Science.gov

Sample records for induced clustered dna

  1. Non-Problematic Risks from Low-Dose Radiation-Induced DNA Damage Clusters

    PubMed Central

    Hayes, Daniel P.

    2008-01-01

    Radiation-induced DNA damage clusters have been proposed and are usually considered to pose the threat of serious biological damage. This has been attributed to DNA repair debilitation or cessation arising from the complexity of cluster damage. It will be shown here, contrary to both previous suggestions and perceived wisdom, that radiation induced damage clusters contribute to non-problematic risks in the low-dose, low-LET regime. The very complexity of cluster damage which inhibits and/or compromises DNA repair will ultimately be responsible for the elimination and/or diminution of precancer-ous and cancerous cells. PMID:18648573

  2. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)

    2000-01-01

    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  3. Clustered DNA damages induced in human hematopoietic cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Bennett, Paula V.; Cintron-Torres, Nela; Hada, Megumi; Trunk, John; Monteleone, Denise; Sutherland, John C.; Laval, Jacques; Stanislaus, Marisha; Gewirtz, Alan

    2002-01-01

    Ionizing radiation induces clusters of DNA damages--oxidized bases, abasic sites and strand breaks--on opposing strands within a few helical turns. Such damages have been postulated to be difficult to repair, as are double strand breaks (one type of cluster). We have shown that low doses of low and high linear energy transfer (LET) radiation induce such damage clusters in human cells. In human cells, DSB are about 30% of the total of complex damages, and the levels of DSBs and oxidized pyrimidine clusters are similar. The dose responses for cluster induction in cells can be described by a linear relationship, implying that even low doses of ionizing radiation can produce clustered damages. Studies are in progress to determine whether clusters can be produced by mechanisms other than ionizing radiation, as well as the levels of various cluster types formed by low and high LET radiation.

  4. Clustered DNA damages induced by high and low LET radiation, including heavy ions

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Schenk, H.; Sidorkina, O.; Laval, J.; Trunk, J.; Monteleone, D.; Sutherland, J.; Lowenstein, D. I. (Principal Investigator)

    2001-01-01

    Clustered DNA damages--here defined as two or more lesions (strand breaks, oxidized purines, oxidized pyrimidines or abasic sites) within a few helical turns--have been postulated as difficult to repair accurately, and thus highly significant biological lesions. Further, attempted repair of clusters may produce double strand breaks (DSBs). However, until recently, there was no way to measure ionizing radiation-induced clustered damages, except DSB. We recently described an approach for measuring classes of clustered damages (oxidized purine clusters, oxidized pyrimidine clusters, abasic clusters, along with DSB). We showed that ionizing radiation (gamma rays and Fe ions, 1 GeV/amu) does induce such clusters in genomic DNA in solution and in human cells. These studies also showed that each damage cluster results from one radiation hit (and its track), thus indicating that they can be induced by very low doses of radiation, i.e. two independent hits are not required for cluster induction. Further, among all complex damages, double strand breaks comprise--at most-- 20%, with the other clustered damages being at least 80%.

  5. Delayed repair of radiation induced clustered DNA damage: Friend or foe?

    PubMed Central

    Eccles, Laura J.; O’Neill, Peter; Lomax, Martine E.

    2011-01-01

    A signature of ionizing radiation exposure is the induction of DNA clustered damaged sites, defined as two or more lesions within one to two helical turns of DNA by passage of a single radiation track. Clustered damage is made up of double strand breaks (DSB) with associated base lesions or abasic (AP) sites, and non-DSB clusters comprised of base lesions, AP sites and single strand breaks. This review will concentrate on the experimental findings of the processing of non-DSB clustered damaged sites. It has been shown that non-DSB clustered damaged sites compromise the base excision repair pathway leading to the lifetime extension of the lesions within the cluster, compared to isolated lesions, thus the likelihood that the lesions persist to replication and induce mutation is increased. In addition certain non-DSB clustered damaged sites are processed within the cell to form additional DSB. The use of E. coli to demonstrate that clustering of DNA lesions is the major cause of the detrimental consequences of ionizing radiation is also discussed. The delayed repair of non-DSB clustered damaged sites in humans can be seen as a “friend”, leading to cell killing in tumour cells or as a “foe”, resulting in the formation of mutations and genetic instability in normal tissue. PMID:21130102

  6. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  7. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. II. Experimental detection

    SciTech Connect

    Rydberg, B.

    1996-02-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single {delta} rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA. In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [{sup 3}H]thymidine and exposed at 0{degrees}C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/pm. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated {open_quotes}regionally multiply damaged sites.{close_quotes} Postirradiation incubation at 37{degrees}C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown. 34 refs., 6 figs., 1 tab.

  8. UVA-induced DNA double-strand breaks result from the repair of clustered oxidative DNA damages

    PubMed Central

    Greinert, R.; Volkmer, B.; Henning, S.; Breitbart, E. W.; Greulich, K. O.; Cardoso, M. C.; Rapp, Alexander

    2012-01-01

    UVA (320–400 nm) represents the main spectral component of solar UV radiation, induces pre-mutagenic DNA lesions and is classified as Class I carcinogen. Recently, discussion arose whether UVA induces DNA double-strand breaks (dsbs). Only few reports link the induction of dsbs to UVA exposure and the underlying mechanisms are poorly understood. Using the Comet-assay and γH2AX as markers for dsb formation, we demonstrate the dose-dependent dsb induction by UVA in G1-synchronized human keratinocytes (HaCaT) and primary human skin fibroblasts. The number of γH2AX foci increases when a UVA dose is applied in fractions (split dose), with a 2-h recovery period between fractions. The presence of the anti-oxidant Naringin reduces dsb formation significantly. Using an FPG-modified Comet-assay as well as warm and cold repair incubation, we show that dsbs arise partially during repair of bi-stranded, oxidative, clustered DNA lesions. We also demonstrate that on stretched chromatin fibres, 8-oxo-G and abasic sites occur in clusters. This suggests a replication-independent formation of UVA-induced dsbs through clustered single-strand breaks via locally generated reactive oxygen species. Since UVA is the main component of solar UV exposure and is used for artificial UV exposure, our results shine new light on the aetiology of skin cancer. PMID:22941639

  9. Oxidative stress at low levels can induce clustered DNA lesions leading to NHEJ mediated mutations

    PubMed Central

    Sharma, Vyom; Collins, Leonard B.; Chen, Ting-huei; Herr, Natalie; Takeda, Shunichi; Sun, Wei; Swenberg, James A.; Nakamura, Jun

    2016-01-01

    DNA damage and mutations induced by oxidative stress are associated with various different human pathologies including cancer. The facts that most human tumors are characterized by large genome rearrangements and glutathione depletion in mice results in deletions in DNA suggest that reactive oxygen species (ROS) may cause gene and chromosome mutations through DNA double strand breaks (DSBs). However, the generation of DSBs at low levels of ROS is still controversial. In the present study, we show that H2O2 at biologically-relevant levels causes a marked increase in oxidative clustered DNA lesions (OCDLs) with a significant elevation of replication-independent DSBs. Although it is frequently reported that OCDLs are fingerprint of high-energy IR, our results indicate for the first time that H2O2, even at low levels, can also cause OCDLs leading to DSBs specifically in G1 cells. Furthermore, a reverse genetic approach revealed a significant contribution of the non-homologous end joining (NHEJ) pathway in H2O2-induced DNA repair & mutagenesis. This genomic instability induced by low levels of ROS may be involved in spontaneous mutagenesis and the etiology of a wide variety of human diseases like chronic inflammation-related disorders, carcinogenesis, neuro-degeneration and aging. PMID:27015367

  10. Clusters of DNA induced by ionizing radiation: formation of short DNA fragments. I. Theoretical modeling

    NASA Technical Reports Server (NTRS)

    Holley, W. R.; Chatterjee, A.

    1996-01-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber comprised of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and delta rays due to knock-on collisions involving energy transfers >100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of OH, H, eaq, etc.; (2) OH attack on sugar molecules leading to strand breaks: (3) OH attack on bases; (4) direct ionization of the sugar molecules leading to strand breaks; (5) direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 bp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. The shapes of the spectra of DNA fragment lengths depend on the symmetries or approximate symmetries of the chromatin structure. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper (B. Rydberg, Radiat, Res. 145, 200-209, 1996) after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the

  11. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    SciTech Connect

    Holley, W.R.; Chatterjee, A.

    1996-02-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and {delta} rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of {circ}OH, {circ}H, e{sub aq}, etc.; {circ}OH attack on sugar molecules leading to strand breaks; {circ}OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs.

  12. Non-DSB clustered DNA lesions induced by ionizing radiation are largely responsible for the loss of plasmid DNA functionality in the presence of cisplatin.

    PubMed

    Kouass Sahbani, S; Rezaee, M; Cloutier, P; Sanche, L; Hunting, D J

    2014-06-25

    The combination of cisplatin and ionizing radiation (IR) increases cell toxicity by both enhancing DNA damage and inhibiting repair mechanisms. Although the formation of cluster DNA lesions, particularly double-strand breaks (DSB) at the site of cisplatin-DNA-adducts has been reported to induce cell death, the contribution of DSB and non-DSB cluster lesions to the cellular toxicity is still unknown. Although both lesions are toxic, it is not always possible to measure their frequency and cell survival in the same model system. To overcome this problem, here, we investigate the effect of cisplatin-adducts on the induction of DSB and non-DSB cluster DNA lesions by IR and determine the impact of such lesions on plasmid functionality. Cluster lesions are two or more lesions on opposite DNA strands with a short distance such that error free repair is difficult or impossible. At a ratio of two cisplatin per plasmid, irradiation of platinated DNA in solution with (137)Cs γ-rays shows enhancements in the formation of DNA DSB and non-DSB cluster lesions by factors of 2.6 and 2.1, respectively, compared to unmodified DNA. However, in absolute terms, the yield for non-DSB cluster lesions is far larger than that for DSB, by a factor of 26. Unmodified and cisplatin-modified DNA were irradiated and subsequently transformed into Escherichia coli to give survival curves representing the functionality of the plasmid DNA as a function of radiation dose. Our results demonstrate that non-DSB cluster lesions are the only toxic lesions present at a sufficient frequency to account for the loss of DNA functionality. Our data also show that Frank-DSB lesions are simply too infrequent to account for the loss of DNA functionality. In conclusion, non-DSB cluster DNA damage is known to be difficult to repair and is probably the lesion responsible for the loss of functionality of DNA modified by cisplatin.

  13. Quantitative Analysis of Clustered DNA Damages Induced by Silicon Beams of Different Kinetic Energy

    SciTech Connect

    Keszenman D. J.; Keszenman, D.J.; Bennett, P.V.; Sutherland, B.M.; Wilson, P.F.

    2013-05-14

    Humans may b exposed to highly energetic charged particle radiation as a result of medical treatments, occupational activitie or accidental events. In recent years, our increasing presence and burgeoning interest in space exploration beyond low Earth orbit has led to a large increase in the research of the biological effects ofcharged particle radiation typical of that encountered in the space radiation environment. The study of the effects of these types of radiation qualities in terms ofDNA damage induction and repair is fundamental to understand mechanisms both underlying their greater biological effectiveness as we)) as the short and long term risks of health effects such as carcinogenesis, degen rative diseases and premature aging. Charged particle radiation induces a variety of DNA alterations, notably bistranded clustered damages, defined as two or more closely-opposed strand break , oxidized bases or abasic sites within a few helical turns. The induction of such highly complex DNA damage enhances the probability of incorrect or incomplete repair and thus constitutes greater potential for genomic instability, cell death and transformation.

  14. Yields of clustered DNA damage induced by charged-particle radiations of similar kinetic energy per nucleon: LET dependence in different DNA microenvironments

    SciTech Connect

    Keszenman, D.J.; Sutherland, B. M.

    2010-08-01

    To determine the linear energy transfer (LET) dependence of the biological effects of densely ionizing radiation in relation to changes in the ionization density along the track, we measured the yields and spectrum of clustered DNA damages induced by charged particles of different atomic number but similar kinetic energy per nucleon in different DNA microenvironments. Yeast DNA embedded in agarose in solutions of different free radical scavenging capacity was irradiated with 1 GeV protons, 1 GeV/nucleon oxygen ions, 980 MeV/nucleon titanium ions or 968 MeV/nucleon iron ions. The frequencies of double-strand breaks (DSBs), abasic sites and oxypurine clusters were quantified. The total DNA damage yields per absorbed dose induced in non-radioquenching solution decreased with LET, with minor variations in radioquenching conditions being detected. However, the total damage yields per particle fluence increased with LET in both conditions, indicating a higher efficiency per particle to induce clustered DNA damages. The yields of DSBs and non-DSB clusters as well as the damage spectra varied with LET and DNA milieu, suggesting the involvement of more than one mechanism in the formation of the different types of clustered damages.

  15. Redox control of the DNA damage-inducible protein DinG helicase activity via its iron-sulfur cluster.

    PubMed

    Ren, Binbin; Duan, Xuewu; Ding, Huangen

    2009-02-20

    The Escherichia coli DNA damage-inducible protein DinG, a member of the superfamily 2 DNA helicases, has been implicated in the nucleotide excision repair and recombinational DNA repair pathways. Combining UV-visible absorption, EPR, and enzyme activity measurements, we demonstrate here that E. coli DinG contains a redox-active [4Fe-4S] cluster with a midpoint redox potential (E(m)) of -390 +/- 23 mV (pH 8.0) and that reduction of the [4Fe-4S] cluster reversibly switches off the DinG helicase activity. Unlike the [4Fe-4S] cluster in E. coli dihydroxyacid dehydratase, the DinG [4Fe-4S] cluster is stable, and the enzyme remains fully active after exposure to 100-fold excess of hydrogen peroxide, indicating that DinG could be functional under oxidative stress conditions. However, the DinG [4Fe-4S] cluster can be efficiently modified by nitric oxide (NO), forming the DinG-bound dinitrosyl iron complex with the concomitant inactivation of helicase activity in vitro and in vivo. Reassembly of the [4Fe-4S] cluster in NO-modified DinG restores helicase activity, indicating that the iron-sulfur cluster in DinG is the primary target of NO cytotoxicity. The results led us to propose that the iron-sulfur cluster in DinG may act as a sensor of intracellular redox potential to modulate its helicase activity and that modification of the iron-sulfur cluster in DinG and likely in other DNA repair enzymes by NO may contribute to NO-mediated genomic instability.

  16. Molecular Analysis of Base Damage Clustering Associated with a Site-Specific Radiation-Induced DNA Double-Strand Break

    PubMed Central

    Datta, Kamal; Jaruga, Pawel; Dizdaroglu, Miral; Neumann, Ronald D.; Winters, Thomas A.

    2010-01-01

    Base damage flanking a radiation-induced DNA double-strand break (DSB) may contribute to DSB complexity and affect break repair. However, to date, an isolated radiation-induced DSB has not been assessed for such structures at the molecular level. In this study, an authentic site-specific radiation-induced DSB was produced in plasmid DNA by triplex forming oligonucleotide-targeted 125I decay. A restriction fragment terminated by the DSB was isolated and probed for base damage with the E. coli DNA repair enzymes, endonuclease III and formamidopyrimidine-DNA glycosylase. Our results demonstrate base damage clustering within 8 bases of the 125I-targeted base in the DNA duplex. An increased yield of base damage (purine>pyrimidine) was observed for DSBs formed by irradiation in the absence of DMSO. An internal control fragment 1354 bp upstream from the targeted base was insensitive to enzymatic probing, indicating the damage detected proximal to the DSB was produced by the 125I decay that formed the DSB. Gas chromatography-mass spectrometry identified three types of damaged bases in the ~32 bp region proximal to the DSB. These base lesions were 8-hydroxyguanine, 8-hydroxyadenine, and 5-hydroxycytosine. Finally, evidence is presented for base damage >24 bp upstream from the 125I-decay site that may form via a charge migration mechanism. PMID:17067210

  17. Measurement of oxidatively-induced clustered DNA lesions using a novel adaptation of single cell gel electrophoresis (comet assay).

    PubMed

    Georgakilas, Alexandros G; Holt, Stewart M; Hair, Jessica M; Loftin, Charles W

    2010-12-01

    The two basic groups of complex DNA damage are double-strand breaks (DSBs) and non-DSB oxidatively-induced clustered DNA lesions (OCDLs). The single-cell gel electrophoresis (SCGE) or comet assay has been widely used for the detection of low levels of various types of DNA lesions including single-strand breaks (SSBs), DSBs, and oxidized bases per individual cell. There are limited data on the use of the comet assay for the detection of non-DSB clustered DNA lesions using different repair enzymes as enzymatic probes. This unit discusses a novel adaptation of the comet assay used to measure these unique types of lesions. Until now OCDL yields have been measured using primarily pulsed-field agarose gel electrophoresis. The advantages offered by the current approach are: (1) measurement of OCDL levels per individual cell; (2) use of a small number of cells (∼10,000) and relatively low doses of ionizing radiation (1 to 2 Gy) or low levels of oxidative stress, which are not compatible with standard agarose gel electrophoresis; and finally, (3) the assay is fast and allows direct comparison with pulsed-field gel electrophoresis results.

  18. Oxidation of the sugar moiety of DNA by ionizing radiation or bleomycin could induce the formation of a cluster DNA lesion

    PubMed Central

    Regulus, Peggy; Duroux, Benoit; Bayle, Pierre-Alain; Favier, Alain; Cadet, Jean; Ravanat, Jean-Luc

    2007-01-01

    Bleomycin, a radiomimetic drug currently used in human cancer therapy, is a well known carcinogen. Its toxicity is mostly attributed to its potentiality to induce DNA double strand breaks likely arising from the formation of two vicinal DNA strand breaks, initiated by C4-hydrogen abstraction on the 2-deoxyribose moiety. In this work we demonstrate that such a hydrogen abstraction reaction is able to induce the formation of a clustered DNA lesion, involving a 3′ strand break together with a modified sugar residue exhibiting a reactive α,β-unsaturated aldehyde that further reacts with a proximate cytosine base. The lesion thus produced was detected as a mixture of four isomers by HPLC coupled to tandem mass spectrometry subsequent to DNA extraction and enzymatic digestion. The modified nucleosides that constitute new types of cytosine adducts were identified as the likely two pairs of diastereomers of 6-(2-deoxy-β-d-erythro-pentofuranosyl)-2-hydroxy-3(3-hydroxy-2-oxopropyl)-2,6-dihydroimidazo[1,2-c]-pyrimidin-5(3H)-one as inferred from mass spectrometry and NMR analyses of the chemically synthesized nucleosides. We demonstrate that bleomycin, and to a minor extent ionizing radiation, are able to induce significant amounts of the cytosine damage in cellular DNA. In addition, the repair kinetic of the lesion in a human lymphocyte cell line is rather slow, with a half-life of 10 h. The 2′-deoxycytidine adducts thus characterized that represent the first example of complex DNA lesions isolated and identified in cellular DNA upon one radical hit are likely to play an important role in the toxicity of bleomycin. PMID:17715301

  19. Melatonin Protects Human Cells from Clustered DNA Damages, Killing and Acquisition of Soft Agar Growth Induced by X-rays or 970 MeV/n Fe ions

    SciTech Connect

    Das, B.; Sutherland, B.; Bennett, P. V.; Cutter, N. C.; Sutherland, J. C.

    2011-06-01

    We tested the ability of melatonin (N-acetyl-5 methoxytryptamine), a highly effective radical scavenger and human hormone, to protect DNA in solution and in human cells against induction of complex DNA clusters and biological damage induced by low or high linear energy transfer radiation (100 kVp X-rays, 970 MeV/nucleon Fe ions). Plasmid DNA in solution was treated with increasing concentrations of melatonin (0.0-3.5 mM) and were irradiated with X-rays. Human cells (28SC monocytes) were also irradiated with X-rays and Fe ions with and without 2 mM melatonin. Agarose plugs containing genomic DNA were subjected to Contour Clamped Homogeneous Electrophoretic Field (CHEF) followed by imaging and clustered DNA damages were measured by using Number Average length analysis. Transformation experiments on human primary fibroblast cells using soft agar colony assay were carried out which were irradiated with Fe ions with or without 2 mM melatonin. In plasmid DNA in solution, melatonin reduced the induction of single- and double-strand breaks. Pretreatment of human 28SC cells for 24 h before irradiation with 2 mM melatonin reduced the level of X-ray induced double-strand breaks by {approx}50%, of abasic clustered damages about 40%, and of Fe ion-induced double-strand breaks (41% reduction) and abasic clusters (34% reduction). It decreased transformation to soft agar growth of human primary cells by a factor of 10, but reduced killing by Fe ions only by 20-40%. Melatonin's effective reduction of radiation-induced critical DNA damages, cell killing, and striking decrease of transformation suggest that it is an excellent candidate as a countermeasure against radiation exposure, including radiation exposure to astronaut crews in space travel.

  20. Method for assaying clustered DNA damages

    DOEpatents

    Sutherland, Betsy M.

    2004-09-07

    Disclosed is a method for detecting and quantifying clustered damages in DNA. In this method, a first aliquot of the DNA to be tested for clustered damages with one or more lesion-specific cleaving reagents under conditions appropriate for cleavage of the DNA to produce single-strand nicks in the DNA at sites of damage lesions. The number average molecular length (Ln) of double stranded DNA is then quantitatively determined for the treated DNA. The number average molecular length (Ln) of double stranded DNA is also quantitatively determined for a second, untreated aliquot of the DNA. The frequency of clustered damages (.PHI..sub.c) in the DNA is then calculated.

  1. DNA-Protected Silver Clusters for Nanophotonics

    PubMed Central

    Gwinn, Elisabeth; Schultz, Danielle; Copp, Stacy M.; Swasey, Steven

    2015-01-01

    DNA-protected silver clusters (AgN-DNA) possess unique fluorescence properties that depend on the specific DNA template that stabilizes the cluster. They exhibit peak emission wavelengths that range across the visible and near-IR spectrum. This wide color palette, combined with low toxicity, high fluorescence quantum yields of some clusters, low synthesis costs, small cluster sizes and compatibility with DNA are enabling many applications that employ AgN-DNA. Here we review what is known about the underlying composition and structure of AgN-DNA, and how these relate to the optical properties of these fascinating, hybrid biomolecule-metal cluster nanomaterials. We place AgN-DNA in the general context of ligand-stabilized metal clusters and compare their properties to those of other noble metal clusters stabilized by small molecule ligands. The methods used to isolate pure AgN-DNA for analysis of composition and for studies of solution and single-emitter optical properties are discussed. We give a brief overview of structurally sensitive chiroptical studies, both theoretical and experimental, and review experiments on bringing silver clusters of distinct size and color into nanoscale DNA assemblies. Progress towards using DNA scaffolds to assemble multi-cluster arrays is also reviewed.

  2. Saccharomyces cerevisiae-based system for studying clustered DNA damages

    SciTech Connect

    Moscariello, M.M.; Sutherland, B.

    2010-08-01

    DNA-damaging agents can induce clustered lesions or multiply damaged sites (MDSs) on the same or opposing DNA strands. In the latter, attempts to repair MDS can generate closely opposed single-strand break intermediates that may convert non-lethal or mutagenic base damage into double-strand breaks (DSBs). We constructed a diploid S. cerevisiae yeast strain with a chromosomal context targeted by integrative DNA fragments carrying different damages to determine whether closely opposed base damages are converted to DSBs following the outcomes of the homologous recombination repair pathway. As a model of MDS, we studied clustered uracil DNA damages with a known location and a defined distance separating the lesions. The system we describe might well be extended to assessing the repair of MDSs with different compositions, and to most of the complex DNA lesions induced by physical and chemical agents.

  3. Embryonic neural inducing factor churchill is not a DNA-binding zinc finger protein: solution structure reveals a solvent-exposed beta-sheet and zinc binuclear cluster.

    PubMed

    Lee, Brian M; Buck-Koehntop, Bethany A; Martinez-Yamout, Maria A; Dyson, H Jane; Wright, Peter E

    2007-08-31

    Churchill is a zinc-containing protein that is involved in neural induction during embryogenesis. At the time of its discovery, it was thought on the basis of sequence alignment to contain two zinc fingers of the C4 type. Further, binding of an N-terminal GST-Churchill fusion protein to a particular DNA sequence was demonstrated by immunoprecipitation selection assay, suggesting that Churchill may function as a transcriptional regulator by sequence-specific DNA binding. We show by NMR solution structure determination that, far from containing canonical C4 zinc fingers, the protein contains three bound zinc ions in novel coordination sites, including an unusual binuclear zinc cluster. The secondary structure of Churchill is also unusual, consisting of a highly solvent-exposed single-layer beta-sheet. Hydrogen-deuterium exchange and backbone relaxation measurements reveal that Churchill is unusually dynamic on a number of time scales, with the exception of regions surrounding the zinc coordinating sites, which serve to stabilize the otherwise unstructured N terminus and the single-layer beta-sheet. No binding of Churchill to the previously identified DNA sequence could be detected, and extensive searches using DNA sequence selection techniques could find no other DNA sequence that was bound by Churchill. Since the N-terminal amino acids of Churchill form part of the zinc-binding motif, the addition of a fusion protein at the N terminus causes loss of zinc and unfolding of Churchill. This observation most likely explains the published DNA-binding results, which would arise due to non-specific interaction of the unfolded protein in the immunoprecipitation selection assay. Since Churchill does not appear to bind DNA, we suggest that it may function in embryogenesis as a protein-interaction factor.

  4. DNA Damage Induced Neuronal Death

    DTIC Science & Technology

    1999-10-01

    Experiments are proposed to examine the molecular mechanism by which mustard chemical warfare agents induce neuronal cell death . DNA damage is the...proposed underlying mechanism of mustard-induced neuronal cell death . We propose a novel research strategy to test this hypothesis by using mice with...perturbed DNA repair to explore the relationship between mustard-induced DNA damage and neuronal cell death . Initial in vitro studies (Years 1, 2 & 3

  5. Development of a radiation track structure clustering algorithm for the prediction of DNA DSB yields and radiation induced cell death in Eukaryotic cells.

    PubMed

    Douglass, Michael; Bezak, Eva; Penfold, Scott

    2015-04-21

    The preliminary framework of a combined radiobiological model is developed and calibrated in the current work. The model simulates the production of individual cells forming a tumour, the spatial distribution of individual ionization events (using Geant4-DNA) and the stochastic biochemical repair of DNA double strand breaks (DSBs) leading to the prediction of survival or death of individual cells. In the current work, we expand upon a previously developed tumour generation and irradiation model to include a stochastic ionization damage clustering and DNA lesion repair model. The Geant4 code enabled the positions of each ionization event in the cells to be simulated and recorded for analysis. An algorithm was developed to cluster the ionization events in each cell into simple and complex double strand breaks. The two lesion kinetic (TLK) model was then adapted to predict DSB repair kinetics and the resultant cell survival curve. The parameters in the cell survival model were then calibrated using experimental cell survival data of V79 cells after low energy proton irradiation. A monolayer of V79 cells was simulated using the tumour generation code developed previously. The cells were then irradiated by protons with mean energies of 0.76 MeV and 1.9 MeV using a customized version of Geant4. By replicating the experimental parameters of a low energy proton irradiation experiment and calibrating the model with two sets of data, the model is now capable of predicting V79 cell survival after low energy (<2 MeV) proton irradiation for a custom set of input parameters. The novelty of this model is the realistic cellular geometry which can be irradiated using Geant4-DNA and the method in which the double strand breaks are predicted from clustering the spatial distribution of ionisation events. Unlike the original TLK model which calculates a tumour average cell survival probability, the cell survival probability is calculated for each cell in the geometric tumour model

  6. Development of a radiation track structure clustering algorithm for the prediction of DNA DSB yields and radiation induced cell death in Eukaryotic cells

    NASA Astrophysics Data System (ADS)

    Douglass, Michael; Bezak, Eva; Penfold, Scott

    2015-04-01

    The preliminary framework of a combined radiobiological model is developed and calibrated in the current work. The model simulates the production of individual cells forming a tumour, the spatial distribution of individual ionization events (using Geant4-DNA) and the stochastic biochemical repair of DNA double strand breaks (DSBs) leading to the prediction of survival or death of individual cells. In the current work, we expand upon a previously developed tumour generation and irradiation model to include a stochastic ionization damage clustering and DNA lesion repair model. The Geant4 code enabled the positions of each ionization event in the cells to be simulated and recorded for analysis. An algorithm was developed to cluster the ionization events in each cell into simple and complex double strand breaks. The two lesion kinetic (TLK) model was then adapted to predict DSB repair kinetics and the resultant cell survival curve. The parameters in the cell survival model were then calibrated using experimental cell survival data of V79 cells after low energy proton irradiation. A monolayer of V79 cells was simulated using the tumour generation code developed previously. The cells were then irradiated by protons with mean energies of 0.76 MeV and 1.9 MeV using a customized version of Geant4. By replicating the experimental parameters of a low energy proton irradiation experiment and calibrating the model with two sets of data, the model is now capable of predicting V79 cell survival after low energy (<2 MeV) proton irradiation for a custom set of input parameters. The novelty of this model is the realistic cellular geometry which can be irradiated using Geant4-DNA and the method in which the double strand breaks are predicted from clustering the spatial distribution of ionisation events. Unlike the original TLK model which calculates a tumour average cell survival probability, the cell survival probability is calculated for each cell in the geometric tumour model

  7. Nanostructure-induced DNA condensation

    NASA Astrophysics Data System (ADS)

    Zhou, Ting; Llizo, Axel; Wang, Chen; Xu, Guiying; Yang, Yanlian

    2013-08-01

    The control of the DNA condensation process is essential for compaction of DNA in chromatin, as well as for biological applications such as nonviral gene therapy. This review endeavours to reflect the progress of investigations on DNA condensation effects of nanostructure-based condensing agents (such as nanoparticles, nanotubes, cationic polymer and peptide agents) observed by using atomic force microscopy (AFM) and other techniques. The environmental effects on structural characteristics of nanostructure-induced DNA condensates are also discussed.

  8. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    2001-01-01

    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  9. Accelerating DNA analysis applications on GPU clusters

    SciTech Connect

    Tumeo, Antonino; Villa, Oreste

    2010-06-13

    DNA analysis is an emerging application of high performance bioinformatic. Modern sequencing machinery are able to provide, in few hours, large input streams of data which needs to be matched against exponentially growing databases known fragments. The ability to recognize these patterns effectively and fastly may allow extending the scale and the reach of the investigations performed by biology scientists. Aho-Corasick is an exact, multiple pattern matching algorithm often at the base of this application. High performance systems are a promising platform to accelerate this algorithm, which is computationally intensive but also inherently parallel. Nowadays, high performance systems also include heterogeneous processing elements, such as Graphic Processing Units (GPUs), to further accelerate parallel algorithms. Unfortunately, the Aho-Corasick algorithm exhibits large performance variabilities, depending on the size of the input streams, on the number of patterns to search and on the number of matches, and poses significant challenges on current high performance software and hardware implementations. An adequate mapping of the algorithm on the target architecture, coping with the limit of the underlining hardware, is required to reach the desired high throughputs. Load balancing also plays a crucial role when considering the limited bandwidth among the nodes of these systems. In this paper we present an efficient implementation of the Aho-Corasick algorithm for high performance clusters accelerated with GPUs. We discuss how we partitioned and adapted the algorithm to fit the Tesla C1060 GPU and then present a MPI based implementation for a heterogeneous high performance cluster. We compare this implementation to MPI and MPI with pthreads based implementations for a homogeneous cluster of x86 processors, discussing the stability vs. the performance and the scaling of the solutions, taking into consideration aspects such as the bandwidth among the different nodes.

  10. DNA damage in cells exhibiting radiation-induced genomic instability

    DOE PAGES

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  11. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.

  12. Clustered DNA lesion repair in eukaryotes: relevance to mutagenesis and cell survival

    PubMed Central

    Sage, Evelyne; Harrison, Lynn

    2011-01-01

    A clustered DNA lesion, also known as a multiply damaged site, is defined as ≥ 2 damages in the DNA within 1–2 helical turns. Only ionizing radiation and certain chemicals introduce DNA damage in the genome in this non-random way. What is now clear is that the lethality of a damaging agent is not just related to the types of DNA lesions introduced, but also to how the damage is distributed in the DNA. Clustered DNA lesions were first hypothesized to exist in the 1990’s, and work has progressed where these complex lesions have been characterized and measured in irradiated as well as in non-irradiated cells. A clustered lesion can consist of single as well as double strand breaks, base damage and abasic sites, and the damages can be situated on the same strand or opposing strands. They include tandem lesions, double strand break (DSB) clusters and non-DSB clusters, and base excision repair as well as the DSB repair pathways can be required to remove these complex lesions. Due to the plethora of oxidative damage induced by ionizing radiation, and the repair proteins involved in their removal from the DNA, it has been necessary to study how repair systems handle these lesions using synthetic DNA damage. This review focuses on the repair process and mutagenic consequences of clustered lesions in yeast and mammalian cells. By examining the studies on synthetic clustered lesions, and the effects of low vs high LET radiation on mammalian cells or tissues, it is possible to extrapolate the potential biological relevance of these clustered lesions to the killing of tumor cells by radiotherapy and chemotherapy, and to the risk of cancer in non-tumor cells, and this will be discussed. PMID:21185841

  13. DNA methylation profiling identifies CG methylation clusters in Arabidopsis genes.

    PubMed

    Tran, Robert K; Henikoff, Jorja G; Zilberman, Daniel; Ditt, Renata F; Jacobsen, Steven E; Henikoff, Steven

    2005-01-26

    Cytosine DNA methylation in vertebrates is widespread, but methylation in plants is found almost exclusively at transposable elements and repetitive DNA. Within regions of methylation, methylcytosines are typically found in CG, CNG, and asymmetric contexts. CG sites are maintained by a plant homolog of mammalian Dnmt1 acting on hemi-methylated DNA after replication. Methylation of CNG and asymmetric sites appears to be maintained at each cell cycle by other mechanisms. We report a new type of DNA methylation in Arabidopsis, dense CG methylation clusters found at scattered sites throughout the genome. These clusters lack non-CG methylation and are preferentially found in genes, although they are relatively deficient toward the 5' end. CG methylation clusters are present in lines derived from different accessions and in mutants that eliminate de novo methylation, indicating that CG methylation clusters are stably maintained at specific sites. Because 5-methylcytosine is mutagenic, the appearance of CG methylation clusters over evolutionary time predicts a genome-wide deficiency of CG dinucleotides and an excess of C(A/T)G trinucleotides within transcribed regions. This is exactly what we find, implying that CG methylation clusters have contributed profoundly to plant gene evolution. We suggest that CG methylation clusters silence cryptic promoters that arise sporadically within transcription units.

  14. Effect of clustered peptide binding on DNA condensation.

    PubMed

    Haley, Jennifer; Kabiru, Paul; Geng, Yan

    2010-01-01

    DNA condensation in-vitro has been studied as a model system to reveal common principles underlying gene packaging in biology, and as the critical first step towards the development of non-viral gene delivery vectors. In this study, we use a bio-inspired approach, where small DNA-binding peptides are controllably clustered by an amphiphilic block copolymer scaffold, to reveal the effect of clustered peptide binding on the energetics, size, shape and physical properties of DNA condensation in-vitro. This provides insights into the general architectural effect of gene-binding proteins on DNA condensation process. Moreover, the versatility afforded by regulating the clustering density and composition of peptides may provide a novel design platform for gene delivery applications in the future.

  15. Repair of clustered DNA damage caused by high LET radiation in human fibroblasts

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Lobrich, M.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1998-01-01

    It has recently been demonstrated experimentally that DNA damage induced by high LET radiation in mammalian cells is non-randomly distributed along the DNA molecule in the form of clusters of various sizes. The sizes of such clusters range from a few base-pairs to at least 200 kilobase-pairs. The high biological efficiency of high LET radiation for induction of relevant biological endpoints is probably a consequence of this clustering, although the exact mechanisms by which the clustering affects the biological outcome is not known. We discuss here results for induction and repair of base damage, single-strand breaks and double-strand breaks for low and high LET radiations. These results are discussed in the context of clustering. Of particular interest is to determine how clustering at different scales affects overall rejoining and fidelity of rejoining of DNA double-strand breaks. However, existing methods for measuring repair of DNA strand breaks are unable to resolve breaks that are close together in a cluster. This causes problems in interpretation of current results from high LET radiation and will require new methods to be developed.

  16. Non-DSB clustered DNA lesions. Does theory colocalize with the experiment?

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Nikolov, Vladimir; Mavragani, Ifigeneia V.; Plante, Ianik; Emfietzoglou, Dimitris; Iliakis, George; Georgakilas, Alexandros G.

    2016-11-01

    Ionizing radiation results in various kinds of DNA lesions such as double strand breaks (DSBs) and other non-DSB base lesions. These lesions may be formed in close proximity (i.e., within a few nanometers) resulting in clustered types of DNA lesions. These damage clusters are considered the fingerprint of ionizing radiation, notably charged particles of high linear energy transfer (LET). Accumulating theoretical and experimental evidence suggests that the induction of these clustered lesions appears under various irradiation conditions but also as a result of high levels of oxidative stress. The biological significance of these clustered DNA lesions pertains to the inability of cells to process them efficiently compared to isolated DNA lesions. The results in the case of unsuccessful or erroneous repair can vary from mutations up to chromosomal instability. In this mini review, we discuss of several Monte Carlo simulations codes and experimental evidence regarding the induction and repair of radiation-induced non-DSB complex DNA lesions. We also critically present the most widely used methodologies (i.e., gel electrophoresis and fluorescence microscopy [in situ colocalization assays]). Based on the comparison of different approaches, we provide examples and suggestions for the improved detection of these lesions in situ. Based on the current status of knowledge, we conclude that there is a great need for improvement of the detection techniques at the cellular or tissue level, which will provide valuable information for understanding the mechanisms used by the cell to process clustered DNA lesions.

  17. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  18. Virus-Surface-Mimicking Surface Clustering of AuNPs onto DNA-Entrapped Polymeric Nanoparticle for Enhanced Cellular Internalization and Nanocluster-Induced NIR Photothermal Therapy.

    PubMed

    Jia, Hui-Zhen; Chen, Wei-Hai; Wang, Xuli; Lei, Qi; Yin, Wei-Na; Wang, Yan; Zhuo, Ren-Xi; Feng, Jun; Zhang, Xian-Zheng

    2015-12-01

    Virus-surface-mimicking decoration of deoxyribonucleic acid (DNA)-entrapped polymeric nanoparticle with AuNPs is demonstrated to lead to enhanced cellular uptake, improved gene transfection, and particularly efficient near-infrared photothermal therapy that cannot be achieved by both of them separately. This hybrid nanosystem represents a novel paradigm of multipurpose organic-inorganic nanoplatform, especially for cancer treatments.

  19. Formation of clustered DNA damage after high-LET irradiation: a review.

    PubMed

    Hada, Megumi; Georgakilas, Alexandros G

    2008-05-01

    Radiation can cause as well as cure cancer. The risk of developing radiation-induced cancer has traditionally been estimated from cancer incidence among survivors of the atomic bombs in Hiroshima and Nagasaki.(1)) These data provide the best estimate of human cancer risk over the dose range for low linear energy transfer (LET) radiations, such as X- or gamma-rays. The situation of estimating the real biological effects becomes even more difficult in the case of high LET particles encountered in space or as the result of domestic exposure to alpha-particles from radon gas emitters or other radioactive emitters like uranium-238. Complex DNA damage, i.e., the signature of high-LET radiations comprises of closely spaced DNA lesions forming a cluster of DNA damage. The two basic groups of complex DNA damage are double strand breaks (DSBs) and non-DSB oxidative clustered DNA lesions (OCDL). Theoretical analysis and experimental evidence suggest an increased complexity and severity of complex DNA damage with increasing LET (linear energy transfer) and a high mutagenic or carcinogenic potential. Data available on the formation of clustered DNA damage (DSBs and OCDL) by high-LET radiations are often controversial suggesting a variable response to dose and type of radiation. The chemical nature and cellular repair mechanisms of complex DNA damage have been much less characterized than those of isolated DNA lesions like an oxidized base or a single strand break especially in the case of high-LET radiation. This review will focus on the induction of clustered DNA damage by high-LET radiations presenting the earlier and recent relative data.

  20. Formation of Clustered DNA Damage after High-LET Irradiation: A Review

    NASA Technical Reports Server (NTRS)

    Hada, Megumi; Georgakilas, Alexandros G.

    2008-01-01

    Radiation can cause as well as cure cancer. The risk of developing radiation-induced cancer has traditionally been estimated from cancer incidence among survivors of the atomic bombs in Hiroshima and Nagasaki. These data provide the best estimate of human cancer risk over the dose range for low linear energy transfer (LET) radiations, such as X- or gamma-rays. The situation of estimating the real biological effects becomes even more difficult in the case of high LET particles encountered in space or as the result of domestic exposure to particles from radon gas emitters or other radioactive emitters like uranium-238. Complex DNA damage, i.e., the signature of high-LET radiations comprises by closely spaced DNA lesions forming a cluster of DNA damage. The two basic groups of complex DNA damage are double strand breaks (DSBs) and non-DSB oxidative clustered DNA lesions (OCDL). Theoretical analysis and experimental evidence suggest there is increased complexity and severity of complex DNA damage with increasing LET (linear energy transfer) and a high mutagenic or carcinogenic potential. Data available on the formation of clustered DNA damage (DSBs and OCDL) by high-LET radiations are often controversial suggesting a variable response to dose and type of radiation. The chemical nature and cellular repair mechanisms of complex DNA damage have been much less characterized than those of isolated DNA lesions like an oxidized base or a single strand break especially in the case of high-LET radiation. This review will focus on the induction of clustered DNA damage by high-LET radiations presenting the earlier and recent relative data.

  1. Cluster Plasmonics: Dielectric and Shape Effects on DNA-Stabilized Silver Clusters.

    PubMed

    Copp, Stacy M; Schultz, Danielle; Swasey, Steven M; Faris, Alexis; Gwinn, Elisabeth G

    2016-06-08

    This work investigates the effects of dielectric environment and cluster shape on electronic excitations of fluorescent DNA-stabilized silver clusters, AgN-DNA. We first establish that the longitudinal plasmon wavelengths predicted by classical Mie-Gans (MG) theory agree with previous quantum calculations for excitation wavelengths of linear silver atom chains, even for clusters of just a few atoms. Application of MG theory to AgN-DNA with 400-850 nm cluster excitation wavelengths indicates that these clusters are characterized by a collective excitation process and suggests effective cluster thicknesses of ∼2 silver atoms and aspect ratios of 1.5 to 5. To investigate sensitivity to the surrounding medium, we measure the wavelength shifts produced by addition of glycerol. These are smaller than reported for much larger gold nanoparticles but easily detectable due to narrower line widths, suggesting that AgN-DNA may have potential for fluorescence-reported changes in dielectric environment at length scales of ∼1 nm.

  2. Preferential recombination between GC clusters in yeast mitochondrial DNA.

    PubMed Central

    Dieckmann, C L; Gandy, B

    1987-01-01

    Yeast mitochondrial DNA molecules have long, AT-rich intergenic spacers punctuated by short GC clusters. GC-rich elements have previously been characterized by others as preferred sites for intramolecular recombination leading to the formation of subgenomic petite molecules. In the present study we show that GC clusters are favored sites for intermolecular recombination between a petite and the wild-type grande genome. The petite studied retains 6.5 kb of mitochondrial DNA reiterated tandemly to form molecules consisting of repeated units. Genetic selection for integration of tandem 6.5 kb repeats of the petite into the grande genome yielded a novel recombination event. One of two crossovers in a double exchange event occurred as expected in the 6.5 kb of matching sequence between the genomes, whereas the second exchange involved a 44 bp GC cluster in the petite and another 44 bp GC cluster in the grande genome 700 bp proximal to the region of homology. Creation of a mitochondrial DNA molecule with a repetitive region led to secondary recombination events that generated a family of molecules with zero to several petite units. The finding that 44 bp GC clusters are preferred as sites for intermolecular exchange adds to the data on petite excision implicating these elements as recombinational hotspots in the yeast mitochondrial genome. Images Fig. 3. Fig. 4. Fig. 5. PMID:3327690

  3. Multistep assembly of DNA condensation clusters by SMC

    PubMed Central

    Kim, HyeongJun; Loparo, Joseph J.

    2016-01-01

    SMC (structural maintenance of chromosomes) family members play essential roles in chromosome condensation, sister chromatid cohesion and DNA repair. It remains unclear how SMCs structure chromosomes and how their mechanochemical cycle regulates their interactions with DNA. Here we used single-molecule fluorescence microscopy to visualize how Bacillus subtilis SMC (BsSMC) interacts with flow-stretched DNAs. We report that BsSMC can slide on DNA, switching between static binding and diffusion. At higher concentrations, BsSMCs form clusters that condense DNA in a weakly ATP-dependent manner. ATP increases the apparent cooperativity of DNA condensation, demonstrating that BsSMC can interact cooperatively through their ATPase head domains. Consistent with these results, ATPase mutants compact DNA more slowly than wild-type BsSMC in the presence of ATP. Our results suggest that transiently static BsSMC molecules can nucleate the formation of clusters that act to locally condense the chromosome while forming long-range DNA bridges. PMID:26725510

  4. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome.

    PubMed

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo.

  5. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome

    PubMed Central

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo. PMID:26559182

  6. Spectrometer for cluster ion beam induced luminescence

    SciTech Connect

    Ryuto, H. Sakata, A.; Takeuchi, M.; Takaoka, G. H.; Musumeci, F.

    2015-02-15

    A spectrometer to detect the ultra-weak luminescence originated by the collision of cluster ions on the surfaces of solid materials was constructed. This spectrometer consists of 11 photomultipliers with band-pass interference filters that can detect the luminescence within the wavelength ranging from 300 to 700 nm and of a photomultiplier without filter. The calibration of the detection system was performed using the photons emitted from a strontium aluminate fluorescent tape and from a high temperature tungsten filament. Preliminary measurements show the ability of this spectrometer to detect the cluster ion beam induced luminescence.

  7. Tidally Induced Bars of Galaxies in Clusters

    NASA Astrophysics Data System (ADS)

    Łokas, Ewa L.; Ebrová, Ivana; del Pino, Andrés; Sybilska, Agnieszka; Athanassoula, E.; Semczuk, Marcin; Gajda, Grzegorz; Fouquet, Sylvain

    2016-08-01

    Using N-body simulations, we study the formation and evolution of tidally induced bars in disky galaxies in clusters. Our progenitor is a massive, late-type galaxy similar to the Milky Way, composed of an exponential disk and a Navarro-Frenk-White dark matter halo. We place the galaxy on four different orbits in a Virgo-like cluster and evolve it for 10 Gyr. As a reference case, we also evolve the same model in isolation. Tidally induced bars form on all orbits soon after the first pericenter passage and survive until the end of the evolution. They appear earlier, are stronger and longer, and have lower pattern speeds for tighter orbits. Only for the tightest orbit are the properties of the bar controlled by the orientation of the tidal torque from the cluster at pericenter. The mechanism behind the formation of the bars is the angular momentum transfer from the galaxy stellar component to its halo. All of the bars undergo extended periods of buckling instability that occur earlier and lead to more pronounced boxy/peanut shapes when the tidal forces are stronger. Using all simulation outputs of galaxies at different evolutionary stages, we construct a toy model of the galaxy population in the cluster and measure the average bar strength and bar fraction as a function of clustercentric radius. Both are found to be mildly decreasing functions of radius. We conclude that tidal forces can trigger bar formation in cluster cores, but not in the outskirts, and thus can cause larger concentrations of barred galaxies toward the cluster center.

  8. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting

    PubMed Central

    Vlijm, Rifka; v.d. Torre, Jaco; Dekker, Cees

    2015-01-01

    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, have determined that AT-rich sequences have a lower binding energy than GC-rich sequences. In cells, however, the double-stranded backbone of DNA is destabilized by negative supercoiling, and not by temperature. To investigate what the effect of GC content is on DNA melting induced by negative supercoiling, we studied DNA molecules with a GC content ranging from 38% to 77%, using single-molecule magnetic tweezer measurements in which the length of a single DNA molecule is measured as a function of applied stretching force and supercoiling density. At low force (<0.5pN), supercoiling results into twisting of the dsDNA backbone and loop formation (plectonemes), without inducing any DNA melting. This process was not influenced by the DNA sequence. When negative supercoiling is introduced at increasing force, local melting of DNA is introduced. We measured for the different DNA molecules a characteristic force Fchar, at which negative supercoiling induces local melting of the dsDNA. Surprisingly, GC-rich sequences melt at lower forces than AT-rich sequences: Fchar = 0.56pN for 77% GC but 0.73pN for 38% GC. An explanation for this counterintuitive effect is provided by the realization that supercoiling densities of a few percent only induce melting of a few percent of the base pairs. As a consequence, denaturation bubbles occur in local AT-rich regions and the sequence-dependent effect arises from an increased DNA bending/torsional energy associated with the plectonemes. This new insight indicates that an increased GC-content adjacent to AT-rich DNA regions will enhance local opening of the double-stranded DNA helix. PMID:26513573

  9. Distinguishing Functional DNA Words; A Method for Measuring Clustering Levels

    PubMed Central

    Moghaddasi, Hanieh; Khalifeh, Khosrow; Darooneh, Amir Hossein

    2017-01-01

    Functional DNA sub-sequences and genome elements are spatially clustered through the genome just as keywords in literary texts. Therefore, some of the methods for ranking words in texts can also be used to compare different DNA sub-sequences. In analogy with the literary texts, here we claim that the distribution of distances between the successive sub-sequences (words) is q-exponential which is the distribution function in non-extensive statistical mechanics. Thus the q-parameter can be used as a measure of words clustering levels. Here, we analyzed the distribution of distances between consecutive occurrences of 16 possible dinucleotides in human chromosomes to obtain their corresponding q-parameters. We found that CG as a biologically important two-letter word concerning its methylation, has the highest clustering level. This finding shows the predicting ability of the method in biology. We also proposed that chromosome 18 with the largest value of q-parameter for promoters of genes is more sensitive to dietary and lifestyle. We extended our study to compare the genome of some selected organisms and concluded that the clustering level of CGs increases in higher evolutionary organisms compared to lower ones. PMID:28128320

  10. Distinguishing Functional DNA Words; A Method for Measuring Clustering Levels

    NASA Astrophysics Data System (ADS)

    Moghaddasi, Hanieh; Khalifeh, Khosrow; Darooneh, Amir Hossein

    2017-01-01

    Functional DNA sub-sequences and genome elements are spatially clustered through the genome just as keywords in literary texts. Therefore, some of the methods for ranking words in texts can also be used to compare different DNA sub-sequences. In analogy with the literary texts, here we claim that the distribution of distances between the successive sub-sequences (words) is q-exponential which is the distribution function in non-extensive statistical mechanics. Thus the q-parameter can be used as a measure of words clustering levels. Here, we analyzed the distribution of distances between consecutive occurrences of 16 possible dinucleotides in human chromosomes to obtain their corresponding q-parameters. We found that CG as a biologically important two-letter word concerning its methylation, has the highest clustering level. This finding shows the predicting ability of the method in biology. We also proposed that chromosome 18 with the largest value of q-parameter for promoters of genes is more sensitive to dietary and lifestyle. We extended our study to compare the genome of some selected organisms and concluded that the clustering level of CGs increases in higher evolutionary organisms compared to lower ones.

  11. trans Autophosphorylation at DNA-Dependent Protein Kinase's Two Major Autophosphorylation Site Clusters Facilitates End Processing but Not End Joining▿

    PubMed Central

    Meek, Katheryn; Douglas, Pauline; Cui, Xiaoping; Ding, Qi; Lees-Miller, Susan P.

    2007-01-01

    Recent studies have established that DNA-dependent protein kinase (DNA-PK) undergoes a series of autophosphorylation events that facilitate successful completion of nonhomologous DNA end joining. Autophosphorylation at sites in two distinct clusters regulates DNA end access to DNA end-processing factors and to other DNA repair pathways. Autophosphorylation within the kinase's activation loop regulates kinase activity. Additional autophosphorylation events (as yet undefined) occur that mediate kinase dissociation. Here we provide the first evidence that autophosphorylation within the two major clusters (regulating end access) occurs in trans. Further, both UV-induced and double-strand break (DSB)-induced phosphorylation in the two major clusters is predominately autophosphorylation. Finally, we show that while autophosphorylation in trans on one of two synapsed DNA-PK complexes facilitates appropriate end processing, this is not sufficient to promote efficient end joining. This suggests that end joining in living cells requires additional phosphorylation events that either occur in cis or that occur on both sides of the DNA-PK synapse. These data support an emerging consensus that, via a series of autophosphorylation events, DNA-PK undergoes a sequence of conformational changes that promote efficient and appropriate repair of DSBs. PMID:17353268

  12. Correlation of bistranded clustered abasic DNA lesion processing with structural and dynamic DNA helix distortion

    PubMed Central

    Bignon, Emmanuelle; Gattuso, Hugo; Morell, Christophe; Dehez, François; Georgakilas, Alexandros G.; Monari, Antonio; Dumont, Elise

    2016-01-01

    Clustered apurinic/apyrimidinic (AP; abasic) DNA lesions produced by ionizing radiation are by far more cytotoxic than isolated AP lesion entities. The structure and dynamics of a series of seven 23-bp oligonucleotides featuring simple bistranded clustered damage sites, comprising of two AP sites, zero, one, three or five bases 3′ or 5′ apart from each other, were investigated through 400 ns explicit solvent molecular dynamics simulations. They provide representative structures of synthetically engineered multiply damage sites-containing oligonucleotides whose repair was investigated experimentally (Nucl. Acids Res. 2004, 32:5609-5620; Nucl. Acids Res. 2002, 30: 2800–2808). The inspection of extrahelical positioning of the AP sites, bulge and non Watson–Crick hydrogen bonding corroborates the experimental measurements of repair efficiencies by bacterial or human AP endonucleases Nfo and APE1, respectively. This study provides unprecedented knowledge into the structure and dynamics of clustered abasic DNA lesions, notably rationalizing the non-symmetry with respect to 3′ to 5′ position. In addition, it provides strong mechanistic insights and basis for future studies on the effects of clustered DNA damage on the recognition and processing of these lesions by bacterial or human DNA repair enzymes specialized in the processing of such lesions. PMID:27587587

  13. Atomically precise arrays of fluorescent silver clusters: a modular approach for metal cluster photonics on DNA nanostructures.

    PubMed

    Copp, Stacy M; Schultz, Danielle E; Swasey, Steven; Gwinn, Elisabeth G

    2015-03-24

    The remarkable precision that DNA scaffolds provide for arraying nanoscale optical elements enables optical phenomena that arise from interactions of metal nanoparticles, dye molecules, and quantum dots placed at nanoscale separations. However, control of ensemble optical properties has been limited by the difficulty of achieving uniform particle sizes and shapes. Ligand-stabilized metal clusters offer a route to atomically precise arrays that combine desirable attributes of both metals and molecules. Exploiting the unique advantages of the cluster regime requires techniques to realize controlled nanoscale placement of select cluster structures. Here we show that atomically monodisperse arrays of fluorescent, DNA-stabilized silver clusters can be realized on a prototypical scaffold, a DNA nanotube, with attachment sites separated by <10 nm. Cluster attachment is mediated by designed DNA linkers that enable isolation of specific clusters prior to assembly on nanotubes and preserve cluster structure and spectral purity after assembly. The modularity of this approach generalizes to silver clusters of diverse sizes and DNA scaffolds of many types. Thus, these silver cluster nano-optical elements, which themselves have colors selected by their particular DNA templating oligomer, bring unique dimensions of control and flexibility to the rapidly expanding field of nano-optics.

  14. The [4Fe4S] cluster of human DNA primase functions as a redox switch using DNA charge transport.

    PubMed

    O'Brien, Elizabeth; Holt, Marilyn E; Thompson, Matthew K; Salay, Lauren E; Ehlinger, Aaron C; Chazin, Walter J; Barton, Jacqueline K

    2017-02-24

    DNA charge transport chemistry offers a means of long-range, rapid redox signaling. We demonstrate that the [4Fe4S] cluster in human DNA primase can make use of this chemistry to coordinate the first steps of DNA synthesis. Using DNA electrochemistry, we found that a change in oxidation state of the [4Fe4S] cluster acts as a switch for DNA binding. Single-atom mutations that inhibit this charge transfer hinder primase initiation without affecting primase structure or polymerization. Generating a single base mismatch in the growing primer duplex, which attenuates DNA charge transport, inhibits primer truncation. Thus, redox signaling by [4Fe4S] clusters using DNA charge transport regulates primase binding to DNA and illustrates chemistry that may efficiently drive substrate handoff between polymerases during DNA replication.

  15. Saami mitochondrial DNA reveals deep maternal lineage clusters.

    PubMed

    Delghandi, M; Utsi, E; Krauss, S

    1998-01-01

    The mitochondrial DNA of 62 Saami from the north of Norway was analyzed in the D loop hypervariable region I and II and sequences were compared to other gene pools. Two major (lineage 1 and 2) and two minor (lineage 3 and 4) maternal lineage clusters were found. Lineage 1 (56.9% of all hitherto analyzed Saami samples) contains a substantial number of branching haplotypes which are unknown in European gene pools. Lineage 2 (31.5%) and lineage 4 (3.6%) have few branching points and are present at a low rate throughout European gene pools. Lineage 3 (4.7%) has polymorphisms characteristic of circumpolar lineages.

  16. DNA packaging induced by micellar aggregates: a novel in vitro DNA condensation system.

    PubMed

    Ghirlando, R; Wachtel, E J; Arad, T; Minsky, A

    1992-08-11

    Evidence for a conceptually novel DNA packaging process is presented. X-ray scattering, electron microscopy, and circular dichroism measurements indicate that in the presence of positively charged micellar aggregates and flexible anionic polymers, such as negatively charged polypeptides or single-stranded RNA species, a complex is formed in which DNA molecules are partially embedded within a micellar scaffold and partially condensed into highly packed chiral structures. Based on studies of micelle-DNA and micelle-flexible anionic polymer systems, as well as on the known effects of a high charge density upon the micellar organization, a DNA packaging model is proposed. According to this model, the DNA induces the elongation of the micelles into rodlike aggregates, forming a closely packed matrix in which the DNA molecules are immobilized. In contrast, the flexible anionic polymers stabilize clusters of spherical micelles which are proposed to effect a capping of the rodlike micelles, thus arresting their elongation and creating surfactant-free segments of the DNA that are able to converge and collapse. Thus, unlike other in vitro DNA packaging systems, in which condensation follows encounters between charge-neutralized DNA molecules, a prepackaging phase where the DNA is immobilized within a matrix is proposed in this case. Cellular and nuclear membranes have been implicated in DNA packaging processes in vivo, and negatively charged polyelectrolytes were shown to be involved in the processes. These observations, combined with the basic tenets of the DNA condensation system described here, allow for the progression to the study of more elaborate model systems and thus might lead to insights into the nature and roles of the intricate in vivo DNA-membrane complexes.

  17. Numerical Analysis of Etoposide Induced DNA Breaks

    PubMed Central

    Muslimović, Aida; Nyström, Susanne; Gao, Yue; Hammarsten, Ola

    2009-01-01

    Background Etoposide is a cancer drug that induces strand breaks in cellular DNA by inhibiting topoisomerase II (topoII) religation of cleaved DNA molecules. Although DNA cleavage by topoisomerase II always produces topoisomerase II-linked DNA double-strand breaks (DSBs), the action of etoposide also results in single-strand breaks (SSBs), since religation of the two strands are independently inhibited by etoposide. In addition, recent studies indicate that topoisomerase II-linked DSBs remain undetected unless topoisomerase II is removed to produce free DSBs. Methodology/Principal Findings To examine etoposide-induced DNA damage in more detail we compared the relative amount of SSBs and DSBs, survival and H2AX phosphorylation in cells treated with etoposide or calicheamicin, a drug that produces free DSBs and SSBs. With this combination of methods we found that only 3% of the DNA strand breaks induced by etoposide were DSBs. By comparing the level of DSBs, H2AX phosphorylation and toxicity induced by etoposide and calicheamicin, we found that only 10% of etoposide-induced DSBs resulted in histone H2AX phosphorylation and toxicity. There was a close match between toxicity and histone H2AX phosphorylation for calicheamicin and etoposide suggesting that the few etoposide-induced DSBs that activated H2AX phosphorylation were responsible for toxicity. Conclusions/Significance These results show that only 0.3% of all strand breaks produced by etoposide activate H2AX phosphorylation and suggests that over 99% of the etoposide induced DNA damage does not contribute to its toxicity. PMID:19516899

  18. Few-atom fluorescent silver clusters assemble at programmed sites on DNA nanotubes.

    PubMed

    O'Neill, Patrick R; Young, Kevin; Schiffels, Daniel; Fygenson, Deborah K

    2012-11-14

    We show that DNA hairpins template the site-specific assembly of fluorescent few-atom Ag clusters on DNA nanotubes. Fluorescent clusters form only at hairpin sites and not on the double-stranded DNA scaffold, allowing for spatially programmed self-assembly. Ag clusters synthesized on hairpins protruding from DNA nanotubes can have nearly identical fluorescence spectra to those synthesized on free hairpins of identical sequence. Analysis of the stepwise photobleaching of individual clusters suggests a chemical yield of ~45%. Given the well-established sequence-specific optical properties of DNA stabilized Ag clusters, these results point the way toward high yield assembly of metal cluster fluorophores with control over spectra as well as spatial arrangement.

  19. Allostery through protein-induced DNA bubbles

    SciTech Connect

    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; Rasmussen, Kim Ø.; Voulgarakis, Nikolaos K.

    2015-03-12

    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resulting melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.

  20. Allostery through protein-induced DNA bubbles

    DOE PAGES

    Traverso, Joseph J.; Manoranjan, Valipuram S.; Bishop, A. R.; ...

    2015-03-12

    Allostery through DNA is increasingly recognized as an important modulator of DNA functions. Here, we show that the coalescence of protein-induced DNA bubbles can mediate allosteric interactions that drive protein aggregation. We propose that such allostery may regulate DNA's flexibility and the assembly of the transcription machinery. Mitochondrial transcription factor A (TFAM), a dual-function protein involved in mitochondrial DNA (mtDNA) packaging and transcription initiation, is an ideal candidate to test such a hypothesis owing to its ability to locally unwind the double helix. Numerical simulations demonstrate that the coalescence of TFAM-induced bubbles can explain experimentally observed TFAM oligomerization. The resultingmore » melted DNA segment, approximately 10 base pairs long, around the joints of the oligomers act as flexible hinges, which explains the efficiency of TFAM in compacting DNA. Since mitochondrial polymerase (mitoRNAP) is involved in melting the transcription bubble, TFAM may use the same allosteric interaction to both recruit mitoRNAP and initiate transcription.« less

  1. Near-infrared silver cluster optically signaling oligonucleotide hybridization and assembling two DNA hosts.

    PubMed

    Petty, Jeffrey T; Nicholson, David A; Sergev, Orlin O; Graham, Stuart K

    2014-09-16

    Silver clusters with ~10 atoms form within DNA strands, and the conjugates are chemical sensors. The DNA host hybridizes with short oligonucleotides, and the cluster moieties optically respond to these analytes. Our studies focus on how the cluster adducts perturb the structure of their DNA hosts. Our sensor is comprised of an oligonucleotide with two components: a 5'-cluster domain that complexes silver clusters and a 3'-recognition site that hybridizes with a target oligonucleotide. The single-stranded sensor encapsulates an ~11 silver atom cluster with violet absorption at 400 nm and with minimal emission. The recognition site hybridizes with complementary oligonucleotides, and the violet cluster converts to an emissive near-infrared cluster with absorption at 730 nm. Our key finding is that the near-infrared cluster coordinates two of its hybridized hosts. The resulting tertiary structure was investigated using intermolecular and intramolecular variants of the same dimer. The intermolecular dimer assembles in concentrated (~5 μM) DNA solutions. Strand stoichiometries and orientations were chromatographically determined using thymine-modified complements that increase the overall conjugate size. The intramolecular dimer develops within a DNA scaffold that is founded on three linked duplexes. The high local cluster concentrations and relative strand arrangements again favor the antiparallel dimer for the near-infrared cluster. When the two monomeric DNA/violet cluster conjugates transform to one dimeric DNA/near-infrared conjugate, the DNA strands accumulate silver. We propose that these correlated changes in DNA structure and silver stoichiometry underlie the violet to near-infrared cluster transformation.

  2. Protein-induced bending and DNA cyclization.

    PubMed

    Kahn, J D; Crothers, D M

    1992-07-15

    We have applied T4 ligase-mediated DNA cyclization kinetics to protein-induced bending in DNA. The presence and direction of a static bend can be inferred from J factors for cyclization of 150- to 160-base-pair minicircles, which include a catabolite activator protein binding site phased against a sequence-directed bend. We demonstrate a quasi-thermodynamic linkage between cyclization and protein binding; we find that properly phased DNAs bind catabolite activator protein approximately 200-fold more tightly as circles than as linear molecules. The results unambiguously distinguish DNA bends from isotropically flexible sites and can explain cooperative binding by proteins that need not contact each other.

  3. Base motif recognition and design of DNA templates for fluorescent silver clusters by machine learning.

    PubMed

    Copp, Stacy M; Bogdanov, Petko; Debord, Mark; Singh, Ambuj; Gwinn, Elisabeth

    2014-09-03

    Discriminative base motifs within DNA templates for fluorescent silver clusters are identified using methods that combine large experimental data sets with machine learning tools for pattern recognition. Combining the discovery of certain multibase motifs important for determining fluorescence brightness with a generative algorithm, the probability of selecting DNA templates that stabilize fluorescent silver clusters is increased by a factor of >3.

  4. Differences between hydrodynamic and macromolecule induced clusters in microcapillary flow

    NASA Astrophysics Data System (ADS)

    Wagner, Christian; Claveria, Viviana; Aouane, Othmane; Coupier, Gwennou; Misbah, Chaouqi; Abkarian, Manouk

    2015-03-01

    Recent studies have been shown that despite the large shear rates, the presence of either fibrinogen or the synthetic polymer dextran leads to an enhanced formation of robust clusters of RBC in microcapillaries under flow conditions. The contribution of hydrodynamical interactions and interactions induced by the presence of macromolecules in the cluster formation has not been established. In order to elucidate this mechanism, we compare experimentally in microchannels under flow condition, the pure hydrodynamical cluster formation of RBCs and the cluster formation of RBCs in the presence of macromolecules inducing aggregation. The results reveal strong differences in the cluster morphology. Emphasizing on the case of clusters formed by two cells, the surface to surface interdistances between the cells in the different solutions shows a bimodal distribution. Numerical simulations based on the boundary integral method showed a good agreement with the experimental findings.

  5. Phoresis-induced clustering of particles in turbulence

    NASA Astrophysics Data System (ADS)

    Schmidt, Lukas; Fouxon, Itzhak; Krug, Dominik; van Reeuwijk, Maarten; Holzner, Markus

    2015-11-01

    We demonstrate phoresis-induced clustering of non-inertial particles in turbulent flows. Phoretic mechanisms such as thermophoresis, chemotaxis or diffusiophroesis are known to create a particle drift with respect to the fluid. Theory, based on the framework of weakly compressible flow, predicts that particles in turbulence streaked by salinity gradients experience a diffusiophoretic drift and will thus form particle cluster. An inclined gravity current setup is used to analyse clustering due to the diffusiophoretic effect in turbulent flow experimentally. Simultaneous 3D particle tracking velocimetry and laser induced fluorescent measurements provide the full Lagrangian velocity field and the local salt concentration in the observed 3D domain. Two independent methods show consistent evidence of the theoretically predicted particle clustering in turbulence. This clustering mechanism can provide the key to the understanding of spontaneous clustering phenomena such as the formation of marine snow in the ocean.

  6. Light-Induced Dielectrophoretic Manipulation of DNA

    PubMed Central

    Hoeb, Marco; Rädler, Joachim O.; Klein, Stefan; Stutzmann, Martin; Brandt, Martin S.

    2007-01-01

    Light-induced dielectrophoretic movement of polystyrene beads and λ-DNA is studied using thin films of amorphous hydrogenated silicon as local photoaddressable electrodes with a diameter of 4 μm. Positive (high-field seeking) dielectrophoretic movement is observed for both types of objects. The absence of strong negative (low-field seeking) dielectrophoresis of DNA at high frequencies is in agreement with the similarity of the dielectric constants of DNA and water, the real part of the dielectric function. The corresponding imaginary part of the dielectric function governed by the conductivity of DNA can be determined from a comparison of the frequency dependence of the dielectrophoretic drift velocity with the Clausius-Mossotti relation. PMID:17483160

  7. Cluster analysis for the probability of DSB site induced by electron tracks

    NASA Astrophysics Data System (ADS)

    Yoshii, Y.; Sasaki, K.; Matsuya, Y.; Date, H.

    2015-05-01

    To clarify the influence of bio-cells exposed to ionizing radiations, the densely populated pattern of the ionization in the cell nucleus is of importance because it governs the extent of DNA damage which may lead to cell lethality. In this study, we have conducted a cluster analysis of ionization and excitation events to estimate the number of double-strand breaks (DSBs) induced by electron tracks. A Monte Carlo simulation for electrons in liquid water was performed to determine the spatial location of the ionization and excitation events. The events were divided into clusters by using the density-based spatial clustering of applications with noise (DBSCAN) algorithm. The algorithm enables us to sort out the events into the groups (clusters) in which a minimum number of neighboring events are contained within a given radius. For evaluating the number of DSBs in the extracted clusters, we have introduced an aggregation index (AI). The computational results show that a sub-keV electron produces DSBs in a dense formation more effectively than higher energy electrons. The root-mean square radius (RMSR) of the cluster size is below 5 nm, which is smaller than the chromatin fiber thickness. It was found that this size of clustering events has a high possibility to cause lesions in DNA within the chromatin fiber site.

  8. Double strand-breaks and DNA-to-protein cross-links induced by fast neutrons in bacteriophage DNA.

    PubMed

    Hawkins, R B

    1979-01-01

    Coliphage T7 was suspended in tryptone broth and exposed to a mixture of fast neutrons and gamma radiation. Plaque survival, double strand-breaks and DNA-to-protein cross-linkage were examined and the results compared with those found in phage exposed to gamma radiation alone. Neutral sucrose density sedimentation patterns indicate that neutron-induced double strand-breaks sometimes occur in clusters of more than 100 in the same phage and that the effeciency with which double strand-breaks form is about 50 times that of gamma-induced double strand-breaks. Neutron-induced protein-to-DNA cross-links probably also occur in clusters with enhanced efficiency relative to low LET radiation.

  9. Chromosome thripsis by DNA double strand break clusters causes enhanced cell lethality, chromosomal translocations and 53BP1-recruitment

    PubMed Central

    Schipler, Agnes; Mladenova, Veronika; Soni, Aashish; Nikolov, Vladimir; Saha, Janapriya; Mladenov, Emil; Iliakis, George

    2016-01-01

    Chromosome translocations are hallmark of cancer and of radiation-induced cell killing, reflecting joining of incongruent DNA-ends that alter the genome. Translocation-formation requires DNA end-joining mechanisms and incompletely characterized, permissive chromatin conditions. We show that chromatin destabilization by clusters of DNA double-strand-breaks (DSBs) generated by the I-SceI meganuclease at multiple, appropriately engineered genomic sites, compromises c-NHEJ and markedly increases cell killing and translocation-formation compared to single-DSBs. Translocation-formation from DSB-clusters utilizes Parp1 activity, implicating alt-EJ in their formation. Immunofluorescence experiments show that single-DSBs and DSB-clusters uniformly provoke the formation of single γ-H2AX foci, suggesting similar activation of early DNA damage response (DDR). Live-cell imaging also shows similar single-focus recruitment of the early-response protein MDC1, to single-DSBs and DSB-clusters. Notably, the late DDR protein, 53BP1 shows in live-cell imaging strikingly stronger recruitment to DSB-clusters as compared to single-DSBs. This is the first report that chromatin thripsis, in the form of engineered DSB-clusters, compromises first-line DSB-repair pathways, allowing alt-EJ to function as rescuing-backup. DSB-cluster-formation is indirectly linked to the increased biological effectiveness of high ionization-density radiations, such as the alpha-particles emitted by radon gas or the heavy-ions utilized in cancer therapy. Our observations provide the first direct mechanistic explanation for this long-known effect. PMID:27257076

  10. Induction of DNA strand breaks, base lesions and clustered damage sites in hydrated plasmid DNA films by ultrasoft X rays around the phosphorus K edge.

    PubMed

    Yokoya, Akinari; Cunniffe, Siobhan M T; Watanabe, Ritsuko; Kobayashi, Katsumi; O'Neill, Peter

    2009-09-01

    To characterize the DNA damage induced by K-shell ionization of phosphorus atom in DNA backbone on the level of hydration, the yields of DNA strand breaks and base lesions arising from the interaction of ultrasoft X rays with energies around the phosphorus K edge were determined using dry and fully hydrated pUC18 plasmid DNA samples. Base lesions and bistranded clustered DNA damage sites were revealed by postirradiation treatment with the base excision repair proteins endonuclease III (Nth) and formamidopyrimidine-DNA glycosylase (Fpg). The yield of prompt single-strand breaks (SSBs) with dry DNA irradiated at the phosphorus K resonance energy (2153 eV) is about one-third that below the phosphorus K edge (2147 eV). The yields of prompt double-strand breaks (DSBs) were found to be less dependent on the X-ray energy, with the yields being about two times lower when irradiated at 2153 eV. Heat-labile sites were not produced in detectable amounts. The yields of base lesions were dependent on the energy of the X rays, especially when the DNA was fully hydrated. Bistranded clustered DNA damage sites, revealed enzymatically as additional DSBs, were produced in dry as well as in hydrated DNA with all three energies of X rays. The yields of these enzyme-sensitive sites were also lower when irradiated at the phosphorus K resonance energy. On the other hand, the yields of prompt SSBs and enzyme-sensitive sites for the two off-resonance energies were, larger than those determined previously for gamma radiation. The results indicate that the photoelectric effect caused by X rays and dense ionization and excitation events along the tracks of low-energy secondary electrons are more effective at inducing SSBs and enzyme-sensitive sites. The complex types of damage, prompt and enzymatically induced DSBs, are preferentially induced by phosphorus K resonance at 2153 eV rather than simple SSBs and isolated base lesions, particularly in hydrated conditions. It is concluded that not

  11. Electrophobic interaction induced impurity clustering in metals

    SciTech Connect

    Zhou, Hong-Bo; Wang, Jin-Long; Jiang, W.; Lu, Guang-Hong; Aguiar, J. A.; Liu, Feng

    2016-10-01

    We introduce the concept of electrophobic interaction, analogous to hydrophobic interaction, for describing the behavior of impurity atoms in a metal, a 'solvent of electrons'. We demonstrate that there exists a form of electrophobic interaction between impurities with closed electron shell structure, which governs their dissolution behavior in a metal. Using He, Be and Ar as examples, we predict by first-principles calculations that the electrophobic interaction drives He, Be or Ar to form a close-packed cluster with a clustering energy that follows a universal power-law scaling with the number of atoms (N) dissolved in a free electron gas, as well as W or Al lattice, as Ec is proportional to (N2/3-N). This new concept unifies the explanation for a series of experimental observations of close-packed inert-gas bubble formation in metals, and significantly advances our fundamental understanding and capacity to predict the solute behavior of impurities in metals, a useful contribution to be considered in future material design of metals for nuclear, metallurgical, and energy applications.

  12. Induction and processing of oxidative clustered DNA lesions in 56Fe-ion-irradiated human monocytes.

    PubMed

    Tsao, Doug; Kalogerinis, Peter; Tabrizi, Isla; Dingfelder, Michael; Stewart, Robert D; Georgakilas, Alexandros G

    2007-07-01

    Space and cosmic radiation is characterized by energetic heavy ions of high linear energy transfer (LET). Although both low- and high-LET radiations can create oxidative clustered DNA lesions and double-strand breaks (DSBs), the local complexity of oxidative clustered DNA lesions tends to increase with increasing LET. We irradiated 28SC human monocytes with doses from 0-10 Gy of (56)Fe ions (1.046 GeV/ nucleon, LET = 148 keV/microm) and determined the induction and processing of prompt DSBs and oxidative clustered DNA lesions using pulsed-field gel electrophoresis (PFGE) and Number Average Length Analysis (NALA). The (56)Fe ions produced decreased yields of DSBs (10.9 DSB Gy(-1) Gbp(-1)) and clusters (1 DSB: approximately 0.8 Fpg clusters: approximately 0.7 Endo III clusters: approximately 0.5 Endo IV clusters) compared to previous results with (137)Cs gamma rays. The difference in the relative biological effectiveness (RBE) of the measured and predicted DSB yields may be due to the formation of spatially correlated DSBs (regionally multiply damaged sites) which result in small DNA fragments that are difficult to detect with the PFGE assay. The processing data suggest enhanced difficulty compared with gamma rays in the processing of DSBs but not clusters. At the same time, apoptosis is increased compared to that seen with gamma rays. The enhanced levels of apoptosis observed after exposure to (56)Fe ions may be due to the elimination of cells carrying high levels of persistent DNA clusters that are removed only by cell death and/or "splitting" during DNA replication.

  13. Nanoparticle induced conformational change in DNA and chirality of silver nanoclusters.

    PubMed

    Roy, Sarita; Basak, Soumen; Dasgupta, Anjan Kr

    2010-02-01

    Nano-clusters formed on macromolecular templates carry the symmetry information of the template. Templates with broken symmetry thus lead to formation of asymmetric clusters. In response, such clusters induce a compensatory stress on the embedded template. Silver nanoparticles grown on a covalently closed negatively supercoiled plasmid DNA (pUC19) exhibit chiral behavior and as a reciprocal response, one observes alteration in DNA conformation. The inference was drawn using gel mobility-shift studies in which a silver nanoparticle (but not ions) induces a mobility shift implying a drift from supercoiled to relaxed state of the plasmid. Supporting evidences for such structural alterations were obtained from circular dichroism (CD) and Fourier transform infrared spectroscopy (FT-IR). Silver ion and silver nanoparticles induce differential FT-IR signals reflected in the fingerprint regions 1720, 1666, 1611, 1529 cm(-1) that respectively corresponds to binding in GT, ATGC, C, and AC (A, T, G, and C representing the four nucleotides). Existence of CD signal in the silver plasmon region (350-550 nm) suggests formation of a chiral clustering of nanoparticles. The reciprocal effect on the covalently closed circular (CCC) pUC19 DNA, namely the transition to a relaxed state, can be regarded as a mimicry of the topological enzyme acting on such CCC DNA.

  14. Speciation and DNA barcodes: testing the effects of dispersal on the formation of discrete sequence clusters.

    PubMed

    Papadopoulou, Anna; Bergsten, Johannes; Fujisawa, Tomochika; Monaghan, Michael T; Barraclough, Timothy G; Vogler, Alfried P

    2008-09-27

    Large-scale sequencing of short mtDNA fragments for biodiversity inventories ('DNA barcoding') indicates that sequence variation in animal mtDNA is highly structured and partitioned into discrete genetic clusters that correspond broadly to species-level entities. Here we explore how the migration rate, an important demographic parameter that is directly related to population isolation, might affect variation in the strength of mtDNA clustering among taxa. Patterns of mtDNA variation were investigated in two groups of beetles that both contain lineages occupying habitats predicted to select for different dispersal abilities: predacious diving beetles (Dytiscidae) in the genus Bidessus from lotic and lentic habitats across Europe and darkling beetles (Tenebrionidae) in the genus Eutagenia from sand and other soil types in the Aegean Islands. The degree of genetic clustering was determined using the recently developed 'mixed Yule coalescent' (MYC) model that detects the transition from between-species to within-population branching patterns. Lineages from presumed stable habitats, and therefore displaying lower dispersal ability and migration rates, showed greater levels of mtDNA clustering and geographical subdivision than their close relatives inhabiting ephemeral habitats. Simulations of expected patterns of mtDNA variation under island models showed that MYC clusters are only detected when the migration rates are much lower than the value of Nm=1 typically used to define the threshold for neutral genetic divergence. Therefore, discrete mtDNA clusters provide strong evidence for independently evolving populations or species, but their formation is suppressed even under very low levels of dispersal.

  15. Application of a clustering-based peak alignment algorithm to analyze various DNA fingerprinting data.

    PubMed

    Ishii, Satoshi; Kadota, Koji; Senoo, Keishi

    2009-09-01

    DNA fingerprinting analysis such as amplified ribosomal DNA restriction analysis (ARDRA), repetitive extragenic palindromic PCR (rep-PCR), ribosomal intergenic spacer analysis (RISA), and denaturing gradient gel electrophoresis (DGGE) are frequently used in various fields of microbiology. The major difficulty in DNA fingerprinting data analysis is the alignment of multiple peak sets. We report here an R program for a clustering-based peak alignment algorithm, and its application to analyze various DNA fingerprinting data, such as ARDRA, rep-PCR, RISA, and DGGE data. The results obtained by our clustering algorithm and by BioNumerics software showed high similarity. Since several R packages have been established to statistically analyze various biological data, the distance matrix obtained by our R program can be used for subsequent statistical analyses, some of which were not previously performed but are useful in DNA fingerprinting studies.

  16. Delaying cluster growth of ionotropic induced alginate gelation by oligoguluronate.

    PubMed

    Padoł, Anna Maria; Maurstad, Gjertrud; Draget, Kurt Ingar; Stokke, Bjørn Torger

    2015-11-20

    Alginates form gels in the presence of various divalent ions, such as Ca(2+) that mediate lateral association of chain segments. Various procedures exist that introduce Ca(2+) to yield alginate hydrogels with overall homogeneous or controlled gradients in the concentration profiles. In the present study, the effect of adding oligomers of α-l-guluronic acid (oligoGs) to gelling solutions of alginate was investigated by determination of the cluster growth stimulated by in situ release of Ca(2+). Three different alginate samples varying in fraction of α-l-guluronic acid and molecular weights were employed. The cluster growth was determined for both pure alginates and alginates with two different concentrations of the oligoGs employing dynamic light scattering. The results show that addition of oligoG slows down the cluster growth, the more efficient for the alginates with higher fraction of α-l-guluronic acid, and the higher molecular weight. The efficiency in delaying and slowing the cluster growth induced by added oligoG were discussed in view of the molecular parameters of the alginates. These results show that oligoG can be added to alginate solutions to control the cluster growth and eventually also transition to the gel state. Quantitative relation between the concentration of added oligoG, type and molecular weight of the alginate, and concentration, can be employed as guidelines in tuning alginate cluster growth with specific properties.

  17. Ligand inducible assembly of a DNA tetrahedron.

    PubMed

    Dohno, Chikara; Atsumi, Hiroshi; Nakatani, Kazuhiko

    2011-03-28

    Here we show that a small synthetic ligand can be used as a key building component for DNA nanofabrication. Using naphthyridinecarbamate dimer (NCD) as a molecular glue for DNA hybridization, we demonstrate NCD-triggered formation of a DNA tetrahedron.

  18. Chemically induced magnetism in atomically precise gold clusters.

    PubMed

    Krishna, Katla Sai; Tarakeshwar, Pilarisetty; Mujica, Vladimiro; Kumar, Challa S S R

    2014-03-12

    Comparative theoretical and experimental investigations are reported into chemically induced magnetism in atomically-precise, ligand-stabilized gold clusters Au25 , Au38 and Au55 . The results indicate that [Au25 (PPh3 )10 (SC12 H25 )5 Cl2 ](2+) and Au38 (SC12 H25 )24 are diamagnetic, Au25 (SC2 H4 Ph)18 is paramagnetic, and Au55 (PPh3 )12 Cl6 , is ferromagnetic at room temperature. Understanding the magnetic properties resulting from quantum size effects in such atomically precise gold clusters could lead to new fundamental discoveries and applications.

  19. Glutathione Depletion and Carbon Ion Radiation Potentiate Clustered DNA Lesions, Cell Death and Prevent Chromosomal Changes in Cancer Cells Progeny

    PubMed Central

    Hanot, Maïté; Boivin, Anthony; Malésys, Céline; Beuve, Michaël; Colliaux, Anthony; Foray, Nicolas; Douki, Thierry; Ardail, Dominique; Rodriguez-Lafrasse, Claire

    2012-01-01

    Poor local control and tumor escape are of major concern in head-and-neck cancers treated by conventional radiotherapy or hadrontherapy. Reduced glutathione (GSH) is suspected of playing an important role in mechanisms leading to radioresistance, and its depletion should enable oxidative stress insult, thereby modifying the nature of DNA lesions and the subsequent chromosomal changes that potentially lead to tumor escape. This study aimed to highlight the impact of a GSH-depletion strategy (dimethylfumarate, and l-buthionine sulfoximine association) combined with carbon ion or X-ray irradiation on types of DNA lesions (sparse or clustered) and the subsequent transmission of chromosomal changes to the progeny in a radioresistant cell line (SQ20B) expressing a high endogenous GSH content. Results are compared with those of a radiosensitive cell line (SCC61) displaying a low endogenous GSH level. DNA damage measurements (γH2AX/comet assay) demonstrated that a transient GSH depletion in resistant SQ20B cells potentiated the effects of irradiation by initially increasing sparse DNA breaks and oxidative lesions after X-ray irradiation, while carbon ion irradiation enhanced the complexity of clustered oxidative damage. Moreover, residual DNA double-strand breaks were measured whatever the radiation qualities. The nature of the initial DNA lesions and amount of residual DNA damage were similar to those observed in sensitive SCC61 cells after both types of irradiation. Misrepaired or unrepaired lesions may lead to chromosomal changes, estimated in cell progeny by the cytome assay. Both types of irradiation induced aberrations in nondepleted resistant SQ20B and sensitive SCC61 cells. The GSH-depletion strategy prevented the transmission of aberrations (complex rearrangements and chromosome break or loss) in radioresistant SQ20B only when associated with carbon ion irradiation. A GSH-depleting strategy combined with hadrontherapy may thus have considerable advantage in the

  20. Glutathione depletion and carbon ion radiation potentiate clustered DNA lesions, cell death and prevent chromosomal changes in cancer cells progeny.

    PubMed

    Hanot, Maïté; Boivin, Anthony; Malésys, Céline; Beuve, Michaël; Colliaux, Anthony; Foray, Nicolas; Douki, Thierry; Ardail, Dominique; Rodriguez-Lafrasse, Claire

    2012-01-01

    Poor local control and tumor escape are of major concern in head-and-neck cancers treated by conventional radiotherapy or hadrontherapy. Reduced glutathione (GSH) is suspected of playing an important role in mechanisms leading to radioresistance, and its depletion should enable oxidative stress insult, thereby modifying the nature of DNA lesions and the subsequent chromosomal changes that potentially lead to tumor escape.This study aimed to highlight the impact of a GSH-depletion strategy (dimethylfumarate, and L-buthionine sulfoximine association) combined with carbon ion or X-ray irradiation on types of DNA lesions (sparse or clustered) and the subsequent transmission of chromosomal changes to the progeny in a radioresistant cell line (SQ20B) expressing a high endogenous GSH content. Results are compared with those of a radiosensitive cell line (SCC61) displaying a low endogenous GSH level. DNA damage measurements (γH2AX/comet assay) demonstrated that a transient GSH depletion in resistant SQ20B cells potentiated the effects of irradiation by initially increasing sparse DNA breaks and oxidative lesions after X-ray irradiation, while carbon ion irradiation enhanced the complexity of clustered oxidative damage. Moreover, residual DNA double-strand breaks were measured whatever the radiation qualities. The nature of the initial DNA lesions and amount of residual DNA damage were similar to those observed in sensitive SCC61 cells after both types of irradiation. Misrepaired or unrepaired lesions may lead to chromosomal changes, estimated in cell progeny by the cytome assay. Both types of irradiation induced aberrations in nondepleted resistant SQ20B and sensitive SCC61 cells. The GSH-depletion strategy prevented the transmission of aberrations (complex rearrangements and chromosome break or loss) in radioresistant SQ20B only when associated with carbon ion irradiation. A GSH-depleting strategy combined with hadrontherapy may thus have considerable advantage in the

  1. DNA-PK is Involved in Repairing a Transient Surge of DNA BreaksInduced by Deceleration of DNA Replication.

    SciTech Connect

    Shimura, Tsutomu; Martin, Melvenia M.; Torres, Michael J.; Gu,Cory; Pluth, Janice M.; DiBernardi, Maria A.; McDonald, Jeffrey S.; Aladjem, Mirit I.

    2006-09-25

    ells that suffer substantial inhibition of DNA replication halt their cell cycle via a checkpoint response mediated by the PI3 kinases ATM and ATR. It is unclear how cells cope with milder replication insults, which are under the threshold for ATM and ATR activation. A third PI3 kinase, DNA-dependent protein kinase (DNA-PK), is also activated following replication inhibition, but the role DNA-PK might play in response to perturbed replication is unclear, since this kinase does not activate the signaling cascades involved in the S-phase checkpoint. Here we report that mild, transient drug-induced perturbation of DNA replication rapidly induced DNA breaks that promptly disappeared in cells that contained a functional DNA-PK whereas such breaks persisted in cells that were deficient in DNA-PK activity. After the initial transient burst of DNA breaks, cells with a functional DNA-PK did not halt replication and continued to synthesize DNA at a slow pace in the presence of replication inhibitors. In contrast, DNA-PK deficient cells subject to low levels of replication inhibition halted cell cycle progression via an ATR-mediated S-phase checkpoint. The ATM kinase was dispensable for the induction of the initial DNA breaks. These observations suggest that DNA-PK is involved in setting a high threshold for the ATR-Chkl-mediated S-phase checkpoint by promptly repairing DNA breaks that appear immediately following inhibition of DNA replication.

  2. Structural changes of linear DNA molecules induced by cisplatin

    SciTech Connect

    Liu, Zhiguo; Liu, Ruisi; Zhou, Zhen; Zu, Yuangang; Xu, Fengjie

    2015-02-20

    Interaction between long DNA molecules and activated cisplatin is believed to be crucial to anticancer activity. However, the exact structural changes of long DNA molecules induced by cisplatin are still not very clear. In this study, structural changes of long linear double-stranded DNA (dsDNA) and short single-stranded DNA (ssDNA) induced by activated cisplatin have been investigated by atomic force microscopy (AFM). The results indicated that long DNA molecules gradually formed network structures, beads-on-string structures and their large aggregates. Electrostatic and coordination interactions were considered as the main driving forces producing these novel structures. An interesting finding in this study is the beads-on-string structures. Moreover, it is worth noting that the beads-on-string structures were linked into the networks, which can be ascribed to the strong DNA–DNA interactions. This study expands our knowledge of the interactions between DNA molecules and cisplatin. - Highlights: • We investigate structural changes of dsDNA and ssDNA induced by cisplatin. • AFM results indicated long dsDNA formed network, beads-on-string and aggregates. • ssDNA can form very similar structures as those of long linear dsDNA. • A possible formation process of theses novel structure is proposed.

  3. A measure of DNA sequence similarity by Fourier Transform with applications on hierarchical clustering.

    PubMed

    Yin, Changchuan; Chen, Ying; Yau, Stephen S-T

    2014-10-21

    Multiple sequence alignment (MSA) is a prominent method for classification of DNA sequences, yet it is hampered with inherent limitations in computational complexity. Alignment-free methods have been developed over past decade for more efficient comparison and classification of DNA sequences than MSA. However, most alignment-free methods may lose structural and functional information of DNA sequences because they are based on feature extractions. Therefore, they may not fully reflect the actual differences among DNA sequences. Alignment-free methods with information conservation are needed for more accurate comparison and classification of DNA sequences. We propose a new alignment-free similarity measure of DNA sequences using the Discrete Fourier Transform (DFT). In this method, we map DNA sequences into four binary indicator sequences and apply DFT to the indicator sequences to transform them into frequency domain. The Euclidean distance of full DFT power spectra of the DNA sequences is used as similarity distance metric. To compare the DFT power spectra of DNA sequences with different lengths, we propose an even scaling method to extend shorter DFT power spectra to equal the longest length of the sequences compared. After the DFT power spectra are evenly scaled, the DNA sequences are compared in the same DFT frequency space dimensionality. We assess the accuracy of the similarity metric in hierarchical clustering using simulated DNA and virus sequences. The results demonstrate that the DFT based method is an effective and accurate measure of DNA sequence similarity.

  4. Radiation-induced degradation of DNA bases

    NASA Astrophysics Data System (ADS)

    Douki, T.; Delatour, T.; Martini, R.; Cadet, J.

    1999-01-01

    Radio-induced degradation of DNA involves radical processes. A series of lesions among the major bases degradation products has been measured in isolated DNA exposed to gamma radiation in aerated aqueous solution. Degradation can be accounted for by the formation of hydroxyl radicals upon radiolysis of water (indirect effect). The four bases are degraded in high yield. Direct effect has been mimicked by photo-induced electron abstraction from the bases producing their radical cation. Quantification of the modified bases showed that guanine is the preferential target. This can be explained by its lower oxidation potential and charge transfer phenomena. La décomposition radio-induite de l'ADN fait intervenir des processus radicalaires. Une série de lésions choisies parmi les produits majeurs de dégradation des bases a été mesurée dans de l'ADN isolé exposé au rayonnement en solution aqueuse aérée. Les modifications sont alors dues aux radicaux hydroxyles produits par la radiolyse de l'eau (effet indirect) et les quatre bases sont efficacement dégradées. L'arrachement d'électrons aux bases par photosensibilisation pour produire leur radical cation, a été utilisé comme modèle de l'effet direct. La quantification des bases modifiées montre que la guanine est préférentiellement dégradée. Cette observation peut s'expliquer par le plus faible potentiel d'oxydation de cette base ainsi que par les phénomènes de transfert de charge vers les guanines.

  5. Influence of the geometrical detail in the description of DNA and the scoring method of ionization clustering on nanodosimetric parameters of track structure: a Monte Carlo study using Geant4-DNA.

    PubMed

    Bueno, M; Schulte, R; Meylan, S; Villagrasa, C

    2015-11-07

    The aim of this study was to evaluate the influence of the geometrical detail of the DNA on nanodosimetric parameters of track structure induced by protons and alpha particles of different energies (LET values ranging from 1 to 162.5 keV µm-1) as calculated by Geant4-DNA Monte Carlo simulations.The first geometry considered consisted of a well-structured placement of a realistic description of the DNA double helix wrapped around cylindrical histones (GeomHist) forming a 18 kbp-long chromatin fiber. In the second geometry considered, the DNA was modeled as a total of 1800 ten bp-long homogeneous cylinders (2.3 nm diameter and 3.4 nm height) placed in random positions and orientations (GeomCyl). As for GeomHist, GeomCyl contained a DNA material equivalent to 18 kbp. Geant4-DNA track structure simulations were performed and ionizations were counted in the scoring volumes. For GeomCyl, clusters were defined as the number of ionizations (ν) scored in each 10 bp-long cylinder. For GeomHist, clusters of ionizations scored in the sugar-phosphate groups of the double-helix were revealed by the DBSCAN clustering algorithm according to a proximity criteria among ionizations separated by less than 10 bp. The topology of the ionization clusters formed using GeomHist and GeomCyl geometries were compared in terms of biologically relevant nanodosimetric quantities.The discontinuous modeling of the DNA for GeomCyl led to smaller cluster sizes than for GeomHist. The continuous modeling of the DNA molecule for GeomHist allowed the merging of ionization points by the DBSCAN algorithm giving rise to larger clusters, which were not detectable within the GeomCyl geometry. Mean cluster size (m1) was found to be of the order of 10% higher for GeomHist compared to GeomCyl for LET < 15 keV µm-1. For higher LETs, the difference increased with LET similarly for protons and alpha particles. Both geometries showed the same relationship between m1 and the cumulative relative frequency of

  6. Influence of the geometrical detail in the description of DNA and the scoring method of ionization clustering on nanodosimetric parameters of track structure: a Monte Carlo study using Geant4-DNA

    NASA Astrophysics Data System (ADS)

    Bueno, M.; Schulte, R.; Meylan, S.; Villagrasa, C.

    2015-11-01

    The aim of this study was to evaluate the influence of the geometrical detail of the DNA on nanodosimetric parameters of track structure induced by protons and alpha particles of different energies (LET values ranging from 1 to 162.5~\\text{keV}~μ {{\\text{m}}-1} ) as calculated by Geant4-DNA Monte Carlo simulations. The first geometry considered consisted of a well-structured placement of a realistic description of the DNA double helix wrapped around cylindrical histones (GeomHist) forming a 18 kbp-long chromatin fiber. In the second geometry considered, the DNA was modeled as a total of 1800 ten bp-long homogeneous cylinders (2.3 nm diameter and 3.4 nm height) placed in random positions and orientations (GeomCyl). As for GeomHist, GeomCyl contained a DNA material equivalent to 18 kbp. Geant4-DNA track structure simulations were performed and ionizations were counted in the scoring volumes. For GeomCyl, clusters were defined as the number of ionizations (ν) scored in each 10 bp-long cylinder. For GeomHist, clusters of ionizations scored in the sugar-phosphate groups of the double-helix were revealed by the DBSCAN clustering algorithm according to a proximity criteria among ionizations separated by less than 10 bp. The topology of the ionization clusters formed using GeomHist and GeomCyl geometries were compared in terms of biologically relevant nanodosimetric quantities. The discontinuous modeling of the DNA for GeomCyl led to smaller cluster sizes than for GeomHist. The continuous modeling of the DNA molecule for GeomHist allowed the merging of ionization points by the DBSCAN algorithm giving rise to larger clusters, which were not detectable within the GeomCyl geometry. Mean cluster size (m1) was found to be of the order of 10% higher for GeomHist compared to GeomCyl for LET <15~\\text{keV}~μ {{\\text{m}}-1} . For higher LETs, the difference increased with LET similarly for protons and alpha particles. Both geometries showed the same relationship

  7. Collision-induced dissociation of protonated water clusters

    NASA Astrophysics Data System (ADS)

    Berthias, F.; Buridon, V.; Abdoul-Carime, H.; Farizon, B.; Farizon, M.; Dinh, P. M.; Reinhard, P.-G.; Suraud, E.; Märk, T. D.

    2014-06-01

    Collision-induced dissociation (CID) has been studied for protonated water clusters H+(H2O)n, with n = 2-8, colliding with argon atoms at a laboratory energy of 8 keV. The experimental data have been taken with an apparatus (Device for Irradiation of Molecular Clusters, `Dispositif d'Irradiation d'Agrégats Moléculaire,' DIAM) that has been recently constructed at the Institut de Physique Nucléaire de Lyon. It includes an event-by-event mass spectrometry detection technique, COINTOF (correlated ion and neutral fragment time of flight). The latter device allows, for each collision event, to detect and identify in a correlated manner all produced neutral and charged fragments. For all the studied cluster ions, it has allowed us to identify branching ratios for the loss of i = 1 to i = n water molecules, leading to fragment ions ranging from H+(H2O)i=n-1 all the way down to the production of protons. Using a corresponding calibration technique we determine total charged fragment production cross sections for incident protonated water clusters H+(H2O)n, with n = 2-7. Observed trends for branching ratios and cross sections, and a comparison with earlier data on measured attenuation cross sections for water clusters colliding with other noble gases (He and Xe), give insight into the underlying dissociation mechanisms.

  8. The role of a basic amino acid cluster in target site selection and non-specific binding of bZIP peptides to DNA.

    PubMed Central

    Metallo, S J; Paolella, D N; Schepartz, A

    1997-01-01

    The ability of a transcription factor to locate and bind its cognate DNA site in the presence of closely related sites and a vast array of non-specific DNA is crucial for cell survival. The CREB/ATF family of transcription factors is an important group of basic region leucine zipper (bZIP) proteins that display high affinity for the CRE site and low affinity for the closely related AP-1 site. Members of the CREB/ATF family share in common a cluster of basic amino acids at the N-terminus of their bZIP element. This basic cluster is necessary and sufficient to cause the CRE site to bend upon binding of a CREB/ATF protein. The possibility that DNA bending and CRE/AP-1 specificity were linked in CREB/ATF proteins was investigated using chimeric peptides derived from human CRE-BP1 (a member of the CREB/ATF family) and yeast GCN4, which lacks both a basic cluster and CRE/AP-1 specificity. Gain of function and loss of function experiments demonstrated that the basic cluster was not responsible for the CRE/AP-1 specificity displayed by all characterized CREB/ATF proteins. The basic cluster was, however, responsible for inducing very high affinity for non- specific DNA. It was further shown that basic cluster-containing peptides bind non-specific DNA in a random coil conformation. We postulate that the high non- specific DNA affinities of basic cluster-containing peptides result from cooperative electrostatic interactions with the phosphate backbone that do not require peptide organization. PMID:9224594

  9. UV and ionizing radiations induced DNA damage, differences and similarities

    NASA Astrophysics Data System (ADS)

    Ravanat, Jean-Luc; Douki, Thierry

    2016-11-01

    Both UV and ionizing radiations damage DNA. Two main mechanisms, so-called direct and indirect pathways, are involved in the degradation of DNA induced by ionizing radiations. The direct effect of radiation corresponds to direct ionization of DNA (one electron ejection) whereas indirect effects are produced by reactive oxygen species generated through water radiolysis, including the highly reactive hydroxyl radicals, which damage DNA. UV (and visible) light damages DNA by again two distinct mechanisms. UVC and to a lesser extend UVB photons are directly absorbed by DNA bases, generating their excited states that are at the origin of the formation of pyrimidine dimers. UVA (and visible) light by interaction with endogenous or exogenous photosensitizers induce the formation of DNA damage through photosensitization reactions. The excited photosensitizer is able to induce either a one-electron oxidation of DNA (type I) or to produce singlet oxygen (type II) that reacts with DNA. In addition, through an energy transfer from the excited photosensitizer to DNA bases (sometime called type III mechanism) formation of pyrimidine dimers could be produced. Interestingly it has been shown recently that pyrimidine dimers are also produced by direct absorption of UVA light by DNA, even if absorption of DNA bases at these wavelengths is very low. It should be stressed that some excited photosensitizers (such as psoralens) could add directly to DNA bases to generate adducts. The review will described the differences and similarities in terms of damage formation (structure and mechanisms) between these two physical genotoxic agents.

  10. Inflammation-induced formation of fat-associated lymphoid clusters

    PubMed Central

    Bénézech, Cécile; Kruglov, Andrei A.; Loo, Yunhua; Nakamura, Kyoko; Zhang, Yang; Nayar, Saba; Jones, Lucy H.; Flores-Langarica, Adriana; McIntosh, Alistair; Marshall, Jennifer; Barone, Francesca; Besra, Gurdyal; Miles, Katherine; Allen, Judith E.; Gray, Mohini; Kollias, George; Cunningham, Adam F.; Withers, David R.; Toellner, Kai Michael; Jones, Nick D.; Veldhoen, Marc; Nedospasov, Sergei A.; McKenzie, Andrew N.J.; Caamaño, Jorge H.

    2015-01-01

    Fat-associated lymphoid clusters (FALCs) are a recently discovered type of lymphoid tissue associated with visceral fat. Here we show that distribution of FALCs was heterogeneous with the pericardium containing large numbers of these clusters. FALCs contributed to the retention of B-1 B cells in the peritoneal cavity through high expression of the chemokine CXCL13 and supported B cell proliferation and germinal center differentiation during peritoneal immune challenges. FALC formation was induced by inflammation, which triggered recruitment of myeloid cells that express tumor necrosis factor (TNF) necessary for TNF receptor-signaling in stromal cells. CD1d-restricted Natural killer T (NKT) cells were likewise required for inducible formation of FALCs. Thus, FALCs support and coordinate innate B and T cell activation during serosal immune responses. PMID:26147686

  11. Acrylonitrile-induced oxidative DNA damage in rat astrocytes.

    PubMed

    Pu, Xinzhu; Kamendulis, Lisa M; Klaunig, James E

    2006-10-01

    Chronic administration of acrylonitrile results in a dose-related increase in astrocytomas in rat brain, but the mechanism of acrylonitrile carcinogenicity is not fully understood. The potential of acrylonitrile or its metabolites to induce direct DNA damage as a mechanism for acrylonitrile carcinogenicity has been questioned, and recent studies indicate that the mechanism involves the induction of oxidative stress in rat brain. The present study examined the ability of acrylonitrile to induce DNA damage in the DI TNC1 rat astrocyte cell line using the alkaline Comet assay. Oxidized DNA damage also was evaluated using formamidopyrimidine DNA glycosylase treatment in the modified Comet assay. No increase in direct DNA damage was seen in astrocytes exposed to sublethal concentrations of acrylonitrile (0-1.0 mM) for 24 hr. However, acrylonitrile treatment resulted in a concentration-related increase in oxidative DNA damage after 24 hr. Antioxidant supplementation in the culture media (alpha-tocopherol, (-)-epigallocathechin-3 gallate, or trolox) reduced acrylonitrile-induced oxidative DNA damage. Depletion of glutathione using 0.1 mM DL-buthionine-[S,R]-sulfoximine increased acrylonitrile-induced oxidative DNA damage (22-46%), while cotreatment of acrylonitrile with 2.5 mM L-2-oxothiazolidine-4-carboxylic acid, a precursor for glutathione biosynthesis, significantly reduced acrylonitrile-induced oxidative DNA damage (7-47%). Cotreatment of acrylonitrile with 0.5 mM 1-aminobenzotriazole, a suicidal inhibitor of cytochrome P450, prevented the oxidative DNA damage produced by acrylonitrile. Cyanide (0.1-0.5 mM) increased oxidative DNA damage (44-160%) in astrocytes. These studies demonstrate that while acrylonitrile does not directly damage astrocyte DNA, it does increase oxidative DNA damage. The oxidative DNA damage following acrylonitrile exposure appears to arise mainly through the P450 metabolic pathway; moreover, glutathione depletion may contribute to the

  12. Crystal structure of Mycobacterium tuberculosis O6-methylguanine-DNA methyltransferase protein clusters assembled on to damaged DNA.

    PubMed

    Miggiano, Riccardo; Perugino, Giuseppe; Ciaramella, Maria; Serpe, Mario; Rejman, Dominik; Páv, Ondřej; Pohl, Radek; Garavaglia, Silvia; Lahiri, Samarpita; Rizzi, Menico; Rossi, Franca

    2016-01-15

    Mycobacterium tuberculosis O(6)-methylguanine-DNA methyltransferase (MtOGT) contributes to protect the bacterial GC-rich genome against the pro-mutagenic potential of O(6)-methylated guanine in DNA. Several strains of M. tuberculosis found worldwide encode a point-mutated O(6)-methylguanine-DNA methyltransferase (OGT) variant (MtOGT-R37L), which displays an arginine-to-leucine substitution at position 37 of the poorly functionally characterized N-terminal domain of the protein. Although the impact of this mutation on the MtOGT activity has not yet been proved in vivo, we previously demonstrated that a recombinant MtOGT-R37L variant performs a suboptimal alkylated-DNA repair in vitro, suggesting a direct role for the Arg(37)-bearing region in catalysis. The crystal structure of MtOGT complexed with modified DNA solved in the present study reveals details of the protein-protein and protein-DNA interactions occurring during alkylated-DNA binding, and the protein capability also to host unmodified bases inside the active site, in a fully extrahelical conformation. Our data provide the first experimental picture at the atomic level of a possible mode of assembling three adjacent MtOGT monomers on the same monoalkylated dsDNA molecule, and disclose the conformational flexibility of discrete regions of MtOGT, including the Arg(37)-bearing random coil. This peculiar structural plasticity of MtOGT could be instrumental to proper protein clustering at damaged DNA sites, as well as to protein-DNA complexes disassembling on repair.

  13. Mitochondrial DNA exhibits resistance to induced point and deletion mutations

    PubMed Central

    Valente, William J.; Ericson, Nolan G.; Long, Alexandra S.; White, Paul A.; Marchetti, Francesco; Bielas, Jason H.

    2016-01-01

    The accumulation of somatic mitochondrial DNA (mtDNA) mutations contributes to the pathogenesis of human disease. Currently, mitochondrial mutations are largely considered results of inaccurate processing of its heavily damaged genome. However, mainly from a lack of methods to monitor mtDNA mutations with sufficient sensitivity and accuracy, a link between mtDNA damage and mutation has not been established. To test the hypothesis that mtDNA-damaging agents induce mtDNA mutations, we exposed MutaTMMouse mice to benzo[a]pyrene (B[a]P) or N-ethyl-N-nitrosourea (ENU), daily for 28 consecutive days, and quantified mtDNA point and deletion mutations in bone marrow and liver using our newly developed Digital Random Mutation Capture (dRMC) and Digital Deletion Detection (3D) assays. Surprisingly, our results demonstrate mutagen treatment did not increase mitochondrial point or deletion mutation frequencies, despite evidence both compounds increase nuclear DNA mutations and demonstrated B[a]P adduct formation in mtDNA. These findings contradict models of mtDNA mutagenesis that assert the elevated rate of mtDNA mutation stems from damage sensitivity and abridged repair capacity. Rather, our results demonstrate induced mtDNA damage does not readily convert into mutation. These findings suggest robust mitochondrial damage responses repress induced mutations after mutagen exposure. PMID:27550180

  14. Emerging critical roles of Fe-S clusters in DNA replication and repair

    PubMed Central

    Fuss, Jill O.; Tsai, Chi-Lin; Ishida, Justin P.; Tainer, John A.

    2015-01-01

    Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life – the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. PMID:25655665

  15. Emerging critical roles of Fe-S clusters in DNA replication and repair.

    PubMed

    Fuss, Jill O; Tsai, Chi-Lin; Ishida, Justin P; Tainer, John A

    2015-06-01

    Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life - the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. This article is part of a Special Issue entitled: Fe/S proteins: Analysis, structure, function, biogenesis and diseases.

  16. Cloning, sequencing and analysis of dnaK -dnaJ gene cluster of Bacillus megaterium.

    PubMed

    Bao, Fangming; Gong, Lei; Shao, Weilan

    2008-12-01

    The DNA fragment of heat shock genes (hrcA-grpE-dnaK-dnaJ) containing complete hrcA-grpE-dnaK operon and the transcription unit of dnaJ was cloned, sequensed and analyzed from Bacillus megaterium RF5. The sequence of hrcA, grpE and dnaJ were first time reported, and their coding products exibit 60%, 63% and 81% of identities to the homologs of B. subtilis. A sigmaA-type promoter of Gram-positive bacteria (PA1) and a terminator were located upstream of the hrcA and downstream of dnaK, and a Controlling inverted repeat of chaperone expression element (CIRCE) was identified between PA1 and hrcA. Another sigmaA-type promoter (PA2) and a terminator were found upstream and downstream of dnaJ, indicating B. megaterium has a transcription unit containing a single gene dnaJ. The structure of dnaJ transcription unit is more similar to that of Listeria monocytogenes than other species of Bacillus. A partial protein-based phylogenetic tree, derived from Gram-positive bacteria using HrcA sequence, indicated a closer phylogenetic relationship between B. megaterium and Geobacillus species than other two Bacillus species.

  17. Oxidatively induced DNA damage and its repair in cancer.

    PubMed

    Dizdaroglu, Miral

    2015-01-01

    Oxidatively induced DNA damage is caused in living organisms by endogenous and exogenous reactive species. DNA lesions resulting from this type of damage are mutagenic and cytotoxic and, if not repaired, can cause genetic instability that may lead to disease processes including carcinogenesis. Living organisms possess DNA repair mechanisms that include a variety of pathways to repair multiple DNA lesions. Mutations and polymorphisms also occur in DNA repair genes adversely affecting DNA repair systems. Cancer tissues overexpress DNA repair proteins and thus develop greater DNA repair capacity than normal tissues. Increased DNA repair in tumors that removes DNA lesions before they become toxic is a major mechanism for development of resistance to therapy, affecting patient survival. Accumulated evidence suggests that DNA repair capacity may be a predictive biomarker for patient response to therapy. Thus, knowledge of DNA protein expressions in normal and cancerous tissues may help predict and guide development of treatments and yield the best therapeutic response. DNA repair proteins constitute targets for inhibitors to overcome the resistance of tumors to therapy. Inhibitors of DNA repair for combination therapy or as single agents for monotherapy may help selectively kill tumors, potentially leading to personalized therapy. Numerous inhibitors have been developed and are being tested in clinical trials. The efficacy of some inhibitors in therapy has been demonstrated in patients. Further development of inhibitors of DNA repair proteins is globally underway to help eradicate cancer.

  18. Substitutions of short heterologous DNA segments of intragenomic or extragenomic origins produce clustered genomic polymorphisms

    PubMed Central

    Harms, Klaus; Lunnan, Asbjørn; Hülter, Nils; Mourier, Tobias; Vinner, Lasse; Andam, Cheryl P.; Marttinen, Pekka; Fridholm, Helena; Hansen, Anders Johannes; Hanage, William P.; Nielsen, Kaare Magne; Willerslev, Eske; Johnsen, Pål Jarle

    2016-01-01

    In a screen for unexplained mutation events we identified a previously unrecognized mechanism generating clustered DNA polymorphisms such as microindels and cumulative SNPs. The mechanism, short-patch double illegitimate recombination (SPDIR), facilitates short single-stranded DNA molecules to invade and replace genomic DNA through two joint illegitimate recombination events. SPDIR is controlled by key components of the cellular genome maintenance machinery in the gram-negative bacterium Acinetobacter baylyi. The source DNA is primarily intragenomic but can also be acquired through horizontal gene transfer. The DNA replacements are nonreciprocal and locus independent. Bioinformatic approaches reveal occurrence of SPDIR events in the gram-positive human pathogen Streptococcus pneumoniae and in the human genome. PMID:27956618

  19. DNA induced chirality and helical twist in achiral liquid crystals

    NASA Astrophysics Data System (ADS)

    Garvey, Alfred; Basu, Rajratan; Kinnamon, Daniel

    A small quantity of DNA sample (Deoxyribonucleic acid -cellulose double-stranded from calf thymus DNA in lyophilized powder form) was doped in an achiral liquid crystal (LC), and the mixture was found to exhibit a weak degree of chirality. The induced chirality in the LC was probed by means of the electroclinic effect in the LC's smectic-A phase, which showed significant pretransitional behavior on approaching the smectic- A-smectic- C transition temperature from above. The same DNA was doped in an achiral nematic LC and the mixture was found to exhibit an average mechanical twist over macroscopic dimensions. The double-stranded DNA-induced chiral pitch length P was determined by measuring the radius of curvature of reverse twist disclination lines in 90o nematic twist cells. In the LC +DNA mixture, the LC's benzene rings interact with the nucleobases of the DNA through π - π stacking, which induces a molecular conformational deracemization in the LC.

  20. Mitochondrial DNA damage by bleomycin induces AML cell death.

    PubMed

    Yeung, ManTek; Hurren, Rose; Nemr, Carine; Wang, Xiaoming; Hershenfeld, Samantha; Gronda, Marcela; Liyanage, Sanduni; Wu, Yan; Augustine, Jeevan; Lee, Eric A; Spagnuolo, Paul A; Southall, Noel; Chen, Catherine; Zheng, Wei; Jeyaraju, Danny V; Minden, Mark D; Laposa, Rebecca; Schimmer, Aaron D

    2015-06-01

    Mitochondria contain multiple copies of their own 16.6 kb circular genome. To explore the impact of mitochondrial DNA (mtDNA) damage on mitochondrial (mt) function and viability of AML cells, we screened a panel of DNA damaging chemotherapeutic agents to identify drugs that could damage mtDNA. We identified bleomycin as an agent that damaged mtDNA in AML cells at concentrations that induced cell death. Bleomycin also induced mtDNA damage in primary AML samples. Consistent with the observed mtDNA damage, bleomycin reduced mt mass and basal oxygen consumption in AML cells. We also demonstrated that the observed mtDNA damage was functionally important for bleomycin-induced cell death. Finally, bleomycin delayed tumor growth in xenograft mouse models of AML and anti-leukemic concentrations of the drug induced mtDNA damage in AML cells preferentially over normal lung tissue. Taken together, mtDNA-targeted therapy may be an effective strategy to target AML cells and bleomycin could be useful in the treatment of this disease.

  1. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  2. Induced DNA repair pathway in mammalian cells

    SciTech Connect

    Overberg, R.

    1985-01-01

    The survival of cultured rat kangaroo cells (PtK-2) and human xeroderma pigmentosum cells incubated with 5 ..mu..M cycloheximide subsequent to ultraviolet irradiation is lower than that of cells incubated without cycloheximide. The drop in survival is considerably larger than that produced by incubation of unirradiated cells with cycloheximide. The phenomenon was also observed when PtK-2 cells were incubated with emetine, another protein synthesis inhibitor, or with 5,6-dichloro-1-..beta..-D-ribofuranosylbenzimidazole, a RNA synthesis inhibitor. PtK cells which received a preliminary UV treatment followed by an incubation period without cycloheximide and then a second irradiation and 24 hour incubation with cycloheximide, survived the effects of the second irradiation better than cells which were incubated in the presence of cycloheximide after the first and second UV irradiation. The application of cycloheximide for 24 hours after UV irradiation of PtK cells resulted in one-half as many 6-thioguanine resistant cells as compared to the number of 6-thioguanine resistant cells found when cycloheximide was not used. These experiments indicate that a UV-inducible cycloheximide-sensitive DNA repair pathway is present in PtK and xeroderma pigmentosum cells, which is error-prone in PtK cells.

  3. Mechanism of site-specific DNA damage induced by ozone.

    PubMed

    Ito, Kimiko; Inoue, Sumiko; Hiraku, Yusuke; Kawanishi, Shosuke

    2005-08-01

    Ozone has been shown to induce lung tumors in mice. The reactivity of ozone with DNA in an aqueous solution was investigated by a DNA sequencing technique using 32P-labeled DNA fragments. Ozone induced cleavages in the deoxyribose-phosphate backbone of double-stranded DNA, which were reduced by hydroxyl radical scavengers, suggesting the participation of hydroxyl radicals in the cleavages. The ozone-induced DNA cleavages were enhanced with piperidine treatment, which induces cleavages at sites of base modification, but the inhibitory effect of hydroxyl radical scavengers on the piperidine-induced cleavages was limited. Main piperidine-labile sites were guanine and thymine residues. Cleavages at some guanine and thymine residues after piperidine treatment became more predominant with denatured single-stranded DNA. Exposure of calf thymus DNA to ozone resulted in a dose-dependent increase of the 8-oxo-7,8-dihydro-2'-deoxyguanosine formation, which was partially inhibited by hydroxyl radical scavengers. ESR studies using 5,5-dimethylpyrroline-N-oxide (DMPO) showed that aqueous ozone produced the hydroxyl radical adduct of DMPO. In addition, the fluorescein-dependent chemiluminescence was detected during the decomposition of ozone in a buffer solution and the enhancing effect of D2O was observed, suggesting the formation of singlet oxygen. However, no or little enhancing effect of D2O on the ozone-induced DNA damage was observed. These results suggest that DNA backbone cleavages were caused by ozone via the production of hydroxyl radicals, while DNA base modifications were mainly caused by ozone itself and the participation of hydroxyl radicals and/or singlet oxygen in base modifications is small, if any. A possible link of ozone-induced DNA damage to inflammation-associated carcinogenesis as well as air pollution-related carcinogenesis is discussed.

  4. Transcriptional pausing and stalling causes multiple clustered mutations by human activation-induced deaminase

    PubMed Central

    Canugovi, Chandrika; Samaranayake, Mala; Bhagwat, Ashok S.

    2009-01-01

    Transcription of the rearranged immunoglobulin gene and expression of the enzyme activation-induced deaminase (AID) are essential for somatic hypermutations of this gene during antibody maturation. While AID acts as a single-strand DNA-cytosine deaminase creating U · G mispairs that lead to mutations, the role played by transcription in this process is less clear. We have used in vitro transcription of the kan gene by the T7 RNA polymerase (RNAP) in the presence of AID and a genetic reversion assay for kanamycin-resistance to investigate the causes of multiple clustered mutations (MCMs) during somatic hypermutations. We find that, depending on transcription conditions, AID can cause single-base substitutions or MCMs. When wild-type RNAP is used for transcription at physiologically relevant concentrations of ribonucleoside triphosphates (NTPs), few MCMs are found. In contrast, slowing the rate of elongation by reducing the NTP concentration or using a mutant RNAP increases several-fold the percent of revertants containing MCMs. Arresting the elongation complexes by a quick removal of NTPs leads to formation of RNA-DNA hybrids (R-loops). Treatment of these structures with AID results in a high percentage of KanR revertants with MCMs. Furthermore, selecting for transcription elongation complexes stalled near the codon that suffers mutations during acquisition of kanamycin-resistance results in an overwhelming majority of revertants with MCMs. These results show that if RNAP II pauses or stalls during transcription of immunoglobulin gene, AID is likely to promote MCMs. As changes in physiological conditions such as occurrence of certain DNA primary or secondary structures or DNA adducts are known to cause transcriptional pausing and stalling in mammalian cells, this process may cause MCMs during somatic hypermutation.—Canugovi, C., Samaranayake, M., Bhagwat, A. S. Transcriptional pausing and stalling causes multiple clustered mutations by human activation-induced

  5. Oxidant-induced DNA damage of target cells.

    PubMed Central

    Schraufstätter, I; Hyslop, P A; Jackson, J H; Cochrane, C G

    1988-01-01

    In this study we examined the leukocytic oxidant species that induce oxidant damage of DNA in whole cells. H2O2 added extracellularly in micromolar concentrations (10-100 microM) induced DNA strand breaks in various target cells. The sensitivity of a specific target cell was inversely correlated to its catalase content and the rate of removal of H2O2 by the target cell. Oxidant species produced by xanthine oxidase/purine or phorbol myristate acetate-stimulated monocytes induced DNA breakage of target cells in proportion to the amount of H2O2 generated. These DNA strand breaks were prevented by extracellular catalase, but not by superoxide dismutase. Cytotoxic doses of HOCl, added to target cells, did not induce DNA strand breakage, and myeloperoxidase added extracellularly in the presence of an H2O2-generating system, prevented the formation of DNA strand breaks in proportion to its H2O2 degrading capacity. The studies also indicated that H2O2 formed hydroxyl radical (.OH) intracellularly, which appeared to be the most likely free radical responsible for DNA damage: .OH was detected in cells exposed to H2O2; the DNA base, deoxyguanosine, was hydroxylated in cells exposed to H2O2; and intracellular iron was essential for induction of DNA strand breaks. PMID:2843565

  6. Prescribed nanoparticle cluster architectures and low-dimensional arrays built using octahedral DNA origami frames

    SciTech Connect

    Tian, Ye; Wang, Tong; Liu, Wenyan; Xin, Huolin L.; Li, Huilin; Ke, Yonggang; Shih, William M.; Gang, Oleg

    2015-05-25

    Three-dimensional mesoscale clusters that are formed from nanoparticles spatially arranged in pre-determined positions can be thought of as mesoscale analogues of molecules. These nanoparticle architectures could offer tailored properties due to collective effects, but developing a general platform for fabricating such clusters is a significant challenge. Here, we report a strategy for assembling 3D nanoparticle clusters that uses a molecular frame designed with encoded vertices for particle placement. The frame is a DNA origami octahedron and can be used to fabricate clusters with various symmetries and particle compositions. Cryo-electron microscopy is used to uncover the structure of the DNA frame and to reveal that the nanoparticles are spatially coordinated in the prescribed manner. We show that the DNA frame and one set of nanoparticles can be used to create nanoclusters with different chiroptical activities. We also show that the octahedra can serve as programmable interparticle linkers, allowing one- and two-dimensional arrays to be assembled that have designed particle arrangements.

  7. Prescribed nanoparticle cluster architectures and low-dimensional arrays built using octahedral DNA origami frames

    DOE PAGES

    Tian, Ye; Wang, Tong; Liu, Wenyan; ...

    2015-05-25

    Three-dimensional mesoscale clusters that are formed from nanoparticles spatially arranged in pre-determined positions can be thought of as mesoscale analogues of molecules. These nanoparticle architectures could offer tailored properties due to collective effects, but developing a general platform for fabricating such clusters is a significant challenge. Here, we report a strategy for assembling 3D nanoparticle clusters that uses a molecular frame designed with encoded vertices for particle placement. The frame is a DNA origami octahedron and can be used to fabricate clusters with various symmetries and particle compositions. Cryo-electron microscopy is used to uncover the structure of the DNA framemore » and to reveal that the nanoparticles are spatially coordinated in the prescribed manner. We show that the DNA frame and one set of nanoparticles can be used to create nanoclusters with different chiroptical activities. We also show that the octahedra can serve as programmable interparticle linkers, allowing one- and two-dimensional arrays to be assembled that have designed particle arrangements.« less

  8. Highly active subnano palladium clusters embedded in i-motif DNA.

    PubMed

    Zhang, Jinli; Wang, Xian; Fu, Yan; Han, You; Cheng, Jingyao; Zhang, Yanqing; Li, Wei

    2013-11-26

    Highly active subnano Pd clusters were synthesized using i-motif DNA as the template through characterization via ESI MS, DLS, XPS, UV-vis, and FTIR. It is indicated that Pd1-Pd5 clusters are generated at a [Pd]/[base] ratio of 0.2, Pd8 to Pd9 clusters are generated at a [Pd]/[base] ratio of 0.5, and large nanoparticles with the size about 2.6 nm are formed at a [Pd]/[base] ratio of 2.0. The i-motif-stabilized Pd8-Pd9 clusters show high catalytic activity toward the reduction of 4-nitrophenol with a relative rate constant value of 2034 min(-1) (mM Pd)(-1). DFT calculations disclose that the unique structure of the i-motif with consecutive hemiprotonated CH(+)·C pairs can efficiently ligate Pd ions at the N3 sites of cytosines and that the synthesized Pd clusters consist of metallic Pd atoms as well as positively charged Pd that is ligated by nucleobases, which is capable of facilitating the activation of the nitryl group of 4-nitrophenol. This work suggests a promising pathway to preparing subnano metal catalysts with enhanced catalytic activity using programmable DNA scaffolds.

  9. Analysis of DNA-protein complexes induced by chemical carcinogens

    SciTech Connect

    Costa, M. )

    1990-11-01

    DNA-protein complexes induced in intact cells by chromate have been isolated and compared with those formed by other agents such as cis-platinum. Actin has been identified as one of the major proteins that is complexed to the DNA by chromate based upon a number of criteria including, a molecular weight and isoelectric point identical to actin, positive reaction with actin polyclonal antibody, and proteolytic mapping. Chromate and cis-platinum both complex proteins of very similar molecular weight and isoelectric points and these complexes can be disrupted by exposure to chelating or reducing agents. These results suggest that the metal itself is participating in rather than catalyzing the formation of a DNA-protein complex. An antiserum which was raised to chromate-induced DNA-protein complexes reacted primarily with a 97,000 protein that could not be detected by silver staining. Western blots and slot blots were utilized to detect p97 DNA-protein complexes formed by cis-platinum, UV, formaldehyde, and chromate. Other work in this area, involving studying whether DNA-protein complexes are formed in actively transcribed DNA compared with genetically inactive DNA, is discussed. Methods to detect DNA-protein complexes, the stability and repair of these lesions, and characterization of DNA-protein complexes are reviewed. Nuclear matrix proteins have been identified as a major substrate for the formation of DNA-protein complexes and these findings are also reviewed.

  10. DNA strand scission induced by adriamycin and aclacinomycin A.

    PubMed

    Someya, A; Tanaka, N

    1979-08-01

    The binding of adriamycin and aclacinomycin A with PM2 DNA, and the consequent cleavage of DNA have been demonstrated by agarose gel electrophoresis, using an ethidium bromide assay. Adriamycin was observed to induce a single strand scission of DNA in the presence of a reducing agent, but aclacinomycin A caused much less degree of DNA breaks. The DNA cleavage was enhanced by Cu2+ and Fe2+, but not significantly by Ni2+, Zn2+, Mg2+ and Ca2+, suggesting that reduction and auto-oxidation of the quinone moiety and H2O2 production participate in the DNA-cutting effect. The DNA degradation was dependent upon concentrations of the anthracyclines and CuCl2. The degree of DNA cleavage at 0.04 mM adriamycin was similar to that at 0.4 mM aclacinomycin A in the presence of 1 mM NADPH and 0.4 mM CuCl2. DNA was degraded to small fragments at 0.4 mM adriamycin and 0.2 mM CuCl2. The anthracycline-induced DNA cleavage was stimulated by H2O2, but partially inhibited by potassium iodide, superoxide dismutase, catalase and nitrogen gas atmosphere. The results suggested that both free radical of anthracycline quinones and hydroxyl radical directly react with DNA strands.

  11. Depletion induced clustering of red blood cells in microchannels

    NASA Astrophysics Data System (ADS)

    Wagner, Christian; Brust, Mathias; Podgorski, Thomas; Coupier, Gwennou

    2012-11-01

    The flow properties of blood are determined by the physical properties of its main constituents, the red blood cells (RBC's). At low shear rates RBC's form aggregates, so called rouleaux. Higher shear rates can break them up and the viscosity of blood shows a shear thinning behavior. The physical origin of the rouleaux formation is not yet fully resolved and there are two competing models available. One predicts that the adhesion is induced by bridging of the plasma (macromolecular) proteins in-between two RBC's. The other is based on the depletion effect and thus predicts the absence of macromolecules in-between the cells of a rouleaux. Recent single cell force measurements by use of an AFM support strongly the depletion model. By varying the concentration of Dextran at different molecular weights we can control the adhesions strength. Measurements at low hematocrit in a microfluidic channel show that the number of size of clusters is determined by the depletion induced adhesion strength.

  12. DNA bending induced by cruciform formation.

    PubMed

    Gough, G W; Lilley, D M

    Cruciform structures in DNA are of considerable interest, both as extreme examples of sequence-dependent structural heterogeneity and as models for four-way junctions such as the Holliday junction of homologous genetic recombination. Cruciforms are of lower thermodynamic stability than regular duplex DNA, and have been observed only in negatively supercoiled molecules, where the unfavourable free energy of formation is offset by the topological relaxation of the torsionally stressed molecule. From an experimental viewpoint this can be a disadvantage, as cruciform structures can be studied only in relatively large supercoiled DNA circles, and are destabilized when a break is introduced at any point. We therefore set out to construct a pseudo-cruciform junction--by generating hereroduplex formation between two inverted repeat sequences. Stereochemically, this should closely resemble a true cruciform but remain stable in a linear DNA fragment. We have now created such a junction and find that it has the expected sensitivities to endonucleases. These DNA fragments exhibit extremely anomalous gel electrophoretic mobility, the extent of which depends on the relative position of the pseudo-cruciform along the length of the molecule. Our results are very similar to those obtained by Wu and Crothers using kinetoplast DNA, and we conclude that the pseudo-cruciform junction introduces a bend in the linear DNA molecule.

  13. Nontrivial clustering of microseismicity induced by hydraulic fracturing

    NASA Astrophysics Data System (ADS)

    Maghsoudi, Samira; Eaton, David W.; Davidsen, Jörn

    2016-10-01

    For induced microseismicity associated with hydraulic fracturing, the frequency-magnitude distribution is typically characterized by a falloff with increasing magnitude that is significantly faster than for seismicity along active fault systems. This characteristic may arise from a break in scale invariance, possibly due to mechanical layering that typifies fine-grained sedimentary rocks in many shale gas and tight oil reservoirs. The latter would imply the presence of spatiotemporal magnitude correlations. Using three microseismic catalogs for well stimulations in widely separated locations with varying hydraulic-fracturing methods, we show that events with similar magnitudes indeed tend to cluster in space and time. In addition, we show that the interevent time distribution can be described by a universal functional form characterized by two power laws. One exponent can be related to the presence of interevent triggering as in aftershock sequences and is a consequence of the Omori-Utsu law. The other one is a reflection of the intrinsic spatial variation in the microseismic response rates. Taken together, these features are indicative of nontrivial spatiotemporal clustering of induced microseismicity and, hence, of direct relevance for time-dependent seismic hazard assessment.

  14. Electrochemistry of the [4Fe4S] Cluster in Base Excision Repair Proteins: Tuning the Redox Potential with DNA.

    PubMed

    Bartels, Phillip L; Zhou, Andy; Arnold, Anna R; Nuñez, Nicole N; Crespilho, Frank N; David, Sheila S; Barton, Jacqueline K

    2017-03-02

    Escherichia coli endonuclease III (EndoIII) and MutY are DNA glycosylases that contain [4Fe4S] clusters and that serve to maintain the integrity of the genome after oxidative stress. Electrochemical studies on highly oriented pyrolytic graphite (HOPG) revealed that DNA binding by EndoIII leads to a large negative shift in the midpoint potential of the cluster, consistent with stabilization of the oxidized [4Fe4S](3+) form. However, the smooth, hydrophobic HOPG surface is nonideal for working with proteins in the absence of DNA. In this work, we use thin film voltammetry on a pyrolytic graphite edge electrode to overcome these limitations. Improved adsorption leads to substantial signals for both EndoIII and MutY in the absence of DNA, and a large negative potential shift is retained with DNA present. In contrast, the EndoIII mutants E200K, Y205H, and K208E, which provide electrostatic perturbations in the vicinity of the cluster, all show DNA-free potentials within error of wild type; similarly, the presence of negatively charged poly-l-glutamate does not lead to a significant potential shift. Overall, binding to the DNA polyanion is the dominant effect in tuning the redox potential of the [4Fe4S] cluster, helping to explain why all DNA-binding proteins with [4Fe4S] clusters studied to date have similar DNA-bound potentials.

  15. Live cell microscopy analysis of radiation-induced DNA double-strand break motion

    PubMed Central

    Jakob, B.; Splinter, J.; Durante, M.; Taucher-Scholz, G.

    2009-01-01

    We studied the spatiotemporal organization of DNA damage processing by live cell microscopy analysis in human cells. In unirradiated U2OS osteosarcoma and HeLa cancer cells, a fast confined and Brownian-like motion of DNA repair protein foci was observed, which was not altered by radiation. By analyzing the motional activity of GFP-53BP1 foci in live cells up to 12-h after irradiation, we detected an additional slower mobility of damaged chromatin sites showing a mean square displacement of ≈0.6 μm2/h after exposure to densely- or sparsely-ionizing radiation, most likely driven by normal diffusion of chromatin. Only occasionally, larger translational motion connected to morphological changes of the whole nucleus could be observed. In addition, there was no general tendency to form repair clusters in the irradiated cells. We conclude that long-range displacements of damaged chromatin domains do not generally occur during DNA double-strand break repair after introduction of multiple damaged sites by charged particles. The occasional and in part transient appearance of cluster formation of radiation-induced foci may represent a higher mobility of chromatin along the ion trajectory. These observations support the hypothesis that spatial proximity of DNA breaks is required for the formation of radiation-induced chromosomal exchanges. PMID:19221031

  16. U1 snDNA clusters in grasshoppers: chromosomal dynamics and genomic organization

    PubMed Central

    Anjos, A; Ruiz-Ruano, F J; Camacho, J P M; Loreto, V; Cabrero, J; de Souza, M J; Cabral-de-Mello, D C

    2015-01-01

    The spliceosome, constituted by a protein set associated with small nuclear RNA (snRNA), is responsible for mRNA maturation through intron removal. Among snRNA genes, U1 is generally a conserved repetitive sequence. To unveil the chromosomal/genomic dynamics of this multigene family in grasshoppers, we mapped U1 genes by fluorescence in situ hybridization in 70 species belonging to the families Proscopiidae, Pyrgomorphidae, Ommexechidae, Romaleidae and Acrididae. Evident clusters were observed in all species, indicating that, at least, some U1 repeats are tandemly arrayed. High conservation was observed in the first four families, with most species carrying a single U1 cluster, frequently located in the third or fourth longest autosome. By contrast, extensive variation was observed among Acrididae, from a single chromosome pair carrying U1 to all chromosome pairs carrying it, with occasional occurrence of two or more clusters in the same chromosome. DNA sequence analysis in Eyprepocnemis plorans (species carrying U1 clusters on seven different chromosome pairs) and Locusta migratoria (carrying U1 in a single chromosome pair) supported the coexistence of functional and pseudogenic lineages. One of these pseudogenic lineages was truncated in the same nucleotide position in both species, suggesting that it was present in a common ancestor to both species. At least in E. plorans, this U1 snDNA pseudogenic lineage was associated with 5S rDNA and short interspersed elements (SINE)-like mobile elements. Given that we conclude in grasshoppers that the U1 snDNA had evolved under the birth-and-death model and that its intragenomic spread might be related with mobile elements. PMID:25248465

  17. U1 snDNA clusters in grasshoppers: chromosomal dynamics and genomic organization.

    PubMed

    Anjos, A; Ruiz-Ruano, F J; Camacho, J P M; Loreto, V; Cabrero, J; de Souza, M J; Cabral-de-Mello, D C

    2015-02-01

    The spliceosome, constituted by a protein set associated with small nuclear RNA (snRNA), is responsible for mRNA maturation through intron removal. Among snRNA genes, U1 is generally a conserved repetitive sequence. To unveil the chromosomal/genomic dynamics of this multigene family in grasshoppers, we mapped U1 genes by fluorescence in situ hybridization in 70 species belonging to the families Proscopiidae, Pyrgomorphidae, Ommexechidae, Romaleidae and Acrididae. Evident clusters were observed in all species, indicating that, at least, some U1 repeats are tandemly arrayed. High conservation was observed in the first four families, with most species carrying a single U1 cluster, frequently located in the third or fourth longest autosome. By contrast, extensive variation was observed among Acrididae, from a single chromosome pair carrying U1 to all chromosome pairs carrying it, with occasional occurrence of two or more clusters in the same chromosome. DNA sequence analysis in Eyprepocnemis plorans (species carrying U1 clusters on seven different chromosome pairs) and Locusta migratoria (carrying U1 in a single chromosome pair) supported the coexistence of functional and pseudogenic lineages. One of these pseudogenic lineages was truncated in the same nucleotide position in both species, suggesting that it was present in a common ancestor to both species. At least in E. plorans, this U1 snDNA pseudogenic lineage was associated with 5S rDNA and short interspersed elements (SINE)-like mobile elements. Given that we conclude in grasshoppers that the U1 snDNA had evolved under the birth-and-death model and that its intragenomic spread might be related with mobile elements.

  18. Herpes simplex virus induces the replication of foreign DNA

    SciTech Connect

    Danovich, R.M.; Frenkel, N.

    1988-08-01

    Plasmids containing the simian virus 40 (SV40) DNA replication origin and the large T gene are replicated in Vero monkey cells but not in rabbit skin cells. Efficient replication of the plasmids was observed in rabbit cells infected with herpes simplex virus type 1 (HSV-1) and HSV-2. The HSV-induced replication required the large T antigen and the SV40 replication origin. However, it produced concatemeric molecules resembling replicative intermediates of HSV DNA and was sensitive to phosphonoacetate at concentrations known to inhibit the HSV DNA polymerase. Therefore, it involved the HSV DNA polymerase itself or a viral gene product(s) which was expressed following the replication of HSV DNA. Analyses of test plasmids lacking SV40 or HSV DNA sequences showed that, under some conditions. HSV also induced low-level replication of test plasmids containing no known eucaryotic replication origins. Together, these results show that HSV induces a DNA replicative activity which amplifies foreign DNA. The relevance of these findings to the putative transforming potential of HSV is discussed.

  19. A Novel Bayesian DNA Motif Comparison Method for Clustering and Retrieval

    PubMed Central

    Margalit, Hanah; Friedman, Nir

    2008-01-01

    Characterizing the DNA-binding specificities of transcription factors is a key problem in computational biology that has been addressed by multiple algorithms. These usually take as input sequences that are putatively bound by the same factor and output one or more DNA motifs. A common practice is to apply several such algorithms simultaneously to improve coverage at the price of redundancy. In interpreting such results, two tasks are crucial: clustering of redundant motifs, and attributing the motifs to transcription factors by retrieval of similar motifs from previously characterized motif libraries. Both tasks inherently involve motif comparison. Here we present a novel method for comparing and merging motifs, based on Bayesian probabilistic principles. This method takes into account both the similarity in positional nucleotide distributions of the two motifs and their dissimilarity to the background distribution. We demonstrate the use of the new comparison method as a basis for motif clustering and retrieval procedures, and compare it to several commonly used alternatives. Our results show that the new method outperforms other available methods in accuracy and sensitivity. We incorporated the resulting motif clustering and retrieval procedures in a large-scale automated pipeline for analyzing DNA motifs. This pipeline integrates the results of various DNA motif discovery algorithms and automatically merges redundant motifs from multiple training sets into a coherent annotated library of motifs. Application of this pipeline to recent genome-wide transcription factor location data in S. cerevisiae successfully identified DNA motifs in a manner that is as good as semi-automated analysis reported in the literature. Moreover, we show how this analysis elucidates the mechanisms of condition-specific preferences of transcription factors. PMID:18463706

  20. Nitrous acid induced damage in T7 DNA and phage

    SciTech Connect

    Scearce, L.M.; Masker, W.E.

    1986-05-01

    The response of bacteriophage T7 to nitrous acid damage was investigated. The T7 system allows in vitro mimicry of most aspects of in vivo DNA metabolism. Nitrous acid is of special interest since it has been previously shown to induce deletions and point mutations as well as novel adducts in DNA. T7 phage was exposed to 56 mM nitrous acid at pH 4.6 in vivo, causing a time dependent 98% decrease in survival for each 10 min duration of exposure to nitrous acid. These studies were extended to include examination of pure T7 DNA exposed in vitro to nitrous acid conditions identical to those used in the in vivo survival studies. The treated DNA was dialyzed to remove the nitrous acid and the DNA was encapsulated into empty phage heads. These in vitro packaged phage showed a survival curve analogous to the in vivo system. There was no change in survival when either in vitro or in vivo exposed phage were grown on wild type E. coli or on E. coli strains deficient in DNA repair due to mutations in DNA polymerase I, exonuclease III or a uvrA mutation. Survival was not increased when nitrous acid treated T7 were grown on E. coli induced for SOS repair. In vitro replication of nitrous acid treated DNA showed a time dependent decrease in the total amount of DNA synthesized.

  1. A Green Solvent Induced DNA Package

    NASA Astrophysics Data System (ADS)

    Satpathi, Sagar; Sengupta, Abhigyan; Hridya, V. M.; Gavvala, Krishna; Koninti, Raj Kumar; Roy, Bibhisan; Hazra, Partha

    2015-03-01

    Mechanistic details of DNA compaction is essential blue print for gene regulation in living organisms. Many in vitro studies have been implemented using several compaction agents. However, these compacting agents may have some kinds of cytotoxic effects to the cells. To minimize this aspect, several research works had been performed, but people have never focused green solvent, i.e. room temperature ionic liquid as DNA compaction agent. To the best of our knowledge, this is the first ever report where we have shown that guanidinium tris(pentafluoroethyl)trifluorophosphate (Gua-IL) acts as a DNA compacting agent. The compaction ability of Gua-IL has been verified by different spectroscopic techniques, like steady state emission, circular dichroism, dynamic light scattering and UV melting. Notably, we have extensively probed this compaction by Gua-IL through field emission scanning electron microscopy (FE-SEM) and fluorescence microscopy images. We also have discussed the plausible compaction mechanism process of DNA by Gua-IL. Our results suggest that Gua-IL forms a micellar kind of self aggregation above a certain concentration (>=1 mM), which instigates this compaction process. This study divulges the specific details of DNA compaction mechanism by a new class of compaction agent, which is highly biodegradable and eco friendly in nature.

  2. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage

    PubMed Central

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-01-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  3. Kinetics of the UV-induced DNA damage response in relation to cell cycle phase. Correlation with DNA replication

    PubMed Central

    Zhao, Hong; Traganos, Frank; Darzynkiewicz, Zbigniew

    2010-01-01

    It has been reported that exposure to UV light triggers DNA damage response (DDR) seen as induction of γH2AX not only in S- but also in G1- phase cells. In the present study, in addition to γH2AX, we assessed other markers of DDR, namely phosphorylation of ATM on Ser1981, of ATM/ATR substrate on Ser/Thr at SQ/TQ cluster domains and of the tumor suppressor p53 on Ser15, in human pulmonary carcinoma A549 cells irradiated with 50 J/m2 of UV-B. Phosphorylation of these proteins detected with phospho-specific Abs and measured by laser scanning cytometry in relation the cell cycle phase was found to be selective to S-phase cells. The kinetics of phosphorylation of ATM was strikingly similar to that of ATM/ATR substrate, peaking at 30 min after UV irradiation and followed by rapid dephosphorylation. The peak of H2AX phosphorylation was seen at 2 h and the peak of p53 phosphorylation at 4 h after exposure to UV light. Local high spatial density of these phospho-proteins reported by intensity of maximal pixel of immunofluorescence in the DDR nuclear foci was distinctly more pronounced in the early compared to late portion of S-phase. Exposure of cells to UV following 1 h pulse-labeling of their DNA with 5-ethynyl-2′deoxyuridine (EdU) made it possible to correlate the extent of DNA replication during the pulse with the extent of the UV-induced H2AX phosphorylation within the same cells. This correlation was very strong (R2= 0.98) and the cells that did not incorporate EdU showed no evidence of H2AX phosphorylation. The data are consistent with the mechanism in which stalling of DNA replication forks upon collision with the primary UV-induced DNA lesions and likely formation of double-strand DNA breaks triggers DDR. The prior reports (including our own) on induction of γH2AX in G1 cells by UV may have erroneously identified cells initiating DNA replication following UV exposure as G1 cells due to the fact that their DNA content did not significantly differ from that of G

  4. Coumarin-Induced DNA Ligation, Rearrangement to DNA Interstrand Crosslinks, and Photorelease of Coumarin Moiety.

    PubMed

    Sun, Huabing; Fan, Heli; Eom, Hyeyoung; Peng, Xiaohua

    2016-11-03

    Coumarin moieties react with thymine and cytosine in DNA by photoinduced [2+2] cycloaddition, which allows quantitative DNA interstrand crosslink (ICL) formation. Here, we report the application of coumarin analogues for DNA photoligation and the rearrangement of coumarin-induced ligation to ICL products. Both DNA sequences and the linker units at position 4 of the coumarin moieties affected coumarin-induced DNA photoligation. A flexible linker unit favored DNA ICL formation but led to inefficient photoligation, whereas coumarins without linker units greatly increased DNA photoligation efficiency. DNA photoligation induced by the coumarin moiety was photoswitchable. Ligation products were formed between coumarin and dT or dC upon 350 nm irradiation but reverted to the original single-stranded oligodeoxyribonucleotides (ODNs) upon 254 nm irradiation. Rearrangement of ligated ODNs into ICL products occurred during the switchable (350 nm/254 nm) processes. Additionally, photoinduced cleavage of coumarin 3 occurred with dC-3 cycloadducts upon 254 nm irradiation, which was confirmed by mass spectrometry analysis.

  5. DNAc: A clustering method for identifying kinship relations between DNA profiles using a novel similarity measure.

    PubMed

    Ntwari, Aimé; Kelil, Abdellali; Drouin, Régen; Monga, Ernest; Wang, Shengrui; Brzezinski, Ryszard; Bronsard, Marc; Yan, Ju

    2011-01-01

    After decades of refinement, DNA testing methods have become essential tools in forensic sciences. They are essentially based on likelihood ratio test principle, which is utilized specifically, by using as prior knowledge the allele frequencies in the population, to confirm or refute a given kinship hypothesis made on two genotypes. This makes these methods ill suited when allele frequencies or kinship hypotheses are unavailable. In this paper, we introduce DNAc, a new clustering methodology for DNA testing based on a new similarity measure that allows an accurate retrieval of the degree of relatedness among two or more genotypes, without relying on kinship hypotheses or allele frequencies in the population. We used DNAc in analyzing microsatellite DNA sequences distributed among 12 genotypes from normal individuals from two distinct families. The results show that DNAc accurately determines kinship among genotypes and further gathers them in the appropriate kinship groups.

  6. DNA mesophases induced by spermidine: structural properties and biological implications.

    PubMed Central

    Pelta, J; Durand, D; Doucet, J; Livolant, F

    1996-01-01

    Conditions of formation of DNA aggregates by the addition of spermidine were determined with 146 base pair DNA fragments as a function of spermidine and NaCl concentration. Two different phases of spermidine-DNA complexes are obtained: a cholesteric liquid crystalline phase with a large helical pitch, with interhelix distances ranging from 31.6 to 32.6 A, and a columnar hexagonal phase with a restricted fluidity in which DNA molecules are more closely packed (29.85 +/- 0.05 A). In both phases, the DNA molecule retains its B form. These phases are always observed in equilibrium with the dilute isotropic solution, and their phase diagram is defined for a DNA concentration of 1 mg/ml. DNA liquid crystalline phases induced by spermidine are compared with the DNA mesophases already described in concentrated solutions in the absence of spermidine. We propose that the liquid crystalline character of the spermidine DNA complexes is involved in the stimulation of the functional properties of the DNA reported in numerous experimental articles, and we discuss how the nature of the phase could regulate the degree of activity of the molecule. Images FIGURE 4 FIGURE 5 FIGURE 6 FIGURE 8 FIGURE 10 PMID:8804588

  7. Unsupervised verification of laser-induced breakdown spectroscopy dataset clustering

    NASA Astrophysics Data System (ADS)

    Wójcik, Michał R.; Zdunek, Rafał; Antończak, Arkadiusz J.

    2016-12-01

    Laser-induced breakdown spectroscopy is a versatile, optical technique used in a wide range of qualitative and quantitative analyses conducted with the use of various chemometric techniques. The aim of this research is to demonstrate the possibility of unsupervised clustering of an unknown dataset using K-means clustering algorithm, and verifying its input parameters through investigating generalized eigenvalues derived with linear discriminant analysis. In all the cases, principal component analyses have been applied to reduce data dimensionality and shorten computation time of the whole operation. The experiment was conducted on a dataset collected from twenty four different materials divided into six groups: metals, semiconductors, ceramics, rocks, metal alloys and others with the use of a three-channel spectrometer (298.02-628.73nm overall spectral range) and a UV (248nm) excimer laser. Additionally, two more complex groups containing all specimens and all specimens excluding rocks were created. The resulting spaces of eigenvalues were calculated for every group and three different distances in the multidimensional space (cosine, square Euclidean and L1). As expected, the correct numbers of specimens within groups with small deviations were obtained, and the validity of the unsupervised method has thus been proven.

  8. Cluster synchronization induced by one-node clusters in networks with asymmetric negative couplings

    SciTech Connect

    Zhang, Jianbao; Ma, Zhongjun; Zhang, Gang

    2013-12-15

    This paper deals with the problem of cluster synchronization in networks with asymmetric negative couplings. By decomposing the coupling matrix into three matrices, and employing Lyapunov function method, sufficient conditions are derived for cluster synchronization. The conditions show that the couplings of multi-node clusters from one-node clusters have beneficial effects on cluster synchronization. Based on the effects of the one-node clusters, an effective and universal control scheme is put forward for the first time. The obtained results may help us better understand the relation between cluster synchronization and cluster structures of the networks. The validity of the control scheme is confirmed through two numerical simulations, in a network with no cluster structure and in a scale-free network.

  9. Phosphoinositide 3-kinase inhibitors induce DNA damage through nucleoside depletion

    PubMed Central

    Juvekar, Ashish; Hu, Hai; Yadegarynia, Sina; Lyssiotis, Costas A.; Ullas, Soumya; Lien, Evan C.; Bellinger, Gary; Son, Jaekyoung; Hok, Rosanna C.; Seth, Pankaj; Daly, Michele B.; Kim, Baek; Scully, Ralph; Asara, John M.; Cantley, Lewis C.; Wulf, Gerburg M.

    2016-01-01

    We previously reported that combining a phosphoinositide 3-kinase (PI3K) inhibitor with a poly-ADP Rib polymerase (PARP)-inhibitor enhanced DNA damage and cell death in breast cancers that have genetic aberrations in BRCA1 and TP53. Here, we show that enhanced DNA damage induced by PI3K inhibitors in this mutational background is a consequence of impaired production of nucleotides needed for DNA synthesis and DNA repair. Inhibition of PI3K causes a reduction in all four nucleotide triphosphates, whereas inhibition of the protein kinase AKT is less effective than inhibition of PI3K in suppressing nucleotide synthesis and inducing DNA damage. Carbon flux studies reveal that PI3K inhibition disproportionately affects the nonoxidative pentose phosphate pathway that delivers Rib-5-phosphate required for base ribosylation. In vivo in a mouse model of BRCA1-linked triple-negative breast cancer (K14-Cre BRCA1f/fp53f/f), the PI3K inhibitor BKM120 led to a precipitous drop in DNA synthesis within 8 h of drug treatment, whereas DNA synthesis in normal tissues was less affected. In this mouse model, combined PI3K and PARP inhibition was superior to either agent alone to induce durable remissions of established tumors. PMID:27402769

  10. The Cartography of UV-induced DNA Damage Formation and DNA Repair.

    PubMed

    Hu, Jinchuan; Adar, Sheera

    2017-01-01

    DNA damage presents a barrier to DNA-templated biochemical processes, including gene expression and faithful DNA replication. Compromised DNA repair leads to mutations, enhancing the risk for genetic diseases and cancer development. Conventional experimental approaches to study DNA damage required a researcher to choose between measuring bulk damage over the entire genome, with little or no resolution regarding a specific location, and obtaining data specific to a locus of interest, without a global perspective. Recent advances in high-throughput genomic tools overcame these limitations and provide high-resolution measurements simultaneously across the genome. In this review, we discuss the available methods for measuring DNA damage and their repair, focusing on genomewide assays for pyrimidine photodimers, the major types of damage induced by ultraviolet irradiation. These new genomic assays will be a powerful tool in identifying key components of genome stability and carcinogenesis.

  11. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  12. Harnessing DNA-induced immune responses for improving cancer vaccines

    PubMed Central

    Herrada, Andrés A.; Rojas-Colonelli, Nicole; González-Figueroa, Paula; Roco, Jonathan; Oyarce, César; Ligtenberg, Maarten A.; Lladser, Alvaro

    2012-01-01

    DNA vaccines have emerged as an attractive strategy to promote protective cellular and humoral immunity against the encoded antigen. DNA vaccines are easy to generate, inexpensive to produce and purify at large-scale, highly stable and safe. In addition, plasmids used for DNA vaccines act as powerful “danger signals” by stimulating several DNA-sensing innate immune receptors that promote the induction of protective adaptive immunity. The induction of tumor-specific immune responses represents a major challenge for DNA vaccines because most of tumor-associated antigens are normal non-mutated self-antigens. As a consequence, induction of potentially self-reactive T cell responses against such poorly immunogenic antigens is controlled by mechanisms of central and peripheral tolerance as well as tumor-induced immunosuppression. Although several DNA vaccines against cancer have reached clinical testing, disappointing results have been observed. Therefore, the development of new adjuvants that strongly stimulate the induction of antitumor T cell immunity and counteract immune-suppressive regulation is an attractive approach to enhance the potency of DNA vaccines and overcome tumor-associated tolerance. Understanding the DNA-sensing signaling pathways of innate immunity that mediate the induction of T cell responses elicited by DNA vaccines represents a unique opportunity to develop novel adjuvants that enhance vaccine potency. The advance of DNA adjuvants needs to be complemented with the development of potent delivery systems, in order to step toward successful clinical application. Here, we briefly discuss recent evidence showing how to harness DNA-induced immune response to improve the potency of cancer vaccines and counteract tumor-associated tolerance. PMID:23111166

  13. An inducible long noncoding RNA amplifies DNA damage signaling

    PubMed Central

    Schmitt, Adam M.; Garcia, Julia T.; Hung, Tiffany; Flynn, Ryan A.; Shen, Ying; Qu, Kun; Payumo, Alexander Y.; Peres-da-Silva, Ashwin; Broz, Daniela Kenzelmann; Baum, Rachel; Guo, Shuling; Chen, James K.; Attardi, Laura D.; Chang, Howard Y.

    2016-01-01

    Long noncoding RNAs (lncRNAs) are prevalent genes with frequently exquisite regulation but mostly unknown functions. Here we demonstrate a role of lncRNAs in guiding organismal DNA damage response. DNA damage activates transcription of DINO (Damage Induced NOncoding) via p53. DINO is required for p53-dependent gene expression, cell cycle arrest, and apoptosis in response to DNA damage, and DINO expression suffice to activate damage signaling and cell cycle arrest in the absence of DNA damage. DINO binds to and promotes p53 protein stabilization, mediating a p53 auto-amplification loop. Dino knockout or promoter inactivation in mice dampens p53 signaling and ameliorates acute radiation syndrome in vivo. Thus, inducible lncRNA can create a feedback loop with its cognate transcription factor to amplify cellular signaling networks. PMID:27668660

  14. Single-molecule visualization of ROS-induced DNA damage in large DNA molecules.

    PubMed

    Lee, Jinyong; Kim, Yongkyun; Lim, Sangyong; Jo, Kyubong

    2016-02-07

    We present a single molecule visualization approach for the quantitative analysis of reactive oxygen species (ROS) induced DNA damage, such as base oxidation and single stranded breaks in large DNA molecules. We utilized the Fenton reaction to generate DNA damage with subsequent enzymatic treatment using a mixture of three types of glycosylases to remove oxidized bases, and then fluorescent labeling on damaged lesions via nick translation. This single molecule analytical platform provided the capability to count one or two damaged sites per λ DNA molecule (48.5 kb), which were reliably dependent on the concentrations of hydrogen peroxide and ferrous ion at the micromolar level. More importantly, the labeled damaged sites that were visualized under a microscope provided positional information, which offered the capability of comparing DNA damaged sites with the in silico genomic map to reveal sequence specificity that GTGR is more sensitive to oxidative damage. Consequently, single DNA molecule analysis provides a sensitive analytical platform for ROS-induced DNA damage and suggests an interesting biochemical insight that the genome primarily active during the lysogenic cycle may have less probability for oxidative DNA damage.

  15. Induced pluripotent stem cells with a pathological mitochondrial DNA deletion

    PubMed Central

    Cherry, Anne B. C.; Gagne, Katelyn E.; McLoughlin, Erin M.; Baccei, Anna; Gorman, Bryan; Hartung, Odelya; Miller, Justine D.; Zhang, Jin; Zon, Rebecca L.; Ince, Tan A.; Neufeld, Ellis J.; Lerou, Paul H.; Fleming, Mark D.; Daley, George Q.; Agarwal, Suneet

    2013-01-01

    In congenital mitochondrial DNA (mtDNA) disorders, a mixture of normal and mutated mtDNA (termed heteroplasmy) exists at varying levels in different tissues, which determines the severity and phenotypic expression of disease. Pearson marrow pancreas syndrome (PS) is a congenital bone marrow failure disorder caused by heteroplasmic deletions in mtDNA. The cause of the hematopoietic failure in PS is unknown, and adequate cellular and animal models are lacking. Induced pluripotent stem (iPS) cells are particularly amenable for studying mtDNA disorders, as cytoplasmic genetic material is retained during direct reprogramming. Here we derive and characterize iPS cells from a patient with PS. Taking advantage of the tendency for heteroplasmy to change with cell passage, we isolated isogenic PS-iPS cells without detectable levels of deleted mtDNA. We found that PS-iPS cells carrying a high burden of deleted mtDNA displayed differences in growth, mitochondrial function, and hematopoietic phenotype when differentiated in vitro, compared to isogenic iPS cells without deleted mtDNA. Our results demonstrate that reprogramming somatic cells from patients with mtDNA disorders can yield pluripotent stem cells with varying burdens of heteroplasmy that might be useful in the study and treatment of mitochondrial diseases. PMID:23400930

  16. Dynamic DNA Methylation Regulates Levodopa-Induced Dyskinesia

    PubMed Central

    Figge, David A.; Eskow Jaunarajs, Karen L.

    2016-01-01

    Levodopa-induced dyskinesia (LID) is a persistent behavioral sensitization that develops after repeated levodopa (l-DOPA) exposure in Parkinson disease patients. LID is a consequence of sustained changes in the transcriptional behavior of striatal neurons following dopaminergic stimulation. In neurons, transcriptional regulation through dynamic DNA methylation has been shown pivotal to many long-term behavioral modifications; however, its role in LID has not yet been explored. Using a rodent model, we show LID development leads to the aberrant expression of DNA demethylating enzymes and locus-specific changes to DNA methylation at the promoter regions of genes aberrantly transcribed following l-DOPA treatment. Looking for dynamic DNA methylation in LID genome-wide, we used reduced representation bisulfite sequencing and found an extensive reorganization of the dorsal striatal methylome. LID development led to significant demethylation at many important regulatory areas of aberrantly transcribed genes. We used pharmacologic treatments that alter DNA methylation bidirectionally and found them able to modulate dyskinetic behaviors. Together, these findings demonstrate that l-DOPA induces widespread changes to striatal DNA methylation and that these modifications are required for the development and maintenance of LID. SIGNIFICANCE STATEMENT Levodopa-induced dyskinesia (LID) develops after repeated levodopa (l-DOPA) exposure in Parkinson disease patients and remains one of the primary obstacles to effective treatment. LID behaviors are a consequence of striatal neuron sensitization due to sustained changes in transcriptional behavior; however, the mechanisms responsible for the long-term maintenance of this cellular priming remain uncertain. Regulation of dynamic DNA methylation has been shown pivotal to the maintenance of several long-term behavioral modifications, yet its role in LID has not yet been explored. In this work, we report a pivotal role for the

  17. Genomic DNA transposition induced by human PGBD5

    PubMed Central

    Henssen, Anton G; Henaff, Elizabeth; Jiang, Eileen; Eisenberg, Amy R; Carson, Julianne R; Villasante, Camila M; Ray, Mondira; Still, Eric; Burns, Melissa; Gandara, Jorge; Feschotte, Cedric; Mason, Christopher E; Kentsis, Alex

    2015-01-01

    Transposons are mobile genetic elements that are found in nearly all organisms, including humans. Mobilization of DNA transposons by transposase enzymes can cause genomic rearrangements, but our knowledge of human genes derived from transposases is limited. In this study, we find that the protein encoded by human PGBD5, the most evolutionarily conserved transposable element-derived gene in vertebrates, can induce stereotypical cut-and-paste DNA transposition in human cells. Genomic integration activity of PGBD5 requires distinct aspartic acid residues in its transposase domain, and specific DNA sequences containing inverted terminal repeats with similarity to piggyBac transposons. DNA transposition catalyzed by PGBD5 in human cells occurs genome-wide, with precise transposon excision and preference for insertion at TTAA sites. The apparent conservation of DNA transposition activity by PGBD5 suggests that genomic remodeling contributes to its biological function. DOI: http://dx.doi.org/10.7554/eLife.10565.001 PMID:26406119

  18. Photochromic switching of the DNA helicity induced by azobenzene derivatives

    PubMed Central

    Deiana, Marco; Pokladek, Ziemowit; Olesiak-Banska, Joanna; Młynarz, Piotr; Samoc, Marek; Matczyszyn, Katarzyna

    2016-01-01

    The photochromic properties of azobenzene, involving conformational changes occurring upon interaction with light, provide an excellent tool to establish new ways of selective regulation applied to biosystems. We report here on the binding of two water-soluble 4-(phenylazo)benzoic acid derivatives (Azo-2N and Azo-3N) with double stranded DNA and demonstrate that the photoisomerization of Azo-3N leads to changes in DNA structure. In particular, we show that stabilization and destabilization of the B-DNA secondary structure can be photochemically induced in situ by light. This photo-triggered process is fully reversible and could be an alternative pathway to control a broad range of biological processes. Moreover, we found that the bicationic Azo-3N exhibited a higher DNA-binding constant than the monocationic Azo-2N pointing out that the number of positive charges along the photosensitive polyamines chain plays a pivotal role in stabilizing the photochrome-DNA complex. PMID:27339811

  19. Photochromic switching of the DNA helicity induced by azobenzene derivatives

    NASA Astrophysics Data System (ADS)

    Deiana, Marco; Pokladek, Ziemowit; Olesiak-Banska, Joanna; Młynarz, Piotr; Samoc, Marek; Matczyszyn, Katarzyna

    2016-06-01

    The photochromic properties of azobenzene, involving conformational changes occurring upon interaction with light, provide an excellent tool to establish new ways of selective regulation applied to biosystems. We report here on the binding of two water-soluble 4-(phenylazo)benzoic acid derivatives (Azo-2N and Azo-3N) with double stranded DNA and demonstrate that the photoisomerization of Azo-3N leads to changes in DNA structure. In particular, we show that stabilization and destabilization of the B-DNA secondary structure can be photochemically induced in situ by light. This photo-triggered process is fully reversible and could be an alternative pathway to control a broad range of biological processes. Moreover, we found that the bicationic Azo-3N exhibited a higher DNA-binding constant than the monocationic Azo-2N pointing out that the number of positive charges along the photosensitive polyamines chain plays a pivotal role in stabilizing the photochrome-DNA complex.

  20. Loss of cellular transformation efficiency induced by DNA irradiation with low-energy (10 eV) electrons.

    PubMed

    Kouass Sahbani, Saloua; Sanche, Leon; Cloutier, Pierre; Bass, Andrew D; Hunting, Darel J

    2014-11-20

    Low energy electrons (LEEs) of energies less than 20 eV are generated in large quantities by ionizing radiation in biological matter. While LEEs are known to induce single (SSBs) and double strand breaks (DSBs) in DNA, their ability to inactivate cells by inducing nonreparable lethal damage has not yet been demonstrated. Here we observe the effect of LEEs on the functionality of DNA, by measuring the efficiency of transforming Escherichia coli with a [pGEM-3Zf (-)] plasmid irradiated with 10 eV electrons. Highly ordered DNA films were prepared on pyrolitic graphite by molecular self-assembly using 1,3-diaminopropane ions (Dap(2+)). The uniformity of these films permits the inactivation of approximately 50% of the plasmids compared to <10% using previous methods, which is sufficient for the subsequent determination of their functionality. Upon LEE irradiation, the fraction of functional plasmids decreased exponentially with increasing electron fluence, while LEE-induced isolated base damage, frank DSB, and non DSB-cluster damage increased linearly with fluence. While DSBs can be toxic, their levels were too low to explain the loss of plasmid functionality observed upon LEE irradiation. Similarly, non-DSB cluster damage, revealed by transforming cluster damage into DSBs by digestion with repair enzymes, also occurred relatively infrequently. The exact nature of the lethal damage remains unknown, but it is probably a form of compact cluster damage in which the lesions are too close to be revealed by purified repair enzymes. In addition, this damage is either not repaired or is misrepaired by E. coli, since it results in plasmid inactivation, when they contain an average of three lesions. Comparison with previous results from a similar experiment performed with γ-irradiated plasmids indicates that the type of clustered DNA lesions, created directly on cellular DNA by LEEs, may be more difficult to repair than those produced by other species from radiolysis.

  1. Loss of Cellular Transformation Efficiency Induced by DNA Irradiation with Low-Energy (10 eV) Electrons

    PubMed Central

    Sahbani, Saloua Kouass; Sanche, Leon; Cloutier, Pierre; Bass, Andrew D.; Hunting, Darel J.

    2015-01-01

    Low energy electrons (LEEs) of energies less than 20 eV are generated in large quantities by ionizing radiation in biological matter. While LEEs are known to induce single (SSBs) and double strand breaks (DSBs) in DNA, their ability to inactivate cells by inducing nonreparable lethal damage has not yet been demonstrated. Here we observe the effect of LEEs on the functionality of DNA, by measuring the efficiency of transforming Escherichia coli with a [pGEM-3Zf (–)] plasmid irradiated with 10 eV electrons. Highly ordered DNA films were prepared on pyrolitic graphite by molecular self-assembly using 1,3-diaminopropane ions (Dap2+). The uniformity of these films permits the inactivation of approximately 50% of the plasmids compared to <10% using previous methods, which is sufficient for the subsequent determination of their functionality. Upon LEE irradiation, the fraction of functional plasmids decreased exponentially with increasing electron fluence, while LEE-induced isolated base damage, frank DSB, and non DSB-cluster damage increased linearly with fluence. While DSBs can be toxic, their levels were too low to explain the loss of plasmid functionality observed upon LEE irradiation. Similarly, non-DSB cluster damage, revealed by transforming cluster damage into DSBs by digestion with repair enzymes, also occurred relatively infrequently. The exact nature of the lethal damage remains unknown, but it is probably a form of compact cluster damage in which the lesions are too close to be revealed by purified repair enzymes. In addition, this damage is either not repaired or is misrepaired by E. coli, since it results in plasmid inactivation, when they contain an average of three lesions. Comparison with previous results from a similar experiment performed with γ-irradiated plasmids indicates that the type of clustered DNA lesions, created directly on cellular DNA by LEEs, may be more difficult to repair than those produced by other species from radiolysis. PMID

  2. Probability distribution analysis of force induced unzipping of DNA

    NASA Astrophysics Data System (ADS)

    Kumar, Sanjay; Giri, Debaprasad

    2006-07-01

    We present a semimicroscopic model of dsDNA by incorporating the directional nature of hydrogen bond to describe the force induced unzipping transition. Using exact enumeration technique, we obtain the force-temperature and the force-extension curves and compare our results with the other models of dsDNA. The model proposed by us is rich enough to describe the basic mechanism of dsDNA unzipping and predicts the existence of an "eye phase." We show oscillations in the probability distribution function during unzipping. Effects of stacking energies on the melting profile have also been studied.

  3. Inducible repair of oxidative DNA damage in Escherichia coli.

    PubMed

    Demple, B; Halbrook, J

    Hydrogen peroxide is lethal to many cell types, including the bacterium Escherichia coli. Peroxides yield transient radical species that can damage DNA and cause mutations. Such partially reduced oxygen species are occasionally released during cellular respiration and are generated by lethal and mutagenic ionizing radiation. Because cells live in an environment where the threat of oxidative DNA damage is continual, cellular mechanisms may have evolved to avoid and repair this damage. Enzymes are known which evidently perform these functions. We report here that resistance to hydrogen peroxide toxicity can be induced in E. coli, that this novel induction is specific and occurs, in part, at the level of DNA repair.

  4. Enantioselective DNA condensation induced by heptameric lanthanum helical supramolecular enantiomers.

    PubMed

    Bao, Fei-Fei; Xu, Xin-Xin; Zhou, Wen; Pang, Chun-Yan; Li, Zaijun; Gu, Zhi-Guo

    2014-09-01

    DNA condensation induced by a pair of heptameric La(III) helical enantiomers M-[La7(S-L)6(CO3)(NO3)6(OCH3)(CH3OH)7]·2CH3OH·5H2O and P-[La7(R-L)6(CO3)(NO3)6(OCH3)(CH3OH)5(H2O)2]·2CH3OH·4H2O (M-La and P-La, L=2-(2-hydroxybenzylamino)-3-carbamoylpropanoic acid) has been investigated by UV/vis spectroscopy, fluorescence spectroscopy, CD spectroscopy, EMSA, RALS, DLS, and SEM. The enantiomers M-La and P-La could induce CT-DNA condensation at a low concentration as observed in UV/vis spectroscopy. DNA condensates possessed globular nanoparticles with nearly homogeneous sizes in solid state determined by SEM (ca. 250 nm for M-La and ca. 200 nm for P-La). The enantiomers bound to DNA through electrostatic attraction and hydrogen bond interactions in a major groove, and rapidly condensed free DNA into its compact state. DNA decompaction has been acquired by using EDTA as disassembly agent, and analyzed by UV/vis spectroscopy, CD spectroscopy and EMSA. Moreover, the enantiomers M-La and P-La displayed discernible discrimination in DNA interaction and DNA condensation, as well as DNA decondensation. Our study suggested that lanthanum(III) enantiomers M-La and P-La were efficient DNA packaging agents with potential applications in gene delivery.

  5. Quantifying clustered DNA damage induction and repair by gel electrophoresis, electronic imaging and number average length analysis

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Georgakilas, Alexandros G.; Bennett, Paula V.; Laval, Jacques; Sutherland, John C.; Gewirtz, A. M. (Principal Investigator)

    2003-01-01

    Assessing DNA damage induction, repair and consequences of such damages requires measurement of specific DNA lesions by methods that are independent of biological responses to such lesions. Lesions affecting one DNA strand (altered bases, abasic sites, single strand breaks (SSB)) as well as damages affecting both strands (clustered damages, double strand breaks) can be quantified by direct measurement of DNA using gel electrophoresis, gel imaging and number average length analysis. Damage frequencies as low as a few sites per gigabase pair (10(9)bp) can be quantified by this approach in about 50ng of non-radioactive DNA, and single molecule methods may allow such measurements in DNA from single cells. This review presents the theoretical basis, biochemical requirements and practical aspects of this approach, and shows examples of their applications in identification and quantitation of complex clustered damages.

  6. Electrochemical DNA biosensor for detection of DNA damage induced by hydroxyl radicals.

    PubMed

    Hájková, Andrea; Barek, Jiří; Vyskočil, Vlastimil

    2017-03-01

    A simple electrochemical DNA biosensor based on a glassy carbon electrode (GCE) was prepared by adsorbing double-stranded DNA (dsDNA) onto the GCE surface and subsequently used for the detection of dsDNA damage induced by hydroxyl radicals. Investigation of the mutual interaction between hydroxyl radicals and dsDNA was conducted using a combination of several electrochemical detection techniques: square-wave voltammetry for direct monitoring the oxidation of dsDNA bases, and cyclic voltammetry and electrochemical impedance spectroscopy as indirect electrochemical methods making use of the redox-active indicator [Fe(CN)6](4-/3-). Hydroxyl radicals were generated electrochemically on the surface of a boron-doped diamond electrode and chemically (via the Fenton's reaction or the auto-oxidation of Fe(II)). The extent of dsDNA damage by electrochemically generated hydroxyl radicals depended on the current density applied to the generating electrode: by applying 5, 10, and 50mAcm(-2), selected relative biosensor responses decreased after 3min incubation from 100% to 38%, 27%, and 3%, respectively. Chemically generated hydroxyl radicals caused less pronounced dsDNA damage, and their damaging activity depended on the form of Fe(II) ions: decreases to 49% (Fenton's reaction; Fe(II) complexed with EDTA) and 33% (auto-oxidation of Fe(II); Fe(II) complexed with dsDNA) were observed after 10min incubation.

  7. Modulation of irinotecan-induced genomic DNA damage by theanine.

    PubMed

    Attia, Sabry

    2012-05-01

    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity.

  8. DNA Damage and Genomic Instability Induced by Inappropriate DNA Re-Replication

    DTIC Science & Technology

    2005-04-01

    ml a that sustained rereplication leads to a dramatic decrease factor. Samples were fixed in 67% ethanol (vol/vol), washed twice with PBS, and...significant decrease in cell viability and a cellular DNA damage response. Strikingly, we have observed DNA damage in the absence of a classical...genome re-replicates. In this reporting period, we have shown that re-replication induces a rapid and significant decrease in cell viability and a

  9. Tissue culture-induced DNA methylation polymorphisms in repetitive DNA of tomato calli and regenerated plants.

    PubMed

    Smulders, M J; Rus-Kortekaas, W; Vosman, B

    1995-12-01

    The propagation of plants through tissue culture can induce a variety of genetic and epigenetic changes. Variation in DNA methylation has been proposed as a mechanism that may explain at least a part of these changes. In the present study, the methylation of tomato callus DNA was compared with that of leaf DNA, from control or regenerated plants, at MspI/HpaII sites around five middle-repetitive sequences. Although the methylation of the internal cytosine in the recognition sequence CCGG varied from zero to nearly full methylation, depending on the probe used, no differences were found between callus and leaf DNA. For the external cytosine, small differences were revealed between leaf and callus DNA with two probes, but no polymorphisms were detected among DNA samples of calli or DNA samples of leaves of regenerated plants. When callus DNA cut with HindIII was studied with one of the probes, H9D9, most of the signal was found in high-molecular-weight DNA, as opposed to control leaf DNA where almost all the signal was in a fragment of 530 bp. Also, an extra fragment of 630 bp was found in the callus DNA that was not present in control leaf DNA. Among leaves of plants regenerated from tissue culture, the 630-bp fragment was found in 10 of 68 regenerated plants. This 630-bp fragment was present among progeny of only 4 of these 10 plants after selfing, i.e. it was partly inherited. In these cases, the fragment was not found in all progeny plants, indicating heterozygosity of the regenerated plants. The data are interpreted as indicating that a HindIII site becomes methylated in callus tissue, and that some of this methylation persists in regenerated plants and is partly transmitted to their progeny.

  10. Evolutionary Dynamics of rDNA Clusters in Chromosomes of Five Clam Species Belonging to the Family Veneridae (Mollusca, Bivalvia)

    PubMed Central

    Pérez-García, Concepción; Hurtado, Ninoska S.; Morán, Paloma; Pasantes, Juan J.

    2014-01-01

    The chromosomal changes accompanying bivalve evolution are an area about which few reports have been published. To improve our understanding on chromosome evolution in Veneridae, ribosomal RNA gene clusters were mapped by fluorescent in situ hybridization (FISH) to chromosomes of five species of venerid clams (Venerupis corrugata, Ruditapes philippinarum, Ruditapes decussatus, Dosinia exoleta, and Venus verrucosa). The results were anchored to the most comprehensive molecular phylogenetic tree currently available for Veneridae. While a single major rDNA cluster was found in each of the five species, the number of 5S rDNA clusters showed high interspecies variation. Major rDNA was either subterminal to the short arms or intercalary to the long arms of metacentric or submetacentric chromosomes, whereas minor rDNA signals showed higher variability. Major and minor rDNAs map to different chromosome pairs in all species, but in R. decussatus one of the minor rDNA gene clusters and the major rDNA cluster were located in the same position on a single chromosome pair. This interspersion of both sequences was confirmed by fiber FISH. Telomeric signals appeared at both ends of every chromosome in all species. FISH mapping data are discussed in relation to the molecular phylogenetic trees currently available for Veneridae. PMID:24967400

  11. Expression of the dnaN and dnaQ genes of Escherichia coli is inducible by mitomycin C.

    PubMed

    Kaasch, M; Kaasch, J; Quiñones, A

    1989-10-01

    The dnaN and dnaQ genes encode the beta subunit and the epsilon subunit of the DNA polymerase III holoenzyme. Using translational fusions to lacZ we found that DNA damage caused by mitomycin C induces expression of the dnaA and dnaQ genes. This induction was not observed in lexA and recA mutants which block the induction of the SOS response, suggesting a relationship between the mechanism(s) of genetic control of DNA polymerase III holoenzyme and the SOS regulatory network. Nevertheless, there is evidence that the mitomycin C induction of dnaN and dnaQ is not a simple lexA-regulated process, because nalidixic acid (an excellent SOS inducer) does not increase dnaN and dnaQ gene expression, and the time course of induction is abnormally slow.

  12. Characterization of Homogeneous, Cooperative Protein-DNA Clusters by Sedimentation Equilibrium Analytical Ultracentrifugation and Atomic Force Microscopy.

    PubMed

    Tessmer, Ingrid; Fried, Michael G

    2015-01-01

    Strong, positively cooperative binding can lead to the clustering of proteins on DNA. Here, we describe one approach to the analysis of such clusters. Our example is based on recent studies of the interactions of O(6)-alkylguanine DNA alkyltransferase (AGT) with high-molecular-weight DNAs (Adams et al., 2009; Tessmer, Melikishvili, & Fried, 2012). Cooperative cluster size distributions are predicted using the simplest homogeneous binding and cooperativity (HBC) model, together with data obtained by sedimentation equilibrium analysis. These predictions are tested using atomic force microscopy imaging; for AGT, measured cluster sizes are found to be significantly smaller than those predicted by the HBC model. A mechanism that may account for cluster size limitation is briefly discussed.

  13. A Combinational Clustering Based Method for cDNA Microarray Image Segmentation.

    PubMed

    Shao, Guifang; Li, Tiejun; Zuo, Wangda; Wu, Shunxiang; Liu, Tundong

    2015-01-01

    Microarray technology plays an important role in drawing useful biological conclusions by analyzing thousands of gene expressions simultaneously. Especially, image analysis is a key step in microarray analysis and its accuracy strongly depends on segmentation. The pioneering works of clustering based segmentation have shown that k-means clustering algorithm and moving k-means clustering algorithm are two commonly used methods in microarray image processing. However, they usually face unsatisfactory results because the real microarray image contains noise, artifacts and spots that vary in size, shape and contrast. To improve the segmentation accuracy, in this article we present a combination clustering based segmentation approach that may be more reliable and able to segment spots automatically. First, this new method starts with a very simple but effective contrast enhancement operation to improve the image quality. Then, an automatic gridding based on the maximum between-class variance is applied to separate the spots into independent areas. Next, among each spot region, the moving k-means clustering is first conducted to separate the spot from background and then the k-means clustering algorithms are combined for those spots failing to obtain the entire boundary. Finally, a refinement step is used to replace the false segmentation and the inseparable ones of missing spots. In addition, quantitative comparisons between the improved method and the other four segmentation algorithms--edge detection, thresholding, k-means clustering and moving k-means clustering--are carried out on cDNA microarray images from six different data sets. Experiments on six different data sets, 1) Stanford Microarray Database (SMD), 2) Gene Expression Omnibus (GEO), 3) Baylor College of Medicine (BCM), 4) Swiss Institute of Bioinformatics (SIB), 5) Joe DeRisi's individual tiff files (DeRisi), and 6) University of California, San Francisco (UCSF), indicate that the improved approach is

  14. A Combinational Clustering Based Method for cDNA Microarray Image Segmentation

    PubMed Central

    Shao, Guifang; Li, Tiejun; Zuo, Wangda; Wu, Shunxiang; Liu, Tundong

    2015-01-01

    Microarray technology plays an important role in drawing useful biological conclusions by analyzing thousands of gene expressions simultaneously. Especially, image analysis is a key step in microarray analysis and its accuracy strongly depends on segmentation. The pioneering works of clustering based segmentation have shown that k-means clustering algorithm and moving k-means clustering algorithm are two commonly used methods in microarray image processing. However, they usually face unsatisfactory results because the real microarray image contains noise, artifacts and spots that vary in size, shape and contrast. To improve the segmentation accuracy, in this article we present a combination clustering based segmentation approach that may be more reliable and able to segment spots automatically. First, this new method starts with a very simple but effective contrast enhancement operation to improve the image quality. Then, an automatic gridding based on the maximum between-class variance is applied to separate the spots into independent areas. Next, among each spot region, the moving k-means clustering is first conducted to separate the spot from background and then the k-means clustering algorithms are combined for those spots failing to obtain the entire boundary. Finally, a refinement step is used to replace the false segmentation and the inseparable ones of missing spots. In addition, quantitative comparisons between the improved method and the other four segmentation algorithms--edge detection, thresholding, k-means clustering and moving k-means clustering--are carried out on cDNA microarray images from six different data sets. Experiments on six different data sets, 1) Stanford Microarray Database (SMD), 2) Gene Expression Omnibus (GEO), 3) Baylor College of Medicine (BCM), 4) Swiss Institute of Bioinformatics (SIB), 5) Joe DeRisi’s individual tiff files (DeRisi), and 6) University of California, San Francisco (UCSF), indicate that the improved approach is

  15. Laser induced neutron production by explosion of the deuterium clusters

    SciTech Connect

    Holkundkar, Amol R.; Mishra, Gaurav Gupta, N. K.

    2014-01-15

    The high energy deuterium ions serve as compact source of neutrons when fused with either deuterium or tritium atoms. In view of this, the explosion of the deuterium clusters under the influence of the laser pulse with intensity ranging from 10{sup 15} to 10{sup 19} W/cm{sup 2} is being studied along with the effect of the cluster radius and inter-cluster distance. The objective of this article is to study the efficiency of the deuterium cluster as a compact source of neutrons under various laser and cluster parameters. It is being observed that the cluster density (number of clusters per unit volume) is quite important to gain high neutron yield.

  16. Hydroxyl radical Thymine adduct induced DNA damages

    NASA Astrophysics Data System (ADS)

    Schyman, Patric; Eriksson, Leif A.; Zhang, Ru bo; Laaksonen, Aatto

    2008-06-01

    DNA damages caused by a 5-hydroxy-5,6-dihydrothymine-6-yl radical (5-OHT-6yl) abstracting a C2‧ hydrogen from a neighboring sugar (inter-H abstraction) have been theoretically investigated using hybrid DFT in gas phase and in water solution. The inter-H abstraction was here shown to be comparable in energy (24 kcal mol-1) with the intra-H abstraction in which the 5-OHT-6yl abstracts a C2‧ hydrogen from its own sugar. The effect of a neutrally or a negatively charged phosphate group was also studied and the results show no significant impact on the activation energy of the hydrogen abstraction whereas base release and strand break reactions are affected.

  17. Low Dose Iron Treatments Induce a DNA Damage Response in Human Endothelial Cells within Minutes

    PubMed Central

    Mollet, Inês G.; Giess, Adam; Paschalaki, Koralia; Periyasamy, Manikandan; Lidington, Elaine C.; Mason, Justin C.; Jones, Michael D.; Game, Laurence; Ali, Simak; Shovlin, Claire L.

    2016-01-01

    Background Spontaneous reports from patients able to report vascular sequelae in real time, and recognition that serum non transferrin bound iron may reach or exceed 10μmol/L in the blood stream after iron tablets or infusions, led us to hypothesize that conventional iron treatments may provoke acute vascular injury. This prompted us to examine whether a phenotype could be observed in normal human endothelial cells treated with low dose iron. Methodology Confluent primary human endothelial cells (EC) were treated with filter-sterilized iron (II) citrate or fresh media for RNA sequencing and validation studies. RNA transcript profiles were evaluated using directional RNA sequencing with no pre-specification of target sequences. Alignments were counted for exons and junctions of the gene strand only, blinded to treatment types. Principal Findings Rapid changes in RNA transcript profiles were observed in endothelial cells treated with 10μmol/L iron (II) citrate, compared to media-treated cells. Clustering for Gene Ontology (GO) performed on all differentially expressed genes revealed significant differences in biological process terms between iron and media-treated EC, whereas 10 sets of an equivalent number of randomly selected genes from the respective EC gene datasets showed no significant differences in any GO terms. After 1 hour, differentially expressed genes clustered to vesicle mediated transport, protein catabolism, and cell cycle (Benjamini p = 0.0016, 0.0024 and 0.0032 respectively), and by 6 hours, to cellular response to DNA damage stimulus most significantly through DNA repair genes FANCG, BLM, and H2AFX. Comet assays demonstrated that 10μM iron treatment elicited DNA damage within 1 hour. This was accompanied by a brisk DNA damage response pulse, as ascertained by the development of DNA damage response (DDR) foci, and p53 stabilization. Significance These data suggest that low dose iron treatments are sufficient to modify the vascular endothelium

  18. Clerocidin selectively modifies the gyrase-DNA gate to induce irreversible and reversible DNA damage

    PubMed Central

    Pan, Xiao Su; Dias, Miriam; Palumbo, Manlio; Fisher, L. Mark

    2008-01-01

    Clerocidin (CL), a microbial diterpenoid, reacts with DNA via its epoxide group and stimulates DNA cleavage by type II DNA topoisomerases. The molecular basis of CL action is poorly understood. We establish by genetic means that CL targets DNA gyrase in the Gram-positive bacterium Streptococcus pneumoniae, and promotes gyrase-dependent single- and double-stranded DNA cleavage in vitro. CL-stimulated DNA breakage exhibited a strong preference for guanine preceding the scission site (−1 position). Mutagenesis of −1 guanines to A, C or T abrogated CL cleavage at a strong pBR322 site. Surprisingly, for double-strand breaks, scission on one strand consistently involved a modified (piperidine-labile) guanine and was not reversed by heat, salt or EDTA, whereas complementary strand scission occurred at a piperidine-stable −1 nt and was reversed by EDTA. CL did not induce cleavage by a mutant gyrase (GyrA G79A) identified here in CL-resistant pneumococci. Indeed, mutations at G79 and at the neighbouring S81 residue in the GyrA breakage-reunion domain discriminated poisoning by CL from that of antibacterial quinolones. The results suggest a novel mechanism of enzyme inhibition in which the −1 nt at the gyrase-DNA gate exhibit different CL reactivities to produce both irreversible and reversible DNA damage. PMID:18723572

  19. Oxygen-induced changes in mitochondrial DNA and DNA repair enzymes in aging rat lens.

    PubMed

    Zhang, Yi; Ouyang, Shan; Zhang, Lan; Tang, Xianling; Song, Zhen; Liu, Ping

    2010-01-01

    The treatment of patients with hyperbaric oxygen (HBO), vitrectomy and loss of vitreous gel during aging is associated with a high risk of subsequent development of nuclear cataract. Many studies proved that oxidation is the key reason of nuclear cataract. Reactive oxygen species (ROS) are formed in mitochondria as a by-product of normal metabolism and as a consequence of exposure to environmental compounds. Therefore, mitochondrial DNA (mtDNA) is at particularly high risk of ROS-induced damage. Oxidative damage to mtDNA has been implicated as a causative factor in a wide variety of degenerative diseases and aging. However, the effect of mtDNA damage to the lens has not been studied. The goals of the study were to identify if there was increased mtDNA damage in lens when the eye were exposed to hyperoxic or hypoxic conditions and also to evaluate the changes in gene expression of mtDNA base excision repair (mtBER) enzymes. Our data have shown that the damage of mtDNA, the expression of mtBER enzymes and the level of 8-OHdG in lens increased after inspired hyperoxia, which is likely associated with oxidative stress. However, there was no effect to mtDNA and mtBER enzymes in lens after inspired hypoxia. Nuclear cataract appeared rapidly at 14 month old rats in hyperoxia group, and lens kept transparency in other groups.

  20. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope

    2014-01-01

    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  1. EGFR induces DNA decomposition via phosphodiester bond cleavage

    PubMed Central

    Tong, Yongpeng; Li, Shuiming; Huang, Chunliu

    2017-01-01

    EGFR may induce DNA degradation. This activity had not been previously described as an EGRF function. To confirm this unexpected activity, testing of EGFR in the presence of ATP and either 5A, 5C, 5G, 5T, or 5U oligonucleotides was performed. HPLC-MS analysis demonstrated that 5A and 5U levels significantly decreased in the presence of EGFR. Furthermore, fragments 4A and 4U were produced in 5A+EGFR+ATP and in 5U+EGFR+ATP reaction mixtures, respectively, but not in EGFR-negative controls. Degradation of Poly(A), Poly(C), Poly(G), Poly(I), Poly(T), and Poly(U) oligomers in the presence of EGFR and ATP correlated with the lower ability of reaction products to pair with complementary oligonucleotides. Gel electrophoresis showed that breakdown products migrated more quickly than controls, especially after addition of paired (complementary) oligomers, Poly(A) and Poly(U). Furthermore, λ DNA reaction products also migrated more quickly after incubation with EGFR. The results suggest that EGFR can induce breakage of certain types of nucleotide phosphodiester bonds, especially within the A residues of DNA or U residues of RNA, to induce DNA or RNA decomposition, respectively. This activity may be important in EGRF signaling, DNA degradation, or repair in normal or cancer cell activities. PMID:28272528

  2. Wetting-induced clustering and phoretic motions of colloidal particles

    NASA Astrophysics Data System (ADS)

    Narayanan, Theyencheri; Semeraro, Enrico; Dattani, Rajiv

    In recent years, self-propelled colloidal systems have received considerable attention as models for active matter. Most commonly used synthetic self-propelled systems involve Janus particles with asymmetric chemical composition in a catalytic medium. An analogous behavior can be obtained when particles are suspended in a phase separating binary liquid mixture due to preferential adsorption of one of the liquid species on the colloidal particles. Above an aggregation temperature (TA), particles become attractive and aggregate to form compact colloidal clusters. In the two phase region of the binary mixture, particles partition into the phase rich in adsorbed component. We have used silica colloids suspended in a binary mixture of 3-methyl pyridine and heavy water to probe this adsorption-induced phoretic motion of particles. Using ultra small-angle X-ray scattering and photon correlation spectroscopy, we investigated the static and dynamic behavior of this system. In the one phase region below TA, particles display a repulsive structure factor with diffusive dynamics. In the two-phase region of the host liquid, the static structure is similar but the dynamics is strongly enhanced with the onset of phase separation reminiscent of self-propelled motion.

  3. Inflammation-Induced Cell Proliferation Potentiates DNA Damage-Induced Mutations In Vivo

    PubMed Central

    Kiraly, Orsolya; Gong, Guanyu; Olipitz, Werner; Muthupalani, Sureshkumar; Engelward, Bevin P.

    2015-01-01

    Mutations are a critical driver of cancer initiation. While extensive studies have focused on exposure-induced mutations, few studies have explored the importance of tissue physiology as a modulator of mutation susceptibility in vivo. Of particular interest is inflammation, a known cancer risk factor relevant to chronic inflammatory diseases and pathogen-induced inflammation. Here, we used the fluorescent yellow direct repeat (FYDR) mice that harbor a reporter to detect misalignments during homologous recombination (HR), an important class of mutations. FYDR mice were exposed to cerulein, a potent inducer of pancreatic inflammation. We show that inflammation induces DSBs (γH2AX foci) and that several days later there is an increase in cell proliferation. While isolated bouts of inflammation did not induce HR, overlap between inflammation-induced DNA damage and inflammation-induced cell proliferation induced HR significantly. To study exogenously-induced DNA damage, animals were exposed to methylnitrosourea, a model alkylating agent that creates DNA lesions relevant to both environmental exposures and cancer chemotherapy. We found that exposure to alkylation damage induces HR, and importantly, that inflammation-induced cell proliferation and alkylation induce HR in a synergistic fashion. Taken together, these results show that, during an acute bout of inflammation, there is a kinetic barrier separating DNA damage from cell proliferation that protects against mutations, and that inflammation-induced cell proliferation greatly potentiates exposure-induced mutations. These studies demonstrate a fundamental mechanism by which inflammation can act synergistically with DNA damage to induce mutations that drive cancer and cancer recurrence. PMID:25647331

  4. Global DNA Methylation Analysis Identifies Two Discrete clusters of Pheochromocytoma with Distinct Genomic and Genetic Alterations

    PubMed Central

    Backman, Samuel; Maharjan, Rajani; Falk-Delgado, Alberto; Crona, Joakim; Cupisti, Kenko; Stålberg, Peter; Hellman, Per; Björklund, Peyman

    2017-01-01

    Pheochromocytomas and paragangliomas (PPGLs) are rare and frequently heritable neural-crest derived tumours arising from the adrenal medulla or extra-adrenal chromaffin cells respectively. The majority of PPGL tumours are benign and do not recur with distant metastases. However, a sizeable fraction of these tumours secrete vasoactive catecholamines into the circulation causing a variety of symptoms including hypertension, palpitations and diaphoresis. The genetic landscape of PPGL has been well characterized and more than a dozen genes have been described as recurrently mutated. Recent studies of DNA-methylation have revealed distinct clusters of PPGL that share DNA methylation patterns and driver mutations, as well as identified potential biomarkers for malignancy. However, these findings have not been adequately validated in independent cohorts. In this study we use an array-based genome-wide approach to study the methylome of 39 PPGL and 4 normal adrenal medullae. We identified two distinct clusters of tumours characterized by different methylation patterns and different driver mutations. Moreover, we identify genes that are differentially methylated between tumour subcategories, and between tumours and normal tissue. PMID:28327598

  5. Computer-based methods for the mouse full-length cDNA encyclopedia: real-time sequence clustering for construction of a nonredundant cDNA library.

    PubMed

    Konno, H; Fukunishi, Y; Shibata, K; Itoh, M; Carninci, P; Sugahara, Y; Hayashizaki, Y

    2001-02-01

    We developed computer-based methods for constructing a nonredundant mouse full-length cDNA library. Our cDNA library construction process comprises assessment of library quality, sequencing the 3' ends of inserts and clustering, and completing a re-array to generate a nonredundant library from a redundant one. After the cDNA libraries are generated, we sequence the 5' ends of the inserts to check the quality of the library; then we determine the sequencing priority of each library. Selected libraries undergo large-scale sequencing of the 3' ends of the inserts and clustering of the tag sequences. After clustering, the nonredundant library is constructed from the original libraries, which have redundant clones. All libraries, plates, clones, sequences, and clusters are uniquely identified, and all information is saved in the database according to this identifier. At press time, our system has been in place for the past two years; we have clustered 939,725 3' end sequences into 127,385 groups from 227 cDNA libraries/sublibraries (see http://genome.gse.riken.go.jp/).

  6. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    NASA Astrophysics Data System (ADS)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

    2014-12-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5'-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 . 10-14 cm2 and 7.06 . 10-14 cm2. The highest cross section was found for 5'-TT(ATA)3TT and 5'-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy.

  7. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    PubMed Central

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

  8. DNA familial binding profiles made easy: comparison of various motif alignment and clustering strategies.

    PubMed

    Mahony, Shaun; Auron, Philip E; Benos, Panayiotis V

    2007-03-30

    Transcription factor (TF) proteins recognize a small number of DNA sequences with high specificity and control the expression of neighbouring genes. The evolution of TF binding preference has been the subject of a number of recent studies, in which generalized binding profiles have been introduced and used to improve the prediction of new target sites. Generalized profiles are generated by aligning and merging the individual profiles of related TFs. However, the distance metrics and alignment algorithms used to compare the binding profiles have not yet been fully explored or optimized. As a result, binding profiles depend on TF structural information and sometimes may ignore important distinctions between subfamilies. Prediction of the identity or the structural class of a protein that binds to a given DNA pattern will enhance the analysis of microarray and ChIP-chip data where frequently multiple putative targets of usually unknown TFs are predicted. Various comparison metrics and alignment algorithms are evaluated (a total of 105 combinations). We find that local alignments are generally better than global alignments at detecting eukaryotic DNA motif similarities, especially when combined with the sum of squared distances or Pearson's correlation coefficient comparison metrics. In addition, multiple-alignment strategies for binding profiles and tree-building methods are tested for their efficiency in constructing generalized binding models. A new method for automatic determination of the optimal number of clusters is developed and applied in the construction of a new set of familial binding profiles which improves upon TF classification accuracy. A software tool, STAMP, is developed to host all tested methods and make them publicly available. This work provides a high quality reference set of familial binding profiles and the first comprehensive platform for analysis of DNA profiles. Detecting similarities between DNA motifs is a key step in the comparative study

  9. Salmon DNA Accelerates Bone Regeneration by Inducing Osteoblast Migration

    PubMed Central

    Sato, Ayako; Kajiya, Hiroshi; Mori, Nana; Sato, Hironobu; Fukushima, Tadao; Kido, Hirofumi

    2017-01-01

    The initial step of bone regeneration requires the migration of osteogenic cells to defective sites. Our previous studies suggest that a salmon DNA-based scaffold can promote the bone regeneration of calvarial defects in rats. We speculate that the salmon DNA may possess osteoinductive properties, including the homing of migrating osteogenic cells. In the present study, we investigated the influence of the salmon DNA on osteoblastic differentiation and induction of osteoblast migration using MG63 cells (human preosteoblasts) in vitro. Moreover, we analyzed the bone regeneration of a critical-sized in vivo calvarial bone defect (CSD) model in rats. The salmon DNA enhanced both mRNA and protein expression of the osteogenesis-related factors, runt-related transcription factor 2 (Runx2), alkaline phosphatase, and osterix (OSX) in the MG63 cells, compared with the cultivation using osteogenic induction medium alone. From the histochemical and immunohistochemical assays using frozen sections of the bone defects from animals that were implanted with DNA disks, many cells were found to express aldehyde dehydrogenase 1, one of the markers for mesenchymal stem cells. In addition, OSX was observed in the replaced connective tissue of the bone defects. These findings indicate that the DNA induced the migration and accumulation of osteogenic cells to the regenerative tissue. Furthermore, an in vitro transwell migration assay showed that the addition of DNA enhanced an induction of osteoblast migration, compared with the medium alone. The implantation of the DNA disks promoted bone regeneration in the CSD of rats, compared with that of collagen disks. These results indicate that the salmon DNA enhanced osteoblastic differentiation and induction of migration, resulting in the facilitation of bone regeneration. PMID:28060874

  10. DNA lesions, inducible DNA repair, and cell division: Three key factors in mutagenesis and carcinogenesis

    SciTech Connect

    Ames, B.N.; Shigenaga, M.K.; Gold, L.S.

    1993-12-01

    DNA lesions that escape repair have a certain probability of giving rise to mutations when the cell divides. Endogenous DNA damage is high: 10{sup 6} oxidative lesions are present per rat cell. An exogenous mutagen produces an increment in lesions over the background rate of endogenous lesions. The effectiveness of a particular lesion depends on whether it is excised by a DNA repair system and the probability that it gives rise to a mutation when the cell divides. When the cell divides, an unrepaired DNA lesion has a certain probability of giving rise to a mutation. Thus, an important factor in the mutagenic effect of an exogenous agent whether it is genotoxic or non-genotoxic, is the increment it causes over the background cell division rate (mitogenesis) in cells that appear to matter most in cancer, the stem cells, which are not on their way to being discarded. Increasing their cell division rate increases by high doses of chemicals. If both the rate of DNA lesions and cell division are increased, then there will be a multiplicative effect on mutagenesis (and carcinogenesis), for example, by high doses of a mutagen that also increases mitogenesis through cell killing. The defense system against reactive electrophilic mutagens, such as the glutathione transferases, are also almost all inducible and buffer cells against increments in active forms of chemicals that can cause DNA lesions. A variety of DNA repair defense systems, almost all inducible, buffer the cell against any increment in DNA lesions. Therefore, the effect of a particular chemical insult depends on the level of each defense, which in turn depends on the past history of exposure. Exogenous agents can influence the induction and effectiveness of these defenses. Defenses can be partially disabled by lack of particular micronutrients in the diet (e.g., antioxidants).

  11. Photo-induced brightening and broadening effects of gold quantum clusters

    NASA Astrophysics Data System (ADS)

    Huang, Hsiu-Ying; Lin, Chia-Hui; Lin, Cheng-An J.

    2016-04-01

    We describe the use of UV light under different radiation time induces a variety of fluorescence wavelength of gold quantum clusters. First, we synthesize blue-emitted gold quantum clusters by dissolving the gold trichloride in pure toluene. To simplify the expression, we assume that the several featured PL peak (425, 450, 470 nm) is the signal for blue-emitted gold quantum clusters. Undergo UV irradiation can brighten and broaden the PL spectra of gold quantum clusters, which are observed by the evolutional spectra versus exposure time. After UV light exposure, the major population of gold quantum clusters @425nm decreased and turned to gold quantum clusters@450nm, followed by the growing population of gold quantum clusters@470nm clusters. Until 2 hour exposure, the spectra become broad with major peak shifted to 525 nm. The tunable spectra from blue to green attributes to the induced growth of gold quantum clusters by UV irradiation. The UV energy indeed tunes and broadens the emission covering the whole visible-spectra range. Finally, we also utilize via proper selection of organic surfactant (such as: trioctyl phosphine, TOP) can coordinate the quantum yield enhancement of blue-emitted gold quantum clusters under UV irradiation. The experiment method is easily for gold quantum clusters synthesis. Thus we expect this materials can be developed for fluorescence labeling application in the future.

  12. Inhibition of DNA Methyltransferases Blocks Mutant Huntingtin-Induced Neurotoxicity

    PubMed Central

    Pan, Yanchun; Daito, Takuji; Sasaki, Yo; Chung, Yong Hee; Xing, Xiaoyun; Pondugula, Santhi; Swamidass, S. Joshua; Wang, Ting; Kim, Albert H.; Yano, Hiroko

    2016-01-01

    Although epigenetic abnormalities have been described in Huntington’s disease (HD), the causal epigenetic mechanisms driving neurodegeneration in HD cortex and striatum remain undefined. Using an epigenetic pathway-targeted drug screen, we report that inhibitors of DNA methyltransferases (DNMTs), decitabine and FdCyd, block mutant huntingtin (Htt)-induced toxicity in primary cortical and striatal neurons. In addition, knockdown of DNMT3A or DNMT1 protected neurons against mutant Htt-induced toxicity, together demonstrating a requirement for DNMTs in mutant Htt-triggered neuronal death and suggesting a neurodegenerative mechanism based on DNA methylation-mediated transcriptional repression. Inhibition of DNMTs in HD model primary cortical or striatal neurons restored the expression of several key genes, including Bdnf, an important neurotrophic factor implicated in HD. Accordingly, the Bdnf promoter exhibited aberrant cytosine methylation in mutant Htt-expressing cortical neurons. In vivo, pharmacological inhibition of DNMTs in HD mouse brains restored the mRNA levels of key striatal genes known to be downregulated in HD. Thus, disturbances in DNA methylation play a critical role in mutant Htt-induced neuronal dysfunction and death, raising the possibility that epigenetic strategies targeting abnormal DNA methylation may have therapeutic utility in HD. PMID:27516062

  13. Mitochondrial DNA damage induces apoptosis in senescent cells

    PubMed Central

    Laberge, R-M; Adler, D; DeMaria, M; Mechtouf, N; Teachenor, R; Cardin, G B; Desprez, P-Y; Campisi, J; Rodier, F

    2013-01-01

    Senescence is a cellular response to damage and stress. The senescence response prevents cancer by suppressing the proliferation of cells with a compromised genome and contributes to optimal wound healing in normal tissues. Persistent senescent cells are also thought to drive aging and age-associated pathologies through their secretion of inflammatory factors that modify the tissue microenvironment and alter the function of nearby normal or transformed cells. Understanding how senescent cells alter the microenvironment would be aided by the ability to induce or eliminate senescent cells at will in vivo. Here, we combine the use of the synthetic nucleoside analog ganciclovir (GCV) with herpes simplex virus thymidine kinase (HSVtk) activity to create or eliminate senescent human cells. We show that low concentrations of GCV induce senescence through the accumulation of nuclear DNA damage while higher concentrations of GCV, similar to those used in vivo, kill non-dividing senescent cells via mitochondrial DNA (mtDNA) damage and caspase-dependent apoptosis. Using this system, we effectively eliminated xenografted normal human senescent fibroblasts or induced senescence in human breast cancer cells in vivo. Thus, cellular senescence and mtDNA damage are outcomes of synthetic nucleoside analog treatment, indicating that the GCV–HSVtk combination can be used effectively to promote the targeted formation or eradication of senescent cells. PMID:23868060

  14. Mitochondrial DNA damage induces apoptosis in senescent cells.

    PubMed

    Laberge, R-M; Adler, D; DeMaria, M; Mechtouf, N; Teachenor, R; Cardin, G B; Desprez, P-Y; Campisi, J; Rodier, F

    2013-07-18

    Senescence is a cellular response to damage and stress. The senescence response prevents cancer by suppressing the proliferation of cells with a compromised genome and contributes to optimal wound healing in normal tissues. Persistent senescent cells are also thought to drive aging and age-associated pathologies through their secretion of inflammatory factors that modify the tissue microenvironment and alter the function of nearby normal or transformed cells. Understanding how senescent cells alter the microenvironment would be aided by the ability to induce or eliminate senescent cells at will in vivo. Here, we combine the use of the synthetic nucleoside analog ganciclovir (GCV) with herpes simplex virus thymidine kinase (HSVtk) activity to create or eliminate senescent human cells. We show that low concentrations of GCV induce senescence through the accumulation of nuclear DNA damage while higher concentrations of GCV, similar to those used in vivo, kill non-dividing senescent cells via mitochondrial DNA (mtDNA) damage and caspase-dependent apoptosis. Using this system, we effectively eliminated xenografted normal human senescent fibroblasts or induced senescence in human breast cancer cells in vivo. Thus, cellular senescence and mtDNA damage are outcomes of synthetic nucleoside analog treatment, indicating that the GCV-HSVtk combination can be used effectively to promote the targeted formation or eradication of senescent cells.

  15. Acoustically Induced Microparticle Orbiting and Clustering on a Solid Surface

    NASA Astrophysics Data System (ADS)

    Abdel-Fattah, A.; Tarimala, S.; Roberts, P. M.

    2008-12-01

    Behavior of colloidal particles in the bulk solution or at interfaces under the effect of high-frequency acoustics is critical to many seemingly different applications ranging from enhanced oil recovery to improved mixing in microfluidic channels and from accelerated contaminant extractions to surface cleaning, drug delivery and microelectronics. It can be detrimental or beneficial, depending on the application. In medical research, flow cytometry and microfluidics, for example, acoustically induced clustering of tracer particles and/or their sticking to the walls of channels, vessels, or tubes often becomes a problem. On the other hand, it can be tailored to enhance processes such as mixing in microfluidic devices, particle separation and sizing, and power generation microdevices. To better understand the underlying mechanisms, microscopic visualization experiments were performed in which polystyrene fluorescent (468/508 nm wavelength) microspheres with a mean diameter of 2.26-µm and density of 1.05 g/cm3, were suspended in either de-ionized water or a 0.1M NaCl solution. The freshly-prepared colloidal suspension was injected into a parallel-plate glass flow cell, which was subjected to high-frequency acoustics (200-500 kHz) through a piezoelectric transducer attached to one of the cell's outer walls. When the suspending medium is de-ionized water, acoustic stimulation of the cell at 313 kHz induced three distinct particle behaviors: 1) entrainment and bulk transport via wavelength-scale Rayleigh streaming, 2) transport via direct radiation forces to concentrate at nodal or anti-nodal planes, and 3) entrapment via boundary layer vorticular microstreaming resulting in mobile particles orbiting deposited particles. This latter phenomenon is intriguing. It occurs at specific frequencies and the shape of the orbits is determined by the applied frequency, whereas the rotation speed is proportional to the applied amplitude. At the higher ionic strength, on the other

  16. Pyrosequencing: Applicability for Studying DNA Damage-induced Mutagenesis

    PubMed Central

    Minko, Irina G.; Earley, Lauriel F.; Larlee, Kimberly E.; Lin, Ying-Chih; Lloyd, R. Stephen

    2014-01-01

    Site-specifically modified DNAs are routinely used in the study of DNA damage-induced mutagenesis. These analyses involve the creation of DNA vectors containing a lesion at a predetermined position, DNA replication, and detection of mutations at the target site. The final step has previously required the isolation of individual DNA clones, hybridization with radioactively-labeled probes, and verification of mutations by Sanger sequencing. In search for an alternative procedure that would allow direct quantification of sequence variants in a mixed population of DNA molecules, we evaluated the applicability of pyrosequencing to site-specific mutagenesis assays. The progeny DNAs were analyzed that originated from replication of N6-(deoxy-D-erythro-pentofuranosyl)-2,6-diamino-3,4-dihydro-4-oxo-5-N-methylformamidopyrimidine (MeFapy-dG)-containing vectors in primate cells, with the lesion being positioned in the 5′-GCNGG-3′ sequence context. Pyrosequencing detected ~8% G to T transversions and ~3.5% G to A transitions, a result that was in excellent agreement with frequencies previously measured by the standard procedure [Earley et al., 2013]. However, ~3.5% G to C transversions and ~2.0% deletions could not be detected by pyrosequencing. Consistent with these observations, the sensitivity of pyrosequencing for measuring the single deoxynucleotide variants differed depending on the deoxynucleotide identity, and in the given sequence contexts, was determined to be ~1-2% for A and T and ~5% for C. Pyrosequencing of other DNA isolates that were obtained following replication of MeFapy-dG-containing vectors in primate cells or Escherichia coli, identified several additional limitations. Collectively, our data demonstrated that pyrosequencing can be used for studying DNA damage-induced mutagenesis as an effective complementary experimental approach to current protocols. PMID:24962778

  17. UV radiation effects on a DNA repair enzyme: conversion of a [4Fe-4S](2+) cluster into a [2Fe-2S] (2+).

    PubMed

    Folgosa, Filipe; Camacho, Inês; Penas, Daniela; Guilherme, Márcia; Fróis, João; Ribeiro, Paulo A; Tavares, Pedro; Pereira, Alice S

    2015-03-01

    Organisms are often exposed to different types of ionizing radiation that, directly or not, will promote damage to DNA molecules and/or other cellular structures. Because of that, organisms developed a wide range of response mechanisms to deal with these threats. Endonuclease III is one of the enzymes responsible to detect and repair oxidized pyrimidine base lesions. However, the effect of radiation on the structure/function of these enzymes is not clear yet. Here, we demonstrate the effect of UV-C radiation on E. coli endonuclease III through several techniques, namely UV-visible, fluorescence and Mössbauer spectroscopies, as well as SDS-PAGE and electrophoretic mobility shift assay. We demonstrate that irradiation with a UV-C source has dramatic consequences on the absorption, fluorescence, structure and functionality of the protein, affecting its [4Fe-4S] cluster and its DNA-binding ability, which results in its inactivation. An UV-C radiation-induced conversion of the [4Fe-4S](2+) into a [2Fe-2S](2+) was observed for the first time and proven by Mössbauer and UV-visible analysis. This work also shows that the DNA-binding capability of endonuclease III is highly dependent of the nuclearity of the endogenous iron-sulfur cluster. Thus, from our point of view, in a cellular context, these results strengthen the argument that cellular sensitivity to radiation can also be due to loss of radiation-induced damage repair ability.

  18. Using DNA origami nanostructures to determine absolute cross sections for UV photon-induced DNA strand breakage.

    PubMed

    Vogel, Stefanie; Rackwitz, Jenny; Schürman, Robin; Prinz, Julia; Milosavljević, Aleksandar R; Réfrégiers, Matthieu; Giuliani, Alexandre; Bald, Ilko

    2015-11-19

    We have characterized ultraviolet (UV) photon-induced DNA strand break processes by determination of absolute cross sections for photoabsorption and for sequence-specific DNA single strand breakage induced by photons in an energy range from 6.50 to 8.94 eV. These represent the lowest-energy photons able to induce DNA strand breaks. Oligonucleotide targets are immobilized on a UV transparent substrate in controlled quantities through attachment to DNA origami templates. Photon-induced dissociation of single DNA strands is visualized and quantified using atomic force microscopy. The obtained quantum yields for strand breakage vary between 0.06 and 0.5, indicating highly efficient DNA strand breakage by UV photons, which is clearly dependent on the photon energy. Above the ionization threshold strand breakage becomes clearly the dominant form of DNA radiation damage, which is then also dependent on the nucleotide sequence.

  19. Radiation-induced DNA content variability in mouse sperm

    SciTech Connect

    Pinkel, D.; Gledhill, B.L.; van Dilla, M.A.; Lake, S.; Wyrobek, A.J.

    1983-09-01

    Mouse sperm collected from the cauda epididymidis 35 days after acute testicular x-ray exposure and fluorescently stained for DNA show dose-dependent increases in the coefficient of variation (CV) of flow cytometrically obtained fluorescence distributions. By comparing dose-response curves obtained with three protocols which overcome the optical and cytochemical difficulties of sperm measurement in different ways we conclude the response is due to x-ray-induced DNA content variability. Computer modeling of the shapes of the fluorescence distributions show that at 600 rad 30 to 40% of the sperm have abnormal DNA content. Some have errors as large as two whole chromosomes, but it is not clear whether they are due to whole chromosome nondisjunction or a finer fragmentation of the genome. Exposures to benzo(a)pyrene and mitomycin C cause no detectable DNA content variability. We conclude mouse sperm DNA content measurements are not sensitive to small amounts of aneuploidy and as such will only be useful in detecting agents that produce substantial DNA content variability. Another animal with a smaller number of chromosomes might be more favorable. These sperm measurement techniques may find additional application in other areas of reproductive biology, such as the determination of the relative numbers of X and Y chromosome-bearing sperm in semen that may be artifically enriched in one population.

  20. Hydrodynamic and macromolecules induced clusters of red blood cells in microcapillary flow

    NASA Astrophysics Data System (ADS)

    Claveira, Viviana; Aouane, Othmane; Coupier, Gwennou; Misbah, Chaouqi; Abkarian, Manouk; Wagner, Christian

    2015-11-01

    Recent studies have been shown that despite the large shear rates, the presence of either fibrinogen or the synthetic polymer dextran leads to an enhanced formation of robust clusters of RBC in microcapillaries under flow conditions. The contribution of hydrodynamic interactions and interactions induced by the presence of macromolecules in the cluster formation has not been established. In order to elucidate this mechanism, we compare experimentally in microchannels under flow condition, the pure hydrodynamic cluster formation of RBCs and the cluster formation of RBCs in the presence of macromolecules inducing aggregation. The results reveal strong differences in the cluster morphology. Emphasizing on the case of clusters formed by two cells, the surface to surface interdistances between the cells in the different solutions shows a bimodal distribution. Numerical simulations based on the boundary integral method showed a good agreement with the experimental findings.

  1. He cluster dynamics in W in the presence of cluster induced formation of He traps

    NASA Astrophysics Data System (ADS)

    Krasheninnikov, S. I.; Smirnov, R. D.

    2016-02-01

    The theoretical model describing spatiotemporal dynamics of He clusters in tungsten, which takes into account He trap generation associated with the growth of He clusters, is presented. Application of this model to the formation of the layer of nano-bubbles underneath of the surface of thick He irradiated sample, before surface morphology starts to change, gives very good agreement with currently available experimental data. The role of thermophoresis in a long-term evolution of nano-bubble containing structures is discussed.

  2. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  3. Numerical Simulation of Bubble Cluster Induced Flow by Three-Dimensional Vortex-in-Cell Method.

    PubMed

    Chen, Bin; Wang, Zhiwei; Uchiyama, Tomomi

    2014-08-01

    The behavior of air bubble clusters rising in water and the induced flow field are numerically studied using a three-dimensional two-way coupling algorithm based on a vortex-in-cell (VIC) method. In this method, vortex elements are convected in the Lagrangian frame and the liquid velocity field is solved from the Poisson equation of potential on the Eulerian grid. Two-way coupling is implemented by introducing a vorticity source term induced by the gradient of void fraction. Present simulation results are favorably compared with the measured results of bubble plume, which verifies the validity of the proposed VIC method. The rising of a single bubble cluster as well as two tandem bubble clusters are simulated. The mechanism of the aggregation effect in the rising process of bubble cluster is revealed and the transient processes of the generation, rising, strengthening, and separation of a vortex ring structure with bubble clusters are illustrated and analyzed in detail. Due to the aggregation, the average rising velocity increases with void fraction and is larger than the terminal rising velocity of single bubble. For the two tandem bubble cluster cases, the aggregation effect is stronger for smaller initial cluster distance, and both the strength of the induced vortex structure and the average bubble rising velocity are larger. For the 20 mm cluster distance case, the peak velocity of the lower cluster is about 2.7 times that of the terminal velocity of the single bubble and the peak average velocity of two clusters is about 2 times larger. While for the 30 mm cluster distance case, both the peak velocity of the lower cluster and two clusters are about 1.7 times that of the terminal velocity of the single bubble.

  4. A novel method for discovering local spatial clusters of genomic regions with functional relationships from DNA contact maps

    PubMed Central

    Hu, Xihao; Shi, Christina Huan; Yip, Kevin Y.

    2016-01-01

    Motivation: The three-dimensional structure of genomes makes it possible for genomic regions not adjacent in the primary sequence to be spatially proximal. These DNA contacts have been found to be related to various molecular activities. Previous methods for analyzing DNA contact maps obtained from Hi-C experiments have largely focused on studying individual interactions, forming spatial clusters composed of contiguous blocks of genomic locations, or classifying these clusters into general categories based on some global properties of the contact maps. Results: Here, we describe a novel computational method that can flexibly identify small clusters of spatially proximal genomic regions based on their local contact patterns. Using simulated data that highly resemble Hi-C data obtained from real genome structures, we demonstrate that our method identifies spatial clusters that are more compact than methods previously used for clustering genomic regions based on DNA contact maps. The clusters identified by our method enable us to confirm functionally related genomic regions previously reported to be spatially proximal in different species. We further show that each genomic region can be assigned a numeric affinity value that indicates its degree of participation in each local cluster, and these affinity values correlate quantitatively with DNase I hypersensitivity, gene expression, super enhancer activities and replication timing in a cell type specific manner. We also show that these cluster affinity values can precisely define boundaries of reported topologically associating domains, and further define local sub-domains within each domain. Availability and implementation: The source code of BNMF and tutorials on how to use the software to extract local clusters from contact maps are available at http://yiplab.cse.cuhk.edu.hk/bnmf/. Contact: kevinyip@cse.cuhk.edu.hk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27307607

  5. DNA damage response in peripheral nervous system: coping with cancer therapy-induced DNA lesions.

    PubMed

    Englander, Ella W

    2013-08-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons.

  6. Low Concentration of Exogenous Carbon Monoxide Modulates Radiation-Induced Bystander Effect in Mammalian Cell Cluster Model.

    PubMed

    Wu, Wenqing; Nie, Lili; Yu, K N; Wu, Lijun; Kong, Peizhong; Bao, Lingzhi; Chen, Guodong; Yang, Haoran; Han, Wei

    2016-12-08

    During radiotherapy procedures, radiation-induced bystander effect (RIBE) can potentially lead to genetic hazards to normal tissues surrounding the targeted regions. Previous studies showed that RIBE intensities in cell cluster models were much higher than those in monolayer cultured cell models. On the other hand, low-concentration carbon monoxide (CO) was previously shown to exert biological functions via binding to the heme domain of proteins and then modulating various signaling pathways. In relation, our previous studies showed that exogenous CO generated by the CO releasing molecule, tricarbonyldichlororuthenium (CORM-2), at a relatively low concentration (20 µM), effectively attenuated the formation of RIBE-induced DNA double-strand breaks (DSB) and micronucleus (MN). In the present work, we further investigated the capability of a low concentration of exogenous CO (CORM-2) of attenuating or inhibiting RIBE in a mixed-cell cluster model. Our results showed that CO (CORM-2) with a low concentration of 30 µM could effectively suppress RIBE-induced DSB (p53 binding protein 1, p53BP1), MN formation and cell proliferation in bystander cells but not irradiated cells via modulating the inducible nitric oxide synthase (iNOS) andcyclooxygenase-2 (COX-2). The results can help mitigate RIBE-induced hazards during radiotherapy procedures.

  7. Low Concentration of Exogenous Carbon Monoxide Modulates Radiation-Induced Bystander Effect in Mammalian Cell Cluster Model

    PubMed Central

    Wu, Wenqing; Nie, Lili; Yu, K. N.; Wu, Lijun; Kong, Peizhong; Bao, Lingzhi; Chen, Guodong; Yang, Haoran; Han, Wei

    2016-01-01

    During radiotherapy procedures, radiation-induced bystander effect (RIBE) can potentially lead to genetic hazards to normal tissues surrounding the targeted regions. Previous studies showed that RIBE intensities in cell cluster models were much higher than those in monolayer cultured cell models. On the other hand, low-concentration carbon monoxide (CO) was previously shown to exert biological functions via binding to the heme domain of proteins and then modulating various signaling pathways. In relation, our previous studies showed that exogenous CO generated by the CO releasing molecule, tricarbonyldichlororuthenium (CORM-2), at a relatively low concentration (20 µM), effectively attenuated the formation of RIBE-induced DNA double-strand breaks (DSB) and micronucleus (MN). In the present work, we further investigated the capability of a low concentration of exogenous CO (CORM-2) of attenuating or inhibiting RIBE in a mixed-cell cluster model. Our results showed that CO (CORM-2) with a low concentration of 30 µM could effectively suppress RIBE-induced DSB (p53 binding protein 1, p53BP1), MN formation and cell proliferation in bystander cells but not irradiated cells via modulating the inducible nitric oxide synthase (iNOS) andcyclooxygenase-2 (COX-2). The results can help mitigate RIBE-induced hazards during radiotherapy procedures. PMID:27941646

  8. Multiomic Analysis of the UV-Induced DNA Damage Response.

    PubMed

    Boeing, Stefan; Williamson, Laura; Encheva, Vesela; Gori, Ilaria; Saunders, Rebecca E; Instrell, Rachael; Aygün, Ozan; Rodriguez-Martinez, Marta; Weems, Juston C; Kelly, Gavin P; Conaway, Joan W; Conaway, Ronald C; Stewart, Aengus; Howell, Michael; Snijders, Ambrosius P; Svejstrup, Jesper Q

    2016-05-11

    In order to facilitate the identification of factors and pathways in the cellular response to UV-induced DNA damage, several descriptive proteomic screens and a functional genomics screen were performed in parallel. Numerous factors could be identified with high confidence when the screen results were superimposed and interpreted together, incorporating biological knowledge. A searchable database, bioLOGIC, which provides access to relevant information about a protein or process of interest, was established to host the results and facilitate data mining. Besides uncovering roles in the DNA damage response for numerous proteins and complexes, including Integrator, Cohesin, PHF3, ASC-1, SCAF4, SCAF8, and SCAF11, we uncovered a role for the poorly studied, melanoma-associated serine/threonine kinase 19 (STK19). Besides effectively uncovering relevant factors, the multiomic approach also provides a systems-wide overview of the diverse cellular processes connected to the transcription-related DNA damage response.

  9. Current-induced enhancement of DNA bubble creation

    NASA Astrophysics Data System (ADS)

    Gu, Lei; Fu, Hua-Hua

    2016-05-01

    Current-induced heating of short double-stranded DNA chains is studied within a two-probe transport setup by using the Langevin approach. The electrons are modeled by a tight-binding Hamiltonian. The DNA atomic motion is described by the Peyrard-Bishop-Dauxois atomic potential, coupled with electrons through the Holstein interaction. The solvent environment is accounted for as a classical heat bath. Voltage biases of 0.1˜ 0.5 {{V}} can effectively break the base pairs and lead to the melting transition, which can be detected from the resulting significant reduction of the conductance. When the bias increases, the opening of base pairs near the leads with higher chemical potential is suppressed and bubble (localized separation of the double strand) formation becomes asymmetric. Our results suggest that the voltage bias can excite the base pairs, hence increases the chemical activity of DNA.

  10. Low-energy plasma immersion ion implantation to induce DNA transfer into bacterial E. coli

    NASA Astrophysics Data System (ADS)

    Sangwijit, K.; Yu, L. D.; Sarapirom, S.; Pitakrattananukool, S.; Anuntalabhochai, S.

    2015-12-01

    Plasma immersion ion implantation (PIII) at low energy was for the first time applied as a novel biotechnology to induce DNA transfer into bacterial cells. Argon or nitrogen PIII at low bias voltages of 2.5, 5 and 10 kV and fluences ranging from 1 × 1012 to 1 × 1017 ions/cm2 treated cells of Escherichia coli (E. coli). Subsequently, DNA transfer was operated by mixing the PIII-treated cells with DNA. Successes in PIII-induced DNA transfer were demonstrated by marker gene expressions. The induction of DNA transfer was ion-energy, fluence and DNA-size dependent. The DNA transferred in the cells was confirmed functioning. Mechanisms of the PIII-induced DNA transfer were investigated and discussed in terms of the E. coli cell envelope anatomy. Compared with conventional ion-beam-induced DNA transfer, PIII-induced DNA transfer was simpler with lower cost but higher efficiency.

  11. Liposome clusters with shear stress-induced membrane permeability.

    PubMed

    Yoshimoto, Makoto; Tamura, Ryota; Natsume, Tomotaka

    2013-09-01

    Clusters of negatively charged liposomes were prepared by the addition of Ca(2+) and characterized in their structure and membrane permeability under shear stress. The liposomes mainly used were composed of zwitterionic 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 20 mol% negatively charged 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) and 30 mol% cholesterol. The liposomes with mean diameter of 193 nm were aggregated into the clusters with a distribution peak at about 1.5 μm in the 50mM Tris buffer solution of pH 8.5 at the lipid and Ca(2+) concentrations of 1.0mM and 40 mM, respectively. More than 90% of liposomes were redispersed at the Ca(2+) concentration of 80 mM. POPG-rich liposomes (POPC/POPG/cholesterol=5:65:30 [lipid]=1.0mM) were irreversibly aggregated at [Ca(2+)]≥ 10 mM, indicating the significant contribution of POPC to the reversible clustering of liposomes. The membranes of liposome clusters were impermeable to 5(6)-carboxyfluorescein (CF) in the static liquid system at 25°C due to the decrease in specific surface area of the liposomal system. In the shear flow, in clear contrast, continuous membrane permeation of CF was observed at the shear rate of 1.5 × 10(3)s(-1), exhibiting comparable membrane permeability to the non-clustered liposomes. The theoretical analysis of modified DLVO potential indicated that liposome membranes were not in contact with each other within the clusters. Therefore, the liposome clusters are structurally flexible under the applied shear stress, providing sufficient lipid membrane-water interfacial area for the permeation of CF. The results obtained would be important to control the formation of liposome clusters and their permeabilization for biochemical and biomedical applications.

  12. Chemically induced morphology change in cluster-based nanostructures

    NASA Astrophysics Data System (ADS)

    Lando, A.; Kébaǧli, N.; Cahuzac, Ph.; Colliex, C.; Couillard, M.; Masson, A.; Schmidt, M.; Bréchignac, C.

    2007-07-01

    Preformed clusters carrying surfactant are used as primary blocks for the building of nano structures. Self assembly of silver atom based clusters, soft landed on a HOPG surface, generates a large variety of new architectures depending on the nature and on the concentration of the impurities. Fractal shapes fragmented into multiple compact like islands, and chain like structures might be formed. A strong local enhancement of the silver atom mobility at the surface of islands is responsible for those morphology changes.

  13. PCA and clustering reveal alternate mtDNA phylogeny of N and M clades.

    PubMed

    Alexe, G; Satya, R Vijaya; Seiler, M; Platt, D; Bhanot, T; Hui, S; Tanaka, M; Levine, A J; Bhanot, G

    2008-11-01

    Phylogenetic trees based on mtDNA polymorphisms are often used to infer the history of recent human migrations. However, there is no consensus on which method to use. Most methods make strong assumptions which may bias the choice of polymorphisms and result in computational complexity which limits the analysis to a few samples/polymorphisms. For example, parsimony minimizes the number of mutations, which biases the results to minimizing homoplasy events. Such biases may miss the global structure of the polymorphisms altogether, with the risk of identifying a "common" polymorphism as ancient without an internal check on whether it either is homoplasic or is identified as ancient because of sampling bias (from oversampling the population with the polymorphism). A signature of this problem is that different methods applied to the same data or the same method applied to different datasets results in different tree topologies. When the results of such analyses are combined, the consensus trees have a low internal branch consensus. We determine human mtDNA phylogeny from 1737 complete sequences using a new, direct method based on principal component analysis (PCA) and unsupervised consensus ensemble clustering. PCA identifies polymorphisms representing robust variations in the data and consensus ensemble clustering creates stable haplogroup clusters. The tree is obtained from the bifurcating network obtained when the data are split into k = 2,3,4,...,kmax clusters, with equal sampling from each haplogroup. Our method assumes only that the data can be clustered into groups based on mutations, is fast, is stable to sample perturbation, uses all significant polymorphisms in the data, works for arbitrary sample sizes, and avoids sample choice and haplogroup size bias. The internal branches of our tree have a 90% consensus accuracy. In conclusion, our tree recreates the standard phylogeny of the N, M, L0/L1, L2, and L3 clades, confirming the African origin of modern humans

  14. Silica radical-induced DNA damage and lipid peroxidation.

    PubMed Central

    Shi, X; Mao, Y; Daniel, L N; Saffiotti, U; Dalal, N S; Vallyathan, V

    1994-01-01

    In recent years, more attention has been given to the mechanism of disease induction caused by the surface properties of minerals. In this respect, specific research needs to be focused on the biologic interactions of oxygen radicals generated by mineral particles resulting in cell injury and DNA damage leading to fibrogenesis and carcinogenesis. In this investigation, we used electron spin resonance (ESR) and spin trapping to study oxygen radical generation from aqueous suspensions of freshly fractured crystalline silica. Hydroxyl radical (.OH), superoxide radical (O2.-) and singlet oxygen (1O2) were all detected. Superoxide dismutase (SOD) partially inhibited .OH yield, whereas catalase abolished .OH generation. H2O2 enhanced .OH generation while deferoxamine inhibited it, indicating that .OH is generated via a Haber-Weiss type reaction. These spin trapping measurements provide the first evidence that aqueous suspensions of silica particles generate O2.- and 1O2. Oxygen consumption measurements indicate that freshly fractured silica uses molecular oxygen to generate O2.- and 1O2. Electrophoretic assays of in vitro DNA strand breakages showed that freshly fractured silica induced DNA strand breakage, which was inhibited by catalase and enhanced by H2O2. In an argon atmosphere, DNA damage was suppressed, showing that molecular oxygen is required for the silica-induced DNA damage. Incubation of freshly fractured silica with linoleic acid generated linoleic acid-derived free radicals and caused dose-dependent lipid peroxidation as measured by ESR spin trapping and malondialdehyde formation. SOD, catalase, and sodium benzoate inhibited lipid peroxidation by 49, 52, and 75%, respectively, again showing the role of oxygen radicals in silica-induced lipid peroxidation.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 7. PMID:7705289

  15. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].

    PubMed

    Smetanina, N M; Pustovalova, M V; Osipov, A N

    2013-01-01

    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells.

  16. Assembling the Streptococcus thermophilus clustered regularly interspaced short palindromic repeats (CRISPR) array for multiplex DNA targeting.

    PubMed

    Guo, Lijun; Xu, Kun; Liu, Zhiyuan; Zhang, Cunfang; Xin, Ying; Zhang, Zhiying

    2015-06-01

    In addition to the advantages of scalable, affordable, and easy to engineer, the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) technology is superior for multiplex targeting, which is laborious and inconvenient when achieved by cloning multiple gRNA expressing cassettes. Here, we report a simple CRISPR array assembling method which will facilitate multiplex targeting usage. First, the Streptococcus thermophilus CRISPR3/Cas locus was cloned. Second, different CRISPR arrays were assembled with different crRNA spacers. Transformation assays using different Escherichia coli strains demonstrated efficient plasmid DNA targeting, and we achieved targeting efficiency up to 95% with an assembled CRISPR array with three crRNA spacers.

  17. Self-assembly of molecule-like nanoparticle clusters directed by DNA nanocages.

    PubMed

    Li, Yulin; Liu, Zhiyu; Yu, Guimei; Jiang, Wen; Mao, Chengde

    2015-04-08

    Analogous to the atom-molecule relationship, nanoparticle (NP) clusters (or NP-molecules) with defined compositions and directional bonds could potentially integrate the properties of the component individual NPs, leading to emergent properties. Despite extensive efforts in this direction, no general approach is available for assembly of such NP-molecules. Here we report a general method for building this type of structures by encapsulating NPs into self-assembled DNA polyhedral wireframe nanocages, which serve as guiding agents for further assembly. As a demonstration, a series of NP-molecules have been assembled and validated. Such NP-molecules will, we believe, pave a way to explore new nanomaterials with emergent functions/properties that are related to, but do not belong to the individual component nanoparticles.

  18. Reconstruction of CMB temperature anisotropies with primordial CMB induced polarization in galaxy clusters

    NASA Astrophysics Data System (ADS)

    Liu, Guo-Chin; Ichiki, Kiyotomo; Tashiro, Hiroyuki; Sugiyama, Naoshi

    2016-07-01

    Scattering of cosmic microwave background (CMB) radiation in galaxy clusters induces polarization signals determined by the quadrupole anisotropy in the photon distribution at the location of clusters. This `remote quadrupole' derived from the measurements of the induced polarization in galaxy clusters provides an opportunity to reconstruct local CMB temperature anisotropies. In this Letter, we develop an algorithm of the reconstruction through the estimation of the underlying primordial gravitational potential, which is the origin of the CMB temperature and polarization fluctuations and CMB induced polarization in galaxy clusters. We found a nice reconstruction for the quadrupole and octopole components of the CMB temperature anisotropies with the assistance of the CMB induced polarization signals. The reconstruction can be an important consistency test on the puzzles of CMB anomalies, especially for the low-quadrupole and axis-of-evil problems reported in Wilkinson Microwave Anisotropy Probe and Planck data.

  19. Nucleosomes Suppress the Formation of Double-strand DNA Breaks during Attempted Base Excision Repair of Clustered Oxidative Damages*

    PubMed Central

    Cannan, Wendy J.; Tsang, Betty P.; Wallace, Susan S.; Pederson, David S.

    2014-01-01

    Exposure to ionizing radiation can produce multiple, clustered oxidative lesions in DNA. The near simultaneous excision of nearby lesions in opposing DNA strands by the base excision repair (BER) enzymes can produce double-strand DNA breaks (DSBs). This attempted BER accounts for many of the potentially lethal or mutagenic DSBs that occur in vivo. To assess the impact of nucleosomes on the frequency and pattern of BER-dependent DSB formation, we incubated nucleosomes containing oxidative damages in opposing DNA strands with selected DNA glycosylases and human apurinic/apyrimidinic endonuclease 1. Overall, nucleosomes substantially suppressed DSB formation. However, the degree of suppression varied as a function of (i) the lesion type and DNA glycosylase tested, (ii) local sequence context and the stagger between opposing strand lesions, (iii) the helical orientation of oxidative lesions relative to the underlying histone octamer, and (iv) the distance between the lesion cluster and the nucleosome edge. In some instances the binding of a BER factor to one nucleosomal lesion appeared to facilitate binding to the opposing strand lesion. DSB formation did not invariably lead to nucleosome dissolution, and in some cases, free DNA ends resulting from DSB formation remained associated with the histone octamer. These observations explain how specific structural and dynamic properties of nucleosomes contribute to the suppression of BER-generated DSBs. These studies also suggest that most BER-generated DSBs will occur in linker DNA and in genomic regions associated with elevated rates of nucleosome turnover or remodeling. PMID:24891506

  20. Scaffold attachment factor A (SAF-A) and Ku temporally regulate repair of radiation-induced clustered genome lesions

    PubMed Central

    Mantha, Anil K.; Hegde, Pavana M.; Pandey, Arvind; Sengupta, Shiladitya; Yu, Yaping; Calsou, Patrick; Chen, David; Lees-Miller, Susan P.; Mitra, Sankar

    2016-01-01

    Ionizing radiation (IR) induces highly cytotoxic double-strand breaks (DSBs) and also clustered oxidized bases in mammalian genomes. Base excision repair (BER) of bi-stranded oxidized bases could generate additional DSBs as repair intermediates in the vicinity of direct DSBs, leading to loss of DNA fragments. This could be avoided if DSB repair via DNA-PK-mediated nonhomologous end joining (NHEJ) precedes BER initiated by NEIL1 and other DNA glycosylases (DGs). Here we show that DNA-PK subunit Ku inhibits DGs via direct interaction. The scaffold attachment factor (SAF)-A, (also called hnRNP-U), phosphorylated at Ser59 by DNA-PK early after IR treatment, is linked to transient release of chromatin-bound NEIL1, thus preventing BER. SAF-A is subsequently dephosphorylated. Ku inhibition of DGs in vitro is relieved by unphosphorylated SAF-A, but not by the phosphomimetic Asp59 mutant. We thus propose that SAF-A, in concert with Ku, temporally regulates base damage repair in irradiated cell genome. PMID:27303920

  1. Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

    PubMed

    Kryachko, E S; Remacle, F

    2005-12-08

    The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

  2. Fullerenes Can Induce Toxic Physical Changes of DNA

    NASA Astrophysics Data System (ADS)

    Czerwinski, Fabian; Oddershede, Lene B.

    2008-03-01

    Fullerenes are fascinating symmetric carbon nanostructures. Nowadays, they are widely used because of their characteristic physical and chemical properties. Until now research has mainly been focused on commercial applications of fullerenes. Only a few investigations have addressed the potential biological hazards, one of which is that fullerenes are believed to alter the elastic properties of DNA upon binding. In our experiments we use optical tweezers with sub-piconewton and nanometer resolution to probe the structural changes and the potential damages which fullerenes might induce on single DNA molecules. Therefore, force-extension relations can be obtained under physiological conditions while varying the concentration of different types of fullerenes. It has theoretically been predicted [1], that certain fullerenes can function as a minor-groove binder to double-stranded DNA, thus altering its elastic properties significantly. Fullerenes are capable of causing severe damage inside living organisms by forming DNA regions which are not accessible for proper enzymatic functions. A further goal of the study is to establish fullerenes as a tool for a more detailed investigation of DNA-protein interactions, such as the trafficing of polymerases or the packing by procaryotic proteins. [1] Zhao X, Striolo A, and Cummings PT: C60 Binds to and Deforms Nucleotides. BiophysJ (89):3856-62, 2005.

  3. Radiation-induced DNA content variability in mouse sperm

    SciTech Connect

    Pinkel, D.; Gledhill, B.L.; Van Dilla, M.A.; Lake, S.; Wyrobek, A.J.

    1983-09-01

    Mouse sperm collected from the cauda epididymidis 35 days after acute testicular X-ray exposure and fluorescently stained for DNA show dose-dependent increases in the coefficient of variation (CV) of flow cytometrically obtained fluorescence distributions. By comparing dose-response curves obtained with three protocols which overcome the optical and cytochemical difficulties of sperm measurement in different ways we conclude the response is due to X-ray-induced DNA content variability. In the range between 0 and 600 rad the dose dependence of the square of CV of the DNA content variability, delta CV2D, is described by delta CV2D . Bx + Cx2, with 0 less than or equal to B less than or equal to 0.23 X 10(-2) and C . (0.44 +/- 0.06) X 10(-4). The dose x is measured in rad and delta CVD is expressed in percent. Computer modeling of the shapes of the fluorescence distributions show that at 600 rad 30 to 40% of the sperm have abnormal DNA content. Some have errors as large as two whole chromosomes, but it is not clear whether they are due to whole chromosome nondisjunction or a finer fragmentation of the genome. Exposures to benzo(a)pyrene and mitomycin C cause no detectable DNA content variability. We conclude mouse sperm DNA content measurements are not sensitive to small amounts of aneuploidy and as such will only be useful in detecting agents that produce substantial DNA content variability. Another animal with a smaller number of chromosomes might be more favorable. These sperm measurement techniques may find additional application in other areas of reproductive biology, such as the determination of the relative numbers of X and Y chromosome-bearing sperm in semen that may be artificially enriched in one population.

  4. Insights into eukaryotic DNA priming from the structure and functional interactions of the 4Fe-4S cluster domain of human DNA primase

    SciTech Connect

    Vaithiyalingam, Sivaraja; Warren, Eric M.; Eichman, Brandt F.; Chazin, Walter J.

    2010-10-19

    DNA replication requires priming of DNA templates by enzymes known as primases. Although DNA primase structures are available from archaea and bacteria, the mechanism of DNA priming in higher eukaryotes remains poorly understood in large part due to the absence of the structure of the unique, highly conserved C-terminal regulatory domain of the large subunit (p58C). Here, we present the structure of this domain determined to 1.7-{angstrom} resolution by X-ray crystallography. The p58C structure reveals a novel arrangement of an evolutionarily conserved 4Fe-4S cluster buried deeply within the protein core and is not similar to any known protein structure. Analysis of the binding of DNA to p58C by fluorescence anisotropy measurements revealed a strong preference for ss/dsDNA junction substrates. This approach was combined with site-directed mutagenesis to confirm that the binding of DNA occurs to a distinctively basic surface on p58C. A specific interaction of p58C with the C-terminal domain of the intermediate subunit of replication protein A (RPA32C) was identified and characterized by isothermal titration calorimetry and NMR. Restraints from NMR experiments were used to drive computational docking of the two domains and generate a model of the p58C-RPA32C complex. Together, our results explain functional defects in human DNA primase mutants and provide insights into primosome loading on RPA-coated ssDNA and regulation of primase activity.

  5. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.

    PubMed

    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji

    2016-03-01

    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV.

  6. Surface-enhanced Raman scattering spectroscopy of topotecan-DNA complexes: Binding to DNA induces topotecan dimerization

    NASA Astrophysics Data System (ADS)

    Mochalov, K. E.; Strel'Tsov, S. A.; Ermishov, M. A.; Grokhovskii, S. L.; Zhuze, A. L.; Ustinova, O. A.; Sukhanova, A. V.; Nabiev, I. R.; Oleinikov, V. A.

    2002-09-01

    The interaction of topotecan (TPT), antitumor inhibitor of human DNA topoisomerase I, with calf thymus DNA was studied by surface-enhanced Raman scattering (SERS) spectroscopy. The SERS spectra of TPT are found to depend on its concentration in solution, which is associated with the dimerization of TPT. The spectral signatures of dimerization are identified. It is shown that binding to DNA induces the formation of TPT dimers. The formation of DNA-TPT-TPT-DNA complexes is considered as one of the possible mechanisms of human DNA topoisomerase I inhibition.

  7. GeMes, Clusters of DNA Methylation under Genetic Control, Can Inform Genetic and Epigenetic Analysis of Disease

    PubMed Central

    Liu, Yun; Li, Xin; Aryee, Martin J.; Ekström, Tomas J.; Padyukov, Leonid; Klareskog, Lars; Vandiver, Amy; Moore, Ann Zenobia; Tanaka, Toshiko; Ferrucci, Luigi; Fallin, M. Daniele; Feinberg, Andrew P.

    2014-01-01

    Epigenetic marks such as DNA methylation have generated great interest in the study of human disease. However, studies of DNA methylation have not established population-epigenetics principles to guide design, efficient statistics, or interpretation. Here, we show that the clustering of correlated DNA methylation at CpGs was similar to that of linkage-disequilibrium (LD) correlation in genetic SNP variation but for much shorter distances. Some clustering of methylated CpGs appeared to be genetically driven. Further, a set of correlated methylated CpGs related to a single SNP-based LD block was not always physically contiguous—segments of uncorrelated methylation as long as 300 kb could be interspersed in the cluster. Thus, we denoted these sets of correlated CpGs as GeMes, defined as potentially noncontiguous methylation clusters under the control of one or more methylation quantitative trait loci. This type of correlated methylation structure has implications for both biological functions of DNA methylation and for the design, analysis, and interpretation of epigenome-wide association studies. PMID:24656863

  8. Boron Clusters as a Platform for New Materials: Synthesis of Functionalized o-Carborane (C2 B10 H12 ) Derivatives Incorporating DNA Fragments.

    PubMed

    Janczak, Slawomir; Olejniczak, Agnieszka; Balabańska, Sandra; Chmielewski, Marcin K; Lupu, Marius; Viñas, Clara; Lesnikowski, Zbigniew J

    2015-10-19

    A synthetic strategy for functionalization of the three vertices of o-carborane and the attachment of the obtained triped to the solid support was developed. Further functionalization of the triped with short DNA sequences by automated DNA synthesis was achieved. The proposed methodology is a first example of boron cluster chemistry on a solid support opening new perspectives in boron cluster functionalization.

  9. Novel kinetic trapping in charged colloidal clusters due to self-induced surface charge organization.

    PubMed

    Klix, Christian L; Murata, Ken-ichiro; Tanaka, Hajime; Williams, Stephen R; Malins, Alex; Royall, C Patrick

    2013-01-01

    Colloidal clusters are an unusual state of matter where tunable interactions enable a sufficient reduction in their degrees of freedom that their energy landscapes can become tractable - they form a playground for statistical mechanics and promise unprecedented control of structure on the submicron lengthscale. We study colloidal clusters in a system where a short-ranged polymer-induced attraction drives clustering, while a weak, long-ranged electrostatic repulsion prevents extensive aggregation. We compare experimental yields of cluster structures with theory which assumes simple addition of competing isotropic interactions between the colloids. Here we show that for clusters of size 4 ≤ m ≤ 7, the yield of minimum energy clusters is much less than expected. We attribute this to an anisotropic self-organized surface charge distribution which leads to unexpected kinetic trapping. We introduce a model for the coupling between counterions and binding sites on the colloid surface with which we interpret our findings.

  10. Delay-induced cluster patterns in coupled Cayley tree networks

    NASA Astrophysics Data System (ADS)

    Singh, A.; Jalan, S.

    2013-07-01

    We study effects of delay in diffusively coupled logistic maps on the Cayley tree networks. We find that smaller coupling values exhibit sensitiveness to value of delay, and lead to different cluster patterns of self-organized and driven types. Whereas larger coupling strengths exhibit robustness against change in delay values, and lead to stable driven clusters comprising nodes from last generation of the Cayley tree. Furthermore, introduction of delay exhibits suppression as well as enhancement of synchronization depending upon coupling strength values. To the end we discuss the importance of results to understand conflicts and cooperations observed in family business.

  11. Karyotype, chromosomal characteristics of multiple rDNA clusters and intragenomic variability of ribosomal ITS2 in Caryophyllaeides fennica (Cestoda).

    PubMed

    Orosová, Martina; Ivica, Králová-Hromadová; Eva, Bazsalovicsová; Marta, Spakulová

    2010-09-01

    Karyotype and chromosomal characteristics, i.e. number and location of ribosomal DNA (rDNA) clusters, and sequence variation of the ribosomal internal transcribed spacer 2 (ITS2) were studied in a monozoic (unsegmented) tapeworm, Caryophyllaeides fennica (Caryophyllidea), using conventional and Ag-staining, fluorescent in situ hybridization (FISH) with 18S rDNA probe, and PCR amplification, cloning and sequencing of the complete ribosomal ITS2 spacer. The karyotype of this species was composed of ten pairs of metacentric (m) chromosomes (2n=20). All chromosomes except the pair No. 2 displayed DAPI-positive heterochromatin in centromeric regions. In addition, two distinct interstitial DAPI-positive bands were identified on chromosome pair No. 7. FISH with 18S rDNA probe revealed four clusters of major ribosomal genes situated in the pericentromeric region of the short arms in two pairs of metacentric chromosomes Nos. 8 and 9. Hybridization signals were stronger in the pair No. 8, indicating a higher amount of rDNA repeats at this nucleolar organizer region (NOR). Analysis of 15 ITS2 rDNA sequences (five recombinant clones from each of three individuals) showed 13 structurally different ribotypes, distinguished by 26 nucleotide substitutions and variable numbers and combinations of short repetitive motifs that allowed sorting the sequences into four ITS2 variants. These results contribute to recently published evidence for the intraindividual ribosomal ITS sequence variability in basal tapeworms with multiple rDNA loci and imply that both phenomena may be mutually linked.

  12. Ribosomal DNA clusters and telomeric (TTAGG)n repeats in blue butterflies (Lepidoptera, Lycaenidae) with low and high chromosome numbers

    PubMed Central

    Vershinina, Alisa O.; Anokhin, Boris A.; Lukhtanov, Vladimir A.

    2015-01-01

    Abstract Ribosomal DNA clusters and telomeric repeats are important parts of eukaryotic genome. However, little is known about their organization and localization in karyotypes of organisms with holocentric chromosomes. Here we present first cytogenetic study of these molecular structures in seven blue butterflies of the genus Polyommatus Latreille, 1804 with low and high chromosome numbers (from n=10 to n=ca.108) using fluorescence in situ hybridization (FISH) with 18S rDNA and (TTAGG)n telomeric probes. FISH with the 18S rDNA probe showed the presence of two different variants of the location of major rDNA clusters in Polyommatus species: with one or two rDNA-carrying chromosomes in haploid karyotype. We discuss evolutionary trends and possible mechanisms of changes in the number of ribosomal clusters. We also demonstrate that Polyommatus species have the classical insect (TTAGG)n telomere organization. This chromosome end protection mechanism probably originated de novo in small chromosomes that evolved via fragmentations. PMID:26140159

  13. Hybrid magnetic nanoparticle/nanogold clusters and their distance-dependent metal-enhanced fluorescence effect via DNA hybridization

    NASA Astrophysics Data System (ADS)

    GuThese Authors Contributed Equally To This Study., Xuefan; Wu, Youshen; Zhang, Lingze; Liu, Yongchun; Li, Yan; Yan, Yongli; Wu, Daocheng

    2014-07-01

    To improve the metal-enhanced fluorescence (MEF) effect of nanogolds (AuNPs) and accurately detect specific DNA sequences via DNA hybridization, novel hybrid magnetic nanoparticles/nanogold clusters (HMNCs) were designed based on finite-difference time-domain simulation results and prepared by using Fe3O4 and nanogolds. The nanogolds outside the HMNC were then conjugated with thiol-terminated DNA molecules, thus DNA modified-HMNCs (DNA-HMNCs) were obtained. The size distributions of these nanostructures were measured by a Malvern size analyzer, and their morphology was observed via transmission electron microscopy (TEM). The ultraviolet (UV)-visible (vis) absorption spectra of the samples were recorded with a UV-2600 spectrophotometer. Fluorescence spectra and the MEF effect were recorded using a spectrophotofluorometer, and lifetimes were determined using a time-correlated single photon counting apparatus. The prepared HMNCs were stable in aqueous solutions and had an average diameter of 87 +/- 3.2 nm, with six to eight AuNPs around a single Fe3O4 nanoparticle. Fluorescein isothiocyanate (FITC) tagged DNA-HMNC conjugates exhibited a significant MEF effect and could accurately detect specific DNA sequences after DNA hybridization. This result indicates their various potential applications in sensors and biomedical fields.To improve the metal-enhanced fluorescence (MEF) effect of nanogolds (AuNPs) and accurately detect specific DNA sequences via DNA hybridization, novel hybrid magnetic nanoparticles/nanogold clusters (HMNCs) were designed based on finite-difference time-domain simulation results and prepared by using Fe3O4 and nanogolds. The nanogolds outside the HMNC were then conjugated with thiol-terminated DNA molecules, thus DNA modified-HMNCs (DNA-HMNCs) were obtained. The size distributions of these nanostructures were measured by a Malvern size analyzer, and their morphology was observed via transmission electron microscopy (TEM). The ultraviolet (UV

  14. UV-inducible DNA repair in the cyanobacteria Anabaena spp

    SciTech Connect

    Levine, E.; Thiel, T.

    1987-09-01

    Strains of the filamentous cyanobacteria Anabaena spp. were capable of very efficient photoreactivation of UV irradiation-induced damage to DNA. Cells were resistant to several hundred joules of UV irradiation per square meter under conditions that allowed photoreactivation, and they also photoreactivated UV-damaged cyanophage efficiently. Reactivation of UV-irradiated cyanophage (Weigle reactivation) also occurred; UV irradiation of host cells greatly enhanced the plaque-forming ability of irradiated phage under nonphotoreactivating conditions. Postirradiation incubation of the host cells under conditions that allowed photoreactivation abolished the ability of the cells to perform Weigle reactivation of cyanophage N-1. Mitomycin C also induced Weigle reactivation of cyanophage N-1, but nalidixic acid did not. The inducible repair system (defined as the ability to perform Weigle reactivation of cyanophages) was relatively slow and inefficient compared with photoreactivation.

  15. Thermal stability of DNA adducts induced by cyanomorpholinoadriamycin in vitro.

    PubMed Central

    Cullinane, C; Phillips, D R

    1993-01-01

    The Adriamycin derivative, cyanomorpholinoadriamycin (CMA) was reacted with DNA in vitro to form apparent interstrand crosslinks. The extent of interstrand crosslink formation was monitored by a gel electrophoresis assay and maximal crosslinking of DNA was observed within 1 hr with 5 microM of drug. The interstrand crosslinks were heat labile, with a midpoint melting temperature of 70 degrees C (10 min exposure to heat) in 45% formamide. When CMA-induced adducts were detected as blockages of lambda-exonuclease, 12 blockage sites were observed with 8 being prior to 5'-GG sequences, one prior to 5'-CC, one prior to 5'-GC and 2 at unresolved combinations of these sequences. These exonuclease-detected blockages reveal the same sites of CMA-induced crosslinking as detected by in vitro transcription footprinting and primer-extension blockages on single strand DNA, where the blockages at 5'-GG and 5'-CC were identified as sites of intrastrand crosslinking and the 5'-GC blockage as a probable site of interstrand crosslinking. The thermal stability of both types of crosslink (10 min exposure to heat) ranged from 63-70 degrees C at individual sites. High levels of adduct were detected with poly (dG-dC) but not with poly (dI-dC). These results suggest adduct formation involving an aminal linkage between the 3 position of the morpholino moiety and N2 of guanine. Images PMID:8493102

  16. Assay to detect chemically induced DNA repair in rat spermatocytes

    SciTech Connect

    Working, P.K.; Butterworth, B.E.

    1984-01-01

    An in vivo/in vitro DNA repair assay has been developed to quantitate chemically induced unscheduled DNA synthesis (UDS) in rat spermatocytes utilizing autoradiography. Male Fischer-344 rats were treated by i.p. injection or gavage with a variety of genotoxic agents dissolved in dimethyl sulfoxide, corn oil, or water. At selected times after treatment, spermatocytes were isolated by trypsin digestion of testes and cultured for 24 hr in the presence of /sup 3/H-thymidine. The direct-acting genotoxicants methyl methanesulfonate (MMS) and ethyl methanesulfonate and the chemotherapeutic agent cyclophosphamide (CPA) produced positive UDS responses in spermatocyes isolated l hr after i.p. injection. Other known genotoxicants--including dimethylnitrosamine, aflatoxin B/sub 1/, 2-acetylaminofluorene, 2, 6-dinitrotoluene, and l,6-dinitropyrene--failed to induce UDS, even with routes of administration and at times of exposure known to produce a positive response in hepatocytes. These results demonstrate that the in vivo/in vitro spermatocyte DNA repair assay may be useful as a predictive screen for germ cell mutagens.

  17. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    PubMed

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1.

  18. Quantitation of DNA Adducts Induced by 1,3-Butadiene

    NASA Astrophysics Data System (ADS)

    Sangaraju, Dewakar; Villalta, Peter W.; Wickramaratne, Susith; Swenberg, James; Tretyakova, Natalia

    2014-07-01

    Human exposure to 1,3-butadiene (BD) present in automobile exhaust, cigarette smoke, and forest fires is of great concern because of its potent carcinogenicity. The adverse health effects of BD are mediated by its epoxide metabolites such as 3,4-epoxy-1-butene (EB), which covalently modify genomic DNA to form promutagenic nucleobase adducts. Because of their direct role in cancer, BD-DNA adducts can be used as mechanism-based biomarkers of BD exposure. In the present work, a mass spectrometry-based methodology was developed for accurate, sensitive, and precise quantification of EB-induced N-7-(1-hydroxy-3-buten-2-yl) guanine (EB-GII) DNA adducts in vivo. In our approach, EB-GII adducts are selectively released from DNA backbone by neutral thermal hydrolysis, followed by ultrafiltration, offline HPLC purification, and isotope dilution nanoLC/ESI+-HRMS3 analysis on an Orbitrap Velos mass spectrometer. Following method validation, EB-GII lesions were quantified in human fibrosarcoma (HT1080) cells treated with micromolar concentrations of EB and in liver tissues of rats exposed to sub-ppm concentrations of BD (0.5-1.5 ppm). EB-GII concentrations increased linearly from 1.15 ± 0.23 to 10.11 ± 0.45 adducts per 106 nucleotides in HT1080 cells treated with 0.5-10 μM DEB. EB-GII concentrations in DNA of laboratory rats exposed to 0.5, 1.0, and 1.5 ppm BD were 0.17 ± 0.05, 0.33 ± 0.08, and 0.50 ± 0.04 adducts per 106 nucleotides, respectively. We also used the new method to determine the in vivo half-life of EB-GII adducts in rat liver DNA (2.20 ± 0.12 d) and to detect EB-GII in human blood DNA. To our knowledge, this is the first application of nanoLC/ESI+-HRMS3 Orbitrap methodology to quantitative analysis of DNA adducts in vivo.

  19. Study on Cluster Analysis Used with Laser-Induced Breakdown Spectroscopy

    NASA Astrophysics Data System (ADS)

    He, Li'ao; Wang, Qianqian; Zhao, Yu; Liu, Li; Peng, Zhong

    2016-06-01

    Supervised learning methods (eg. PLS-DA, SVM, etc.) have been widely used with laser-induced breakdown spectroscopy (LIBS) to classify materials; however, it may induce a low correct classification rate if a test sample type is not included in the training dataset. Unsupervised cluster analysis methods (hierarchical clustering analysis, K-means clustering analysis, and iterative self-organizing data analysis technique) are investigated in plastics classification based on the line intensities of LIBS emission in this paper. The results of hierarchical clustering analysis using four different similarity measuring methods (single linkage, complete linkage, unweighted pair-group average, and weighted pair-group average) are compared. In K-means clustering analysis, four kinds of choosing initial centers methods are applied in our case and their results are compared. The classification results of hierarchical clustering analysis, K-means clustering analysis, and ISODATA are analyzed. The experiment results demonstrated cluster analysis methods can be applied to plastics discrimination with LIBS. supported by Beijing Natural Science Foundation of China (No. 4132063)

  20. Bisdemethoxycurcumin induces DNA damage and inhibits DNA repair associated protein expressions in NCI-H460 human lung cancer cells.

    PubMed

    Yu, Chien-Chih; Yang, Su-Tso; Huang, Wen-Wen; Peng, Shu-Fen; Huang, An-Cheng; Tang, Nou-Ying; Liu, Hsin-Chung; Yang, Mei-Due; Lai, Kuang-Chi; Chung, Jing-Gung

    2015-08-30

    Nonsmall cell lung carcinoma (NSCLC) is a devastating primary lung tumor resistant to conventional therapies. Bisdemethoxycurcumin (BDMC) is one of curcumin derivate from Turmeric and has been shown to induce NSCLC cell death. Although there is one report to show BDMC induced DNA double strand breaks, however, no available information to show BDMC induced DNA damage action with inhibited DNA repair protein in lung cancer cells in detail. In this study, we tested BDMC-induced DNA damage and condensation in NCI-H460 cells by using Comet assay and DAPI staining examinations, respectively and we found BDMC induced DNA damage and condension. Western blotting was used to examine the effects of BDMC on protein expression associated with DNA damage and repair and results indicated that BDMC suppressed the protein levels associated with DNA damage and repair, such as 14-3-3σ (an important checkpoint keeper of DDR), O6-methylguanine-DNA methyltransferase, DNA repair proteins breast cancer 1, early onset, mediator of DNA damage checkpoint 1 but activate phosphorylated p53 and p-H2A.X (phospho Ser140) in NCI-H460 cells. Confocal laser systems microscopy was used for examining the protein translocation and results show that BDMC increased the translocation of p-p53 and p-H2A.X (phospho Ser140) from cytosol to nuclei in NCI-H460 cells. In conclusion, BDMC induced DNA damage and condension and affect DNA repair proteins in NCI-H460 cells in vitro. © 2015 Wiley Periodicals, Inc. Environ Toxicol, 2015.

  1. Dynamical DNA accessibility induced by chromatin remodeling and protein binding

    NASA Astrophysics Data System (ADS)

    Montel, F.; Faivre-Moskalenko, C.; Castelnovo, M.

    2014-11-01

    Chromatin remodeling factors are enzymes being able to alter locally chromatin structure at the nucleosomal level and they actively participate in the regulation of gene expression. Using simple rules for individual nucleosome motion induced by a remodeling factor, we designed simulations of the remodeling of oligomeric chromatin, in order to address quantitatively collective effects in DNA accessibility upon nucleosome mobilization. Our results suggest that accessibility profiles are inhomogeneous thanks to borders effects like protein binding. Remarkably, we show that the accessibility lifetime of DNA sequence is roughly doubled in the vicinity of borders as compared to its value in bulk regions far from the borders. These results are quantitatively interpreted as resulting from the confined diffusion of a large nucleosome depleted region.

  2. DNA Oligonucleotide Fragment Ion Rearrangements Upon Collision-Induced Dissociation

    NASA Astrophysics Data System (ADS)

    Harper, Brett; Neumann, Elizabeth K.; Solouki, Touradj

    2015-08-01

    Collision-induced dissociation (CID) of m/z-isolated w type fragment ions and an intact 5' phosphorylated DNA oligonucleotide generated rearranged product ions. Of the 21 studied w ions of various nucleotide sequences, fragment ion sizes, and charge states, 18 (~86%) generated rearranged product ions upon CID in a Synapt G2-S HDMS (Waters Corporation, Manchester, England, UK) ion mobility-mass spectrometer. Mass spectrometry (MS), ion mobility spectrometry (IMS), and theoretical modeling data suggest that purine bases can attack the free 5' phosphate group in w type ions and 5' phosphorylated DNA to generate sequence permuted [phosphopurine]- fragment ions. We propose and discuss a potential mechanism for generation of rearranged [phosphopurine]- and complementary y-B type product ions.

  3. Investigation of the influence on conformational transition of DNA induced by cationic lipid vesicles

    NASA Astrophysics Data System (ADS)

    Zhang, Zheling; Huang, Weimin; Wang, Erkang; Dong, Shaojun

    2003-01-01

    Recent studies have focused on the structural features of DNA-lipid assemblies. In this paper we take nile blue A (NBA) as a probe molecule to study the influence of the conformational transition of DNA induced by didodecyldimethylammonium bromide (DDAB) cationic vesicles to the interaction between DNA and the probe molecules. We find that upon binding to DNA, a secondary conformational transition of DNA induced by the cationic liposome from the native B-form to the C-form resulted in the change of binding modes of NBA to DNA and different complexes are formed between DNA, DDAB and NBA.

  4. Novel DNA damage checkpoint in mitosis: Mitotic DNA damage induces re-replication without cell division in various cancer cells.

    PubMed

    Hyun, Sun-Yi; Rosen, Eliot M; Jang, Young-Joo

    2012-07-06

    DNA damage induces multiple checkpoint pathways to arrest cell cycle progression until damage is repaired. In our previous reports, when DNA damage occurred in prometaphase, cells were accumulated in 4 N-DNA G1 phase, and mitosis-specific kinases were inactivated in dependent on ATM/Chk1 after a short incubation for repair. We investigated whether or not mitotic DNA damage causes cells to skip-over late mitotic periods under prolonged incubation in a time-lapse study. 4 N-DNA-damaged cells re-replicated without cell division and accumulated in 8 N-DNA content, and the activities of apoptotic factors were increased. The inhibition of DNA replication reduced the 8 N-DNA cell population dramatically. Induction of replication without cell division was not observed upon depletion of Chk1 or ATM. Finally, mitotic DNA damage induces mitotic slippage and that cells enter G1 phase with 4 N-DNA content and then DNA replication is occurred to 8 N-DNA content before completion of mitosis in the ATM/Chk1-dependent manner, followed by caspase-dependent apoptosis during long-term repair.

  5. Stimulus-induced transition of clustering firings in neuronal networks with information transmission delay

    NASA Astrophysics Data System (ADS)

    Wang, Qingyun; Zhang, Honghui; Chen, Guanrong

    2013-07-01

    We study the evolution of spatiotemporal dynamics and transition of clustering firing synchronization on spiking Hodgkin-Huxley neuronal networks as information transmission delay and the periodic stimulus are varied. In particular, it is shown that the tuned information transmission delay can induce a clustering anti-phase synchronization transition with the pacemaker, where two equal clusters can alternatively synchronize in anti-phase firing. More interestingly, we show that the periodic stimulus can drive the delay-induced clustering anti-phase firing synchronization bifurcate to the collective perfect synchronization, which is routed by the complex process including collective chaotic firings and clustering out-of-phase synchronization of the neuronal networks. In addition, the periodic stimulus induced clustering firings of the spiking neuronal networks are robust to the connectivity probability of small world networks. Furthermore, the different stimulus frequency induced complexity is also investigated. We hope that the results of this paper can provide insights that could facilitate the understanding of the joint impact of information transmission delays and periodic stimulus on controlling dynamical behaviors of realistic neuronal networks.

  6. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

  7. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENNTIAL FLUORESENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

  8. An adaptive decorrelation method removes Illumina DNA base-calling errors caused by crosstalk between adjacent clusters.

    PubMed

    Wang, Bo; Wan, Lin; Wang, Anqi; Li, Lei M

    2017-02-20

    Base-calling accuracy is crucial for high-throughput DNA sequencing and downstream analysis such as read mapping and genome assembly. Accordingly, we made an endeavor to reduce DNA sequencing errors of Illumina systems by correcting three kinds of crosstalk in the cluster intensity data. We discovered that signal crosstalk between adjacent clusters accounts for a large portion of sequencing errors in Illumina systems, even after correcting color crosstalk caused by the overlap of dye emission spectra and phasing/pre-phasing caused by out-of-step nucleotide synthesis. Interestingly and importantly, spatial crosstalk between adjacent clusters is cluster-specific and often asymmetric, which cannot be corrected by existing deconvolution methods. Therefore, we introduce a novel mathematical method able to estimate and remove spatial crosstalk, thereby reducing base-calling errors by 44-69% at a given mapping rate from Illumina systems. Furthermore, the resolution gained from this work provides new room for higher throughput of DNA sequencing and of general measurement systems using fluorescence-based imaging technology. The resulting base-caller 3Dec is available for academic users at http://github.com/flishwnag/3dec. Not only does it reduce 62.1% errors compared to the standard pipeline, but also its implementation is fast enough for daily sequencing.

  9. An adaptive decorrelation method removes Illumina DNA base-calling errors caused by crosstalk between adjacent clusters

    PubMed Central

    Wang, Bo; Wan, Lin; Wang, Anqi; Li, Lei M.

    2017-01-01

    Base-calling accuracy is crucial for high-throughput DNA sequencing and downstream analysis such as read mapping and genome assembly. Accordingly, we made an endeavor to reduce DNA sequencing errors of Illumina systems by correcting three kinds of crosstalk in the cluster intensity data. We discovered that signal crosstalk between adjacent clusters accounts for a large portion of sequencing errors in Illumina systems, even after correcting color crosstalk caused by the overlap of dye emission spectra and phasing/pre-phasing caused by out-of-step nucleotide synthesis. Interestingly and importantly, spatial crosstalk between adjacent clusters is cluster-specific and often asymmetric, which cannot be corrected by existing deconvolution methods. Therefore, we introduce a novel mathematical method able to estimate and remove spatial crosstalk, thereby reducing base-calling errors by 44–69% at a given mapping rate from Illumina systems. Furthermore, the resolution gained from this work provides new room for higher throughput of DNA sequencing and of general measurement systems using fluorescence-based imaging technology. The resulting base-caller 3Dec is available for academic users at http://github.com/flishwnag/3dec. Not only does it reduce 62.1% errors compared to the standard pipeline, but also its implementation is fast enough for daily sequencing. PMID:28216647

  10. Theoretical rate constants of super-exchange hole transfer and thermally induced hopping in DNA.

    PubMed

    Shimazaki, Tomomi; Asai, Yoshihiro; Yamashita, Koichi

    2005-01-27

    Recently, the electronic properties of DNA have been extensively studied, because its conductivity is important not only to the study of fundamental biological problems, but also in the development of molecular-sized electronics and biosensors. We have studied theoretically the reorganization energies, the activation energies, the electronic coupling matrix elements, and the rate constants of hole transfer in B-form double-helix DNA in water. To accommodate the effects of DNA nuclear motions, a subset of reaction coordinates for hole transfer was extracted from classical molecular dynamics (MD) trajectories of DNA in water and then used for ab initio quantum chemical calculations of electron coupling constants based on the generalized Mulliken-Hush model. A molecular mechanics (MM) method was used to determine the nuclear Franck-Condon factor. The rate constants for two types of mechanisms of hole transfer-the thermally induced hopping (TIH) and the super-exchange mechanisms-were determined based on Marcus theory. We found that the calculated matrix elements are strongly dependent on the conformations of the nucleobase pairs of hole-transferable DNA and extend over a wide range of values for the "rise" base-step parameter but cluster around a particular value for the "twist" parameter. The calculated activation energies are in good agreement with experimental results. Whereas the rate constant for the TIH mechanism is not dependent on the number of A-T nucleobase pairs that act as a bridge, the rate constant for the super-exchange process rapidly decreases when the length of the bridge increases. These characteristic trends in the calculated rate constants effectively reproduce those in the experimental data of Giese et al. [Nature 2001, 412, 318]. The calculated rate constants were also compared with the experimental results of Lewis et al. [Nature 2000, 406, 51].

  11. A Zn(II)2Cys6 DNA binding protein regulates the sirodesmin PL biosynthetic gene cluster in Leptosphaeria maculans

    PubMed Central

    Fox, Ellen M.; Gardiner, Donald M.; Keller, Nancy P.; Howlett, Barbara J.

    2008-01-01

    A gene, sirZ, encoding a Zn(II)2Cys6 DNA binding protein is present in a cluster of genes responsible for the biosynthesis of the epipolythiodioxopiperazine (ETP) toxin, sirodesmin PL in the ascomycete plant pathogen, Leptosphaeria maculans. RNA-mediated silencing of sirZ gives rise to transformants that produce only residual amounts of sirodesmin PL and display a decrease in the transcription of several sirodesmin PL biosynthetic genes. This indicates that SirZ is a major regulator of this gene cluster. Proteins similar to SirZ are encoded in the gliotoxin biosynthetic gene cluster of Aspergillus fumigatus (gliZ) and in an ETP-like cluster in Penicillium lilacinoechinulatum (PlgliZ). Despite its high level of sequence similarity to gliZ, PlgliZ is unable to complement the gliotoxin-deficiency of a mutant of gliZ in A. fumigatus. Putative binding sites for these regulatory proteins in the promoters of genes in these clusters were predicted using bioinformatic analysis. These sites are similar to those commonly bound by other proteins with Zn(II)2Cys6 DNA binding domains. PMID:18023597

  12. ThioFinder: a web-based tool for the identification of thiopeptide gene clusters in DNA sequences.

    PubMed

    Li, Jing; Qu, Xudong; He, Xinyi; Duan, Lian; Wu, Guojun; Bi, Dexi; Deng, Zixin; Liu, Wen; Ou, Hong-Yu

    2012-01-01

    Thiopeptides are a growing class of sulfur-rich, highly modified heterocyclic peptides that are mainly active against Gram-positive bacteria including various drug-resistant pathogens. Recent studies also reveal that many thiopeptides inhibit the proliferation of human cancer cells, further expanding their application potentials for clinical use. Thiopeptide biosynthesis shares a common paradigm, featuring a ribosomally synthesized precursor peptide and conserved posttranslational modifications, to afford a characteristic core system, but differs in tailoring to furnish individual members. Identification of new thiopeptide gene clusters, by taking advantage of increasing information of DNA sequences from bacteria, may facilitate new thiopeptide discovery and enrichment of the unique biosynthetic elements to produce novel drug leads by applying the principle of combinatorial biosynthesis. In this study, we have developed a web-based tool ThioFinder to rapidly identify thiopeptide biosynthetic gene cluster from DNA sequence using a profile Hidden Markov Model approach. Fifty-four new putative thiopeptide biosynthetic gene clusters were found in the sequenced bacterial genomes of previously unknown producing microorganisms. ThioFinder is fully supported by an open-access database ThioBase, which contains the sufficient information of the 99 known thiopeptides regarding the chemical structure, biological activity, producing organism, and biosynthetic gene (cluster) along with the associated genome if available. The ThioFinder website offers researchers a unique resource and great flexibility for sequence analysis of thiopeptide biosynthetic gene clusters. ThioFinder is freely available at http://db-mml.sjtu.edu.cn/ThioFinder/.

  13. Common molecular mechanisms in field- and agrin-induced acetylcholine receptor clustering.

    PubMed

    Sabrina, F; Stollberg, J

    1997-04-01

    1. The aggregation of acetylcholine receptors at the developing neuromuscular junction is critical to the development and function of this synapse. In vitro studies have shown that receptor aggregation can be induced by the finding of agrin to the muscle cell surface and by the electric field-induced concentration of a (nonreceptor) molecule at the cathodal cell pole. 2. We report here on the interaction between agrin binding and electric fields with respect to the distribution of receptors and agrin binding sites. 3. (a) Pretreatment of cells with agrin completely blocks the development of field-induced receptor clusters. (b) Field-induced aggregation of receptors precedes the field-induced aggregation of agrin binding sites by approximately 30 min. (c) Electric fields prevent agrin-induced receptor clustering despite the presence of agrin binding sites and freely diffusing receptors. 4. These results indicate that another membrane component-but not the agrin binding site and not the receptor-is required for agrin-induced receptor clustering. They also suggest that electric fields and agrin cause receptor clustering via common molecular mechanisms.

  14. Analysis of radiation-induced small Cu particle cluster formation in aqueous CuCl2

    USGS Publications Warehouse

    Jayanetti, Sumedha; Mayanovic, Robert A.; Anderson, Alan J.; Bassett, William A.; Chou, I.-Ming

    2001-01-01

    Radition-induced small Cu particle cluster formation in aqueous CuCl2 was analyzed. It was noticed that nearest neighbor distance increased with the increase in the time of irradiation. This showed that the clusters approached the lattice dimension of bulk copper. As the average cluster size approached its bulk dimensions, an increase in the nearest neighbor coordination number was found with the decrease in the surface to volume ratio. Radiolysis of water by incident x-ray beam led to the reduction of copper ions in the solution to themetallic state.

  15. Osmotically induced reversible transitions in lipid-DNA mesophases.

    PubMed

    Danino, Dganit; Kesselman, Ellina; Saper, Gadiel; Petrache, Horia I; Harries, Daniel

    2009-04-08

    We follow the effect of osmotic pressure on isoelectric complexes that self-assemble from mixtures of DNA and mixed neutral and cationic lipids. Using small angle x-ray diffraction and freeze-fracture cryo-electron microscopy, we find that lamellar complexes known to form in aqueous solutions can reversibly transition to hexagonal mesophases under high enough osmotic stress exerted by adding a neutral polymer. Using molecular spacings derived from x-ray diffraction, we estimate the reversible osmotic pressure-volume (Pi-V) work needed to induce this transition. We find that the transition free energy is comparable to the work required to elastically bend lipid layers around DNA. Consistent with this, the required work is significantly lowered by an addition of hexanol, which is known to soften lipid bilayers. Our findings not only help to resolve the free-energy contributions associated with lipid-DNA complex formation, but they also demonstrate the importance that osmotic stress can have to the macromolecular phase geometry in realistic biological environments.

  16. DNA Damage and Genomic Instability Induced by Inappropriate DNA Re-replication

    DTIC Science & Technology

    2007-04-01

    replication in yeast cells. We have demonstrated that re-replication induces a rapid and significant decrease in cell viability and a cellular DNA damage...Ura 50 ng/ml factor. Samples were fixed in 67% ethanol (vol/vol), washed twice with PBS, and resuspended in 50 ng/ml 46-diamidino-2-phenylindole... decrease plating efficiency (Figure 1B). Both the pGAL1-ntcdc6 rerep- licating strain and pGAL1 control strain grew with similar efficiency when

  17. Clustering of Caucasian Leber hereditary optic neuropathy patients containing the 11778 or 14484 mutations on an mtDNA lineage

    SciTech Connect

    Brown, M.D.; Sun, F.; Wallace, D.C.

    1997-02-01

    Leber hereditary optic neuropathy (LHON) is a type of blindness caused by mtDNA mutations. Three LHON mtDNA mutations at nucleotide positions 3460, 11778, and 14484 are specific for LHON and account for 90% of worldwide cases and are thus designated as {open_quotes}primary{close_quotes} LHON mutations. Fifteen other {open_quotes}secondary{close_quotes} LHON mtDNA mutations have been identified, but their pathogenicity is unclear. mtDNA haplotype and phylogenetic analysis of the primary LHON mutations in North American Caucasian patients and controls has shown that, unlike the 3460 and 11778 mutations, which are distributed throughout the European-derived (Caucasian) mtDNA phylogeny, patients containing the 14484 mutation tended to be associated with European mtDNA haplotype J. To investigate this apparent clustering, we performed {chi}{sup 2}-based statistical analyses to compare the distribution of LHON patients on the Caucasian phylogenetic tree. Our results indicate that, unlike the 3460 and 11778 mutations, the 14484 mutation was not distributed on the phylogeny in proportion to the frequencies of the major Caucasian mtDNA haplogroups found in North America. The 14484 mutation was next shown to occur on the haplogroup J background more frequently that expected, consistent with the observation that {approximately}75% of worldwide 14484-positive LHON patients occur in association with haplogroup J. The 11778 mutation also exhibited a moderate clustering on haplogroup J. These observations were supported by statistical analysis using all available mutation frequencies reported in the literature. This paper thus illustrates the potential importance of genetic background in certain mtDNA-based diseases, speculates on a pathogenic role for a subset of LHON secondary mutations and their interaction with primary mutations, and provides support for a polygenic model for LHON expression in some cases. 18 refs., 3 tabs.

  18. RNase H enables efficient repair of R-loop induced DNA damage

    PubMed Central

    Amon, Jeremy D; Koshland, Douglas

    2016-01-01

    R-loops, three-stranded structures that form when transcripts hybridize to chromosomal DNA, are potent agents of genome instability. This instability has been explained by the ability of R-loops to induce DNA damage. Here, we show that persistent R-loops also compromise DNA repair. Depleting endogenous RNase H activity impairs R-loop removal in Saccharomyces cerevisiae, causing DNA damage that occurs preferentially in the repetitive ribosomal DNA locus (rDNA). We analyzed the repair kinetics of this damage and identified mutants that modulate repair. We present a model that the persistence of R-loops at sites of DNA damage induces repair by break-induced replication (BIR). This R-loop induced BIR is particularly susceptible to the formation of lethal repair intermediates at the rDNA because of a barrier imposed by RNA polymerase I. DOI: http://dx.doi.org/10.7554/eLife.20533.001 PMID:27938663

  19. Kaempferol induces DNA damage and inhibits DNA repair associated protein expressions in human promyelocytic leukemia HL-60 cells.

    PubMed

    Wu, Lung-Yuan; Lu, Hsu-Feng; Chou, Yu-Cheng; Shih, Yung-Luen; Bau, Da-Tian; Chen, Jaw-Chyun; Hsu, Shu-Chun; Chung, Jing-Gung

    2015-01-01

    Numerous evidences have shown that plant flavonoids (naturally occurring substances) have been reported to have chemopreventive activities and protect against experimental carcinogenesis. Kaempferol, one of the flavonoids, is widely distributed in fruits and vegetables, and may have cancer chemopreventive properties. However, the precise underlying mechanism regarding induced DNA damage and suppressed DNA repair system are poorly understood. In this study, we investigated whether kaempferol induced DNA damage and affected DNA repair associated protein expression in human leukemia HL-60 cells in vitro. Percentages of viable cells were measured via a flow cytometry assay. DNA damage was examined by Comet assay and DAPI staining. DNA fragmentation (ladder) was examined by DNA gel electrophoresis. The changes of protein levels associated with DNA repair were examined by Western blotting. Results showed that kaempferol dose-dependently decreased the viable cells. Comet assay indicated that kaempferol induced DNA damage (Comet tail) in a dose-dependent manner and DAPI staining also showed increased doses of kaempferol which led to increased DNA condensation, these effects are all of dose-dependent manners. Western blotting indicated that kaempferol-decreased protein expression associated with DNA repair system, such as phosphate-ataxia-telangiectasia mutated (p-ATM), phosphate-ataxia-telangiectasia and Rad3-related (p-ATR), 14-3-3 proteins sigma (14-3-3σ), DNA-dependent serine/threonine protein kinase (DNA-PK), O(6)-methylguanine-DNA methyltransferase (MGMT), p53 and MDC1 protein expressions, but increased the protein expression of p-p53 and p-H2AX. Protein translocation was examined by confocal laser microscopy, and we found that kaempferol increased the levels of p-H2AX and p-p53 in HL-60 cells. Taken together, in the present study, we found that kaempferol induced DNA damage and suppressed DNA repair and inhibited DNA repair associated protein expression in HL-60

  20. Identification of column edges of DNA fragments by using K-means clustering and mean algorithm on lane histograms of DNA agarose gel electrophoresis images

    NASA Astrophysics Data System (ADS)

    Turan, Muhammed K.; Sehirli, Eftal; Elen, Abdullah; Karas, Ismail R.

    2015-07-01

    Gel electrophoresis (GE) is one of the most used method to separate DNA, RNA, protein molecules according to size, weight and quantity parameters in many areas such as genetics, molecular biology, biochemistry, microbiology. The main way to separate each molecule is to find borders of each molecule fragment. This paper presents a software application that show columns edges of DNA fragments in 3 steps. In the first step the application obtains lane histograms of agarose gel electrophoresis images by doing projection based on x-axis. In the second step, it utilizes k-means clustering algorithm to classify point values of lane histogram such as left side values, right side values and undesired values. In the third step, column edges of DNA fragments is shown by using mean algorithm and mathematical processes to separate DNA fragments from the background in a fully automated way. In addition to this, the application presents locations of DNA fragments and how many DNA fragments exist on images captured by a scientific camera.

  1. Oxidative stress induces DNA damage and inhibits the repair of DNA lesions induced by N-acetoxy-2-acetylaminofluorene in human peripheral mononuclear leukocytes.

    PubMed

    Pero, R W; Anderson, M W; Doyle, G A; Anna, C H; Romagna, F; Markowitz, M; Bryngelsson, C

    1990-08-01

    Human mononuclear leukocytes were exposed to prooxidants such as H2O2, phorbol-12-myristate-13-acetate, and 4-nitroquinoline-N-oxide, and the effects on induction of DNA damage and repair were evaluated. ADP ribosylation was activated by prooxidant exposure and the response was bimodal with peaks of activation occurring at about 30 min and 4-5 h. Other evidence for prooxidant-induced DNA damage was provided by nucleoid sedimentation assays. Unscheduled DNA synthesis (UDS) was only slightly induced by prooxidant exposure which suggested that either the DNA lesions were repaired by a short patch mechanism involving little UDS, or the repair process was inhibited by prooxidant exposures, or some combination of both. This point was clarified by the fact that the repair of DNA lesions induced by N-acetoxy-2-acetylaminofluorene, an inducer of large patch DNA repair, was inhibited in a dose-dependent manner by exposure to H2O2 and the inhibition was dependent on ADP ribosylation. In contrast, the repair of DNA strand breaks induced by prooxidant exposures as identified above were complete within about 8 h and the repair was independent of ADP ribosylation. Both ADP ribosylation and N-acetoxy-2-acetylaminofluorene-induced UDS were shown to be up- and down-regulated by the redox state of human mononuclear leukocytes indicating a unique mechanism of cellular control over DNA repair.

  2. Histone Acetylation Induced Transformation of B-DNA to Z-DNA in Cells Probed through FT-IR Spectroscopy.

    PubMed

    Zhang, Fengqiu; Huang, Qing; Yan, Jingwen; Chen, Zhu

    2016-04-19

    A nucleosome is made up of DNA and histones, and acetylation of histones perturbs the interaction of DNA and histones and thus affects the chromatin conformation and function. However, whether or how acetylation induces DNA conformation changes is still elusive. In this work, we applied FT-IR spectroscopy to monitor the DNA signals in cells as the histone acetylation was regulated by trichostatin A (TSA), a reversible inhibitor to histone deacetylases (HDACs). Our results unambiguously demonstrate the significant transformation of B-DNA to Z-DNA upon histone acetylation in the TSA treated HeLa cells. This is the first report providing the explicit experimental evidence for such a B-Z transformation of DNA in the epigenetic states of cells.

  3. Calculation on spectrum of direct DNA damage induced by low-energy electrons including dissociative electron attachment.

    PubMed

    Liu, Wei; Tan, Zhenyu; Zhang, Liming; Champion, Christophe

    2017-03-01

    In this work, direct DNA damage induced by low-energy electrons (sub-keV) is simulated using a Monte Carlo method. The characteristics of the present simulation are to consider the new mechanism of DNA damage due to dissociative electron attachment (DEA) and to allow determining damage to specific bases (i.e., adenine, thymine, guanine, or cytosine). The electron track structure in liquid water is generated, based on the dielectric response model for describing electron inelastic scattering and on a free-parameter theoretical model and the NIST database for calculating electron elastic scattering. Ionization cross sections of DNA bases are used to generate base radicals, and available DEA cross sections of DNA components are applied for determining DNA-strand breaks and base damage induced by sub-ionization electrons. The electron elastic scattering from DNA components is simulated using cross sections from different theoretical calculations. The resulting yields of various strand breaks and base damage in cellular environment are given. Especially, the contributions of sub-ionization electrons to various strand breaks and base damage are quantitatively presented, and the correlation between complex clustered DNA damage and the corresponding damaged bases is explored. This work shows that the contribution of sub-ionization electrons to strand breaks is substantial, up to about 40-70%, and this contribution is mainly focused on single-strand break. In addition, the base damage induced by sub-ionization electrons contributes to about 20-40% of the total base damage, and there is an evident correlation between single-strand break and damaged base pair A-T.

  4. Effect of homologous tumor DNA on the evolution of SV40-induced hamster sarcoma.

    PubMed

    Nastac, E; Stoian, M; Iosipenco, M; Suru, M; Hozoc, M; Repanovici, R

    1985-01-01

    DNA extracted from SV40-induced hamster sarcoma (SV40--HS DNA) increased the survival length of animals carrying the homologous tumor and--in some cases--inhibited the development of the tumor. The efficacy of the preparation was directly proportional to the number of administrations; it did not necessarily depend on the amount of SV40--HS DNA per dose. SV40 DNA had no favourable effect on the evolution of the SV40-induced tumor, which suggests that viral DNA does not represent the active component of the SV40--HS DNA preparations. Some possible mechanisms of the effect of homologous tumor preparations are discussed.

  5. A kinetic analysis of strand breaks on large DNA induced by cigarette smoke extract

    NASA Astrophysics Data System (ADS)

    Kurita, Hirofumi; Takata, Tatsuya; Yasuda, Hachiro; Takashima, Kazunori; Mizuno, Akira

    2010-06-01

    We report a kinetic analysis of strand breakages on large DNA molecules induced by cigarette smoke extract (CSE), an extract of soluble cigarette smoke components. Previously, this DNA damage was analyzed by agarose gel electrophoresis, whereas we used fluorescence to kinetically analyze damage to individual DNA molecules. CSE caused a marked change in length of DNA molecules. The rate of CSE-induced double-strand breakage on large random-coiled DNA molecules was determined using a simple theoretical model, allowing the facile estimation of the rate of double-strand breaks on large DNA molecules.

  6. Novobiocin Inhibits the Antimicrobial Resistance Acquired through DNA Damage-Induced Mutagenesis in Acinetobacter baumannii

    PubMed Central

    Jara, Luis M.; Pérez-Varela, María; Corral, Jordi; Arch, Marta; Cortés, Pilar; Bou, Germán; Barbé, Jordi

    2015-01-01

    Acinetobacter baumannii, a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarin novobiocin, which inhibits the DNA damage response in Gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this Gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis. PMID:26503651

  7. Investigating the time clustering of induced microseismicity generated by hydraulic fracturing

    NASA Astrophysics Data System (ADS)

    Telesca, Luciano; Eisner, Leo; Stabile, Tony A.; Vlček, Josef

    2016-12-01

    By using the global and local coefficient of variation and the Allan Factor we investigated the time-clustering properties of the time dynamics of fluid-injection–induced microseismicity. The experiment consists of a microseismic monitoring through a nearly vertical borehole of 12 receivers of a hydraulic fracturing stimulation along a horizontal well separated into more than 20 sections (stages) The main finding of the applied methodology is the discrimination between fault triggering and new fracturing, being the first characterized by a clusterization of the induced microseismic events and the second by a Poissonian behaviour of the generated events.

  8. DNA and redox state induced conformational changes in the DNA-binding domain of the Myb oncoprotein.

    PubMed Central

    Myrset, A H; Bostad, A; Jamin, N; Lirsac, P N; Toma, F; Gabrielsen, O S

    1993-01-01

    The DNA-binding domain of the oncoprotein Myb comprises three imperfect repeats, R1, R2 and R3. Only R2 and R3 are required for sequence-specific DNA-binding. Both are assumed to contain helix-turn-helix (HTH)-related motifs, but multidimensional heteronuclear NMR spectroscopy revealed a disordered structure in R2 where the second HTH helix was predicted [Jamin et al. (1993) Eur. J. Biochem., 216, 147-154]. We propose that the disordered region folds into a 'recognition' helix and generates a full HTH-related motif upon binding to DNA. This would move Cys43 into the hydrophobic core of R2. We observed that Cys43 was accessible to N-ethylmaleimide alkylation in the free protein, but inaccessible in the DNA complex. Mutant proteins with charged (C43D) or polar (C43S) side chains in position 43 bound DNA with reduced affinity, while hydrophobic replacements (C43A, C43V and C43I) gave unaltered or improved DNA-binding. Specific DNA-binding enhanced protease resistance dramatically. Fluorescence emission spectra and quenching experiments supported a DNA-induced conformational change. Moreover, reversible oxidation of Cys43 had an effect similar to the inactivating C43D mutation. The highly oxidizable Cys43 could function as a molecular sensor for a redox regulatory mechanism turning specific DNA-binding on or off by controlling the DNA-induced conformational change in R2. Images PMID:8223472

  9. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product.

  10. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.

    PubMed

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh

    2014-01-01

    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury.

  11. DNA-methylation dependent regulation of embryo-specific 5S ribosomal DNA cluster transcription in adult tissues of sea urchin Paracentrotus lividus.

    PubMed

    Bellavia, Daniele; Dimarco, Eufrosina; Naselli, Flores; Caradonna, Fabio

    2013-10-01

    We have previously reported a molecular and cytogenetic characterization of three different 5S rDNA clusters in the sea urchin Paracentrotus lividus and recently, demonstrated the presence of high heterogeneity in functional 5S rRNA. In this paper, we show some important distinctive data on 5S rRNA transcription for this organism. Using single strand conformation polymorphism (SSCP) analysis, we demonstrate the existence of two classes of 5S rRNA, one which is embryo-specific and encoded by the smallest (700 bp) cluster and the other which is expressed at every stage and encoded by longer clusters (900 and 950 bp). We also demonstrate that the embryo-specific class of 5S rRNA is expressed in oocytes and embryonic stages and is silenced in adult tissue and that this phenomenon appears to be due exclusively to DNA methylation, as indicated by sensitivity to 5-azacytidine, unlike Xenopus where this mechanism is necessary but not sufficient to maintain the silenced status.

  12. Repair of oxidatively induced DNA damage by DNA glycosylases: Mechanisms of action, substrate specificities and excision kinetics.

    PubMed

    Dizdaroglu, Miral; Coskun, Erdem; Jaruga, Pawel

    Endogenous and exogenous reactive species cause oxidatively induced DNA damage in living organisms by a variety of mechanisms. As a result, a plethora of mutagenic and/or cytotoxic products are formed in cellular DNA. This type of DNA damage is repaired by base excision repair, although nucleotide excision repair also plays a limited role. DNA glycosylases remove modified DNA bases from DNA by hydrolyzing the glycosidic bond leaving behind an apurinic/apyrimidinic (AP) site. Some of them also possess an accompanying AP-lyase activity that cleaves the sugar-phosphate chain of DNA. Since the first discovery of a DNA glycosylase, many studies have elucidated the mechanisms of action, substrate specificities and excision kinetics of these enzymes present in all living organisms. For this purpose, most studies used single- or double-stranded oligodeoxynucleotides with a single DNA lesion embedded at a defined position. High-molecular weight DNA with multiple base lesions has been used in other studies with the advantage of the simultaneous investigation of many DNA base lesions as substrates. Differences between the substrate specificities and excision kinetics of DNA glycosylases have been found when these two different substrates were used. Some DNA glycosylases possess varying substrate specificities for either purine-derived lesions or pyrimidine-derived lesions, whereas others exhibit cross-activity for both types of lesions. Laboratory animals with knockouts of the genes of DNA glycosylases have also been used to provide unequivocal evidence for the substrates, which had previously been found in in vitro studies, to be the actual substrates in vivo as well. On the basis of the knowledge gained from the past studies, efforts are being made to discover small molecule inhibitors of DNA glycosylases that may be used as potential drugs in cancer therapy.

  13. DNA fragment sizing and sorting by laser-induced fluorescence

    DOEpatents

    Hammond, Mark L.; Jett, James H.; Keller, Richard A.; Marrone, Babetta L.; Martin, John C.

    1996-01-01

    A method is provided for sizing DNA fragments using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA piece or the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is linearly related to the fragment length. The distribution of DNA fragment sizes forms a characterization of the DNA piece for use in forensic and research applications.

  14. Increase of the mean inner Coulomb potential in Au clusters induced by surface tension and its implication for electron scattering

    SciTech Connect

    Popescu, Radian; Mueller, Erich; Wanner, Matthias; Gerthsen, Dagmar; Schowalter, Marco; Rosenauer, Andreas; Boettcher, Artur; Loeffler, Daniel; Weis, Patrick

    2007-12-15

    Electron holography in a transmission electron microscope was applied to measure the phase shift {delta}{phi} induced by Au clusters as a function of the cluster size. Large {delta}{phi} observed for small Au clusters cannot be described by the well-known equation {delta}{phi}=C{sub E}V{sub 0}t (C{sub E}, interaction constant; V{sub 0}, mean inner Coulomb potential (MIP) of bulk gold; and t, cluster thickness). The rapid increase of the Au MIP with decreasing cluster size derived from {delta}{phi} can be explained by the compressive strain of surface atoms in the cluster.

  15. Topographic confinement of epithelial clusters induces epithelial-to-mesenchymal transition in compliant matrices

    PubMed Central

    Nasrollahi, Samila; Pathak, Amit

    2016-01-01

    Epithelial cells disengage from their clusters and become motile by undergoing epithelial-to-mesenchymal transition (EMT), an essential process for both embryonic development and tumor metastasis. Growing evidence suggests that high extracellular matrix (ECM) stiffness induces EMT. In reality, epithelial clusters reside in a heterogeneous microenvironment whose mechanical properties vary not only in terms of stiffness, but also topography, dimensionality, and confinement. Yet, very little is known about how various geometrical parameters of the ECM might influence EMT. Here, we adapt a hydrogel-microchannels based matrix platform to culture mammary epithelial cell clusters in ECMs of tunable stiffness and confinement. We report a previously unidentified role of ECM confinement in EMT induction. Surprisingly, confinement induces EMT even in the cell clusters surrounded by a soft matrix, which otherwise protects against EMT in unconfined environments. Further, we demonstrate that stiffness-induced and confinement-induced EMT work through cell-matrix adhesions and cytoskeletal polarization, respectively. These findings highlight that both the structure and the stiffness of the ECM can independently regulate EMT, which brings a fresh perspective to the existing paradigm of matrix stiffness-dependent dissemination and invasion of tumor cells. PMID:26728047

  16. Topographic confinement of epithelial clusters induces epithelial-to-mesenchymal transition in compliant matrices

    NASA Astrophysics Data System (ADS)

    Nasrollahi, Samila; Pathak, Amit

    2016-01-01

    Epithelial cells disengage from their clusters and become motile by undergoing epithelial-to-mesenchymal transition (EMT), an essential process for both embryonic development and tumor metastasis. Growing evidence suggests that high extracellular matrix (ECM) stiffness induces EMT. In reality, epithelial clusters reside in a heterogeneous microenvironment whose mechanical properties vary not only in terms of stiffness, but also topography, dimensionality, and confinement. Yet, very little is known about how various geometrical parameters of the ECM might influence EMT. Here, we adapt a hydrogel-microchannels based matrix platform to culture mammary epithelial cell clusters in ECMs of tunable stiffness and confinement. We report a previously unidentified role of ECM confinement in EMT induction. Surprisingly, confinement induces EMT even in the cell clusters surrounded by a soft matrix, which otherwise protects against EMT in unconfined environments. Further, we demonstrate that stiffness-induced and confinement-induced EMT work through cell-matrix adhesions and cytoskeletal polarization, respectively. These findings highlight that both the structure and the stiffness of the ECM can independently regulate EMT, which brings a fresh perspective to the existing paradigm of matrix stiffness-dependent dissemination and invasion of tumor cells.

  17. Repetitive motor learning induces coordinated formation of clustered dendritic spines in vivo.

    PubMed

    Fu, Min; Yu, Xinzhu; Lu, Ju; Zuo, Yi

    2012-02-19

    Many lines of evidence suggest that memory in the mammalian brain is stored with distinct spatiotemporal patterns. Despite recent progresses in identifying neuronal populations involved in memory coding, the synapse-level mechanism is still poorly understood. Computational models and electrophysiological data have shown that functional clustering of synapses along dendritic branches leads to nonlinear summation of synaptic inputs and greatly expands the computing power of a neural network. However, whether neighbouring synapses are involved in encoding similar memory and how task-specific cortical networks develop during learning remain elusive. Using transcranial two-photon microscopy, we followed apical dendrites of layer 5 pyramidal neurons in the motor cortex while mice practised novel forelimb skills. Here we show that a third of new dendritic spines (postsynaptic structures of most excitatory synapses) formed during the acquisition phase of learning emerge in clusters, and that most such clusters are neighbouring spine pairs. These clustered new spines are more likely to persist throughout prolonged learning sessions, and even long after training stops, than non-clustered counterparts. Moreover, formation of new spine clusters requires repetition of the same motor task, and the emergence of succedent new spine(s) accompanies the strengthening of the first new spine in the cluster. We also show that under control conditions new spines appear to avoid existing stable spines, rather than being uniformly added along dendrites. However, succedent new spines in clusters overcome such a spatial constraint and form in close vicinity to neighbouring stable spines. Our findings suggest that clustering of new synapses along dendrites is induced by repetitive activation of the cortical circuitry during learning, providing a structural basis for spatial coding of motor memory in the mammalian brain.

  18. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    SciTech Connect

    Yoshimura, Akari; Kobayashi, Yume; Tada, Shusuke; Seki, Masayuki; Enomoto, Takemi

    2014-09-12

    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  19. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.

    1984-01-01

    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  20. Effect of intercellular contact on DNA conformation, radiation-induced DNA damage, and mutation in Chinese hamster V79 cells

    SciTech Connect

    Olive, P.L.; Durand, R.E.

    1985-01-01

    Chinese hamster V79 cells, when grown as small spheroids in suspension culture, are more resistant to killing by ionizing radiation than when grown as monolayers. The authors have attempted to determine whether this enhanced survival following irradiation is reflected in DNA damage and repair at the structural level (by measuring alkali-induced DNA unwinding rates from strand breaks) and at the functional level (by measuring resistance to forward mutation at the HGPRT locus). For a given dose of radiation, the unwinding of DNA in high salt/weak alkali was less complete for spheroid DNA than for monolayer DNA, and the rate of repair of radiation damage was faster in spheroid DNA. These differential responses were lost 8 hr after separation of spheroids into single cells, coinciding with loss of radioresistance measured by clonogenicity. In addition, spheroid cells showed fewer numbers of induced mutants per Gray, although, for a given level of survival, the mutation frequency for monolayers and spheroids was identical. These results suggest that conformational changes in DNA resulting from cell growth as spheroids might enhance repair of radiation-induced lesions.

  1. DNA Self-Assembling Nanostructures Induced by Trivalent Ions and Polycations

    NASA Astrophysics Data System (ADS)

    Kasyanenko, Nina; Afanasieva, Daria

    The purpose of this work is to compare DNA condensation induced by small multivalent ions and polycations. DNA complexes with trivalent ions Fe3+, La3+, [Co(NH3)6]3+, spermidine and cationic polymers in a solution were investigated. The influence of cations on the volume, persistent length, and secondary structure of DNA was studied. A comparison of DNA packaging induced by trivalent ions and polycations was made. DNA complexes with trivalent metal ions and polycations were characterized by means of low gradient viscometry, dynamic light scattering, circular dichroism, UV spectrometry, flow birefringence, and atomic force microscopy.

  2. Divalent counterion-induced condensation of triple-strand DNA.

    PubMed

    Qiu, Xiangyun; Parsegian, V Adrian; Rau, Donald C

    2010-12-14

    Understanding and manipulation of the forces assembling DNA/RNA helices have broad implications for biology, medicine, and physics. One subject of significance is the attractive force between dsDNA mediated by polycations of valence ≥ 3. Despite extensive studies, the physical origin of the "like-charge attraction" remains unsettled among competing theories. Here we show that triple-strand DNA (tsDNA), a more highly charged helix than dsDNA, is precipitated by alkaline-earth divalent cations that are unable to condense dsDNA. We further show that our observation is general by examining several cations (Mg(2+), Ba(2+), and Ca(2+)) and two distinct tsDNA constructs. Cation-condensed tsDNA forms ordered hexagonal arrays that redissolve upon adding monovalent salts. Forces between tsDNA helices, measured by osmotic stress, follow the form of hydration forces observed with condensed dsDNA. Probing a well-defined system of point-like cations and tsDNAs with more evenly spaced helical charges, the counterintuitive observation that the more highly charged tsDNA (vs. dsDNA) is condensed by cations of lower valence provides new insights into theories of polyelectrolytes and the biological and pathological roles of tsDNA. Cations and tsDNAs also hold promise as a model system for future studies of DNA-DNA interactions and electrostatic interactions in general.

  3. HGF-induced DNA synthesis in hepatocytes is suppressed by p38.

    PubMed

    Aasrum, Monica; Brusevold, Ingvild J; Christoffersen, Thoralf; Thoresen, G Hege

    2016-12-01

    Previous studies in rat hepatocytes have shown that the MEK/ERK, PI3K/Akt and p38 pathways are all involved in the activation of DNA synthesis by EGF and that sustained activation of MEK/ERK is required. Here, we show that although HGF stimulated DNA synthesis and activated signaling in the same manner as EGF, the contribution of the signaling pathways to the induction of DNA synthesis differed. While HGF-induced DNA synthesis was dependent on MEK/ERK, with no significant contribution from PI3K/Akt, p38 suppressed HGF-induced DNA synthesis. The p38 inhibitor SB203580 increased HGF-induced DNA synthesis and enhanced the phosphorylation of ERK. In contrast, SB203580 decreased EGF-induced ERK phosphorylation. This suggests that p38 has distinct effects on DNA synthesis induced by EGF and HGF. Due to differential regulation of signaling through the MEK/ERK pathway, p38 acts as an enhancer of EGF-induced DNA synthesis and as a suppressor of HGF-induced DNA synthesis.

  4. RORβ Induces Barrel-like Neuronal Clusters in the Developing Neocortex

    PubMed Central

    Jabaudon, Denis; J. Shnider, Sara; J. Tischfield, David; J. Galazo, Maria

    2012-01-01

    Neurons in layer IV of the rodent whisker somatosensory cortex are tangentially organized in periodic clusters called barrels, each of which is innervated by thalamocortical axons transmitting sensory information from a single principal whisker, together forming a somatotopic map of the whisker pad. Proper thalamocortical innervation is critical for barrel formation during development, but the molecular mechanisms controlling layer IV neuron clustering are unknown. Here, we investigate the role in this mapping of the nuclear orphan receptor RORβ, which is expressed in neurons in layer IV during corticogenesis. We find that RORβ protein expression specifically increases in the whisker barrel cortex during barrel formation and that in vivo overexpression of RORβ is sufficient to induce periodic barrel-like clustering of cortical neurons. Remarkably, this clustering can be induced as early as E18, prior to innervation by thalamocortical afferents and whisker derived-input. At later developmental stages, these ectopic neuronal clusters are specifically innervated by thalamocortical axons, demonstrated by anterograde labeling from the thalamus and by expression of thalamocortical-specific synaptic markers. Together, these data indicate that RORβ expression levels control cytoarchitectural patterning of neocortical neurons during development, a critical process for the topographical mapping of whisker input onto the cortical surface. PMID:21799210

  5. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.

    PubMed

    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A

    2013-09-01

    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity.

  6. Antibody-Induced Acetylcholine Receptor Clusters Inhabit Liquid-Ordered and Liquid-Disordered Domains

    PubMed Central

    Kamerbeek, Constanza B.; Borroni, Virginia; Pediconi, María F.; Sato, Satoshi B.; Kobayashi, Toshihide; Barrantes, Francisco J.

    2013-01-01

    The distribution of nicotinic acetylcholine receptor (AChR) clusters at the cell membrane was studied in CHO-K1/A5 cells using fluorescence microscopy. Di-4-ANEPPDHQ, a fluorescent probe that differentiates between liquid-ordered (Lo) and liquid-disordered (Ld) phases in model membranes, was used in combination with monoclonal anti-AChR antibody labeling of live cells, which induces AChR clustering. The so-called generalized polarization (GP) of di-4-ANEPPDHQ was measured in regions of the cell-surface membrane associated with or devoid of antibody-induced AChR clusters, respectively. AChR clusters were almost equally distributed between Lo and Ld domains, independently of receptor surface levels and agonist (carbamoylcholine and nicotine) or antagonist (α-bungarotoxin) binding. Cholesterol depletion diminished the cell membrane mean di-4-ANEPPDHQ GP and the number of AChR clusters associated with Ld membrane domains increased concomitantly. Depolymerization of the filamentous actin cytoskeleton by Latrunculin A had the opposite effect, with more AChR clusters associated with Lo domains. AChR internalized via small vesicles having lower GP and lower cholesterol content than the surface membrane. Upon cholesterol depletion, only 12% of the AChR-containing vesicles costained with the fluorescent cholesterol analog fPEG-cholesterol, i.e., AChR endocytosis was essentially dissociated from that of cholesterol. In conclusion, the distribution of AChR submicron-sized clusters at the cell membrane appears to be regulated by cholesterol content and cytoskeleton integrity. PMID:24094401

  7. Estrogens protect against hydrogen peroxide and arachidonic acid induced DNA damage.

    PubMed

    Tang, M; Subbiah, M T

    1996-01-19

    The ability of estrogens to protect against DNA damage induced by either hydrogen peroxide or arachidonic acid alone or in combination with Cu2+ was investigated. DNA strand breaks were determined by conversion of double stranded supercoiled OX-174 RFI DNA to double stranded open circular DNA and linear single stranded DNA. Estradiol-17 beta significantly decreased the formation of single and double strand breaks in DNA induced by H2O2 alone or with Cu2+. Equilin (an equine estrogen) was more effective than estradiol-17 beta at the doses tested. Arachidonic acid in the presence of Cu2+ caused the formation of high levels of linear DNA which was protected by estrogen with equilen being more effective. These studies suggest that estrogens through this protective effect on DNA damage might contribute to cardioprotection.

  8. Involvement of DNA-PK and ATM in radiation- and heat-induced DNA damage recognition and apoptotic cell death.

    PubMed

    Tomita, Masanori

    2010-01-01

    Exposure to ionizing radiation and hyperthermia results in important biological consequences, e.g. cell death, chromosomal aberrations, mutations, and DNA strand breaks. There is good evidence that the nucleus, specifically cellular DNA, is the principal target for radiation-induced cell lethality. DNA double-strand breaks (DSBs) are considered to be the most serious type of DNA damage induced by ionizing radiation. On the other hand, verifiable mechanisms which can lead to heat-induced cell death are damage to the plasma membrane and/or inactivation of heat-labile proteins caused by protein denaturation and subsequent aggregation. Recently, several reports have suggested that DSBs can be induced after hyperthermia because heat-induced phosphorylated histone H2AX (γ-H2AX) foci formation can be observed in several mammalian cell lines. In mammalian cells, DSBs are repaired primarily through two distinct and complementary mechanisms: non-homologous end joining (NHEJ), and homologous recombination (HR) or homology-directed repair (HDR). DNA-dependent protein kinase (DNA-PK) and ataxia-telangiectasia mutated (ATM) are key players in the initiation of DSB repair and phosphorylate and/or activate many substrates, including themselves. These phosphorylated substrates have important roles in the functioning of cell cycle checkpoints and in cell death, as well as in DSB repair. Apoptotic cell death is a crucial cell suicide mechanism during development and in the defense of homeostasis. If DSBs are unrepaired or misrepaired, apoptosis is a very important system which can protect an organism against carcinogenesis. This paper reviews recently obtained results and current topics concerning the role of DNA-PK and ATM in heat- or radiation-induced apoptotic cell death.

  9. Spectrum of Radiation-Induced Clustered Non-DSB Damage - A Monte Carlo Track Structure Modeling and Calculations.

    PubMed

    Watanabe, Ritsuko; Rahmanian, Shirin; Nikjoo, Hooshang

    2015-05-01

    The aim of this report is to present the spectrum of initial radiation-induced cellular DNA damage [with particular focus on non-double-strand break (DSB) damage] generated by computer simulations. The radiation types modeled in this study were monoenergetic electrons (100 eV-1.5 keV), ultrasoft X-ray photons Ck, AlK and TiK, as well as some selected ions including 3.2 MeV/u proton; 0.74 and 2.4 MeV/u helium ions; 29 MeV/u nitrogen ions and 950 MeV/u iron ions. Monte Carlo track structure methods were used to simulate damage induction by these radiation types in a cell-mimetic condition from a single-track action. The simulations took into account the action of direct energy deposition events and the reaction of hydroxyl radicals on atomistic linear B-DNA segments of a few helical turns including the water of hydration. Our results permitted the following conclusions: a. The absolute levels of different types of damage [base damage, simple and complex single-strand breaks (SSBs) and DSBs] vary depending on the radiation type; b. Within each damage class, the relative proportions of simple and complex damage vary with radiation type, the latter being higher with high-LET radiations; c. Overall, for both low- and high-LET radiations, the ratios of the yields of base damage to SSBs are similar, being about 3.0 ± 0.2; d. Base damage contributes more to the complexity of both SSBs and DSBs, than additional SSB damage and this is true for both low- and high-LET radiations; and e. The average SSB/DSB ratio for low-LET radiations is about 18, which is about 5 times higher than that for high-LET radiations. The hypothesis that clustered DNA damage is more difficult for cells to repair has gained currency among radiobiologists. However, as yet, there is no direct in vivo experimental method to validate the dependence of kinetics of DNA repair on DNA damage complexity (both DSB and non-DSB types). The data on the detailed spectrum of DNA damage presented here, in particular

  10. Divalent counterion-induced condensation of triple-strand DNA

    PubMed Central

    Qiu, Xiangyun; Parsegian, V. Adrian; Rau, Donald C.

    2010-01-01

    Understanding and manipulation of the forces assembling DNA/RNA helices have broad implications for biology, medicine, and physics. One subject of significance is the attractive force between dsDNA mediated by polycations of valence ≥3. Despite extensive studies, the physical origin of the “like-charge attraction” remains unsettled among competing theories. Here we show that triple-strand DNA (tsDNA), a more highly charged helix than dsDNA, is precipitated by alkaline-earth divalent cations that are unable to condense dsDNA. We further show that our observation is general by examining several cations (Mg2+, Ba2+, and Ca2+) and two distinct tsDNA constructs. Cation-condensed tsDNA forms ordered hexagonal arrays that redissolve upon adding monovalent salts. Forces between tsDNA helices, measured by osmotic stress, follow the form of hydration forces observed with condensed dsDNA. Probing a well-defined system of point-like cations and tsDNAs with more evenly spaced helical charges, the counterintuitive observation that the more highly charged tsDNA (vs. dsDNA) is condensed by cations of lower valence provides new insights into theories of polyelectrolytes and the biological and pathological roles of tsDNA. Cations and tsDNAs also hold promise as a model system for future studies of DNA–DNA interactions and electrostatic interactions in general. PMID:21098260

  11. BRCA2 diffuses as oligomeric clusters with RAD51 and changes mobility after DNA damage in live cells

    PubMed Central

    Reuter, Marcel; Zelensky, Alex; Smal, Ihor; Meijering, Erik; van Cappellen, Wiggert A.; de Gruiter, H. Martijn; van Belle, Gijsbert J.; van Royen, Martin E.; Houtsmuller, Adriaan B.; Essers, Jeroen; Kanaar, Roland

    2014-01-01

    Genome maintenance by homologous recombination depends on coordinating many proteins in time and space to assemble at DNA break sites. To understand this process, we followed the mobility of BRCA2, a critical recombination mediator, in live cells at the single-molecule level using both single-particle tracking and fluorescence correlation spectroscopy. BRCA2-GFP and -YFP were compared to distinguish diffusion from fluorophore behavior. Diffusive behavior of fluorescent RAD51 and RAD54 was determined for comparison. All fluorescent proteins were expressed from endogenous loci. We found that nuclear BRCA2 existed in oligomeric clusters, and exhibited heterogeneous mobility. DNA damage increased BRCA2 transient binding, presumably including binding to damaged sites. Despite its very different size, RAD51 displayed mobility similar to BRCA2, which indicates physical interaction between these proteins both before and after induction of DNA damage. We propose that BRCA2-mediated sequestration of nuclear RAD51 serves to prevent inappropriate DNA interactions and that all RAD51 is delivered to DNA damage sites in association with BRCA2. PMID:25488918

  12. Dielectric-spectroscopy approach to ferrofluid nanoparticle clustering induced by an external electric field.

    PubMed

    Rajnak, Michal; Kurimsky, Juraj; Dolnik, Bystrik; Kopcansky, Peter; Tomasovicova, Natalia; Taculescu-Moaca, Elena Alina; Timko, Milan

    2014-09-01

    An experimental study of magnetic colloidal particles cluster formation induced by an external electric field in a ferrofluid based on transformer oil is presented. Using frequency domain isothermal dielectric spectroscopy, we study the influence of a test cell electrode separation distance on a low-frequency relaxation process. We consider the relaxation process to be associated with an electric double layer polarization taking place on the particle surface. It has been found that the relaxation maximum considerably shifts towards lower frequencies when conducting the measurements in the test cells with greater electrode separation distances. As the electric field intensity was always kept at a constant value, we propose that the particle cluster formation induced by the external ac electric field accounts for that phenomenon. The increase in the relaxation time is in accordance with the Schwarz theory of electric double layer polarization. In addition, we analyze the influence of a static electric field generated by dc bias voltage on a similar shift in the relaxation maximum position. The variation of the dc electric field for the hysteresis measurements purpose provides understanding of the development of the particle clusters and their decay. Following our results, we emphasize the utility of dielectric spectroscopy as a simple, complementary method for detection and study of clusters of colloidal particles induced by external electric field.

  13. Laser-Induced Heating for DNA Replication in a Microfluidics

    NASA Astrophysics Data System (ADS)

    Hung, Min-Sheng; Chen, Chin-Pin

    In this study, we integrated microfluidics and a laser to develop a microfluidic system that performs target DNA replication. To achieve replication of targeted position of DNA, DNA fibers are stretched and both ends immobilized onto an electrode through dielectrophoresis. During the process, 2 designed primers, as well as DNA polymerase and its substrates, are fed into the microfluidics, and a focused infrared laser is used to irradiate the center of the DNA strand. An on-off switching mechanism is used to create thermal cycling. A polymerase chain reaction is then used to confirm the successfully replicated DNA.

  14. Coordination of the Ser2056 and Thr2609 Clusters of DNA-PKcs in Regulating Gamma Rays and Extremely Low Fluencies of Alpha-Particle Irradiation to G0/G1 Phase Cells

    PubMed Central

    Nagasawa, Hatsumi; Lin, Yu-Fen; Kato, Takamitsu A.; Brogan, John R.; Shih, Hung-Ying; Kurimasa, Akihiro; Bedford, Joel S.; Chen, Benjamin P. C.; Little, John B.

    2017-01-01

    The catalytic subunit of DNA dependent protein kinase (DNA-PKcs) and its kinase activity are critical for mediation of non-homologous end-joining (NHEJ) of DNA double-strand breaks (DSB) in mammalian cells after gamma-ray irradiation. Additionally, DNA-PKcs phosphorylations at the T2609 cluster and the S2056 cluster also affect DSB repair and cellular sensitivity to gamma radiation. Previously we reported that phosphorylations within these two regions affect not only NHEJ but also homologous recombination repair (HRR) dependent DSB repair. In this study, we further examine phenotypic effects on cells bearing various combinations of mutations within either or both regions. Effects studied included cell killing as well as chromosomal aberration induction after 0.5–8 Gy gamma-ray irradiation delivered to synchronized cells during the G0/G1 phase of the cell cycle. Blocking phosphorylation within the T2609 cluster was most critical regarding sensitization and depended on the number of available phosphorylation sites. It was also especially interesting that only one substitution of alanine in each of the two clusters separately abolished the restoration of wild-type sensitivity by DNA-PKcs. Similar patterns were seen for induction of chromosomal aberrations, reflecting their connection to cell killing. To study possible change in coordination between HRR and NHEJ directed repair in these DNA-PKcs mutant cell lines, we compared the induction of sister chromatid exchanges (SCEs) by very low fluencies of alpha particles with mutant cells defective in the HRR pathway that is required for induction of SCEs. Levels of true SCEs induced by very low fluence of alpha-particle irradiation normally seen in wild-type cells were only slightly decreased in the S2056 cluster mutants, but were completely abolished in the T2609 cluster mutants and were indistinguishable from levels seen in HRR deficient cells. Again, a single substitution in the S2056 together with a single

  15. Fibronectin inhibits cytokine production induced by CpG DNA in macrophages without direct binding to DNA.

    PubMed

    Yoshida, Hiroyuki; Nishikawa, Makiya; Yasuda, Sachiyo; Toyota, Hiroyasu; Kiyota, Tsuyoshi; Takahashi, Yuki; Takakura, Yoshinobu

    2012-10-01

    Fibronectin (FN) is known to have four DNA-binding domains although their physiological significance is unknown. Primary murine peritoneal macrophages have been shown to exhibit markedly lower responsiveness to CpG motif-replete plasmid DNA (pDNA), Toll-like receptor-9 (TLR9) ligand, compared with murine macrophage-like cell lines. The present study was conducted to examine whether FN having DNA-binding domains is involved in this phenomenon. The expression of FN was significantly higher in primary macrophages than in a macrophage-like cell line, RAW264.7, suggesting that abundant FN might suppress the responsiveness in the primary macrophages. However, electrophoretic analysis revealed that FN did not bind to pDNA in the presence of a physiological concentration of divalent cations. Surprisingly, marked tumor necrosis factor - (TNF-)α production from murine macrophages upon CpG DNA stimulation was significantly reduced by exogenously added FN in a concentration-dependent manner but not by BSA, laminin or collagen. FN did not affect apparent pDNA uptake by the cells. Moreover, FN reduced TNF-α production induced by polyI:C (TLR3 ligand), and imiquimod (TLR7 ligand), but not by LPS (TLR4 ligand), or a non-CpG pDNA/cationic liposome complex. The confocal microscopic study showed that pDNA was co-localized with FN in the same intracellular compartment in RAW264.7, suggesting that FN inhibits cytokine signal transduction in the endosomal/lysosomal compartment. Taken together, the results of the present study has revealed, for the first time, a novel effect of FN whereby the glycoprotein modulates cytokine signal transduction via CpG-DNA/TLR9 interaction in macrophages without direct binding to DNA through its putative DNA-binding domains.

  16. Comparison of transcriptional responses to osmotic stresses induced by NaCl and sorbitol additions in Saccharomyces cerevisiae using DNA microarray.

    PubMed

    Hirasawa, Takashi; Ashitani, Kengo; Yoshikawa, Katsunori; Nagahisa, Keisuke; Furusawa, Chikara; Katakura, Yoshio; Shimizu, Hiroshi; Shioya, Suteaki

    2006-12-01

    Transcriptional responses of laboratory and brewing strains of Saccharomyces cerevisiae to osmotic stresses induced by adding either NaCl or sorbitol to their cultures were compared by clustering DNA microarray data. Our results suggest that the difference in the transcriptional responses of the two strains between NaCl and sorbitol additions is small when the dynamics of the total change in gene expression are similar.

  17. Condensation and salt-induced decondensation of DNA upon incorporation of a V-shaped luminescent [Ru2(bpy)4(mbpibH2)](4+).

    PubMed

    Gan, Gui-Lian; Chao, Hui; Cai, Xue-Ping; Jiang, Zhen-Shen; Li, Hong

    2013-12-01

    This paper first reports on the condensation of DNA to a tightly packed state induced by a V-shaped di-ruthenium(II) complex [Ru2(bpy)4(mbpibH2)]Cl4 (bpy=2,2'-bipyridine and mbpibH2=1,3-bis([1,10]phenanthroline[5,6-d]imidazol-2-yl)benzene), which binds to the groove of herring sperm DNA (hsDNA) with the binding constant of 2.0×10(7)M(-1) (0.05M NaCl, pH7.2). The di-Ru(II) complex is found to induce the condensation of both hsDNA to long chain-like particle clusters and originally circular plasmid pBR322 DNA to particulate structure under neutral conditions. More interestingly, the presence of NaCl has a significant impact on the condensation and decondensation of DNA upon incorporation of [Ru2(bpy)4(mbpibH2)](4+), representing tunable luminescence characteristics by NaCl. High salt concentration facilitates the decondensation of DNA-[Ru2(bpy)4(mbpibH2)](4+) adducts. The results from this study offer an effective method to control the condensation and decondensation of DNA upon incorporation of luminescent concentrators.

  18. Linearity and additivity in cluster-induced sputtering: A molecular-dynamics study of van der Waals bonded systems

    SciTech Connect

    Anders, Christian; Urbassek, Herbert M.; Johnson, Robert E.

    2004-10-15

    Using molecular-dynamics simulation, we study sputtering of a condensed-gas solid induced by the impact of atomic clusters with sizes 1{<=}n{<=}10{sup 4}. Above a nonlinear onset regime, we find a linear increase of the sputter yield Y with the total energy E of the bombarding cluster. The fitting coefficients in the linear regime depend only on the cluster size n such that for fixed bombardment energy, sputtering decreases with increasing cluster size n. We find that to a good approximation the sputter yield in this regime obeys an additivity rule in cluster size n such that doubling the cluster size at the same cluster velocity amounts to doubling the sputter yield. The sputter-limiting energy {epsilon}{sub s} is introduced which separates erosion ({epsilon}>{epsilon}{sub s}) from growth ({epsilon}<{epsilon}{sub s}) under cluster impact.

  19. Photosensitized UVA-Induced Cross-Linking between Human DNA Repair and Replication Proteins and DNA Revealed by Proteomic Analysis

    PubMed Central

    2016-01-01

    Long wavelength ultraviolet radiation (UVA, 320–400 nm) interacts with chromophores present in human cells to induce reactive oxygen species (ROS) that damage both DNA and proteins. ROS levels are amplified, and the damaging effects of UVA are exacerbated if the cells are irradiated in the presence of UVA photosensitizers such as 6-thioguanine (6-TG), a strong UVA chromophore that is extensively incorporated into the DNA of dividing cells, or the fluoroquinolone antibiotic ciprofloxacin. Both DNA-embedded 6-TG and ciprofloxacin combine synergistically with UVA to generate high levels of ROS. Importantly, the extensive protein damage induced by these photosensitizer+UVA combinations inhibits DNA repair. DNA is maintained in intimate contact with the proteins that effect its replication, transcription, and repair, and DNA–protein cross-links (DPCs) are a recognized reaction product of ROS. Cross-linking of DNA metabolizing proteins would compromise these processes by introducing physical blocks and by depleting active proteins. We describe a sensitive and statistically rigorous method to analyze DPCs in cultured human cells. Application of this proteomics-based analysis to cells treated with 6-TG+UVA and ciprofloxacin+UVA identified proteins involved in DNA repair, replication, and gene expression among those most vulnerable to cross-linking under oxidative conditions. PMID:27654267

  20. DNA fragment sizing and sorting by laser-induced fluorescence

    SciTech Connect

    Jett, J.H.; Hammond, M.L.; Keller, R.A.; Marrone, B.L.; Martin, J.C.

    1992-12-31

    A method is provided for obtaining DNA fingerprints using high speed detection systems, such as flow cytometry to determine unique characteristics of DNA pieces from a selected sample. In one characterization the DNA piece is fragmented at preselected sites to produce a plurality of DNA fragments. The DNA piece or the resulting DNA fragments are treated with a dye effective to stain stoichiometrically the DNA fragments. The fluorescence from the dye in the stained fragments is then examined to generate an output functionally related to the number of nucleotides in each one of the DNA fragments. In one embodiment, the intensity of the fluorescence emissions from each fragment is directly proportional to the fragment length. Additional dyes can be bound to the DNA piece and DNA fragments to provide information additional to length information. Oligonucleotide specific dyes and/or hybridization probes can be bound to the DNA fragments to provide information on oligonucleotide distribution or probe hybridization to DNA fragments of different sizes.

  1. DNA damage induced by red food dyes orally administered to pregnant and male mice.

    PubMed

    Tsuda, S; Murakami, M; Matsusaka, N; Kano, K; Taniguchi, K; Sasaki, Y F

    2001-05-01

    We determined the genotoxicity of synthetic red tar dyes currently used as food color additives in many countries, including JAPAN: For the preliminary assessment, we treated groups of 4 pregnant mice (gestational day 11) once orally at the limit dose (2000 mg/kg) of amaranth (food red No. 2), allura red (food red No. 40), or acid red (food red No. 106), and we sampled brain, lung, liver, kidney, glandular stomach, colon, urinary bladder, and embryo 3, 6, and 24 h after treatment. We used the comet (alkaline single cell gel electrophoresis) assay to measure DNA damage. The assay was positive in the colon 3 h after the administration of amaranth and allura red and weakly positive in the lung 6 h after the administration of amaranth. Acid red did not induce DNA damage in any sample at any sampling time. None of the dyes damaged DNA in other organs or the embryo. We then tested male mice with amaranth, allura red, and a related color additive, new coccine (food red No. 18). The 3 dyes induced DNA damage in the colon starting at 10 mg/kg. Twenty ml/kg of soaking liquid from commercial red ginger pickles, which contained 6.5 mg/10 ml of new coccine, induced DNA damage in colon, glandular stomach, and bladder. The potencies were compared to those of other rodent carcinogens. The rodent hepatocarcinogen p-dimethylaminoazobenzene induced colon DNA damage at 1 mg/kg, whereas it damaged liver DNA only at 500 mg/kg. Although 1 mg/kg of N-nitrosodimethylamine induced DNA damage in liver and bladder, it did not induce colon DNA damage. N-nitrosodiethylamine at 14 mg/kg did not induce DNA damage in any organs examined. Because the 3 azo additives we examined induced colon DNA damage at a very low dose, more extensive assessment of azo additives is warranted.

  2. Oxidant and environmental toxicant-induced effects compromise DNA ligation during base excision DNA repair

    PubMed Central

    Çağlayan, Melike; Wilson, Samuel H.

    2015-01-01

    DNA lesions arise from many endogenous and environmental agents, and they promote deleterious events leading to genomic instability and cell death. Base excision repair (BER) is the main DNA repair pathway responsible for repairing single strand breaks, base lesions and abasic sites in mammalian cells. During BER, DNA substrates and repair intermediates are channeled from one step to the next in a sequential fashion so that release of toxic repair intermediates is minimized. This includes handoff of the product of gap-filling DNA synthesis to the DNA ligation step. The conformational differences in DNA polymerase β (pol β) associated with incorrect or oxidized nucleotide (8-oxodGMP) insertion could impact channeling of the repair intermediate to the final step of BER, i.e., DNA ligation by DNA ligase I or the DNA Ligase III/XRCC1 complex. Thus, modified DNA ligase substrates produced by faulty pol β gap-filling could impair coordination between pol β and DNA ligase. Ligation failure is associated with 5'-AMP addition to the repair intermediate and accumulation of strand breaks that could be more toxic than the initial DNA lesions. Here, we provide an overview of the consequences of ligation failure in the last step of BER. We also discuss DNA-end processing mechanisms that could play roles in reversal of impaired BER. PMID:26596511

  3. Oxidant and environmental toxicant-induced effects compromise DNA ligation during base excision DNA repair

    PubMed Central

    çağlayan, Melike; Wilson, Samuel H.

    2015-01-01

    DNA lesions arise from many endogenous and environmental agents, and they promote deleterious events leading to genomic instability and cell death. Base excision repair (BER) is the main DNA repair pathway responsible for repairing single strand breaks, base lesions and abasic sites in mammalian cells. During BER, DNA substrates and repair intermediates are channeled from one step to the next in a sequential fashion so that release of toxic repair intermediates is minimized. This includes handoff of the product of gap-filling DNA synthesis to the DNA ligation step. The conformational differences in DNA polymerase β (pol β) associated with incorrect or oxidized nucleotide (8-oxodGMP) insertion could impact channeling of the repair intermediate to the final step of BER, i.e., DNA ligation by DNA ligase I or the DNA Ligase III/XRCC1 complex. Thus, modified DNA ligase substrates produced by faulty pol β gap-filling could impair coordination between pol β and DNA ligase. Ligation failure is associated with 5′-AMP addition to the repair intermediate and accumulation of strand breaks that could be more toxic than the initial DNA lesions. Here, we provide an overview of the consequences of ligation failure in the last step of BER. We also discuss DNA-end processing mechanisms that could play roles in reversal of impaired BER. PMID:26466358

  4. Oxidant and environmental toxicant-induced effects compromise DNA ligation during base excision DNA repair.

    PubMed

    Çağlayan, Melike; Wilson, Samuel H

    2015-11-01

    DNA lesions arise from many endogenous and environmental agents, and such lesions can promote deleterious events leading to genomic instability and cell death. Base excision repair (BER) is the main DNA repair pathway responsible for repairing single strand breaks, base lesions and abasic sites in mammalian cells. During BER, DNA substrates and repair intermediates are channeled from one step to the next in a sequential fashion so that release of toxic repair intermediates is minimized. This includes handoff of the product of gap-filling DNA synthesis to the DNA ligation step. The conformational differences in DNA polymerase β (pol β) associated with incorrect or oxidized nucleotide (8-oxodGMP) insertion could impact channeling of the repair intermediate to the final step of BER, i.e., DNA ligation by DNA ligase I or the DNA Ligase III/XRCC1 complex. Thus, modified DNA ligase substrates produced by faulty pol β gap-filling could impair coordination between pol β and DNA ligase. Ligation failure is associated with 5'-AMP addition to the repair intermediate and accumulation of strand breaks that could be more toxic than the initial DNA lesions. Here, we provide an overview of the consequences of ligation failure in the last step of BER. We also discuss DNA-end processing mechanisms that could play roles in reversal of impaired BER.

  5. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    PubMed Central

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Background. Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis. PMID:26273425

  6. The human oxidative DNA glycosylase NEIL1 excises psoralen-induced interstrand DNA cross-links in a three-stranded DNA structure.

    PubMed

    Couvé, Sophie; Macé-Aimé, Gaëtane; Rosselli, Filippo; Saparbaev, Murat K

    2009-05-01

    Previously, we have demonstrated that human oxidative DNA glycosylase NEIL1 excises photoactivated psoralen-induced monoadducts but not genuine interstrand cross-links (ICLs) in duplex DNA. It has been postulated that the repair of ICLs in mammalian cells is mainly linked to DNA replication and proceeds via dual incisions in one DNA strand that bracket the cross-linked site. This process, known as "unhooking," enables strand separation and translesion DNA synthesis through the gap, yielding a three-stranded DNA repair intermediate composed of a short unhooked oligomer covalently bound to the duplex. At present, the detailed molecular mechanism of ICL repair in mammalian cells remains unclear. Here, we constructed and characterized three-stranded DNA structures containing a single ICL as substrates for the base excision repair proteins. We show that NEIL1 excises with high efficiency the unhooked ICL fragment within a three-stranded DNA structure. Complete reconstitution of the repair of unhooked ICL shows that it can be processed in a short patch base excision repair pathway. The new substrate specificity of NEIL1 points to a preferential involvement in the replication-associated repair of ICLs. Based on these data, we propose a model for the mechanism of ICL repair in mammalian cells that implicates the DNA glycosylase activity of NEIL1 downstream of Xeroderma Pigmentosum group F/Excision Repair Cross-Complementing 1 endonuclease complex (XPF/ERCC1) and translesion DNA synthesis repair steps. Finally, our data demonstrate that Nei-like proteins from Escherichia coli to human cells can excise bulky unhooked psoralen-induced ICLs via hydrolysis of glycosidic bond between cross-linked base and deoxyribose sugar, thus providing an alternative heuristic solution for the removal of complex DNA lesions.

  7. Naturally occurring branched-chain polyamines induce a crosslinked meshwork structure in a giant DNA

    NASA Astrophysics Data System (ADS)

    Muramatsu, Akira; Shimizu, Yuta; Yoshikawa, Yuko; Fukuda, Wakao; Umezawa, Naoki; Horai, Yuhei; Higuchi, Tsunehiko; Fujiwara, Shinsuke; Imanaka, Tadayuki; Yoshikawa, Kenichi

    2016-12-01

    We studied the effect of branched-chain polyamines on the folding transition of genome-sized DNA molecules in aqueous solution by the use of single-molecule observation with fluorescence microcopy. Detailed morphological features of polyamine/DNA complexes were characterized by atomic force microscopy (AFM). The AFM observations indicated that branched-chain polyamines tend to induce a characteristic change in the higher-order structure of DNA by forming bridges or crosslinks between the segments of a DNA molecule. In contrast, natural linear-chain polyamines cause a parallel alignment between DNA segments. Circular dichroism measurements revealed that branched-chain polyamines induce the A-form in the secondary structure of DNA, while linear-chain polyamines have only a minimum effect. This large difference in the effects of branched- and linear-chain polyamines is discussed in relation to the difference in the manner of binding of these polyamines to negatively charged double-stranded DNA.

  8. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  9. RNA-directed DNA methylation induces transcriptional activation in plants

    PubMed Central

    Shibuya, Kenichi; Fukushima, Setsuko; Takatsuji, Hiroshi

    2009-01-01

    A class-C floral homeotic gene of Petunia, pMADS3, is specifically expressed in the stamen and carpels of developing flowers. We had previously reported the ect-pMADS3 phenomenon in which introduction of a part of the pMADS3 genomic sequence, including intron 2, induces ectopic expression of endogenous pMADS3. Unlike transcriptional or posttranscriptional gene silencing triggered by the introduction of homologous sequences, this observation is unique in that the gene expression is up-regulated. In this study, we demonstrated that the ect-pMADS3 phenomenon is due to transcriptional activation based on RNA-directed DNA methylation (RdDM) occurring in a particular CG in a putative cis-element in pMADS3 intron 2. The CG methylation was maintained over generations, along with pMADS3 ectopic expression, even in the absence of RNA triggers. These results demonstrate a previously undescribed transcriptional regulatory mechanism that could lead to the generation of a transcriptionally active epiallele, thereby contributing to plant evolution. Our results also reveal a putative negative cis-element for organ-specific transcriptional regulation of class-C floral homeotic genes, which could be difficult to identify by other approaches. PMID:19164525

  10. Phonon induced spin relaxation times of single donors and donor clusters in silicon

    NASA Astrophysics Data System (ADS)

    Hsueh, Yuling; Buch, Holger; Hollenberg, Lloyd; Simmons, Michelle; Klimeck, Gerhard; Rahman, Rajib

    2014-03-01

    The phonon induced relaxation times (T1) of electron spins bound to single phosphorous (P) donors and P donor clusters in silicon is computed using the atomistic tight-binding method. The electron-phonon Hamiltonian is directly computed from the strain dependent tight-binding Hamiltonian, and the relaxation time is computed from Fermi's Golden Rule using the donor states and the electron-phonon Hamiltonian. The self-consistent Hartree method is used to compute the multi-electron wavefunctions in donor clusters. The method takes into account the full band structure of silicon including the spin-orbit interaction, and captures both valley repopulation and single valley g-factor shifts in a unified framework. The single donor relaxation rate varies proportionally to B5, and is of the order of seconds at B =2T, both in good agreement with experimental single donor data (A. Morello et. al., Nature 467, 687 (2010)). T1 calculations in donor clusters show variations for different electron numbers and donor numbers and locations. The computed T1 in a 4P:5e donor cluster match well with a scanning tunneling microscope patterned P donor cluster (H. Buch et. al., Nature Communications 4, 2017 (2013)).

  11. Plasma protein induced clustering of red blood cells in micro capillaries

    NASA Astrophysics Data System (ADS)

    Wagner, Christian; Brust, Mathias; Aouane, Othmane; Flormann, Daniel; Thiebaud, Marine; Verdier, Claude; Coupier, Gwennou; Podgorski, Thomas; Misbah, Chaouqi; Selmi, Hassib

    2013-11-01

    The plasma molecule fibrinogen induces aggregation of RBCs to clusters, the so called rouleaux. Higher shear rates in bulk flow can break them up which results in the pronounced shear thinning of blood. This led to the assumption that rouleaux formation does not take place in the microcapillaries of the vascular network where high shear rates are present. However, the question is of high medical relevance. Cardio vascular disorders are still the main cause of death in the western world and cardiac patients have often higher fibrinogen level. We performed AFM based single cell force spectroscopy to determine the work of separation. Measurements at low hematocrit in a microfluidic channel show that the number of size of clusters is determined by the adhesion strength and we found that cluster formation is strongly enhanced by fibrinogen at physiological concentrations, even at shear rate as high as 1000 1/s. Numerical simulations based on a boundary integral method confirm our findings and the clustering transition takes place both in the experiments and in the simulations at the same interaction energies. In vivo measurements with intravital fluorescence microscopy in a dorsal skin fold chamber in a mouse reveal that RBCs indeed form clusters in the micrcapillary flow. This work was supported by the German Science Foundation research imitative SFB1027.

  12. Susceptibility to Exercise-Induced Muscle Damage: a Cluster Analysis with a Large Sample.

    PubMed

    Damas, F; Nosaka, K; Libardi, C A; Chen, T C; Ugrinowitsch, C

    2016-07-01

    We investigated the responses of indirect markers of exercise-induced muscle damage (EIMD) among a large number of young men (N=286) stratified in clusters based on the largest decrease in maximal voluntary contraction torque (MVC) after an unaccustomed maximal eccentric exercise bout of the elbow flexors. Changes in MVC, muscle soreness (SOR), creatine kinase (CK) activity, range of motion (ROM) and upper-arm circumference (CIR) before and for several days after exercise were compared between 3 clusters established based on MVC decrease (low, moderate, and high responders; LR, MR and HR). Participants were allocated to LR (n=61), MR (n=152) and HR (n=73) clusters, which depicted significantly different cluster centers of 82%, 61% and 42% of baseline MVC, respectively. Once stratified by MVC decrease, all muscle damage markers were significantly different between clusters following the same pattern: small changes for LR, larger changes for MR, and the largest changes for HR. Stratification of individuals based on the magnitude of MVC decrease post-exercise greatly increases the precision in estimating changes in EIMD by proxy markers such as SOR, CK activity, ROM and CIR. This indicates that the most commonly used markers are valid and MVC orchestrates their responses, consolidating the role of MVC as the best EIMD indirect marker.

  13. The cytosolic Fe-S cluster assembly component MET18 is required for the full enzymatic activity of ROS1 in active DNA demethylation

    PubMed Central

    Wang, Xiaokang; Li, Qi; Yuan, Wei; Cao, Zhendong; Qi, Bei; Kumar, Suresh; Li, Yan; Qian, Weiqiang

    2016-01-01

    DNA methylation patterns in plants are dynamically regulated by DNA methylation and active DNA demethylation in response to both environmental changes and development of plant. Beginning with the removal of methylated cytosine by ROS1/DME family of 5-methylcytosine DNA glycosylases, active DNA demethylation in plants occurs through base excision repair. So far, many components involved in active DNA demethylation remain undiscovered. Through a forward genetic screening of Arabidopsis mutants showing DNA hypermethylation at the EPF2 promoter region, we identified the conserved iron-sulfur cluster assembly protein MET18. MET18 dysfunction caused DNA hypermethylation at more than 1000 loci as well as the silencing of reporter genes and some endogenous genes. MET18 can directly interact with ROS1 in vitro and in vivo. ROS1 activity was reduced in the met18 mutant plants and point mutation in the conserved Fe-S cluster binding motif of ROS1 disrupted its biological function. Interestingly, a large number of DNA hypomethylated loci, especially in the CHH context, were identified from the met18 mutants and most of the hypo-DMRs were from TE regions. Our results suggest that MET18 can regulate both active DNA demethylation and DNA methylation pathways in Arabidopsis. PMID:27193999

  14. DNA binding of Jun and Fos bZip domains: homodimers and heterodimers induce a DNA conformational change in solution.

    PubMed Central

    John, M; Leppik, R; Busch, S J; Granger-Schnarr, M; Schnarr, M

    1996-01-01

    We constructed plasmids encoding the sequences for the bZip modules of c-Jun and c-Fos which could then be expressed as soluble proteins in Escherichia coli. The purified bZip modules were tested for their binding capacities of synthetic oligonucleotides containing either TRE or CRE recognition sites in electrophoretic mobility shift assays and circular dichroism (CD). Electrophoretic mobility shift assays showed that bZip Jun homodimers and bZip Jun/Fos heterodimers bind a collagenase-like TRE (CTGACTCAT) with dissociation constants of respectively 1.4 x 10(-7) M and 5 x 10(-8) M. As reported earlier [Patel et al. (1990) Nature 347, 572-575], DNA binding induces a marked change of the protein structure. However, we found that the DNA also undergoes a conformational change. This is most clearly seen with small oligonucleotides of 13 or 14 bp harboring respectively a TRE (TGACTCA) or a CRE (TGACGTCA) sequence. In this case, the positive DNA CD signal at 280 nm increases almost two-fold with a concomitant blue-shift of 3-4 nm. Within experimental error the same spectral changes are observed for TRE and CRE containing DNA fragments. The spectral changes observed with a non-specific DNA fragment are weaker and the signal of free DNA is recovered upon addition of much smaller salt concentrations than required for a specific DNA fragment. Surprisingly the spectral changes induced by Jun/Jun homodimers are not identical to those induced by Jun/Fos heterodimers. However, in both cases the increase of the positive CD band and the concomitant blue shift would be compatible with a B to A-transition of part of the binding site or a DNA conformation intermediate between the canonical A and B structures. PMID:8948639

  15. Immunofluorescence detection of clustered gamma-H2AX foci induced by HZE-particle radiation.

    PubMed

    Desai, N; Davis, E; O'Neill, P; Durante, M; Cucinotta, F A; Wu, H

    2005-10-01

    We studied the spatial and temporal distributions of foci of the phosphorylated form of the histone protein H2AX (gamma-H2AX), which is known to be activated by double-strand breaks after irradiation of human fibroblast cells with high-energy silicon (54 keV/microm) and iron (176 keV/microm) ions. Here we present data obtained with the ion path parallel to a monolayer of human fibroblast cells that leads to gamma-H2AX aggregates in the shape of streaks stretching over several micrometers in an x/y plane, thus enabling the analysis of the fluorescence distributions along the ion trajectories. Qualitative analyses of these distributions provide insights into DNA damage processing kinetics for high charge and energy (HZE) ions, including evidence of increased clustering of DNA damage and slower processing with increasing LET.

  16. Photo-induced transformation process at gold clusters-semiconductor interface: Implications for the complexity of gold clusters-based photocatalysis

    PubMed Central

    Liu, Siqi; Xu, Yi-Jun

    2016-01-01

    The recent thrust in utilizing atomically precise organic ligands protected gold clusters (Au clusters) as photosensitizer coupled with semiconductors for nano-catalysts has led to the claims of improved efficiency in photocatalysis. Nonetheless, the influence of photo-stability of organic ligands protected-Au clusters at the Au/semiconductor interface on the photocatalytic properties remains rather elusive. Taking Au clusters–TiO2 composites as a prototype, we for the first time demonstrate the photo-induced transformation of small molecular-like Au clusters to larger metallic Au nanoparticles under different illumination conditions, which leads to the diverse photocatalytic reaction mechanism. This transformation process undergoes a diffusion/aggregation mechanism accompanied with the onslaught of Au clusters by active oxygen species and holes resulting from photo-excited TiO2 and Au clusters. However, such Au clusters aggregation can be efficiently inhibited by tuning reaction conditions. This work would trigger rational structural design and fine condition control of organic ligands protected-metal clusters-semiconductor composites for diverse photocatalytic applications with long-term photo-stability. PMID:26947754

  17. Decreased skeletal muscle mitochondrial DNA in patients with statin-induced myopathy.

    PubMed

    Stringer, Henry A J; Sohi, Gurmeet K; Maguire, John A; Côté, Hélène C F

    2013-02-15

    Statins are widely used to treat hyperlipidemia and lower cardiovascular disease risk. While statins are generally well tolerated, some patients experience statin-induced myopathy (SIM). Statin treatment has been associated with mitochondrial dysfunction and mitochondrial DNA (mtDNA) depletion. In this retrospective study, skeletal muscle biopsies from patients diagnosed with SIM were studied. These were compared with biopsies from patients clinically assessed as having statin-unrelated myopathy but whose biopsy showed no or negligible pathology. For each biopsy sample, mtDNA was quantified relative to nuclear DNA (mtDNA content) by qPCR, mtDNA deletions were investigated by long-template PCR followed by gel densitometry, and mtDNA oxidative damage was quantified using a qPCR-based assay. For a subset of matched samples, mtDNA heteroplasmy and mutations were investigated by cloning/sequencing. Skeletal muscle mtDNA content was significantly lower in SIM patients (N=23, mean±SD, 2036±1146) than in comparators (N=24, 3220±1594), p=0.006. There was no difference in mtDNA deletion score or oxidative mtDNA damage between the two groups, and no evidence of increased mtDNA heteroplasmy or somatic mutations was detected. The significant difference in skeletal muscle mtDNA suggests that SIM or statin treatments are associated with depletion of skeletal muscle mtDNA or that patients with an underlying predisposition to SIM have lower mtDNA levels. If statins induce mtDNA depletion, this would likely reflect decreased mitochondria biogenesis and/or increased mitochondria autophagy. Further work is necessary to distinguish between the lower mtDNA as a predisposition to SIM or an effect of SIM or statin treatment.

  18. Clustering-Induced Attraction in Granular Mixtures of Rods and Spheres

    PubMed Central

    2016-01-01

    Depletion-induced aggregation of rods enhanced by clustering is observed to produce a novel model of attractive pairs of rods separated by a line of spheres in a quasi-2D, vertically-shaken, granular gas of rods and spheres. We show that the stability of these peculiar granular aggregates increases as a function of shaking intensity. Velocity distributions of spheres inside and outside of a pair of rods trapping a line of spheres show a clear suppression of the momentum acquired by the trapped spheres. The condensed phase formed between the rods is caused by a clustering instability of the trapped spheres, enhanced by a vertical guidance produced by the confining rods. The liberated area corresponding to direct excluded-volume pairs and indirect depletion-aggregated pairs is measured as a function of time. The stability of rod pairs mediated by spheres reveals an attraction comparable in strength to the one purely induced by depletion forces. PMID:27218804

  19. The chiroptical signature of achiral metal clusters induced by dissymmetric adsorbates.

    PubMed

    Goldsmith, Michael-Rock; George, Christopher B; Zuber, Gérard; Naaman, Ron; Waldeck, David H; Wipf, Peter; Beratan, David N

    2006-01-07

    Using a dissymmetrically-perturbed particle-in-a-box model, we demonstrate that the induced optical activity of chiral monolayer protected clusters, such as Whetten's Au28(SG)16 glutathione-passivated gold nanoclusters (J. Phys. Chem. B, 2000, 104, 2630-2641), could arise from symmetric metal cores perturbed by a dissymmetric or chiral field originating from the adsorbates. This finding implies that the electronic states of the nanocluster core are chiral, yet the lattice geometries of these cores need not be geometrically distorted by the chiral adsorbates. Based on simple chiral monolayer protected cluster models, we rationalize how the adsorption pattern of the tethering sulfur atoms has a substantial effect on the induced CD in the NIR spectral region, and we show how the chiral image charge produced in the core provides a convenient means of visualizing dissymmetric perturbations to the achiral gold nanocluster core.

  20. Identification of a UV-induced trans-acting protein that stimulates polyomavirus DNA replication

    SciTech Connect

    Ronai, Z.A.; Weinstein, I.B. )

    1988-03-01

    Previous studies provided indirect evidence that the ability of a variety of DNA-damaging agents to induce asynchronous polyomavirus DNA replication in the H3 rat fibroblast cell line is mediated by a trans-acting factor. Using an erythrocyte insertion technique to introduce protein fractions from UV-irradiated cells into unirradiated H3 cells, we have now obtained evidence that this factor is a 60-kilodalton protein. These findings provide evidence that DNA damage in mammalian cells induces a factor that can alter the replication of a viral DNA.

  1. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc

    2015-06-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  2. Herpes Simplex Virus and Interferon Signaling Induce Novel Autophagic Clusters in Sensory Neurons

    PubMed Central

    Katzenell, Sarah

    2016-01-01

    ABSTRACT Herpes simplex virus 1 (HSV-1) establishes lifelong infection in the neurons of trigeminal ganglia (TG), cycling between productive infection and latency. Neuronal antiviral responses are driven by type I interferon (IFN) and are crucial to controlling HSV-1 virulence. Autophagy also plays a role in this neuronal antiviral response, but the mechanism remains obscure. In this study, HSV-1 infection of murine TG neurons triggered unusual clusters of autophagosomes, predominantly in neurons lacking detectable HSV-1 antigen. Treatment of neurons with IFN-β induced a similar response, and cluster formation by infection or IFN treatment was dependent upon an intact IFN-signaling pathway. The autophagic clusters were decorated with both ISG15, an essential effecter of the antiviral response, and p62, a selective autophagy receptor. The autophagic clusters were not induced by rapamycin or starvation, consistent with a process of selective autophagy. While clusters were triggered by other neurotropic herpesviruses, infection with unrelated viruses failed to induce this response. Following ocular infection in vivo, clusters formed exclusively in the infected ophthalmic branch of the TG. Taken together, our results show that infection with HSV and antiviral signaling in TG neurons produce an unorthodox autophagic response. This autophagic clustering is associated with antiviral signaling, the presence of viral genome, and the absence of HSV protein expression and may therefore represent an important neuronal response to HSV infection and the establishment of latency. IMPORTANCE Herpes simplex virus type 1 (HSV-1) is a ubiquitous virus and a significant cause of morbidity and some mortality. It is the causative agent of benign cold sores, but it can also cause blindness and life-threatening encephalitis. The success of HSV-1 is largely due to its ability to establish lifelong latent infections in neurons and to occasionally reactivate. The exact mechanisms by which

  3. How to Cope with DNA Damage Induced by Ionizing Radiation and Anti-Cancer Drugs?

    NASA Astrophysics Data System (ADS)

    Enomoto, A.; Miyagawa, K.

    Ionizing radiation and chemotherapeutic agents induce many types of DNA lesions, of which DNA double-strand breaks (DSBs) are assumed to be the most deleterious. DNA damage response mechanisms encompass pathways of DNA damage signaling, DNA repair, cell cycle checkpoint arrest, and apoptosis. Increasing evidence suggests that these pathways function co-operatively to maintain genomic stability in the face of exogenous and endogenous DNA damage. The relative impact of one mechanism over another probably depends on the kinds of lesions, the cell cycle phase, and the cell or tissue type. The inability to respond properly to or to repair DSBs may lead to hypersensitivity to DNA damaging agents and genomic instability including chromosomal aberrations. Chromosomal instability, a state of continuous accumulation of chromosomal change, is a common feature of many human cancers and of chromosome instability syndromes with increased cancer susceptibility. Here, we review the DNA da mage response and the links between deficiencies in response to DSBs and chromosomal instability.

  4. Fibrinogen-induced perivascular microglial clustering is required for the development of axonal damage in neuroinflammation

    PubMed Central

    Davalos, Dimitrios; Kyu Ryu, Jae; Merlini, Mario; Baeten, Kim M.; Le Moan, Natacha; Petersen, Mark A.; Deerinck, Thomas J.; Smirnoff, Dimitri S.; Bedard, Catherine; Hakozaki, Hiroyuki; Gonias Murray, Sara; Ling, Jennie B.; Lassmann, Hans; Degen, Jay L.; Ellisman, Mark H.; Akassoglou, Katerina

    2012-01-01

    Blood-brain barrier disruption, microglial activation and neurodegeneration are hallmarks of multiple sclerosis. However, the initial triggers that activate innate immune responses and their role in axonal damage remain unknown. Here we show that the blood protein fibrinogen induces rapid microglial responses toward the vasculature and is required for axonal damage in neuroinflammation. Using in vivo two-photon microscopy, we demonstrate that microglia form perivascular clusters before myelin loss or paralysis onset and that, of the plasma proteins, fibrinogen specifically induces rapid and sustained microglial responses in vivo. Fibrinogen leakage correlates with areas of axonal damage and induces reactive oxygen species release in microglia. Blocking fibrin formation with anticoagulant treatment or genetically eliminating the fibrinogen binding motif recognized by the microglial integrin receptor CD11b/CD18 inhibits perivascular microglial clustering and axonal damage. Thus, early and progressive perivascular microglial clustering triggered by fibrinogen leakage upon blood-brain barrier disruption contributes to axonal damage in neuroinflammatory disease. PMID:23187627

  5. Cell synchronization by inhibitors of DNA replication induces replication stress and DNA damage response: analysis by flow cytometry

    PubMed Central

    Darzynkiewicz, Zbigniew; Halicka, H. Dorota; Zhao, Hong

    2010-01-01

    Cell synchronization is often achieved by inhibition of DNA replication. The cells cultured in the presence of such inhibitors as hydroxyurea, aphidicolin or thymidine become arrested at the entrance to S-phase and upon release from the block they synchronously progress through S, G2 and M. We recently reported that exposure of cells to these inhibitors at concentrations commonly used to synchronize cell populations led to phosphorylation of histone H2AX on Ser139 (induction of γH2AX) through activation of ataxia telangiectasia mutated and Rad3-related protein kinase (ATR). These findings imply that the induction of DNA replication stress by these inhibitors activates the DNA damage response cell signaling pathways and caution about interpreting data obtained with the use of cells synchronized such way as representing unperturbed cells. The protocol presented in this chapter describes the methodology of assessment of phosphorylation of histone H2AX-Ser139, ATM/ATR substrate on Ser/Thr at SQ/TQ cluster domains as well as ataxia telangiectasia mutated (ATM) protein kinase in cells treated with inhibitors of DNA replication. Phosphorylation of these proteins is detected in individual cell immunocytochemically with phospho-specific Ab and measured by flow cytometry. Concurrent measurement of cellular DNA content and phosphorylated proteins followed by multiparameter cytometric analysis allows one to correlate extent of their phosphorylation with cell cycle phase. PMID:21755443

  6. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells.

    PubMed

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-06-24

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague-Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo.

  7. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage–induced cell senescence

    PubMed Central

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A.; Kumar, Sheetal; Kalab, Petr

    2016-01-01

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase–regulated nuclear–cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage–induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β–dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP–regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  8. Structures of DNA Polymerase Mispaired DNA Termini Transitioning to Pre-catalytic Complexes Support an Induced-Fit Fidelity Mechanism.

    PubMed

    Batra, Vinod K; Beard, William A; Pedersen, Lars C; Wilson, Samuel H

    2016-11-01

    High-fidelity DNA synthesis requires that polymerases display a strong preference for right nucleotide insertion. When the wrong nucleotide is inserted, the polymerase deters extension from the mismatched DNA terminus. Twenty-three crystallographic structures of DNA polymerase β with terminal template-primer mismatches were determined as binary DNA and ternary pre-catalytic substrate complexes. These structures indicate that the mismatched termini adopt various distorted conformations that attempt to satisfy stacking and hydrogen-bonding interactions. The binary complex structures indicate an induced strain in the mismatched template nucleotide. Addition of a non-hydrolyzable incoming nucleotide stabilizes the templating nucleotide with concomitant strain in the primer terminus. Several dead-end ternary complex structures suggest that DNA synthesis might occur as the enzyme transitions from an open to a closed complex. The structures are consistent with an induced-fit mechanism where a mismatched terminus is misaligned relative to the correct incoming nucleotide to deter or delay further DNA synthesis.

  9. Spatiotemporal dynamics of DNA repair proteins following laser microbeam induced DNA damage - when is a DSB not a DSB?

    PubMed

    Reynolds, Pamela; Botchway, Stanley W; Parker, Anthony W; O'Neill, Peter

    2013-08-30

    The formation of DNA lesions poses a constant threat to cellular stability. Repair of endogenously and exogenously produced lesions has therefore been extensively studied, although the spatiotemporal dynamics of the repair processes has yet to be fully understood. One of the most recent advances to study the kinetics of DNA repair has been the development of laser microbeams to induce and visualize recruitment and loss of repair proteins to base damage in live mammalian cells. However, a number of studies have produced contradictory results that are likely caused by the different laser systems used reflecting in part the wavelength dependence of the damage induced. Additionally, the repair kinetics of laser microbeam induced DNA lesions have generally lacked consideration of the structural and chemical complexity of the DNA damage sites, which are known to greatly influence their reparability. In this review, we highlight the key considerations when embarking on laser microbeam experiments and interpreting the real time data from laser microbeam irradiations. We compare the repair kinetics from live cell imaging with biochemical and direct quantitative cellular measurements for DNA repair.

  10. Extracellular Self-DNA (esDNA), but Not Heterologous Plant or Insect DNA (etDNA), Induces Plasma Membrane Depolarization and Calcium Signaling in Lima Bean (Phaseolus lunatus) and Maize (Zea mays)

    PubMed Central

    Barbero, Francesca; Guglielmotto, Michela; Capuzzo, Andrea; Maffei, Massimo E.

    2016-01-01

    Extracellular self-DNA (esDNA) is produced during cell and tissue damage or degradation and has been shown to induce significant responses in several organisms, including plants. While the inhibitory effects of esDNA have been shown in conspecific individuals, little is known on the early events involved upon plant esDNA perception. We used electrophysiology and confocal laser scanning microscopy calcium localization to evaluate the plasma membrane potential (Vm) variations and the intracellular calcium fluxes, respectively, in Lima bean (Phaseolus lunatus) and maize (Zea mays) plants exposed to esDNA and extracellular heterologous DNA (etDNA) and to etDNA from Spodoptera littoralis larvae and oral secretions. In both species, esDNA induced a significant Vm depolarization and an increased flux of calcium, whereas etDNA was unable to exert any of these early signaling events. These findings confirm the specificity of esDNA to induce plant cell responses and to trigger early signaling events that eventually lead to plant response to damage. PMID:27690017

  11. Extracellular Self-DNA (esDNA), but Not Heterologous Plant or Insect DNA (etDNA), Induces Plasma Membrane Depolarization and Calcium Signaling in Lima Bean (Phaseolus lunatus) and Maize (Zea mays).

    PubMed

    Barbero, Francesca; Guglielmotto, Michela; Capuzzo, Andrea; Maffei, Massimo E

    2016-09-29

    Extracellular self-DNA (esDNA) is produced during cell and tissue damage or degradation and has been shown to induce significant responses in several organisms, including plants. While the inhibitory effects of esDNA have been shown in conspecific individuals, little is known on the early events involved upon plant esDNA perception. We used electrophysiology and confocal laser scanning microscopy calcium localization to evaluate the plasma membrane potential (Vm) variations and the intracellular calcium fluxes, respectively, in Lima bean (Phaseolus lunatus) and maize (Zea mays) plants exposed to esDNA and extracellular heterologous DNA (etDNA) and to etDNA from Spodoptera littoralis larvae and oral secretions. In both species, esDNA induced a significant Vm depolarization and an increased flux of calcium, whereas etDNA was unable to exert any of these early signaling events. These findings confirm the specificity of esDNA to induce plant cell responses and to trigger early signaling events that eventually lead to plant response to damage.

  12. Mycobacterium tuberculosis WhiB1 is an essential DNA-binding protein with a nitric oxide sensitive iron-sulphur cluster

    PubMed Central

    Smith, Laura J.; Stapleton, Melanie R.; Fullstone, Gavin J. M.; Crack, Jason C.; Thomson, Andrew J.; Le Brun, Nick E.; Hunt, Debbie M.; Harvey, Evelyn; Adinolfi, Salvatore; Buxton, Roger S.; Green, Jeffrey

    2010-01-01

    Mycobacterium tuberculosis is a major pathogen that has the ability to establish, and emerge from, a persistent state. Wbl family proteins are associated with developmental processes in actinomycetes, and M. tuberculosis has seven such proteins. Here it is shown that the M. tuberculosis H37Rv whiB1 gene is essential. The WhiB1 protein possesses a [4Fe-4S]2+ cluster that is stable in air but reacts rapidly with eight equivalents of nitric oxide to yield two dinuclear dinitrosyl-iron thiol complexes. The [4Fe-4S] form of WhiB1 did not bind whiB1 promoter DNA, but the reduced and oxidized apo-WhiB1, and nitric oxide-treated holo-WhiB1 did bind to DNA. Mycobacterium smegmatis RNA polymerase induced transcription of whiB1 in vitro; however in the presence of apo-WhiB1 transcription was severely inhibited, irrespective of the presence or absence of the CRP protein Rv3676, which is known to activate whiB1 expression. Footprinting suggested that autorepression of whiB1 is achieved by apo-WhiB1 binding at a region that overlaps the core promoter elements. A model incorporating regulation of whiB1 expression in response to nitric oxide and cAMP is discussed with implications for sensing two important signals in establishing M. tuberculosis infections. PMID:20929442

  13. Mycobacterium tuberculosis WhiB1 is an essential DNA-binding protein with a nitric oxide-sensitive iron-sulfur cluster.

    PubMed

    Smith, Laura J; Stapleton, Melanie R; Fullstone, Gavin J M; Crack, Jason C; Thomson, Andrew J; Le Brun, Nick E; Hunt, Debbie M; Harvey, Evelyn; Adinolfi, Salvatore; Buxton, Roger S; Green, Jeffrey

    2010-12-15

    Mycobacterium tuberculosis is a major pathogen that has the ability to establish, and emerge from, a persistent state. Wbl family proteins are associated with developmental processes in actinomycetes, and M. tuberculosis has seven such proteins. In the present study it is shown that the M. tuberculosis H37Rv whiB1 gene is essential. The WhiB1 protein possesses a [4Fe-4S]2+ cluster that is stable in air but reacts rapidly with eight equivalents of nitric oxide to yield two dinuclear dinitrosyl-iron thiol complexes. The [4Fe-4S] form of WhiB1 did not bind whiB1 promoter DNA, but the reduced and oxidized apo-WhiB1, and nitric oxide-treated holo-WhiB1 did bind to DNA. Mycobacterium smegmatis RNA polymerase induced transcription of whiB1 in vitro; however, in the presence of apo-WhiB1, transcription was severely inhibited, irrespective of the presence or absence of the CRP (cAMP receptor protein) Rv3676, which is known to activate whiB1 expression. Footprinting suggested that autorepression of whiB1 is achieved by apo-WhiB1 binding at a region that overlaps the core promoter elements. A model incorporating regulation of whiB1 expression in response to nitric oxide and cAMP is discussed with implications for sensing two important signals in establishing M. tuberculosis infections.

  14. Genetic lineages of undifferentiated-type gastric carcinomas analysed by unsupervised clustering of genomic DNA microarray data

    PubMed Central

    2013-01-01

    Background It is suspected that early gastric carcinoma (GC) is a dormant variant that rarely progresses to advanced GC. We demonstrated that the dormant and aggressive variants of tubular adenocarcinomas (TUBs) of the stomach are characterized by loss of MYC and gain of TP53 and gain of MYC and/or loss of TP53, respectively. The aim of this study is to determine whether this is also the case in undifferentiated-type GCs (UGCs) of different genetic lineages: one with a layered structure (LS+), derived from early signet ring cell carcinomas (SIGs), and the other, mostly poorly differentiated adenocarcinomas, without LS but with a minor tubular component (TC), dedifferentiated from TUBs (LS−/TC+). Methods Using 29 surgically resected stomachs with 9 intramucosal and 20 invasive UGCs (11 LS+ and 9 LS−/TC+), 63 genomic DNA samples of mucosal and invasive parts and corresponding reference DNAs were prepared from formalin-fixed, paraffin-embedded tissues with laser microdissection, and were subjected to array-based comparative genomic hybridization (aCGH), using 60K microarrays, and subsequent unsupervised, hierarchical clustering. Of 979 cancer-related genes assessed, we selected genes with mean copy numbers significantly different between the two major clusters. Results Based on similarity in genomic copy-number profile, the 63 samples were classified into two major clusters. Clusters A and B, which were rich in LS+ UGC and LS−/TC+ UGC, respectively, were discriminated on the basis of 40 genes. The aggressive pattern was more frequently detected in LS−/TC+ UGCs, (20/26; 77%), than in LS+UGCs (17/37; 46%; P = 0.0195), whereas no dormant pattern was detected in any of the UGC samples. Conclusions In contrast to TUBs, copy number alterations of MYC and TP53 exhibited an aggressive pattern in LS+ SIG at early and advanced stages, indicating that early LS+ UGCs inevitably progress to an advanced GC. Cluster B (enriched in LS−/TC+) exhibited more

  15. Homologous recombination contributes to the repair of DNA double-strand breaks induced by high-energy iron ions

    SciTech Connect

    Zafar, Faria; Seidler, Sara B.; Kronenberg, Amy; Schild, David; Wiese, Claudia

    2010-06-29

    To test the contribution of homologous recombinational repair (HRR) in repairing DNA damaged sites induced by high-energy iron ions, we used: (1) HRR-deficient rodent cells carrying a deletion in the RAD51D gene and (2) syngeneic human cells impaired for HRR by RAD51D or RAD51 knockdown using RNA interference. We show that in response to iron ions, HRR contributes to cell survival in rodent cells, and that HRR-deficiency abrogates RAD51 foci formation. Complementation of the HRR defect by human RAD51D rescues both enhanced cytotoxicity and RAD51 foci formation. For human cells irradiated with iron ions, cell survival is decreased, and, in p53 mutant cells, the levels of mutagenesis are increased when HRR is impaired. Human cells synchronized in S phase exhibit more pronounced resistance to iron ions as compared with cells in G1 phase, and this increase in radioresistance is diminished by RAD51 knockdown. These results implicate a role for RAD51-mediated DNA repair (i.e. HRR) in removing a fraction of clustered lesions induced by charged particle irradiation. Our results are the first to directly show the requirement for an intact HRR pathway in human cells in ensuring DNA repair and cell survival in response to high-energy high LET radiation.

  16. Low concentration of arsenite exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity

    SciTech Connect

    Qin Xujun; Hudson, Laurie G.; Liu Wenlan; Timmins, Graham S.; Liu Kejian

    2008-10-01

    Epidemiological studies have associated arsenic exposure with many types of human cancers. Arsenic has also been shown to act as a co-carcinogen even at low concentrations. However, the precise mechanism of its co-carcinogenic action is unknown. Recent studies indicate that arsenic can interfere with DNA-repair processes. Poly(ADP-ribose) polymerase (PARP)-1 is a zinc-finger DNA-repair protein, which can promptly sense DNA strand breaks and initiate DNA-repair pathways. In the present study, we tested the hypothesis that low concentrations of arsenic could inhibit PAPR-1 activity and so exacerbate levels of ultraviolet radiation (UVR)-induced DNA strand breaks. HaCat cells were treated with arsenite and/or UVR, and then DNA strand breaks were assessed by comet assay. Low concentrations of arsenite ({<=} 2 {mu}M) alone did not induce significant DNA strand breaks, but greatly enhanced the DNA strand breaks induced by UVR. Further studies showed that 2 {mu}M arsenite effectively inhibited PARP-1 activity. Zinc supplementation of arsenite-treated cells restored PARP-1 activity and significantly diminished the exacerbating effect of arsenite on UVR-induced DNA strand breaks. Importantly, neither arsenite treatment, nor zinc supplementation changed UVR-triggered reactive oxygen species (ROS) formation, suggesting that their effects upon UVR-induced DNA strand breaks are not through a direct free radical mechanism. Combination treatments of arsenite with PARP-1 inhibitor 3-aminobenzamide or PARP-1 siRNA demonstrate that PARP-1 is the target of arsenite. Together, these findings show that arsenite at low concentration exacerbates UVR-induced DNA strand breaks by inhibiting PARP-1 activity, which may represent an important mechanism underlying the co-carcinogenicity of arsenic.

  17. Genetic and Functional Studies of Genes that Regulate DNA-Damage-Induced Cell Death

    DTIC Science & Technology

    2004-11-01

    AD Award Number: DAMD17-01-1-0145 TITLE: Genetic and Functional Studies of Genes that Regulate DNA-damage-induced Cell Death PRINCIPAL INVESTIGATOR...and Functional Studies of Genes that Regulate DAMD17-01-1-0145 DNA-damage-induced Cell Death 6. A UTHOR(S) Zhou Songyang, Ph.D. 7. PERFORMING ORGANIZA...mechanisms of genes that regulate DNA damage induced cell death are much less well studied. We have proposed to establish a genetic system to screen for

  18. Epigenetic clustering of gastric carcinomas based on DNA methylation profiles at the precancerous stage: its correlation with tumor aggressiveness and patient outcome

    PubMed Central

    Yamanoi, Kazuhiro; Arai, Eri; Tian, Ying; Takahashi, Yoriko; Miyata, Sayaka; Sasaki, Hiroki; Chiwaki, Fumiko; Ichikawa, Hitoshi; Sakamoto, Hiromi; Kushima, Ryoji; Katai, Hitoshi; Yoshida, Teruhiko; Sakamoto, Michiie; Kanai, Yae

    2015-01-01

    The aim of this study was to clarify the significance of DNA methylation alterations during gastric carcinogenesis. Single-CpG resolution genome-wide DNA methylation analysis using the Infinium assay was performed on 109 samples of non-cancerous gastric mucosa (N) and 105 samples of tumorous tissue (T). DNA methylation alterations in T samples relative to N samples were evident for 3861 probes. Since N can be at the precancerous stage according to the field cancerization concept, unsupervised hierarchical clustering based on DNA methylation levels was performed on N samples (βN) using the 3861 probes. This divided the 109 patients into three clusters: A (n = 20), B1 (n = 20), and B2 (n = 69). Gastric carcinomas belonging to Cluster B1 showed tumor aggressiveness more frequently than those belonging to Clusters A and B2. The recurrence-free and overall survival rates of patients in Cluster B1 were lower than those of patients in Clusters A and B2. Sixty hallmark genes for which βN characterized the epigenetic clustering were identified. We then focused on DNA methylation levels in T samples (βT) of the 60 hallmark genes. In 48 of them, including the ADAM23, OLFM4, AMER2, GPSM1, CCL28, DTX1 and COL23A1 genes, βT was again significantly correlated with tumor aggressiveness, and the recurrence-free and/or overall survival rates. Multivariate analyses revealed that βT was a significant prognostic factor, being independent of clinicopathological parameters. These data indicate that DNA methylation profiles at the precancerous stage may be inherited by gastric carcinomas themselves, thus determining tumor aggressiveness and patient outcome. PMID:25740824

  19. Methods to detect replication-dependent and replication-independent DNA structure-induced genetic instability

    PubMed Central

    Wang, Guliang; Gaddis, Sally; Vasquez, Karen M.

    2013-01-01

    DNA can adopt a variety of alternative secondary (i.e., non-B DNA) conformations that play important roles in cellular metabolism, including genetic instability, disease etiology, and evolution. While we still have much to learn, research in this field has expanded dramatically in the past decade. We have summarized in our previous Methods review (Wang et al., Methods, 2009) some commonly used techniques to determine non-B DNA structural conformations and non-B DNA-induced genetic instability in prokaryotes and eukaryotes. Since that time, we and others have further characterized mechanisms involved in DNA structure-induced mutagenesis and have proposed both replication-dependent and replication-independent models. Thus, in this review, we highlight some current methodologies to identify DNA replication-related and replication-independent mutations occurring at non-B DNA regions to allow for a better understanding of the mechanisms underlying DNA structure-induced genetic instability. We also describe a new web-based search engine to identify potential intramolecular triplex (H-DNA) and left-handed Z-DNA-forming motifs in entire genomes or at selected sequences of interest. PMID:23954565

  20. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  1. Persistent and heritable structural damage induced in heterochromatic DNA from rat liver by N-nitrosodimethylamine

    SciTech Connect

    Ward, E.J.; Stewart, B.W.

    1987-03-24

    Analysis, by benzoylated DEAE-cellulose chromatography, has been made of structural change in eu- and heterochromatic DNA from rat liver following administration of the carcinogen N-nitrosodimethylamine. Either hepatic DNA was prelabeled with (/sup 3/H)thymidine administered 2-3 weeks before injection of the carcinogen or the labeled precursor was given during regenerative hyperplasia in rats treated earlier with N-nitrosodimethylamine. Following phenol extraction of either whole liver homogenate or nuclease-fractionated eu- and heterochromatin, carcinogen-modified DNA was examined by stepwise or caffeine gradient elution from benzoylated DEAE-cellulose. In whole DNA, nitrosamine-induced single-stranded character was maximal 4-24 h after treatment, declining rapidly thereafter; gradient elution of these DNA preparations also provided short-term evidence of structural change. Caffeine gradient chromatography suggested short-term nitrosamine-induced structural change in euchromatic DNA, while increased binding of heterochromatic DNA was evident for up to 3 months after carcinogen treatment. Preparations of newly synthesized heterochromatic DNA from animals subjected to hepatectomy up to 2 months after carcinogen treatment provided evidence of heritable structural damage. Carcinogen-induced binding of heterochromatic DNA to benzoylated DEAE-cellulose was indicative of specific structural lesions whose affinity equalled that of single-stranded DNA up to 1.0 kilobase in length. The data suggest that structural lesions in heterochromatin, which may be a consequence of incomplete repair, are preferentially degraded by endogenous nuclease(s).

  2. Epigenetic clustering of lung adenocarcinomas based on DNA methylation profiles in adjacent lung tissue: Its correlation with smoking history and chronic obstructive pulmonary disease.

    PubMed

    Sato, Takashi; Arai, Eri; Kohno, Takashi; Takahashi, Yoriko; Miyata, Sayaka; Tsuta, Koji; Watanabe, Shun-ichi; Soejima, Kenzo; Betsuyaku, Tomoko; Kanai, Yae

    2014-07-15

    The aim of this study was to clarify the significance of DNA methylation alterations during lung carcinogenesis. Infinium assay was performed using 139 paired samples of non-cancerous lung tissue (N) and tumorous tissue (T) from a learning cohort of patients with lung adenocarcinomas (LADCs). Fifty paired N and T samples from a validation cohort were also analyzed. DNA methylation alterations on 1,928 probes occurred in N samples relative to normal lung tissue from patients without primary lung tumors, and were inherited by, or strengthened in, T samples. Unsupervised hierarchical clustering using DNA methylation levels in N samples on all 26,447 probes subclustered patients into Cluster I (n = 32), Cluster II (n = 35) and Cluster III (n = 72). LADCs in Cluster I developed from the inflammatory background in chronic obstructive pulmonary disease (COPD) in heavy smokers and were locally invasive. Most patients in Cluster II were non-smokers and had a favorable outcome. LADCs in Cluster III developed in light smokers were most aggressive (frequently showing lymphatic and blood vessel invasion, lymph node metastasis and an advanced pathological stage), and had a poor outcome. DNA methylation levels of hallmark genes for each cluster, such as IRX2, HOXD8, SPARCL1, RGS5 and EI24, were again correlated with clinicopathological characteristics in the validation cohort. DNA methylation profiles reflecting carcinogenetic factors such as smoking and COPD appear to be established in non-cancerous lung tissue from patients with LADCs and may determine the aggressiveness of tumors developing in individual patients, and thus patient outcome.

  3. Association of arsenic-induced malignant transformation with DNA hypomethylation and aberrant gene expression

    PubMed Central

    Zhao, Christopher Q.; Young, Matthew R.; Diwan, Bhalchandra A.; Coogan, Timothy P.; Waalkes, Michael P.

    1997-01-01

    Inorganic arsenic, a human carcinogen, is enzymatically methylated for detoxication, consuming S-adenosyl-methionine (SAM) in the process. The fact that DNA methyltransferases (MeTases) require this same methyl donor suggests a role for methylation in arsenic carcinogenesis. Here we test the hypothesis that arsenic-induced initiation results from DNA hypomethylation caused by continuous methyl depletion. The hypothesis was tested by first inducing transformation in a rat liver epithelial cell line by chronic exposure to low levels of arsenic, as confirmed by the development of highly aggressive, malignant tumors after inoculation of cells into Nude mice. Global DNA hypomethylation occurred concurrently with malignant transformation and in the presence of depressed levels of S-adenosyl-methionine. Arsenic-induced DNA hypomethylation was a function of dose and exposure duration, and remained constant even after withdrawal of arsenic. Hyperexpressibility of the MT gene, a gene for which expression is clearly controlled by DNA methylation, was also detected in transformed cells. Acute arsenic or arsenic at nontransforming levels did not induce global hypomethylation of DNA. Whereas transcription of DNA MeTase was elevated, the MeTase enzymatic activity was reduced with arsenic transformation. Taken together, these results indicate arsenic can act as a carcinogen by inducing DNA hypomethylation, which in turn facilitates aberrant gene expression, and they constitute a tenable theory of mechanism in arsenic carcinogenesis. PMID:9380733

  4. The fluorophore 4',6-diamidino-2-phenylindole (DAPI) induces DNA folding in long double-stranded DNA.

    PubMed

    Beccia, Maria Rosa; Biver, Tarita; Pardini, Alberto; Spinelli, Jacopo; Secco, Fernando; Venturini, Marcella; Busto Vázquez, Natalia; Lopez Cornejo, Maria Pilar; Martin Herrera, Victoria Isabel; Prado Gotor, Rafael

    2012-08-01

    DAPI (4',6-diamidino-2-phenylindole) is a widely used fluorescent dye, whose complicated binding features to DNAs and RNAs have been the object of debates and are still not fully understood. In this study, different approaches were employed, including binding equilibrium measurements (spectrofluorometry), melting experiments (spectrophotometry), viscometric measurements, circular dichroism, and T-jump kinetic analyses; all data concur in shedding light on the complex mechanistic aspects of the binding mode of DAPI to natural DNA. Conditions are found that induce the mode of the DAPI/DNA interaction to change from groove binding to intercalation. Moreover, it is observed, for the first time, that DAPI is able to induce the formation of a rather compact polymer-dye adduct under particular conditions. The results suggest that this form is a folded or coiled DNA structure stabilized by DAPI dye bridges.

  5. Basic Mechanics of DNA Methylation and the Unique Landscape of the DNA Methylome in Metal-Induced Carcinogenesis

    PubMed Central

    Brocato, Jason; Costa, Max

    2013-01-01

    DNA methylation plays an intricate role in the regulation of gene expression and events that compromise the integrity of the methylome may potentially contribute to disease development. DNA methylation is a reversible and regulatory modification that elicits a cascade of events leading to chromatin condensation and gene silencing. In general, normal cells are characterized by gene-specific hypomethylation and global hypermethylation, while cancer cells portray a reverse profile to this norm. The unique methylome displayed in cancer cells is induced after exposure to carcinogenic metals such as nickel, arsenic, cadmium, and chromium (VI). These metals alter the DNA methylation profile by provoking both hyper- and hypomethylation events. The metal-stimulated deviations to the methylome are possible mechanisms for metal-induced carcinogenesis and may provide potential biomarkers for cancer detection. Development of therapies based on the cancer methylome requires further research including human studies that supply results with larger impact and higher human relevance. PMID:23844698

  6. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  7. The Cytosolic Iron-Sulfur Cluster Assembly Protein MMS19 Regulates Transcriptional Gene Silencing, DNA Repair, and Flowering Time in Arabidopsis

    PubMed Central

    Han, Yong-Feng; Huang, Huan-Wei; Li, Lin; Cai, Tao; Chen, She; He, Xin-Jian

    2015-01-01

    MMS19 is an essential component of the cytoplasmic iron-sulfur (Fe-S) cluster assembly complex in fungi and mammals; the mms19 null mutant alleles are lethal. Our study demonstrates that MMS19/MET18 in Arabidopsis thaliana interacts with the cytoplasmic Fe-S cluster assembly complex but is not an essential component of the complex. We find that MMS19 also interacts with the catalytic subunits of DNA polymerases, which have been demonstrated to be involved in transcriptional gene silencing (TGS), DNA repair, and flowering time regulation. Our results indicate that MMS19 has a similar biological function, suggesting a functional link between MMS19 and DNA polymerases. In the mms19 null mutant, the assembly of Fe-S clusters on the catalytic subunit of DNA polymerase α is reduced but not blocked, which is consistent with the viability of the mutant. Our study suggests that MMS19 assists the assembly of Fe-S clusters on DNA polymerases in the cytosol, thereby facilitating transcriptional gene silencing, DNA repair, and flowering time control. PMID:26053632

  8. Identification and analysis of safener-inducible expressed sequence tags in Populus using a cDNA microarray.

    PubMed

    Rishi, A S; Munir, Shirin; Kapur, Vivek; Nelson, Neil D; Goyal, Arun

    2004-12-01

    Safeners are the chemicals used to protect plants from detrimental effects of herbicides, but their mode of action at the molecular level is not well understood. As an initial step towards understanding the molecular mechanism of safener action in trees, homologous genes in hybrid poplar (Populus nigra x Populus maximowiczii) that were induced by a safener were identified. We here describe the identification of differentially expressed genes in Populus that are induced by Concep-III, a herbicide safener. Expressed sequence tags (ESTs) enriched for transcriptionally induced genes were isolated by suppressive subtractive hybridization (SSH). The SSH library cDNA inserts were used to construct a cDNA microarray for high-throughput validation of the up-regulated expression of safener-induced genes. Single-pass and partial sequences of 1,344 safener-induced ESTs were assembled into 418 singletons and 328 clusters, but the putative functions of almost 53% of the ESTs are not known. Genes encoding proteins involved in all three different phases of safener action, viz., oxidation, conjugation, and sequestration, were found in the SSH library. Almost 75% of genes that showed greater than 2-fold expression upon safener treatment were redundant in the SSH library. The expression pattern for selected genes was validated by reverse transcription-polymerase chain reaction. A few safener-induced genes that were not previously reported to be induced by safeners, but which may have a role in herbicide metabolism, were identified. The newly identified genes could have potential for application in genetic engineering of plants for herbicide detoxification and tolerance.

  9. Characterization of human translesion DNA synthesis across a UV-induced DNA lesion

    PubMed Central

    Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J

    2016-01-01

    Translesion DNA synthesis (TLS) during S-phase uses specialized TLS DNA polymerases to replicate a DNA lesion, allowing stringent DNA synthesis to resume beyond the offending damage. Human TLS involves the conjugation of ubiquitin to PCNA clamps encircling damaged DNA and the role of this post-translational modification is under scrutiny. A widely-accepted model purports that ubiquitinated PCNA recruits TLS polymerases such as pol η to sites of DNA damage where they may also displace a blocked replicative polymerase. We provide extensive quantitative evidence that the binding of pol η to PCNA and the ensuing TLS are both independent of PCNA ubiquitination. Rather, the unique properties of pols η and δ are attuned to promote an efficient and passive exchange of polymerases during TLS on the lagging strand. DOI: http://dx.doi.org/10.7554/eLife.19788.001 PMID:27770570

  10. Nitric oxide is involved in phosphorus deficiency-induced cluster root development and citrate exudation in white lupin

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White lupin (Lupinus albus) forms specialized cluster roots characterized by exudation of organic anions under phosphorus (P) deficiency. Here, we evaluated the role of nitric oxide (NO) in P deficiency-induced cluster-root formation and citrate exudation in white lupin. Plants were treated with NO ...

  11. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.

    PubMed

    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2014-07-01

    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma.

  12. Study on DNA Damage Induced by Neon Beam Irradiation in Saccharomyces Cerevisiae

    NASA Astrophysics Data System (ADS)

    Lu, Dong; Li, Wenjian; Wu, Xin; Wang, Jufang; Ma, Shuang; Liu, Qingfang; He, Jinyu; Jing, Xigang; Ding, Nan; Dai, Zhongying; Zhou, Jianping

    2010-12-01

    Yeast strain Saccharomyces cerevisiae was irradiated with different doses of 85 MeV/u 20Ne10+ to investigate DNA damage induced by heavy ion beam in eukaryotic microorganism. The survival rate, DNA double strand breaks (DSBs) and DNA polymorphic were tested after irradiation. The results showed that there were substantial differences in DNA between the control and irradiated samples. At the dose of 40 Gy, the yeast cell survival rate approached 50%, DNA double-strand breaks were barely detectable, and significant DNA polymorphism was observed. The alcohol dehydrogenase II gene was amplified and sequenced. It was observed that base changes in the mutant were mainly transversions of T→G and T→C. It can be concluded that heavy ion beam irradiation can lead to change in single gene and may be an effective way to induce mutation.

  13. Neurotensin enhances estradiol induced DNA synthesis in immature rat uterus

    SciTech Connect

    Mistry, A.; Vijayan, E.

    1985-05-27

    Systemic administration of Neurotensin, a tridecapeptide, in immature rats treated with estradiol benzoate significantly enhances uterine DNA synthesis as reflected by the incorporation of /sup 3/H-thymidine. The peptide may have a direct action on the uterus. Substance P, a related peptide, had no effect on uterine DNA synthesis. 18 references, 4 tables.

  14. DNA polymorphism in Cab locus of tomato induced by tissue culture.

    PubMed

    Nambisan, P; Chopra, V L; Mohapatra, T

    1992-03-01

    Plants were regenerated from callus induced from leaf disc explants of a tomato F1 hybrid heterozygous for three marker loci anthocyaninless (a), without anthocyanin (aw), and hairless (hl). Regenerants were studied for somaclonal variation at the phenotypic level by scoring for variation in the marker loci, and at the DNA level by probing geomic DNA blots with a chlorophyll a/b binding protein (Cab-3C) cDNA sequence. While no variation was observed at the phenotypic level in over 950 somaclones studied, DNA polymorphism for the Cab locus could be detected in two out of 17 somaclones tested. Tissue culture induced variation at the phenotypic level for specific loci is very low (less than 0.001 for a, aw or hl) but DNA sequence changes are induced at much greater frequency (approximately 0.1 for a multicopy gene family such as Cab).

  15. ERCC2/XPD Lys751Gln alter DNA repair efficiency of platinum-induced DNA damage through P53 pathway.

    PubMed

    Zhang, Guopei; Guan, Yangyang; Zhao, Yuejiao; van der Straaten, Tahar; Xiao, Sha; Xue, Ping; Zhu, Guolian; Liu, Qiufang; Cai, Yuan; Jin, Cuihong; Yang, Jinghua; Wu, Shengwen; Lu, Xiaobo

    2017-02-01

    Platinum-based treatment causes Pt-DNA adducts which lead to cell death. The platinum-induced DNA damage is recognized and repaired by the nucleotide excision repair (NER) system of which ERCC2/XPD is a critical enzyme. Single nucleotide polymorphisms in ERCC2/XPD have been found to be associated with platinum resistance. The aim of the present study was to investigate whether ERCC2/XPD Lys751Gln (rs13181) polymorphism is causally related to DNA repair capacity of platinum-induced DNA damage. First, cDNA clones expressing different genotypes of the polymorphism was transfected to an ERCC2/XPD defective CHO cell line (UV5). Second, all cells were treated with cisplatin. Cellular survival rate were investigated by MTT growth inhibition assay, DNA damage levels were investigated by comet assay and RAD51 staining. The distribution of cell cycle and the change of apoptosis rates were detected by a flow cytometric method (FCM). Finally, P53mRNA and phospho-P53 protein levels were further investigated in order to explore a possible explanation. As expected, there was a significantly increased in viability of UV5(ERCC2 (AA)) as compared to UV5(ERCC2 (CC)) after cisplatin treatment. The DNA damage level of UV5(ERCC2 (AA)) was significant decreased compared to UV5(ERCC2 (CC)) at 24 h of treatment. Mutation of ERCC2rs13181 AA to CC causes a prolonged S phase in cell cycle. UV5(ERCC2 (AA)) alleviated the apoptosis compared to UV5(ERCC2 (CC)), meanwhile P53mRNA levels in UV(ERCC2 (AA)) was also lower when compared UV5(ERCC2 (CC)). It co-incides with a prolonged high expression of phospho-P53, which is relevant for cell cycle regulation, apoptosis, and the DNA damage response (DDR). We concluded that ERCC2/XPD rs13181 polymorphism is possibly related to the DNA repair capacity of platinum-induced DNA damage. This functional study provides some clues to clarify the relationship between cisplatin resistance and ERCC2/XPDrs13181 polymorphism.

  16. Methotrexate-induced misincorporation of uracil into DNA

    PubMed Central

    Goulian, M.; Bleile, B.; Tseng, B. Y.

    1980-01-01

    A line of human lymphoid cells was tested for the presence of dUMP in DNA with or without treatment with the dihydrofolate reductase inhibitor, methotrexate. Cells treated with methotrexate and labeled with [3H]dUrd contained dUMP in DNA in readily detectable amounts (≈0.8 pmol of dUMP per μmol of total DNA nucleotide), and this was increased ≈3-fold if the cells were also treated with Ura at the same time. No dUMP (<1 fmol/μmol of DNA) could be detected by these methods in DNA from cells not treated with methotrexate, regardless of whether Ura was present or absent. The presence of dUMP in DNA from cells treated with methotrexate is a result of the great increase in intracellular concentration of dUTP and the fall in dTTP that accompany inhibition of thymidylate synthetase (5,10-methylenetetrahydrofolate:dUMP C-methyltransferase; EC 2.1.1.45) by the drug. These changes are apparently sufficient to overcome the normal mechanisms that exclude dUMP from DNA, and the enhancement by Ura reflects suppression of one of the mechanisms, Ura removal from DNA by the enzyme Ura-DNA glycosylase. The results suggest an active lesion of DNA in cells in which thymidylate synthetase is inhibited. Under these conditions there appears to be a cyclic incorporation and removal of dUMP resulting from reinsertion of dUMP during gap repair at sites of Ura removal. This consequence of the normal excision-repair process, which occurs when intracellular levels of dUTP approach those of dTTP, may have effects related to the cytotoxicity of drug inhibitors of thymidylate synthetase, clinical deficiencies of folate and vitamin B-12, and thymineless death, in general. Images PMID:6929529

  17. Peri-nuclear clustering of mitochondria is triggered during aluminum maltolate induced apoptosis.

    PubMed

    Dewitt, David A; Hurd, Jennifer A; Fox, Nena; Townsend, Brigitte E; Griffioen, Kathleen J S; Ghribi, Othman; Savory, John

    2006-07-01

    Synapse loss and neuronal death are key features of Alzheimer's disease pathology. Disrupted axonal transport of mitochondria is a potential mechanism that could contribute to both. As the major producer of ATP in the cell, transport of mitochondria to the synapse is required for synapse maintenance. However, mitochondria also play an important role in the regulation of apoptosis. Investigation of aluminum (Al) maltolate induced apoptosis in human NT2 cells led us to explore the relationship between apoptosis related changes and the disruption of mitochondrial transport. Similar to that observed with tau over expression, NT2 cells exhibit peri-nuclear clustering of mitochondria following treatment with Al maltolate. Neuritic processes largely lacked mitochondria, except in axonal swellings. Similar, but more rapid results were observed following staurosporine administration, indicating that the clustering effect was not specific to Al maltolate. Organelle clustering and transport disruption preceded apoptosis. Incubation with the caspase inhibitor zVAD-FMK effectively blocked apoptosis, however failed to prevent organelle clustering. Thus, transport disruption is associated with the initiation, but not necessarily the completion of apoptosis. These results, together with observed transport defects and apoptosis related changes in Alzheimer disease brain suggest that mitochondrial transport disruption may play a significant role in synapse loss and thus the pathogenesis or Alzheimer's disease.

  18. Scaling of shear-induced diffusion and clustering in a blood-like suspension

    NASA Astrophysics Data System (ADS)

    Mountrakis, L.; Lorenz, E.; Hoekstra, A. G.

    2016-04-01

    The transport of cells and substances in dense suspensions like blood heavily depends on the microstructure and the dynamics arising from their interactions with red blood cells (RBCs). Computer simulations are used to probe into the detailed transport-related characteristics of a blood-like suspension, for a wide range of volume fractions and shear rates. The shear-induced diffusion of RBCs does not follow the established linear scaling with shear rate for higher volume fractions. The properties directly related to RBC deformability —stretching and flow orientation— are not sufficient to explain this departure according to the model of Breedveld, pointing to the dominance of collective effects in the suspension. A cluster size analysis confirms that collective effects dominate high volume fractions, as the mean cluster size is above 2 and the number of “free RBCs” is significantly decreased in denser suspensions. The mean duration of RBC contacts in clusters is increased in the high volume fraction and shear rate cases, showing that these clusters live longer.

  19. Acrylonitrile-Induced Oxidative Stress and Oxidative DNA Damage in Male Sprague-Dawley Rats

    PubMed Central

    Kamendulis, Lisa M.; Klaunig, James E.

    2009-01-01

    Studies have demonstrated that the induction of oxidative stress may be involved in brain tumor induction in rats by acrylonitrile. The present study examined whether acrylonitrile induces oxidative stress and DNA damage in rats and whether blood can serve as a valid surrogate for the biomonitoring of oxidative stress induced by acrylonitrile in the exposed population. Male Sprague-Dawley rats were treated with 0, 3, 30, 100, and 200 ppm acrylonitrile in drinking water for 28 days. One group of rats were also coadministered N-acetyl cysteine (NAC) (0.3% in diet) with acrylonitrile (200 ppm in drinking water) to examine whether antioxidant supplementation was protective against acrylonitrile-induced oxidative stress. Direct DNA strand breakage in white blood cells (WBC) and brain was measured using the alkaline comet assay. Oxidative DNA damage in WBC and brain was evaluated using formamidopyrimidine DNA glycosylase (fpg)-modified comet assay and with high-performance liquid chromatography-electrochemical detection. No significant increase in direct DNA strand breaks was observed in brain and WBC from acrylonitrile-treated rats. However, oxidative DNA damage (fpg comet and 8′hydroxyl-2-deoxyguanosine) in brain and WBC was increased in a dose-dependent manner. In addition, plasma levels of reactive oxygen species (ROS) increased in rats administered acrylonitrile. Dietary supplementation with NAC prevented acrylonitrile-induced oxidative DNA damage in brain and WBC. A slight, but significant, decrease in the GSH:GSSG ratio was seen in brain at acrylonitrile doses > 30 ppm. These results provide additional support that the mode of action for acrylonitrile-induced astrocytomas involves the induction of oxidative stress and damage. Significant associations were seen between oxidative DNA damage in WBC and brain, ROS formation in plasma, and the reported tumor incidences. Since oxidative DNA damage in brain correlated with oxidative damage in WBC, these results suggest

  20. Specificity of mutations induced by incorporation of oxidized dNTPs into DNA by human DNA polymerase eta.

    PubMed

    Hidaka, Katsuhiko; Yamada, Masami; Kamiya, Hiroyuki; Masutani, Chikahide; Harashima, Hideyoshi; Hanaoka, Fumio; Nohmi, Takehiko

    2008-03-01

    Aberrant oxidation is a property of many tumor cells. Oxidation of DNA precursors, i.e., deoxynucleotide triphosphates (dNTPs), as well as DNA is a major cause of genome instability. Here, we report that human DNA polymerase eta (h Poleta) incorporates oxidized dNTPs, i.e., 2-hydroxy-2'-deoxyadenosine 5'-triphosphate (2-OH-dATP) and 8-hydroxy-2'-deoxyguanosine 5'-triphosphate (8-OH-dGTP), into DNA in an erroneous and efficient manner, thereby inducing various types of mutations during in vitro gap-filling DNA synthesis. When 2-OH-dATP was present at a concentration equal to those of the four normal dNTPs in the reaction mixture, DNA synthesis by h Poleta enhanced the frequency of G-to-T transversions eight-fold higher than that of the transversions in control where only the normal dNTPs were present. When 8-OH-dGTP was present at an equimolar concentration to the normal dNTPs, it enhanced the frequency of A-to-C transversions 17-fold higher than the control. It also increased the frequency of C-to-A transversions about two-fold. These results suggest that h Poleta incorporates 2-OH-dATP opposite template G and incorporates 8-OH-dGTP opposite template A and slightly opposite template C during DNA synthesis. Besides base substitutions, h Poleta enhanced the frequency of single-base frameshifts and deletions with the size of more than 100 base pairs when 8-OH-dGTP was present in the reaction mixture. Since h Poleta is present in replication foci even without exogenous DNA damage, we suggest that h Poleta may be involved in induction of various types of mutations through the erroneous and efficient incorporation of oxidized dNTPs into DNA in human cells.

  1. The Energetic Contribution of Induced Electrostatic Asymmetry to DNA Bending by a Site-Specific Protein

    PubMed Central

    Hancock, Stephen P.; Hiller, David A.; Perona, John J.; Jen-Jacobson, Linda

    2012-01-01

    DNA bending can be promoted by reducing the net negative electrostatic potential around phosphates on one face of the DNA, such that electrostatic repulsion among phosphates on the opposite face drives bending toward the less negative surface. To provide the first assessment of the energetic contribution to DNA bending when electrostatic asymmetry is induced by a site-specific DNA binding protein, we manipulated the electrostatics in the EcoRV endonuclease-DNA complex by mutation of cationic sidechains that contact DNA phosphates and/or by replacing a selected phosphate in each strand with uncharged methylphosphonate. Reducing the net negative charge at two symmetrically located phosphates on the concave DNA face contributes −2.3 to −0.9 kcal/mol (depending on position) to complex formation. In contrast, reducing negative charge on the opposing convex face produces a penalty of +1.3 kcal/mol. Förster resonance energy transfer experiments show that the extent of axial DNA bending (about 50°) is little affected in the modified complexes, implying that modification affects the energetic cost but not the extent of DNA bending. Kinetic studies show that favorable effects of induced electrostatic asymmetry on equilibrium binding derive primarily from a reduced rate of complex dissociation, suggesting stabilization of the specific complex between protein and markedly bent DNA. A smaller increase in the association rate may suggest that the DNA in the initial encounter complex is mildly bent. The data imply that protein-induced electrostatic asymmetry makes a significant contribution to DNA bending, but is not itself sufficient to drive full bending in the specific EcoRV-DNA complex. PMID:21167173

  2. Stacking of Short DNA Induces the Gyroid Cubic-to-Inverted Hexagonal Phase Transition in Lipid–DNA Complexes

    PubMed Central

    Leal, Cecília; Ewert, Kai K.; Bouxsein, Nathan F.; Shirazi, Rahau S.; Li, Youli; Safinya, Cyrus R.

    2012-01-01

    Lyotropic phases of amphiphiles are a prototypical example of self-assemblies. Their structure is generally determined by amphiphile shape and their phase transitions are primarily governed by composition. In this paper, we demonstrate a new paradigm for membrane shape control where the electrostatic coupling of charged membranes to short DNA (sDNA), with tunable temperature-dependent end-to-end stacking interactions, enables switching between the inverted gyroid cubic structure (QIIG) and the inverted hexagonal phase (HIIC). We investigated the structural shape transitions induced in the QIIG phase upon complexation with a series of sDNAs (5, 11, 24, and 48 bp) with three types of end structure (“sticky” adenine (A)–thymine (T) (dAdT) overhangs, no overhang (blunt), and “nonsticky” dTdT overhangs) using synchrotron small-angle X-ray scattering. Very short 5 bp sDNA with dAdT overhangs and blunt ends induce coexistence of the QIIG and the HIIC phase, with the fraction of QIIG increasing with temperature. Phase coexistence for blunt 5 bp sDNA is observed from 27 °C to about 65 °C, where the HIIC phase disappears and the temperature dependence of the lattice spacing of the QIIG phase indicates that the sDNA duplexes melt into single strands. The only other sDNA for which melting is observed is 5 bp sDNA with dTdT overhangs, which forms the QIIG phase throughout the studied range of temperature (27 °C to 85.2 °C). The longer 11 bp sDNA forms coexisting QIIG and HIIC phases (with the fraction of QIIG again increasing with temperature) only for “nonsticky” dTdT overhangs, while dAdT overhangs and blunt ends exclusively template the HIIC phase. For 24 and 48 bp sDNAs the HIIC phase replaces the QIIG phase at all investigated temperatures, independent of sDNA end structure. Our work demonstrates how the combined effects of sDNA length and end structure (which determine the temperature-dependent stacking length) tune the phase behavior of the complexes

  3. DNA strand scission induced by a non-thermal atmospheric pressure plasma jet.

    PubMed

    Ptasińska, Sylwia; Bahnev, Blagovest; Stypczyńska, Agnieszka; Bowden, Mark; Mason, Nigel J; Braithwaite, Nicholas St J

    2010-07-28

    The DNA molecule is observed to be very susceptible to short-term exposures to an atmospheric pressure plasma jet. The DNA damage induced by plasma-generated species, i.e. excited atoms, charged particles, electrons and UV light is determined.

  4. Oleandrin induces DNA damage responses in cancer cells by suppressing the expression of Rad51

    PubMed Central

    Bao, Zhengqiang; Tian, Baoping; Wang, Xiaohui; Feng, Hanrong; Liang, Ye; Chen, Zhihua; Li, Wen; Shen, Huahao; Ying, Songmin

    2016-01-01

    Oleandrin is a monomeric compound extracted from leaves and seeds of Nerium oleander. It had been reported that oleandrin could effectively inhibit the growth of human cancer cells. However, the specific mechanisms of the oleandrin-induced anti-tumor effects remain largely unclear. Genomic instability is one of the main features of cancer cells, it can be the combined effect of DNA damage and tumour-specific DNA repair defects. DNA damage plays important roles during tumorigenesis. In fact, most of the current chemotherapy agents were designed to kill cancer cells by inducing DNA damage. In this study, we found that oleandrin was effective to induce apoptosis in cancer cells, and cause rapid DNA damage response, represented by nuclear RPA (Replication Protein A, a single strand DNA binding protein) and γH2AX(a marker for DNA double strand breaks) foci formation. Interestingly, expression of RAD51, a key protein involved in homologous recombination (HR), was suppressed while XRCC1 was up-regulated in oleandrin treated cancer cells. These results suggested that XRCC1 may play a predominant role in repairing oleandrin-induced DNA damage. Collectively, oleandrin may be a potential anti-tumor agent by suppressing the expression of Rad51. PMID:27449097

  5. Cleavage enhancement of specific chemical bonds in DNA-Cisplatin complexes induced by X-rays

    NASA Astrophysics Data System (ADS)

    Zheng, Yi; Yao, Xiaobin; Luo, Xinglan; Fu, Xianzhi

    2014-04-01

    The chemical bond transformation of cisplatin-DNA complexes can be probed efficiently by XPS which provides a concomitant X-ray irradiation source as well. The presence to Pt could considerably increase formation of the SE induced by X-ray and that the further interaction of these LEE with DNA leads to the enhancement of bond cleavages.

  6. Repair of radiation-induced heat-labile sites is independent of DNA-PKcs, XRCC1 or PARP

    SciTech Connect

    Stenerlöw, Bo; Karlsson, Karin H.; Radulescu, Irina; Rydberg, Bjorn; Stenerlow, Bo

    2008-04-29

    Ionizing radiation induces a variety of different DNA lesions: in addition to the most critical DNA damage, the DSB, numerous base alterations, SSBs and other modifications of the DNA double-helix are formed. When several non-DSB lesions are clustered within a short distance along DNA, or close to a DSB, they may interfere with the repair of DSBs and affect the measurement of DSB induction and repair. We have previously shown that a substantial fraction of DSBs measured by pulsed-field gel electrophoresis (PFGE) are in fact due to heat-labile sites (HLS) within clustered lesions, thus reflecting an artifact of preparation of genomic DNA at elevated temperature. To further characterize the influence of HLS on DSB induction and repair, four human cell lines (GM5758, GM7166, M059K, U-1810) with apparently normal DSB rejoining were tested for bi-phasic rejoining after gamma irradiation. When heat-released DSBs were excluded from the measurements the fraction of fast rejoining decreased to less than 50% of the total. However, neither the half-times of the fast (t{sub 1/2} = 7-8 min) or slow (t{sub 1/2} = 2.5 h) DSB rejoining were changed significantly. At t=0 the heat-released DSBs accounted for almost 40% of the DSBs, corresponding to 10 extra DSB/cell/Gy in the initial DSB yield. These heat-released DSBs were repaired within 60-90 min in all tested cells, including M059K cells treated with wortmannin or DNA-PKcs defect M059J cells. Furthermore, cells lacking XRCC1 or Poly(ADP-ribose) polymerase-1 (PARP-1) rejoined both total DSBs and heat-released DSBs similar to normal cells. In summary, the presence of heat-labile sites have a substantial impact on DSB induction yields and DSB rejoining rates measured by pulsed-field gel electrophoresis, and HLS repair is independent of DNA-PKcs, XRCC1 and PARP.

  7. Chromatin Structure Following UV-Induced DNA Damage—Repair or Death?

    PubMed Central

    Farrell, Andrew W.; Halliday, Gary M.; Lyons, James Guy

    2011-01-01

    In eukaryotes, DNA is compacted into a complex structure known as chromatin. The unravelling of DNA is a crucial step in DNA repair, replication, transcription and recombination as this allows access to DNA for these processes. Failure to package DNA into the nucleosome, the individual unit of chromatin, can lead to genomic instability, driving a cell into apoptosis, senescence, or cellular proliferation. Ultraviolet (UV) radiation damage causes destabilisation of chromatin integrity. UV irradiation induces DNA damage such as photolesions and subjects the chromatin to substantial rearrangements, causing the arrest of transcription forks and cell cycle arrest. Highly conserved processes known as nucleotide and base excision repair (NER and BER) then begin to repair these lesions. However, if DNA repair fails, the cell may be forced into apoptosis. The modification of various histones as well as nucleosome remodelling via ATP-dependent chromatin remodelling complexes are required not only to repair these UV-induced DNA lesions, but also for apoptosis signalling. Histone modifications and nucleosome remodelling in response to UV also lead to the recruitment of various repair and pro-apoptotic proteins. Thus, the way in which a cell responds to UV irradiation via these modifications is important in determining its fate. Failure of these DNA damage response steps can lead to cellular proliferation and oncogenic development, causing skin cancer, hence these chromatin changes are critical for a proper response to UV-induced injury. PMID:22174650

  8. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed

    2014-01-01

    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  9. CDK1 Enhances Mitochondrial Bioenergetics for Radiation-Induced DNA Repair

    PubMed Central

    Qin, Lili; Fan, Ming; Candas, Demet; Jiang, Guochun; Papadopoulos, Stelios; Tian, Lin; Woloschak, Gayle; Grdina, David J.; Li, Jian Jian

    2015-01-01

    SUMMARY Nuclear DNA repair capacity is a critical determinant of cell fate under genotoxic stress conditions. DNA repair is a well-defined energy consuming process; however, it is unclear how DNA repair is fueled and whether mitochondrial energy production contributes to nuclear DNA repair. Here, we report a dynamic enhancement of oxygen consumption and mitochondrial ATP generation in irradiated normal cells, paralleled with increased mitochondrial relocation of cell cycle kinase CDK1 and nuclear DNA repair. The basal and radiation-induced mitochondrial ATP generation is significantly reduced in cells harboring CDK1 phosphorylation deficient mutant complex I subunits. Similarly, mitochondrial ATP generation and nuclear DNA repair are also severely compromised in cells harboring mitochondrial-targeted kinase deficient CDK1. These results demonstrate a mechanism governing the communication between mitochondria and nucleus, by which CDK1 boosts mitochondrial bioenergetics to meet the increased cellular fuel demand for DNA repair and cell survival under genotoxic stress. PMID:26670043

  10. Parvovirus B19 Nonstructural Protein-Induced Damage of Cellular DNA and Resultant Apoptosis

    PubMed Central

    Poole, Brian D.; Kivovich, Violetta; Gilbert, Leona; Naides, Stanley J.

    2011-01-01

    Parvovirus B19 is a widespread virus with diverse clinical presentations. The viral nonstructural protein, NS1, binds to and cleaves the viral genome, and induces apoptosis when transfected into nonpermissive cells, such as hepatocytes. We hypothesized that the cytotoxicity of NS1 in such cells results from chromosomal DNA damage caused by the DNA-nicking and DNA-attaching activities of NS1. Upon testing this hypothesis, we found that NS1 covalently binds to cellular DNA and is modified by PARP, an enzyme involved in repairing single-stranded DNA nicks. We furthermore discovered that the DNA nick repair pathway initiated by poly(ADPribose)polymerase and the DNA repair pathways initiated by ATM/ATR are necessary for efficient apoptosis resulting from NS1 expression. PMID:21278893

  11. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  12. Diallyl sulfide inhibits diethylstilbesterol-induced DNA adducts in the breast of female ACI rats.

    PubMed

    Green, M; Wilson, C; Newell, O; Sadrud-Din, S; Thomas, R

    2005-09-01

    Diethylstilbestrol (DES) is metabolized to reactive intermediates that produce DNA adducts and ultimately cancer. Diallyl sulfide (DAS) has been shown to inhibit the metabolism of several procarcinogens. The ability of DES to produce DNA adducts in microsomal, mitochondrial, and nuclear in vitro metabolic systems and in the breast of female ACI rats, as well as ability of DAS to inhibit DNA adducts were investigated. Microsomes, mitochondria, and nuclei isolated from breast tissue of female ACI rats were used to catalyze oxidation reactions. Female ACI rats were treated i.p. as follows: (1) corn oil, (2) 200mg/kg DES, (3) 200mg/kg DES/200mg/kg of DAS, (4) 200mg/kg DES/400mg/kg DAS. DES produced DNA adducts in each metabolic system. The relative adduct levels were 2.1 x 10(-4), 6.2 x 10(-6), and 2.9 x 10(-7) in microsomal, mitochondrial, and nuclear reactions, respectively. DAS inhibited DNA adducts in each metabolic system. The percent inhibition ranged from 86% in microsomes to 93% in nuclei. DES produced DNA adducts in mtDNA and nDNA. DAS completely inhibited the DES-induced mtDNA adducts and caused a dose dependent decrease in nDNA adduct formation. These findings suggest that DAS could inhibit DES-induced breast cancer by inhibiting its metabolism.

  13. Bacteria clustering by polymers induces the expression of quorum sense controlled phenotypes

    PubMed Central

    Lui, Leong T.; Xue, Xuan; Sui, Cheng; Brown, Alan; Pritchard, David I.; Halliday, Nigel; Winzer, Klaus; Howdle, Steven M.; Fernandez-Trillo, Francisco; Krasnogor, Natalio; Alexander, Cameron

    2014-01-01

    Bacteria deploy a range of chemistries to regulate their behaviour and respond to their environment. Quorum sensing is one mean by which bacteria use chemical reactions to modulate pre-infection behaviour such as surface attachment. Polymers that can interfere with bacterial adhesion or the chemical reactions used for quorum sensing are thus a potential means to control bacterial population responses. Here we report how polymeric “bacteria sequestrants”, designed to bind to bacteria through electrostatic interactions and thus inhibit bacterial adhesion to surfaces, induce the expression of quorum sensing controlled phenotypes as a consequence of cell clustering. A combination of polymer and analytical chemistry, biological assays and computational modelling has been used to characterise the feedback between bacteria clustering and quorum sensing signaling. We have also derived design principles and chemical strategies for controlling bacterial behaviour at the population level. PMID:24256871

  14. Bacteria clustering by polymers induces the expression of quorum-sensing-controlled phenotypes

    NASA Astrophysics Data System (ADS)

    Lui, Leong T.; Xue, Xuan; Sui, Cheng; Brown, Alan; Pritchard, David I.; Halliday, Nigel; Winzer, Klaus; Howdle, Steven M.; Fernandez-Trillo, Francisco; Krasnogor, Natalio; Alexander, Cameron

    2013-12-01

    Bacteria deploy a range of chemistries to regulate their behaviour and respond to their environment. Quorum sensing is one method by which bacteria use chemical reactions to modulate pre-infection behaviour such as surface attachment. Polymers that can interfere with bacterial adhesion or the chemical reactions used for quorum sensing are therefore a potential means to control bacterial population responses. Here, we report how polymeric ‘bacteria sequestrants’, designed to bind to bacteria through electrostatic interactions and therefore inhibit bacterial adhesion to surfaces, induce the expression of quorum-sensing-controlled phenotypes as a consequence of cell clustering. A combination of polymer and analytical chemistry, biological assays and computational modelling has been used to characterize the feedback between bacteria clustering and quorum sensing signalling. We have also derived design principles and chemical strategies for controlling bacterial behaviour at the population level.

  15. Zingerone protects against stannous chloride-induced and hydrogen peroxide-induced oxidative DNA damage in vitro.

    PubMed

    Rajan, Iyappan; Narayanan, Nithya; Rabindran, Remitha; Jayasree, P R; Manish Kumar, P R

    2013-12-01

    In this paper, we report the dose-dependent antioxidant activity and DNA protective effects of zingerone. At 500 μg/mL, the DPPH radical scavenging activity of zingerone and ascorbic acid as a standard was found to be 86.7 and 94.2 % respectively. At the same concentration, zingerone also showed significant reducing power (absorbance 0.471) compared to that of ascorbic acid (absorbance 0.394). The in vitro toxicity of stannous chloride (SnCl2) was evaluated using genomic and plasmid DNA. SnCl2-induced degradation of genomic DNA was found to occur at a concentration of 0.8 mM onwards with complete degradation at 1.02 mM and above. In the case of plasmid DNA, conversion of supercoiled DNA into the open circular form indicative of DNA nicking activity was observed at a concentration of 0.2 mM onwards; complete conversion was observed at a concentration of 1.02 mM and above. Zingerone was found to confer protection against SnCl2-induced oxidative damage to genomic and plasmid DNA at concentrations of 500 and 750 μg/mL onwards, respectively. This protective effect was further confirmed in the presence of UV/H2O2-a known reactive oxygen species (ROS) generating system-wherein protection by zingerone against ROS-mediated DNA damage was observed at a concentration of 250 μg/mL onwards in a dose-dependent manner. This study clearly indicated the in vitro DNA protective property of zingerone against SnCl2-induced, ROS-mediated DNA damage.

  16. Crowding-induced Cooperativity in DNA Surface Hybridization

    NASA Astrophysics Data System (ADS)

    Lei, Qun-Li; Ren, Chun-Lai; Su, Xiao-Hang; Ma, Yu-Qiang

    2015-04-01

    High density DNA brush is not only used to model cellular crowding, but also has a wide application in DNA-functionalized materials. Experiments have shown complicated cooperative hybridization/melting phenomena in these systems, raising the question that how molecular crowding influences DNA hybridization. In this work, a theoretical modeling including all possible inter and intramolecular interactions, as well as molecular details for different species, is proposed. We find that molecular crowding can lead to two distinct cooperative behaviours: negatively cooperative hybridization marked by a broader transition width, and positively cooperative hybridization with a sharper transition, well reconciling the experimental findings. Moreover, a phase transition as a result of positive cooperativity is also found. Our study provides new insights in crowding and compartmentation in cell, and has the potential value in controlling surface morphologies of DNA functionalized nano-particles.

  17. Crowding-induced Cooperativity in DNA Surface Hybridization

    PubMed Central

    Lei, Qun-li; Ren, Chun-lai; Su, Xiao-hang; Ma, Yu-qiang

    2015-01-01

    High density DNA brush is not only used to model cellular crowding, but also has a wide application in DNA-functionalized materials. Experiments have shown complicated cooperative hybridization/melting phenomena in these systems, raising the question that how molecular crowding influences DNA hybridization. In this work, a theoretical modeling including all possible inter and intramolecular interactions, as well as molecular details for different species, is proposed. We find that molecular crowding can lead to two distinct cooperative behaviours: negatively cooperative hybridization marked by a broader transition width, and positively cooperative hybridization with a sharper transition, well reconciling the experimental findings. Moreover, a phase transition as a result of positive cooperativity is also found. Our study provides new insights in crowding and compartmentation in cell, and has the potential value in controlling surface morphologies of DNA functionalized nano-particles. PMID:25875056

  18. Methylation-induced blocks to in vitro DNA replication.

    PubMed

    Larson, K; Sahm, J; Shenkar, R; Strauss, B

    1985-01-01

    Single-stranded primed M13mp2 templates and double-stranded templates were treated with either dimethyl sulfate (DMS) or N-methyl-N'-nitro-N-nitrosoguanidine and used for DNA synthesis in vitro. Methylation inhibits the ability of the molecules to serve as templates. When either E. coli DNA polymerase I or AMV reverse transcriptase were used as polymerases, DNA synthesis terminated one nucleotide 3' to the site of adenine residues in the template. Heating of the templates resulted in the appearance of additional termination bands one nucleotide before the site of G's in the template. We assume that methylated A's but not methylated G's are blocks to in vitro DNA synthesis and that heating converts a portion of the sites of methylated G to AP sites which are blocks to synthesis.

  19. RNA m(6)A methylation regulates the ultraviolet-induced DNA damage response.

    PubMed

    Xiang, Yang; Laurent, Benoit; Hsu, Chih-Hung; Nachtergaele, Sigrid; Lu, Zhike; Sheng, Wanqiang; Xu, Chuanyun; Chen, Hao; Ouyang, Jian; Wang, Siqing; Ling, Dominic; Hsu, Pang-Hung; Zou, Lee; Jambhekar, Ashwini; He, Chuan; Shi, Yang

    2017-03-23

    Cell proliferation and survival require the faithful maintenance and propagation of genetic information, which are threatened by the ubiquitous sources of DNA damage present intracellularly and in the external environment. A system of DNA repair, called the DNA damage response, detects and repairs damaged DNA and prevents cell division until the repair is complete. Here we report that methylation at the 6 position of adenosine (m(6)A) in RNA is rapidly (within 2 min) and transiently induced at DNA damage sites in response to ultraviolet irradiation. This modification occurs on numerous poly(A)(+) transcripts and is regulated by the methyltransferase METTL3 (methyltransferase-like 3) and the demethylase FTO (fat mass and obesity-associated protein). In the absence of METTL3 catalytic activity, cells showed delayed repair of ultraviolet-induced cyclobutane pyrimidine adducts and elevated sensitivity to ultraviolet, demonstrating the importance of m(6)A in the ultraviolet-responsive DNA damage response. Multiple DNA polymerases are involved in the ultraviolet response, some of which resynthesize DNA after the lesion has been excised by the nucleotide excision repair pathway, while others participate in trans-lesion synthesis to allow replication past damaged lesions in S phase. DNA polymerase κ (Pol κ), which has been implicated in both nucleotide excision repair and trans-lesion synthesis, required the catalytic activity of METTL3 for immediate localization to ultraviolet-induced DNA damage sites. Importantly, Pol κ overexpression qualitatively suppressed the cyclobutane pyrimidine removal defect associated with METTL3 loss. Thus, we have uncovered a novel function for RNA m(6)A modification in the ultraviolet-induced DNA damage response, and our findings collectively support a model in which m(6)A RNA serves as a beacon for the selective, rapid recruitment of Pol κ to damage sites to facilitate repair and cell survival.

  20. Divalent cation-induced cluster formation by polyphosphoinositides in model membranes.

    PubMed

    Wang, Yu-Hsiu; Collins, Agnieszka; Guo, Lin; Smith-Dupont, Kathryn B; Gai, Feng; Svitkina, Tatyana; Janmey, Paul A

    2012-02-22

    Polyphosphoinositides (PPIs) and in particular phosphatidylinositol-(4,5)-bisphosphate (PI4,5P2), control many cellular events and bind with variable levels of specificity to hundreds of intracellular proteins in vitro. The much more restricted targeting of proteins to PPIs in cell membranes is thought to result in part from the formation of spatially distinct PIP2 pools, but the mechanisms that cause formation and maintenance of PIP2 clusters are still under debate. The hypothesis that PIP2 forms submicrometer-sized clusters in the membrane by electrostatic interactions with intracellular divalent cations is tested here using lipid monolayer and bilayer model membranes. Competitive binding between Ca(2+) and Mg(2+) to PIP2 is quantified by surface pressure measurements and analyzed by a Langmuir competitive adsorption model. The physical chemical differences among three PIP2 isomers are also investigated. Addition of Ca(2+) but not Mg(2+), Zn(2+), or polyamines to PIP2-containing monolayers induces surface pressure drops coincident with the formation of PIP2 clusters visualized by fluorescence, atomic force, and electron microscopy. Studies of bilayer membranes using steady-state probe-partitioning fluorescence resonance energy transfer (SP-FRET) and fluorescence correlation spectroscopy (FCS) also reveal divalent metal ion (Me(2+))-induced cluster formation or diffusion retardation, which follows the trend: Ca(2+) ≫ Mg(2+) > Zn(2+), and polyamines have minimal effects. These results suggest that divalent metal ions have substantial effects on PIP2 lateral organization at physiological concentrations, and local fluxes in their cytoplasmic levels can contribute to regulating protein-PIP2 interactions.

  1. Correlation-induced DNA adsorption on like-charged membranes

    NASA Astrophysics Data System (ADS)

    Buyukdagli, Sahin; Blossey, Ralf

    2016-10-01

    The adsorption of DNA or other polyelectrolyte molecules on charged membranes is a recurrent motif in soft matter and bionanotechnological systems. Two typical situations encountered are the deposition of single DNA chains onto substrates for further analysis, e.g., by force microscopy, or the pulling of polyelectrolytes into membrane nanopores, as in sequencing applications. In this paper, we present a theoretical analysis of such scenarios based on the self-consistent field theory approach, which allows us to address the important effect of charge correlations. We calculate the grand potential of a stiff polyelectrolyte immersed in an electrolyte in contact with a negatively charged dielectric membrane. For the sake of conciseness, we neglect conformational polymer fluctuations and model the molecule as a rigid charged line. At strongly charged membranes, the adsorbed counterions enhance the screening ability of the interfacial region. In the presence of highly charged polymers such as double-stranded DNA molecules close to the membrane, this enhanced interfacial screening dominates the mean-field level DNA-membrane repulsion and results in the adsorption of the DNA molecule to the surface. This picture provides a simple explanation for the recently observed DNA binding onto similarly charged substrates [G. L.-Caballero et al., Soft Matter 10, 2805 (2014), 10.1039/c3sm52428k] and points out charge correlations as a non-negligible ingredient of polymer-surface interactions.

  2. Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.

    PubMed

    Schellenberg, Matthew J; Perera, Lalith; Strom, Christina N; Waters, Crystal A; Monian, Brinda; Appel, C Denise; Vilas, Caroline K; Williams, Jason G; Ramsden, Dale A; Williams, R Scott

    2016-05-05

    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA-protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg(2+)-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg(2+) binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons.

  3. UV-Induced Adenine Radicals Induced in DNA A-Tracts: Spectral and Dynamical Characterization.

    PubMed

    Banyasz, Akos; Ketola, Tiia-Maaria; Muñoz-Losa, Aurora; Rishi, Sunny; Adhikary, Amitava; Sevilla, Michael D; Martinez-Fernandez, Lara; Improta, Roberto; Markovitsi, Dimitra

    2016-10-06

    Adenyl radicals generated in DNA single and double strands, (dA)20 and (dA)20·(dT)20, by one- and two-photon ionization by 266 nm laser pulses decay at 600 nm with half-times of 1.0 ± 0.1 and 4 ± 1 ms, respectively. Though ionization initially forms the cation radical, the radicals detected for (dA)20 are quantitatively identified as N6-deprotonated adenyl radicals by their absorption spectrum, which is computed quantum mechanically employing TD-DFT. Theoretical calculations show that deprotonation of the cation radical induces only weak spectral changes, in line with the spectra of the adenyl radical cation and the deprotonated radical trapped in low temperature glasses.

  4. Contributions of the TEL-patch Amino Acid Cluster on TPP1 to Telomeric DNA Synthesis by Human Telomerase

    PubMed Central

    Dalby, Andrew B.; Hofr, Ctirad; Cech, Thomas R.

    2015-01-01

    Telomere maintenance is a highly coordinated process, and its misregulation is linked to cancer as well as telomere-shortening syndromes. Recent studies have shown that the TEL-patch – a cluster of amino acids on the surface of the shelterin component TPP1 – is necessary for the recruitment of telomerase to the telomere in human cells. However, there has been only basic biochemical analysis of the role of TPP1 in the telomerase recruitment process. Here we develop an in vitro assay to quantitatively measure the contribution of the TEL-patch to telomerase recruitment – binding and extension of the first telomeric repeat. We also demonstrate that the TEL-patch contributes to the translocation step of the telomerase reaction. Finally, our quantitative observations indicate that the TEL-patch stabilizes the association between telomerase and telomeric DNA substrates, providing a molecular explanation for its contributions to telomerase recruitment and action. PMID:25623306

  5. A subset of herpes simplex virus replication genes induces DNA amplification within the host cell genome

    SciTech Connect

    Heilbronn, R.; zur Hausen, H. )

    1989-09-01

    Herpes simplex virus (HSV) induces DNA amplification of target genes within the host cell chromosome. To characterize the HSV genes that mediate the amplification effect, combinations of cloned DNA fragments covering the entire HSV genome were transiently transfected into simian virus 40 (SV40)-transformed hamster cells. This led to amplification of the integrated SV40 DNA sequences to a degree comparable to that observed after transfection of intact virion DNA. Transfection of combinations of subclones and of human cytomegalovirus immediate-early promoter-driven expression constructs for individual open reading frames led to the identification of sic HSV genes which together were necessary and sufficient for the induction of DNA amplification: UL30 (DNA polymerase), UL29 (major DNA-binding protein), UL5, UL8, UL42, and UL52. All of these genes encode proteins necessary for HSV DNA replication. However, an additional gene coding for an HSV origin-binding protein (UL9) was required for origin-dependent HSV DNA replication but was dispensable for SV40 DNA amplification. The results show that a subset of HSV replication genes is sufficient for the induction of DNA amplification. This opens the possibility that HSV expresses functions sufficient for DNA amplification but separate from those responsible for lytic viral growth. HSV infection may thereby induce DNA amplification within the host cell genome without killing the host by lytic viral growth. This may lead to persistence of a cell with a new genetic phenotype, which would have implications for the pathogenicity of the virus in vivo.

  6. Characterization of UVC-induced DNA damage in bloodstains: forensic implications.

    PubMed

    Hall, Ashley; Ballantyne, Jack

    2004-09-01

    The ability to detect DNA polymorphisms using molecular genetic techniques has revolutionized the forensic analysis of biological evidence. DNA typing now plays a critical role within the criminal justice system, but one of the limiting factors with the technology is that DNA isolated from biological stains recovered from the crime scene is sometimes so damaged as to be intractable to analysis. Potential remedies for damaged DNA are likely to be dependent upon the precise nature of the DNA damage present in any particular sample but, unfortunately, current knowledge of the biochemical nature, and the extent, of such DNA damage in dried biological stains is rudimentary. As a model for DNA damage assessment in biological stains recovered from crime scenes, we have subjected human bloodstains and naked DNA in the hydrated and dehydrated states to varying doses of UVC radiation. It was possible to damage the DNA sufficiently in a bloodstain to cause a standard autosomal short tandem repeat (STR) profile to be lost. However, a detailed analysis of the process, based upon assays developed to detect bipyrimidine photoproducts (BPPPs), single- and double-strand breaks, and DNA-DNA crosslinks, produced some unexpected findings. Contrary to the situation with living tissues or cells in culture, the predominant UVC-induced damage to DNA in bloodstains appears not to be pyrimidine dimers. Although some evidence for the presence of BPPPs and DNA crosslinks was obtained, the major form of UVC damage causing genetic profile loss appeared to be single-strand breaks. It was not possible, however, to preclude the possibility that a combination of damage types was responsible for the profile loss observed. We demonstrate here that a significant measure of protection against UVC-mediated genetic profile loss in dried biological stain material is afforded by the dehydrated state of the DNA and, to a lesser extent, the DNA cellular milieu.

  7. Use of RAPD to detect sodium arsenite-induced DNA damage in human lymphoblastoid cells.

    PubMed

    Lee, Yuan-Cho; Yang, Vivian C; Wang, Tsu-Shing

    2007-09-24

    Inorganic arsenic is a known human carcinogen, yet its mechanism of action remains unclear. Our previous study showed that arsenite significantly induces oxidative DNA adducts and DNA-protein cross-links in several mammalian cell lines. In the present study, we used the random amplified polymorphic DNA (RAPD) assay to evaluate the possible target in the genomic DNA of human lymphoblastoid cells that were exposed to sodium arsenite. Treatment with both 10 and 80 microM arsenite for 4h induced significant changes in RAPD profiles compared with the control pattern. Two 10-mer RAPD primers (D11 and F1) produced the most distinguishable banding profiles between arsenite-treated and control genomic DNA. The sequencing of four arsenite-sensitive RAPD bands showed that the RB1CC1 and PACE4 genes might be the DNA targets of sodium arsenite treatment. We propose that arsenite may induce sequence- or gene-specific damage and then change the RAPD profile in human lymphoblastoid cells. The results of our study also show that RAPD combined with other techniques is a good tool for detecting alterations in genomic DNA and for the direct screening of new molecular markers related to arsenite-induced carcinogenesis.

  8. Modification of tumour cell metabolism modulates sensitivity to Chk1 inhibitor-induced DNA damage

    PubMed Central

    Massey, Andrew J.

    2017-01-01

    Chk1 kinase inhibitors are currently under clinical investigation as potentiators of cytotoxic chemotherapy and demonstrate potent activity in combination with anti-metabolite drugs that increase replication stress through the inhibition of nucleotide or deoxyribonucleotide biosynthesis. Inhibiting other metabolic pathways critical for the supply of building blocks necessary to support DNA replication may lead to increased DNA damage and synergy with an inhibitor of Chk1. A screen of small molecule metabolism modulators identified combinatorial activity between a Chk1 inhibitor and chloroquine or the LDHA/LDHB inhibitor GSK 2837808A. Compounds, such as 2-deoxyglucose or 6-aminonicotinamide, that reduced the fraction of cells undergoing active replication rendered tumour cells more resistant to Chk1 inhibitor-induced DNA damage. Withdrawal of glucose or glutamine induced G1 and G2/M arrest without increasing DNA damage and reduced Chk1 expression and activation through autophosphorylation. This suggests the expression and activation of Chk1 kinase is associated with cells undergoing active DNA replication. Glutamine starvation rendered tumour cells more resistant to Chk1 inhibitor-induced DNA damage and reversal of the glutamine starvation restored the sensitivity of tumour cells to Chk1 inhibitor-induced DNA damage. Chk1 inhibitors may be a potentially useful therapeutic treatment for patients whose tumours contain a high fraction of replicating cells. PMID:28106079

  9. THE PROTEASOME REGULATES BACTERIAL CpG DNA-INDUCED SIGNALING PATHWAYS IN MURINE MACROPHAGES

    PubMed Central

    Gao, Jian Jun; Shen, Jing; Kolbert, Christopher; Raghavakaimal, Sreekumar; Papasian, Christopher J.; Qureshi, Asaf A.; Vogel, Stefanie N.; Morrison, David C.; Qureshi, Nilofer

    2010-01-01

    Our previous work has provided strong evidence that the proteasome is central to the vast majority of genes induced in mouse macrophages in response to lipopolysaccharide (LPS) stimulation. In the studies presented here, we evaluated the role of the macrophage proteasome in response to a second microbial product CpG DNA (unmethylated bacterial DNA). For these studies, we applied Affymetrix microarray analysis of RNA derived from murine macrophages stimulated with CpG DNA in the presence or absence of proteasome inhibitor, lactacystin. The results of these studies revealed that similar to LPS, a vast majority of those macrophage genes regulated by CpG DNA are also under the control of the proteasome at 4 h. In contrast to LPS stimulation, however, many of these genes were induced much later than 4 h, at 18 h, in response to CpG DNA. Lactacystin treatment of macrophages completely blocked the CpG DNA-induced gene expression of TNF-α and other genes involved in production of inflammatory mediators. These data strongly support the conclusion that, similar to LPS, the macrophage proteasome is a key regulator of CpG DNA-induced signaling pathways. PMID:20160661

  10. Macrophage activation induced by Brucella DNA suppresses bacterial intracellular replication via enhancing NO production.

    PubMed

    Liu, Ning; Wang, Lin; Sun, Changjiang; Yang, Li; Tang, Bin; Sun, Wanchun; Peng, Qisheng

    2015-12-01

    Brucella DNA can be sensed by TLR9 on endosomal membrane and by cytosolic AIM2-inflammasome to induce proinflammatory cytokine production that contributes to partially activate innate immunity. Additionally, Brucella DNA has been identified to be able to act as a major bacterial component to induce type I IFN. However, the role of Brucella DNA in Brucella intracellular growth remains unknown. Here, we showed that stimulation with Brucella DNA promote macrophage activation in TLR9-dependent manner. Activated macrophages can suppresses wild type Brucella intracellular replication at early stage of infection via enhancing NO production. We also reported that activated macrophage promotes bactericidal function of macrophages infected with VirB-deficient Brucella at the early or late stage of infection. This study uncovers a novel function of Brucella DNA, which can help us further elucidate the mechanism of Brucella intracellular survival.

  11. Recombinant covalently closed circular hepatitis B virus DNA induces prolonged viral persistence in immunocompetent mice.

    PubMed

    Qi, Zhihua; Li, Gaiyun; Hu, Hao; Yang, Chunhui; Zhang, Xiaoming; Leng, Qibin; Xie, Youhua; Yu, Demin; Zhang, Xinxin; Gao, Yueqiu; Lan, Ke; Deng, Qiang

    2014-07-01

    It remains crucial to develop a laboratory model for studying hepatitis B virus (HBV) chronic infection. We hereby produced a recombinant covalently closed circular DNA (rcccDNA) in view of the key role of cccDNA in HBV persistence. A loxP-chimeric intron was engineered into a monomeric HBV genome in a precursor plasmid (prcccDNA), which was excised using Cre/loxP-mediated DNA recombination into a 3.3-kb rcccDNA in the nuclei of hepatocytes. The chimeric intron was spliced from RNA transcripts without interrupting the HBV life cycle. In cultured hepatoma cells, cotransfection of prcccDNA and pCMV-Cre (encoding Cre recombinase) resulted in accumulation of nuclear rcccDNA that was heat stable and epigenetically organized as a minichromosome. A mouse model of HBV infection was developed by hydrodynamic injection of prcccDNA. In the presence of Cre recombinase, rcccDNA was induced in the mouse liver with effective viral replication and expression, triggering a compromised T-cell response against HBV. Significant T-cell hyporesponsiveness occurred in mice receiving 4 μg prcccDNA, resulting in prolonged HBV antigenemia for up to 9 weeks. Persistent liver injury was observed as elevated alanine transaminase activity in serum and sustained inflammatory infiltration in the liver. Although a T-cell dysfunction was induced similarly, mice injected with a plasmid containing a linear HBV replicon showed rapid viral clearance within 2 weeks. Collectively, our study provides an innovative approach for producing a cccDNA surrogate that established HBV persistence in immunocompetent mice. It also represents a useful model system in vitro and in vivo for evaluating antiviral treatments against HBV cccDNA. Importance: (i) Unlike plasmids that contain a linear HBV replicon, rcccDNA established HBV persistence with sustained liver injury in immunocompetent mice. This method could be a prototype for developing a mouse model of chronic HBV infection. (ii) An exogenous intron was

  12. ATM mediates oxidative stress-induced dephosphorylation of DNA ligase IIIalpha.

    PubMed

    Dong, Zhiwan; Tomkinson, Alan E

    2006-01-01

    Among the three mammalian genes encoding DNA ligases, only the LIG3 gene does not have a homolog in lower eukaryotes. In somatic mammalian cells, the nuclear form of DNA ligase IIIalpha forms a stable complex with the DNA repair protein XRCC1 that is also found only in higher eukaryotes. Recent studies have shown that XRCC1 participates in S phase-specific DNA repair pathways independently of DNA ligase IIIalpha and is constitutively phosphorylated by casein kinase II. In this study we demonstrate that DNA ligase IIIalpha, unlike XRCC1, is phosphorylated in a cell cycle-dependent manner. Specifically, DNA ligase IIIalpha is phosphorylated on Ser123 by the cell division cycle kinase Cdk2 beginning early in S phase and continuing into M phase. Interestingly, treatment of S phase cells with agents that cause oxygen free radicals induces the dephosphorylation of DNA ligase IIIalpha. This oxidative stress-induced dephosphorylation of DNA ligase IIIalpha is dependent upon the ATM (ataxia-telangiectasia mutated) kinase and appears to involve inhibition of Cdk2 and probably activation of a phosphatase.

  13. ATM mediates oxidative stress-induced dephosphorylation of DNA ligase IIIα

    PubMed Central

    Dong, Zhiwan; Tomkinson, Alan E.

    2006-01-01

    Among the three mammalian genes encoding DNA ligases, only the LIG3 gene does not have a homolog in lower eukaryotes. In somatic mammalian cells, the nuclear form of DNA ligase IIIα forms a stable complex with the DNA repair protein XRCC1 that is also found only in higher eukaryotes. Recent studies have shown that XRCC1 participates in S phase-specific DNA repair pathways independently of DNA ligase IIIα and is constitutively phosphorylated by casein kinase II. In this study we demonstrate that DNA ligase IIIα, unlike XRCC1, is phosphorylated in a cell cycle-dependent manner. Specifically, DNA ligase IIIα is phosphorylated on Ser123 by the cell division cycle kinase Cdk2 beginning early in S phase and continuing into M phase. Interestingly, treatment of S phase cells with agents that cause oxygen free radicals induces the dephosphorylation of DNA ligase IIIα. This oxidative stress-induced dephosphorylation of DNA ligase IIIα is dependent upon the ATM (ataxia-telangiectasia mutated) kinase and appears to involve inhibition of Cdk2 and probably activation of a phosphatase. PMID:17040896

  14. NEK8 regulates DNA damage-induced RAD51 foci formation and replication fork protection

    PubMed Central

    Abeyta, Antonio; Castella, Maria; Jacquemont, Celine; Taniguchi, Toshiyasu

    2017-01-01

    ABSTRACT Proteins essential for homologous recombination play a pivotal role in the repair of DNA double strand breaks, DNA inter-strand crosslinks and replication fork stability. Defects in homologous recombination also play a critical role in the development of cancer and the sensitivity of these cancers to chemotherapy. RAD51, an essential factor for homologous recombination and replication fork protection, accumulates and forms immunocytochemically detectable nuclear foci at sites of DNA damage. To identify kinases that may regulate RAD51 localization to sites of DNA damage, we performed a human kinome siRNA library screen, using DNA damage-induced RAD51 foci formation as readout. We found that NEK8, a NIMA family kinase member, is required for efficient DNA damage-induced RAD51 foci formation. Interestingly, knockout of Nek8 in murine embryonic fibroblasts led to cellular sensitivity to the replication inhibitor, hydroxyurea, and inhibition of the ATR kinase. Furthermore, NEK8 was required for proper replication fork protection following replication stall with hydroxyurea. Loading of RAD51 to chromatin was decreased in NEK8-depleted cells and Nek8-knockout cells. Single-molecule DNA fiber analyses revealed that nascent DNA tracts were degraded in the absence of NEK8 following treatment with hydroxyurea. Consistent with this, Nek8-knockout cells showed increased chromosome breaks following treatment with hydroxyurea. Thus, NEK8 plays a critical role in replication fork stability through its regulation of the DNA repair and replication fork protection protein RAD51. PMID:27892797

  15. Lac repressor: Crystallization of intact tetramer and its complexes with inducer and operator DNA

    SciTech Connect

    Pace, H.C.; Lu, P. ); Lewis, M. Smith Kline and French Labs., King of Prussia, PA )

    1990-03-01

    The intact lac repressor tetramer, which regulates expression of the lac operon in Escherichia coli, has been crystallized in the native form, with an inducer, and in a ternary complex with operator DNA and an anti-inducer. The crystals without DNA diffract to better than 3.5 {angstrom}. They belong to the monoclinic space group C2 and have cell dimensions a = 164.7 {angstrom}, b = 75.6 {angstrom}, and c = 161.2 {angstrom}, with {alpha} = {gamma} = 90{degree} and {beta} = 125.5{degree}. Cocrystals have been obtained with a number of different lac operator-related DNA fragments. The complex with a blunt-ended 16-base-pair strand yielded tetragonal bipyramids that diffract to 6.5 {angstrom}. These protein-DNA cocrystals crack upon exposure to the gratuitous inducer isopropyl {beta}-D-thiogalactoside, suggesting a conformational change in the repressor-operator complex.

  16. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells

    PubMed Central

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-01-01

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague–Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  17. Minimal role of base excision repair in TET-induced global DNA demethylation in HEK293T cells

    PubMed Central

    Jin, Chunlei; Qin, Taichun; Barton, Michelle Craig; Jelinek, Jaroslav; Issa, Jean-Pierre J

    2015-01-01

    Oxidation of 5-methylcytosine by TET family proteins can induce DNA replication-dependent (passive) DNA demethylation and base excision repair (BER)-based (active) DNA demethylation. The balance of active vs. passive TET-induced demethylation remains incompletely determined. In the context of large scale DNA demethylation, active demethylation may require massive induction of the DNA repair machinery and thus compromise genome stability. To study this issue, we constructed a tetracycline-controlled TET-induced global DNA demethylation system in HEK293T cells. Upon TET overexpression, we observed induction of DNA damage and activation of a DNA damage response; however, BER genes are not upregulated to promote DNA repair. Depletion of TDG (thymine DNA glycosylase) or APEX1 (apurinic/apyrimidinic endonuclease 1), two key BER enzymes, enhances rather than impairs global DNA demethylation, which can be explained by stimulated proliferation. By contrast, growth arrest dramatically blocks TET-induced global DNA demethylation. Thus, in the context of TET-induction in HEK293T cells, the DNA replication-dependent passive mechanism functions as the predominant pathway for global DNA demethylation. In the same context, BER-based active demethylation is markedly restricted by limited BER upregulation, thus potentially preventing a disastrous DNA damage response to extensive active DNA demethylation. PMID:26440216

  18. DNA damage and estrogenic activity induced by the environmental pollutant 2-nitrotoluene and its metabolite

    PubMed Central

    Watanabe, Chigusa; Egami, Takashi; Midorikawa, Kaoru; Hiraku, Yusuke; Oikawa, Shinji; Kawanishi, Shosuke

    2010-01-01

    Objectives The environmental pollutant 2-nitrotoluene (2-NO2-T) is carcinogenic and reproductively toxic in animals. In this study, we elucidated the mechanisms of its carcinogenicity and reproductive toxicity. Methods We examined DNA damage induced by 2-NO2-T and its metabolite, 2-nitrosotoluene (2-NO-T), using 32P-5′-end-labeled DNA. We measured 8-oxo-7, 8-dihydro-2′-deoxyguanosine (8-oxodG), an indicator of oxidative DNA damage, in calf thymus DNA and cellular DNA in cultured human leukemia (HL-60) cells treated with 2-NO2-T and 2-NO-T. 8-Oxoguanine DNA glycosylase (OGG1) gene expression in HL-60 cells was measured by real-time polymerase chain reaction (PCR). We examined estrogenic activity using an E-screen assay and a surface plasmon resonance (SPR) sensor. Results In experiments with isolated DNA fragments, 2-NO-T induced oxidative DNA damage in the presence of Cu (II) and β-nicotinamide adenine dinucleotide disodium salt (reduced form) (NADH), while 2-NO2-T did not. 2-NO-T significantly increased levels of 8-oxodG in HL-60 cells. Real-time polymerase chain reaction (PCR) analysis revealed upregulation of OGG1 gene expression induced by 2-NO-T. An E-screen assay using the human breast cancer cell line MCF-7 revealed that 2-NO2-T induced estrogen-dependent cell proliferation. In contrast, 2-NO-T decreased the cell number and suppressed 17β-estradiol-induced cell proliferation. The data obtained with the SPR sensor using estrogen receptor α and the estrogen response element supported the results of the E-screen assay. Conclusions Oxidative DNA damage caused by 2-NO-T and estrogen-disrupting effects caused by 2-NO2-T and 2-NO-T may play a role in the reproductive toxicity and carcinogenicity of these entities. PMID:21432561

  19. Mechanisms of peroxisome proliferator-induced DNA hypomethylation in rat liver.

    PubMed

    Pogribny, Igor P; Tryndyak, Volodymyr P; Boureiko, Anna; Melnyk, Stepan; Bagnyukova, Tetyana V; Montgomery, Beverly; Rusyn, Ivan

    2008-09-26

    Genomic hypomethylation is a consistent finding in both human and animal tumors and mounting experimental evidence suggests a key role for epigenetic events in tumorigenesis. Furthermore, it has been suggested that early changes in DNA methylation and histone modifications may serve as sensitive predictive markers in animal testing for carcinogenic potency of environmental agents. Alterations in metabolism of methyl donors, disturbances in activity and/or expression of DNA methyltransferases, and presence of DNA single-strand breaks could contribute to the loss of cytosine methylation during carcinogenesis; however, the precise mechanisms of genomic hypomethylation induced by chemical carcinogens remain largely unknown. This study examined the mechanism of DNA hypomethylation during hepatocarcinogenesis induced by peroxisome proliferators WY-14,643 (4-chloro-6-(2,3-xylidino)-pyrimidynylthioacetic acid) and DEHP (di-(2-ethylhexyl)phthalate), agents acting through non-genotoxic mode of action. In the liver of male Fisher 344 rats exposed to WY-14,643 (0.1% (w/w), 5 months), the level of genomic hypomethylation increased by approximately 2-fold, as compared to age-matched controls, while in the DEHP group (1.2% (w/w), 5 months) DNA methylation did not change. Global DNA hypomethylation in livers from WY-14,643 group was accompanied by the accumulation of DNA single-strand breaks, increased cell proliferation, and diminished expression of DNA methyltransferase 1, while the metabolism of methyl donors was not affected. In contrast, none of these parameters changed significantly in rats fed DEHP. Since WY-14,643 is much more potent carcinogen than DEHP, we conclude that the extent of loss of DNA methylation may be related to the carcinogenic potential of the chemical agent, and that accumulation of DNA single-strand breaks coupled to the increase in cell proliferation and altered DNA methyltransferase expression may explain genomic hypomethylation during peroxisome

  20. DNA-Tile Structures Induce Ionic Currents through Lipid Membranes.

    PubMed

    Göpfrich, Kerstin; Zettl, Thomas; Meijering, Anna E C; Hernández-Ainsa, Silvia; Kocabey, Samet; Liedl, Tim; Keyser, Ulrich F

    2015-05-13

    Self-assembled DNA nanostructures have been used to create man-made transmembrane channels in lipid bilayers. Here, we present a DNA-tile structure with a nominal subnanometer channel and cholesterol-tags for membrane anchoring. With an outer diameter of 5 nm and a molecular weight of 45 kDa, the dimensions of our synthetic nanostructure are comparable to biological ion channels. Because of its simple design, the structure self-assembles within a minute, making its creation scalable for applications in biology. Ionic current recordings demonstrate that the tile structures enable ion conduction through lipid bilayers and show gating and voltage-switching behavior. By demonstrating the design of DNA-based membrane channels with openings much smaller than that of the archetypical six-helix bundle, our work showcases their versatility inspired by the rich diversity of natural membrane components.

  1. The ATM Kinase Induces MicroRNA Biogenesis in the DNA Damage Response

    PubMed Central

    Zhang, Xinna; Wan, Guohui; Berger, Franklin G.; He, Xiaoming; Lu, Xiongbin

    2011-01-01

    SUMMARY The DNA damage response involves a complex network of processes that detect and repair DNA damage. Here we show that miRNA biogenesis is globally induced upon DNA damage in an ATM-dependent manner. About one fourth of miRNAs are significantly up-regulated after DNA damage, while loss of ATM abolishes their induction. KSRP (KH-type splicing regulatory protein) is a key player that translates DNA damage signaling to miRNA biogenesis. The ATM kinase directly binds to and phosphorylates KSRP, leading to enhanced interaction between KSRP and pri-miRNAs and increased KSRP activity in miRNA processing. Mutations of the ATM phosphorylation sites of KSRP impaired its activity in regulating miRNAs. These findings reveal a mechanism by which DNA damage signaling is linked to miRNA biogenesis. PMID:21329876

  2. G4-Tetra DNA Duplex Induce Lung Cancer Cell Apoptosis in A549 Cells

    NASA Astrophysics Data System (ADS)

    Xu, Xiaobo; Zhao, YiZhuo; Lu, Hu; Fu, Cuiping; Li, Xiao; Jiang, Liyan; Li, Shanqun

    2016-10-01

    The specific DNA is typically impermeable to the plasma membrane due to its natural characters, but DNA tetra structures (DTNs) can be readily uptake by cells in the absence of transfection agents, providing a new strategy to deliver DNA drugs. In this research, the delivery efficiency of tetrahedral DNA nanostructures was measured on adenocarcinomic human alveolar basal epithelial (A549) cells via delivering AS1411 (G4). The DNA tetra-AS1411 complex was rapidly and abundantly uptake by A549 cells, and the induced apoptosis was enhanced. Furthermore, biodistribution in mouse proved the rapid clearance from non-targeted organs in vivo. This study improved the understanding of potential function in DNA-based drug delivery and proved that DTNs-AS1411 could be potentially useful for the treatment of lung cancer.

  3. Microwave-Induced Inactivation of DNA-Based Hybrid Catalyst in Asymmetric Catalysis

    PubMed Central

    Zhao, Hua; Shen, Kai

    2015-01-01

    DNA-based hybrid catalysts have gained strong interests in asymmetric reactions. However, to maintain the high enantioselectivity, these reactions are usually conducted at relatively low temperatures (e.g. < 5 °C) for 2–3 days. Aiming to improve the reaction’s turnover rate, we evaluated microwave irradiation with simultaneous cooling as potential energy source since this method has been widely used to accelerate various chemical and enzymatic reactions. However, our data indicated that microwave irradiation induced an inactivation of DNA-based hybrid catalyst even at low temperatures (such as 5 °C). Circular dichroism (CD) spectra and gel electrophoresis of DNA suggest that microwave exposure degrades DNA molecules and disrupts DNA double-stranded structures, causing changes of DNA–metal ligand binding properties and thus poor DNA catalytic performance. PMID:26712696

  4. Stochastic modeling of fluid-particle flows in homogeneous cluster-induced turbulence

    NASA Astrophysics Data System (ADS)

    Innocenti, Alessio; Chibbaro, Sergio; Fox, Rodney; Salvetti, Maria Vittoria

    2016-11-01

    Inertial particles in turbulent flows are characterized by preferential concentration and segregation and, at sufficient mass loading, dense clusters may spontaneously generate due to momentum coupling between the phases. These clusters in turn can generate and sustain turbulence in the fluid phase, which we refer to as cluster-induced turbulence (CIT). In the present work, we tackle the problem of homogeneous gravity driven CIT in the framework of a stochastic model, based on a Lagrangian formalism which includes naturally the Eulerian one. A rigorous formalism has been put forward focusing in particular on the terms responsible of the two-way coupling in the carrier phase, which is the key mechanism in this type of flow. Moreover, the decomposition of the particle-phase velocity into the spatially correlated and uncorrelated components has been used allowing to identify the contributions to the correlated fluctuating energy and to the granular temperature. Tests have been performed taking into account also the effects of collisions between particles. Results are compared against DNS, and they show a good accuracy in predicting first and second order moments of particle velocity and fluid velocity seen by particles.

  5. Ligation of erythrocyte CR1 induces its clustering in complex with scaffolding protein FAP-1

    PubMed Central

    Glodek, Aleksandra M.; Weaver, Gregory; Klickstein, Lloyd B.; Nicholson-Weller, Anne

    2008-01-01

    The primary identified function of complement receptor 1 (CR1/CD35) on primate erythrocytes is to bind complement-tagged inflammatory particles including microbes and immune complexes. When erythrocytes circulate through liver and spleen, sinusoidal phagocytes remove CR1-adherent particles and erythrocytes return to the circulation. This process of immune adherence clearance is important for host defense and prevention of autoimmunity. CR1 was previously described as clustered in the human erythrocyte membrane, which was thought to be necessary for binding complement-opsonized particles. In contrast, we demonstrate that on erythrocytes CR1 is not clustered, but dispersed, and able to bind complement-tagged particles. When fresh erythrocytes are solubilized by nonionic detergent, CR1 partitions to the cytoskeleton fraction. Using a PDZ-peptide array, CR1's cytoplasmic tail, which contains 2 PDZ-motifs, binds PDZ domains 2, 3, and 5 of Fas-associated phosphatase 1 (FAP-1), a scaffolding protein. We show that FAP-1, not previously recognized as an erythroid protein, is expressed on circulating erythrocytes. CR1 and FAP-1 coimmunoprecipitate, which confirms their molecular association. Disperse CR1 on erythrocytes may be advantageous for capturing immune-complexes, while ligation-induced CR1 clustering may prevent ingestion of the erythrocyte during the immune-complex transfer to the macrophages by keeping the opsonic stimulus localized thus preventing phagocyosis. PMID:18684861

  6. Application of DNA amplification to pneumocystosis: presence of serum Pneumocystis carinii DNA during human and experimentally induced Pneumocystis carinii pneumonia

    PubMed Central

    1992-01-01

    Pneumocystis carinii pneumonia is a leading cause of morbidity and mortality in patients with the acquired immunodeficiency syndrome (AIDS). Much remains unknown about the basic biology of P. carinii and studies of this infection have been hampered by the lack of cultivation methods. We developed a sensitive and specific assay for P. carinii by utilizing DNA amplification of the P. carinii dihydrofolate reductase (DHFR) gene. By this method, P. carinii DNA was detected in the lungs of rats with experimentally induced P. carinii pneumonia 2 wk before the onset of histopathological changes. DNA amplification analysis of serum demonstrated that by 10 wk of corticosteroid treatment, 12 of 12 (100%) infected rats had circulating DHFR DNA. P. carinii DHFR DNA also was detected in the serum of patients with AIDS and active P. carinii pneumonia (12 of 14 sera collected prospectively). Patients with advanced AIDS but without a history of P. carinii pneumonia were negative by this assay (0 of 6 sera examined). Serum polymerase chain reaction may facilitate investigations into the natural history and epidemiology of P. carinii infection, provide insight into the pathogenesis of parasite dissemination, and offer a useful, noninvasive diagnostic test for the detection of human pneumocystosis. PMID:1402679

  7. Inhibition of uracil DNA glycosylase sensitizes cancer cells to 5-fluorodeoxyuridine through replication fork collapse-induced DNA damage

    PubMed Central

    Yan, Yan; Han, Xiangzi; Qing, Yulan; Condie, Allison G.; Gorityala, Shashank; Yang, Shuming; Xu, Yan; Zhang, Youwei; Gerson, Stanton L.

    2016-01-01

    5-fluorodeoxyuridine (5-FdU, floxuridine) is active against multiple cancers through the inhibition of thymidylate synthase, which consequently introduces uracil and 5-FU incorporation into the genome. Uracil DNA glycosylase (UDG) is one of the main enzymes responsible for the removal of uracil and 5-FU. However, how exactly UDG mediates cellular sensitivity to 5-FdU, and if so whether it is through its ability to remove uracil and 5-FU have not been well characterized. In this study, we report that UDG depletion led to incorporation of uracil and 5-FU in DNA following 5-FdU treatment and significantly enhanced 5-FdU's cytotoxicity in cancer cell lines. Co-treatment, but not post-treatment with thymidine prevented cell death of UDG depleted cells by 5-FdU, indicating that the enhanced cytotoxicity is due to the retention of uracil and 5-FU in genomic DNA in the absence of UDG. Furthermore, UDG depleted cells were arrested at late G1 and early S phase by 5-FdU, followed by accumulation of sub-G1 population indicating cell death. Mechanistically, 5-FdU dramatically reduced DNA replication speed in UDG depleted cells. UDG depletion also greatly enhanced DNA damage as shown by γH2AX foci formation. Notably, the increased γH2AX foci formation was not suppressed by caspase inhibitor treatment, suggesting that DNA damage precedes cell death induced by 5-FdU. Together, these data provide novel mechanistic insights into the roles of UDG in DNA replication, damage repair, and cell death in response to 5-FdU and suggest that UDG is a target for improving the anticancer effect of this agent. PMID:27517750

  8. Extracellular Signals induce Glycoprotein M6a Clustering of Lipid-rafts and associated Signaling Molecules.

    PubMed

    Honda, Atsuko; Ito, Yasuyuki; Takahashi-Niki, Kazuko; Matsushita, Natsuki; Nozumi, Motohiro; Tabata, Hidenori; Takeuchi, Kosei; Igarashi, Michihiro

    2017-03-08

    Lipid-raft domains, where sphingolipids and cholesterol are enriched, concentrate signaling molecules. To examine how signaling protein complexes are clustered in rafts, we focused on the functions of glycoprotein M6a (GPM6a), which is expressed at a high concentration in developing mouse neurons. Using imaging of lipid-rafts, we found that GPM6a congregated in rafts in a GPM6a palmitoylation-dependent manner, thereby contributing to lipid-raft clustering. Additionally, we found that signaling proteins downstream of GPM6a, i.e., Rufy3, Rap2, and Tiam2/STEF, accumulated in lipid-rafts in a GPM6a-dependent manner, and that they were essential for laminin-dependent polarity during neurite formation in neuronal development. In utero RNAi targeting of GPM6a resulted in abnormally polarized neurons with multiple neurites. These results demonstrate that GPM6a induces the clustering of lipid-rafts, which supports the raft aggregation of its associated downstream molecules for acceleration of neuronal polarity determination. Thus, GPM6a acts as a signal transducer that responds to extracellular signals.SIGNIFICANCE STATEMENTLipid-raft domains, where sphingolipids and cholesterol are enriched, concentrate signaling molecules. We focused on glycoprotein M6a (GPM6a), which is expressed at a high concentration in developing neurons. Using imaging of lipid-rafts, we found that GPM6a congregated in rafts in a palmitoylation-dependent manner, thereby contributing to lipid-raft clustering. Additionally, we found that signaling proteins downstream of GPM6a accumulated in lipid-rafts in a GPM6a-dependent manner, and that they were essential for laminin-dependent polarity during neurite formation. In utero RNAi targeting of GPM6a resulted in abnormally polarized neurons with multiple neurites. These results demonstrate that GPM6a induces the clustering of lipid-rafts, which supports the raft aggregation of its associated downstream molecules for acceleration of polarity determination

  9. Resection is a major repair pathway of heavy ion-induced DNA lesions

    NASA Astrophysics Data System (ADS)

    Durante, Marco; Averbeck, Nicole; Taucher-Scholz, Gisela

    Space radiation include densely ionizing heavy ions, which can produce clustered DNA damage with high frequency in human cells. Repair of these complex lesions is generally assumed to be more difficult than for simple double-strand breaks. We show here that human cells use break resection with increasing frequency after exposure to heavy ions. Resection can lead to misrepair of the DNA lesion, via microhomology mediated end-joining. Resection can therefore be responsible for the increased effectiveness of heavy ions in the induction of mutations and genetic late effects.

  10. Diethyl pyrocarbonate reaction with the lactose repressor protein affects both inducer and DNA binding

    SciTech Connect

    Sams, C.F.; Matthews, K.S.

    1988-04-05

    Modification of the lactose repressor protein of Escherichia coli with diethyl pyrocarbonate (DPC) results in decreased inducer binding as well as operator and nonspecific DNA binding. Spectrophotometric measurements indicated a maximum of three histidines per subunit was modified, and quantitation of lysine residues with trinitrobenzenesulfonate revealed the modification of one lysine residue. The loss of DNA binding, both operator and nonspecific, was correlated with histidine modification; removal of the carbethoxy groups from the histidines by hydroxylamine was accompanied by significant recovery of DNA binding function. The presence of inducing sugars during the DPC reaction had no effect on histidine modification or the loss of DNA binding activity. In contrast, inducer binding was not recovered upon reversal of the histidine modification. However, the presence of inducer during reaction protected lysine from reaction and also prevented the decrease in inducer binding; these results indicate that reaction of the lysine residue(s) may correlate to the loss of sugar binding activity. Since no difference in incorporation of radiolabeled carbethoxy was observed following reaction with diethyl pyrocarbonate in the presence or absence of inducer, the reagent appears to function as a catalyst in the modification of the lysine. The formation of an amide bond between the affected lysine and a nearby carboxylic acid moiety provides a possible mechanism for the activity loss. Reaction of the isolated NH2-terminal domain resulted in loss of DNA binding with modification of the single histidine at position 29. Results from the modification of core domain paralleled observations with intact repressor.

  11. The DNA damage response induced by infection with human cytomegalovirus and other viruses.

    PubMed

    Xiaofei, E; Kowalik, Timothy F

    2014-05-23

    Viruses use different strategies to overcome the host defense system. Recent studies have shown that viruses can induce DNA damage response (DDR). Many of these viruses use DDR signaling to benefit their replication, while other viruses block or inactivate DDR signaling. This review focuses on the effects of DDR and DNA repair on human cytomegalovirus (HCMV) replication. Here, we review the DDR induced by HCMV infection and its similarities and differences to DDR induced by other viruses. As DDR signaling pathways are critical for the replication of many viruses, blocking these pathways may represent novel therapeutic opportunities for the treatment of certain infectious diseases. Lastly, future perspectives in the field are discussed.

  12. A novel cyanide-inducible gene cluster helps protect Pseudomonas aeruginosa from cyanide.

    PubMed

    Frangipani, Emanuela; Pérez-Martínez, Isabel; Williams, Huw D; Cherbuin, Gaëtan; Haas, Dieter

    2014-02-01

    Pseudomonas aeruginosa produces the toxic secondary metabolite hydrogen cyanide (HCN) at high cell population densities and low aeration. Here, we investigated the impact of HCN as a signal in cell-cell communication by comparing the transcriptome of the wild-type strain PAO1 to that of an HCN-negative mutant under cyanogenic conditions. HCN repressed four genes and induced 12 genes. While the individual functions of these genes are unknown, with one exception (i.e. a ferredoxin-dependent reductase), a highly inducible six-gene cluster (PA4129-PA4134) was found to be crucial for protection of P. aeruginosa from external HCN intoxication. A double mutant deleted for PA4129-PA4134 and cioAB (encoding cyanide-insensitive oxidase) did not grow with 100 μM KCN, whereas the corresponding single mutants were essentially unaffected, suggesting a synergistic action of the PA4129-PA4134 gene products and cyanide-insensitive oxidase.

  13. DNA mediated wire-like clusters of self-assembled TiO₂ nanomaterials: supercapacitor and dye sensitized solar cell applications.

    PubMed

    Nithiyanantham, U; Ramadoss, Ananthakumar; Ede, Sivasankara Rao; Kundu, Subrata

    2014-07-21

    A new route for the formation of wire-like clusters of TiO₂ nanomaterials self-assembled in DNA scaffold within an hour of reaction time is reported. TiO₂ nanomaterials are synthesized by the reaction of titanium-isopropoxide with ethanol and water in the presence of DNA under continuous stirring and heating at 60 °C. The individual size of the TiO₂ NPs self-assembled in DNA and the diameter of the wires can be tuned by controlling the DNA to Ti-salt molar ratios and other reaction parameters. The eventual diameter of the individual particles varies between 15 ± 5 nm ranges, whereas the length of the nanowires varies in the 2-3 μm range. The synthesized wire-like DNA-TiO₂ nanomaterials are excellent materials for electrochemical supercapacitor and DSSC applications. From the electrochemical supercapacitor experiment, it was found that the TiO₂ nanomaterials showed different specific capacitance (Cs) values for the various nanowires, and the order of Cs values are as follows: wire-like clusters (small size) > wire-like clusters (large size). The highest Cs of 2.69 F g(-1) was observed for TiO₂ having wire-like structure with small sizes. The study of the long term cycling stability of wire-like clusters (small size) electrode were shown to be stable, retaining ca. 80% of the initial specific capacitance, even after 5000 cycles. The potentiality of the DNA-TiO₂ nanomaterials was also tested in photo-voltaic applications and the observed efficiency was found higher in the case of wire-like TiO₂ nanostructures with larger sizes compared to smaller sizes. In future, the described method can be extended for the synthesis of other oxide based materials on DNA scaffold and can be further used in other applications like sensors, Li-ion battery materials or treatment for environmental waste water.

  14. The protective effect of clay minerals against damage to adsorbed DNA induced by cadmium and mercury.

    PubMed

    Hou, Yakun; Wu, Pingxiao; Zhu, Nengwu

    2014-01-01

    The adsorption of Salmon Sperm DNA on three kinds of raw clay (rectorite, montmorillonite and sericite) was investigated as a function of pH, ionic strength and the concentrations of DNA and phosphate ions in solution. The DNA adsorption was reduced in the following order: rectorite>montmorillonite>sericite. Based on these findings, there is a strong evidence that the mechanisms for DNA adsorption on clay involve electrostatic forces, cation bridging and ligand exchange. Cyclic voltammetry (CV) and UV-vis absorption and fluorescence spectroscopy were used to compare the properties of unbound DNA and the absorbed DNA on rectorite, both in the absence and presence of Cd(2+) and Hg(2+) inaqueous solutions. The interaction of heavy metals with the unbound DNA was evidenced by the disappearance of reduction peaks in CV, a small bathochromic shift in UV-vis spectroscopy and an incomplete quenching in the emission spectra. Such changes were not observed in the DNA-rectorite hybrids, which is evidence that adsorption on the clay can reduce the extent of the DNA damage caused by heavy metals. Therefore, in these experience the rectorite played an important role in protecting DNA against Cd(2+) and Hg(2+) induced damage.

  15. Conformational selection and induced fit for RNA polymerase and RNA/DNA hybrid backtracked recognition

    PubMed Central

    Wu, Jian; Ye, Wei; Yang, Jingxu; Chen, Hai-Feng

    2015-01-01

    RNA polymerase catalyzes transcription with a high fidelity. If DNA/RNA mismatch or DNA damage occurs downstream, a backtracked RNA polymerase can proofread this situation. However, the backtracked mechanism is still poorly understood. Here we have performed multiple explicit-solvent molecular dynamics (MD) simulations on bound and apo DNA/RNA hybrid to study backtracked recognition. MD simulations at room temperature suggest that specific electrostatic interactions play key roles in the backtracked recognition between the polymerase and DNA/RNA hybrid. Kinetics analysis at high temperature shows that bound and apo DNA/RNA hybrid unfold via a two-state process. Both kinetics and free energy landscape analyses indicate that bound DNA/RNA hybrid folds in the order of DNA/RNA contracting, the tertiary folding and polymerase binding. The predicted Φ-values suggest that C7, G9, dC12, dC15, and dT16 are key bases for the backtracked recognition of DNA/RNA hybrid. The average RMSD values between the bound structures and the corresponding apo ones and Kolmogorov-Smirnov (KS) P-test analyses indicate that the recognition between DNA/RNA hybrid and polymerase might follow an induced fit mechanism for DNA/RNA hybrid and conformation selection for polymerase. Furthermore, this method could be used to relative studies of specific recognition between nucleic acid and protein. PMID:26594643

  16. Single-cell analysis challenges the connection between autophagy and senescence induced by DNA damage.

    PubMed

    Filippi-Chiela, Eduardo Cremonese; Bueno e Silva, Mardja Manssur; Thomé, Marcos Paulo; Lenz, Guido

    2015-01-01

    Autophagy and senescence have been described as central features of cell biology, but the interplay between these mechanisms remains obscure. Using a therapeutically relevant model of DNA damage-induced senescence in human glioma cells, we demonstrated that acute treatment with temozolomide induces DNA damage, a transitory activation of PRKAA/AMPK-ULK1 and MAPK14/p38 and the sustained inhibition of AKT-MTOR. This produced a transient induction of autophagy, which was followed by senescence. However, at the single cell level, this coordinated transition was not observed, and autophagy and senescence were triggered in a very heterogeneous manner. Indeed, at a population level, autophagy was highly negatively correlated with senescence markers, while in single cells this correlation did not exist. The inhibition of autophagy triggered apoptosis and decreased senescence, while its activation increased temozolomide-induced senescence, showing that DNA damage-induced autophagy acts by suppressing apoptosis.

  17. Regulation of DNA damage-induced apoptosis by the c-Abl tyrosine kinase

    PubMed Central

    Yuan, Zhi-Min; Huang, Yinyin; Ishiko, Takatoshi; Kharbanda, Surender; Weichselbaum, Ralph; Kufe, Donald

    1997-01-01

    Activation of the c-Abl protein tyrosine kinase by certain DNA-damaging agents contributes to down-regulation of Cdk2 and G1 arrest by a p53-dependent mechanism. The present work investigates the potential role of c-Abl in apoptosis induced by DNA damage. Transient transfection studies with wild-type, but not kinase-inactive, c-Abl demonstrate induction of apoptosis. Cells that stably express inactive c-Abl exhibit resistance to ionizing radiation-induced loss of clonogenic survival and apoptosis. Cells null for c-abl are also impaired in the apoptotic response to ionizing radiation. We further show that cells deficient in p53 undergo apoptosis in response to expression of c-Abl and exhibit decreases in radiation-induced apoptosis when expressing inactive c-Abl. These findings suggest that c-Abl kinase regulates DNA damage-induced apoptosis. PMID:9037071

  18. Cytometric analysis of DNA changes induced by sulfur mustard

    SciTech Connect

    Smith, W.J.; Sanders, K.M.; Ruddle, S.E.; Gross, C.L.

    1993-05-13

    Sulfur mustard is an alkylating agent which causes severe, potentially debilitating blisters following cutaneous exposure. Its mechanism of pathogenesis is unknown and no antidote exists to prevent its pathology. The biochemical basis of sulfur mustard's vesicating activity has been hypothesized to be a cascade of events beginning with alkylation of DNA. Using human cells in culture, we have assessed the effects of sulfur mustard on cell cycle activity using flow cytometry with propidium iodide. Two distinct patterns emerged, a Gl/S interface block at concentrations equivalent to vesicating doses (>50-micronM) and a G2 block at 10-fold lower concentrations. In addition, noticeable increases in amount of dye uptake were observed at 4 and 24 hours after sulfur mustard exposure. These increases are believed to be related to DNA repair activities and can be prevented by treatment of the cells with niacinamide, which inhibits DNA repair. Other drugs which provide alternate alkylating sites or inhibit cell cycle progression were shown to lower the cytotoxicity of sulfur mustard and to protect against its direct DNA damaging effects.

  19. DNA Methylation in the Medial Prefrontal Cortex Regulates Alcohol-Induced Behavior and Plasticity

    PubMed Central

    Tapocik, Jenica D.; Juergens, Nathan; Pitcairn, Caleb; Borich, Abbey; Schank, Jesse R.; Sun, Hui; Schuebel, Kornel; Zhou, Zhifeng; Yuan, Qiaoping; Vendruscolo, Leandro F.; Goldman, David; Heilig, Markus

    2015-01-01

    Recent studies have suggested an association between alcoholism and DNA methylation, a mechanism that can mediate long-lasting changes in gene transcription. Here, we examined the contribution of DNA methylation to the long-term behavioral and molecular changes induced by a history of alcohol dependence. In search of mechanisms underlying persistent rather than acute dependence-induced neuroadaptations, we studied the role of DNA methylation regulating medial prefrontal cortex (mPFC) gene expression and alcohol-related behaviors in rats 3 weeks into abstinence following alcohol dependence. Postdependent rats showed escalated alcohol intake, which was associated with increased DNA methylation as well as decreased expression of genes encoding synaptic proteins involved in neurotransmitter release in the mPFC. Infusion of the DNA methyltransferase inhibitor RG108 prevented both escalation of alcohol consumption and dependence-induced downregulation of 4 of the 7 transcripts modified in postdependent rats. Specifically, RG108 treatment directly reversed both downregulation of synaptotagmin 2 (Syt2) gene expression and hypermethylation on CpG#5 of its first exon. Lentiviral inhibition of Syt2 expression in the mPFC increased aversion-resistant alcohol drinking, supporting a mechanistic role of Syt2 in compulsive-like behavior. Our findings identified a functional role of DNA methylation in alcohol dependence-like behavioral phenotypes and a candidate gene network that may mediate its effects. Together, these data provide novel evidence for DNA methyltransferases as potential therapeutic targets in alcoholism. PMID:25878287

  20. DNA methylation in the medial prefrontal cortex regulates alcohol-induced behavior and plasticity.

    PubMed

    Barbier, Estelle; Tapocik, Jenica D; Juergens, Nathan; Pitcairn, Caleb; Borich, Abbey; Schank, Jesse R; Sun, Hui; Schuebel, Kornel; Zhou, Zhifeng; Yuan, Qiaoping; Vendruscolo, Leandro F; Goldman, David; Heilig, Markus

    2015-04-15

    Recent studies have suggested an association between alcoholism and DNA methylation, a mechanism that can mediate long-lasting changes in gene transcription. Here, we examined the contribution of DNA methylation to the long-term behavioral and molecular changes induced by a history of alcohol dependence. In search of mechanisms underlying persistent rather than acute dependence-induced neuroadaptations, we studied the role of DNA methylation regulating medial prefrontal cortex (mPFC) gene expression and alcohol-related behaviors in rats 3 weeks into abstinence following alcohol dependence. Postdependent rats showed escalated alcohol intake, which was associated with increased DNA methylation as well as decreased expression of genes encoding synaptic proteins involved in neurotransmitter release in the mPFC. Infusion of the DNA methyltransferase inhibitor RG108 prevented both escalation of alcohol consumption and dependence-induced downregulation of 4 of the 7 transcripts modified in postdependent rats. Specifically, RG108 treatment directly reversed both downregulation of synaptotagmin 2 (Syt2) gene expression and hypermethylation on CpG#5 of its first exon. Lentiviral inhibition of Syt2 expression in the mPFC increased aversion-resistant alcohol drinking, supporting a mechanistic role of Syt2 in compulsive-like behavior. Our findings identified a functional role of DNA methylation in alcohol dependence-like behavioral phenotypes and a candidate gene network that may mediate its effects. Together, these data provide novel evidence for DNA methyltransferases as potential therapeutic targets in alcoholism.

  1. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton

    SciTech Connect

    Malloy, K.D.; Holman, M.A.; Mitchell, D.

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlated with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. 54 refs., 4 figs., 2 tabs.

  2. Rofecoxib prevents ctdsDNA against damage induced by copper sulfate and ultraviolet B radiation in vitro study.

    PubMed

    Al-Nimer, Marwan S M; Al-Deen, Suad M; Abdul Lateef, Zainab W

    2010-12-01

    Rofecoxib is a selective cyclooxygenase COX-2 enzyme inhibitor with chemoprotective effect against cancer in experimental models. This study aimed to investigate the effect of rofecoxib against ctds DNA damage induced by copper ions or ultraviolet (UV)B radiation. Aliquot ctdsDNA samples were incubated with copper sulfate solution (50 nmol) and rofecoxib (0.8 mol) was added either before or after the admixing the ctdsDNA with copper sulfate. In another experimental series, aliquot of ctdsDNA were exposed to UVB radiation for 30 min in absence or presence of rofecoxib. Rofecoxib significantly attenuated the separation of double strands of DNA (detected by increase the absorbance of DNA at 260 nm) induced by Cu ions. Rofecoxib significantly offered protection against UVB-induced DNA damage. It is concluded that rofecoxib offered protection against copper ions or UVB induced-DNA damage via different mechanisms not related to the inhibition COX-2.

  3. Microcystin-LR induced DNA damage in human peripheral blood lymphocytes.

    PubMed

    Zegura, B; Gajski, G; Straser, A; Garaj-Vrhovac, V; Filipič, M

    2011-12-24

    Human exposure to microcystins, which are produced by freshwater cyanobacterial species, is of growing concern due to increasing appearance of cyanobacterial blooms as a consequence of global warming and increasing water eutrophication. Although microcystins are considered to be liver-specific, there is evidence that they may also affect other tissues. These substances have been shown to induce DNA damage in vitro and in vivo, but the mechanisms of their genotoxic activity remain unclear. In human peripheral blood lymphocytes (HPBLs) exposure to non-cytotoxic concentrations (0, 0.1, 1 and 10μg/ml) of microcystin-LR (MCLR) induced a dose- and time-dependent increase in DNA damage, as measured with the comet assay. Digestion of DNA from MCLR-treated HPBLs with purified formamidopyrimidine-DNA glycosylase (Fpg) displayed a greater number of DNA strand-breaks than non-digested DNA, confirming the evidence that MCLR induces oxidative DNA damage. With the cytokinesis-block micronucleus assay no statistically significant induction of micronuclei, nucleoplasmic bridges and nuclear buds was observed after a 24-h exposure to MCLR. At the molecular level, no changes in the expression of selected genes involved in the cellular response to DNA damage and oxidative stress were observed after a 4-h exposure to MCLR (1μg/ml). After 24h, DNA damage-responsive genes (p53, mdm2, gadd45a, cdkn1a), a gene involved in apoptosis (bax) and oxidative stress-responsive genes (cat, gpx1, sod1, gsr, gclc) were up-regulated. These results provide strong support that MCLR is an indirectly genotoxic agent, acting via induction of oxidative stress, and that lymphocytes are also the target of microcystin-induced toxicity.

  4. Ultrasensitive electrochemical DNA biosensor based on functionalized gold clusters/graphene nanohybrids coupling with exonuclease III-aided cascade target recycling.

    PubMed

    Wang, Wei; Bao, Ting; Zeng, Xi; Xiong, Huayu; Wen, Wei; Zhang, Xiuhua; Wang, Shengfu

    2017-05-15

    In this work, a novel and ultrasensitive electrochemical biosensor was constructed for DNA detection based on functionalized gold clusters/graphene nanohybrids (AuNCs/GR nanobybrids) and exonuclease III (Exo III)-aided cascade target recycling. By utilizing the capacity of GR as universal template, different metal nanoclusters including AuNCs/GR nanobybrids and PtNCs/GR nanohybrids were synthesized through convenient ultrasonic method. Exo III-aided cascade recycling was initiated by target DNA, generating the final cleavage product (S2), which acted as a linkage between capture probe and the functionalized metal nanoclusters/GR conjugates in the construction of the biosensor. The AuNCs/GR-DNA-enzyme conjugates acted as interfaces of enzyme-catalyzed silver deposition reaction, achieving DNA detection ranging from 0.02 fM to 20 pM with a detection limit of 0.057 fM. In addition, PtNCs/GR-DNA conjugates presented peroxidase-like activity and the functionalized PtNCs/GR nanohybrids-based electrochemical biosensor also realized DNA detection by catalyzing the 3,3',5,5'-tetramethylbenzidine-hydrogen peroxide (TMB-H2O2) system to produce electrochemical signal. This metal clusters/GR-based multiple-amplified electrochemical biosensor provided an universal method for DNA detection.

  5. DNA-damage-inducible (din) loci are transcriptionally activated in competent Bacillus subtilis

    SciTech Connect

    Love, P.E.; Lyle, M.J.; Yasbin, R.E.

    1985-09-01

    DNA damage-inducible (din) operon fusions were generated in Bacillus subtilis by transpositional mutagenesis. These YB886(din::Tn917-lacZ) fusion isolates produced increased ..beta..-galactosidase when exposed to mitomycin C, UV radiation, or ethyl methanesulfonate, indicating that the lacZ structural gene had inserted into host transcriptional units that are induced by a variety of DNA-damaging agents. One of the fusion strains was DNA-repair deficient and phenotypically resembled a UV-sensitive mutant of B. subtilis. Induction of ..beta..-galactosidase also occurred in the competent subpopulation of each of the din fusion strains, independent of exposure to DNA-damaging agents. Both the DNA-damage-inducible and competence-inducible components of ..beta..-galactosidase expression were abolished by the recE4 mutation, which inhibits SOS-like (SOB) induction but does not interfere with the development of the component state. The results indicate that gene expression is stimulated at specific loci within the B. subtilis chromosome both by DNA-damaging agents and by the development of competence and that this response is under the control of the SOB regulatory system. Furthermore, they demonstrate that at the molecular level SOB induction and the development of competence are interrelated cellular events.

  6. Mechanisms of ion-bombardment-induced DNA transfer into bacterial E. coli cells

    NASA Astrophysics Data System (ADS)

    Yu, L. D.; Sangwijit, K.; Prakrajang, K.; Phanchaisri, B.; Thongkumkoon, P.; Thopan, P.; Singkarat, S.; Anuntalabhochai, S.

    2014-05-01

    As a useful ion beam biotechnology, ion-bombardment-induced DNA transfer into bacterial Escherichia coli (E. coli) cells has been successfully operated using argon ions. In the process ion bombardment of the bacterial cells modifies the cell envelope materials to favor the exogenous DNA molecules to pass through the envelope to enter the cell. The occurrence of the DNA transfer induction was found ion energy and fluence dependent in a complex manner. At ion energy of a few keV and a few tens of keV to moderate fluences the DNA transfer could be induced by ion bombardment of the bacterial cells, while at the same ion energy but to high fluences DNA transfer could not be induced. On the other hand, when the ion energy was medium, about 10-20 keV, the DNA transfer could not be induced by ion bombardment of the cells. The complexity of the experimental results indicated a complex mechanism which should be related to the complex structure of the bacterial E. coli cell envelope. A phase diagram was proposed to interpret different mechanisms involved as functions of the ion energy and fluence.

  7. Both physiological and pharmacological levels of melatonin reduce DNA adduct formation induced by the carcinogen safrole.

    PubMed

    Tan, D; Reiter, R J; Chen, L D; Poeggeler, B; Manchester, L C; Barlow-Walden, L R

    1994-02-01

    Hepatic DNA adduct formation induced by the chemical carcinogen, safrole, was suppressed by both endogenous pineal melatonin release and by the exogenous administration of melatonin to rats. DNA damage after administration of of melatonin to rats. DNA damage after administration of 100 mg/kg safrole (i.p.) was measured by the P1 enhanced 32P-postlabeling analysis method. The RAL (relative adduct labeling) x 10(7) of carcinogen modified DNA in the liver of untreated controls and in safrole treated animals killed during the day, at night, after pinealectomy and pinealectomy plus melatonin injection (0.15 mg/kg x 4 or a total of 0.6 mg/kg) was 0, 12.6 +/- 0.75, 10.9 +/- 0.72, 13.6 +/- 1.12 and 5.7 +/- 0.53 respectively. For the same groups of animals, circulating melatonin levels at the termination of the study were 31 +/- 3, 29 +/- 2, 276 +/- 31, 24 +/- 1 and 13,950 +/- 1016 pg/ml serum respectively. The higher the melatonin concentration in the serum the lower was DNA adduct formation in the rat liver. Thus, high nocturnal levels of melatonin were protective against safrole-induced DNA damage. These findings indicate that the functional pineal gland plays an important role in oncostatic actions of carcinogens such as safrole. At physiological levels, melatonin seemed to prevent especially the formation of what was referred to as the N1 DNA adduct. Melatonin's ability to suppress DNA adduct formation may relate to its inhibitory effect on a mixed function oxidase, cytochrome p-450, and on the recently identified hydroxyl radical scavenging capacity of the indole. The oncostatic action of melatonin is also suggested by its nuclear accumulation and DNA stabilization characteristics. At pharmacological levels melatonin is extremely potent in preventing DNA modification induced by the chemical carcinogen, safrole.

  8. A human cellular sequence implicated in trk oncogene activation is DNA damage inducible

    SciTech Connect

    Ben-Ishai, R.; Scharf, R.; Sharon, R.; Kapten, I. )

    1990-08-01

    Xeroderma pigmentosum cells, which are deficient in the repair of UV light-induced DNA damage, have been used to clone DNA-damage-inducible transcripts in human cells. The cDNA clone designated pC-5 hybridizes on RNA gel blots to a 1-kilobase transcript, which is moderately abundant in nontreated cells and whose synthesis is enhanced in human cells following UV irradiation or treatment with several other DNA-damaging agents. UV-enhanced transcription of C-5 RNA is transient and occurs at lower fluences and to a greater extent in DNA-repair-deficient than in DNA-repair-proficient cells. Southern blot analysis indicates that the C-5 gene belongs to a multigene family. A cDNA clone containing the complete coding sequence of C-5 was isolated. Sequence analysis revealed that it is homologous to a human cellular sequence encoding the amino-terminal activating sequence of the trk-2h chimeric oncogene. The presence of DNA-damage-responsive sequences at the 5' end of a chimeric oncogene could result in enhanced expression of the oncogene in response to carcinogens.

  9. Analysis of the Contribution of Charge Transport in Iodine-125 induced DNA Damage

    PubMed Central

    Ndlebe, Thabisile; Panyutin, Igor; Neumann, Ronald

    2009-01-01

    Auger electron emitters, like iodine-125, are the radionuclides of choice for gene-targeted radiotherapy. The highly localized damage they induced in DNA is produced by three mechanisms: direct damage by the emitted Auger electrons, indirect damage by diffusible free radicals produced by Auger electrons travelling in water, and charge neutralization of the residual, highly positively charged, tellurium daughter atom by stripping electrons from covalent bonds of neighboring residues. The purpose of our work was to determine whether these mechanisms proceed through an intermediate energy transfer step along DNA. It was proposed that this intermediate step proceeds through the charge transport mechanism in DNA. Conventional charge transport has been described as either a hopping mechanism initiated by charge injection into DNA and propagated by charge migration along the DNA, or a tunneling mechanism in which charge moves directly from a donor to an acceptor within DNA. Well-known barriers for the hopping mechanism were used to probe the role of charge transport in 125I induced DNA damage. We studied their effect on the distribution of DNA breaks produced by the decay of iodine-125 in samples frozen at −80°C. We found that these barriers had no measurable effect on the iodine-125 breaks distribution. PMID:20041764

  10. Extracellular DNA Acidifies Biofilms and Induces Aminoglycoside Resistance in Pseudomonas aeruginosa.

    PubMed

    Wilton, Mike; Charron-Mazenod, Laetitia; Moore, Richard; Lewenza, Shawn

    2015-11-09

    Biofilms consist of surface-adhered bacterial communities encased in an extracellular matrix composed of DNA, exopolysaccharides, and proteins. Extracellular DNA (eDNA) has a structural role in the formation of biofilms, can bind and shield biofilms from aminoglycosides, and induces antimicrobial peptide resistance mechanisms. Here, we provide evidence that eDNA is responsible for the acidification of Pseudomonas aeruginosa planktonic cultures and biofilms. Further, we show that acidic pH and acidification via eDNA constitute a signal that is perceived by P. aeruginosa to induce the expression of genes regulated by the PhoPQ and PmrAB two-component regulatory systems. Planktonic P. aeruginosa cultured in exogenous 0.2% DNA or under acidic conditions demonstrates a 2- to 8-fold increase in aminoglycoside resistance. This resistance phenotype requires the aminoarabinose modification of lipid A and the production of spermidine on the bacterial outer membrane, which likely reduce the entry of aminoglycosides. Interestingly, the additions of the basic amino acid L-arginine and sodium bicarbonate neutralize the pH and restore P. aeruginosa susceptibility to aminoglycosides, even in the presence of eDNA. These data illustrate that the accumulation of eDNA in biofilms and infection sites can acidify the local environment and that acidic pH promotes the P. aeruginosa antibiotic resistance phenotype.

  11. Listeria monocytogenes induces host DNA damage and delays the host cell cycle to promote infection

    PubMed Central

    Leitão, Elsa; Costa, Ana Catarina; Brito, Cláudia; Costa, Lionel; Pombinho, Rita; Cabanes, Didier; Sousa, Sandra

    2014-01-01

    Listeria monocytogenes (Lm) is a human intracellular pathogen widely used to uncover the mechanisms evolved by pathogens to establish infection. However, its capacity to perturb the host cell cycle was never reported. We show that Lm infection affects the host cell cycle progression, increasing its overall duration but allowing consecutive rounds of division. A complete Lm infectious cycle induces a S-phase delay accompanied by a slower rate of DNA synthesis and increased levels of host DNA strand breaks. Additionally, DNA damage/replication checkpoint responses are triggered in an Lm dose-dependent manner through the phosphorylation of DNA-PK, H2A.X, and CDC25A and independently from ATM/ATR. While host DNA damage induced exogenously favors Lm dissemination, the override of checkpoint pathways limits infection. We propose that host DNA replication disturbed by Lm infection culminates in DNA strand breaks, triggering DNA damage/replication responses, and ensuring a cell cycle delay that favors Lm propagation. PMID:24552813

  12. Damage to dry plasmid DNA induced by nanosecond XUV-laser pulses

    NASA Astrophysics Data System (ADS)

    Nováková, Eva; Davídková, Marie; Vyšín, Ludék; Burian, Tomáš; Grisham, Michael E.; Heinbuch, Scott; Rocca, Jorge J.; Juha, Libor

    2011-06-01

    Ionizing radiation induces a variety of DNA damages including single-strand breaks (SSBs), double-strand breaks (DSBs), abasic sites, modified sugar and bases. Most theoretical and experimental studies have been focused on DNA strand scissions, in particular production of DNA double-strand breaks. DSBs have been proven to be a key damage at a molecular level responsible for the formation of chromosomal aberrations, leading often to cell death. The complexity of lesions produced in DNA by ionizing radiations is thought to depend on the amount of energy deposited at the site of each lesion. We have studied the nature of DNA damage induced directly by the pulsed 46.9 nm radiation provided by a capillary-discharge Ne-like Ar laser (CDL). Different surface doses were delivered with a repetition rate of a few Hz and an average pulse energy ~ 1 μJ. A simple model DNA molecule, i.e., dried closed-circular plasmid DNA (pBR322), was irradiated. The agarose gel electrophoresis method was used for determination of both SSB and DSB yields. Results are compared with a previous study of plasmid DNA irradiated with a single sub-nanosecond 1-keV X-ray pulse produced by a large-scale, double-stream gas puff target, illuminated by sub-kJ, near-infrared (NIR) focused laser pulses at the PALS facility (Prague Asterix Laser System).

  13. Molecular-based rapid inventories of sympatric diversity: a comparison of DNA barcode clustering methods applied to geography-based vs clade-based sampling of amphibians.

    PubMed

    Paz, Andrea; Crawford, Andrew J

    2012-11-01

    Molecular markers offer a universal source of data for quantifying biodiversity. DNA barcoding uses a standardized genetic marker and a curated reference database to identify known species and to reveal cryptic diversity within wellsampled clades. Rapid biological inventories, e.g. rapid assessment programs (RAPs), unlike most barcoding campaigns, are focused on particular geographic localities rather than on clades. Because of the potentially sparse phylogenetic sampling, the addition of DNA barcoding to RAPs may present a greater challenge for the identification of named species or for revealing cryptic diversity. In this article we evaluate the use of DNA barcoding for quantifying lineage diversity within a single sampling site as compared to clade-based sampling, and present examples from amphibians. We compared algorithms for identifying DNA barcode clusters (e.g. species, cryptic species or Evolutionary Significant Units) using previously published DNA barcode data obtained from geography-based sampling at a site in Central Panama, and from clade-based sampling in Madagascar. We found that clustering algorithms based on genetic distance performed similarly on sympatric as well as clade-based barcode data, while a promising coalescent-based method performed poorly on sympatric data. The various clustering algorithms were also compared in terms of speed and software implementation. Although each method has its shortcomings in certain contexts, we recommend the use of the ABGD method, which not only performs fairly well under either sampling method, but does so in a few seconds and with a user-friendly Web interface.

  14. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    PubMed Central

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-01-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  15. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.

    1989-01-01

    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  16. Botanical Extracts as Medical Countermeasures for Radiation Induced DNA Damage

    DTIC Science & Technology

    2012-03-01

    seed extract supplements and Labrador tea whole leaf extracts as potential radioprotectants. Three different commercial grape seed extracts were... supplements and Labrador tea whole leaf extracts as potential radioprotectants. A novel assay was used to compare DNA damage in cellular and...concentrations of commercial grape seed extract supplements and Labrador tea. In addition, this work has identified and validated a set of procedures to use

  17. Alkylation Induced DNA Repair and Mutagenesis in Escherichia coli.

    DTIC Science & Technology

    1987-11-23

    III (Gates and inn, 1977), Micrococcus luteus UV endo- nuclease (Grossman et al, 1978) and bacteriophage T UV endonuclease (Warner et al, 1980) have DNA...34, Garland Publishing, Inc. New York & London USA. Ather, A., Z. Ahmed and S. Riazxxddin, 1984. Adaptive response of Micrococcus luteus to alkylating...Laval, J., 3. Pierre and F. Laval. 1981. Release of 7-nmthylguanine residues frain alkylated ENA by extracts of Micrococcus luteus and Escherichia

  18. Repair Machinery for Radiation-Induced DNA Damage

    DTIC Science & Technology

    2000-07-01

    significant defect in the repair of certain DNA damages, but of which damages needs to be determined. We have selected Chinese Hamster Ovary ( CHO ) as...chromosome (BAC) genomic fragment, which we isolated from a CHO BAC library, revealed that APE1 exists as a single copy gene in AA8 (see Appendix, Figure... cells , we first determined the APE1 gene copy number in the CHO AA8 cell line. Fluorescence in situ hybridization with an APE1 bacterial artificial

  19. Crystal Structure of the Lactose Operon Repressor and Its Complexes with DNA and Inducer

    NASA Astrophysics Data System (ADS)

    Lewis, Mitchell; Chang, Geoffrey; Horton, Nancy C.; Kercher, Michele A.; Pace, Helen C.; Schumacher, Maria A.; Brennan, Richard G.; Lu, Ponzy

    1996-03-01

    The lac operon of Escherichia coli is the paradigm for gene regulation. Its key component is the lac repressor, a product of the lacI gene. The three-dimensional structures of the intact lac repressor, the lac repressor bound to the gratuitous inducer isopropyl-β-D-1-thiogalactoside (IPTG) and the lac repressor complexed with a 21-base pair symmetric operator DNA have been determined. These three structures show the conformation of the molecule in both the induced and repressed states and provide a framework for understanding a wealth of biochemical and genetic information. The DNA sequence of the lac operon has three lac repressor recognition sites in a stretch of 500 base pairs. The crystallographic structure of the complex with DNA suggests that the tetrameric repressor functions synergistically with catabolite gene activator protein (CAP) and participates in the quaternary formation of repression loops in which one tetrameric repressor interacts simultaneously with two sites on the genomic DNA.

  20. Exposure to 1800 MHz radiofrequency radiation induces oxidative damage to mitochondrial DNA in primary cultured neurons.

    PubMed

    Xu, Shangcheng; Zhou, Zhou; Zhang, Lei; Yu, Zhengping; Zhang, Wei; Wang, Yuan; Wang, Xubu; Li, Maoquan; Chen, Yang; Chen, Chunhai; He, Mindi; Zhang, Guangbin; Zhong, Min

    2010-01-22

    Increasing evidence indicates that oxidative stress may be involved in the adverse effects of radiofrequency (RF) radiation on the brain. Because mitochondrial DNA (mtDNA) defects are closely associated with various nervous system diseases and mtDNA is particularly susceptible to oxidative stress, the purpose of this study was to determine whether radiofrequency radiation can cause oxidative damage to mtDNA. In this study, we exposed primary cultured cortical neurons to pulsed RF electromagnetic fields at a frequency of 1800 MHz modulated by 217 Hz at an average special absorption rate (SAR) of 2 W/kg. At 24 h after exposure, we found that RF radiation induced a significant increase in the levels of 8-hydroxyguanine (8-OHdG), a common biomarker of DNA oxidative damage, in the mitochondria of neurons. Concomitant with this finding, the copy number of mtDNA and the levels of mitochondrial RNA (mtRNA) transcripts showed an obvious reduction after RF exposure. Each of these mtDNA disturbances could be reversed by pretreatment with melatonin, which is known to be an efficient antioxidant in the brain. Together, these results suggested that 1800 MHz RF radiation could cause oxidative damage to mtDNA in primary cultured neurons. Oxidative damage to mtDNA may account for the neurotoxicity of RF radiation in the brain.

  1. The Potential Role of 8-Oxoguanine DNA Glycosylase-Driven DNA Base Excision Repair in Exercise-Induced Asthma

    PubMed Central

    Belanger, KarryAnne K.; Ameredes, Bill T.; Boldogh, Istvan

    2016-01-01

    Asthma is characterized by reversible airway narrowing, shortness of breath, wheezing, coughing, and other symptoms driven by chronic inflammatory processes, commonly triggered by allergens. In 90% of asthmatics, most of these symptoms can also be triggered by intense physical activities and severely exacerbated by environmental factors. This condition is known as exercise-induced asthma (EIA). Current theories explaining EIA pathogenesis involve osmotic and/or thermal alterations in the airways caused by changes in respiratory airflow during exercise. These changes, along with existing airway inflammatory conditions, are associated with increased cellular levels of reactive oxygen species (ROS) affecting important biomolecules including DNA, although the underlying molecular mechanisms have not been completely elucidated. One of the most abundant oxidative DNA lesions is 8-oxoguanine (8-oxoG), which is repaired by 8-oxoguanine DNA glycosylase 1 (OGG1) during the base excision repair (BER) pathway. Whole-genome expression analyses suggest a cellular response to OGG1-BER, involving genes that may have a role in the pathophysiology of EIA leading to mast cell degranulation, airway hyperresponsiveness, and bronchoconstriction. Accordingly, this review discusses a potential new hypothesis in which OGG1-BER-induced gene expression is associated with EIA symptoms. PMID:27524866

  2. Staphylococcus aureus Sepsis Induces Early Renal Mitochondrial DNA Repair and Mitochondrial Biogenesis in Mice

    PubMed Central

    Bartz, Raquel R.; Fu, Ping; Suliman, Hagir B.; Crowley, Stephen D.; MacGarvey, Nancy Chou; Welty-Wolf, Karen; Piantadosi, Claude A.

    2014-01-01

    Acute kidney injury (AKI) contributes to the high morbidity and mortality of multi-system organ failure in sepsis. However, recovery of renal function after sepsis-induced AKI suggests active repair of energy-producing pathways. Here, we tested the hypothesis in mice that Staphyloccocus aureus sepsis damages mitochondrial DNA (mtDNA) in the kidney and activates mtDNA repair and mitochondrial biogenesis. Sepsis was induced in wild-type C57Bl/6J and Cox-8 Gfp-tagged mitochondrial-reporter mice via intraperitoneal fibrin clots embedded with S. aureus. Kidneys from surviving mice were harvested at time zero (control), 24, or 48 hours after infection and evaluated for renal inflammation, oxidative stress markers, mtDNA content, and mitochondrial biogenesis markers, and OGG1 and UDG mitochondrial DNA repair enzymes. We examined the kidneys of the mitochondrial reporter mice for changes in staining density and distribution. S. aureus sepsis induced sharp amplification of renal Tnf, Il-10, and Ngal mRNAs with decreased renal mtDNA content and increased tubular and glomerular cell death and accumulation of protein carbonyls and 8-OHdG. Subsequently, mtDNA repair and mitochondrial biogenesis was evidenced by elevated OGG1 levels and significant increases in NRF-1, NRF-2, and mtTFA expression. Overall, renal mitochondrial mass, tracked by citrate synthase mRNA and protein, increased in parallel with changes in mitochondrial GFP-fluorescence especially in proximal tubules in the renal cortex and medulla. Sub-lethal S. aureus sepsis thus induces widespread renal mitochondrial damage that triggers the induction of the renal mtDNA repair protein, OGG1, and mitochondrial biogenesis as a conspicuous resolution mechanism after systemic bacterial infection. PMID:24988481

  3. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.

    2011-01-01

    UVA has long been known for generating an oxidative stress in cells. In this paper we review the different types of DNA damage induced by UVA, i.e. strand breaks, bipyrimidine photoproducts, and oxidatively damaged bases. Emphasis is given to the mechanism of formation that is further illustrated by the presentation of new in vitro data. Examples of oxidation of proteins involved in DNA metabolism are also given.

  4. Melatonin attenuates brain mitochondria DNA damage induced by potassium cyanide in vivo and in vitro.

    PubMed

    Yamamoto, Hiro-aki; Mohanan, Parayanthala V

    2002-09-30

    The effect of potassium cyanide on mitochondria DNA (mtDNA) in mouse brain was investigated in vivo and in vitro. When potassium cyanide (0, 0.1, 1.0 or 2.0 mM) was incubated with a crude mitochondria fraction prepared from mouse brain at 37 degrees C for 60 min, the damage of mtDNA was observed in a concentration-dependent manner. However, the mtDNA damage was prevented by a co-treatment with melatonin (1.5 mM), a scavenger of hydroxyl radicals (*OH). Furthermore, a subcutaneous injection of potassium cyanide (7mg/kg) caused both brain mtDNA damage and severe seizures in mouse. The damage of mtDNA and seizures induced by potassium cyanide were abolished by the pre-injection of melatonin (20 mg/kg). Hydrogen peroxide (1.5 mM) inflicted damage to brain mtDNA in the presence of Fe(2+) (3.0 microM). The damage was abolished by the co-treatment with melatonin. Furthermore, when cyanide (0, 0.1 or 1.0 mM) was incubated with the crude mitochondria fraction prepared from mouse brain, the lipid peroxidation was significantly increased in a concentration-dependent manner. The increased lipid peroxidation was completely inhibited by the co-treatment with melatonin (1.0 mM). These results suggest that reactive oxygen species including the *OH may play a cardinal role for mtDNA damage induced by potassium cyanide. Hence, the present study concluded that melatonin protects against DNA damage induced by the *OH produced by cyanide or hydrogen peroxide.

  5. The production and repair of aflatoxin B sub 1 -induced DNA damage

    SciTech Connect

    Leadon, S.A.

    1990-05-01

    To investigate the influence of function or activity of a DNA sequence on its repair, we have studied excision repair of aflatoxin B{sub 1} (AFB{sub 1})-induced damage in the nontranscribed, heterochromatic alpha DNA of monkey cells and in the metallothionein genes of human cells. In confluent cells, AFB{sub 1} adducts are produced in similar frequencies in alpha and in the rest of the DNA, but removal from alpha DNA is severely deficient, however, removal of AFB{sub 1} adducts from alpha DNA is enhanced by small doses of UV. The repair deficiencies are not observed in actively growing cells. We have also shown that there is preferential repair of AFB{sub 1} damage in active genes. AFB{sub 1} damage is efficiently repaired in the active human metallothionein (hMT) genes, but deficiently repaired in inactive hMT genes. 51 refs., 3 tabs.

  6. DNA demethylation induced by 5-azacytidine does not affect fragile X expression.

    PubMed Central

    Glover, T W; Coyle-Morris, J; Pearce-Birge, L; Berger, C; Gemmill, R M

    1986-01-01

    Experiments were performed to determine the role of DNA demethylation in fragile X expression. Fragile X positive lymphoblastoid cells were treated with 5-azacytidine and harvested for analysis of fragile X expression both directly following treatment and after a recovery period in the absence of the drug. The effectiveness of 5-azacytidine treatment in inducing DNA demethylation was concurrently monitored by analysis of methylation changes at random autosomal loci in isolated DNA from treated cells. Under conditions where 5-azacytidine was found to inhibit fragile X expression, no DNA demethylation was observed. At the time when demethylation did occur, fragile X expression was not affected. These results strongly indicate that DNA demethylation is not involved in fragile X expression. Images Fig. 1 PMID:2420174

  7. DNA demethylation caused by 5-Aza-2′-deoxycytidine induces mitotic alterations and aneuploidy

    PubMed Central

    Lentini, Laura; Cilluffo, Danilo; Di Leonardo, Aldo

    2016-01-01

    Aneuploidy, the unbalanced number of chromosomes in a cell, is considered a prevalent form of genetic instability and is largely acknowledged as a condition implicated in tumorigenesis. Epigenetic alterations like DNA hypomethylation have been correlated with cancer initiation/progression. Furthermore, a growing body of evidence suggests the involvement of epigenome-wide disruption as a cause of global DNA hypomethylation in aneuploidy generation. Here, we report that the DNA hypomethylating drug 5-aza-2′-deoxycytidine (DAC), affects the correct ploidy of nearly diploid HCT-116 human cells by altering the methylation pattern of the chromosomes. Specifically, we show that a DAC-induced reduction of 5-Methyl Cytosine at the pericentromeric region of chromosomes correlates with aneuploidy and mitotic defects. Our results suggest that DNA hypomethylation leads to aneuploidy by altering the DNA methylation landscape at the centromere that is necessary to ensure proper chromosomes segregation by recruiting the proteins necessary to build up a functional kinetochore. PMID:26771138

  8. Condensations of single DNA molecules induced by heptaplatin and its chiral isomer

    SciTech Connect

    Zhang, Hong-Yan; Liu, Yu-Ru; Li, Wei; Li, Hui; Dou, Shuo-Xing; Xie, Ping; Wang, Wei-Chi; Wang, Peng-Ye

    2014-08-15

    Heptaplatin is a third-generation platinum antitumor drug. It has a chiral isomer. We studied the interactions between the two isomers and DNA by using magnetic tweezers and atomic force microscopy (AFM) to investigate the effect of chiralities of the isomers on the interactions. We found that the extension curves and average condensation rates of DNA molecules incubated with heptaplatin were nearly the same as those incubated with its chiral isomer. In addition, the structures of DNA molecules incubated with heptaplatin were also similar to those incubated with its chiral isomer. These results indicate the difference in chirality of the two isomers does not induce different interactions of the isomers with DNA. Our study may facilitate the understanding of interactions of platinum complexes with DNA and the design of new antitumor platinum complexes.

  9. Condensations of single DNA molecules induced by heptaplatin and its chiral isomer

    NASA Astrophysics Data System (ADS)

    Zhang, Hong-Yan; Liu, Yu-Ru; Li, Wei; Li, Hui; Dou, Shuo-Xing; Xie, Ping; Wang, Wei-Chi; Wang, Peng-Ye

    2014-08-01

    Heptaplatin is a third-generation platinum antitumor drug. It has a chiral isomer. We studied the interactions between the two isomers and DNA by using magnetic tweezers and atomic force microscopy (AFM) to investigate the effect of chiralities of the isomers on the interactions. We found that the extension curves and average condensation rates of DNA molecules incubated with heptaplatin were nearly the same as those incubated with its chiral isomer. In addition, the structures of DNA molecules incubated with heptaplatin were also similar to those incubated with its chiral isomer. These results indicate the difference in chirality of the two isomers does not induce different interactions of the isomers with DNA. Our study may facilitate the understanding of interactions of platinum complexes with DNA and the design of new antitumor platinum complexes.

  10. Human papillomavirus type 16 DNA-induced malignant transformation of NIH 3T3 cells

    SciTech Connect

    Yasumoto, S.; Burkhardt, A.L.; Doniger, J.; DiPaolo, J.A.

    1986-02-01

    A biological function for human papillomavirus 16 (HPV 16) DNA was demonstrated by transformation of NIH 3T3 cells. HPV 16 DNA has been found frequently in genital cancer and has been classified as a papillomavirus on the basis of DNA homology. A recombinant HPV 16 DNA (pSHPV16d), which contains a head-to-tail dimer of the full-length HPV 16 genome, induced morphologic transformation; the transformed cells were tumorigenic in nude mice. Expression of transforming activity was unique because of the long latency period (more than 4 weeks) required for induction of morphologic transformation and because the transfected DNA existed primarily in a multimeric form with some rearrangement. Furthermore, virus-specific RNAs were expressed in the transformants. The transformation of NIH 3T3 cells provides a model for analyzing the functions of HPV 16, which is associated with cervical carcinomas.

  11. Infectious virus replication in papillomas induced by molecularly cloned cottontail rabbit papillomavirus DNA.

    PubMed Central

    Brandsma, J L; Xiao, W

    1993-01-01

    The ability to obtain infectious papillomavirus virions from molecularly cloned DNA has not been previously reported. We demonstrate here that viral genomes isolated from a recombinant++ DNA clone of cottontail rabbit papillomavirus (CRPV) gave rise to infectious virus when inoculated into cottontail rabbit skin. Replication occurred in papillomas that formed at inoculation sites. Extract of a DNA-induced papilloma was serially passaged to naive rabbits with high efficiency. Complete virus was fractionated on cesium chloride density gradients, and papillomavirus particles were visualized by electron microscopy. CRPV DNA isolated from virions contained DNA sequence polymorphisms that are characteristic of the input CRPV-WA strain of virus, thereby proving that the newly generated virus originated from the molecularly cloned viral genome. These findings indicate that this will be a useful system in which to perform genetic analysis of viral gene functions involved in replication. Images PMID:8380092

  12. DGCR8 Mediates Repair of UV-Induced DNA Damage Independently of RNA Processing.

    PubMed

    Calses, Philamer C; Dhillon, Kiranjit K; Tucker, Nyka; Chi, Yong; Huang, Jen-Wei; Kawasumi, Masaoki; Nghiem, Paul; Wang, Yemin; Clurman, Bruce E; Jacquemont, Celine; Gafken, Philip R; Sugasawa, Kaoru; Saijo, Masafumi; Taniguchi, Toshiyasu

    2017-04-04

    Ultraviolet (UV) radiation is a carcinogen that generates DNA lesions. Here, we demonstrate an unexpected role for DGCR8, an RNA binding protein that canonically functions with Drosha to mediate microRNA processing, in the repair of UV-induced DNA lesions. Treatment with UV induced phosphorylation on serine 153 (S153) of DGCR8 in both human and murine cells. S153 phosphorylation was critical for cellular resistance to UV, the removal of UV-induced DNA lesions, and the recovery of RNA synthesis after UV exposure but not for microRNA expression. The RNA-binding and Drosha-binding activities of DGCR8 were not critical for UV resistance. DGCR8 depletion was epistatic to defects in XPA, CSA, and CSB for UV sensitivity. DGCR8 physically interacted with CSB and RNA polymerase II. JNKs were involved in the UV-induced S153 phosphorylation. These findings suggest that UV-induced S153 phosphorylation mediates transcription-coupled nucleotide excision repair of UV-induced DNA lesions in a manner independent of microRNA processing.

  13. A trap potential model investigation of the optical activity induced in dye-DNA intercalation complexes

    NASA Astrophysics Data System (ADS)

    Kamiya, Mamoru

    1988-02-01

    The fundamental features of the optical activity induced in dye-DNA intercalation complexes are studied by application of the trap potential model which is useful to evaluate the induced rotational strength without reference to detailed geometrical information about the intercalation complexes. The specific effect of the potential depth upon the induced optical activity is explained in terms of the relative magnitudes of the wave-phase and helix-phase variations in the path of an electron moving on a restricted helical segment just like an exciton trapped around the dye intercalation site. The parallel and perpendicular components of the induced rotational strength well reflect basic properties of the helicity effects about the longitudinal and tangential axes of the DNA helical cylinder. The trap potential model is applied to optimize the potential parameters so as to reproduce the ionic strength effect upon the optical activity induced to proflavine-DNA intercalation complexes. From relationships between the optimized potential parameters and ionic strengths, it is inferred that increase in the ionic strength contributes to the optical activity induced by the nearest-neighbour interaction between intercalated proflavine and DNA base pairs.

  14. Protection from heat-induced protein migration and DNA repair inhibition by cycloheximide.

    PubMed

    Armour, E P; Lee, Y J; Corry, P M; Borrelli, M J

    1988-12-15

    The mechanism by which Cycloheximide (CHM) protects cells from heat induced killing has been investigated. Cycloheximide (10 micrograms/ml) added for 2 hr before and during a 3 hour heating at 43 degrees C prevented a 40% increase of heat-induced protein accumulation in the nucleus and protected cells (0.0001 vs. 0.15 surviving fraction) from heat-induced killing. Heat-induced DNA repair inhibition was also suppressed when cells were treated with CHM in the above manner. This combination of results suggests that protein accumulation in the nucleus and inhibition of DNA repair are related and these events are associated with CHM protection from heat induced cell killing.

  15. Simulation of 125I induced DNA strand breaks in a CAP-DNA complex.

    PubMed

    Li, W; Friedland, W; Jacob, P; Paretzke, H G; Panyutin, I; Neumann, R D

    2002-01-01

    The E. coli catabolite gene activator protein (CAP)-DNA complex with 125I located at the position of the H5 atom of the cytosine near the centre was incorporated into the PARTRAC track structure code. DNA strand breaks due to irradiation were calculated by track structure and radical attack simulations; strand breaks due to neutralisation of the highly charged 125Te ion were derived from a semi-empirical distribution. According to the calculations, the neutralisation effect dominates the strand breakage frequency at 2 bases away from the 125I decay site on both strands. The first breakage distribution counted from a 32P labelled end on the strand with 125I agreed well with experimental data, but on the opposite strand, the calculated distribution is more concentrated around the decay site and its yield is about 20% larger than the measured data.

  16. DNA damage induced by chronic inflammation contributes to colon carcinogenesis in mice

    PubMed Central

    Meira, Lisiane B.; Bugni, James M.; Green, Stephanie L.; Lee, Chung-Wei; Pang, Bo; Borenshtein, Diana; Rickman, Barry H.; Rogers, Arlin B.; Moroski-Erkul, Catherine A.; McFaline, Jose L.; Schauer, David B.; Dedon, Peter C.; Fox, James G.; Samson, Leona D.

    2008-01-01

    Chronic inflammation increases cancer risk. While it is clear that cell signaling elicited by inflammatory cytokines promotes tumor development, the impact of DNA damage production resulting from inflammation-associated reactive oxygen and nitrogen species (RONS) on tumor development has not been directly tested. RONS induce DNA damage that can be recognized by alkyladenine DNA glycosylase (Aag) to initiate base excision repair. Using a mouse model of episodic inflammatory bowel disease by repeated administration of dextran sulfate sodium in the drinking water, we show that Aag-mediated DNA repair prevents colonic epithelial damage and reduces the severity of dextran sulfate sodium–induced colon tumorigenesis. Importantly, DNA base lesions expected to be induced by RONS and recognized by Aag accumulated to higher levels in Aag-deficient animals following stimulation of colonic inflammation. Finally, as a test of the generality of this effect we show that Aag-deficient animals display more severe gastric lesions that are precursors of gastric cancer after chronic infection with Helicobacter pylori. These data demonstrate that the repair of DNA lesions formed by RONS during chronic inflammation is important for protection against colon carcinogenesis. PMID:18521188

  17. UV-induced DNA damage in Cyclops abyssorum tatricus populations from clear and turbid alpine lakes

    PubMed Central

    Tartarotti, Barbara; Saul, Nadine; Chakrabarti, Shumon; Trattner, Florian; Steinberg, Christian E. W.; Sommaruga, Ruben

    2014-01-01

    Zooplankton from clear alpine lakes thrive under high levels of solar UV radiation (UVR), but in glacially turbid ones they are more protected from this damaging radiation. Here, we present results from experiments done with Cyclops abyssorum tatricus to assess UV-induced DNA damage and repair processes using the comet assay. Copepods were collected from three alpine lakes of differing UV transparency ranging from clear to glacially turbid, and exposed to artificial UVR. In addition, photoprotection levels [mycosporine-like amino acids (MAAs) and lipophilic antioxidant capacity] were estimated in the test populations. Similar UV-induced DNA damage levels were observed among the copepods from all lakes, but background DNA damage (time zero and dark controls) was lowest in the copepods from the glacially turbid lake, resulting in a higher relative DNA damage accumulation. Most DNA strand breaks were repaired after recovery in the dark. Low MAA concentrations were found in the copepods from the glacially turbid lake, while the highest levels were observed in the population from the most UV transparent lake. However, the highest lipophilic antioxidant capacities were measured in the copepods from the lake with intermediate UV transparency. Photoprotection and the ability to repair DNA damage, and consequently reducing UV-induced damage, are part of the response mechanisms in zooplankton to changes in water transparency caused by glacier retreat. PMID:24616551

  18. Viral Single-Strand DNA Induces p53-Dependent Apoptosis in Human Embryonic Stem Cells

    PubMed Central

    Hirsch, Matthew L.; Fagan, B. Matthew; Dumitru, Raluca; Bower, Jacquelyn J.; Yadav, Swati; Porteus, Matthew H.; Pevny, Larysa H.; Samulski, R. Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication. PMID:22114676

  19. Ultraviolet-induced cell death is independent of DNA replication in rat kangaroo cells.

    PubMed

    Miyaji, E N; Menck, C F

    1995-05-01

    Rat kangaroo (Potorous tridactylus) cells have an efficient repair system for photoreactivation of lethal lesions induced by 254 nm UV. However, this ability is lost with increasing time after UV, being completely ineffective after 24 h. Critical events leading to UV-induced cell death must occur within this period of time. DNA synthesis was inhibited by the DNA polymerase inhibitor aphidicolin and the loss of the capability to photorepair lethal lesions was maintained as for replicating cells. Similar data were obtained in synchronized cells UV irradiated immediately before S phase. Under the same conditions, the ability to remove cyclobutane pyrimidine dimers by photoreactivation in these cells remained unchanged 24 h after irradiation. These data indicate that the critical events responsible for UV-induced cell death occur in the absence of DNA replication.

  20. Target-Induced and Equipment-Free DNA Amplification with a Simple Paper Device.

    PubMed

    Liu, Meng; Hui, Christy Y; Zhang, Qiang; Gu, Jimmy; Kannan, Balamurali; Jahanshahi-Anbuhi, Sana; Filipe, Carlos D M; Brennan, John D; Li, Yingfu

    2016-02-18

    We report on a paper device capable of carrying out target-induced rolling circle amplification (RCA) to produce massive DNA amplicons that can be easily visualized. Interestingly, we observed that RCA was more proficient on paper than in solution, which we attribute to a significantly higher localized concentration of immobilized DNA. Furthermore, we have successfully engineered a fully functional paper device for sensitive DNA or microRNA detection via printing of all RCA-enabling molecules within a polymeric sugar film formed from pullulan, which was integrated with the paper device. This encapsulation not only stabilizes the entrapped reagents at room temperature but also enables colorimetric bioassays with minimal steps.

  1. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    SciTech Connect

    Han, Xu; Ptasinska, Sylwia; Klas, Matej; Liu, Yueying; Sharon Stack, M.

    2013-06-10

    The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

  2. Methylglyoxal-induced DNA-protein cross-links and cytotoxicity in Chinese hamster ovary cells.

    PubMed

    Brambilla, G; Sciabà, L; Faggin, P; Finollo, R; Bassi, A M; Ferro, M; Marinari, U M

    1985-05-01

    The technique of alkaline elution was applied to study the capacity of methylglyoxal to induce DNA damage and repair in Chinese hamster ovary cells. DNA cross-linking was observed after a 90-min exposure to a subtoxic dose (1.5 mM), and the cross-links were fully repaired by 24 h. The cross-linking appeared to be DNA-protein in nature, since proteinase treatment removed the effect. When the same cells were exposed to methylglyoxal in the presence of a rat liver metabolic system, both cytotoxicity and cross-linking frequency were significantly reduced.

  3. DNA damage response induces structural alterations in histone H3–H4

    PubMed Central

    Izumi, Yudai; Fujii, Kentaro; Yamamoto, Satoshi; Matsuo, Koichi; Namatame, Hirofumi; Taniguchi, Masaki; Yokoya, Akinari

    2017-01-01

    Synchrotron-radiation circular-dichroism spectroscopy was used to reveal that the DNA damage response induces a decrement of α-helix and an increment of β-strand contents of histone H3–H4 extracted from X-ray–irradiated human HeLa cells. The trend of the structural alteration was qualitatively opposite to that of our previously reported results for histone H2A–H2B. These results strongly suggest that histones share roles in DNA damage responses, particularly in DNA repair processes and chromatin remodeling, via a specific structural alteration of each histone. PMID:27672100

  4. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    SciTech Connect

    Kim, G. J.; Lee, J. K.; Kim, W.; Kim, K. T.

    2010-01-11

    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  5. Photo-Induced Click Chemistry for DNA Surface Structuring by Direct Laser Writing.

    PubMed

    Kerbs, Antonina; Mueller, Patrick; Kaupp, Michael; Ahmed, Ishtiaq; Quick, Alexander S; Abt, Doris; Wegener, Martin; Niemeyer, Christof M; Barner-Kowollik, Christopher; Fruk, Ljiljana

    2017-02-15

    Oligonucleotides containing photo-caged dienes were prepared and shown to react quantitatively in a light-induced Diels-Alder cycloaddition with functional maleimides in aqueous solution within minutes. Due to its high yield and fast rate, the reaction was exploited for DNA surface patterning with sub-micrometer resolution employing direct laser writing (DLW). Functional DNA arrays were written by direct laser writing (DLW) in variable patterns, which were further encoded with fluorophores and proteins through DNA directed immobilization. This mild and efficient light-driven platform technology holds promise for the fabrication of complex bioarrays with sub-micron resolution.

  6. Spatiotemporal kinetics of γ-H2AX protein on charged particles induced DNA damage

    NASA Astrophysics Data System (ADS)

    Niu, H.; Chang, H. C.; Cho, I. C.; Chen, C. H.; Liu, C. S.; Chou, W. T.

    2014-08-01

    In several researches, it has been demonstrated that charged particles can induce more complex DNA damages. These complex damages have higher ability to cause the cell death or cell carcinogenesis. For this reason, clarifying the DNA repair mechanism after charged particle irradiation plays an important role in the development of charged particle therapy and space exploration. Unfortunately, the detail spatiotemporal kinetic of DNA damage repair is still unclear. In this study, we used γ-H2AX protein to investigate the spatiotemporal kinetics of DNA double strand breaks in alpha-particle irradiated HeLa cells. The result shows that the intensity of γ-H2AX foci increased gradually, and reached to its maximum at 30 min after irradiation. A good linear relationship can be observed between foci intensity and radiation dose. After 30 min, the γ-H2AX foci intensity was decreased with time passed, but remained a large portion (∼50%) at 48 h passed. The data show that the dissolution rate of γ-H2AX foci agreed with two components DNA repairing model. These results suggest that charged particles can induce more complex DNA damages and causing the retardation of DNA repair.