate and adaptive immune responses failed to be activated owing to immune modulation in the tumour microenvironment. Decades of scientific study links the overexpression of human epidermal growth factor receptor 2 (ERBB2) antigen with aggressive tumours. The Chimeric Antigen Receptor (CAR) coding for specific tumour-associated antigens could initiate intrinsic T-cell signalling, inducing T-cell activation, and cytotoxic activity without the need for major histocompatibility complex recognition. This renders CAR as a potentially universal immunotherapeutic option. Herein, we aimed to establish CAR in CD3+ T-cells, isolated from human peripheral blood mononucleated cells that could subsequently target and induce apoptosis in the ERBB2 overexpressing human breast cancer cell line, SKBR3. Constructed CAR was inserted into a lentiviral plasmid containing a green fluorescent protein tag and produced as lentiviral particles that were used to transduce activated T-cells. Transduced CAR-T cells were then primed with SKBR3 cells to evaluate their functionality. Results showed increased apoptosis in SKBR3 cells co-cultured with CAR-T cells compared to the control (non–transduced T-cells). This study demonstrates that CAR introduction helps overcome the innate limitations of native T-cells leading to cancer cell apoptosis. We recommend future studies should focus on in vivo cytotoxicity of CAR-T cells against ERBB2 expressing tumours. PMID:28885562

  10. Human CD3+ T-Cells with the Anti-ERBB2 Chimeric Antigen Receptor Exhibit Efficient Targeting and Induce Apoptosis in ERBB2 Overexpressing Breast Cancer Cells.

    PubMed

    Munisvaradass, Rusheni; Kumar, Suresh; Govindasamy, Chandramohan; Alnumair, Khalid S; Mok, Pooi Ling

    2017-09-08

    Breast cancer is a common malignancy among women. The innate and adaptive immune responses failed to be activated owing to immune modulation in the tumour microenvironment. Decades of scientific study links the overexpression of human epidermal growth factor receptor 2 (ERBB2) antigen with aggressive tumours. The Chimeric Antigen Receptor (CAR) coding for specific tumour-associated antigens could initiate intrinsic T-cell signalling, inducing T-cell activation, and cytotoxic activity without the need for major histocompatibility complex recognition. This renders CAR as a potentially universal immunotherapeutic option. Herein, we aimed to establish CAR in CD3+ T-cells, isolated from human peripheral blood mononucleated cells that could subsequently target and induce apoptosis in the ERBB2 overexpressing human breast cancer cell line, SKBR3. Constructed CAR was inserted into a lentiviral plasmid containing a green fluorescent protein tag and produced as lentiviral particles that were used to transduce activated T-cells. Transduced CAR-T cells were then primed with SKBR3 cells to evaluate their functionality. Results showed increased apoptosis in SKBR3 cells co-cultured with CAR-T cells compared to the control (non-transduced T-cells). This study demonstrates that CAR introduction helps overcome the innate limitations of native T-cells leading to cancer cell apoptosis. We recommend future studies should focus on in vivo cytotoxicity of CAR-T cells against ERBB2 expressing tumours.

  11. Two distinct populations of bovine IL-17⁺ T-cells can be induced and WC1⁺IL-17⁺γδ T-cells are effective killers of protozoan parasites.

    PubMed

    Peckham, R K; Brill, R; Foster, D S; Bowen, A L; Leigh, J A; Coffey, T J; Flynn, R J

    2014-06-25

    IL-17 has emerged as a key player in the immune system, exhibiting roles in protection from infectious diseases and promoting inflammation in autoimmunity. Initially thought to be CD4 T-cell-derived, the sources of IL-17 are now known to be varied and belong to both the innate and adaptive arms of the immune system. Mechanisms for inducing IL-17 production in lymphoid cells are thought to rely on appropriate antigenic stimulation in the context of TGF-β1, IL-6 and/or IL-1β. Using culture protocols adapted from human studies, we have effectively induced both bovine CD4(+) and WC1(+) γδ T-cells to produce IL-17 termed Th17 and γδ17 cells, respectively. The negative regulatory effect of IFN-γ on mouse and human IL-17 production can be extended to the bovine model, as addition of IFN-γ decreases IL-17 production in both cell types. Furthermore we show that infection with the protozoan Neospora caninum will induce fibroblasts to secrete pro-IL-17 factors thereby inducing a γδ17 phenotype that preferentially kills infected target cells. Our study identifies two T-cell sources of IL-17, and is the first to demonstrate a protective effect of IL-17(+) T-cells in ruminants. Our findings offer further opportunities for future adjuvants or vaccines which could benefit from inducing these responses.

  12. Cross-talk between T Cells and Hematopoietic Stem Cells during Adoptive Cellular Therapy for Malignant Glioma.

    PubMed

    Wildes, Tyler J; Grippin, Adam; Dyson, Kyle A; Wummer, Brandon M; Damiani, David J; Abraham, Rebecca S; Flores, Catherine T; Mitchell, Duane A

    2018-04-30

    Purpose: Adoptive T-cell immunotherapy (ACT) has emerged as a viable therapeutic for peripheral and central nervous system (CNS) tumors. In peripheral cancers, optimal efficacy of ACT is reliant on dendritic cells (DCs) in the tumor microenvironment. However, the CNS is largely devoid of resident migratory DCs to function as antigen-presenting cells during immunotherapy. Herein, we demonstrate that cellular interactions between adoptively transferred tumor-reactive T cells and bone marrow-derived hematopoietic stem and progenitor cells (HSPCs) lead to the generation of potent intratumoral DCs within the CNS compartment. Experimental Design: We evaluated HSPC differentiation during ACT in vivo in glioma-bearing hosts and HSPC proliferation and differentiation in vitro using a T-cell coculture system. We utilized FACS, ELISAs, and gene expression profiling to study the phenotype and function of HSPC-derived cells ex vivo and in vivo. To demonstrate the impact of HSPC differentiation and function on antitumor efficacy, we performed survival experiments. Results: Transfer of HSPCs with concomitant ACT led to the production of activated CD86 + CD11c + MHCII + cells consistent with DC phenotype and function within the brain tumor microenvironment. These intratumoral DCs largely supplanted abundant host myeloid-derived suppressor cells. We determined that during ACT, HSPC-derived cells in gliomas rely on T-cell-released IFNγ to differentiate into DCs, activate T cells, and reject intracranial tumors. Conclusions: Our data support the use of HSPCs as a novel cellular therapy. Although DC vaccines induce robust immune responses in the periphery, our data demonstrate that HSPC transfer uniquely generates intratumoral DCs that potentiate T-cell responses and promote glioma rejection in situ Clin Cancer Res; 1-12. ©2018 AACR. ©2018 American Association for Cancer Research.

  13. Reishi Protein LZ-8 Induces FOXP3+ Treg Expansion via a CD45-Dependent Signaling Pathway and Alleviates Acute Intestinal Inflammation in Mice

    PubMed Central

    Hsu, Hsien-Yeh; Kuan, Yen-Chou; Lin, Tung-Yi; Tsao, Shu-Ming; Hsu, Jason; Ma, Li-Juan; Sheu, Fuu

    2013-01-01

    LZ-8, an immunomodulatory protein isolated from Ganoderma lucidum (also known as Ling-Zhi or Reishi), has been shown to promote cell proliferation and IL-2 production in T cells. In this study, we show that LZ-8 induces the expansion of both murine and human CD4+ T cells into FOXP3+ regulatory T (Treg) cells. LZ-8 treatment was found to stimulate a 4-fold and a 10-fold expansion in the Treg populations of murine and human primary CD4+ T cells, respectively. In addition, the expression of CTLA-4 and IL-10 was induced in LZ-8-treated CD4+ T cells. Using neutralizing antibodies and gene-deficient T-cell lines, we also found that LZ-8 promotes Treg expansion through a CD45-mediated signaling pathway and that the CD18-dependent induction of IL-2 was involved in Treg formation and IL-10 production. The suppressive activity of LZ-8 was confirmed using a murine model of DSS-induced colitis; the disease was alleviated by the adoptive transfer of LZ-8-treated CD4+ T cells. In conclusion, a new regulatory function for LZ-8 was identified, and the molecular mechanisms underlying this function were elucidated. PMID:23864893

  14. Cellular and Molecular Players in Adipose Tissue Inflammation in the Development of Obesity-induced Insulin Resistance

    PubMed Central

    Lee, Byung-Cheol; Lee, Jongsoon

    2013-01-01

    There is increasing evidence showing that inflammation is an important pathogenic mediator of the development of obesity-induced insulin resistance. It is now generally accepted that tissue-resident immune cells play a major role in the regulation of this obesity-induced inflammation. The roles that adipose tissue (AT)-resident immune cells play have been particularly extensively studied. AT contains most types of immune cells and obesity increases their numbers and activation levels, particularly in AT macrophages (ATMs). Other pro-inflammatory cells found in AT include neutrophils, Th1 CD4 T cells, CD8 T cells, B cells, DCs, and mast cells. However, AT also contains anti-inflammatory cells that counter the pro-inflammatory immune cells that are responsible for the obesity-induced inflammation in this tissue. These anti-inflammatory cells include regulatory CD4 T cells (Tregs), Th2 CD4 T cells, and eosinophils. Hence, AT inflammation is shaped by the regulation of pro- and anti-inflammatory immune cell homeostasis, and obesity skews this balance towards a more pro-inflammatory status. Recent genetic studies revealed several molecules that participate in the development of obesity-induced inflammation and insulin resistance. In this review, the cellular and molecular players that participate in the regulation of obesity-induced inflammation and insulin resistance are discussed, with particular attention being placed on the roles of the cellular players in these pathogeneses. PMID:23707515

  15. Modulation of ceramide metabolism in T-leukemia cell lines potentiates apoptosis induced by the cationic antimicrobial peptide bovine lactoferricin.

    PubMed

    Furlong, Suzanne J; Ridgway, Neale D; Hoskin, David W

    2008-03-01

    Bovine lactoferricin (LfcinB) is a cationic antimicrobial peptide that selectively induces apoptosis in several different types of human cancer cells. However, the potential use of LfcinB as an anticancer agent is presently limited by the need for relatively high concentrations of the peptide to trigger apoptosis. Ceramide is a membrane sphingolipid that is believed to function as a second messenger during apoptosis. In this study, we investigated the role of ceramide in LfcinB-induced apoptosis in CCRF-CEM and Jurkat T-leukemia cell lines. Exposure to LfcinB caused nuclear condensation and fragmentation, poly(ADP-ribose) polymerase (PARP) cleavage, and DNA fragmentation in CCRF-CEM and Jurkat T-cell acute lymphoblastic leukemia cell lines. Treatment with C6 ceramide, a cell-permeable, short-chain ceramide analog, also induced apoptotic nuclear morphology, PARP cleavage, and DNA fragmentation in T-leukemia cells. Although LfcinB treatment did not cause ceramide to accumulate in CCRF-CEM or Jurkat cells, the addition of C6 ceramide to LfcinB-treated T-leukemia cells resulted in increased DNA fragmentation. Furthermore, modulation of cellular ceramide metabolism either by inhibiting ceramidases with D-erythro-2-(N-myristoylamino)-1-phenyl-1-propanol or N-oleoylethanolamine, or by blocking glucosylceramide synthase activity with 1-phenyl-2-palmitoylamino-3-morpholino-1-propanol, enhanced the ability of LfcinB to trigger apoptosis in both Jurkat and CCRF-CEM cells. In addition, LfcinB-induced apoptosis of T-leukemia cells was enhanced in the presence of the antiestrogen tamoxifen, which has multiple effects on cancer cells, including inhibition of glucosylceramide synthase activity. We conclude that manipulation of cellular ceramide levels in combination with LfcinB therapy warrants further investigation as a novel strategy for the treatment of T cell-derived leukemias.

  16. Pathogen Proliferation Governs the Magnitude but Compromises the Function of CD8 T Cells1

    PubMed Central

    Sad, Subash; Dudani, Renu; Gurnani, Komal; Russell, Marsha; van Faassen, Henk; Finlay, Brett; Krishnan, Lakshmi

    2014-01-01

    CD8+ T cell memory is critical for protection against many intracellular pathogens. However, it is not clear how pathogen virulence influences the development and function of CD8+ T cells. Salmonella typhimurium (ST) is an intracellular bacterium that causes rapid fatality in susceptible mice and chronic infection in resistant strains. We have constructed recombinant mutants of ST, expressing the same immunodominant Ag OVA, but defective in various key virulence genes. We show that the magnitude of CD8+ T cell response correlates directly to the intracellular proliferation of ST. Wild-type ST displayed efficient intracellular proliferation and induced increased numbers of OVA-specific CD8+ T cells upon infection in mice. In contrast, mutants with defective Salmonella pathogenicity island II genes displayed poor intracellular proliferation and induced reduced numbers of OVA-specific CD8+ T cells. However, when functionality of the CD8+ T cell response was measured, mutants of ST induced a more functional response compared with the wild-type ST. Infection with wild-type ST, in contrast to mutants defective in pathogenicity island II genes, induced the generation of mainly effector-memory CD8+ T cells that expressed little IL-2, failed to mediate efficient cytotoxicity, and proliferated poorly in response to Ag challenge in vivo. Taken together, these results indicate that pathogens that proliferate rapidly and chronically in vivo may evoke functionally inferior memory CD8+ T cells which may promote the survival of the pathogen. PMID:18424704

  17. GARP: a key receptor controlling FOXP3 in human regulatory T cells.

    PubMed

    Probst-Kepper, M; Geffers, R; Kröger, A; Viegas, N; Erck, C; Hecht, H-J; Lünsdorf, H; Roubin, R; Moharregh-Khiabani, D; Wagner, K; Ocklenburg, F; Jeron, A; Garritsen, H; Arstila, T P; Kekäläinen, E; Balling, R; Hauser, H; Buer, J; Weiss, S

    2009-09-01

    Recent evidence suggests that regulatory pathways might control sustained high levels of FOXP3 in regulatory CD4(+)CD25(hi) T (T(reg)) cells. Based on transcriptional profiling of ex vivo activated T(reg) and helper CD4(+)CD25(-) T (T(h)) cells we have identified GARP (glycoprotein-A repetitions predominant), LGALS3 (lectin, galactoside-binding, soluble, 3) and LGMN (legumain) as novel genes implicated in human T(reg) cell function, which are induced upon T-cell receptor stimulation. Retroviral overexpression of GARP in antigen-specific T(h) cells leads to an efficient and stable re-programming of an effector T cell towards a regulatory T cell, which involves up-regulation of FOXP3, LGALS3, LGMN and other T(reg)-associated markers. In contrast, overexpression of LGALS3 and LGMN enhance FOXP3 and GARP expression, but only partially induced a regulatory phenotype. Lentiviral down-regulation of GARP in T(reg) cells significantly impaired the suppressor function and was associated with down-regulation of FOXP3. Moreover, down-regulation of FOXP3 resulted in similar phenotypic changes and down-regulation of GARP. This provides compelling evidence for a GARP-FOXP3 positive feedback loop and provides a rational molecular basis for the known difference between natural and transforming growth factor-beta induced T(reg) cells as we show here that the latter do not up-regulate GARP. In summary, we have identified GARP as a key receptor controlling FOXP3 in T(reg) cells following T-cell activation in a positive feedback loop assisted by LGALS3 and LGMN, which represents a promising new system for the therapeutic manipulation of T cells in human disease.

  18. CD8+ T Cells Contribute to the Development of Coronary Arteritis in the Lactobacillus casei Cell Wall Extract-Induced Murine Model of Kawasaki Disease.

    PubMed

    Noval Rivas, Magali; Lee, Youngho; Wakita, Daiko; Chiba, Norika; Dagvadorj, Jargalsaikhan; Shimada, Kenichi; Chen, Shuang; Fishbein, Michael C; Lehman, Thomas J A; Crother, Timothy R; Arditi, Moshe

    2017-02-01

    Kawasaki disease (KD) is the leading cause of acquired heart disease among children in developed countries. Coronary lesions in KD in humans are characterized by an increased presence of infiltrating CD3+ T cells; however, the specific contributions of the different T cell subpopulations in coronary arteritis development remain unknown. Therefore, we sought to investigate the function of CD4+ and CD8+ T cells, Treg cells, and natural killer (NK) T cells in the pathogenesis of KD. We addressed the function of T cell subsets in KD development by using a well-established murine model of Lactobacillus casei cell wall extract (LCWE)-induced KD vasculitis. We determined which T cell subsets were required for development of KD vasculitis by using several knockout murine strains and depleting monoclonal antibodies. LCWE-injected mice developed coronary lesions characterized by the presence of inflammatory cell infiltrates. Frequently, this chronic inflammation resulted in complete occlusion of the coronary arteries due to luminal myofibroblast proliferation (LMP) as well as the development of coronary arteritis and aortitis. We found that CD8+ T cells, but not CD4+ T cells, NK T cells, or Treg cells, were required for development of KD vasculitis. The LCWE-induced murine model of KD vasculitis mimics many histologic features of the disease in humans, such as the presence of CD8+ T cells and LMP in coronary artery lesions as well as epicardial coronary arteritis. Moreover, CD8+ T cells functionally contribute to the development of KD vasculitis in this murine model. Therapeutic strategies targeting infiltrating CD8+ T cells might be useful in the management of KD in humans. © 2016, American College of Rheumatology.

  19. Identification of a regulatory T cell specific cell surface molecule that mediates suppressive signals and induces Foxp3 expression.

    PubMed

    Wang, Rui; Wan, Qi; Kozhaya, Lina; Fujii, Hodaka; Unutmaz, Derya

    2008-07-16

    Regulatory T (T(reg)) cells control immune activation and maintain tolerance. How T(regs) mediate their suppressive function is unclear. Here we identified a cell surface molecule, called GARP, (or LRRC32), which within T cells is specifically expressed in T(regs) activated through the T cell receptor (TCR). Ectopic expression of GARP in human naïve T (T(N)) cells inhibited their proliferation and cytokine secretion upon TCR activation. Remarkably, GARP over-expression in T(N) cells induced expression of T(reg) master transcription factor Foxp3 and endowed them with a partial suppressive function. The extracellular but not the cytoplasmic region of GARP, was necessary for these functions. Silencing Foxp3 in human T(reg) cells reduced expression of GARP and attenuated their suppressive function. However, GARP function was not affected when Foxp3 was downregulated in GARP-overexpressing cells, while silencing GARP in Foxp3-overexpressing cells reduced their suppressive activity. These findings reveal a novel cell surface molecule-mediated regulatory mechanism, with implications for modulating aberrant immune responses.

  20. Protective CD8 Memory T Cell Responses to Mouse Melanoma Are Generated in the Absence of CD4 T Cell Help

    PubMed Central

    Steinberg, Shannon M.; Zhang, Peisheng; Turk, Mary Jo

    2011-01-01

    Background We have previously demonstrated that temporary depletion of CD4 T cells in mice with progressive B16 melanoma, followed by surgical tumor excision, induces protective memory CD8 T cell responses to melanoma/melanocyte antigens. We also showed that persistence of these CD8 T cells is supported, in an antigen-dependent fashion, by concurrent autoimmune melanocyte destruction. Herein we explore the requirement of CD4 T cell help in priming and maintaining this protective CD8 T cell response to melanoma. Methodology and Principal Findings To induce melanoma/melanocyte antigen-specific CD8 T cells, B16 tumor bearing mice were depleted of regulatory T cells (Treg) by either temporary, or long-term continuous treatment with anti-CD4 (mAb clone GK1.5). Total depletion of CD4 T cells led to significant priming of IFN-γ-producing CD8 T cell responses to TRP-2 and gp100. Surprisingly, treatment with anti-CD25 (mAb clone PC61), to specifically deplete Treg cells while leaving help intact, was ineffective at priming CD8 T cells. Thirty to sixty days after primary tumors were surgically excised, mice completely lacking CD4 T cell help developed autoimmune vitiligo, and maintained antigen-specific memory CD8 T cell responses that were highly effective at producing cytokines (IFN-γ, TNF-α, and IL-2). Mice lacking total CD4 T cell help also mounted protection against re-challenge with B16 melanoma sixty days after primary tumor excision. Conclusions and Significance This work establishes that CD4 T cell help is dispensable for the generation of protective memory T cell responses to melanoma. Our findings support further use of CD4 T cell depletion therapy for inducing long-lived immunity to cancer. PMID:22046294

  1. Osteoblast-Secreted Factors Mediate Dormancy of Metastatic Prostate Cancer in the Bone via Activation of the TGFβRIII-p38MAPK-pS249/T252RB Pathway.

    PubMed

    Yu-Lee, Li-Yuan; Yu, Guoyu; Lee, Yu-Chen; Lin, Song-Chang; Pan, Jing; Pan, Tianhong; Yu, Kai-Jie; Liu, Bin; Creighton, Chad J; Rodriguez-Canales, Jaime; Villalobos, Pamela A; Wistuba, Ignacio I; de Nadal, Eulalia; Posas, Francesc; Gallick, Gary E; Lin, Sue-Hwa

    2018-06-01

    Bone metastasis from prostate cancer can occur years after prostatectomy, due to reactivation of dormant disseminated tumor cells (DTC) in the bone, yet the mechanism by which DTCs are initially induced into a dormant state in the bone remains to be elucidated. We show here that the bone microenvironment confers dormancy to C4-2B4 prostate cancer cells, as they become dormant when injected into mouse femurs but not under the skin. Live-cell imaging of dormant cells at the single-cell level revealed that conditioned medium from differentiated, but not undifferentiated, osteoblasts induced C4-2B4 cellular quiescence, suggesting that differentiated osteoblasts present locally around the tumor cells in the bone conferred dormancy to prostate cancer cells. Gene array analyses identified GDF10 and TGFβ2 among osteoblast-secreted proteins that induced quiescence of C4-2B4, C4-2b, and PC3-mm2, but not 22RV1 or BPH-1 cells, indicating prostate cancer tumor cells differ in their dormancy response. TGFβ2 and GDF10 induced dormancy through TGFβRIII to activate phospho-p38MAPK, which phosphorylates retinoblastoma (RB) at the novel N-terminal S249/T252 sites to block prostate cancer cell proliferation. Consistently, expression of dominant-negative p38MAPK in C4-2b and C4-2B4 prostate cancer cell lines abolished tumor cell dormancy both in vitro and in vivo Lower TGFβRIII expression in patients with prostate cancer correlated with increased metastatic potential and decreased survival rates. Together, our results identify a dormancy mechanism by which DTCs are induced into a dormant state through TGFβRIII-p38MAPK-pS249/pT252-RB signaling and offer a rationale for developing strategies to prevent prostate cancer recurrence in the bone. Significance: These findings provide mechanistic insights into the dormancy of metastatic prostate cancer in the bone and offer a rationale for developing strategies to prevent prostate cancer recurrence in the bone. Cancer Res; 78(11); 2911-24. ©2018 AACR . ©2018 American Association for Cancer Research.

  2. Inflammation-induced IgA+ cells dismantle anti-liver cancer immunity

    PubMed Central

    Shalapour, Shabnam; Lin, Xue-Jia; Bastian, Ingmar N.; Brain, John; Burt, Alastair D.; Aksenov, Alexander A.; Vrbanac, Alison F.; Li, Weihua; Perkins, Andres; Matsutani, Takaji; Zhong, Zhenyu; Dhar, Debanjan; Navas-Molina, Jose A.; Xu, Jun; Loomba, Rohit; Downes, Michael; Yu, Ruth T.; Evans, Ronald M.; Dorrestein, Pieter C.; Knight, Rob; Benner, Christopher; Anstee, Quentin M.; Karin, Michael

    2018-01-01

    The role of adaptive immunity in early cancer development is controversial. Here we show that chronic inflammation and fibrosis in humans and mice with non-alcoholic fatty liver disease is accompanied by accumulation of liver-resident immunoglobulin-A-producing (IgA+) cells. These cells also express programmed death ligand 1 (PD-L1) and interleukin-10, and directly suppress liver cytotoxic CD8+ T lymphocytes, which prevent emergence of hepatocellular carcinoma and express a limited repertoire of T-cell receptors against tumour-associated antigens. Whereas CD8+ T-cell ablation accelerates hepatocellular carcinoma, genetic or pharmacological interference with IgA+ cell generation attenuates liver carcinogenesis and induces cytotoxic T-lymphocyte-mediated regression of established hepatocellular carcinoma. These findings establish the importance of inflammation-induced suppression of cytotoxic CD8+ T-lymphocyte activation as a tumour-promoting mechanism. PMID:29144460

  3. Nickel suppresses the PACAP-induced increase in guinea pig cardiac neuron excitability

    PubMed Central

    Tompkins, John D.; Merriam, Laura A.; Girard, Beatrice M.; May, Victor

    2015-01-01

    Pituitary adenylate cyclase-activating polypeptide (PACAP) is a potent intercellular signaling molecule involved in multiple homeostatic functions. PACAP/PAC1 receptor signaling increases excitability of neurons within the guinea pig cardiac ganglia, making them a unique system to establish mechanisms underlying PACAP modulation of neuronal function. Calcium influx is required for the PACAP-increased cardiac neuron excitability, although the pathway is unknown. This study tested whether PACAP enhancement of calcium influx through either T-type or R-type channels contributed to the modulation of excitability. Real-time quantitative polymerase chain reaction analyses indicated transcripts for Cav3.1, Cav3.2, and Cav3.3 T-type isoforms and R-type Cav2.3 in cardiac neurons. These neurons often exhibit a hyperpolarization-induced rebound depolarization that remains when cesium is present to block hyperpolarization-activated nonselective cationic currents (Ih). The T-type calcium channel inhibitors, nickel (Ni2+) or mibefradil, suppressed the rebound depolarization, and treatment with both drugs hyperpolarized cardiac neurons by 2–4 mV. Together, these results are consistent with the presence of functional T-type channels, potentially along with R-type channels, in these cardiac neurons. Fifty micromolar Ni2+, a concentration that suppresses currents in both T-type and R-type channels, blunted the PACAP-initiated increase in excitability. Ni2+ also blunted PACAP enhancement of the hyperpolarization-induced rebound depolarization and reversed the PACAP-mediated increase in excitability, after being initiated, in a subset of cells. Lastly, low voltage-activated currents, measured under perforated patch whole cell recording conditions and potentially flowing through T-type or R-type channels, were enhanced by PACAP. Together, our results suggest that a PACAP-enhanced, Ni2+-sensitive current contributes to PACAP-induced modulation of neuronal excitability. PMID:25810261

  4. Fluoride-induced thyroid dysfunction in rats: roles of dietary protein and calcium level.

    PubMed

    Wang, H; Yang, Z; Zhou, B; Gao, H; Yan, X; Wang, J

    2009-02-01

    To assess the roles of dietary protein (Pr) and calcium (Ca) level associated with excessive fluoride (F) intake and the impact of dietary Pr, Ca, and F on thyroid function, 144 30-day-old Wistar albino rats were randomly allotted to six groups of 24 (female:male = 1:1). The six groups were fed (1) a normal control (NC) diet (17.92% Pr, 0.85% Ca = NC group); (2) the NC diet and high F (338 mg NaF [=150 mg F ion]/L in their drinking water = NC+F group); (3) low Pr and low Ca diet (10.01% Pr, 0.24% Ca = LPrLCa group); (4) low Pr and low Ca diet plus high F = LPrLCa+F group; (5) high Pr and low Ca diet plus high F (25.52% Pr, 0.25% Ca = HPrLCa+F group); and (6) low Pr and high Ca diet plus high F (10.60% Pr, 1.93% Ca = LPrHCa+F group). The areas of thyroid follicles were determined by Image-Proplus 5.1, and triiodothyronine (T3), free T3 (FT3), thyroxine (T4), and free T4 (FT4) levels in serum were measured by radioimmunoassay. The histopathological study revealed obviously flatted follicular epithelia cells and hyperplastic nodules, consisting of thyroid parafollicular cells that appeared by excessive F ingestion, on the 120th day. Pr or Ca supplementation reverses the F-induced damage in malnutrition. The serum T3, FT3, T4, and FT4 levels in the NC+F group were significantly decreased and significantly increased in the LPrLCa+F group. Thus, excessive F administration induces thyroid dysfunction in rats; dietary Pr and Ca level play key roles in F-induced thyroid dysfunction.

  5. Comparability of automated human induced pluripotent stem cell culture: a pilot study.

    PubMed

    Archibald, Peter R T; Chandra, Amit; Thomas, Dave; Chose, Olivier; Massouridès, Emmanuelle; Laâbi, Yacine; Williams, David J

    2016-12-01

    Consistent and robust manufacturing is essential for the translation of cell therapies, and the utilisation automation throughout the manufacturing process may allow for improvements in quality control, scalability, reproducibility and economics of the process. The aim of this study was to measure and establish the comparability between alternative process steps for the culture of hiPSCs. Consequently, the effects of manual centrifugation and automated non-centrifugation process steps, performed using TAP Biosystems' CompacT SelecT automated cell culture platform, upon the culture of a human induced pluripotent stem cell (hiPSC) line (VAX001024c07) were compared. This study, has demonstrated that comparable morphologies and cell diameters were observed in hiPSCs cultured using either manual or automated process steps. However, non-centrifugation hiPSC populations exhibited greater cell yields, greater aggregate rates, increased pluripotency marker expression, and decreased differentiation marker expression compared to centrifugation hiPSCs. A trend for decreased variability in cell yield was also observed after the utilisation of the automated process step. This study also highlights the detrimental effect of the cryopreservation and thawing processes upon the growth and characteristics of hiPSC cultures, and demonstrates that automated hiPSC manufacturing protocols can be successfully transferred between independent laboratories.

  6. Aerobic physical training does not condition against strenuous exercise-induced changes in immune function but modulates T cell proliferative responses.

    PubMed

    Patiño, Pablo J; Caraballo, Domingo I; Szewczyk, Katarzyna; Quintana, Juan C; Bedoya, Lady R; Ramírez, Beatriz E; Jaramillo, Andrés

    2017-09-29

    Exercise-induced stress induces considerable changes in the immune system. To better understand the mechanisms related to these immune changes during acute and chronic physical stress, we studied the effects of aerobic physical training (APT) on several parameters of the immune system. Previously untrained males (18-25 years of age) were divided into a group that was subjected to 6 months of APT (n=10) and a sedentary control group (n=7). The subjects performed a cardiopulmonary exercise test (CET) at 0, 3, and 6 months of the APT program. B cell (CD19+), T cell (CD4+ and CD8+), and natural killer cell (CD56+) levels, and mitogen-induced T cell proliferation and cytokine production (interleukin-1, interleukin-4, interleukin-12, and interferon-) were evaluated before and at 30 seconds and 24 hours after the CET. There was a significant increase in CD4+ T cells and natural killer cells and a significant reduction in T cell proliferation in both groups 30 seconds after the CET at 3 and 6 months of the APT program. Of note, the trained group showed significantly lower resting T cell proliferation (before and 24 hour after the CET) than the sedentary control group at 3 and 6 months of the APT program. There were no significant differences in cytokine production after the CET between both groups at any time point of the APT program. These data show that APT does not condition against strenuous exercise induced immune changes but significantly modulates T cell proliferative responses.

  7. SLP-76 sterile α motif (SAM) and individual H5 α helix mediate oligomer formation for microclusters and T-cell activation.

    PubMed

    Liu, Hebin; Thaker, Youg Raj; Stagg, Loren; Schneider, Helga; Ladbury, John E; Rudd, Christopher E

    2013-10-11

    Despite the importance of the immune adaptor SLP-76 in T-cell immunity, it has been unclear whether SLP-76 directly self-associates to form higher order oligomers for T-cell activation. In this study, we show that SLP-76 self-associates in response to T-cell receptor ligation as mediated by the N-terminal sterile α motif (SAM) domain. SLP-76 co-precipitated alternately tagged SLP-76 in response to anti-CD3 ligation. Dynamic light scattering and fluorescent microscale thermophoresis of the isolated SAM domain (residues 1-78) revealed evidence of dimers and tetramers. Consistently, deletion of the SAM region eliminated SLP-76 co-precipitation of itself, concurrent with a loss of microcluster formation, nuclear factor of activated T-cells (NFAT) transcription, and interleukin-2 production in Jurkat or primary T-cells. Furthermore, the H5 α helix within the SAM domain contributed to self-association. Retention of H5 in the absence of H1-4 sufficed to support SLP-76 self-association with smaller microclusters that nevertheless enhanced anti-CD3-driven AP1/NFAT transcription and IL-2 production. By contrast, deletion of the H5 α helix impaired self-association and anti-CD3 induced AP1/NFAT transcription. Our data identified for the first time a role for the SAM domain in mediating SLP-76 self-association for T-cell function.

  8. SLP-76 Sterile α Motif (SAM) and Individual H5 α Helix Mediate Oligomer Formation for Microclusters and T-cell Activation*

    PubMed Central

    Liu, Hebin; Thaker, Youg Raj; Stagg, Loren; Schneider, Helga; Ladbury, John E.; Rudd, Christopher E.

    2013-01-01

    Despite the importance of the immune adaptor SLP-76 in T-cell immunity, it has been unclear whether SLP-76 directly self-associates to form higher order oligomers for T-cell activation. In this study, we show that SLP-76 self-associates in response to T-cell receptor ligation as mediated by the N-terminal sterile α motif (SAM) domain. SLP-76 co-precipitated alternately tagged SLP-76 in response to anti-CD3 ligation. Dynamic light scattering and fluorescent microscale thermophoresis of the isolated SAM domain (residues 1–78) revealed evidence of dimers and tetramers. Consistently, deletion of the SAM region eliminated SLP-76 co-precipitation of itself, concurrent with a loss of microcluster formation, nuclear factor of activated T-cells (NFAT) transcription, and interleukin-2 production in Jurkat or primary T-cells. Furthermore, the H5 α helix within the SAM domain contributed to self-association. Retention of H5 in the absence of H1–4 sufficed to support SLP-76 self-association with smaller microclusters that nevertheless enhanced anti-CD3-driven AP1/NFAT transcription and IL-2 production. By contrast, deletion of the H5 α helix impaired self-association and anti-CD3 induced AP1/NFAT transcription. Our data identified for the first time a role for the SAM domain in mediating SLP-76 self-association for T-cell function. PMID:23935094

  9. Release of active TGF-β1 from the Latent TGF-β1/GARP complex on T regulatory cells is mediated by Integrin β81

    PubMed Central

    Edwards, Justin P.; Thornton, Angela M.; Shevach, Ethan M.

    2014-01-01

    Activated T regulatory cells (Treg) express latent TGF-β1 on their cell surface bound to GARP. Although integrins have been implicated in mediating the release of active TGF-β1 from the complex of latent TGF-β1 and latent TGF-β1 binding protein, their role in processing latent TGF-β1 from the latent TGF-β1/GARP complex is unclear. Mouse CD4+Foxp3+ Treg, but not CD4+Foxp3− T cells, expressed integrin β8 (Itgb8) as detected by qRT-PCR. Itgb8 expression was a marker of thymically-derived (t)Treg, as it could not be detected on Foxp3+Helios− Tregs or on Foxp3+ T cells induced in vitro. Tregs from Itgb8 conditional knockouts exhibited normal suppressor function in vitro and in vivo in a model of colitis, but failed to provide TGF-β1 to drive Th17 or iTreg differentiation in vitro. In addition, Itgb8 knockout Tregs expressed higher levels of latent TGF-β1 on their cell surface consistent with defective processing. Thus, integrin αvβ8 is a marker of tTregs and functions in a cell intrinsic manner in mediating the processing of latent TGF-β1 from the latent TGF-β1/GARP complex on the surface of tTregs. PMID:25127859

  10. Bisphenol A (BPA) aggravates multiple low-dose streptozotocin-induced Type 1 diabetes in C57BL/6 mice.

    PubMed

    Cetkovic-Cvrlje, Marina; Thinamany, Sinduja; Bruner, Kylie A

    2017-12-01

    Type 1 diabetes (T1D) is a T-cell-mediated autoimmune disorder characterized by destruction of insulin-producing pancreatic β-cells. Whereas epidemiological data implicate environmental factors in the increasing incidence of T1D, their identity remains unknown. Though exposure to bisphenol A (BPA) has been associated with several disorders, no epidemiologic evidence has linked BPA exposure and T1D. The goal of this study was to elucidate diabetogenic potentials of BPA and underlying mechanisms in the context of T-cell immunity, in a multiple low-dose streptozotocin (MLDSTZ)-induced autoimmune mouse T1D model. C57BL/6 mice were orally exposed to 1 or 10 mg BPA/L starting at 4 wk of age; diabetes was induced at 9 wk of age with STZ. T-cell composition, function, and insulitis levels were studied at Days 11 and 50 during diabetes development (i.e. post-first STZ injection). Results showed both BPA doses increased diabetes incidence and affected T-cell immunity. However, mechanisms of diabetogenic action appeared divergent based on dose. Low-dose BPA fits a profile of an agent that exhibits pro-diabetogenic effects via T-cell immunomodulation in the early stages of disease development, i.e. decreases in splenic T-cell subpopulations [especially CD4 + T-cells] along with a trend in elevation of splenic T-cell formation of pro-inflammatory cytokines (IFN-γ, TNF-α, and IL-6). In contrast, high-dose BPA did not affect T-cell populations and led to decreased levels of IFN-γ and TNF-α. Both treatments did not affect insulitis levels at the disease early stage, but aggravated it later on. By the study end, besides decreasing T-cell proliferative capacity, low-dose BPA did not affect other T-cell-related parameters, including cytokine secretion, comparable to the effects of high-dose BPA. In conclusion, this study confirmed BPA as a potential diabetogenic compound with immunomodulatory mechanisms of action - in the context of T-cell immunity - that seemed to be dose dependent in the early immunopathogenesis of a MLDSTZ-induced model of T1D.

  11. An initial examination of the potential role of T-cell immunity in protection against feline immunodeficiency virus (FIV) infection.

    PubMed

    Aranyos, Alek M; Roff, Shannon R; Pu, Ruiyu; Owen, Jennifer L; Coleman, James K; Yamamoto, Janet K

    2016-03-14

    The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A-T) conferred a protection rate of 87% (13 of 15, p < 0.001) against FIVPet using the FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers > 13 × 10(6) cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4(+) and CD8(+) T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. An initial examination of the potential role of T-cell immunity in protection against feline immunodeficiency virus (FIV) infection

    PubMed Central

    Aranyos, Alek M.; Roff, Shannon R.; Pu, Riuyu; Owen, Jennifer L.; Coleman, James K.; Yamamoto, Janet K.

    2016-01-01

    The importance of vaccine-induced T-cell immunity in conferring protection with prototype and commercial FIV vaccines is still unclear. Current studies performed adoptive transfer of T cells from prototype FIV-vaccinated cats to partial-to-complete feline leukocyte antigen (FLA)-matched cats a day before either homologous FIVPet or heterologous-subtype pathogenic FIVFC1 challenge. Adoptive-transfer (A–T) conferred a protection rate of 87% (13 of 15, p<0.001) against FIVPet using FLA-matched T cells, whereas all 12 control cats were unprotected. Furthermore, A-T conferred protection rate of 50% (6 of 12, p<0.023) against FIVFC1 using FLA-matched T cells, whereas all 8 control cats were unprotected. Transfer of FLA-matched T and B cells demonstrated that T cells are needed to confer A-T protection. In addition, complete FLA-matching and addition of T-cell numbers >13×106 cells were required for A-T protection against FIVFC1 strain, reported to be a highly pathogenic virus resistant to vaccine-induced neutralizing-antibodies. The addition of FLA-matched B cells alone was not protective. The poor quality of the anti-FIV T-cell immunity induced by the vaccine likely contributed to the lack of protection in an FLA-matched recipient against FIVFC1. The quality of the immune response was determined by the presence of high mRNA levels of cytolysin (perforin) and cytotoxins (granzymes A, B, and H) and T helper-1 cytokines (interferon-γ [IFNγ] and IL2). Increased cytokine, cytolysin and cytotoxin production was detected in the donors which conferred protection in A-T studies. In addition, the CD4+ and CD8+ T-cell proliferation and/or IFNγ responses to FIV p24 and reverse transcriptase increased with each year in cats receiving 1X-3X vaccine boosts over 4 years. These studies demonstrate that anti-FIV T-cell immunity induced by vaccination with a dual-subtype FIV vaccine is essential for prophylactic protection against AIDS lentiviruses such as FIV and potentially HIV-1. PMID:26802606

  13. δ-Tocopherol inhibits receptor tyrosine kinase-induced AKT activation in prostate cancer cells.

    PubMed

    Wang, Hong; Hong, Jungil; Yang, Chung S

    2016-11-01

    The cancer preventive activity of vitamin E is suggested by epidemiological studies and supported by animal studies with vitamin E forms, γ-tocopherol and δ-tocopherol (δ-T). Several recent large-scale cancer prevention trials with high dose of α-tocopherol, however, yielded disappointing results. Whether vitamin E prevents or promotes cancer is a serious concern. A better understanding of the molecular mechanisms of action of the different forms of tocopherols would enhance our understanding of this topic. In this study, we demonstrated that δ-T was the most effective tocopherol form in inhibiting prostate cancer cell growth, by inducing cell cycle arrest and apoptosis. By profiling the effects of δ-T on the cell signaling using the phospho-kinase array, we found that the most inhibited target was the phosphorylation of AKT on T308. Further study on the activation of AKT by EGFR and IGFR revealed that δ-T attenuated the EGF/IGF-induced activation of AKT (via the phosphorylation of AKT on T308 induced by the activation of PIK3). Expression of dominant active PIK3 and AKT in prostate cancer cell line DU145 in which PIK3, AKT, and PTEN are wild type caused the cells to be reflectory to the inhibition of δ-T, supporting that δ-T inhibits the PIK3-mediated activation of AKT. Our data also suggest that δ-T interferes with the EGF-induced EGFR internalization, which leads to the inhibition of the receptor tyrosine kinase-dependent activation of AKT. In summary, our results revealed a novel mechanism of δ-T in inhibiting prostate cancer cell growth, supporting the cancer preventive activity δ-T. © 2015 Wiley Periodicals, Inc. © 2015 Wiley Periodicals, Inc.

  14. Nickel-Refining Fumes Induced DNA Damage and Apoptosis of NIH/3T3 Cells via Oxidative Stress

    PubMed Central

    Wang, Yue; Wang, Sheng-Yuan; Jia, Li; Zhang, Lin; Ba, Jing-Chong; Han, Dan; Yu, Cui-Ping; Wu, Yong-Hui

    2016-01-01

    Although there have been numerous studies examining the toxicity and carcinogenicity of nickel compounds in humans and animals, its molecular mechanisms of action are not fully elucidated. In our research, NIH/3T3 cells were exposed to nickel-refining fumes at the concentrations of 0, 6.25, 12.50, 25, 50 and 100 μg/mL for 24 h. Cell viability, cell apoptosis, reactive oxygen species (ROS) level, lactate dehydrogenase (LDH) assay, the level of glutathione (GSH), activities of superoxide dismutase (SOD), catalase (CAT), and malondialdehyde (MDA) level were detected. The exposure of NIH/3T3 cells to nickel-refining fumes significantly reduced cell viability and induced cell apoptotic death in a dose-dependent manner. Nickel-refining fumes significantly increased ROS levels and induced DNA damage. Nickel-refining fumes may induce the changes in the state of ROS, which may eventually initiate oxidative stress, DNA damage and apoptosis of NIH/3T3 cells. PMID:27347984

  15. Radiation-induced equilibrium is a balance between tumor cell proliferation and T cell-mediated killing

    PubMed Central

    Liang, Hua; Deng, Liufu; Chmura, Steven; Burnette, Byron; Liadis, Nicole; Darga, Thomas; Beckett, Michael A.; Lingen, Mark W.; Witt, MaryEllyn; Weichselbaum, Ralph R.; Fu, Yang-Xin

    2013-01-01

    Local failures following radiation therapy are multifactorial and the contributions of the tumor and the host are complex. Current models of tumor equilibrium suggest that a balance exists between cell birth and cell death due to insufficient angiogenesis, immune effects, or intrinsic cellular factors. We investigated whether host immune responses contribute to radiation induced tumor equilibrium in animal models. We report an essential role for immune cells and their cytokines in suppressing tumor cell regrowth in two experimental animal model systems. Depletion of T cells or neutralization of interferon-gamma reversed radiation-induced equilibrium leading to tumor regrowth. We also demonstrate that PD-L1 blockade augments T cell responses leading to rejection of tumors in radiation induced equilibrium. We identify an active interplay between tumor cells and immune cells that occurs in radiation-induced tumor equilibrium and suggest a potential role for disruption of the PD-L1/PD-1 axis in increasing local tumor control. PMID:23630355

  16. Critical roles of conventional dendritic cells in promoting T cell‐dependent hepatitis through regulating natural killer T cells

    PubMed Central

    Wang, J.; Cao, X.; Zhao, J.; Zhao, H.; Wei, J.; Li, Q.; Qi, X.; Yang, Z.; Wang, L.; Zhang, H.; Bai, L.; Wu, Z.; Zhao, L.; Hong, Z.

    2017-01-01

    Summary Dendritic cells (DCs) play critical roles in initiating and regulating innate immunity as well as adaptive immune responses. However, the role of conventional dendritic cells (cDCs) in concanavalin A (ConA)‐induced fulminant hepatitis is unknown. In this study, we demonstrated that depletion of cDCs using either CD11c‐diphtheria toxin receptor transgenic mice (DTR Tg) mice or anti‐CD11c antibody reduced the severity of liver injury significantly, indicating a detrimental role of cDCs in ConA‐induced hepatitis. We elucidated further the pathological role of cDCs as being the critical source of interleukin (IL)‐12, which induced the secretion of interferon (IFN)‐γ by natural killer (NK) T cells. Reconstitution of cDCs‐depleted mice with IL‐12 restored ConA‐induced hepatitis significantly. Furthermore, we determined that NK T cells were the target of DC‐derived IL‐12, and NK T cells contributed to liver inflammation and injury through production of IFN‐γ. In summary, our study demonstrated a novel function of cDCs in mediating ConA‐induced hepatitis through regulating IFN‐γ secretion of NK T cells in an IL‐12‐dependent fashion. Targeting cDCs might provide potentially therapeutic applications in treating autoimmune related liver diseases. PMID:27891589

  17. ArtinM Mediates Murine T Cell Activation and Induces Cell Death in Jurkat Human Leukemic T Cells

    PubMed Central

    Oliveira-Brito, Patrícia Kellen Martins; Gonçalves, Thiago Eleutério; Vendruscolo, Patrícia Edivânia; Roque-Barreira, Maria Cristina

    2017-01-01

    The recognition of cell surface glycans by lectins may be critical for the innate and adaptive immune responses. ArtinM, a d-mannose-binding lectin from Artocarpus heterophyllus, activates antigen-presenting cells by recognizing TLR2 N-glycans and induces Th1 immunity. We recently demonstrated that ArtinM stimulated CD4+ T cells to produce proinflammatory cytokines. Here, we further studied the effects of ArtinM on adaptive immune cells. We showed that ArtinM activates murine CD4+ and CD8+ T cells, augmenting their positivity for CD25, CD69, and CD95 and showed higher interleukin (IL)-2 and interferon (IFN)-γ production. The CD4+ T cells exhibited increased T-bet expression in response to ArtinM, and IL-2 production by CD4+ and CD8+ T cells depended on the recognition of CD3εγ-chain glycans by ArtinM. The ArtinM effect on aberrantly-glycosylated neoplastic lymphocytes was studied in Jurkat T cells, in which ArtinM induced IL-2, IFN-γ, and IL-1β production, but decreased cell viability and growth. A higher frequency of AnnexinV- and propidium iodide-stained cells demonstrated the induction of Jurkat T cells apoptosis by ArtinM, and this apoptotic response was reduced by caspases and protein tyrosine kinase inhibitors. The ArtinM effects on murine T cells corroborated with the immunomodulatory property of lectin, whereas the promotion of Jurkat T cells apoptosis may reflect a potential applicability of ArtinM in novel strategies for treating lymphocytic leukemia. PMID:28665310

  18. T cell exhaustion: from pathophysiological basics to tumor immunotherapy.

    PubMed

    Catakovic, Kemal; Klieser, Eckhard; Neureiter, Daniel; Geisberger, Roland

    2017-01-05

    The immune system is capable of distinguishing between danger- and non-danger signals, thus inducing either an appropriate immune response against pathogens and cancer or inducing self-tolerance to avoid autoimmunity and immunopathology. One of the mechanisms that have evolved to prevent destruction by the immune system, is to functionally silence effector T cells, termed T cell exhaustion, which is also exploited by viruses and cancers for immune escape In this review, we discuss some of the phenotypic markers associated with T cell exhaustion and we summarize current strategies to reinvigorate exhausted T cells by blocking these surface marker using monoclonal antibodies.

  19. Leptin deficiency impairs maturation of dendritic cells and enhances induction of regulatory T and Th17 cells

    PubMed Central

    Moraes-Vieira, Pedro M.M.; Larocca, Rafael A.; Bassi, Enio J.; Peron, Jean Pierre S.; Andrade-Oliveira, Vinícius; Wasinski, Frederick; Araujo, Ronaldo; Thornley, Thomas; Quintana, Francisco J.; Basso, Alexandre S.; Strom, Terry B.; Câmara, Niels O.S.

    2016-01-01

    Leptin is an adipose-secreted hormone that plays an important role in both metabolism and immunity. Leptin has been shown to induce Th1-cell polarization and inhibit Th2-cell responses. Additionally, leptin induces Th17-cell responses, inhibits regulatory T (Treg) cells and modulates autoimmune diseases. Here, we investigated whether leptin mediates its activity on T cells by influencing dendritic cells (DCs) to promote Th17 and Treg-cell immune responses in mice. We observed that leptin deficiency (i) reduced the expression of DC maturation markers, (ii) decreased DC production of IL-12, TNF-α, and IL-6, (iii) increased DC production of TGF-β, and (iv) limited the capacity of DCs to induce syngeneic CD4+ T-cell proliferation. As a consequence of this unique phenotype, DCs generated under leptin-free conditions induced Treg or TH17 cells more efficiently than DCs generated in the presence of leptin. These data indicate important roles for leptin in DC homeostasis and the initiation and maintenance of inflammatory and regulatory immune responses by DCs. PMID:24271843

  20. CXCR6 is expressed on T cells in both T helper type 1 (Th1) inflammation and allergen-induced Th2 lung inflammation but is only a weak mediator of chemotaxis

    PubMed Central

    Latta, Markus; Mohan, Karkada; Issekutz, Thomas B

    2007-01-01

    Numerous chemokine receptors are increased in number on T cells in inflamed tissues. Our objective was to examine CXCR6 expression on lymphocytes during immune and inflammatory reactions and its potential for mediating T-cell recruitment. The cDNA for rat CXCR6 was cloned and monoclonal antibodies (mAbs) to CXCR6 were developed. CXCR6 was present on 4–6% of CD4 and CD8 T cells in blood, normal lymph nodes (LNs) and the spleen, primarily on memory T cells. In vitro antigen re-stimulation of LN T cells from animals with autoimmune arthritis and experimental autoimmune encephalomyelitis (EAE) increased the proportion of CXCR6+ T cells to 35–50% and anti-T-cell receptor (TCR) activation to 60–80%. In vivo, after antigen challenge of LNs there was only a small increase in CXCR6+ T cells on the lymphoblasts in the LNs, and a much higher percentage of T cells were CXCR6+ in virus-induced peritoneal exudates (∼47%) and in allergen-induced lung inflammation (33%). Chemotaxis of CXCR6-expressing inflammatory T cells to CXCL16 was poor, but that to CXCL10 was robust. We conclude that few T cells in normal and antigen-challenged LNs are CXCR6+, whereas a high proportion of in vitro activated T cells and T cells from inflammatory sites are CXCR6+, but these cells migrate poorly to CXCL16. This suggests that CXCR6 may contribute to T-cell positioning and activation, rather than recruitment. CXCR6 is also expressed on T cells not only in T helper type 1 (Th1) inflammation (arthritis and EAE) but also, as shown here, in Th2 inflammation, where it is increased after allergen challenge. PMID:17437534

  1. CXCR6 is expressed on T cells in both T helper type 1 (Th1) inflammation and allergen-induced Th2 lung inflammation but is only a weak mediator of chemotaxis.

    PubMed

    Latta, Markus; Mohan, Karkada; Issekutz, Thomas B

    2007-08-01

    Numerous chemokine receptors are increased in number on T cells in inflamed tissues. Our objective was to examine CXCR6 expression on lymphocytes during immune and inflammatory reactions and its potential for mediating T-cell recruitment. The cDNA for rat CXCR6 was cloned and monoclonal antibodies (mAbs) to CXCR6 were developed. CXCR6 was present on 4-6% of CD4 and CD8 T cells in blood, normal lymph nodes (LNs) and the spleen, primarily on memory T cells. In vitro antigen re-stimulation of LN T cells from animals with autoimmune arthritis and experimental autoimmune encephalomyelitis (EAE) increased the proportion of CXCR6(+) T cells to 35-50% and anti-T-cell receptor (TCR) activation to 60-80%. In vivo, after antigen challenge of LNs there was only a small increase in CXCR6(+) T cells on the lymphoblasts in the LNs, and a much higher percentage of T cells were CXCR6(+) in virus-induced peritoneal exudates (approximately 47%) and in allergen-induced lung inflammation (33%). Chemotaxis of CXCR6-expressing inflammatory T cells to CXCL16 was poor, but that to CXCL10 was robust. We conclude that few T cells in normal and antigen-challenged LNs are CXCR6(+), whereas a high proportion of in vitro activated T cells and T cells from inflammatory sites are CXCR6(+), but these cells migrate poorly to CXCL16. This suggests that CXCR6 may contribute to T-cell positioning and activation, rather than recruitment. CXCR6 is also expressed on T cells not only in T helper type 1 (Th1) inflammation (arthritis and EAE) but also, as shown here, in Th2 inflammation, where it is increased after allergen challenge.

  2. Microfluidic platform for real-time signaling analysis of multiple single T cells in parallel.

    PubMed

    Faley, Shannon; Seale, Kevin; Hughey, Jacob; Schaffer, David K; VanCompernolle, Scott; McKinney, Brett; Baudenbacher, Franz; Unutmaz, Derya; Wikswo, John P

    2008-10-01

    Deciphering the signaling pathways that govern stimulation of naïve CD4+ T helper cells by antigen-presenting cells via formation of the immunological synapse is key to a fundamental understanding of the progression of successful adaptive immune response. The study of T cell-APC interactions in vitro is challenging, however, due to the difficulty of tracking individual, non-adherent cell pairs over time. Studying single cell dynamics over time reveals rare, but critical, signaling events that might be averaged out in bulk experiments, but these less common events are undoubtedly important for an integrated understanding of a cellular response to its microenvironment. We describe a novel application of microfluidic technology that overcomes many limitations of conventional cell culture and enables the study of hundreds of passively sequestered hematopoietic cells for extended periods of time. This microfluidic cell trap device consists of 440 18 micromx18 micromx10 microm PDMS, bucket-like structures opposing the direction of flow which serve as corrals for cells as they pass through the cell trap region. Cell viability analysis revealed that more than 70% of naïve CD4+ T cells (TN), held in place using only hydrodynamic forces, subsequently remain viable for 24 hours. Cytosolic calcium transients were successfully induced in TN cells following introduction of chemical, antibody, or cellular forms of stimulation. Statistical analysis of TN cells from a single stimulation experiment reveals the power of this platform to distinguish different calcium response patterns, an ability that might be utilized to characterize T cell signaling states in a given population. Finally, we investigate in real time contact- and non-contact-based interactions between primary T cells and dendritic cells, two main participants in the formation of the immunological synapse. Utilizing the microfluidic traps in a daisy-chain configuration allowed us to observe calcium transients in TN cells exposed only to media conditioned by secretions of lipopolysaccharide-matured dendritic cells, an event which is easily missed in conventional cell culture where large media-to-cell ratios dilute cellular products. Further investigation into this intercellular signaling event indicated that LPS-matured dendritic cells, in the absence of antigenic stimulation, secrete chemical signals that induce calcium transients in T(N) cells. While the stimulating factor(s) produced by the mature dendritic cells remains to be identified, this report illustrates the utility of these microfluidic cell traps for analyzing arrays of individual suspension cells over time and probing both contact-based and intercellular signaling events between one or more cell populations.

  3. Low Dose Decitabine Treatment Induces CD80 Expression in Cancer Cells and Stimulates Tumor Specific Cytotoxic T Lymphocyte Responses

    PubMed Central

    Zhou, Ji-Hao; Yao, Yu-Shi; Li, Yong-Hui; Xu, Yi-Han; Li, Jing-Xin; Gao, Xiao-Ning; Zhou, Min-Hang; Jiang, Meng-Meng; Gao, Li; Ding, Yi; Lu, Xue-Chun; Shi, Jin-Long; Luo, Xu-Feng; Wang, Jia; Wang, Li-Li; Qu, Chunfeng; Bai, Xue-Feng; Yu, Li

    2013-01-01

    Lack of immunogenicity of cancer cells has been considered a major reason for their failure in induction of a tumor specific T cell response. In this paper, we present evidence that decitabine (DAC), a DNA methylation inhibitor that is currently used for the treatment of myelodysplastic syndrome (MDS), acute myeloid leukemia (AML) and other malignant neoplasms, is capable of eliciting an anti-tumor cytotoxic T lymphocyte (CTL) response in mouse EL4 tumor model. C57BL/6 mice with established EL4 tumors were treated with DAC (1.0 mg/kg body weight) once daily for 5 days. We found that DAC treatment resulted in infiltration of IFN-γ producing T lymphocytes into tumors and caused tumor rejection. Depletion of CD8+, but not CD4+ T cells resumed tumor growth. DAC-induced CTL response appeared to be elicited by the induction of CD80 expression on tumor cells. Epigenetic evidence suggests that DAC induces CD80 expression in EL4 cells via demethylation of CpG dinucleotide sites in the promoter of CD80 gene. In addition, we also showed that a transient, low-dose DAC treatment can induce CD80 gene expression in a variety of human cancer cells. This study provides the first evidence that epigenetic modulation can induce the expression of a major T cell co-stimulatory molecule on cancer cells, which can overcome immune tolerance, and induce an efficient anti-tumor CTL response. The results have important implications in designing DAC-based cancer immunotherapy. PMID:23671644

  4. Low dose decitabine treatment induces CD80 expression in cancer cells and stimulates tumor specific cytotoxic T lymphocyte responses.

    PubMed

    Wang, Li-Xin; Mei, Zhen-Yang; Zhou, Ji-Hao; Yao, Yu-Shi; Li, Yong-Hui; Xu, Yi-Han; Li, Jing-Xin; Gao, Xiao-Ning; Zhou, Min-Hang; Jiang, Meng-Meng; Gao, Li; Ding, Yi; Lu, Xue-Chun; Shi, Jin-Long; Luo, Xu-Feng; Wang, Jia; Wang, Li-Li; Qu, Chunfeng; Bai, Xue-Feng; Yu, Li

    2013-01-01

    Lack of immunogenicity of cancer cells has been considered a major reason for their failure in induction of a tumor specific T cell response. In this paper, we present evidence that decitabine (DAC), a DNA methylation inhibitor that is currently used for the treatment of myelodysplastic syndrome (MDS), acute myeloid leukemia (AML) and other malignant neoplasms, is capable of eliciting an anti-tumor cytotoxic T lymphocyte (CTL) response in mouse EL4 tumor model. C57BL/6 mice with established EL4 tumors were treated with DAC (1.0 mg/kg body weight) once daily for 5 days. We found that DAC treatment resulted in infiltration of IFN-γ producing T lymphocytes into tumors and caused tumor rejection. Depletion of CD8(+), but not CD4(+) T cells resumed tumor growth. DAC-induced CTL response appeared to be elicited by the induction of CD80 expression on tumor cells. Epigenetic evidence suggests that DAC induces CD80 expression in EL4 cells via demethylation of CpG dinucleotide sites in the promoter of CD80 gene. In addition, we also showed that a transient, low-dose DAC treatment can induce CD80 gene expression in a variety of human cancer cells. This study provides the first evidence that epigenetic modulation can induce the expression of a major T cell co-stimulatory molecule on cancer cells, which can overcome immune tolerance, and induce an efficient anti-tumor CTL response. The results have important implications in designing DAC-based cancer immunotherapy.

  5. Interleukin-10 Gene-Modified Dendritic Cell-Induced Type 1 Regulatory T Cells Induce Transplant-Tolerance and Impede Graft Versus Host Disease After Allogeneic Stem Cell Transplantation.

    PubMed

    Wan, Jiangbo; Huang, Fang; Hao, Siguo; Hu, Weiwei; Liu, Chuanxu; Zhang, Wenhao; Deng, Xiaohui; Chen, Linjun; Ma, Liyuan; Tao, Rong

    2017-01-01

    Tr1 cells can induce peripheral tolerance to self- and foreign antigens, and have been developed as a therapeutic tool for the induction of tolerance to transplanted tissue. We explored the feasibility of generating Tr1 cells by using IL-10 gene-modified recipient DCs (DCLV-IL-10) to stimulate donor naive CD4+ T cells. We also investigated some biological properties of Tr1 cells. DCLV-IL-10 were generated through DCs transduced with a lentivirus vector carrying the IL-10 gene, and Tr1 cells were produced by using DCLV-IL-10 to stimulate naive CD4+ T cells. The effects of Tr1 cells on T-cell proliferation and the occurrence of graft versus host disease (GVHD) following allogeneic stem-cell transplantation (allo-HSCT) were investigated. The DCLV-IL-10-induced Tr1 cells co-expressed LAG-3 and CD49b. Moreover, they also expressed CD4, CD25, and IL-10, but not Foxp3, and secreted significantly higher levels of IL-10 (1,729.36 ± 185.79 pg/mL; P < 0.001) and INF-γ (1,524.48 ± 168.65 pg/mL; P < 0.01) than the control T cells upon the stimulation by allogeneic DCs. Tr1 cells markedly suppressed T-lymphocyte proliferation and the mixed lymphocytic response (MLR) in vitro. The mice used in the allo-HSCT model had longer survival times and lower clinical and pathological GVHD scores than the control mice. IL-10 gene-modified DC-induced Tr1 cells may be used as a potent cellular therapy for the prevention of GVHD after allo-HSCT. © 2017 The Author(s). Published by S. Karger AG, Basel.

  6. Butyric Acid-Induced T-Cell Apoptosis Is Mediated by Caspase-8 and -9 Activation in a Fas-Independent Manner

    PubMed Central

    Kurita-Ochiai, Tomoko; Ochiai, Kuniyasu; Fukushima, Kazuo

    2001-01-01

    Our previous study demonstrated that butyric acid, an extracellular metabolite of periodontopathic bacteria, induced apoptosis in murine thymocytes, splenic T cells, and human Jurkat cells. In this study, we examined whether CD95 ligand-receptor interaction is involved in butyric acid-induced T-cell apoptosis. Flow cytometry analysis indicated that expression of Fas in Jurkat and T cells from peripheral blood mononuclear cells was not affected by butyric acid treatment. Furthermore, the expression of Fas and FasL protein in Western blotting was not affected by butyric acid treatment. Coincubation with blocking anti-Fas antibodies prevented Fas-induced apoptosis but not butyric acid-induced apoptosis. Anti-FasL antibodies also did not prevent butyric acid-induced apoptosis at any dose examined. Although cytotoxic anti-Fas antibody affected butyric acid-induced apoptosis, a synergistic effect was not seen. Time-dependent activation of caspase-8 and -9 was recognized in butyric acid- as well as Fas-mediated apoptosis. IETD-CHO and LEHD-CHO, specific inhibitors of caspase-8 and -9, respectively, completely blocked Fas-mediated apoptosis and partially prevented butyric acid-induced apoptosis. These results suggest that the Fas-FasL interaction is not involved in butyric acid-induced apoptosis and that caspase-8 and -9-dependent apoptosis plays an important role in butyric acid-induced apoptosis, as well as Fas-induced apoptosis. PMID:11238216

  7. The inhibitory effect of naringenin on atopic dermatitis induced by DNFB in NC/Nga mice.

    PubMed

    Kim, Tae-Ho; Kim, Gun-Dong; Ahn, Hyun-Jong; Cho, Jeong-Je; Park, Yong Seek; Park, Cheung-Seog

    2013-10-10

    Atopic dermatitis (AD) is a chronic and relapsing inflammatory dermatitis characterized by pruritic and eczematous skin lesions. Here, we investigated the therapeutic effect of the fruit flavonoid naringenin on DNFB induced atopic dermatitis mice model. AD-like skin lesion was induced by repetitive skin contact with DNFB in NC/Nga mice and the effects of the fruit flavonoid naringenin were evaluated on the basis of histopathological findings of skin, ear swelling and cytokine production of CD4(+)T cells. Intraperitoneal injection of naringenin for one week after DNFB challenge significantly lowered ear swelling and improved back skin lesions. In addition, naringenin significantly suppressed production of interferon-gamma (IFN-γ) by activated CD4(+) T cells and serum IgE level. Furthermore, naringenin reduced DNFB-induced infiltration of eosinophils, mast cells, CD4(+) T cells, and CD8(+) T cells in skin lesions. Naringenin may suppress the development of AD-like skin lesions in DNFB-treated NC/Nga mice by reducing IFN-γ production of activated CD4(+) T cells, serum IgE levels and infiltration of immune cells to skin lesion. © 2013.

  8. Mithramycin A induces apoptosis by regulating the mTOR/Mcl-1/tBid pathway in androgen-independent prostate cancer cells

    PubMed Central

    Choi, Eun-Sun; Chung, Taeho; Kim, Jun-Sung; Lee, Hakmo; Kwon, Ki Han; Cho, Nam-Pyo; Cho, Sung-Dae

    2013-01-01

    Mithramycin A (Mith) is an aureolic acid-type polyketide produced by various soil bacteria of the genus Streptomyces. Mith inhibits myeloid cell leukemia-1 (Mcl-1) to induce apoptosis in prostate cancer, but the molecular mechanism underlying this process has not been fully elucidated. The aim of this study was therefore to investigate the detailed molecular mechanism related to Mith-induced apoptosis in prostate cancer cells. Mith decreased the phosphorylation of mammalian target of rapamycin (mTOR) in both cell lines overexpressing phospho-mTOR compared to RWPE-1 human normal prostate epithelial cells. Mith significantly induced truncated Bid (tBid) and siRNA-mediated knock-down of Mcl-1 increased tBid protein levels. Moreover, Mith also inhibited the phosphorylation of mTOR on serine 2448 and Mcl-1, and increased tBid protein in prostate tumors in athymic nude mice bearing DU145 cells as xenografts. Thus, Mith acts as an effective tumor growth inhibitor in prostate cancer cells through the mTOR/Mcl-1/tBid signaling pathway. PMID:24062605

  9. Rebamipide attenuates autoimmune arthritis severity in SKG mice via regulation of B cell and antibody production.

    PubMed

    Byun, J-K; Moon, S-J; Jhun, J-Y; Kim, E-K; Park, J-S; Youn, J; Min, J-K; Park, S-H; Kim, H-Y; Cho, M-L

    2014-10-01

    Oxidative stress is involved in the pathophysiology of rheumatoid arthritis (RA). We investigated the therapeutic potential of rebamipide, a gastroprotective agent with a property of reactive oxygen species scavenger, on the development of inflammatory polyarthritis and the pathophysiological mechanisms by which rebamipide might confer anti-arthritic effects in SKG mice, an animal model of RA. Intraperitoneal (i.p.) injection of rebamipide attenuated the severity of clinical and histological arthritis. Rebampide treatment reduced the number of T helper type 1 (Th1), Th2, Th17, inducible T cell co-stimulator (ICOS)(+) follicular helper T (Tfh) transitional type (T2) and mature B cells in the spleen, but increased the number of regulatory T (Treg ), CD19(+) CD1d(high) CD5(high) , CD19(+) CD25(high) forkhead box protein 3 (FoxP3)(+) regulatory B (Breg ) cells, memory B cells, and transitional type 1 (T1) B cells. In addition, flow cytometric analysis revealed significantly decreased populations of FAS(+) GL-7(+) germinal centre B cells and B220(-) CD138(+) plasma cells in the spleens of rebamipide-treated SKG mice compared to controls. Rebamipide decreased germinal centre B cells and reciprocally induced Breg cells in a dose-dependent manner in vitro. Rebamipide-induced Breg cells had more suppressive capacity in relation to T cell proliferation and also inhibited Th17 differentiation from murine CD4(+) T cells. Together, these data show that i.p. administration of rebamipide suppresses arthritis severity by inducing Breg and Treg cells and suppressing Tfh and Th17 cells in a murine model of RA. © 2014 British Society for Immunology.

  10. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways.

    PubMed

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung

    2013-10-01

    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  11. β₂ adrenergic receptor activation suppresses bone morphogenetic protein (BMP)-induced alkaline phosphatase expression in osteoblast-like MC3T3E1 cells.

    PubMed

    Yamada, Takayuki; Ezura, Yoichi; Hayata, Tadayoshi; Moriya, Shuichi; Shirakawa, Jumpei; Notomi, Takuya; Arayal, Smriti; Kawasaki, Makiri; Izu, Yayoi; Harada, Kiyoshi; Noda, Masaki

    2015-06-01

    β adrenergic stimulation suppresses bone formation in vivo while its actions in osteoblastic differentiation are still incompletely understood. We therefore examined the effects of β2 adrenergic stimulation on osteoblast-like MC3T3-E1 cells focusing on BMP-induced alkaline phosphatase expression. Morphologically, isoproterenol treatment suppresses BMP-induced increase in the numbers of alkaline phosphatase-positive small foci in the cultures of MC3T3-E1 cells. Biochemically, isoproterenol treatment suppresses BMP-induced enzymatic activity of alkaline phosphatase in a dose-dependent manner. Isoproterenol suppression of alkaline phosphatase activity is observed even when the cells are treated with high concentrations of BMP. With respect to cell density, isoproterenol treatment tends to suppress BMP-induced increase in alkaline phosphatase expression more in osteoblasts cultured at higher cell density. In terms of treatment protocol, continuous isoproterenol treatment is compared to cyclic treatment. Continuous isoproterenol treatment is more suppressive against BMP-induced increase in alkaline phosphatase expression than cyclic regimen. At molecular level, isoproterenol treatment suppresses BMP-induced enhancement of alkaline phosphatase mRNA expression. Regarding the mode of isoproterenol action, isoproterenol suppresses BMP-induced BRE-luciferase activity. These data indicate that isoproterenol regulates BMP-induced alkaline phosphatase expression in osteoblast-like MC3T3E1 cells. © 2014 Wiley Periodicals, Inc.

  12. Copresentation of antigen and ligands of Siglec-G induces B cell tolerance independent of CD22.

    PubMed

    Pfrengle, Fabian; Macauley, Matthew S; Kawasaki, Norihito; Paulson, James C

    2013-08-15

    Differentiation of self from nonself is indispensable for maintaining B cell tolerance in peripheral tissues. CD22 and Siglec-G (sialic acid-binding Ig-like lectin G) are two inhibitory coreceptors of the BCR that are implicated in maintenance of tolerance to self Ags. Enforced ligation of CD22 and the BCR by a nanoparticle displaying both Ag and CD22 ligands induces a tolerogenic circuit resulting in apoptosis of the Ag-reactive B cell. Whether Siglec-G also has this property has not been investigated in large part owing to the lack of a selective Siglec-G ligand. In this article, we report the development of a selective high-affinity ligand for Siglec-G and its application as a chemical tool to investigate the tolerogenic potential of Siglec-G. We find that liposomal nanoparticles decorated with Ag and Siglec-G ligand inhibit BCR signaling in both B1 and B2 B cells compared with liposomes displaying Ag alone. Not only is inhibition of B cell activation observed by ligating the BCR with Siglec-G, but robust tolerance toward T-independent and T-dependent Ags is also induced in mice. The ability of Siglec-G to inhibit B cell activation equally in both B1 and B2 subsets is consistent with our observation that Siglec-G is expressed at a relatively constant level throughout numerous B cell subsets. These results suggest that Siglec-G may contribute to maintenance of B cell tolerance toward self Ags in various B cell compartments.

  13. Squaramide-Based Supramolecular Materials for Three-Dimensional Cell Culture of Human Induced Pluripotent Stem Cells and Their Derivatives

    PubMed Central

    2018-01-01

    Synthetic hydrogel materials can recapitulate the natural cell microenvironment; however, it is equally necessary that the gels maintain cell viability and phenotype while permitting reisolation without stress, especially for use in the stem cell field. Here, we describe a family of synthetically accessible, squaramide-based tripodal supramolecular monomers consisting of a flexible tris(2-aminoethyl)amine (TREN) core that self-assemble into supramolecular polymers and eventually into self-recovering hydrogels. Spectroscopic measurements revealed that monomer aggregation is mainly driven by a combination of hydrogen bonding and hydrophobicity. The self-recovering hydrogels were used to encapsulate NIH 3T3 fibroblasts as well as human-induced pluripotent stem cells (hiPSCs) and their derivatives in 3D. The materials reported here proved cytocompatible for these cell types with maintenance of hiPSCs in their undifferentiated state essential for their subsequent expansion or differentiation into a given cell type and potential for facile release by dilution due to their supramolecular nature. PMID:29528623

  14. Fc receptors for mouse IgG1 on human monocytes: polymorphism and role in antibody-induced T cell proliferation.

    PubMed

    Tax, W J; Hermes, F F; Willems, R W; Capel, P J; Koene, R A

    1984-09-01

    In previous studies, it was shown that there is polymorphism in the mitogenic effect of mouse IgG1 monoclonal antibodies against the T3 antigen of human T cells. This polymorphism implies that IgG1 anti-T3 antibodies are not mitogenic for T cells from 30% of healthy individuals. The present results demonstrate that this polymorphism is caused by polymorphism of an Fc receptor for mouse IgG1, present on human monocytes. The Fc receptor for murine IgG1 could be detected by a newly developed rosetting assay on monocytes from all individuals responsive to the mitogenic effect of IgG1 anti-T3 antibodies. This Fc receptor was not detectable on monocytes from those individuals exhibiting no mitogenic responses to IgG1 anti-T3 monoclonal antibodies. Cross-linking of T3 antigens appears to be essential for antibody-induced mitosis of T cells, because mononuclear cells that did not proliferate in response to WT 31 (an IgG1 antibody against T3 antigen) showed a proliferative response to Sepharose beads coated with WT 31. The Fc receptor--if functionally present--may be involved in the cross-linking of T3 antigens through anti-T3 antibodies. Further evidence for the involvement of this Fc receptor in antibody-induced T cell proliferation was provided by inhibition studies. Immune complexes containing IgG1 antibodies were able to inhibit the proliferative response to IgG1 anti-T3 antibodies. This inhibition by immune complexes appears to be mediated through the monocyte Fc receptor for mouse IgG1. These findings are important for the interpretation of previously described inhibitory effects of anti-T cell monoclonal antibodies on T cell proliferation, and show that such inhibitory effects may be monocyte-mediated (via immune complexes) rather than caused by a direct involvement of the respective T cell antigens in T cell mitosis. The Fc receptor for mouse IgG1 plays a role in antibody-induced T cell proliferation. Its polymorphism may have important implications for the therapeutic use of IgG1 monoclonal antibodies.

  15. Unusual Suspects in the Development of Obesity-Induced Inflammation and Insulin Resistance: NK cells, iNKT cells, and ILCs.

    PubMed

    Bonamichi, Beatriz Dal Santo Francisco; Lee, Jongsoon

    2017-08-01

    The notion that obesity-induced inflammation mediates the development of insulin resistance in animal models and humans has been gaining strong support. It has also been shown that immune cells in local tissues, in particular in visceral adipose tissue, play a major role in the regulation of obesity-induced inflammation. Specifically, obesity increases the numbers and activation of proinflammatory immune cells, including M1 macrophages, neutrophils, Th1 CD4 T cells, and CD8 T cells, while simultaneously suppressing anti-inflammatory cells such as M2 macrophages, CD4 regulatory T cells, regulatory B cells, and eosinophils. Recently, however, new cell types have been shown to participate in the development of obesity-induced inflammation and insulin resistance. Some of these cell types also appear to regulate obesity. These cells are natural killer (NK) cells and innate lymphoid cells (ILCs), which are closely related, and invariant natural killer T (iNKT) cells. It should be noted that, although iNKT cells resemble NK cells in name, they are actually a completely different cell type in terms of their development and functions in immunity and metabolism. In this review, we will focus on the roles that these relatively new players in the metabolism field play in obesity-induced insulin resistance and the regulation of obesity. Copyright © 2017 Korean Diabetes Association.

  16. Response of γδ T cells to plant-derived tannins

    PubMed Central

    Holderness, Jeff; Hedges, Jodi F.; Daughenbaugh, Katie; Kimmel, Emily; Graff, Jill; Freedman, Brett; Jutila, Mark A.

    2008-01-01

    Many pharmaceutical drugs are isolated from plants used in traditional medicines. Through screening plant extracts, both traditional medicines and compound libraries, new pharmaceutical drugs continue to be identified. Currently, two plant-derived agonists for γδ T cells are described. These plant-derived agonists impart innate effector functions upon distinct γδ T cell subsets. Plant tannins represent one class of γδ T cell agonist and preferentially activate the mucosal population. Mucosal γδ T cells function to modulate tissue immune responses and induce epithelium repair. Select tannins, isolated from apple peel, rapidly induce immune gene transcription in γδ T cells, leading to cytokine production and increased responsiveness to secondary signals. Activity of these tannin preparations tracks to the procyanidin fraction, with the procyanidin trimer (C1) having the most robust activity defined to date. The response to the procyanidins is evolutionarily conserved in that responses are seen with human, bovine, and murine γδ T cells. Procyanidin-induced responses described in this review likely account for the expansion of mucosal γδ T cells seen in mice and rats fed soluble extracts of tannins. Procyanidins may represent a novel approach for treatment of tissue damage, chronic infection, and autoimmune therpies. PMID:19166386

  17. Hepatocyte-induced CD4+ T cell alloresponse is associated with major histocompatibility complex class II up-regulation on hepatocytes and suppressible by regulatory T cells.

    PubMed

    DeTemple, Daphne E; Oldhafer, Felix; Falk, Christine S; Chen-Wacker, Chen; Figueiredo, Constanca; Kleine, Moritz; Ramackers, Wolf; Timrott, Kai; Lehner, Frank; Klempnauer, Juergen; Bock, Michael; Vondran, Florian W R

    2018-03-01

    Hepatocyte transplantation is a promising therapeutic approach for various liver diseases. Despite the liver's tolerogenic potential, early immune-mediated loss of transplanted cells is observed, and longterm acceptance has not been achieved yet. Patients deemed tolerant after liver transplantation presented an increased frequency of regulatory T cells (Tregs), which therefore also might enable reduction of posttransplant cell loss and enhance longterm allograft acceptance. We hence characterized hepatocyte-induced immune reactions and evaluated the immunomodulatory potential of Tregs applying mixed lymphocyte cultures and mixed lymphocyte hepatocyte cultures. These were set up using peripheral blood mononuclear cells and primary human hepatocytes, respectively. Polyclonally expanded CD4 + CD25 high CD127 low Tregs were added to cocultures in single-/trans-well setups with/without supplementation of anti-interferon γ (IFNγ) antibodies. Hepatocyte-induced alloresponses were then analyzed by multicolor flow cytometry. Measurements indicated that T cell response upon stimulation was associated with IFNγ-induced major histocompatibility complex (MHC) class II up-regulation on hepatocytes and mediated by CD4 + T cells. An indirect route of antigen presentation could be ruled out by use of fragmented hepatocytes and culture supernatants of hepatocytes. Allospecific proliferation was accompanied by inflammatory cytokine secretion. CD8 + T cells showed early up-regulation of CD69 despite lack of cell proliferation in the course of coculture. Supplementation of Tregs effectively abrogated hepatocyte-induced alloresponses and was primarily cell contact dependent. In conclusion, human hepatocytes induce a CD4 + T cell alloresponse in vitro, which is associated with MHC class II up-regulation on hepatocytes and is susceptible to suppression by Tregs. Liver Transplantation 24 407-419 2018 AASLD. © 2018 The Authors. Liver Transplantation published by Wiley Periodicals, Inc. on behalf of American Association for the Study of Liver Diseases.

  18. Persistence of T-cell immune response induced by two acellular pertussis vaccines in children five years after primary vaccination.

    PubMed

    Palazzo, Raffaella; Carollo, Maria; Bianco, Manuela; Fedele, Giorgio; Schiavoni, Ilaria; Pandolfi, Elisabetta; Villani, Alberto; Tozzi, Alberto E; Mascart, Françoise; Ausiello, Clara M

    2016-01-01

    The resurgence of pertussis suggests the need for greater efforts to understand the long-lasting protective responses induced by vaccination. In this paper we dissect the persistence of T memory responses induced by primary vaccination with two different acellular pertussis (aP) vaccines, hexavalent Hexavac® vaccine (Hexavac) (Sanofi Pasteur MSD) and Infanrix hexa® (Infanrix) (Glaxo-SmithKline Biologicals). We evaluated magnitude and duration of T-cell responses to pertussis toxin (PT) by measuring T-cell proliferation, cytokines (IL-2 and IFNγ) production and memory subsets in two groups of children 5 years after primary vaccination. Some of the enrolled children received only primary vaccination, while others had the pre-school boost dose. Positive T-cell responses to PT were detected in 36% of children. Percentage of responsive children, T-cell proliferation and CD4IL-2+ cells were significantly higher in the children primed with Hexavac than in those who received Infanrix vaccine. No major effects of the boost on PT-specific proliferation were observed. Overall, our data documented a persistence of T-cell memory against PT in a minor fraction of children 5 years after primary vaccination. The different responses induced by Hexavac and Infanrix vaccine could rely on differences in PT inactivation process or excipients/adjuvants formulations.

  19. T-cell Responses in Individuals Infected with Zika Virus and in Those Vaccinated Against Dengue Virus.

    PubMed

    Paquin-Proulx, Dominic; Leal, Fabio E; Terrassani Silveira, Cassia G; Maestri, Alvino; Brockmeyer, Claudia; Kitchen, Shannon M; Cabido, Vinicius D; Kallas, Esper G; Nixon, Douglas F

    2017-01-01

    The outbreak of Zika virus (ZIKV) infection in Brazil has raised concerns that infection during pregnancy could cause microcephaly and other severe neurodevelopmental malformations in the fetus. The mechanisms by which ZIKV causes fetal abnormalities are largely unknown. The importance of pre-infection with dengue virus (DENV), or other flaviviruses endemic to Brazil, remains to be investigated. It has been reported that antibodies directed against DENV can increase ZIKV infectivity by antibody dependent enhancement (ADE), suggesting that a history of prior DENV infection might worsen the outcome of ZIKV infection. We used bioinformatics tools to design 18 peptides from the ZIKV envelope containing predicted HLA-I T-cell epitopes and investigated T-cell cross-reactivity between ZIKV-infected individuals and DENV-vaccinated subjects by IFNγ ELISPOT. Three peptides induced IFNγ production in both ZIKV-infected subjects and in DENV-vaccinated individuals. Flow cytometry indicated that 1 ZIKV peptide induced a CD4+ T-cell response in DENV-vaccinated subjects. We demonstrated that vaccination against DENV induced a T-cell response against ZIKV and identified one such CD4+ T-cell epitope. The ZIKV-reactive CD4+ T cells induced by DENV vaccination and identified in this study could contribute to the appearance of cross-reactive antibodies mediating ADE.

  20. Analysis of host versus tumor interaction in cancer patients: opposing role of transforming growth factor-beta1 and interleukin-6 in the development of in situ tumor immunity.

    PubMed

    Tsai, Jy-Ping; Chen, Hsin-Wei; Cheng, Mei-Lien; Liu, Hsiung-Kun; Lee, Yi-Ping; Hsieh, Chia Ling; Luh, Kwen-Tay; Wu, Chew-Wun; Hsu, Li-Han; Chao, Tsu-Yi; Wang, Wen-Hua; Chang, Chung-Ming; Ting, Chou-Chik

    2005-01-01

    A different degree of immunodeficiency is often found at tumor sites in cancer patients. At the late stage many patients develop malignant effusion that contains large numbers of tumor cells and host immune cells that constantly interact with each other. These sites may provide an ideal model to examine in situ anti-tumor immunity. The T cells in effusion were found to be immunodeficient, which suggested a defective anti-tumor cytotoxic T lymphocytes response. To pursue the mechanism for the T cell deficiency, we determined the production of immunomodulating cytokines in the effusion and detected the presence of transforming growth factor-beta1 (TGFbeta), prostaglandin E2, IL-6, IL-10, and IFNgamma. There was no detectable IL-2, IL-4, IL-12, or TNFalpha. The most prominent feature was the presence of TGFbeta and IL-6 at a very high level. Thus, the possible role of these two cytokines on T cell competence was further determined. TGFbeta was found to induce T cell anergy and reduced the production of perforin in T killer cells and their lytic activity. These events lead to the induction of peripheral T cell tolerance with profound T cell deficiency. IL-6 did not affect perforin production or cytolytic activity of the T killer cells. But the CD4+ CD25+ regulatory T cells (TR) that were often employed by TGFbeta to suppress T cell response were reduced in the malignant effusion, consistent with the fact that IL-6 down-regulates TR and this may represent the host's vigorous response to the tumor's subversion. These results show that TGFbeta and IL-6 might play pivotal but opposing roles in the host tumor interaction that, together with other immunomodulating components, determines the outcome for the development of local tumor immunity.

  1. Ganoderic acid Me induces the apoptosis of competent T cells and increases the proportion of Treg cells through enhancing the expression and activation of indoleamine 2,3-dioxygenase in mouse lewis lung cancer cells.

    PubMed

    Que, Zujun; Zou, Fangyuan; Zhang, Anle; Zheng, Yuanhong; Bi, Ling; Zhong, Jianjiang; Tian, Jianhui; Liu, Jianwen

    2014-11-01

    The indoleamine 2,3-dioxygenase-(IDO-) mediated microenvironment plays an important role in tumor immune escape. It is known that ganoderic acid Me can enhance IFN-γ expression and IDO is preferentially induced by IFN-γ. However, whether GA-Me can induce IDO expression has not been clarified yet. We established stable clones of IDO-overexpressing 2 LL cells (2LL-EGFP-IDO). After co-culturing with IDO expressing or control vector-transfected 2LL-EGFP cells, T cell apoptosis was determined and the proportion of the regulatory T cells (Tregs) and CD8+ T cell subset was measured. The total cellular protein samples of 2 LL-EGFP-IDO cells were isolated for detecting JAK-STAT1 signalling pathway. Co-culture supernatants were used to detect amino acids and cytokines. IDO transfected 2 LL cells yielded high level of IDO enzymatic activity, resulting in complete depletion of tryptophan from the culture medium. We found that apoptosis occurred in T cells after cocultured with IDO+2LL cells and the proportion of CD4+CD25+ cells and FoxP3+ cells increased while CD8+ cells decreased. The specific inhibitor of IDO, 1-D-MT and GA-Me efficiently enhanced T cell apoptosis, increased Tregs, and reduced CD8+ T cells in vitro. Increased expression of IDO, p-JAK1 and p-STAT1 were confirmed by Western blot analysis. The levels of IFN-γ, IL-10, LDH and kynurenine in co-culture supernatant correspondingly increased, while tryptophan reduced. These results suggest that GA-Me contributing to IDO helps to create a tolerogenic milieu in lung tumors by directly inducing T cell apoptosis, restraining CD8+ T cell activation, and enhancing Treg-mediated immunosuppression. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. Protection of Bovine Mammary Epithelial Cells from Hydrogen Peroxide-Induced Oxidative Cell Damage by Resveratrol.

    PubMed

    Jin, Xiaolu; Wang, Kai; Liu, Hongyun; Hu, Fuliang; Zhao, Fengqi; Liu, Jianxin

    2016-01-01

    The mammary epithelial cells (MECs) of high-producing dairy cows are likely to be subject to oxidative stress (OS) due to the intensive cell metabolism. The objectives of this study were to investigate the cytoprotective effects of resveratrol against hydrogen peroxide- (H2O2-) induced OS in cultured bovine MECs (MAC-T). Pretreatment of MAC-T cells with resveratrol could rescue the decrease in cell viability and resulted in lower intracellular reactive oxygen species (ROS) accumulation after H2O2 exposure. Resveratrol helped MAC-T cells to prevent H2O2-induced endoplasmic reticulum stress and mitochondria-related cell apoptosis. Moreover, resveratrol induced mRNA expression of multiple antioxidant defense genes in MAC-T cells under normal/oxidative conditions. Nuclear factor erythroid 2-related factor 2 (Nrf2) was required for the cytoprotective effects on MAC-T cells by resveratrol, as knockdown of Nrf2 significantly abolished resveratrol-induced cytoprotective effects against OS. In addition, by using selective inhibitors, we further confirmed that the induction of Nrf2 by resveratrol was mediated through the prolonged activation of PI3K/Akt and ERK/MAPK pathways but negatively regulated by p38/MAPK pathway. Overall, resveratrol has beneficial effects on bovine MECs redox balance and may be potentially used as a therapeutic medicine against oxidative insult in lactating animals.

  3. Small GTPase Tc10 and its homologue RhoT induce N-WASP-mediated long process formation and neurite outgrowth.

    PubMed

    Abe, Tomoyuki; Kato, Masayoshi; Miki, Hiroaki; Takenawa, Tadaomi; Endo, Takeshi

    2003-01-01

    Rho family small GTPases regulate multiple cellular functions through reorganization of the actin cytoskeleton. Among them, Cdc42 and Tc10 induce filopodia or peripheral processes in cultured cells. We have identified a member of the family, designated as RhoT, which is closely related to Tc10. Tc10 was highly expressed in muscular tissues and brain and remarkably induced during differentiation of C2 skeletal muscle cells and neuronal differentiation of PC12 and N1E-115 cells. On the other hand, RhoT was predominantly expressed in heart and uterus and induced during neuronal differentiation of N1E-115 cells. Tc10 exogenously expressed in fibroblasts generated actin-filament-containing peripheral processes longer than the Cdc42-formed filopodia, whereas RhoT produced much longer and thicker processes containing actin filaments. Furthermore, both Tc10 and RhoT induced neurite outgrowth in PC12 and N1E-115 cells, but Cdc42 did not do this by itself. Tc10 and RhoT as well as Cdc42 bound to the N-terminal CRIB-motif-containing portion of N-WASP and activated N-WASP to induce Arp2/3-complex-mediated actin polymerization. The formation of peripheral processes and neurites by Tc10 and RhoT was prevented by the coexpression of dominant-negative mutants of N-WASP. Thus, N-WASP is essential for the process formation and neurite outgrowth induced by Tc10 and RhoT. Neuronal differentiation of PC12 and N1E-115 cells induced by dibutyryl cyclic AMP and by serum starvation, respectively, was prevented by dominant-negative Cdc42, Tc10 and RhoT. Taken together, all these Rho family proteins are required for neuronal differentiation, but they exert their functions differentially in process formation and neurite extension. Consequently, N-WASP activated by these small GTPases mediates neuronal differentiation in addition to its recently identified role in glucose uptake.

  4. L-Selenomethionine Does not Protect Against Testosterone Plus 17β-Estradiol-Induced Oxidative Stress and Pre-Neoplastic Lesions in the Prostate of NBL Rats

    PubMed Central

    Özten, Nur; Schlicht, Michael; Diamond, Alan M.; Bosland, Maarten C.

    2014-01-01

    Previous animal studies examining dietary selenium effects on prostatic carcinogenesis did not show preventive benefit, including one study in a rat model involving testosterone (T) and estradiol (E2)-induced prostatic oxidative stress. Here, we examined modulation of T+E2-induced prostatic oxidative stress, dysplasia, and inflammation by L-selenomethionine at 1.5 or 3.0 mg selenium/kg in NIH-07 diet in Nbl/Crl rats treated with T+E2 for 16 weeks. Hormone treatment increased immunohistochemical staining for 8-hydroxydeoxyguanosine (8-OHdG) in the prostatic sites of T+E2-induced preneoplasia (p<0.05), but selenomethionine did not attenuate 8-OHdG staining and dysplasia in the lateral prostate. Glutathione-peroxidase activity and mRNA expression were induced by T+E2 (p<0.05–p<0.0001) but not changed by selenomethionine. Selenomethionine did not cause significant responses in expression and activity of glutathione-peroxidase and MnSOD, except for a reduction of MnSOD protein expression in the lateral prostate (p<0.01). The absence of reduction of oxidative stress and dysplasia and the minimal effects on antioxidant enzymes caused by selenomethionine are consistent with the null effects observed in selenium supplementation animal studies and clinical trials. Significant (p<0.01) opposite apoptosis/cell proliferation balance responses to selenomethionine and to T+E2 occurred in the lateral and dorsal prostate, explaining why T+E2 induces lesions selectively in the lateral lobe of NBL rats. PMID:24773027

  5. L-selenomethionine does not protect against testosterone plus 17β-estradiol-induced oxidative stress and preneoplastic lesions in the prostate of NBL rats.

    PubMed

    Özten, Nur; Schlicht, Michael; Diamond, Alan M; Bosland, Maarten C

    2014-01-01

    Previous animal studies examining dietary selenium effects on prostatic carcinogenesis did not show preventive benefit, including 1 study in a rat model involving testosterone (T) and estradiol (E2)-induced prostatic oxidative stress. Here, we examined modulation of T + E2-induced prostatic oxidative stress, dysplasia, and inflammation by L-selenomethionine at 1.5 or 3.0 mg selenium/kg in NIH-07 diet in Noble (Nbl)/Crl rats treated with T + E2 for 16 wk. Hormone treatment increased immunohistochemical staining for 8-hydroxydeoxyguanosine (8-OHdG) in the prostatic sites of T + E2-induced preneoplasia (P < 0.05), but selenomethionine did not attenuate 8-OHdG staining and dysplasia in the lateral prostate. Glutathione-peroxidase activity (P < 0.05) and mRNA expression were induced by T + E2 (P < 0.0001) but not changed by selenomethionine. Selenomethionine did not cause significant responses in expression and activity of glutathione-peroxidase and MnSOD, except for a reduction of MnSOD protein expression in the lateral prostate (P < 0.01). The absence of reduction of oxidative stress and dysplasia and the minimal effects on antioxidant enzymes caused by selenomethionine are consistent with the null effects observed in selenium supplementation animal studies and clinical trials. Significant (P < 0.01) opposite apoptosis/cell proliferation balance responses to selenomethionine and to T + E2 occurred in the lateral and dorsal prostate, explaining why T + E2 induces lesions selectively in the lateral lobe of NBL rats.

  6. Homologous Prime-Boost Vaccination with OVA Entrapped in Self-Adjuvanting Archaeosomes Induces High Numbers of OVA-Specific CD8+ T Cells that Protect Against Subcutaneous B16-OVA Melanoma

    PubMed Central

    Stark, Felicity C.; McCluskie, Michael J.; Krishnan, Lakshmi

    2016-01-01

    Homologous prime-boost vaccinations with live vectors typically fail to induce repeated strong CD8+ T cell responses due to the induction of anti-vector immunity, highlighting the need for alternative delivery vehicles. The unique ether lipids of archaea may be constituted into liposomes, archaeosomes, which do not induce anti-carrier responses, making them an ideal candidate for use in repeat vaccination systems. Herein, we evaluated in mice the maximum threshold of antigen-specific CD8+ T cell responses that may be induced by multiple homologous immunizations with ovalbumin (OVA) entrapped in archaeosomes derived from the ether glycerolipids of the archaeon Methanobrevibacter smithii (MS-OVA). Up to three immunizations with MS-OVA administered in optimized intervals (to allow for sufficient resting of the primed cells prior to boosting), induced a potent anti-OVA CD8+ T cell response of up to 45% of all circulating CD8+ T cells. Additional MS-OVA injections did not add any further benefit in increasing the memory of CD8+ T cell frequency. In contrast, OVA expressed by Listeria monocytogenes (LM-OVA), an intracellular bacterial vector failed to evoke a boosting effect after the second injection, resulting in significantly reduced antigen-specific CD8+ T cell frequencies. Furthermore, repeated vaccination with MS-OVA skewed the response increasingly towards an effector memory (CD62low) phenotype. Vaccinated animals were challenged with B16-OVA at late time points after vaccination (+7 months) and were afforded protection compared to control. Therefore, archaeosomes constituted a robust particulate delivery system to unravel the kinetics of CD8+ T cell response induction and memory maintenance and constitute an efficient vaccination regimen optimized for tumor protection. PMID:27869670

  7. IL-7 Promotes T Cell Viability, Trafficking, and Functionality and Improves Survival in Sepsis

    PubMed Central

    Unsinger, Jacqueline; McGlynn, Margaret; Kasten, Kevin R.; Hoekzema, Andrew S.; Watanabe, Eizo; Muenzer, Jared T.; McDonough, Jacquelyn S.; Tschoep, Johannes; Ferguson, Thomas A.; McDunn, Jonathan E.; Morre, Michel; Hildeman, David A.; Caldwell, Charles C.; Hotchkiss, Richard S.

    2010-01-01

    Sepsis is a highly lethal disorder characterized by widespread apoptosis-induced depletion of immune cells and the development of a profound immunosuppressive state. IL-7 is a potent antiapoptotic cytokine that enhances immune effector cell function and is essential for lymphocyte survival. In this study, recombinant human IL-7 (rhIL-7) efficacy and potential mechanisms of action were tested in a murine peritonitis model. Studies at two independent laboratories showed that rhIL-7 markedly improved host survival, blocked apoptosis of CD4 and CD8 T cells, restored IFN-γ production, and improved immune effector cell recruitment to the infected site. Importantly, rhIL-7 also prevented a hallmark of sepsis (i.e., the loss of delayed-type hypersensitivity), which is an IFN-γ– and T cell-dependent response. Mechanistically, rhIL-7 significantly increased the expression of the leukocyte adhesion markers LFA-1 and VLA-4, consistent with its ability to improve leukocyte function and trafficking to the infectious focus. rhIL-7 also increased the expression of CD8. The potent antiapoptotic effect of rhIL-7 was due to increased Bcl-2, as well as to a dramatic decrease in sepsis-induced PUMA, a heretofore unreported effect of IL-7. If additional animal studies support its efficacy in sepsis and if current clinical trials continue to confirm its safety in diverse settings, rhIL-7 should be strongly considered for clinical trials in sepsis. PMID:20200277

  8. Protective effects of Lagerstroemia speciosa on 3-morpholinosydnonimine (SIN-1)-induced oxidative stress in HIT-T15 pancreatic β cells.

    PubMed

    Song, Jia-Le; Zhao, Xin; Wang, Qiang; Zhang, Ting

    2013-05-01

    Reactive oxygen species (ROS)-induced pancreatic β cell death affects insulin secretion and is important in the pathogenesis of diabetes. Lagerstroemia speciosa, a traditional folk medicine, has been used for t he prevention and treatment of diabetes. However, whether Lagerstroemia speciosa has a cytoprotective effect on pancreatic β cells remains to be elucidated. The present study aimed to investigate the cytoprotective effects of hot water extracts from Lagerstroemia speciosa leaves (LWE) on 3-morpholinosydnonimine (SIN-1)-induced oxidative damage in Syrian hamster pancreatic insulinoma HIT-T15 cells. The HIT-T15 cells were first treated with SIN-1 (50 µM) for 24 h and then co-incubated with LWE for 48 h. SIN-1 significantly decreased HIT-T15 cell viability (P<0.05); however, LWE did not exert a significant cytotoxic effect and increased the viability of HIT-T15 cells in a dose‑dependent manner. To further investigate the protective effects of LWE on SIN-1‑induced oxidative stress in HIT-T15 cells, the cellular levels of ROS, lipid peroxidation and endogenous antioxidant enzymes, including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-px), were determined. LWE decreased the intracellular levels of ROS and lipid peroxidation, and increased the activities of antioxidant enzymes. These results suggest that LWE has a cytoprotective effect against SIN-1‑induced oxidative stress in HIT-T15 cells through the inhibition of lipid peroxidation, a decrease in ROS levels and an increase in antioxidant enzyme activity. In addition, LWE increased insulin secretion in SIN-1-treated HIT-T15 cells. Our results suggested that LWE were effective in the treatment of diabetes. Further studies are required to study the anti-diabetic molecular mechanism in a cell model.

  9. α4β7+ CD4+ Effector/Effector Memory T Cells Differentiate into Productively and Latently Infected Central Memory T Cells by Transforming Growth Factor β1 during HIV-1 Infection.

    PubMed

    Cheung, Ka-Wai; Wu, Tongjin; Ho, Sai Fan; Wong, Yik Chun; Liu, Li; Wang, Hui; Chen, Zhiwei

    2018-04-15

    HIV-1 transmission occurs mainly through mucosal tissues. During mucosal transmission, HIV-1 preferentially infects α 4 β 7 + gut-homing CCR7 - CD4 + effector/effector memory T cells (T EM ) and results in massive depletion of these cells and other subsets of T EM in gut-associated lymphoid tissues. However, besides being eliminated by HIV-1, the role of T EM during the early stage of infection remains inconclusive. Here, using in vitro -induced α 4 β 7 + gut-homing T EM (α 4 β 7 + T EM ), we found that α 4 β 7 + T EM differentiated into CCR7 + CD4 + central memory T cells (T CM ). This differentiation was HIV-1 independent but was inhibited by SB431542, a specific transforming growth factor β (TGF-β) receptor I kinase inhibitor. Consistently, T EM -to-T CM differentiation was observed in α 4 β 7 + T EM stimulated with TGF-β1 (TGF-β). The T CM properties of the TGF-β-induced T EM -derived T CM (α 4 β 7 + T CM ) were confirmed by their enhanced CCL19 chemotaxis and the downregulation of surface CCR7 upon T cell activation in vitro Importantly, the effect of TGF-β on T CM differentiation also held in T EM directly isolated from peripheral blood. To investigate the significance of the TGF-β-dependent T EM -to-T CM differentiation in HIV/AIDS pathogenesis, we observed that both productively and latently infected α 4 β 7 + T CM could differentiate from α 4 β 7 + T EM in the presence of TGF-β during HIV-1 infection. Collectively, this study not only provides a new insight for the plasticity of T EM but also suggests that the TGF-β-dependent T EM -to-T CM differentiation is a previously unrecognized mechanism for the formation of latently infected T CM after HIV-1 infection. IMPORTANCE HIV-1 is the causative agent of HIV/AIDS, which has led to millions of deaths in the past 30 years. Although the implementation of highly active antiretroviral therapy has remarkably reduced the HIV-1-related morbidity and mortality, HIV-1 is not eradicated in treated patients due to the presence of latent reservoirs. Besides, the pathogenesis in CD4 T cells early after infection still remains elusive. Immediately after HIV-1 mucosal infection, CD4 T cells are preferentially infected and depleted. However, in addition to being depleted, the other roles of the CD4 T cells, especially the effector/effector memory T cells (T EM ), in disease progression are not completely understood. The significance of this study is in revealing a novel mechanism for the formation of latently HIV-1-infected central memory CD4 T cells, a major latent reservoir from CD4 T EM after infection. Our findings suggest previously unrecognized roles of CD4 T EM in HIV-1 pathogenesis. Copyright © 2018 American Society for Microbiology.

  10. New iridoids from Verbascum nobile and their effect on lectin-induced T cell activation and proliferation.

    PubMed

    Dimitrova, Petya; Alipieva, Kalina; Grozdanova, Tsvetinka; Simova, Svetlana; Bankova, Vassya; Georgiev, Milen I; Popova, Milena P

    2018-01-01

    The Verbascum species are widely used traditional herb remedies against respiratory, inflammatory conditions and disorders. In the present study methanol extract of the aerial parts of the endemic Verbascum nobile Velen, was investigated and two novel iridoid glycosides 1 and 2, together with nine known constituents: iridoids, phenylethanoids, and saponins characteristic of Verbascum genus were identified. Further, the biological activity of the extract and selected isolated compounds on concanavalin (Con A)-induced T cell proliferation and activation of human Jurkat T cell line and splenic murine CD3 T cells was evaluated. T cell growth was studied by colorimetric-based WST proliferation assay while DNA content, cell cycling, dynamic of cell proliferation, expression of activation markers, intracellular expression of cytokine IFN-γ, and phosphorylation of ERK were analyzed by flow cytometry. Caspase-mediated apoptosis resulting in a poly (ADP-ribose) polymerase (PARP) cleavage was assessed by colorimetric in-cell kit. It was found that the extract, and all tested compounds (1, 2, 3 and 9) inhibited lectin-induced cell growth of Jurkat T cell line. The novel compounds decreased the frequencies of cells in S phase without causing a significant cell cycle arrest at G1 phase, caspases-mediated apoptosis and/or a profound change in the dynamic of splenic murine CD3 + T cell proliferation. Both compounds showed stronger inhibitory effect on Con A-induced ERK phosphorylation than the known bioactive compounds 3 and 9, and suppressed the expression of early activation marker CD69, the intracellular level of IFN-γ, and the generation of CD3 + IFN-γ + effectors. Our data suggest that the novel iridoid glycosides might have a potential to modulate T cell-related pathologies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Endothelial cell-derived microparticles induce plasmacytoid dendritic cell maturation: potential implications in inflammatory diseases

    PubMed Central

    Angelot, Fanny; Seillès, Estelle; Biichlé, Sabeha; Berda, Yael; Gaugler, Béatrice; Plumas, Joel; Chaperot, Laurence; Dignat-George, Françoise; Tiberghien, Pierre; Saas, Philippe; Garnache-Ottou, Francine

    2009-01-01

    Background Increased circulating endothelial microparticles, resulting from vascular endothelium dysfunction, and plasmacytoid dendritic cell activation are both encountered in common inflammatory disorders. The aim of our study was to determine whether interactions between endothelial microparticles and plasmacytoid dendritic cells could contribute to such pathologies. Design and Methods Microparticles generated from endothelial cell lines, platelets or activated T cells were incubated with human plasmacytoid dendritic cells sorted from healthy donor blood or with monocyte-derived dendritic cells. Dendritic cell maturation was evaluated by flow cytometry, cytokine secretion as well as naive T-cell activation and polarization. Labeled microparticles were also used to study cellular interactions. Results Endothelial microparticles induced plasmacytoid dendritic cell maturation. In contrast, conventional dendritic cells were resistant to endothelial microparticle-induced maturation. In addition to upregulation of co-stimulatory molecules, endothelial microparticle-matured plasmacytoid dendritic cells secreted inflammatory cytokines (interleukins 6 and 8, but no interferon-α) and also induced allogeneic naive CD4+ T cells to proliferate and to produce type 1 cytokines such as interferon-γ and tumor necrosis factor-α. Endothelial microparticle endocytosis by plasmacytoid dendritic cells appeared to be required for plasmacytoid dendritic cell maturation. Importantly, the ability of endothelial microparticles to induce plasmacytoid dendritic cells to mature was specific as microparticles derived from activated T cells or platelets (the major source of circulating microparticules in healthy subjects) did not induce such plasmacytoid dendritic cell maturation. Conclusions Our data show that endothelial microparticles specifically induce plasmacytoid dendritic cell maturation and production of inflammatory cytokines. This novel activation pathway may be implicated in various inflammatory disorders and endothelial microparticles could be an important immunmodulatory therapeutic target. PMID:19648164

  12. Engagement of Cytotoxic T Lymphocyte–associated Antigen 4 (CTLA-4) Induces Transforming Growth Factor β (TGF-β) Production by Murine CD4+ T Cells

    PubMed Central

    Chen, Wanjun; Jin, Wenwen; Wahl, Sharon M.

    1998-01-01

    Evidence indicates that cytotoxic T lymphocyte–associated antigen 4 (CTLA-4) may negatively regulate T cell activation, but the basis for the inhibitory effect remains unknown. We report here that cross-linking of CTLA-4 induces transforming growth factor β (TGF-β) production by murine CD4+ T cells. CD4+ T helper type 1 (Th1), Th2, and Th0 clones all secrete TGF-β after antibody cross-linking of CTLA-4, indicating that induction of TGF-β by CTLA-4 signaling represents a ubiquitous feature of murine CD4+ T cells. Stimulation of the CD3–T cell antigen receptor complex does not independently induce TGF-β, but is required for optimal CTLA-4–mediated TGF-β production. The consequences of cross-linking of CTLA-4, together with CD3 and CD28, include inhibition of T cell proliferation and interleukin (IL)-2 secretion, as well as suppression of both interferon γ (Th1) and IL-4 (Th2). Moreover, addition of anti–TGF-β partially reverses this T cell suppression. When CTLA-4 was cross-linked in T cell populations from TGF-β1 gene–deleted (TGF-β1−/−) mice, the T cell responses were only suppressed 38% compared with 95% in wild-type mice. Our data demonstrate that engagement of CTLA-4 leads to CD4+ T cell production of TGF-β, which, in part, contributes to the downregulation of T cell activation. CTLA-4, through TGF-β, may serve as a counterbalance for CD28 costimulation of IL-2 and CD4+ T cell activation. PMID:9815262

  13. Identification of a G protein coupled receptor induced in activated T cells.

    PubMed

    Kaplan, M H; Smith, D I; Sundick, R S

    1993-07-15

    Many genes are induced after T cell activation to make a cell competent for proliferation and ultimately, function. Many of these genes encode surface receptors for growth factors that signal a cell to proliferate. We have cloned a novel gene (clone 6H1) that codes for a member of the G protein-coupled receptor superfamily. This gene was isolated from a chicken activated T cell cDNA library by low level hybridization to mammalian IL-2 cDNA probes. The 308 amino acid open reading frame has seven hydrophobic, presumably transmembrane domains and a consensus site for interaction with G proteins. Tissue distribution studies suggest that gene expression is restricted to activated T cells. The message appears by 1 h after activation and is maintained for at least 45 h. Transcription of 6H1 is induced by a number of T cell stimuli and is inhibited by cyclosporin A, but not by cycloheximide. This is the first description of a member of this superfamily expressed specifically in activated T cells. The gene product may provide a link between T cell growth factors and G protein activation.

  14. Immunotherapy of murine retrovirus-induced acquired immunodeficiency by CD4 T regulatory cell depletion and PD-1 blockade.

    PubMed

    Li, Wen; Green, William R

    2011-12-01

    LP-BM5 retrovirus induces a complex disease featuring an acquired immunodeficiency syndrome termed murine AIDS (MAIDS) in susceptible strains of mice, such as C57BL/6 (B6). CD4 T helper effector cells are required for MAIDS induction and progression of viral pathogenesis. CD8 T cells are not needed for viral pathogenesis, but rather, are essential for protection from disease in resistant strains, such as BALB/c. We have discovered an immunodominant cytolytic T lymphocyte (CTL) epitope encoded in a previously unrecognized LP-BM5 retroviral alternative (+1 nucleotide [nt]) gag translational open reading frame. CTLs specific for this cryptic gag epitope are the basis of protection from LP-BM5-induced immunodeficiency in BALB/c mice, and the inability of B6 mice to mount an anti-gag CTL response appears critical to the initiation and progression of LP-BM5-induced MAIDS. However, uninfected B6 mice primed by LP-BM5-induced tumors can generate CTL responses to an LP-BM5 retrovirus infection-associated epitope(s) that is especially prevalent on such MAIDS tumor cells, indicating the potential to mount a protective CD8 T-cell response. Here, we utilized this LP-BM5 retrovirus-induced disease system to test whether modulation of normal immune down-regulatory mechanisms can alter retroviral pathogenesis. Thus, following in vivo depletion of CD4 T regulatory (Treg) cells and/or selective interruption of PD-1 negative signaling in the CD8 T-cell compartment, retroviral pathogenesis was significantly decreased, with the combined treatment of CD4 Treg cell depletion and PD-1 blockade working in a synergistic fashion to substantially reduce the induction of MAIDS.

  15. Peroxisome Proliferator-Activated Receptor γ Deficiency in T Cells Accelerates Chronic Rejection by Influencing the Differentiation of CD4+ T Cells and Alternatively Activated Macrophages

    PubMed Central

    Ye, Ping; Cheng, Chao; Wu, Jie; Wang, Sihua; Sun, Yuan; Liu, Zheng; Xie, Aini; Xia, Jiahong

    2014-01-01

    Background In a previous study, activation of the peroxisome proliferator–activated receptor γ (PPARγ) inhibited chronic cardiac rejection. However, because of the complexity of chronic rejection and the fact that PPARγ is widely expressed in immune cells, the mechanism of the PPARγ - induced protective effect was unclear. Materials and Methods A chronic rejection model was established using B6.C-H-2bm12KhEg (H-2bm12) mice as donors, and MHC II-mismatched T-cell-specific PPARγ knockout mice or wild type (WT) littermates as recipients. The allograft lesion was assessed by histology and immunohistochemistry. T cells infiltrates in the allograft were isolated, and cytokines and subpopulations were detected using cytokine arrays and flow cytometry. Transcription levels in the allograft were measured by RT-PCR. In vitro, the T cell subset differentiation was investigated after culture in various polarizing conditions. PPARγ-deficient regularory T cells (Treg) were cocultured with monocytes to test their ability to induce alternatively activated macrophages (AAM). Results T cell-specific PPARγ knockout recipients displayed reduced cardiac allograft survival and an increased degree of pathology compared with WT littermates. T cell-specific PPARγ knockout resulted in more CD4+ T cells infiltrating into the allograft and altered the Th1/Th2 and Th17/Treg ratios. The polarization of AAM was also reduced by PPARγ deficiency in T cells through the action of Th2 and Treg. PPARγ-deficient T cells eliminated the pioglitazone-induced polarization of AAM and reduced allograft survival. Conclusions PPARγ-deficient T cells influenced the T cell subset and AAM polarization in chronic allograft rejection. The mechanism of PPARγ activation in transplantation tolerance could yield a novel treatment without side effects. PMID:25383620

  16. Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9.

    PubMed

    Dumoutier, L; Louahed, J; Renauld, J C

    2000-02-15

    IL-9 is a Th2 cytokine active on various cell types such as T and B lymphocytes, mast cells, and eosinophils, and potentially involved in allergy and asthma. To understand better the molecular mechanisms underlying the activity of this cytokine, we used a cDNA subtraction method to identify genes specifically induced by IL-9 in mouse T cells. One of the IL-9-regulated genes isolated by this approach turned out to encode a 180-amino acid long protein, including a potential signal peptide, and showing 22% amino acid identity with IL-10. This protein, designated IL-10-related T cell-derived inducible factor (IL-TIF), is induced by IL-9 in thymic lymphomas, T cells, and mast cells, and by lectins in freshly isolated splenocytes. Experiments concerning the mechanism regulating IL-TIF expression in T cells indicate that IL-9 induction is rapid (within 1 h), does not require protein synthesis, and depends on the activation of the Janus kinase (JAK)-STAT pathway. In vivo, constitutive expression of IL-TIF was detected by RT-PCR in thymus and brain, suggesting that the role of this new factor is not restricted to the immune system. Transfection of HEK293 cells with the IL-TIF cDNA resulted in the production of a glycosylated protein of about 25 kDa that was found to induce STAT activation in mesangial and neuronal cell lines. Further studies will have to address the possibility that some of the IL-9 activities may be mediated by IL-TIF.

  17. A Novel Bcl-x Isoform Connected to the T Cell Receptor Regulates Apoptosis in T Cells

    PubMed Central

    Yang, Xiao-Feng; Weber, Georg F.

    2014-01-01

    Summary We define a novel Bcl-x isoform, Bcl-xγ, that is generated by alternative splicing and characterized by a unique 47 amino acid C-terminus. Bcl-xγ is expressed primarily in thymocytes, where it may depend on an interaction between the TCR and host MHC products, and in mature T cells, where its expression is associated with ligation of the T cell receptor. Overexpression of Bcl-xγ in T cells inhibits activation-induced apoptosis; inhibition of Bcl-xγ, after stable expression of Bcl-xγ antisense cDNA, enhances activation-induced apoptosis. In contrast to other Bcl-x isoforms, cells that fail to express Bcl-xγ after CD3 ligation undergo programmed cell death, while activated T cells that express Bcl-xγ are spared. Identification of Bcl-xγ helps provide amolecular explanation of T cell activation and death after antigen engagement. PMID:9390687

  18. Infliximab induces clonal expansion of γδ-T cells in Crohn's disease: a predictor of lymphoma risk?

    PubMed

    Kelsen, Jens; Dige, Anders; Schwindt, Heinrich; D'Amore, Francesco; Pedersen, Finn S; Agnholt, Jørgen; Christensen, Lisbet A; Dahlerup, Jens F; Hvas, Christian L

    2011-03-31

    Concominant with the widespread use of combined immunotherapy in the management of Crohn's disease (CD), the incidence of hepato-splenic gamma-delta (γδ)-T cell lymphoma has increased sharply in CD patients. Malignant transformation of lymphocytes is believed to be a multistep process resulting in the selection of malignant γδ-T cell clones. We hypothesised that repeated infusion of anti-TNF-α agents may induce clonal selection and that concurrent treatment with immunomodulators further predisposes patients to γδ-T cell expansion. We investigated dynamic changes in the γδ-T cells of patient with CD following treatment with infliximab (Remicade®; n=20) or adalimumab (Humira®; n=26) using flow cytometry. In patients with a high γδ-T cell level, the γδ-T cells were assessed for clonality. Of these 46 CD patients, 35 had a γδ-T cells level (mean 1.6%) comparable to healthy individuals (mean 2.2%), and 11 CD patients (24%) exhibited an increased level of γδ-T cells (5-15%). In the 18 patients also receiving thiopurines or methotrexate, the average baseline γδ-T cell level was 4.4%. In three male CD patients with a high baseline value, the γδ-T cell population increased dramatically following infliximab therapy. A fourth male patient also on infliximab monotherapy presented with 20% γδ-T cells, which increased to 25% shortly after treatment and was 36% between infusions. Clonality studies revealed an oligoclonal γδ-T cell pattern with dominant γδ-T cell clones. In support of our clinical findings, in vitro experiments showed a dose-dependent proliferative effect of anti-TNF-α agents on γδ-T cells. CD patients treated with immunomodulators had constitutively high levels of γδ-T cells. Infliximab exacerbated clonal γδ-T cell expansion in vivo and induced γδ-T cell proliferation in vitro. Overall, young, male CD patients with high baseline γδ-T cell levels may be at an increased risk of developing malignant γδ-T cell lymphomas following treatment with anti-TNF-α agents.

  19. Distinct p300-Responsive Mechanisms Promote Caspase-Dependent Apoptosis by Human T-Cell Lymphotropic Virus Type 1 Tax Protein

    PubMed Central

    Nicot, Christophe; Harrod, Robert

    2000-01-01

    The dysregulation of cellular apoptosis pathways has emerged as a critical early event associated with the development of many types of human cancers. Numerous viral and cellular oncogenes, aside from their inherent transforming properties, are known to induce programmed cell death, consistent with the hypothesis that genetic defects are required to support tumor survival. Here, we report that nuclear expression of the CREB-binding protein (CBP)/p300-binding domain of the human T-cell lymphotropic virus type 1 (HTLV-1) transactivator, Tax, triggers an apoptotic death-inducing signal during short-term clonal analyses, as well as in transient cell death assays. Coexpression of the antiapoptotic factor Bcl-2 increased serum stimulation; incubation with the chemical caspase inhibitor z-Val-Ala-dl-Asp fluoromethylketone antagonized Tax-induced cell death. The CBP/p300-binding defective Tax mutants K88A and V89A exhibited markedly reduced cytotoxic effects compared to the wild-type Tax protein. Importantly, nuclear expression of the minimal CBP/p300-binding peptide of Tax induced apoptosis in the absence of Tax-dependent transcriptional activities, while its K88A counterpart did not cause cell death. Further, Tax-mediated apoptosis was effectively prevented by ectopic expression of the p300 coactivator. We also report that activation of the NF-κB transcription pathway by Tax, under growth arrest conditions, results in apoptosis that occurs independent of direct Tax coactivator effects. Our results allude to a novel pivotal role for the transcriptional coactivator p300 in determining cell fate and raise the possibility that dysregulated coactivator usage may pose an early barrier to transformation that must be selectively overcome as a prerequisite for the initiation of neoplasia. PMID:11046153

  20. Distinct p300-responsive mechanisms promote caspase-dependent apoptosis by human T-cell lymphotropic virus type 1 Tax protein.

    PubMed

    Nicot, C; Harrod, R

    2000-11-01

    The dysregulation of cellular apoptosis pathways has emerged as a critical early event associated with the development of many types of human cancers. Numerous viral and cellular oncogenes, aside from their inherent transforming properties, are known to induce programmed cell death, consistent with the hypothesis that genetic defects are required to support tumor survival. Here, we report that nuclear expression of the CREB-binding protein (CBP)/p300-binding domain of the human T-cell lymphotropic virus type 1 (HTLV-1) transactivator, Tax, triggers an apoptotic death-inducing signal during short-term clonal analyses, as well as in transient cell death assays. Coexpression of the antiapoptotic factor Bcl-2 increased serum stimulation; incubation with the chemical caspase inhibitor z-Val-Ala-DL-Asp fluoromethylketone antagonized Tax-induced cell death. The CBP/p300-binding defective Tax mutants K88A and V89A exhibited markedly reduced cytotoxic effects compared to the wild-type Tax protein. Importantly, nuclear expression of the minimal CBP/p300-binding peptide of Tax induced apoptosis in the absence of Tax-dependent transcriptional activities, while its K88A counterpart did not cause cell death. Further, Tax-mediated apoptosis was effectively prevented by ectopic expression of the p300 coactivator. We also report that activation of the NF-kappaB transcription pathway by Tax, under growth arrest conditions, results in apoptosis that occurs independent of direct Tax coactivator effects. Our results allude to a novel pivotal role for the transcriptional coactivator p300 in determining cell fate and raise the possibility that dysregulated coactivator usage may pose an early barrier to transformation that must be selectively overcome as a prerequisite for the initiation of neoplasia.

  1. Intracerebral Mycobacterium bovis bacilli Calmette-Guerin infection-induced immune responses in the CNS 1

    PubMed Central

    Lee, JangEun; Ling, Changying; Kosmalski, Michelle M.; Hulseberg, Paul; Schreiber, Heidi A.; Sandor, Matyas; Fabry, Zsuzsanna

    2010-01-01

    To study whether cerebral mycobacterial infection induces granuloma and protective immunity similar to systemic infection, we intracerebrally infected mice with Mycobacterium bovis bacilli Calmette-Guerin. Granuloma and IFN-γ+CD4+ T cell responses are induced in the central nervous system (CNS) similar to periphery, but the presence of IFN-γIL-17 double-positive CD4+ T cells is unique to the CNS. The major CNS source of TNF-α is microglia, with modest production by CD4+ T cells and macrophage. Protective immunity is accompanied by accumulation of Foxp3+CD4+ T cells and PD-L2+ dendritic cells, suggesting that both inflammatory and anti-inflammatory responses develop in the CNS following mycobacterial infection. PMID:19535154

  2. Autologous dendritic cells transfected with prostate-specific antigen RNA stimulate CTL responses against metastatic prostate tumors

    PubMed Central

    Heiser, Axel; Coleman, Doris; Dannull, Jens; Yancey, Donna; Maurice, Margaret A.; Lallas, Costas D.; Dahm, Philipp; Niedzwiecki, Donna; Gilboa, Eli; Vieweg, Johannes

    2002-01-01

    Autologous dendritic cells (DCs) transfected with mRNA encoding prostate-specific antigen (PSA) are able to stimulate potent, T cell–mediated antitumor immune responses in vitro. A phase I trial was performed to evaluate this strategy for safety, feasibility, and efficacy to induce T cell responses against the self-protein PSA in patients with metastatic prostate cancer. In 13 study subjects, escalating doses of PSA mRNA–transfected DCs were administered with no evidence of dose-limiting toxicity or adverse effects, including autoimmunity. Induction of PSA-specific T cell responses was consistently detected in all patients, suggesting in vivo bioactivity of the vaccine. Vaccination was further associated with a significant decrease in the log slope PSA in six of seven subjects; three patients that could be analyzed exhibited a transient molecular clearance of circulating tumor cells. The demonstration of vaccine safety, successful in vivo induction of PSA-specific immunity, and impact on surrogate clinical endpoints provides a scientific rationale for further clinical investigation of RNA-transfected DCs in the treatment of human cancer. PMID:11828001

  3. B cells regulate thymic CD8+T cell differentiation in lupus-prone mice.

    PubMed

    Xing, Chen; Zhu, Gaizhi; Xiao, He; Fang, Ying; Liu, Xiaoling; Han, Gencheng; Chen, Guojiang; Hou, Chunmei; Shen, Beifen; Li, Yan; Ma, Ning; Wang, Renxi

    2017-10-27

    Previous studies have shown that under normal physiological conditions thymic B cells play a critical function in T cell negative selection. We tested the effect of thymic B cells on thymic T-cell differentiation in autoimmune diseases including systemic lupus erythematosus (SLE). We found that thymic B cells and CD8 - CD4 + and CD4 - CD8 + T cells increased, whereas CD4 + CD8 + T cells decreased in lupus-prone mice. Once B cells were reduced, the change was reversed. Furthermore, we found that B cells blocked thymic immature single positive (ISP) CD4 - CD8 + CD3 lo/- RORγt - T cells progression into CD4 + CD8 + T cells. Interestingly, we found a novel population of thymic immature T cells (CD4 - CD8 + CD3 lo RORγt + ) that were induced into mature CD4 - CD8 + CD3 + RORγt + T cells by B cells in lupus-prone mice. Importantly, we found that IgG, produced by thymic B cells, played a critical role in the differentiation of thymic CD8 + ISP and mature RORγt + CD8 + T cells in lupus-prone mice. In conclusion, B cells blocked the differentiation from thymic CD8 + ISP and induced the differentiation of a novel immature CD4 - CD8 + CD3 lo RORγt + T cells into mature RORγt + CD8 + T cells by secreting IgG antibody in lupus-prone mice.

  4. Enhancing the Effects of Low Dose Doxorubicin Treatment by the Radiation in T47D and SKBR3 Breast Cancer Cells

    PubMed Central

    Aghaee, Fahimeh; Baradaran, Behzad; Mesbahi, Asghar; Mohammadzadeh, Mohammad; Jafarabadi, Mohammad Asghari

    2013-01-01

    Purpose Breast cancer is the most common malignancy of women worldwide. Radiotherapy consists of a vital element in the treatment of breast cancer but relative side effects and different radioactive responses are limiting factors for a successful treatment. Doxorubicin has been used to treat cancers for over 30 years and is considered as the most effective drug in the treatment of breast cancer. There are also many chronic side effects that limit the amount of doxorubicin that can be administered. The combined radio-drug treatment, with low doses, can be an approach for reducing side effects from single modality treatments instead of suitable cure rates. Methods We have studied the effect of 1, 1.5, and 2 Gy doses of 9 MV X-rays along with 1 µM doxorubicin on inducing cell death, apoptosis and also p53 and PTEN gene expression in T47D and SKBR3 breast cancer cells. Results Doxorubicin treatment resulted in upregulation of radiation-induced levels of p53 and downregulation of PTEN at 1 and 1.5 Gy in T47D breast cancer cells, as well as downregulation of p53 mRNA level of expression and upregulation of PTEN mRNA level of expression in SKBR3 breast cancer cell line. In addition, doxorubicin in combination with radiation decreased the viability of breast cancer cell lines in the both cell lines. Conclusion Low doses of doxorubicin, with least cell toxicity, may be an effective treatment for breast cancer when used in conjunction with ionizing radiation. PMID:23843848

  5. Profound CD4+/CCR5+ T cell expansion is induced by CD8+ lymphocyte depletion but does not account for accelerated SIV pathogenesis

    PubMed Central

    Okoye, Afam; Park, Haesun; Rohankhedkar, Mukta; Coyne-Johnson, Lia; Lum, Richard; Walker, Joshua M.; Planer, Shannon L.; Legasse, Alfred W.; Sylwester, Andrew W.; Piatak, Michael; Lifson, Jeffrey D.; Sodora, Donald L.; Villinger, Francois; Axthelm, Michael K.; Schmitz, Joern E.

    2009-01-01

    Depletion of CD8+ lymphocytes during acute simian immunodeficiency virus (SIV) infection of rhesus macaques (RMs) results in irreversible prolongation of peak-level viral replication and rapid disease progression, consistent with a major role for CD8+ lymphocytes in determining postacute-phase viral replication set points. However, we report that CD8+ lymphocyte depletion is also associated with a dramatic induction of proliferation among CD4+ effector memory T (TEM) cells and, to a lesser extent, transitional memory T (TTrM) cells, raising the question of whether an increased availability of optimal (activated/proliferating), CD4+/CCR5+ SIV “target” cells contributes to this accelerated pathogenesis. In keeping with this, depletion of CD8+ lymphocytes in SIV− RMs led to a sustained increase in the number of potential CD4+ SIV targets, whereas such depletion in acute SIV infection led to increased target cell consumption. However, we found that the excess CD4+ TEM cell proliferation of CD8+ lymphocyte–depleted, acutely SIV-infected RMs was completely inhibited by interleukin (IL)-15 neutralization, and that this inhibition did not abrogate the rapidly progressive infection in these RMs. Moreover, although administration of IL-15 during acute infection induced robust CD4+ TEM and TTrM cell proliferation, it did not recapitulate the viral dynamics of CD8+ lymphocyte depletion. These data suggest that CD8+ lymphocyte function has a larger impact on the outcome of acute SIV infection than the number and/or activation status of target cells available for infection and viral production. PMID:19546246

  6. Vaccination with live attenuated simian immunodeficiency virus causes dynamic changes in intestinal CD4+CCR5+ T cells

    PubMed Central

    2011-01-01

    Background Vaccination with live attenuated SIV can protect against detectable infection with wild-type virus. We have investigated whether target cell depletion contributes to the protection observed. Following vaccination with live attenuated SIV the frequency of intestinal CD4+CCR5+ T cells, an early target of wild-type SIV infection and destruction, was determined at days 3, 7, 10, 21 and 125 post inoculation. Results In naive controls, modest frequencies of intestinal CD4+CCR5+ T cells were predominantly found within the LPL TTrM-1 and IEL TTrM-2 subsets. At day 3, LPL and IEL CD4+CCR5+ TEM cells were dramatically increased whilst less differentiated subsets were greatly reduced, consistent with activation-induced maturation. CCR5 expression remained high at day 7, although there was a shift in subset balance from CD4+CCR5+ TEM to less differentiated TTrM-2 cells. This increase in intestinal CD4+CCR5+ T cells preceded the peak of SIV RNA plasma loads measured at day 10. Greater than 65.9% depletion of intestinal CD4+CCR5+ T cells followed at day 10, but overall CD4+ T cell homeostasis was maintained by increased CD4+CCR5- T cells. At days 21 and 125, high numbers of intestinal CD4+CCR5- naive TN cells were detected concurrent with greatly increased CD4+CCR5+ LPL TTrM-2 and IEL TEM cells at day 125, yet SIV RNA plasma loads remained low. Conclusions This increase in intestinal CD4+CCR5+ T cells, following vaccination with live attenuated SIV, does not correlate with target cell depletion as a mechanism of protection. Instead, increased intestinal CD4+CCR5+ T cells may correlate with or contribute to the protection conferred by vaccination with live attenuated SIV. PMID:21291552

  7. IL-7 signaling imparts polyfunctionality and stemness potential to CD4+ T cells

    PubMed Central

    Ding, Zhi-Chun; Liu, Chufeng; Cao, Yang; Habtetsion, Tsadik; Kuczma, Michal; Pi, Wenhu; Kong, Heng; Cacan, Ercan; Greer, Susanna F.; Cui, Yan; Blazar, Bruce R.; Munn, David H.; Zhou, Gang

    2016-01-01

    ABSTRACT The functional status of CD4+ T cells is a critical determinant of antitumor immunity. Polyfunctional CD4+ T cells possess the ability to concomitantly produce multiple Th1-type cytokines, exhibiting a functional attribute desirable for cancer immunotherapy. However, the mechanisms by which these cells are induced are neither defined nor it is clear if these cells can be used therapeutically to treat cancer. Here, we report that CD4+ T cells exposed to exogenous IL-7 during antigenic stimulation can acquire a polyfunctional phenotype, characterized by their ability to simultaneously express IFNγ, IL-2, TNFα and granzyme B. This IL-7-driven polyfunctional phenotype was associated with increased histone acetylation in the promoters of the effector genes, indicative of increased chromatin accessibility. Moreover, forced expression of a constitutively active (CA) form of STAT5 recapitulated IL-7 in inducing CD4+ T-cell polyfunctionality. Conversely, the expression of a dominant negative (DN) form of STAT5 abolished the ability of IL-7 to induce polyfunctional CD4+ T cells. These in-vitro-generated polyfunctional CD4+ T cells can traffic to tumor and expand intratumorally in response to immunization. Importantly, adoptive transfer of polyfunctional CD4+ T cells following lymphodepletive chemotherapy was able to eradicate large established tumors. This beneficial outcome was associated with the occurrence of antigen epitope spreading, activation of the endogenous CD8+ T cells and persistence of donor CD4+ T cells exhibiting memory stem cell attributes. These findings indicate that IL-7 signaling can impart polyfunctionality and stemness potential to CD4+ T cells, revealing a previously unknown property of IL-7 that can be exploited in adoptive T-cell immunotherapy. PMID:27471650

  8. Protective effects of Korean red ginseng against radiation-induced apoptosis in human HaCaT keratinocytes

    PubMed Central

    Chang, Jae Won; Park, Keun Hyung; HWANG, Hye Sook; Shin, Yoo Seob; Oh, Young-Taek; Kim, Chul-Ho

    2014-01-01

    Radiation-induced oral mucositis is a dose-limiting toxic side effect for patients with head and neck cancer. Numerous attempts at improving radiation-induced oral mucositis have not produced a qualified treatment. Ginseng polysaccharide has multiple immunoprotective effects. Our aim was to investigate the effectiveness of Korean red ginseng (KRG) on radiation-induced damage in the human keratinocyte cell line HaCaT and in an in vivo zebrafish model. Radiation inhibited HaCaT cell proliferation and migration in a cell viability assay and wound healing assay, respectively. KRG protected against these effects. KRG attenuated the radiation-induced embryotoxicity in the zebrafish model. Irradiation of HaCaT cells caused apoptosis and changes in mitochondrial membrane potential (MMP). KRG inhibited the radiation-induced apoptosis and intracellular generation of reactive oxygen species (ROS), and stabilized the radiation-induced loss of MMP. Western blots revealed KRG-mediated reduced expression of ataxia telangiectasia mutated protein (ATM), p53, c-Jun N-terminal kinase (JNK), p38 and cleaved caspase-3, compared with their significant increase after radiation treatment. The collective results suggest that KRG protects HaCaT cells by blocking ROS generation, inhibiting changes in MMP, and inhibiting the caspase, ATM, p38 and JNK pathways. PMID:24078877

  9. Protective effects of Korean red ginseng against radiation-induced apoptosis in human HaCaT keratinocytes.

    PubMed

    Chang, Jae Won; Park, Keun Hyung; Hwang, Hye Sook; Shin, Yoo Seob; Oh, Young-Taek; Kim, Chul-Ho

    2014-03-01

    Radiation-induced oral mucositis is a dose-limiting toxic side effect for patients with head and neck cancer. Numerous attempts at improving radiation-induced oral mucositis have not produced a qualified treatment. Ginseng polysaccharide has multiple immunoprotective effects. Our aim was to investigate the effectiveness of Korean red ginseng (KRG) on radiation-induced damage in the human keratinocyte cell line HaCaT and in an in vivo zebrafish model. Radiation inhibited HaCaT cell proliferation and migration in a cell viability assay and wound healing assay, respectively. KRG protected against these effects. KRG attenuated the radiation-induced embryotoxicity in the zebrafish model. Irradiation of HaCaT cells caused apoptosis and changes in mitochondrial membrane potential (MMP). KRG inhibited the radiation-induced apoptosis and intracellular generation of reactive oxygen species (ROS), and stabilized the radiation-induced loss of MMP. Western blots revealed KRG-mediated reduced expression of ataxia telangiectasia mutated protein (ATM), p53, c-Jun N-terminal kinase (JNK), p38 and cleaved caspase-3, compared with their significant increase after radiation treatment. The collective results suggest that KRG protects HaCaT cells by blocking ROS generation, inhibiting changes in MMP, and inhibiting the caspase, ATM, p38 and JNK pathways.

  10. PubMed

    Galaine, Jeanne; Godet, Yann; Adotévi, Olivier

    2016-11-01

    T cells activation is a finely regulated process to establish an effective anti-infectious or antitumor immune response while avoiding harmful autoimmune reactions. Although T cells are considered to be the main protagonists of the antitumor immune response, they act in interaction with other immune cells. The meeting of naive T cells with dendritic cells induces their differentiation into effector cells following the recognition of the peptide-MHC complex by the T cell receptor. The interaction of costimulatory molecules present on the surface of T cells with their ligand (s) expressed by mature dendritic cells contribute to the optimal T cell activation and to the formation of the immunological synapse. Conversely, engagement of inhibitory receptors expressed by T cells induces a negative feedback involved in the T cells homeostasis but also in the tumor escape from the immune system. The integration of stimulatory signals contributes to the proliferation, the survival and the differentiation of T cells whereas the inhibitory signals permit their regulation. The better understanding of T cell activation mechanisms has led to the development of therapeutic strategies aimed at stimulating the antitumor immune response or alleviating the immunosuppression. © 2016 Société Française du Cancer. Publié par Elsevier Masson SAS. Tous droits réservés.

  11. Mycobacterium leprae-Infected Macrophages Preferentially Primed Regulatory T Cell Responses and Was Associated with Lepromatous Leprosy.

    PubMed

    Yang, Degang; Shui, Tiejun; Miranda, Jake W; Gilson, Danny J; Song, Zhengyu; Chen, Jia; Shi, Chao; Zhu, Jianyu; Yang, Jun; Jing, Zhichun

    2016-01-01

    The persistence of Mycobacterium leprae (M. leprae) infection is largely dependent on the types of host immune responses being induced. Macrophage, a crucial modulator of innate and adaptive immune responses, could be directly infected by M. leprae. We therefore postulated that M. leprae-infected macrophages might have altered immune functions. Here, we treated monocyte-derived macrophages with live or killed M. leprae, and examined their activation status and antigen presentation. We found that macrophages treated with live M. leprae showed committed M2-like function, with decreased interleukin 1 beta (IL-1beta), IL-6, tumor necrosis factor alpha (TNF-alpha) and MHC class II molecule expression and elevated IL-10 and CD163 expression. When incubating with naive T cells, macrophages treated with live M. leprae preferentially primed regulatory T (Treg) cell responses with elevated FoxP3 and IL-10 expression, while interferon gamma (IFN-gamma) expression and CD8+ T cell cytotoxicity were reduced. Chromium release assay also found that live M. leprae-treated macrophages were more resistant to CD8+ T cell-mediated cytotoxicity than sonicated M. leprae-treated monocytes. Ex vivo studies showed that the phenotype and function of monocytes and macrophages had clear differences between L-lep and T-lep patients, consistent with the in vitro findings. Together, our data demonstrate that M. leprae could utilize infected macrophages by two mechanisms: firstly, M. leprae-infected macrophages preferentially primed Treg but not Th1 or cytotoxic T cell responses; secondly, M. leprae-infected macrophages were more effective at evading CD8+ T cell-mediated cytotoxicity.

  12. Immunization-induced anaplasma marginale-specific T lymphocyte reponses impaired by A. marginale infection are restored after eliminating the infection with tetracycline

    USDA-ARS?s Scientific Manuscript database

    Infection of cattle with Anaplasma marginale fails to prime sustained effector/memory T-cell responses, and high bacterial load may induce antigen-specific CD4 T exhaustion and deletion. We tested the hypothesis that clearance of persistent infection restores the exhausted T-cell response. We show t...

  13. Features of Effective T Cell-Inducing Vaccines against Chronic Viral Infections

    PubMed Central

    Panagioti, Eleni; Klenerman, Paul; Lee, Lian N.; van der Burg, Sjoerd H.; Arens, Ramon

    2018-01-01

    For many years, the focus of prophylactic vaccines was to elicit neutralizing antibodies, but it has become increasingly evident that T cell-mediated immunity plays a central role in controlling persistent viral infections such as with human immunodeficiency virus, cytomegalovirus, and hepatitis C virus. Currently, various promising prophylactic vaccines, capable of inducing substantial vaccine-specific T cell responses, are investigated in preclinical and clinical studies. There is compelling evidence that protection by T cells is related to the magnitude and breadth of the T cell response, the type and homing properties of the memory T cell subsets, and their cytokine polyfunctionality and metabolic fitness. In this review, we evaluated these key factors that determine the qualitative and quantitative properties of CD4+ and CD8+ T cell responses in the context of chronic viral disease and prophylactic vaccine development. Elucidation of the mechanisms underlying T cell-mediated protection against chronic viral pathogens will facilitate the development of more potent, durable and safe prophylactic T cell-based vaccines. PMID:29503649

  14. Mitochondrial translocation of signal transducer and activator of transcription 5 (STAT5) in leukemic T cells and cytokine-stimulated cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chueh, Fu-Yu; Leong, King-Fu; Yu, Chao-Lan, E-mail: chaolan.yu@rosalindfranklin.edu

    2010-11-26

    Research highlights: {yields} STAT5 interacts with a mitochondrial protein PDC-E2 in a leukemic T cell line LSTRA. {yields} Tyrosine-phosphorylated STAT5, but not STAT3, is present in LSTRA mitochondria. {yields} Cytokines induce mitochondrial translocation of STAT5, but not STAT1 or STAT3. {yields} Cytokine-induced mitochondrial translocation of tyrosine-phosphorylated STAT5 is transient. {yields} Mitochondrial STAT5 binds to a putative STAT5 site in the mitochondrial DNA in vitro. -- Abstract: Signal transducers and activators of transcription (STATs) were first identified as key signaling molecules in response to cytokines. Constitutive STAT activation also has been widely implicated in oncogenesis. We analyzed STAT5-associated proteins in amore » leukemic T cell line LSTRA, which exhibits constitutive tyrosine phosphorylation and activation of STAT5. A cellular protein was found to specifically interact with STAT5 in LSTRA cells by co-immunoprecipitation. Sequencing analysis and subsequent immunoblotting confirmed the identity of this STAT5-associated protein as the E2 component of mitochondrial pyruvate dehydrogenase complex (PDC-E2). Consistent with this interaction, both subcellular fractionation and immunofluorescence microscopy revealed mitochondrial localization of STAT5 in LSTRA cells. Mitochondrial localization of tyrosine-phosphorylated STAT5 also occurred in cytokine-stimulated cells. A time course experiment further demonstrated the transient kinetics of STAT5 mitochondrial translocation after cytokine stimulation. In contrast, cytokine-induced STAT1 and STAT3 activation did not result in their translocation into mitochondria. Furthermore, we showed that mitochondrial STAT5 bound to the D-loop regulatory region of mitochondrial DNA in vitro. It suggests a potential role of STAT5 in regulating the mitochondrial genome. Proliferative metabolism toward aerobic glycolysis is well known in cancer cells as the Warburg effect and is also observed in cytokine-stimulated cells. Our novel findings of cytokine-induced STAT5 translocation into mitochondria and its link to oncogenesis provide important insights into the underlying mechanisms of this characteristic metabolic shift.« less

  15. Sinomenine inhibits lipopolysaccharide-induced inflammatory injury by regulation of miR-101/MKP-1/JNK pathway in keratinocyte cells.

    PubMed

    Liu, Shumei; Man, Yigang; Zhao, Li

    2018-05-01

    Recent studies have demonstrated that Sinomenine (SIN) exerted anti-inflammatory effect in various immune-related diseases. However, the effect of SIN on glucocorticoids dermatitis has not been investigated. In our study, we aimed to explore the effect of SIN on lipopolysaccharide (LPS)-induced inflammatory injury in HaCaT cells. We constructed an inflammatory injury model of LPS-induced HaCaT cells, then SIN was added to LPS-treated cells, cell viability, apoptosis, apoptosis-associated factors and inflammatory cytokines were detected by CCK-8, flow cytometry, western blot, qRT-PCR and ELISA. Subsequently, miR-101 mimic and mimic control were transfected into HaCaT cells to investigate the effect of SIN and miR-101 on LPS-induced cells injury. Furthermore, MKP-1 and JNK signal pathways were measured by qRT-PCR and western blot. Finally, the animal experiment was performed to further clarify the effect of SIN on inflammatoty injury. LPS suppressed cell viability, promoted apoptosis and increased IL-6, IL-8 and TNF-α expressions and secretions in HaCaT cells. SIN significantly alleviated LPS-induced HaCaT cells injury. Additionally, SIN down-regulated miR-101 expression, and the protective effect of SIN on LPS-induced inflammatory injury was abolished by miR-101 overexpression. Besides, SIN promoted MKP-1 expression by down-regulation of miR-101, and SIN inhibited JNK signal pathway by up-regulation of MKP-1 expression in LPS-treated HaCaT cells. Animal experiments revealed that SIN exhibited anti-inflammatory effects in vivo. The data indicated that SIN attenuated LPS-induced inflammatory injury by regulation of miR-101, MKP-1 and JNK pathway. These findings might provide a novel method for treatment of glucocorticoids dermatitis. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  16. Apoptosis-Inducing-Factor-Dependent Mitochondrial Function Is Required for T Cell but Not B Cell Function.

    PubMed

    Milasta, Sandra; Dillon, Christopher P; Sturm, Oliver E; Verbist, Katherine C; Brewer, Taylor L; Quarato, Giovanni; Brown, Scott A; Frase, Sharon; Janke, Laura J; Perry, S Scott; Thomas, Paul G; Green, Douglas R

    2016-01-19

    The role of apoptosis inducing factor (AIF) in promoting cell death versus survival remains controversial. We report that the loss of AIF in fibroblasts led to mitochondrial electron transport chain defects and loss of proliferation that could be restored by ectopic expression of the yeast NADH dehydrogenase Ndi1. Aif-deficiency in T cells led to decreased peripheral T cell numbers and defective homeostatic proliferation, but thymic T cell development was unaffected. In contrast, Aif-deficient B cells developed and functioned normally. The difference in the dependency of T cells versus B cells on AIF for function and survival correlated with their metabolic requirements. Ectopic Ndi1 expression rescued homeostatic proliferation of Aif-deficient T cells. Despite its reported roles in cell death, fibroblasts, thymocytes and B cells lacking AIF underwent normal death. These studies suggest that the primary role of AIF relates to complex I function, with differential effects on T and B cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. Glucose-Sensing Receptor T1R3: A New Signaling Receptor Activated by Glucose in Pancreatic β-Cells.

    PubMed

    Kojima, Itaru; Nakagawa, Yuko; Hamano, Kunihisa; Medina, Johan; Li, Longfei; Nagasawa, Masahiro

    2015-01-01

    Subunits of the sweet taste receptors T1R2 and T1R3 are expressed in pancreatic β-cells. Compared with T1R3, mRNA expression of T1R2 is considerably lower. At the protein level, expression of T1R2 is undetectable in β-cells. Accordingly, a major component of the sweet taste-sensing receptor in β-cells may be a homodimer of T1R3 rather than a heterodimer of T1R2/T1R3. Inhibition of this receptor by gurmarin or deletion of the T1R3 gene attenuates glucose-induced insulin secretion from β-cells. Hence the T1R3 homodimer functions as a glucose-sensing receptor (GSR) in pancreatic β-cells. When GSR is activated by the T1R3 agonist sucralose, elevation of intracellular ATP concentration ([ATP]i) is observed. Sucralose increases [ATP]i even in the absence of ambient glucose, indicating that sucralose increases [ATP]i not simply by activating glucokinase, a rate-limiting enzyme in the glycolytic pathway. In addition, sucralose augments elevation of [ATP]i induced by methylsuccinate, suggesting that sucralose activates mitochondrial metabolism. Nonmetabolizable 3-O-methylglucose also increases [ATP]i and knockdown of T1R3 attenuates elevation of [ATP]i induced by high concentration of glucose. Collectively, these results indicate that the T1R3 homodimer functions as a GSR; this receptor is involved in glucose-induced insulin secretion by activating glucose metabolism probably in mitochondria.

  18. Enhancement of antigen-specific CD4 + and CD8 + T cell responses using a self-assembled biologic nanolipoprotein particle vaccine

    DOE PAGES

    Weilhammer, Dina; Dunkle, Alexis D.; Blanchette, Craig D.; ...

    2017-02-14

    To address the need for vaccine platforms that induce robust cell-mediated immunity, we investigated the potential of utilizing self-assembling biologic nanolipoprotein particles (NLPs) as an antigen and adjuvant delivery system to induce antigen-specific murine T cell responses. Here, we utilized OT-I and OT-II TCR-transgenic mice to investigate the effects of NLP-mediated delivery of the model antigen ovalbumin (OVA) on T cell activation. Delivery of OVA with the TLR4 agonist monophosphoryl lipid A (MPLA) in the context of NLPs significantly enhanced the activation of both CD4 + and CD8 + T cells in vitro compared to co-administration of free OVA andmore » MPLA. Upon intranasal immunization of mice harboring TCR-transgenic cells, NLPs enhanced the adjuvant effects of MPLA and the in vivo delivery of OVA, leading to significantly increased expansion of CD4 + and CD8 + T cells in lung-draining lymph nodes. Therefore, NLPs are a promising vaccine platform for inducing T cell responses following intranasal administration.« less

  19. Enhancement of antigen-specific CD4 + and CD8 + T cell responses using a self-assembled biologic nanolipoprotein particle vaccine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Weilhammer, Dina; Dunkle, Alexis D.; Blanchette, Craig D.

    To address the need for vaccine platforms that induce robust cell-mediated immunity, we investigated the potential of utilizing self-assembling biologic nanolipoprotein particles (NLPs) as an antigen and adjuvant delivery system to induce antigen-specific murine T cell responses. Here, we utilized OT-I and OT-II TCR-transgenic mice to investigate the effects of NLP-mediated delivery of the model antigen ovalbumin (OVA) on T cell activation. Delivery of OVA with the TLR4 agonist monophosphoryl lipid A (MPLA) in the context of NLPs significantly enhanced the activation of both CD4 + and CD8 + T cells in vitro compared to co-administration of free OVA andmore » MPLA. Upon intranasal immunization of mice harboring TCR-transgenic cells, NLPs enhanced the adjuvant effects of MPLA and the in vivo delivery of OVA, leading to significantly increased expansion of CD4 + and CD8 + T cells in lung-draining lymph nodes. Therefore, NLPs are a promising vaccine platform for inducing T cell responses following intranasal administration.« less

  20. IL-1 receptor antagonist-deficient mice develop autoimmune arthritis due to intrinsic activation of IL-17-producing CCR2+Vγ6+γδ T cells

    PubMed Central

    Akitsu, Aoi; Ishigame, Harumichi; Kakuta, Shigeru; Chung, Soo-hyun; Ikeda, Satoshi; Shimizu, Kenji; Kubo, Sachiko; Liu, Yang; Umemura, Masayuki; Matsuzaki, Goro; Yoshikai, Yasunobu; Saijo, Shinobu; Iwakura, Yoichiro

    2015-01-01

    Interleukin-17 (IL-17)-producing γδ T (γδ17) cells have been implicated in inflammatory diseases, but the underlying pathogenic mechanisms remain unclear. Here, we show that both CD4+ and γδ17 cells are required for the development of autoimmune arthritis in IL-1 receptor antagonist (IL-1Ra)-deficient mice. Specifically, activated CD4+ T cells direct γδ T-cell infiltration by inducing CCL2 expression in joints. Furthermore, IL-17 reporter mice reveal that the Vγ6+ subset of CCR2+ γδ T cells preferentially produces IL-17 in inflamed joints. Importantly, because IL-1Ra normally suppresses IL-1R expression on γδ T cells, IL-1Ra-deficient mice exhibit elevated IL-1R expression on Vγ6+ cells, which play a critical role in inducing them to produce IL-17. Our findings demonstrate a pathogenic mechanism in which adaptive and innate immunity induce an autoimmune disease in a coordinated manner. PMID:26108163

  1. Recombinant yellow fever vaccine virus 17D expressing simian immunodeficiency virus SIVmac239 gag induces SIV-specific CD8+ T-cell responses in rhesus macaques.

    PubMed

    Bonaldo, Myrna C; Martins, Mauricio A; Rudersdorf, Richard; Mudd, Philip A; Sacha, Jonah B; Piaskowski, Shari M; Costa Neves, Patrícia C; Veloso de Santana, Marlon G; Vojnov, Lara; Capuano, Saverio; Rakasz, Eva G; Wilson, Nancy A; Fulkerson, John; Sadoff, Jerald C; Watkins, David I; Galler, Ricardo

    2010-04-01

    Here we describe a novel vaccine vector for expressing human immunodeficiency virus (HIV) antigens. We show that recombinant attenuated yellow fever vaccine virus 17D expressing simian immunodeficiency virus SIVmac239 Gag sequences can be used as a vector to generate SIV-specific CD8(+) T-cell responses in the rhesus macaque. Priming with recombinant BCG expressing SIV antigens increased the frequency of these SIV-specific CD8(+) T-cell responses after recombinant YF17D boosting. These recombinant YF17D-induced SIV-specific CD8(+) T cells secreted several cytokines, were largely effector memory T cells, and suppressed viral replication in CD4(+) T cells.

  2. Chemically Attenuated Blood-Stage Plasmodium yoelii Parasites Induce Long-Lived and Strain-Transcending Protection

    PubMed Central

    Raja, Amber I.; Cai, Yeping; Reiman, Jennifer M.; Groves, Penny; Chakravarty, Sumana; McPhun, Virginia; Doolan, Denise L.; Cockburn, Ian; Hoffman, Stephen L.; Stanisic, Danielle I.

    2016-01-01

    The development of a vaccine is essential for the elimination of malaria. However, despite many years of effort, a successful vaccine has not been achieved. Most subunit vaccine candidates tested in clinical trials have provided limited efficacy, and thus attenuated whole-parasite vaccines are now receiving close scrutiny. Here, we test chemically attenuated Plasmodium yoelii 17X and demonstrate significant protection following homologous and heterologous blood-stage challenge. Protection against blood-stage infection persisted for at least 9 months. Activation of both CD4+ and CD8+ T cells was shown after vaccination; however, in vivo studies demonstrated a pivotal role for both CD4+ T cells and B cells since the absence of either cell type led to loss of vaccine-induced protection. In spite of significant activation of circulating CD8+ T cells, liver-stage immunity was not evident. Neither did vaccine-induced CD8+ T cells contribute to blood-stage protection; rather, these cells contributed to pathogenesis, since all vaccinated mice depleted of both CD4+ and CD8+ T cells survived a challenge infection. This study provides critical insight into whole-parasite vaccine-induced immunity and strong support for testing whole-parasite vaccines in humans. PMID:27245410

  3. Analysis of adenovirus-induced immunity to infection with Listeria monocytogenes: Fading protection coincides with declining CD8 T cell numbers and phenotypic changes.

    PubMed

    Jahn, Marie Louise; Steffensen, Maria Abildgaard; Christensen, Jan Pravsgaard; Thomsen, Allan Randrup

    2018-05-11

    Defining correlates of T cell mediated protection is important in order to accelerate the development of efficient T cell based vaccines conferring long-term immunity. Extensive studies have provided important insight regarding the characteristics and functional properties of the effector and memory CD8 T cells induced by viral vector based vaccines. However, long-term protection has been difficult to achieve with T cell inducing vaccines, and the determinants underlying this loss in protection over time are still not fully defined. In this study we analyzed different parameters of the CD8 T cell response as a function of time after vaccination with a human serotype 5 adenovector expressing the glycoprotein (GP) of LCMV tethered to the MHC class II-associated invariant chain. Using this vector we have previously found that CD8 T cells mediate protection from challenge with GP-expressing Listeria monocytogenes at 60 days post vaccination, but only little protection after further 60 days, and we now confirm this observation. A comparison of vaccine-primed CD8 T cells early and late after vaccination revealed a minor decline in the overall numbers of antigen specific memory CD8 T cells during this interval. More importantly, we also observed phenotypic changes over time with a distinct decline in the frequency and number of KLRG1 + CD8 T cells, and, notably, adoptive transfer studies confirmed that memory CD8 T cells expressing KLRG1 are central to protection from systemic L. monocytogenes infection. Together these findings imply that multiple factors including changes in memory T cell numbers and phenotypic composition over time influence the longevity of CD8 T-cell mediated protection. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Regulatory CD8{sup +} T cells induced by exposure to all-trans retinoic acid and TGF-{beta} suppress autoimmune diabetes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kishi, Minoru; Yasuda, Hisafumi, E-mail: yasuda@med.kobe-u.ac.jp; Abe, Yasuhisa

    Antigen-specific regulatory CD4{sup +} T cells have been described but there are few reports on regulatory CD8{sup +} T cells. We generated islet-specific glucose-6-phosphatase catalytic subunit-related protein (IGRP)-specific regulatory CD8{sup +} T cells from 8.3-NOD transgenic mice. CD8{sup +} T cells from 8.3-NOD splenocytes were cultured with IGRP, splenic dendritic cells (SpDCs), TGF-{beta}, and all-trans retinoic acid (ATRA) for 5 days. CD8{sup +} T cells cultured with either IGRP alone or IGRP and SpDCs in the absence of TGF-{beta} and ATRA had low Foxp3{sup +} expression (1.7 {+-} 0.9% and 3.2 {+-} 4.5%, respectively). In contrast, CD8{sup +} T cellsmore » induced by exposure to IGRP, SpDCs, TGF-{beta}, and ATRA showed the highest expression of Foxp3{sup +} in IGRP-reactive CD8{sup +} T cells (36.1 {+-} 10.6%), which was approximately 40-fold increase compared with that before induction culture. CD25 expression on CD8{sup +} T cells cultured with IGRP, SpDCs, TGF-{beta}, and ATRA was only 7.42%, whereas CD103 expression was greater than 90%. These CD8{sup +} T cells suppressed the proliferation of diabetogenic CD8{sup +} T cells from 8.3-NOD splenocytes in vitro and completely prevented diabetes onset in NOD-scid mice in cotransfer experiments with diabetogenic splenocytes from NOD mice in vivo. Here we show that exposure to ATRA and TGF-{beta} induces CD8{sup +}Foxp3{sup +} T cells ex vivo, which suppress diabetogenic T cells in vitro and in vivo.« less

  5. T suppressor cells are required for the maintenance of the antigen-induced B-cell unresponsive state in humans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Benveniste, E.; Stevens, R.H.

    1983-04-01

    Tetanus toxoid immunization of humans generates circulating B cells which secrete IgG anti-tetanus toxoid antibodies (IgG-Tet) when stimulated in vitro with T cells and pokeweed mitogen (PWM). A unique property of these cells is the inhibition of maturation into antibody-secreting plasma cells following a 1-hr in vitro pulse with tetanus toxoid. Studies were undertaken to determine if different T-cell subsets could modulate the in vitro generated B-cell unresponsive state. The addition of OKT4+/OKT8- cells to antigen-treated B cells resulted in a partial reversal of the antigen-induced inhibition of IgG-Tet synthesis. The addition of OKT4-/OKT8+ cells to the treated B cellsmore » caused a suppression of IgG-Tet synthesis comparable to that seen in cultures containing unfractionated T cells. These results indicate that (1) the B-cell unresponsive state generated by antigen treatment is not absolute, (2) the degree of B-cell unresponsiveness results from a balance of suppressor and helper signals, and (3) T-suppressor cells need to be present to induce and maintain the B-cell unresponsive state.« less

  6. Antithymocyte globulins in renal transplantation-from lymphocyte depletion to lymphocyte activation: The doubled-edged sword.

    PubMed

    Bamoulid, Jamal; Crépin, Thomas; Courivaud, Cécile; Rebibou, Jean-Michel; Saas, Philippe; Ducloux, Didier

    2017-07-01

    Compelling data suggest that lymphocyte depletion following T cell depleting therapy may induce prolonged CD4 T cell lymphopenia and trigger lymphocyte activation in some patients. These profound and non-reversible immune changes in T cell pool subsets are the consequence of both impaired thymic renewal and peripheral homeostatic proliferation. Chronic viral challenges by CMV play a major role in these immune alterations. Even when the consequences of CD4 T cell lymphopenia have been now well described, recent studies shed new light on the clinical consequences of immune activation. In this review, we will first focus on the mechanisms involved in T cell pool reconstitution after T cell depletion and further consider the clinical consequences of ATG-induced T cell activation and senescence in renal transplant recipients. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Multipotent Adult Progenitor Cells Suppress T Cell Activation in In Vivo Models of Homeostatic Proliferation in a Prostaglandin E2-Dependent Manner

    PubMed Central

    Carty, Fiona; Corbett, Jennifer M.; Cunha, João Paulo M. C. M.; Reading, James L.; Tree, Timothy I. M.; Ting, Anthony E.; Stubblefield, Samantha R.; English, Karen

    2018-01-01

    Lymphodepletion strategies are used in the setting of transplantation (including bone marrow, hematopoietic cell, and solid organ) to create space or to prevent allograft rejection and graft versus host disease. Following lymphodepletion, there is an excess of IL-7 available, and T cells that escape depletion respond to this cytokine undergoing accelerated proliferation. Moreover, this environment promotes the skew of T cells to a Th1 pro-inflammatory phenotype. Existing immunosuppressive regimens fail to control this homeostatic proliferative (HP) response, and thus the development of strategies to successfully control HP while sparing T cell reconstitution (providing a functioning immune system) represents a significant unmet need in patients requiring lymphodepletion. Multipotent adult progenitor cells (MAPC®) have the capacity to control T cell proliferation and Th1 cytokine production. Herein, this study shows that MAPC cells suppressed anti-thymocyte globulin-induced cytokine production but spared T cell reconstitution in a pre-clinical model of lymphodepletion. Importantly, MAPC cells administered intraperitoneally were efficacious in suppressing interferon-γ production and in promoting the expansion of regulatory T cells in the lymph nodes. MAPC cells administered intraperitoneally accumulated in the omentum but were not present in the spleen suggesting a role for soluble factors. MAPC cells suppressed lymphopenia-induced cytokine production in a prostaglandin E2-dependent manner. This study suggests that MAPC cell therapy may be useful as a novel strategy to target lymphopenia-induced pathogenic T cell responses in lymphodepleted patients. PMID:29740426

  8. Resident CD141 (BDCA3)+ dendritic cells in human skin produce IL-10 and induce regulatory T cells that suppress skin inflammation.

    PubMed

    Chu, Chung-Ching; Ali, Niwa; Karagiannis, Panagiotis; Di Meglio, Paola; Skowera, Ania; Napolitano, Luca; Barinaga, Guillermo; Grys, Katarzyna; Sharif-Paghaleh, Ehsan; Karagiannis, Sophia N; Peakman, Mark; Lombardi, Giovanna; Nestle, Frank O

    2012-05-07

    Human skin immune homeostasis, and its regulation by specialized subsets of tissue-residing immune sentinels, is poorly understood. In this study, we identify an immunoregulatory tissue-resident dendritic cell (DC) in the dermis of human skin that is characterized by surface expression of CD141, CD14, and constitutive IL-10 secretion (CD141(+) DDCs). CD141(+) DDCs possess lymph node migratory capacity, induce T cell hyporesponsiveness, cross-present self-antigens to autoreactive T cells, and induce potent regulatory T cells that inhibit skin inflammation. Vitamin D(3) (VitD3) promotes certain phenotypic and functional properties of tissue-resident CD141(+) DDCs from human blood DCs. These CD141(+) DDC-like cells can be generated in vitro and, once transferred in vivo, have the capacity to inhibit xeno-graft versus host disease and tumor alloimmunity. These findings suggest that CD141(+) DDCs play an essential role in the maintenance of skin homeostasis and in the regulation of both systemic and tumor alloimmunity. Finally, VitD3-induced CD141(+) DDC-like cells have potential clinical use for their capacity to induce immune tolerance.

  9. Resident CD141 (BDCA3)+ dendritic cells in human skin produce IL-10 and induce regulatory T cells that suppress skin inflammation

    PubMed Central

    Chu, Chung-Ching; Ali, Niwa; Karagiannis, Panagiotis; Di Meglio, Paola; Skowera, Ania; Napolitano, Luca; Barinaga, Guillermo; Grys, Katarzyna; Sharif-Paghaleh, Ehsan; Karagiannis, Sophia N.; Peakman, Mark; Lombardi, Giovanna

    2012-01-01

    Human skin immune homeostasis, and its regulation by specialized subsets of tissue-residing immune sentinels, is poorly understood. In this study, we identify an immunoregulatory tissue-resident dendritic cell (DC) in the dermis of human skin that is characterized by surface expression of CD141, CD14, and constitutive IL-10 secretion (CD141+ DDCs). CD141+ DDCs possess lymph node migratory capacity, induce T cell hyporesponsiveness, cross-present self-antigens to autoreactive T cells, and induce potent regulatory T cells that inhibit skin inflammation. Vitamin D3 (VitD3) promotes certain phenotypic and functional properties of tissue-resident CD141+ DDCs from human blood DCs. These CD141+ DDC-like cells can be generated in vitro and, once transferred in vivo, have the capacity to inhibit xeno-graft versus host disease and tumor alloimmunity. These findings suggest that CD141+ DDCs play an essential role in the maintenance of skin homeostasis and in the regulation of both systemic and tumor alloimmunity. Finally, VitD3-induced CD141+ DDC-like cells have potential clinical use for their capacity to induce immune tolerance. PMID:22547651

  10. Triple DMARD treatment in early rheumatoid arthritis modulates synovial T cell activation and plasmablast/plasma cell differentiation pathways.

    PubMed

    Walsh, Alice M; Wechalekar, Mihir D; Guo, Yanxia; Yin, Xuefeng; Weedon, Helen; Proudman, Susanna M; Smith, Malcolm D; Nagpal, Sunil

    2017-01-01

    This study sought to investigate the genome-wide transcriptional effects of a combination of disease modifying anti-rheumatic drugs (tDMARD; methotrexate, sulfasalazine and hydroxychloroquine) in synovial tissues obtained from early rheumatoid arthritis (RA) patients. While combination DMARD strategies have been investigated for clinical efficacy, very little data exists on the potential molecular mechanism of action. We hypothesized that tDMARD would impact multiple biological pathways, but the specific pathways were unknown. Paired synovial biopsy samples from early RA patients before and after 6 months of tDMARD therapy were collected by arthroscopy (n = 19). These biopsies as well as those from subjects with normal synovium (n = 28) were profiled by total RNA sequencing. Large differences in gene expression between RA and control biopsies (over 5000 genes) were identified. Despite clinical efficacy, the expression of a restricted set of less than 300 genes was reversed after 6 months of treatment. Many genes remained elevated, even in patients who achieved low disease activity. Interestingly, tDMARD downregulated genes included those involved in T cell activation and signaling and plasmablast/plasma cell differentiation and function. We have identified transcriptomic signatures that characterize synovial tissue from RA patients with early disease. Analysis after 6 months of tDMARD treatment highlight consistent alterations in expression of genes related to T cell activation and plasmablast/plasma cell differentiation. These results provide novel insight into the biology of early RA and the mechanism of tDMARD action and may help identify novel drug targets to improve rates of treatment-induced disease remission.

  11. The Breadth of Synthetic Long Peptide Vaccine-Induced CD8+ T Cell Responses Determines the Efficacy against Mouse Cytomegalovirus Infection

    PubMed Central

    Panagioti, Eleni; Redeker, Anke; van Duikeren, Suzanne; Franken, Kees LMC; Drijfhout, Jan Wouter; van der Burg, Sjoerd H.

    2016-01-01

    There is an ultimate need for efficacious vaccines against human cytomegalovirus (HCMV), which causes severe morbidity and mortality among neonates and immunocompromised individuals. In this study we explored synthetic long peptide (SLP) vaccination as a platform modality to protect against mouse CMV (MCMV) infection in preclinical mouse models. In both C57BL/6 and BALB/c mouse strains, prime-booster vaccination with SLPs containing MHC class I restricted epitopes of MCMV resulted in the induction of strong and polyfunctional (i.e., IFN-γ+, TNF+, IL-2+) CD8+ T cell responses, equivalent in magnitude to those induced by the virus itself. SLP vaccination initially led to the formation of effector CD8+ T cells (KLRG1hi, CD44hi, CD127lo, CD62Llo), which eventually converted to a mixed central and effector-memory T cell phenotype. Markedly, the magnitude of the SLP vaccine-induced CD8+ T cell response was unrelated to the T cell functional avidity but correlated to the naive CD8+ T cell precursor frequency of each epitope. Vaccination with single SLPs displayed various levels of long-term protection against acute MCMV infection, but superior protection occurred after vaccination with a combination of SLPs. This finding underlines the importance of the breadth of the vaccine-induced CD8+ T cell response. Thus, SLP-based vaccines could be a potential strategy to prevent CMV-associated disease. PMID:27637068

  12. Pivotal roles of CD4+ effector T cells in mediating agonistic anti-GITR mAb-induced-immune activation and tumor immunity in CT26 tumors.

    PubMed

    Zhou, Pengfei; L'italien, Lawrence; Hodges, Douglas; Schebye, Xiao Min

    2007-12-01

    Glucocorticoid-induced TNF receptor family related protein (GITR) is a member of the TNFR superfamily. Previous studies have shown that in vivo administration of a GITR agonistic Ab (DTA-1) is able to overcome tolerance and induce tumor rejection in several murine syngeneic tumor models. However, little is known about the in vivo targets and the mechanisms of how this tolerance is overcome in a tumor-bearing host, nor is much known about how the immune network is regulated to achieve this antitumor response. In this study, we demonstrate that the in vivo ligation of GITR on CD4(+) effector T cells renders them refractory to suppression by regulatory T (T(reg)) cells in the CT26 tumor-bearing mouse. GITR engagement on T(reg) cells does not appear to directly abrogate their suppressive function; rather, it increases the expansion of T(reg) cells and promotes IL-10 production, a cytokine important for their suppressive function. Moreover, CD4(+) effector T cells play a crucial role in mediating DTA-1-induced immune activation and expansion of CD8(+), NK, and B cells in the tumor-draining lymph nodes. This includes increased CD69 expression on all of these subsets. In addition, NK and tumor-specific CD8(+) T cells are generated that are cytolytic, which show increased intracellular IFN-gamma production and CD107a mobilization, the latter a hallmark of cytolytic activities that lead to tumor killing.

  13. Expression of tyrosine hydroxylase in CD4+ T cells contributes to alleviation of Th17/Treg imbalance in collagen-induced arthritis.

    PubMed

    Wang, Xiao-Qin; Liu, Yan; Cai, Huan-Huan; Peng, Yu-Ping; Qiu, Yi-Hua

    2016-12-01

    Tyrosine hydroxylase (TH), a rate-limiting enzyme for the synthesis of catecholamines, is expressed in T lymphocytes. However, the role of T cell-expressed TH in rheumatoid arthritis (RA) is less clear. Herein, we aimed to show the contribution of TH expression by CD4 + T cells to alleviation of helper T (Th)17/regulatory T (Treg) imbalance in collagen-induced arthritis (CIA), a mouse model of RA. CIA was prepared by intradermal injection of collagen type II (CII) at tail base of DBA1/J mice. Expression of TH in the spleen and the ankle joints was measured by real-time polymerase chain reaction and Western blot analysis. Percentages of TH-expressing Th17 and Treg cells in splenic CD4 + T cells were determined by flow cytometry. Overexpression and knockdown of TH gene in CD4 + T cells were taken to evaluate effects of TH on Th17 and Treg cells in CIA. TH expression was upregulated in both the inflamed tissues (spleen and ankle joints) and the CD4 + T cells of CIA mice. In splenic CD4 + T cells, the cells expressing TH were increased during CIA. These cells that expressed more TH in CIA were mainly Th17 cells rather than Treg cells. TH gene overexpression in CD4 + T cells from CIA mice reduced Th17 cell percentage as well as Th17-related transcription factor and cytokine expression and secretion, whereas TH gene knockdown enhanced the Th17 cell activity. In contrast, TH gene overexpression increased Treg-related cytokine expression and secretion in CD4 + T cells of CIA mice, while TH gene knockdown decreased the Treg cell changes. Collectively, these findings show that CIA induces TH expression in CD4 + T cells, particularly in Th17 cells, and suggest that the increased TH expression during CIA represents an anti-inflammatory mechanism.

  14. Regulation of CD4 T cells and their effects on immunopathological inflammation following viral infection.

    PubMed

    Bhattacharyya, Mitra; Madden, Patrick; Henning, Nathan; Gregory, Shana; Aid, Malika; Martinot, Amanda J; Barouch, Dan H; Penaloza-MacMaster, Pablo

    2017-10-01

    CD4 T cells help immune responses, but knowledge of how memory CD4 T cells are regulated and how they regulate adaptive immune responses and induce immunopathology is limited. Using adoptive transfer of virus-specific CD4 T cells, we show that naive CD4 T cells undergo substantial expansion following infection, but can induce lethal T helper type 1-driven inflammation. In contrast, memory CD4 T cells exhibit a biased proliferation of T follicular helper cell subsets and were able to improve adaptive immune responses in the context of minimal tissue damage. Our analyses revealed that type I interferon regulates the expansion of primary CD4 T cells, but does not seem to play a critical role in regulating the expansion of secondary CD4 T cells. Strikingly, blockade of type I interferon abrogated lethal inflammation by primary CD4 T cells following viral infection, despite that this treatment increased the numbers of primary CD4 T-cell responses. Altogether, these data demonstrate important aspects of how primary and secondary CD4 T cells are regulated in vivo, and how they contribute to immune protection and immunopathology. These findings are important for rational vaccine design and for improving adoptive T-cell therapies against persistent antigens. © 2017 John Wiley & Sons Ltd.

  15. Control of polyclonal immunoglobulin production from human lymphocytes by leukotrienes; leukotriene B4 induces an OKT8(+), radiosensitive suppressor cell from resting, human OKT8(-) T cells.

    PubMed Central

    Atluru, D; Goodwin, J S

    1984-01-01

    We report that leukotriene B4 (LTB4), a 5-lipoxygenase metabolite of arachidonic acid, is a potent suppressor of polyclonal Ig production in pokeweed mitogen (PWM)-stimulated cultures of human peripheral blood lymphocytes, while LTC4 and LTD4 have little activity in this system. Preincubation of T cells with LTB4 in nanomolar to picomolar concentrations rendered these cells suppressive of Ig production in subsequent PWM-stimulated cultures of fresh, autologous B + T cells. This LTB4-induced suppressor cell was radiosensitive, and its generation could be blocked by cyclohexamide but not by mitomycin C. The LTB4-induced suppressor cell was OKT8(+), while the precursor for the cell could be OKT8(-). The incubation of OKT8(-) T cells with LTB4 for 18 h resulted in the appearance of the OKT8(+) on 10-20% of the cells, and this could be blocked by cyclohexamide but not by mitomycin C. Thus, LTB4 in very low concentrations induces a radiosensitive OKT8(+) suppressor cell from OKT8(-) cells. In this regard, LTB4 is three to six orders of magnitude more potent than any endogenous hormonal inducer of suppressor cells previously described. Glucocorticosteroids, which block suppressor cell induction in many systems, may act by inhibiting endogenous production of LTB4. Images PMID:6090503

  16. Naive B cells generate regulatory T cells in the presence of a mature immunologic synapse.

    PubMed

    Reichardt, Peter; Dornbach, Bastian; Rong, Song; Beissert, Stefan; Gueler, Faikah; Loser, Karin; Gunzer, Matthias

    2007-09-01

    Naive B cells are ineffective antigen-presenting cells and are considered unable to activate naive T cells. However, antigen-specific contact of these cells leads to stable cell pairs that remain associated over hours in vivo. The physiologic role of such pairs has not been evaluated. We show here that antigen-specific conjugates between naive B cells and naive T cells display a mature immunologic synapse in the contact zone that is absent in T-cell-dendritic-cell (DC) pairs. B cells induce substantial proliferation but, contrary to DCs, no loss of L-selectin in T cells. Surprisingly, while DC-triggered T cells develop into normal effector cells, B-cell stimulation over 72 hours induces regulatory T cells inhibiting priming of fresh T cells in a contact-dependent manner in vitro. In vivo, the regulatory T cells home to lymph nodes where they potently suppress immune responses such as in cutaneous hypersensitivity and ectopic allogeneic heart transplant rejection. Our finding might help to explain old observations on tolerance induction by B cells, identify the mature immunologic synapse as a central functional module of this process, and suggest the use of naive B-cell-primed regulatory T cells, "bTregs," as a useful approach for therapeutic intervention in adverse adaptive immune responses.

  17. Pre-B cell leukemia homeobox 1 is associated with lupus susceptibility in mice and humans

    PubMed Central

    Cuda, Carla M.; Li, Shiwu; Liang, Shujuan; Yin, Yiming; Potula, Hari Hara S.K.; Xu, Zhiwei; Sengupta, Mayami; Chen, Yifang; Butfiloski, Edward; Baker, Henry; Chang, Lung-Ji; Dozmorov, Igor; Sobel, Eric S.; Morel, Laurence

    2011-01-01

    Sle1a.1 is part of the Sle1 susceptibility locus, which has the strongest association with lupus nephritis in the NZM2410 mouse model. Here we show that Sle1a.1 results in the production of activated and autoreactive CD4+ T cells. In addition, Sle1a.1 expression reduces the peripheral regulatory T cell (Treg) pool, as well as induces a defective response of CD4+ T cells to the retinoic acid (RA) expansion of TGFβ-induced Tregs. At the molecular level, Sle1a.1 corresponds to an increased expression of a novel splice isoform of Pbx1, Pbx1-d. Pbx1-d over-expression is sufficient to induce an activated/inflammatory phenotype in Jurkat T cells, and to decrease their apoptotic response to RA. PBX1-d is expressed more frequently in the CD4+ T cells from lupus patients than from healthy controls, and its presence correlates with an increased central memory T cell population. These findings indicate that Pbx1 is a novel lupus susceptibility gene that regulates T cell activation and tolerance. PMID:22180614

  18. Immune effects of nickel.

    PubMed

    Salsano, F; Francia, C; Roumpedaki, I; Proietti, M; Pisarri, S; Verna, N; Gabriele, E; Di Gioacchino, G; Di Gioacchino, M

    2004-01-01

    Data on nickel immunomodulation are contradictory. The most consistent immune effects are suppression of immune responses. It has been shown that T-lymphocytes and NK cells are more susceptible to nickel toxicity than are B lymphocytes or macrophages. Data reported about cytokine production in human and nickel reactive T-cell clones are also conflicting. Some authors studied showed a higher synthesis of IL4, IL5 and IL13 but not of IFN gamma and TNFalpha in Ni allergic subjects. We found that the addiction on NiSo4 to the PBMC cultures of non sensitised subjects induces a reduction of release of IL5, IFN gamma and TNFalpha. Our studies demonstrate a clear difference in the NK cell activity between nickel-tolerant and intolerant individuals. In particular NK cell activity in reduced in sensitised patients respect to the normal subjects and the addition of Ni has immunotoxic potential. Researches are in progress in an Attempt to correlate the present data with other immune parameters and to measure the effects of a Ni Free diet on the immune system of subjects with Ni intolerance. The comprehension of the mechanisms inducing these changes requires further studies in the uptake and intracellular distribution and binding of the metal.

  19. Antigen-specific, CD4+CD25+ regulatory T cell clones induced in Peyer's patches.

    PubMed

    Tsuji, Noriko M; Mizumachi, Koko; Kurisaki, Jun-Ichi

    2003-04-01

    Since intestine is exposed to numerous exogenous antigens such as food and commensal bacteria, the organ bears efficient mechanisms for establishment of tolerance and induction of regulatory T cells (T(reg)). Intestinal and inducible T(reg) include T(r)1-like and T(h)3 cells whose major effector molecules are IL-10 and transforming growth factor (TGF)-beta. These antigen-specific T(reg) are expected to become clinical targets to modify the inflammatory immune response associated with allergy, autoimmune diseases and transplantation. In the present study, we characterized the antigen-specific T(reg) induced in the intestine by orally administering high-dose beta-lactoglobulin (BLG) to BALB/c mice. Seven days after feeding, only Peyer's patch (PP) cells among different organs exerted significant suppressive effect on antibody production upon in vitro BLG stimulation. This suppressive effect was also prominent in six BLG-specific CD4(+) T cell clones (OPP1-6) established from PP from mice orally administered with high doses of BLG and was partially reversed by antibodies to TGF-beta. Intravenous transfer of OPP2 efficiently suppressed BLG-specific IgG1 production in serum following immunization, indicating the role of such T(reg) in the systemic tolerance after oral administration of antigen (oral tolerance). OPP clones secrete TGF-beta, IFN-gamma and low levels of IL-10, a cytokine pattern similar to that secreted by anergic T cells. OPP clones bear a CD4(+)CD25(+) phenotype and show significantly lower proliferative response compared to T(h)0 clones. This lower response is recovered by the addition of IL-2. Thus, antigen-specific CD4(+)CD25(+) T(reg), which have characteristics of anergic cells and actively suppress antibody production are induced in PP upon oral administration of protein antigen.

  20. Phloridzin docosahexaenoate, a novel flavonoid derivative, suppresses growth and induces apoptosis in T-cell acute lymphoblastic leukemia cells.

    PubMed

    Arumuggam, Niroshaathevi; Melong, Nicole; Too, Catherine Kl; Berman, Jason N; Rupasinghe, Hp Vasantha

    2017-01-01

    The overall clinical outcome in T-cell acute lymphoblastic leukemia (T-ALL) can be improved by minimizing risk for treatment failure using effective pharmacological adjuvants. Phloridzin (PZ), a flavonoid precursor found in apple peels, was acylated with docosahexaenoic acid (DHA) yielding a novel ester known as phloridzin docosahexaenoate (PZ-DHA). Here, we have studied the cytotoxic effects of PZ-DHA on human leukemia cells using in vitro and in vivo models. The inhibitory effects of PZ-DHA were tested on human Jurkat T-ALL cells in comparison to K562 chronic myeloid leukemia (CML) cells and non-malignant murine T-cells. PZ-DHA, not PZ or DHA alone, reduced cell viability and ATP levels, increased intracellular LDH release, and caused extensive morphological alterations in both Jurkat and K562 cells. PZ-DHA also inhibited cell proliferation, and selectively induced apoptosis in Jurkat and K562 cells while sparing normal murine T-cells. The cytotoxic effects of PZ-DHA on Jurkat cells were associated with caspase activation, DNA fragmentation, and selective down-regulation of STAT3 phosphorylation. PZ-DHA significantly inhibited Jurkat cell proliferation in zebrafish larvae; however, the proliferation of K562 cells was not affected in vivo . We propose that PZ-DHA-induced cytotoxic response is selective towards T-ALL in the presence of a tumor-stromal microenvironment. Prospective studies evaluating the combinatorial effects of PZ-DHA with conventional chemotherapy for T-ALL are underway.

Top