Science.gov

Sample records for induce donor-specific transplantation

  1. Donor-specific antibodies accelerate arteriosclerosis after kidney transplantation.

    PubMed

    Hill, Gary S; Nochy, Dominique; Bruneval, Patrick; Duong van Huyen, J P; Glotz, Denis; Suberbielle, Caroline; Zuber, Julien; Anglicheau, Dany; Empana, Jean-Philippe; Legendre, Christophe; Loupy, Alexandre

    2011-05-01

    In biopsies of renal allografts, arteriosclerosis is often more severe than expected based on the age of the donor, even without a history of rejection vasculitis. To determine whether preformed donor-specific antibodies (DSAs) may contribute to the severity of arteriosclerosis, we examined protocol biopsies from patients with (n=40) or without (n=59) DSA after excluding those with any evidence of vasculitis. Among DSA-positive patients, arteriosclerosis significantly progressed between month 3 and month 12 after transplant (mean Banff cv score 0.65 ± 0.11 to 1.12 ± 0.10, P=0.014); in contrast, among DSA-negative patients, we did not detect a statistically significant progression during the same timeframe (mean Banff cv score 0.65 ± 0.11 to 0.81 ± 0.10, P=not significant). Available biopsies at later time points supported a rate of progression of arteriosclerosis in DSA-negative patients that was approximately one third that in DSA-positive patients. Accelerated arteriosclerosis was significantly associated with peritubular capillary leukocytic infiltration, glomerulitis, subclinical antibody-mediated rejection, and interstitial inflammation. In conclusion, these data support the hypothesis that donor-specific antibodies dramatically accelerate post-transplant progression of arteriosclerosis.

  2. HLA class I donor-specific triplet antibodies detected after renal transplantation.

    PubMed

    Varnavidou-Nicolaidou, A; Doxiadis, I I N; Iniotaki-Theodoraki, A; Patargias, T; Stavropoulos-Giokas, C; Kyriakides, G K

    2004-01-01

    The purpose of this study was to investigate whether IgG, non-donor-specific anti-HLA class I antibodies (HLAabI) detected after renal transplantation recognize immunogenic amino acid triplets expressed on the foreign graft. In addition, we sought to evaluate the effect of these antibodies as well as other posttransplant HLAabI on graft outcome. Posttransplant sera from 264 renal recipients were tested for the presence of IgG HLAabI and HLA class II-specific alloantibodies (HLAabII) by ELISA. The HLAMatchmaker computer algorithm was used to define the HLA class I non-donor-specific antibodies, which seem to recognize immunogenic amino acid triplets. Donor-specific triplet antibodies (DSTRab) were detected in 16 of 22 (72.7%) recipients based on at least one HLA-A or -B mismatched antigen with the donor. DSTRab were found either without (n = 7) or with (n = 9) HLA donor-specific antibodies (HLA-DSA). The presence of DSTRab alone in the periphery was associated with acute rejection, whereas the presence of both DSTRab and HLA-DSA was associated with chronic rejection and graft failure.

  3. Donor-Specific Anti-HLA Antibodies in Allogeneic Hematopoietic Stem Cell Transplantation

    PubMed Central

    Morin-Zorman, Sarah; Loiseau, Pascale; Taupin, Jean-Luc; Caillat-Zucman, Sophie

    2016-01-01

    Allogeneic hematopoietic stem cell transplantation (AHSCT) is a curative treatment for a wide variety of hematological diseases. In 30% of the cases, a geno-identical donor is available. Any other situation displays some level of human leukocyte antigen (HLA) incompatibility between donor and recipient. Deleterious effects of anti-HLA immunization have long been recognized in solid organ transplant recipients. More recently, anti-HLA immunization was shown to increase the risk of primary graft failure (PGF), a severe complication of AHSCT that occurs in 3–4% of matched unrelated donor transplantation and up to 15% in cord blood transplantation and T-cell depleted haplo-identical stem cell transplantation. Rates of PGF in patients with DSA were reported to be between 24 and 83% with the highest rates in haplo-identical and cord blood transplantation recipients. This led to the recommendation of anti-HLA antibody screening to detect donor-specific antibodies (DSA) in recipients prior to AHSCT. In this review, we highlight the role of anti-HLA antibodies in AHSCT and the mechanisms that may lead to PGF in patients with DSA, and discuss current issues in the field. PMID:27570526

  4. Desensitization for renal transplantation: depletion of donor-specific anti-HLA antibodies, preservation of memory antibodies, and clinical risks.

    PubMed

    Rogers, Natasha M; Eng, Hooi S; Yu, Raymond; Kireta, Svjetlana; Tsiopelas, Eleni; Bennett, Greg D; Brook, Nicholas R; Gillis, David; Russ, Graeme R; Coates, P Toby

    2011-01-01

    Desensitization protocols reduce donor-specific anti-HLA antibodies (DSA) and enable renal transplantation in patients with a positive complement-dependent cytotoxic cross-match (CDC-CXM). The effect of this treatment on protective antibody and immunoglobulin levels is unknown. Thirteen patients with end-stage renal disease, DSA and positive CDC-CXM underwent desensitization. Sera collected pre- and post-transplantation were analysed for anti-tetanus and anti-pneumococcal antibodies, total immunoglobulin (Ig) levels and IgG subclasses and were compared to healthy controls and contemporaneous renal transplant recipients treated with standard immunosuppression alone. Ten patients developed negative CDC-CXM and enzyme-linked immunosorbent assay (ELISA) and underwent successful transplantation. Eight recipients achieved good graft function without antibody-mediated or late rejection, BK virus or cytomegalovirus infection. One patient had primary non-function due to recurrent oxalosis, and one patient with immediate graft function died from septicaemia. Seven recipients required post-operative transfusion and three developed septicaemia. DSA remained negative by ELISA at 12 months, but were detectable by Luminex(®) . Anti-tetanus and anti-pneumococcal antibodies, total Ig and IgG subclasses were below the normal range but comparable to levels in renal transplant recipients who had not undergone desensitization. Desensitization protocols effectively reduce DSA and allow successful transplantation. Post-operative bleeding and short-term infectious risk is increased. Protective antibody and serum immunoglobulin levels are relatively preserved.

  5. Donor-specific anti-HLA Abs and graft failure in matched unrelated donor hematopoietic stem cell transplantation.

    PubMed

    Ciurea, Stefan O; Thall, Peter F; Wang, Xuemei; Wang, Sa A; Hu, Ying; Cano, Pedro; Aung, Fleur; Rondon, Gabriela; Molldrem, Jeffrey J; Korbling, Martin; Shpall, Elizabeth J; de Lima, Marcos; Champlin, Richard E; Fernandez-Vina, Marcelo

    2011-11-24

    Anti-HLA donor-specific Abs (DSAs) have been reported to be associated with graft failure in mismatched hematopoietic stem cell transplantation; however, their role in the development of graft failure in matched unrelated donor (MUD) transplantation remains unclear. We hypothesize that DSAs against a mismatched HLA-DPB1 locus is associated with graft failure in this setting. The presence of anti-HLA Abs before transplantation was determined prospectively in 592 MUD transplantation recipients using mixed-screen beads in a solid-phase fluorescent assay. DSA identification was performed using single-Ag beads containing the corresponding donor's HLA-mismatched Ags. Anti-HLA Abs were detected in 116 patients (19.6%), including 20 patients (3.4%) with anti-DPB1 Abs. Overall, graft failure occurred in 19 of 592 patients (3.2%), including 16 of 584 (2.7%) patients without anti-HLA Abs compared with 3 of 8 (37.5%) patients with DSA (P = .0014). In multivariate analysis, DSAs were the only factor highly associated with graft failure (P = .0001; odds ratio = 21.3). Anti-HLA allosensitization was higher overall in women than in men (30.8% vs 12.1%; P < .0001) and higher in women with 1 (P = .008) and 2 or more pregnancies (P = .0003) than in men. We conclude that the presence of anti-DPB1 DSAs is associated with graft failure in MUD hematopoietic stem cell transplantation.

  6. Risk of antibody-mediated rejection in kidney transplant recipients with anti-HLA-C donor-specific antibodies.

    PubMed

    Aubert, O; Bories, M-C; Suberbielle, C; Snanoudj, R; Anglicheau, D; Rabant, M; Martinez, F; Scemla, A; Legendre, C; Sberro-Soussan, R

    2014-06-01

    Anti-HLA donor-specific antibodies (DSAs) cause acute and chronic antibody-mediated rejection (AMR). However, the clinical relevance of anti-HLA-C antibodies remains unclear. We evaluated the clinical relevance of the presence of anti-HLA-C DSA at day 0 in renal transplant recipients. In this retrospective, case-controlled study, 608 patients who underwent kidney transplantation between August 2008 and March 2012 were screened for the presence of isolated anti-HLA-C DSA at day 0. A total of 22 renal transplant recipients were selected and followed for a period of 1 year. AMR was classified according to the Banff classification. The 22 patients were compared with 88 immunized patients. Acute AMR was diagnosed in six patients (27.3%). The median level of DSA at day 0 was 1179 (530-17,941). The mean fluorescence intensity in the anti-C group was 4966 (978-17,941) in the AMR group and 981 (530-8012) in the group of patients without AMR. Acute AMR was diagnosed less frequently in the 88 immunized individuals (9.1%) than in the DSA anti-C group (p = 0.033). The level of DSA at day 0 was predictive for AMR (p = 0.017). Patients with a high level of pretransplant anti-HLA-C DSAs are likely to develop acute AMR during the first year after transplantation.

  7. [Effect of pre-transplant donor specific antibody on antibody-mediated rejection and graft dysfunction].

    PubMed

    Wang, Ning; Li, Wei; Zhang, Sheng

    2016-05-01

    目的:研究肾移植受者的术前供者特异性抗体(donor specific antibody,DSA)与其术后发生抗体介导的体液排斥反应(antibody-mediated rejection,AMR)及移植肾功能的关系。方法:选取符合要求的肾移植受者88例。术前采用Luminex流式法对肾移植受者进行DSA检测,并将受者分为DSA阳性组(n=20)与DSA阴性组(n=68)。随访时间为2年。术后参照Banff 2005标准对移植肾病理形态进行评估分级,并观察移植肾的情况。结果: DSA阳性组与阴性组AMR发生率分别为20.0%和1.5%,移植物丢失发生率分别为15.0%和1.5%,两组比较差异均有统计学意义(分别P<0.01,P<0.05);AMR受者最高DSA的荧光指数中值(mean fluorescence intensity,MFI)较非AMR受者差异明显(P<0.01);受试者工作特征(receiver operating characteristic,ROC)曲线显示肾移植术后受者发展为AMR的最高MFI阈值为7909.5。两组移植肾功能延迟回复的发生相比较,差异无统计学意义(P>0.05)。结论:肾移植术前检测DSA水平,可以预测AMR的发生风险和移植肾功能状态。最高DSA值的MFI截点(7909.5)能够预测AMR发生的风险。.

  8. Donor Specific Anti-HLA Antibody and Risk of Graft Failure in Haploidentical Stem Cell Transplantation

    PubMed Central

    Kongtim, Piyanuch; Cao, Kai; Ciurea, Stefan O.

    2016-01-01

    Outcomes of allogeneic hematopoietic stem cell transplantation (AHSCT) using HLA-half matched related donors (haploidentical) have recently improved due to better control of alloreactive reactions in both graft-versus-host and host-versus-graft directions. The recognition of the role of humoral rejection in the development of primary graft failure in this setting has broadened our understanding about causes of engraftment failure in these patients, helped us better select donors for patients in need of AHSCT, and developed rational therapeutic measures for HLA sensitized patients to prevent this unfortunate event, which is usually associated with a very high mortality rate. With these recent advances the rate of graft failure in haploidentical transplantation has decreased to less than 5%. PMID:26904122

  9. Clinical and anti-HLA antibody profile of nine renal transplant recipients with failed grafts: donor-specific and non-donor-specific antibody development.

    PubMed

    Rebellato, Lorita M; Ozawa, Miyuki; Verbanac, Kathryn M; Catrou, Paul; Haisch, Carl E; Terasaki, Paul I

    2006-01-01

    This study applied the single antigen microsphere technology to the retrospective analysis of sequential post-transplant serum samples in the context of the patient's clinical course. Detailed information on nine of the study patients was presented as representative of the larger cohort and illustrative of different patterns of anti-HLA antibody development and different clinical scenarios that culminated in graft failure. Our major observations are summarized as follows: 1. These data confirm the high sensitivity of the single antigen bead method: In some patients, DSA and NDSA that were undetected by standard methods were found pre-transplant and in sequential post-transplant samples. 2. The precise role that anti-HLA antibody plays in a particular rejection are complicated in cases in which humoral rejection is not diagnosed in the biopsy: The possible involvement of ADCC and mechanisms involving an indirect role for antibody in the rejection process should be carefully investigated. 3. Although anti-HLA antibodies are associated with graft rejection, the time interval between detection and rejection can vary dramatically between patients. Both DSA and NDSA can be adsorbed by the graft and erratically detected in the circulation, in some cases remaining undetected until nephrectomy. 4. Anti-HLA antibody strengths often fluctuate widely over a patient's clinical course, with de novo DSA generally of greater strength than de novo NDSA. 5. In addition to DSA, we have observed the consistent induction of diverse, cross-reactive NDSA. This occurs not only during the post-transplant course but also after graft failure, when immunosuppression is tapered prior to nephrectomy. Our data support further studies to evaluate the value of prospective monitoring of anti-HLA antibodies to better understand the place of anti-HLA antibodies in acute rejection. This may improve our ability to reverse some acute rejection episodes. Since acute rejection has been considered a

  10. Mechanisms of immunologic unresponsiveness induced by ultraviolet-irradiated donor-specific blood transfusions and peritransplant cyclosporine

    SciTech Connect

    Oluwole, S.F.; Chabot, J.; Pepino, P.; Reemtsma, K.; Hardy, M.A.

    1988-09-01

    Recipient pretreatment with UV-B irradiated donor-specific blood transfusions (UV-DST) combined with peritransplant cyclosporine on days 0, +1, and +2 leads to permanent cardiac allograft survival in the ACI-to-Lewis rat strain combination. This study investigates the mechanisms of immunologic unresponsiveness induced by UV-DST and CsA by examining several in vitro and in vivo parameters in long-term cardiac allograft recipients. The results of the in vitro studies demonstrate that thoracic duct lymphocytes (TDL) of treated and allografted Lewis rats respond less in a mixed lymphocyte reaction to donor splenic lymphocytes (SpL) by 69%, 75%, and 73% (P less than 0.001) at 30, 50, and 100 days after transplantation, respectively, compared with controls, while the response to a third-party (W/F) SpL is unimpaired. In coculture experiments, the TDL from treated recipients specifically suppressed the response of unmodified Lewis TDL to ACI SpL by 59% and 40% (P less than 0.01) at 30 and 50 days after transplantation, respectively, while responses to W/F SpL were suppressed by only 3-6%. The sera obtained from ungrafted rats transfused with UV-DST suppressed the MLR between unmodified Lewis TDL and ACI SpL by 31% (P less than 0.05) while the sera from UV-DST and CsA-treated and allografted rats specifically suppressed the MLR by 75%, 80% (P less than 0.001) and 37% (P less than 0.01) at 10, 30, and 50 days after transplantation, respectively. In vivo adoptive transfer of 10(4) donor-type dendritic cells (DC) into recipients of beating cardiac allografts at 40 or 60 days after transplantation led to rapid and acute allograft rejection, while the adoptive transfer of 10(8) unseparated SpL obtained at 50 days after transplantation from treated Lewis recipients to syngeneic naive hosts led to a modest but significant prolongation of ACI test cardiac allografts.

  11. Post-transplant donor-specific antibody production and graft outcome in kidney transplantation: results of sixteen-year monitoring by flow cytometry.

    PubMed

    Piazza, Antonina; Poggi, Elvira; Ozzella, Giuseppina; Borrelli, Laura; Scornajenghi, Alessandra; Iaria, Giuseppe; Tisone, Giuseppe; Adorno, Domenico

    2006-01-01

    Our data show that monitoring by sensitive flow cytometric techniques of the de novo production of anti-HLA antibodies in patients receiving kidney transplantation is a useful and noninvasive tool to identify the onset of an immune response towards the graft before any clinical manifestation of antibody-mediated graft injury. Consequently prospective posttransplant monitoring of anti-HLA donor-directed antibodies may offer the chance to realize an effective clinical intervention in order to prevent graft dysfunction and to prolong graft survival. The long follow-up period of the study allowed us to demonstrate a very low graft survival rate in patients who developed donor-specific HLA antibodies in comparison with patients who did not have antibodies, thus confirming the "humoral theory of transplantation". The posttransplant production of anti-HLA antibodies can predict not only graft failure but also chronic dysfunction of the graft. Moreover, our findings suggest that graft survival is influenced by the epitope- and locus-specificity of anti-HLA donor-directed antibodies. The interval between antibody appearance and loss of graft function was short in some patients but reached several years in others. Moreover, some patients showed consistent production of antibodies for many years and an uneventful clinical status. These findings suggest a mechanism of graft "accommodation" or the production of "harmless" antibodies. Immunosuppressive drug combinations able to inhibit T and B cell activation are useful tools to prevent the humoral immune response against graft and consequently to prolong graft survival.

  12. Antibodies to HLA-E may account for the non-donor-specific anti-HLA class-Ia antibodies in renal and liver transplant recipients.

    PubMed

    Ravindranath, Mepur H; Pham, Tho; Ozawa, Miyuki; Terasaki, Paul I

    2012-01-01

    The non-donor-specific anti-HLA-Ia antibodies correlate significantly with lower graft survival in organ transplant patients. Based on our earlier findings that anti-HLA-E murine monoclonal antibodies (MEM-E/02 and 3D12) reacted with different HLA-Ia alleles and the peptides shared by HLA-E and HLA class, Ia alleles inhibited the HLA-Ia reactivity of the anti-HLA-E antibodies in normal non-alloimmunized males, the possibility of that anti-HLA-E IgG may account for the non-donor-specific anti-HLA-Ia antibodies in the allograft recipients was examined by multiplex-Luminex®-immunoassay. About 73% of renal and 53% of liver transplant patients' sera with high level of anti-HLA-E IgG showed reactivity to different non-donor HLA-Ia alleles. About 50% renal and 52% liver allograft recipients' sera with low level of anti-HLA-E IgG had no reactivity to any HLA-Ia alleles; however, the IgG isolated from the same sera with protein-G columns showed the presence of anti-HLA-E IgG with HLA-Ia reactivity. Furthermore, both recombinant HLA-E and the IgG-free serum containing soluble HLA-E (sHLA-E) inhibited HLA-Ia reactivity of anti-HLA-E murine monoclonal IgG significantly. The data suggest that the HLA-Ia reactivity of the anti-HLA-E antibody accounts for the non-donor-specific anti-HLA-Ia antibodies. It is proposed that the sHLA-E heavy chain, shed in circulation after organ transplantation, may expose cryptic epitopes of HLA-E to elicit anti-HLA-E IgG antibodies, which may cross react with HLA-Ia alleles due to the peptide sequences shared between them. This study provides a new explanation for the presence of non-donor-specific antibodies for non-existing HLA-Ia alleles, frequently observed and correlated with survival in organ transplant recipients.

  13. Bioengineering Thymus Organoids to Restore Thymic Function and Induce Donor-Specific Immune Tolerance to Allografts.

    PubMed

    Fan, Yong; Tajima, Asako; Goh, Saik Kia; Geng, Xuehui; Gualtierotti, Giulio; Grupillo, Maria; Coppola, Antonina; Bertera, Suzanne; Rudert, William A; Banerjee, Ipsita; Bottino, Rita; Trucco, Massimo

    2015-07-01

    One of the major obstacles in organ transplantation is to establish immune tolerance of allografts. Although immunosuppressive drugs can prevent graft rejection to a certain degree, their efficacies are limited, transient, and associated with severe side effects. Induction of thymic central tolerance to allografts remains challenging, largely because of the difficulty of maintaining donor thymic epithelial cells in vitro to allow successful bioengineering. Here, the authors show that three-dimensional scaffolds generated from decellularized mouse thymus can support thymic epithelial cell survival in culture and maintain their unique molecular properties. When transplanted into athymic nude mice, the bioengineered thymus organoids effectively promoted homing of lymphocyte progenitors and supported thymopoiesis. Nude mice transplanted with thymus organoids promptly rejected skin allografts and were able to mount antigen-specific humoral responses against ovalbumin on immunization. Notably, tolerance to skin allografts was achieved by transplanting thymus organoids constructed with either thymic epithelial cells coexpressing both syngeneic and allogenic major histocompatibility complexes, or mixtures of donor and recipient thymic epithelial cells. Our results demonstrate the technical feasibility of restoring thymic function with bioengineered thymus organoids and highlight the clinical implications of this thymus reconstruction technique in organ transplantation and regenerative medicine.

  14. Bioengineering Thymus Organoids to Restore Thymic Function and Induce Donor-Specific Immune Tolerance to Allografts

    PubMed Central

    Fan, Yong; Tajima, Asako; Goh, Saik Kia; Geng, Xuehui; Gualtierotti, Giulio; Grupillo, Maria; Coppola, Antonina; Bertera, Suzanne; Rudert, William A; Banerjee, Ipsita; Bottino, Rita; Trucco, Massimo

    2015-01-01

    One of the major obstacles in organ transplantation is to establish immune tolerance of allografts. Although immunosuppressive drugs can prevent graft rejection to a certain degree, their efficacies are limited, transient, and associated with severe side effects. Induction of thymic central tolerance to allografts remains challenging, largely because of the difficulty of maintaining donor thymic epithelial cells in vitro to allow successful bioengineering. Here, the authors show that three-dimensional scaffolds generated from decellularized mouse thymus can support thymic epithelial cell survival in culture and maintain their unique molecular properties. When transplanted into athymic nude mice, the bioengineered thymus organoids effectively promoted homing of lymphocyte progenitors and supported thymopoiesis. Nude mice transplanted with thymus organoids promptly rejected skin allografts and were able to mount antigen-specific humoral responses against ovalbumin on immunization. Notably, tolerance to skin allografts was achieved by transplanting thymus organoids constructed with either thymic epithelial cells coexpressing both syngeneic and allogenic major histocompatibility complexes, or mixtures of donor and recipient thymic epithelial cells. Our results demonstrate the technical feasibility of restoring thymic function with bioengineered thymus organoids and highlight the clinical implications of this thymus reconstruction technique in organ transplantation and regenerative medicine. PMID:25903472

  15. Anti-human leukocyte antigen DQ antibodies in renal transplantation: Are we underestimating the most frequent donor specific alloantibodies?

    PubMed

    Carta, Paolo; Di Maria, Lorenzo; Caroti, Leonardo; Buti, Elisa; Antognoli, Giulia; Minetti, Enrico Eugenio

    2015-07-01

    The role of anti-human leukocyte antigens DQ region (HLA-DQ) in transplantation is historically less studied than HLA-DR and HLA class I regions, but several studies are demonstrating that anti HLA-DQ antibodies are among the most frequent anti HLA antibodies that develop after transplantation and can have great influence on the developing of humoral rejection and graft loss. In this article we review the gene structure and nomenclature of the HLA-DQ region, the role of anti HLA-DQ antibodies after and before transplantation and briefly the associations of particular HLA-DQ alleles and other diseases.

  16. De Novo Donor-Specific HLA Antibodies Developing Early or Late after Transplant Are Associated with the Same Risk of Graft Damage and Loss in Nonsensitized Kidney Recipients

    PubMed Central

    Cioni, Michela; Nocera, Arcangelo; Innocente, Annalisa; Tagliamacco, Augusto; Trivelli, Antonella; Basso, Sabrina; Quartuccio, Giuseppe; Fontana, Iris; Magnasco, Alberto; Drago, Francesca; Gurrado, Antonella; Guido, Ilaria; Compagno, Francesca; Garibotto, Giacomo; Klersy, Catherine; Verrina, Enrico; Ghiggeri, Gian Marco; Cardillo, Massimo

    2017-01-01

    De novo posttransplant donor-specific HLA-antibody (dnDSA) detection is now recognized as a tool to identify patients at risk for antibody-mediated rejection (AMR) and graft loss. It is still unclear whether the time interval from transplant to DSA occurrence influences graft damage. Utilizing sera collected longitudinally, we evaluated 114 consecutive primary pediatric kidney recipients grafted between 2002 and 2013 for dnDSA occurrence by Luminex platform. dnDSAs occurred in 39 patients at a median time of 24.6 months. In 15 patients, dnDSAs developed within 1 year (early-onset group), while the other 24 seroconverted after the first posttransplant year (late-onset group). The two groups were comparable when considering patient- and transplant-related factors, as well as DSA biological properties, including C1q and C3d complement-binding ability. Only recipient age at transplant significantly differed in the two cohorts, with younger patients showing earlier dnDSA development. Late AMR was diagnosed in 47% of the early group and in 58% of the late group. Graft loss occurred in 3/15 (20%) and 4/24 (17%) patients in early- and late-onset groups, respectively (p = ns). In our pediatric kidney recipients, dnDSAs predict AMR and graft loss irrespective of the time elapsed between transplantation and antibody occurrence. PMID:28367453

  17. Disparate rates of acute rejection and donor-specific antibodies among high-immunologic risk renal transplant subgroups receiving antithymocyte globulin induction.

    PubMed

    Patel, Samir J; Suki, Wadi N; Loucks-DeVos, Jennifer; Graviss, Edward A; Nguyen, Duc T; Knight, Richard J; Kuten, Samantha A; Moore, Linda W; Teeter, Larry D; Gaber, Lillian W; Gaber, A Osama

    2016-08-01

    Lymphocyte-depleting induction lowers acute rejection (AR) rates among high-immunologic risk (HIR) renal transplant recipients, including African Americans (AAs), retransplants, and the sensitized. It is unclear whether different HIR subgroups experience similarly low rates of AR. We aimed to describe the incidence of AR and de novo donor-specific antibody (dnDSA) among HIR recipients categorized by age, race, or donor type. All received antithymocyte globulin (ATG) induction and triple maintenance immunosuppression. A total of 464 HIR recipients from 2007 to 2014 were reviewed. AR and dnDSA rates at 1 year for the entire population were 14% and 27%, respectively. AR ranged from 6.7% among living donor (LD) recipients to 30% in younger AA deceased donor (DD) recipients. De novo donor-specific antibody at 1 year ranged from 7% in older non-AA LD recipients to 32% in AAs. AA race remained as an independent risk factor for AR among DD recipients and for dnDSA among all HIR recipients. Development of both AR and dnDSA within the first year was associated with a 54% graft survival at 5 years and was an independent risk factor for graft loss. Despite utilization of recommended immunosuppression for HIR recipients, substantial disparities exist among subgroups, warranting further consideration of individualized immunosuppression in certain HIR subgroups.

  18. Pre-Transplant Donor-Specific T-Cell Alloreactivity Is Strongly Associated with Early Acute Cellular Rejection in Kidney Transplant Recipients Not Receiving T-Cell Depleting Induction Therapy

    PubMed Central

    Crespo, Elena; Lucia, Marc; Cruzado, Josep M.; Luque, Sergio; Melilli, Edoardo; Manonelles, Anna; Lloberas, Nuria; Torras, Joan; Grinyó, Josep M.; Bestard, Oriol

    2015-01-01

    Preformed T-cell immune-sensitization should most likely impact allograft outcome during the initial period after kidney transplantation, since donor-specific memory T-cells may rapidly recognize alloantigens and activate the effector immune response, which leads to allograft rejection. However, the precise time-frame in which acute rejection is fundamentally triggered by preformed donor-specific memory T cells rather than by de novo activated naïve T cells is still to be established. Here, preformed donor-specific alloreactive T-cell responses were evaluated using the IFN-γ ELISPOT assay in a large consecutive cohort of kidney transplant patients (n = 90), to assess the main clinical variables associated with cellular sensitization and its predominant time-frame impact on allograft outcome, and was further validated in an independent new set of kidney transplant recipients (n = 67). We found that most highly T-cell sensitized patients were elderly patients with particularly poor HLA class-I matching, without any clinically recognizable sensitizing events. While one-year incidence of all types of biopsy-proven acute rejection did not differ between T-cell alloreactive and non-alloreactive patients, Receiver Operating Characteristic curve analysis indicated the first two months after transplantation as the highest risk time period for acute cellular rejection associated with baseline T-cell sensitization. This effect was particularly evident in young and highly alloreactive individuals that did not receive T-cell depletion immunosuppression. Multivariate analysis confirmed preformed T-cell sensitization as an independent predictor of early acute cellular rejection. In summary, monitoring anti-donor T-cell sensitization before transplantation may help to identify patients at increased risk of acute cellular rejection, particularly in the early phases after kidney transplantation, and thus guide decision-making regarding the use of induction therapy. PMID:25689405

  19. IgM-Enriched Human Intravenous Immunoglobulin-Based Treatment of Patients With Early Donor Specific Anti-HLA Antibodies After Lung Transplantation

    PubMed Central

    Ius, Fabio; Sommer, Wiebke; Kieneke, Daniela; Tudorache, Igor; Kühn, Christian; Avsar, Murat; Siemeni, Thierry; Salman, Jawad; Erdfelder, Carolin; Verboom, Murielle; Kielstein, Jan; Tecklenburg, Andreas; Greer, Mark; Hallensleben, Michael; Blasczyk, Rainer; Schwerk, Nicolaus; Gottlieb, Jens; Welte, Tobias; Haverich, Axel; Warnecke, Gregor

    2016-01-01

    Background At our institution, until April 2013, patients who showed early donor specific anti-HLA antibodies (DSA) after lung transplantation were preemptively treated with therapeutic plasma exchange (tPE) and a single dose of Rituximab. In April 2013, we moved to a therapy based on IgM-enriched human immunoglobulins (IVIG), repeated every 4 weeks, and a single dose of Rituximab. Methods This observational study was designed to evaluate the short-term patient and graft survival in patients who underwent IVIG-based DSA treatment (group A, n = 57) versus contemporary patients transplanted between April 2013 and January 2015 without DSA (group C, n = 180), as well as to evaluate DSA clearance in IVIG-treated patients versus historic patients who had undergone tPE-based treatment (group B, n = 56). Patient records were retrospectively reviewed. Follow-up ended on April 1, 2015. Results At 6 months and 1 year of follow-up, group A had a survival similar to group C (P = 0.81) but better than group B (P = 0.008). Group A showed statistically nonsignificant trends toward improved freedom from pulsed-steroid therapy and biopsy-confirmed rejection over groups B and C. The DSA clearance was better in group A than group B at treatment end (92% vs 64%; P = 0.002) and last DSA control (90% vs 75%; P = 0.04). Conclusions Patients with new early DSA but without graft dysfunction that are treated with IVIG and Rituximab have similarly good early survival as contemporary lung transplant recipients without early DSA. The IVIG yielded increased DSA clearance compared with historic tPE-based treatment, yet spontaneous clearance of new DSA also remains common. PMID:26714123

  20. The Influence of Immunosuppressive Agents on the Risk of De Novo Donor-Specific HLA Antibody Production in Solid Organ Transplant Recipients.

    PubMed

    OʼLeary, Jacqueline G; Samaniego, Millie; Barrio, Marta Crespo; Potena, Luciano; Zeevi, Adriana; Djamali, Arjang; Cozzi, Emanuele

    2016-01-01

    Production of de novo donor-specific antibodies (dnDSA) is a major risk factor for acute and chronic antibody-mediated rejection and graft loss after all solid organ transplantation. In this article, we review the data available on the risk of individual immunosuppressive agents and their ability to prevent dnDSA production. Induction therapy with rabbit antithymocyte globulin may achieve a short-term decrease in dnDSA production in moderately sensitized patients. Rituximab induction may be beneficial in sensitized patients, and in abrogating rebound antibody response in patients undergoing desensitization or treatment for antibody-mediated rejection. Use of bortezomib for induction therapy in at-risk patients is of interest, but the benefits are unproven. In maintenance regimens, nonadherent and previously sensitized patients are not suitable for aggressive weaning protocols, particularly early calcineurin inhibitor withdrawal without lymphocyte-depleting induction. Early conversion to mammalian target of rapamycin inhibitor monotherapy has been reported to increase the risk of dnDSA formation, but a combination of mammalian target of rapamycin inhibitor and reduced-exposure calcineurin inhibitor does not appear to alter the risk. Early steroid therapy withdrawal in standard-risk patients after induction has no known dnDSA penalty. The available data do not demonstrate a consistent effect of mycophenolic acid on dnDSA production. Risk minimization for dnDSA requires monitoring of adherence, appropriate risk stratification, risk-based immunosuppression intensity, and prospective DSA surveillance.

  1. The Influence of Immunosuppressive Agents on the Risk of De Novo Donor-Specific HLA Antibody Production in Solid Organ Transplant Recipients

    PubMed Central

    O'Leary, Jacqueline G.; Samaniego, Millie; Barrio, Marta Crespo; Potena, Luciano; Zeevi, Adriana; Djamali, Arjang; Cozzi, Emanuele

    2016-01-01

    Production of de novo donor-specific antibodies (dnDSA) is a major risk factor for acute and chronic antibody-mediated rejection and graft loss after all solid organ transplantation. In this article, we review the data available on the risk of individual immunosuppressive agents and their ability to prevent dnDSA production. Induction therapy with rabbit antithymocyte globulin may achieve a short-term decrease in dnDSA production in moderately sensitized patients. Rituximab induction may be beneficial in sensitized patients, and in abrogating rebound antibody response in patients undergoing desensitization or treatment for antibody-mediated rejection. Use of bortezomib for induction therapy in at-risk patients is of interest, but the benefits are unproven. In maintenance regimens, nonadherent and previously sensitized patients are not suitable for aggressive weaning protocols, particularly early calcineurin inhibitor withdrawal without lymphocyte-depleting induction. Early conversion to mammalian target of rapamycin inhibitor monotherapy has been reported to increase the risk of dnDSA formation, but a combination of mammalian target of rapamycin inhibitor and reduced-exposure calcineurin inhibitor does not appear to alter the risk. Early steroid therapy withdrawal in standard-risk patients after induction has no known dnDSA penalty. The available data do not demonstrate a consistent effect of mycophenolic acid on dnDSA production. Risk minimization for dnDSA requires monitoring of adherence, appropriate risk stratification, risk-based immunosuppression intensity, and prospective DSA surveillance. PMID:26680372

  2. Determining donor-specific antibody C1q-binding ability improves the prediction of antibody-mediated rejection in human leucocyte antigen-incompatible kidney transplantation.

    PubMed

    Malheiro, Jorge; Tafulo, Sandra; Dias, Leonídio; Martins, La Salete; Fonseca, Isabel; Beirão, Idalina; Castro-Henriques, António; Cabrita, António

    2017-04-01

    Detrimental impact of preformed donor-specific antibodies (DSAs) against human leucocyte antigens on outcomes after kidney transplantation are well documented, however, the value of their capacity to bind complement for predicting antibody-mediated rejection (AMR) and graft survival still needs to be confirmed. We aimed to study DSA characteristics (strength and C1q binding) that might distinguish harmful DSA from clinically irrelevant ones. We retrospectively studied 60 kidney-transplanted patients with preformed DSA detected by single antigen bead (SAB) assays (IgG and C1q kits), from a cohort of 517 kidney graft recipients (124 with detectable anti-HLA antibodies). Patients were divided into DSA strength (MFI < vs. ≥ 15 000) and C1q-binding ability. AMR frequency was high (30%) and it increased with DSA strength (P = 0.002) and C1q+ DSA (P < 0.001). The performance of DSA C1q-binding ability as a predictor of AMR was better than DSA strength (diagnostic odds ratio 16.3 vs. 6.4, respectively). Furthermore, a multivariable logistic regression showed that C1q+ DSA was a risk factor for AMR (OR = 16.80, P = 0.001), while high MFI DSAs were not. Graft survival was lower in high MFI C1q+ DSA in comparison with patients with C1q- high or low MFI DSA (at 6 years, 38%, 83% and 80%, respectively; P = 0.001). Both DSA strength and C1q-binding ability assessment seem valuable for improving pretransplant risk assessment. Since DSA C1q-binding ability was a better predictor of AMR and correlated with graft survival, C1q-SAB may be a particularly useful tool.

  3. Donor-specific anti-HLA antibodies after bone-graft transplantation. Impact on a subsequent renal transplantation: a case report.

    PubMed

    Mosconi, G; Baraldi, O; Fantinati, C; Panicali, L; Veronesi, M; Cappuccilli, M L; Corsini, S; Zanelli, P; Bassi, A; Buscaroli, A; Feliciangeli, G; Stefoni, S

    2009-05-01

    Immunological evaluation by panel-reactive antibody (PRA) and determination of anti-HLA specificity are important phases in the evaluation of patients awaiting kidney transplantation. The main causes of immunization are previous solid organ transplantation, hemotransfusion, and pregnancy. It is also possible that immunogenicity can be triggered by vascularized tissue grafts. Immune induction by cryopreserved bone prostheses is not yet understood. A 19-year-old patient with osteosarcoma had undergone resection of the left proximal tibia with reconstruction using human bone in 1997. The donor HLA typing was as follows: A3, A29 (19); B44 (12), Bw4; DR13 (6), DR7, DR52, DR53. The patient was subsequently enrolled onto the waiting list for cadaveric donor kidney transplantation due to chronic kidney failure caused by cisplatin toxicity. Pretransplantation immunological screening using the complement-dependent cytotoxicity (CDC) technique revealed a PRA of 63%. IgG antibody specificities were detected against class I and class II donor antigens, specifically anti-A3, B44, DR7 antibodies, using flow cytometry (Tepnel Luminex). Further immunological studies using single HLA specificity analysis (LSA Class I degrees -II degrees , Tepnel-Luminex) showed direct antibodies against all donor antigen specificities. This case showed immune induction after the implantation of bone prosthesis in a kidney transplant candidate, underlining the importance of the availability of HLA typing data of donors of a human prosthesis.

  4. Impact of donor-specific anti-HLA antibodies on graft failure and survival after reduced intensity conditioning-unrelated cord blood transplantation: a Eurocord, Société Francophone d'Histocompatibilité et d'Immunogénétique (SFHI) and Société Française de Greffe de Moelle et de Thérapie Cellulaire (SFGM-TC) analysis.

    PubMed

    Ruggeri, Annalisa; Rocha, Vanderson; Masson, Emeline; Labopin, Myriam; Cunha, Renato; Absi, Lena; Boudifa, Ali; Coeffic, Brigitte; Devys, Anne; De Matteis, Muriel; Dubois, Valérie; Hanau, Daniel; Hau, Françoise; Jollet, Isabelle; Masson, Dominique; Pedron, Beatrice; Perrier, Pascale; Picard, Christophe; Ramouneau-Pigot, Annie; Volt, Fernanda; Charron, Dominique; Gluckman, Eliane; Loiseau, Pascale

    2013-07-01

    Graft failure is a major complication after unrelated cord blood transplantation. Presence of HLA-antibodies before cord blood transplantation may impact graft failure. To analyze the effect of anti-HLA antibodies on unrelated cord blood transplantation outcomes, we analyzed 294 unrelated cord blood transplant recipients after reduced intensity conditioning regimen. The majority of the patients (82%) were transplanted for malignancies, 60% with double-unrelated cord blood transplant, 63% were HLA mismatched. Retrospectively, pre-unrelated cord blood transplant serum was tested for HLA-Ab using Luminex™ platform. Results were interpreted as mean fluorescence intensity (MFI) against donor-specific mismatch. Among 62 recipients (23%) who had anti-HLA antibodies before unrelated cord blood transplant, 14 patients had donor specific anti-HLA antibodies (DSA) (7 were donor-specific anti-HLA antibodies for single unrelated cord blood transplant and 7 for double unrelated cord blood transplant). Donor specific anti-HLA antibodies threshold ranged from 1620-17629 of mean fluorescence intensity (MFI). Cumulative incidence of Day-60 neutrophil engraftment was 76%: 44% for recipients with donor specific anti-HLA antibodies and 81% in those without donor specific anti-HLA antibodies (P=0.006). The cumulative incidence of 1-year transplant related mortality was 46% in patients with donor specific anti-HLA antibodies and 32% in those without antibodies (P=0.06). The presence of donor specific anti-HLA antibodies was associated with a trend for decreased survival rate (42% vs. 29%; P=0.07). Donor specific anti-HLA antibody in recipients of unrelated cord blood transplant is associated with graft failure and decreased survival. Patient's screening for donor specific anti-HLA antibodies before unrelated cord blood transplantation is recommended before choosing an HLA mismatched cord blood unit. Whenever possible it is important to avoid selecting a unit for which the patient has

  5. Impact of donor-specific antibodies on the outcomes of kidney graft: Pathophysiology, clinical, therapy

    PubMed Central

    Salvadori, Maurizio; Bertoni, Elisabetta

    2014-01-01

    Allo-antibodies, particularly when donor specific, are one of the most important factors that cause both early and late graft dysfunction. The authors review the current state of the art concerning this important issue in renal transplantation. Many antibodies have been recognized as mediators of renal injury. In particular donor-specific-Human Leukocyte Antigens antibodies appear to play a major role. New techniques, such as solid phase techniques and Luminex, have revealed these antibodies from patient sera. Other new techniques have uncovered alloantibodies and signs of complement activation in renal biopsy specimens. It has been acknowledged that the old concept of chronic renal injury caused by calcineurine inhibitors toxicity should be replaced in many cases by alloantibodies acting against the graft. In addition, the number of patients on waiting lists with preformed anti-human leukocyte antigens (HLA) antibodies is increasing, primarily from patients with a history of renal transplant failure already been sensitized. We should distinguish early and late acute antibody-mediated rejection from chronic antibody-mediated rejection. The latter often manifets late during the course of the post-transplant period and may be difficult to recognize if specific techniques are not applied. Different therapeutic strategies are used to control antibody-induced damage. These strategies may be applied prior to transplantation or, in the case of acute antibody-mediated rejection, after transplantation. Many new drugs are appearing at the horizon; however, these drugs are far from the clinic because they are in phase I-II of clinical trials. Thus the pipeline for the near future appears almost empty. PMID:24669363

  6. Prolongation of rat heart allografts by donor-specific blood transfusion treated with ultraviolet irradiation

    SciTech Connect

    Oluwole, S.F.; Iga, C.; Lau, H.; Hardy, M.A.

    1985-07-01

    The effect of donor-specific blood transfusion was compared to that of UVB-irradiated donor-specific blood transfusion on heart allograft survival in inbred rats with major histocompatibility differences. In one series ACI rats received heterotopic heart grafts from Lewis rats and 1 mL transfusion of donor-type blood at 1, 2, and 3 weeks prior to the transplantation. Fifty percent of the grafts were permanently accepted (survival greater than 200 days). Following UVB-irradiated donor-specific blood transfusion, 55% of the grafts survived indefinitely. In a mixed lymphocyte reaction ACI lymphocytes are weak responders to Lewis lymphocytes. In another series, Lewis rats received ACI hearts. Donor-specific transfusions at 1, 2, and 3 weeks prior to transplantation did not significantly alter the survival of heart allografts. Lewis lymphocytes react strongly to ACI stimulator cells in a mixed lymphocyte reaction. However, when the donor blood was UVB-irradiated prior to transfusion, the ACI allograft survival was significantly prolonged in this ACI-to-Lewis strain combination. When Lewis rats received W/F hearts following either donor-specific or UVB-irradiated donor-specific transfusions, the hearts' survival was similarly and significantly prolonged, but did not become permanent. Mixed lymphocyte reaction reveals that the stimulation index of Lewis lymphocytes against W/F lymphocytes is greater than that of ACI versus Lewis, but is less than that between Lewis responder cells against ACI stimulators.

  7. Donor-Specific Regulatory T Cells Acquired from Tolerant Mice Bearing Cardiac Allograft Promote Mixed Chimerism and Prolong Intestinal Allograft Survival

    PubMed Central

    Shen, Xiao-Fei; Jiang, Jin-Peng; Yang, Jian-Jun; Wang, Wei-Zhong; Guan, Wen-Xian; Du, Jun-Feng

    2016-01-01

    The induction of donor-specific transplant tolerance has always been a central problem for small bowel transplantation (SBT), which is thought to be the best therapy for end-stage bowel failure. With the development of new tolerance-inducing strategies, mixed chimerism induced by co-stimulation blockade has become most potent for tolerance of allografts, such as skin, kidney, and heart. However, a lack of clinically available co-stimulation blockers has hindered efficient application in humans. Furthermore, unlike those for other types of solid organ transplantation, strategies to induce robust mixed chimerism for intestinal allografts have not been fully developed. To improve current mixed chimerism induction protocols for future clinical application, we developed a new protocol using donor-specific regulatory T (Treg) cells from mice with heart allograft tolerance, immunosuppressive drugs which could be used clinically and low doses of irradiation. Our results demonstrated that donor-specific Treg cells acquired from tolerant mice after in vitro expansion generate stable chimerism and lead to acceptance of intestinal allograft. Increased intragraft Treg cells and clonal deletion contribute to the development of SBT tolerance. PMID:27909438

  8. Mixed chimerism to induce tolerance for solid organ transplantation

    SciTech Connect

    Wren, S.M.; Nalesnik, M.; Hronakes, M.L.; Oh, E.; Ildstad, S.T. )

    1991-04-01

    Chimerism, or the coexistence of tissue elements from more than one genetically different strain or species in an organism, is the only experimental state that results in the induction of donor-specific transplantation tolerance. Transplantation of a mixture of T-cell-depleted syngeneic (host-type) plus T-cell-depleted allogeneic (donor) bone marrow into a normal adult recipient mouse (A + B----A) results in mixed allogeneic chimerism. Recipient mice exhibit donor-specific transplantation tolerance, yet have full immunocompetence to recognize and respond to third-party transplantation antigens. After complete hematolymphopoietic repopulation at 28 days, animals accept a donor-specific skin graft but reject major histocompatibility complex (MHC) locus-disparate third-party grafts. We now report that permanent graft acceptance can also be achieved when the graft is placed at the time of bone marrow transplantation. Histologically, grafts were viable and had only minimal inflammatory changes. This model may have potential future clinical application for the induction of donor-specific transplantation tolerance.

  9. C1Q Assay Results in Complement-Dependent Cytotoxicity Crossmatch Negative Renal Transplant Candidates with Donor-Specific Antibodies: High Specificity but Low Sensitivity When Predicting Flow Crossmatch

    PubMed Central

    Castelán, Natalia; de Santiago, Adrián; Arvizu, Adriana; Gonzalez-Tableros, Norma; López, Mayra; Salcedo, Isaac; Vilatobá, Mario; Granados, Julio

    2016-01-01

    The aim of the present study was to describe the association of positive flow cross match (FXM) and C1q-SAB. Methods. In this observational, cross-sectional, and comparative study, patients included had negative AHG-CDC-XM and donor specific antibodies (DSA) and were tested with FXM. All pretransplant sera were tested with C1q-SAB assay. Results. A total of 50 donor/recipient evaluations were conducted; half of them had at least one C1q+ Ab (n = 26, 52%). Ten patients (20.0%) had DSA C1q+ Ab. Twenty-five (50%) FXMs were positive. Factors associated with a positive FXM were the presence of C1q+ Ab (DSA C1q+ Ab: OR 27, 2.80–259.56, P = 0.004, and no DSA C1q+ Ab: OR 5, 1.27–19.68, P = 0.021) and the DSA LABScreen-SAB MFI (OR 1.26, 95% CI 1.06–1.49, P = 0.007). The cutoff point of immunodominant LABScreen SAB DSA-MFI with the greatest sensitivity and specificity to predict FXM was 2,300 (sensitivity: 72% and specificity: 75%). For FXM prediction, DSA C1q+ Ab was the most specific (95.8%, 85–100) and the combination of DSA-MFI > 2,300 and C1q+ Ab was the most sensitive (92.0%, 79.3–100). Conclusions. C1q+ Ab and LABScreen SAB DSA-MFI were significantly associated with FXM. DSA C1q+ Ab was highly specific but with low sensitivity. PMID:27688904

  10. Mixed chimerism and permanent specific transplantation tolerance induced by a nonlethal preparative regimen

    SciTech Connect

    Sharabi, Y.; Sachs, D.H.

    1989-02-01

    The use of allogeneic bone marrow transplantation as a means of inducing donor-specific tolerance across MHC barriers could provide an immunologically specific conditioning regimen for organ transplantation. However, a major limitation to this approach is the toxicity of whole body irradiation as currently used to abrogate host resistance and permit marrow engraftment. The present study describes methodology for abrogating host resistance and permitting marrow engraftment without lethal irradiation. Our preparative protocol involves administration of anti-CD4 and anti-CD8 mAbs in vivo, 300-rad WBI, 700-rad thymic irradiation, and unmanipulated fully MHC-disparate bone marrow. B10 mice prepared by this regimen developed stable mixed lymphohematopoetic chimerism without any clinical evidence of graft-vs.-host disease. Engraftment was accompanied by induction of specific tolerance to donor skin grafts (B10.D2), while third-party skin grafts (B10.BR) were promptly rejected. Mice treated with the complete regimen without bone marrow transplantation appeared healthy and enjoyed long-term survival. This study therefore demonstrates that stable mixed chimerism with donor-specific tolerance can be induced across an MHC barrier after a nonlethal preparative regimen, without clinical GVHD and without the risk of aplasia.

  11. [Renal transplantation without maintenance immunosuppression. Identical twins and kidney transplantation following a successful bone marrow graft].

    PubMed

    Hadi, Riad Abdel; Thomé, Gustavo Gomes; Ribeiro, Adriana Reginato; Manfro, Roberto Ceratti

    2015-01-01

    Renal transplantation without maintenance immunosuppression has been sporadically reported in the literature. The cases include non-adherent patients who discontinued their immunosuppressive medications, transplantation between identical twins, kidney transplantation after a successful bone marrow graft from the same donor and simultaneous bone marrow and kidney transplantation for the treatment of multiple myeloma with associated renal failure. There are also ongoing clinical trials designed to induce donor specific transplant tolerance with infusion of hematopoietic cells from the same kidney donor. Here we describe two cases of renal transplantation without immunosuppression as examples of situations described above.

  12. Evolving approaches of hematopoietic stem cell-based therapies to induce tolerance to organ transplants: the long road to tolerance.

    PubMed

    Leventhal, J; Miller, J; Abecassis, M; Tollerud, D J; Ildstad, S T

    2013-01-01

    The immunoregulatory properties of hematopoietic stem cells (HSCs) have been recognized for more than 60 years, beginning in 1945, when Owen reported that genetically disparate freemartin cattle sharing a common placenta were red blood cell chimeras. In 1953, Billingham, Brent, and Medawar demonstrated that murine neonatal chimeras prepared by infusion of donor-derived hematopoietic cells exhibited donor-specific tolerance to skin allografts. Various approaches using HSCs in organ transplantation have gradually brought closer to reality the dream of inducing donor-specific tolerance in organ transplant recipients. Several hurdles needed to be overcome, especially the risk of graft-versus-host disease (GVHD), the toxicity of ablative conditioning, and the need for close donor-recipient matching. For wide acceptance, HSC therapy must be safe and reproducible in mismatched donor-recipient combinations. Discoveries in other disciplines have often unexpectedly and synergistically contributed to progress in this area. This review presents a historic perspective of the quest for tolerance in organ transplantation, highlighting current clinical approaches.

  13. The impact of donor-specific anti-HLA antibodies on late kidney allograft failure.

    PubMed

    Loupy, Alexandre; Hill, Gary S; Jordan, Stanley C

    2012-04-17

    Despite improvements in outcomes of renal transplantation, kidney allograft loss remains substantial, and is associated with increased morbidity, mortality and costs. Identifying the pathologic pathways responsible for allograft loss, and the attendant development of therapeutic interventions, will be one of the guiding future objectives of transplant medicine. One of the most important advances of the past decade has been the demonstration of the destructive power of anti-HLA alloantibodies and their association with antibody-mediated rejection (ABMR). Compelling evidence exists to show that donor-specific anti-HLA antibodies (DSAs) are largely responsible for the chronic deterioration of allografts, a condition previously attributed to calcineurin inhibitor toxicity and chronic allograft nephropathy. The emergence of sensitive techniques to detect DSAs, together with advances in the assessment of graft pathology, have expanded the spectrum of what constitutes ABMR. Today, subtler forms of rejection--such as indolent ABMR, C4d-negative ABMR, and transplant arteriopathy--are seen in which DSAs exert a marked pathological effect. In addition, arteriosclerosis, previously thought to be a bystander lesion related to the vicissitudes of aging, is accelerated in ABMR. Advances in our understanding of the pathological significance of DSAs and ABMR show their primacy in the mediation of chronic allograft destruction. Therapies aimed at B cells, plasma cells and antibodies will be important therapeutic options to improve the length and quality of kidney allograft survival.

  14. Influence of preformed donor-specific antibodies and C4d on early liver allograft function.

    PubMed

    Perera, M T; Silva, M A; Murphy, N; Briggs, D; Mirza, D F; Neil, D A H

    2013-12-01

    INTRODUCTION. The impact of preformed donor-specific antibodies (DSA) is incompletely understood in liver transplantation. The incidence and impact of preformed DSA on early post liver transplant were assessed and these were correlated with compliment fragment C4d on allograft biopsy. METHODS. Pretransplant serum from 41 consecutive liver transplant recipients (brain dead donors; DBD = 27 and cardiac death donors; DCD = 14) were tested for class-specific anti-human leukocyte antigen (HLA) and compared against donor HLA types. Liver biopsies were taken during cold storage (t-1) and post-reperfusion (t0) stained with C4d and graded for preservation-reperfusion injury (PRI). RESULTS. Of the 41 recipients, 8 (20%) had anti-HLA class I/II antibodies pretransplant, 3 (7%) were confirmed preformed DSA; classes I and II (n=1) and class I only (n=2). No biopsies showed definite evidence of antibody-mediated rejection. Graft biopsies in overall showed only mild PRI with ischemic hepatocyte C4d pattern similar in both positive and negative DSA patients. One DSA-positive (33%) compared with four DSA-negative patients (10%) had significant early graft dysfunction; severe PRI causing graft loss from primary nonfunction was seen only in DSA-negative group. Allograft biopsy of preformed DSA-positive patient demonstrated only minimal PRI; however, no identifiable cause could be attributed to graft dysfunction other than preformed DSA. CONCLUSION. Preformed DSA are present in 5-10% liver transplant recipients. There is no association between anti-HLA DSA and PRI and C4d, but preformed DSA may cause early morbidity. Larger studies on the impact of DSA with optimization of C4d techniques are required.

  15. Many de novo donor-specific antibodies recognize β2 -microglobulin-free, but not intact HLA heterodimers.

    PubMed

    Michel, K; Santella, R; Steers, J; Sahajpal, A; Downey, F X; Thohan, V; Oaks, M

    2016-05-01

    Solid-phase single antigen bead (SAB) assays are standard of care for detection and identification of donor-specific antibody (DSA) in patients who receive solid organ transplantation (SOT). While several studies have documented the reproducibility and sensitivity of SAB testing for DSA, there are little data available concerning its specificity. This study describes the identification of antibodies to β(2) -microglobulin-free human leukocyte antigen (β(2) -m-fHLA) heavy chains on SAB arrays and provides a reassessment of the clinical relevance of DSA testing by this platform. Post-transplant sera from 55 patients who were positive for de novo donor-specific antibodies on a SAB solid-phase immunoassay were tested under denaturing conditions in order to identify antibodies reactive with β(2) -m-fHLA or native HLA (nHLA). Antibodies to β(2) -m-fHLA were present in nearly half of patients being monitored in the post-transplant period. The frequency of antibodies to β(2) -m-fHLA was similar among DSA and HLA antigens that were irrelevant to the transplant (non-DSA). Among the seven patients with clinical or pathologic antibody-mediated rejection (AMR), none had antibodies to β(2) -m-fHLA exclusively; thus, the clinical relevance of β(2) -m-fHLA is unclear. Our data suggests that SAB testing produces false positive reactions due to the presence of β(2) -m-fHLA and these can lead to inappropriate assignment of unacceptable antigens during transplant listing and possibly inaccurate identification of DSA in the post-transplant period.

  16. Racial Differences in Incident De Novo Donor-Specific Anti-HLA Antibody among Primary Renal Allograft Recipients.

    PubMed

    Everly, Matthew J; Briley, Kimberly P; Haisch, Carl E; Dieplinger, Georg; Bolin, Paul; Kendrick, Scott A; Morgan, Claire; Maldonado, Angela Q; Rebellato, Lorita M

    2017-02-17

    Controversy exists as to whether African American (AA) transplant recipients are at risk for developing de novo donor-specific anti-human leukocyte antigen (HLA) antibody (dnDSA). We studied 341 HLA-mismatched, primary renal allograft recipients who were consecutively transplanted between 3/1999 and 12/2010. Sera were collected sequentially pre- and post-transplant and tested for anti-HLA immunoglobulin G (IgG) via single antigen bead assay. Of the 341 transplant patients (225 AA and 116 non-AA), 107 developed dnDSA at a median of 9.2 months post-transplant. AA patients had a 5-year dnDSA incidence of 35%. This was significantly higher than the 5-year dnDSA incidence for non-AA patients (21%). DQ mismatch (risk) and receiving a living-related donor (LRD) transplant (protective) were transplant factors associated with dnDSA. Within the AA patient cohort, HLA-DQ mismatch, not-receiving a LRD transplant, non-adherence, and BK viremia were the most common factors associated with early dnDSA (occurring <24 months post-transplant). Non-adherence and pre-transplant diabetes history were the strong precursors to late dnDSA. Despite the higher rates of dnDSA in the AA cohort, post-dnDSA survival was the same in AA and non-AA patients. This study suggests that DQ matching, increasing LRD transplantation in AA patients, and minimizing under-immunosuppression will be key to preventing dnDSA. This article is protected by copyright. All rights reserved.

  17. Antibody-Mediated Rejection Due to Preexisting versus De Novo Donor-Specific Antibodies in Kidney Allograft Recipients.

    PubMed

    Aubert, Olivier; Loupy, Alexandre; Hidalgo, Luis; Duong van Huyen, Jean-Paul; Higgins, Sarah; Viglietti, Denis; Jouven, Xavier; Glotz, Denis; Legendre, Christophe; Lefaucheur, Carmen; Halloran, Philip F

    2017-03-02

    Antibody-mediated rejection (ABMR) can occur in patients with preexisting anti-HLA donor-specific antibodies (DSA) or in patients who develop de novo DSA. However, how these processes compare in terms of allograft injury and outcome has not been addressed. From a cohort of 771 kidney biopsy specimens from two North American and five European centers, we performed a systematic assessment of clinical and biologic parameters, histopathology, circulating DSA, and allograft gene expression for all patients with ABMR (n=205). Overall, 103 (50%) patients had preexisting DSA and 102 (50%) had de novo DSA. Compared with patients with preexisting DSA ABMR, patients with de novo DSA ABMR displayed increased proteinuria, more transplant glomerulopathy lesions, and lower glomerulitis, but similar levels of peritubular capillaritis and C4d deposition. De novo DSA ABMR was characterized by increased expression of IFNγ-inducible, natural killer cell, and T cell transcripts, but less expression of AKI transcripts compared with preexisting DSA ABMR. The preexisting DSA ABMR had superior graft survival compared with the de novo DSA ABMR (63% versus 34% at 8 years after rejection, respectively; P<0.001). After adjusting for clinical, histologic, and immunologic characteristics and treatment, we identified de novo DSA ABMR (hazard ratio [HR], 1.82 compared with preexisting DSA ABMR; 95% confidence interval [95% CI], 1.07 to 3.08; P=0.03); low eGFR (<30 ml/min per 1.73 m(2)) at diagnosis (HR, 3.27; 95% CI, 1.48 to 7.23; P<0.001); ≥0.30 g/g urine protein-to-creatinine ratio (HR, 2.44; 95% CI, 1.47 to 4.09; P<0.001); and presence of cg lesions (HR, 2.25; 95% CI, 1.34 to 3.79; P=0.002) as the main independent determinants of allograft loss. Our findings support the transplant of kidneys into highly sensitized patients and should encourage efforts to monitor patients for de novo DSA.

  18. Transient antibody targeting of CD45RC induces transplant tolerance and potent antigen-specific regulatory T cells

    PubMed Central

    Picarda, Elodie; Bézie, Séverine; Boucault, Laetitia; Autrusseau, Elodie; Kilens, Stéphanie; Martinet, Bernard; Daguin, Véronique; Donnart, Audrey; Charpentier, Eric; Anegon, Ignacio

    2017-01-01

    Rat and human CD4+ and CD8+ Tregs expressing low levels of CD45RC have strong immunoregulatory properties. We describe here that human CD45 isoforms are nonredundant and identify distinct subsets of cells. We show that CD45RC is not expressed by CD4+ and CD8+ Foxp3+ Tregs, while CD45RA/RB/RO are. Transient administration of a monoclonal antibody (mAb) targeting CD45RC in a rat cardiac allotransplantation model induced transplant tolerance associated with inhibition of allogeneic humoral responses but maintained primary and memory responses against cognate antigens. Anti-CD45RC mAb induced rapid death of CD45RChigh T cells through intrinsic cell signaling but preserved and potentiated CD4+ and CD8+ CD45RClow/– Tregs, which are able to adoptively transfer donor-specific tolerance to grafted recipients. Anti-CD45RC treatment results in distinct transcriptional signature of CD4+ and CD8+ CD45RClow/– Tregs. Finally, we demonstrate that anti-human CD45RC treatment inhibited graft-versus-host disease (GVHD) in immune-humanized NSG mice. Thus, short-term anti-CD45RC is a potent therapeutic candidate to induce transplantation tolerance in human. PMID:28194440

  19. Antibody-Dependent NK Cell Activation Is Associated with Late Kidney Allograft Dysfunction and the Complement-Independent Alloreactive Potential of Donor-Specific Antibodies

    PubMed Central

    Legris, Tristan; Picard, Christophe; Todorova, Dilyana; Lyonnet, Luc; Laporte, Cathy; Dumoulin, Chloé; Nicolino-Brunet, Corinne; Daniel, Laurent; Loundou, Anderson; Morange, Sophie; Bataille, Stanislas; Vacher-Coponat, Henri; Moal, Valérie; Berland, Yvon; Dignat-George, Francoise; Burtey, Stéphane; Paul, Pascale

    2016-01-01

    Although kidney transplantation remains the best treatment for end-stage renal failure, it is limited by chronic humoral aggression of the graft vasculature by donor-specific antibodies (DSAs). The complement-independent mechanisms that lead to the antibody-mediated rejection (ABMR) of kidney allografts remain poorly understood. Increasing lines of evidence have revealed the relevance of natural killer (NK) cells as innate immune effectors of antibody-dependent cellular cytotoxicity (ADCC), but few studies have investigated their alloreactive potential in the context of solid organ transplantation. Our study aimed to investigate the potential contribution of the antibody-dependent alloreactive function of NK cells to kidney graft dysfunction. We first conducted an observational study to investigate whether the cytotoxic function of NK cells is associated with chronic allograft dysfunction. The NK-Cellular Humoral Activation Test (NK-CHAT) was designed to evaluate the recipient and antibody-dependent reactivity of NK cells against allogeneic target cells. The release of CD107a/Lamp1+ cytotoxic granules, resulting from the recognition of rituximab-coated B cells by NK cells, was analyzed in 148 kidney transplant recipients (KTRs, mean graft duration: 6.2 years). Enhanced ADCC responsiveness was associated with reduced graft function and identified as an independent risk factor predicting a decline in the estimated glomerular filtration rate over a 1-year period (hazard ratio: 2.83). In a second approach, we used the NK-CHAT to reveal the cytotoxic potential of circulating alloantibodies in vitro. The level of CD16 engagement resulting from the in vitro recognition of serum-coated allogeneic B cells or splenic cells was further identified as a specific marker of DSA-induced ADCC. The NK-CHAT scoring of sera obtained from 40 patients at the time of transplant biopsy was associated with ABMR diagnosis. Our findings indicate that despite the administration of

  20. CD47 is required for suppression of allograft rejection by donor-specific transfusion.

    PubMed

    Wang, Hui; Wu, Xiaojian; Wang, Yuantao; Oldenborg, Per-Arne; Yang, Yong-Guang

    2010-04-01

    CD47 is a ligand of the inhibitory receptor, signal regulatory protein (SIRP)alpha, and its interaction with SIRPalpha on macrophages prevents phagocytosis of autologous hematopoietic cells. CD47-SIRPalpha signaling also regulates dendritic cell (DC) endocytosis, activation, and maturation. In this study, we show that CD47 expression on donor cells plays an important role in suppression of allograft rejection by donor-specific transfusion (DST). DST was performed by i.v. injection of splenocytes from C57BL/6 donors into MHC class I-disparate bm1 mice 7 d prior to donor skin grafting. Administration of wild-type (WT) C57BL/6 donor splenocytes markedly prolonged donor skin survival in bm1 mouse recipients. In contrast, bm1 mice receiving DST from CD47 knockout (KO) donors showed no inhibition or even acceleration of donor skin graft rejection compared with non-DST control (naive) bm1 mice. T cells from bm1 mice receiving CD47 KO, but not WT, DST exhibited strong anti-donor responses. The ability of DST to suppress alloresponses was positively correlated with the density of CD47 molecules on donor cells, as CD47(+/-) DST was able to prolonged donor skin survival, but to a significantly less extent than WT DST. Furthermore, DCs from CD47 KO, but not WT, DST recipients showed rapid activation and contributed to donor skin rejection. These results show for the first time that CD47 on donor cells is required to repress recipient DC activation and suppress allograft rejection after DST, and suggest CD47 as a potential target for facilitating the induction of transplant tolerance.

  1. A Novel Model on DST-Induced Transplantation Tolerance by the Transfer of Self-Specific Donor tTregs to a Haplotype-Matched Organ Recipient

    PubMed Central

    Mohr Gregoriussen, Angelica Maria; Bohr, Henrik Georg

    2017-01-01

    Donor-specific blood transfusion (DST) can lead to significant prolongation of allograft survival in experimental animal models and sometimes human recipients of solid organs. The mechanisms responsible for the beneficial effect on graft survival have been a topic of research and debate for decades and are not yet fully elucidated. Once we discover how the details of the mechanisms involved are linked, we could be within reach of a procedure making it possible to establish donor-specific tolerance with minimal or no immunosuppressive medication. Today, it is well established that CD4+Foxp3+ regulatory T cells (Tregs) are indispensable for maintaining immunological self-tolerance. A large number of animal studies have also shown that Tregs are essential for establishing and maintaining transplantation tolerance. In this paper, we present a hypothesis of one H2-haplotype-matched DST-induced transplantation tolerance (in mice). The formulated hypothesis is based on a re-interpretation of data from an immunogenetic experiment published by Niimi and colleagues in 2000. It is of importance that the naïve recipient mice in this study were never immunosuppressed and were therefore fully immune competent during the course of tolerance induction. Based on the immunological status of the recipients, we suggest that one H2-haplotype-matched self-specific Tregs derived from the transfusion blood can be activated and multiply in the host by binding to antigen-presenting cells presenting allopeptides in their major histocompatibility complex (MHC) class II (MHC-II). We also suggest that the endothelial and epithelial cells within the solid organ allograft upregulate the expression of MHC-II and attract the expanded Treg population to suppress inflammation within the graft. We further suggest that this biological process, here termed MHC-II recruitment, is a vital survival mechanism for organs (or the organism in general) when attacked by an immune system. PMID:28270810

  2. A Novel Model on DST-Induced Transplantation Tolerance by the Transfer of Self-Specific Donor tTregs to a Haplotype-Matched Organ Recipient.

    PubMed

    Mohr Gregoriussen, Angelica Maria; Bohr, Henrik Georg

    2017-01-01

    Donor-specific blood transfusion (DST) can lead to significant prolongation of allograft survival in experimental animal models and sometimes human recipients of solid organs. The mechanisms responsible for the beneficial effect on graft survival have been a topic of research and debate for decades and are not yet fully elucidated. Once we discover how the details of the mechanisms involved are linked, we could be within reach of a procedure making it possible to establish donor-specific tolerance with minimal or no immunosuppressive medication. Today, it is well established that CD4+Foxp3+ regulatory T cells (Tregs) are indispensable for maintaining immunological self-tolerance. A large number of animal studies have also shown that Tregs are essential for establishing and maintaining transplantation tolerance. In this paper, we present a hypothesis of one H2-haplotype-matched DST-induced transplantation tolerance (in mice). The formulated hypothesis is based on a re-interpretation of data from an immunogenetic experiment published by Niimi and colleagues in 2000. It is of importance that the naïve recipient mice in this study were never immunosuppressed and were therefore fully immune competent during the course of tolerance induction. Based on the immunological status of the recipients, we suggest that one H2-haplotype-matched self-specific Tregs derived from the transfusion blood can be activated and multiply in the host by binding to antigen-presenting cells presenting allopeptides in their major histocompatibility complex (MHC) class II (MHC-II). We also suggest that the endothelial and epithelial cells within the solid organ allograft upregulate the expression of MHC-II and attract the expanded Treg population to suppress inflammation within the graft. We further suggest that this biological process, here termed MHC-II recruitment, is a vital survival mechanism for organs (or the organism in general) when attacked by an immune system.

  3. Local Differentiation of Sugar Donor Specificity of Flavonoid Glycosyltransferase in Lamiales[W

    PubMed Central

    Noguchi, Akio; Horikawa, Manabu; Fukui, Yuko; Fukuchi-Mizutani, Masako; Iuchi-Okada, Asako; Ishiguro, Masaji; Kiso, Yoshinobu; Nakayama, Toru; Ono, Eiichiro

    2009-01-01

    Flavonoids are most commonly conjugated with various sugar moieties by UDP-sugar:glycosyltransferases (UGTs) in a lineage-specific manner. Generally, the phylogenetics and regiospecificity of flavonoid UGTs are correlated, indicating that the regiospecificity of UGT differentiated prior to speciation. By contrast, it is unclear how the sugar donor specificity of UGTs evolved. Here, we report the biochemical, homology-modeled, and phylogenetic characterization of flavonoid 7-O-glucuronosyltransferases (F7GAT), which is responsible for producing specialized metabolites in Lamiales plants. All of the Lamiales F7GATs were found to be members of the UGT88-related cluster and specifically used UDP-glucuronic acid (UDPGA). We identified an Arg residue that is specifically conserved in the PSPG box in the Lamiales F7GATs. Substitution of this Arg with Trp was sufficient to convert the sugar donor specificity of the Lamiales F7GATs from UDPGA to UDP-glucose. Homology modeling of the Lamiales F7GAT suggested that the Arg residue plays a critical role in the specific recognition of anionic carboxylate of the glucuronic acid moiety of UDPGA with its cationic guanidinium moiety. These results support the hypothesis that differentiation of sugar donor specificity of UGTs occurred locally, in specific plant lineages, after establishment of general regiospecificity for the sugar acceptor. Thus, the plasticity of sugar donor specificity explains, in part, the extraordinary structural diversification of phytochemicals. PMID:19454730

  4. Stem cell transplantation reverses chemotherapy-induced cognitive dysfunction

    PubMed Central

    Acharya, Munjal M.; Martirosian, Vahan; Chmielewski, Nicole N.; Hanna, Nevine; Tran, Katherine K.; Liao, Alicia C.; Christie, Lori-Ann; Parihar, Vipan K.; Limoli, Charles L.

    2014-01-01

    The frequent use of chemotherapy to combat a range of malignancies can elicit severe cognitive dysfunction often referred to as “chemobrain”, a condition that can persist long after the cessation of treatment in as many as 75% of survivors. While cognitive health is a critical determinant of therapeutic outcome, chemobrain remains an unmet medical need that adversely impacts quality of life in pediatric and adult cancer survivors. Using a rodent model of chemobrain, we showed that chronic cyclophosphamide treatment induced significant performance based decrements on behavioral tasks designed to interrogate hippocampal and cortical function. Intrahippocampal transplantation of human neural stem cells resolved all cognitive impairments when animals were tested one month after the cessation of chemotherapy. In transplanted animals, grafted cells survived (8%) and differentiated along neuronal and astroglial lineages, where improved cognition was associated with reduced neuroinflammation and enhanced host dendritic arborization. Stem cell transplantation significantly reduced the number of activated microglia after cyclophosphamide treatment in the brain. Granule and pyramidal cell neurons within the dentate gyrus and CA1 subfields of the hippocampus exhibited significant reductions in dendritic complexity, spine density, immature and mature spine types following chemotherapy, adverse effects that were eradicated by stem cell transplantation. Our findings provide the first evidence that cranial transplantation of stem cells can reverse the deleterious effects of chemobrain, through a trophic support mechanism involving the attenuation of neuroinflammation and the preservation host neuronal architecture. PMID:25687405

  5. Faecal microbiota transplantation protects against radiation-induced toxicity.

    PubMed

    Cui, Ming; Xiao, Huiwen; Li, Yuan; Zhou, Lixin; Zhao, Shuyi; Luo, Dan; Zheng, Qisheng; Dong, Jiali; Zhao, Yu; Zhang, Xin; Zhang, Junling; Lu, Lu; Wang, Haichao; Fan, Saijun

    2017-04-01

    Severe radiation exposure may cause acute radiation syndrome, a possibly fatal condition requiring effective therapy. Gut microbiota can be manipulated to fight against many diseases. We explored whether intestinal microbe transplantation could alleviate radiation-induced toxicity. High-throughput sequencing showed that gastrointestinal bacterial community composition differed between male and female mice and was associated with susceptibility to radiation toxicity. Faecal microbiota transplantation (FMT) increased the survival rate of irradiated animals, elevated peripheral white blood cell counts and improved gastrointestinal tract function and intestinal epithelial integrity in irradiated male and female mice. FMT preserved the intestinal bacterial composition and retained mRNA and long non-coding RNA expression profiles of host small intestines in a sex-specific fashion. Despite promoting angiogenesis, sex-matched FMT did not accelerate the proliferation of cancer cells in vivo FMT might serve as a therapeutic to mitigate radiation-induced toxicity and improve the prognosis of tumour patients after radiotherapy.

  6. Evaluation of C1q Status and Titer of De Novo Donor-Specific Antibodies as Predictors of Allograft Survival.

    PubMed

    Wiebe, C; Gareau, A J; Pochinco, D; Gibson, I W; Ho, J; Birk, P E; Blydt-Hansen, T; Karpinski, M; Goldberg, A; Storsley, L; Rush, D N; Nickerson, P W

    2017-03-01

    De novo donor-specific antibodies (dnDSAs) that develop after renal transplantation are independent predictors of allograft loss. However, it is unknown if dnDSA C1q status or titer at the time of first detection can independently predict allograft loss. In a consecutive cohort of 508 renal transplant recipients, 70 developed dnDSAs. Histologic and clinical outcomes were correlated with the C1q assay or dnDSA titer. C1q positivity correlated with dnDSA titer (p < 0.01) and mean fluorescence intensity (p < 0.01) and was more common in class II versus class I dnDSAs (p < 0.01). C1q status correlated with tubulitis (p = 0.02) and C4d status (p = 0.03) in biopsies at the time of dnDSA development, but not T cell-mediated rejection (TCMR) or antibody-mediated rejection (ABMR). De novo DSA titer correlated with Banff g, i, t, ptc, C4d scores, TCMR (p < 0.01) and ABMR (p < 0.01). Post-dnDSA graft loss was observed more frequently in recipients with C1q-positve dnDSA (p < 0.01) or dnDSA titer ≥ 1:1024 (p ≤ 0.01). However, after adjustment for clinical phenotype and nonadherence in multivariate models, neither C1q status nor dnDSA titer were independently associated with allograft loss, questioning the utility of these assays at the time of dnDSA development.

  7. Propylthiouracil-induced acute liver failure: role of liver transplantation.

    PubMed

    Carrion, Andres F; Czul, Frank; Arosemena, Leopoldo R; Selvaggi, Gennaro; Garcia, Monica T; Tekin, Akin; Tzakis, Andreas G; Martin, Paul; Ghanta, Ravi K

    2010-01-01

    Propylthiouracil- (PTU-) induced hepatotoxicity is rare but potentially lethal with a spectrum of liver injury ranging from asymptomatic elevation of transaminases to fulminant hepatic failure and death. We describe two cases of acute hepatic failure due to PTU that required liver transplantation. Differences in the clinical presentation, histological characteristics, and posttransplant management are described as well as alternative therapeutic options. Frequent monitoring for PTU-induced hepatic dysfunction is strongly advised because timely discontinuation of this drug and implementation of noninvasive therapeutic interventions may prevent progression to liver failure or even death.

  8. Lansoprazole-induced acute allergic interstitial nephritis in a renal transplant recipient: a case report.

    PubMed

    Yildirim, Tolga; Yilmaz, Rahmi; Baydar, Dilek Ertoy; Kutlugun, Aysun Aybal; Aki, Tuncay; Turgan, Cetin

    2012-12-01

    Drug-induced interstitial nephritis is one of the causes of graft dysfunction in renal transplant recipients. Although commonly implicated as a cause of drug-induced interstitial nephritis in the general population, proton pump inhibitor-induced interstitial nephritis has not yet been reported in renal transplant recipients. Trimethoprim-sulfamethoxazole is responsible for most cases of interstitial nephritis in this population. Here, we describe the first case of proton pump inhibitor-related interstitial nephritis in a renal transplant recipient.

  9. ASSOCIATION BETWEEN DE NOVO DONOR SPECIFIC HLA ANTIBODY, C4D STAINING IN RENAL GRAFT BIOPSY AND GRAFT OUTCOME: A SINGLE CENTER EXPERIENCE.

    PubMed

    Cicciarelli, James; Cho, Yong W; Koss, Michael; Helstab-Houston, Kathryn; Mendez, Robert; Kasahara, Noriyuki; Hutchinson, Ian V; Shah, Tariq

    2009-01-01

    In 69 renal transplant recipients (RTR), all had a functioning graft (SCr < 2.0) at one year. After one year, transplant dysfunction was observed and these 69 RTR were biopsied, tested for C4d deposition and donor specific antibodies (DSA). Of these 69 RTR, 29 (42%) showed C4d negativity, 27 (39%) were C4d positive and 13 (19%) were not diagnostic. Forty-nine (71%) recipients had HLA antibodies and 41 (59%) had DSA. The proportion of C4d positivity was significantly higher in patients with DSA (HLA Class I only, II only, and I & II) in comparison to patients without post-transplant HLA antibodies. The incidence of graft failure (including current SCr > 4.0) in RTR with HLA Class II antibodies (Class II only or I & II) was significantly higher than in RTR without post-transplant HLA antibodies (P=0.03).Even after amelioration of rejection, the RTR with Class II DSA group continued to fail beyond 2 years after transplantation when compared with the other 2 groups (None/NDSA or HLA Class I only), however, the difference in graft survival between HLA Class II and None/NDSA groups did not reach statistical significance (log-rank P=0.32). Significant association between C4d staining, post-transplant HLA Class II antibodies and graft failure strongly suggests the importance of post-transplant HLA antibodies. HLA Class II DSAs may be an indicator of chronic allograft nephropathy (CAN) proceeding to graft loss. We propose that amelioration of CAN graft loss may be affected by monitoring and identification of DSA with appropriate immunosuppression of these antibodies.

  10. Radiation-induced tumors in transplanted ovaries. [Mice

    SciTech Connect

    Covelli, V.; Di Majo, V.; Bassani, B.; Metalli, P.; Silini, G.

    1982-04-01

    A comparison was made of tumor induction in the ovaries of whole-body-irradiation mice (250-kV X rays, doses of 0.25-4.00 Gy) or in ovaries irradiated in vivo and then transplanted intramuscularly into castrated syngeneic hosts. The form of the dose-induction relationships was similar in the two cases, showing a steeply rising branch at doses up to 0.75 Gy followed by a maximum and an elevated plateau up to 4.00 Gy. A higher incidence of tumors in transplanted organs was apparent for doses up to the maximum, which was attributed to castration-induced hormonal imbalance. Specific death rate analysis of mice dying with ovarian tumors showed that in this system radiation acts essentially by decreasing tumor latency. Ovarian tumors were classified in various histological types and their development in time was followed by serial sacrifice. Separate analysis of death rate of animals carrying different tumor classes allowed further resolution of the various components of the tumor induction phenomenon. It was thus possible to show that the overall death rate analysis masks a true effect of induction of granulosa cell tumors in whole-body-irradiation animals. The transplantation technique offers little advantage for the study of radiation induction of ovarian tumor.

  11. Pyrintegrin Induces Soft Tissue Formation by Transplanted or Endogenous Cells

    PubMed Central

    Shah, Bhranti S.; Chen, Mo; Suzuki, Takahiro; Embree, Mildred; Kong, Kimi; Lee, Chang H.; He, Ling; Xiang, Lusai; Ahn, Jeffrey A.; Ding, Sheng; Mao, Jeremy J.

    2017-01-01

    Focal adipose deficiency, such as lipoatrophy, lumpectomy or facial trauma, is a formidable challenge in reconstructive medicine, and yet scarcely investigated in experimental studies. Here, we report that Pyrintegrin (Ptn), a 2,4-disubstituted pyrimidine known to promote embryonic stem cells survival, is robustly adipogenic and induces postnatal adipose tissue formation in vivo of transplanted adipose stem/progenitor cells (ASCs) and recruited endogenous cells. In vitro, Ptn stimulated human adipose tissue derived ASCs to differentiate into lipid-laden adipocytes by upregulating peroxisome proliferator-activated receptor (PPARγ) and CCAAT/enhancer-binding protein-α (C/EBPα), with differentiated cells increasingly secreting adiponectin, leptin, glycerol and total triglycerides. Ptn-primed human ASCs seeded in 3D-bioprinted biomaterial scaffolds yielded newly formed adipose tissue that expressed human PPARγ, when transplanted into the dorsum of athymic mice. Remarkably, Ptn-adsorbed 3D scaffolds implanted in the inguinal fat pad had enhanced adipose tissue formation, suggesting Ptn’s ability to induce in situ adipogenesis of endogenous cells. Ptn promoted adipogenesis by upregulating PPARγ and C/EBPα not only in adipogenesis induction medium, but also in chemically defined medium specifically for osteogenesis, and concurrently attenuated Runx2 and Osx via BMP-mediated SMAD1/5 phosphorylation. These findings suggest Ptn’s novel role as an adipogenesis inducer with a therapeutic potential in soft tissue reconstruction and augmentation. PMID:28128224

  12. Promiscuous activity of ER glucosidase II discovered through donor specificity analysis of UGGT

    SciTech Connect

    Miyagawa, Atsushi; Totani, Kiichiro; Matsuo, Ichiro; Ito, Yukishige

    2010-12-17

    Research highlights: {yields} UGGT has a narrow donor specificity. {yields} UGGT gave several non-natural high-mannose-type glycans. {yields} G-II has a promiscuous activity as broad specificity hexosidase. -- Abstract: In glycoprotein quality control system in the endoplasmic reticulum (ER), UGGT (UDP-glucose:glycoprotein glucosyltransferase) and glucosidase II (G-II) play key roles. UGGT serves as a glycoprotein folding sensor by virtue of its unique specificity to glucosylate glycoproteins at incompletely folded stage. By using various UDP-Glc analogues, we first analyzed donor specificity of UGGT, which was proven to be rather narrow. However, marginal activity was observed with UDP-galactose and UDP-glucuronic acid as well as with 3-, 4- and 6-deoxy glucose analogues to give corresponding transfer products. Intriguingly, G-II smoothly converted all of them back to Man{sub 9}GlcNAc{sub 2}, providing an indication that G-II has a promiscuous activity as a broad specificity hexosidase.

  13. Donor-specific HLA antibodies in chronic renal allograft rejection: a prospective trial with a four-year follow-up.

    PubMed

    Lachmann, Nils; Terasaki, Paul I; Schönemann, Constanze

    2006-01-01

    A total of 1,043 serum samples of kidney allograft recipients with functioning grafts at a mean of 6 years after transplantation were tested once for HLA abs and monitored for graft and patient survival for 4 years after testing. All grafts were transplanted between 1984 and 2004 at the Charité hospital (Berlin, Germany). 1. To our knowledge this is the first study with more than 1,000 patients designed to elucidate the impact of DSA and NDSA on late renal graft outcome. True donor specificity of HLA abs in 30% of antibody positive patients was determined by using a single HLA antigen coated bead assay. 2. The long-term graft survival was adversely impacted by the presence of HLA abs directed against mismatched HLA antigens and to a lesser extent also by NDSA. This difference was shown to be leveled at late stages of graft damage, suggesting NDSA as a predictor of adsorbed DSA killing the graft. 3. The deleterious effect of preexisting and de novo formed HLA abs on long-term graft function was shown to be equal. Despite a negative crossmatch at the time of transplantation sensitized recipients and those who produced HLA abs de novo posttransplant showed the same increased risk of late graft failure. 4. Among patients with DSA and additional NDSA the majority of 74% of assigned potential HLA class I epitopes were shared among DSA and NDSA suggesting mismatched donor antigens as the cause of detected NDSA.

  14. Bacterial Infections, Alloimmunity, and Transplantation Tolerance

    PubMed Central

    Ahmed, Emily B.; Daniels, Melvin; Alegre, Maria-Luisa; Chong, Anita S.

    2010-01-01

    Transplantation of solid organs across histocompatibility barriers in the absence of immunosuppression is invariably followed by acute allograft rejection. Although several immunosuppressive regimens have been developed to prevent allograft rejection, these global immunosuppressive agents effectively inhibit all T cells leaving the host vulnerable to infections. Thus a major goal in transplantation immunology is to induce donor-specific tolerance that results in the extended suppression of allograft-specific immune responses, while leaving the remainder of the immune system competent to fight infections and malignancies. Initial successes in identifying approaches that successfully induce transplantation tolerance in experimental models have led to a newer research focus of identifying potential barriers to the induction of such tolerance as well as events that may reverse established allograft tolerance. Both clinical and experimental studies have identified bacterial infections as a possible trigger of allograft rejection. Recently, experimental models of transplantation tolerance have identified that bacterial signals can promote acute allograft rejection either by preventing the induction of transplantation tolerance or by reversing tolerance after it has been stably established. This review summarizes experimental and clinical literature supporting the hypothesis that bacterial infections and innate immunity can qualitatively and quantitatively alter adaptive alloreactivity through effects on innate immune responses. PMID:21126661

  15. Alloreactive Regulatory T Cells Allow the Generation of Mixed Chimerism and Transplant Tolerance.

    PubMed

    Ruiz, Paulina; Maldonado, Paula; Hidalgo, Yessia; Sauma, Daniela; Rosemblatt, Mario; Bono, Maria Rosa

    2015-01-01

    The induction of donor-specific transplant tolerance is one of the main goals of modern immunology. Establishment of a mixed chimerism state in the transplant recipient has proven to be a suitable strategy for the induction of long-term allograft tolerance; however, current experimental recipient preconditioning protocols have many side effects, and are not feasible for use in future therapies. In order to improve the current mixed chimerism induction protocols, we developed a non-myeloablative bone-marrow transplant (NM-BMT) protocol using retinoic acid (RA)-induced alloantigen-specific Tregs, clinically available immunosuppressive drugs, and lower doses of irradiation. We demonstrate that RA-induced alloantigen-specific Tregs in addition to a NM-BMT protocol generates stable mixed chimerism and induces tolerance to allogeneic secondary skin allografts in mice. Therefore, the establishment of mixed chimerism through the use of donor-specific Tregs rather than non-specific immunosuppression could have a potential use in organ transplantation.

  16. Alloreactive Regulatory T Cells Allow the Generation of Mixed Chimerism and Transplant Tolerance

    PubMed Central

    Ruiz, Paulina; Maldonado, Paula; Hidalgo, Yessia; Sauma, Daniela; Rosemblatt, Mario; Bono, Maria Rosa

    2015-01-01

    The induction of donor-specific transplant tolerance is one of the main goals of modern immunology. Establishment of a mixed chimerism state in the transplant recipient has proven to be a suitable strategy for the induction of long-term allograft tolerance; however, current experimental recipient preconditioning protocols have many side effects, and are not feasible for use in future therapies. In order to improve the current mixed chimerism induction protocols, we developed a non-myeloablative bone-marrow transplant (NM-BMT) protocol using retinoic acid (RA)-induced alloantigen-specific Tregs, clinically available immunosuppressive drugs, and lower doses of irradiation. We demonstrate that RA-induced alloantigen-specific Tregs in addition to a NM-BMT protocol generates stable mixed chimerism and induces tolerance to allogeneic secondary skin allografts in mice. Therefore, the establishment of mixed chimerism through the use of donor-specific Tregs rather than non-specific immunosuppression could have a potential use in organ transplantation. PMID:26635810

  17. Voriconazole-Induced Periostitis & Enthesopathy in Solid Organ Transplant Patients: Case Reports

    PubMed Central

    Sircar, Monica; Kotton, Camille; Wojciechowski, David; Safa, Kassem; Gilligan, Hannah; Heher, Eliot; Williams, Winfred; Thadhani, Ravi; Tolkoff-Rubin, Nina

    2016-01-01

    Background Voriconazole is frequently used to treat fungal infections in solid organ transplant patients. Recently, there have been reports suggesting that prolonged voriconazole therapy may lead to periostitis. Aim Here we present two cases of voriconazole-induced periostitis in solid organ transplant patients. Case Presentation Voriconazole was given to two transplant patients-one with a liver transplant and the second with a heart transplant, to treat their fungal infections. Both developed voriconazole-induced toxicity. While undergoing voriconazole therapy, they had incapacitating bone pain. The liver transplant patient had to be taken off voriconazole, and the heart transplant patient succumbed to non-voriconazole related causes. Conclusions Voriconazole therapy in two solid organ transplant patients resulted in periostitis. We provide potential etiologies underlying voriconazole-induced periostitis, including fluoride toxicity, abnormalities in the pulmonary vascular bed leading to the production of downstream inflammatory mediators, and abnormal pharmacokinetics of hepatic drug metabolism. In addition to monitoring blood voriconazole trough levels, we suggest careful assessment for musculoskeletal pain in patients undergoing voriconazole treatment for two months or more, particularly if their daily dosages of voriconazole exceed 500 mg per day. Appropriate workup should include measurement of alkaline phosphatase, voriconazole trough and fluoride levels as well as a bone scan. Overall, early recognition of voriconazole-induced musculoskeletal toxicity is important for better morbidity outcomes. PMID:27990445

  18. Defining the immunogenicity and antigenicity of HLA epitopes is crucial for optimal epitope matching in clinical renal transplantation.

    PubMed

    Kramer, C S M; Roelen, D L; Heidt, S; Claas, F H J

    2017-04-05

    Transplantation of an human leukocyte antigen (HLA) mismatched graft can lead to the development of donor-specific antibodies (DSA), which can result in antibody mediated rejection and graft loss as well as complicate repeat transplantation. These DSA are induced by foreign epitopes present on the mismatched HLA antigens of the donor. However, not all epitopes appear to be equally effective in their ability to induce DSA. Understanding the characteristics of HLA epitopes is crucial for optimal epitope matching in clinical transplantation. In this review, the latest insights on HLA epitopes are described with a special focus on the definition of immunogenicity and antigenicity of HLA epitopes. Furthermore, the use of this knowledge to prevent HLA antibody formation and to select the optimal donor for sensitised transplant candidates will be discussed.

  19. Molecular diagnosis of antibody-mediated rejection in human kidney transplants.

    PubMed

    Sellarés, J; Reeve, J; Loupy, A; Mengel, M; Sis, B; Skene, A; de Freitas, D G; Kreepala, C; Hidalgo, L G; Famulski, K S; Halloran, P F

    2013-04-01

    Antibody-mediated rejection is the major cause of kidney transplant failure, but the histology-based diagnostic system misses most cases due to its requirement for C4d positivity. We hypothesized that gene expression data could be used to test biopsies for the presence of antibody-mediated rejection. To develop a molecular test, we prospectively assigned diagnoses, including C4d-negative antibody-mediated rejection, to 403 indication biopsies from 315 patients, based on histology (microcirculation lesions) and donor-specific HLA antibody. We then used microarray data to develop classifiers that assigned antibody-mediated rejection scores to each biopsy. The transcripts distinguishing antibody-mediated rejection from other conditions were mostly expressed in endothelial cells or NK cells, or were IFNG-inducible. The scores correlated with the presence of microcirculation lesions and donor-specific antibody. Of 45 biopsies with scores>0.5, 39 had been diagnosed as antibody-mediated rejection on the basis of histology and donor-specific antibody. High scores were also associated with unanimity among pathologists that antibody-mediated rejection was present. The molecular score also strongly predicted future graft loss in Cox regression analysis. We conclude that microarray assessment of gene expression can assign a probability of ABMR to transplant biopsies without knowledge of HLA antibody status, histology, or C4d staining, and predicts future failure.

  20. Composite osseomusculocutaneous sternum, ribs, thymus, pectoralis muscles, and skin allotransplantation model of bone marrow transplantation.

    PubMed

    Bozkurt, Mehmet; Klimczak, Aleksandra; Nasir, Serdar; Zor, Fatih; Krokowicz, Lukasz; Siemionow, Maria

    2013-01-01

    Cellular and vascularized bone marrow cells have been used to induce donor-specific chimerism in various models of composite tissue allotransplantation. Although thymus transplantation has been reported in the literature, the effect of thymus transplantation on chimerism levels in vascularized bone containing composite tissue allotransplantation has not been reported. In this study, a new method for composite vascularized sternal bone marrow transplant model is descried that can be applied to augment chimerism after transplantation. A total of seven composite osseomusculocutaneous sternum, ribs, thymus, pectoralis muscles, and skin transplantations were performed in two groups. The first group (n = 5) was designed as an allotransplantation group and the second group (n = 2) was designed as an isotransplantation group. Composite osseomusculocutaneous sternum, ribs, thymus, and pectoralis muscles allografts were harvested on the common carotid artery and external jugular vein and a heterotopic transplantation was performed to the inguinal region of the recipient rat. Cyclosporine A monotherapy was administered in order to prevent acute and chronic allograft rejection. Animals sacrificed when any sign of rejection occurred. The longest survival was 156 day post-transplant. Assessment of bone marrow cells within sternum bone component and flow cytometry analysis of donor-specific chimerism in the peripheral blood of recipients were evaluated. Our results showed that this composite allograft carried 7.5 × 10(6) of viable hematopoietic cells within the sternum component. At day 7 post-transplant chimerism was developed in T-cell population and mean level was assessed at 2.65% for RT1(n) /CD4 and at 1.0% for RT1(n) /CD8. In this study, a new osseomusculocutaneous sternum, ribs, thymus, pectoralis muscle, and skin allotransplantation model is reported which can be used to augment hematopoietic activity for chimerism induction after transplantation.

  1. [Fetal experimentation, transplantations, cosmetics and their connection with induced abortion].

    PubMed

    Redondo Calderón, José Luis

    2012-01-01

    The increase in induced abortion produces large numbers of cells, tissues and organs, which are used in several fields of Medicine, either in research or in treatment. The main uses are in Cardiology, Hematology, Metabolism, Embryology, Neurology, Immunology, Ophthalmology, Dermatology and Transplantations. Flavor enhancers and cosmetics also benefit. Utilitarianism has led to an increase in abortion-originated cell and tissue banks. Abortion is justified through the manipulation of language. Vested interests give rise to complicity in researchers and society as a whole. Abortion and tissue 'donation' cannot be split; since fresh tissues are involved there is a symbiotic relationship between them. Valid consent is not possible. A contradiction emerges, the nasciturus is not desired or valued but fetal organs are. When someone is deprived of his rights it is because another wants to enslave them. Research must have a moral base. Knowledge should not be increased at any price. Something that is legal and well intentioned is not always morally acceptable. The duty of omission is applicable. Means to achieve a goal must be ethical means. Educational efforts to restore respect for the human embryo and fetus must be promoted. Technical advances are not always in accordance with human nature and dignity. Research and treatment that do not resort to cells, tissues and organs obtained from induced abortions should be promoted.

  2. Donor-specific antibody against denatured HLA-A1: clinically nonsignificant?

    PubMed

    Pereira, Shalini; Perkins, Susan; Lee, Jar-How; Shumway, Wayne; LeFor, William; Lopez-Cepero, Mayra; Wong, Cynthia; Connolly, Amy; Tan, Jane C; Grumet, F Carl

    2011-06-01

    Pre-transplant screening of a woman with end-stage renal disease (ESRD) showed no anti-human leukocyte antigen (HLA) alloantibodies by anti-human globulin-complement-dependent cytotoxicity (AHG-CDC; class I) or enzyme-linked immunosorbent assay (class II). Following a negative AHG-CDC crossmatch, an HLA*01:01+ deceased donor (DD) kidney was transplanted in September 2005. Subsequent screening of pre-transplant serum by LABScreen Single Antigen (SA) array showed strong reactivity versus A*01:01. Despite that reactivity, at 5 years post-transplant, the patient has a serum creatinine of 1.6 mg/dl and has never experienced humoral or cellular rejection. Retrospective flow-cytometric crossmatch of pre- and post-transplant sera versus DD cells was negative. Rescreening of multiple pre- and post-transplant sera revealed anti-A1 reactivity persisting from the first through the last samples tested. The patient's anti-A1 was almost two fold more reactive with denatured A*01:01 FlowPRA SA beads after denaturation with acid treatment (pH 2.7) than with untreated beads. Parallel results were observed with pH 2.7 treated versus untreated A1+ T cells in FXM. These data highlight the difficulty in interpreting screening results obtained using bead arrays, because of antibodies that appear to recognize denatured but not native class I HLA antigens. We suggest that such bead-positive, flow cytometric crossmatch negative antibodies are not associated with humoral rejection, may not necessarily be detrimental to a graft, and deserve further evaluation before becoming a barrier to transplantation.

  3. Folate antagonist, methotrexate induces neuronal differentiation of human embryonic stem cells transplanted into nude mouse retina.

    PubMed

    Hara, Akira; Taguchi, Ayako; Aoki, Hitomi; Hatano, Yuichiro; Niwa, Masayuki; Yamada, Yasuhiro; Kunisada, Takahiro

    2010-06-25

    Transplanted embryonic stem (ES) cells can be integrated into the retinas of adult mice as well-differentiated neuroretinal cells. However, the transplanted ES cells also have a tumorigenic activity as they have the ability for multipotent differentiation to various types of tissues. In the present study, human ES (hES) cells were transplanted into adult nude mouse retinas by intravitreal injections 20 h after intravitreal N-methyl-D-aspartate (NMDA) administration. After the transplantation of hES cells, the folate antagonist, methotrexate (MTX) was administrated in order to control the differentiation of the transplanted hES cells. Neuronal differentiation and teratogenic potential of hES cells were examined immunohistochemically 5 weeks after transplantation. The proliferative activity of transplanted cells was determined by both the mitotic index and the Ki-67 proliferative index. Disappearance of Oct-4-positive hES cells showing undifferentiated morphology was observed after intraperitoneal MTX treatment daily, for 15 days. Decreased mitotic and Ki-67 proliferative indices, and increased neuronal differentiation were detected in the surviving hES cells after the MTX treatment. These results suggest two important effects of intraperitoneal MTX treatment for hES cells transplanted into nude mouse retina: (1) MTX treatment following transplantation induces neuronal differentiation, and (2) MTX decreases proliferative activity and tumorigenic potential.

  4. Protein F-induced immune tolerance in liver transplantation in rats.

    PubMed

    Zhuang, Jianbin; Wang, Yijun; Du, Zhi; Wang, Sumei

    2014-05-01

    Liver-specific protein F is commonly used in liver transplantation studies for its allograft immunogenicity. The objective of this study was to investigate immune tolerance induced by protein F in liver transplantation in rats. Healthy inbred male Wistar and Sprague-Dawley (SD) rats were used in this study. The transplant recipient rats were randomly divided into three groups. The SD rats transplanted with liver tissues from SD rats or Wistar rats were defined as intragraft control group (Group A) or acute reaction group (Group B), respectively. The SD rats that received thymic administration of 4 mg protein F 1 week prior to transplantation with livers from Wistar rats were defined as protein F interference group (Group C). Kamada's two-cuff technique was utilized in the liver transplantation surgeries. The postoperative general condition, transplantation survival time, pathological examination, and serum IFN-γ level (quantified by ELISA) were recorded and compared to evaluate the immune response and outcomes in the recipient rats after liver transplantation. Group A rats exhibited good postoperative condition and prolonged survival (median survival time was 92 days). In contrast, Group B rats lost body weight rapidly after liver transplantation, and died starting at day 12 (median survival time was 15 days). Compared to Group B, Group C rats showed significantly longer survival (medium survival time was 71 days). Our findings indicate that protein F is an important transplantation antigen with allograft immunogenicity, which could successfully induce immune tolerance in liver transplantation.

  5. Transplanting mouse induced pluripotent stem cells into mouse otocysts in vivo.

    PubMed

    Takeda, Hiroki; Minoda, Ryosei; Miwa, Toru; Yamada, Takao; Ise, Momoko

    2017-03-27

    The otocyst is an attractive target for studying treatment strategies for genetic hearing loss and for understanding inner ear development. We have previously reported that trans-uterine supplemental gene therapy in vivo into the otocysts of mice, which had a loss of function mutation in a causative gene of deafness, was able to prevent putative hearing loss. We herein set out to clarify the feasibility of allogenic cell transplantation into the mouse otocysts in vivo. We transplanted naive mouse-derived induced pluripotent stem cells (miPSCs) into the otocysts of wild type mice or connexin (Cx) 30 deficient mice, at embryonic day 11.5 (E11.5). The transplanted m-iPSCs survived in the lumens of the inner ears at E13.5 and E15.5 in wild type mice. In the Cx30 deficient mouse, the transplanted cells survived similarly, with some of the transplanted cells migrating into the lining cells of the lumens of the inner ears at E13.5 and showing tumorigenic cell proliferation at E15.5. In addition, engrafted cells appear to be able to differentiate after the cell transplantation. Our results suggest that otocyst transplanted cells survived and differentiated. A Cx30 deficiency may facilitate cell migration. These findings may offer some hope for cell transplantation therapy for profound genetic hearing loss caused by a Cxs deficiency.

  6. Significance of anti-HLA and donor-specific antibodies in long-term renal graft survival.

    PubMed

    Saidman, S

    2007-04-01

    Numerous studies have demonstrated an association of posttransplant HLA antibodies with decreased long-term graft survival. The presence of C4d deposition in these cases supports the hypothesis that antibody and complement deposition are involved in the pathogenesis of graft failure. Development of HLA antibodies may predate the clinical manifestation of chronic rejection (CR). However, frequency of donor-specific antibody is low when all patients are screened regardless of their graft function, and it may be more valuable to look for antibody only in patients with mild dysfunction. Effective treatment for CR has not been identified, although increased immunosuppression has been shown to decrease antibody levels and stabilize graft function. Many patients have been identified with good graft function despite the presence of circulating donor-specific HLA antibody. Additional studies focusing on the mechanism behind the apparent protection from the detrimental effects of antibody in such patients are needed.

  7. Basiliximab induced non-cardiogenic pulmonary edema in two pediatric renal transplant recipients.

    PubMed

    Dolan, Niamh; Waldron, Mary; O'Connell, Marie; Eustace, Nick; Carson, Kevin; Awan, Atif

    2009-11-01

    We report two cases of non-cardiogenic pulmonary edema as a complication of basiliximab induction therapy in young pediatric renal transplant patients identified following a retrospective review of all pediatric renal transplant cases performed in the National Paediatric Transplant Centre, Childrens University Hospital, Temple Street, Dublin, Ireland. Twenty-eight renal transplantations, of which five were living-related (LRD) and 23 were from deceased donors (DD), were performed in 28 children between 2003 and 2006. In six cases, transplantations were pre-emptive. Immunosuppression was induced pre-operatively using a combination of basiliximab, tacrolimus and methylprednisolone in all patients. Basiliximab induction was initiated 2 h prior to surgery in all cases and, in 26 patients, basiliximab was re-administered on post-operative day 4. Two patients, one LRD and one DD, aged 6 and 11 years, respectively, developed acute non-cardiogenic pulmonary edema within 36 h of surgery. Renal dysplasia was identified as the primary etiological factor for renal failure in both cases. Both children required assisted ventilation for between 4 and 6 days. While both grafts had primary function, the DD transplant patient subsequently developed acute tubular necrosis and was eventually lost within 3 weeks due to thrombotic microangiopathy and severe acute antibody-mediated rejection despite adequate immunosuppression. Non-cardiogenic pulmonary edema is a potentially devastating post-operative complication of basiliximab induction therapy in young pediatric patients following renal transplantation. Early recognition and appropriate supportive therapy is vital for patient and, where possible, graft survival.

  8. Persistence of yellow fever vaccine-induced antibodies after solid organ transplantation.

    PubMed

    Wyplosz, B; Burdet, C; François, H; Durrbach, A; Duclos-Vallée, J C; Mamzer-Bruneel, M-F; Poujol, P; Launay, O; Samuel, D; Vittecoq, D; Consigny, P H

    2013-09-01

    Immunization using live attenuated vaccines represents a contra-indication after solid organ transplantation (SOT): consequently, transplant candidates planning to travel in countries where yellow fever is endemic should be vaccinated prior to transplantation. The persistence of yellow fever vaccine-induced antibodies after transplantation has not been studied yet. We measured yellow-fever neutralizing antibodies in 53 SOT recipients vaccinated prior to transplantation (including 29 kidney recipients and 18 liver recipients). All but one (98%) had protective titers of antibodies after a median duration of 3 years (min.: 0.8, max.: 21) after transplantation. The median antibody level was 40 U/L (interquartile range: 40-80). For the 46 patients with a known or estimated date of vaccination, yellow-fever antibodies were still detectable after a median time of 13 years (range: 2-32 years) post-immunization. Our data suggest there is long-term persistence of antibodies to yellow fever in SOT recipients who have been vaccinated prior to transplantation.

  9. Small bowel transplantation induces adrenergic hypersensitivity in ileal longitudinal smooth muscle in rats.

    PubMed

    Ohtani, N; Balsiger, B M; Anding, W J; Duenes, J A; Sarr, M G

    2000-01-01

    Our aim was to determine the effects of small bowel transplantation on contractility of longitudinal muscle in the rat ileum. Full-thickness longitudinal muscle strips from four groups of rats (naive controls, sham-operated controls, and 1 week and 8 weeks after syngeneic orthotopic small bowel transplantation) were studied in vitro. Neither baseline contractility nor response to neural blockade (tetrodotoxin) or adrenergic/cholinergic blockade differed among the groups. Although the dose response to the cholinergic agonist bethanechol and to nitric oxide did not differ among groups, the ED50 (negative log of concentration giving half-maximal effect) for the adrenergic agonist norepinephrine was increased l week and 8 weeks after transplantation, indicating a hypersensitivity response not blocked by tetrodotoxin. Nonadrenergic, noncholinergic inhibitory responses to electrical field stimulation were of greater amplitude and occurred at lesser frequencies (>/=5 Hz) 1 week after small bowel transplantation, but returned to control values 8 weeks postoperatively. These inhibitory responses were blocked by the nitric oxide synthase inhibitor L-NMMA but not by methylene blue, a nonspecific inhibitor of guanylate cyclase. Small bowel transplantation induces a persistent adrenergic denervation hypersensitivity at the muscle and appears to upregulate, at least transiently, other inhibitory mechanisms mediated by neural release of nitric oxide. Small bowel transplantation does not alter muscle response to cholinergic pathways. These alterations in smooth muscle contractility may affect gut function early after clinical small bowel transplantation.

  10. Engineering of bone marrow cells with fas-ligand protein-enhances donor-specific tolerance to solid organs.

    PubMed

    Askenasy, E M; Shushlav, Y; Sun, Z; Shirwan, H; Yolcu, E S; Askenasy, N

    2011-11-01

    Effective immunomodulation to induce tolerance to tissue/organ allografts is attained by infusion of donor lymphocytes endowed with killing capacity through ectopic expression of a short-lived Fas-ligand (FasL) protein. The same approach has proven effective in improving hematopoietic stem and progenitor cell engraftment. This study evaluates the possibility of substitution of immune cells for bone marrow cells (BMC) to induce FasL-mediated tolerance to solid organ grafts. Expression of FasL protein on BMC increased the survival of simultaneously grafted vascularized heterotopic cardiac grafts to 90%, as compared to 30% in recipients of naïve BMC. Similar results were obtained for skin allografts implanted into radiation chimeras at 1 week after bone marrow transplantation. Further reduction of preparative conditioning to busulfan resulted in acceptance of donor skin implanted at 2 weeks after transplantation of naïve and FasL-coated BMC, whereas third-party grafts were acutely rejected. The levels of donor chimerism were in the range of 0.7% to 12% at the time of skin grafting, with higher levels in recipients of FasL-coated BMC. It is concluded that FasL-mediated abrogation of alloimmune responses can be effectively attained with BMC. There is no threshold of donor chimerism, but tolerance to solid organs evolves during the process of donor-host mutual acceptance.

  11. Vascular smooth muscle cell apoptosis promotes transplant arteriosclerosis through inducing the production of SDF-1α.

    PubMed

    Li, J; Liu, S; Li, W; Hu, S; Xiong, J; Shu, X; Hu, Q; Zheng, Q; Song, Z

    2012-08-01

    Transplant arteriosclerosis is a leading cause of late allograft loss. Medial smooth muscle cell (SMC) apoptosis is considered to be an important event in transplant arteriosclerosis. However, the precise contribution of medial SMC apoptosis to transplant arteriosclerosis and the underlying mechanisms remain unclear. We transferred wild-type p53 to induce apoptosis of cultured SMCs. We found that apoptosis induces the production of SDF-1α from apoptotic and neighboring viable cells, resulting in increased SDF-1α in the culture media. Conditioned media from Ltv-p53-transferred SMCs activated PI3K/Akt/mTOR and MAPK/Erk signaling in a SDF-1α-dependent manner and thereby promoted mesenchymal stem cell (MSC) migration and proliferation. In a rat aorta transplantation model, lentivirus-mediated BclxL transfer selectively inhibits medial SMC apoptosis in aortic allografts, resulting in a remarkable decrease of SDF-1α both in allograft media and in blood plasma, associated with diminished recruitment of CD90(+)CD105(+) double-positive cells and impaired neointimal formation. Systemic administration of rapamycin or PD98059 also attenuated MSC recruitment and neointimal formation in the aortic allografts. These results suggest that medial SMC apoptosis is critical for the development of transplant arteriosclerosis through inducing SDF-1α production and that MSC recruitment represents a major component of vascular remodeling, constituting a relevant target and mechanism for therapeutic interventions.

  12. A Case Report of Drug-Induced Thrombocytopenia after Living Donor Liver Transplantation.

    PubMed

    Arai, Keisuke; Kuramitsu, Kaori; Fukumoto, Takumi; Kido, Masahiro; Takebe, Atsushi; Tanaka, Motofumi; Kinoshita, Hisoka; Ajiki, Tetsuo; Toyama, Hirochika; Asari, Sadaki; Goto, Tadahiro; Ku, Yonson

    2016-06-16

    There are few descriptions of severe thrombocytopenia during the early postoperative period after liver transplantation, and these have not been fully documented in the literature. Here, we report a case of drug-induced thrombocytopenia requiring transfusion of blood products after living donor liver transplantation. We determined that this was not caused by the interferon-free anti-viral therapy but by tacrolimus A 61-year-old woman with hepatitis C-related cirrhosis and hepatorenal syndrome underwent living donor liver transplantation using a left lobe graft from her son. After transplantation, immunosuppression consisted of tacrolimus and steroid. Seven weeks after transplantation, interferon-free therapy with daclatasvir and asunaprevir was started. Thirteen days thereafter, hepatitis C virus tested negative. However, the platelet count had begun to gradually decrease just before starting anti-viral therapy. Daclatasvir and asunaprevir were stopped because this was suspected to be a side-effect of these drugs, but the patient nonetheless went on to develop severe thrombocytopenia (platelet count 17,000/μL), which needed transfusions. Now suspecting tacrolimus as the inducer of this side effect, we changed to cyclosporin, after which the platelet count gradually recovered. Viral markers were still not detectable up to 2 months after discontinuation of the antiviral drugs. We conclude that when severe thrombocytopenia occurs, possible drug-induced thrombocytopenia as well as other disorders must be investigated.

  13. Sodium nitrite protects against kidney injury induced by brain death and improves post-transplant function.

    PubMed

    Kelpke, Stacey S; Chen, Bo; Bradley, Kelley M; Teng, Xinjun; Chumley, Phillip; Brandon, Angela; Yancey, Brett; Moore, Brandon; Head, Hughston; Viera, Liliana; Thompson, John A; Crossman, David K; Bray, Molly S; Eckhoff, Devin E; Agarwal, Anupam; Patel, Rakesh P

    2012-08-01

    Renal injury induced by brain death is characterized by ischemia and inflammation, and limiting it is a therapeutic goal that could improve outcomes in kidney transplantation. Brain death resulted in decreased circulating nitrite levels and increased infiltrating inflammatory cell infiltration into the kidney. Since nitrite stimulates nitric oxide signaling in ischemic tissues, we tested whether nitrite therapy was beneficial in a rat model of brain death followed by kidney transplantation. Nitrite, administered over 2 h of brain death, blunted the increased inflammation without affecting brain death-induced alterations in hemodynamics. Kidneys were transplanted after 2 h of brain death and renal function followed over 7 days. Allografts collected from nitrite-treated brain-dead rats showed significant improvement in function over the first 2 to 4 days after transplantation compared with untreated brain-dead animals. Gene microarray analysis after 2 h of brain death without or with nitrite therapy showed that the latter significantly altered the expression of about 400 genes. Ingenuity Pathway Analysis indicated that multiple signaling pathways were affected by nitrite, including those related to hypoxia, transcription, and genes related to humoral immune responses. Thus, nitrite therapy attenuates brain death-induced renal injury by regulating responses to ischemia and inflammation, ultimately leading to better post-transplant kidney function.

  14. Pharmacological modulation of amphetamine-induced dyskinesia in transplanted hemi-parkinsonian rats.

    PubMed

    Smith, Gaynor A; Breger, Ludivine S; Lane, Emma L; Dunnett, Stephen B

    2012-10-01

    Foetal cell transplantation in patients with Parkinson's disease can induce motor complications independent of L-DOPA administration, known as graft-induced dyskinesia. In the 6-OHDA lesioned rat model of Parkinson's disease, post-transplantation abnormal movements can develop in response to an amphetamine challenge, a behaviour which is used to model graft-induced dyskinesia. Although L-DOPA-induced dyskinesia has been well characterised pharmacologically, we lack knowledge on the modulation of post-transplantation amphetamine-induced dyskinesia which may shed light on the mechanisms underlying graft-induced dyskinesia. We assessed a series of drugs effective at reducing L-DOPA-induced dyskinesia against post-transplantation amphetamine-induced dyskinesia. Agents include: dopaminergic antagonists (D₁: CP94253; D₂: SCH-22390; D₃: nafadotride), serotonergic agonists (5-HT(1A): 8-OH-DPAT; 5-HT(1B): CP94253), opioid antagonist (μ: naloxone), cannabinoid agonist (CB₁: WIN55, 212-2), adrenergic antagonist (α₁ and α₂: yohimbine) and glutamatergic antagonists (NMDA: amantadine and MK-801; mGluR5: MTEP; AMPA: IEM1460). Abnormal involuntary movements in response to amphetamine were decreased by SCH-22390, raclopride, CP94253 and 8-OH-DPAT, yet were unaltered by naloxone, WIN55, 212-2, yohimbine, amantadine, MTEP and IEM1460. Unusually, MK-801 increased the appearance of amphetamine-induced dyskinesia. The results suggest that dopaminergic, serotoninergic and glutamatergic systems are likely to have a fundamental role in the development of graft-induced dyskinesias, which are mechanistically distinct from L-DOPA-induced behvaviours. Importantly, the expression of D₁ and D₂ receptors was unrelated to the severity of AIMs.

  15. Waning of vaccine-induced immunity to measles in kidney transplanted children.

    PubMed

    Rocca, Salvatore; Santilli, Veronica; Cotugno, Nicola; Concato, Carlo; Manno, Emma Concetta; Nocentini, Giulia; Macchiarulo, Giulia; Cancrini, Caterina; Finocchi, Andrea; Guzzo, Isabella; Dello Strologo, Luca; Palma, Paolo

    2016-09-01

    Vaccine-preventable diseases are a significant cause of morbidity and mortality in solid organ transplant recipients who undergo immunosuppression after transplantation. Data on immune responses and long-term maintenance after vaccinations in such population are still limited.We cross-sectionally evaluated the maintenance of immune response to measles vaccine in kidney transplanted children on immunosuppressive therapy. Measles-specific enzyme-linked immunosorbent assay and B-cell enzyme-linked immunosorbent spot were performed in 74 kidney transplant patients (Tps) and in 23 healthy controls (HCs) previously vaccinated and tested for humoral protection against measles. The quality of measles antibody response was measured by avidity test. B-cell phenotype, investigated via flow cytometry, was further correlated to the ability of Tps to maintain protective humoral responses to measles over time.We observed the loss of vaccine-induced immunity against measles in 19% of Tps. Nonseroprotected children showed signs of impaired B-cell distribution as well as immune senescence and lower antibody avidity. We further reported as time elapsed between vaccination and transplantation, as well as the vaccine administration during dialysis are clinical factors affecting the maintenance of the immune memory response against measles.Tps present both quantitative and qualitative alterations in the maintenance of protective immunity to measles vaccine. Prospective studies are needed to optimize the vaccination schedules in kidney transplant recipients in order to increase the immunization coverage over time in this population.

  16. Follicular T helper cells and humoral reactivity in kidney transplant patients

    PubMed Central

    de Graav, G N; Dieterich, M; Hesselink, D A; Boer, K; Clahsen-van Groningen, M C; Kraaijeveld, R; Litjens, N H R; Bouamar, R; Vanderlocht, J; Tilanus, M; Houba, I; Boonstra, A; Roelen, D L; Claas, F H J; Betjes, M G H; Weimar, W; Baan, C C

    2015-01-01

    Memory B cells play a pivotal role in alloreactivity in kidney transplantation. Follicular T helper (Tfh) cells play an important role in the differentiation of B cells into immunoglobulin-producing plasmablasts [through interleukin (IL)-21]. It is unclear to what extent this T cell subset regulates humoral alloreactivity in kidney transplant patients, therefore we investigated the absolute numbers and function of peripheral Tfh cells (CD4POSCXCR5POS T cells) in patients before and after transplantation. In addition, we studied their relationship with the presence of donor-specific anti-human leucocyte antigen (HLA) antibodies (DSA), and the presence of Tfh cells in rejection biopsies. After transplantation peripheral Tfh cell numbers remained stable, while their IL-21-producing capacity decreased under immunosuppression. When isolated after transplantation, peripheral Tfh cells still had the capacity to induce B cell differentiation and immunoglobulin production, which could be inhibited by an IL-21-receptor-antagonist. After transplantation the quantity of Tfh cells was the highest in patients with pre-existent DSA. In kidney biopsies taken during rejection, Tfh cells co-localized with B cells and immunoglobulins in follicular-like structures. Our data on Tfh cells in kidney transplantation demonstrate that Tfh cells may mediate humoral alloreactivity, which is also seen in the immunosuppressed milieu. PMID:25557528

  17. Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS

    DTIC Science & Technology

    2013-10-01

    profiling 3 Abstract ( words) The generation of human induced pluripotent stem cells (hiPSCs) represents an exciting advancement with...Sensys KAF-1400 CCD camera (Roper Scientific) or on a Zeiss laser confocal microscope. Transplanted cells were localized by staining for human...GGAAAAATTGTCAGTAGTGCAATGGAACCAGATCGGGAATACCATTTTGGACAAGCA GTACGGTTTGTATGTAACTCAGGCTACAAGATTGAAGGAGATG 36 NES NM_006617.1 2345- 2445

  18. Cortical plasticity induced by transplantation of embryonic somatostatin or parvalbumin interneurons.

    PubMed

    Tang, Yunshuo; Stryker, Michael P; Alvarez-Buylla, Arturo; Espinosa, Juan Sebastian

    2014-12-23

    GABAergic inhibition has been shown to play an important role in the opening of critical periods of brain plasticity. We recently have shown that transplantation of GABAergic precursors from the embryonic medial ganglionic eminence (MGE), the source of neocortical parvalbumin- (PV(+)) and somatostatin-expressing (SST(+)) interneurons, can induce a new period of ocular dominance plasticity (ODP) after the endogenous period has closed. Among the diverse subtypes of GABAergic interneurons PV(+) cells have been thought to play the crucial role in ODP. Here we have used MGE transplantation carrying a conditional allele of diphtheria toxin alpha subunit and cell-specific expression of Cre recombinase to deplete PV(+) or SST(+) interneurons selectively and to investigate the contributions of each of these types of interneurons to ODP. As expected, robust plasticity was observed in transplants containing PV(+) cells but in which the majority of SST(+) interneurons were depleted. Surprisingly, transplants in which the majority of PV(+) cells were depleted induced plasticity as effectively as those containing PV(+) cells. In contrast, depleting both cell types blocked induction of plasticity. These findings reveal that PV(+) cells do not play an exclusive role in ODP; SST(+) interneurons also can drive cortical plasticity and contribute to the reshaping of neural networks. The ability of both PV(+) and SST(+) interneurons to induce de novo cortical plasticity could help develop new therapeutic approaches for brain repair.

  19. The Spleen Is an Ideal Site for Inducing Transplanted Islet Graft Expansion in Mice

    PubMed Central

    Takahashi, Hiroyuki; Kodama, Shohta

    2017-01-01

    Alternative islet transplantation sites have the potential to reduce the marginal number of islets required to ameliorate hyperglycemia in recipients with diabetes. Previously, we reported that T cell leukemia homeobox 1 (Tlx1)+ stem cells in the spleen effectively regenerated into insulin-producing cells in the pancreas of non-obese diabetic mice with end-stage disease. Thus, we investigated the spleen as a potential alternative islet transplantation site. Streptozotocin-induced diabetic C57BL/6 mice received syngeneic islets into the portal vein (PV), beneath the kidney capsule (KC), or into the spleen (SP). The marginal number of islets by PV, KC, or SP was 200, 100, and 50, respectively. Some plasma inflammatory cytokine levels in the SP group were significantly lower than those of the PV group after receiving a marginal number of islets, indicating reduced inflammation in the SP group. Insulin contents were increased 280 days after islet transplantation compared with those immediately following transplantation (p<0.05). Additionally, Tlx1-related genes, including Rrm2b and Pla2g2d, were up-regulated, which indicates that islet grafts expanded in the spleen. The spleen is an ideal candidate for an alternative islet transplantation site because of the resulting reduced inflammation and expansion of the islet graft. PMID:28135283

  20. Tridermal tumorigenesis of induced pluripotent stem cells transplanted in ischemic brain.

    PubMed

    Kawai, Hiromi; Yamashita, Toru; Ohta, Yasuyuki; Deguchi, Kentaro; Nagotani, Shoko; Zhang, Xuemei; Ikeda, Yoshio; Matsuura, Tohru; Abe, Koji

    2010-08-01

    Stroke is a major neurologic disorder. Induced pluripotent stem (iPS) cells can be produced from basically any part of patients, with high reproduction ability and pluripotency to differentiate into various types of cells, suggesting that iPS cells can provide a hopeful therapy for cell transplantation. However, transplantation of iPS cells into ischemic brain has not been reported. In this study, we showed that the iPS cells fate in a mouse model of transient middle cerebral artery occlusion (MCAO). Undifferentiated iPS cells (5 x 10(5)) were transplanted into ipsilateral striatum and cortex at 24 h after 30 mins of transient MCAO. Behavioral and histologic analyses were performed at 28 day after the cell transplantation. To our surprise, the transplanted iPS cells expanded and formed much larger tumors in mice postischemic brain than in sham-operated brain. The clinical recovery of the MCAO+iPS group was delayed as compared with the MCAO+PBS (phosphate-buffered saline) group. iPS cells formed tridermal teratoma, but could supply a great number of Dcx-positive neuroblasts and a few mature neurons in the ischemic lesion. iPS cells have a promising potential to provide neural cells after ischemic brain injury, if tumorigenesis is properly controlled.

  1. Outcomes of liver transplantation for paracetamol (acetaminophen)-induced hepatic failure.

    PubMed

    Cooper, Sheldon C; Aldridge, Roland C; Shah, Tahir; Webb, Kerry; Nightingale, Peter; Paris, Sue; Gunson, Bridget K; Mutimer, David J; Neuberger, James M

    2009-10-01

    Paracetamol (acetaminophen) hepatotoxicity, whether due to intentional overdose or therapeutic misadventure, is an indication for liver transplantation in selected cases. However, there is a concern that long-term outcomes may be compromised by associated psychopathology that may predispose patients to further episodes of self-harm or poor treatment adherence. We therefore undertook a retrospective analysis of patients transplanted for paracetamol-induced fulminant hepatic failure (FHF) to determine their long-term outcomes, psychiatric problems, and compliance and whether these issues could be predicted from pretransplant information. Records from patients undergoing liver transplantation for paracetamol-associated liver failure in this unit and 2 comparison groups (patients undergoing liver replacement for FHF from other causes and for chronic liver diseases) were examined. Of 60 patients transplanted for paracetamol-induced FHF between 1989 and 2007, 44 (73%) survived to discharge. Currently, 35 patients (58%) are surviving at an average of 9 years post-transplantation. The incidence of psychiatric disease (principally depression) and 30-day mortality were greatest in the paracetamol group, but for those who survived 30 days, there was no difference in long-term survival rates between the groups. Adherence to follow-up appointments and compliance with immunosuppression were lowest in the paracetamol overdose group. Poor adherence was not predicted by any identifiable premorbid psychiatric conditions. Two patients grafted for paracetamol FHF died from self-harm (1 from suicide and 1 from alcoholic liver disease after 5 years). This study suggests that, notwithstanding the shortage of donor liver grafts, transplantation is an appropriate therapy in selected patients, although close follow-up is indicated.

  2. Impact of preformed donor-specific antibodies against HLA class I on kidney graft outcomes: Comparative analysis of exclusively anti-Cw vs anti-A and/or -B antibodies

    PubMed Central

    Santos, Sofia; Malheiro, Jorge; Tafulo, Sandra; Dias, Leonídio; Carmo, Rute; Sampaio, Susana; Costa, Marta; Campos, Andreia; Pedroso, Sofia; Almeida, Manuela; Martins, La Salete; Henriques, Castro; Cabrita, António

    2016-01-01

    AIM To analyze the clinical impact of preformed antiHLA-Cw vs antiHLA-A and/or -B donor-specific antibodies (DSA) in kidney transplantation. METHODS Retrospective study, comparing 12 patients transplanted with DSA exclusively antiHLA-Cw with 23 patients with preformed DSA antiHLA-A and/or B. RESULTS One year after transplantation there were no differences in terms of acute rejection between the two groups (3 and 6 cases, respectively in the DSA-Cw and the DSA-A-B groups; P = 1). At one year, eGFR was not significantly different between groups (median 59 mL/min in DSA-Cw group, compared to median 51 mL/min in DSA-A-B group, P = 0.192). Moreover, kidney graft survival was similar between groups at 5-years (100% in DSA-Cw group vs 91% in DSA-A-B group, P = 0.528). The sole independent predictor of antibody mediated rejection (AMR) incidence was DSA strength (HR = 1.07 per 1000 increase in MFI, P = 0.034). AMR was associated with shortened graft survival at 5-years, with 75% and 100% grafts surviving in patients with or without AMR, respectively (Log-rank P = 0.005). CONCLUSION Our data indicate that DSA-Cw are associated with an identical risk of AMR and impact on graft function in comparison with “classical” class I DSA. PMID:28058219

  3. Tempering allorecognition to induce transplant tolerance with chemically modified apoptotic donor cells.

    PubMed

    McCarthy, D P; Bryant, J; Galvin, J P; Miller, S D; Luo, X

    2015-06-01

    The development of organ transplantation as a therapy for end-stage organ failure is among the most significant achievements of 20th century medicine, but chronic rejection remains a barrier to achieving long-term success. Current therapeutic regimens consist of immunosuppressive drugs that are efficient at delaying rejection but are associated with significant risks such as opportunistic infections, toxicity, and malignancy. Thus, the induction of specific immune tolerance to transplant antigens is the coveted aim of researchers. The use of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (ECDI)-treated, autoantigen-coupled syngeneic leukocytes has been developed as a specific immunotherapy in preclinical models of autoimmunity and is currently in a phase II clinical trial for the treatment of multiple sclerosis. In this review, we discuss the use of allogeneic ECDI-treated apoptotic donor leukocytes (allo-ECDI-SP) as a strategy for inducing antigen-specific tolerance in allogeneic transplantation. Allo-ECDI-SP therapy induces long-term systemic immune tolerance to transplant antigens by subverting alloimmune recognition and exploiting apoptotic cell uptake pathways to recapitulate innate mechanisms of peripheral tolerance. Lastly, we discuss potential indications and challenges for transitioning allo-ECDI-SP therapy into clinical practice.

  4. Tempering Allorecognition to Induce Transplant Tolerance With Chemically Modified Apoptotic Donor Cells

    PubMed Central

    McCarthy, D. P.; Bryant, J.; Galvin, J. P.; Miller, S. D.; Luo, X.

    2015-01-01

    The development of organ transplantation as a therapy for end-stage organ failure is among the most significant achievements of 20th century medicine, but chronic rejection remains a barrier to achieving long-term success. Current therapeutic regimens consist of immunosuppressive drugs that are efficient at delaying rejection but are associated with significant risks such as opportunistic infections, toxicity, and malignancy. Thus, the induction of specific immune tolerance to transplant antigens is the coveted aim of researchers. The use of 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (ECDI)-treated, autoantigen-coupled syngeneic leukocytes has been developed as a specific immunotherapy in preclinical models of autoimmunity and is currently in a phase II clinical trial for the treatment of multiple sclerosis. In this review, we discuss the use of allogeneic ECDI-treated apoptotic donor leukocytes (allo-ECDI-SP) as a strategy for inducing antigen-specific tolerance in allogeneic transplantation. Allo-ECDI-SP therapy induces long-term systemic immune tolerance to transplant antigens by subverting alloimmune recognition and exploiting apoptotic cell uptake pathways to recapitulate innate mechanisms of peripheral tolerance. Lastly, we discuss potential indications and challenges for transitioning allo-ECDI-SP therapy into clinical practice. PMID:25807873

  5. Antagonistic effect of toll-like receptor signaling and bacterial infections on transplantation tolerance*

    PubMed Central

    Alegre, Maria-Luisa; Chen, Luqiu; Wang, Tongmin; Ahmed, Emily; Wang, Chyung-Ru; Chong, Anita

    2009-01-01

    The induction of donor-specific tolerance remains a major goal in the field of transplantation immunology. Therapies that target costimulatory molecules can induce tolerance to heart and pancreatic islet allografts in mouse models, but fail to do so following transplantation of skin or intestinal allografts. We have proposed that organs colonized by commensal bacteria such as skin, lung and intestine may be resistant to such therapies as a result of bacterial translocation at the time of transplantation, which may promote antigen-presenting cell (APC) maturation and the production of pro-inflammatory cytokines, consequently enhancing responses of alloreactive T cells. Our results indicate that the inability to sense signaling by most toll-like receptors (TLRs), as well as by interleukin (IL)-1R and IL-18R, as a result of genetic ablation of myeloid differentiation factor 88 (MyD88) promotes the acceptance of skin allografts. Conversely, TLR signals and infections by a model bacterium, Listeria monocytogenes (LM), at the time of transplantation can prevent the induction of transplantation tolerance. The effects of the TLR9 agonist CpG are MyD88-dependent, while the pro-rejection capacity of LM depends on the intracellular sensing of LM and the production of type I interferon (IFN). Therefore, transiently targeting these innate, pro-inflammatory pathways may have therapeutic value to promote transplantation tolerance. PMID:19424015

  6. IVIg Treatment Reduces Catalytic Antibody Titers of Renal Transplanted Patients

    PubMed Central

    Mahendra, Ankit; Peyron, Ivan; Dollinger, Cécile; Gilardin, Laurent; Sharma, Meenu; Wootla, Bharath; Padiolleau-Lefevre, Séverine; Friboulet, Alain; Boquet, Didier; Legendre, Christophe; Kaveri, Srinivas V.

    2013-01-01

    Catalytic antibodies are immunoglobulins endowed with enzymatic activity. Catalytic IgG has been reported in several human autoimmune and inflammatory diseases. In particular, low levels of catalytic IgG have been proposed as a prognostic marker for chronic allograft rejection in patients undergoing kidney transplant. Kidney allograft is a treatment of choice for patients with end-stage renal failure. Intravenous immunoglobulins, a therapeutic pool of human IgG, is used in patients with donor-specific antibodies, alone or in conjunction with other immunosuppressive treatments, to desensitize the patients and prevent the development of acute graft rejection. Here, we followed for a period of 24 months the levels of catalytic IgG towards the synthetic peptide Pro-Phe-Arg-methylcoumarinimide in a large cohort of patients undergoing kidney transplantation. Twenty-four percent of the patients received IVIg at the time of transplantation. Our results demonstrate a marked reduction in levels of catalytic antibodies in all patients three months following kidney transplant. The decrease was significantly pronounced in patients receiving adjunct IVIg therapy. The results suggests that prevention of acute graft rejection using intravenous immunoglobulins induces a transient reduction in the levels of catalytic IgG, thus potentially jeopardizing the use of levels of catalytic antibodies as a prognosis marker for chronic allograft nephropathy. PMID:23967092

  7. Rapid dendritic cell activation and resistance to allotolerance induction in anti-CD154-treated mice receiving CD47-deficient donor-specific transfusion.

    PubMed

    Wang, Yuantao; Wang, Hui; Bronson, Roderick; Fu, Yaowen; Yang, Yong-Guang

    2014-03-01

    CD47-SIRPα signaling plays an important role in regulating macrophage and dendritic cell (DC) activation. Here we investigated the role of CD47 expression on donor cells in tolerance induction by combined treatment with donor-specific transfusion (DST) plus anti-CD154 mAb in a mouse model of fully MHC-mismatched heart allotransplantation. The majority of BALB/c recipient mice that received anti-CD154 and CD47(+/+) B6 splenocytes (DST) showed indefinite donor heart survival (median survival time, MST > 150 days). Donor heart survival was improved in anti-CD154-treated BALB/c mice that received CD47(+/-) (MST = 90 days) or CD47(-/-) B6 DST (MST = 42 days) when compared to the nontreated (MST = 7 days) and anti-CD154 alone-treated (MST = 15 days) controls, but significantly reduced when compared to mice receiving anti-CD154 plus CD47(+/+) B6 DST. Recipient mice treated with anti-CD154 plus CD47(-/-) or CD47(+/-) DST also showed significantly increased antidonor, but not anti-third-party, MLR responses compared to those receiving anti-CD154 and CD47(+/+) DST. Furthermore, CD47(-/-) DST induced rapid activation of CD11c(hi)SIRPα(hi)CD8α(-) DCs via a mechanism independent of donor alloantigens. These results demonstrated that CD47 expression on donor cells is essential to the success of tolerance induction by combined therapy with DST and CD40/CD154 blockade.

  8. Safety and Efficacy of Transplantation with Allogeneic Skin Tumors to Treat Chemically-Induced Skin Tumors in Mice

    PubMed Central

    Zhang, Zhiwei; Sun, Hua; Zhang, Jianhua; Ge, Chunlei; Dong, Suwei; Li, Zhen; Li, Ruilei; Chen, Xiaodan; Li, Mei; Chen, Yun; Zou, Yingying; Qian, Zhongyi; Yang, Lei; Yang, Jinyan; Zhu, Zhitao; Liu, Zhimin; Song, Xin

    2016-01-01

    Background Transplantation with allogeneic cells has become a promising modality for cancer therapy, which can induce graft-versus-tumor (GVT) effect. This study was aimed at assessing the safety, efficacy, and tissue type GVT (tGVT) response of transplantation with allogeneic skin tumors to treat chemically-induced skin tumors in mice. Material/Methods FVB/N and ICR mice were exposed topically to chemicals to induce skin tumors. Healthy ICR mice were transplanted with allogeneic skin tumors from FVB/N mice to test the safety. The tumor-bearing ICR mice were transplanted with, or without, allogeneic skin tumors to test the efficacy. The body weights (BW), body condition scores (BCS), tumor volumes in situ, metastasis tumors, overall survival, and serum cytokines were measured longitudinally. Results Transplantation with no more than 0.03 g allogeneic skin tumors from FVB/N mice to healthy ICR mice was safe. After transplantation with allogeneic skin tumors to treat tumor-bearing mice, it inhibited the growth of tumors slightly at early stage, accompanied by fewer metastatic tumors at 24 days after transplantation (21.05% vs. 47.37%), while there were no statistically significant differences in the values of BW, BCS, tumor volumes in situ, metastasis tumors, and overall survival between the transplanted and non-transplanted groups. The levels of serum interleukin (IL)-2 were significantly reduced in the controls (P<0.05), but not in the recipients, which may be associated with the tGVT response. Conclusions Our results suggest that transplantation with allogeneic skin tumors is a safe treatment in mice, which can induce short-term tGVT response mediated by IL-2. PMID:27587310

  9. Induced pluripotent stem cells: An unlimited source of organs for transplantation.

    PubMed

    De Vos, J; Assou, S

    2016-12-07

    Organ production outside the human body could address the shortage of organs for transplantation. However, in vitro organ production is still a faraway perspective, particularly because of the difficulty in establishing an effective vascularization. A new emerging technology proposes to use carrier animals for the development of human organs. In this approach, induced pluripotent stem cells (iPSC) are injected in animal embryos to produce chimeric animals that contain autologous human organs.

  10. Clinical and molecular significance of microvascular inflammation in transplant kidney biopsies.

    PubMed

    Gupta, Anjali; Broin, Pilib Ó; Bao, Yi; Pullman, James; Kamal, Layla; Ajaimy, Maria; Lubetzky, Michelle; Colovai, Adriana; Schwartz, Daniel; de Boccardo, Graciela; Golden, Aaron; Akalin, Enver

    2016-01-01

    The diagnostic criteria for antibody-mediated rejection (AMR) are continuously evolving. Here we investigated the clinical and molecular significance of different Banff microvascular inflammation (MVI) scores in transplant kidney biopsies. A total of 356 patients with clinically indicated kidney transplant biopsies were classified into three groups based on MVI scores of 0, 1, 2, or more for Groups 1-3, respectively. Gene expression profiles were assessed using arrays on a representative subset of 93 patients. The incidence of donor-specific anti-HLA antibodies was increased from 25% in Group 1 to 36% in Group 2 and to 54% in Group 3. Acute and chronic AMR were significantly more frequent in Group 3 (15% and 35%) compared with the Group 2 (3% and 15%) and Group 1 (0% and 5%), respectively. Gene expression profiles showed increased interferon-γ and rejection-induced, cytotoxic and regulatory T-cell, natural killer cell-associated and donor-specific antibody (DSA)-selective transcripts in Group 3 compared with Groups 1 and 2. There was no significant difference in gene expression profiles between the Groups 1 and 2. Increased intragraft expression of DSA-selective transcripts was found in the biopsies of C4d- Group 3 patients. Thus, an MVI score of 2 or more was significantly associated with a histological diagnosis of acute and chronic antibody-mediated rejection. Hence, increased intragraft DSA-selective gene transcripts may be used as molecular markers for AMR, especially in C4d- biopsies.

  11. Regression of Adjuvant-Induced Arthritis in Rats Following Bone Marrow Transplantation

    NASA Astrophysics Data System (ADS)

    van Bekkum, Dirk W.; Bohre, Els P. M.; Houben, Paul F. J.; Knaan-Shanzer, Shoshan

    1989-12-01

    Total body irradiation followed by bone marrow transplantation was found to be an effective treatment for adjuvant arthritis induced in rats. This treatment is most effective when applied shortly after the clinical manifestation of arthritis--i.e., 4-7 weeks after administration of Mycobacterium tuberculosis. Transplantation of bone marrow at a later stage results in a limited recovery, in that the inflammatory reaction regresses but the newly formed excessive bone is not eliminated. Local irradiation of the affected joints had no effect on the disease. It could also be excluded that the recovery of arthritis following marrow transplantation is due to lack of available antigen. Transplantation of syngeneic bone marrow is as effective as that of allogeneic bone marrow from a rat strain that is not susceptible to induction of adjuvant arthritis. The beneficial effect of this treatment cannot be ascribed to the immunosuppressive effect of total body irradiation, since treatment with the highly immunosuppressive drug Cyclosporin A resulted in a regression of the joint swelling but relapse occurred shortly after discontinuation of the treatment.

  12. Neural Stem Cell Transplantation Induces Stroke Recovery by Upregulating Glutamate Transporter GLT-1 in Astrocytes

    PubMed Central

    Russo, Gianluca Luigi; Peruzzotti-Jametti, Luca; Rossi, Silvia; Sandrone, Stefano; Butti, Erica; De Ceglia, Roberta; Bergamaschi, Andrea; Motta, Caterina; Gallizioli, Mattia; Studer, Valeria; Colombo, Emanuela; Farina, Cinthia; Comi, Giancarlo; Politi, Letterio Salvatore; Muzio, Luca; Villani, Claudia; Invernizzi, Roberto William; Hermann, Dirk Matthias; Centonze, Diego

    2016-01-01

    Ischemic stroke is the leading cause of disability, but effective therapies are currently widely lacking. Recovery from stroke is very much dependent on the possibility to develop treatments able to both halt the neurodegenerative process as well as to foster adaptive tissue plasticity. Here we show that ischemic mice treated with neural precursor cell (NPC) transplantation had on neurophysiological analysis, early after treatment, reduced presynaptic release of glutamate within the ipsilesional corticospinal tract (CST), and an enhanced NMDA-mediated excitatory transmission in the contralesional CST. Concurrently, NPC-treated mice displayed a reduced CST degeneration, increased axonal rewiring, and augmented dendritic arborization, resulting in long-term functional amelioration persisting up to 60 d after ischemia. The enhanced functional and structural plasticity relied on the capacity of transplanted NPCs to localize in the peri-ischemic and ischemic area, to promote the upregulation of the glial glutamate transporter 1 (GLT-1) on astrocytes and to reduce peri-ischemic extracellular glutamate. The upregulation of GLT-1 induced by transplanted NPCs was found to rely on the secretion of VEGF by NPCs. Blocking VEGF during the first week after stroke reduced GLT-1 upregulation as well as long-term behavioral recovery in NPC-treated mice. Our results show that NPC transplantation, by modulating the excitatory–inhibitory balance and stroke microenvironment, is a promising therapy to ameliorate disability, to promote tissue recovery and plasticity processes after stroke. SIGNIFICANCE STATEMENT Tissue damage and loss of function occurring after stroke can be constrained by fostering plasticity processes of the brain. Over the past years, stem cell transplantation for repair of the CNS has received increasing interest, although underlying mechanism remain elusive. We here show that neural stem/precursor cell transplantation after ischemic stroke is able to foster

  13. Female qualities in males: vitellogenin synthesis induced by ovary transplants into the male silkworm, Bombyx mori.

    PubMed

    Yang, Congwen; Lin, Ying; Shen, Guanwang; Chen, Enxiang; Wang, Yanxia; Luo, Juan; Zhang, Haiyan; Xing, Runmiao; Xia, Qingyou

    2014-10-10

    Female qualities in males are common in vertebrates but have not been extensively reported in insects. Vitellogenin (Vg) is highly expressed in the female fat body and is generally required for the formation of yolk proteins in the insect egg. Vg upregulation is generally regarded as a female quality in female oviparous animals. In this study, we found that Bombyx mori Vg (BmVg) is especially highly expressed in the female pupa. Downregulation of the BmVg gene in the female pupa by RNA interference (RNAi) interfered with egg formation and embryonic development, showing the importance of BmVg in these processes. So, we used BmVg as a biomarker for female qualities in the silkworm. Hematoxylin-eosin staining and immunofluorescence histochemistry showed that ovary transplants induced BmVg synthesis in the male pupa fat body. Ovaries transplanted into male silkworms produced only a few eggs with deformed yolk granules. These results suggested that the amount of BmVg in the male silkworm was insufficient for eggs to undergo complete embryonic development. After 17-beta-estradiol was used to treat male pupae and male pupal fat bodies, BmVg was upregulated in vivo and in vitro. These findings indicated that the male silkworm has innate female qualities that were induced by a transplanted ovary and 17β-estradiol. However, in silkworms, female qualities in males are not as complete as in females.

  14. Effect of ultraviolet-B-irradiated donor-specific blood transfusions and peritransplant immunosuppression with cyclosporine on rat cardiac allograft survival

    SciTech Connect

    Oluwole, S.F.; Lau, H.T.; Reemtsma, K.; Hardy, M.A.

    1988-02-01

    We have previously demonstrated that pretreatment of ACI recipients with ultraviolet-irradiated donor-specific blood transfusion (UV-DST) leads to permanent cardiac allograft survival without further host immunosuppression (ACI rats are weak responders to Lewis lymphocytes in mixed-lymphocyte reaction). This study examines the effect of UV-DST and the timing of transfusions on ACI cardiac allograft survival in Lewis recipients with and without the addition of peritransplant cyclosporine (CsA) (20 mg/kg i.m.) given on days 0, +1, and +2 in relation to the time of transplantation. The mean survival time (MST) of ACI cardiac allografts in Lewis recipients was significantly increased to 33.6 +/- 5.7 days (P less than 0.001) by CsA treatment alone as compared to 6.5 +/- 0.5 days survival in control. When DST was given on day -3 combined with CsA, graft survival was increased to 42.0 +/- 9.3 days (P less than 0.01), as compared to 5.8 +/- 1.3 days when DST alone was used. When DST was irradiated with ultraviolet B (UV-DST) and administered on day -3 combined with peritransplant CsA, the MST was increased to 68.83 +/- 16.1 days as compared to an MST of 10.0 +/- 1.0 days in controls treated with UV-DST alone. When UV-DST was given on day -7 and combined with peritransplant CsA immunosuppression, the results were similar. However, when UV-DST was peritransplant CsA course, 4 of 6 recipients maintained their ACI heart allografts indefinitely (greater than 300 days) in contrast to the effect of UV-DST alone (MST of 13.5 days). Third-party (W/F) UV-irradiated blood transfusions were ineffective in prolonging ACI cardiac allografts in Lewis rats, regardless of whether the transfusions were given alone or in combination with peritransplant immunosuppression with CsA.

  15. Tuning the Phosphoryl Donor Specificity of Dihydroxyacetone Kinase from ATP to Inorganic Polyphosphate. An Insight from Computational Studies.

    PubMed

    Sánchez-Moreno, Israel; Bordes, Isabel; Castillo, Raquel; Ruiz-Pernía, José Javier; Moliner, Vicent; García-Junceda, Eduardo

    2015-11-24

    Dihydroxyacetone (DHA) kinase from Citrobacter freundii provides an easy entry for the preparation of DHA phosphate; a very important C3 building block in nature. To modify the phosphoryl donor specificity of this enzyme from ATP to inorganic polyphosphate (poly-P); a directed evolution program has been initiated. In the first cycle of evolution, the native enzyme was subjected to one round of error-prone PCR (EP-PCR) followed directly (without selection) by a round of DNA shuffling. Although the wild-type DHAK did not show activity with poly-P, after screening, sixteen mutant clones showed an activity with poly-phosphate as phosphoryl donor statistically significant. The most active mutant presented a single mutation (Glu526Lys) located in a flexible loop near of the active center. Interestingly, our theoretical studies, based on molecular dynamics simulations and hybrid Quantum Mechanics/Molecular Mechanics (QM/MM) optimizations, suggest that this mutation has an effect on the binding of the poly-P favoring a more adequate position in the active center for the reaction to take place.

  16. Tuning the Phosphoryl Donor Specificity of Dihydroxyacetone Kinase from ATP to Inorganic Polyphosphate. An Insight from Computational Studies

    PubMed Central

    Sánchez-Moreno, Israel; Bordes, Isabel; Castillo, Raquel; Ruiz-Pernía, José Javier; Moliner, Vicent; García-Junceda, Eduardo

    2015-01-01

    Dihydroxyacetone (DHA) kinase from Citrobacter freundii provides an easy entry for the preparation of DHA phosphate; a very important C3 building block in nature. To modify the phosphoryl donor specificity of this enzyme from ATP to inorganic polyphosphate (poly-P); a directed evolution program has been initiated. In the first cycle of evolution, the native enzyme was subjected to one round of error-prone PCR (EP-PCR) followed directly (without selection) by a round of DNA shuffling. Although the wild-type DHAK did not show activity with poly-P, after screening, sixteen mutant clones showed an activity with poly-phosphate as phosphoryl donor statistically significant. The most active mutant presented a single mutation (Glu526Lys) located in a flexible loop near of the active center. Interestingly, our theoretical studies, based on molecular dynamics simulations and hybrid Quantum Mechanics/Molecular Mechanics (QM/MM) optimizations, suggest that this mutation has an effect on the binding of the poly-P favoring a more adequate position in the active center for the reaction to take place. PMID:26610480

  17. Plasma protein corona modulates the vascular wall interaction of drug carriers in a material and donor specific manner.

    PubMed

    Sobczynski, Daniel J; Charoenphol, Phapanin; Heslinga, Michael J; Onyskiw, Peter J; Namdee, Katawut; Thompson, Alex J; Eniola-Adefeso, Omolola

    2014-01-01

    The nanoscale plasma protein interaction with intravenously injected particulate carrier systems is known to modulate their organ distribution and clearance from the bloodstream. However, the role of this plasma protein interaction in prescribing the adhesion of carriers to the vascular wall remains relatively unknown. Here, we show that the adhesion of vascular-targeted poly(lactide-co-glycolic-acid) (PLGA) spheres to endothelial cells is significantly inhibited in human blood flow, with up to 90% reduction in adhesion observed relative to adhesion in simple buffer flow, depending on the particle size and the magnitude and pattern of blood flow. This reduced PLGA adhesion in blood flow is linked to the adsorption of certain high molecular weight plasma proteins on PLGA and is donor specific, where large reductions in particle adhesion in blood flow (>80% relative to buffer) is seen with ∼60% of unique donor bloods while others exhibit moderate to no reductions. The depletion of high molecular weight immunoglobulins from plasma is shown to successfully restore PLGA vascular wall adhesion. The observed plasma protein effect on PLGA is likely due to material characteristics since the effect is not replicated with polystyrene or silica spheres. These particles effectively adhere to the endothelium at a higher level in blood over buffer flow. Overall, understanding how distinct plasma proteins modulate the vascular wall interaction of vascular-targeted carriers of different material characteristics would allow for the design of highly functional delivery vehicles for the treatment of many serious human diseases.

  18. Stimulation of local solid tumour development of the nonproducer Marek's disease tumour transplant JMV by virus-induced immunosuppression.

    PubMed

    Bulow, V V; Weiland, F

    1980-01-01

    Chickens could be protected against lethal lymphoblastic leukaemia due to the nonproducer JMV Marek's disease (MD) tumour transplant by infection with the herpesvirus of turkeys (HVT) or various strains of MD virus. However, solid JMV tumours developed in MD virus-infected birds at the site of intramuscular or subcutaneous transplantation, but tumours never developed at the site of MD virus inoculation. The incidence and extent of local tumour growth, the development of metastases and the inhibition of tumour regression were related to the pathogenicity of the MD virus strains used for pre-treatment of the chickens. Infection of chickens with reticulo-endotheliosis virus (REV-C) or with chick syncytial virus (CSV), which are nonprotective against MD virus or JMV transplants, stimulated local tumour development of the attenuated JMV-A variant of the JMV transplant. Chickens which did not reject local tumours died of visceral JMV tumour metastases. A direct helper mechanism of viral infection on the oncogenicity of transplants was excluded. The results suggested that virus-induced immunosuppression stimulated the development of local JMV tumours which never occurred in normal chickens. Immunity to the JMV transplant, including resistance to lethal leukaemia and successful regression of local tumours, did not coincide with immunity to MD virus-induced visceral lymphomas or nerve lesions. Vaccinal induced tumour immunity evidently was defective. The significance of these results is discussed with reference to immunological functions of MD tumour-specific antigens.

  19. Inducible and endothelial nitric oxide synthase expression during development of transplant arteriosclerosis in rat aortic grafts.

    PubMed Central

    Akyürek, L. M.; Fellström, B. C.; Yan, Z. Q.; Hansson, G. K.; Funa, K.; Larsson, E.

    1996-01-01

    In the vascular system, distinct isoforms of nitric oxide synthase (NOS) generate nitric oxide (NO), which acts as a biological messenger. Its role in the development of transplant arteriosclerosis (TA) is still unclear. To investigate whether NO is involved in TA, we studied the expression of NOS isoforms, inducible NOS (iNOS) and endothelial NOS (eNOS), by immunohistochemistry and in situ hybridization during the first two post-transplantation months and their relation with cold ischemia (1 to 24 hours) and reperfusion injury using an aortic transplantation model in the rat. We found an increased iNOS expression in the intima and adventitia and a decreased expression in the media, whereas eNOS expression was not significantly altered during the development of TA. Co-localization studies suggested that iNOS-positive cells were vascular smooth muscle cells, monocyte-derived macrophages, and endothelial cells. Prolonged ischemic storage time resulted in an increase in eNOS expression in the neointima. In situ hybridization showed iNOS mRNA expression by vascular cells in the neointima and media. NO produced by iNOS and eNOS may be involved, at least in part, in the pathogenesis of TA in aortic grafts. Additional studies are needed to confirm the modulatory mechanism of NO during the development of TA. Images Figure 3 Figure 4 Figure 6 PMID:8952533

  20. Mechanisms of transplantation tolerance in animals and humans.

    PubMed

    Sykes, Megan

    2009-05-15

    Donor-specific immune tolerance would avoid the toxicities of chronic immunosuppressive therapies while preventing graft rejection. Hematopoietic cell transplantation has shown preliminary success for intentional tolerance induction in pilot clinical trials. The mechanisms of tolerance in these trials and the animal studies leading up to them are discussed.

  1. Establishment of a surgically induced cryptorchidism canine recipient model for spermatogonial stem cell transplantation

    PubMed Central

    Lee, Won-Young; Lee, Ran; Song, Hyuk; Hur, Tai-Young; Lee, Seunghoon; Ahn, Jiyun

    2016-01-01

    Transplantation of spermatogonial stem cells (SSCs) in experimental animal models has been used to study germ line stem cell biology and to produce transgenic animals. The species-specific recipient model preparation is important for the characterization of SSCs and the production of offspring. Here, we investigated the effects of surgically induced cryptorchidism in dog as a new recipient model for spermatogonial stem cell transplantation. Artificially unilateral or bilateral cryptorchidism was induced in ten mature male dogs by surgically returning the testis and epididymis to the abdominal cavity. The testes and epididymides were collected every week after the induction of artificial cryptorchidism (surgery) for one month. To determine the effect of surgical cryptorchidism, the seminiferous tubule diameter was measured and immunohistochemistry using PGP9.5 and GATA4 antibodies was analyzed. The diameters of the seminiferous tubules of abdominal testes were significantly reduced compared to those of the scrotal testes. Immunohistochemistry results showed that PGP9.5 positive undifferentiated spermatogonia were significantly reduced after surgical cryptorchidism induction, but there were no significant changes in GATA-4 positive sertoli cells. To evaluate the testis function recovery rate, orchiopexy was performed on two dogs after 30 days of bilateral cryptorchidism. In the orchiopexy group, SCP3 positive spermatocytes were detected, and spermatogenesis was recovered 8 weeks after orchiopexy. In this study, we provided optimum experimental conditions and time for surgical preparation of a recipient canine model for SSC transplantation. Additionally, our data will contribute to recipient preparation by using surgically induced cryptorchidism in non-rodent species. PMID:28053620

  2. Inducible costimulatory molecule deficiency induced imbalance of Treg and Th17/Th2 delays rejection reaction in mice undergoing allogeneic tracheal transplantation

    PubMed Central

    Xu, Jingsong; Wu, Yu; Wang, Guifang; Qin, Yanghua; Zhu, Li; Tang, Gusheng; Shen, Qian

    2014-01-01

    Objective: This study aimed to investigate the role of inducible costimulatory molecule (ICOS) pathway in the rejection reaction of mice undergoing allogeneic tracheal transplantation. Methods: The bronchus was separated from wide-type (WT) BalB/c mice and transplanted into WT BalB/c mice, C57 mice and icos-/- mice to prepare the obliterative bronchiolitis (OB) animal model. The transplanted bronchus was pathologically examined; flow cytometry was done to detect the T cell subsets and activity of the bronchus and spleen of recipient mice. Results: 21 d after transplantation, evident rejection reaction was observed and the proportion of Th2 and Th17 cells increased significantly in the bronchus and spleen in C57 mice receiving allogeneic tracheal transplantation when compared with mice with autologous transplantation, but the proportion of Treg cells was comparable between them. When compared with WT BalB/c mice, the proportion of Th2, Th17 and Treg cells reduced markedly and rejection reaction was attenuated in icos-/- mice receiving tracheal transplantation, although rejection reaction was still noted. Conclusion: icos knockout may delay the rejection reaction after tracheal transplantation, which might be ascribed to the imbalance among Th2, Th17 and Treg cells. PMID:25628788

  3. Complement-fixing donor-specific antibodies identified by a novel C1q assay are associated with allograft loss.

    PubMed

    Sutherland, Scott M; Chen, Ge; Sequeira, Flavia A; Lou, Calvin D; Alexander, Steven R; Tyan, Dolly B

    2012-02-01

    Long-term outcomes following renal transplantation remain disappointing. Recently, interest has focused on the antibody-mediated component of allograft injury and the deleterious effects of DSA. We applied a novel C1q solid-phase assay in parallel with the standard IgG SAB assay to identify DSA with the potential to activate complement by binding C1q. Among 193 consecutive renal transplants at our center, 19.2% developed de novo DSA following transplantation. Of the patients with DSA, 43% had antibodies that bound C1q in vitro [C1q+ DSA]. Patients with C1q+ DSA were more likely to develop allograft loss than patients with DSA that did not bind C1q (46.7% vs. 15%; p = 0.04); patients with C1q+ DSA were nearly six times more likely to lose their transplant than those with C1q- DSA. Additionally, patients with C1q+ DSA who underwent allograft biopsy were more likely to demonstrate C4d deposition (50% vs. 8%; p = 0.03) and meet criteria for acute rejection (60% vs. 17%; p = 0.02) when compared with patients with DSA that did not bind C1q. These data suggest that DSA with the ability to activate complement, as determined by this novel C1q assay, are associated with greater risk of acute rejection and allograft loss.

  4. Directly auto-transplanted mesenchymal stem cells induce bone formation in a ceramic bone substitute in an ectopic sheep model.

    PubMed

    Boos, Anja M; Loew, Johanna S; Deschler, Gloria; Arkudas, Andreas; Bleiziffer, Oliver; Gulle, Heinz; Dragu, Adrian; Kneser, Ulrich; Horch, Raymund E; Beier, Justus P

    2011-06-01

    Bone tissue engineering approaches increasingly focus on the use of mesenchymal stem cells (MSC). In most animal transplantation models MSC are isolated and expanded before auto cell transplantation which might be critical for clinical application in the future. Hence this study compares the potential of directly auto-transplanted versus in vitro expanded MSC with or without bone morphogenetic protein-2 (BMP-2) to induce bone formation in a large volume ceramic bone substitute in the sheep model. MSC were isolated from bone marrow aspirates and directly auto-transplanted or expanded in vitro and characterized using fluorescence activated cell sorting (FACS) and RT-PCR analysis before subcutaneous implantation in combination with BMP-2 and β-tricalcium phosphate/hydroxyapatite (β-TCP/HA) granules. Constructs were explanted after 1 to 12 weeks followed by histological and RT-PCR evaluation. Sheep MSC were CD29(+), CD44(+) and CD166(+) after selection by Ficoll gradient centrifugation, while directly auto-transplanted MSC-populations expressed CD29 and CD166 at lower levels. Both, directly auto-transplanted and expanded MSC, were constantly proliferating and had a decreasing apoptosis over time in vivo. Directly auto-transplanted MSC led to de novo bone formation in a heterotopic sheep model using a β-TCP/HA matrix comparable to the application of 60 μg/ml BMP-2 only or implantation of expanded MSC. Bone matrix proteins were up-regulated in constructs following direct auto-transplantation and in expanded MSC as well as in BMP-2 constructs. Up-regulation was detected using immunohistology methods and RT-PCR. Dense vascularization was demonstrated by CD31 immunohistology staining in all three groups. Ectopic bone could be generated using directly auto-transplanted or expanded MSC with β-TCP/HA granules alone. Hence BMP-2 stimulation might become dispensable in the future, thus providing an attractive, clinically feasible approach to bone tissue engineering.

  5. Foetal Cell Transplantation for Parkinson's Disease: Focus on Graft-Induced Dyskinesia.

    PubMed

    Tronci, Elisabetta; Fidalgo, Camino; Carta, Manolo

    2015-01-01

    Transplantation of dopamine- (DA-) rich foetal ventral mesencephalic cells emerged as a promising therapy for Parkinson's disease (PD), as it allowed significant improvement of motor symptoms in several PD patients in open-label studies. However, double-blind clinical trials have been largely disappointing. The general agreement in the field is that the lack of standardization of tissue collection and preparation, together with the absence of postsurgical immunosuppression, played a key role in the failure of these studies. Moreover, a further complication that emerged in previous studies is the appearance of the so-called graft-induced dyskinesia (GID), in a subset of grafted patients, which resembles dyskinesia induced by L-DOPA but in the absence of medication. Preclinical evidence pointed to the serotonin neurons as possible players in the appearance of GID. In agreement, clinical investigations have shown that grafted tissue may contain a large number of serotonin neurons, in the order of half of the DA cells; moreover, the serotonin 5-HT1A receptor agonist buspirone has been found to produce significant dampening of GID in grafted patients. In this paper, we will review the recent preclinical and clinical studies focusing on cell transplantation for PD and on the mechanisms underlying GID.

  6. Origin of enriched regulatory t cells in patients receiving combined kidney/bone marrow transplantation to induce transplantation tolerance.

    PubMed

    Sprangers, Ben; DeWolf, Susan; Savage, Thomas M; Morokata, Tatsuaki; Obradovic, Aleksandar; LoCascio, Samuel A; Shonts, Brittany; Zuber, Julien; Lau, Sai Ping; Shah, Ravi; Morris, Heather; Steshenko, Valeria; Zorn, Emmanuel; Preffer, Frederic I; Olek, Sven; Dombkowski, David M; Turka, Laurence A; Colvin, Robert; Winchester, Robert; Kawai, Tatsuo; Sykes, Megan

    2017-03-01

    We examined tolerance mechanisms in patients receiving HLA-mismatched combined kidney and bone marrow transplantation (CKBMT) that led to transient chimerism under a previously-published non-myeloablative conditioning regimen (Immune Tolerance Network study ITN036). Polychromatic flow cytometry (FCM) and high throughput sequencing of TCRβ hypervariable regions of DNA from peripheral blood T regulatory cells (Tregs) and CD4 non-Tregs revealed marked early enrichment of regulatory T cells (CD3(+) CD4(+) CD25(high) CD127(low) Foxp3(+) ) in blood that resulted from peripheral proliferation (Ki67(+) ), possibly new thymic emigration (CD31(+) ) and, in one tolerant subject, conversion from non-Tregs. Among recovering conventional T cells, central memory CD4(+) and CD8(+) cells predominated. A large fraction of the T cell clones detected in post-transplant biopsy specimens by TCR sequencing were detected in the peripheral blood and were not donor-reactive. Our results suggest that enrichment of Tregs by new thymic emigration and lymphopenia-driven peripheral proliferation in the early post-transplant period may contribute to tolerance following CKBMT. Furthermore, most conventional T cell clones detected in immunologically quiescent post-transplant biopsies appear to be circulating cells in the microvasculature rather than infiltrating T cells. This article is protected by copyright. All rights reserved.

  7. Steroid-induced femoral head osteonecrosis in immune thrombocytopenia treatment with osteochondral autograft transplantation.

    PubMed

    Fotopoulos, Vasileios Ch; Mouzopoulos, George; Floros, Themistoklis; Tzurbakis, Matthaios

    2015-09-01

    Osteonecrosis of the femoral head is a devastating complication of steroid administration and has rarely been observed in the treatment of immune thrombocytopenia. The treatment of osteochondral defects in advanced stages of avascular necrosis (AVN), characterized by collapse of the subchondral bone, remains an unsolved burden in orthopedic surgery. In this report, we present a case of a 19-year-old female that was admitted in the Emergency Department with walking disability and painful hip joint movement due to steroid-induced femoral head osteonecrosis. Two years before she was diagnosed with immune thrombocytopenia, for which she received pulse steroid therapy with high dose of dexamethasone and underwent a splenectomy. This case report is the first to describe the use of osteochondral autograft transplantation as a treatment of steroid-induced AVN of the femoral head due to immune thrombocytopenia at the age of 19 years with very good clinical and radiological results 3 years postoperatively.

  8. Amelioration of penetrating ballistic-like brain injury induced cognitive deficits after neuronal differentiation of transplanted human neural stem cells.

    PubMed

    Spurlock, Markus S; Ahmed, Aminul Islam; Rivera, Karla N; Yokobori, Shoji; Lee, Stephanie W; Sam, Pingdewinde N; Shear, Deborah A; Hefferan, Michael P; Hazel, Thomas G; Johe, Karl K; Gajavelli, Shyam; Tortella, Frank C; Bullock, Ross

    2017-03-01

    Penetrating traumatic brain injury (PTBI) is one of the major cause of death and disability worldwide. Previous studies in penetrating ballistic-like brain injury (PBBI), a PTBI rat model revealed widespread peri-lesional neurodegeneration, similar to that seen in humans following gunshot wound to head, which is unmitigated by any available therapies to date. Therefore, we evaluated human neural stem cell (hNSC) engraftment to putatively exploit the potential of cell therapy that has been seen in other central nervous system injury models. Towards this, green fluorescent protein (GFP) labeled hNSCs (400,000 per animal) were transplanted in immunosuppressed Sprague Dawley (SD), Fisher, and athymic (ATN) PBBI rats one week after injury. Tacrolimus (3mg/kg two days prior to transplantation, then 1mg/kg/day), Methylprednisolone (10mg/kg on day of transplant, 1mg/kg/week thereafter), and Mycophenolate mofetil (30mg/kg/day) for seven days following transplantation were used to confer immunosuppression. Engraftment in SD and ATN was comparable at 8-weeks post transplantation. Evaluation of hNSC differentiation and distribution revealed increased neuronal differentiation of transplanted cells with time. At 16-weeks post-transplantation neither cell proliferation nor glial lineage markers expression was detected. Transplanted cell morphology was similar to neighboring host neurons and there was relatively little migration of cells from the peri-transplant site. By 16 weeks, GFP positive processes extended both rostro-caudally and bilaterally into parenchyma, spreading along host white matter tracts, traversing internal capsule, extending ~13 mm caudally from transplantation site reaching into the brain stem. In a Morris water maze test at 8-weeks post-transplantation, animals with transplants had shorter latency to platform compared to vehicle treated animals. However, weak injury-induced cognitive deficits in the control group at the delayed time point confounded benefits

  9. Thoracic organ transplantation: laboratory methods.

    PubMed

    Patel, Jignesh K; Kobashigawa, Jon A

    2013-01-01

    Although great progress has been achieved in thoracic organ transplantation through the development of effective immunosuppression, there is still significant risk of rejection during the early post-transplant period, creating a need for routine monitoring for both acute antibody and cellular mediated rejection. The currently available multiplexed, microbead assays utilizing solubilized HLA antigens afford the capability of sensitive detection and identification of HLA and non-HLA specific antibodies. These assays are being used to assess the relative strength of donor specific antibodies; to permit performance of virtual crossmatches which can reduce the waiting time to transplantation; to monitor antibody levels during desensitization; and for heart transplants to monitor antibodies post-transplant. For cell mediated immune responses, the recent development of gene expression profiling has allowed noninvasive monitoring of heart transplant recipients yielding predictive values for acute cellular rejection. T cell immune monitoring in heart and lung transplant recipients has allowed individual tailoring of immunosuppression, particularly to minimize risk of infection. While the current antibody and cellular laboratory techniques have enhanced the ability to manage thoracic organ transplant recipients, future developments from improved understanding of microchimerism and graft tolerance may allow more refined allograft monitoring techniques.

  10. Pathogen Stimulation History Impacts Donor-Specific CD8(+) T Cell Susceptibility to Costimulation/Integrin Blockade-Based Therapy.

    PubMed

    Badell, I R; Kitchens, W H; Wagener, M E; Lukacher, A E; Larsen, C P; Ford, M L

    2015-12-01

    Recent studies have shown that the quantity of donor-reactive memory T cells is an important factor in determining the relative heterologous immunity barrier posed during transplantation. Here, we hypothesized that the quality of T cell memory also potently influences the response to costimulation blockade-based immunosuppression. Using a murine skin graft model of CD8(+) memory T cell-mediated costimulation blockade resistance, we elicited donor-reactive memory T cells using three distinct types of pathogen infections. Strikingly, we observed differential efficacy of a costimulation and integrin blockade regimen based on the type of pathogen used to elicit the donor-reactive memory T cell response. Intriguingly, the most immunosuppression-sensitive memory T cell populations were composed primarily of central memory cells that possessed greater recall potential, exhibited a less differentiated phenotype, and contained more multi-cytokine producers. These data, therefore, demonstrate that the memory T cell barrier is dependent on the specific type of pathogen infection via which the donor-reactive memory T cells are elicited, and suggest that the immune stimulation history of a given transplant patient may profoundly influence the relative barrier posed by heterologous immunity during transplantation.

  11. Rat Heterotopic Heart Transplantation Model to Investigate Unloading-Induced Myocardial Remodeling

    PubMed Central

    Fu, Xuebin; Segiser, Adrian; Carrel, Thierry P.; Tevaearai Stahel, Hendrik T.; Most, Henriette

    2016-01-01

    Unloading of the failing left ventricle in order to achieve myocardial reverse remodeling and improvement of contractile function has been developed as a strategy with the increasing frequency of implantation of left ventricular assist devices in clinical practice. But, reverse remodeling remains an elusive target, with high variability and exact mechanisms still largely unclear. The small animal model of heterotopic heart transplantation (hHTX) in rodents has been widely implemented to study the effects of complete and partial unloading on cardiac failing and non-failing tissue to better understand the structural and molecular changes that underlie myocardial recovery. We herein review the current knowledge on the effects of volume unloading the left ventricle via different methods of hHTX in rats, differentiating between changes that contribute to functional recovery and adverse effects observed in unloaded myocardium. We focus on methodological aspects of heterotopic transplantation, which increase the correlation between the animal model and the setting of the failing unloaded human heart. Last, but not least, we describe the late use of sophisticated techniques to acquire data, such as small animal MRI and catheterization, as well as ways to assess unloaded hearts under “reloaded” conditions. While giving regard to certain limitations, heterotopic rat heart transplantation certainly represents the crucial model to mimic unloading-induced changes in the heart and as such the intricacies and challenges deserve highest consideration. Careful translational research will further improve our knowledge of the reverse remodeling process and how to potentiate its effect in order to achieve recovery of contractile function in more patients. PMID:27807535

  12. Amelioration of Hyperbilirubinemia in Gunn Rats after Transplantation of Human Induced Pluripotent Stem Cell-Derived Hepatocytes

    PubMed Central

    Chen, Yong; Li, Yanfeng; Wang, Xia; Zhang, Wei; Sauer, Vanessa; Chang, Chan-Jung; Han, Bing; Tchaikovskaya, Tatyana; Avsar, Yesim; Tafaleng, Edgar; Madhusudana Girija, Sanal; Tar, Krisztina; Polgar, Zsuzsanna; Strom, Stephen; Bouhassira, Eric E.; Guha, Chandan; Fox, Ira J.; Roy-Chowdhury, Jayanta; Roy-Chowdhury, Namita

    2015-01-01

    Summary Hepatocyte transplantation has the potential to cure inherited liver diseases, but its application is impeded by a scarcity of donor livers. Therefore, we explored whether transplantation of hepatocyte-like cells (iHeps) differentiated from human induced pluripotent stem cells (iPSCs) could ameliorate inherited liver diseases. iPSCs reprogrammed from human skin fibroblasts were differentiated to iHeps, which were transplanted into livers of uridinediphosphoglucuronate glucuronosyltransferase-1 (UGT1A1)-deficient Gunn rats, a model of Crigler-Najjar syndrome 1 (CN1), where elevated unconjugated bilirubin causes brain injury and death. To promote iHep proliferation, 30% of the recipient liver was X-irradiated before transplantation, and hepatocyte growth factor was expressed. After transplantation, UGT1A1+ iHep clusters constituted 2.5%–7.5% of the preconditioned liver lobe. A decline of serum bilirubin by 30%–60% and biliary excretion of bilirubin glucuronides indicated that transplanted iHeps expressed UGT1A1 activity, a postnatal function of hepatocytes. Therefore, iHeps warrant further exploration as a renewable source of hepatocytes for treating inherited liver diseases. PMID:26074313

  13. Expression of hypoxia-inducible factor-1α and hepatocyte growth factor in development of fibrosis in the transplanted kidney.

    PubMed

    Kellenberger, Terese; Marcussen, Niels; Nyengaard, Jens R; Wogensen, Lise; Jespersen, Bente

    2015-02-01

    Late renal graft loss is associated with interstitial fibrosis. Hypoxia-inducible factor-1α (HIF-1α) is thought to facilitate fibrosis through interaction with TGF-β1, while hepatocyte growth factor (HGF) may act antifibrotic in the kidney allograft. The aim of this study was to investigate the expression of HIF-1α and HGF in protocol biopsies as possible prognostic biomarkers for renal fibrosis. Thirty-nine renal transplant recipients were included in the study. Protocol biopsies performed 1 and 2 years after transplantation were used for immunohistochemistry analysis. The correlation between HIF-1α/HGF and the Banff score was analysed. In addition, progression in renal fibrosis and graft survival among recipients with high or low expression of HIF-1α/HGF after transplantation was compared. There was no significant correlation between fibrosis and the HIF-1α expression 1 and 2 years after transplantation, but an inverse significant correlation between the HGF expression and the fibrosis score 1 year after transplantation was shown. Even when adjusting for human leucocyte antigen mismatches, there was a significant relationship between fibrosis and HGF expression. Graft survival was not significantly correlated to HIF-1α or HGF at 1 year, although the trend was towards better graft survival with high HGF. HGF may have antifibrotic effects in human renal transplants. (Central.Denmark.Region.Committee number: 1-10-72-318-13).

  14. Immune tolerance of mice allogenic tooth transplantation induced by immature dendritic cells

    PubMed Central

    Li, Wenying; Deng, Feng; Wang, Yu; Ma, Ce; Wang, Yurong

    2015-01-01

    As a common procedure in dentistry for replacing a missing tooth, allogenic tooth transplantation has encountered many difficulties in the clinical application because of immunological rejection. It is hypothesized that immature dendritic cell injection might be a potential alternative method to avoid or alleviate immunological rejection in allogenic tooth transplantation. To test this hypothesis, a mouse model of allogenic and autogeneic tooth transplantation was to established test the immunosuppressive effect of immature dendritic cells (imDCs) derived from donor bone marrows on transplant rejection in allogenic tooth transplantation. 2 × 106 imDCs generated with 50 U/ml GM-CSF were injected to each recipient mouse by two ways: tail vein injection 7 days before transplantation or regional dermal injection at day 0 and day 3 after transplantation. Groups of autogeneic tooth transplantation and allogenic tooth transplantation without any treatment were set as control groups. The effects were evaluated with histopathology and immunohistochemistry. We found there was no obvious rejection in autogeneic tooth transplantation group; tail intravenous injection group showed obviously alleviated rejection while local injection group and none-treatment allogenic tooth transplantation group both showed severe rejection. Our results suggested that the rejection of allogenic tooth transplantation could be alleviated by tail vein injection of donor bone marrow-derived imDCs though it could not be completely eliminated. The clinical application of imDCs in allogenic tooth transplantation still needs further deep research. PMID:26131099

  15. Intratracheal transplantation of endothelial progenitor cells attenuates smoking-induced COPD in mice

    PubMed Central

    Shi, Zhihui; Chen, Yan; Cao, Jun; Zeng, Huihui; Yang, Yue; Chen, Ping; Luo, Hong; Peng, Hong; Cai, Shan; Guan, Chaxiang

    2017-01-01

    Background Endothelial progenitor cells (EPCs) might play a protective role in COPD. The aim of this study was to investigate whether intratracheal allogeneic transplantation of bone-marrow-derived EPCs would attenuate the development of smoking-induced COPD in mice. Methods Isolated mononuclear cells from the bone marrow of C57BL/6J mice were cultured in endothelial cell growth medium-2 for 10 days, yielding EPCs. A murine model of COPD was established by passive 90-day exposure of cigarette smoke. On day 30, EPCs or phosphate-buffered saline alone was administered into the trachea. On day 90, EPCs or 30 μL phosphate-buffered saline alone was administered into the trachea, and on day 120, inflammatory cells, antioxidant activity, apoptosis, matrix metalloproteinase (MMP)-2, and MMP-9 were measured. Results After EPC treatment, the lung function of the mice had improved compared with the untreated mice. Mean linear intercept and destructive index were reduced in the EPCs-treated group compared with the untreated group. In addition, the EPCs-treated mice exhibited less antioxidant activity in bronchoalveolar lavage fluid compared with the untreated mice. Moreover, decreased activities of MMP-2, MMP-9, and TUNEL-positive cells in lung tissues were detected in EPCs-treated mice. Conclusion Intratracheal transplantation of EPCs attenuated the development of pulmonary emphysema and lung function disorder probably by alleviating inflammatory infiltration, decelerating apoptosis, inhibiting proteolytic enzyme activity, and improving antioxidant activity. PMID:28360519

  16. Minor histocompatibility antigens on transfused leukoreduced units of red blood cells induce bone marrow transplant rejection in a mouse model.

    PubMed

    Desmarets, Maxime; Cadwell, Chantel M; Peterson, Kenneth R; Neades, Renee; Zimring, James C

    2009-09-10

    When successful, human leukocyte antigen (HLA)-matched bone marrow transplantation with reduced-intensity conditioning is a cure for several nonmalignant hematologic disorders that require chronic transfusion, such as sickle cell disease and aplastic anemia. However, there are unusually high bone marrow transplant (BMT) rejection rates in these patients. Rejection correlates with the number of transfusions before bone marrow transplantation, and it has been hypothesized that preimmunization to antigens on transfused blood may prime BMT rejection. Using a novel mouse model of red blood cell (RBC) transfusion and major histocompatibility complex-matched bone marrow transplantation, we report that transfusion of RBC products induced BMT rejection across minor histocompatibility antigen (mHA) barriers. It has been proposed that contaminating leukocytes are responsible for transfusion-induced BMT rejection; however, filter leukoreduction did not prevent rejection in the current studies. Moreover, we generated a novel transgenic mouse with RBC-specific expression of a model mHA and demonstrated that transfusion of RBCs induced a CD8(+) T-cell response. Together, these data suggest that mHAs on RBCs themselves are capable of inducing BMT rejection. Cellular immunization to mHAs is neither monitored nor managed by current transfusion medicine practice; however, the current data suggest that mHAs on RBCs may represent an unappreciated and significant consequence of RBC transfusion.

  17. Improvement of Carbon Tetrachloride-Induced Acute Hepatic Failure by Transplantation of Induced Pluripotent Stem Cells without Reprogramming Factor c-Myc

    PubMed Central

    Chang, Hua-Ming; Liao, Yi-Wen; Chiang, Chih-Hung; Chen, Yi-Jen; Lai, Ying-Hsiu; Chang, Yuh-Lih; Chen, Hen-Li; Jeng, Shaw-Yeu; Hsieh, Jung-Hung; Peng, Chi-Hsien; Li, Hsin-Yang; Chien, Yueh; Chen, Szu-Yu; Chen, Liang-Kung; Huo, Teh-Ia

    2012-01-01

    The only curative treatment for hepatic failure is liver transplantation. Unfortunately, this treatment has several major limitations, as for example donor organ shortage. A previous report demonstrated that transplantation of induced pluripotent stem cells without reprogramming factor c-Myc (3-genes iPSCs) attenuates thioacetamide-induced hepatic failure with minimal incidence of tumorigenicity. In this study, we investigated whether 3-genes iPSC transplantation is capable of rescuing carbon tetrachloride (CCl4)-induced fulminant hepatic failure and hepatic encephalopathy in mice. Firstly, we demonstrated that 3-genes iPSCs possess the capacity to differentiate into hepatocyte-like cells (iPSC-Heps) that exhibit biological functions and express various hepatic specific markers. 3-genes iPSCs also exhibited several antioxidant enzymes that prevented CCl4-induced reactive oxygen species production and cell death. Intraperitoneal transplantation of either 3-genes iPSCs or 3-genes iPSC-Heps significantly reduced hepatic necrotic areas, improved hepatic functions, and survival rate in CCl4-treated mice. CCl4-induced hepatic encephalopathy was also improved by 3-genes iPSC transplantation. Hoechst staining confirmed the successful engraftment of both 3-genes iPSCs and 3-genes iPSC-Heps, indicating the homing properties of these cells. The most pronounced hepatoprotective effect of iPSCs appeared to originate from the highest antioxidant activity of 3-gene iPSCs among all transplanted cells. In summary, our findings demonstrated that 3-genes iPSCs serve as an available cell source for the treatment of an experimental model of acute liver diseases. PMID:22489170

  18. Bidirectional homeostatic plasticity induced by interneuron cell death and transplantation in vivo.

    PubMed

    Howard, MacKenzie Allen; Rubenstein, John L R; Baraban, Scott C

    2014-01-07

    Chronic changes in excitability and activity can induce homeostatic plasticity. These perturbations may be associated with neurological disorders, particularly those involving loss or dysfunction of GABA interneurons. In distal-less homeobox 1 (Dlx1(-/-)) mice with late-onset interneuron loss and reduced inhibition, we observed both excitatory synaptic silencing and decreased intrinsic neuronal excitability. These homeostatic changes do not fully restore normal circuit function, because synaptic silencing results in enhanced potential for long-term potentiation and abnormal gamma oscillations. Transplanting medial ganglionic eminence interneuron progenitors to introduce new GABAergic interneurons, we demonstrate restoration of hippocampal function. Specifically, miniature excitatory postsynaptic currents, input resistance, hippocampal long-term potentiation, and gamma oscillations are all normalized. Thus, in vivo homeostatic plasticity is a highly dynamic and bidirectional process that responds to changes in inhibition.

  19. Amlodipine-induced gingival overgrowth in a child after liver transplant

    PubMed Central

    Guollo, André; Vivas, Ana Paula Molina; Lopes, Rodrigo Nascimento; Porta, Gilda

    2016-01-01

    Drug-induced gingival overgrowth (GO) has been associated with phenytoin, cyclosporine, and calcium channel blocker therapies. This study reports the case of an 11-year-old girl who was referred for evaluation of GO, which had occurred over the last 6 months. Her medical history included a liver transplant due to biliary atresia 3 years ago, immunosuppressive therapy, and hypertension, which is why she was started on a daily intake of amlodipine. The intraoral examination showed generalized GO, and the treatment consisted of a gingivectomy. Subsequently, amlodipine was replaced with captopril and oral hygiene instructions. There was no recurrence of GO after 28 months of follow-up. Although GO may be related to the chronic use of amlodipine, such an association is uncommon in pediatrics, and the treatment consists of the replacement of medication combined with a surgical approach and plaque control. PMID:27818959

  20. Seasonal and pollution-induced variations in biomarkers of transplanted mussels within the Beagle Channel.

    PubMed

    Giarratano, Erica; Gil, Mónica N; Malanga, Gabriela

    2011-06-01

    The occurrence of biomarker variations linked to environmental factors makes it difficult to distinguish the effect of pollution. In an attempt to evaluate spatial and seasonal effects of environmental parameters on biomarker responses, mussels Mytilus edulis chilensis coming from an aquaculture farm were transplanted to several points within Ushuaia Bay (Beagle Channel) for 6 weeks in summer and winter. Activities of superoxide dismutase, catalase, glutathione-S-transferase and levels of lipid peroxidation were measured in gills and digestive gland. Cu, Zn, Fe, Cd and Pb concentrations were also assessed. Results indicated a significant effect of seasons on biological responses as well as in metal bioaccumulation showing the influence of natural factors such as dissolved oxygen, temperature and food availability. The interdependence of those environmental factors is important for the homeostasis of thermoconformers, especially regarding their oxidative metabolism and should also be taken into consideration to distinguish natural from pollution-induced variations.

  1. Substantial early loss of induced pluripotent stem cells following transplantation in myocardial infarction.

    PubMed

    Martens, Andreas; Rojas, Sebastian V; Baraki, Hassina; Rathert, Christian; Schecker, Natalie; Zweigerdt, Robert; Schwanke, Kristin; Rojas-Hernandez, Sara; Martin, Ulrich; Saito, Shunsuke; Schmitto, Jan D; Haverich, Axel; Kutschka, Ingo

    2014-11-01

    The limited success of cardiac stem cell therapy has lately generated discussion regarding its effectiveness. We hypothesized that immediate cell loss after intramyocardial injection significantly obscures the regenerative potential of stem cell therapy. Therefore, our aim was to assess the distribution and quantity of induced pluripotent stem cells after intramyocardial delivery using in vivo bioluminescence analysis. In this context, we wanted to investigate if the injection of different cell concentrations would exert influence on cardiac cell retention. Murine-induced pluripotent stem cells were transfected for luciferase reporter gene expression and transplanted into infarcted myocardium in mice after left anterior descending coronary artery ligation. Cells were delivered constantly in aqueous media (15 μL) in different cell concentrations (group A, n = 10, 5.0 × 10(5) cells; group B, n = 10, 1.0 × 10(6) cells). Grafts were detected using bioluminescence imaging. Organ explants were imaged 10 min after injection to quantify early cardiac retention and cell biodistribution. Bioluminescence imaging showed a massive early displacement from the injection site to the pulmonary circulation, leading to lung accumulation. Mean cell counts of explanted organs in group A were 7.51 × 10(4) ± 4.09 × 10(3) (heart), 6.44 × 10(4) ± 2.48 × 10(3) (left lung), and 8.06 × 10(5) ± 3.61 × 10(3) (right lung). Respective cell counts in group B explants were 1.69 × 10(5) ± 7.69 × 10(4) (heart), 2.11 × 10(5) ± 4.58 × 10(3) (left lung), and 3.25 × 10(5) ± 9.35 × 10(3) (right lung). Applying bioluminescence imaging, we could unveil and quantify massive early cardiac stem cell loss and pulmonary cell accumulation following intramyocardial injection. Increased injection concentrations led to much higher intracardiac cell counts; however, pulmonary biodistribution of transplanted cells still persisted. Therefore, we recommend applying tissue engineering techniques for

  2. Unique molecular changes in kidney allografts after simultaneous liver-kidney compared with solitary kidney transplantation.

    PubMed

    Taner, Timucin; Park, Walter D; Stegall, Mark D

    2017-02-20

    Kidney allografts transplanted simultaneously with liver allografts from the same donor are known to be immunologically privileged. This is especially evident in recipients with high levels of donor-specific anti-HLA antibodies. Here we investigated the mechanisms of liver's protective impact using gene expression in the kidney allograft. Select solitary kidney transplant or simultaneous liver-kidney transplant recipients were retrospectively reviewed and separated into four groups: 16 cross-match negative kidney transplants, 15 cross-match positive kidney transplants, 12 cross-match negative simultaneous liver-kidney transplants, and nine cross-match-positive simultaneous liver-kidney transplants. Surveillance biopsies of cross-match-positive kidney transplants had increased expression of genes associated with donor-specific antigens, inflammation, and endothelial cell activation compared to cross-match-negative kidney transplants. These changes were not found in cross-match-positive simultaneous liver-kidney transplant biopsies when compared to cross-match-negative simultaneous liver-kidney transplants. In addition, simultaneously transplanting a liver markedly increased renal expression of genes associated with tissue integrity/metabolism, regardless of the cross-match status. While the expression of inflammatory gene sets in cross-match-positive simultaneous liver-kidney transplants was not completely reduced to the level of cross-match-negative kidney transplants, the downstream effects of donor-specific anti-HLA antibodies were blocked. Thus, simultaneous liver-kidney transplants can have a profound impact on the kidney allograft, not only by decreasing inflammation and avoiding endothelial cell activation in cross-match-positive recipients, but also by increasing processes associated with tissue integrity/metabolism by unknown mechanisms.

  3. Allogenic iPSC-derived RPE cell transplants induce immune response in pigs: a pilot study.

    PubMed

    Sohn, Elliott H; Jiao, Chunhua; Kaalberg, Emily; Cranston, Cathryn; Mullins, Robert F; Stone, Edwin M; Tucker, Budd A

    2015-07-03

    Stem cell strategies focused on replacement of RPE cells for the treatment of geographic atrophy are under intense investigation. Although the eye has long been considered immune privileged, there is limited information about the immune response to transplanted cells in the subretinal space of large animals. The purpose of this study was to evaluate the survival of allogenic induced pluripotent stem cell-derived RPE cells (iPSC-RPE) delivered to the subretinal space of the pig as well as determine whether these cells induce an immune response in non-diseased eyes. GFP positive iPSC-RPE, generated from outbred domestic swine, were injected into the subretinal space of vitrectomized miniature swine. Control eyes received vehicle only. GFP positive iPSC-RPE cells were identified in the subretinal space 3 weeks after injection in 5 of 6 eyes. Accompanying GFP-negative cells positive for IgG, CD45 and macrophage markers were also identified in close proximity to the injected iPSC-RPE cells. All subretinal cells were negative for GFAP as well as cell cycle markers. We found that subretinal injection of allogenic iPSC-RPE cells into wild-type mini-pigs can induce the innate immune response. These findings suggest that immunologically matched or autologous donor cells should be considered for clinical RPE cell replacement.

  4. Autologous transplantation of intestine-isolated glia cells improves neuropathology and restores cognitive deficits in β amyloid-induced neurodegeneration.

    PubMed

    Esposito, Giuseppe; Sarnelli, Giovanni; Capoccia, Elena; Cirillo, Carla; Pesce, Marcella; Lu, Jie; Calì, Gaetano; Cuomo, Rosario; Steardo, Luca

    2016-03-04

    Alzheimer's disease (AD) is characterized by chronic deposition of β-amyloid (Aβ) in the brain, progressive neurodegeneration and consequent cognitive and behavioral deficits that typify the disease. Astrocytes are pivotal in this process because they are activated in the attempt to digest Aβ which starts a neuroinflammatory response that further contributes to neurodegeneration. The intestine is a good source of astrocytes-like cells-referred to as enteric glial cells (EGCs). Here we show that the autologous transplantation of EGCs into the brain of Aβ-injected rats arrested the development of the disease after their engraftment. Transplanted EGCs showed anti-amyloidogenic activity, embanked Aβ-induced neuroinflammation and neurodegeneration, and released neutrophic factors. The overall result was the amelioration of the pathological hallmarks and the cognitive and behavioral deficits typical of Aβ-associated disease. Our data indicate that autologous EGCs transplantation may provide an efficient alternative for applications in cell-replacement therapies to treat neurodegeneration in AD.

  5. Cardiac allograft acceptance after localized bone marrow transplantation by isolated limb perfusion in nonmyeloablated recipients.

    PubMed

    Askenasy, Nadir; Yolcu, Esma S; Shirwan, Haval; Wang, Zhiliang; Farkas, Daniel L; Yoleuk, Esma S

    2003-01-01

    Donor-specific tolerance to cardiac grafts may be induced by hematopoietic chimerism. This study evaluates the potential of localized bone marrow transplantation (BMT) performed by isolated limb (IL) perfusion to induce tolerance to secondary cardiac grafts without myeloablative conditioning. BALB/c recipients (H2d) preconditioned with lethal and sublethal doses of busulfan were injected i.v. and IL with 10(7) whole bone marrow cells (wBMCs) from B10 donors (H2(b)). Two hours after IL infusion of PKH-labeled wBMCs into myeloablated hosts, there were few labeled cells in the host peripheral blood (p < 0.001 versus i.v.) and femurs of the infused limb contained 57% +/- 7% PKH-labeled blasts (p < 0.001 versus 8% +/- 0.6% after i.v.). Femurs of the noninfused limbs contained 60-70 PKH-labeled blasts (p < 0.001 versus i.v.-BMT) after 2 days and 47% +/- 5% of 0.32 x 10(7) donor cells (p < 0.001 versus 78% +/- 4% of 1.2 x 10(7) donor cells in infused femurs) after 4 weeks. The survival rates of myeloablated hosts were 90% and 80% after i.v. and IL infusion, respectively, and the chimeras had 78%-84% donor peripheral blood cells. In recipients conditioned with 35 mg/g busulfan, the levels of donor chimerism in peripheral blood were 33% +/- 4% and 21% +/- 4% at 3 weeks after i.v.- and IL-BMT, respectively. Transplantation of donor-matched (H2(b)) secondary vascularized hearts in these chimeras after 3 weeks resulted in graft survival for periods exceeding 8 weeks, while third-party (H2(k)) allografts were acutely rejected (p < 0.001 versus H2(b)). These data indicate that IL perfusion is a reliable alternative procedure for establishment of hematopoietic chimerism and donor-specific tolerance without myeloablative conditioning.

  6. Activation and amplification of c-Ki-ras in a chemically induced transplantable human pancreas carcinoma

    SciTech Connect

    Parsa, I.; Maheshwari, K.K.

    1986-03-01

    Increasing evidence suggests that carcinogenesis is associated with the stepwise activation of oncogenes. The c-Ki-ras oncogene has been demonstrated in several human solid tumors and is shown to be amplified in tumor cell lines. The authors have probed endonuclease cleaved human pancreas (HP) DNAs and DNAs from an in vitro induced transplantable human pancreas carcinoma (HP-T1) for the presence and/or amplification of c-Ki-ras oncogene. The DNAs were cleaved with BamHI, BgIII, EcoRI, HhaI, HinfI, KpnI, PSTI, PvuII, SaII, SstI, TaqI or XbaI and were subjected to Southern blot analysis using /sup 32/P-labelled EcoRI fragments from HiHi3 clone. The hybridization profiles were similar in both DNAs when digested with BamHI, BgIII, HinfI, KpnI, SaII, SstI, or TaqI. The EcoRI cleaved DNAs from HP and HP-T1 revealed two hybridizing fragments of 6.8 and 3.0 kbp. The 3.0 kbp fragments in DNA from HP-T1 showed more than a 100 folds enhancement as compared to that of HP. The 6.8 hybridizing fragments also appeared 10 fold greater in HP-T1 DNA. Similar enhancements were also present in HP-T1 DNA cleaved with PstI and PvuII. Preliminary results from comparison of poly(A)/sup +/RNAs, prepared from total HP and HP-T1 RNAs, by Northern blot analysis using the same probe reflect similar enhancement in RNA from transplantable pancreas carcinoma.

  7. Kidney transplantation at the University of Pennsylvania: 1998-2008.

    PubMed

    Porrett, Paige M; Kamoun, Malek; Parsons, Ron; Bloom, Roy; Goral, Simin; Reese, Peter; Grossman, Robert; Baluarte, Jorge; Bleicher, Melissa; Doyle, Alden; Markmann, James F; Levine, Matt; Barker, Clyde; Olthoff, Kim; Naji, Ali; Shaked, Abraham; Abt, Peter

    2009-01-01

    Kidney transplantation at the University of Pennsylvania has grown substantially over the past 11 years. Although our transplant volume has increased primarily as a consequence of multiorgan transplants as well as the utilization of historically "marginal" allografts, our post-transplantation outcomes remain excellent in both children and adults. We attribute these outcomes to technical improvements in tissue typing and donor-recipient crossmatching, modification of immunosuppression protocols, and rigorous donor and recipient selection. In the next decade, we hope to substantially expand our living donor program and refine our overall donor and recipient selection process such that we maintain excellent post-transplant outcomes in the face of aging and increasingly comorbid donors and recipients. We further predict significant changes in post-transplant management of kidney recipients with respect to immunosuppression regimens. In particular, we anticipate the modulation of immunosuppression regimens in recipients with high titers of donor-specific antibody and the integration of B-cell specific immunosuppression into post-transplant patient care. Only time will tell whether such therapies will 1) improve long-term outcomes, 2) allow us to diminish the degree of non-specific pharmacologic immunosuppression currently in use, 3) or even promote donor-specific tolerance in kidney transplant recipients.

  8. Transfusion Induced Bone Marrow Transplant Rejection Due to Minor Histocompatibility Antigens

    PubMed Central

    Patel, Seema R; Zimring, James C

    2014-01-01

    Traditionally, alloimmunization to transfused blood products has focused exclusively upon recipient antibodies recognizing donor alloantigens present on the cell surface. Accordingly, the immunological sequelae of alloimmunization have been antibody mediated effects (i.e. hemolytic transfusion reactions, platelet refractoriness, anti-HLA and anti-HNA effects, etc.). However, in addition to the above sequelae, there is also a correlation between the number of antecedent transfusions in humans and the rate of bone marrow transplant (BMT) rejection - under reduced intensity conditioning with HLA matched or HLA identical marrow. BMT of this nature is the only existing cure for a series of non-malignant hematological diseases (e.g. sickle cell disease, thalassemias, etc.); however, rejection remains a clinical problem. It has been hypothesized that transfusion induces subsequent BMT rejection through immunization. Studies in animal models have observed the same effect and have demonstrated that transfusion induced BMT rejection can occur in response to alloimmunization. However, unlike traditional antibody responses, sensitization in this case results in cellular immune effects, involving populations such as T cell or NK cells. In this case, rejection occurs in the absence of alloantibodies, and would not be detected by existing immune-hematological methods. We review human and animal studies in light of the hypothesis that, for distinct clinical populations, enhanced rejection of BMT may be an unappreciated adverse consequence of transfusion which current blood bank methodologies are unable to detect. PMID:24090731

  9. Preclinical Studies of Induced Pluripotent Stem Cell-Derived Astrocyte Transplantation in ALS

    DTIC Science & Technology

    2012-10-01

    Pluripotent Stem Cell -Derived Astrocyte Transplantation in ALS PRINCIPAL INVESTIGATOR: Nicholas J. Maragakis, M.D...Pluripotent Stem Cell -Derived Astrocyte Transplantation in ALS 5b. GRANT NUMBER W81XWH-10-1-0520 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d...into astrocytes following transplantation. 15. SUBJECT TERMS Stem Cells , iPS cells , astrocytes, familial ALS 16. SECURITY CLASSIFICATION OF

  10. Correction of murine hemoglobinopathies by prenatal tolerance induction and postnatal nonmyeloablative allogeneic BM transplants.

    PubMed

    Peranteau, William H; Hayashi, Satoshi; Abdulmalik, Osheiza; Chen, Qiukan; Merchant, Aziz; Asakura, Toshio; Flake, Alan W

    2015-09-03

    Sickle cell disease (SCD) and thalassemias (Thal) are common congenital disorders, which can be diagnosed early in gestation and result in significant morbidity and mortality. Hematopoietic stem cell transplantation, the only curative therapy for SCD and Thal, is limited by the absence of matched donors and treatment-related toxicities. In utero hematopoietic stem cell transplantation (IUHCT) is a novel nonmyeloablative transplant approach that takes advantage of the immunologic immaturity and normal developmental properties of the fetus to achieve mixed allogeneic chimerism and donor-specific tolerance (DST). We hypothesized that a combined strategy of IUHCT to induce DST, followed by postnatal nonmyeloablative same donor "booster" bone marrow (BM) transplants in murine models of SCD and Thal would result in high levels of allogeneic engraftment and donor hemoglobin (Hb) expression with subsequent phenotypic correction of SCD and Thal. Our results show that: (1) IUHCT is associated with DST and low levels of allogeneic engraftment in the murine SCD and Thal models; (2) low-level chimerism following IUHCT can be enhanced to high-level chimerism and near complete Hb replacement with normal donor Hb with this postnatal "boosting" strategy; and (3) high-level chimerism following IUHCT and postnatal "boosting" results in phenotypic correction in the murine Thal and SCD models. This study supports the potential of IUHCT, combined with a postnatal nonmyelablative "boosting" strategy, to cure Thal and SCD without the toxic conditioning currently required for postnatal transplant regimens while expanding the eligible transplant patient population due to the lack of a restricted donor pool.

  11. Early acute antibody-mediated rejection of a negative flow crossmatch 3rd kidney transplant with exclusive disparity at HLA-DP.

    PubMed

    Mierzejewska, Beata; Schroder, Paul M; Baum, Caitlin E; Blair, Annette; Smith, Connie; Duquesnoy, Rene J; Marrari, Marilyn; Gohara, Amira; Malhotra, Deepak; Kaw, Dinkar; Liwski, Robert; Rees, Michael A; Stepkowski, Stanislaw

    2014-08-01

    Donor-specific alloantibodies (DSA) to HLA-DP may cause antibody-mediated rejection (AMR), especially in re-transplants. We describe the immunization history of a patient who received 3 kidney transplants; the 3rd kidney was completely matched except at DPA1 and DPB1. Prior to the 3rd transplant, single antigen bead analysis (SAB) showed DSA reactivity against DPA1 shared by the 1st and 3rd donors, but B and T flow crossmatch (FXM) results were negative. Within 11 days the 3rd transplant underwent acute C4d+ AMR which coincided with the presence of complement (C1q)-binding IgG1 DSA against donor DPA1 and DPB1. Using HLAMatchmaker and SAB, we provide evidence that eplet (epitope) spreading on DPA1 and eplet sharing on differing DPB1 alleles of the 1st and 3rd transplants was associated with AMR. Since weak DSA to DPA1/DPB1 may induce acute AMR with negative FXM, donor DPA1/DPB1 high resolution typing should be considered in sensitized patients with DP-directed DSA.

  12. Intestinal Transplant Inflammation: the Third Inflammatory Bowel Disease.

    PubMed

    Kroemer, Alexander; Cosentino, Christopher; Kaiser, Jason; Matsumoto, Cal S; Fishbein, Thomas M

    2016-11-01

    Intestinal transplantation is the most immunologically complex of all abdominal organ transplants. Understanding the role both humoral and innate and adaptive cellular immunity play in intestinal transplantation is critical to improving outcomes and increasing indications for patients suffering from intestinal failure. Recent findings highlighting the impact of donor-specific antibodies on intestinal allografts, the role of NOD2 as a key regulator of intestinal immunity, the protective effects of innate lymphoid cells, and the role of Th17 in acute cellular rejection are reviewed here.

  13. Transplantation of betatrophin-expressing adipose-derived mesenchymal stem cells induces β-cell proliferation in diabetic mice.

    PubMed

    Sun, Liang-Liang; Liu, Tian-Jin; Li, Limei; Tang, Wei; Zou, Jun-Jie; Chen, Xiang-Fang; Zheng, Jiao-Yang; Jiang, Bei-Ge; Shi, Yong-Quan

    2017-04-01

    Recent progress in regenerative medicine has suggested that mesenchymal stem cell (MSC)-based therapy is a novel potential cure for diabetes. Betatrophin is a newly identified hormone that can increase the production and expansion of insulin-secreting β-cells when administered to mice. In this study, we evaluated the effect of betatrophin overexpression by human adipose-derived MSCs (ADMSCs) by in vitro experiments, as well as following their transplantation into a mice with streptozotocin (STZ)-induced diabetes. The overexpression of betatrophin did not affect the ADMSCs in terms of proliferation, differentiation and morphology. However, the co-culture of human islets with ADMSCs overexpressing betatrophin (ADMSCs-BET) induced islet proliferation, β-cell specific transcription factor expression, and the islet production of insulin under the stimulation of glucose or KCl and Arg. In addition, ADMSCs-BET enhanced the anti-inflammatory and anti-apoptotic effects of the co-cultured islets compared with ADMSCs cultured alone. In mice with STZ-induced diabetes, the transplantation of ADMSCs-BET ameliorated the hyperglycemia and weight loss associated with STZ-induced diabetes; ADMSCs-BET also significantly enhanced the ratio of β-cells per islet compared to the transplantation of ADMSCs alone. Thus, our study demonstrates a novel strategy for inducing β-cell regeneration. ADMSCs-BET may replace insulin injections by increasing the number of endogenous insulin-producing cells in patients with diabetes. This combined strategy of ADMSC transplantation and gene therapy may prove to be a useful therapy for the treatment of diabetes.

  14. Transplantation of betatrophin-expressing adipose-derived mesenchymal stem cells induces β-cell proliferation in diabetic mice

    PubMed Central

    Sun, Liang-Liang; Liu, Tian-Jin; Li, Limei; Tang, Wei; Zou, Jun-Jie; Chen, Xiang-Fang; Zheng, Jiao-Yang; Jiang, Bei-Ge; Shi, Yong-Quan

    2017-01-01

    Recent progress in regenerative medicine has suggested that mesenchymal stem cell (MSC)-based therapy is a novel potential cure for diabetes. Betatrophin is a newly identified hormone that can increase the production and expansion of insulin-secreting β-cells when administered to mice. In this study, we evaluated the effect of betatrophin overexpression by human adipose-derived MSCs (ADMSCs) by in vitro experiments, as well as following their transplantation into a mice with streptozotocin (STZ)-induced diabetes. The overexpression of betatrophin did not affect the ADMSCs in terms of proliferation, differentiation and morphology. However, the co-culture of human islets with ADMSCs overexpressing betatrophin (ADMSCs-BET) induced islet proliferation, β-cell specific transcription factor expression, and the islet production of insulin under the stimulation of glucose or KCl and Arg. In addition, ADMSCs-BET enhanced the anti-inflammatory and anti-apoptotic effects of the co-cultured islets compared with ADMSCs cultured alone. In mice with STZ-induced diabetes, the transplantation of ADMSCs-BET ameliorated the hyperglycemia and weight loss associated with STZ-induced diabetes; ADMSCs-BET also significantly enhanced the ratio of β-cells per islet compared to the transplantation of ADMSCs alone. Thus, our study demonstrates a novel strategy for inducing β-cell regeneration. ADMSCs-BET may replace insulin injections by increasing the number of endogenous insulin-producing cells in patients with diabetes. This combined strategy of ADMSC transplantation and gene therapy may prove to be a useful therapy for the treatment of diabetes. PMID:28290605

  15. Cord blood transplantation in Japan.

    PubMed

    Uchida, Naoyuki

    2016-05-01

    Cord blood transplantation (CBT) has increasingly been used in Japan and the annual number of CBT now exceeds 1,200. The cumulative number of CBT reached 12,853 in 2015, accounting for almost 1/3 of total CBT performed worldwide. It is true that smaller body size and lower costs, as compared to western countries, have been advantages for Japanese people in using CB as graft alternative. In addition, several novel findings regarding serious issues following CBT have been obtained, which further enhanced the use of CB. First, several mechanisms of engraftment failure following CBT other than cell dose have been reported, such as the presence of donor-specific anti-HLA antibodies or the development of hemophagocytic syndrome. Second, unique profiles of infectious complications following CBT have been reported, such as higher incidences of early bacterial infections and HHV-6 encephalitis, as compared to those following bone marrow (BM)/peripheral blood (PB) transplants. Third, the incidence of disease relapse was comparable to those following BM/PB transplants. Novel pre-transplant conditioning regimens using intravenous busulfan have been investigated with promising results being obtained to date. A recent analysis of Japanese transplant registry data revealed similar survival following CBT to HLA-matched unrelated BM/PB transplants.

  16. Unraveling the Role of Allo-Antibodies and Transplant Injury

    PubMed Central

    Matsuda, Yoshiko; Sarwal, Minnie M.

    2016-01-01

    Alloimmunity driving rejection in the context of solid organ transplantation can be grossly divided into mechanisms predominantly driven by either T cell-mediated rejection (TCMR) and antibody-mediated rejection (ABMR), though the co-existence of both types of rejections can be seen in a variable number of sampled grafts. Acute TCMR can generally be well controlled by the establishment of effective immunosuppression (1, 2). Acute ABMR is a low frequency finding in the current era of blood group and HLA donor/recipient matching and the avoidance of engraftment in the context of high-titer, preformed donor-specific antibodies. However, chronic ABMR remains a major complication resulting in the untimely loss of transplanted organs (3–10). The close relationship between donor-specific antibodies and ABMR has been revealed by the highly sensitive detection of human leukocyte antigen (HLA) antibodies (7, 11–15). Injury to transplanted organs by activation of humoral immune reaction in the context of HLA identical transplants and the absence of donor specific antibodies (17–24), strongly suggest the participation of non-HLA (nHLA) antibodies in ABMR (25). In this review, we discuss the genesis of ABMR in the context of HLA and nHLA antibodies and summarize strategies for ABMR management. PMID:27818660

  17. Liver transplant

    MedlinePlus

    Hepatic transplant; Transplant - liver; Orthotopic liver transplant; Liver failure - liver transplant; Cirrhosis - liver transplant ... The donated liver may be from: A donor who has recently died and has not had liver injury. This type of ...

  18. Parvovirus B 19 (PVB19) induced pure red cell aplasia (PRCA) in immunocompromised patient after liver transplantation.

    PubMed

    Mrzljak, Anna; Kardum-Skelin, Ika; Cvrlje, Vesna Colić; Kanizaj, Tajana Filipec; Sustercić, Dunja; Gustin, Denis; Kocman, Branislav

    2010-03-01

    Presented here is a case of human parvovirus B19 (PVB19) induced pure red-cell aplasia (PRCA) in immunocompromised patient after orthotopic liver transplantation (OLT). PVB19 is a small, single-stranded DNA whose target cell is the erythroid progenitor in bone marrow. Manifestations of PVB19 infection vary with the immunologic status of the patient, ranging from asymptomatic to severe infections and PRCA. Post-transplant PRCA is induced either by immunosuppressive agents or PVB19. In the presented case, bone marrow aspiration characterized by the absence of mature erythroid precursors and detection of PVB19 DNA in blood led to treatment with high-dose intravenous human immunoglobulins (IVIG) and subsequent recovery of erythropoiesis. Due to insufficient antibody response in immunocompromised patients, suppression of the PVB19 infection is delayed and repetitive treatments may be administrated in attempt of reversing PRCA.

  19. Transplantation of Embryonic and Induced Pluripotent Stem Cell-Derived 3D Retinal Sheets into Retinal Degenerative Mice

    PubMed Central

    Assawachananont, Juthaporn; Mandai, Michiko; Okamoto, Satoshi; Yamada, Chikako; Eiraku, Mototsugu; Yonemura, Shigenobu; Sasai, Yoshiki; Takahashi, Masayo

    2014-01-01

    Summary In this article, we show that mouse embryonic stem cell- or induced pluripotent stem cell-derived 3D retinal tissue developed a structured outer nuclear layer (ONL) with complete inner and outer segments even in an advanced retinal degeneration model (rd1) that lacked ONL. We also observed host-graft synaptic connections by immunohistochemistry. This study provides a “proof of concept” for retinal sheet transplantation therapy for advanced retinal degenerative diseases. PMID:24936453

  20. Zhichan decoction induces differentiation of dopaminergic neurons in Parkinson's disease rats after neural stem cell transplantation

    PubMed Central

    Shi, Huifen; Song, Jie; Yang, Xuming

    2014-01-01

    The goal of this study was to increase the dopamine content and reduce dopaminergic metabolites in the brain of Parkinson's disease rats. Using high-performance liquid chromatography, we found that dopamine and dopaminergic metabolite (dihydroxyphenylacetic acid and homovanillic acid) content in the midbrain of Parkinson's disease rats was increased after neural stem cell transplantation + Zhichan decoction, compared with neural stem cell transplantation alone. Our genetic algorithm results show that dihydroxyphenylacetic acid and homovanillic acid levels achieve global optimization. Neural stem cell transplantation + Zhichan decoction increased dihydroxyphenylacetic acid levels up to 10-fold, while transplantation alone resulted in a 3-fold increment. Homovanillic acid levels showed no apparent change. Our experimental findings show that after neural stem cell transplantation in Parkinson's disease rats, Zhichan decoction can promote differentiation of neural stem cells into dopaminergic neurons. PMID:25206914

  1. Immune response to uv-induced tumors: transplantation immunity and lymphocyte populations exhibiting anti-tumor activity

    SciTech Connect

    Streeter, P.R.

    1985-01-01

    Ultraviolet light-induced murine skin tumors were analyzed for their ability to induce tumor-specific and cross-protective transplantation immunity in immunocompetent syngeneic mice. These studies revealed that progressor UV-tumors, like regressor UV-tumors, possess tumor-specific transplantation antigens. Cross-protective transplantation immunity to UV-tumors, however, was associated with sensitization to the serum used to culture the tumor lines rather than to cross-reactive or common determinants on UV-tumors. An analysis of the cytolytic activity of lymphocytes from the spleens of mice immunized with either regressor or progressor UV-tumors revealed a striking difference between the two immune splenocyte populations. From regressor tumor-immune animals, cytolytic T (Tc) lymphocytes with specificity for the immunizing tumor were found. However, the analysis of splenic lymphocytes from progressor tumor immune animals revealed no such effector cells. To more effectively examine those lymphocytes exhibiting cytolytic activity in vitro, T lymphocyte cloning technology was used as a means of isolating homogeneous lymphocyte populations with the effector activities described above. The mechanisms where NK cells and other nonspecific effector cells could be induced in tumor-immune animals are discussed in the context of class II restricted immune responses.

  2. Genetic disassociation of autoimmunity and resistance to costimulation blockade-induced transplantation tolerance in nonobese diabetic mice.

    PubMed

    Pearson, Todd; Markees, Thomas G; Serreze, David V; Pierce, Melissa A; Marron, Michele P; Wicker, Linda S; Peterson, Laurence B; Shultz, Leonard D; Mordes, John P; Rossini, Aldo A; Greiner, Dale L

    2003-07-01

    Curing type 1 diabetes by islet transplantation requires overcoming both allorejection and recurrent autoimmunity. This has been achieved with systemic immunosuppression, but tolerance induction would be preferable. Most islet allotransplant tolerance induction protocols have been tested in nonobese diabetic (NOD) mice, and most have failed. Failure has been attributed to the underlying autoimmunity, assuming that autoimmunity and resistance to transplantation tolerance have a common basis. Out of concern that NOD biology could be misleading in this regard, we tested the hypothesis that autoimmunity and resistance to transplantation tolerance in NOD mice are distinct phenotypes. Unexpectedly, we observed that (NOD x C57BL/6)F(1) mice, which have no diabetes, nonetheless resist prolongation of skin allografts by costimulation blockade. Further analyses revealed that the F(1) mice shared the dendritic cell maturation defects and abnormal CD4(+) T cell responses of the NOD but had lost its defects in macrophage maturation and NK cell activity. We conclude that resistance to allograft tolerance induction in the NOD mouse is not a direct consequence of overt autoimmunity and that autoimmunity and resistance to costimulation blockade-induced transplantation tolerance phenotypes in NOD mice can be dissociated genetically. The outcomes of tolerance induction protocols tested in NOD mice may not accurately predict outcomes in human subjects.

  3. Inhibition of inducible nitric oxide synthase prevents graft injury after transplantation of livers from rats after cardiac death.

    PubMed

    Shi, Yanjun; Rehman, Hasibur; Wright, Gary L; Zhong, Zhi

    2010-11-01

    This study investigated the roles of inducible nitric oxide synthase (iNOS) in the failure of rat liver grafts from cardiac death donors (GCDD). Livers were explanted after 30-minute aorta clamping and implanted after 4-hour storage in University of Wisconsin solution. The iNOS expression increased slightly in grafts from non-cardiac death donors (GNCDD) but markedly in GCDD. Serum nitrite and nitrate and hepatic 3-nitrotyrosine adducts, indicators of NO and peroxynitrite production, respectively, were substantially higher after transplantation of GCDD than GNCDD. Production of reactive nitrogen species (RNS) was largely blocked by 1400W (N-[1-naphthyl]ethylenediamine dihydrochloride; 5 μM), a specific iNOS inhibitor. Alanine aminotransferase release, bilirubin, necrosis, and apoptosis were 6.4-fold, 6.5-fold, 2.3-fold, and 2.7-fold higher, respectively, after transplantation of GCDD than GNCDD. The inhibitor 1400W effectively blocked these alterations and also increased survival of GCDD to 80% from 33%. Increased RNS production and failure of GCDD were associated with activation of c-Jun-N-terminal kinase (JNK), an effect that was blocked by inhibition of iNOS. Inhibition of JNK also improved the outcome after transplantation of GCDD. Together, the data indicate that iNOS increases substantially in GCDD, leading to RNS overproduction, JNK activation, and more severe graft injury. Inhibitors of iNOS are suggested as effective therapies to improve the outcome after transplantation of GCDD.

  4. Neonatal testicular cell transplantation restores murine spermatogenesis damaged in the course of herpes simplex virus-induced orchitis.

    PubMed

    Malolina, Ekaterina A; Kulibin, Andrey Yu; Kushch, Alla A

    2016-04-01

    Genital tract infection and inflammation may affect male fertility, causing germ and Sertoli cell loss. We determined if testicular cell transplantation is effective at repairing testicular injury induced by herpes simplex virus (HSV) orchitis. ROSA26 mice were used as donors and the recipients were C57BL/6 mice after HSV testicular inoculation; some of the recipients were treated with the antiviral drug acyclovir (ACV). ACV reduced the amount of HSV antigen in testes on Day 3 after transplantation and enhanced the efficacy of transplantation at Day 30. In recipient testes, donor Sertoli cells formed new seminiferous tubules; significantly more new tubules were observed in the testes of ACV-treated mice compared with mice not treated with ACV (17.8% vs 3.6%). Over half (50.4%) of new tubules in ACV-treated testes contained germ cells and round spermatids were detected in 14.2% of new tubules compared with 15.9% and 5.3% in testes not treated with ACV, respectively. At Day 150 the seminiferous epithelium was completely recovered in some donor tubules and elongated spermatids were observed inside it. Thus, our findings reveal the effectiveness of the combination of antiviral therapy with neonatal testis-cell transplantation for the restoration of spermatogenesis damaged by viral infection.

  5. Mesenchymal stromal-cell transplants induce oligodendrocyte progenitor migration and remyelination in a chronic demyelination model.

    PubMed

    Jaramillo-Merchán, J; Jones, J; Ivorra, J L; Pastor, D; Viso-León, M C; Armengól, J A; Moltó, M D; Geijo-Barrientos, E; Martínez, S

    2013-08-29

    Demyelinating disorders such as leukodystrophies and multiple sclerosis are neurodegenerative diseases characterized by the progressive loss of myelin that may lead toward a chronic demyelination of the brain's white matter, impairing normal axonal conduction velocity and ultimately causing neurodegeneration. Current treatments modifying the pathological mechanisms are capable of ameliorating the disease; however, frequently, these therapies are not sufficient to repress the progressive demyelination into a chronic condition and permanent loss of function. To this end, we analyzed the effect that bone marrow-derived mesenchymal stromal cell (BM-MSC) grafts exert in a chronically demyelinated mouse brain. As a result, oligodendrocyte progenitors were recruited surrounding the graft due to the expression of various trophic signals by the grafted MSCs. Although there was no significant reaction in the non-grafted side, in the grafted regions oligodendrocyte progenitors were detected. These progenitors were derived from the nearby tissue as well as from the neurogenic niches, including the subependymal zone and dentate gyrus. Once near the graft site, the cells matured to myelinating oligodendrocytes. Finally, electrophysiological studies demonstrated that axonal conduction velocity was significantly increased in the grafted side of the fimbria. In conclusion, we demonstrate here that in chronic demyelinated white matter, BM-MSC transplantation activates oligodendrocyte progenitors and induces remyelination in the tissue surrounding the stem cell graft.

  6. Mesenchymal stromal-cell transplants induce oligodendrocyte progenitor migration and remyelination in a chronic demyelination model

    PubMed Central

    Jaramillo-Merchán, J; Jones, J; Ivorra, J L; Pastor, D; Viso-León, M C; Armengól, J A; Moltó, M D; Geijo-Barrientos, E; Martínez, S

    2013-01-01

    Demyelinating disorders such as leukodystrophies and multiple sclerosis are neurodegenerative diseases characterized by the progressive loss of myelin that may lead toward a chronic demyelination of the brain's white matter, impairing normal axonal conduction velocity and ultimately causing neurodegeneration. Current treatments modifying the pathological mechanisms are capable of ameliorating the disease; however, frequently, these therapies are not sufficient to repress the progressive demyelination into a chronic condition and permanent loss of function. To this end, we analyzed the effect that bone marrow-derived mesenchymal stromal cell (BM-MSC) grafts exert in a chronically demyelinated mouse brain. As a result, oligodendrocyte progenitors were recruited surrounding the graft due to the expression of various trophic signals by the grafted MSCs. Although there was no significant reaction in the non-grafted side, in the grafted regions oligodendrocyte progenitors were detected. These progenitors were derived from the nearby tissue as well as from the neurogenic niches, including the subependymal zone and dentate gyrus. Once near the graft site, the cells matured to myelinating oligodendrocytes. Finally, electrophysiological studies demonstrated that axonal conduction velocity was significantly increased in the grafted side of the fimbria. In conclusion, we demonstrate here that in chronic demyelinated white matter, BM-MSC transplantation activates oligodendrocyte progenitors and induces remyelination in the tissue surrounding the stem cell graft. PMID:23990019

  7. Defining the optimal window for cranial transplantation of human induced pluripotent stem cell-derived cells to ameliorate radiation-induced cognitive impairment.

    PubMed

    Acharya, Munjal M; Martirosian, Vahan; Christie, Lori-Ann; Riparip, Lara; Strnadel, Jan; Parihar, Vipan K; Limoli, Charles L

    2015-01-01

    Past preclinical studies have demonstrated the capability of using human stem cell transplantation in the irradiated brain to ameliorate radiation-induced cognitive dysfunction. Intrahippocampal transplantation of human embryonic stem cells and human neural stem cells (hNSCs) was found to functionally restore cognition in rats 1 and 4 months after cranial irradiation. To optimize the potential therapeutic benefits of human stem cell transplantation, we have further defined optimal transplantation windows for maximizing cognitive benefits after irradiation and used induced pluripotent stem cell-derived hNSCs (iPSC-hNSCs) that may eventually help minimize graft rejection in the host brain. For these studies, animals given an acute head-only dose of 10 Gy were grafted with iPSC-hNSCs at 2 days, 2 weeks, or 4 weeks following irradiation. Animals receiving stem cell grafts showed improved hippocampal spatial memory and contextual fear-conditioning performance compared with irradiated sham-surgery controls when analyzed 1 month after transplantation surgery. Importantly, superior performance was evident when stem cell grafting was delayed by 4 weeks following irradiation compared with animals grafted at earlier times. Analysis of the 4-week cohort showed that the surviving grafted cells migrated throughout the CA1 and CA3 subfields of the host hippocampus and differentiated into neuronal (∼39%) and astroglial (∼14%) subtypes. Furthermore, radiation-induced inflammation was significantly attenuated across multiple hippocampal subfields in animals receiving iPSC-hNSCs at 4 weeks after irradiation. These studies expand our prior findings to demonstrate that protracted stem cell grafting provides improved cognitive benefits following irradiation that are associated with reduced neuroinflammation.

  8. Photoreceptor transplantation in inherited and environmentally induced retinal degeneration: anatomy, immunohistochemistry and function.

    PubMed

    Silverman, M S; Hughes, S E

    1989-01-01

    In conclusion, we have shown that photoreceptors can be transplanted to retina in which the host's photoreceptors are lost by environmental (constant light) or inherited deficits. Furthermore transplanted photoreceptor cells maintain basic characteristics of normal photoreceptor cells by producing opsin and maintaining an intercellular organization and apposition to the host retina that is similar to that seen in the normal outer nuclear layer. To accomplish this we have devised a method to isolate the intact photoreceptor layer. This is significant because it will be necessary to maintain tight matrix organization if coherent vision is to be restored to the retina compromised by the loss of photoreceptors. We have further developed a surgical approach which minimizes trauma to the eye and allows controlled positioning of sheets of transplanted photoreceptors to their homotopic location within the eye. In addition these methods for transplantation and isolation of photoreceptors could be utilized to prepare and transplant other retinal layers so that selected populations of retinal cells can be used in other neurobiological investigations. Photoreceptors can be transplanted when developing or when mature. Not only can mature rat photoreceptors can be transplanted, but we have shown that mature photoreceptors from human donors can be transplanted as well. This is significantly different from neurons which must be immature in order to be transplanted. At present the reason for this difference is not known but has obvious importance for retinal and neural transplantation research in general. Finally, we have shown that transplanted photoreceptors activate the host's dystrophic retina in a light dependent manner that closely resembles the activation pattern seen in normal retina. This finding taken together with our results showing that human photoreceptors can be transplanted presents the possibility that some forms of human blindness might eventually be ameliorated

  9. Extent of pre-operative L-DOPA-induced dyskinesia predicts the severity of graft-induced dyskinesia after fetal dopamine cell transplantation.

    PubMed

    García, Joanna; Carlsson, Thomas; Döbrössy, Máté; Nikkhah, Guido; Winkler, Christian

    2011-12-01

    Graft-induced dyskinesia has emerged as a problematic side effect after transplantation of fetal dopamine cells into the striatum of patients with Parkinson's disease. These adverse effects of dystonic and choreatiform hyperkinesias that persisted even after withdrawal of L-DOPA medication are not yet fully understood, which poses a main obstacle for the re-initiation of neural transplantation in Parkinson's disease. The severity of pre-operative L-DOPA-induced dyskinesia has been proposed as one of several parameters influencing the development of graft-induced dyskinesia. We have therefore characterized graft-induced dyskinesia in the rat model of Parkinson's disease in animals with either mild or severe pre-operative L-DOPA-induced dyskinesia. We show that animals with intrastriatal grafts of fetal dopamine cells and severe pre-operative L-DOPA-induced dyskinesia will reduce their L-DOPA-induced dyskinesia scores by more than 75% but at the same time develop graft-induced dyskinesia of intermediate to strong severity. In contrast, animals with dopamine grafts of similar size but only mild pre-operative L-DOPA-induced dyskinesia also developed graft-induced dyskinesia but this was very mild and of intermediate severity only in a single animal. Severity of pre-operative L-DOPA-induced dyskinesia was correlated with the severity of graft-induced dyskinesia. Our data suggest that patients with no or only mild L-DOPA-induced dyskinesia may carry a lower risk for the development of graft-induced dyskinesia and therefore are better candidates to receive intracerebral grafts of fetal dopamine cells as compared to patients with more pronounced L-DOPA-induced dyskinesia.

  10. Induction of antinuclear antibodies by de novo autoimmune hepatitis regulates alloimmune responses in rat liver transplantation.

    PubMed

    Nakano, Toshiaki; Goto, Shigeru; Lai, Chia-Yun; Hsu, Li-Wen; Tseng, Hui-Peng; Chen, Kuang-Den; Chiu, King-Wah; Wang, Chih-Chi; Cheng, Yu-Fan; Chen, Chao-Long

    2013-01-01

    Concanavalin A (Con A) is a lectin originating from the jack-bean and well known for its ability to stimulate T cells and induce autoimmune hepatitis. We previously demonstrated the induction of immunosuppressive antinuclear autoantibody in the course of Con A-induced transient autoimmune hepatitis. This study aimed to clarify the effects of Con A-induced hepatitis on liver allograft rejection and acceptance. In this study, we observed the unique phenomenon that the induction of transient de novo autoimmune hepatitis by Con A injection paradoxically overcomes the rejection without any immunosuppressive drug and exhibits significantly prolonged survival after orthotopic liver transplantation (OLT). Significantly increased titers of anti-nuclear Abs against histone H1 and high-mobility group box 1 (HMGB1) and reduced donor specific alloantibody response were observed in Con A-injected recipients. Induction of Foxp3 and IL-10 in OLT livers of Con A-injected recipients suggested the involvement of regulatory T cells in this unique phenomenon. Our present data suggest the significance of autoimmune responses against nuclear histone H1 and HMGB1 for competing allogeneic immune responses, resulting in the acceptance of liver allografts in experimental liver transplantation.

  11. Role of endothelial-to-mesenchymal transition induced by TGF-β1 in transplant kidney interstitial fibrosis.

    PubMed

    Wang, Zijie; Han, Zhijian; Tao, Jun; Wang, Jun; Liu, Xuzhong; Zhou, Wanli; Xu, Zhen; Zhao, Chunchun; Wang, Zengjun; Tan, Ruoyun; Gu, Min

    2017-04-04

    Chronic allograft dysfunction (CAD) induced by kidney interstitial fibrosis is the main cause of allograft failure in kidney transplantation. Endothelial-to-mesenchymal transition (EndMT) may play an important role in kidney fibrosis. We, therefore, undertook this study to characterize the functions and potential mechanism of EndMT in transplant kidney interstitial fibrosis. Proteins and mRNAs associated with EndMT were examined in human umbilical vein endothelial cells (HUVECs) treated with transforming growth factor-beta1 (TGF-β1) at different doses or at different intervals with western blotting, qRT-PCR and ELISA assays. Cell motility and migration were evaluated with motility and migration assays. The mechanism of EndMT induced by TGF-β1 was determined by western blotting analysis of factors involved in various canonical and non-canonical pathways. In addition, human kidney tissues from control and CAD group were also examined for these proteins by HE, Masson's trichrome, immunohistochemical, indirect immunofluorescence double staining and western blotting assays. TGF-β1 significantly promoted the development of EndMT in a time-dependent and dose-dependent manner and promoted the motility and migration ability of HUVECs. The TGF-β/Smad and Akt/mTOR/p70S6K signalling pathways were found to be associated with the pathogenesis of EndMT induced by TGF-β1, which was also proven in vivo by the analysis of specimens from the control and CAD groups. EndMT may promote transplant kidney interstitial fibrosis by targetting the TGF-β/Smad and Akt/mTOR/p70S6K signalling pathways, and hence, result in the development of CAD in kidney transplant recipients.

  12. Bone marrow transplant

    MedlinePlus

    Transplant - bone marrow; Stem cell transplant; Hematopoietic stem cell transplant; Reduced intensity nonmyeloablative transplant; Mini transplant; Allogenic bone marrow transplant; Autologous bone marrow transplant; ...

  13. Treatment with sirolimus ameliorates tacrolimus-induced autoimmune cytopenias after solid organ transplant.

    PubMed

    Teachey, David T; Jubelirer, Tracey; Baluarte, H Jorge; Wade, Amanda; Manno, Catherine S

    2009-12-01

    The development of autoimmune blood cell cytopenias is a potentially life-threatening complication of solid organ transplantation, resulting from T-cell dysregulation from immunosuppressive medications. Conventional treatment with corticosteroids and IVIgG is often unsuccessful as these therapies are unlikely to overcome the T-cell dysregulation. We describe two patients who developed severe autoimmune cytopenias after solid organ transplantation. They had limited response to conventional medications, but had complete resolution of autoimmunity upon transition of immunosuppression from tacrolimus to sirolimus. Altering the immunosuppressive regimen to modify T-cell dysregulation may be beneficial for patients who develop post-transplant autoimmune disease and allow continued preservation of allograft.

  14. Contrast-induced acute kidney injury in kidney transplant recipients: A systematic review and meta-analysis

    PubMed Central

    Cheungpasitporn, Wisit; Thongprayoon, Charat; Mao, Michael A; Mao, Shennen A; D'Costa, Matthew R; Kittanamongkolchai, Wonngarm; Kashani, Kianoush B

    2017-01-01

    AIM To evaluate the incidence of contrast-induced acute kidney injury (CIAKI) in kidney transplant recipients. METHODS A literature search was performed using MEDLINE, EMBASE, and the Cochrane Database of Systematic Reviews from the inception of the databases through July 2016. Studies assessing the incidence of CIAKI in kidney transplant recipients were included. We applied a random-effects model to estimate the incidence of CIAKI. RESULTS Six studies of 431 kidney transplant recipients were included in the analyses to assess the incidence of CIAKI in kidney transplant recipients. The estimated incidence of CIAKI and CIAKI-requiring dialysis were 9.6% (95%CI: 4.5%-16.3%) and 0.4% (95%CI: 0.0%-1.2%), respectively. A sensitivity analysis limited only to the studies that used low-osmolar or iso-osmolar contrast showed the estimated incidence of CIAKI was 8.0% (95%CI: 3.5%-14.2%). The estimated incidences of CIAKI in recipients who received contrast media with cardiac catheterization, other types of angiogram, and CT scan were 16.1% (95%CI: 6.6%-28.4%), 10.1% (95%CI: 4.2%-18.0%), and 6.1% (95%CI: 1.8%-12.4%), respectively. No graft losses were reported within 30 d post-contrast media administration. However, data on the effects of CIAKI on long-term graft function were limited. CONCLUSION The estimated incidence of CIAKI in kidney transplant recipients is 9.6%. The risk stratification should be considered based on allograft function, indication, and type of procedure. PMID:28280699

  15. Osteogenic Effects of Dedifferentiated Fat Cell Transplantation in Rabbit Models of Bone Defect and Ovariectomy-Induced Osteoporosis

    PubMed Central

    Kikuta, Shinsuke; Tanaka, Nobuaki; Kazama, Tomohiko; Kazama, Minako; Kano, Koichiro; Ryu, Junnosuke; Tokuhashi, Yasuaki

    2013-01-01

    We have previously reported that mature adipocyte-derived dedifferentiated fat (DFAT) cells have a high proliferative activity and the potential to differentiate into lineages of mesenchymal tissue similar to bone marrow mesenchymal stem cells (MSCs). In the present study, we examined the effects of autologous DFAT cell transplantation on bone regeneration in a rabbit bone defect model and an ovariectomy (OVX)-induced osteoporosis model. The formation of tissue-engineered bone (TEB) was observed when rabbit DFAT cells were loaded onto a β-tricalcium phosphate (TCP)/collagen sponge and cultured in an osteogenic differentiation medium for 3 weeks. Autologous implantation of DFAT cell-mediated TEB constructs promoted bone regeneration in a rabbit tibial defect model. Regenerated bone tissue induced by transplantation of DFAT cell-mediated TEB constructs was histologically well differentiated and exhibited higher bone strength in a three-point bending test compared to that induced by the β-TCP/collagen sponge alone. In OVX-induced osteoporosis model rabbits, DFAT cells were obtained with the osteogenic activity similar to cells from healthy rabbits. Intrabone marrow injection of autologous DFAT cells significantly increased the bone mineral density (BMD) at the injected site in the OVX rabbits. Transplanted DFAT cells remained mainly on the injection side of the bone marrow by at least 28 days after intrabone marrow injection and a part of them expressed osteocalcin. In conclusion, these results demonstrate that autologous implantation of DFAT cells contributed to bone regeneration in a rabbit bone defect model and an OVX-induced osteoporosis model. DFAT cells may be an attractive cell source for cell-based bone tissue engineering to treat nonunion fractures in all patients, including those with osteoporosis. PMID:23566022

  16. Osteogenic effects of dedifferentiated fat cell transplantation in rabbit models of bone defect and ovariectomy-induced osteoporosis.

    PubMed

    Kikuta, Shinsuke; Tanaka, Nobuaki; Kazama, Tomohiko; Kazama, Minako; Kano, Koichiro; Ryu, Junnosuke; Tokuhashi, Yasuaki; Matsumoto, Taro

    2013-08-01

    We have previously reported that mature adipocyte-derived dedifferentiated fat (DFAT) cells have a high proliferative activity and the potential to differentiate into lineages of mesenchymal tissue similar to bone marrow mesenchymal stem cells (MSCs). In the present study, we examined the effects of autologous DFAT cell transplantation on bone regeneration in a rabbit bone defect model and an ovariectomy (OVX)-induced osteoporosis model. The formation of tissue-engineered bone (TEB) was observed when rabbit DFAT cells were loaded onto a β-tricalcium phosphate (TCP)/collagen sponge and cultured in an osteogenic differentiation medium for 3 weeks. Autologous implantation of DFAT cell-mediated TEB constructs promoted bone regeneration in a rabbit tibial defect model. Regenerated bone tissue induced by transplantation of DFAT cell-mediated TEB constructs was histologically well differentiated and exhibited higher bone strength in a three-point bending test compared to that induced by the β-TCP/collagen sponge alone. In OVX-induced osteoporosis model rabbits, DFAT cells were obtained with the osteogenic activity similar to cells from healthy rabbits. Intrabone marrow injection of autologous DFAT cells significantly increased the bone mineral density (BMD) at the injected site in the OVX rabbits. Transplanted DFAT cells remained mainly on the injection side of the bone marrow by at least 28 days after intrabone marrow injection and a part of them expressed osteocalcin. In conclusion, these results demonstrate that autologous implantation of DFAT cells contributed to bone regeneration in a rabbit bone defect model and an OVX-induced osteoporosis model. DFAT cells may be an attractive cell source for cell-based bone tissue engineering to treat nonunion fractures in all patients, including those with osteoporosis.

  17. Evidence of induced non-tolerance in HLA-identical twins with hemoglobinopathy after in utero fetal transplantation.

    PubMed

    Orlandi, F; Giambona, A; Messana, F; Marino, M; Abate, I; Calzolari, R; Damiani, F; Jakil, C; Renda, M; Dieli, F; Buscemi, F; Westgren, M; Ringden, O; Maggio, A

    1996-09-01

    Fetus-to-fetus transplantation has been suggested for the treatment of hemoglobinopathies in utero. However, dissimilar results have to date been obtained by different groups. We describe a case in which fetus-to-fetus transplantation in HLA-identical twins was performed at the 19th week of gestation by infusion of 0.8 ml of fetal blood from normal to beta-thalassemia affected fetus with the main aim of inducing tolerance. No evidence of engraftment, determined by KM19 polymorphism, was present after 2 years of the procedure. Moreover, an alloreactive cytotoxic T lymphocyte precursor (CTLp) study of affected fetus vs donor and other different stimulators showed that immunization vs tolerance was the real effect of the procedure.

  18. Reviewing the pathogenesis of antibody-mediated rejection and renal graft pathology after kidney transplantation.

    PubMed

    Morozumi, Kunio; Takeda, Asami; Otsuka, Yasuhiro; Horike, Keiji; Gotoh, Norihiko; Narumi, Shunji; Watarai, Yoshihiko; Kobayashi, Takaaki

    2016-07-01

    The clinicopathological context of rejection after kidney transplantation was well recognized. Banff conferences greatly contributed to elucidate the pathogenesis and to establish the pathologic criteria of rejection after kidney transplantation. The most important current problem of renal transplantation is de novo donor-specific antibody (DSA) production leading chronic rejection and graft loss. Microvascular inflammation is considered as a reliable pathological marker for antibody-mediated rejection (AMR) in the presence of DSA. Electron microscopic study allowed us to evaluate early changes in peritubular capillaries in T-lymphocyte mediated rejection and transition to antibody-mediated rejection. Severe endothelial injuries with edema and activated lymphocyte invaded into subendothelial space with early multi-layering of peritubular capillary basement membrane suggest T-lymphocyte mediated rejection induce an unbounded chain of antibody-mediated rejection. The risk factors of AMR after ABO-incompatible kidney transplantation are important issues. Anti-ABO blood type antibody titre of IgG excess 32-fold before transplant operation is the only predictable factor for acute AMR. Characteristics of chronic active antibody-mediated rejection (CAAMR) are one of the most important problems. Light microscopic findings and C4d stain of peritubular capillary and glomerular capillary are useful diagnostic criteria of CAAMR. Microvascular inflammation, double contour of glomerular capillary and thickening of peritubular capillary basement are good predictive factors of the presence of de novo DSA. C4d stain of linear glomerular capillary is a more sensitive marker for CAAMR than positive C4d of peritubular capillary. Early and sensitive diagnostic attempts of diagnosing CAAMR are pivotal to prevent chronic graft failure.

  19. Simultaneous Transplantation of Hematopoietic Stem Cells and a Vascularized Composite Allograft Leads to Tolerance

    PubMed Central

    Mathes, David W.; Chang, Jeff; Hwang, Billanna; Graves, Scott S.; Storer, Barry E.; Butts-Miwongtum, Tiffany; Sale, George E.; Storb, Rainer

    2014-01-01

    Background We have previously demonstrated that tolerance to a vascularized composite allograft (VCA) can be achieved after the establishment of mixed chimerism. Here, we test the hypothesis that tolerance to a VCA in our dog leukocyte antigen (DLA)-matched canine model is not dependent on the previous establishment of mixed chimerism and can be induced coincident with hematopoietic cell transplantation (HCT). Methods Eight DLA-matched, minor antigen mismatched dogs received 200 cGy of radiation and a VCA transplant. Four dogs received donor bone marrow at the time of VCA transplantation (group 1) while a second group of 4 dogs did not (group 2). All recipients received a limited course of post-grafting immunosuppression. All dogs that received HCT and VCA were given donor, third party and autologous skin grafts. Results All group 1 recipients were tolerant to their VCA (> 62 weeks). Three of the four dogs in group 2 rejected their VCA transplants after the cessation of immunosuppression. Biopsies obtained from muscle and skin of VCA from group 1 showed few infiltrating cells compared to extensive infiltrates in biopsies of VCA from group 2. Compared to autologous skin and muscle, elevated levels of CD3+ FoxP3+ T-regulatory cells were found in skin and muscle obtained from VCA of HCT recipients. All group 1 animals were tolerant to their donor skin graft and promptly rejected the third-part skin grafts. Conclusion These data demonstrated donor specific tolerance to all components of the VCA can be established through simultaneous nonmyeloablative allogeneic HCT and VCA transplant protocol. PMID:24918616

  20. Cell Injury-Induced Release of Fibroblast Growth Factor 2: Relevance to Intracerebral Mesenchymal Stromal Cell Transplantations

    PubMed Central

    Vinodkumar, Deepti; McGrogan, Michael; Bates, Damien

    2015-01-01

    Beneficial effects of intracerebral transplantation of mesenchymal stromal cells (MSC) and their derivatives are believed to be mediated mostly by factors produced by engrafted cells. However, the mesenchymal cell engraftment rate is low, and the majority of grafted cells disappear within a short post-transplantation period. Here, we hypothesize that dying transplanted cells can affect surrounding tissues by releasing their active intracellular components. To elucidate the type, amounts, and potency of these putative intracellular factors, freeze/thaw extracts of MSC or their derivatives were tested in enzyme-linked immunosorbent assays and bioassays. We found that fibroblast growth factor (FGF)2 and FGF1, but not vascular endothelial growth factor and monocyte chemoattractant protein 1 levels were high in extracts despite being low in conditioned media. Extracts induced concentration-dependent proliferation of rat cortical neural progenitor cells and human umbilical vein endothelial cells; these proliferative responses were specifically blocked by FGF2-neutralizing antibody. In the neuropoiesis assay with rat cortical cells, both MSC extracts and killed cells induced expression of nestin, but not astrocyte differentiation. However, suspensions of killed cells strongly potentiated the astrogenic effects of live MSC. In transplantation-relevant MSC injury models (peripheral blood cell-mediated cytotoxicity and high cell density plating), MSC death coincided with the release of intracellular FGF2. The data showed that MSC contain a major depot of active FGF2 that is released upon cell injury and is capable of acutely stimulating neuropoiesis and angiogenesis. We therefore propose that both dying and surviving grafted MSC contribute to tissue regeneration. PMID:25873141

  1. Clinical Significance of Pre- and Post-Transplant BAFF Levels in Kidney Transplant Recipients

    PubMed Central

    Min, Ji Won; Kim, Kyoung Woon; Kim, Bo-Mi; Doh, Kyoung Chan; Choi, Min Seok; Choi, Bum Soon; Park, Cheol Whee; Yang, Chul Woo; Kim, Yong-Soo

    2016-01-01

    It is well known that pre-transplant B cell activating factor (BAFF) levels are associated with the development of de novo anti-HLA antibodies and antibody mediated rejection post-transplant. However, the clinical significance of BAFF values at allograft rejection has not been determined. In this study, we investigated the clinical significance of pre-transplant BAFF level as well as post-transplant BAFF levels measured when indication biopsy was done. We checked for anti-HLA antibodies in 115 kidney transplant recipients who required allograft biopsy due to an increase in serum creatinine. With the same serum specimen, we measured BAFF levels, and in 78 of these patients, pre-transplant BAFF and anti-HLA antibody levels were detected as well. Patients in each group were divided into tertiles according to BAFF levels. We investigated the relationship between BAFF levels and the occurrence of anti-HLA antibodies. Pre-transplant BAFF levels showed significant association with pre-transplant sensitization, and also with early rejection (Tertile 3, 26.9% vs. Tertile 1, 11.5%; P<0.05). Post-transplant BAFF levels showed significant association with pre-transplant sensitization, but did not show association with anti-HLA antibodies and positive donor-specific antibodies at the time of biopsy. We did not find any association between post-transplant BAFF levels and allograft biopsy results, Banff scores and microvascular inflammation scores. In conclusion, pre-transplant BAFF levels are associated with pre-transplant sensitization and are useful in predicting allograft rejection. But post-transplant BAFF levels measured at the time of indication biopsy are not associated with the appearance of de novo HLA-DSA, allograft rejection, biopsy findings and other allograft outcomes. PMID:27631619

  2. Clinicopathologic features and outcome of mycophenolate-induced colitis in renal transplant recipients.

    PubMed

    de Andrade, Luis Gustavo M; Rodrigues, Maria Aparecida M; Romeiro, Fernando G; Garcia, Paula D; Contti, Mariana M; de Carvalho, Maria Fernanda C

    2014-11-01

    Reports on the clinical course of mycophenolic acid (MPA)-related colitis in kidney transplant recipients are scarce. This study aimed at assessing MPA-related colitis incidence, risk factors, and progression after kidney transplantation. All kidney transplant patients taking MPA who had colonic biopsies for persistent chronic diarrhea, between 2000 and 2012, at the Kidney Transplantation Unit of Botucatu Medical School Hospital, Brazil, were included. Cytomegalovirus (CMV) immunohistochemistry was performed in all biopsy specimens. Data on presenting symptoms, medications, immunosuppressive drugs, colonoscopic findings, and follow-up were obtained. Of 580 kidney transplant patients on MPA, 34 underwent colonoscopy. Colonoscopic findings were associated with MPA usage in 16 patients. The most frequent histologic patterns were non-specific colitis (31.3%), inflammatory bowel disease (IBD)-like colitis (25%), normal/near normal (18.8%), graft-versus-host disease-like (18.8%), and ischemia-like colitis (12.5%). All patients had persistent acute diarrhea and weight loss. Six of the 16 MPA-related diarrhea patients (37.5%) showed acute dehydration requiring hospitalization. Diarrhea resolved when MPA was switched to sirolimus (50%), discontinued (18.75%), switched to azathioprine (12.5%), or reduced by 50% (18.75%). No graft loss occurred. Four patients died during the study period. Late-onset MPA was more frequent, and no correlation with MPA dose or formulation was found.

  3. Impact of dopamine versus serotonin cell transplantation for the development of graft-induced dyskinesia in a rat Parkinson model.

    PubMed

    García, Joanna; Carlsson, Thomas; Döbrössy, Máté; Nikkhah, Guido; Winkler, Christian

    2012-08-27

    Graft-induced dyskinesia (GID), covering a range of dystonic and choreiform involuntary movements, has been observed in some patients with Parkinson's disease (PD) after intracerebral cell transplantation. These dyskinesias have been severe in a number of patients and represent one of the main obstacles for further development of the cell therapy in PD. Serotonin neurons, included into the dopaminergic cell suspension due to the nature of the dissection process, have been suggested as a key factor for the development of GID, since the administration of the serotonin (5-HT)(1A)-receptor agonist buspirone reduced dyskinesia in transplanted PD patients. In the present study, we characterized GID in the rat PD model after transplantation of dopaminergic grafts containing different amounts of serotonin neurons. The severity of GID was significantly correlated with the amount of grafted dopamine and serotonin neurons, but the r-values were low. However, neither the innervation density of dopamine and serotonin fibers in the grafted striatum nor the dopamine-to-serotonin cell ratio correlated significantly with the severity of GID. The results extend prior knowledge of the role of dopaminergic grafts in the development of GID and show that, in the animal model, serotonin neurons within the graft suspension might be involved, but given sufficient dopamine cells, their impact on GID may be minor.

  4. Autologous transplantation of intestine-isolated glia cells improves neuropathology and restores cognitive deficits in β amyloid-induced neurodegeneration

    PubMed Central

    Esposito, Giuseppe; Sarnelli, Giovanni; Capoccia, Elena; Cirillo, Carla; Pesce, Marcella; Lu, Jie; Calì, Gaetano; Cuomo, Rosario; Steardo, Luca

    2016-01-01

    Alzheimer’s disease (AD) is characterized by chronic deposition of β-amyloid (Aβ) in the brain, progressive neurodegeneration and consequent cognitive and behavioral deficits that typify the disease. Astrocytes are pivotal in this process because they are activated in the attempt to digest Aβ which starts a neuroinflammatory response that further contributes to neurodegeneration. The intestine is a good source of astrocytes-like cells-referred to as enteric glial cells (EGCs). Here we show that the autologous transplantation of EGCs into the brain of Aβ-injected rats arrested the development of the disease after their engraftment. Transplanted EGCs showed anti-amyloidogenic activity, embanked Aβ-induced neuroinflammation and neurodegeneration, and released neutrophic factors. The overall result was the amelioration of the pathological hallmarks and the cognitive and behavioral deficits typical of Aβ-associated disease. Our data indicate that autologous EGCs transplantation may provide an efficient alternative for applications in cell-replacement therapies to treat neurodegeneration in AD. PMID:26940982

  5. Generation of induced pluripotent stem cells as a potential source of hematopoietic stem cells for transplant in PNH patients.

    PubMed

    Phondeechareon, Tanapol; Wattanapanitch, Methichit; U-Pratya, Yaowalak; Damkham, Chanapa; Klincumhom, Nuttha; Lorthongpanich, Chanchao; Kheolamai, Pakpoom; Laowtammathron, Chuti; Issaragrisil, Surapol

    2016-10-01

    Paroxysmal nocturnal hemoglobinuria (PNH) is an acquired hemolytic anemia caused by lack of CD55 and CD59 on blood cell membrane leading to increased sensitivity of blood cells to complement. Hematopoietic stem cell transplantation (HSCT) is the only curative therapy for PNH, however, lack of HLA-matched donors and post-transplant complications are major concerns. Induced pluripotent stem cells (iPSCs) derived from patients are an attractive source for generating autologous HSCs to avoid adverse effects resulting from allogeneic HSCT. The disease involves only HSCs and their progeny; therefore, other tissues are not affected by the mutation and may be used to produce disease-free autologous HSCs. This study aimed to derive PNH patient-specific iPSCs from human dermal fibroblasts (HDFs), characterize and differentiate to hematopoietic cells using a feeder-free protocol. Analysis of CD55 and CD59 expression was performed before and after reprogramming, and hematopoietic differentiation. Patients' dermal fibroblasts expressed CD55 and CD59 at normal levels and the normal expression remained after reprogramming. The iPSCs derived from PNH patients had typical pluripotent properties and differentiation capacities with normal karyotype. After hematopoietic differentiation, the differentiated cells expressed early hematopoietic markers (CD34 and CD43) with normal CD59 expression. The iPSCs derived from HDFs of PNH patients have normal levels of CD55 and CD59 expression and hold promise as a potential source of HSCs for autologous transplantation to cure PNH patients.

  6. Building A New Treatment For Heart Failure-Transplantation of Induced Pluripotent Stem Cell-derived Cells into the Heart

    PubMed Central

    Miyagawa, Shigeru; Fukushima, Satsuki; Imanishi, Yukiko; Kawamura, Takuji; Mochizuki-Oda, Noriko; Masuda, Shigeo; Sawa, Yoshiki

    2016-01-01

    Advanced cardiac failure is a progressive intractable disease and is the main cause of mortality and morbidity worldwide. Since this pathology is represented by a definite decrease in cardiomyocyte number, supplementation of functional cardiomyocytes into the heart would hypothetically be an ideal therapeutic option. Recently, unlimited in vitro production of human functional cardiomyocytes was established by using induced pluripotent stem cell (iPSC) technology, which avoids the use of human embryos. A number of basic studies including ours have shown that transplantation of iPSC-derived cardiomyocytes (iPSC-CMs) into the damaged heart leads to recovery of cardiac function, thereby establishing “proof-of-concept” of this iPSC-transplantation therapy. However, considering clinical application of this therapy, its feasibility, safety, and therapeutic efficacy need to be further investigated in the pre-clinical stage. This review summarizes up-to-date important topics related to safety and efficacy of iPSC-CMs transplantation therapy for cardiac disease and discusses the prospects for this treatment in clinical studies.

  7. Abate Cytochrome C induced apoptosome to protect donor liver against ischemia reperfusion injury on rat liver transplantation model

    PubMed Central

    Zhuang, Zhuonan; Lian, Peilong; Wu, Xiaojuan; Shi, Baoxu; Zhuang, Maoyou; Zhou, Ruiling; Zhao, Rui; Zhao, Zhen; Guo, Sen; Ji, Zhipeng; Xu, Kesen

    2016-01-01

    Objective: Aim of this study is to protect donor liver against ischemia-reperfusion injury by abating Cytochrome C induced apoptosome on rat model. Methods: A total of 25 clean SD inbred male rats were used in this research. The rats in ischemia-reperfusion injury group (I/R group, n=5) were under liver transplantation operation; rats in dichloroacetate diisopropylamine group (DADA group, n=5) were treated DADA before liver transplantation; control group (Ctrl group, n=5); other 10 rats were used to offer donor livers. Results: In DADA therapy group, Cytochrome C expression in donor hepatocellular cytoplasm was detected lower than that in I/R group. And the Cytochrome C induced apoptosome was also decreased in according to the lower expressions of Apaf-1 and Caspase3. Low level of cleaved PARP expression revealed less apoptosis in liver tissue. The morphology of donor liver mitochondria in DADA group was observed to be slightly edema but less than I/R group after operation 12 h. The liver function indexes of ALT and AST in serum were tested, and the results in DADA group showed it is significantly lower than I/R group after operation 12 h. The inflammation indexes of IL-6 and TNF-α expressions in DADA group were significantly lower than that in I/R group after operation 24 h. Conclusion: The dichloroacetate diisopropylamine treatment could protect the hepatocellular mitochondria in case of the spillage of Cytochrome C induced apoptosome, and protect the liver against ischemia-reperfusion injury. Thus, it may be a method to promote the recovery of donor liver function after transplantation. PMID:27186297

  8. Multiple carcinomas in the hemodialysis access induced ischemic hand of a renal transplant patient.

    PubMed

    Van Hoek, Frank; Van Tits, Herm W; Van Lijnschoten, Ineke; De Haas, Boudewijn D; Scheltinga, Marc R

    2010-01-01

    Long term immunosuppression following organ transplantation promotes the onset of skin cancers. A renal transplant patient developed multiple hyperkeratotic nodi in the left hand and digital pain following prolonged immunosuppression. Several skin abnormalities were observed in an ischemic and atrophic left hand in the presence of a patent Cimino-Brescia arteriovenous fistula previously used for hemodialysis. Severe hand ischemia was confirmed by digital plethysmography. Pathological examination of all 7 excised skin lesions indicated manifestations of well differentiated squamous cell carcinomas (SCC). Severe loco-regional ischemia due to an intact hemodialysis access may enhance the toxic effects of chronic immunosuppressive medication. Oxidative stress may act as a co-carcinogenic factor for the development of SCC in renal transplant patients receiving immunosuppressive agents.

  9. REGRESSION OF TRANSPLANTED LYMPHOMAS INDUCED IN VIVO BY MEANS OF NORMAL GUINEA PIG SERUM

    PubMed Central

    Kidd, John G.

    1953-01-01

    In the experiments here described transplanted lymphomas of two kinds regularly regressed following repeated injections of normal guinea pig serum intraperitoneally into mice carrying them, the animals meanwhile remaining lively and devoid of signs of illness or wasting. The lymphomas of untreated control mice, by contrast, usually grew progressively and killed their hosts within 20 to 30 days, and the same was true of the growth of other mice given repeated injections of horse serum or rabbit serum. In similar experiments, the cells of a transplanted lymphosarcoma of rats were temporarily kept from proliferating by repeated intraperitoneal injections of guinea pig serum, though the cells of two transplanted mammary carcinomas of mice, and those of fibrosarcoma, grew unimpeded in hosts likewise treated. Additional experiments related to the phenomenon here described, and a discussion of the findings as a whole, are given in an associated paper. PMID:13109110

  10. Endothelial Cell Apoptosis Induces TGF-β Signaling-Dependent Host Endothelial-Mesenchymal Transition to Promote Transplant Arteriosclerosis.

    PubMed

    Li, J; Xiong, J; Yang, B; Zhou, Q; Wu, Y; Luo, H; Zhou, H; Liu, N; Li, Y; Song, Z; Zheng, Q

    2015-12-01

    Endothelial cells (ECs) apoptosis is an initial event in transplant arteriosclerosis (TA), resulting in allograft function loss. To elucidate the precise mechanisms of ECs apoptosis leading to neointimal smooth muscle cells (SMCs) accumulation during TA. We induced apoptosis in cultured ECs by overexpressing p53 through lentivirus-mediated transfection. ECs apoptosis induced the production of transforming growth factor (TGF)-β1 in both apoptotic and neighboring viable cells, leading to increased TGF-β1 in the culture media. Conditioned media from Ltv-p53-transfected ECs further promoted transition of cultured ECs to SM-like cells by activating TGF-β/Smad3, PI3K/Akt/mTOR, and MAPK/ERK signaling in a TGF-β-dependent manner. In transgenic rat aorta transplantation models, inhibition of ECs apoptosis in Bcl-xL(+/+) knock-in rat aortic allografts significantly reduced TGF-β1 production both in allograft endothelia and in blood plasma, which in turn decreased accumulation of SM22α+ cells from transgenic recipient ECs originally marked with EGFP knock-in in neointima and alleviated TA. Systemic treatment with SIS3, AP23573, or PD98059 also prevented recipient ECs-originated SM-like cells accumulation and intima hyperplasia in aortic allografts. These data suggest that allograft EC apoptosis induced recipient endothelial-mesenchymal (smooth muscle) transition via TGF-β signaling, resulting in recipient EC-derived SMC accumulation as a major mechanism of vascular remodeling during TA.

  11. Fecal microbiota transplantation inducing remission in Crohn's colitis and the associated changes in fecal microbial profile.

    PubMed

    Kao, Dina; Hotte, Naomi; Gillevet, Patrick; Madsen, Karen

    2014-08-01

    Inflammatory bowel disease (IBD) is a chronic relapsing disorder of the intestine of unclear etiology. Increasing evidence has pointed to intestinal dysbiosis as a potential factor in a genetically susceptible individual. Fecal microbiota transplantation (FMT) has been used to treat inflammatory bowel disease with variable degrees of success. Herein, we report a patient with Crohn's colitis, previously failing an immunosuppressant, who achieved clinical, endoscopic, and histologic remission after a single fecal microbiota transplantation infusion. We have further characterized the changes in the fecal microbiota associated with this observation.

  12. Bone marrow transplant - discharge

    MedlinePlus

    Transplant - bone marrow - discharge; Stem cell transplant - discharge; Hematopoietic stem cell transplant - discharge; Reduced intensity; Non-myeloablative transplant - discharge; Mini transplant - discharge; Allogenic bone marrow transplant - ...

  13. Reg3α Overexpression Protects Pancreatic β Cells from Cytokine-Induced Damage and Improves Islet Transplant Outcome

    PubMed Central

    Ding, Ying; Xu, Yuemei; Shuai, Xuanyu; Shi, Xuhui; Chen, Xiang; Huang, Wenbin; Liu, Yun; Liang, Xiubin; Zhang, Zhihong; Su, Dongming

    2014-01-01

    The process of islet transplantation for treating type 1 diabetes has been limited by the high level of graft failure. This may be overcome by locally delivering trophic factors to enhance engraftment. Regenerating islet-derived protein 3α (Reg3α) is a pancreatic secretory protein which functions as an antimicrobial peptide in control of inflammation and cell proliferation. In this study, to investigate whether Reg3α could improve islet engraftment, a marginal mass of syngeneic islets pretransduced with adenoviruses expressing Reg3α or control EGFP were transplanted under the renal capsule of streptozotocin-induced diabetic mice. Mice receiving islets with elevated Reg3α production exhibited significantly lower blood glucose levels (9.057 ± 0.59 mmol/L versus 13.48 ± 0.35 mmol/L, P < 0.05) and improved glucose-stimulated insulin secretion (1.80 ± 0.17 ng/mL versus 1.16 ± 0.16 ng/mL, P < 0.05) compared with the control group. The decline of apoptotic events (0.57% ± 0.15% versus 1.06% ± 0.07%, P < 0.05) and increased β-cell proliferation (0.70% ± 0.10% versus 0.36% ± 0.14%, P < 0.05) were confirmed in islet grafts overexpressing Reg3α by morphometric analysis. Further experiments showed that Reg3α production dramatically protected cultured islets and pancreatic β cells from cytokine-induced apoptosis and the impairment of glucose-stimulated insulin secretion. Moreover, exposure to cytokines led to the activation of MAPKs in pancreatic β cells, which was reversed by Reg3α overexpression in contrast to control group. These results strongly suggest that Reg3α could enhance islet engraftments through its cytoprotective effect and advance the therapeutic efficacy of islet transplantation. PMID:25826674

  14. Bioluminescent Imaging of Genetically Selected Induced Pluripotent Stem Cell-Derived Cardiomyocytes after Transplantation into Infarcted Heart of Syngeneic Recipients

    PubMed Central

    Lepperhof, Vera; Polchynski, Olga; Kruttwig, Klaus; Brüggemann, Chantal; Neef, Klaus; Drey, Florian; Zheng, Yunjie; Ackermann, Justus P.; Choi, Yeong-Hoon; Wunderlich, Thomas F.; Hoehn, Mathias; Hescheler, Jürgen; Šarić, Tomo

    2014-01-01

    Cell loss after transplantation is a major limitation for cell replacement approaches in regenerative medicine. To assess the survival kinetics of induced pluripotent stem cell (iPSC)-derived cardiomyocytes (CM) we generated transgenic murine iPSC lines which, in addition to CM-specific expression of puromycin N-acetyl-transferase and enhanced green fluorescent protein (EGFP), also constitutively express firefly luciferase (FLuc) for bioluminescence (BL) in vivo imaging. While undifferentiated iPSC lines generated by random integration of the transgene into the genome retained stable FLuc activity over many passages, the BL signal intensity was strongly decreased in purified iPS-CM compared to undifferentiated iPSC. Targeted integration of FLuc-expression cassette into the ROSA26 genomic locus using zinc finger nuclease (ZFN) technology strongly reduced transgene silencing in iPS-CM, leading to a several-fold higher BL compared to iPS-CM expressing FLuc from random genomic loci. To investigate the survival kinetics of iPS-CM in vivo, purified CM obtained from iPSC lines expressing FLuc from a random or the ROSA26 locus were transplanted into cryoinfarcted hearts of syngeneic mice. Engraftment of viable cells was monitored by BL imaging over 4 weeks. Transplanted iPS-CM were poorly retained in the myocardium independently of the cell line used. However, up to 8% of cells survived for 28 days at the site of injection, which was confirmed by immunohistological detection of EGFP-positive iPS-CM in the host tissue. Transplantation of iPS-CM did not affect the scar formation or capillary density in the periinfarct region of host myocardium. This report is the first to determine the survival kinetics of drug-selected iPS-CM in the infarcted heart using BL imaging and demonstrates that transgene silencing in the course of iPSC differentiation can be greatly reduced by employing genome editing technology. FLuc-expressing iPS-CM generated in this study will enable further

  15. Improvement of neurological deficits in 6-hydroxydopamine-lesioned rats after transplantation with allogeneic simian virus 40 large tumor antigen gene-induced immortalized dopamine cells

    PubMed Central

    Clarkson, Edward D.; Rosa, Francisco G. La; Edwards-Prasad, Judith; Weiland, David A.; Witta, Samir E.; Freed, Curt R.; Prasad, Kedar N.

    1998-01-01

    The replacement of dopamine (DA) by DA neuron transplants in the treatment of advanced Parkinson disease (PD) is a rational approach. Because of limitations associated with fetal tissue transplants, a clone (1RB3AN27) of simian virus 40 large tumor antigen (LTa) gene-induced immortalized DA neurons were used in this study. These allogeneic immortalized dopamine neurons, when grafted into striata of normal rats, did not divide, did not form tumors, did not produce LTa, did not extend neurites to host neurons, and were not rejected, for as long as 13 months after transplantation. Grafted cells when recultured in vitro resumed cell proliferation and LTa production, suggesting the presence of a LTa gene-inhibiting factor in the brain. The grafting of undifferentiated and differentiated 1RB3AN27 cells or differentiated murine neuroblastoma (NBP2) cells into striata of 6-hydroxydopamine-lesioned rats (an animal model of PD) caused a time-dependent improvement in neurological deficits (reduction in the methamphetamine-induced turning rate). At 3 months after transplantation, 100% of the animals receiving differentiated 1RB3AN27 cells, 63% of the animals receiving undifferentiated 1RB3AN27 cells, 56% of the animals receiving differentiated NBP2 cells, and 0% of the sham-transplanted animals showed improvements in neurological deficits. At 6 months after transplantation, there was a progressive increase in spontaneous recovery in sham-transplanted animals. These results suggest that immortalized DA neurons should be further studied for their potential use in transplant therapy in advanced PD patients. PMID:9448320

  16. The reversal of hyperglycemia after transplantation of mouse embryonic stem cells induced into early hepatocyte-like cells in streptozotocin-induced diabetic mice.

    PubMed

    Boroujeni, Nasim Beigi; Hashemi, Seyed Mahmoud; Khaki, Zohreh; Soleimani, Masoud

    2011-04-01

    Cellular replacement therapy is a potential therapeutic strategy for diabetes. In this study, we investigated the effect of transplantation of induced mouse embryonic stem cells (mESCs) into endoderm and early hepatocyte-like cells in streptozotocin (STZ)-diabetic mice. After embryoid body (EB) formation from mESC, the EBs were cultured in the presence of dexamethasone (DEX) and insulin for 4 days then was added acidic fibroblast growth factor (aFGF), hepatocyte growth factor (HGF) and oncostatin M (OSM) for 10 days, respectively. Blood glucose levels, intraperitoneal glucose tolerance (IGT) test and islet histology were assessed. The result revealed that transplantation of induced mESCs into early hepatocyte-like cells could repair pancreatic islets of control group. Blood glucose levels and intraperitoneal glucose tolerance test were significantly improved in test group compared to control group. Furthermore, there was significant increase in the number of islets in test group compared to control group. The findings declare that induced mESCs into endoderm and early hepatocyte-like cells, are appropriate candidate for regenerative therapy of pancreatic islets in type I diabetes.

  17. Mouse model of alloimmune-induced vascular rejection and transplant arteriosclerosis.

    PubMed

    Enns, Winnie; von Rossum, Anna; Choy, Jonathan

    2015-05-17

    Vascular rejection that leads to transplant arteriosclerosis (TA) is the leading representation of chronic heart transplant failure. In TA, the immune system of the recipient causes damage of the arterial wall and dysfunction of endothelial cells and smooth muscle cells. This triggers a pathological repair response that is characterized by intimal thickening and luminal occlusion. Understanding the mechanisms by which the immune system causes vasculature rejection and TA may inform the development of novel ways to manage graft failure. Here, we describe a mouse aortic interposition model that can be used to study the pathogenic mechanisms of vascular rejection and TA. The model involves grafting of an aortic segment from a donor animal into an allogeneic recipient. Rejection of the artery segment involves alloimmune reactions and results in arterial changes that resemble vascular rejection. The basic technical approach we describe can be used with different mouse strains and targeted interventions to answer specific questions related to vascular rejection and TA.

  18. Transplantation models to characterize the mechanisms of stem cell-induced islet regeneration.

    PubMed

    Bell, Gillian I; Seneviratne, Ayesh K; Nasri, Grace N; Hess, David A

    2013-09-20

    This unit describes our current knowledge regarding the isolation human bone marrow-derived progenitor cells for the paracrine stimulation of islet regeneration after transplantation into immunodeficient mouse models of diabetes. By using high aldehyde dehydrogenase (ALDH(hi) ) activity, a conserved function in multiple stem cell lineages, a mixed population of hematopoietic, endothelial, and mesenchymal progenitor cells can be efficiently purified using flow cytometry. We describe in vitro approaches to characterize and expand these distinct cell types. Importantly, these cell types can be transplanted into immunodeficient mice rendered beta-cell deficient by streptozotocin (STZ) treatment, in order monitor functional recovery from hyperglycemia and to characterize endogenous islet regeneration via paracrine mechanisms. Herein, we provide detailed protocols for: (1) isolation and characterization of ALDH(hi) cells for the establishment of hematopoietic and multipotent-stromal progenitor lineages; (2) intravenous and intrapancreatic transplantation of human stem cell subtypes for the quantification of glycemic recovery in STZ-treated immunodeficient mice; and (3) immunohistochemical characterization of islet recovery via the stimulation of islet neogenic, beta-cell proliferative, and islet revascularization programs. Collectively, these systems can be used to support the pre-clinical development of human progenitor cell-based therapies to treat diabetes via islet regeneration.

  19. Intracranial hemorrhage induced uncontrolled seizure in a deceased donor liver transplant patient: a case report

    PubMed Central

    Oh, Seung-Young; Lee, Hannah; Park, Yang-Hyo

    2016-01-01

    Seizure is the second most common neurologic complication after liver transplantation and may be caused by metabolic abnormalities, electrolyte imbalance, infection, and immunosuppressant toxicity. A 61-year-old male patient underwent liver transplantation due to hepatitis B virus-related liver cirrhosis with portal systemic encephalopathy. The immediate postoperative course of the patient was uncomplicated. However, on postoperative day (POD) 6, weakness developed in both lower extremities. No abnormal findings were detected on a brain computed tomography (CT) scan on POD 8, but a generalized tonic clonic seizure developed which was difficult to control even with multiple antiepileptic drugs. A follow-up brain CT scan on POD 15 showed a 2.7 cm sized acute intracranial hemorrhage (ICH) in the left parietal lobe. The patient's mental status improved after 2 months and he was able to communicate through eye blinking or head shaking. Our case reports an acute ICH that manifested into a refractory seizure in a patient who underwent a liver transplant. PMID:27703637

  20. Hematopoietic cell transplantation for tolerance induction: animal models to clinical trials.

    PubMed

    Sykes, Megan

    2009-02-15

    The induction of donor-specific immune tolerance is the "holy grail" of transplantation, as it would avoid the toxicities of chronic immunosuppressive therapies while preventing acute and chronic graft rejection. A large number of approaches to tolerance induction have been described in the experimental literature, but only hematopoietic cell transplantation has shown preliminary success for intentional tolerance induction in pilot clinical trials. This review summarizes the conditions that allow progress to be made in moving strategies for tolerance induction from the bench to the bedside and discuss the mechanisms by which tolerance may be achieved through hematopoietic cell transplantation.

  1. Total lymphatic irradiation and bone marrow in human heart transplantation

    SciTech Connect

    Kahn, D.R.; Hong, R.; Greenberg, A.J.; Gilbert, E.F.; Dacumos, G.C.; Dufek, J.H.

    1984-08-01

    Six patients, aged 36 to 59 years, had heart transplants for terminal myocardial disease using total lymphatic irradiation (TLI) and donor bone marrow in addition to conventional therapy. All patients were poor candidates for transplantation because of marked pulmonary hypertension, unacceptable tissue matching, or age. Two patients are living and well more than four years after the transplants. Two patients died of infection at six and seven weeks with normal hearts. One patient, whose preoperative pulmonary hypertension was too great for an orthotopic heart transplant, died at 10 days after such a procedure. The other patient died of chronic rejection seven months postoperatively. Donor-specific tolerance developed in 2 patients. TLI and donor bone marrow can produce specific tolerance to donor antigens and allow easy control of rejection, but infection is still a major problem. We describe a new technique of administering TLI with early reduction of prednisone that may help this problem.

  2. Essential role for B cells in transplantation tolerance

    PubMed Central

    Redfield, Robert R; Rodriguez, Eduardo; Parsons, Ronald; Vivek, Kumar; Mustafa, Moiz M; Noorchashm, Hooman; Naji, Ali

    2017-01-01

    T lymphocytes are the primary targets of immunotherapy in clinical transplantation. However, B lymphocytes are detrimental to graft survival by virtue of their capacity to present antigen to T cells via the indirect pathway of allorecognition and the generation of donor specific alloantibody. Furthermore, the long-term survival of organ allografts remains challenged by chronic rejection, a process in which activated B cells have been found to play a significant role. Therefore, the achievement of transplantation tolerance will likely require induction of both T and B cell tolerance to alloantigens. Moreover, human and animal investigations have shown that subsets of B cells, Transitional and Regulatory, are inherently tolerogenic. Developing therapeutic strategies that exploit these populations may be key to achieving transplantation tolerance. In this review we describe the current evidence for the essential role of B cells in transplant tolerance and discuss emerging B cell directed strategies to achieve allograft tolerance. PMID:21982511

  3. Kidney transplant

    MedlinePlus

    Renal transplant; Transplant - kidney ... Barry JM, Conlin MJ. In: Renal transplantation. Wein AJ, ed. Campbell-Walsh Urology . 10th ed. Philadelphia, PA: Elsevier Saunders; 2011:chap 44. Kidney Disease: Improving Global Outcomes ( ...

  4. Kidney Transplant

    MedlinePlus

    Kidney transplant Overview By Mayo Clinic Staff A kidney transplant is a surgical procedure to place a healthy kidney ... bloodstream via a machine (dialysis) or a kidney transplant to stay alive. Mayo Clinic's approach . Mayo Clinic ...

  5. Lung Transplant

    MedlinePlus

    Lung transplant Overview By Mayo Clinic Staff A lung transplant is a surgical procedure to replace a diseased or ... lung, usually from a deceased donor. A lung transplant is reserved for people who have tried other ...

  6. Heparin-induced thrombocytopenia (HIT II) in liver transplant recipients: a retrospective multivariate analysis of prognostic factors.

    PubMed

    Hüser, Norbert; Aßfalg, Volker; Reim, Daniel; Novotny, Alexander; Thorban, Stefan; Cheng, Zhangjun; Kornberg, Arno; Friess, Helmut; Büchler, Peter; Matevossian, Edouard

    2012-07-01

    We investigated the prevalence of HIT II in liver transplant recipients and analysed associated factors. In recipients with clinically suspected HIT II in the 4Ts pretest clinical scoring system HIPA-assay was performed. Next, 37 clinical variables were analysed retrospectively for their association with HIT II. Factors significantly correlated to our findings in univariate analysis were included in a multivariate model and binary logistic regression analysis. Among 46 recipients 21 patients were suspicious in the 4Ts pretest and 14 of them (30.4%) were diagnosed HIT-antibody positive. Patient's age (P = 0.001), postoperative dialysis (P = 0.028), and postoperative hospital stay (P = 0.035) were significantly associated with development of HIT-antibodies in univariate analysis. Postoperative dialysis and postoperative hospital stay turned out as epiphenomena of patient's age, the only independent predictor (P = 0.021). Using multiple χ(2) -testing, a cut-off could be calculated, assigning patients younger than 59 years to a low risk group and patients of 59 years and older to a high risk group. High incidence of peri-operative HIT II seroconversion in liver transplant recipients is not associated with factors known to induce thrombocyte activation, like blood products or cell-saver. Only patients' age was identified as independent predictor.

  7. In vivo expansion of the endogenous B-cell compartment stimulated by radiation and serial bone marrow transplantation induces B-cell leukaemia in mice.

    PubMed

    Holyoake, T L; Freshney, M G; Samuel, K; Ansell, J; Watson, G E; Wright, E G; Graham, G J; Pragnell, I B

    2001-07-01

    Chronic lymphocytic leukaemia (CLL) is a malignancy of CD5(+) B cells. This B-cell lineage is established during ontogeny and replenished by the process of self-renewal. Spontaneous and induced leukaemias that frequently affect this lineage are thought to arise as a result of the frequent cell division required to maintain the population throughout adulthood and in response to repeated exposure to environmental antigens. In a series of bone marrow transplant (BMT) experiments performed in B6D2F1 mice, B-cell leukaemia occurred in recipients of serially transplanted syngeneic bone marrow. This study was therefore designed to determine the frequency and phenotype of the observed leukaemia. Male donor cells were initially transplanted into lethally irradiated female hosts and secondary (2 degrees ) BMT was performed at 3 months. At 1, 2, 3 and 16 months following primary (1 degrees ) BMT, and when 2 degrees BMT recipients developed leukaemia, animals were sacrificed and their tissues extensively examined. These analyses confirmed a host-derived CD5(+) transplantable B-cell leukaemia that was initiated in 50% of 1 degrees BMT recipients. With serial passage, the leukaemia became more aggressive and lost CD5 expression, suggesting transformation to a high-grade leukaemia/lymphoma. This previously unreported observation suggests that the combination of radiation and subsequent serial transplantation induces a proliferative stress to the host B-cell compartment that is causative in leukaemic transformation.

  8. Treatment of surgically induced acute liver failure with transplantation of highly differentiated immortalized human hepatocytes.

    PubMed

    Kobayashi, N; Miyazaki, M; Fukaya, K; Inoue, Y; Sakaguchi, M; Noguchi, H; Matsumura, T; Watanabe, T; Totsugawa, T; Tanaka, N; Namba, M

    2000-01-01

    Primary human hepatocytes are an ideal source of hepatic function in bioartficial liver (BAL), but the shortage of human livers available for hepatocyte isolation limits this modality. To resolve this issue, primary human fetal hepatocytes were immortalized using simian virus 40 large T antigen. One of the immortal cell lines, OUMS-29, showed highly differentiated liver functions. Intrasplenic transplantation of OUMS-29 cells protected 90% hepatectomized rats from hyperammonemia and significantly prolonged their survival. Essentially unlimited availability of OUMS-29 cells supports their clinical use for BAL treatment.

  9. Hepatic Sinusoidal Obstruction Syndrome Induced by Non-transplant Chemotherapy for Non-Hodgkin Lymphoma

    PubMed Central

    Sakumura, Miho; Tajiri, Kazuto; Miwa, Shigeharu; Nagata, Kohei; Kawai, Kengo; Miyazono, Takayoshi; Arita, Kotaro; Wada, Akinori; Murakami, Jun; Sugiyama, Toshiro

    2017-01-01

    Hepatic sinusoidal obstruction syndrome (SOS), a serious complication that mainly occurs after hematopoietic-stem cell transplantation (HSCT), is caused by damage to the sinusoidal endothelial cells after the obstruction of the sinusoid. Recently, hepatic SOS was reported to occur after non-HSCT chemotherapies. This report describes a patient who experienced hepatic SOS after non-HSCT chemotherapy for non-Hodgkin lymphoma. A liver biopsy showed the slight dilatation of the hepatic sinusoid, which may be indicative of hepatic SOS. Hepatic SOS should be included in the differential diagnosis of patients with severe liver injury following the administration of chemotherapy regimens that are toxic to the vascular endothelial cells. PMID:28202860

  10. Persistence of Yellow Fever vaccine-induced antibodies after cord blood stem cell transplant

    PubMed Central

    Avelino-Silva, Vivian Iida; Freire, Marcos da Silva; Rocha, Vanderson; Rodrigues, Celso Arrais; Novis, Yana Sarkis; Sabino, Ester C.; Kallas, Esper Georges

    2016-01-01

    ABSTRACT We report the case of a cord blood haematopoietic stem cell transplant recipient who was vaccinated for Yellow Fever (YF) 7 days before initiating chemotherapy and had persistent YF antibodies more than 3 years after vaccination. Since the stem cell donor was never exposed to wild YF or to the YF vaccine, and our patient was not exposed to YF or revaccinated, this finding strongly suggests the persistence of recipient immunity. We briefly discuss potential consequences of incomplete elimination of recipient's leukocytes following existing haematopoietic cancer treatments. PMID:26618995

  11. Efficacy of induction therapy with ATG and intravenous immunoglobulins in patients with low-level donor-specific HLA-antibodies.

    PubMed

    Bächler, K; Amico, P; Hönger, G; Bielmann, D; Hopfer, H; Mihatsch, M J; Steiger, J; Schaub, S

    2010-05-01

    Low-level donor-specific HLA-antibodies (HLA-DSA) (i.e. detectable by single-antigen flow beads, but negative by complement-dependent cytotoxicity crossmatch) represent a risk factor for early allograft rejection. The short-term efficacy of an induction regimen consisting of polyclonal anti-T-lymphocyte globulin (ATG) and intravenous immunoglobulins (IvIg) in patients with low-level HLA-DSA is unknown. In this study, we compared 67 patients with low-level HLA-DSA not having received ATG/IvIg induction (historic control) with 37 patients, who received ATG/IvIg induction. The two groups were equal regarding retransplants, HLA-matches, number and class of HLA-DSA. The overall incidence of clinical/subclinical antibody-mediated rejection (AMR) was lower in the ATG/IvIg than in the historic control group (38% vs. 55%; p = 0.03). This was driven by a significantly lower rate of clinical AMR (11% vs. 46%; p = 0.0002). Clinical T-cell-mediated rejection (TCR) was significantly lower in the ATG/IvIg than in the historic control group (0% vs. 50%; p < 0.0001). Within the first year, allograft loss due to AMR occurred in 7.5% in the historic control and in 0% in the ATG/IvIg group. We conclude that in patients with low-level HLA-DSA, ATG/IvIg induction significantly reduces TCR and the severity of AMR, but the high rate of subclinical AMR suggests an insufficient control of the humoral immune response.

  12. Antibody-Mediated Lung Transplant Rejection

    PubMed Central

    Hachem, Ramsey

    2012-01-01

    Antibody-mediated rejection after lung transplantation remains enigmatic. However, emerging evidence over the past several years suggests that humoral immunity plays an important role in allograft rejection. Indeed, the development of donor-specific antibodies after transplantation has been identified as an independent risk factor for acute cellular rejection and bronchiolitis obliterans syndrome. Furthermore, cases of acute antibody-mediated rejection resulting in severe allograft dysfunction have been reported, and these demonstrate that antibodies can directly injure the allograft. However, the incidence and toll of antibody-mediated rejection are unknown because there is no widely accepted definition and some cases may be unrecognized. Clearly, humoral immunity has become an important area for research and clinical investigation. PMID:23002428

  13. Dimethyl sulfoxide-induced toxicity in cord blood stem cell transplantation: report of three cases and review of the literature.

    PubMed

    Ruiz-Delgado, Guillermo J; Mancías-Guerra, Consuelo; Tamez-Gómez, Edna L; Rodríguez-Romo, Laura N; López-Otero, Avril; Hernández-Arizpe, Ana; Gómez-Almaguer, David; Ruiz-Argüelles, Guillermo J

    2009-01-01

    Umbilical cord blood transplantation using nonmyeloablative conditioning is currently considered by many as a valid potential alternative for any patient who requires an unrelated donor allograft and who is without a suitably matched and readily available volunteer. Dimethyl sulfoxide (DMSO) has been used for years as a cryoprotectant agent; it acts by penetrating the cell and binding water molecules and it has been described as harmless for the individual who receives it in limited amounts. In this paper, we describe 3 cases of DMSO-induced toxicities and briefly review the most common adverse reactions of the DMSO when used as a cryopreservation agent for the long-term storage of cord blood cells. Two of the 3 cases had a dismal prognosis. A brief review of the literature is presented.

  14. Dose-independent confusion induced by voriconazole in a patient with Asian ancestry after allogeneic hematopoietic stem cell transplant.

    PubMed

    Hui, John

    2016-02-01

    This is the case of a 71-year-old man with Asian ancestry who had myelodysplastic syndrome admitted for allogeneic hematopoietic stem cell transplant. This case suggests that voriconazole-induced confusion is probably dose-independent and reversible with no residual symptoms after discontinuation of voriconazole. Patient can experience confusion even voriconazole is ordered according to package insert and serum voriconazole level is within therapeutic range (1-6 µg/mL). The onset of confusion can be delayed and sudden after seven days of voriconazole therapy. Genotyping of CYP2C19 can be tested for Asian populations since 15-20% of them could be poor metabolizers of voriconazole.

  15. Nimesulide-induced severe hemolytic anemia and acute liver failure leading to liver transplantation.

    PubMed

    Rodrigo, L; de Francisco, R; Pérez-Pariente, J M; Cadahia, V; Tojo, R; Rodriguez, M; Lucena, Ma I; Andrade, R J

    2002-11-01

    We present the case of a 63-year-old woman who had undergone 7 months of treatment with Nimesulide (100 mg/b.i.d.) for symptomatic osteoarthritis. The patient was admitted to our unit with a clinical picture of progressive jaundice over 3 weeks. Clinical and analytical studies revealed acute liver failure, this being confirmed by liver biopsy, which showed submassive necrosis. Serological tests for different viral agents causing hepatitis were all negative. In addition, she presented a picture of severe haemolytic anaemia resistant to several treatments and needed multiple transfusions. Twenty-three days after admission, the patient presented hepatic encephalopathy and received an orthotopic liver transplant on day 25. The evolution after transplantation was good and the patient continues in good health with no evidence of haemolysis almost 2 years later. Liver toxicity due to Nimesulide is well known, but to our knowledge the occurrence of haemolytic anaemia has not been related to this drug previously. For these reasons, Nimesulide has been restricted or removed from the market in several countries in recent months.

  16. Detection of Donor-Derived Microparticles in the Peripheral Blood of a Hand Transplant Recipient During Rejection

    PubMed Central

    Kim, Joseph Y.; Kelesidis, Theodoros; Yang, Otto O.

    2017-01-01

    Background Microparticles (MPs) are released from the plasma membrane of activated or dying cells and bear surface molecules from those cells. We examined whether donor-derived MPs in the peripheral blood of the recipient could serve as a marker of tissue damage due to rejection of a transplanted hand. Methods Platelet-free plasma from the recipient of the transplanted hand was analyzed for MPs bearing the donor-specific HLA molecule A*02 using flow cytometry. Rejection status of the transplanted hand was monitored by histopathology of skin punch biopsies. Results Donor-specific MPs expressing HLA A*02 were quantifiable in the peripheral blood of the recipient. Levels of these MPs increased with worsening rejection of the transplanted hand. Conclusions These findings demonstrate the ability to detect donor specific MPs through staining of graft cell-specific HLA and promote further investigation into the potential utility of flow cytometry for donor-derived MPs as a noninvasive tool to assess rejection in solid organ transplantation patients.

  17. Sensitivity to myc-induced apoptosis is retained in spontaneous and transplanted lymphomas of CD2-mycER mice.

    PubMed

    Blyth, K; Stewart, M; Bell, M; James, C; Evan, G; Neil, J C; Cameron, E R

    2000-02-10

    To study the effects of the Myc oncoprotein in a regulatable in vivo system, we generated lines of transgenic mice in which a tamoxifen inducible Myc fusion protein (c-mycER) is expressed under the control of the CD2 locus control region. Activation of the Myc oncoprotein resulted in both proliferation and apoptosis in vivo. Lines with a high transgene copy number developed spontaneous lymphomas at low frequency, but the tumour incidence was significantly increased with tamoxifen treatment. Surprisingly, we found that cellular sensitivity to Myc-induced apoptosis was retained in tumours from these mice and in most lymphoma cell lines, even when null for p53. Resistance to Myc-induced apoptosis could be conferred on these cells by co-expression of Bcl-2. However, acquired resistance is clearly not an obligatory progression event as sensitivity to apoptosis was retained in transplanted tumours in athymic mice. In conclusion, lymphomas arising in CD2-mycER mice retain the capacity to undergo apoptosis in response to Myc activation and show no phenotypic evidence of the presence of an active dominant inhibitor.

  18. Effects of bone marrow cell transplant on thyroid function in an I131-induced low T4 and elevated TSH rat model

    PubMed Central

    Guajardo-Salinas, Gustavo E; Carvajal, Juan A; Gaytan-Ramos, Ángel A; Arroyo, Luis; López-Reyes, Alberto G; Islas, José F; Cano, Beiman G; Arroyo-Currás, Netzahualcoyótl; Dávalos, Alfredo; Madrid, Gloria; Moreno-Cuevas, Jorge E

    2007-01-01

    Background We developed a study using low dose radioactive iodine creating an animal model of transient elevation of thyroid stimulating hormone (TSH). Male derived bone marrow cells were transplanted to asses their effect on thyroid function and their capability to repair the thyroid parenchyma. Results At 40 an 80 days after I131 treatment, the study groups TSH and T4 serum values both increased and decreased significantly respectively compared to the negative control group. Eight weeks after cell transplantation, neither TSH nor T4 showed a significant difference in any group. The mean number of SRY gene copies found in group I (Left Intracardiac Transplant) was 523.3 and those in group II (Intrathyroid Transplant) were only 73. Group III (No Transplant) and IV had no copies. Group I presented a partial restore of the histological pattern of rat thyroid with approximately 20% – 30% of normal-sized follicles. Group II did not show any histological differences compared to group III (Positive control). Conclusion Both a significant increase of TSH and decrease of T4 can be induced as early as day 40 after a low dose of I131 in rats. Restore of normal thyroid function can be spontaneously achieved after using a low dose RAI in a rat model. The use of BM derived cells did not affect the re-establishment of thyroid function and might help restore the normal architecture after treatment with RAI. PMID:17233913

  19. Anti-thymocyte globulin induced non-cardiogenic pulmonary edema during renal transplantation.

    PubMed

    Parikh, Beena K; Bhosale, Guruprasad P; Shah, Veena R

    2011-10-01

    Non-cardiogenic pulmonary edema (NCPE) is a clinical syndrome characterized by simultaneous presence of severe hypoxemia, bilateral alveolar infiltrates on chest radiograph, without evidence of left atrial hypertension/congestive heart failure/fluid overload. The diagnosis of drugrelated NCPE relies upon documented exclusion of other causes of NCPE like gastric aspiration, sepsis, trauma, negative pressure pulmonary edema. We describe a 28year-old, 50 kg male with ASA risk III posted for laparoscopic renal transplantation, who developed NCPE after 4 hours of administration of rabbit anti-human thymocyte immunoglobulin (ATG). He was successfully treated with mechanical ventilatory support and adjuvant therapy. This report emphasizes that this fatal complication may occur with use of ATG.

  20. Association of Campylobacter pylori with induced expression of class II transplantation antigens on gastric epithelial cells.

    PubMed Central

    Engstrand, L; Scheynius, A; Påhlson, C; Grimelius, L; Schwan, A; Gustavsson, S

    1989-01-01

    Campylobacter pylori was identified with immunoperoxidase staining and a mouse monoclonal antibody directed against C. pylori in gastric biopsy specimens from 24 patients with gastritis. C. pylori was not found in gastric biopsy specimens from six subjects with histologically normal mucosa. The monoclonal antibody, which was reactive with a surface protein of approximately 20 kilodaltons, was found to be specific for C. pylori, and the immunoperoxidase staining proved to be more sensitive and rapid than culture in detecting the organism. In the tissue specimens where C. pylori was detected with the monoclonal antibody, there was a strong expression of class II transplantation antigens on the epithelial cells and an increased number of T lymphocytes. These findings indicate that C. pylori may initiate local immune responses. Images PMID:2645211

  1. Hand transplantation.

    PubMed

    Amer, Hatem; Carlsen, Brian T; Dusso, Jennifer L; Edwards, Brooks S; Moran, Steven L

    2011-05-01

    The first successful hand transplant was performed in 1998, opening up a new possibility for patients who have suffered mutilating hand injuries. Since then, more than 60 such procedures have been performed throughout the world. This article describes the evolution of hand transplantation, outcomes of patients listed in the International Registry of Hand and Composite Tissue Transplantation, and ethical issues involved in hand transplantation. It also describes the hand transplantation program at Mayo Clinic, which was established in 2010.

  2. Characterization of transfusion-elicited acute antibody-mediated rejection in a rat model of kidney transplantation.

    PubMed

    Huang, G; Wilson, N A; Reese, S R; Jacobson, L M; Zhong, W; Djamali, A

    2014-05-01

    Animal models of antibody-mediated rejection (ABMR) may provide important evidence supporting proof of concept. We elicited donor-specific antibodies (DSA) by transfusion of donor blood (Brown Norway RT1(n) ) into a complete mismatch recipient (Lewis RT1(l) ) 3 weeks prior to kidney transplantation. Sensitized recipients had increased anti-donor splenocyte IgG1, IgG2b and IgG2c DSA 1 week after transplantation. Histopathology was consistent with ABMR characterized by diffuse peritubular capillary C4d and moderate microvascular inflammation with peritubular capillaritis + glomerulitis > 2. Immunofluorescence studies of kidney allograft tissue demonstrated a greater CD68/CD3 ratio in sensitized animals, primarily of the M1 (pro-inflammatory) phenotype, consistent with cytokine gene analyses that demonstrated a predominant T helper (TH )1 (interferon-γ, IL-2) profile. Immunoblot analyses confirmed the activation of the M1 macrophage phenotype as interferon regulatory factor 5, inducible nitric oxide synthase and phagocytic NADPH oxidase 2 were significantly up-regulated. Clinical biopsy samples in sensitized patients with acute ABMR confirmed the dominance of M1 macrophage phenotype in humans. Despite the absence of tubulitis, we were unable to exclude the effects of T cell-mediated rejection. These studies suggest that M1 macrophages and TH 1 cytokines play an important role in the pathogenesis of acute mixed rejection in sensitized allograft recipients.

  3. Point mutation in activated c-Ha-ras gene of a chemically induced transplantable human pancreas carcinoma

    SciTech Connect

    Maheshwari, K.K.; Parsa, I.

    1986-03-05

    The authors have reported a model of human pancreas carcinogenesis where repeated treatment with MNU of explants results in the development of transplantable carcinoma. This report compares the endonuclease digests of DNAs from normal human pancreas (HP) and MNU-induced transplantable tumor (HP-T1) analyzed with /sup 32/P-labelled Ha-ras probe prepared from clone BS-9. The hybridization patterns of BamHI, BglII, EcoRI and HindIII digests of HP were significantly different from those of HP-T1. In EcoRI digests a 3.0 kb fragments of HP-T1 DNA hybridized with Ha-ras probe instead of a 4.3 kb fragments seen in HP DNA. The pattern for HindIII digests was similar to those of EcoRI. The BgIII digests of HP DNA revealed two hybridizing fragments of 8.0 and 4.3 kb whereas those of HP-T1 DNA fragments measured 8.5 and 4.0 kb. BamHI treated HP DNA showed only hybridizing fragments of 6.6 kb while the HP-T1 DNA showed to hybridizing fragments of 6.8 and 7.2 kb. The digested DNAs by HhaI, HinfI, KpnI, pstI, PvuII, SaII, SstI, TaqI and XbaI showed similar hybridization profiles. The point mutation in c-Ha-ras was examined in the HpaII and MspI double digests of both DNAs by 0.6 Kb SmaI fragments of pEJ. The hybridized fragments measured 412 and 355 bp in DNA digests from tumor and normal pancreas respectively.

  4. Microarray expression profiles of genes in lung tissues of rats subjected to focal cerebral ischemia-induced lung injury following bone marrow-derived mesenchymal stem cell transplantation

    PubMed Central

    Hu, Yue; Xiong, Liu-Lin; Zhang, Piao; Wang, Ting-Hua

    2017-01-01

    Ischemia-induced stroke is the most common disease of the nervous system and is associated with a high mortality rate worldwide. Cerebral ischemia may lead to remote organ dysfunction, particular in the lungs, resulting in lung injury. Nowadays, bone marrow-derived mesenchymal stem cells (BMSCs) are widely studied in clinical trials as they may provide an effective solution to the treatment of neurological and cardiac diseases; however, the underlying molecular mechanisms remain unknown. In this study, a model of permanent focal cerebral ischemia-induced lung injury was successfully established and confirmed by neurological evaluation and lung injury scores. We demonstrated that the transplantation of BMSCs (passage 3) via the tail vein into the lung tissues attenuated lung injury. In order to elucidate the underlying molecular mechanisms, we analyzed the gene expression profiles in lung tissues from the rats with focal cerebral ischemia and transplanted with BMSCs using a Gene microarray. Moreover, the Gene Ontology database was employed to determine gene function. We found that the phosphoinositide 3-kinase (PI3K)-AKT signaling pathway, transforming growth factor-β (TGF-β) and platelet-derived growth factor (PDGF) were downregulated in the BMSC transplantation groups, compared with the control group. These results suggested that BMSC transplantation may attenuate lung injury following focal cerebral ischemia and that this effect is associated with the downregulation of TGF-β, PDGF and the PI3K-AKT pathway. PMID:27922691

  5. Microarray expression profiles of genes in lung tissues of rats subjected to focal cerebral ischemia-induced lung injury following bone marrow-derived mesenchymal stem cell transplantation.

    PubMed

    Hu, Yue; Xiong, Liu-Lin; Zhang, Piao; Wang, Ting-Hua

    2017-01-01

    Ischemia-induced stroke is the most common disease of the nervous system and is associated with a high mortality rate worldwide. Cerebral ischemia may lead to remote organ dysfunction, particular in the lungs, resulting in lung injury. Nowadays, bone marrow-derived mesenchymal stem cells (BMSCs) are widely studied in clinical trials as they may provide an effective solution to the treatment of neurological and cardiac diseases; however, the underlying molecular mechanisms remain unknown. In this study, a model of permanent focal cerebral ischemia-induced lung injury was successfully established and confirmed by neurological evaluation and lung injury scores. We demonstrated that the transplantation of BMSCs (passage 3) via the tail vein into the lung tissues attenuated lung injury. In order to elucidate the underlying molecular mechanisms, we analyzed the gene expression profiles in lung tissues from the rats with focal cerebral ischemia and transplanted with BMSCs using a Gene microarray. Moreover, the Gene Ontology database was employed to determine gene function. We found that the phosphoinositide 3-kinase (PI3K)-AKT signaling pathway, transforming growth factor-β (TGF-β) and platelet-derived growth factor (PDGF) were downregulated in the BMSC transplantation groups, compared with the control group. These results suggested that BMSC transplantation may attenuate lung injury following focal cerebral ischemia and that this effect is associated with the downregulation of TGF-β, PDGF and the PI3K-AKT pathway.

  6. Miconazole mucoadhesive buccal tablet in high-dose therapy with autologous stem cell transplantation (HDT/ASCT)-induced mucositis.

    PubMed

    Orvain, C; Moles-Moreau, M P; François, S; Mercier, M; Moal, F; Hamel, J F; Parot-Schinkel, E; Ifrah, N; Hunault-Berger, M; Tanguy-Schmidt, A

    2015-02-01

    Oral mucositis is a major cause of morbidity in high-dose therapy/autologous stem cell transplantation (HDT/ASCT), where microbial colonization has an important pathological implication. In this study, we evaluated the impact of miconazole mucoadhesive buccal tablet (MBT) on mucositis-related complications. During two consecutive 34-month periods, patients treated with HDT/ASCT in our hematology department received either miconazole MBT (60 patients) or conventional oral amphotericin B suspensions three times a day (44 patients) in order to prevent or decrease chemotherapy-induced mucositis. The use of miconazole MBT is associated with less infectious complications as indicated by shorter antibiotic use (7.8 vs. 12.3 days; p < 0.0001), shorter intravenous antifungal use (1.4 vs. 3.6 days; p = 0.02), and a trend towards less yeast contamination in stool samples. Less patients required any analgesic drugs during hospitalization in the miconazole MBT group (18 vs. 7 %; p = 0.09). Indirect indicators of chemotherapy-induced mucositis (duration of hospitalization, morphine use) were in favor of miconazole MBT in patients with multiple myeloma (MM) but not for those with lymphoma. This study suggests that miconazole MBT provides a valid alternative to oral amphotericin B suspensions in regards to mucositis-related complications. A prospective and randomized study is warranted to establish the definite role of miconazole MBT.

  7. The long-term outcome of treated sensitized patients who undergo heart transplantation

    PubMed Central

    Kobashigawa, Jon A.; Patel, Jignesh K.; Kittleson, Michelle M.; Kawano, Matt A.; Kiyosaki, Krista K.; Davis, Stephanie N.; Moriguchi, Jaime D.; Reed, Elaine F.; Ardehali, Abbas A.

    2013-01-01

    Background Sensitized patients prior to heart transplantation are reportedly at risk for hyperacute rejection and for poor outcome after heart transplantation. It is not known whether the reduction of circulating antibodies pre-transplant alters post-transplant outcome. Methods and Results Between July 1993 and July 2003, we reviewed 523 heart transplant patients of which 95 had pre-transplant panel reactive antibody (PRAs) >10%; 21/95 were treated pre-transplant for circulating antibodies. These 21 patients had PRAs > 10% (majority 50–100%) and were treated with combination therapy including plasmapheresis, intravenous gamma globulin and rituximab to reduce antibody counts. The 74 untreated patients with PRAs > 10% (untreated sensitized group) and those patients with PRAs < 10% (control group) were used for comparison. Routine post-transplant immunosuppression included triple-drug therapy. After desensitization therapy, circulating antibody levels pre-transplant decreased from a mean of 70.5 to 30.2%, which resulted in a negative prospective donor-specific crossmatch and successful heart transplantation. Compared to the untreated sensitized group and the control group, the treated sensitized group had similar five-yr survival (81.1% and 75.7% vs. 71.4%, respectively, p = 0.523) and freedom from cardiac allograft vasculopathy (74.3% and 72.7% vs. 76.2%, respectively, p = 0.850). Conclusion Treatment of sensitized patients pre-transplant appears to result in acceptable long-term outcome after heart transplantation. PMID:20973825

  8. N-acetylcysteine induces shedding of selectins from liver and intestine during orthotopic liver transplantation

    PubMed Central

    Taut, F J H; Schmidt, H; Zapletal, C M; Thies, J C; Grube, C; Motsch, J; Klar, E; Martin, E

    2001-01-01

    In orthotopic liver transplantation (OLT), N-acetylcysteine (NAC) reduces ischaemia/reperfusion (I/R) injury, improves liver synthesis function and prevents primary nonfunction of the graft. To further elucidate the mechanisms of these beneficial effects of NAC, we investigated influence of high-dose NAC therapy on the pattern of adhesion molecule release from liver and intestine during OLT. Nine patients receiving allograft OLT were treated with 150 mg NAC/kg during the first hour after reperfusion; 10 patients received the carrier only. One hour after reperfusion, samples of arterial, portal venous and hepatic venous plasma were taken and blood flow in the hepatic artery and the portal vein was measured. Absolute concentrations of sICAM-1, sVCAM-1, sP-selectin and sE-selectin were not markedly different. However, balance calculations showed release of selectins from NAC-treated livers as opposed to net uptake in controls (P ≤ 0·02 for sP-selectin). This shedding of selectins might be a contributing factor to the decrease in leucocyte adherence and improved haemodynamics found experimentally with NAC-treatment. PMID:11422213

  9. Physiological relaxation induced by horticultural activity: transplanting work using flowering plants

    PubMed Central

    2013-01-01

    Background Despite increasing attention and a growing volume of research data, little physiological evidence is available on the benefits of horticultural activity and the different effects on individuals. Therefore, the aim of the present study was to investigate the physiological effects of horticultural activity and to examine how differences in personality alter these effects. Results The effects of transplanting real flowers (horticultural activity) and handling artificial flowers (control activity) on human physiological activity were compared. On the first day, eight participants engaged in horticultural activity and another eight in the control activity. On the second day, participants switched roles. Participants’ physiological conditions during each activity were assessed by measuring the heart rate and heart rate variability (HRV). Psychological responses, which were measured using a semantic differential rating scale, showed that the horticultural activity promoted comfortable, soothed, and natural feelings, compared to the control activity. Analysis of physiological responses using two-way repeated measures analysis of variance (ANOVA) revealed that sympathetic nervous activity significantly decreased in the late time period (11 to 15 minutes) of horticultural activity only in the type A group. Conclusions This study supports the fact that the horticultural activity can enhance psychological and physiological relaxation effects, although these physiological effects can differ among individuals with different personalities. PMID:24112302

  10. Transplantation of bone marrow-derived mesenchymal stem cells rescues partially rachitic phenotypes induced by 1,25-Dihydroxyvitamin D deficiency in mice

    PubMed Central

    Zhang, Zengli; Yin, Shaomeng; Xue, Xian; Ji, Ji; Tong, Jian; Goltzman, David; Miao, Dengshun

    2016-01-01

    To determine whether the transplantation of bone marrow-derived mesenchymal stem cells (BM-MSCs) can improve the 1,25(OH)2D deficiency-induced rachitic phenotype, 2×106 BM-MSCs from wild-type mice or vehicle were transplanted by tail vein injection into mice deficient in 1,25(OH)2D due to targeted deletion of 1α(OH)ase (1α(OH)ase-/-). Our results show that 1α(OH)ase mRNA was expressed in the BM-MSCs derived from wild-type mice, and was detected in long bone, kidney and intestine from BM-MSC-transplanted 1α(OH)ase-/- recipients. Serum calcium, 1,25(OH)2D3 levels and body weight were significantly increased in BM-MSC-transplanted 1α(OH)ase-/- recipients compared to vehicle-treated 1α(OH)ase-/- mice. Skeletal mineralization improved in 1α(OH)ase-/- recipients as demonstrated by BMD measurement, micro-CT analysis and von Kossa staining of undecalcified sections. Expression levels of type I collagen, osteocalcin, bone sialoprotein and vitronectin and the size of calcified nodules were decreased in BM-MSC cultures from 1α(OH)ase-/- mice compared with those from wild-type mice, however, these parameters were increased in those from BM-MSCs-transplanted 1α(OH)ase-/- recipients compared with those from vehicle-treated 1α(OH)ase-/- mice. This study indicates that donor BM-MSCs cells can relocate to multiple tissues where they synthesize 1α(OH)ase and produce 1,25(OH)2D that contributes to the improvement of serum calcium and skeletal mineralization. Results from this study suggest that BM-MSC transplantation may provide a therapeutic approach to treatment of pseudovitamin D-deficiency rickets. PMID:27830022

  11. How deceased donor transplantation is impacting a decline in commercial transplantation-the Tamil Nadu experience.

    PubMed

    Abraham, Georgi; Reddy, Yuvaram N V; Amalorpavanathan, Joseph; Daniel, Dolly; Roy-Chaudhury, Prabir; Shroff, Sunil; Reddy, Yogesh

    2012-04-27

    India with a population of 1.2 billion has a renal transplantation rate of 3.25 per million population. The major cause of chronic kidney disease is hypertension and diabetes. The crude and age-adjusted incidence rates of end-stage renal disease are estimated to be 151 and 232 per million population, respectively, in India. There was a remarkable lack of knowledge in the public about deceased organ donation until a decade ago. However, the role played by the media and nongovernmental organizations in partnership with the government has emphasized and implemented deceased donor transplantation in certain states in India-to mention particularly, the Tamil Nadu model. In the last 2 years, deceased organ donation has reached 1.3 per million population in Tamil Nadu, thereby effectively eliminating commercial transplantation. There is no religious bar for organ donation. A central transplant coordinator appointed by the government oversees legitimate and transparent allocation of deceased organs both in the public and private facilities as per the transplant waiting list. This model also takes care of the poor sections of society by conducting donation and transplantation through government-run public facilities free of cost. In the last 2 years, deceased donor transplantation has been performed through this network procuring organs such as the heart, heart valves, lung, liver, kidneys, cornea, and skin. The infrastructural lack of immunological surveillance-including donor-specific antibody monitoring, human leukocyte antigen typing, and panel reactive antibody except in a few tertiary care centers-prevents allocation according to the immunological status of the recipient. This private-public partnership promoting deceased donor transplantation has effectively eliminated commercialization in transplantation in the state of Tamil Nadu with a population of 72 million which is a model for other regions of South Asia and developing countries.

  12. HLA-Mismatched Renal Transplantation without Maintenance Immunosuppression

    PubMed Central

    Kawai, Tatsuo; Cosimi, A. Benedict; Spitzer, Thomas R.; Tolkoff-Rubin, Nina; Suthanthiran, Manikkam; Saidman, Susan L.; Shaffer, Juanita; Preffer, Frederic I.; Ding, Ruchuang; Sharma, Vijay; Fishman, Jay A.; Dey, Bimalangshu; Ko, Dicken S.C.; Hertl, Martin; Goes, Nelson B.; Wong, Waichi; Williams, Winfred W.; Colvin, Robert B.; Sykes, Megan; Sachs, David H.

    2010-01-01

    Summary Five patients with end-stage renal disease received combined bone marrow and kidney transplants from HLA single-haplotype mismatched living related donors, with the use of a nonmyeloablative preparative regimen. Transient chimerism and reversible capillary leak syndrome developed in all recipients. Irreversible humoral rejection occurred in one patient. In the other four recipients, it was possible to discontinue all immunosuppressive therapy 9 to 14 months after the transplantation, and renal function has remained stable for 2.0 to 5.3 years since transplantation. The T cells from these four recipients, tested in vitro, showed donor-specific unresponsiveness and in specimens from allograft biopsies, obtained after withdrawal of immunosuppressive therapy, there were high levels of P3 (FOXP3) messenger RNA (mRNA) but not granzyme B mRNA. PMID:18216355

  13. Therapeutic Efficacy of Human Hepatocyte Transplantation in a SCID/uPA Mouse Model with Inducible Liver Disease

    PubMed Central

    Douglas, Donna N.; Kawahara, Toshiyasu; Sis, Banu; Bond, David; Fischer, Karl P.; Tyrrell, D. Lorne J.; Lewis, Jamie T.; Kneteman, Norman M.

    2010-01-01

    Background Severe Combined Immune Deficient (SCID)/Urokinase-type Plasminogen Activator (uPA) mice undergo liver failure and are useful hosts for the propagation of transplanted human hepatocytes (HH) which must compete with recipient-derived hepatocytes for replacement of the diseased liver parenchyma. While partial replacement by HH has proven useful for studies with Hepatitis C virus, complete replacement of SCID/uPA mouse liver by HH has never been achieved and limits the broader application of these mice for other areas of biomedical research. The herpes simplex virus type-1 thymidine kinase (HSVtk)/ganciclovir (GCV) system is a powerful tool for cell-specific ablation in transgenic animals. The aim of this study was to selectively eliminate murine-derived parenchymal liver cells from humanized SCID/uPA mouse liver in order to achieve mice with completely humanized liver parenchyma. Thus, we reproduced the HSVtk (vTK)/GCV system of hepatic failure in SCID/uPA mice. Methodology/Principal Findings In vitro experiments demonstrated efficient killing of vTK expressing hepatoma cells after GCV treatment. For in vivo experiments, expression of vTK was targeted to the livers of FVB/N and SCID/uPA mice. Hepatic sensitivity to GCV was first established in FVB/N mice since these mice do not undergo liver failure inherent to SCID/uPA mice. Hepatic vTK expression was found to be an integral component of GCV-induced pathologic and biochemical alterations and caused death due to liver dysfunction in vTK transgenic FVB/N and non-transplanted SCID/uPA mice. In SCID/uPA mice with humanized liver, vTK/GCV caused death despite extensive replacement of the mouse liver parenchyma with HH (ranging from 32–87%). Surprisingly, vTK/GCV-dependent apoptosis and mitochondrial aberrations were also localized to bystander vTK-negative HH. Conclusions/Significance Extensive replacement of mouse liver parenchyma by HH does not provide a secure therapeutic advantage against vTK/GCV-induced

  14. Amifostine Induces Antioxidant Enzymatic Activities in Normal Tissues and a Transplantable Tumor That Can Affect Radiation Response

    SciTech Connect

    Grdina, David J. Murley, Jeffrey S.; Kataoka, Yasushi; Baker, Kenneth L.; Kunnavakkam, Rangesh; Coleman, Mitchell C.; Spitz, Douglas R.

    2009-03-01

    Purpose: To determine whether amifostine can induce elevated manganese superoxide dismutase (SOD2) in murine tissues and a transplantable SA-NH tumor, resulting in a delayed tumor cell radioprotective effect. Methods and Materials: SA-NH tumor-bearing C3H mice were treated with a single 400 mg/kg or three daily 50 mg/kg doses of amifostine administered intraperitoneally. At selected time intervals after the last injection, the heart, liver, lung, pancreas, small intestine, spleen, and SA-NH tumor were removed and analyzed for SOD2, catalase, and glutathione peroxidase (GPx) enzymatic activity. The effect of elevated SOD2 enzymatic activity on the radiation response of SA-NH cells was determined. Results: SOD2 activity was significantly elevated in selected tissues and a tumor 24 h after amifostine treatment. Catalase and GPx activities remained unchanged except for significant elevations in the spleen. GPx was also elevated in the pancreas. SA-NH tumor cells exhibited a twofold elevation in SOD2 activity and a 27% elevation in radiation resistance. Amifostine administered in three daily fractions of 50 mg/kg each also resulted in significant elevations of these antioxidant enzymes. Conclusions: Amifostine can induce a delayed radioprotective effect that correlates with elevated levels of SOD2 activity in SA-NH tumor. If limited to normal tissues, this delayed radioprotective effect offers an additional potential for overall radiation protection. However, amifostine-induced elevation of SOD2 activity in tumors could have an unanticipated deleterious effect on tumor responses to fractionated radiation therapy, given that the radioprotector is administered daily just before each 2-Gy fractionated dose.

  15. Autologous bone marrow stromal cell transplantation as a treatment for acute radiation enteritis induced by a moderate dose of radiation in dogs.

    PubMed

    Xu, Wenda; Chen, Jiang; Liu, Xu; Li, Hongyu; Qi, Xingshun; Guo, Xiaozhong

    2016-05-01

    Radiation enteritis is one of the most common complications of cancer radiotherapy, and the development of new and effective measures for its prevention and treatment is of great importance. Adult bone marrow stromal stem cells (ABMSCs) are capable of self-renewal and exhibit low immunogenicity. In this study, we investigated ABMSC transplantation as a treatment for acute radiation enteritis. We developed a dog model of acute radiation enteritis using abdominal intensity-modulated radiation therapy in a single X-ray dose of 14 Gy. ABMSCs were cultured in vitro, identified via immunofluorescence and flow cytometry, and double labeled with CM-Dil and superparamagnetic iron oxide (SPIO) before transplantation, which took place 48 hours after abdominal irradiation in a single fraction. The dog model of acute radiation enteritis was transplanted with cultured ABMSCs labeled with CM-Dil and SPIO into the mesenteric artery through the femoral artery. Compared with untreated control groups, dogs treated with ABMSCs exhibited substantially longer survival time and improved relief of clinical symptoms. ABMSC transplantation induced the regeneration of the intestinal epithelium and the recovery of intestinal function. Furthermore, ABMSC transplantation resulted in elevated serum levels of the anti-inflammatory cytokine interleukin-11 (IL10) and intestinal radioprotective factors, such as keratinocyte growth factor, basic fibroblast growth factor-2, and platelet-derived growth factor-B while reducing the serum level of the inflammatory cytokine IL17. ABMSCs induced the regeneration of the intestinal epithelium and regulated the secretion of serum cytokines and the expression of radioprotective proteins and thus could be beneficial in the development of novel and effective mitigators of and protectors against acute radiation enteritis.

  16. Mechanical Loading Attenuates Radiation-Induced Bone Loss in Bone Marrow Transplanted Mice

    PubMed Central

    Govey, Peter M.; Zhang, Yue; Donahue, Henry J.

    2016-01-01

    Exposure of bone to ionizing radiation, as occurs during radiotherapy for some localized malignancies and blood or bone marrow cancers, as well as during space travel, incites dose-dependent bone morbidity and increased fracture risk. Rapid trabecular and endosteal bone loss reflects acutely increased osteoclastic resorption as well as decreased bone formation due to depletion of osteoprogenitors. Because of this dysregulation of bone turnover, bone’s capacity to respond to a mechanical loading stimulus in the aftermath of irradiation is unknown. We employed a mouse model of total body irradiation and bone marrow transplantation simulating treatment of hematologic cancers, hypothesizing that compression loading would attenuate bone loss. Furthermore, we hypothesized that loading would upregulate donor cell presence in loaded tibias due to increased engraftment and proliferation. We lethally irradiated 16 female C57Bl/6J mice at age 16 wks with 10.75 Gy, then IV-injected 20 million GFP(+) total bone marrow cells. That same day, we initiated 3 wks compression loading (1200 cycles 5x/wk, 10 N) in the right tibia of 10 of these mice while 6 mice were irradiated, non-mechanically-loaded controls. As anticipated, before-and-after microCT scans demonstrated loss of trabecular bone (-48.2% Tb.BV/TV) and cortical thickness (-8.3%) at 3 wks following irradiation. However, loaded bones lost 31% less Tb.BV/TV and 8% less cortical thickness (both p<0.001). Loaded bones also had significant increases in trabecular thickness and tissue mineral densities from baseline. Mechanical loading did not affect donor cell engraftment. Importantly, these results demonstrate that both cortical and trabecular bone exposed to high-dose therapeutic radiation remain capable of an anabolic response to mechanical loading. These findings inform our management of bone health in cases of radiation exposure. PMID:27936104

  17. Platelets in Early Antibody-Mediated Rejection of Renal Transplants

    PubMed Central

    Kuo, Hsiao-Hsuan; Fan, Ran; Dvorina, Nina; Chiesa-Vottero, Andres

    2015-01-01

    Antibody-mediated rejection is a major complication in renal transplantation. The pathologic manifestations of acute antibody-mediated rejection that has progressed to functional impairment of a renal transplant have been defined in clinical biopsy specimens. However, the initial stages of the process are difficult to resolve with the unavoidable variables of clinical studies. We devised a model of renal transplantation to elucidate the initial stages of humoral rejection. Kidneys were orthotopically allografted to immunodeficient mice. After perioperative inflammation subsided, donor-specific alloantibodies were passively transferred to the recipient. Within 1 hour after a single transfer of antibodies, C4d was deposited diffusely on capillaries, and von Willebrand factor released from endothelial cells coated intravascular platelet aggregates. Platelet-transported inflammatory mediators platelet factor 4 and serotonin accumulated in the graft at 100- to 1000-fold higher concentrations compared with other platelet-transported chemokines. Activated platelets that expressed P-selectin attached to vascular endothelium and macrophages. These intragraft inflammatory changes were accompanied by evidence of acute endothelial injury. Repeated transfers of alloantibodies over 1 week sustained high levels of platelet factor 4 and serotonin. Platelet depletion decreased platelet mediators and altered the accumulation of macrophages. These data indicate that platelets augment early inflammation in response to donor-specific antibodies and that platelet-derived mediators may be markers of evolving alloantibody responses. PMID:25145937

  18. The clinical impact of humoral immunity in pediatric renal transplantation.

    PubMed

    Chaudhuri, Abanti; Ozawa, Mikki; Everly, Matthew J; Ettenger, Robert; Dharnidharka, Vikas; Benfield, Mark; Mathias, Robert; Portale, Anthony; McDonald, Ruth; Harmon, William; Kershaw, David; Vehaskari, V Matti; Kamil, Elaine; Baluarte, H Jorge; Warady, Bradley; Li, Li; Sigdel, Tara K; Hsieh, Szu-chuan; Dai, Hong; Naesens, Maarten; Waskerwitz, Janie; Salvatierra, Oscar; Terasaki, Paul I; Sarwal, Minnie M

    2013-03-01

    The development of anti-donor humoral responses after transplantation associates with higher risks for acute rejection and 1-year graft survival in adults, but the influence of humoral immunity on transplant outcomes in children is not well understood. Here, we studied the evolution of humoral immunity in low-risk pediatric patients during the first 2 years after renal transplantation. Using data from 130 pediatric renal transplant patients randomized to steroid-free (SF) or steroid-based (SB) immunosuppression in the NIH-SNSO1 trial, we correlated the presence of serum anti-HLA antibodies to donor HLA antigens (donor-specific antibodies) and serum MHC class 1-related chain A (MICA) antibody with both clinical outcomes and histology identified on protocol biopsies at 0, 6, 12, and 24 months. We detected de novo antibodies after transplant in 24% (23% of SF group and 25% of SB group), most often after the first year. Overall, 22% developed anti-HLA antibodies, of which 6% were donor-specific antibodies, and 6% developed anti-MICA antibody. Presence of these antibodies de novo associated with significantly higher risks for acute rejection (P=0.02), chronic graft injury (P=0.02), and decline in graft function (P=0.02). In summary, antibodies to HLA and MICA antigens appear in approximately 25% of unsensitized pediatric patients, placing them at greater risk for acute and chronic rejection with accelerated loss of graft function. Avoiding steroids does not seem to modify this incidence. Whether serial assessments of these antibodies after transplant could guide individual tailoring of immunosuppression requires additional study.

  19. The Clinical Impact of Humoral Immunity in Pediatric Renal Transplantation

    PubMed Central

    Chaudhuri, Abanti; Ozawa, Mikki; Everly, Matthew J.; Ettenger, Robert; Dharnidharka, Vikas; Benfield, Mark; Mathias, Robert; Portale, Anthony; McDonald, Ruth; Harmon, William; Kershaw, David; Vehaskari, V. Matti; Kamil, Elaine; Baluarte, H. Jorge; Warady, Bradley; Li, Li; Sigdel, Tara K.; Hsieh, Szu-chuan; Dai, Hong; Naesens, Maarten; Waskerwitz, Janie; Salvatierra, Oscar; Terasaki, Paul I.

    2013-01-01

    The development of anti-donor humoral responses after transplantation associates with higher risks for acute rejection and 1-year graft survival in adults, but the influence of humoral immunity on transplant outcomes in children is not well understood. Here, we studied the evolution of humoral immunity in low-risk pediatric patients during the first 2 years after renal transplantation. Using data from 130 pediatric renal transplant patients randomized to steroid-free (SF) or steroid-based (SB) immunosuppression in the NIH-SNSO1 trial, we correlated the presence of serum anti-HLA antibodies to donor HLA antigens (donor-specific antibodies) and serum MHC class 1-related chain A (MICA) antibody with both clinical outcomes and histology identified on protocol biopsies at 0, 6, 12, and 24 months. We detected de novo antibodies after transplant in 24% (23% of SF group and 25% of SB group), most often after the first year. Overall, 22% developed anti-HLA antibodies, of which 6% were donor-specific antibodies, and 6% developed anti-MICA antibody. Presence of these antibodies de novo associated with significantly higher risks for acute rejection (P=0.02), chronic graft injury (P=0.02), and decline in graft function (P=0.02). In summary, antibodies to HLA and MICA antigens appear in approximately 25% of unsensitized pediatric patients, placing them at greater risk for acute and chronic rejection with accelerated loss of graft function. Avoiding steroids does not seem to modify this incidence. Whether serial assessments of these antibodies after transplant could guide individual tailoring of immunosuppression requires additional study. PMID:23449533

  20. Lung Transplantation

    MedlinePlus

    ... are used to treat people who have severe COPD Cystic fibrosis Idiopathic pulmonary fibrosis Alpha-1 antitrypsin deficiency Pulmonary hypertension Complications of lung transplantation include rejection of the transplanted lung and infection. NIH: National Heart, Lung, and Blood Institute

  1. Hair transplant

    MedlinePlus

    ... page: //medlineplus.gov/ency/article/007205.htm Hair transplant To use the sharing features on this page, please enable JavaScript. A hair transplant is a surgical procedure to improve baldness. Description ...

  2. Liver Transplant

    MedlinePlus

    ... Home > Your Liver > Liver Disease Information > Liver Transplant Liver Transplant Explore this section to learn more about ... resource. www.paulcox.com.au Why is the liver important? The liver is the second largest organ ...

  3. Cornea Transplant

    MedlinePlus

    ... who had several conditions, such as certain central nervous system conditions, infections, and prior eye surgery or eye conditions, or from people who died from an unknown cause. During your cornea transplant On the day of your cornea transplant, you' ...

  4. Pancreas transplant

    MedlinePlus

    ... In: Cameron JL, Cameron AM, eds. Current Surgical Therapy . 11th ed. Philadelphia, PA: Elsevier Saunders; 2014:511-5. Gruessner AC, Gruessner RWG. Pancreas and kidney transplantation for diabetic nephropathy. In: Morris PJ, Knechtle SJ, eds. Kidney Transplantation: ...

  5. Future of liver transplantation: non-human primates for patient-specific organs from induced pluripotent stem cells.

    PubMed

    Sanal, Madhusudana Girija

    2011-08-28

    Strategies to fill the huge gap in supply versus demand of human organs include bioartificial organs, growing humanized organs in animals, cell therapy, and implantable bioengineered constructs. Reproducing the complex relations between different cell types, generation of adequate vasculature, and immunological complications are road blocks in generation of bioengineered organs, while immunological complications limit the use of humanized organs produced in animals. Recent developments in induced pluripotent stem cell (iPSC) biology offer a possibility of generating human, patient-specific organs in non-human primates (NHP) using patient-derived iPSC and NHP-derived iPSC lacking the critical developmental genes for the organ of interest complementing a NHP tetraploid embryo. The organ derived in this way will have the same human leukocyte antigen (HLA) profile as the patient. This approach can be curative in genetic disorders as this offers the possibility of gene manipulation and correction of the patient's genome at the iPSC stage before tetraploid complementation. The process of generation of patient-specific organs such as the liver in this way has the great advantage of making use of the natural signaling cascades in the natural milieu probably resulting in organs of great quality for transplantation. However, the inexorable scientific developments in this direction involve several social issues and hence we need to educate and prepare society in advance to accept the revolutionary consequences, good, bad and ugly.

  6. Stage-Specific Human Induced Pluripotent Stem Cells Map the Progression of Myeloid Transformation to Transplantable Leukemia.

    PubMed

    Kotini, Andriana G; Chang, Chan-Jung; Chow, Arthur; Yuan, Han; Ho, Tzu-Chieh; Wang, Tiansu; Vora, Shailee; Solovyov, Alexander; Husser, Chrystel; Olszewska, Malgorzata; Teruya-Feldstein, Julie; Perumal, Deepak; Klimek, Virginia M; Spyridonidis, Alexandros; Rampal, Raajit K; Silverman, Lewis; Reddy, E Premkumar; Papaemmanuil, Elli; Parekh, Samir; Greenbaum, Benjamin D; Leslie, Christina S; Kharas, Michael G; Papapetrou, Eirini P

    2017-03-02

    Myeloid malignancy is increasingly viewed as a disease spectrum, comprising hematopoietic disorders that extend across a phenotypic continuum ranging from clonal hematopoiesis to myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). In this study, we derived a collection of induced pluripotent stem cell (iPSC) lines capturing a range of disease stages encompassing preleukemia, low-risk MDS, high-risk MDS, and secondary AML. Upon their differentiation, we found hematopoietic phenotypes of graded severity and/or stage specificity that together delineate a phenotypic roadmap of disease progression culminating in serially transplantable leukemia. We also show that disease stage transitions, both reversal and progression, can be modeled in this system using genetic correction or introduction of mutations via CRISPR/Cas9 and that this iPSC-based approach can be used to uncover disease-stage-specific responses to drugs. Our study therefore provides insight into the cellular events demarcating the initiation and progression of myeloid transformation and a new platform for testing genetic and pharmacological interventions.

  7. Future of liver transplantation: Non-human primates for patient-specific organs from induced pluripotent stem cells

    PubMed Central

    Sanal, Madhusudana Girija

    2011-01-01

    Strategies to fill the huge gap in supply versus demand of human organs include bioartificial organs, growing humanized organs in animals, cell therapy, and implantable bioengineered constructs. Reproducing the complex relations between different cell types, generation of adequate vasculature, and immunological complications are road blocks in generation of bioengineered organs, while immunological complications limit the use of humanized organs produced in animals. Recent developments in induced pluripotent stem cell (iPSC) biology offer a possibility of generating human, patient-specific organs in non-human primates (NHP) using patient-derived iPSC and NHP-derived iPSC lacking the critical developmental genes for the organ of interest complementing a NHP tetraploid embryo. The organ derived in this way will have the same human leukocyte antigen (HLA) profile as the patient. This approach can be curative in genetic disorders as this offers the possibility of gene manipulation and correction of the patient’s genome at the iPSC stage before tetraploid complementation. The process of generation of patient-specific organs such as the liver in this way has the great advantage of making use of the natural signaling cascades in the natural milieu probably resulting in organs of great quality for transplantation. However, the inexorable scientific developments in this direction involve several social issues and hence we need to educate and prepare society in advance to accept the revolutionary consequences, good, bad and ugly. PMID:21990949

  8. ST Elevation Infarction after Heart Transplantation Induced by Coronary Spasms and Mural Thrombus Detected by Optical Coherence Tomography

    PubMed Central

    Holm, Niels Ramsing; Eiskjær, Hans; Poulsen, Steen Hvitfeldt; Maeng, Michael; Terkelsen, Christian Juhl; Christiansen, Evald Høj

    2016-01-01

    The case illustrates the possible link between coronary spasms, intraluminal thrombus formation, and widespread organized and layered thrombi in HTx patients. Furthermore, the case underlines the clinical value of OCT as a novel method for high-resolution vessel imaging in heart-transplanted (HTx) patients with coronary spasms and suspected coronary artery disease. Coronary spasms and sudden death are frequent complications after HTx. The underlying mechanisms leading to these complications are unknown. The present case displays the clinical course of a 19-year-old HTx patient who was hospitalized due to acute myocardial infarction induced by severe coronary spasms. The patients remained unstable on conservative therapy. Therefore, an optical coherence tomography (OCT) was performed and revealed massive, organized thrombi in the left main coronary artery, the circumflex coronary artery, and the left anterior descending coronary artery. The patient was stabilized after percutaneous coronary intervention. As a mural thrombus often goes undetected by coronary angiography, OCT may prove benefit in HTx patients with myocardial infarction or suspected coronary spasms. PMID:27980873

  9. Characterization of IFNγ-producing natural killer cells induced by cytomegalovirus reactivation after haploidentical hematopoietic stem cell transplantation

    PubMed Central

    Jin, Fengyan; Lin, Hai; Gao, Sujun; Wang, Hengxiang; Yan, Hongmin; Guo, Jinglong; Hu, Zheng; Jin, Chunhui; Wang, Yongqi; Wang, Zhidong; Zhao, Yangzhi; Liu, Yu; Zheng, Xiaoli; Tan, Yehui; Li, Wei; Dai, Yun; Yang, Yanping

    2017-01-01

    During human cytomegalovirus (CMV) infection after umbilical cord blood or HLA-matched hematopoietic stem cell transplantation (HSCT), a population of NKG2C-expressing natural killer (NK) cells expand and persist. The expanded NK cells express high levels of inhibitory killer immunoglobulin-like receptors (KIR) specific for self-HLA and potently produce IFNγ. However, it remains unknown whether similar events would occur after haploidentical HSCT (haplo-HSCT). Here, we demonstrated that IFNγ-producing NK cells were expanded in haplo-HSCT patients with CMV reactivation. We then identified these expanded cells as a subset of CD56dim NK cells that expressed higher levels of both NKG2C and KIR, but lower level of NKG2A. Functionally, the subset of NK cells expressing NKG2C and self-KIR in patients with CMV reactivation accounted for IFNγ production in response to K562 cells. However, these phenomena were not observed in patients without CMV reactivation. We therefore characterized a subset of NK cells with the CD56dim, NKG2C+, and self-KIR+ phenotype that expanded and were responsible for IFNγ production during CMV infection after haplo-HSCT. Together, these findings support a notion that CMV reactivation induces expansion of more mature NK cells with memory-like features, which contributes to long-term control of both CMV infection and leukemia relapse after haplo-HSCT. PMID:27980216

  10. Cytokine induced killer cells as adoptive immunotherapy strategy to augment graft versus tumor after hematopoietic cell transplantation.

    PubMed

    Sangiolo, D; Mesiano, G; Carnevale-Schianca, F; Piacibello, W; Aglietta, M; Cignetti, A

    2009-07-01

    Donor lymphocyte infusion (DLI) is used to increase the graft versus tumor (GVT) effect after allogeneic hematopoietic cell transplant (HCT). The limited spectrum of activity and high risk of graft versus host disease (GVHD) remain major limitations of this approach. The finding of new cell populations for adoptive immunotherapy, with the ability to separate GVT from GVHD, would be useful. Here we review the main basic, preclinical and clinical research on cytokine-induced killer (CIK) cells, highlighting the aspects of their antitumor and alloreactive potentials that might favourably affect the balance between GVT and GVHD. CIK cells are ex vivo-expanded T lymphocytes sharing NK markers and endowed with a potent MHC-unrestricted antitumor activity against haematological and solid malignancies. Studies in preclinical animal models have demonstrated their low GVHD potential when infused across MHC-barriers, and recent clinical studies seem to confirm these findings in patients with hematological malignancies relapsing after HCT. If consolidated with larger clinical trials, adoptive immunotherapy with CIK cells might represent an effective alternative to classic DLI, helping HCT to succesfully meet current challenges like the extension across major HLA-barriers and application to solid tumors.

  11. Desensitization for solid organ and hematopoietic stem cell transplantation

    PubMed Central

    Zachary, Andrea A; Leffell, Mary S

    2014-01-01

    Desensitization protocols are being used worldwide to enable kidney transplantation across immunologic barriers, i.e. antibody to donor HLA or ABO antigens, which were once thought to be absolute contraindications to transplantation. Desensitization protocols are also being applied to permit transplantation of HLA mismatched hematopoietic stem cells to patients with antibody to donor HLA, to enhance the opportunity for transplantation of non-renal organs, and to treat antibody-mediated rejection. Although desensitization for organ transplantation carries an increased risk of antibody-mediated rejection, ultimately these transplants extend and enhance the quality of life for solid organ recipients, and desensitization that permits transplantation of hematopoietic stem cells is life saving for patients with limited donor options. Complex patient factors and variability in treatment protocols have made it difficult to identify, precisely, the mechanisms underlying the downregulation of donor-specific antibodies. The mechanisms underlying desensitization may differ among the various protocols in use, although there are likely to be some common features. However, it is likely that desensitization achieves a sort of immune detente by first reducing the immunologic barrier and then by creating an environment in which an autoregulatory process restricts the immune response to the allograft. PMID:24517434

  12. Intestinal and multivisceral transplantation

    PubMed Central

    Meira, Sérgio Paiva; Guardia, Bianca Della; Evangelista, Andréia Silva; Matielo, Celso Eduardo Lourenço; Neves, Douglas Bastos; Pandullo, Fernando Luis; Felga, Guilherme Eduardo Gonçalves; Alves, Jefferson André da Silva; Curvelo, Lilian Amorim; Diaz, Luiz Gustavo Guedes; Rusi, Marcela Balbo; Viveiros, Marcelo de Melo; de Almeida, Marcio Dias; Epstein, Marina Gabrielle; Pedroso, Pamella Tung; Salvalaggio, Paolo; Meirelles, Roberto Ferreira; Rocco, Rodrigo Andrey; de Almeida, Samira Scalso; de Rezende, Marcelo Bruno

    2015-01-01

    Intestinal transplantation has shown exceptional growth over the past 10 years. At the end of the 1990’s, intestinal transplantation moved out of the experimental realm to become a routine practice in treating patients with severe complications related to total parenteral nutrition and intestinal failure. In the last years, several centers reported an increasing improvement in survival outcomes (about 80%), during the first 12 months after surgery, but long-term survival is still a challenge. Several advances led to clinical application of transplants. Immunosuppression involved in intestinal and multivisceral transplantation was the biggest gain for this procedure in the past decade due to tacrolimus, and new inducing drugs, mono- and polyclonal anti-lymphocyte antibodies. Despite the advancement of rigid immunosuppression protocols, rejection is still very frequent in the first 12 months, and can result in long-term graft loss. The future of intestinal transplantation and multivisceral transplantation appears promising. The major challenge is early recognition of acute rejection in order to prevent graft loss, opportunistic infections associated to complications, post-transplant lymphoproliferative disease and graft versus host disease; and consequently, improve results in the long run. PMID:25993080

  13. Uterus transplantation.

    PubMed

    Altchek, Albert

    2003-05-01

    Until recently, only life and death situations warranted organ transplantation. Nonvital transplantation, to further a patient s wishes and goals, was not considered justified. It can be argued, however, that this distinction is not morally significant. Patients with kidney failure, for example, can be kept alive by dialysis. But their quality of life would be greatly enhanced by kidney transplant, which is thus considered a justified procedure. So a spectrum of rationales may justify transplantation. Transplantation of the uterus would relieve the anguish of women who greatly desire to conceive a child. Some women do not have a uterus. In some cases this is due to a congenital absence (Rokitansky s syndrome). In other cases, surgical removal of the uterus was required to repair an obstetrical rupture. With a transplanted uterus, many of these women could have the opportunity to become pregnant as a result of nonvital organ transplant. While other organ transplant donations most often come from cadavers and less often from living donors (kidney or partial liver), the donor source for a uterus may be an otherwise healthy living patient who requires uterus removal as a standard care procedure. Furthermore, it should be possible to remove the transplanted uterus from the recipient after successful pregnancies, so the patient would not be subjected to lifelong antirejection medications. Since animal uterus transplantation has been done successfully, human uterus transplantation might be considered for select cases. One such case has been reported.

  14. Derivation of transplantable 7,12-dimethylbenz(a)anthracene-induced chicken fibrosarcoma lines: differences in metastasizing properties and organ specificity

    SciTech Connect

    Galton, J.E.; Xue, B.; Hochwald, G.M.; Thorbecke, G.J.

    1982-08-01

    Transplantable 7,12-dimethylbenz(a)anthracene-induced SC chicken fibrosarcoma (CHCT-NYU) lines were studied for their ability to grow in internal organs after iv injection (artificial metastases) into 1- to 3-week-old chickens. Some tumor lines were recently derived, whereas others were studied after many serial subcutaneous transplantations. Artificial metastases were seen in the stomach, pancreas, lungs, heart, and muscle, and occasionally in the kidneys and liver. Agammaglobulinemic recipients showed more extensive organ involvement than normal recipients of the same age. Whole-body ..gamma..-irradiation enhanced the incidence of artificial metastases, particularly in lungs. Antibody from the serum of a primary tumor-bearing host reduced the growth of the corresponding tumor in many organs. The metastatic pattern of line CHCT-NYU4 was a relatively stable property. However, intravenous transplantation of tumor cells from line CHCT-NYU4 taken from the liver, lungs, and pancreas of a single recipient established sublines with changes in organ specificity. After a few such serial transplants of liver-derived tumor, a line was derived that grew virtually in the liver alone. A subline with preference for growth in lungs was also obtained, but its ability to grow in the pancreas persisted. A pancreas-derived tumor line also grew in the liver and lungs. Subcutaneous transplants of tissue fragments of the lung-derived tumor line caused the appearance of spontaneous metastases in lungs. The incidence of spontaneous metastases with the lung-derived line was much greater than that with the liver-derived line or with the original CHCT-NYU4 line.

  15. Pancreas Transplantation

    PubMed Central

    Sutherland, David ER

    2010-01-01

    Diabetes mellitus is generally treated with oral diabetic drugs and/or insulin. However, the morbidity and mortality associated with this condition increases over time, even in patients receiving intensive insulin treatment, and this is largely attributable to diabetic complications or the insulin therapy itself. Pancreas transplantation in humans was first conducted in 1966, since when there has been much debate regarding the legitimacy of this procedure. Technical refinements and the development of better immunosuppressants and better postoperative care have brought about marked improvements in patient and graft survival and a reduction in postoperative morbidity. Consequently, pancreas transplantation has become the curative treatment modality for diabetes, particularly for type I diabetes. An overview of pancreas transplantation is provided herein, covering the history of pancreas transplantation, indications for transplantation, cadaveric and living donors, surgical techniques, immunosuppressants, and outcome following pancreas transplantation. The impact of successful pancreas transplantation on the complications of diabetes will also be reviewed briefly. PMID:21253293

  16. De novo anti-HLA antibody responses after renal transplantation: detection and clinical impact.

    PubMed

    Seveso, Michela; Bosio, Erika; Ancona, Ermanno; Cozzi, Emanuele

    2009-01-01

    Numerous retrospective and prospective studies have been conducted to determine the prevalence and significance on long-term graft survival of de novo post-transplant donor-specific antibodies (DSA), directed against both HLA and non-HLA molecules. Moreover, it has been postulated that the development of anti-HLA antibodies may precede the clinical manifestation of chronic rejection, therefore being considered a predictive marker. In this context, the detection of C4d deposition in the failing kidney in patients presenting de novo DSA supports the hypothesis that antibody production and complement deposition could be involved in the pathogenesis of graft failure. Due to the development of more sensitive meth-ods to detect alloantibodies, the number of transplanted patients which show the appearance of DSA at different times following transplantation has increased. Nevertheless, this increased sensitivity has allowed the identification of circulating donor-specific anti-HLA antibodies in many patients with otherwise good graft function. Such findings are worthy of discussion, as it has yet to be determined whether these circulating antibodies can only be considered an early marker of humoral rejection or whether they could play a protective role. The possible relevance of the post-transplant appearance of non-DSA should also be mentioned. This review will focus primarily on de novo anti-donor HLA antibody responses in kidney transplant patients and will only briefly deal with anti-non HLA and non-DSA that will be discussed elsewhere in this issue.

  17. Protein a Immunoadsorption May Hamper the Decision to Transplant Due to Interference With CDC Crossmatch Results.

    PubMed

    Koefoed-Nielsen, Pernille; Bistrup, Claus; Christiansen, Mette

    2016-06-03

    Transplanting immunized patients requires immunological monitoring in the pretransplant phase to follow reduction of donor specific HLA antibodies (DSA) after Staphylococcus aureus protein A (SPA) immunoadsorption (IA) or therapeutic plasma exchange followed by IVIG and Rituximab administration. Pretreatment aims to significantly reduce DSA strength. The Tissue Typing Lab at Aarhus University Hospital performs immunological monitoring of approximately 150 kidney transplantation patients per year from two transplant centers. From 2012 to 2013, we experienced seven patients desensitized using SPA IA, initially presenting negative cytotoxic complement dependent (CDC) T-cell crossmatches but positive B and T cell flowcytometric crossmatch, who despite significant DSA reduction developed weakly positive CDC T-cell crossmatch shortly prior to transplantation. We hypothesised that leached SPA during IA could be the cause, as the complication was not observed in patients who received plasma exchanges. We found that the positive CDC was not donor specific and SPA column material incubated with control serum reproduced a positive CDC T-cell crossmatch. Finally, we detected leached SPA in one of the patient samples using a highly sensitive time-resolved fluorescent assay. In conclusion, the results emphasize the importance of carefully considering CDC crossmatch results subsequent to IA, before a planned transplantation is either postponed or cancelled. J. Clin. Apheresis 00:000-000, 2016. © 2016 Wiley Periodicals, Inc.

  18. Simultaneous Occurrence of Varicella Zoster Virus-Induced Pancreatitis and Hepatitis in a Renal Transplant Recipient: A Case Report and Review of Literature

    PubMed Central

    Chhabra, Puneet; Ranjan, Priyadarshi; Bhasin, Deepak K

    2017-01-01

    Introduction: Gastrointestinal complications are common after renal transplantation, including oral lesions, esophagitis, gastritis, diarrhea, and colon carcinoma. The differential diagnosis is difficult in this scenario because multiple factors such as drugs, infections, and preexisting gastrointestinal disease come into play. Case Presentation: We report a case of varicella zoster virus-induced pancreatitis and hepatitis in a renal transplant recipient. The patient underwent renal transplantation 3 years earlier and now presented with severe pain in the epigastrium radiating to his back and had raised serum lipase levels and skin lesions characteristic of varicella. Liver enzyme levels were also elevated. He was started on a regimen of acyclovir. His pain improved in 24 hours, and liver enzyme levels returned to normal in 48 hours. Discussion: There is a paucity of literature on the simultaneous occurrence of varicella zoster virus-induced hepatitis and pancreatitis in both immunocompetent and immunocompromised patients. Our case highlights the gastrointestinal complications of varicella infection in immunocompromised patients that may precede the characteristic dermatologic manifestations, and the fact that rarely both hepatitis and pancreatitis may be seen. PMID:28333601

  19. Analysis of differential immune responses induced by innate and adaptive immunity following transplantation

    PubMed Central

    He, Hongzhen; Stone, James R; Perkins, David L

    2003-01-01

    The roles of innate and adaptive immunity in allograft rejection remain incompletely understood. Previous studies analysing lymphocyte deficient or syngeneic graft recipients have identified subsets of inflammatory chemokines and cytokines induced by antigen independent mechanisms. In the current study, we analysed a panel of 60 inflammatory parameters including serum cytokines, intragraft chemokines and cytokines, receptors, and cellular markers. Our results confirmed the up-regulation of a subset of markers by innate mechanisms and also identified a subset of parameters up-regulated only in the context of an adaptive response. Thus, we successfully differentiated markers of the innate and adaptive phases of rejection. Current paradigms emphasize that innate signals can promote a subsequent adaptive response. Interestingly, in our studies, expression of the markers induced by innate mechanisms was markedly amplified in the allogeneic, but not syngeneic or lymphocyte deficient, recipients. These results suggest that inflammatory mediators can have functional overlap between the innate and adaptive responses, and that the adaptive component of the rejection process amplifies the innate response by positive feedback regulation. PMID:12757613

  20. Magnetic fluid hyperthermia induced by radiofrequency capacitive field for the treatment of transplanted subcutaneous tumors in rats.

    PubMed

    Li, Xu-Hong; Rong, Peng-Fei; Jin, He-Kun; Wang, Wei; Tang, Jin-Tian

    2012-02-01

    Magnetic fluid hyperthermia (MFH) induced by a magnetic field has become a new heating technology for the treatment of malignant tumors due to its ability to heat the tumor tissue precisely and properly, and due to its significant therapeutic effects. In this study, MFH induced by radiofrequency capacitive field (RCF) for the treatment of transplanted subcutaneous tumors in rats, was investigated. A total of 50 rats bearing subcutaneous tumors were randomly divided into five groups, including i) a pseudo-treatment (PT) control group, ii) magnetic fluid (MF) group, iii) pure hyperthermia (PH) group, iv) magnetic fluid hyperthermia 1 (MFH1) group, and v) magnetic fluid hyperthermia 2 (MFH2) group. Tumors were irradiated for 30 min in the MFH1 group 24 h following injection of MF. Tumors were irradiated for 30 min in the MFH2 group 24 h following injection of MF, and irradiation was repeated for 30 min 72 h following injection of MF. Tumor volumes, tumor volume inhibition ratios and survival times in the rat model were examined. Temperatures of tumor cores and rims both rapidly reached the desired temperature (∼50°C) for tumor treatment within 5 to 10 min in the MFH1 and MFH2 groups, and we maintained this temperature level by manually adjusting the output power (70-130 W). Tumor volumes of the MFH1 and MFH2 groups were reduced compared to those of the PT, MF and PH groups. The inhibitory effect on tumor growth in the MFH2 group (91.57%) was higher compared to that in the MFH1 group (85.21%) and the other groups. The survival time of the MFH2 group (51.62±2.28 days) and MFH1 group (43.10±1.57 days) was increased compared to that of the PH, MF and PT groups. The results obtained show that MFH induced by RCF may serve as a potential and promising method for the treatment of tumors.

  1. Alloantibody induced platelet responses in transplants: potent mediators in small packages.

    PubMed

    Kuo, Hsiao-Hsuan; Morrell, Craig N; Baldwin, William M

    2012-12-01

    The early histological studies of organ allografts noted platelets attached to vascular endothelium. Platelets adhere to vessels before any morphological evidence of endothelial injury. Subsequently, in vitro and in vivo experiments have demonstrated that alloantibodies can induce exocytosis of von Willebrand factor and P-selectin from endothelial cells and attachment of platelets within minutes. Platelets also adhere to and stimulate leukocytes. These interactions are increased by complement activation. After attachment platelets degranulate, releasing preformed mediators. Some chemokines stored together in platelet granules can form heteromers with synergistic functions. Heteromers containing platelet factor 4 (PF4; CXCL4) are specific to platelets and provide insights to unique platelet functions and opportunities for therapeutic intervention.

  2. Cell transplantation therapies for spinal cord injury focusing on induced pluripotent stem cells.

    PubMed

    Nakamura, Masaya; Okano, Hideyuki

    2013-01-01

    Stimulated by the 2012 Nobel Prize in Physiology or Medicine awarded for Shinya Yamanaka and Sir John Gurdon, there is an increasing interest in the induced pluripotent stem (iPS) cells and reprograming technologies in medical science. While iPS cells are expected to open a new era providing enormous opportunities in biomedical sciences in terms of cell therapies and regenerative medicine, safety-related concerns for iPS cell-based cell therapy should be resolved prior to the clinical application of iPS cells. In this review, the pre-clinical investigations of cell therapy for spinal cord injury (SCI) using neural stem/progenitor cells derived from iPS cells, and their safety issues in vivo, are outlined. We also wish to discuss the strategy for the first human trails of iPS cell-based cell therapy for SCI patients.

  3. Lung transplantation

    PubMed Central

    Afonso, José Eduardo; Werebe, Eduardo de Campos; Carraro, Rafael Medeiros; Teixeira, Ricardo Henrique de Oliveira Braga; Fernandes, Lucas Matos; Abdalla, Luis Gustavo; Samano, Marcos Naoyuki; Pêgo-Fernandes, Paulo Manuel

    2015-01-01

    ABSTRACT Lung transplantation is a globally accepted treatment for some advanced lung diseases, giving the recipients longer survival and better quality of life. Since the first transplant successfully performed in 1983, more than 40 thousand transplants have been performed worldwide. Of these, about seven hundred were in Brazil. However, survival of the transplant is less than desired, with a high mortality rate related to primary graft dysfunction, infection, and chronic graft dysfunction, particularly in the form of bronchiolitis obliterans syndrome. New technologies have been developed to improve the various stages of lung transplant. To increase the supply of lungs, ex vivo lung reconditioning has been used in some countries, including Brazil. For advanced life support in the perioperative period, extracorporeal membrane oxygenation and hemodynamic support equipment have been used as a bridge to transplant in critically ill patients on the waiting list, and to keep patients alive until resolution of the primary dysfunction after graft transplant. There are patients requiring lung transplant in Brazil who do not even come to the point of being referred to a transplant center because there are only seven such centers active in the country. It is urgent to create new centers capable of performing lung transplantation to provide patients with some advanced forms of lung disease a chance to live longer and with better quality of life. PMID:26154550

  4. HLA Class I Sensitization in Islet Transplant Recipients – Report from the Collaborative Islet Transplant Registry

    PubMed Central

    Naziruddin, Bashoo; Wease, Steve; Stablein, Donald; Barton, Franca B.; Berney, Thierry; Rickels, Michael R.; Alejandro, Rodolfo

    2015-01-01

    Pancreatic islet transplantation is a promising treatment option for patients severely affected with type 1 diabetes. This report from CITR presents pre- and post-transplant human leukocyte antigen (HLA) class I sensitization rates in islet alone transplantation. Data came from 303 recipients transplanted with islet alone between January 1999 and December 2008. HLA class I sensitization was determined by the presence of anti-HLA class I antibodies. Panel-reactive antibodies (PRA) from prior to islet infusion and at 6 months, and yearly post-transplant was correlated to measures of islet graft failure. The cumulative number of mismatched HLA alleles increased with each additional islet infusion from a median of 3 for one infusion to 9 for three infusions. Pre-transplant PRA was not predictive of islet graft failure. However, development of PRA ≥20% post-transplant was associated with 3.6 fold (p=.001) increased hazard ratio for graft failure. Patients with complete graft loss who had discontinued immunosuppression had significantly higher rate of PRA ≥ 20% compared to those with functioning grafts who remained on immunosuppression. Exposure to repeat HLA class I mismatch at second or third islet infusions resulted in less frequent development of de novo HLA class I antibodies when compared to increased class I mismatch. The development of HLA class I antibodies while on immunosuppression is associated with subsequent islet graft failure. The risk of sensitization may be reduced by minimizing the number of islet donors used per recipient, and in the absence of donor-specific anti-HLA antibodies, repeating HLA class I mismatches with subsequent islet infusions. PMID:22080832

  5. Severe antibody-mediated rejection following IVIG infusion in a kidney transplant recipient with BK-virus nephropathy.

    PubMed

    Mainra, R; Xu, Q; Chibbar, R; Hassan, A; Shoker, A

    2013-06-01

    Intravenous immune-globulin (IVIG) use in renal transplantation has increased, with common uses including desensitization, treatment of antibody mediated rejection and adjunctive therapy for BK virus nephropathy. Although considered generally safe, potential side effects can occur in up to 23% of patients including acute kidney injury. We present a case of an unexpected cause of acute kidney injury in a renal transplant recipient following IVIG infusion. A 48-year-old nonsensitized female with end stage renal disease secondary to polycystic kidney disease received a deceased donor kidney transplant. The initial post-transplant period was unremarkable however at three years post-transplant the patient develops BK virus nephropathy. Despite a reduction in immunosuppression, graft function worsened and IVIG infusion was commenced. Immediately following the IVIG infusion, the patient develops anuric acute kidney injury necessitating hemodialysis. Renal transplant biopsy performed before and after the IVIG infusion revealed the de novo development of acute antibody mediated rejection and donor specific antibodies in the serum. Anti-HLA and donor-specific antibodies were also confirmed in a diluted sample of the IVIG preparation. We argue that the anti-HLA antibodies present in the IVIG caused an acute antibody mediated rejection in this previously nonsensitized female.

  6. The Role of Humoral Alloreactivity in Liver Transplantation: Lessons Learned and New Perspectives

    PubMed Central

    2017-01-01

    More than ten years after the initial description of the humoral theory of transplantation by Dr. Paul I. Terasaki, the significance of humoral alloimmunity in liver transplantation has yet to be clearly defined. The liver allograft has an inherent tolerogenic capacity which confers its resistance to cell-mediated as well as antibody-mediated rejection. Nevertheless, the protection against alloimmunity is not complete, and antibody-mediated tissue injury can occur in the liver graft under specific circumstances. In this article the evidence on the clinicopathologic effects of donor-specific alloantibodies in liver transplantation will be examined and interpreted in parallel with lessons learned from renal transplantation. The unique anatomic and immunologic features of the liver will be reviewed to gain new insights into the complex interactions between humoral immune system and the liver allograft. PMID:28164136

  7. Combination of monoclonal antibodies with DST inhibits accelerated rejection mediated by memory T cells to induce long-lived heart allograft acceptance in mice.

    PubMed

    Shao, Wei; Chen, Jibing; Dai, Helong; Peng, Yuanzheng; Wang, Feng; Xia, Junjie; Thorlacius, Henrik; Zhu, Qi; Qi, Zhongquan

    2011-08-30

    Donor-reactive memory T cells mediated accelerated rejection is known as a barrier to the survival of transplanted organs. We investigated the combination of different monoclonal antibodies (mAbs) and donor-specific transfusion (DST) in memory T cells-based adoptive mice model. In the presence of donor-reactive memory T cells, the mean survival time (MST) of grafts in the anti-CD40L/LFA-1/DST group was 49.8d. Adding anti-CD44/CD70 mAbs to anti-CD40L/LFA-1/DST treatment. The MST was more than 100 d (MST>100 d). Compared with anti-CD40L/LFA-1/DST group, anti-CD40L/LFA-1/CD44/CD70/DST group notably reduced the expansion of memory T cells, enhanced the proportion of CD4+Foxp3+ regulatory T cells (Tregs) and suppressed donor-specific responses. Our data suggest that anti-CD40L/LFA-1/CD44/CD70mAbs and DST can synergistically inhibit accelerated rejection mediated by memory T cells to induce long-lived heart allograft acceptance in mice.

  8. International kidney paired donation transplantations to increase kidney transplant of O group and highly sensitized patient: First report from India

    PubMed Central

    Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Shah, Priya S; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Vijay A; Varyani, Umesh T; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L

    2017-01-01

    AIM To report the first international living related two way kidney paired donation (KPD) transplantation from India which occurred on 17th February 2015 after legal permission from authorization committee. METHODS Donor recipient pairs were from Portugal and India who were highly sensitized and ABO incompatible with their spouse respectively. The two donor recipient pairs had negative lymphocyte cross-matching, flow cross-match and donor specific antibody in two way kidney exchange with the intended KPD donor. Local KPD options were fully explored for Indian patient prior to embarking on international KPD. RESULTS Both pairs underwent simultaneous uneventful kidney transplant surgeries and creatinine was 1 mg/dL on tacrolimus based immunosuppression at 11 mo follow up. The uniqueness of these transplantations was that they are first international KPD transplantations in our center. CONCLUSION International KPD will increases quality and quantity of living donor kidney transplantation. This could be an important step to solving the kidney shortage with additional benefit of reduced costs, improved quality and increased access for difficult to match incompatible pairs like O blood group patient with non-O donor and sensitized patient. To the best of our knowledge this is first international KPD transplantation from India. PMID:28280697

  9. Intrathecal Transplantation of Autologous Adherent Bone Marrow Cells Induces Functional Neurological Recovery in a Canine Model of Spinal Cord Injury.

    PubMed

    Gabr, Hala; El-Kheir, Wael Abo; Farghali, Haithem A M A; Ismail, Zeinab M K; Zickri, Maha B; El Maadawi, Zeinab M; Kishk, Nirmeen A; Sabaawy, Hatem E

    2015-01-01

    Spinal cord injury (SCI) results in demyelination of surviving axons, loss of oligodendrocytes, and impairment of motor and sensory functions. We have developed a clinical strategy of cell therapy for SCI through the use of autologous bone marrow cells for transplantation to augment remyelination and enhance neurological repair. In a preclinical large mammalian model of SCI, experimental dogs were subjected to a clipping contusion of the spinal cord. Two weeks after the injury, GFP-labeled autologous minimally manipulated adherent bone marrow cells (ABMCs) were transplanted intrathecally to investigate the safety and efficacy of autologous ABMC therapy. The effects of ABMC transplantation in dogs with SCI were determined using functional neurological scoring, and the integration of ABMCs into the injured cords was determined using histopathological and immunohistochemical investigations and electron microscopic analyses of sections from control and transplanted spinal cords. Our data demonstrate the presence of GFP-labeled cells in the injured spinal cord for up to 16 weeks after transplantation in the subacute SCI stage. GFP-labeled cells homed to the site of injury and were detected around white matter tracts and surviving axons. ABMC therapy in the canine SCI model enhanced remyelination and augmented neural regeneration, resulting in improved neurological functions. Therefore, autologous ABMC therapy appears to be a safe and promising therapy for spinal cord injuries.

  10. New-onset lupus nephritis in a kidney transplant recipient with cystinosis-differential diagnosis with cysteamine-induced lupus: case report.

    PubMed

    Rocha, S; Martins, L S; Vizcaíno, R; Dias, L; Almeida, M; Pedroso, S; Vidinha, J; Rocha, M; Rocha, G; Mota, C; Henriques, A; Cabrita, A

    2011-01-01

    A case of lupus nephritis in an adult female kidney transplant recipient with cystinosis under cysteamine therapy is reported. Previous reports of new-onset lupus in cystinotic patients have focused in a possible relationship of lupus with cysteamine therapy, but no obvious pathophysiological association has been disclosed. The authors present a case of a 19-year-old female kidney transplant recipient with cystinosis admitted for acute allograft dysfunction, with clinical and immunologic manifestations of lupus nephritis. Cysteamine was considered as a potential cause of drug-induced lupus, and we temporarily interrupted this drug. The clinical picture, the negativity of antihistone antibodies, the nondisappearance of antinuclear antibodies after discontinuation of the drug, and the clinical stability after resuming cysteamine therapy suggested that the underlying mechanism of lupus was unrelated to the drug. This may be the first report of new-onset lupus in a kidney transplant recipient with cystinosis. Clinicians should be aware of the association of autoimmune abnormalities in patients with cystinosis.

  11. The Effects of Oral Cryotherapy on Chemotherapy-Induced Oral Mucositis in Patients Undergoing Autologous Transplantation of Blood Stem Cells: A Clinical Trial

    PubMed Central

    Askarifar, Marzieh; Lakdizaji, Sima; Ramzi, Mani; Rahmani, Azad; Jabbarzadeh, Faranak

    2016-01-01

    Background Oral mucositis is one of the irritating side effects of chemotherapy in patients undergoing bone marrow transplantation. However, up until now, the common methods of oral mucositis therapy have failed to show significant effects. Objectives The aim of this study was to investigate the effects of local cryotherapy on the intensity of chemotherapy-induced oral mucositis in autologous bone marrow transplantation patients. Patients and Methods In this single, blinded, randomized clinical trial, 29 patients undergoing stem cell transplantation in Iran were selected by convenience sampling, and randomly allocated to control (n = 13) and intervention groups (n = 16). In the intervention group, cryotherapy was applied, while the control group received a normal saline mouthwash. The severity of the mucositis and neutrophil rate were investigated in five periods, based on the world health organization (WHO) scales. The data were analyzed using descriptive statistics, the Mann-Whitney test, repeated measures analysis of variance (ANOVA), and linear regression. Results In both groups, the mucositis reached its peak intensity on the 7th day, and the least intensity was obtained on the 21st day. The neutrophil rate reached the minimum value on the 7th day, then increased up to the 21st day. The two groups showed no significant differences between the mucositis severity on the 14th and 21st days (P = 0.164), while the severity of the mucositis in the cryotherapy group was significantly less than that in the saline mouthwash group (1.81 < 2.54 and 0.13 < 0.92, respectively) on the 7th and 14th days (P < 0.05). There was no significant difference in the neutrophil rate between the groups. Conclusions The results showed that cryotherapy is more effective than the saline mouthwash in reducing the severity of mucositis. This method is recommended for the prevention of mucositis in bone marrow transplantation. PMID:27257512

  12. 3-Bromopyruvate and sodium citrate target glycolysis, suppress survivin, and induce mitochondrial-mediated apoptosis in gastric cancer cells and inhibit gastric orthotopic transplantation tumor growth

    PubMed Central

    WANG, TING-AN; ZHANG, XIAO-DONG; GUO, XING-YU; XIAN, SHU-LIN; LU, YUN-FEI

    2016-01-01

    Glycolysis is the primary method utilized by cancer cells to produce the energy (adenosine triphosphate, ATP) required for cell proliferation. Therefore, inhibition of glycolysis may inhibit tumor growth. We previously found that both 3-bromopyruvate (3-BrPA) and sodium citrate (SCT) can inhibit glycolysis in vitro; however, the underlying inhibitory mechanisms remain unclear. In the present study, we used a human gastric cancer cell line (SGC-7901) and an orthotopic transplantation tumor model in nude mice to explore the specific mechanisms of 3-BrPA and SCT. We found that both 3-BrPA and SCT effectively suppressed cancer cell proliferation, arrested the cell cycle, induced apoptosis, and decreased the production of lactate and ATP. 3-BrPA significantly reduced the glycolytic enzyme hexokinase activity, while SCT selectively inhibited phosphofructokinase-1 activity. Furthermore, 3-BrPA and SCT upregulated the expression of pro-apoptotic proteins (Bax, cytochrome c, and cleaved caspase-3) and downregulated the expression of anti-apoptotic proteins (Bcl-2 and survivin). Finally, our animal model of gastric cancer indicated that intraperitoneal injection of 3-BrPA and SCT suppressed orthotopic transplantation tumor growth and induced tumor apoptosis. Taken together, these results suggest that 3-BrPA and SCT selectively suppress glycolytic enzymes, decrease ATP production, induce mitochondrial-mediated apoptosis, downregulate survivin, and inhibit tumor growth. Moreover, an intraperitoneal injection is an effective form of administration of 3-BrPA and SCT. PMID:26708213

  13. 3-bromopyruvate and sodium citrate target glycolysis, suppress survivin, and induce mitochondrial-mediated apoptosis in gastric cancer cells and inhibit gastric orthotopic transplantation tumor growth.

    PubMed

    Wang, Ting-An; Zhang, Xiao-Dong; Guo, Xing-Yu; Xian, Shu-Lin; Lu, Yun-Fei

    2016-03-01

    Glycolysis is the primary method utilized by cancer cells to produce the energy (adenosine triphosphate, ATP) required for cell proliferation. Therefore, inhibition of glycolysis may inhibit tumor growth. We previously found that both 3-bromopyruvate (3-BrPA) and sodium citrate (SCT) can inhibit glycolysis in vitro; however, the underlying inhibitory mechanisms remain unclear. In the present study, we used a human gastric cancer cell line (SGC-7901) and an orthotopic transplantation tumor model in nude mice to explore the specific mechanisms of 3-BrPA and SCT. We found that both 3-BrPA and SCT effectively suppressed cancer cell proliferation, arrested the cell cycle, induced apoptosis, and decreased the production of lactate and ATP. 3-BrPA significantly reduced the glycolytic enzyme hexokinase activity, while SCT selectively inhibited phosphofructokinase-1 activity. Furthermore, 3-BrPA and SCT upregulated the expression of pro-apoptotic proteins (Bax, cytochrome c, and cleaved caspase-3) and downregulated the expression of anti-apoptotic proteins (Bcl-2 and survivin). Finally, our animal model of gastric cancer indicated that intraperitoneal injection of 3-BrPA and SCT suppressed orthotopic transplantation tumor growth and induced tumor apoptosis. Taken together, these results suggest that 3-BrPA and SCT selectively suppress glycolytic enzymes, decrease ATP production, induce mitochondrial-mediated apoptosis, downregulate survivin, and inhibit tumor growth. Moreover, an intraperitoneal injection is an effective form of administration of 3-BrPA and SCT.

  14. Therapeutic effects of human amnion-derived mesenchymal stem cell transplantation and conditioned medium enema in rats with trinitrobenzene sulfonic acid-induced colitis

    PubMed Central

    Miyamoto, Shuichi; Ohnishi, Shunsuke; Onishi, Reizo; Tsuchiya, Ikuki; Hosono, Hidetaka; Katsurada, Takehiko; Yamahara, Kenichi; Takeda, Hiroshi; Sakamoto, Naoya

    2017-01-01

    Cell therapy with mesenchymal stem cells (MSCs) is expected to provide a new strategy for the treatment of inflammatory bowel disease (IBD). Large amounts of MSCs can be obtained from human amnion. Therefore, we investigated the effect of transplantation of human amnion-derived MSCs (hAMSCs) or enema of conditioned medium (CM) from hAMSCs into rats with 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis. In the first experiment, 10-week-old male Sprague-Dawley rats were intravenously injected with hAMSCs (1 × 106 cells) 3 h after rectal administration of TNBS (45 mg/kg). In the second experiment, rats with TNBS-induced colitis received CM by enema into the colon for 3 days. Colitis was investigated by endoscopy, histology, immunohistochemistry, and by measuring mRNA expression of inflammatory mediators. Administration of hAMSCs or CM enema significantly improved the endoscopic score. In addition, these two interventions resulted in significantly decreased infiltration of neutrophils and monocytes/macrophages and decreased expression levels of TNF-α, CXCL1, and CCL2. In conclusion, transplantation of hAMSCs and CM enema provided significant improvement in rats with TNBS-induced colitis. CM from hAMSCs and hAMSCs may be new strategies for the treatment of IBD. PMID:28386323

  15. Perioperative care in an adolescent patient with heparin-induced thrombocytopenia for placement of a cardiac assist device and heart transplantation: case report and literature review

    PubMed Central

    Kamata, Mineto; Sebastian, Roby; McConnell, Patrick I; Gomez, Daniel; Naguib, Aymen; Tobias, Joseph D

    2017-01-01

    Heparin-induced thrombocytopenia (HIT) can cause life-threatening complications following the administration of heparin. Discontinuation of all sources of heparin exposure and the use of alternative agents for anticoagulation are necessary when HIT is suspected or diagnosed. We present the successful use of bivalirudin anticoagulation in an adolescent patient during cardiopulmonary bypass who underwent both placement of a left ventricular assist device and subsequent heart transplantation within a 36-hour period. The pathophysiology and diagnosis of HIT are reviewed, previous reports of the use of direct thrombin inhibitors for cardiac surgery are presented, and potential dosing regimens for bivalirudin are discussed. PMID:28243155

  16. Prostaglandin E2 potentiates mesenchymal stem cell-induced IL-10+IFN-γ+CD4+ regulatory T cells to control transplant arteriosclerosis.

    PubMed

    Hsu, Wan-Tseng; Lin, Cheng-Hsin; Chiang, Bor-Luen; Jui, Hsiang-Yiang; Wu, Kenneth Kun-Yu; Lee, Chii-Ming

    2013-03-01

    Mesenchymal stem cells (MSCs) are known for their immunomodulatory functions. We previously demonstrated that bone marrow-derived MSCs effectively control transplant arteriosclerosis (TA) by enhancing IL-10(+) and IFN-γ(+) cells. The objective of this study is to elucidate the mechanism by which MSCs induce IL-10(+)IFN-γ(+)CD4(+) regulatory T type 1 (T(R)1)-like cells. In an MLR system using porcine PBMCs, MSC-induced IL-10(+)IFN-γ(+)CD4(+) cells, which confer resistance to allogeneic proliferation in an IL-10-dependent manner, resemble T(R)1-like cells. Both cyclooxygenase-derived PGE(2) and IDO help to induce T(R)1-like cells by MSCs. MSCs constitutively secrete PGE(2), which is augmented in allogeneic reactions. However, T(R)1-like cells were deficient in PGE(2) and 4-fold less potent than were MSCs in suppressing MLR. PGE(2) mimetic supplements can enhance the immunosuppressive potency of T(R)1-like cells. In a porcine model of allogeneic femoral arterial transplantation, MSC-induced T(R)1-like cells combined with PGE(2), but not either alone, significantly reduced TA at the end of 6 wk (percentage of luminal area stenosis: T(R)1-like cells + PGE(2): 11 ± 10%; PGE(2) alone: 93 ± 8.7%; T(R)1-like cells alone: 88 ± 2.4% versus untreated 94 ± 0.9%, p < 0.001). These findings indicate that PGE(2) helps MSC-induced IL-10(+)IFN-γ(+)CD4(+) T(R)1-like cells inhibit TA. PGE(2) combined with MSC-induced T(R)1-like cells represents a new approach for achieving immune tolerance.

  17. History of Clinical Transplantation

    PubMed Central

    Starzl, Thomas E.

    2010-01-01

    The emergence of transplantation has seen the development of increasingly potent immunosuppressive agents, progressively better methods of tissue and organ preservation, refinements in histocompatibility matching, and numerous innovations in surgical techniques. Such efforts in combination ultimately made it possible to successfully engraft all of the organs and bone marrow cells in humans. At a more fundamental level, however, the transplantation enterprise hinged on two seminal turning points. The first was the recognition by Billingham, Brent, and Medawar in 1953 that it was possible to induce chimerism-associated neonatal tolerance deliberately. This discovery escalated over the next 15 years to the first successful bone marrow transplantations in humans in 1968. The second turning point was the demonstration during the early 1960s that canine and human organ allografts could self-induce tolerance with the aid of immunosuppression. By the end of 1962, however, it had been incorrectly concluded that turning points one and two involved different immune mechanisms. The error was not corrected until well into the 1990s. In this historical account, the vast literature that sprang up during the intervening 30 years has been summarized. Although admirably documenting empiric progress in clinical transplantation, its failure to explain organ allograft acceptance predestined organ recipients to lifetime immunosuppression and precluded fundamental changes in the treatment policies. After it was discovered in 1992 that long-surviving organ transplant recipients had persistent microchimerism, it was possible to see the mechanistic commonality of organ and bone marrow transplantation. A clarifying central principle of immunology could then be synthesized with which to guide efforts to induce tolerance systematically to human tissues and perhaps ultimately to xenografts. PMID:10833242

  18. Discontinuation of calcineurin inhibitors treatment allows the development of FOXP3+ regulatory T-cells in patients after kidney transplantation.

    PubMed

    van de Wetering, Jacqueline; Koumoutsakos, Periklis; Peeters, Annemiek; van der Mast, Barbara J; de Kuiper, Petronella; IJzermans, Jan N M; Weimar, Willem; Baan, Carla C

    2011-01-01

    This study investigated specific gene expression profiles in patients with donor-specific cytotoxic-hyporesponsiveness, reflected by cytotoxic T-lymphocyte precursor frequency (CTLpf). The effect of calcineurin inhibitor (CNI) withdrawal was studied on markers for cytotoxicity (perforin, granzyme B), apoptosis (Fas,FasL), Th1 and Th2 cytokines (IL-2, IL-10), Th1 and Th2 transcription factors (T-bet, GATA 3), Th17 transcription factor and cytokine (RORγt, IL-17), and for immune regulation/activation (CD25, FOXP3). Peripheral blood samples from renal allograft recipients (n = 18) more than two yr after transplantation with stable renal function were analyzed before and four months after CNI withdrawal. Additionally, systolic and diastolic blood pressure, cholesterol, serum creatinine and proteinuria were evaluated, and no significant differences were measured before and after CNI withdrawal. However, CNIs' discontinuation influenced peripheral gene expression profiles. After CNI withdrawal, the mRNA expression of Granzyme B, Perforin, Fas, FasL, T-bet, GATA3 and CD25 were significantly lower than during CNI treatment. After CNI discontinuation, donor-specific CTLpf decreased, while FOXP3 expression discriminated between detectable and non-detectable donor-specific cytolysis reactivity; FOXP3 transcript values were highest in absence of donor-specific cytotoxicity (p < 0.01). Our study shows CNI withdrawal in stable kidney transplant recipients two yr after transplantation is safe. Moreover, discontinuation of CNIs' treatment allows FOXP3+ regulatory T-cells development, resulting in a significant decrease of anti-donor immune reactivity.

  19. Linezolid-induced lactic acidosis in two liver transplant patients with the mitochondrial DNA A2706G polymorphism.

    PubMed

    Del Pozo, J L; Fernández-Ros, N; Sáez, E; Herrero, J I; Yuste, J R; Banales, J M

    2014-07-01

    Mitochondrial toxicity has been recently suggested to be the underlying mechanism of long-term linezolid-associated toxicity in patients with 16S rRNA genetic polymorphisms. Here, we report for the first time two cases of lactic acidosis due to long-term linezolid exposure in liver transplant recipients who presented an A2706G mitochondrial DNA polymorphism.

  20. Preconditioning Human Cardiac Stem Cells with an HO-1 Inducer Exerts Beneficial Effects After Cell Transplantation in the Infarcted Murine Heart.

    PubMed

    Cai, Chuanxi; Guo, Yiru; Teng, Lei; Nong, Yibing; Tan, Min; Book, Michael J; Zhu, Xiaoping; Wang, Xiao-Liang; Du, Junjie; Wu, Wen-Jian; Xie, Wei; Hong, Kyung U; Li, Qianhong; Bolli, Roberto

    2015-12-01

    The regenerative potential of c-kit(+) cardiac stem cells (CSCs) is severely limited by the poor survival of cells after transplantation in the infarcted heart. We have previously demonstrated that preconditioning human CSCs (hCSCs) with the heme oxygenase-1 inducer, cobalt protoporphyrin (CoPP), has significant cytoprotective effects in vitro. Here, we examined whether preconditioning hCSCs with CoPP enhances CSC survival and improves cardiac function after transplantation in a model of myocardial infarction induced by a 45-minute coronary occlusion and 35-day reperfusion in immunodeficient mice. At 30 minutes of reperfusion, CoPP-preconditioned hCSCs(GFP+), hCSCs(GFP+), or medium were injected into the border zone. Quantitative analysis with real-time qPCR for the expression of the human-specific gene HLA revealed that the number of survived hCSCs was significantly greater in the preconditioned-hCSC group at 24 hours and 7 and 35 days compared with the hCSC group. Coimmunostaining of tissue sections for both green fluorescent protein (GFP) and human nuclear antigen further confirmed greater hCSC numbers at 35 days in the preconditioned-hCSC group. At 35 days, compared with the hCSC group, the preconditioned-hCSC group exhibited increased positive and negative left ventricular (LV) dP/dt, end-systolic elastance, and anterior wall/apical strain rate (although ejection fraction was similar), reduced LV remodeling, and increased proliferation of transplanted cells and of cells apparently committed to cardiac lineage. In conclusion, CoPP-preconditioning of hCSCs enhances their survival and/or proliferation, promotes greater proliferation of cells expressing cardiac markers, and results in greater improvement in LV remodeling and in indices of cardiac function after infarction.

  1. Pancreas Transplantation Delays the Progression of Morphological, Morphometric and Ultrastructural Changes in Testes of Alloxan-Induced Diabetic Rats.

    PubMed

    Tadeu Spadella, César; Teixeira Trindade, Amélia Arcângela; Natália Lucchesi, Amanda; Sperandéo de Macedo, Célia

    2017-02-01

    Aim: The aim of this study was to assess the effects of pancreas transplantation on the progression of testicular lesions in diabetic rats. Methods: Diabetic rats were subjected to pancreas transplantation and sacrificed after 6, 14, 26 and 50 weeks of follow-up, using non-diabetic and untreated diabetic rats as controls. Results: Successful pancreas transplantation corrected all of the metabolic changes observed in diabetic rats, including low levels of testosterone. The testicular mass was decreased, and the relative weight of the testes was high in diabetic rats. The seminiferous tubules of diabetic rats showed progressive atrophy of the germinal epithelium, with cytoplasmic vacuolization, detachment of germ cells to the tubular lumen and the appearance of giant cells. Leydig cells were abnormally distributed, and hyperplasia of Sertoli cells was observed. Sperm were not detectable within the tubular lumen in late follow-up. The diameter, total area, lumen area, and germinal epithelium area of the seminiferous tubules were low, and tubular density was high in diabetic rats. Ultrastructural changes were also observed in these rats, compromising the cytoplasm, organelles and cellular nuclei of the germ, Sertoli, and Leydig cells. The most frequent changes consisted of accumulation of lipid droplets and electron-dense dark material in the cell cytoplasm, cellular degeneration and apoptosis. Similar to non-diabetic rats, pancreas-transplanted rats showed progressive testicular lesions, but they were much less severe and occurred much later than in the untreated diabetic controls. Conclusion: Diabetes causes morphological and ultrastructural changes in rat testes, but the progression of lesions can be significantly delayed by successful pancreas transplantation, which may have a positive impact on male infertility due to diabetes.

  2. [Liver transplantation and pregnancy].

    PubMed

    Goarin, A-C; Homer, L

    2010-11-01

    Management during their sexual life of patients with a liver transplantation is a more or less common situation depending centers. Based on literature review, a focus on management of recipient women was conducted, from contraception to pregnancy, describing the complications related to the status of transplant recipient, but also those that may be related to immunosuppressive agents. If fertility and access to contraception are only slightly modified by graft, complications related to graft or immunosuppressive drugs can affect the pregnancy. On the maternal side, hypertension and preeclampsia are more common, as well as renal dysfunction, iatrogenic diabetes and bacterial or viral infections, acute rejection and graft loss do not appear to be influenced by pregnancy. The fetus is also exposed to risks such as induced prematurity and IUGR. Pregnancy in recipients of hepatic grafts therefore requires joint follow-up by transplant specialist and perinatologist, which leads in most cases to successful outcome for mother and child.

  3. Pretransplant identification of acute rejection risk following kidney transplantation.

    PubMed

    Lebranchu, Yvon; Baan, Carla; Biancone, Luigi; Legendre, Christophe; Morales, José Maria; Naesens, Maarten; Thomusch, Oliver; Friend, Peter

    2014-02-01

    Lack of an accepted definition for 'high immunological risk' hampers individualization of immunosuppressive therapy after kidney transplantation. For recipient-related risk factors for acute rejection, the most compelling evidence points to younger age and African American ethnicity. Recipient gender, body mass, previous transplantation, and concomitant infection or disease do not appear to be influential. Deceased donation now has only a minor effect on rejection risk, but older donor age remains a significant predictor. Conventional immunological markers (human leukocyte antigen [HLA] mismatching, pretransplant anti-HLA alloantibodies, and panel reactive antibodies) are being reassessed in light of growing understanding about the role of donor-specific antibodies (DSA). At the time of transplant, delayed graft function is one of the most clear-cut risk factors for acute rejection. Extended cold ischemia time (≥ 24 h) may also play a contributory role. While it is not yet possible to establish conclusively the relative contribution of different risk factors for acute rejection after kidney transplantation, the available data point to variables that should be taken into account at the time of transplant. Together, these offer a realistic basis for planning an appropriate immunosuppression regimen in individual patients.

  4. Arm transplantation: prospects and visions.

    PubMed

    Jones, N F; Schneeberger, S

    2009-03-01

    Based on the results of above-elbow replantation, it is possible that above-elbow arm transplantation will be successful and result in a superior functional outcome as defined by the Chen criteria. Above-elbow arm transplantation is probably technically simpler than distal forearm or wrist transplantation, especially since the macroanastomoses do not require microsurgical expertise. However, hand function depends on reinnervation of forearm muscles and the distance for nerves to regenerate for reinnervation of intrinsic muscles of the hand is significant. The vascularized bone marrow transplanted with the arm holds potential to induce chimerism and promote tolerance but could also make the recipient more susceptible to graft-versus-host disease. Prospective trials comparing the functional results after above-elbow arm transplantation with the functional results achieved by the best neuronal-controlled above-elbow prosthesis are warranted and will determine the gold standard of upper-extremity reconstruction.

  5. General insufficiency of the classical CDC-based crossmatch to detect donor-specific anti-HLA antibodies leading to invalid results under recipients' medical treatment or underlying diseases.

    PubMed

    Schlaf, G; Mauz-Körholz, C; Ott, U; Leike, S; Altermann, W

    2012-01-01

    Antibodies directed against HLA antigens of a given donor represent the most prominent cause for hyper-acute and acute rejections. In order to select recipients without donor-specific antibodies the complement-dependent cytotoxicity (CDC-) crossmatch as the standard procedure was established. As a functional assay it strongly depends on the availability of isolated donor lymphocytes and in particular on their vitality. However, due to several diseases or pharmacological treatment of a given recipient unexpected "false-positive" results of the CDC-crossmatch may arise. We here present three groups of patients which demonstrate the limits of the conventional crossmatch. 1) Kidney recipients before living donations exhibited positive CDC-reactions due to their conditioning using the therapeutical anti-CD20 mAb Rituximab (n=7), routinely used to deplete B-cells, or the anti-CD25 mAb basiliximab (n=2) to inhibit the proliferation of activated T-cells. 2) Recipients suffering from various leukaemias (n=5) exhibited "positive" CDC-crossmatches using PBL of the donors, although formerly these patients had never shown anti-HLA antibodies. Instead of donor-specific allo-antibodies, cytostatic agents such as 6-mercaptopurine led to an unspecific cell death. 3) Patients projected for post mortem or living kidney donations (n=44) exhibited "positive" CDC-crossmatch results which were not in accordance with their former antibody status and, partially, with high degrees of HLA-matching. These implausible results were due to underlying auto-immune diseases, mainly of the systemic immune complex type III such as lupus erythematosus, mainly leading to false-positive B-cell crossmatches by immune complexes binding to Fcγ-receptors. In all these 58 cases the alternatively performed ELISA-based "Antibody Monitoring System" (AMS-) crossmatch assay was not artifically affected, suggesting that this assay may be comprehensively established at least for the cases described.

  6. Lung Transplant

    MedlinePlus

    ... will recover in the hospital’s intensive care unit (ICU) before moving to a hospital room for one to three weeks. Your doctor may recommend pulmonary rehabilitation after your lung transplant surgery to help you ...

  7. Pancreas Transplantation

    MedlinePlus

    The pancreas is a gland behind your stomach and in front of your spine. It produces the juices that ... hormones that help control blood sugar levels. A pancreas transplant is surgery to place a healthy pancreas ...

  8. Lung transplant

    MedlinePlus

    ... in the arteries of the lungs ( pulmonary hypertension ) Sarcoidosis Lung transplant may not be done for people ... Chronic Cystic fibrosis Idiopathic pulmonary fibrosis Lung disease Sarcoidosis Review Date 4/13/2015 Updated by: Dale ...

  9. Intestine Transplant

    MedlinePlus

    ... Support Groups Patient Resources Newsroom Minorities AFTER THE TRANSPLANT Medications Staying Healthy Recovery Resources Lifestyle Changes Pregnancy Cancer PEDIATRIC Addressing Children's Needs Coping With Anxiety Helping Your Child Adjust Camps Resources LIVING DONATION ...

  10. Transplant services

    MedlinePlus

    ... that you may have. References Herman M, Keaveny AP. Organ transplantation. In: Walsh D, Caraceni AT, Fainsinger ... Support Get email updates Subscribe to RSS Follow us Disclaimers Copyright Privacy Accessibility Quality Guidelines Viewers & Players ...

  11. Luminex® and Its Applications for Solid Organ Transplantation, Hematopoietic Stem Cell Transplantation, and Transfusion†

    PubMed Central

    Lachmann, Nils; Todorova, Kremena; Schulze, Harald; Schönemann, Constanze

    2013-01-01

    Summary The detection of antibodies against the human leukocyte antigen (HLA) complex has become indispensable in every clinical practice. The development of solid-phase assays like the Luminex allows the standardized measurement of anti-HLA antibodies (HLAab) with high sensitivity, albeit the relevance for some clinical settings remains a matter of debate. In this review we aim to describe the principle of Luminex-based antibody detection, including two modifications that allow identifying solely complement-activating antibodies. We then describe three applications for Luminex: i) detection of HLAab preceding solid-organ transplantation and monitoring of donor-specific antibodies posttransplant as a risk factor for antibody-mediated rejection; ii) presence of HLAab in recipients as a risk for graft failure in hematopoietic stem cell transplantation, especially in haploidentical or mismatched transplantations; iii) role of HLAab in blood transfusion including refractory thrombocytopenia and selection of suitable platelet donors, transfusion-related lung injury after plasma transfusion, and immunization against HLA after red blood cell transfusion despite leukodepletion. Although the Luminex platform constitutes a potent technology for HLA antibody detection, some drawbacks require the well-educated analysis and interpretation of data in critical cases. In addition, Luminex has become an important tool to identify clinically relevant antibodies. PMID:23922543

  12. Unexpected anti-HLA-DR and -DQ alloantibodies after nephrectomy of an HLA-DR and -DQ identical first renal transplant.

    PubMed

    Proust, Barbara; Kennel, Anne; Ladrière, Marc; Kessler, Michèle; Perrier, Pascale

    2009-07-01

    The development of the single antigen beads assay by Luminex technology enables accurate identification of allele-specific antibodies. Herein, we report the identification of donor-specific HLA-DR and -DQ antibodies in a first kidney transplant recipient who received a DR and DQ identical kidney transplant. The recipient was a non-sensitized, non-transfused male patient suffering from an end-stage renal failure due to focal and segmental glomerulosclerosis. Two weeks after graft nephrectomy, anti-class I (donor-specific and non-donor specific) and class II antibodies were detected. The single antigen beads technique identified class II antibodies directed against DRB3*0202 and HLA-DQB1*0603 alleles. High-resolution class II typing revealed five allelic incompatibilities between donor and recipient. Amino-acid sequence alignment showed why this post-transplant highly immunized patient developed only these two allele-specific antibodies. Minimizing HLA mismatches between donor and recipient is important, but it is also useful to consider the combination of all HLA molecules present in the donor and recipient in order to define the antibody epitopes responsible for alloantibody responses.

  13. [Haploidentical hematopoietic stem cell transplantation: Guidelines from the Francophone society of marrow transplantation and cellular therapy (SFGM-TC)].

    PubMed

    Nguyen, Stéphanie; Chalandon, Yves; Lemarie, Claude; Simon, Sophie; Masson, Dominique; Dhedin, Nathalie; Suarez, Felipe; Renaud, Barbara; Charbonnier, Amandine; Yafour, Nabil; François, Sylvie; Duléry, Rémy; Blaise, Didier; Yakoub-Agha, Ibrahim; Rubio, Marie-Thérèse

    2016-11-01

    Haploidentical hematopoietic stem cell transplantation (HSCT) is being increasingly used due to improvement of the transplantation procedures allowing a reduction of graft-versus-host-disease (GVHD) and of transplant-related mortality (TRM). Such improvements have been particularly observed after administration of T-replete HSCT graft associated to an in vivo T cell depletion by the administration of high-doses of cyclophosphamide (HD-Cy) after transplantation. Here, we have analyzed the results of haplo-identical T replete HSC transplants, in particular, when performed with post-transplant HD-Cy in order to provide recommendations for the clinical practice. Criteria of choice for a haploidentical donor by priority order are absence of donor-specific antibodies (DSA) and to prioritize: CMV seronegative recipient/donor couples, ABO matching in case of deserythrocytation, male donor for a male recipient, the youngest donor. There is no clear argument in favor of the use of bone marrow versus peripheral blood stem cells (PBSC) after non myeloablative conditioning regimen, while after ablative conditioning PBSC seem to be associated with higher risks of GVHD without obvious impact on survival. Results of haploidentical HSCT, confirmed by several groups, are interesting in lymphomas (in particular Hodgkin disease) and for acute leukemia. Outcomes of patients rely on age, disease status at transplant and conditioning intensity. At equivalent disease risk, results of haploidentical HSCT seem comparable to those of HLA matched HSCT, raising the question of the classification of such transplants as alternatives. In all cases, we recommend to include patients in prospective clinical trials.

  14. Stable enhanced green fluorescent protein expression after differentiation and transplantation of reporter human induced pluripotent stem cells generated by AAVS1 transcription activator-like effector nucleases.

    PubMed

    Luo, Yongquan; Liu, Chengyu; Cerbini, Trevor; San, Hong; Lin, Yongshun; Chen, Guokai; Rao, Mahendra S; Zou, Jizhong

    2014-07-01

    Human induced pluripotent stem (hiPS) cell lines with tissue-specific or ubiquitous reporter genes are extremely useful for optimizing in vitro differentiation conditions as well as for monitoring transplanted cells in vivo. The adeno-associated virus integration site 1 (AAVS1) locus has been used as a "safe harbor" locus for inserting transgenes because of its open chromatin structure, which permits transgene expression without insertional mutagenesis. However, it is not clear whether targeted transgene expression at the AAVS1 locus is always protected from silencing when driven by various promoters, especially after differentiation and transplantation from hiPS cells. In this paper, we describe a pair of transcription activator-like effector nucleases (TALENs) that enable more efficient genome editing than the commercially available zinc finger nuclease at the AAVS1 site. Using these TALENs for targeted gene addition, we find that the cytomegalovirus-immediate early enhancer/chicken β-actin/rabbit β-globin (CAG) promoter is better than cytomegalovirus 7 and elongation factor 1α short promoters in driving strong expression of the transgene. The two independent AAVS1, CAG, and enhanced green fluorescent protein (EGFP) hiPS cell reporter lines that we have developed do not show silencing of EGFP either in undifferentiated hiPS cells or in randomly and lineage-specifically differentiated cells or in teratomas. Transplanting cardiomyocytes from an engineered AAVS1-CAG-EGFP hiPS cell line in a myocardial infarcted mouse model showed persistent expression of the transgene for at least 7 weeks in vivo. Our results show that high-efficiency targeting can be obtained with open-source TALENs and that careful optimization of the reporter and transgene constructs results in stable and persistent expression in vitro and in vivo.

  15. Exogenous interleukin-33 targets myeloid-derived suppressor cells and generates periphery-induced Foxp3+ regulatory T cells in skin-transplanted mice

    PubMed Central

    Gajardo, Tania; Morales, Rodrigo A; Campos-Mora, Mauricio; Campos-Acuña, Javier; Pino-Lagos, Karina

    2015-01-01

    Interleukin-33 (IL-33) has been a focus of study because of its variety of functions shaping CD4+ T-cell biology. In the present work, we evaluated the modulatory effect of IL-33 on suppressor cells in an in vivo transplantation model. C57BL/6 wild-type mice were grafted with syngeneic or allogeneic skin transplants and treated with exogenous IL-33 daily. After 10 days of treatment, we analysed draining lymph node cellularity and found in allogeneic animals an increment in myeloid-derived suppressor cells, which co-express MHC-II, and become enriched upon IL-33 treatment. In line with this observation, inducible nitric oxide synthase and arginase 1 expression were also increased in allogeneic animals upon IL-33 administration. In addition, IL-33 treatment up-regulated the number of Foxp3+ regulatory T (Treg) cells in the allogeneic group, complementing the healthier integrity of the allografts and the increased allograft survival. Moreover, we demonstrate that IL-33 promotes CD4+ T-cell expansion and conversion of CD4+ Foxp3− T cells into CD4+ Foxp3+ Treg cells in the periphery. Lastly, the cytokine pattern of ex vivo-stimulated draining lymph nodes indicates that IL-33 dampens interferon-γ and IL-17 production, stimulating IL-10 secretion. Altogether, our work complements previous studies on the immune-modulatory activity of IL-33, showing that this cytokine affects myeloid-derived suppressor cells at the cell number and gene expression levels. More importantly, our research demonstrates for the first time that IL-33 allows for in vivo Foxp3+ Treg cell conversion and favours an anti-inflammatory or tolerogenic state by skewing cytokine production. Therefore, our data suggest a potential use of IL-33 to prevent allograft rejection, bringing new therapeutics to the transplantation field. PMID:25988395

  16. Stem Cell Transplant

    MedlinePlus

    ... transplant is a procedure that infuses healthy blood stem cells into your body to replace your damaged or ... A bone marrow transplant is also called a stem cell transplant. A bone marrow transplant may be necessary ...

  17. Meniscal allograft transplantation

    MedlinePlus

    Meniscus transplant; Surgery - knee - meniscus transplant; Surgery - knee - cartilage; Arthroscopy - knee - meniscus transplant ... that you are a good candidate for a meniscus transplant, x-rays of your knee are usually ...

  18. Transplantation tolerance in primates after total lymphoid irradiation and allogeneic bone marrow injection

    SciTech Connect

    Smit, J.A.; Hill, R.R.H.; Myburgh, J.A.; Browde, S.

    1980-08-01

    After total lymphoid irradiation (TLI), allogeneic bone marrow (BM) injection, and organ transplantation in baboons, there is a prolonged period of reduced lymphocyte proliferative responsiveness to polyclonal mitogens and allogeneic lymphocytes. The effect observed is greater with the use of fractionated TLI than after single doses of irradiation. Suppressor cell activity can be demonstrated in vitro in most animals by inhibition of mixed lymphocyte reactivity (MLR) by mitomycin-treated recipient lymphocytes harvested after TLI, with or without allogeneic BM injection, and organ transplantation. Preliminary data suggest the presence of both donor-specific and nondonor-specific suppression, although other interpretations are possible, and suppressor phenomena may not be responsible for the transplantation tolerance observed.

  19. Donor selection in T cell-replete haploidentical hematopoietic stem cell transplantation: knowns, unknowns, and controversies.

    PubMed

    Ciurea, Stefan O; Champlin, Richard E

    2013-02-01

    Multiple donors are generally available for haploidentical hematopoietic stem cell transplantation. Here we discuss the factors that should be considered when selecting donors for this type of transplantation according to the currently available evidence. Donor-specific anti-HLA antibodies (DSAs) increase the risk of graft failure and should be avoided whenever possible. Strategies to manage recipients with DSAs are discussed. One should choose a full haplotype mismatch rather than a better-matched donor and maximize the dose of infused hematopoietic cells. Donor age and sex are other important factors. Other factors, including predicted natural killer cell alloreactivity and consideration of noninherited maternal alleles, are more controversial. Larger studies are needed to further clarify the role of these factors for donor selection in haploidentical hematopoietic stem cell transplantation.

  20. The Leuven immunomodulatory protocol promotes T-regulatory cells and substantially prolongs survival after first intestinal transplantation.

    PubMed

    Ceulemans, Laurens J; Braza, Faouzi; Monbaliu, Diethard; Jochmans, Ina; De Hertogh, Gert; Du Plessis, Johannie; Emonds, Marie-Paule; Kitade, Hiroaki; Kawai, Masaru; Li, Ying; Xiangdong, Zhao; Koshiba, Takaaki; Sprangers, Ben; Brouard, Sophie; Waer, Mark; Pirenne, Jacques

    2016-04-01

    Intestinal transplantation (ITx) remains challenged by frequent/severe rejections and immunosuppression-related complications (infections/malignancies/drug-toxicity). We developed in the lab the Leuven Immunomodulatory Protocol (LIP) and translated it to the clinics. LIP consists in experimentally-proven maneuvers, destined to promote T-regulatory (Tregs)-dependent graft-protective mechanisms: Donor-Specific-Blood-Transfusion (DSBT); avoiding high-dose steroids/calcineurin-inhibitors; minimizing reperfusion-injury and endotoxin-translocation. LIP was tested in 13 consecutive ITx from deceased donors (2000-2014) (observational cohort study). Age was 37y(3y-57y). 5y graft/patient survival was 92%. One patient died at 9mo to Aspergillosis, another at 12y to NSAID-induced enteropathy. Early acute rejection (AR) developed in 2(15%); late AR in 3(23%); all were reversible. No chronic rejection occurred. No malignancies developed and eGFR remained stable post-Tx. At last follow-up {3.5y(0.5-12.5y)}, no DSA were detected and 11 survivors were TPN-free with a Karnofsky-score>90% in 8 recipients (follow-up >1y). A high frequency of circulating CD4+CD45RA-FoxP3high memory Tregs was found {1,8%(1.39-2.21)}, comparable to tolerant-Kidney Transplant (KTx) recipients and superior to stable IS-KTx, KTx with CR and healthy volunteers. In this ITx cohort we show that DSBT in a low-inflammatory/pro-regulatory environment activates Tregs at levels similar to tolerant-KTx, without causing sensitization. LIP limits rejection under reduced IS and thereby prolongs long-term survival to an extent not previously attained after ITx. This article is protected by copyright. All rights reserved.

  1. Intranigral transplantation of epigenetically induced BDNF-secreting human mesenchymal stem cells: implications for cell-based therapies in Parkinson's disease.

    PubMed

    Somoza, Rodrigo; Juri, Carlos; Baes, Mauricio; Wyneken, Ursula; Rubio, Francisco Javier

    2010-11-01

    It is thought that the ability of human mesenchymal stem cells (hMSC) to deliver neurotrophic factors might be potentially useful for the treatment of neurodegenerative disorders. The aim of the present study was to characterize signals and/or molecules that regulate brain-derived neurotrophic factor (BDNF) protein expression/delivery in hMSC cultures and evaluate the effect of epigenetically generated BDNF-secreting hMSC on the intact and lesioned substantia nigra (SN). We tested 4 different culture media and found that the presence of fetal bovine serum (FBS) decreased the expression of BDNF, whereas exogenous addition of epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF) to serum-free medium was required to induce BDNF release (125 ± 12 pg/day/10⁶ cells). These cells were called hM(N)SC. Although the induction medium inhibited the expression of alpha smooth muscle actin (ASMA), an hMSC marker, and increased the nestin-positive subpopulation of hMSC cultures, the ability to express BDNF was restricted to the nestin-negative subpopulation. One week after transplantation into the SN, the human cells integrated into the surrounding tissue, and some showed a dopaminergic phenotype. We also observed the activation of Trk receptors for neurotrophic factors around the implant site, including the BDNF receptor TrkB. When we transplanted these cells into the unilateral lesioned SN induced by striatal injection of 6-hydroxydopamine (6-OHDA), a significant hypertrophy of nigral tyrosine hydroxylase (TH)(+) cells, an increase of striatal TH-staining and stabilization of amphetamine-induced motor symptoms were observed. Therefore, hMSC cultures exposed to the described induction medium might be highly useful as a vehicle for neurotrophic delivery to the brain and specifically are strong candidates for future therapeutic application in Parkinson's disease.

  2. Comparative transcriptome analysis in induced neural stem cells reveals defined neural cell identities in vitro and after transplantation into the adult rodent brain.

    PubMed

    Hallmann, Anna-Lena; Araúzo-Bravo, Marcos J; Zerfass, Christina; Senner, Volker; Ehrlich, Marc; Psathaki, Olympia E; Han, Dong Wook; Tapia, Natalia; Zaehres, Holm; Schöler, Hans R; Kuhlmann, Tanja; Hargus, Gunnar

    2016-05-01

    Reprogramming technology enables the production of neural progenitor cells (NPCs) from somatic cells by direct transdifferentiation. However, little is known on how neural programs in these induced neural stem cells (iNSCs) differ from those of alternative stem cell populations in vitro and in vivo. Here, we performed transcriptome analyses on murine iNSCs in comparison to brain-derived neural stem cells (NSCs) and pluripotent stem cell-derived NPCs, which revealed distinct global, neural, metabolic and cell cycle-associated marks in these populations. iNSCs carried a hindbrain/posterior cell identity, which could be shifted towards caudal, partially to rostral but not towards ventral fates in vitro. iNSCs survived after transplantation into the rodent brain and exhibited in vivo-characteristics, neural and metabolic programs similar to transplanted NSCs. However, iNSCs vastly retained caudal identities demonstrating cell-autonomy of regional programs in vivo. These data could have significant implications for a variety of in vitro- and in vivo-applications using iNSCs.

  3. Transplantation Effectiveness of Induced Pluripotent Stem Cells Is Improved by a Fibrinogen Biomatrix in an Experimental Model of Ischemic Heart Failure

    PubMed Central

    Martens, Andreas; Zweigerdt, Robert; Baraki, Hassina; Rathert, Christian; Schecker, Natalie; Rojas-Hernandez, Sara; Schwanke, Kristin; Martin, Ulrich; Haverich, Axel; Kutschka, Ingo

    2015-01-01

    Objectives: The aim of this study was to investigate whether a fibrinogen biomatrix improves the transplantation effectiveness of induced pluripotent stem cells (iPSCs) in a model of myocardial infarction. Background: Early retention, engraftment, and cell proliferation are important factors for successful cardiac stem cell therapy. Common transplantation techniques involve the direction injection of cells in aqueous media. However, this approach yields low retention and variable cell biodistribution, leading to reduced grafts that are unable to sufficiently regenerate damaged myocardium. Biologically compatible scaffolds that improve the retention of injected cells can improve cardiac stem cell therapy. Methods: Murine iPSCs were transfected for luciferase reporter gene expression. First, in vitro experiments were performed comparing cell viability in fibrinogen and medium. Second, iPSCs were transplanted intramyocardially by direct injection into ischemic myocardium of immunodeficient mice, following permanent left coronary artery ligation. Cells were delivered in medium or fibrinogen. Follow-up included graft assessment by bioluminescence imaging, the evaluation of cardiac function by magnetic resonance imaging, and histology to evaluate graft size and determine the extent of myocardial scarring. Results: In vitro experiments showed proliferation of iPSCs in fibrinogen from 6.4×103±8.0×102 after 24 h to 2.1×104±3.2×103 after 72 h. Early cardiac cell amount in control group animals was low (23.7%±0.7%) with massive cell accumulation in the right (46.3%±1.0%) and the left lung (30.0%±0.6%). When iPSCs were injected applying the fibrinogen biomatrix, intramyocardial cell amount was increased (66.3%±0.9%) with demonstrable graft proliferation over the experimental time course. Left ventricle-function was higher in the fibrinogen group (42.9%±2.8%), also showing a higher fraction of refilled infarcted-area (66.9%±2.7%). Conclusions: The fibrinogen

  4. Successful kidney transplant in a patient with IgG anti HLA Class-I auto-antibodies: a case report.

    PubMed

    Alhamid, Naji; Alterky, Hani; Almouslem, Amanda; Al-Rayess, Heba; Othman, Mohammad Imad

    2014-07-01

    Donor specific antibodies (DSA) play a significant role in graft rejection. Many laboratory methods, varied in sensitivity and specificity, are used to detect them. We report a case of a 38-year-old man presented with end stage renal disease considered for kidney transplantation. He had no history of blood transfusions nor transplantation procedures. Dilemma rose when he got multiple positive crossmatches with matching donors and a positive autologous crossmatch due to IgG anti HLA auto-antibodies, which are at the same time against matched donors. Since positive crossmatch is a contraindication for transplant, we couldn't perform transplant from any matched donor. Therefore, we considered a total mismatched donor then transplantation was performed. Observation after surgery showed normalization of creatinine, blood pressure and a good function of the planted allograft for two years of follow up.

  5. Challenges inherent to the diagnosis of antibody-mediated rejection in lung transplantation

    PubMed Central

    Chin, Nicholas; Westall, Glen; Paraskeva, Miranda; Ciciulla, John; Cantwell, Linda; Snell, Greg

    2015-01-01

    A bilateral sequential lung transplant was performed on a young female with cystic fibrosis-related bronchiectasis. She had negative prospective T- and B-cell crossmatch, and no known donor-specific antibodies. Post-transplantation, she developed bilateral pulmonary infiltrates of uncertain etiology, compounded by persistent tachycardia and questionable medication adherence. Despite aggressive intervention for suspected cellular rejection with high-dose intravenous corticosteroid, immunoglobulin, and anti-thymocyte globulin, her condition deteriorated to ultimately require ventilatory support. The eventual discovery of eplet donor-recipient mismatches on related DQB1 alleles raised the diagnosis of antibody-mediated rejection. Before plasmapheresis could be instituted, the patient rapidly succumbed to respiratory failure. Postmortem examination confirmed features of atypical allograft rejection, without evidence of classic acute cellular rejection. This is an unconventional case of antibody-mediated lung allograft rejection – an entity that is currently a difficult diagnostic and therapeutic challenge. Prevention of donor-specific antibodies by correct donor-recipient matching, and optimizing adherence post-transplantation are most important. PMID:25802749

  6. Antibody Subclass Repertoire and Graft Outcome Following Solid Organ Transplantation

    PubMed Central

    Valenzuela, Nicole M.; Hickey, Michelle J.; Reed, Elaine F.

    2016-01-01

    Long-term outcomes in solid organ transplantation are constrained by the development of donor-specific alloantibodies (DSA) against human leukocyte antigen (HLA) and other targets, which elicit antibody-mediated rejection (ABMR). However, antibody-mediated graft injury represents a broad continuum, from extensive complement activation and tissue damage compromising the function of the transplanted organ, to histological manifestations of endothelial cell injury and mononuclear cell infiltration but without concurrent allograft dysfunction. In addition, while transplant recipients with DSA as a whole fare worse than those without, a substantial minority of patients with DSA do not experience poorer graft outcome. Taken together, these observations suggest that not all DSA are equally pathogenic. Antibody effector functions are controlled by a number of factors, including antibody concentration, antigen availability, and antibody isotype/subclass. Antibody isotype is specified by many integrated signals, including the antigen itself as well as from antigen-presenting cells or helper T cells. To date, a number of studies have described the repertoire of IgG subclasses directed against HLA in pretransplant patients and evaluated the clinical impact of different DSA IgG subclasses on allograft outcome. This review will summarize what is known about the repertoire of antibodies to HLA and non-HLA targets in transplantation, focusing on the distribution of IgG subclasses, as well as the general biology, etiology, and mechanisms of injury of different humoral factors. PMID:27822209

  7. Cytosine-Phosphorothionate-Guanine Oligodeoxynucleotides Exacerbates Hemophagocytosis by Inducing Tumor Necrosis Factor-Alpha Production in Mice after Bone Marrow Transplantation.

    PubMed

    Liu, Jiajia; Guo, Yong-Mei; Onai, Nobuyuki; Ohyagi, Hideaki; Hirokawa, Makoto; Takahashi, Naoto; Tagawa, Hiroyuki; Ubukawa, Kumi; Kobayashi, Isuzu; Tezuka, Hiroyuki; Minamiya, Yoshihiro; Ohteki, Toshiaki; Sawada, Kenichi

    2016-04-01

    Hemophagocytic syndrome (HPS) is frequently associated with hematopoietic stem cell transplantation and is treated with some benefit derived from TNF-α inhibitors. However, the mechanisms of how HPS occurs and how a TNF-α inhibitor exerts some benefit to HPS management have remained unclear. We evaluated the effect of toll-like receptor (TLR) ligands, especially focusing on cytosine-phosphorothionate-guanine oligodeoxynucleotide (CpG), a TLR9 ligand, on HPS in mice that underwent transplantation with syngeneic or allogeneic bone marrow (BM) cells (Syn-BMT, Allo-BMT), or with allogeneic BM cells plus splenocytes to promote graft-versus-host disease (GVHD mice). Hemophagocytosis was a common feature early after all BMT, but it subsided in Syn-BMT and Allo-BMT mice. In GVHD mice, however, hemophagocytosis persisted and was accompanied by upregulated production of IFN-γ but not TNF-α, and it was suppressed by blockade of IFN-γ but not TNF-α. A single injection of the TLR9 ligand CpG promoted HPS in all BMT mice and was lethal in GVHD mice, accompanied by greatly upregulated production of TNF-α, IL-6, and IFN-γ. Blocking of TNF-α, but not IL-6 or IFN-γ, suppressed CpG-induced HPS in all BMT mice and rescued GVHD mice from CpG-induced mortality. Thus, TLR9 signaling mediates TNF-α-driven HPS in BMT mice and is effectively treated through TNF-α inhibition.

  8. Immune Response to Tissue Restricted Self-Antigens Induces Airway Inflammation and Fibrosis Following Murine Lung Transplantation

    PubMed Central

    Subramanian, V.; Ramachandran, S.; Banan, B.; Bharat, A.; Wang, X.; Benshoff, N.; Kreisel, D.; Gelman, A. E.; Mohanakumar, T.

    2014-01-01

    Immune responses against lung-associated self-antigens (self-Ags) are hypothesized to play a role in the development of chronic lung graft rejection. We determined whether immune responses to lung self-Ags, K-alpha-1-tubulin (Kα1T) and Collagen V (Col-V) in the absence of alloimmunity, could promote airway inflammation and fibrosis. Following syngeneic murine orthotopic lung transplantation (LTx) we administered antibodies (Abs) to either Kα1T or Col-V or in combination to both of these self-Ags. As compared to recipients of isotype control Abs Kα1T Abs and/or Col-V Abs-treated recipients had marked lung graft cellular infiltration and bronchiolar fibrosis, This inflammation was also associated the accumulation of Kα1T and Col-V specific IFN-γ+ and IL-17+ T cells. Notably, the administration of Abs to Kα1T led to cellular and humoral immune responses to Col-V prior to development of fibrosis, and vice versa, indicating that epitope spreading can occur rapidly in an alloantigen independent manner. Collectively, these data support a model of chronic lung transplant rejection where the progressive loss of self-tolerance through epitope spreading promotes airway fibrosis. Strategies that target autoreactive Abs may be useful to inhibit chronic rejection of lung grafts. PMID:25220332

  9. Nuclear factor erythroid-2 related factor 2 overexpressed mesenchymal stem cells transplantation, improves renal function, decreases injuries markers and increases repair markers in glycerol-induced Acute kidney injury rats

    PubMed Central

    Zhaleh, Fateme; Amiri, Fatemeh; Mohammadzadeh-Vardin, Mohammad; Bahadori, Marzie; Harati, Mitra Dehghan; Roudkenar, Mehryar Habibi; Saki, Sasan

    2016-01-01

    Objective(s): Recently cell therapy is a promising therapeutic modality for many types of disease including acute kidney injury (AKI). Due to the unique biological properties, mesenchymal stem cells (MSCs) are attractive cells in this regard. This study aims to transplant MSCs equipped with nuclear factor E2-related factor 2 (Nrf2) in rat experimental models of acute kidney and evaluate regeneration potential of injured kidney especially expression of injury and repaired biomarkers. Materials and methods: Nrf2 was overexpressed in bone marrow-derived MSCs by pcDNA.3.1 plasmid. AKI was induced using glycerol in rat models. The regenerative potential of Nrf2-overexpressed MSCs was evaluated in AKI-Induced animal models using biochemical and histological methods after transplantation. Expression of repaired genes, AQP1 and CK-18, as well as injury markers, Kim-1 and Cystatin C, was also assayed in engrafted kidney sections. Results: Our results revealed that transplantation of Nrf2-overexpressed MSCs into AKI-induced rats decreased blood urea nitrogen and creatinine and ameliorated kidney regeneration throughout 14 days. Upregulation of repaired markers and downregulation of injury markers were considerable 14 days after transplantation. Conclusions: Overexpression of Nrf2 in MSCs suggests a new strategy to increase efficiency of MSC-based cell therapy in AKI. PMID:27114803

  10. Heart Transplantation

    MedlinePlus

    A heart transplant removes a damaged or diseased heart and replaces it with a healthy one. The healthy heart comes from a donor who has died. It is the last resort for people with heart failure when all other treatments have failed. The ...

  11. Transplant production

    Technology Transfer Automated Retrieval System (TEKTRAN)

    For field pepper (Capsicum spp.) production, plants can be established from direct seed or transplants depending on the location and cultural practices for the specific pepper type grown. Direct seeding can result in slow, variable, and reduced plant stands due to variations in soil temperature, wat...

  12. Oral manifestations in transplant patients

    PubMed Central

    Nappalli, Deepika; Lingappa, Ashok

    2015-01-01

    Organ transplantation is a widely undertaken procedure and has become an important alternative for the treatment of different end-stage organ diseases that previously had a poor prognosis. The field of organ transplant and hematopoietic stem cell transplant is developing rapidly. The increase in the number of transplant recipients also has an impact on oral and dental services. Most of the oral problems develop as a direct consequence of drug-induced immunosuppression or the procedure itself. These patients may present with oral complaints due to infections or mucosal lesions. Such lesions should be identified, diagnosed, and treated. New treatment strategies permit continuous adaptation of oral care regimens to the changing scope of oral complications. The aim of this review is to analyze those oral manifestations and to discuss the related literature. PMID:26005458

  13. Acute Pancreatitis after Kidney Transplantation

    PubMed Central

    Tabakovic, Mithat; Salkic, Nermin N.; Bosnjic, Jasmina; Alibegovic, Ervin

    2012-01-01

    Acute pancreatitis is a rare but life-threatening complication in patients with transplanted kidney. The incidence of acute pancreatitis after kidney transplantation ranges from 2% to 7%, with mortality rate between 50 and 100%. We report a case of a female patient aged 46 years, developing an interstitial acute pancreatitis 8 years following a renal transplantation. The specific aethiological factor was not clearly established, although possibility of biliary pancreatitis with spontaneous stone elimination and/or medication-induced pancreatitis remains the strongest. Every patient after renal transplantation with an acute onset of abdominal pain should be promptly evaluated for presence of pancreatitis with a careful application of the most appropriate diagnostic procedure for each individual patient. PMID:23259142

  14. Intermittent Antibody-based Combination Therapy Removes Allo-antibodies and Achieves Indefinite Heart Transplant Survival in Pre-sensitised Recipients

    PubMed Central

    Shariff, Hina; Tanriver, Yakup; Brown, Kathryn L.; Meader, Lucy; Greenlaw, Roseanna; Mamode, Nizam; Jurcevic, Stipo

    2010-01-01

    Background It is well established that primed/memory T cells play a critical role in heart transplant rejection. This contributes to the challenges faced in the transplant clinic since current treatments which are efficient in controlling naïve T cell alloresponses have limited efficacy on primed T cell responders. Methods Fully MHC mismatched heart transplantation was performed from BALB/c to C57BL/6 mice pre-sensitised with BALB/c splenocytes 14 days pre-transplantation. A combination therapy comprising CD70-, CD154- and CD8-specific antibodies was administered at day 0 and 4 post-transplantation with Rapamycin on days 0-4. Results The antibody combination therapy extended heart transplant survival in pre-sensitised recipients from MST 8 days (median survival time) to MST 78 days. A decrease in the number of splenic IFN-γ secreting cells measured by ELISpot assay was seen in the treated group compared to the untreated controls. However, graft-infiltrating CD8+ and CD4+ T cells persisted despite treatment and the number of intra-graft CD4+ T cells increased at day 30 post-transplantation. When an additional “rescue therapy” comprising the same antibodies was re-administered at days 30, 60 and 90 post-transplantation, T cell infiltration was reduced and indefinite graft survival was observed. Furthermore, rescue therapy resulted in gradual decrease in titre and, by day 90 post-transplantation the complete loss of the pre-existing, donor-specific antibodies. Conclusion We conclude that our antibody combination therapy extends allograft survival in pre-sensitised recipients. When combined with intermittent antibody-mediated rescue therapy, this results in indefinite allograft survival and a loss of the pre-existing, donor-specific antibodies from the circulation. PMID:20571468

  15. Effect of endothelial progenitor cells derived from human umbilical cord blood on oxygen-induced retinopathy in mice by intravitreal transplantation

    PubMed Central

    Wang, Dan; Zhang, Bo; Shi, Hui; Yang, Wei; Bi, Ming-Chao; Song, Xiang-Fu; Zhang, Chen; Cheng, Jian-Hui; Hao, Ji-Long; Song, E

    2016-01-01

    AIM To investigate the effect of endothelial progenitor cells (EPCs) labeled by carboxy fluorescein diacetate succinimidyl ester (CFSE) on murine oxygen-induced retinopathy (OIR) by intravitreal transplantation. METHODS After isolated from human umbilical cord blood mononuclear cells, EPCs were cultivated and then labeled with CFSE in vitro. C57BL/6J mice were placed to 75% hyperoxia chamber from P7 to P12 to establish OIR model. At P12, OIR mice were intravitreally injected with 1 µL suspension contained 2×105 EPCs (EPCs group) or isometric phosphate buffered saline (PBS group). The contralateral eye of each mice received no injection (OIR group). Evans blue angiography and frozen section were examined to track the labeled cells in OIR group at P15 and P19. Using retina paraffin sections and adenosinediphos phatase staining at P12 and P19, the effect of EPCs on OIR mice was evaluated quantitatively and qualitatively. RESULTS The retinas from EPCs group with less non-perfusion area and fewer peripheral tufts were observed at P19, comparing with that from PBS or OIR group. The retinopathy in EPCs group receded earlier with less non-ganglion cells and neovascular nuclei, together with relatively regular distribution. The counts of the neovascular nuclei at P19 were reduced by 44% or 45%, compared with those of OIR group or PBS group respectively. Three days after EPCs injection, a large number of EPCs appeared in the vitreous cavity and adhered to the retinal surface. While at one week, the cells gathered between the internal plexiform layer and the inner limiting membrane, and some EPCs appeared in retinal vessels. CONCLUSION EPCs transplantation can participate in the reparative procedure of the neovascularization in OIR. PMID:27990359

  16. Effective wound healing in streptozotocin-induced diabetic rats by adipose-derived stromal cell transplantation in plasma-gel containing fragmin/protamine microparticles.

    PubMed

    Sumi, Yuki; Ishihara, Masayuki; Kishimoto, Satoko; Takikawa, Makoto; Hattori, Hidemi; Takikawa, Megumi; Azuma, Ryuichi; Nakamura, Shingo; Fujita, Masanori; Kiyosawa, Tomoharu

    2014-01-01

    We investigated the effectiveness of the application of inbred adipose-derived stromal cells (IR-ASCs) in high inbred rat plasma (IRP) (6%)-Dulbecco modified Eagle medium (DMEM) gel with fragmin/protamine microparticles (F/P MPs) (IR-ASCs + IRP-DMEM gel + F/P MPs) on wound healing in streptozotocin-induced diabetic rats. F/P MPs have previously been used as a cell carrier for IR-ASCs in inbred Fisher 344 rats and for preservation and controlled release of various cytokines in IRP-DMEM gel. We applied IR-ASCs + IRP-DMEM gel + F/P MPs to full-thickness skin excisions on the backs of the diabetic rats. The statistical significance of wound closure was evaluated on postwounding days 3, 7, 10, and 14, and the skin area surrounding the wound was removed for histological examination on days 7 and 14. The wound closure rate and histological examination of wounds treated with IR-ASCs + IRP-DMEM gel + F/P MPs demonstrated significantly advanced epithelialization, capillary formation, and granulation tissue formation. When DiI-labeled IR-ASCs + IRP-DMEM gel + F/P MPs were applied to full-thickness skin wounds on the backs of the diabetic rats, histological observation at 2 weeks showed appearances of both DiI-labeled granulation tissue and CD31-immunostained microvessels in the transplant areas. A portion of the transplanted IR-ASCs + IRP-DMEM gel + F/P MPs had been taken up into the granulation tissues to promote wound healing. Thus, IR-ASCs + IRP-DMEM gel + F/P MPs were effective for repairing healing-impaired wounds such as those arising in the diabetic rats.

  17. Low-grade proteinuria and microalbuminuria in renal transplantation.

    PubMed

    Halimi, Jean-Michel

    2013-07-27

    Nephrotic-range proteinuria has been known for years to be associated with poor renal outcome. Newer evidence indicates that early (1-3 months after transplantation) low-grade proteinuria and microalbuminuria (1) provide information on the graft in terms of donor characteristics and ischemia/reperfusion injury, (2) may occur before the development of donor-specific antibodies, (3) predict the development of diabetes and cardiovascular events, and (4) are associated with reduced long-term graft and patient survivals. Low-grade proteinuria and microalbuminuria are also predictive of diabetes, cardiovascular morbidity, and death in nontransplanted populations, which may help us to understand the pathophysiology of low-grade proteinuria or microalbuminuria in renal transplantation. The impact of immunosuppressive medications, including mammalian target of rapamycin inhibitors, on graft survival is still discussed, and the effect on proteinuria is crucial to the debate. The fact that chronic allograft rejection may exist as early as 3 months after renal transplantation indicates that optimal management of low-grade proteinuria or microalbuminuria should occur very early after transplantation to improve long-term renal function and the overall outcome of renal transplant recipients. The presence of low-grade proteinuria or microalbuminuria early after transplantation must be taken into account to choose adequate immunosuppressive and antihypertensive medications. Limited information exists regarding the benefit of therapeutic interventions to reduce low-grade proteinuria or microalbuminuria. Whether renin angiotensin blockade results in optimal nephroprotection in patients with low-grade proteinuria or microalbuminuria is not proven, especially in the absence of chronic allograft nephropathy. Observational studies and randomized clinical trials yield conflicting results. Finally, randomized clinical trials are urgently needed.

  18. Acute antibody-mediated rejection in kidney transplant recipients.

    PubMed

    Davis, Scott; Cooper, James E

    2017-01-01

    Antibody-mediated rejection has now been recognized as one of the most important causes of graft loss. Transplantation across HLA barriers and nonadherence can result in acute antibody-mediated rejection, which is associated with particularly worse graft outcomes. New technologies, including genomic studies and assays to detect and define donor-specific antibodies, have provided important insights into the pathophysiology and diagnosis of acute antibody-mediated rejection but have engendered many questions about the clinical application of these tests in the prognosis and prevention of this protean disease process. In this article, we review the pathophysiology of acute antibody-mediated rejection, the evolving diagnostic criteria, and specific challenges related to its prognosis, treatment, and prevention.

  19. Antibiotic-Induced Depletion of Anti-Inflammatory Clostridia is Associated with the Development of GVHD in Pediatric Stem Cell Transplant Patients.

    PubMed

    Simms-Waldrip, Tiffany R; Sunkersett, Gauri; Coughlin, Laura A; Savani, Milan R; Arana, Carlos; Kim, Jiwoong; Kim, Minsoo; Zhan, Xiaowei; Greenberg, David E; Xie, Yang; Davies, Stella M; Koh, Andrew Y

    2017-02-09

    Adult stem cell transplantation (SCT) patients with graft-versus-host-disease (GVHD) exhibit significant disruptions in gut microbial communities. These changes are associated with higher overall mortality and appear to be driven by specific antibiotic therapies. It is unclear whether pediatric SCT patients who develop GVHD exhibit similar antibiotic-induced gut microbiota community changes. Here, we show that pediatric SCT patients (from Children's Medical Center Dallas, n=8, and Cincinnati Children's Hospital, n=7) who develop GVHD show a significant decline, up to 10-log fold, in gut anti-inflammatory Clostridia (AIC), compared to those without GVHD. In fact, the development of GVHD is significantly associated with this AIC decline and with cumulative antibiotic exposure, particularly antibiotics effective against anaerobic bacteria (p= 0.003, Firth logistic regression analysis). Using metagenomic shotgun sequencing analysis, we were able to identify specific commensal bacterial species, including AIC, that were significantly depleted in GVHD patients. We then used a preclinical GVHD model to verify our clinical observations. Clindamycin depleted AIC and exacerbated GVHD in mice, whereas oral AIC supplementation increased gut AIC levels and mitigated GVHD in mice. Together, these data suggest that an antibiotic-induced AIC depletion in the gut microbiota is associated with the development of GVHD in pediatric SCT patients.

  20. Immunomodulation with dendritic cells and donor lymphocyte infusion converge to induce graft vs neuroblastoma reactions without GVHD after allogeneic bone marrow transplantation

    PubMed Central

    Ash, S; Stein, J; Askenasy, N; Yaniv, I

    2010-01-01

    Background: Mounting evidence points to the efficacy of donor lymphocyte infusion (DLI) and immunisation with tumour-pulsed dendritic cells (DC) in generating graft vs leukaemia reactions after allogeneic bone marrow transplantation (BMT). We assessed the efficacy of DLI and DC in generating potent graft vs neuroblastoma tumour (GVT) reactions following allogeneic BMT. Methods: Mice bearing congenic (H2Ka) Neuro-2a tumours were grafted with allogeneic (H2Kb) T-cell-depleted bone marrow cells. Tumour-pulsed donor DC (DCNeuro2a) were inoculated (on day +7) in conjunction with donor (H2Kb) and haploidentical (H2Ka/b) lymphocytes. Results: Murine Neuro-2a cells elicit immune reactions as efficient as B lymphoma in major histocompatibility complex antigen-disparate mice. Lymphopenia induced by conditioning facilitates GVT, and transition to adaptive immunity is enhanced by simultaneous infusion of and DCNeuro2a and lymphocytes devoid of graft vs host (GVH) activity (H2Ka/b). In variance, the efficacy of DC-mediated immunomodulation was diminished by severe graft vs host disease (GVHD), showing mechanistic dissociation and antagonising potential to GVT. Conclsions: The GVHD is not a prerequisite to induce GVT reactivity after allogeneic BMT, but is rather detrimental to induction of anti-tumour immunity by DC-mediated immunomodulation. Simultaneous inoculation of tumour-pulsed donor DC and DLI synergise in stimulation of potent GVT reactions to the extent of eradication of established NB tumours. PMID:20978501

  1. Monitoring of organ transplants through genomic analyses of circulating cell-free DNA

    NASA Astrophysics Data System (ADS)

    de Vlaminck, Iwijn

    Solid-organ transplantation is the preferred treatment for patients with end-stage organ diseases, but complications due to infection and acute rejection undermine its long-term benefits. While clinicians strive to carefully monitor transplant patients, diagnostic options are currently limited. My colleagues and I in the lab of Stephen Quake have found that a combination of next-generation sequencing with a phenomenon called circulating cell-free DNA enables non-invasive diagnosis of both infection and rejection in transplantation. A substantial amount of small fragments of cell-free DNA circulate in blood that are the debris of dead cells. We discovered that donor specific DNA is released in circulation during injury to the transplant organ and we show that the proportion of donor DNA in plasma is predictive of acute rejection in heart and lung transplantation. We profiled viral and bacterial DNA sequences in plasma of transplant patients and discovered that the relative representation of different viruses and bacteria is informative of immunosuppression. This discovery suggested a novel biological measure of a person's immune strength, a finding that we have more recently confirmed via B-cell repertoire sequencing. Lastly, our studies highlight applications of shotgun sequencing of cell-free DNA in the broad, hypothesis free diagnosis of infection.

  2. Ex vivo application of carbon monoxide in UW solution prevents transplant-induced renal ischemia/reperfusion injury in pigs.

    PubMed

    Yoshida, J; Ozaki, K S; Nalesnik, M A; Ueki, S; Castillo-Rama, M; Faleo, G; Ezzelarab, M; Nakao, A; Ekser, B; Echeverri, G J; Ross, M A; Stolz, D B; Murase, N

    2010-04-01

    I/R injury is a major deleterious factor of successful kidney transplantation (KTx). Carbon monoxide (CO) is an endogenous gaseous regulatory molecule, and exogenously delivered CO in low concentrations provides potent cytoprotection. This study evaluated efficacies of CO exposure to excised kidney grafts to inhibit I/R injury in the pig KTx model. Porcine kidneys were stored for 48 h in control UW or UW supplemented with CO (CO-UW) and autotransplanted in a 14-day follow-up study. In the control UW group, animal survival was 80% (4/5) with peak serum creatinine levels of 12.0 +/- 5.1 mg/dL. CO-UW showed potent protection, and peak creatinine levels were reduced to 6.9 +/- 1.4 mg/dL with 100% (5/5) survival without any noticeable adverse event or abnormal COHb value. Control grafts at 14 days showed significant tubular damages, focal fibrotic changes and numerous infiltrates. The CO-UW group showed significantly less severe histopathological changes with less TGF-beta and p-Smad3 expression. Grafts in CO-UW also showed significantly lower early mRNA levels for proinflammatory cytokines and less lipid peroxidation. CO in UW provides significant protection against renal I/R injury in the porcine KTx model. Ex vivo exposure of kidney grafts to CO during cold storage may therefore be a safe strategy to reduce I/R injury.

  3. Antibody response to DBY minor histocompatibility antigen is induced after allogeneic stem cell transplantation and in healthy female donors

    PubMed Central

    Miklos, David B.; Kim, Haesook T.; Zorn, Emmanuel; Hochberg, Ephraim P.; Guo, Luxuan; Mattes-Ritz, Alex; Viatte, Sebastien; Soiffer, Robert J.; Antin, Joseph H.

    2005-01-01

    Minor histocompatibility antigens (mHAs) recognized by donor T cells play a central role as immunologic targets of graft-versus-host disease (GVHD) and graft versus leukemia after allogeneic hematopoietic stem cell transplantation (HSCT). Men who have undergone sex-mismatched allogeneic HSCT are at high risk for GVHD because of immune responses directed against mHAs encoded by genes on the Y chromosome (termed H-Y antigens). We hypothesized that the immunogenicity of mHAs results in a coordinated response involving B cells as well as T cells. To test this, we measured antibody responses to a well-characterized H-Y antigen, dead box RNA helicase Y (DBY), and its homolog, DBX, in 150 HSCT patients. Using Western blot and enzyme-linked immunosorbent assay (ELISA), we found that 50% of male patients who received stem cell grafts from female donors developed antibody responses to recombinant DBY protein. Antibodies to DBY were also detected in 17% of healthy women, but not in healthy men. Antibody responses were directed primarily against areas of amino acid disparity between DBY and DBX. These studies demonstrate that the immune response to mHA includes the generation of specific antibodies and suggests that the serologic response to these antigens may also be useful in the identification of new mHAs. PMID:14512314

  4. Pancreatic Islet Transplantation

    MedlinePlus

    ... allo-transplantation?" For each pancreatic islet allo-transplant infusion, researchers use specialized enzymes to remove islets from ... in a lab. Transplant patients typically receive two infusions with an average of 400,000 to 500, ...

  5. [Effect of allogenic mesenchymal stem cells transplantation on the expression of interleukin-22 and matrix metalloproteinase-3 in rats with collagen induced arthritis].

    PubMed

    Liu, G Y; Bian, S; Li, F; Li, X F; Fan, K; An, H Z; Jia, X X

    2017-03-07

    Objective: To study the effect of allogeneic bone marrow mesenchymal stem cells transplantation on the expression of interleukin -22 (IL-22), matrix metalloproteinase -3 (MMP-3) in serum and synovial of rats with collagen induced arthritis. Methods: Type Ⅱ collagen were injected twice to establish the collagen induced arthritis (CIA) rat model. Forty-eight rats were randomly divided into 3 groups: control group, CIA control group, CIA experiment group. Rat bone marrow mesenchymal stem cells were cultured by bone marrow method combined with adherent culture method. After identify, the remaining cells were injected in the CIA experimental group. Enzyme linked immunosorbent assay (ELISA) and immunohistochemistry were used to detect the expression of IL-22 and MMP-3 in serum and anklebone joint's synovium of rats, respectively. Synovial cells were isolated and cultured, and were treated with different concentrations of IL-22. MMP-3 protein and mRNA were detected before and after stimulation by Western blot and real-time quantitative polymerase chain reaction (RT-qPCR). Results: After MSC transplantation, arthritis index, X-ray, HE staining of CIA rat showed that joint damage significantly reduced compared with the control group. The ELISA results showed that the expression of MMP-3 and IL-22 in CIA control group was higher than those in the control group (125.79±9.12 vs 102.00±7.63 ng/ml, P<0.05), (292.35±31.23 vs 257.27±13.99 ng/ml, P<0.05) and CIA experiment group (125.79±9.12 vs 97.94±9.50 ng/ml, P<0.05), (292.35±31.23 vs 262.16±22.02 ng/ml, P<0.05) with statistically significant difference (P<0.05). There was no significant difference between the control group and CIA experimental group. Immunohistochemical showed similar results with ELISA. Western blotting and RT-qPCR showed that MMP-3 protein and mRNA expression was increased after IL-22 stimulation in a dose-dependent manner. Conclusion: IL-22 and MMP-3 play an important role in the pathogenesis of

  6. Remote ischemic perconditioning prevents liver transplantation-induced ischemia/reperfusion injury in rats: Role of ROS/RNS and eNOS

    PubMed Central

    He, Ning; Jia, Jun-Jun; Li, Jian-Hui; Zhou, Yan-Fei; Lin, Bing-Yi; Peng, Yi-Fan; Chen, Jun-Jie; Chen, Tian-Chi; Tong, Rong-Liang; Jiang, Li; Xie, Hai-Yang; Zhou, Lin; Zheng, Shu-Sen

    2017-01-01

    AIM To investigate the underlying mechanisms of the protective role of remote ischemic perconditioning (RIPerC) in rat liver transplantation. METHODS Sprague-Dawley rats were subjected to sham, orthotopic liver transplantation (OLT), ischemic postconditioning (IPostC) or RIPerC. After 3 h reperfusion, blood samples were taken for measurement of alanine aminotransferase, aspartate aminotransferase, creatinine (Cr) and creatinine kinase-myocardial band (CK-MB). The liver lobes were harvested for the following measurements: reactive oxygen species (ROS), H2O2, mitochondrial membrane potential (ΔΨm) and total nitric oxide (NO). These measurements were determined using an ROS/H2O2, JC1 and Total NOx Assay Kit, respectively. Endothelial NO synthase (eNOS) was analyzed by reverse transcription-polymerase chain reaction (RT-PCR) and western blotting, and peroxynitrite was semi-quantified by western blotting of 3-nitrotyrosine. RESULTS Compared with the OLT group, the grafts subjected to RIPerC showed significantly improved liver and remote organ functions (P < 0.05). ROS (P < 0.001) including H2O2 (P < 0.05) were largely elevated in the OLT group as compared with the sham group, and RIPerC (P < 0.05) reversed this trend. The collapse of ΔΨm induced by OLT ischemia/reperfusion (I/R) injury was significantly attenuated in the RIPerC group (P < 0.001). A marked increase of NO content and phosphoserine eNOS, both in protein and mRNA levels, was observed in liver graft of the RIPerC group as compared with the OLT group (P < 0.05). I/R-induced 3-nitrotyrosine content was significantly reduced in the RIPerC group as compared with the OLT group (P < 0.05). There were no significant differences between the RIPerC and IPostC groups for all the results except Cr. The Cr level was lower in the RIPerC group than in the IPostC group (P < 0.01). CONCLUSION Liver graft protection by RIPerC is similar to or better than that of IPostC, and involves inhibition of oxidative stress and up

  7. Comparison of structural changes in skin and amnion tissue grafts for transplantation induced by gamma and electron beam irradiation for sterilization.

    PubMed

    Mrázová, H; Koller, J; Kubišová, K; Fujeríková, G; Klincová, E; Babál, P

    2016-06-01

    Sterilization is an important step in the preparation of biological material for transplantation. The aim of the study is to compare morphological changes in three types of biological tissues induced by different doses of gamma and electron beam radiation. Frozen biological tissues (porcine skin xenografts, human skin allografts and human amnion) were irradiated with different doses of gamma rays (12.5, 25, 35, 50 kGy) and electron beam (15, 25, 50 kGy). Not irradiated specimens served as controls. The tissue samples were then thawn and fixed in 10 % formalin, processed by routine paraffin technique and stained with hematoxylin and eosin, alcian blue at pH 2.5, orcein, periodic acid Schiff reaction, phosphotungstic acid hematoxylin, Sirius red and silver impregnation. The staining with hematoxylin and eosin showed vacuolar cytoplasmic changes of epidermal cells mainly in the samples of xenografts irradiated by the lowest doses of gamma and electron beam radiation. The staining with orcein revealed damage of fine elastic fibers in the xenograft dermis at the dose of 25 kGy of both radiation types. Disintegration of epithelial basement membrane, especially in the xenografts, was induced by the dose of 15 kGy of electron beam radiation. The silver impregnation disclosed nuclear chromatin condensation mainly in human amnion at the lowest doses of both radiation types and disintegration of the fine collagen fibers in the papillary dermis induced by the lowest dose of electron beam and by the higher doses of gamma radiation. Irradiation by both, gamma rays and the electron beam, causes similar changes on cells and extracellular matrix, with significant damage of the basement membrane and of the fine and elastic and collagen fibers in the papillary dermis, the last caused already by low dose electron beam radiation.

  8. Allogeneic/xenogeneic transplantation of peptide-labeled mitochondria in Parkinson's disease: restoration of mitochondria functions and attenuation of 6-hydroxydopamine-induced neurotoxicity.

    PubMed

    Chang, Jui-Chih; Wu, Shey-Lin; Liu, Ko-Hung; Chen, Ya-Hui; Chuang, Chieh-Sen; Cheng, Fu-Chou; Su, Hong-Lin; Wei, Yau-Huei; Kuo, Shou-Jen; Liu, Chin-San

    2016-04-01

    Although restoration of mitochondrial function in mitochondrial diseases through peptide-mediated allogeneic mitochondrial delivery (PMD) has been demonstrated in vitro, the in vivo therapeutic efficacy of PMD in Parkinson's disease (PD) has yet to be determined. In this study, we compared the functionality of mitochondrial transfer with or without Pep-1 conjugation in neurotoxin (6-hydroxydopamine, 6-OHDA)-induced PC12 cells and PD rat models. We injected mitochondria into the medial forebrain bundle (MFB) of the PD rats after subjecting the nigrostriatal pathway to a unilateral 6-OHDA lesion for 21 days, and we verified the effectiveness of the mitochondrial graft in enhancing mitochondrial function in the soma of the substantia nigra (SN) neuron through mitochondrial transport dynamics in the nigrostriatal circuit. The result demonstrated that only PMD with allogeneic and xenogeneic sources significantly sustained mitochondrial function to resist the neurotoxin-induced oxidative stress and apoptotic death in the rat PC12 cells. The remaining cells exhibited a greater capability of neurite outgrowth. Furthermore, allogeneic and xenogeneic transplantation of peptide-labeled mitochondria after 3 months improved the locomotive activity in the PD rats. This increase was accompanied by a marked decrease in dopaminergic neuron loss in the substantia nigra pars compacta (SNc) and consistent enhancement of tyrosine hydroxylase-positive immunoreaction of dopaminergic neurons in the SNc and striatum. We also observed that in the SN dopaminergic neuron in the treated PD rats, mitochondrial complex I protein and mitochondrial dynamics were restored, thus ameliorating the oxidative DNA damage. Moreover, we determined signal translocation of graft allogeneic mitochondria from the MFB to the calbindin-positive SN neuron, which demonstrated the regulatory role of mitochondrial transport in alleviating 6-OHDA-induced degeneration of dopaminergic neurons.

  9. From Humoral Theory to Performant Risk Stratification in Kidney Transplantation.

    PubMed

    Lefaucheur, C; Viglietti, D; Mangiola, M; Loupy, A; Zeevi, A

    2017-01-01

    The purpose of the present review is to describe how we improve the model for risk stratification of transplant outcomes in kidney transplantation by incorporating the novel insights of donor-specific anti-HLA antibody (DSA) characteristics. The detection of anti-HLA DSA is widely used for the assessment of pre- and posttransplant risks of rejection and allograft loss; however, not all anti-HLA DSA carry the same risk for transplant outcomes. These antibodies have been shown to cause a wide spectrum of effects on allografts, ranging from the absence of injury to indolent or full-blown acute antibody-mediated rejection. Consequently, the presence of circulating anti-HLA DSA does not provide a sufficient level of accuracy for the risk stratification of allograft outcomes. Enhancing the predictive performance of anti-HLA DSA is currently one of the most pressing unmet needs for facilitating individualized treatment choices that may improve outcomes. Recent advancements in the assessment of anti-HLA DSA properties, including their strength, complement-binding capacity, and IgG subclass composition, significantly improved the risk stratification model to predict allograft injury and failure. Although risk stratification based on anti-HLA DSA properties appears promising, further specific studies that address immunological risk stratification in large and unselected populations are required to define the benefits and cost-effectiveness of such comprehensive assessment prior to clinical implementation.

  10. Utility of HLA Antibody Testing in Kidney Transplantation

    PubMed Central

    Konvalinka, Ana

    2015-01-01

    HLA antigens are polymorphic proteins expressed on donor kidney allograft endothelium and are critical targets for recipient immune recognition. HLA antibodies are risk factors for acute and chronic rejection and allograft loss. Solid-phase immunoassays for HLA antibody detection represent a major advance in sensitivity and specificity over cell-based methods and are widely used in organ allocation and pretransplant risk assessment. Post-transplant, development of de novo donor–specific HLA antibodies and/or increase in donor-specific antibodies from pretransplant levels are associated with adverse outcomes. Although single antigen bead assays have allowed sensitive detection of recipient HLA antibodies and their specificities, a number of interpretive considerations must be appreciated to understand test results in clinical and research contexts. This review, which is especially relevant for clinicians caring for transplant patients, discusses the technical aspects of single antigen bead assays, emphasizes their quantitative limitations, and explores the utility of HLA antibody testing in identifying and managing important pre- and post-transplant clinical outcomes. PMID:25804279

  11. From Humoral Theory to Performant Risk Stratification in Kidney Transplantation

    PubMed Central

    Viglietti, D.; Mangiola, M.; Loupy, A.; Zeevi, A.

    2017-01-01

    The purpose of the present review is to describe how we improve the model for risk stratification of transplant outcomes in kidney transplantation by incorporating the novel insights of donor-specific anti-HLA antibody (DSA) characteristics. The detection of anti-HLA DSA is widely used for the assessment of pre- and posttransplant risks of rejection and allograft loss; however, not all anti-HLA DSA carry the same risk for transplant outcomes. These antibodies have been shown to cause a wide spectrum of effects on allografts, ranging from the absence of injury to indolent or full-blown acute antibody-mediated rejection. Consequently, the presence of circulating anti-HLA DSA does not provide a sufficient level of accuracy for the risk stratification of allograft outcomes. Enhancing the predictive performance of anti-HLA DSA is currently one of the most pressing unmet needs for facilitating individualized treatment choices that may improve outcomes. Recent advancements in the assessment of anti-HLA DSA properties, including their strength, complement-binding capacity, and IgG subclass composition, significantly improved the risk stratification model to predict allograft injury and failure. Although risk stratification based on anti-HLA DSA properties appears promising, further specific studies that address immunological risk stratification in large and unselected populations are required to define the benefits and cost-effectiveness of such comprehensive assessment prior to clinical implementation. PMID:28133619

  12. Treatment Options and Strategies for Antibody Mediated Rejection after Renal Transplantation

    PubMed Central

    Levine, Matthew H.

    2011-01-01

    Antibody mediated rejection is a significant clinical problem encountered in a subset of renal transplant recipients. This type of rejection has a variable pathogenesis from the presence of donor specific antibodies with no overt disease to immediate hyperacute rejection and many variations between. Antibody mediated rejection is more common in human leukocyte antigen sensitized patients. In general, transplant graft survival after antibody mediated rejection is jeopardized, with less than 50% graft survival 5 years after this diagnosis. A variety of agents have been utilized singly and in combinations to treat antibody mediated rejection with differing results and significant research efforts are being placed on developing new targets for intervention. These same agents have been used in desensitization protocols with some success. In this review, we describe the biology of antibody mediated rejection, review the available agents to treat this form of rejection, and highlight areas of ongoing and future research into this difficult clinical problem. PMID:21940179

  13. A new data-driven model for post-transplant antibody dynamics in high risk kidney transplantation.

    PubMed

    Zhang, Yan; Briggs, David; Lowe, David; Mitchell, Daniel; Daga, Sunil; Krishnan, Nithya; Higgins, Robert; Khovanova, Natasha

    2017-02-01

    The dynamics of donor specific human leukocyte antigen antibodies during early stage after kidney transplantation are of great clinical interest as these antibodies are considered to be associated with short and long term clinical outcomes. The limited number of antibody time series and their diverse patterns have made the task of modelling difficult. Focusing on one typical post-transplant dynamic pattern with rapid falls and stable settling levels, a novel data-driven model has been developed for the first time. A variational Bayesian inference method has been applied to select the best model and learn its parameters for 39 time series from two groups of graft recipients, i.e. patients with and without acute antibody-mediated rejection (AMR) episodes. Linear and nonlinear dynamic models of different order were attempted to fit the time series, and the third order linear model provided the best description of the common features in both groups. Both deterministic and stochastic parameters are found to be significantly different in the AMR and no-AMR groups showing that the time series in the AMR group have significantly higher frequency of oscillations and faster dissipation rates. This research may potentially lead to better understanding of the immunological mechanisms involved in kidney transplantation.

  14. HLA class I sensitization in islet transplant recipients: report from the Collaborative Islet Transplant Registry.

    PubMed

    Naziruddin, Bashoo; Wease, Steve; Stablein, Donald; Barton, Franca B; Berney, Thierry; Rickels, Michael R; Alejandro, Rodolfo

    2012-01-01

    Pancreatic islet transplantation is a promising treatment option for patients severely affected with type 1 diabetes. This report from CITR presents pre- and posttransplant human leukocyte antigen (HLA) class I sensitization rates in islet-alone transplantation. Data came from 303 recipients transplanted with islet-alone between January 1999 and December 2008. HLA class I sensitization was determined by the presence of anti-HLA class I antibodies. Panel-reactive antibodies (PRA) from prior to islet infusion and at 6 months, and yearly posttransplant was correlated to measures of islet graft failure. The cumulative number of mismatched HLA alleles increased with each additional islet infusion from a median of 3 for one infusion to 9 for three infusions. Pretransplant PRA was not predictive of islet graft failure. However, development of PRA >20% posttransplant was associated with 3.6-fold (p < 0.001) increased hazard ratio for graft failure. Patients with complete graft loss who had discontinued immunosuppression had significantly higher rate of PRA ≥ 20% compared to those with functioning grafts who remained on immunosuppression. Exposure to repeat HLA class I mismatch at second or third islet infusions resulted in less frequent development of de novo HLA class I antibodies when compared to increased class I mismatch. The development of HLA class I antibodies while on immunosuppression is associated with subsequent islet graft failure. The risk of sensitization may be reduced by minimizing the number of islet donors used per recipient, and in the absence of donor-specific anti-HLA antibodies, repeating HLA class I mismatches with subsequent islet infusions.

  15. The effect of insulin treatment and of islet transplantation on the resistance artery function in the STZ-induced diabetic rat.

    PubMed Central

    Heygate, K. M.; Davies, J.; Holmes, M.; James, R. F.; Thurston, H.

    1996-01-01

    1. This study was designed to investigate the influence of insulin treatment and islet transplantation on the smooth muscle contractility and endothelium-dependent and independent relaxation of resistance arteries in the chemically induced streptozotocin (STZ) diabetic rat after 6-8 weeks, and 12-14 weeks of diabetes, compared to non-diabetic age-matched controls. 2. The morphology, and contractile responses to high potassium physiological salt solution (KPSS), KPSS containing 10(-5) M noradrenaline (NAK), and concentration-response curves to noradrenaline (NA) of mesenteric resistance arteries were recorded, along with the endothelium-dependent relaxation responses to acetylcholine (ACh) and bradykinin (BK), and endothelium-independent relaxation to sodium nitroprusside (SNP). Concentration-response curves were then repeated in the presence of a nitric oxide synthase inhibitor, NG-nitro-L-arginine (L-NOARG). 3. Insulin-treated diabetic rats in the 12 week study demonstrated enhanced vascular contractility to KPSS, NAK and NA, compared to age-matched non-diabetic controls. 4. Incubation with L-NOARG resulted in both a significant increase in maximum contractile response, and sensitivity (pD2) to NA in the untreated diabetic group (6 weeks). A significant shift in sensitivity was also seen in the insulin-treated diabetic group. In the 12 week study, incubation with L-NOARG resulted in an increased maximum contractile response and sensitivity to NA in the insulin-treated diabetics. An increase in sensitivity was also observed in the untreated diabetic group. 5. Endothelium-dependent relaxation to ACh was significantly augmented in the untreated diabetics (6-weeks), compared to the control group. In the 12-week study, relaxation to both ACh and BK was not significantly different in any of the experimental groups when compared to the sham-operated non-diabetic controls. 6. Incubation with L-NOARG resulted in a significant attenuation of the maximum relaxation response

  16. Redefining Strategies to Introduce Tolerance-Inducing Cellular Therapy in Human beings to Combat Autoimmunity and Transplantation Reactions.

    PubMed

    Ten Brinke, Anja; Joosten, Irma; van Ham, S Marieke; van Kooten, Cees; Prakken, Berent Jan

    2014-01-01

    Clinical translation of tolerance-inducing cell therapies requires a novel approach focused on innovative networks, patient involvement, and, foremost, a fundamental paradigm shift in thinking from both Academia, and Industry and Regulatory Agencies. Tolerance-inducing cell products differ essentially from conventional drugs. They are personalized and target interactive immunological networks to shift the balance toward tolerance. The human cell products are often absent or fundamentally different in animals. This creates important limitations of pre-clinical animal testing for safety and efficacy of these products and calls for novel translational approaches, which require the combined efforts of the different parties involved. Dedicated international and multidisciplinary consortia that focus on clinical translation are of utmost importance. They can help in informing and educating regulatory policy makers on the unique requirements for these cell products, ranging from pre-clinical studies in animals to in vitro human studies. In addition, they can promote reliable immunomonitoring tools. The development of tolerance-inducing cell products requires not only bench-to-bedside but also reverse translation, from bedside back to the bench.

  17. Rescue of Fructose-Induced Metabolic Syndrome by Antibiotics or Faecal Transplantation in a Rat Model of Obesity.

    PubMed

    Di Luccia, Blanda; Crescenzo, Raffaella; Mazzoli, Arianna; Cigliano, Luisa; Venditti, Paola; Walser, Jean-Claude; Widmer, Alex; Baccigalupi, Loredana; Ricca, Ezio; Iossa, Susanna

    2015-01-01

    A fructose-rich diet can induce metabolic syndrome, a combination of health disorders that increases the risk of diabetes and cardiovascular diseases. Diet is also known to alter the microbial composition of the gut, although it is not clear whether such alteration contributes to the development of metabolic syndrome. The aim of this work was to assess the possible link between the gut microbiota and the development of diet-induced metabolic syndrome in a rat model of obesity. Rats were fed either a standard or high-fructose diet. Groups of fructose-fed rats were treated with either antibiotics or faecal samples from control rats by oral gavage. Body composition, plasma metabolic parameters and markers of tissue oxidative stress were measured in all groups. A 16S DNA-sequencing approach was used to evaluate the bacterial composition of the gut of animals under different diets. The fructose-rich diet induced markers of metabolic syndrome, inflammation and oxidative stress, that were all significantly reduced when the animals were treated with antibiotic or faecal samples. The number of members of two bacterial genera, Coprococcus and Ruminococcus, was increased by the fructose-rich diet and reduced by both antibiotic and faecal treatments, pointing to a correlation between their abundance and the development of the metabolic syndrome. Our data indicate that in rats fed a fructose-rich diet the development of metabolic syndrome is directly correlated with variations of the gut content of specific bacterial taxa.

  18. Successful ABO-incompatible living-related intestinal transplantation: a 2-year follow-up.

    PubMed

    Fan, D M; Zhao, Q C; Wang, W Z; Shi, H; Wang, M; Chen, D L; Zheng, J Y; Li, M B; Wu, G S

    2015-05-01

    ABO-incompatible intestinal transplantation has rarely been performed due to poor patient outcomes. Herein we present a case of successful ABO-incompatible intestinal transplantation with a 2-year follow-up. A 16-year-old female with a history of extensive bowel resection received an ABO-incompatible living donor bowel graft from her father (blood type AB graft into a type A recipient). Posttransplant immunosuppression consisted of an initial anti-CD20, plasmapheresis/intravenous immunoglobulin before transplantation, followed by an anti-thymocyte globulin (ATG) induction and splenectomy, and maintenance with tacrolimus and prednisone. Her postoperative course was remarkable for a single episode of rejection on day 14 which responded promptly to treatment with methyprednisolone and ATG. Three months after transplantation, the patient developed an abdominal abscess requiring open surgical drainage. No viral infections were encountered. Posttransplant anti-B antibody titers and anti-B7 donor-specific antibody levels remained low. At a 2-year follow-up, the patient showed a progressive weight gain of 5.0 kg. This case illustrates that ABO-incompatible living-related bowel transplantation is immunologically feasible and is associated with good outcomes for the recipient. The management of blood type antibodies and the use of adequate immunosuppression in the early period of the procedure may be the keys to the success of future cases.

  19. A Phased Desensitization Protocol With Rituximab and Bortezomib for Highly Sensitized Kidney Transplant Candidates

    PubMed Central

    Ide, Kentaro; Tanaka, Yuka; Sasaki, Yu; Tahara, Hiroyuki; Ohira, Masahiro; Ishiyama, Kohei; Tashiro, Hirotaka; Ohdan, Hideki

    2015-01-01

    Background Desensitization protocols comprising plasmapheresis, IVIGs, and rituximab and/or bortezomib have allowed for successful kidney transplantation in some highly HLA-sensitized patients with end-stage renal disease. However, the optimal combination of these therapies and their proper timing remains entirely unknown. We propose a phased desensitization strategy using rituximab followed by bortezomib as a safer method. Methods Three sensitized kidney transplant candidates who could not be desensitized using our conventional protocol, which consists of a single rituximab dose combined with plasmapheresis, were enrolled in this study. When IgM+ CD27− naive B cells reappeared but IgM+ CD27+ memory B cells remained undetectable in their peripheral blood, the patients were treated with 1 cycle of bortezomib followed by plasmapheresis. Results After bortezomib treatment, patients' donor-specific anti-HLA antibodies (DSA) values were decreased, and cross-match tests were consistently negative. All 3 patients underwent living donor kidney transplantation. They showed immediate renal function, and both DSA and non-DSA were undetectable during the observation period. Neither antibody-mediated rejection nor severe acute cellular rejection was encountered in these patients after transplantation. Conclusions The present cases suggest that a phased use of rituximab and bortezomib can safely desensitize highly sensitized kidney transplant candidates. PMID:27500219

  20. Improving allogeneic islet transplantation by suppressing Th17 and enhancing Treg with histone deacetylase inhibitors.

    PubMed

    Sugimoto, Koji; Itoh, Takeshi; Takita, Morihito; Shimoda, Masayuki; Chujo, Daisuke; SoRelle, Jeff A; Naziruddin, Bashoo; Levy, Marlon F; Shimada, Mitsuo; Matsumoto, Shinichi

    2014-04-01

    Islet transplantation is a new treatment for achieving insulin independence for patients with severe diabetes. However, major drawbacks of this treatment are the long graft survival, the necessity for immunosuppressive drugs, and the efficacy of transplantation. Donor-specific transfusion (DST) has been shown to reduce rejection after organ transplantation, potentially through enhanced regulatory T-cell (Treg) activity. However, recent findings have shown that activated Treg can be converted into Th17 cells. We focused on histone deacetylase inhibitors (HDACi) because it was reported that inhibition of HDAC activity prevented Treg differentiation into IL17-producing cells. We therefore sought to enhance Treg while suppressing Th17 cells using DST with HDACi to prolong graft survival. To stimulate Treg by DST, we used donor splenocytes. In DST with HDACi group, Foxp3 mRNA expression and Treg population increased in the thymus and spleen, whereas Th17 population decreased. qPCR analysis of lymphocyte mRNA indicated that Foxp3, IL-10, and TGF-b expression increased. However, interleukin 17a, Stat3 (Th17), and IFN-g expression decreased in DST + HDACi group, relative to DST alone. Moreover, DST treated with HDACi prolonged graft survival relative to controls in mice islet transplantation. DST with HDACi may therefore have utility in islet transplantation.

  1. Transplantation in Turkey.

    PubMed

    Haberal, Mehmet

    2013-01-01

    The cornerstone events of transplantation history in Turkey are summarized herein. In 1975, we performed the first living-related renal transplant in Turkey. We followed this in 1978 with the first deceased donor kidney transplantation, using an organ supplied by Eurotransplant. In 1979, the law on harvesting, storage, grafting, and transplantation of organs and tissues was enacted; later that year, the first local deceased donor kidney transplantation was performed by our team. In 1988, another groundbreaking event in Turkey was successfully achieved: the first cadaveric liver transplantation. In 1990, the first pediatric living-related segmental liver transplantation in Turkey, the region, and Europe was performed by our team. One month later, an adult-to-adult living-related liver transplantation was successfully performed. In May 1992, we performed the first combined liver-kidney transplantation from a living-related donor, which was the first operation of its kind. To date, we have performed 2,084 kidney and, since 1988, 439 liver transplantations. During 29 years of solid organ transplantation history in Turkey, 20,794 kidney transplants have been performed nationwide in 62 different centers, as well as 6,565 liver, 621 heart, and 168 pancreas transplants. In 2001, the Ministry of Health established the National Coordination Center as an umbrella organization to promote transplantation activities, especially for deceased donor organ procurement. Transplantation activities are accelerating daily throughout the country, but deceased donors are still far below the desired rates.

  2. Pre-transplant low level HLA antibody shows a composite poor outcome in long-term outcome of renal transplant recipients.

    PubMed

    Tian, Jun; Li, Dadong; Alberghini, Tod V; Rewinski, Michael; Guo, Ning; Bow, Laurine M

    2015-03-01

    To determine the significance of low-level DSA (donor specific antibody) in patients transplanted with negative cytotoxicity AHG (antihuman immunoglobulin) crossmatch, data from 279 patients who received a kidney transplant between July 1999 and March 2006 were collected. All kidney recipients received ABO-compatible donors. A poor outcome was defined as any one of the following: death, Cr>2.0 mmol/L, occurrence of a rejection episode. Luminex Screening and Single Antigen assays from Tepnel Life Codes were used to detect human leukocyte antigen antibodies on pre-transplant sera retrospectively. Twenty-four out of 279 recipients demonstrated the presence of solid-phase DSA (MFI>1000) present pre-transplant. In DSA+ group, the accumulated good versus poor outcome rate was 0.30 versus 0.70, respectively. These rates were 0.49 and 0.51, respectively, in the DSA- group. The difference in composite poor outcome between DSA+ versus DSA- group was significant (p=0.030). The DSA- group had no difference in patient survival as compared to the DSA+ group (p=0.061). There is no statistically significant difference for either mortality or outcome results between high MFI (>2000) and low MFI (≤2000) groups. Our data suggest that solid-phase antibodies which are not strong enough to elicit a positive T-AHG crossmatch may influence long-term graft outcome.

  3. [Mycobacterium tuberculosis infection following organ transplantation].

    PubMed

    Haas, Charles; Le Jeunne, Claire

    2006-11-01

    In transplant recipients, immunosuppressive treatment affects cell-mediated immunity and increases the risk of tuberculosis. Tuberculosis may be transmitted by the donor organ or occur de novo, but such cases are rare. The vast majority of cases of active tuberculosis in transplant recipients result from reactivation of latent Mycobacterium tuberculosis infection. The incidence varies from one region of the globe to another, from 0.5-1.0% in North America, to 0.36-5.5% in Europe and 7.0-11.8% in India. The incidence of tuberculosis among transplant recipients is much higher than in the general population. Diabetes mellitus, renal impairment, systemic lupus erythematosus, chronic liver disease and AIDS all increase the risk of post-transplant tuberculosis. Extrapulmonary and disseminated forms are frequent in this setting. The diagnosis of tuberculosis in transplant recipients is often difficult, and treatment is frequently delayed. Tuberculosis can be life-threatening in such cases. Treatment is difficult because rifampicin is a cytochrome P450 inducer (leading to reduced levels of cyclosporine), and because the hepatotoxicity of isoniazid, rifampin and pyrazinamide is frequently increased in transplant recipients. Treatment of latent tuberculosis before transplantation markedly reduces the risk of developing active tuberculosis after transplantation.

  4. Nutrition in kidney transplantation.

    PubMed

    Veroux, Massimiliano; Corona, Daniela; Sinagra, Nunziata; Tallarita, Tiziano; Ekser, Burcin; Giaquinta, Alessia; Zerbo, Domenico; Veroux, Pierfrancesco

    2013-10-01

    Organ transplantation has progressively established itself as the preferred therapy for many end-stage organ failures. However, many of these chronic diseases and their treatments can negatively affect nutritional status, leading to malnutrition and mineral deficiencies.Nutritional status is an important determinant of the clinical outcome of kidney transplant recipients.Malnutrition and obesity may represent a contraindication to transplantation in many cases and may increase the risk of postoperative complications after the transplantation. Nutritional support in kidney transplant recipients is challenging, since it must take into account the pre-transplant nutritional status, the side effects of immunosuppression, the function of the transplanted graft, the presence of infection, and the general status of the patient at the time of the transplantation.With these considerations in mind, we reviewed current literature on the impact of nutritional status on the outcome of kidney transplantation.

  5. Transplantation Immunity. Contemporary Views.

    PubMed

    Zaretskaya, Yuliya M.

    1999-12-01

    "Transplantation immunity in Cyclosporin era" is a special chapter in science under name transplantation immunity. Nowadays, practically all the organs can be grafted: kidney, heart, lung, liver, pancreas both as organ, and as islet cells, bone marrow from relative and unrelative donors. The broad spectrum of grafted organs gave one more surprising peculiarity of transplantation immunity: it operates with different strength after transplantation of various organs. If the decreasing gradient of transplantation immunity could be composed, then it appeared to be approximately in the following order: bone marrow - skin - kidney - heart - lung. The most complicated operating activity of transplantation immunity is occurring after bone marrow transplantation, especially from unrelative donor, because in bone marrow transplantation immunological process develops in both directions. Therefore now, bone marrow is the only organ (tissue), when the complete compatibility between donor and recipient is required after its transplantation; especially in cases with unrelative donors.

  6. Organ transplantation in Tunisia.

    PubMed

    El Matri, Aziz; Ben Abdallah, Taieb

    2015-04-01

    Kidney transplants were first performed in Tunisia in 1986, and transplants soon extended to other organs including the heart, liver, and pancreas. Live-related donor and deceased-donor kidney transplants were both began in the summer of 1986. An organ procurement and transplant law was passed in March 1991, and the National Centre for Advancement of Organ Transplantation was created in 1995. The number of transplantation units has increased to 7 throughout the country, and the yearly transplant number has progressively increased to 139 in 2010, including 20% from deceased kidney donors. Despite these gains, the need continues to grow. Heart transplants began in January 1993, and Tunisia and Jordan are currently the only Arab countries where it is practiced. However, only 16 patients have received a heart transplant as of 2004, and the number of recipients has decreased in the past 10 years. Liver transplants are rare in other Arab countries, but began in Tunisia in January 1998. Over 10 years, 38 patients benefited from this procedure. After a few years of stagnation, the number of liver transplants is increasing. While all types of transplantation are needed, kidney transplantation is a priority in Tunisia. The target is to perform 400 transplants annually, which would require a long-term strategy to provide full financial coverage using the National Health Insurance Funds in both the public and private sectors.

  7. Major Histocompatibility Complex Class I Chain-Related A (MICA) Molecules: Relevance in Solid Organ Transplantation

    PubMed Central

    Baranwal, Ajay Kumar; Mehra, Narinder K.

    2017-01-01

    An ever growing number of reports on graft rejection and/or failure even with good HLA matches have highlighted an important role of non-HLA antigens in influencing allograft immunity. The list of non-HLA antigens that have been implicated in graft rejection in different types of organ transplantation has already grown long. Of these, the Major Histocompatibility Complex class I chain-related molecule A (MICA) is one of the most polymorphic and extensively studied non-HLA antigenic targets especially in the kidney transplantation. Humoral response to MICA antigens has repeatedly been associated with lower graft survival and an increased risk of acute and chronic rejection following kidney and liver transplantation with few studies showing conflicting results. Although there are clear indications of MICA antibodies being associated with adverse graft outcome, a definitive consensus on this relationship has not been arrived yet. Furthermore, only a few studies have dealt with the impact of MICA donor-specific antibodies as compared to those that are not donor specific on graft outcome. In addition to the membrane bound form, a soluble isoform of MICA (sMICA), which has the potential to engage the natural killer cell-activating receptor NKG2D resulting in endocytosis and degradation of receptor–ligand interaction complex leading to suppression of NKG2D-mediated host innate immunity, has been a subject of intense discussion. Most studies on sMICA have been directed toward understanding their influence on tumor growth, with limited literature focusing its role in transplant biology. Furthermore, a unique dimorphism (methionine to valine) at position 129 in the α2 domain categorizes MICA alleles into strong (MICA-129 met) and weak (MICA-129 val) binders of NKG2D receptor depending on whether they have methionine or valine at this position. Although the implications of MICA 129 dimorphism have been highlighted in hematopoietic stem cell transplantation, its role in

  8. Kidney transplantation in immunologically high-risk patients.

    PubMed

    Keven, K; Sengul, S; Celebi, Z K; Tuzuner, A; Yalcin, F; Duman, T; Tutkak, H

    2013-04-01

    An increased number of sensitized patients await kidney transplantation (KTx). Sensitization has a major impact on patient mortality and morbidity due to prolonged waiting time and may preclude live donor transplantation. However, recent reports have shown that KTx can be performed successfully using novel immunosuppressive protocols. This study presents our experience with patients displaying donor-specific antibody (DSA) (+). We enrolled 5 lymphocyte cross-match (LCM) negative (complement-dependent cytotoxicity) and panel-reactive antibody (PRA) plus DSA-positive patients mean fluorescein intensity [MFI] > 1000) who underwent living kidney donor procedures. All subjects were females and their mean age was 36.7 years. In our protocol, we started mycophenolate mofetil (2 g/d), tacrolimus (0.01 mg/kg) and prednisolone (0.5 mg/kg) on day -6. We performed 2 sessions of total plasma exchange (TPE) with albumin replacement and administered 2 doses of IVIG (5 g/d). On day -1, we added rituximab (200 mg). On the operation day and on day +4, the patients received doses of basiliximab. Serum samples were taken on days -6, 0, and 30 as well as at 1 year after transplantation. All patients displayed immediate graft function. Mean basal DSA titer was 5624 MFI. After desensitization, the MFI titers decreased at the time of transplantation to 2753 MFI, and were 2564 MFI at the 1st month and 802 MFI at 1st year. Three patients experienced acute rejection episodes (60%). After treatment for rejection, the average follow-up was 17 months and last creatinine levels were 0.6-0.8 mg/dL (minimum-maximum). In conclusion, KTx can be succesfully performed in sensitized patients displaying DSA. However, there seems to be a greater acute rejection risk. There is no consensus regarding adequate doses of IVIG or plasmapheresis treatments; furthermore, more studies are needed to clarify the safe MFI titer of the DSA.

  9. Living donor renal transplantation in patients with antiphospholipid syndrome

    PubMed Central

    Choi, Ji Yoon; Jung, Joo Hee; Shin, Sung; Kim, Young Hoon; Han, Duck Jong

    2016-01-01

    Abstract Introduction: Antiphospholipid syndrome (APS), autoantibodies directed against phospholipid-binding proteins are associated with cause vascular thrombosis. Patients with APS requiring renal transplantation are at risk of early graft loss due to arterial or venous thrombosis, or thrombotic microangiopathy (TMA). Here, we report 3 cases of successful renal transplantation in patients with APS. Clinical Findings: A 53-year-old man with end-stage renal disease (ESRD) had experienced bilateral deep venous thrombosis (DVT) in the lower extremities 16 years ago and was administered warfarin. However, he frequently experienced recurrent DVT despite of anticoagulation therapy. Before the surgery, APS was confirmed based on positive results lupus anticoagulant in serological tests. A 40-year-old man with polycystic kidney disease and a history recurrent DVT tested positive for lupus anticoagulant and anticardiolipin antibodies. Lastly, a 42-year-old woman with ESRD was diagnosed with APS 7 years ago. She also developed DVT and tested positive for lupus anticoagulant and anti-B2-glycoprotein 1. The anticoagulation protocol was as follows in all cases: Warfarin was stopped 5 days before living donor renal transplantation and intravenous heparin therapy was started. During surgery, bolus heparin injections (3000 U) were administered to prevent arterial or venous thrombosis. Heparin was substituted with warfarin on postoperative day 4. The third patient (42/F) developed clinical rejection indicated by increased serum creatinine levels and donor-specific antibodies (DSA) and received steroid pulse therapy, plasmapheresis, and rituximab. This treatment restored graft function to within the normal range. The latest graft function in all patients was maintained at normal levels in the outpatient clinic. Conclusions: Living donor renal transplantation may be successful in patients with APS following perioperative anticoagulation therapy. However, because of the high risk of

  10. Reversible cortical blindness after lung transplantation.

    PubMed

    Knower, Mark T; Pethke, Scott D; Valentine, Vincent G

    2003-06-01

    Cyclosporine (CYA) is a calcineurin inhibitor widely used in immunosuppressive regimens after organ transplantation. Several neurologic side effects are frequently associated with CYA use; however, reversible cortical blindness is a rare manifestation of CYA toxicity traditionally seen after liver and bone marrow transplantation. This report presents a case of reversible cortical blindness after lung transplantation, then details the risk factors and clinical course of 28 previously well-documented cases of CYA-induced cortical blindness after transplantation. Identification of known risk factors, clinical clues, and typical radiographic findings may aid in the diagnosis of CYA-induced cortical blindness, since reduction in CYA dose or cessation of CYA therapy usually permits resolution of the neurologic effects.

  11. Chemotherapy-induced B-cell depletion in hepatoblastoma patients undergoing ABO-incompatible living donor liver transplantation.

    PubMed

    Kanazawa, Hiroyuki; Fukuda, Akinari; Mali, Vidyadhar Padmakar; Rahayatri, Tri Hening; Hirata, Yoshihiro; Sasaki, Kengo; Uchida, Hajime; Shigeta, Takanobu; Sakamoto, Seisuke; Matsumoto, Kimikazu; Kasahara, Mureo

    2016-05-01

    LT from ABO-I donors requires preconditioning regimens to prevent postoperative catastrophic AMR. NAC for HBL is known to cause myelosuppression leading to a reduction in the number and function of lymphocytes. We investigated this chemotherapy-induced myelosuppression in HBL patients listed for LT from ABO-I donors with reference to the kinetics of B, T cells, and anti-ABO blood type isoagglutinin titers. Between 2005 and 2015, of the 319 patients who underwent LDLT at our institute, 12 were indicated for unresectable HBL. Three patients with unresectable HBL who underwent LDLT from ABO-I donors are included in this study. Immunosuppression consisted of a standard regime of tacrolimus and low-dose steroids as in ABO compatible/identical LDLT. No additional preoperative therapies for B-cell depletion were used. Absolute lymphocyte counts, lymphocyte subsets (including CD20+ B cells, CD3+CD4+ T cells and CD3+CD8+ T cells), and anti-ABO blood type isoagglutinin titers were measured before LDLT and postoperatively. The median age at diagnosis was 19 months (range, 3-31 months). The median follow-up was seven months (range, 6-15 months). The median interval from the last NAC to LDLT was 33 days (range, 25-52 days). The median interval from LDLT to adjuvant chemotherapy was 28 days (range, 22-36 days). The counts of CD20+ B cells before LDLT were depleted to median 5 cells/mm(3) (range, 0-6 cells/mm(3)). There was a transient rebound in the CD20+ B cell counts on day seven (maximum of 82 cells/mm(3)) followed by a decline starting at 14 days after LDLT that was sustained for the duration of adjuvant chemotherapy. Anti-ABO blood type isoagglutinin titers were lowered to between 1:1 and 1:16 before LDLT and remained low for the duration of follow-up in this study. All of the three patients remained in good health without either acute cellular or AMR after LDLT. The B-cell depletion that occurs after cisplatin-based chemotherapy for HBL may help accomplish safe ABO-I LDLT

  12. Mice spermatogonial stem cells transplantation induces macrophage migration into the seminiferous epithelium and lipid body formation: high-resolution light microscopy and ultrastructural studies.

    PubMed

    Dias, Felipe F; Chiarini-Garcia, Hélio; Parreira, Gleydes G; Melo, Rossana C N

    2011-12-01

    Transplantation of spermatogonial stem cells (SSCs), the male germline stem cells, in experimental animal models has been successfully used to study mechanisms involved in SSC self-renewal and to restore fertility. However, there are still many challenges associated with understanding the recipient immune response for SSCs use in clinical therapies. Here, we have undertaken a detailed structural study of macrophages elicited by SSCs transplantation in mice using both high-resolution light microscopy (HRLM) and transmission electron microscopy (TEM). We demonstrate that SSCs transplantation elicits a rapid and potent recruitment of macrophages into the seminiferous epithelium (SE). Infiltrating macrophages were derived from differentiation of peritubular monocyte-like cells into typical activated macrophages, which actively migrate through the SE, accumulate in the tubule lumen, and direct phagocytosis of differentiating germ cells and spermatozoa. Quantitative TEM analyses revealed increased formation of lipid bodies (LBs), organelles recognized as intracellular platforms for synthesis of inflammatory mediators and key markers of macrophage activation, within both infiltrating macrophages and Sertoli cells. LBs significantly increased in number and size in parallel to the augmented macrophage migration during different times post-transplantation. Our findings suggest that LBs may be involved with immunomodulatory mechanisms regulating the seminiferous tubule niche after SSC transplantation.

  13. Pancreas transplantation: review

    PubMed Central

    Meirelles, Roberto Ferreira; Salvalaggio, Paolo; Pacheco-Silva, Alvaro

    2015-01-01

    ABSTRACT Vascularized pancreas transplantation is the only treatment that establishes normal glucose levels and normalizes glycosylated hemoglobin levels in type 1 diabetic patients. The first vascularized pancreas transplant was performed by William Kelly and Richard Lillehei, to treat a type 1 diabetes patient, in December 1966. In Brazil, Edison Teixeira performed the first isolated segmental pancreas transplant in 1968. Until the 1980s, pancreas transplants were restricted to a few centers of the United States and Europe. The introduction of tacrolimus and mycophenolate mofetil in 1994, led to a significant outcome improvement and consequently, an increase in pancreas transplants in several countries. According to the International Pancreas Transplant Registry, until December 31st, 2010, more than 35 thousand pancreas transplants had been performed. The one-year survival of patients and pancreatic grafts exceeds 95 and 83%, respectively. The better survival of pancreatic (86%) and renal (93%) grafts in the first year after transplantation is in the simultaneous pancreas-kidney transplant group of patients. Immunological loss in the first year after transplant for simultaneous pancreas-kidney, pancreas after kidney, and pancreas alone are 1.8, 3.7, and 6%, respectively. Pancreas transplant has 10 to 20% surgical complications requiring laparotomy. Besides enhancing quality of life, pancreatic transplant increases survival of uremic diabetic patient as compared to uremic diabetic patients on dialysis or with kidney transplantation alone. PMID:26154551

  14. Clinical and immunological relevance of antibodies in solid organ transplantation.

    PubMed

    Mehra, N K; Baranwal, A K

    2016-12-01

    The two important issues affecting recipients of solid organ transplants and of importance to immunologists are (i) sensitization of the recipient to HLA antigens and the resultant humoral immune response leading to the development of anti-HLA antibodies; and ii) development of robust assays for early detection of humoral rejection post-transplant. Evidence from several studies clearly indicates that presence of circulating anti-HLA antibodies especially donor specific leads to early graft loss and high titres of DSA may even lead to hyperacute or accelerated acute rejection. Long-term graft survival too is adversely affected by the presence of either pre- or post-transplant DSA. HLA matching status of the recipient - donor pair - is an important factor in the modulation of humoral response following transplantation and in a way affects de novo development of DSA. Data collected over the past decade clearly indicate significantly lower level of DSAs in optimally matched donor-recipient pairs. HLA mismatches especially those on HLA-DR and HLA-C loci have wider implications on post-transplant graft survival. The presence of circulating anti-HLA antibodies leads to endothelial damage in the newly grafted organ through complement dependent or independent pathways. Although detection of C4d deposition in renal biopsies serves as an important indicator of humoral rejection, its absence does not preclude the presence of DSAs and humoral rejection, and hence, it cannot be relied upon in every case. The emergence of epitope-based screening for anti-HLA antibodies on Luminex platform with high degree of sensitivity has revolutionized the screening for anti-HLA antibodies and DSAs. Studies indicate that humoral response to non-HLA antigens might also have a detrimental effect on allograft survival. High titres of such circulating antibodies may even lead to hyperacute rejection. Pre-emptive testing of solid organ recipients, especially kidney transplant recipients for anti

  15. Inducible co-stimulator (ICOS) up-regulation on activated T-cells in chronic graft-vs.-host disease following dog-leukocyte-antigen-nonidentical hematopoietic cell transplantation: A potential therapeutic target

    PubMed Central

    Sato, Masahiko; Storb, Rainer; Loretz, Carol; Stone, Diane; Mielcarek, Marco; Sale, George E.; Rezvani, Andrew R.; Graves, Scott S.

    2013-01-01

    Background Inducible co-stimulator (ICOS), a member of the CD28 family of costimulatory molecules, is induced on CD4+ and CD8+ T-cells following their activation. ICOS functions as an essential immune regulator and ICOS blockade is a potential approach to immune modulation in allogeneic transplantation. Here, we describe the expression profile of ICOS in dogs and determine whether ICOS expression is up-regulated during chronic graft versus host disease (GVHD) and host versus graft (HVG) reactions in the canine hematopoietic cell transplantation model. Methods Monoclonal antibodies against cell surface-expressed ICOS were produced and tested in vitro for suppression of canine mixed leukocyte reactions (MLR). Expression of ICOS on CD3+ cells was evaluated by flow cytometry using peripheral blood, lymph nodes and splenocytes obtained from dogs undergoing GVH and HVG reactions. Results Canine ICOS was expressed in an inducible pattern on T-cells activated by Con A, anti-CD3 mAb in combination with anti-CD28 mAb, and alloantigen stimulation. Immunosuppressive effects of ICOS blockade were observed in MLR using peripheral blood mononuclear cells from dog-leukocyte-antigen-nonidentical dogs. Immunosuppressive effects of ICOS blockade were observed in MLR when anti-ICOS was combined with suboptimal concentrations of cytotoxic T-lymphocyte antigen 4-Ig (CTLA4-Ig) or cyclosporine. ICOS expression was significantly up-regulated on T-cells in dogs undergoing graft rejection or chronic GVHD after allogeneic hematopoietic cell transplantation. Conclusion These studies suggest that ICOS plays a role in graft rejection and GVHD in an out-bred animal model, and ICOS blockade may be an approach to prevention and treatment of chronic GVHD. PMID:23694952

  16. American Society of Transplantation

    MedlinePlus

    ... DONOR PROGRAM ILDA Webinar Series FQAPI Webinar Series Business of Transplantation Webinar Series Fellows Webinar Series Other Webinars AST/AJT Journal Club Publications Podcasts Conference Recordings Transplant Nephrology Core ...

  17. Corneal transplant - discharge

    MedlinePlus

    ... page: //medlineplus.gov/ency/patientinstructions/000243.htm Corneal transplant - discharge To use the sharing features on this page, please enable JavaScript. You had a corneal transplant. Most of the tissue of your cornea (the ...

  18. Successful liver transplantation in a patient with splanchnic vein thrombosis and pulmonary embolism due to polycythemia vera with Jak2v617f mutation and heparin-induced thrombocytopenia.

    PubMed

    Biagioni, Emanuela; Pedrazzi, Paola; Marietta, Marco; Di Benedetto, Fabrizio; Villa, Erica; Luppi, Mario; Girardis, Massimo

    2013-10-01

    Heparin-induced thrombocytopenia (HIT) is a rare complication of heparin treatment resulting in a severe acquired thrombophilic condition with an associated mortality of about 10 %. We report the first case of successful urgent liver transplantation (LT) in a patient with end-stage liver disease due to a Budd-Chiari syndrome, portal vein thrombosis and pulmonary embolism due to acquired thrombophilia associated to polycythemia vera carrying JAK2V617F gene mutation and HIT in the acute phase. Lepirudin was used to provide anticoagulation in the LT perioperative period that was performed without haemorrhagic and thrombotic complications despite the donor received heparin during liver explantation.

  19. Transplantation of Heterospheroids of Islet Cells and Mesenchymal Stem Cells for Effective Angiogenesis and Antiapoptosis

    PubMed Central

    Shin, Jung-Youn; Jeong, Jee-Heon; Han, Jin; Bhang, Suk Ho; Jeong, Gun-Jae; Haque, Muhammad R.; Al-Hilal, Taslim A.; Noh, Myungkyung

    2015-01-01

    Although islet transplantation has been suggested as an alternative therapy for type 1 diabetes, there are efficiency concerns that are attributed to poor engraftment of transplanted islets. Hypoxic condition and delayed vasculogenesis induce necrosis and apoptosis of the transplanted islets. To overcome these limitations in islet transplantation, heterospheroids (HSs), which consist of rat islet cells (ICs) and human bone marrow-derived mesenchymal stem cells (hMSCs), were transplanted to the kidney and liver. The HSs cultured under the hypoxic condition system exhibited a significant increase in antiapoptotic gene expression in ICs. hMSCs in the HSs secreted angiogenic and antiapoptotic proteins. With the HS system, ICs and hMSCs were successfully located in the same area of the liver after transplantation of HSs through the portal vein, whereas the transplantation of islets and the dissociated hMSCs did not result in localization of transplanted ICs and hMSCs in the same area. HS transplantation resulted in an increase in angiogenesis at the transplantation area and a decrease in the apoptosis of transplanted ICs after transplantation into the kidney subcapsule compared with transplantation of islet cell clusters (ICCs). Insulin production levels of ICs were higher in the HS transplantation group compared with the ICC transplantation group. The HS system may be a more efficient transplantation method than the conventional methods for the treatment of type 1 diabetes. PMID:25344077

  20. Survival Benefit with Kidney Transplants from HLA-Incompatible Live Donors

    PubMed Central

    Orandi, B.J.; Luo, X.; Massie, A.B.; Garonzik-Wang, J.M.; Lonze, B.E.; Ahmed, R.; Van Arendonk, K.J.; Stegall, M.D.; Jordan, S.C.; Oberholzer, J.; Dunn, T.B.; Ratner, L.E.; Kapur, S.; Pelletier, R.P.; Roberts, J.P.; Melcher, M.L.; Singh, P.; Sudan, D.L.; Posner, M.P.; El-Amm, J.M.; Shapiro, R.; Cooper, M.; Lipkowitz, G.S.; Rees, M.A.; Marsh, C.L.; Sankari, B.R.; Gerber, D.A.; Nelson, P.W.; Wellen, J.; Bozorgzadeh, A.; Gaber, A.O.; Montgomery, R.A.; Segev, D.L.

    2016-01-01

    BACKGROUND A report from a high-volume single center indicated a survival benefit of receiving a kidney transplant from an HLA-incompatible live donor as compared with remaining on the waiting list, whether or not a kidney from a deceased donor was received. The generalizability of that finding is unclear. METHODS In a 22-center study, we estimated the survival benefit for 1025 recipients of kidney transplants from HLA-incompatible live donors who were matched with controls who remained on the waiting list or received a transplant from a deceased donor (waiting-list-or-transplant control group) and controls who remained on the waiting list but did not receive a transplant (waiting-list-only control group). We analyzed the data with and without patients from the highest-volume center in the study. RESULTS Recipients of kidney transplants from incompatible live donors had a higher survival rate than either control group at 1 year (95.0%, vs. 94.0% for the waiting-list-or-transplant control group and 89.6% for the waiting-list-only control group), 3 years (91.7% vs. 83.6% and 72.7%, respectively), 5 years (86.0% vs. 74.4% and 59.2%), and 8 years (76.5% vs. 62.9% and 43.9%) (P<0.001 for all comparisons with the two control groups). The survival benefit was significant at 8 years across all levels of donor-specific antibody: 89.2% for recipients of kidney transplants from incompatible live donors who had a positive Luminex assay for anti-HLA antibody but a negative flow-cytometric cross-match versus 65.0% for the waiting-list-or-transplant control group and 47.1% for the waiting-list-only control group; 76.3% for recipients with a positive flow-cytometric cross-match but a negative cytotoxic cross-match versus 63.3% and 43.0% in the two control groups, respectively; and 71.0% for recipients with a positive cytotoxic cross-match versus 61.5% and 43.7%, respectively. The findings did not change when patients from the highest-volume center were excluded. CONCLUSIONS This

  1. Bone marrow-derived stem cell transplantation for the treatment of insulin-dependent diabetes.

    PubMed

    Fotino, Carmen; Ricordi, Camillo; Lauriola, Vincenzo; Alejandro, Rodolfo; Pileggi, Antonello

    2010-01-01

    The bone marrow is an invaluable source of adult pluripotent stem cells, as it gives rise to hematopoietic stem cells, endothelial progenitor cells, and mesenchymal cells, amongst others. The use of bone marrow-derived stem cell (BMC) transplantation (BMT) may be of assistance in achieving tissue repair and regeneration, as well as in modulating immune responses in the context of autoimmunity and transplantation. Ongoing clinical trials are evaluating the effects of BMC to preserve functional beta-cell mass in subjects with type 1 and type 2 diabetes, and to favor engraftment and survival of transplanted islets. Additional trials are evaluating the impact of BMT (i.e., mesenchymal stem cells) on the progression of diabetes complications. This article reviews the progress in the field of BMC for the treatment of subjects with insulin-dependent diabetes, and summarizes clinical data of pilot studies performed over the last two decades at our research center by combining allogeneic islet transplantation with donor-specific BMC. Clinical data is summarized from pilot studies performed at our research center over the last two decades.

  2. Post-transplant development of C1q-positive HLA antibodies and kidney graft survival.

    PubMed

    Piazza, Antonina; Poggi, Elvira; Ozzella, Giuseppina; Adorno, Domenico

    2013-01-01

    The development of de novo human leukocyte antigen (HLA) donor specific antibodies (DSA), detected by both cytotoxic or solid phase assays, was considered the major risk factor for allograft failure in kidney transplantation. However, it was shown that not all patients with persistent production of DSA suffered loss of their grafts. Modified Luminex-Single Antigen assays, able to identify C1q-fixing antibodies, represent a new strategy in assessing the clinical relevance of detected DSA. This study demonstrated that C1q-fixing capability of de novo DSA is a clinically relevant marker of worse outcome and inferior graft survival in kidney transplantation. In fact, our findings evidenced a very low graft survival only in the patients who developed DSA able to fix C1q during post-transplant course, while patients producing C1q-negative DSA had good graft survival, which was comparable to that found in our previous study for DSA-negative patients. Moreover, anti-HLA class II antibodies had a higher incidence than anti-HLA class I, and the ability to fix C1q was significantly more frequent among anti-DQ DSA than anti-DR DSA. Monitoring of de novo C1q-DSA production represents a useful, non-invasive tool for risk stratification and prediction of graft outcome in kidney transplantation.

  3. Eculizumab to treat antibody-mediated rejection in a 7-year-old kidney transplant recipient.

    PubMed

    Chehade, Hassib; Rotman, Samuel; Matter, Maurice; Girardin, Eric; Aubert, Vincent; Pascual, Manuel

    2015-02-01

    We report on successful early eculizumab administration to treat acute antibody-mediated rejection (ABMR) in a highly sensitized kidney transplant recipient. The recipient is a 7-year-old boy who received, 6 months after a desensitization protocol with monthly intravenous immunoglobulin infusion, a second kidney transplant in the presence of low donor-specific antibodies (DSAs). Both pretransplant lymphocytotoxic and flow cytometric crossmatch were negative. Allograft function recovered promptly, with excellent initial function. On postoperative day (POD) 4, the child developed significant proteinuria with an acute rise in serum creatinine. Allograft biopsy showed severe acute ABMR. Intravenous eculizumab (600 mg), preceded by a single session of plasmapheresis, was administered on POD 5 and 12 along with a 4-day thymoglobulin course. After the first dose of eculizumab, a strikingly rapid normalization of allograft function with a decrease in proteinuria occurred. However, because circulating DSA levels remained elevated, the child received 3 doses of intravenous immunoglobulin (POD 15, 16, and 17), with a significant subsequent decrease in DSA levels. At 9 months after transplant, the child continues to maintain excellent allograft function with undetectable circulating DSA levels. This unique case highlights the potential efficacy of using early eculizumab to rapidly reverse severe ABMR in pediatric transplantation, and therefore it suggests a novel therapeutic approach to treat acute ABMR.

  4. ABO incompatible renal transplantation following lung transplantation.

    PubMed

    Snell, G I; Davis, A K; Menahem, S; Kotecha, S; Whitford, H M; Levvey, B J; Paraskeva, M; Webb, A; Westall, G W; Walker, R G

    2016-11-01

    We present management strategies utilised for the first case of an urgent live-donor ABO incompatible B blood group renal transplant, in a patient with a prior A blood group lung transplant for cystic fibrosis. Three years on, renal function is excellent and stable, whilst lung function has improved.

  5. Organ Transplants in Kazakhstan.

    PubMed

    Baigenzhin, Abay; Doskaliyev, Zhaksylyk; Tuganbekova, Saltanat; Zharikov, Serik; Altynova, Sholpan; Gaipov, Abduzhappar

    2015-11-01

    The Republic of Kazakhstan is one of the fastest developing countries in the world and has a health care system that is unique in Central Asia. Its organ transplant services are also developing rapidly. We aimed to analyze and briefly report on the current status of organ transplant in the Republic of Kazakhstan. We analyzed organ transplant activities in that country for the period 2012 to 2014. All data were collected from the official database of the National Transplant Coordinating Center of the Republic of Kazakhstan. At the end of 2014, the number of transplant centers had increased to 10, three of which could perform multiorgan transplants; during the same period, the number of deceased-donor organ-donating hospitals increased up to 37. By 2013, the transplant activity rate for all centers had reached 9.22 per million population. During the previous 3 years (2012-2014), there was a 3-fold increase in the number of living donors and an 18-fold increase in the number of kidney transplants. Between 2012 and 2014, the number of living-donor liver transplants increased from 17 to 25, and the number of deceased-donor transplants increased from 3 to 7. During the last 3 years (2012-2014), the number of heart transplants increased to 7 cases. During the last 3 years (2012-2014), Kazakhstan achieved a significant improvement in the organization of its transplant services, and a noticeable upward trend in the system continues.

  6. Hematopoietic Cell Transplantation after Solid Organ Transplantation.

    PubMed

    Doney, Kristine C; Mielcarek, Marco; Stewart, F Marc; Appelbaum, Frederick R

    2015-12-01

    Solid organ transplantation (SOT) followed by hematopoietic cell transplantation (HCT) has been used to treat a single disease with multiorgan involvement or 2 separate diseases, the first requiring SOT and the second often a possible complication of SOT. Results of such serial transplants have been reported sporadically in the literature, usually as single case studies. Thirteen autologous and 27 allogeneic HCTs after SOT published previously are summarized. A more detailed review is provided for an additional 16 patients transplanted at a single institution, 8 of whom had autologous and 8 of whom had allogeneic HCT after SOT. Five of 8 autologous transplant recipients are alive a median of 4.6 years after HCT. Four of 8 allogeneic HCT recipients are alive a median of 8.7 years after HCT. In carefully selected patients, HCT after SOT is feasible and associated with a low incidence of either solid organ or hematopoietic cell rejection.

  7. Antibodies in Transplantation

    PubMed Central

    Platt, Jeffrey L.

    2011-01-01

    Transplantation of cells, tissues, and organs from one individual to another can incite the production of antibodies specific for foreign antigens, especially major histocompatibility antigens, in the graft. Antibodies specific for a graft provide an index of immunity and a potential trigger for injury and rejection. However, the index of immunity can sometimes miss antibody-mediated rejection and besides causing injury the antibodies against a graft can also protect a graft from injury by blocking immune recognition, called enhancement, regulating activation of complement, and inducing changes in the graft that resist damage. Reviewed here are potential limitations in the use of antibodies as an index of immunity and the ways antibodies cause and/or prevent injury. PMID:20807473

  8. Renal transplantation across ABO barrier

    PubMed Central

    Gupta, P. N.; Pokhariyal, S.; Bansal, S.; Jain, S.; Saxena, V.; Sharma, R.; Jain, M.; Jha, P.; Sethi, S. K.; Ghosh, P.; Tewari, A.; Ahlawat, R.; Kher, V.

    2013-01-01

    In India, patients without a compatible blood group donor are usually excluded from renal transplantation. For young patients, it is a difficult therapeutic choice to stay on long-term dialysis. We describe the case of a 19-year-old male patient who had blood group O +ve and had no compatible donor in the family. His mother was B +ve and was willing to donate. The patient had an initial anti-B antibody titer of 1:512 and underwent antibody depletion with plasmapheresis (11 sessions) and intravenous immunoglobulin (IVIG) 100 mg/kg after every plasmapheresis. He also received rituximab 500 mg for 3 days prior to transplant and was induced with basiliximab. At the time of transplant, his anti-B titers were <1:8. Post-operatively, he required four sessions of plasmapheresis and IVIG as his titers rebounded to 1:64. The titers then spontaneously subsided to <1:16 and have stayed at the same level for 6 months post-transplant. The patient continues to have normal renal function with a creatinine of 1.4 mg/dl% and has had no episodes of rejection. PMID:23814422

  9. Radiofrequency and microwave ablation in combination with transarterial chemoembolization induce equivalent histopathologic coagulation necrosis in hepatocellular carcinoma patients bridged to liver transplantation

    PubMed Central

    Ginsburg, Michael; Ahmed, Osman; Doshi, Taral; Hart, John; Te, Helen; Van Ha, Thuong Gustav

    2016-01-01

    Background Bridging therapy plays an increasingly important role in the management of patients with hepatocellular carcinoma (HCC) awaiting liver transplantation (LT). Combination therapy with drug-eluting bead transarterial chemoembolization (DEB-TACE) and percutaneous thermal ablation, such as radiofrequency ablation (RFA) or microwave ablation (MWA), has shown success at prolonging survival and bridging patients to LT. However, few studies have evaluated the two combination therapy regimens head-to-head at a single institution, and fewer have compared histopathology. This retrospective study compares tumor coagulation on explanted livers in patients with HCC treated with DEB-TACE sequentially combined with RFA versus MWA. Methods From 2005 to 2015, 42 sequential patients underwent combination therapy prior to LT by Milan criteria, with 11 patients (11 tumors; mean, 2.9 cm; range, 1.8–4.3 cm) in the DEB-TACE/RFA cohort and 31 patients (40 tumors; mean, 2.4 cm; range, 1.1–5.4 cm) in the DEB-TACE/MWA cohort. The mean TACE procedures in the RFA and MWA cohorts were 1.3 (range, 1–2) and 1.3 (range, 1–3), respectively. The mean thermal ablations in the RFA and MWA cohorts were 1.2 (range, 1–2) and 1.3 (range, 1–3), respectively. Tumor coagulation was evaluated on explanted livers. Results Mean tumor coagulation in the RFA and MWA cohorts were 88.9% (range, 0–100%) and 90.5% (range, 30–100%), respectively (P=0.82). Rates of complete tumor coagulation in the RFA and MWA cohorts were 45% and 53%, respectively (P=0.74). No difference in tumor coagulation was found between the cohorts when separating tumors <3 cm (P=0.21) and >3 cm (P=0.09). Among all 51 tumors, the 36 in complete response (CR) on imaging at LT demonstrated mean tumor coagulation of 95.8%. No correlation was found between tumor coagulation and initial tumor size or time interval to LT. No tumor seeding was seen along the ablation tracts. Conclusions RFA and MWA in sequential combination

  10. Faecal microbiota transplantation-A clinical view.

    PubMed

    Mattner, J; Schmidt, F; Siegmund, B

    2016-08-01

    Faecal microbiota transplantation has gained increasing attention over the last decade as various phenotypes could be transferred from a donor to a recipient in different animal models. Clinically, however, the sole indication with evidence from a randomized placebo controlled trial is refractory Clostridium difficile infection. Despite revealing successful clinical outcomes, questions concerning regulatory affairs, the identification of the best donor, the optimal mixture of the transplant as well as the preferred route of administration remain to be clarified even for this indication. Initiated by the idea that alterations in the composition of the intestinal microbiota are associated with intestinal inflammation in inflammatory bowel disease, several studies investigated whether faecal microbiota transplantation would be an equally suitable approach for these devastating disorders. Indeed, the available data indicate changes in the microbiota composition following faecal microbial transplantation depending on the degree of intestinal inflammation. Furthermore, first data even provide evidence that the transplantation of an "optimized" microbiota induces clinical remission in ulcerative colitis. However, despite these intriguing results it needs to be considered that not only "a cure of inflammation", but also risk factors and phenotypes including obesity can be transferred via faecal microbiota transplantation. Thus, a deeper understanding of the impact of a distinct microbiota composition is required before "designing" the optimal faecal microbiota transplant.

  11. Optical Coherence Tomography in Kidney Transplantation

    NASA Astrophysics Data System (ADS)

    Andrews, Peter M.; Wierwille, Jeremiah; Chen, Yu

    End-stage renal disease (ESRD) is associated with both high mortality rates and an enormous economic burden [1]. The preferred treatment option for ESRD that can extend patients' lives and improve their quality of life is kidney transplantation. However, organ shortages continue to pose a major problem in kidney transplantation. Most kidneys for transplantation come from heart-beating cadavers. Although non-heart-beating cadavers represent a potentially large pool of donor kidneys, these kidneys are not often used due to the unknown extent of damage to the renal tubules (i.e., acute tubular necrosis or "ATN") induced by ischemia (i.e., lack of blood flow). Also, ischemic insult suffered by kidneys awaiting transplantation frequently causes ATN that leads to varying degrees of delayed graft function (DGF) after transplantation. Finally, ATN represents a significant risk for eventual graft and patient survival [2, 3] and can be difficult to discern from rejection. In present clinical practice, there is no reliable real-time test to determine the viability of donor kidneys and whether or not donor kidneys might exhibit ATN. Therefore, there is a critical need for an objective and reliable real-time test to predict ATN to use these organs safely and utilize the donor pool optimally. In this review, we provided preliminary data indicating that OCT can be used to predict the post-transplant function of kidneys used in transplantation.

  12. Towards a validation of a cellular biomarker suite in native and transplanted zebra mussels: a 2-year integrative field study of seasonal and pollution-induced variations.

    PubMed

    Guerlet, Edwige; Ledy, Karine; Meyer, Antoinette; Giambérini, Laure

    2007-03-30

    Two of the questions raised in the validation process of biomarkers are their relevance in the identification and discrimination of environmental perturbations, and the influence of seasonal factors on these biological endpoints. Determining the advantages and restrictions associated with the use of native or transplanted animals and comparing their responses is also needed. To obtain this information, a 2-year integrative field study was conducted in the vicinity of a nuclear power plant in northeastern France. A station was located in the reservoir receiving the cooling waters of the plant, and two other sites were studied 2 km upstream and 5 km downstream from the reservoir's discharge in the Moselle river. Elevated temperatures, copper contamination and a 1.4-fold-concentration factor of dissolved salts affected water quality of the reservoir. Native and transplanted zebra mussels (Dreissena polymorpha) were collected monthly and their digestive glands were processed for histochemical determinations of the lysosomal and peroxisomal systems and of the lipofuscin and neutral lipid contents. The responses were quantified using automated image analysis and stereology. Apart from neutral lipid contents, there were no systematic seasonal patterns in mussel populations or from 1 year to another. Principal Component Analyses showed a general higher discrimination potential of biological responses in transplanted organisms compared to native ones. They also pointed out the relationships between the cellular and physiological markers and abiotic factors. The present multiple biomarker integrative approach in transplanted D. polymorpha brings promising elements in their validation process as relevant biomonitoring tools.

  13. MiR-152 may silence translation of CaMK II and induce spontaneous immune tolerance in mouse liver transplantation.

    PubMed

    Wang, Yan; Tian, Yang; Ding, Yuan; Wang, Jingcheng; Yan, Sheng; Zhou, Lin; Xie, Haiyang; Chen, Hui; Li, Hui; Zhang, Jinhua; Zhao, Jiacong; Zheng, Shusen

    2014-01-01

    Spontaneous immune tolerance in mouse liver transplantation has always been a hotspot in transplantation-immune research. Recent studies revealed that regulatory T cells (Tregs), hepatic satellite cells and Kupffer cells play a potential role in spontaneous immune tolerance, however the precise mechanism of spontaneous immune tolerance is still undefined. By using Microarray Chips, we investigated different immune regulatory factors to decipher critical mechanisms of spontaneous tolerance after mouse liver transplantation. Allogeneic (C57BL/6-C3H) and syngeneic (C3H-C3H) liver transplantation were performed by 6-8 weeks old male C57BL/6 and C3H mice. Graft samples (N = 4 each group) were collected from 8 weeks post-operation mice. 11 differentially expressed miRNAs in allogeneic grafts (Allografts) vs. syngeneic grafts (Syngrafts) were identified using Agilent Mouse miRNA Chips. It was revealed that 185 genes were modified by the 11 miRNAs, furthermore, within the 185 target genes, 11 of them were tightly correlated with immune regulation after Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis and Genbank data cross-comparison. Verified by real-time PCR and western blot, our results indicated that mRNA expression levels of IL-6 and TAB2 were respectively down regulated following miR-142-3p and miR-155 augment. In addition, increased miR-152 just silenced mRNA of CaMK II and down-regulated translation of CaMK II in tolerated liver grafts, which may play a critical role in immune regulation and spontaneous tolerance induction of mouse liver transplantation.

  14. Shared decision making in transplantation: how patients see their role in the decision process of accepting a donor liver.

    PubMed

    Op den Dries, Sanna; Annema, Coby; Berg, Aad P van den; Ranchor, Adelita V; Porte, Robert J

    2014-09-01

    At the time of the organ offer for transplantation, donor-related risks such as disease transmission and graft failure are weighed against the patient's risk of remaining on the waiting list. The patient's commonly inactive role in decision making and the timing and extent of donor-specific risk information have been discussed in the medical literature. This is the first study revealing the opinions of liver patients on these issues. Forty patients listed for liver transplantation and 179 liver transplant patients participated in an anonymous questionnaire-based survey. The majority of the patients wanted to be informed about donor-related risks (59.8%-74.8%). The preferred timing for being informed about donor-related risks was the time of the organ offer for 53.3% of the patients. Among these patients, 79.8% wished to be involved in making the decision to accept or not accept a liver for transplantation, 10.6% wished to make the final decision alone, and only 9.6% did not want to be involved in the decision-making process. Implementing this knowledge through the standardization of the content, the manner of transfer, and the amount of information that we provide to our patients will improve opportunities for shared decision making at different time points during the transplant allocation process. This will enable us to provide the same opportunities and care to every patient on the waiting list.

  15. Effect of deoxyspergualin on vascular rejection in canine kidney transplantation.

    PubMed

    Tanabe, K; Takahashi, K; Nemoto, K; Okada, M; Yasuo, M; Hayasaka, Y; Toma, H; Ota, K

    1994-08-01

    Deoxyspergualin (DSG), an analogue of spergualin produced by Bacillus laterosporus, has a strong immunosuppressive effect in various transplantation models. In this study, we investigated the effect of DSG on vascular rejection in canine kidney transplantation. To enhance vascular rejection, donor-specific blood transfusion (DST) was carried out on days 28, 21 and 14 preceding kidney transplantation. After DST, the donor kidney was transplanted to the recipient iliac fossa. The recipient animals were divided into five groups: namely, Group 1 (n = 7), no treatment; Group 2 (n = 6), DST only; Group 3 (n = 5), DSG only (treated with DSG intravenously at 1.2 mg./kg./day for the first 3 days after transplantation, 1.0 mg./kg./day for the following 3 days and 0.8 mg./kg./day for the following 8 days); Group 4 (n = 6), DST and DSG treatment (same protocol as Group 3); and Group 5 (n = 5), DST and cyclosporine (CsA) (treated with CsA orally at 10 mg./kg./day for 14 days after transplantation). In Group 2, DST treatment significantly reduced kidney graft survival time (8.6 +/- 2.2 days) compared with Group 1 (14.1 +/- 5.5 days). Despite DST, DSG treatment (Group 4) significantly prolonged graft survival time (29.5 +/- 2.6 days), whereas treatment with CsA (Group 5) did not prolong survival time (14.1 +/- 5.5 days) (Group 4 versus 5, p < 0.01). The onset of rejection was significantly delayed in Group 4 (22.1 +/- 2.7 days) compared with Groups 2 (5.7 +/- 2.4 days) and 5 (13.0 +/- 5.7 days) (p < 0.01). In contrast, the interval between rejection onset and animal death was significantly reduced in Groups 2 (3.0 +/- 0.6 days) and 5 (2.4 +/- 1.0 days) compared with Group 4 (7.3 +/- 1.7 days) (p < 0.01). These findings suggest that DSG successfully prevented humoral-type (accelerated acute-type) rejections. Histologically, nonDST groups (Groups 1 and 3) showed minimum vascular rejection. In contrast, all recipients in Group 2 showed severe vascular rejection, as did 80% of Cs

  16. Clinical Characteristics of Transplant-associated Encephalopathy in Children

    PubMed Central

    2017-01-01

    We aimed to analyze characteristics of encephalopathy after both hematopoietic stem cell and solid organ pediatric transplantation. We retrospectively reviewed medical records of 662 pediatric transplant recipients (201 with liver transplantation [LT], 55 with heart transplantation [HT], and 67 with kidney transplantation [KT], 339 with allogeneic hematopoietic stem cell transplantation [HSCT]) who received their graft organs at Asan Medical Center between January 2000 and July 2014. Of the 662 patients, 50 (7.6%) experienced encephalopathy after transplantation. The incidence of encephalopathy was significantly different according to the type of organ transplant: LT, 16/201 (8.0%), HT, 13/55 (23.6%), KT, 5/67 (7.5%), and HSCT, 16/339 (4.7%) (P < 0.001). Drug-induced encephalopathy (n = 14) was the most common encephalopathy for all transplant types, but particularly after HSCT. Hypertensive encephalopathy was the most common after KT and HT, whereas metabolic encephalopathy was the most common after LT. The median time to encephalopathy onset also differed according to the transplant type: 5 days after KT (range 0–491 days), 10 days after HT (1–296 days), 49.5 days after HSCT (9–1,405 days), and 39 days after LT (1–1,092 days) (P = 0.018). The mortality rate among patients with encephalopathy was 42.0% (n = 21/50). Only 5 patients died of neurologic complications. Transplant-associated encephalopathy presented different characteristics according to the type of transplant. Specialized diagnostic approach for neurologic complications specific to the type of transplant may improve survival and quality of life in children after transplantation. PMID:28145649

  17. IMPROVING LONG-TERM OUTCOMES IN KIDNEY TRANSPLANTATION: TOWARDS A NEW PARADIGM OF POST-TRANSPLANT CARE IN THE UNITED STATES

    PubMed Central

    GASTON, ROBERT S.

    2016-01-01

    Since the 1950s, care for kidney transplant recipients in the United States has evolved around a model in which clinical management, quality metrics, and financial underpinnings are focused around the surgical procedure itself reflecting the concept that perioperative and short-term interventions are primary determinants of success. In the current era, short-term results are indeed excellent, but long-term success remains elusive for many. Emerging data, particularly a newfound understanding of donor-specific antibody and its consequences, now challenge the concept that late graft failure is the consequence of early events. Several major longitudinal studies, including the long-term Deterioration of Kidney Allograft Function (DeKAF) project and Clinical Trials in Organ Transplantation-09 (CTOT-09), highlight the primacy of later events in influencing long-term outcomes after kidney transplantation. Proper long-term care and monitoring of kidney recipients, with timely diagnosis and treatment of identifiable injury, offers the best prospect of improving long-term graft survival. PMID:28066070

  18. Acute antibody-mediated rejection after intestinal transplantation

    PubMed Central

    Wu, Guo-Sheng; Cruz Jr, Ruy J; Cai, Jun-Chao

    2016-01-01

    AIM To investigate the incidence, risk factors and clinical outcomes of acute antibody-mediated rejection (ABMR) after intestinal transplantation (ITx). METHODS A retrospective single-center analysis was performed to identify cases of acute ABMR after ITx, based on the presence of donor-specific antibody (DSA), acute tissue damage, C4d deposition, and allograft dysfunction. RESULTS Acute ABMR was identified in 18 (10.3%) out of 175 intestinal allografts with an average occurrence of 10 d (range, 4-162) after ITx. All acute ABMR cases were presensitized to donor human leukocyte antigens class I and/or II antigens with a detectable DSA. A positive cross-match was seen in 14 (77.8%) cases and twelve of 18 patients (66.7%) produced newly-formed DSA following ITx. Histological characteristics of acute ABMR include endothelial C4d deposits, interstitial hemorrhage, and severe congestion with focal fibrin thrombin in the lamina propria capillaries. Multivariate analysis identified a liver-free graft and high level of panel reactive antibody as a significant independent risk factor. Despite initial improvement after therapy, eleven recipients (61.1%) lost transplant secondary to rejection. Of those, 9 (50%) underwent graft removal and 4 (22.2%) received second transplantation following acute ABMR. At an average follow-up of 32.3 mo (range, 13.3-76.4), 8 (44.4%) recipients died. CONCLUSION Our results indicate that acute ABMR is an important cause of intestine graft dysfunction, particularly in a liver-exclusive graft and survivors are at an increased risk of developing refractory acute rejection and chronic rejection. More effective strategies to prevent and manage acute ABMR are needed to improve outcomes. PMID:28058223

  19. B Lymphocyte Homeostasis and BLyS Directed Immunotherapy in Transplantation

    PubMed Central

    Parsons, Ronald F.; Vivek, Kumar; Redfield, Robert R.; Migone, Thi-Sau; Cancro, Michael P.; Naji, Ali; Noorchashm, Hooman

    2010-01-01

    Current strategies for immunotherapy after transplantation are primarily T-lymphocyte directed and effectively abrogate acute rejection. However, the reality of chronic allograft rejection attests to the fact that transplantation tolerance remains an elusive goal. Donor-specific antibodies are considered the primary cause of chronic rejection. When naïve, alloreactive B cells encounter alloantigen and are activated, a resilient “sensitized” state, characterized by the presence of high-affinity antibody, is established. Here, we will delineate findings that support transient B-lymphocyte depletion therapy at the time of transplantation to preempt sensitization by eliminating alloreactive specificities from the recipient B-cell pool (i.e., “repertoire remodeling”). Recent advances in our understanding of B-lymphocyte homeostasis provide novel targets for immunomodulation in transplantation. Specifically, the TNF-related cytokine, BLyS, is the dominant survival factor for “tolerance-susceptible” Transitional and “preimmune” mature Follicular B-cells. The Transitional phenotype is the intermediate through which all newly formed B cells pass before maturing into the Follicular subset, which is responsible for mounting an alloantigen specific antibody response. Systemic BLyS levels dictate the stringency of negative selection during peripheral B cell repertoire development. Thus, targeting BLyS will likely provide an opportunity for repertoire directed therapy to eliminate alloreactive B-cell specificities in transplant recipients; a requirement for the achievement of humoral tolerance and prevention of chronic rejection. In this review the fundamentals of pre-immune B cell selection, homeostasis and activation will be described. Also, new and current B-lymphocyte directed therapy for antibody mediated rejection and the highly sensitized state will be discussed. Overall, our objective will be to propose a rational approach for induction of B cell

  20. Acute and chronic antibody-mediated rejection in pediatric kidney transplantation.

    PubMed

    Pape, Lars; Becker, Jan U; Immenschuh, Stephan; Ahlenstiel, Thurid

    2015-03-01

    Acute antibody-mediated rejection is a diagnostic challenge in renal transplantation medicine. However, it is an important diagnosis to make, since chronic antibody-mediated rejection (CAMR) is the main cause of long-term graft loss. Antibody-mediated rejection is diagnosed by detecting donor-specific antibodies (DSAs) in the blood in combination with observing typical histomorphological signs in kidney biopsy, as described in the Banff classification. Therapy is based on the removal of DSAs by administering intravenous immunoglobulins (IVIGs), plasmapheresis, or immunoadsorption. Reoccurrence of antibodies is diminished by the use of rituximab, increased immunosuppression, and in some cases additional experimental substances. A combination of these techniques has been shown to be successful in the majority of cases of acute and chronic antibody-mediated rejection. Routine DSA monitoring is warranted for early detection of antibody-mediated rejection.

  1. Utilization of Intraoperative TEE to Assess Supraventricular Tachycardia-Inducing Right-Sided Cardiac Compression by the Liver, Post-Liver-Transplantation Status

    PubMed Central

    Stoll, W. David; Hand, William R.; Rohan, Vinayak S.; Gaddy, Parker M.; Reeves, Scott T.; Chavin, Kenneth D.

    2015-01-01

    This unique and interesting case report involves a patient who recently underwent a combined liver and kidney transplant (due to autosomal dominant polycystic kidney disease) and subsequently suffered from episodes of supraventricular tachycardia (SVT) secondary to the new liver graft compressing the right atrium and ventricle. After this was diagnosed, the patient underwent operative plication of the right hemidiaphragm. Intraoperative transesophageal echocardiography was used to demonstrate cardiac compression from the liver and demonstrate resolution of compression after plication of the hemidiaphragm. PMID:25861512

  2. Bile salt-induced pro-oxidant liver damage promotes transplanted cell proliferation for correcting Wilson disease in the Long-Evans Cinnamon rat model.

    PubMed

    Joseph, Brigid; Kapoor, Sorabh; Schilsky, Michael L; Gupta, Sanjeev

    2009-05-01

    Insights into disease-specific mechanisms for liver repopulation are needed for cell therapy. To understand the efficacy of pro-oxidant hepatic perturbations in Wilson disease, we studied Long-Evans Cinnamon (LEC) rats with copper toxicosis under several conditions. Hepatocytes from healthy Long-Evans Agouti (LEA) rats were transplanted intrasplenically into the liver. A cure was defined as lowering of copper to below 250 microg/g liver, presence of ATPase, Cu++ transporting, beta polypeptide (atp7b) messenger RNA (mRNA) in the liver and improvement in liver histology. Treatment of animals with the hydrophobic bile salt, cholic acid, or liver radiation before cell transplantation produced cure rates of 14% and 33%, respectively; whereas liver radiation plus partial hepatectomy followed by cell transplantation proved more effective, with cure in 55%, P < 0.01; and liver radiation plus cholic acid followed by cell transplantation was most effective, with cure in 75%, P < 0.001. As a group, cell therapy cures in rats preconditioned with liver radiation plus cholic acid resulted in less hepatic copper, indicating greater extent of liver repopulation. We observed increased hepatic catalase and superoxide dismutase activities in LEC rats, suggesting chronic oxidative stress. After liver radiation or cholic acid, hepatic lipid peroxidation levels increased, indicating further oxidative injury, although we did not observe overt additional cytotoxicity. This contrasted with healthy animals in which liver radiation and cholic acid produced hepatic steatosis and loss of injured hepatocytes. We concluded that pro-oxidant perturbations were uniquely effective for cell therapy in Wilson disease because of the nature of preexisting hepatic damage.

  3. Plasmodium vivax induced hemolytic uremic syndrome: An uncommon manifestation that leads to a grave complication and treated successfully with renal transplantation.

    PubMed

    Jhorawat, Rajesh; Beniwal, Pankaj; Malhotra, Vinay

    2015-01-01

    We are reporting a case of hemolytic uremic syndrome, a rare manifestation of Plasmodium vivax malaria. A young driver was admitted with acute febrile illness, decreased urine output, anemia, thrombocytopenia, jaundice, and increased serum lactate dehydrogenase. He showed a partial response to antimalarial drugs. However, he was readmitted with worsening renal parameters. His kidney biopsy revealed chronic thrombotic microangiopathy. He remained dialysis dependent and later underwent renal transplantation successfully, with excellent graft function at 1-year.

  4. Obesity and kidney transplantation.

    PubMed

    Jindal, Rahul M; Zawada, Edward T

    2004-06-01

    There is a worldwide epidemic of obesity, and an increasing number of patients who are obese are presenting for solid-organ transplantation. Obesity increases the risk for delayed graft function and local wound complications after technically successful kidney transplantation. Obese patients are more likely to have comorbid factors leading to premature death with a functioning kidney transplant. We suggest the use of World Health Organization criteria when reporting the impact of obesity on recipients of solid-organ transplants. Prospective multicenter studies are indicated to evaluate long-term outcomes in obese patients who successfully receive a kidney transplant. Rigorous efforts should be made to optimize weight before and after solid-organ transplantation by a judicious combination of diet, exercise, minimization of steroid therapy, surgery, and psychological therapies.

  5. Transplantation psychoneuroimmunology: building hypotheses.

    PubMed

    Klapheke, M M

    2000-06-01

    The research findings of psychoneuroimmunology have not yet been fully applied to the field of transplantation psychiatry. Though much study has been devoted to the impact of psychiatric disease on the immunosuppressed state and disease progression in HIV-related illness, little has yet been written on the immunology implications of psychiatric disturbances in the immunosuppressed post-transplant patient. Utilizing Medline literature searches to review relevant research data in psychoneuroimmunology and transplantation immunology, the author formulates and examines four transplantation psychoneuroimmunology hypotheses involving the potential impact of depression on post-transplant organ rejection, cancer, coronary artery disease, and infections. The author concludes that though major questions remain, it appears reasonable to include the impact of depression, and possibly other psychological states, among factors that may affect the net state of immunosuppression in transplant patients.

  6. Lung transplant infection.

    PubMed

    Burguete, Sergio R; Maselli, Diego J; Fernandez, Juan F; Levine, Stephanie M

    2013-01-01

    Lung transplantation has become an accepted therapeutic procedure for the treatment of end-stage pulmonary parenchymal and vascular disease. Despite improved survival rates over the decades, lung transplant recipients have lower survival rates than other solid organ transplant recipients. The morbidity and mortality following lung transplantation is largely due to infection- and rejection-related complications. This article will review the common infections that develop in the lung transplant recipient, including the general risk factors for infection in this population, and the most frequent bacterial, viral, fungal and other less frequent opportunistic infections. The epidemiology, diagnosis, prophylaxis, treatment and outcomes for the different microbial pathogens will be reviewed. The effects of infection on lung transplant rejection will also be discussed.

  7. Cuba's kidney transplantation program.

    PubMed

    Mármol, Alexander; Pérez, Alexis; Pérez de Prado, Juan C; Fernández-Vega, Silvia; Gutiérrez, Francisco; Arce, Sergio

    2010-10-01

    The first kidney transplant in Cuba was performed on 24 February 1970, using a cadaveric donor. In 1979, living donor kidney transplantation began between first-degree relatives. A total of 2775 patients are enrolled in renal replacement therapy in 47 hospitals across the country, 1440 of whom are awaiting kidney transplantation. Organs for the kidney program are procured in 63 accredited hospitals equipped for multidisciplinary management of brain death. Accordingly, over 90% of transplanted kidneys are from cadaveric donors. Identification of potential recipients is carried out through a national, computerized program that affords all patients the same opportunity regardless of distance from a transplant center, and selection of the most suitable candidate is based primarily on HLA compatibility. KEYWORDS Chronic renal failure, kidney transplantation.

  8. Mechanisms of tolerance induced via mixed chimerism.

    PubMed

    Sykes, Megan

    2007-05-01

    Mixed hematopoietic chimerism provides a powerful means of inducing robust, donor-specific tolerance. In this article, the minimal requirements for achieving mixed chimerism, the development of new reagents that promote its achievement, and the mechanisms by which peripheral and intrathymic tolerance are achieved via mixed chimerism are discussed. An emerging understanding of these mechanisms, along with the development of new immunosuppressive reagents, is allowing advancement toward clinical application of this approach.

  9. Successful Simultaneous Liver-Kidney Transplantation in the Presence of Multiple High-Titered Class I and II Antidonor HLA Antibodies

    PubMed Central

    Paterno, Flavio; Girnita, Alin; Brailey, Paul; Witte, David; Wang, Jiang; Cuffy, Madison C.; Diwan, Tayyab; Tremblay, Simon; Revollo, Jane Y.; Alloway, Rita R.; Schoech, Michael R.; Anwar, Nadim; Shah, Shimul A.; Woodle, Steve E.

    2016-01-01

    Abstract The results of simultaneous liver-kidney transplants in highly sensitized recipients have been controversial in terms of antibody-mediated rejection and kidney allograft outcomes. This case report provides a detailed and sophisticated documentation of histocompatibility and pathologic data in a simultaneous liver-kidney transplant performed in a recipient with multiple high-titered class I and II antidonor HLA antibodies and a strongly positive cytotoxic crossmatch. Patient received induction with steroids, rituximab, and eculizumab without lymphocyte depleting agents. The kidney transplant was delayed by 6 hours after the liver transplant to allow more time to the liver allograft to “absorb” donor-specific antibodies (DSA). Interestingly, the liver allograft did not prevent immediate antibody-mediated injury to the kidney allograft in this highly sensitized recipient. Anti-HLA single antigen bead analysis of liver and kidney allograft biopsy eluates revealed deposition of both class I and II DSA in both liver and kidney transplants during the first 2 weeks after transplant. Afterward, both liver and kidney allograft functions improved and remained normal after a year with progressive reduction in serum DSA values. PMID:27990486

  10. Monitoring Pharmacologically Induced Immunosuppression by Immune Repertoire Sequencing to Detect Acute Allograft Rejection in Heart Transplant Patients: A Proof-of-Concept Diagnostic Accuracy Study

    PubMed Central

    Valantine, Hannah A.; Penland, Lolita; Luikart, Helen; Strehl, Calvin; Cohen, Garrett; Khush, Kiran K.; Quake, Stephen R.

    2015-01-01

    Background It remains difficult to predict and to measure the efficacy of pharmacological immunosuppression. We hypothesized that measuring the B-cell repertoire would enable assessment of the overall level of immunosuppression after heart transplantation. Methods and Findings In this proof-of-concept study, we implemented a molecular-barcode-based immune repertoire sequencing assay that sensitively and accurately measures the isotype and clonal composition of the circulating B cell repertoire. We used this assay to measure the temporal response of the B cell repertoire to immunosuppression after heart transplantation. We selected a subset of 12 participants from a larger prospective cohort study (ClinicalTrials.gov NCT01985412) that is ongoing at Stanford Medical Center and for which enrollment started in March 2010. This subset of 12 participants was selected to represent post-heart-transplant events, with and without acute rejection (six participants with moderate-to-severe rejection and six without). We analyzed 130 samples from these patients, with an average follow-up period of 15 mo. Immune repertoire sequencing enables the measurement of a patient’s net state of immunosuppression (correlation with tacrolimus level, r = −0.867, 95% CI −0.968 to −0.523, p = 0.0014), as well as the diagnosis of acute allograft rejection, which is preceded by increased immune activity with a sensitivity of 71.4% (95% CI 30.3% to 94.9%) and a specificity of 82.0% (95% CI 72.1% to 89.1%) (cell-free donor-derived DNA as noninvasive gold standard). To illustrate the potential of immune repertoire sequencing to monitor atypical post-transplant trajectories, we analyzed two more patients, one with chronic infections and one with amyloidosis. A larger, prospective study will be needed to validate the power of immune repertoire sequencing to predict rejection events, as this proof-of-concept study is limited to a small number of patients who were selected based on several

  11. Pediatric Renal Transplantation

    PubMed Central

    Talwalkar, Yeshawant B.; Harner, Marvin H.; Musgrave, James E.; Lawson, Russell K.; Campbell, Robert A.

    1975-01-01

    Thirty-one children received 38 kidney transplants from 22 live and 16 cadaver donors. Among the 31 patients, 25 received one transplant each, 5 received two transplants each and 1 received three transplants. Peritoneal or hemodialysis (or both) was carried out in 22 patients, with an average dialytic maintenance of 12 weeks before transplantation. Posttransplant immunosuppressive therapy included prednisone and azathioprine. Antilymphocyte globulin was administered to 33 recipients as adjunctive immunosuppressive therapy. At present, 23 patients have functioning allografts, 3 are on hemodialysis and 5 are dead. Of 22 live kidney transplants, 18 are presently functioning two months to 14 years after transplantation with an average of 36 months. Of 16 cadaver kidney transplants, 5 are presently functioning 9 to 57 months after transplantation with an average of 32 months. Actuarial live donor allograft survival for one year was 76 percent, for two years was 66 percent and for three years was 64 percent. Cadaver allograft survival was 50 percent, 40 percent and 40 percent, respectively. Complications were urologic and infection related. Of nine recipients with sustained hypertension, in six the condition was due to chronic rejection, while in one it was due to recurrence of the original disease in the allograft. Linear growth was measured in 15 children who were less than 14 years of age at the time of transplantation and in whom allografts survived more than one year. Maximum average linear growth velocity occurred during the first year after transplantation. Our experience indicates pediatric renal transplantation can be successfully used in the treatment of terminal renal failure. PMID:1098288

  12. Perioperative nutritional therapy in liver transplantation.

    PubMed

    Hammad, Ahmed; Kaido, Toshimi; Uemoto, Shinji

    2015-03-01

    Protein-energy malnutrition is frequently seen in patients with end-stage liver disease who undergo liver transplantation. This causes a deterioration of the patients' clinical condition and affects their post-transplantation survival. Accurate assessment of the nutritional status and adequate intervention are prerequisites for perioperative nutritional treatment. However, the metabolic abnormalities induced by liver failure make the traditional assessment of the nutritional status difficult. The methods that were recently developed for accurately assessing the nutritional status by body bioelectrical impedance may be implemented in pre-transplant management. Because preoperative malnutrition and the loss of skeletal muscle mass, called sarcopenia, have a significant negative impact on the post-transplantation outcome, it is essential to provide adequate nutritional support during all phases of liver transplantation. Oral nutrition is preferred, but tube enteral nutrition may be required to provide the necessary caloric intake. We herein discuss both bioelectrical impedance and the latest findings in the current perioperative nutritional interventions in liver transplant patients regarding synbiotics, micronutrients, branched-chain amino acid supplementation, the use of immune system modulating formulas, the fluid balance and the offering of nocturnal meals.

  13. Immunological aspects of liver cell transplantation

    PubMed Central

    Oldhafer, Felix; Bock, Michael; Falk, Christine S; Vondran, Florian W R

    2016-01-01

    Within the field of regenerative medicine, the liver is of major interest for adoption of regenerative strategies due to its well-known and unique regenerative capacity. Whereas therapeutic strategies such as liver resection and orthotopic liver transplantation (OLT) can be considered standards of care for the treatment of a variety of liver diseases, the concept of liver cell transplantation (LCTx) still awaits clinical breakthrough. Success of LCTx is hampered by insufficient engraftment/long-term acceptance of cellular allografts mainly due to rejection of transplanted cells. This is in contrast to the results achieved for OLT where long-term graft survival is observed on a regular basis and, hence, the liver has been deemed an immune-privileged organ. Immune responses induced by isolated hepatocytes apparently differ considerably from those observed following transplantation of solid organs and, thus, LCTx requires refined immunological strategies to improve its clinical outcome. In addition, clinical usage of LCTx but also related basic research efforts are hindered by the limited availability of high quality liver cells, strongly emphasizing the need for alternative cell sources. This review focuses on the various immunological aspects of LCTx summarizing data available not only for hepatocyte transplantation but also for transplantation of non-parenchymal liver cells and liver stem cells. PMID:27011904

  14. Consideration of strategies for hematopoietic cell transplantation.

    PubMed

    Yaniv, Isaac; Ash, Shifra; Farkas, Daniel L; Askenasy, Nadir; Stein, Jerry

    2009-01-01

    Bone marrow transplantation has been adoptively transferred from oncology to the treatment of autoimmune disorders. Along with extension of prevalent transplant-related concepts, the assumed mechanism that arrests autoimmunity involves elimination of pathogenic cells and resetting of immune homeostasis. Similar to graft versus tumor (GVT) reactivity, allogeneic transplants are considered to provide a better platform of immunomodulation to induce a graft versus autoimmunity reaction (GVA). It is yet unclear whether recurrence of autoimmunity in both autologous and allogeneic settings reflects relapse of the disease, transplant-associated immune dysfunction or insufficient immune modulation. Possible causes of disease recurrence include reactivation of residual host pathogenic cells and persistence of memory cells, genetic predisposition to autoimmunity and pro-inflammatory characteristics of the target tissues. Most important, there is little evidence that autoimmune disorders are indeed abrogated by current transplant procedures, despite reinstitution of both peripheral and thymic immune homeostasis. It is postulated that non-specific immunosuppressive therapy that precedes and accompanies current bone marrow transplant strategies is detrimental to the active immune process that restores self-tolerance. This proposition refocuses the need to develop strategies of immunomodulation without immunosuppression.

  15. U.S. Transplantation Data

    MedlinePlus

    ... lives. Sign up to be an organ donor. Technology for transplantation UNOS developed the online database system, ... more Learn how organ transplantation works See the impact transplantation makes Give now Contact 700 N. 4th ...

  16. Update in liver transplantation.

    PubMed Central

    Wong, W. W.; Bain, V. G.

    1999-01-01

    OBJECTIVE: To review recent developments in liver transplantation with particular emphasis on issues relevant to patient care before and after transplantation. QUALITY OF EVIDENCE: Preference was given to recent studies with well-designed cohort methods and large numbers of study subjects. Data on natural history are summarized from large databases in Canada and the United States. Due to the nature of the subjects involved, most treatment studies are open studies or consecutive series rather than randomized controlled trials. MAIN MESSAGE: Substantial advances in liver transplantation have established it as an effective treatment for most end-stage liver diseases, with 1-year survival rates higher than 85% in many centres. Early referral by family physicians and careful patient selection by transplant centres remain crucial to continued success. Managing these patients requires special care from family physicians because of post-transplantation immunosuppression, increased risk of opportunistic infection, and transplantation-associated medical problems. Other unresolved issues include recurrence of disease (hepatitis B and C, and malignancy) and an ongoing shortage of organs. CONCLUSIONS: Liver transplantation is an effective form of therapy for end-stage liver disease, improving both patients' likelihood of survival and their quality of life. Because medical care of liver transplant patients is so complex, coordinated efforts between primary care physicians and transplant teams are crucial. PMID:10349068

  17. Intestinal transplantation: a review.

    PubMed

    Desai, Chirag Sureshchandra; Khan, Khalid Mahmood; Girlanda, Raffaele; Fishbein, Thomas M

    2012-09-01

    Parenteral nutrition is a life-saving therapy for patients with intestinal failure. Intestinal transplantation is now recognized as a treatment for patients who develop complications of parenteral nutrition and in whom attempts at intestinal rehabilitation have failed. Patients with parenteral nutrition related liver disease will require a liver graft typically part of a multivisceral transplant. Isolated intestinal transplants are more commonly performed in adults while multivisceral transplants are most commonly performed in infants. Isolated intestinal transplants have the best short-term outcome, with over 80 % survival at 1 year. Patients requiring multivisceral transplants have a high rate of attrition with a 1 year survival less than 70 %. Prognostic factors for a poor outcome include patient hospitalization at the time of transplant and donor age greater than 40 years while systemic sepsis and acute rejection are the major determinant of early postoperative outcome. For patients surviving the first year the outcome of transplantation of the liver in addition to intestine affords some survival advantage though long-term outcome does not yet match other abdominal organs. Outcomes for intestinal retransplantation are poor as a result of immunology and patient debility. Overall intestinal transplantation continues to develop and is a clear indication with cost and quality of life advantages in patients with intestinal failure that do not remain stable on parenteral nutrition.

  18. Pancreas preservation for pancreas and islet transplantation

    PubMed Central

    Iwanaga, Yasuhiro; Sutherland, David E.R.; Harmon, James V.; Papas, Klearchos K.

    2010-01-01

    Purpose of review To summarize advances and limitations in pancreas procurement and preservation for pancreas and islet transplantation, and review advances in islet protection and preservation. Recent findings Pancreases procured after cardiac death, with in-situ regional organ cooling, have been successfully used for islet transplantation. Colloid-free Celsior and histidine-tryptophan-ketoglutarate preservation solutions are comparable to University of Wisconsin solution when used for cold storage before pancreas transplantation. Colloid-free preservation solutions are inferior to University of Wisconsin solution for pancreas preservation prior to islet isolation and transplantation. Clinical reports on pancreas and islet transplants suggest that the two-layer method may not offer significant benefits over cold storage with the University of Wisconsin solution: improved oxygenation may depend on the graft size; benefits in experimental models may not translate to human organs. Improvements in islet yield and quality occurred from pancreases treated with inhibitors of stress-induced apoptosis during procurement, storage, isolation or culture. Pancreas perfusion may be desirable before islet isolation and transplantation and may improve islet yields and quality. Methods for real-time, noninvasive assessment of pancreas quality during preservation have been implemented and objective islet potency assays have been developed and validated. These innovations should contribute to objective evaluation and establishment of improved pancreas preservation and islet isolation strategies. Summary Cold storage may be adequate for preservation before pancreas transplants, but insufficient when pancreases are processed for islets or when expanded donors are used. Supplementation of cold storage solutions with cytoprotective agents and perfusion may improve pancreas and islet transplant outcomes. PMID:18685343

  19. Preoperative prognostic values of α-fetoprotein (AFP) and protein induced by vitamin K absence or antagonist-II (PIVKA-II) in patients with hepatocellular carcinoma for living donor liver transplantation

    PubMed Central

    Kim, Seok-Hwan; Kim, Wan-Joon; Kang, Woo-Hyoung; Kwon, Jae Hyun; Jwa, Eun Kyung; Cho, Hwui-Dong; Ha, Su-Min; Chung, Yong-Kyu; Lee, Sung-Gyu

    2016-01-01

    Background Adult living donor liver transplantation (LDLT) is one of the best treatments for hepatocellular carcinoma (HCC). However, when recurrence of HCC after LDLT occurs, the prognosis is poor because of rapid progression. Preoperative level of α-fetoprotein (AFP) and protein induced by vitamin K antagonist-II (PIVKA-II) reportedly correlate with recurrence of HCC after LDLT. Methods We examined AFP and PIVKA-II preoperatively as predictors of HCC recurrence in 461 patients who underwent LDLT using right liver graft for HCC from May 2007 to December 2013. Results Among these, 77 patients (16.7%) who experienced recurrence were retrospectively reviewed. Multivariate analysis revealed tumor size >5 cm, AFP >150 nag/mol and PIVKA-II >100 maul/mol as significant independent risk factors for recurrence. The median time to recurrence was 10 months. The median survival time after recurrence was 26 months, and the 1-, 3- and 5-year survival rates after recurrence were 80.5%, 58%, and 28.3% respectively. Conclusions Preoperatively, not only morphology of the tumor but also AFP and PIVKA-II levels can offers important information for the recurrence after LDLT for HCC. Thus, combination of tumor markers might be used for expansion of pre-existing strict selection criteria of liver transplantation for HCC. PMID:28124000

  20. Liver Transplantation: MedlinePlus Health Topic

    MedlinePlus

    ... Handouts Liver transplant (Medical Encyclopedia) Also in Spanish Topic Image MedlinePlus Email Updates Get Liver Transplantation updates ... ENCYCLOPEDIA Liver transplant Liver transplant - slideshow Related Health Topics Cirrhosis Hepatitis Liver Diseases Organ Transplantation National Institutes ...

  1. Bone marrow transplant – children - discharge

    MedlinePlus

    Transplant - bone marrow - children - discharge; Stem cell transplant - children - discharge; Hematopoietic stem cell transplant -children - discharge; Reduced intensity, non-myeloablative transplant - children - discharge; Mini transplant - children - discharge; Allogenic ...

  2. Application of Operational Tolerance Signatures Are Limited by Variability and Type of Immunosuppression in Renal Transplant Recipients: A Cross-Sectional Study

    PubMed Central

    Bottomley, Matthew J.; Chen, Mian; Fuggle, Sue; Harden, Paul N.; Wood, Kathryn J.

    2017-01-01

    Background Renal transplant recipients (RTR) frequently develop complications relating to chronic immunosuppression. Identifying RTR who could safely reduce immunosuppression is therefore highly desirable. We hypothesized that “signatures” described in RTR who have stopped immunosuppression but maintained stable graft function (“operational tolerance”) may enable identification of immunosuppressed RTR who are candidates for immunosuppression minimization. However, the effect of immunosuppression itself on these signatures and circulating B-cell populations is currently unknown. Methods We undertook a cross-sectional study of 117 RTR to assess the effect of immunosuppression upon circulating B cell populations, humoral alloresponse and 2 previously published “signatures” of operational tolerance. Results Immunosuppression associated with alterations in both published “signatures.” Azathioprine associated with a decrease in transitional and naive B-cell numbers and calcineurin inhibition associated with an increase in the number of circulating plasmablasts. However, only azathioprine use associated with the presence of donor-specific anti-HLA IgG antibodies. Calcineurin inhibition associated with an increase in total serum IgM but not IgG. Data were corrected for age, time since last transplant, and other immunosuppression. Conclusions Current signatures of operational tolerance may be significantly affected by immunosuppressive regimen, which may hinder use in their current form in clinical practice. Calcineurin inhibition may prevent the development of long-lasting humoral alloresponses, whereas azathioprine therapy may be associated with donor specific antibody development. PMID:28349125

  3. Pilot test of a patient decision aid about liver transplant organ quality.

    PubMed

    Volk, Michael L; Roney, Meghan; Fagerlin, Angela

    2014-07-01

    Prior studies have shown that patients are reluctant to accept donor-specific risks, and transplant professionals lack an effective and time-efficient means of obtaining informed consent. We designed and pilot-tested a Web-based patient decision aid (DA) on organ quality. The DA was administered to 53 liver transplant candidates (median Model for End-Stage Liver Disease score = 14, range = 7-26), and they took a mean of 15 minutes to complete it. Questions about knowledge and attitudes were asked before and after the DA. Subjects' knowledge improved, with 53% and 60% correctly answering questions about hepatitis B virus and human immunodeficiency virus transmission before the DA and 94% and 100%, respectively, correctly answering them afterward (P < 0.001). The accuracy of mortality prediction also improved from a mean 3-month mortality estimate of 22% before the DA to 12% afterward (P < 0.001). After the DA, subjects felt that it was more likely that they might be offered a less-than-perfect liver (P = 0.001), and they were more likely to consider accepting such a liver (P < 0.001). In conclusion, implementing a Web-based patient DA is feasible and improves knowledge among liver transplant candidates. The use of this tool may decrease candidates' reluctance to accept extended criteria organs.

  4. Donor and host photoreceptors engage in material transfer following transplantation of post-mitotic photoreceptor precursors

    PubMed Central

    Pearson, R. A.; Gonzalez-Cordero, A.; West, E. L.; Ribeiro, J. R.; Aghaizu, N.; Goh, D.; Sampson, R. D.; Georgiadis, A.; Waldron, P. V.; Duran, Y.; Naeem, A.; Kloc, M.; Cristante, E.; Kruczek, K.; Warre-Cornish, K.; Sowden, J. C.; Smith, A. J.; Ali, R. R.

    2016-01-01

    Photoreceptor replacement by transplantation is proposed as a treatment for blindness. Transplantation of healthy photoreceptor precursor cells into diseased murine eyes leads to the presence of functional photoreceptors within host retinae that express an array of donor-specific proteins. The resulting improvement in visual function was understood to be due to donor cells integrating within host retinae. Here, however, we show that while integration occurs the majority of donor-reporter-labelled cells in the host arises as a result of material transfer between donor and host photoreceptors. Material transfer does not involve permanent donor–host nuclear or cell–cell fusion, or the uptake of free protein or nucleic acid from the extracellular environment. Instead, RNA and/or protein are exchanged between donor and host cells in vivo. These data require a re-evaluation of the mechanisms underlying rescue by photoreceptor transplantation and raise the possibility of material transfer as a strategy for the treatment of retinal disorders. PMID:27701378

  5. Bioethics of organ transplantation.

    PubMed

    Caplan, Arthur

    2014-03-01

    As the ability to transplant organs and tissues has grown, the demand for these procedures has increased as well--to the point at which it far exceeds the available supply creating the core ethical challenge for transplantation--rationing. The gap between supply and demand, although large, is worse than it appears to be. There are two key steps to gaining access to a transplant. First, one must gain access to a transplant center. Then, those waiting need to be selected for a transplant. Many potential recipients do not get admitted to a program. They are deemed too old, not of the right nationality, not appropriate for transplant as a result of severe mental impairment, criminal history, drug abuse, or simply because they do not have access to a competent primary care physician who can refer them to a transplant program. There are also financial obstacles to access to transplant waiting lists in the United States and other nations. In many poor nations, those needing transplants simply die because there is no capacity or a very limited capacity to perform transplants. Although the demand for organs now exceeds the supply, resulting in rationing, the size of waiting lists would quickly expand were there to suddenly be an equally large expansion in the number of organs available for transplantation. Still, even with the reality of unavoidable rationing, saving more lives by increasing organ supply is a moral good. Current public policies for obtaining organs from cadavers are not adequate in that they do not produce the number of organs that public polls of persons in the United States indicate people are willing to donate.

  6. Increasing access to kidney transplantation for sensitized recipient through three-way kidney paired donation with desensitization: The first Indian report

    PubMed Central

    Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Modi, Manisha P; Shah, Priya S; Varyani, Umesh T; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Viajay A; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L

    2016-01-01

    The combination of kidney paired donation (KPD) with desensitization represents a promising method of increasing the rate of living donor kidney transplantation (LDKT) in immunologically challenging patients. Patients who are difficult to match and desensitize due to strong donor specific antibody are may be transplanted by a combination of desensitization and KPD protocol with more immunologically favorable donor. We present our experience of combination of desensitization protocol with three-way KPD which contributed to successful LDKT in highly sensitized end stage renal disease patient. All recipients were discharged with normal and stable allograft function at 24 mo follow up. We believe that this is first report from India where three-way KPD exchange was performed with the combination of KPD and desensitization. The combination of desensitization protocol with KPD improves access and outcomes of LDKT. PMID:27803919

  7. Increasing access to kidney transplantation for sensitized recipient through three-way kidney paired donation with desensitization: The first Indian report.

    PubMed

    Kute, Vivek B; Patel, Himanshu V; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Modi, Manisha P; Shah, Priya S; Varyani, Umesh T; Wakhare, Pavan S; Shinde, Saiprasad G; Ghodela, Viajay A; Patel, Minaxi H; Trivedi, Varsha B; Trivedi, Hargovind L

    2016-10-16

    The combination of kidney paired donation (KPD) with desensitization represents a promising method of increasing the rate of living donor kidney transplantation (LDKT) in immunologically challenging patients. Patients who are difficult to match and desensitize due to strong donor specific antibody are may be transplanted by a combination of desensitization and KPD protocol with more immunologically favorable donor. We present our experience of combination of desensitization protocol with three-way KPD which contributed to successful LDKT in highly sensitized end stage renal disease patient. All recipients were discharged with normal and stable allograft function at 24 mo follow up. We believe that this is first report from India where three-way KPD exchange was performed with the combination of KPD and desensitization. The combination of desensitization protocol with KPD improves access and outcomes of LDKT.

  8. Organ transplantation and replacement

    SciTech Connect

    Cerilli, G.J.

    1988-01-01

    This book contains 49 chapters. Some of the titles are: Molecular, Genetic, and Clinical Aspects of the HLA System; The Normal Immune Response; Significance of the ABO Antigen System; The Role of Dialysis in the Management of End-Stage Renal Disease; Access for Dialysis; Patient Selection for Renal Transplantation; The Living Donor in Kidney Transplantation; and Kidney Preservation by Cold Storage.

  9. [Uterus transplantation. Current situation].

    PubMed

    Gauthier, T; Piver, P; Mesnard, C; Marquet, P; Pichon, N; Guillaudeau, A; Drouet, M; Gardet, E; Laskar, M; Essig, M; Aubard, Y

    2012-11-01

    Except adoption, absolute uterine factor infertility lacks solution in case of motherhood desire. Gestational surrogacy is still not approved in France. Over the last decade, uterus transplantation experimentation made advances. Data from animal research, progress in immunosuppressive treatment and knowledge about pregnancy after transplantation provide a scenario in which a human allotransplantation project can become reality.

  10. Islet Cell Transplantation

    MedlinePlus

    ... person who has type 1 diabetes must take insulin daily to live. Transplanted islet cells, however, can take over the work of the destroyed cells. The beta cells in these islets will begin to make and release insulin. Researchers hope islet transplantation will help people with ...

  11. Hair transplantation surgery

    PubMed Central

    Khanna, Manoj

    2008-01-01

    Techniques in hair transplantation have evolved recently which make results look more natural. Hair restoration is one of the most exciting and innovative surgical fields in aesthetic surgery today. A precise appreciation of anatomy has allowed the use of follicular unit grafts. With better methods of harvesting and implantation, hair transplantation results represent a blend of art and science. PMID:20174544

  12. Pancreatitis following liver transplantation.

    PubMed

    Alexander, J A; Demetrius, A J; Gavaler, J S; Makowka, L; Starzl, T E; Van Thiel, D H

    1988-06-01

    Since 1981, when the liver transplantation program was initiated at the University of Pittsburgh, we have been impressed with the prevalence of pancreatitis occurring following liver transplantation in patients transplanted for hepatitis B-related liver disease. To either confirm this clinical impression or refute it, the records of the 27 HbsAg+ patients and those of an additional 24 HbsAg- but HbcAb and/or HbsAb+ patients who underwent orthotopic liver transplantation were reviewed to determine the prevalence of clinical pancreatitis and hyperamylasemia (biochemical pancreatitis) following liver transplantation (OLTx). Post-OLTx hyperamylasemia occurred significantly more frequently in HbsAg+ patients (6/27) than it did in the HbsAg- patients (0/24) (P less than 0.05). More importantly, clinical pancreatitis occurred in 14% (4/27) of the HbsAg+ patients and 0% (0/24) of the HbsAg- patients. Interestingly, in each case, the pancreatitis was associated with the occurrence of acute hepatitis B infection of the allograft. Based upon these data, we conclude that pancreatitis occurring after liver transplantation is more common in patients transplanted for active viral liver disease caused by hepatitis B than in those with inactive viral liver disease. These observations suggest that pancreatitis occurring in, at least some cases following liver transplantation for viral liver disease, may result from hepatitis B virus infection of the pancreas.

  13. Some immunogenic acid biochemical properties of tumor-associated transplantation antigens (TATA) obtained in soluble form or solubilized from two methylcholanthrene-induced sarcomas, Meth A and CI-4.

    PubMed

    Rogers, M J; Law, L W

    1981-06-15

    The subcellular distribution of the tumor-associated transplantation antigens (TATAs) of two highly immunogenic methylcholanthrene-induced sarcomas, Meth A and CI-4, were compared. Most of the TATA of CI-4 was found in the soluble fraction (cytosol) of the cell while the TATA from Meth A was variably distributed between the membrane and cytosol. The soluble fraction TATAs from both tumors were very immunogenic and their strong immunity could not be influenced by administering antigen in a variety of protocols that altered the immune response in other systems. The soluble fraction and membrane-associated TATAs from both tumors could be specifically bound to liposomes in reconstitution experiments and the antigenicity of all of the TATAs was significantly enhanced when they were incorporated into these artificial membranes.

  14. A Paradigm Shift on the Question of B Cells in Transplantation? Recent Insights on Regulating the Alloresponse

    PubMed Central

    Firl, Daniel J.; Benichou, Gilles; Kim, James I.; Yeh, Heidi

    2017-01-01

    B lymphocytes contribute to acute and chronic allograft rejection through their production of donor-specific antibodies (DSAs). In addition, B cells present allopeptides bound to self-MHC class II molecules and provide costimulation signals to T cells, which are essential to their activation and differentiation into memory T cells. On the other hand, both in laboratory rodents and patients, the concept of effector T cell regulation by B cells is gaining traction in the field of transplantation. Specifically, clinical trials using anti-CD20 monoclonal antibodies to deplete B cells and reverse DSA had a deleterious effect on rates of acute cellular rejection; a peculiar finding that calls into question a central paradigm in transplantation. Additional work in humans has characterized IL-10-producing B cells (IgM memory and transitional B cells), which suppress the proliferation and inflammatory cytokine productions of effector T cells in vitro. Understanding the mechanisms of regulating the alloresponse is critical if we are to achieve operational tolerance across transplantation. This review will focus on recent evidence in murine and human transplantation with respect to non-traditional roles for B cells in determining clinical outcomes. PMID:28210263

  15. Novel insights into pretransplant allosensitization in heart transplant recipients in the contemporary era of immunosuppression and rejection surveillance.

    PubMed

    Svobodova, Eva; Gazdic, Tomas; Kubanek, Milos; Vymetalova, Jevgenija; Voska, Ludek; Kment, Martin; Lanska, Vera; Kolesar, Libor; Urban, Marian; Netuka, Ivan; Pirk, Jan; Melenovsky, Vojtech; Kautzner, Josef; Slavcev, Antonij; Malek, Ivan

    2016-01-01

    Solid-phase assays (SPA) have facilitated detection and definition of antibodies to human leukocyte antigens (HLA) and major histocompatibility complex class I chain-related antigen A (MICA). However, clinical consequences of pretransplant SPA results in heart transplantation have been studied insufficiently in the current era of immunosuppression and rejection surveillance. Pretransplant sera, panel-reactive antibodies (PRA), pretransplant crossmatch, and clinical data were retrospectively analyzed in 264 adult heart transplant recipients. The specificity of HLA and MICA antibodies and C1q-binding activity of donor-specific antibodies (DSA) were defined using SPA. Pretransplant HLA antibodies were detected in 57 (22%) individuals, in 28 individuals (11%); these antibodies were DSA after transplant. Preformed DSA and elevated peak PRA were independent predictors of pathologic AMR, which occurred in 19 individuals (7%). The increasing number of DSA and the cumulative mean fluorescence intensity of DSA were associated with AMR. C1q-binding assay was a suboptimal predictor of AMR in our cohort. Pretransplant allosensitization and MICA antibodies were related neither to impaired graft survival nor to other adverse clinical events during a median follow-up of 39 months. Identification of preformed DSA by SPA, in addition to PRA monitoring, may predict AMR in the contemporary era of heart transplantation.

  16. A Paradigm Shift on the Question of B Cells in Transplantation? Recent Insights on Regulating the Alloresponse.

    PubMed

    Firl, Daniel J; Benichou, Gilles; Kim, James I; Yeh, Heidi

    2017-01-01

    B lymphocytes contribute to acute and chronic allograft rejection through their production of donor-specific antibodies (DSAs). In addition, B cells present allopeptides bound to self-MHC class II molecules and provide costimulation signals to T cells, which are essential to their activation and differentiation into memory T cells. On the other hand, both in laboratory rodents and patients, the concept of effector T cell regulation by B cells is gaining traction in the field of transplantation. Specifically, clinical trials using anti-CD20 monoclonal antibodies to deplete B cells and reverse DSA had a deleterious effect on rates of acute cellular rejection; a peculiar finding that calls into question a central paradigm in transplantation. Additional work in humans has characterized IL-10-producing B cells (IgM memory and transitional B cells), which suppress the proliferation and inflammatory cytokine productions of effector T cells in vitro. Understanding the mechanisms of regulating the alloresponse is critical if we are to achieve operational tolerance across transplantation. This review will focus on recent evidence in murine and human transplantation with respect to non-traditional roles for B cells in determining clinical outcomes.

  17. Heart transplantation: review

    PubMed Central

    Mangini, Sandrigo; Alves, Bárbara Rubim; Silvestre, Odílson Marcos; Pires, Philippe Vieira; Pires, Lucas José Tachotti; Curiati, Milena Novaes Cardoso; Bacal, Fernando

    2015-01-01

    ABSTRACT Heart transplantation is currently the definitive gold standard surgical approach in the treatment of refractory heart failure. However, the shortage of donors limits the achievement of a greater number of heart transplants, in which the use of mechanical circulatory support devices is increasing. With well-established indications and contraindications, as well as diagnosis and treatment of rejection through defined protocols of immunosuppression, the outcomes of heart transplantation are very favorable. Among early complications that can impact survival are primary graft failure, right ventricular dysfunction, rejection, and infections, whereas late complications include cardiac allograft vasculopathy and neoplasms. Despite the difficulties for heart transplantation, in particular, the shortage of donors and high mortality while on the waiting list, in Brazil, there is a great potential for both increasing effective donors and using circulatory assist devices, which can positively impact the number and outcomes of heart transplants. PMID:26154552

  18. Hand transplant surgery.

    PubMed

    Nassimizadeh, M; Nassimizadeh, A K; Power, D

    2014-11-01

    In September 1998 the world's first hand transplant was performed in Lyon, France. A new era in reconstructive surgery had begun. This case highlighted the potential for composite tissue allotransplantation (CTA). While CTA is not a new technique, it unifies the principles of reconstructive microsurgery and transplant surgery, achieving the goals of absolute correction of a defect with anatomically and physiologically identical tissue with none of the issues of donor site morbidity associated with autologous tissue transfer. The adoption of this technique for non-life threatening conditions to improve quality of life has generated a number of new ethical considerations. Additionally, the prominence of transplanted hands has led to much discussion around the issue of body identity and psychological assessment of potential recipients. This is fundamental to any hand transplantation programme. With the advent of hand transplantation dawning in the UK, we review the many ethical considerations that contribute to this new frontier.

  19. Hand transplant surgery

    PubMed Central

    Nassimizadeh, AK; Power, D

    2014-01-01

    In September 1998 the world’s first hand transplant was performed in Lyon, France. A new era in reconstructive surgery had begun. This case highlighted the potential for composite tissue allotransplantation (CTA). While CTA is not a new technique, it unifies the principles of reconstructive microsurgery and transplant surgery, achieving the goals of absolute correction of a defect with anatomically and physiologically identical tissue with none of the issues of donor site morbidity associated with autologous tissue transfer. The adoption of this technique for non-life threatening conditions to improve quality of life has generated a number of new ethical considerations. Additionally, the prominence of transplanted hands has led to much discussion around the issue of body identity and psychological assessment of potential recipients. This is fundamental to any hand transplantation programme. With the advent of hand transplantation dawning in the UK, we review the many ethical considerations that contribute to this new frontier. PMID:25350176

  20. Adverse Outcomes of Tacrolimus Withdrawal in Immune-Quiescent Kidney Transplant Recipients.

    PubMed

    Hricik, Donald E; Formica, Richard N; Nickerson, Peter; Rush, David; Fairchild, Robert L; Poggio, Emilio D; Gibson, Ian W; Wiebe, Chris; Tinckam, Kathryn; Bunnapradist, Suphamai; Samaniego-Picota, Milagros; Brennan, Daniel C; Schröppel, Bernd; Gaber, Osama; Armstrong, Brian; Ikle, David; Diop, Helena; Bridges, Nancy D; Heeger, Peter S

    2015-12-01

    Concerns about adverse effects of calcineurin inhibitors (CNIs) have prompted development of protocols that minimize their use. Whereas previous CNI withdrawal trials in heterogeneous cohorts showed unacceptable rates of acute rejection (AR), we hypothesized that we could identify individuals capable of tolerating CNI withdrawal by targeting immunologically quiescent kidney transplant recipients. The Clinical Trials in Organ Transplantation-09 Trial was a randomized, prospective study of nonsensitized primary recipients of living donor kidney transplants. Subjects received rabbit antithymocyte globulin, tacrolimus, mycophenolate mofetil, and prednisone. Six months post-transplantation, subjects without de novo donor-specific antibodies (DSAs), AR, or inflammation at protocol biopsy were randomized to wean off or remain on tacrolimus. The intended primary end point was the change in interstitial fibrosis/tubular atrophy score between implantation and 24-month protocol biopsies. Serially collected urine CXCL9 ELISA results were correlated with outcomes. The study was terminated prematurely because of unacceptable rates of AR (4 of 14) and/or de novo DSAs (5 of 14) in the tacrolimus withdrawal arm. Positive urinary CXCL9 predated clinical detection of AR by a median of 15 days. Analyses showed that >16 HLA-DQ epitope mismatches and pretransplant, peripheral blood, donor-reactive IFN-γ ELISPOT assay results correlated with development of DSAs and/or AR on tacrolimus withdrawal. Although data indicate that urinary CXCL9 monitoring, epitope mismatches, and ELISPOT assays are potentially informative, complete CNI withdrawal must be strongly discouraged in kidney transplant recipients who are receiving standard-of-care immunosuppression, including those who are deemed to be immunologically quiescent on the basis of current clinical and laboratory criteria.

  1. A novel field transplantation technique reveals intra-specific metal-induced oxidative responses in strains of Ectocarpus siliculosus with different pollution histories.

    PubMed

    Sáez, Claudio A; González, Alberto; Contreras, Rodrigo A; Moody, A John; Moenne, Alejandra; Brown, Murray T

    2015-04-01

    A novel field transplantation technique, in which seaweed material is incorporated into dialysis tubing, was used to investigate intra-specific responses to metals in the model brown alga Ectocarpus siliculosus. Metal accumulation in the two strains was similar, with higher concentrations in material deployed to the metal-contaminated site (Ventanas, Chile) than the pristine site (Quintay, Chile). However, the oxidative responses differed. At Ventanas, strain Es147 (from low-polluted site) underwent oxidative damage whereas Es524 (from highly polluted site) was not affected. Concentrations of reduced ascorbate (ASC) and reduced glutathione (GSH) were significantly higher in Es524. Activities of the antioxidant enzymes superoxide dismutase (SOD), ascorbate peroxidase (APX), catalase (CAT), and glutathione reductase (GR) all increased in Es524, whereas only SOD increased in Es147. For the first time, employing a field transplantation technique, we provide unambiguous evidence of inter-population variation of metal-tolerance in brown algae and establish that antioxidant defences are, in part, responsible.

  2. Late acute humoral rejection in low-risk renal transplant recipients induced with an interleukin-2 receptor antagonist and maintained with standard therapy: preliminary communication.

    PubMed

    Morales, J; Contreras, L; Zehnder, C; Pinto, V; Elberg, M; Araneda, S; Herzog, C; Calabran, L; Aguiló, J; Ferrario, M; Buckel, E; Fierro, J A

    2011-01-01

    Low-risk renal transplant recipients treated with standard immunosuppressive therapy including interleukin-2 receptor (IL-2R) antagonist show a low incidence of early rejection episodes but few reports have examined the incidence and severity of late rejection processes. This study evaluated retrospectively cellular and antibody-mediated rejection (AMR) among 42 recipients selected because they showed low panel-reactive-antibodies, short cold ischemia time, no delayed graft function, and therapy including basiliximab (Simulect) induction. The mean observation time was 6.6 years. Sixty-seven percent of donors were deceased. Ten-year patient and death-censored graft survivals were 81% and 78%, respectively. Seven patients lost their kidneys due to nonimmunologic events. The seven recipients who experienced cellular rejection episodes during the first posttransplant year had them reversed with steroids. Five patients displayed late acute AMR causing functional deterioration in four cases including 1 graft loss. De novo sensitization occurred in 48% of recipients including patients without clinical rejection. In conclusion, long-term follow-up of kidney transplant recipients selected by a low immunologic risk showed a persistent risk of de novo sensitization evolving to acute AMR in 11% of cases. Although immunologic events were related to late immunosuppressive reduction, most graft losses were due to nonimmunologic factors.

  3. Transplantation of Neural Stem Cells Cotreated with Thyroid Hormone and GDNF Gene Induces Neuroprotection in Rats of Chronic Experimental Allergic Encephalomyelitis

    PubMed Central

    Gao, Xiaoqing; Hu, Guangqiang; Deng, Li; Fan, Guangbi; Yang, Chaoxian; Du, Jie

    2016-01-01

    The present study investigates whether transplantation of NSCs treated with T3 alone (T3/NSCs), or in conjunction with GDNF gene (GDNF-T3/NSCs), provides a better therapeutic effect than NSCs for chronic EAE. EAE rats were, respectively, injected with NSCs, T3/NSCs, GDNF-T3/NSCs, and saline at 10 days and sacrificed at 60 days after EAE immunization. The three cell grafted groups showed a significant reduction in clinical scores, inflammatory infiltration, and demyelination compared with the saline-injected group, and among the cell grafted groups, the reduction in GDNF-T3/NSCs group was the most notable, followed by T3/NSCs group. Grafted T3/NSCs and GDNF-T3/NSCs acquired more MAP2, GalC, and less GFAP in brain compared with grafted NSCs, and grafted GDNF-T3/NSCs acquired most MAP2 and least GalC among the cell grafted groups. Furthermore, T3/NSCs and GDNF-T3/NSCs grafting increased the expression of mRNA for PDGFαR, GalC, and MBP in lesion areas of brain compared with NSCs grafting, and the expression of mRNA for GalC and MBP in GDNF-T3/NSCs group was higher than that in T3/NSCs group. In conclusion, T3/NSCs grafting, especially GDNF-T3/NSCs grafting, provides a better neuroprotective effect for EAE than NSCs transplantation. PMID:26881104

  4. Induction treatment of previously undiagnosed ANCA-associated vasculitis in a renal transplant patient with Rituximab

    PubMed Central

    Graham-Brown, M. P. M.; Aljayyousi, R.; Baines, R. J.; Burton, J. O.; Brunskill, N. J.; Furness, P.; Topham, P.

    2016-01-01

    We report the case of a 40-year-old female transplant patient with undiagnosed ANCA-associated vasculitis (AAV) and renal allograft dysfunction who achieved disease remission with restoration of transplant function following induction therapy with rituximab. There are currently no trial data looking at the use of rituximab for induction of remission of renal transplant patients with AAV. Although recurrence of AAV following renal transplantation is rare, such patients have invariably had multiple previous exposures to induction and maintenance immunosuppressive regimens, often limiting treatment options post-transplantation. In this case, rituximab was well tolerated with no side effects, and was successful in salvaging transplant function. Optimal treatment regimens for relapsed AAV in the transplant population are not known, and clinical trials are needed to evaluate the efficacy and safety of rituximab at inducing and maintaining disease remission in relapsed AAV following transplantation. PMID:27699052

  5. [Increased efficacy of allogenic bone marrow transplantation].

    PubMed

    Fedotenkov, A G; Danilova, L A; Ignasheva, L P

    1982-08-01

    Experiments made in vivo and vitro have demonstrated that conservation of allogeneic hemopoietic tissue with glycerin brings about a decrease in transplatation, homologous activity of T lymphocytes. Allogeneic bone marrow conserved with glycerin compares very favourably with freshly prepared allogeneic bone marrow since the transplant-versus-host reaction is attenuated under the effect of glycerin. Moreover, it shows a higher proliferative activity. The glycerin-induced reduction of the inactivating effect of lymphocytes against non-syngeneic colony-forming units enables the conserved bone marrow to be transplanted from several donors.

  6. Small Bowel Transplant

    PubMed Central

    2003-01-01

    EXECUTIVE SUMMARY Objective The Medical Advisory Secretariat undertook a review of the evidence on the effectiveness and cost-effectiveness of small bowel transplant in the treatment of intestinal failure. Small Bowel Transplantation Intestinal failure is the loss of absorptive capacity of the small intestine that results in an inability to meet the nutrient and fluid requirements of the body via the enteral route. Patients with intestinal failure usually receive nutrients intravenously, a procedure known as parenteral nutrition. However, long-term parenteral nutrition is associated with complications including liver failure and loss of venous access due to recurrent infections. Small bowel transplant is the transplantation of a cadaveric intestinal allograft for the purpose of restoring intestinal function in patients with irreversible intestinal failure. The transplant may involve the small intestine alone (isolated small bowel ISB), the small intestine and the liver (SB-L) when there is irreversible liver failure, or multiple organs including the small bowel (multivisceral MV or cluster). Although living related donor transplant is being investigated at a limited number of centres, cadaveric donors have been used in most small bowel transplants. The actual transplant procedure takes approximately 12-18 hours. After intestinal transplant, the patient is generally placed on prophylactic antibiotic medication and immunosuppressive regimen that, in the majority of cases, would include tacrolimus, corticosteroids and an induction agent. Close monitoring for infection and rejection are essential for early treatment. Medical Advisory Secretariat Review The Medical Advisory Secretariat undertook a review of 35 reports from 9 case series and 1 international registry. Sample size of the individual studies ranged from 9 to 155. As of May 2001, 651 patients had received small bowel transplant procedures worldwide. According to information from the Canadian Organ Replacement

  7. Long-term survival of cardiac allografts induced by cyclophosphamide combined with CTLA4Ig-gene transfer mediated by adenoviral vector.

    PubMed

    Wang, G M; Ma, J B; Jin, Y Z; Feng, Y G; Hao, J; Gao, X; Xie, S S

    2006-11-01

    There is a need to achieve donor-specific tolerance in clinical organ transplantation, where potential benefits remain overshadowed by chronic rejection and the side-effects of long-term immunosuppressive therapy. It is known that the mature immune system in mice can be reprogrammed to accept a foreign graft as if it was "self". The AdCTLA4Ig-mediated gene transfer (SC) + cyclophosphamide (CP) treatment alone prolongs allograft survival but does not induce tolerance. However, in our study, the AdCTLA4Ig-mediated gene transfer combined with SC + CP treatment yielded significantly prolonged mean survival times (149.7 +/- 18.0 days), while those in the untreated or AdLacZ treated mice were rejected in normal fashion (5.3 +/- 0.5 and 5.2 +/- 0.4 days, respectively), and survival in the AdCTLA4Ig or SC + CP treated groups were 45.7 +/- 9.6 or 50.2 +/- 5.3 days, respectively. In conclusion, a protocol of AdCTLA4Ig + SC + CP improved the survival of DA-->LEW cardiac allografts.

  8. Identifying Subphenotypes of Antibody-Mediated Rejection in Kidney Transplants.

    PubMed

    Halloran, P F; Merino Lopez, M; Barreto Pereira, A

    2016-03-01

    The key lesions in antibody-mediated kidney transplant rejection (ABMR) are microcirculation inflammation (peritubular capillaritis and/or glomerulitis lesions, abbreviated "pg") and glomerular double contours (cg lesions). We used these features to explore subphenotypes in 164 indication biopsies with ABMR-related diagnoses: 137 ABMR (109 pure and 28 mixed with T cell-mediated rejection [TCMR]) and 27 transplant glomerulopathy (TG), identified from prospective multicenter studies. The lesions indicated three ABMR subphenotypes: pgABMR, cgABMR, and pgcgABMR. Principal component analysis confirmed these subphenotypes and showed that TG can be reclassified as pgcgABMR (n = 17) or cgABMR (n = 10). ABMR-related biopsies included 45 pgABMR, 90 pgcgABMR, and 25 cgABMR, with four unclassifiable. Dominating all time intervals was the subphenotype pgcgABMR. The pgABMR subphenotype presented earliest (median <2 years), frequently mixed with TCMR, and was most associated with nonadherence. The cgABMR subphenotype presented late (median 9 years). Subphenotypes differed in their molecular changes, with pgABMR having the most histologic-molecular discrepancies (i.e. potential errors). Donor-specific antibody (DSA) was not identified in 29% of pgcgABMR and 46% of cgABMR, but failure rates and molecular findings were similar to cases where DSA was known to be positive. Thus, ABMR presents distinct subphenotypes, early pg-dominant, late cg-dominant, and combined pgcg phenotype, differing in time, molecular features, accompanying TCMR, HLA antibody, and probability of nonadherence.

  9. [Surgical techniques of organ transplants].

    PubMed

    Froněk, Jiří

    2015-01-01

    The list of surgical procedures of solid organ transplantations appears very interesting and colorful, even with overlap among techniques. Liver transplantation is a life-saving procedure in a majority of cases, the liver can be transplanted as a full or partial graft. The liver graft can be split for two recipients; it can also be reduced for a small recipient if splitting is not indicated. Kidney transplantation is the most common solid organ transplant procedure, the majority of kidney grafts come from brain-dead donors whereas the number of live donor transplants is increasing, also thanks to paired donation and blood group incompatible transplantation methods. The small bowel and multivisceral transplantation are rare procedures; they serve selected patients with short bowel syndrome, some patients with retroperitoneal tumors or with extensive visceral thrombosis. Solid organ transplants are well established treatment methods with good and proven outcomes. A majority of patients can return to a normal life after their transplants.

  10. Epigenomics in hematopoietic transplantation: novel treatment strategies.

    PubMed

    Engel, Nicole; Rank, Andreas

    2011-10-01

    Allogeneic hematopoietic stem cell transplantation is a high risk but curative treatment option for leukemia, myelodysplasia and other hematological malignancies. After high dose radio- or chemo-therapy, recipient's hematopoiesis is replaced by a new immunosystem and residual malignant cells are eliminated by the graft-versus-leukemia reaction. The benefit of this immunological effect is limited by the most frequent complication of hematopoietic stem cell transplantation: graft-versus-host disease. In addition to their well-known anti-tumor activity, epigenetic drugs mediate immunotolerance without reducing alloreactivity or even enhance graft-versus-leukemia effect without inducing graft-versus-host disease by regulating cytokine release, increasing the circulating number of regulatory T cells and interacting with natural killer cells. We focus on the use of epigenetic drugs in the allogeneic transplantation setting in relation to their anti-tumor and immunomodulatory potential.

  11. Current status of pediatric renal transplant pathology.

    PubMed

    Becker, Jan U

    2017-03-01

    Histopathology is still an indispensable tool for the diagnosis of kidney transplant dysfunction in adult and pediatric patients. This review presents consolidated knowledge, recent developments and future prospects on the biopsy procedure, the diagnostic work-up, classification schemes, the histopathology of rejection, including antibody-mediated forms, ABO-incompatible transplants, protocol biopsies, recurrent and de novo disease, post-transplant lymphoproliferative disorder, infectious complications and drug-induced toxicity. It is acknowledged that frequently the correct diagnosis can only be reached in consensus with clinical, serological, immunogenetical, bacteriological and virological findings. This review shall enhance the understanding of the pediatric nephrologist for the thought processes of nephropathologists with the aim to facilitate teamwork between these specialist groups for the benefit of the patient.

  12. Cell sheet transplantation for heart tissue repair.

    PubMed

    Matsuura, Katsuhisa; Haraguchi, Yuji; Shimizu, Tatsuya; Okano, Teruo

    2013-08-10

    Cell transplantation is attracting considerable attention as the next-generation therapy for treatment of cardiovascular diseases. We have developed cell sheet engineering as a type of scaffold-less tissue engineering for application in myocardial tissue engineering and the repair of injured heart tissue by cell transplantation. Various types of cell sheet transplantation have improved cardiac function in animal models and clinical settings. Furthermore, cell-based tissue engineering with human induced pluripotent stem cell technology is about to create thick vascularized cardiac tissue for cardiac grafts and heart tissue models. In this review, we summarize the current cardiac cell therapies for treating heart failure with cell sheet technology and cell sheet-based tissue engineering.

  13. Mechanism of tacrolimus-induced chronic renal fibrosis following transplantation is regulated by ox-LDL and its receptor, LOX-1

    PubMed Central

    Deng, Shi; Jin, Tao; Zhang, Li; Bu, Hong; Zhang, Peng

    2016-01-01

    Chronic renal allograft dysfunction (CRAD) is the most common cause of graft failure following renal transplantation. However, the underlying mechanisms remain to be fully elucidated. Immunosuppressants and hyperlipidemia are associated with renal fibrosis following long-term use. The present study aimed to determine the effects of tacrolimus (FK506) and lipid metabolism disorder on CRAD. In vitro and in vivo models were used for this investigation. Cells of the mouse proximal renal tubular epithelial cell strain, NRK-52E, were cultured either with oxidized low-density lipoprotein (ox-LDL), FK506, ox-LDL combined with FK506, or vehicle, respectively. Changes in cell morphology and changes in the levels of lectin-like ox-LDL receptor-1 (LOX-1), reactive oxygen species (ROS), hydrogen peroxide and fibrosis-associated genes were evaluated at 24, 48 and 72 h. In separate experiment, total of 60 Sprague-Dawley rats were divided randomly into four groups, which included a high-fat group, FK506 group, high-fat combined with FK506 group, and control group. After 2, 4 and 8 weeks, the serum lipid levels, the levels of ox-LDL, ROS, and the expression levels of transforming growth factor (TGF)-β1 and connective tissue growth factor were determined. The in vitro and in vivo models revealed that lipid metabolism disorder and FK506 caused oxidative stress and a fibrogenic response. In addition, decreased levels of LOX-1 markedly reduced the levels of TGF-β1 in the in vitro model. Taken together, FK506 and dyslipidemia were found to be associated with CRAD following transplantation. PMID:27633115

  14. Microbiota Disruption Induced by Early Use of Broad-Spectrum Antibiotics Is an Independent Risk Factor of Outcome after Allogeneic Stem Cell Transplantation.

    PubMed

    Weber, Daniela; Jenq, Robert R; Peled, Jonathan U; Taur, Ying; Hiergeist, Andreas; Koestler, Josef; Dettmer, Katja; Weber, Markus; Wolff, Daniel; Hahn, Joachim; Pamer, Eric G; Herr, Wolfgang; Gessner, André; Oefner, Peter J; van den Brink, Marcel R M; Holler, Ernst

    2017-02-14

    In allogeneic stem cell transplantation (ASCT), systemic broad-spectrum antibiotics are frequently used for treatment of infectious complications, but their effect on microbiota composition is still poorly understood. This retrospective analysis of 621 patients who underwent ASCT at the University Medical Center of Regensburg and Memorial Sloan Kettering Cancer Center in New York assessed the impact of timing of peritransplant antibiotic treatment on intestinal microbiota composition as well as transplant-related mortality (TRM) and overall survival. Early exposure to antibiotics was associated with lower urinary 3-indoxyl sulfate levels (P < .001) and a decrease in fecal abundance of commensal Clostridiales (P = .03) compared with late antibiotic treatment, which was particularly significant (P = .005) for Clostridium cluster XIVa in the Regensburg group. Earlier antibiotic treatment before ASCT was further associated with a higher TRM (34%, 79/236) compared with post-ASCT (21%, 62/297, P = .001) or no antibiotics (7%, 6/88, P < .001). Timing of antibiotic treatment was the dominant independent risk factor for TRM (HR, 2.0; P ≤ .001) in multivariate analysis besides increase age (HR, 2.15; P = .004), reduced Karnofsky performance status (HR, 1.47; P = .03), and female donor-male recipient sex combination (HR, 1.56; P = .02) A competing risk analysis revealed the independent effect of early initiation of antibiotics on graft-versus-host disease-related TRM (P = .004) in contrast to infection-related TRM and relapse (not significant). The poor outcome associated with early administration of antibiotic therapy that is active against commensal organisms, and specifically the possibly protective Clostridiales, calls for the use of Clostridiales-sparing antibiotics and rapid restoration of microbiota diversity after cessation of antibiotic treatment.

  15. Patient selection for liver transplantation.

    PubMed

    Carrion, Andres F; Aye, Lydia; Martin, Paul

    2013-08-01

    Improved outcomes in liver transplant recipients reflect advances in surgical technique, post-operative care, immunosuppression as well as better selection of potential candidates. The pre-transplant evaluation is a multidisciplinary process intended to recognize and treat important comorbid conditions that may impair outcomes during the peri- and post-transplant periods. Important psychosocial issues should also be ascertained and tackled early during the pre-transplant evaluation with an overarching intention to improve the success of liver transplantation.

  16. [Infections after organ transplantation].

    PubMed

    Kern, W V; Wagner, D; Hirsch, H H

    2005-06-01

    Early postoperative infections after transplantation vary according to the transplanted organ. During the subsequent course opportunistic infections such as cytomegalovirus reactivation, Pneumocystis jiroveci pneumonia, invasive pneumococcal infection and mould infections predominate. Reactivated tuberculous infection appears to become more prevalent. Some of the opportunistic infections are preventable by chemoprophylaxis; others can be managed very effectively by monitoring and early preemptive therapy. Physicians caring for patients after organ transplantation need to early consider in the differential diagnosis rare pathogens which are often overlooked with standard diagnostic procedures.

  17. [Chronic transplant nephropathy].

    PubMed

    Campistol Plana, J M

    2008-01-01

    In 2007 there were important scientific contributions in the field of kidney transplant and specifically in chronic transplant nephropathy (interstitial fibrosis and tubular atrophy). A new nomenclature and classification of chronic kidney disease was probably the most important contribution in this entity. Use of the C4d stain has allowed the concepts of glomerulopathy to be updated and to reveal the frequency of this entity and its impact in kidney transplant. Finally, two experimental studies provide new perspectives on the treatment of chronic kidney disease such as the use of statins or the use of pyridoxamine to block glycation end products.

  18. Islet transplantation: immunological perspectives.

    PubMed

    Inverardi, Luca; Kenyon, Norma S; Ricordi, Camillo

    2003-10-01

    Clinical trials of islet transplantation are showing remarkable success, but they require administration of chronic immunosuppression, and are underscoring the large gap that exists between the number of human donors available and the number of patients that could benefit from the procedure. Recent progress has been made in the definition of key immunological mechanisms that are involved in determining islet transplant outcome. Clinical and preclinical studies, and studies in small animal model systems, will all eventually contribute to the definition of efficient and safe protocols for islet transplantation. If the use of xenografts is successful, it might represent a solution to the shortage of human organs.

  19. Cytomegalovirus Immunoglobulin After Thoracic Transplantation: An Overview.

    PubMed

    Grossi, Paolo; Mohacsi, Paul; Szabolcs, Zoltán; Potena, Luciano

    2016-03-01

    Cytomegalovirus (CMV) is a highly complex pathogen which, despite modern prophylactic regimens, continues to affect a high proportion of thoracic organ transplant recipients. The symptomatic manifestations of CMV infection are compounded by adverse indirect effects induced by the multiple immunomodulatory actions of CMV. These include a higher risk of acute rejection, cardiac allograft vasculopathy after heart transplantation, and potentially bronchiolitis obliterans syndrome in lung transplant recipients, with a greater propensity for opportunistic secondary infections. Prophylaxis for CMV using antiviral agents (typically oral valganciclovir or intravenous ganciclovir) is now almost universal, at least in high-risk transplants (D+/R-). Even with extended prophylactic regimens, however, challenges remain. The CMV events can still occur despite antiviral prophylaxis, including late-onset infection or recurrent disease, and patients with ganciclovir-resistant CMV infection or who are intolerant to antiviral therapy require alternative strategies. The CMV immunoglobulin (CMVIG) and antiviral agents have complementary modes of action. High-titer CMVIG preparations provide passive CMV-specific immunity but also exert complex immunomodulatory properties which augment the antiviral effect of antiviral agents and offer the potential to suppress the indirect effects of CMV infection. This supplement discusses the available data concerning the immunological and clinical effects of CMVIG after heart or lung transplantation.

  20. Syngeneic Transplants with Modified Chimeric Hematopoietic Tumors.

    PubMed

    Hemann, Michael

    2015-08-03

    This protocol describes strategies to rapidly transduce tumor cells ex vivo and then transplant modified cells into immunocompetent-recipient mice. Inherent in the definition of a bona fide murine hematopoietic malignancy, unlike a myelo- or lympho-proliferative disease, is the ability to transplant tumors and give rise to a malignancy in recipient animals. This characteristic of hematopoietic disease makes these tumors a tractable model for examining the role of specific genes in tumor growth, dissemination, or therapeutic response. Additionally, because of the systemic nature of hematopoietic malignancies, transplanted tumors are frequently pathologically indistinguishable from donor malignancies-allowing one to perform decisive therapy studies on large cohorts of transplant recipients. Finally, following ex vivo manipulation, transplanted tumors can be made chimeric for the presence of defined retrovirally induced alterations. Thus, these malignancies can be made to resemble genetically heterogeneous human tumors that are in the process of acquiring new capabilities. In these experiments, fluorescent markers serve as a surrogate marker for the expression of a defined alteration, and the change in the percentage of fluorescent cells in a tumor population over time or in response to therapy can be used to gauge the impact of specific alterations on tumor behavior.

  1. Long-term genotoxic effects of immunosuppressive drugs on lymphocytes of kidney transplant recipients.

    PubMed

    Lizotti Cilião, Heloísa; Batista de Oliveira Camargo-Godoy, Rossana; Mazzaron Barcelos, Gustavo Rafael; Zanuto, Amanda; Daher Alvares Delfino, Vinicius; de Syllos Cólus, Ilce Mara

    2016-08-01

    Immunosuppressive therapy can prevent rejection after organ transplantation. However, increased cancer risk is a serious complication among patients undergoing such therapy. We have evaluated whether prolonged use of immunosuppressive drugs is genotoxic. DNA instability was assessed, using the comet and micronucleus assays, in blood lymphocytes of 76 kidney transplant patients. DNA damage detected by the comet assay increased with time after transplantation. The estimated glomerular filtration rate of the patients did not influence the incidence of DNA damage. No association between micronucleated mononucleated cells and time elapsed after transplantation was observed. Our results suggest that prolonged use of immunosuppressive drugs in kidney transplant patients can induce genetic instability.

  2. Kidney Transplantation: MedlinePlus Health Topic

    MedlinePlus

    ... Start Here Kidney Transplant (Mayo Foundation for Medical Education and Research) Kidney Transplant (National Kidney Foundation) Treatment Methods for Kidney Failure: Transplantation (National Institute of Diabetes ...

  3. Transplantable liver production plan

    PubMed Central

    Hata, Toshiyuki; Uemoto, Shinji; Kobayashi, Eiji

    2013-01-01

    Organ grafts developed in the xenogeneic pig scaffold are expected to resolve most issues of donor safety and ethical concerns about living-donor liver transplantation in Japan. We have been working on so-called “Yamaton” projects to develop transplantable organs using genetically engineered pigs. Our goal is to produce chimeric livers with human parenchyma in such pigs. The Yamaton-Liver project demonstrated the proof of concept by showing that rat–mouse chimeric livers could develop in mice and be successfully transplanted into syngeneic or allogeneic rats. Under conventional immunosuppression, the transplanted livers showed long-term function and protection against rejection. Because chimeric liver grafts have xenogeneic components, additional strategies, such as humanization of pig genes, induction of hematopoietic chimeras in donors, and replacement of pig endothelial cells with human ones, might be required in clinical use. Our projects still need to overcome various hurdles but can bring huge benefits to patients in the future. PMID:23896578

  4. Pancreas transplant - slideshow

    MedlinePlus

    ... this page: //medlineplus.gov/ency/presentations/100129.htm Pancreas transplant - series—Normal anatomy To use the sharing ... to slide 6 out of 6 Overview The pancreas resides in the back of the abdomen. It ...

  5. Experimental uterus transplantation.

    PubMed

    Johannesson, Liza; Enskog, Anders

    2014-11-01

    Today, most causes of infertility are successfully treated. Yet there is still a subgroup of female infertility affecting around 4%, which so far is untreatable because of an absolute uterine factor. To acquire motherhood, these women are today referred to either adoption or surrogacy. Research in the field of uterus transplantation has been evaluated in different animal models for decades and has presently reached a human clinical application as a possible treatment for absolute uterine factor infertility. Organ transplantation is no longer reserved to those with a life-threatening disease and neither is organ transplantation together with concurrent immunosuppression prohibiting pregnancy. Uterus transplantation involves four parties - recipient, donor, partner of recipient and future child - and is a subject of ethical controversies.

  6. Art, surgery and transplantation.

    PubMed

    Toledo-Pereyra, Luis H

    2009-01-01

    Roy Calne (1930-) has elegantly cultivated the science and art of transplantation. Throughout his medical and artistic career his eyes have remained fully open not only to science and scientific advances but to any new developments that would enhance his art of painting as applied to his patients, colleagues, events and surgical operations related to transplantation. Calne contributed to and developed a new field through art in the understanding of the lives of his patients, the working of his colleagues and the application of surgical principles to the specialty in which he labours, surgical transplantation. The application of "Art, Surgery and Transplantation" should in many ways be the fountain of information and support for those seeking this way of therapy.

  7. Textbooks, Transitions, and Transplants

    ERIC Educational Resources Information Center

    Callahan, Leroy G.; Passi, Sneh Lata

    1972-01-01

    Three popular textbooks were analyzed for level of cognitive processes used, and implications were drawn regarding supplementary activities if the English primary school model is to be transplanted" in America. (MM)

  8. After the Transplant: Medications

    MedlinePlus

    ... Risks Cancer Types Risk Factors Prevention & Early Detection Medications After transplants, the focus for patients transitions from ... a donor organ to learning how to manage medications and their side effects as part of daily ...

  9. Talking about Kidney Transplants.

    ERIC Educational Resources Information Center

    Solomon, Joan; Swift, Julia

    1990-01-01

    Described is a project in which information about the moral issues surrounding tissue transplants was obtained and videotaped for classroom use. Moral positions and possible educational strategies are discussed. Examples of student statements are presented. (CW)

  10. Liver transplant - slideshow

    MedlinePlus

    ... this page: //medlineplus.gov/ency/presentations/100090.htm Liver transplant - series—Normal anatomy To use the sharing ... to slide 5 out of 5 Overview The liver is in the right upper abdomen. The liver ...

  11. After the Transplant

    MedlinePlus

    ... Support Groups Patient Resources Newsroom Minorities AFTER THE TRANSPLANT Medications Staying Healthy Recovery Resources Lifestyle Changes Pregnancy Cancer PEDIATRIC Addressing Children's Needs Coping With Anxiety Helping Your Child Adjust Camps Resources LIVING DONATION ...

  12. Before the Transplant

    MedlinePlus

    ... Support Groups Patient Resources Newsroom Minorities AFTER THE TRANSPLANT Medications Staying Healthy Recovery Resources Lifestyle Changes Pregnancy Cancer PEDIATRIC Addressing Children's Needs Coping With Anxiety Helping Your Child Adjust Camps Resources LIVING DONATION ...

  13. Kidney transplant - slideshow

    MedlinePlus

    ... ency/presentations/100087.htm Kidney transplant - series—Normal anatomy To use the sharing features on this page, ... Bethesda, MD 20894 U.S. Department of Health and Human Services National Institutes of Health Page last updated: ...

  14. Heart transplant - slideshow

    MedlinePlus

    ... ency/presentations/100086.htm Heart transplant - series—Normal anatomy To use the sharing features on this page, ... Bethesda, MD 20894 U.S. Department of Health and Human Services National Institutes of Health Page last updated: ...

  15. Corneal transplant - slideshow

    MedlinePlus

    ... ency/presentations/100082.htm Corneal transplant - series—Normal anatomy To use the sharing features on this page, ... Bethesda, MD 20894 U.S. Department of Health and Human Services National Institutes of Health Page last updated: ...

  16. Pregnancy and kidney transplantation.

    PubMed

    Josephson, Michelle A; McKay, Dianne B

    2011-01-01

    Despite decades of experience with child bearing in women with kidney transplants, these pregnancies remain high risk with an increased prevalence of hypertension and pre-eclampsia. Infertility, common in women with end-stage renal disease, is rapidly restored after transplant although pregnancy rates appear lower in transplant recipients than the general public. Many unanswered questions exist, some old questions such as what is the optimal timing of pregnancy after transplant, whether breast feeding is safe, the long-term impact if any on the offspring, and whether pregnancy negatively affects the kidney graft; and some new questions such as whether to modify immunosuppression in a patient taking a mycophenolic acid-containing drug, whether kidney donation has a deleterious impact on future pregnancies, whether to use erythropoietin-stimulating agents, and the role of BK virus. Counseling about contraception and pregnancy after transplant should be initiated during the pretransplant evaluation process. It is important because of the rapid restoration of fertility that occurs after transplant as well as the many risks and unanswered questions that remain.

  17. Frailty and Transplantation.

    PubMed

    Exterkate, Leonie; Slegtenhorst, Bendix R; Kelm, Matthias; Seyda, Midas; Schuitenmaker, Jeroen M; Quante, Markus; Uehara, Hirofumi; El Khal, Abdala; Tullius, Stefan G

    2016-04-01

    Consequences of aging are gaining clinical relevance. In transplantation, aging and immunosenescence impact treatment and outcomes. The impact of aging, however, will critically depend on distinguishing healthy, chronological aging from biological aging that may result into frailty. Approximately 15% of individuals older than 65 years are frail, and it is expected that this condition will gain more clinical relevance with an expected increase to greater than 20% over the next 5 years. Clearly, frailty impacts various general aspects of health care and organ transplantation in particular including patient selection, waitlist management and treatment after transplantation. In general, frailty has been characterized by a compromised physiological reserve and an augmented vulnerability. In comparison to healthy aging, inflammatory markers and cytokines are increased in frail older adults. Thus, modifications of the immune response, in addition to physical limitations and changes of metabolism, are likely to impact outcomes after transplantation. Here, we provide a risk assessment of frailty at the time of transplant evaluation and review effects on outcomes and recovery after transplantation. Moreover, we summarize our current understanding of the pathophysiology of frailty and consequences on immune responses and metabolism.

  18. Umbilical cord blood transplantation.

    PubMed

    Koo, Hong Hoe; Ahn, Hyo Seop

    2012-07-01

    Since the first umbilical cord blood transplantation (CBT) in 1998, cord blood (CB) has now become one of the most commonly used sources of hematopoietic stem cells for transplantation. CBT has advantages of easy procurement, no risk to donor, low risk of transmitting infections, immediate availability and immune tolerance allowing successful transplantation despite human leukocyte antigen disparity. Several studies have shown that the number of cells transplanted is the most important factor for engraftment in CBT, and it limits the wide use of CB in adult patients. New strategies for facilitating engraftment and reducing transplantation-related mortality are ongoing in the field of CBT and include the use of a reduced-intensity conditioning regimen, double-unit CBT, ex vivo expansion of CB, and co-transplantation of CB and mesenchymal stem cells. Recently, the results of two international studies with large sample sizes showed that CB is an acceptable alternative source of hematopoietic stem cells for adult recipients who lack human leukocyte antigen-matched adult donors. Along with the intensive researches, development in banking process of CB will amplify the use of CB and offer the chance for cure in more patients.

  19. Liver-Regenerative Transplantation: Regrow and Reset

    PubMed Central

    de l’Hortet, A. Collin; Takeishi, K.; Guzman-Lepe, J.; Handa, K.; Matsubara, K.; Fukumitsu, K.; Dorko, K.; Presnell, S. C.; Yagi, H.; Soto-Gutierrez, A.

    2016-01-01

    Liver transplantation, either a partial liver from a living or deceased donor or a whole liver from a deceased donor, is the only curative therapy for severe end-stage liver disease. Only one-third of those on the liver transplant waiting list will be transplanted, and the demand for livers is projected to increase 23% in the next 20 years. Consequently, organ availability is an absolute constraint on the number of liver transplants that can be performed. Regenerative therapies aim to enhance liver tissue repair and regeneration by any means available (cell repopulation, tissue engineering, biomaterials, proteins, small molecules, and genes). Recent experimental work suggests that liver repopulation and engineered liver tissue are best suited to the task if an unlimited availability of functional induced pluripotent stem (iPS)–derived liver cells can be achieved. The derivation of iPS cells by reprogramming cell fate has opened up new lines of investigation, for instance, the generation of iPS-derived xenogeneic organs or the possibility of simply inducing the liver to reprogram its own hepatocyte function after injury. We reviewed current knowledge about liver repopulation, generation of engineered livers and reprogramming of liver function. We also discussed the numerous barriers that have to be overcome for clinical implementation. PMID:26699680

  20. Tregs and kidney: From diabetic nephropathy to renal transplantation

    PubMed Central

    Dousdampanis, Periklis; Trigka, Kostantina; Mouzaki, Athanasia

    2016-01-01

    Kidney transplantation is recognised as the most effective treatment for patients with end-stage renal disease (ESRD). Kidney transplantation continues to face several challenges including long-term graft and patient survival, and the side effects of immunosuppressive therapy. The tendency in kidney transplantation is to avoid the side effects of immunosuppresants and induce immune tolerance. Regulatory T-cells (Tregs) contribute to self-tolerance, tolerance to alloantigen and transplant tolerance, mainly by suppressing the activation and function of reactive effector T-cells. Additionally, Tregs are implicated in the pathogenesis of diabetes, which is the leading cause of ESRD, suggesting that these cells play a role both in the pathogenesis of chronic kidney disease and the induction of transplant tolerance. Several strategies to achieve immunological tolerance to grafts have been tested experimentally, and include combinations of co-stimulatory blockade pathways, T-cell depletion, in vivo Treg-induction and/or infusion of ex-vivo expanded Tregs. However, a successful regimen that induces transplant tolerance is not yet available for clinical application. This review brings together certain key studies on the role of Tregs in ESRD, diabetes and kidney transplantation, only to emphasize that many more studies are needed to elucidate the clinical significance and the therapeutic applications of Tregs. PMID:27683634

  1. Brown adipose tissue transplantation ameliorates polycystic ovary syndrome

    PubMed Central

    Yuan, Xiaoxue; Hu, Tao; Zhao, Han; Huang, Yuanyuan; Ye, Rongcai; Lin, Jun; Zhang, Chuanhai; Zhang, Hanlin; Wei, Gang; Zhou, Huiqiao; Dong, Meng; Zhao, Jun; Wang, Haibin; Liu, Qingsong; Lee, Hyuek Jong; Jin, Wanzhu; Chen, Zi-Jiang

    2016-01-01

    Polycystic ovary syndrome (PCOS), which is characterized by anovulation, hyperandrogenism, and polycystic ovaries, is a complex endocrinopathy. Because the cause of PCOS at the molecular level is largely unknown, there is no cure or specific treatment for PCOS. Here, we show that transplantation of brown adipose tissue (BAT) reversed anovulation, hyperandrogenism, and polycystic ovaries in a dehydroepiandrosterone (DHEA)-induced PCOS rat. BAT transplantation into a PCOS rat significantly stabilized menstrual irregularity and improved systemic insulin sensitivity up to a normal level, which was not shown in a sham-operated or muscle-transplanted PCOS rat. Moreover, BAT transplantation, not sham operation or muscle transplantation, surprisingly improved fertility in PCOS rats. Interestingly, BAT transplantation activated endogenous BAT and thereby increased the circulating level of adiponectin, which plays a prominent role in whole-body energy metabolism and ovarian physiology. Consistent with BAT transplantation, administration of adiponectin protein dramatically rescued DHEA-induced PCOS phenotypes. These results highlight that endogenous BAT activity is closely related to the development of PCOS phenotypes and that BAT activation might be a promising therapeutic option for the treatment of PCOS. PMID:26903641

  2. Inhibitory effect of green tea extract on the process of pancreatic carcinogenesis induced by N-nitrosobis-(2-oxypropyl)amine (BOP) and on tumor promotion after transplantation of N-nitrosobis-(2-hydroxypropyl)amine (BHP)-induced pancreatic cancer in Syrian hamsters.

    PubMed

    Hiura, A; Tsutsumi, M; Satake, K

    1997-10-01

    Epidemiologic studies have shown a lower risk of gastrointestinal cancer in green tea drinkers. In the present study, the inhibitory effect of green tea extract (GTE) on the process of pancreatic carcinogenesis induced by N-nitrosobis-(2-oxypropyl)amine (BOP) and on tumor promotion after transplantation of N-nitrosobis-(2-hydroxypropyl)amine (BHP)-induced pancreatic cancer were investigated in hamsters. In the first experiment, shortly after the initiation of pancreatic carcinogenesis by BOP, the animals in the GTE group were given GTE (0.5 mg/L) in their drinking water and the control group was given tap water. All animals were sacrificed 24 weeks later. There were no significant differences in body weight, water intake, or food consumption between the two groups during the experiments. GTE consumption was approximately 1.25 mg/day/100 g body weight during this experiment. Seven of the 13 hamsters (54%) in the control group were found to have pancreatic tumors, versus six of the 18 hamsters (33%) in the GTE group. The average number of tumors in the control group was 1.0/hamster, compared with 0.5/hamster in the GTE group. The overall incidence of macroscopic pancreatic tumors in the GTE group was about half that in the control group. The incidence of pancreatic cancer was 54% (12/13) in the control group and 44% (8/18) in the GTE group. The number of pancreatic cancers, including invasive carcinoma and carcinoma in situ, in the GTE group was 0.88/hamster, significantly lower than in the control group (1.68/hamster) (p < 0.05). The incidence of atypical ductal hyperplasia, which is thought to be an early pancreatic cancer, was also significantly lower in the GTE group than in the control group (1.50/hamster vs. 4.65/hamster) (p < 0.05). In the second experiment, 1-mm3 pieces of BHP-induced pancreatic cancer were transplanted into the back of hamsters. The control group (N = 16) was maintained on the basal diet and tap water throughout the experiment, and the GTE

  3. A case of accelerated acute rejection after ABO-compatible living unrelated kidney transplantation.

    PubMed

    Matsuo, Nanae; Yamamoto, Hiroyasu; Kobayashi, Akimitsu; Yamamoto, Izumi; Mitome, Jun; Maruyama, Yukio; Hayakawa, Hiroshi; Miyazaki, Yoichi; Utsunomiya, Yasunori; Hosoya, Tatsuo; Yamaguchi, Yutaka

    2009-08-01

    A 59-yr-old Japanese woman with chronic renal failure caused by IgA nephropathy and antineutrophil cytoplasmic antibody (ANCA)-related glomerulonephritis underwent kidney transplantation from a living unrelated spousal donor. The blood type was compatible, while the human leukocyte antigen (HLA) typing showed a 5/6 locus mismatch. She had become pregnant twice by her donor and had never received blood transfusions. Complement-dependent cytotoxicity cross-match, flow cytometry cross-match (FCXM), and flow panel reactive antibody (PRA) were negative. She initially underwent one week of immunosuppression with mycophenolate mofetil (MMF) and double filtration plasmapheresis (DFPP) immediately before transplantation to reduce the risk of antibody-mediated rejection. Induction therapy consisted of MMF, tacrolimus (TAC), methylprednisolone (MP), and basiliximab. The allograft function was excellent immediately after the operation. However, the urine output and platelet count declined rapidly on post-operative day (POD) 3, while the serum creatinine (sCr) and lactate dehydrogenase levels rose gradually. Subsequently, we could not detect the diastolic arterial flow on Doppler sonography. We diagnosed accelerated acute rejection and treated her with plasma exchange (PEX), intravenous MP pulse therapy, and rituximab. The first episode biopsy on POD 7 revealed acute vascular rejection and acute antibody-mediated rejection (Banff score AMR II). Her urinary excretion increased beginning on POD 13, while the sCr level decreased gradually and reached 0.9 mg/dL on POD 22. In our retrospective analysis, the LAB screen detected donor-specific antibody (DSA). This case suggested that, for successful kidney transplantation in highly sensitized recipients, such as husband-to-wife spousal kidney transplantation with a history of pregnancy, we should keep the risk of AMR in mind, even if the sensitive antibody detection tests are negative.

  4. Renal transplantation in infants.

    PubMed Central

    Najarian, J S; Frey, D J; Matas, A J; Gillingham, K J; So, S S; Cook, M; Chavers, B; Mauer, S M; Nevins, T E

    1990-01-01

    The timing of renal transplantation in infants is controversial. Between 1965 and 1989, 79 transplants in 75 infants less than 2 years old were performed: 23 who were 12 months or younger, 52 who were older than 12 months; 63 donors were living related, 1 was living unrelated, and 15 were cadaver donors; 75 were primary transplants and 4 were retransplants. Infants were considered for transplantation when they were on, or about to begin, dialysis. All had intra-abdominal transplants with arterial anastomosis to the distal aorta. Sixty-four per cent are alive with functioning grafts. The most frequent etiologies of renal failure were hypoplasia (32%) and obstructive uropathy (20%); oxalosis was the etiology in 11%. Since 1983 patient survival has been 95% and 91% at 1 and 5 years; graft survival has been 86% and 73% at 1 and 5 years. For cyclosporine immunosuppressed patients, patient survival is 100% at 1 and 5 years; graft survival is 96% and 82% at 1 and 5 years. There was no difference in outcome between infants who were 12 months or younger versus those who were aged 12 to 24 months; similarly there was no difference between infants and older children. Sixteen (21%) patients died: 5 after operation from coagulopathy (1) and infection (4); and 11 late from postsplenectomy sepsis (4), recurrent oxalosis (3), infection (2), and other causes (2). Routine splenectomy is no longer done. There has not been a death from infection in patients transplanted since 1983. Rejection was the most common cause of graft loss (in 15 patients); other causes included death (with function) (7), recurrent oxalosis (3), and technical complications (3). Overall 52% of patients have not had a rejection episode; mean creatinine level in patients with functioning grafts is 0.8 +/- 0.2 mg/dL. Common postoperative problems include fever, atelectasis, and ileus. At the time of their transplants, the infants were small for age; but with a successful transplant, their growth, head

  5. Lenalidomide consolidation and maintenance therapy after autologous stem cell transplant for multiple myeloma induces persistent changes in T-cell homeostasis.

    PubMed

    Clave, Emmanuel; Douay, Corinne; Coman, Tereza; Busson, Marc; Bompoint, Caroline; Moins-Teisserenc, Helene; Glauzy, Salomé; Carmagnat, Maryvonnick; Gorin, Norbert Claude; Toubert, Antoine; Garderet, Laurent

    2014-08-01

    Whether the efficacy of lenalidomide in the treatment of multiple myeloma (MM) is due to direct tumor toxicity only or to additional immunomodulatory effects is unclear. We studied the effect of lenalidomide treatment on T-cell immune reconstitution in patients with MM who had undergone autologous peripheral blood stem cell transplant (ASCT). Twenty-nine newly diagnosed patients with MM received induction therapy followed by high-dose melphalan and ASCT. After ASCT, 11 patients received lenalidomide consolidation therapy for 2 months followed by maintenance therapy until disease progression. The remaining 18 patients received no treatment. Serial analysis of thymic output, as given by numbers of T-cell receptor excision circles (sjTRECs), and T-cell phenotyping was performed until 18 months post-ASCT. Lenalidomide impaired long-term thymic T-cell reconstitution, decreased CD4 + and CD8 + CD45RA + CCR7 - effector-terminal T-cell absolute counts and increased CD4 + CD25 + CD127 - /low regulatory T-cells. Lenalidomide consolidation and long-term maintenance therapy, administered post-ASCT, may have a potentially negative impact on immune surveillance.

  6. Efficacy of cryotherapy associated with laser therapy for decreasing severity of melphalan-induced oral mucositis during hematological stem-cell transplantation: a prospective clinical study.

    PubMed

    de Paula Eduardo, Fernanda; Bezinelli, Leticia Mello; da Graça Lopes, Roberta Marques; Nascimento Sobrinho, Jairo Jose; Hamerschlak, Nelson; Correa, Luciana

    2015-09-01

    Melphalan followed by hematopoietic stem-cell transplantation (HSCT) is the standard treatment for multiple myeloma and other hematopoietic neoplasms. However, high doses of melphalan cause severe oral mucositis (OM). The objective was to verify the efficacy of cryotherapy plus laser therapy on reduction of OM severity. HSCT patients undergoing melphalan chemotherapy (n = 71) were randomly divided into two groups according to OM treatment: oral cryotherapy performed with ice chips for 1 h 35 min followed by low-level laser therapy (InGaAIP, 660 nm, 40 mW, 6 J/cm(2) ) (n = 54) and laser therapy alone with the same protocol (n = 17). A control group (n = 33) was composed of HSCT patients treated with melphalan who received no specific treatment for OM. OM scores and clinical information were collected from D0 to D + 11. The cryotherapy/laser therapy group showed the lowest OM scores (maximum Grade I) and the lowest mean number of days (8 days) with OM in comparison with the other groups (p < 0.001). OM Grades III and IV were present with high frequency only in the control group. The association of cryotherapy with laser therapy was effective in reducing OM severity in HSCT patients who underwent melphalan conditioning.

  7. Perforation of the Right Ventricle Induced by Pulmonary Artery Catheter at Induction of Anesthesia for the Surgery for Liver Transplantation: A Case Report and Reviewed of Literature

    PubMed Central

    Auxiliadora-Martins, Maria; Apinagés dos Santos, Erick; Adans Wenzinger, Daniel; Alkmim-Teixeira, Gil Cezar; Neto, Gerardo Cristino de M.; Sankarankutty, Ajith Kumar; de Castro e Silva, Orlando; Martins-Filho, Olindo Assis; Basile-Filho, Anibal

    2009-01-01

    We report a case of a 45-year-old male patient diagnosed with liver cirrhosis by hepatitis C and alcohol, with a Child-Pugh score C and a model for end-stage liver disease (MELD) score of 27, and submitted to liver transplantation. The subject underwent insertion of the pulmonary artery catheter (PAC) in the right internal jugular vein, with technical difficulty concerning catheter advance. There was sudden hypotension, increase in central venous pressure (CVP), and decrease in SvO2 15 minutes after the PAC had been inserted, followed by cardiorespiratory arrest in pulseless electrical activity (PEA), which was promptly assisted with resuscitation. Pericardiocentesis was performed without success, so the individual was subjected to a subxiphoid pericardial window, which led to output of large amounts of blood as well as PEA reversal to sinus rhythm. Sternotomy was performed; rupture of the apex of the right ventricle (RV) was detected, and suture of the site was accomplished. After hemodynamic stabilization, the patient was transferred to the ICU, where he developed septic shock and, despite adequate therapy, died on the eighteenth day after ICU admission. PMID:20066172

  8. Transfusion problems associated with transplantation

    SciTech Connect

    Storb, R.; Weiden, P.L.

    1981-04-01

    Researchers have reviewed the role of blood transfusions in renal and marrow graft recipients. Striking contrasts are evident: while transfusions may promote successful kidney grafting, any transfusions before initiation of the transplant conditioning regimen may jeopardize the treatment of severe aplastic anemia by marrow transplantation. Researchers have suggested guidelines for the transfusion support of transplant candidates before transplantation and for marrow graft recipients after transplantation. It is important to recognize that after conditioning for marrow transplantation, all patients will be profoundly pancytopenic for a limited period of time, and intensive transfusion support is vital to patient survival.

  9. [Transplantation of corneal endothelial cells].

    PubMed

    Amano, Shiro

    2002-12-01

    Though conventional corneal transplantation has achieved great success, it still has several drawbacks including limited availability of donor corneas, recurrent allograft rejection, and subsequent graft failure in certain cases. Reconstructing clinically usable corneas by applying the technology of regenerative medicine can offer a solution to these problems, as well as making corneal transplantation a non-emergency surgery and enabling the usage of banked corneal cells. In the present study, we focused on corneal endothelium that is critical for corneal transparency and investigated the reconstruction of cornea utilizing cultured human corneal endothelial cells (HCECs). We succeeded in steadily culturing HCECs by using culture dishes pre-coated with extracellular matrix produced by calf corneal endothelial cells and culture media that contained basic fibroblast growth factor and fetal bovine serum. We performed the following analysis utilizing these cultured HCECs. The older the donor was, the more frequently large senescent cells appeared in the passaged HCECs. The telomeres of HCECs were measured as terminal restriction fragments (TRF) by Southern blotting. HCECs, in vivo from donors in their seventies had a long TRFs of over 12 kilobases. Passaging shortened the TRFs but there was no difference in TRFs among donors of various ages. These results indicated that shortening of telomere length is not related to senescence of HCECs. We investigated the role of advanced glycation end products (AGEs) in the senescence of in vivo HCECs. The results indicated that AGE-protein in the aqueous humor is endocytosed into HCECs via AGE receptors expressed on the surface of HCECs and damages HCECs by producing reactive oxygen species and inducing apoptosis, suggesting that AGEs, at least partly, cause the senescence of HECEs. HCECs were cultured using adult human serum instead of bovine serum to get rid of bovine material that can be infected with prions. Primary and passage

  10. European Transplant Registry of Senior Renal Transplant Recipients on Advagraf

    ClinicalTrials.gov

    2016-08-11

    Graft Failure; Death; Acute Rejection of Renal Transplant; Infections; Bone Disease; Post Transplant Diabetes Mellitus; Quality of Life; HLA Antibody Production; Cardiovascular Risk Factors; Non-HLA Antibody Production

  11. Twin pregnancy in a liver transplant recipient with HIV infection.

    PubMed

    Van Schalkwyk, McI; Westbrook, R H; O'Beirne, J; Wright, A; Gonzalez, A; Johnson, M A; Kinloch-de Loës, S

    2016-10-05

    We are not aware of a report detailing the complex obstetrical and medical management of twin pregnancy in the context of HIV infection and early post-liver transplantation period. Here we describe the successful outcome of a twin pregnancy in a 28-year-old HIV-positive female receiving antiretroviral therapy and immunosuppressive therapy who was the recipient of a liver transplant for previous drug-induced liver failure.

  12. Stem cell transplantation for autoimmune diseases.

    PubMed

    Gratwohl, A; Passweg, J; Gerber, I; Tyndall, A

    2001-12-01

    Much progress has been made in the field of haemopoietic stem cell transplants (HSCTs) for severe autoimmune disorders. Theoretical considerations, animal data and anecdotal evidence suggested some time ago that intensive immunoablation followed by autologous HSCT could restore normal immune reactivity in patients with severe autoimmune disorders. Based on a concept statement issued in 1995, two European societies, the European League Against Rheumatism (EULAR) and the European Group for Blood and Marrow Transplantation (EBMT) began collecting phase I/II trial data in an international collaborative network. Sufficient information from more than 350 patients allows a preliminary assessment with level three evidence. Autologous HSCTs can induce remissions in all disease categories tested so far. Remissions can be transient or durable. HSCTs are associated with significant morbidity and mortality. Treatment-related mortality (TRM) is near 10% at 1 year and is associated with the intensity of the conditioning and the stage of the disease at the time of transplant. Marked interdisease differences exist. There are few data available in haematological autoimmune diseases, more in systemic sclerosis (SSc), systemic lupus erythematosus (SLE), juvenile idiopathic arthritis (JIA) and multiple sclerosis (MS). Patient selection has been recognized as a crucial element from the phase I-II trials. Patients with advanced disease, severely compromised organ function or irreversible organ damage should not be considered as candidates for HSCT. Prospective randomized studies should now determine the value of HSCT compared to standard therapy. Such trials are ongoing for patients with systemic sclerosis (ASTIS trial--Autologous Stem Cell Transplantation International Scleroderma Trial) or are planned for patients with multiple sclerosis (ASTIMS trial--Autologous Stem Cell Transplantation International Multiple Sclerosis Trial) and rheumatoid arthritis (ASTIRA trial--Autologous Stem

  13. The role of donor age and gender in the success of human muscle precursor cell transplantation.

    PubMed

    Stölting, Meline N L; Hefermehl, Lukas J; Tremp, Mathias; Azzabi, Fahd; Sulser, Tullio; Eberli, Daniel

    2017-02-01

    Autologous cell transplantation for the treatment of muscle damage is envisioned to involve the application of muscle precursor cells (MPCs) isolated from adult skeletal muscle. At the onset of trauma, these cells are recruited to proliferate and rebuild injured muscle fibres. However, a variety of donor-specific cues may directly influence the yield and quality of cells isolated from a muscle biopsy. In this study, we isolated human MPCs and assessed the role of donor gender and age on the ability of these MPCs to form functional bioengineered muscle. We analysed the cell yield, growth and molecular expression in vitro, and the muscle tissue formation and contractility of the bioengineered muscle, from cells isolated from men and women in three different age groups: young (20-39 years), adult (40-59 years) and elderly (60-80 years). Our results suggest that human MPCs can be successfully isolated and grown from patients of all ages and both genders. However, young female donors provide fast-growing cells in vitro with an optimum contractile output in vivo and are therefore an ideal cell source for muscle reconstruction. Taken together, these findings describe the donor-related limitations of MPC transplantation and provide insights for a straightforward and unbiased clinical application of these cells for muscle reconstruction. Copyright © 2014 John Wiley & Sons, Ltd.

  14. The role of complement in antibody-mediated rejection in kidney transplantation.

    PubMed

    Stegall, Mark D; Chedid, Marcio F; Cornell, Lynn D

    2012-11-01

    Over the past decade, several studies have suggested that the complement system has an active role in both acute and chronic allograft rejection. These studies have been facilitated by improved techniques to detect antibody-mediated organ rejection, including immunohistological staining for C4d deposition in the allograft and solid-phase assays that identify donor-specific alloantibodies (DSAs) in the serum of transplant recipients. Studies with eculizumab, a humanized monoclonal antibody directed against complement component C5, have shown that activation of the terminal complement pathway is necessary for the development of acute antibody-mediated rejection in recipients of living-donor kidney allografts who have high levels of DSAs. The extent to which complement activation drives chronic antibody-mediated injury leading to organ rejection is less clear. In chronic antibody-mediated injury, early complement activation might facilitate chemotaxis of inflammatory cells into the allograft in a process that later becomes somewhat independent of DSA levels and complement factors. In this Review, we discuss the different roles that the complement system might have in antibody-mediated allograft rejection, with specific emphasis on renal transplantation.

  15. The Need for Inducing Tolerance in Vascularized Composite Allotransplantation

    PubMed Central

    Ravindra, Kadiyala V.; Xu, Hong; Bozulic, Larry D.; Song, David D.; Ildstad, Suzanne T.

    2012-01-01

    Successful hand and face transplantation in the last decade has firmly established the field of vascularized composite allotransplantation (VCA). The experience in VCA has thus far been very similar to solid organ transplantation in terms of the morbidity associated with long-term immunosuppression. The unique immunological features of VCA such as split tolerance and resistance to chronic rejection are being investigated. Simultaneously there has been laboratory work studying tolerogenic protocols in animal VCA models. In order to optimize VCA outcomes, translational studies are needed to develop less toxic immunosuppression and possibly achieve donor-specific tolerance. This article reviews the immunology, animal models, mixed chimerism & tolerance induction in VCA and the direction of future research to enable better understanding and wider application of VCA. PMID:23251216

  16. Fetal tissue transplantation: can it be morally insulated from abortion?

    PubMed

    Strong, C

    1991-06-01

    Ethical controversy over transplantation of human fetal tissue has arisen because the source of tissue is induced abortions. Opposition to such transplants has been based on various arguments, including the following: rightful informed consent cannot be obtained for use of fetal tissue from induced abortions, and fetal tissue transplantation might result in an increase in the number of abortions. These arguments were not accepted by the National Institutes of Health (NIH) Human Fetal Tissue Transplantation Research Panel. The majority opinion of the panel stated that abortion and fetal tissue use are entirely separate issues, and that tissue use is ethically acceptable because it can be morally insulated from the issue of abortion. In support of this view, panel members and others have replied to the arguments put forward by opponents of fetal tissue use. However, replies to the two arguments mentioned above have been unsatisfactory, and the shortcomings of those replies are identified herein. Examination of the arguments pro and con suggests that fetal tissue use cannot be completely insulated from the issue of abortion. Thus, in seeking an ethical justification for fetal tissue transplantation we must consider reasons other than those put forward by the NIH panel. In this paper it is argued that whatever wrong is involved in using fetal tissue from induced abortions must be balanced against the benefits for patients, and it is on this basis that fetal tissue transplantation can be ethically justified.

  17. Cardiac transplantation in children.

    PubMed

    Zuberbuhler, J R; Fricker, F J; Griffith, B P

    1989-05-01

    Heart transplantation is becoming an accepted treatment for children with irreversible and profoundly disabling cardiomyopathy. The risk is much higher when there is underlying congenital heart disease, and even moderately elevated pulmonary vascular resistance is a contraindication to orthotopic heart transplantation. Heterotopic or heart-lung transplantation may be considered in patients with elevated pulmonary vascular resistance. In a few centers, heart transplantation is being performed as an alternative to palliative surgical procedures in children with hypoplastic left heart syndrome. Chronic immune suppression is necessary in all patients postoperatively. Cyclosporine and prednisone are the mainstays of therapy, and azathioprine is often added to the regimen. ATG is used prophylactically in the immediate postoperative period and acute rejection episodes are treated with pulses of prednisone, ATG, or OKT3. Infection continues to be a major problem, and the chronic long-term effects of both rejection and the drugs used to treat it, especially cyclosporine, are also very important. Coronary artery disease and lymphoproliferative disease are causes of death, and hypertension and decreased renal function are present in almost all survivors. The shortage of donor hearts is becoming a progressively more important problem and may affect selection criteria in the future. On the positive side, most children can return to age-appropriate activities following transplantation and they seem to tolerate their chronic illness and its attendant repeated invasive procedures surprisingly well.

  18. Overview of marrow transplantation

    SciTech Connect

    Thomas, E.D.

    1985-12-01

    Bone marrow transplantation is now an accepted form of therapy for many hematologic disorders including aplastic anemia, genetically determined diseases and malignant diseases, particularly leukemia, and for rescue of patients given intensive chemoradiotherapy for malignant disease. The donor may be a healthy identical twin, a family member or even an unrelated person. Selection is made on the basis of human leukocyte antigen tissue typing. Intensive chemoradiotherapy is used to suppress patients' immune systems to facilitate engraftment and destroy diseased marrow. Transfusion of platelets, erythrocytes and granulocytes (or all of these), antibiotic coverage and protection from infection are necessary during the pancytopenic period. Survival rates vary considerably depending on a patient's disease, clinical state and age. Patients with aplastic anemia transplanted early in the course of their disease have a survival rate of approximately 80%. Patients with acute lymphoblastic leukemia are usually transplanted in a second or subsequent remission and have a survival rate of 25% to 40%. Patients with acute nonlymphoblastic leukemia in remission have survivals ranging from 45% to 70%. More than 200 patients in the chronic phase of chronic granulocytic leukemia have been transplanted with survival ranging from 50% to 70%. Complications of marrow transplantation include marrow graft rejection, graft-versus-host disease, immunologic insufficiency and the possibility of recurrence of the leukemia. 14 references.

  19. Marrow transplantation for leukemia

    SciTech Connect

    Thomas, E.D.

    1981-07-01

    Marrow transplantation for selected patients with leukemia, as for patients with severe combined immunologic deficiency or severe aplastic anemia, has now become an accepted clinical procedure. For patients with acute leukemia who have relapsed after achieving a remission of chemotherapy, marrow grafting from an identical twin or an HLA-identical sibling has now been demonstrated to produce median remissions as long as or longer than any reported for combination chemotherapy. In contrast to chemotherapy, marrow transplantation offers the possibility of cure for a small but significant fraction of these patients. Marrow transplantation for patients with ANL in first remission has now resulted in median survivals much longer than any reported with chemotherapy. Although it now appears that more than 50% of these patients can be cured with marrow transplantation, a much longer follow-up is indicated since some patients who achieve a complete remission with combination chemotherapy are now living for a long time, and some of these patients (less than 20%) may also be cured. Current intensive research with new modalities such as interferon, Acyclovir, Cyclosporin A, and monoclonal antibodies can reasonably be expected to improve the overall results of marrow transplantation.

  20. Face transplantation: Anesthetic challenges

    PubMed Central

    Dalal, Aparna

    2016-01-01

    Face transplantation is a complex vascular composite allotransplantation (VCA) surgery. It involves multiple types of tissue, such as bone, muscles, blood vessels, nerves to be transferred from the donor to the recipient as one unit. VCAs were added to the definition of organs covered by the Organ Procurement and Transplantation Network Final Rule and National Organ Transplant Act. Prior to harvest of the face from the donor, a tracheostomy is usually performed. The osteotomies and dissection of the midface bony skeleton may involve severe hemorrhagic blood loss often requiring transfusion of blood products. A silicon face mask created from the facial impression is used to reconstruct the face and preserve the donor’s dignity. The recipient airway management most commonly used is primary intubation of an existing tracheostoma with a flexometallic endotracheal tube. The recipient surgery usually averages to 19-20 h. Since the face is a very vascular organ, there is usually massive bleeding, both in the dissection phase as well as in the reperfusion phase. Prior to reperfusion, often, after one sided anastomosis of the graft, the contralateral side is allowed to bleed to get rid of the preservation solution and other additives. Intraoperative product replacement should be guided by laboratory values and point of care testing for coagulation and hemostasis. In face transplantation, bolus doses of pressors or pressor infusions have been used intraoperatively in several patients to manage hypotension. This article reviews the anesthetic considerations for management for face transplantation, and some of the perioperative challenges faced. PMID:28058213

  1. Ethics of fetal tissue transplantation.

    PubMed

    Sanders, L M; Giudice, L; Raffin, T A

    1993-09-01

    Now that the Clinton Administration has overturned the ban on federal funding for fetal tissue transplantation, old ethical issues renew their relevance and new ethical issues arise. Is fetal tissue transplantation necessary and beneficial? Are fetal rights violated by the use of fetal tissue in research? Is there a moral danger that the potential of fetal tissue donation will encourage elective abortions? Should pregnant women be allowed to designate specific fetal transplant recipients? What criteria should be used to select fetal tissue transplants? Whose consent should be required for the use of fetal tissue for transplantation? We review the current state of clinical research with fetal tissue transplantation, the legal history of fetal tissue research, the major arguments against the use of fetal tissue for transplantation, and the new postmoratorium ethical dilemmas. We include recommendations for guidelines to govern the medical treatment of fetal tissue in transplantation.

  2. Stem Cell Transplants (For Teens)

    MedlinePlus

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Stem Cell Transplants KidsHealth > For Teens > Stem Cell Transplants Print ... Does it Take to Recover? Coping What Are Stem Cells? As you probably remember from biology class, every ...

  3. About the Operation: Liver Transplant

    MedlinePlus

    ... Heart/Lung Kidney Pancreas Kidney/Pancreas Liver Intestine Liver Transplant There are two very different surgical approaches to liver transplantation: the orthotopic and the heterotopic approach, both ...

  4. Organ Procurement and Transplantation Network

    MedlinePlus

    ... Directors. View all news articles Organ Procurement & Transplantation Network U.S. Department of Health and Human Services Health ... Privacy Policy Questions? Contact Organ Procurement and Transplantation Network United Network for Organ Sharing Post Office Box ...

  5. Stem Cell Transplants (For Teens)

    MedlinePlus

    ... Loss Surgery? A Week of Healthy Breakfasts Shyness Stem Cell Transplants KidsHealth > For Teens > Stem Cell Transplants A ... Does it Take to Recover? Coping What Are Stem Cells? As you probably remember from biology class, every ...

  6. Donor selection in heart transplantation

    PubMed Central

    Emani, Sitaramesh; Sai-Sudhakar, Chittoor B.; Higgins, Robert S. D.; Whitson, Bryan A.

    2014-01-01

    There is increased scrutiny on the quality in health care with particular emphasis on institutional heart transplant survival outcomes. An important aspect of successful transplantation is appropriate donor selection. We review the current guidelines as well as areas of controversy in the selection of appropriate hearts as donor organs to ensure optimal outcomes. This decision is paramount to the success of a transplant program as well as recipient survival and graft function post-transplant. PMID:25132976

  7. Malignant tumours after renal transplantation.

    PubMed

    Fahlenkamp, D; Reinke, P; Kirchner, S; Schnorr, D; Lindeke, A; Loening, S A

    1996-10-01

    In 1243 patients after renal transplantation, 39 malignant tumours were detected in 37 patients. The average latency period between transplantation and tumour disease was 72 months. Tumours included 8 malignant lymphomas, 7 dermatomas and 24 visceral tumours. The patients who developed a tumour had received fewer blood transfusions before transplantation than a tumour-free control group of 60 patients with renal transplants. Rejection crises occurred in a significantly smaller number of tumour patients compared with the control group.

  8. Six end-stage renal disease patients benefited from first non-simultaneous single center 6-way kidney exchange transplantation in India

    PubMed Central

    Kute, Vivek B; Patel, Himanshu V; Varyani, Umesh T; Shah, Pankaj R; Modi, Pranjal R; Shah, Veena R; Rizvi, Sayyed J; Pal, Bipin C; Shah, Priya S; Wakhare, Pavan S; Ghodela, Vijay A; Shinde, Saiprasad G; Trivedi, Varsha B; Patel, Minaxi H; Trivedi, Hargovind L

    2016-01-01

    AIM To avoid desensitization protocols and ABO incompatible kidney transplantation (KT) due to high costs and increased risk of infections from intense immunosuppression. METHODS We present institutional ethical review board - approved study of single center 6-way kidney exchange transplantation. The participants comprised ABO incompatibility (n = 1); positive cross-match and/or presence of donor specific antibody (n = 5). The average time required from registration in kidney paired donation (KPD) registry to find suitable donors was 45 d and time required to perform transplants after legal permission was 2 mo. RESULTS Graft and patient survival were 100%, and 100%, respectively. One patient had biopsy-proven acute borderline T cell rejection (Banff update 2013, type 3). Mean serum creatinine was 0.8 mg/dL at 9 mo follow-up. The waiting time in KPD was short as compared to deceased donor KT. CONCLUSION We report first non-simultaneous, single center, 6-way kidney exchange transplantation from India. Our experience will encourage other centers in India to undertake this practice. PMID:27872835

  9. Renal transplantation in developing countries.

    PubMed

    Akoh, Jacob A

    2011-07-01

    Patients with established renal failure, living in developing countries, face many obstacles including lack of access to transplantation centers, quality and safety issues, and exploittation associated with transplant tourism. This review aims to determine the state and outcome of renal transplantation performed in developing countries and to recommend some solutions. The lack of suitable legislation and infrastructure has prevented growth of deceased donor programs; so, living donors have continued to be the major source of transplantable kidneys. Transplant tourism and commercial kidney transplants are associated with a high incidence of surgical complications, acute rejection and invasive infection, which cause major morbidity and mortality. Developing transplant services worldwide has many benefits - improving the results of transplantation as they would be performed legally, increasing the donor pool, making transplant tourism unnecessary and granting various governments the moral courage to fight unacceptable practices. A private-public partnership underpinned by transparency, public audit and accountability is a prerequisite for effective transplant services in the developing world. Finally, lack of dialysis facilities coupled with better outcomes in patients spending <6 months on dialysis prior to transplantation favor pre-emptive transplantation in developing countries.

  10. THEMES OF LIVER TRANSPLANTATION

    PubMed Central

    Starzl, Thomas E.; Fung, John J.

    2010-01-01

    Liver transplantation was the product of 5 interlocking themes. These began in 1958-59 with canine studies of then theoretical hepatotrophic molecules in portal venous blood (Theme I) and with the contemporaneous parallel development of liver and multivisceral transplant models (Theme II). Further Theme I investigations showed that insulin was the principal, although not the only, portal hepatotrophic factor. In addition to resolving long-standing controversies about the pathophysiology of portacaval shunt, the hepatotrophic studies blazed new trails in the regulation of liver size, function, and regeneration. They also targeted inborn metabolic errors (e.g. familial hyperlipoproteinemia) whose palliation by portal diversion presaged definitive correction with liver replacement. Clinical use of the Theme II transplant models depended on multiple drug immunosuppression (Theme III, Immunology), guided by an empirical algorithm of pattern recognition and therapeutic response. Successful liver replacement was first accomplished in 1967 with azathioprine, prednisone, and ALG. With this regimen, the world’s longest surviving liver recipient is now 40 years postoperative. Incremental improvements in survival outcome occurred (Theme IV) when azathioprine was replaced by cyclosporine (1979) which was replaced in turn by tacrolimus (1989). However, the biologic meaning of alloengraftment remained enigmatic until multilineage donor leukocyte microchimerism was discovered in 1992 in long surviving organ recipients. Seminal mechanisms were then identified (clonal exhaustion-deletion and immune ignorance) that linked organ engraftment and the acquired tolerance of bone marrow transplantation and eventually clarified the relationship of transplantation immunology to the immunology of infections, neoplasms, and autoimmune disorders. With this insight, better strategies of immunosuppression have evolved. As liver and other kinds of organ transplantation became accepted as

  11. A Combination of Human Embryonic Stem Cell-Derived Pancreatic Endoderm Transplant with LDHA-Repressing miRNA Can Attenuate High-Fat Diet Induced Type II Diabetes in Mice

    PubMed Central

    Chen, Yunya; Wang, Xiujie; Shao, Xinyu

    2015-01-01

    Type II diabetes mellitus (T2D) is a chronic metabolic disorder that results from defects in both insulin secretion and insulin action. The deficit and dysfunction of insulin secreting β-cell are signature symptom for T2D. Additionally, in pancreatic β-cell, a small group of genes which are abundantly expressed in most other tissues are highly selectively repressed. Lactate dehydrogenase A (LDHA) is one of such genes. Upregulation of LDHA is found in both human T2D and rodent T2D models. In this study, we identified a LDHA-suppressing microRNA (hsa-miR-590-3p) and used it together with human embryonic stem cell (hESC) derived pancreatic endoderm (PE) transplantation into a high-fat diet induced T2D mouse model. The procedure significantly improved glucose metabolism and other symptoms of T2D. Our findings support the potential T2D treatment using the combination of microRNA and hESC-differentiated PE cells. PMID:26770982

  12. (±)-Gossypol induces apoptosis and autophagy in head and neck carcinoma cell lines and inhibits the growth of transplanted salivary gland cancer cells in BALB/c mice.

    PubMed

    Benvenuto, Monica; Mattera, Rosanna; Masuelli, Laura; Taffera, Gloria; Andracchio, Orlando; Tresoldi, Ilaria; Lido, Paolo; Giganti, Maria Gabriella; Godos, Justyna; Modesti, Andrea; Bei, Roberto

    2017-05-01

    Racemic Gossypol [(±)-GOS], composed of both (-)-GOS and (+)-GOS, is a small BH3-mimetic polyphenol derived from cotton seeds. (±)-GOS has been employed and well tolerated by cancer patients. Head and neck carcinoma (HNC) represents one of the most fatal cancers worldwide, and a significant proportion of HNC expresses high levels of antiapoptotic Bcl-2 proteins. In this study, we demonstrate that (±)-GOS inhibits cell proliferation and induces apoptosis and autophagy of human pharynx, tongue, and salivary gland cancer cell lines and of mouse salivary gland cancer cells (SALTO). (±)-GOS was able to: (a) decrease the ErbB2 protein expression; (b) inhibit the phosphorylation of ERK1/2 and AKT; (c) stimulate p38 and JNK1/2 protein phosphorylation. (±)-GOS administration was safe in BALB/c mice and it reduced the growth of transplanted SALTO cells in vivo and prolonged mice median survival. Our results suggest the potential role of (±)-GOS as an antitumor agent in HNC patients.

  13. Depletion of autoreactive immunologic memory followed by autologous hematopoietic stem cell transplantation in patients with refractory SLE induces long-term remission through de novo generation of a juvenile and tolerant immune system.

    PubMed

    Alexander, Tobias; Thiel, Andreas; Rosen, Oliver; Massenkeil, Gero; Sattler, Arne; Kohler, Siegfried; Mei, Henrik; Radtke, Hartmut; Gromnica-Ihle, Erika; Burmester, Gerd-Rüdiger; Arnold, Renate; Radbruch, Andreas; Hiepe, Falk

    2009-01-01

    Clinical trials have indicated that immunoablation followed by autologous hematopoietic stem cell transplantation (ASCT) has the potential to induce clinical remission in patients with refractory systemic lupus erythematosus (SLE), but the mechanisms have remained unclear. We now report the results of a single-center prospective study of long-term immune reconstitution after ASCT in 7 patients with SLE. The clinical remissions observed in these patients are accompanied by the depletion of autoreactive immunologic memory, reflected by the disappearance of pathogenic anti-double-stranded DNA (dsDNA) antibodies and protective antibodies in serum and a fundamental resetting of the adaptive immune system. The latter comprises recurrence of CD31(+)CD45RA(+)CD4(+) T cells (recent thymic emigrants) with a doubling in absolute numbers compared with age-matched healthy controls at the 3-year follow-up (P = .016), the regeneration of thymic-derived FoxP3(+) regulatory T cells, and normalization of peripheral T-cell receptor (TCR) repertoire usage. Likewise, responders exhibited normalization of the previously disturbed B-cell homeostasis with numeric recovery of the naive B-cell compartment within 1 year after ASCT. These data are the first to demonstrate that both depletion of the autoreactive immunologic memory and a profound resetting of the adaptive immune system are required to reestablish self-tolerance in SLE.

  14. Decreased chronic cellular and antibody-mediated injury in the kidney following simultaneous liver-kidney transplantation.

    PubMed

    Taner, Timucin; Heimbach, Julie K; Rosen, Charles B; Nyberg, Scott L; Park, Walter D; Stegall, Mark D

    2016-04-01

    In simultaneous liver-kidney transplantation (SLK), the liver can protect the kidney from hyperacute rejection and may also decrease acute cellular rejection rates. Whether the liver protects against chronic injury is unknown. To answer this we studied renal allograft surveillance biopsies in 68 consecutive SLK recipients (14 with donor-specific alloantibodies at transplantation [DSA+], 54 with low or no DSA, [DSA-]). These were compared with biopsies of a matched cohort of kidney transplant alone (KTA) recipients (28 DSA+, 108 DSA-). Overall 5-year patient and graft survival was not different: 93.8% and 91.2% in SLK, and 91.9% and 77.1% in KTA. In DSA+ recipients, KTA had a significantly higher incidence of acute antibody-mediated rejection (46.4% vs. 7.1%) and chronic transplant glomerulopathy (53.6% vs. 0%). In DSA- recipients at 5 years, KTA had a significantly higher cumulative incidence of T cell-mediated rejection (clinical plus subclinical, 30.6% vs. 7.4%). By 5 years, DSA+ KTA had a 44% decline in mean GFR while DSA+SLK had stable GFR. In DSA- KTA, the incidence of a combined endpoint of renal allograft loss or over a 50% decline in GFR was significantly higher (20.4% vs. 7.4%). Simultaneously transplanted liver allograft was the most predictive factor for a significantly lower incidence of cellular (odds ratio 0.13, 95% confidence interval 0.06-0.27) and antibody-mediated injury (odds ratio 0.11, confidence interval 0.03-0.32), as well as graft functional decline (odds ratio 0.22, confidence interval 0.06-0.59). Thus, SLK is associated with reduced chronic cellular and antibody-mediated alloimmune injury in the kidney allograft.

  15. Obesity and liver transplantation

    PubMed Central

    Ayloo, Subhashini; Armstrong, John; Hurton, Scott; Molinari, Michele

    2015-01-01

    The percentage of overweight and obese patients (OPs) waiting for a liver transplant continues to increase. Despite the significant advances occurred in bariatric medicine, obesity is still considered a relative contraindication to liver transplantation (LT). The main aim of this review is to appraise the literature on the outcomes of OPs undergoing LT, treatments that might reduce their weight before, during or after surgery, and discuss some of the controversies and limitations of the current knowledge with the intent of highlighting areas where future research is needed. PMID:26421262

  16. Neuropilin-1 in Transplantation Tolerance

    PubMed Central

    Campos-Mora, Mauricio; Morales, Rodrigo A.; Gajardo, Tania; Catalán, Diego; Pino-Lagos, Karina

    2013-01-01

    In the immune system, Neuropilin-1 (Nrp1) is a molecule that plays an important role in establishing the immunological synapse between dendritic cells (DCs) and T cells. Recently, Nrp1 has been identified as a marker that seems to distinguish natural T regulatory (nTreg) cells, generated in the thymus, from inducible T regulatory (iTreg) cells raised in the periphery. Given the crucial role of both nTreg and iTreg cells in the generation and maintenance of immune tolerance, the ability to phenotypically identify each of these cell populations in vivo is needed to elucidate their biological properties. In turn, these properties have the potential to be developed for therapeutic use to promote immune tolerance. Here we describe the nature and functions of Nrp1, including its potential use as a therapeutic target in transplantation tolerance. PMID:24324469

  17. Allogeneic transplantation strategies including haploidentical transplantation in sickle cell disease.

    PubMed

    Gluckman, Eliane

    2013-01-01

    Sickle cell disease (SCD) is the most common inherited hemoglobinopathy. Despite antenatal counseling and neonatal screening programs implemented in higher income countries, SCD is still associated with multiple morbidities and early mortality. To date, the only curative approach to SCD is hematopoietic stem cell transplantation, but this therapy is not yet established worldwide. The registries of the European Blood and Marrow Transplant (EBMT) and the Centre for International Blood and Marrow Transplant Research (CIBMTR) account, respectively, for 611 and 627 patients receiving transplantations for SCD. Most of these patients were transplanted with grafts from an HLA-identical sibling donor. The main obstacles to increasing the number of transplantations are a lack of awareness on the part of physicians and families, the absence of reliable prognostic factors for severity, and the perceived risk that transplantation complications may outweigh the benefits of early transplantation. Results show that more than 90% of patients having undergone an HLA-identical sibling transplantation after myeloablative conditioning are cured, with very limited complications. Major improvement is expected from the use of new reduced-toxicity conditioning regimens and the use of alternative donors, including unrelated cord blood transplantations and related haploidentical bone marrow or peripheral blood stem cell transplantations.

  18. Photoacoustic imaging of angiogenesis in subdermal islet transplant sites

    NASA Astrophysics Data System (ADS)

    Shi, Wei; Pawlick, Rena; Bruni, Antonio; Rafiei, Yasmin; Pepper, Andrew R.; Gala-Lopez, Boris; Choi, Min; Malcolm, Andrew; Zemp, Roger J.; Shapiro, A. M. James

    2016-03-01

    Exogenous insulin administration is the mainstay treatment therapy for patients with Type-1 diabetes mellitus (T1DM). However, for select patients, clinical islet transplantation is an alternative therapeutic treatment. In this procedure, islets are transplanted into the hepatic portal vein, and despite improved success within the last decade, obstacles are still associated with this approach. It has been discovered that the subcutaneous space may be an effective alternative site for islet transplantation, and may provide advantages of easy access and potential for simple monitoring. The ability to monitor islet viability and the transplant microenvironment may be key to future success in islet transplantation. A subcutaneous device-less technique has been developed to facilitate angiogenesis in the islet transplant site, however, a method for monitoring the potential engraftment site have yet to be explored fully. Here we demonstrate the ability to track angiogenesis in mice with 1, 2, 3 and 4 weeks post-catheter implant on both sides of the abdomen using a FujiFilm VisualSonics Vevo-LAZR system. Quantitative analysis on vessel densities exhibited gradual vessel growth successfully induced by catheter implantation. Our study demonstrates the ability of employing photoacoustic and micro-ultrasound imaging to track angiogenesis around the catheter site prior to islet transplantation.

  19. Topical Recombinant Human Epidermal Growth Factor for Oral Mucositis Induced by Intensive Chemotherapy with Hematopoietic Stem Cell Transplantation: Final Analysis of a Randomized, Double-Blind, Placebo-Controlled, Phase 2 Trial

    PubMed Central

    Kim, Ji-Won; Kim, Myeong Gyu; Lee, Hyun Jung; Koh, Youngil; Kwon, Ji-Hyun; Kim, Inho; Park, Seonyang; Kim, Byoung Kook; Oh, Jung Mi; Kim, Kyung Im; Yoon, Sung-Soo

    2017-01-01

    The aim of this study was to evaluate the efficacy and safety of recombinant human epidermal growth factor (rhEGF) oral spray for oral mucositis (OM) induced by intensive chemotherapy with hematopoietic stem cell transplantation. In this phase 2 study, patients were randomized to either rhEGF (50 microg/mL) or placebo in a 1:1 ratio. The primary endpoint was incidence of National Cancer Institute (NCI) grade ≥2 OM. A total of 138 patients were enrolled in this study. In the intention-to-treat analysis, rhEGF did not reduce the incidence of NCI grade ≥2 OM (p = 0.717) nor reduce its duration (p = 0.725). Secondary endpoints including the day of onset and duration of NCI grade ≥2 OM, the incidence of NCI grade ≥3 OM and its duration, and patient-reported quality of life were also similar between the two groups. In the per-protocol analysis, however, the duration of opioid analgesic use was shorter in the rhEGF group (p = 0.036), and recipients in the rhEGF group required a lower cumulative dose of opioid analgesics than those in the placebo group (p = 0.046), among patients with NCI grade ≥2 OM. Adverse events were mild and transient. This study found no evidence to suggest that rhEGF oral spray reduces the incidence of OM. However, further studies are needed to investigate the effect of rhEGF on OM-induced pain reduction after intensive chemotherapy. PMID:28045958

  20. ABO-Incompatible Kidney Transplantation

    PubMed Central

    Morath, Christian; Zeier, Martin; Döhler, Bernd; Opelz, Gerhard; Süsal, Caner

    2017-01-01

    ABO-incompatible (ABOi) kidney transplantation has long been considered a contraindication to successful kidney transplantation. During the last 25 years, increasing organ shortage enforced the development of strategies to overcome the ABO antibody barrier. In the meantime, ABOi kidney transplantation has become a routine procedure with death-censored graft survival rates comparable to the rates in compatible transplantations. Desensitization is usually achieved by apheresis and B cell-depleting therapies that are accompanied by powerful immunosuppression. Anti-A/B antibodies are aimed to be below a certain threshold at the time of ABOi kidney transplantation and during the first 2 weeks after surgery. Thereafter, even a rebound of anti-A/B antibodies does not appear to harm the kidney transplant, a phenomenon that is called accommodation, but is poorly understood. There is still concern, however, that infectious complications such as viral disease, Pneumocystis jirovecii pneumonia, and severe urinary tract infections are increased after ABOi transplantations. Recent data from the Collaborative Transplant Study show that during the first year after kidney transplantation, one additional patient death from an infectious complication occurs in 100 ABOi kidney transplant recipients. Herein, we review the recent evidence on ABOi kidney transplantation with a focus on desensitization strategies and respective outcomes. PMID:28321223

  1. ABO-Incompatible Kidney Transplantation.

    PubMed

    Morath, Christian; Zeier, Martin; Döhler, Bernd; Opelz, Gerhard; Süsal, Caner

    2017-01-01

    ABO-incompatible (ABOi) kidney transplantation has long been considered a contraindication to successful kidney transplantation. During the last 25 years, increasing organ shortage enforced the development of strategies to overcome the ABO antibody barrier. In the meantime, ABOi kidney transplantation has become a routine procedure with death-censored graft survival rates comparable to the rates in compatible transplantations. Desensitization is usually achieved by apheresis and B cell-depleting therapies that are accompanied by powerful immunosuppression. Anti-A/B antibodies are aimed to be below a certain threshold at the time of ABOi kidney transplantation and during the first 2 weeks after surgery. Thereafter, even a rebound of anti-A/B antibodies does not appear to harm the kidney transplant, a phenomenon that is called accommodation, but is poorly understood. There is still concern, however, that infectious complications such as viral disease, Pneumocystis jirovecii pneumonia, and severe urinary tract infections are increased after ABOi transplantations. Recent data from the Collaborative Transplant Study show that during the first year after kidney transplantation, one additional patient death from an infectious complication occurs in 100 ABOi kidney transplant recipients. Herein, we review the recent evidence on ABOi kidney transplantation with a focus on desensitization strategies and respective outcomes.

  2. Facial transplantation: A concise update

    PubMed Central

    Barrera-Pulido, Fernando; Gomez-Cia, Tomas; Sicilia-Castro, Domingo; Garcia-Perla-Garcia, Alberto; Gacto-Sanchez, Purificacion; Hernandez-Guisado, Jose-Maria; Lagares-Borrego, Araceli; Narros-Gimenez, Rocio; Gonzalez-Padilla, Juan D.

    2013-01-01

    Objectives: Update on clinical results obtained by the first worldwide facial transplantation teams as well as review of the literature concerning the main surgical, immunological, ethical, and follow-up aspects described on facial transplanted patients. Study design: MEDLINE search of articles published on “face transplantation” until March 2012. Results: Eighteen clinical cases were studied. The mean patient age was 37.5 years, with a higher prevalence of men. Main surgical indication was gunshot injuries (6 patients). All patients had previously undergone multiple conventional surgical reconstructive procedures which had failed. Altogether 8 transplant teams belonging to 4 countries participated. Thirteen partial face transplantations and 5 full face transplantations have been performed. Allografts are varied according to face anatomical components and the amount of skin, muscle, bone, and other tissues included, though all were grafted successfully and remained viable without significant postoperative surgical complications. The patient with the longest follow-up was 5 years. Two patients died 2 and 27 months after transplantation. Conclusions: Clinical experience has demonstrated the feasibility of facial transplantation as a valuable reconstructive option, but it still remains considered as an experimental procedure with unresolved issues to settle down. Results show that from a clinical, technical, and immunological standpoint, facial transplantation has achieved functional, aesthetic, and social rehabilitation in severely facial disfigured patients. Key words:Face transplantation, composite tissue transplantation, face allograft, facial reconstruction, outcomes and complications of face transplantation. PMID:23229268

  3. Transplantation Outcomes in Primary Hyperoxaluria

    PubMed Central

    Bergstralh, Eric J.; Monico, Carla G; Lieske, John C.; Herges, Regina M.; Langman, Craig B.; Hoppe, Bernd; Milliner, Dawn S

    2010-01-01

    Optimal transplantation strategies are uncertain in primary hyperoxaluria (PH) due to potential for recurrent oxalosis. Outcomes of different transplantation approaches were compared using life table methods to determine kidney graft survival among 203 patients in the International Primary Hyperoxaluria Registry. From 1976–2009, 84 kidney alone (K) and combined kidney and liver (K+L) transplants were performed in 58 patients. Among 58 first kidney transplants (32 K, 26 K+L), 1, 3, and 5 year kidney graft survival was 82%, 68%, and 49%. Renal graft loss occurred in 26 first transplants due to oxalosis in 10, chronic allograft nephropathy in 6, rejection in 5, and other causes in 5. Delay in PH diagnosis until after transplant favored early graft loss (p=0.07). K+L had better kidney graft outcomes than K with death censored graft survival 95% vs. 56% at 3yrs (p=.011). Among 29 year 2000–09 first transplants (24 K+L), 84% were functioning at 3 years compared to 55% of earlier transplants (p=0.05). At 6.8 years after transplantation, 46 of 58 patients are living (43 with functioning grafts). Outcomes of transplantation in PH have improved over time, with recent K+L transplantation highly successful. Recurrent oxalosis accounted for a minority of kidney graft losses. PMID:20849551

  4. Transplantation outcomes in primary hyperoxaluria.

    PubMed

    Bergstralh, E J; Monico, C G; Lieske, J C; Herges, R M; Langman, C B; Hoppe, B; Milliner, D S

    2010-11-01

    Optimal transplantation strategies are uncertain in primary hyperoxaluria (PH) due to potential for recurrent oxalosis. Outcomes of different transplantation approaches were compared using life-table methods to determine kidney graft survival among 203 patients in the International Primary Hyperoxaluria Registry. From 1976-2009, 84 kidney alone (K) and combined kidney and liver (K + L) transplants were performed in 58 patients. Among 58 first kidney transplants (32 K, 26 K + L), 1-, 3- and 5-year kidney graft survival was 82%, 68% and 49%. Renal graft loss occurred in 26 first transplants due to oxalosis in ten, chronic allograft nephropathy in six, rejection in five and other causes in five. Delay in PH diagnosis until after transplant favored early graft loss (p = 0.07). K + L had better kidney graft outcomes than K with death-censored graft survival 95% versus 56% at 3 years (p = 0.011). Among 29 year 2000-09 first transplants (24 K + L), 84% were functioning at 3 years compared to 55% of earlier transplants (p = 0.05). At 6.8 years after transplantation, 46 of 58 patients are living (43 with functioning grafts). Outcomes of transplantation in PH have improved over time, with recent K + L transplantation highly successful. Recurrent oxalosis accounted for a minority of kidney graft losses.

  5. Living Donor Liver Transplantation

    MedlinePlus

    ... instructions before and after surgery. • Have a compatible blood type. • Have an emotional tie with the recipient. • Not ... test is to find out if the donor's blood type matches the recipient’s blood type. Next, the transplant ...

  6. Ovary and uterus transplantation.

    PubMed

    Gosden, Roger G

    2008-12-01

    Ovarian and uterine transplantation are procedures gaining more attention again because of potential applications in respectively fertility preservation for cancer and other patients and, more tentatively, women with uterine agenesis or hysterectomy. Cryopreservation of tissue slices, and possibly whole organs, is providing opportunities for banking ovaries for indefinite periods before transplanting them back to restore fertility. The natural plasticity of this organ facilitates grafting to different sites where they can be revascularized and rapidly restore the normal physiology of secretion and ovulation. Ischemic damage is a chief limitation because many follicles are lost, at least in avascular grafts, and fu