Science.gov

Sample records for induced dna damages

  1. DNA Damage Induced Neuronal Death

    DTIC Science & Technology

    1999-10-01

    Experiments are proposed to examine the molecular mechanism by which mustard chemical warfare agents induce neuronal cell death . DNA damage is the...proposed underlying mechanism of mustard-induced neuronal cell death . We propose a novel research strategy to test this hypothesis by using mice with...perturbed DNA repair to explore the relationship between mustard-induced DNA damage and neuronal cell death . Initial in vitro studies (Years 1, 2 & 3

  2. Acrylonitrile-induced oxidative DNA damage in rat astrocytes.

    PubMed

    Pu, Xinzhu; Kamendulis, Lisa M; Klaunig, James E

    2006-10-01

    Chronic administration of acrylonitrile results in a dose-related increase in astrocytomas in rat brain, but the mechanism of acrylonitrile carcinogenicity is not fully understood. The potential of acrylonitrile or its metabolites to induce direct DNA damage as a mechanism for acrylonitrile carcinogenicity has been questioned, and recent studies indicate that the mechanism involves the induction of oxidative stress in rat brain. The present study examined the ability of acrylonitrile to induce DNA damage in the DI TNC1 rat astrocyte cell line using the alkaline Comet assay. Oxidized DNA damage also was evaluated using formamidopyrimidine DNA glycosylase treatment in the modified Comet assay. No increase in direct DNA damage was seen in astrocytes exposed to sublethal concentrations of acrylonitrile (0-1.0 mM) for 24 hr. However, acrylonitrile treatment resulted in a concentration-related increase in oxidative DNA damage after 24 hr. Antioxidant supplementation in the culture media (alpha-tocopherol, (-)-epigallocathechin-3 gallate, or trolox) reduced acrylonitrile-induced oxidative DNA damage. Depletion of glutathione using 0.1 mM DL-buthionine-[S,R]-sulfoximine increased acrylonitrile-induced oxidative DNA damage (22-46%), while cotreatment of acrylonitrile with 2.5 mM L-2-oxothiazolidine-4-carboxylic acid, a precursor for glutathione biosynthesis, significantly reduced acrylonitrile-induced oxidative DNA damage (7-47%). Cotreatment of acrylonitrile with 0.5 mM 1-aminobenzotriazole, a suicidal inhibitor of cytochrome P450, prevented the oxidative DNA damage produced by acrylonitrile. Cyanide (0.1-0.5 mM) increased oxidative DNA damage (44-160%) in astrocytes. These studies demonstrate that while acrylonitrile does not directly damage astrocyte DNA, it does increase oxidative DNA damage. The oxidative DNA damage following acrylonitrile exposure appears to arise mainly through the P450 metabolic pathway; moreover, glutathione depletion may contribute to the

  3. Mitochondrial DNA damage by bleomycin induces AML cell death.

    PubMed

    Yeung, ManTek; Hurren, Rose; Nemr, Carine; Wang, Xiaoming; Hershenfeld, Samantha; Gronda, Marcela; Liyanage, Sanduni; Wu, Yan; Augustine, Jeevan; Lee, Eric A; Spagnuolo, Paul A; Southall, Noel; Chen, Catherine; Zheng, Wei; Jeyaraju, Danny V; Minden, Mark D; Laposa, Rebecca; Schimmer, Aaron D

    2015-06-01

    Mitochondria contain multiple copies of their own 16.6 kb circular genome. To explore the impact of mitochondrial DNA (mtDNA) damage on mitochondrial (mt) function and viability of AML cells, we screened a panel of DNA damaging chemotherapeutic agents to identify drugs that could damage mtDNA. We identified bleomycin as an agent that damaged mtDNA in AML cells at concentrations that induced cell death. Bleomycin also induced mtDNA damage in primary AML samples. Consistent with the observed mtDNA damage, bleomycin reduced mt mass and basal oxygen consumption in AML cells. We also demonstrated that the observed mtDNA damage was functionally important for bleomycin-induced cell death. Finally, bleomycin delayed tumor growth in xenograft mouse models of AML and anti-leukemic concentrations of the drug induced mtDNA damage in AML cells preferentially over normal lung tissue. Taken together, mtDNA-targeted therapy may be an effective strategy to target AML cells and bleomycin could be useful in the treatment of this disease.

  4. UV and ionizing radiations induced DNA damage, differences and similarities

    NASA Astrophysics Data System (ADS)

    Ravanat, Jean-Luc; Douki, Thierry

    2016-11-01

    Both UV and ionizing radiations damage DNA. Two main mechanisms, so-called direct and indirect pathways, are involved in the degradation of DNA induced by ionizing radiations. The direct effect of radiation corresponds to direct ionization of DNA (one electron ejection) whereas indirect effects are produced by reactive oxygen species generated through water radiolysis, including the highly reactive hydroxyl radicals, which damage DNA. UV (and visible) light damages DNA by again two distinct mechanisms. UVC and to a lesser extend UVB photons are directly absorbed by DNA bases, generating their excited states that are at the origin of the formation of pyrimidine dimers. UVA (and visible) light by interaction with endogenous or exogenous photosensitizers induce the formation of DNA damage through photosensitization reactions. The excited photosensitizer is able to induce either a one-electron oxidation of DNA (type I) or to produce singlet oxygen (type II) that reacts with DNA. In addition, through an energy transfer from the excited photosensitizer to DNA bases (sometime called type III mechanism) formation of pyrimidine dimers could be produced. Interestingly it has been shown recently that pyrimidine dimers are also produced by direct absorption of UVA light by DNA, even if absorption of DNA bases at these wavelengths is very low. It should be stressed that some excited photosensitizers (such as psoralens) could add directly to DNA bases to generate adducts. The review will described the differences and similarities in terms of damage formation (structure and mechanisms) between these two physical genotoxic agents.

  5. DNA damage in cells exhibiting radiation-induced genomic instability

    DOE PAGES

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  6. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.

    2015-02-22

    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.

  7. An inducible long noncoding RNA amplifies DNA damage signaling

    PubMed Central

    Schmitt, Adam M.; Garcia, Julia T.; Hung, Tiffany; Flynn, Ryan A.; Shen, Ying; Qu, Kun; Payumo, Alexander Y.; Peres-da-Silva, Ashwin; Broz, Daniela Kenzelmann; Baum, Rachel; Guo, Shuling; Chen, James K.; Attardi, Laura D.; Chang, Howard Y.

    2016-01-01

    Long noncoding RNAs (lncRNAs) are prevalent genes with frequently exquisite regulation but mostly unknown functions. Here we demonstrate a role of lncRNAs in guiding organismal DNA damage response. DNA damage activates transcription of DINO (Damage Induced NOncoding) via p53. DINO is required for p53-dependent gene expression, cell cycle arrest, and apoptosis in response to DNA damage, and DINO expression suffice to activate damage signaling and cell cycle arrest in the absence of DNA damage. DINO binds to and promotes p53 protein stabilization, mediating a p53 auto-amplification loop. Dino knockout or promoter inactivation in mice dampens p53 signaling and ameliorates acute radiation syndrome in vivo. Thus, inducible lncRNA can create a feedback loop with its cognate transcription factor to amplify cellular signaling networks. PMID:27668660

  8. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia

    2014-03-01

    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  9. Hydroxyl radical Thymine adduct induced DNA damages

    NASA Astrophysics Data System (ADS)

    Schyman, Patric; Eriksson, Leif A.; Zhang, Ru bo; Laaksonen, Aatto

    2008-06-01

    DNA damages caused by a 5-hydroxy-5,6-dihydrothymine-6-yl radical (5-OHT-6yl) abstracting a C2‧ hydrogen from a neighboring sugar (inter-H abstraction) have been theoretically investigated using hybrid DFT in gas phase and in water solution. The inter-H abstraction was here shown to be comparable in energy (24 kcal mol-1) with the intra-H abstraction in which the 5-OHT-6yl abstracts a C2‧ hydrogen from its own sugar. The effect of a neutrally or a negatively charged phosphate group was also studied and the results show no significant impact on the activation energy of the hydrogen abstraction whereas base release and strand break reactions are affected.

  10. Inducible repair of oxidative DNA damage in Escherichia coli.

    PubMed

    Demple, B; Halbrook, J

    Hydrogen peroxide is lethal to many cell types, including the bacterium Escherichia coli. Peroxides yield transient radical species that can damage DNA and cause mutations. Such partially reduced oxygen species are occasionally released during cellular respiration and are generated by lethal and mutagenic ionizing radiation. Because cells live in an environment where the threat of oxidative DNA damage is continual, cellular mechanisms may have evolved to avoid and repair this damage. Enzymes are known which evidently perform these functions. We report here that resistance to hydrogen peroxide toxicity can be induced in E. coli, that this novel induction is specific and occurs, in part, at the level of DNA repair.

  11. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    2001-01-01

    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  12. Oxidatively induced DNA damage and its repair in cancer.

    PubMed

    Dizdaroglu, Miral

    2015-01-01

    Oxidatively induced DNA damage is caused in living organisms by endogenous and exogenous reactive species. DNA lesions resulting from this type of damage are mutagenic and cytotoxic and, if not repaired, can cause genetic instability that may lead to disease processes including carcinogenesis. Living organisms possess DNA repair mechanisms that include a variety of pathways to repair multiple DNA lesions. Mutations and polymorphisms also occur in DNA repair genes adversely affecting DNA repair systems. Cancer tissues overexpress DNA repair proteins and thus develop greater DNA repair capacity than normal tissues. Increased DNA repair in tumors that removes DNA lesions before they become toxic is a major mechanism for development of resistance to therapy, affecting patient survival. Accumulated evidence suggests that DNA repair capacity may be a predictive biomarker for patient response to therapy. Thus, knowledge of DNA protein expressions in normal and cancerous tissues may help predict and guide development of treatments and yield the best therapeutic response. DNA repair proteins constitute targets for inhibitors to overcome the resistance of tumors to therapy. Inhibitors of DNA repair for combination therapy or as single agents for monotherapy may help selectively kill tumors, potentially leading to personalized therapy. Numerous inhibitors have been developed and are being tested in clinical trials. The efficacy of some inhibitors in therapy has been demonstrated in patients. Further development of inhibitors of DNA repair proteins is globally underway to help eradicate cancer.

  13. Modulation of irinotecan-induced genomic DNA damage by theanine.

    PubMed

    Attia, Sabry

    2012-05-01

    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity.

  14. Oxidant-induced DNA damage of target cells.

    PubMed Central

    Schraufstätter, I; Hyslop, P A; Jackson, J H; Cochrane, C G

    1988-01-01

    In this study we examined the leukocytic oxidant species that induce oxidant damage of DNA in whole cells. H2O2 added extracellularly in micromolar concentrations (10-100 microM) induced DNA strand breaks in various target cells. The sensitivity of a specific target cell was inversely correlated to its catalase content and the rate of removal of H2O2 by the target cell. Oxidant species produced by xanthine oxidase/purine or phorbol myristate acetate-stimulated monocytes induced DNA breakage of target cells in proportion to the amount of H2O2 generated. These DNA strand breaks were prevented by extracellular catalase, but not by superoxide dismutase. Cytotoxic doses of HOCl, added to target cells, did not induce DNA strand breakage, and myeloperoxidase added extracellularly in the presence of an H2O2-generating system, prevented the formation of DNA strand breaks in proportion to its H2O2 degrading capacity. The studies also indicated that H2O2 formed hydroxyl radical (.OH) intracellularly, which appeared to be the most likely free radical responsible for DNA damage: .OH was detected in cells exposed to H2O2; the DNA base, deoxyguanosine, was hydroxylated in cells exposed to H2O2; and intracellular iron was essential for induction of DNA strand breaks. PMID:2843565

  15. Mechanism of site-specific DNA damage induced by ozone.

    PubMed

    Ito, Kimiko; Inoue, Sumiko; Hiraku, Yusuke; Kawanishi, Shosuke

    2005-08-01

    Ozone has been shown to induce lung tumors in mice. The reactivity of ozone with DNA in an aqueous solution was investigated by a DNA sequencing technique using 32P-labeled DNA fragments. Ozone induced cleavages in the deoxyribose-phosphate backbone of double-stranded DNA, which were reduced by hydroxyl radical scavengers, suggesting the participation of hydroxyl radicals in the cleavages. The ozone-induced DNA cleavages were enhanced with piperidine treatment, which induces cleavages at sites of base modification, but the inhibitory effect of hydroxyl radical scavengers on the piperidine-induced cleavages was limited. Main piperidine-labile sites were guanine and thymine residues. Cleavages at some guanine and thymine residues after piperidine treatment became more predominant with denatured single-stranded DNA. Exposure of calf thymus DNA to ozone resulted in a dose-dependent increase of the 8-oxo-7,8-dihydro-2'-deoxyguanosine formation, which was partially inhibited by hydroxyl radical scavengers. ESR studies using 5,5-dimethylpyrroline-N-oxide (DMPO) showed that aqueous ozone produced the hydroxyl radical adduct of DMPO. In addition, the fluorescein-dependent chemiluminescence was detected during the decomposition of ozone in a buffer solution and the enhancing effect of D2O was observed, suggesting the formation of singlet oxygen. However, no or little enhancing effect of D2O on the ozone-induced DNA damage was observed. These results suggest that DNA backbone cleavages were caused by ozone via the production of hydroxyl radicals, while DNA base modifications were mainly caused by ozone itself and the participation of hydroxyl radicals and/or singlet oxygen in base modifications is small, if any. A possible link of ozone-induced DNA damage to inflammation-associated carcinogenesis as well as air pollution-related carcinogenesis is discussed.

  16. Phosphoinositide 3-kinase inhibitors induce DNA damage through nucleoside depletion

    PubMed Central

    Juvekar, Ashish; Hu, Hai; Yadegarynia, Sina; Lyssiotis, Costas A.; Ullas, Soumya; Lien, Evan C.; Bellinger, Gary; Son, Jaekyoung; Hok, Rosanna C.; Seth, Pankaj; Daly, Michele B.; Kim, Baek; Scully, Ralph; Asara, John M.; Cantley, Lewis C.; Wulf, Gerburg M.

    2016-01-01

    We previously reported that combining a phosphoinositide 3-kinase (PI3K) inhibitor with a poly-ADP Rib polymerase (PARP)-inhibitor enhanced DNA damage and cell death in breast cancers that have genetic aberrations in BRCA1 and TP53. Here, we show that enhanced DNA damage induced by PI3K inhibitors in this mutational background is a consequence of impaired production of nucleotides needed for DNA synthesis and DNA repair. Inhibition of PI3K causes a reduction in all four nucleotide triphosphates, whereas inhibition of the protein kinase AKT is less effective than inhibition of PI3K in suppressing nucleotide synthesis and inducing DNA damage. Carbon flux studies reveal that PI3K inhibition disproportionately affects the nonoxidative pentose phosphate pathway that delivers Rib-5-phosphate required for base ribosylation. In vivo in a mouse model of BRCA1-linked triple-negative breast cancer (K14-Cre BRCA1f/fp53f/f), the PI3K inhibitor BKM120 led to a precipitous drop in DNA synthesis within 8 h of drug treatment, whereas DNA synthesis in normal tissues was less affected. In this mouse model, combined PI3K and PARP inhibition was superior to either agent alone to induce durable remissions of established tumors. PMID:27402769

  17. Multiomic Analysis of the UV-Induced DNA Damage Response.

    PubMed

    Boeing, Stefan; Williamson, Laura; Encheva, Vesela; Gori, Ilaria; Saunders, Rebecca E; Instrell, Rachael; Aygün, Ozan; Rodriguez-Martinez, Marta; Weems, Juston C; Kelly, Gavin P; Conaway, Joan W; Conaway, Ronald C; Stewart, Aengus; Howell, Michael; Snijders, Ambrosius P; Svejstrup, Jesper Q

    2016-05-11

    In order to facilitate the identification of factors and pathways in the cellular response to UV-induced DNA damage, several descriptive proteomic screens and a functional genomics screen were performed in parallel. Numerous factors could be identified with high confidence when the screen results were superimposed and interpreted together, incorporating biological knowledge. A searchable database, bioLOGIC, which provides access to relevant information about a protein or process of interest, was established to host the results and facilitate data mining. Besides uncovering roles in the DNA damage response for numerous proteins and complexes, including Integrator, Cohesin, PHF3, ASC-1, SCAF4, SCAF8, and SCAF11, we uncovered a role for the poorly studied, melanoma-associated serine/threonine kinase 19 (STK19). Besides effectively uncovering relevant factors, the multiomic approach also provides a systems-wide overview of the diverse cellular processes connected to the transcription-related DNA damage response.

  18. Mitochondrial DNA damage induces apoptosis in senescent cells

    PubMed Central

    Laberge, R-M; Adler, D; DeMaria, M; Mechtouf, N; Teachenor, R; Cardin, G B; Desprez, P-Y; Campisi, J; Rodier, F

    2013-01-01

    Senescence is a cellular response to damage and stress. The senescence response prevents cancer by suppressing the proliferation of cells with a compromised genome and contributes to optimal wound healing in normal tissues. Persistent senescent cells are also thought to drive aging and age-associated pathologies through their secretion of inflammatory factors that modify the tissue microenvironment and alter the function of nearby normal or transformed cells. Understanding how senescent cells alter the microenvironment would be aided by the ability to induce or eliminate senescent cells at will in vivo. Here, we combine the use of the synthetic nucleoside analog ganciclovir (GCV) with herpes simplex virus thymidine kinase (HSVtk) activity to create or eliminate senescent human cells. We show that low concentrations of GCV induce senescence through the accumulation of nuclear DNA damage while higher concentrations of GCV, similar to those used in vivo, kill non-dividing senescent cells via mitochondrial DNA (mtDNA) damage and caspase-dependent apoptosis. Using this system, we effectively eliminated xenografted normal human senescent fibroblasts or induced senescence in human breast cancer cells in vivo. Thus, cellular senescence and mtDNA damage are outcomes of synthetic nucleoside analog treatment, indicating that the GCV–HSVtk combination can be used effectively to promote the targeted formation or eradication of senescent cells. PMID:23868060

  19. Mitochondrial DNA damage induces apoptosis in senescent cells.

    PubMed

    Laberge, R-M; Adler, D; DeMaria, M; Mechtouf, N; Teachenor, R; Cardin, G B; Desprez, P-Y; Campisi, J; Rodier, F

    2013-07-18

    Senescence is a cellular response to damage and stress. The senescence response prevents cancer by suppressing the proliferation of cells with a compromised genome and contributes to optimal wound healing in normal tissues. Persistent senescent cells are also thought to drive aging and age-associated pathologies through their secretion of inflammatory factors that modify the tissue microenvironment and alter the function of nearby normal or transformed cells. Understanding how senescent cells alter the microenvironment would be aided by the ability to induce or eliminate senescent cells at will in vivo. Here, we combine the use of the synthetic nucleoside analog ganciclovir (GCV) with herpes simplex virus thymidine kinase (HSVtk) activity to create or eliminate senescent human cells. We show that low concentrations of GCV induce senescence through the accumulation of nuclear DNA damage while higher concentrations of GCV, similar to those used in vivo, kill non-dividing senescent cells via mitochondrial DNA (mtDNA) damage and caspase-dependent apoptosis. Using this system, we effectively eliminated xenografted normal human senescent fibroblasts or induced senescence in human breast cancer cells in vivo. Thus, cellular senescence and mtDNA damage are outcomes of synthetic nucleoside analog treatment, indicating that the GCV-HSVtk combination can be used effectively to promote the targeted formation or eradication of senescent cells.

  20. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope

    2014-01-01

    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  1. Novel DNA damage checkpoint in mitosis: Mitotic DNA damage induces re-replication without cell division in various cancer cells.

    PubMed

    Hyun, Sun-Yi; Rosen, Eliot M; Jang, Young-Joo

    2012-07-06

    DNA damage induces multiple checkpoint pathways to arrest cell cycle progression until damage is repaired. In our previous reports, when DNA damage occurred in prometaphase, cells were accumulated in 4 N-DNA G1 phase, and mitosis-specific kinases were inactivated in dependent on ATM/Chk1 after a short incubation for repair. We investigated whether or not mitotic DNA damage causes cells to skip-over late mitotic periods under prolonged incubation in a time-lapse study. 4 N-DNA-damaged cells re-replicated without cell division and accumulated in 8 N-DNA content, and the activities of apoptotic factors were increased. The inhibition of DNA replication reduced the 8 N-DNA cell population dramatically. Induction of replication without cell division was not observed upon depletion of Chk1 or ATM. Finally, mitotic DNA damage induces mitotic slippage and that cells enter G1 phase with 4 N-DNA content and then DNA replication is occurred to 8 N-DNA content before completion of mitosis in the ATM/Chk1-dependent manner, followed by caspase-dependent apoptosis during long-term repair.

  2. Nitrous acid induced damage in T7 DNA and phage

    SciTech Connect

    Scearce, L.M.; Masker, W.E.

    1986-05-01

    The response of bacteriophage T7 to nitrous acid damage was investigated. The T7 system allows in vitro mimicry of most aspects of in vivo DNA metabolism. Nitrous acid is of special interest since it has been previously shown to induce deletions and point mutations as well as novel adducts in DNA. T7 phage was exposed to 56 mM nitrous acid at pH 4.6 in vivo, causing a time dependent 98% decrease in survival for each 10 min duration of exposure to nitrous acid. These studies were extended to include examination of pure T7 DNA exposed in vitro to nitrous acid conditions identical to those used in the in vivo survival studies. The treated DNA was dialyzed to remove the nitrous acid and the DNA was encapsulated into empty phage heads. These in vitro packaged phage showed a survival curve analogous to the in vivo system. There was no change in survival when either in vitro or in vivo exposed phage were grown on wild type E. coli or on E. coli strains deficient in DNA repair due to mutations in DNA polymerase I, exonuclease III or a uvrA mutation. Survival was not increased when nitrous acid treated T7 were grown on E. coli induced for SOS repair. In vitro replication of nitrous acid treated DNA showed a time dependent decrease in the total amount of DNA synthesized.

  3. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  4. Single-molecule visualization of ROS-induced DNA damage in large DNA molecules.

    PubMed

    Lee, Jinyong; Kim, Yongkyun; Lim, Sangyong; Jo, Kyubong

    2016-02-07

    We present a single molecule visualization approach for the quantitative analysis of reactive oxygen species (ROS) induced DNA damage, such as base oxidation and single stranded breaks in large DNA molecules. We utilized the Fenton reaction to generate DNA damage with subsequent enzymatic treatment using a mixture of three types of glycosylases to remove oxidized bases, and then fluorescent labeling on damaged lesions via nick translation. This single molecule analytical platform provided the capability to count one or two damaged sites per λ DNA molecule (48.5 kb), which were reliably dependent on the concentrations of hydrogen peroxide and ferrous ion at the micromolar level. More importantly, the labeled damaged sites that were visualized under a microscope provided positional information, which offered the capability of comparing DNA damaged sites with the in silico genomic map to reveal sequence specificity that GTGR is more sensitive to oxidative damage. Consequently, single DNA molecule analysis provides a sensitive analytical platform for ROS-induced DNA damage and suggests an interesting biochemical insight that the genome primarily active during the lysogenic cycle may have less probability for oxidative DNA damage.

  5. The Cartography of UV-induced DNA Damage Formation and DNA Repair.

    PubMed

    Hu, Jinchuan; Adar, Sheera

    2017-01-01

    DNA damage presents a barrier to DNA-templated biochemical processes, including gene expression and faithful DNA replication. Compromised DNA repair leads to mutations, enhancing the risk for genetic diseases and cancer development. Conventional experimental approaches to study DNA damage required a researcher to choose between measuring bulk damage over the entire genome, with little or no resolution regarding a specific location, and obtaining data specific to a locus of interest, without a global perspective. Recent advances in high-throughput genomic tools overcame these limitations and provide high-resolution measurements simultaneously across the genome. In this review, we discuss the available methods for measuring DNA damage and their repair, focusing on genomewide assays for pyrimidine photodimers, the major types of damage induced by ultraviolet irradiation. These new genomic assays will be a powerful tool in identifying key components of genome stability and carcinogenesis.

  6. Silica radical-induced DNA damage and lipid peroxidation.

    PubMed Central

    Shi, X; Mao, Y; Daniel, L N; Saffiotti, U; Dalal, N S; Vallyathan, V

    1994-01-01

    In recent years, more attention has been given to the mechanism of disease induction caused by the surface properties of minerals. In this respect, specific research needs to be focused on the biologic interactions of oxygen radicals generated by mineral particles resulting in cell injury and DNA damage leading to fibrogenesis and carcinogenesis. In this investigation, we used electron spin resonance (ESR) and spin trapping to study oxygen radical generation from aqueous suspensions of freshly fractured crystalline silica. Hydroxyl radical (.OH), superoxide radical (O2.-) and singlet oxygen (1O2) were all detected. Superoxide dismutase (SOD) partially inhibited .OH yield, whereas catalase abolished .OH generation. H2O2 enhanced .OH generation while deferoxamine inhibited it, indicating that .OH is generated via a Haber-Weiss type reaction. These spin trapping measurements provide the first evidence that aqueous suspensions of silica particles generate O2.- and 1O2. Oxygen consumption measurements indicate that freshly fractured silica uses molecular oxygen to generate O2.- and 1O2. Electrophoretic assays of in vitro DNA strand breakages showed that freshly fractured silica induced DNA strand breakage, which was inhibited by catalase and enhanced by H2O2. In an argon atmosphere, DNA damage was suppressed, showing that molecular oxygen is required for the silica-induced DNA damage. Incubation of freshly fractured silica with linoleic acid generated linoleic acid-derived free radicals and caused dose-dependent lipid peroxidation as measured by ESR spin trapping and malondialdehyde formation. SOD, catalase, and sodium benzoate inhibited lipid peroxidation by 49, 52, and 75%, respectively, again showing the role of oxygen radicals in silica-induced lipid peroxidation.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 7. PMID:7705289

  7. Pyrosequencing: Applicability for Studying DNA Damage-induced Mutagenesis

    PubMed Central

    Minko, Irina G.; Earley, Lauriel F.; Larlee, Kimberly E.; Lin, Ying-Chih; Lloyd, R. Stephen

    2014-01-01

    Site-specifically modified DNAs are routinely used in the study of DNA damage-induced mutagenesis. These analyses involve the creation of DNA vectors containing a lesion at a predetermined position, DNA replication, and detection of mutations at the target site. The final step has previously required the isolation of individual DNA clones, hybridization with radioactively-labeled probes, and verification of mutations by Sanger sequencing. In search for an alternative procedure that would allow direct quantification of sequence variants in a mixed population of DNA molecules, we evaluated the applicability of pyrosequencing to site-specific mutagenesis assays. The progeny DNAs were analyzed that originated from replication of N6-(deoxy-D-erythro-pentofuranosyl)-2,6-diamino-3,4-dihydro-4-oxo-5-N-methylformamidopyrimidine (MeFapy-dG)-containing vectors in primate cells, with the lesion being positioned in the 5′-GCNGG-3′ sequence context. Pyrosequencing detected ~8% G to T transversions and ~3.5% G to A transitions, a result that was in excellent agreement with frequencies previously measured by the standard procedure [Earley et al., 2013]. However, ~3.5% G to C transversions and ~2.0% deletions could not be detected by pyrosequencing. Consistent with these observations, the sensitivity of pyrosequencing for measuring the single deoxynucleotide variants differed depending on the deoxynucleotide identity, and in the given sequence contexts, was determined to be ~1-2% for A and T and ~5% for C. Pyrosequencing of other DNA isolates that were obtained following replication of MeFapy-dG-containing vectors in primate cells or Escherichia coli, identified several additional limitations. Collectively, our data demonstrated that pyrosequencing can be used for studying DNA damage-induced mutagenesis as an effective complementary experimental approach to current protocols. PMID:24962778

  8. DNA Damage and Genomic Instability Induced by Inappropriate DNA Re-Replication

    DTIC Science & Technology

    2005-04-01

    ml a that sustained rereplication leads to a dramatic decrease factor. Samples were fixed in 67% ethanol (vol/vol), washed twice with PBS, and...significant decrease in cell viability and a cellular DNA damage response. Strikingly, we have observed DNA damage in the absence of a classical...genome re-replicates. In this reporting period, we have shown that re-replication induces a rapid and significant decrease in cell viability and a

  9. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.

    1984-01-01

    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  10. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc

    2015-01-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  11. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc

    2015-06-01

    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  12. Electrochemical DNA biosensor for detection of DNA damage induced by hydroxyl radicals.

    PubMed

    Hájková, Andrea; Barek, Jiří; Vyskočil, Vlastimil

    2017-03-01

    A simple electrochemical DNA biosensor based on a glassy carbon electrode (GCE) was prepared by adsorbing double-stranded DNA (dsDNA) onto the GCE surface and subsequently used for the detection of dsDNA damage induced by hydroxyl radicals. Investigation of the mutual interaction between hydroxyl radicals and dsDNA was conducted using a combination of several electrochemical detection techniques: square-wave voltammetry for direct monitoring the oxidation of dsDNA bases, and cyclic voltammetry and electrochemical impedance spectroscopy as indirect electrochemical methods making use of the redox-active indicator [Fe(CN)6](4-/3-). Hydroxyl radicals were generated electrochemically on the surface of a boron-doped diamond electrode and chemically (via the Fenton's reaction or the auto-oxidation of Fe(II)). The extent of dsDNA damage by electrochemically generated hydroxyl radicals depended on the current density applied to the generating electrode: by applying 5, 10, and 50mAcm(-2), selected relative biosensor responses decreased after 3min incubation from 100% to 38%, 27%, and 3%, respectively. Chemically generated hydroxyl radicals caused less pronounced dsDNA damage, and their damaging activity depended on the form of Fe(II) ions: decreases to 49% (Fenton's reaction; Fe(II) complexed with EDTA) and 33% (auto-oxidation of Fe(II); Fe(II) complexed with dsDNA) were observed after 10min incubation.

  13. Novobiocin Inhibits the Antimicrobial Resistance Acquired through DNA Damage-Induced Mutagenesis in Acinetobacter baumannii

    PubMed Central

    Jara, Luis M.; Pérez-Varela, María; Corral, Jordi; Arch, Marta; Cortés, Pilar; Bou, Germán; Barbé, Jordi

    2015-01-01

    Acinetobacter baumannii, a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarin novobiocin, which inhibits the DNA damage response in Gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this Gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis. PMID:26503651

  14. Inflammation-Induced Cell Proliferation Potentiates DNA Damage-Induced Mutations In Vivo

    PubMed Central

    Kiraly, Orsolya; Gong, Guanyu; Olipitz, Werner; Muthupalani, Sureshkumar; Engelward, Bevin P.

    2015-01-01

    Mutations are a critical driver of cancer initiation. While extensive studies have focused on exposure-induced mutations, few studies have explored the importance of tissue physiology as a modulator of mutation susceptibility in vivo. Of particular interest is inflammation, a known cancer risk factor relevant to chronic inflammatory diseases and pathogen-induced inflammation. Here, we used the fluorescent yellow direct repeat (FYDR) mice that harbor a reporter to detect misalignments during homologous recombination (HR), an important class of mutations. FYDR mice were exposed to cerulein, a potent inducer of pancreatic inflammation. We show that inflammation induces DSBs (γH2AX foci) and that several days later there is an increase in cell proliferation. While isolated bouts of inflammation did not induce HR, overlap between inflammation-induced DNA damage and inflammation-induced cell proliferation induced HR significantly. To study exogenously-induced DNA damage, animals were exposed to methylnitrosourea, a model alkylating agent that creates DNA lesions relevant to both environmental exposures and cancer chemotherapy. We found that exposure to alkylation damage induces HR, and importantly, that inflammation-induced cell proliferation and alkylation induce HR in a synergistic fashion. Taken together, these results show that, during an acute bout of inflammation, there is a kinetic barrier separating DNA damage from cell proliferation that protects against mutations, and that inflammation-induced cell proliferation greatly potentiates exposure-induced mutations. These studies demonstrate a fundamental mechanism by which inflammation can act synergistically with DNA damage to induce mutations that drive cancer and cancer recurrence. PMID:25647331

  15. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage

    PubMed Central

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa

    2016-01-01

    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  16. RNase H enables efficient repair of R-loop induced DNA damage

    PubMed Central

    Amon, Jeremy D; Koshland, Douglas

    2016-01-01

    R-loops, three-stranded structures that form when transcripts hybridize to chromosomal DNA, are potent agents of genome instability. This instability has been explained by the ability of R-loops to induce DNA damage. Here, we show that persistent R-loops also compromise DNA repair. Depleting endogenous RNase H activity impairs R-loop removal in Saccharomyces cerevisiae, causing DNA damage that occurs preferentially in the repetitive ribosomal DNA locus (rDNA). We analyzed the repair kinetics of this damage and identified mutants that modulate repair. We present a model that the persistence of R-loops at sites of DNA damage induces repair by break-induced replication (BIR). This R-loop induced BIR is particularly susceptible to the formation of lethal repair intermediates at the rDNA because of a barrier imposed by RNA polymerase I. DOI: http://dx.doi.org/10.7554/eLife.20533.001 PMID:27938663

  17. Repair Machinery for Radiation-Induced DNA Damage

    DTIC Science & Technology

    2000-07-01

    significant defect in the repair of certain DNA damages, but of which damages needs to be determined. We have selected Chinese Hamster Ovary ( CHO ) as...chromosome (BAC) genomic fragment, which we isolated from a CHO BAC library, revealed that APE1 exists as a single copy gene in AA8 (see Appendix, Figure... cells , we first determined the APE1 gene copy number in the CHO AA8 cell line. Fluorescence in situ hybridization with an APE1 bacterial artificial

  18. DNA damage response in peripheral nervous system: coping with cancer therapy-induced DNA lesions.

    PubMed

    Englander, Ella W

    2013-08-01

    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons.

  19. DNA damage induced by red food dyes orally administered to pregnant and male mice.

    PubMed

    Tsuda, S; Murakami, M; Matsusaka, N; Kano, K; Taniguchi, K; Sasaki, Y F

    2001-05-01

    We determined the genotoxicity of synthetic red tar dyes currently used as food color additives in many countries, including JAPAN: For the preliminary assessment, we treated groups of 4 pregnant mice (gestational day 11) once orally at the limit dose (2000 mg/kg) of amaranth (food red No. 2), allura red (food red No. 40), or acid red (food red No. 106), and we sampled brain, lung, liver, kidney, glandular stomach, colon, urinary bladder, and embryo 3, 6, and 24 h after treatment. We used the comet (alkaline single cell gel electrophoresis) assay to measure DNA damage. The assay was positive in the colon 3 h after the administration of amaranth and allura red and weakly positive in the lung 6 h after the administration of amaranth. Acid red did not induce DNA damage in any sample at any sampling time. None of the dyes damaged DNA in other organs or the embryo. We then tested male mice with amaranth, allura red, and a related color additive, new coccine (food red No. 18). The 3 dyes induced DNA damage in the colon starting at 10 mg/kg. Twenty ml/kg of soaking liquid from commercial red ginger pickles, which contained 6.5 mg/10 ml of new coccine, induced DNA damage in colon, glandular stomach, and bladder. The potencies were compared to those of other rodent carcinogens. The rodent hepatocarcinogen p-dimethylaminoazobenzene induced colon DNA damage at 1 mg/kg, whereas it damaged liver DNA only at 500 mg/kg. Although 1 mg/kg of N-nitrosodimethylamine induced DNA damage in liver and bladder, it did not induce colon DNA damage. N-nitrosodiethylamine at 14 mg/kg did not induce DNA damage in any organs examined. Because the 3 azo additives we examined induced colon DNA damage at a very low dose, more extensive assessment of azo additives is warranted.

  20. Non-Problematic Risks from Low-Dose Radiation-Induced DNA Damage Clusters

    PubMed Central

    Hayes, Daniel P.

    2008-01-01

    Radiation-induced DNA damage clusters have been proposed and are usually considered to pose the threat of serious biological damage. This has been attributed to DNA repair debilitation or cessation arising from the complexity of cluster damage. It will be shown here, contrary to both previous suggestions and perceived wisdom, that radiation induced damage clusters contribute to non-problematic risks in the low-dose, low-LET regime. The very complexity of cluster damage which inhibits and/or compromises DNA repair will ultimately be responsible for the elimination and/or diminution of precancer-ous and cancerous cells. PMID:18648573

  1. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

  2. DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENNTIAL FLUORESENCE ASSAY

    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

  3. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)

    2000-01-01

    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  4. Botanical Extracts as Medical Countermeasures for Radiation Induced DNA Damage

    DTIC Science & Technology

    2012-03-01

    seed extract supplements and Labrador tea whole leaf extracts as potential radioprotectants. Three different commercial grape seed extracts were... supplements and Labrador tea whole leaf extracts as potential radioprotectants. A novel assay was used to compare DNA damage in cellular and...concentrations of commercial grape seed extract supplements and Labrador tea. In addition, this work has identified and validated a set of procedures to use

  5. Clerocidin selectively modifies the gyrase-DNA gate to induce irreversible and reversible DNA damage

    PubMed Central

    Pan, Xiao Su; Dias, Miriam; Palumbo, Manlio; Fisher, L. Mark

    2008-01-01

    Clerocidin (CL), a microbial diterpenoid, reacts with DNA via its epoxide group and stimulates DNA cleavage by type II DNA topoisomerases. The molecular basis of CL action is poorly understood. We establish by genetic means that CL targets DNA gyrase in the Gram-positive bacterium Streptococcus pneumoniae, and promotes gyrase-dependent single- and double-stranded DNA cleavage in vitro. CL-stimulated DNA breakage exhibited a strong preference for guanine preceding the scission site (−1 position). Mutagenesis of −1 guanines to A, C or T abrogated CL cleavage at a strong pBR322 site. Surprisingly, for double-strand breaks, scission on one strand consistently involved a modified (piperidine-labile) guanine and was not reversed by heat, salt or EDTA, whereas complementary strand scission occurred at a piperidine-stable −1 nt and was reversed by EDTA. CL did not induce cleavage by a mutant gyrase (GyrA G79A) identified here in CL-resistant pneumococci. Indeed, mutations at G79 and at the neighbouring S81 residue in the GyrA breakage-reunion domain discriminated poisoning by CL from that of antibacterial quinolones. The results suggest a novel mechanism of enzyme inhibition in which the −1 nt at the gyrase-DNA gate exhibit different CL reactivities to produce both irreversible and reversible DNA damage. PMID:18723572

  6. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-06-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  7. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    PubMed

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1.

  8. The ATM Kinase Induces MicroRNA Biogenesis in the DNA Damage Response

    PubMed Central

    Zhang, Xinna; Wan, Guohui; Berger, Franklin G.; He, Xiaoming; Lu, Xiongbin

    2011-01-01

    SUMMARY The DNA damage response involves a complex network of processes that detect and repair DNA damage. Here we show that miRNA biogenesis is globally induced upon DNA damage in an ATM-dependent manner. About one fourth of miRNAs are significantly up-regulated after DNA damage, while loss of ATM abolishes their induction. KSRP (KH-type splicing regulatory protein) is a key player that translates DNA damage signaling to miRNA biogenesis. The ATM kinase directly binds to and phosphorylates KSRP, leading to enhanced interaction between KSRP and pri-miRNAs and increased KSRP activity in miRNA processing. Mutations of the ATM phosphorylation sites of KSRP impaired its activity in regulating miRNAs. These findings reveal a mechanism by which DNA damage signaling is linked to miRNA biogenesis. PMID:21329876

  9. Genetic and Functional Studies of Genes that Regulate DNA-Damage-Induced Cell Death

    DTIC Science & Technology

    2004-11-01

    AD Award Number: DAMD17-01-1-0145 TITLE: Genetic and Functional Studies of Genes that Regulate DNA-damage-induced Cell Death PRINCIPAL INVESTIGATOR...and Functional Studies of Genes that Regulate DAMD17-01-1-0145 DNA-damage-induced Cell Death 6. A UTHOR(S) Zhou Songyang, Ph.D. 7. PERFORMING ORGANIZA...mechanisms of genes that regulate DNA damage induced cell death are much less well studied. We have proposed to establish a genetic system to screen for

  10. How to Cope with DNA Damage Induced by Ionizing Radiation and Anti-Cancer Drugs?

    NASA Astrophysics Data System (ADS)

    Enomoto, A.; Miyagawa, K.

    Ionizing radiation and chemotherapeutic agents induce many types of DNA lesions, of which DNA double-strand breaks (DSBs) are assumed to be the most deleterious. DNA damage response mechanisms encompass pathways of DNA damage signaling, DNA repair, cell cycle checkpoint arrest, and apoptosis. Increasing evidence suggests that these pathways function co-operatively to maintain genomic stability in the face of exogenous and endogenous DNA damage. The relative impact of one mechanism over another probably depends on the kinds of lesions, the cell cycle phase, and the cell or tissue type. The inability to respond properly to or to repair DSBs may lead to hypersensitivity to DNA damaging agents and genomic instability including chromosomal aberrations. Chromosomal instability, a state of continuous accumulation of chromosomal change, is a common feature of many human cancers and of chromosome instability syndromes with increased cancer susceptibility. Here, we review the DNA da mage response and the links between deficiencies in response to DSBs and chromosomal instability.

  11. Acrylonitrile-Induced Oxidative Stress and Oxidative DNA Damage in Male Sprague-Dawley Rats

    PubMed Central

    Kamendulis, Lisa M.; Klaunig, James E.

    2009-01-01

    Studies have demonstrated that the induction of oxidative stress may be involved in brain tumor induction in rats by acrylonitrile. The present study examined whether acrylonitrile induces oxidative stress and DNA damage in rats and whether blood can serve as a valid surrogate for the biomonitoring of oxidative stress induced by acrylonitrile in the exposed population. Male Sprague-Dawley rats were treated with 0, 3, 30, 100, and 200 ppm acrylonitrile in drinking water for 28 days. One group of rats were also coadministered N-acetyl cysteine (NAC) (0.3% in diet) with acrylonitrile (200 ppm in drinking water) to examine whether antioxidant supplementation was protective against acrylonitrile-induced oxidative stress. Direct DNA strand breakage in white blood cells (WBC) and brain was measured using the alkaline comet assay. Oxidative DNA damage in WBC and brain was evaluated using formamidopyrimidine DNA glycosylase (fpg)-modified comet assay and with high-performance liquid chromatography-electrochemical detection. No significant increase in direct DNA strand breaks was observed in brain and WBC from acrylonitrile-treated rats. However, oxidative DNA damage (fpg comet and 8′hydroxyl-2-deoxyguanosine) in brain and WBC was increased in a dose-dependent manner. In addition, plasma levels of reactive oxygen species (ROS) increased in rats administered acrylonitrile. Dietary supplementation with NAC prevented acrylonitrile-induced oxidative DNA damage in brain and WBC. A slight, but significant, decrease in the GSH:GSSG ratio was seen in brain at acrylonitrile doses > 30 ppm. These results provide additional support that the mode of action for acrylonitrile-induced astrocytomas involves the induction of oxidative stress and damage. Significant associations were seen between oxidative DNA damage in WBC and brain, ROS formation in plasma, and the reported tumor incidences. Since oxidative DNA damage in brain correlated with oxidative damage in WBC, these results suggest

  12. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed

    2014-01-01

    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  13. DNA damage induced by low energy electron collision and new experimental setup for further studying DNA damage by plasma

    NASA Astrophysics Data System (ADS)

    Park, Yeunsoo; Sanche, Leon; Wagner, Richard

    2013-09-01

    Low energy electrons (LEEs; below 10 eV) are the most abundant among the radiolytic species generated along the high energy radiation track in living cell. And these electrons are also one of major components with ions and photon in plasma. Interestingly, it has turned out that LEEs can create DNA damages such as base release, single- and double- strand breaks (SSB and DSB) via indirect action named dissociative electron attachment (DEA). The purposes of this study are to further find out exact mechanisms of DNA damage by LEEs at the molecular level and to verify new DNA damage like structural alteration on DNA subunits. And we will expand our study to DNA damage by plasma source to develop plasma-based new medical and biological applications. We are currently setting new experimental system for reaching our goals. We will show some recent results about new finding DNA modification damage and some experimental designs and working principles.

  14. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.

    PubMed

    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji

    2016-03-01

    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV.

  15. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.

    1989-01-01

    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  16. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  17. RNA m(6)A methylation regulates the ultraviolet-induced DNA damage response.

    PubMed

    Xiang, Yang; Laurent, Benoit; Hsu, Chih-Hung; Nachtergaele, Sigrid; Lu, Zhike; Sheng, Wanqiang; Xu, Chuanyun; Chen, Hao; Ouyang, Jian; Wang, Siqing; Ling, Dominic; Hsu, Pang-Hung; Zou, Lee; Jambhekar, Ashwini; He, Chuan; Shi, Yang

    2017-03-23

    Cell proliferation and survival require the faithful maintenance and propagation of genetic information, which are threatened by the ubiquitous sources of DNA damage present intracellularly and in the external environment. A system of DNA repair, called the DNA damage response, detects and repairs damaged DNA and prevents cell division until the repair is complete. Here we report that methylation at the 6 position of adenosine (m(6)A) in RNA is rapidly (within 2 min) and transiently induced at DNA damage sites in response to ultraviolet irradiation. This modification occurs on numerous poly(A)(+) transcripts and is regulated by the methyltransferase METTL3 (methyltransferase-like 3) and the demethylase FTO (fat mass and obesity-associated protein). In the absence of METTL3 catalytic activity, cells showed delayed repair of ultraviolet-induced cyclobutane pyrimidine adducts and elevated sensitivity to ultraviolet, demonstrating the importance of m(6)A in the ultraviolet-responsive DNA damage response. Multiple DNA polymerases are involved in the ultraviolet response, some of which resynthesize DNA after the lesion has been excised by the nucleotide excision repair pathway, while others participate in trans-lesion synthesis to allow replication past damaged lesions in S phase. DNA polymerase κ (Pol κ), which has been implicated in both nucleotide excision repair and trans-lesion synthesis, required the catalytic activity of METTL3 for immediate localization to ultraviolet-induced DNA damage sites. Importantly, Pol κ overexpression qualitatively suppressed the cyclobutane pyrimidine removal defect associated with METTL3 loss. Thus, we have uncovered a novel function for RNA m(6)A modification in the ultraviolet-induced DNA damage response, and our findings collectively support a model in which m(6)A RNA serves as a beacon for the selective, rapid recruitment of Pol κ to damage sites to facilitate repair and cell survival.

  18. Bisdemethoxycurcumin induces DNA damage and inhibits DNA repair associated protein expressions in NCI-H460 human lung cancer cells.

    PubMed

    Yu, Chien-Chih; Yang, Su-Tso; Huang, Wen-Wen; Peng, Shu-Fen; Huang, An-Cheng; Tang, Nou-Ying; Liu, Hsin-Chung; Yang, Mei-Due; Lai, Kuang-Chi; Chung, Jing-Gung

    2015-08-30

    Nonsmall cell lung carcinoma (NSCLC) is a devastating primary lung tumor resistant to conventional therapies. Bisdemethoxycurcumin (BDMC) is one of curcumin derivate from Turmeric and has been shown to induce NSCLC cell death. Although there is one report to show BDMC induced DNA double strand breaks, however, no available information to show BDMC induced DNA damage action with inhibited DNA repair protein in lung cancer cells in detail. In this study, we tested BDMC-induced DNA damage and condensation in NCI-H460 cells by using Comet assay and DAPI staining examinations, respectively and we found BDMC induced DNA damage and condension. Western blotting was used to examine the effects of BDMC on protein expression associated with DNA damage and repair and results indicated that BDMC suppressed the protein levels associated with DNA damage and repair, such as 14-3-3σ (an important checkpoint keeper of DDR), O6-methylguanine-DNA methyltransferase, DNA repair proteins breast cancer 1, early onset, mediator of DNA damage checkpoint 1 but activate phosphorylated p53 and p-H2A.X (phospho Ser140) in NCI-H460 cells. Confocal laser systems microscopy was used for examining the protein translocation and results show that BDMC increased the translocation of p-p53 and p-H2A.X (phospho Ser140) from cytosol to nuclei in NCI-H460 cells. In conclusion, BDMC induced DNA damage and condension and affect DNA repair proteins in NCI-H460 cells in vitro. © 2015 Wiley Periodicals, Inc. Environ Toxicol, 2015.

  19. DNA Damage and Genomic Instability Induced by Inappropriate DNA Re-replication

    DTIC Science & Technology

    2007-04-01

    replication in yeast cells. We have demonstrated that re-replication induces a rapid and significant decrease in cell viability and a cellular DNA damage...Ura 50 ng/ml factor. Samples were fixed in 67% ethanol (vol/vol), washed twice with PBS, and resuspended in 50 ng/ml 46-diamidino-2-phenylindole... decrease plating efficiency (Figure 1B). Both the pGAL1-ntcdc6 rerep- licating strain and pGAL1 control strain grew with similar efficiency when

  20. Characterization of UVC-induced DNA damage in bloodstains: forensic implications.

    PubMed

    Hall, Ashley; Ballantyne, Jack

    2004-09-01

    The ability to detect DNA polymorphisms using molecular genetic techniques has revolutionized the forensic analysis of biological evidence. DNA typing now plays a critical role within the criminal justice system, but one of the limiting factors with the technology is that DNA isolated from biological stains recovered from the crime scene is sometimes so damaged as to be intractable to analysis. Potential remedies for damaged DNA are likely to be dependent upon the precise nature of the DNA damage present in any particular sample but, unfortunately, current knowledge of the biochemical nature, and the extent, of such DNA damage in dried biological stains is rudimentary. As a model for DNA damage assessment in biological stains recovered from crime scenes, we have subjected human bloodstains and naked DNA in the hydrated and dehydrated states to varying doses of UVC radiation. It was possible to damage the DNA sufficiently in a bloodstain to cause a standard autosomal short tandem repeat (STR) profile to be lost. However, a detailed analysis of the process, based upon assays developed to detect bipyrimidine photoproducts (BPPPs), single- and double-strand breaks, and DNA-DNA crosslinks, produced some unexpected findings. Contrary to the situation with living tissues or cells in culture, the predominant UVC-induced damage to DNA in bloodstains appears not to be pyrimidine dimers. Although some evidence for the presence of BPPPs and DNA crosslinks was obtained, the major form of UVC damage causing genetic profile loss appeared to be single-strand breaks. It was not possible, however, to preclude the possibility that a combination of damage types was responsible for the profile loss observed. We demonstrate here that a significant measure of protection against UVC-mediated genetic profile loss in dried biological stain material is afforded by the dehydrated state of the DNA and, to a lesser extent, the DNA cellular milieu.

  1. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung

    2016-01-01

    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  2. Estrogens protect against hydrogen peroxide and arachidonic acid induced DNA damage.

    PubMed

    Tang, M; Subbiah, M T

    1996-01-19

    The ability of estrogens to protect against DNA damage induced by either hydrogen peroxide or arachidonic acid alone or in combination with Cu2+ was investigated. DNA strand breaks were determined by conversion of double stranded supercoiled OX-174 RFI DNA to double stranded open circular DNA and linear single stranded DNA. Estradiol-17 beta significantly decreased the formation of single and double strand breaks in DNA induced by H2O2 alone or with Cu2+. Equilin (an equine estrogen) was more effective than estradiol-17 beta at the doses tested. Arachidonic acid in the presence of Cu2+ caused the formation of high levels of linear DNA which was protected by estrogen with equilen being more effective. These studies suggest that estrogens through this protective effect on DNA damage might contribute to cardioprotection.

  3. Oleandrin induces DNA damage responses in cancer cells by suppressing the expression of Rad51

    PubMed Central

    Bao, Zhengqiang; Tian, Baoping; Wang, Xiaohui; Feng, Hanrong; Liang, Ye; Chen, Zhihua; Li, Wen; Shen, Huahao; Ying, Songmin

    2016-01-01

    Oleandrin is a monomeric compound extracted from leaves and seeds of Nerium oleander. It had been reported that oleandrin could effectively inhibit the growth of human cancer cells. However, the specific mechanisms of the oleandrin-induced anti-tumor effects remain largely unclear. Genomic instability is one of the main features of cancer cells, it can be the combined effect of DNA damage and tumour-specific DNA repair defects. DNA damage plays important roles during tumorigenesis. In fact, most of the current chemotherapy agents were designed to kill cancer cells by inducing DNA damage. In this study, we found that oleandrin was effective to induce apoptosis in cancer cells, and cause rapid DNA damage response, represented by nuclear RPA (Replication Protein A, a single strand DNA binding protein) and γH2AX(a marker for DNA double strand breaks) foci formation. Interestingly, expression of RAD51, a key protein involved in homologous recombination (HR), was suppressed while XRCC1 was up-regulated in oleandrin treated cancer cells. These results suggested that XRCC1 may play a predominant role in repairing oleandrin-induced DNA damage. Collectively, oleandrin may be a potential anti-tumor agent by suppressing the expression of Rad51. PMID:27449097

  4. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.

    PubMed

    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A

    2013-09-01

    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity.

  5. The DNA damage response in viral-induced cellular transformation.

    PubMed

    Nikitin, P A; Luftig, M A

    2012-01-31

    The DNA damage response (DDR) has emerged as a critical tumour suppressor pathway responding to cellular DNA replicative stress downstream of aberrant oncogene over-expression. Recent studies have now implicated the DDR as a sensor of oncogenic virus infection. In this review, we discuss the mechanisms by which tumour viruses activate and also suppress the host DDR. The mechanism of tumour virus induction of the DDR is intrinsically linked to the need for these viruses to promote an S-phase environment to replicate their nucleic acid during infection. However, inappropriate expression of viral oncoproteins can also activate the DDR through various mechanisms including replicative stress, direct interaction with DDR components and induction of reactive oxygen species. Given the growth-suppressive consequences of activating the DDR, tumour viruses have also evolved mechanisms to attenuate these pathways. Aberrant expression of viral oncoproteins may therefore promote tumourigenesis through increased somatic mutation and aneuploidy due to DDR inactivation. This review will focus on the interplay between oncogenic viruses and the DDR with respect to cellular checkpoint control and transformation.

  6. Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

    SciTech Connect

    Zheng, Juanjuan; Zhang, Yu; Xu, Wentao; Luo, YunBo; Hao, Junran; Shen, Xiao Li; Yang, Xuan; Li, Xiaohong; Huang, Kunlun

    2013-04-15

    Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did not affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage induced by

  7. UV-induced DNA damage in Cyclops abyssorum tatricus populations from clear and turbid alpine lakes

    PubMed Central

    Tartarotti, Barbara; Saul, Nadine; Chakrabarti, Shumon; Trattner, Florian; Steinberg, Christian E. W.; Sommaruga, Ruben

    2014-01-01

    Zooplankton from clear alpine lakes thrive under high levels of solar UV radiation (UVR), but in glacially turbid ones they are more protected from this damaging radiation. Here, we present results from experiments done with Cyclops abyssorum tatricus to assess UV-induced DNA damage and repair processes using the comet assay. Copepods were collected from three alpine lakes of differing UV transparency ranging from clear to glacially turbid, and exposed to artificial UVR. In addition, photoprotection levels [mycosporine-like amino acids (MAAs) and lipophilic antioxidant capacity] were estimated in the test populations. Similar UV-induced DNA damage levels were observed among the copepods from all lakes, but background DNA damage (time zero and dark controls) was lowest in the copepods from the glacially turbid lake, resulting in a higher relative DNA damage accumulation. Most DNA strand breaks were repaired after recovery in the dark. Low MAA concentrations were found in the copepods from the glacially turbid lake, while the highest levels were observed in the population from the most UV transparent lake. However, the highest lipophilic antioxidant capacities were measured in the copepods from the lake with intermediate UV transparency. Photoprotection and the ability to repair DNA damage, and consequently reducing UV-induced damage, are part of the response mechanisms in zooplankton to changes in water transparency caused by glacier retreat. PMID:24616551

  8. Modification of tumour cell metabolism modulates sensitivity to Chk1 inhibitor-induced DNA damage

    PubMed Central

    Massey, Andrew J.

    2017-01-01

    Chk1 kinase inhibitors are currently under clinical investigation as potentiators of cytotoxic chemotherapy and demonstrate potent activity in combination with anti-metabolite drugs that increase replication stress through the inhibition of nucleotide or deoxyribonucleotide biosynthesis. Inhibiting other metabolic pathways critical for the supply of building blocks necessary to support DNA replication may lead to increased DNA damage and synergy with an inhibitor of Chk1. A screen of small molecule metabolism modulators identified combinatorial activity between a Chk1 inhibitor and chloroquine or the LDHA/LDHB inhibitor GSK 2837808A. Compounds, such as 2-deoxyglucose or 6-aminonicotinamide, that reduced the fraction of cells undergoing active replication rendered tumour cells more resistant to Chk1 inhibitor-induced DNA damage. Withdrawal of glucose or glutamine induced G1 and G2/M arrest without increasing DNA damage and reduced Chk1 expression and activation through autophosphorylation. This suggests the expression and activation of Chk1 kinase is associated with cells undergoing active DNA replication. Glutamine starvation rendered tumour cells more resistant to Chk1 inhibitor-induced DNA damage and reversal of the glutamine starvation restored the sensitivity of tumour cells to Chk1 inhibitor-induced DNA damage. Chk1 inhibitors may be a potentially useful therapeutic treatment for patients whose tumours contain a high fraction of replicating cells. PMID:28106079

  9. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.

    2011-01-01

    UVA has long been known for generating an oxidative stress in cells. In this paper we review the different types of DNA damage induced by UVA, i.e. strand breaks, bipyrimidine photoproducts, and oxidatively damaged bases. Emphasis is given to the mechanism of formation that is further illustrated by the presentation of new in vitro data. Examples of oxidation of proteins involved in DNA metabolism are also given.

  10. Melatonin attenuates brain mitochondria DNA damage induced by potassium cyanide in vivo and in vitro.

    PubMed

    Yamamoto, Hiro-aki; Mohanan, Parayanthala V

    2002-09-30

    The effect of potassium cyanide on mitochondria DNA (mtDNA) in mouse brain was investigated in vivo and in vitro. When potassium cyanide (0, 0.1, 1.0 or 2.0 mM) was incubated with a crude mitochondria fraction prepared from mouse brain at 37 degrees C for 60 min, the damage of mtDNA was observed in a concentration-dependent manner. However, the mtDNA damage was prevented by a co-treatment with melatonin (1.5 mM), a scavenger of hydroxyl radicals (*OH). Furthermore, a subcutaneous injection of potassium cyanide (7mg/kg) caused both brain mtDNA damage and severe seizures in mouse. The damage of mtDNA and seizures induced by potassium cyanide were abolished by the pre-injection of melatonin (20 mg/kg). Hydrogen peroxide (1.5 mM) inflicted damage to brain mtDNA in the presence of Fe(2+) (3.0 microM). The damage was abolished by the co-treatment with melatonin. Furthermore, when cyanide (0, 0.1 or 1.0 mM) was incubated with the crude mitochondria fraction prepared from mouse brain, the lipid peroxidation was significantly increased in a concentration-dependent manner. The increased lipid peroxidation was completely inhibited by the co-treatment with melatonin (1.0 mM). These results suggest that reactive oxygen species including the *OH may play a cardinal role for mtDNA damage induced by potassium cyanide. Hence, the present study concluded that melatonin protects against DNA damage induced by the *OH produced by cyanide or hydrogen peroxide.

  11. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    PubMed Central

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.

    2013-01-01

    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  12. DNA-damage-inducible (din) loci are transcriptionally activated in competent Bacillus subtilis

    SciTech Connect

    Love, P.E.; Lyle, M.J.; Yasbin, R.E.

    1985-09-01

    DNA damage-inducible (din) operon fusions were generated in Bacillus subtilis by transpositional mutagenesis. These YB886(din::Tn917-lacZ) fusion isolates produced increased ..beta..-galactosidase when exposed to mitomycin C, UV radiation, or ethyl methanesulfonate, indicating that the lacZ structural gene had inserted into host transcriptional units that are induced by a variety of DNA-damaging agents. One of the fusion strains was DNA-repair deficient and phenotypically resembled a UV-sensitive mutant of B. subtilis. Induction of ..beta..-galactosidase also occurred in the competent subpopulation of each of the din fusion strains, independent of exposure to DNA-damaging agents. Both the DNA-damage-inducible and competence-inducible components of ..beta..-galactosidase expression were abolished by the recE4 mutation, which inhibits SOS-like (SOB) induction but does not interfere with the development of the component state. The results indicate that gene expression is stimulated at specific loci within the B. subtilis chromosome both by DNA-damaging agents and by the development of competence and that this response is under the control of the SOB regulatory system. Furthermore, they demonstrate that at the molecular level SOB induction and the development of competence are interrelated cellular events.

  13. Single-cell analysis challenges the connection between autophagy and senescence induced by DNA damage.

    PubMed

    Filippi-Chiela, Eduardo Cremonese; Bueno e Silva, Mardja Manssur; Thomé, Marcos Paulo; Lenz, Guido

    2015-01-01

    Autophagy and senescence have been described as central features of cell biology, but the interplay between these mechanisms remains obscure. Using a therapeutically relevant model of DNA damage-induced senescence in human glioma cells, we demonstrated that acute treatment with temozolomide induces DNA damage, a transitory activation of PRKAA/AMPK-ULK1 and MAPK14/p38 and the sustained inhibition of AKT-MTOR. This produced a transient induction of autophagy, which was followed by senescence. However, at the single cell level, this coordinated transition was not observed, and autophagy and senescence were triggered in a very heterogeneous manner. Indeed, at a population level, autophagy was highly negatively correlated with senescence markers, while in single cells this correlation did not exist. The inhibition of autophagy triggered apoptosis and decreased senescence, while its activation increased temozolomide-induced senescence, showing that DNA damage-induced autophagy acts by suppressing apoptosis.

  14. Regulation of DNA damage-induced apoptosis by the c-Abl tyrosine kinase

    PubMed Central

    Yuan, Zhi-Min; Huang, Yinyin; Ishiko, Takatoshi; Kharbanda, Surender; Weichselbaum, Ralph; Kufe, Donald

    1997-01-01

    Activation of the c-Abl protein tyrosine kinase by certain DNA-damaging agents contributes to down-regulation of Cdk2 and G1 arrest by a p53-dependent mechanism. The present work investigates the potential role of c-Abl in apoptosis induced by DNA damage. Transient transfection studies with wild-type, but not kinase-inactive, c-Abl demonstrate induction of apoptosis. Cells that stably express inactive c-Abl exhibit resistance to ionizing radiation-induced loss of clonogenic survival and apoptosis. Cells null for c-abl are also impaired in the apoptotic response to ionizing radiation. We further show that cells deficient in p53 undergo apoptosis in response to expression of c-Abl and exhibit decreases in radiation-induced apoptosis when expressing inactive c-Abl. These findings suggest that c-Abl kinase regulates DNA damage-induced apoptosis. PMID:9037071

  15. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.

    PubMed

    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2014-07-01

    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma.

  16. NEK8 regulates DNA damage-induced RAD51 foci formation and replication fork protection

    PubMed Central

    Abeyta, Antonio; Castella, Maria; Jacquemont, Celine; Taniguchi, Toshiyasu

    2017-01-01

    ABSTRACT Proteins essential for homologous recombination play a pivotal role in the repair of DNA double strand breaks, DNA inter-strand crosslinks and replication fork stability. Defects in homologous recombination also play a critical role in the development of cancer and the sensitivity of these cancers to chemotherapy. RAD51, an essential factor for homologous recombination and replication fork protection, accumulates and forms immunocytochemically detectable nuclear foci at sites of DNA damage. To identify kinases that may regulate RAD51 localization to sites of DNA damage, we performed a human kinome siRNA library screen, using DNA damage-induced RAD51 foci formation as readout. We found that NEK8, a NIMA family kinase member, is required for efficient DNA damage-induced RAD51 foci formation. Interestingly, knockout of Nek8 in murine embryonic fibroblasts led to cellular sensitivity to the replication inhibitor, hydroxyurea, and inhibition of the ATR kinase. Furthermore, NEK8 was required for proper replication fork protection following replication stall with hydroxyurea. Loading of RAD51 to chromatin was decreased in NEK8-depleted cells and Nek8-knockout cells. Single-molecule DNA fiber analyses revealed that nascent DNA tracts were degraded in the absence of NEK8 following treatment with hydroxyurea. Consistent with this, Nek8-knockout cells showed increased chromosome breaks following treatment with hydroxyurea. Thus, NEK8 plays a critical role in replication fork stability through its regulation of the DNA repair and replication fork protection protein RAD51. PMID:27892797

  17. Dynamics of DNA Damage Induced Pathways to Cancer

    PubMed Central

    Tian, Kun; Rajendran, Ramkumar; Doddananjaiah, Manjula

    2013-01-01

    Chemotherapy is commonly used in cancer treatments, however only 25% of cancers are responsive and a significant proportion develops resistance. The p53 tumour suppressor is crucial for cancer development and therapy, but has been less amenable to therapeutic applications due to the complexity of its action, reflected in 66,000 papers describing its function. Here we provide a systematic approach to integrate this information by constructing a large-scale logical model of the p53 interactome using extensive database and literature integration. The model contains 206 nodes representing genes or proteins, DNA damage input, apoptosis and cellular senescence outputs, connected by 738 logical interactions. Predictions from in silico knock-outs and steady state model analysis were validated using literature searches and in vitro based experiments. We identify an upregulation of Chk1, ATM and ATR pathways in p53 negative cells and 61 other predictions obtained by knockout tests mimicking mutations. The comparison of model simulations with microarray data demonstrated a significant rate of successful predictions ranging between 52% and 71% depending on the cancer type. Growth factors and receptors FGF2, IGF1R, PDGFRB and TGFA were identified as factors contributing selectively to the control of U2OS osteosarcoma and HCT116 colon cancer cell growth. In summary, we provide the proof of principle that this versatile and predictive model has vast potential for use in cancer treatment by identifying pathways in individual patients that contribute to tumour growth, defining a sub population of “high” responders and identification of shifts in pathways leading to chemotherapy resistance. PMID:24023735

  18. Development of a qPCR Method to Measure Mitochondrial and Genomic DNA Damage with Application to Chemotherapy-Induced DNA Damage and Cryopreserved Cells.

    PubMed

    Evans, Stephen O; Jameson, Michael B; Cursons, Ray T M; Peters, Linda M; Bird, Steve; Jacobson, Gregory M

    2016-10-08

    DNA damage quantitation assays such as the comet assay have focused on the measurement of total nuclear damage per cell. The adoption of PCR-based techniques to quantify DNA damage has enabled sequence- and organelle-specific assessment of DNA lesions. Here we report on an adaptation of a qPCR technique to assess DNA damage in nuclear and mitochondrial targets relative to control. Novel aspects of this assay include application of the assay to the Rotor-Gene platform with optimized DNA polymerase/fluorophore/primer set combination in a touchdown PCR protocol. Assay validation was performed using ultraviolet C radiation in A549 and THP1 cancer cell lines. A comparison was made to the comet assay applied to peripheral blood mononuclear cells, and an estimation of the effects of cryopreservation on ultraviolet C-induced DNA damage was carried out. Finally, dose responses for DNA damage were measured in peripheral blood mononuclear cells following exposure to the cytotoxic agents bleomycin and cisplatin. We show reproducible experimental outputs across the tested conditions and concordance with published findings with respect to mitochondrial and nuclear genotoxic susceptibilities. The application of this DNA damage assay to a wide range of clinical and laboratory-derived samples is both feasible and resource-efficient.

  19. Development of a qPCR Method to Measure Mitochondrial and Genomic DNA Damage with Application to Chemotherapy-Induced DNA Damage and Cryopreserved Cells

    PubMed Central

    Evans, Stephen O.; Jameson, Michael B.; Cursons, Ray T. M.; Peters, Linda M.; Bird, Steve; Jacobson, Gregory M.

    2016-01-01

    DNA damage quantitation assays such as the comet assay have focused on the measurement of total nuclear damage per cell. The adoption of PCR-based techniques to quantify DNA damage has enabled sequence- and organelle-specific assessment of DNA lesions. Here we report on an adaptation of a qPCR technique to assess DNA damage in nuclear and mitochondrial targets relative to control. Novel aspects of this assay include application of the assay to the Rotor-Gene platform with optimized DNA polymerase/fluorophore/primer set combination in a touchdown PCR protocol. Assay validation was performed using ultraviolet C radiation in A549 and THP1 cancer cell lines. A comparison was made to the comet assay applied to peripheral blood mononuclear cells, and an estimation of the effects of cryopreservation on ultraviolet C-induced DNA damage was carried out. Finally, dose responses for DNA damage were measured in peripheral blood mononuclear cells following exposure to the cytotoxic agents bleomycin and cisplatin. We show reproducible experimental outputs across the tested conditions and concordance with published findings with respect to mitochondrial and nuclear genotoxic susceptibilities. The application of this DNA damage assay to a wide range of clinical and laboratory-derived samples is both feasible and resource-efficient. PMID:27740596

  20. Phosphorylation of Daxx by ATM Contributes to DNA Damage-Induced p53 Activation

    PubMed Central

    Cheng, Qian; Qu, Like; Brewer, Michael D.; Chen, Jiandong; Yang, Xiaolu

    2013-01-01

    p53 plays a central role in tumor suppression. It does so by inducing anti-proliferative processes as a response to various tumor-promoting stresses. p53 is regulated by the ubiquitin ligase Mdm2. The optimal function of Mdm2 requires Daxx, which stabilizes Mdm2 through the deubiquitinase Hausp/USP7 and also directly promotes Mdm2’s ubiquitin ligase activity towards p53. The Daxx-Mdm2 interaction is disrupted upon DNA damage. However, both the mechanisms and the consequence of the Daxx-Mdm2 dissociation are not understood. Here we show that upon DNA damage Daxx is phosphorylated in a manner that is dependent on ATM, a member of the PI 3-kinase family that orchestrates the DNA damage response. The main phosphorylation site of Daxx is identified to be Ser564, which is a direct target of ATM. Phosphorylation of endogenous Daxx at Ser564 occurs rapidly during the DNA damage response and precedes p53 activation. Blockage of this phosphorylation event prevents the separation of Daxx from Mdm2, stabilizes Mdm2, and inhibits DNA damage-induced p53 activation. These results suggest that phosphorylation of Daxx by ATM upon DNA damage disrupts the Daxx-Mdm2 interaction and facilitates p53 activation. PMID:23405218

  1. DNA damage-induced centrosome amplification occurs via excessive formation of centriolar satellites.

    PubMed

    Löffler, H; Fechter, A; Liu, F Y; Poppelreuther, S; Krämer, A

    2013-06-13

    Centrosome amplification is a frequent phenomenon in malignancies and may facilitate tumorigenesis by promoting chromosomal instability. On the other hand, a centrosome inactivation checkpoint comprising centrosome amplification leading to elimination of cells by mitotic catastrophe has been described in response to DNA damage by ionizing radiation or cytostatic drugs. So far, the exact nature of DNA damage-induced centrosome amplification, which might be overduplication or fragmentation of existing centrosomes, has been controversial. To solve this controversy, we have established a method to distinguish between these two possibilities using A549 cells expressing photoconvertible CETN2-Dendra2. In response to various DNA-damaging treatments, centrosome amplification but not fragmentation was observed. Moreover, centrosome amplification was preceded by excessive formation of centrin-containing centriolar satellites, which were identified as de novo-generated atypical centrin dots staining positive for centriolar satellite markers but negative or only weakly positive for other established centrosomal markers, and which could be verified as centriolar satellites using immunogold electron microscopy. In line with this notion, disruption of dynein-mediated recruitment of centrosomal proteins via centriolar satellites suppressed centrosome amplification after DNA damage, and excessive formation of centriolar satellites could be inhibited by interference with Chk1, a known mediator of centrosome amplification in response to DNA damage. In conclusion, we provide a model in which a Chk1-mediated DNA damage checkpoint induces excessive formation of centriolar satellites constituting assembly platforms for centrosomal proteins, which subsequently leads to centrosome amplification.

  2. Correlation between helium atmospheric pressure plasma jet (APPJ) variables and plasma induced DNA damage

    NASA Astrophysics Data System (ADS)

    Adhikari, Ek R.; Ptasinska, Sylwia

    2016-09-01

    A helium atmospheric pressure plasma jet (APPJ) source with a dielectric capillary and two tubular electrodes was used to induce damage in aqueous plasmid DNA. The fraction of different types of DNA damage (i.e., intact or undamaged, double strand breaks (DSBs), and single strand breaks (SSBs)) that occurred as the result of plasma irradiation was quantified through analysis of agarose gel electrophoresis images. The total DNA damage increased with an increase in both flow rate and duration of irradiation, but decreased with an increase in distance between the APPJ and sample. The average power of the plasma was calculated and the length of APPJ was measured for various flow rates and voltages applied. The possible effects of plasma power and reactive species on DNA damage are discussed.

  3. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  4. The production and repair of aflatoxin B sub 1 -induced DNA damage

    SciTech Connect

    Leadon, S.A.

    1990-05-01

    To investigate the influence of function or activity of a DNA sequence on its repair, we have studied excision repair of aflatoxin B{sub 1} (AFB{sub 1})-induced damage in the nontranscribed, heterochromatic alpha DNA of monkey cells and in the metallothionein genes of human cells. In confluent cells, AFB{sub 1} adducts are produced in similar frequencies in alpha and in the rest of the DNA, but removal from alpha DNA is severely deficient, however, removal of AFB{sub 1} adducts from alpha DNA is enhanced by small doses of UV. The repair deficiencies are not observed in actively growing cells. We have also shown that there is preferential repair of AFB{sub 1} damage in active genes. AFB{sub 1} damage is efficiently repaired in the active human metallothionein (hMT) genes, but deficiently repaired in inactive hMT genes. 51 refs., 3 tabs.

  5. Detection of DNA damage induced by space radiation in Mir and space shuttle.

    PubMed

    Ohnishi, Takeo; Ohnishi, Ken; Takahashi, Akihisa; Taniguchi, Yoshitaka; Sato, Masaru; Nakano, Tamotsu; Nagaoka, Shunji

    2002-12-01

    Although physical monitoring of space radiation has been accomplished, we aim to measure exact DNA damage as caused by space radiation. If DNA damage is caused by space radiation, we can detect DNA damage dependent on the length of the space flight periods by using post-labeling methods. To detect DNA damage caused by space radiation, we placed fixed human cervical carcinoma (HeLa) cells in the Russian Mir space station for 40 days and in an American space shuttle for 9 days. After landing, we labeled space-radiation-induced DNA strand breaks by enzymatic incorporation of [3H]-dATP with terminal deoxyribo-nucleotidyl transferase (TdT). We detected DNA damage as many grains on fixed silver emulsion resulting from beta-rays emitted from 3H-atoms in the nuclei of the cells placed in the Mir-station (J/Mir mission, STS-89), but detected hardly any in the ground control sample. In the space shuttle samples (S/MM-8), the number of cells having many grains was lower than that in the J/Mir mission samples. These results suggest that DNA damage is caused by space radiation and that it is dependent on the length of the space flight.

  6. Kaempferol induces DNA damage and inhibits DNA repair associated protein expressions in human promyelocytic leukemia HL-60 cells.

    PubMed

    Wu, Lung-Yuan; Lu, Hsu-Feng; Chou, Yu-Cheng; Shih, Yung-Luen; Bau, Da-Tian; Chen, Jaw-Chyun; Hsu, Shu-Chun; Chung, Jing-Gung

    2015-01-01

    Numerous evidences have shown that plant flavonoids (naturally occurring substances) have been reported to have chemopreventive activities and protect against experimental carcinogenesis. Kaempferol, one of the flavonoids, is widely distributed in fruits and vegetables, and may have cancer chemopreventive properties. However, the precise underlying mechanism regarding induced DNA damage and suppressed DNA repair system are poorly understood. In this study, we investigated whether kaempferol induced DNA damage and affected DNA repair associated protein expression in human leukemia HL-60 cells in vitro. Percentages of viable cells were measured via a flow cytometry assay. DNA damage was examined by Comet assay and DAPI staining. DNA fragmentation (ladder) was examined by DNA gel electrophoresis. The changes of protein levels associated with DNA repair were examined by Western blotting. Results showed that kaempferol dose-dependently decreased the viable cells. Comet assay indicated that kaempferol induced DNA damage (Comet tail) in a dose-dependent manner and DAPI staining also showed increased doses of kaempferol which led to increased DNA condensation, these effects are all of dose-dependent manners. Western blotting indicated that kaempferol-decreased protein expression associated with DNA repair system, such as phosphate-ataxia-telangiectasia mutated (p-ATM), phosphate-ataxia-telangiectasia and Rad3-related (p-ATR), 14-3-3 proteins sigma (14-3-3σ), DNA-dependent serine/threonine protein kinase (DNA-PK), O(6)-methylguanine-DNA methyltransferase (MGMT), p53 and MDC1 protein expressions, but increased the protein expression of p-p53 and p-H2AX. Protein translocation was examined by confocal laser microscopy, and we found that kaempferol increased the levels of p-H2AX and p-p53 in HL-60 cells. Taken together, in the present study, we found that kaempferol induced DNA damage and suppressed DNA repair and inhibited DNA repair associated protein expression in HL-60

  7. A human cellular sequence implicated in trk oncogene activation is DNA damage inducible

    SciTech Connect

    Ben-Ishai, R.; Scharf, R.; Sharon, R.; Kapten, I. )

    1990-08-01

    Xeroderma pigmentosum cells, which are deficient in the repair of UV light-induced DNA damage, have been used to clone DNA-damage-inducible transcripts in human cells. The cDNA clone designated pC-5 hybridizes on RNA gel blots to a 1-kilobase transcript, which is moderately abundant in nontreated cells and whose synthesis is enhanced in human cells following UV irradiation or treatment with several other DNA-damaging agents. UV-enhanced transcription of C-5 RNA is transient and occurs at lower fluences and to a greater extent in DNA-repair-deficient than in DNA-repair-proficient cells. Southern blot analysis indicates that the C-5 gene belongs to a multigene family. A cDNA clone containing the complete coding sequence of C-5 was isolated. Sequence analysis revealed that it is homologous to a human cellular sequence encoding the amino-terminal activating sequence of the trk-2h chimeric oncogene. The presence of DNA-damage-responsive sequences at the 5' end of a chimeric oncogene could result in enhanced expression of the oncogene in response to carcinogens.

  8. Analysis of the Contribution of Charge Transport in Iodine-125 induced DNA Damage

    PubMed Central

    Ndlebe, Thabisile; Panyutin, Igor; Neumann, Ronald

    2009-01-01

    Auger electron emitters, like iodine-125, are the radionuclides of choice for gene-targeted radiotherapy. The highly localized damage they induced in DNA is produced by three mechanisms: direct damage by the emitted Auger electrons, indirect damage by diffusible free radicals produced by Auger electrons travelling in water, and charge neutralization of the residual, highly positively charged, tellurium daughter atom by stripping electrons from covalent bonds of neighboring residues. The purpose of our work was to determine whether these mechanisms proceed through an intermediate energy transfer step along DNA. It was proposed that this intermediate step proceeds through the charge transport mechanism in DNA. Conventional charge transport has been described as either a hopping mechanism initiated by charge injection into DNA and propagated by charge migration along the DNA, or a tunneling mechanism in which charge moves directly from a donor to an acceptor within DNA. Well-known barriers for the hopping mechanism were used to probe the role of charge transport in 125I induced DNA damage. We studied their effect on the distribution of DNA breaks produced by the decay of iodine-125 in samples frozen at −80°C. We found that these barriers had no measurable effect on the iodine-125 breaks distribution. PMID:20041764

  9. Microcystin-LR induced DNA damage in human peripheral blood lymphocytes.

    PubMed

    Zegura, B; Gajski, G; Straser, A; Garaj-Vrhovac, V; Filipič, M

    2011-12-24

    Human exposure to microcystins, which are produced by freshwater cyanobacterial species, is of growing concern due to increasing appearance of cyanobacterial blooms as a consequence of global warming and increasing water eutrophication. Although microcystins are considered to be liver-specific, there is evidence that they may also affect other tissues. These substances have been shown to induce DNA damage in vitro and in vivo, but the mechanisms of their genotoxic activity remain unclear. In human peripheral blood lymphocytes (HPBLs) exposure to non-cytotoxic concentrations (0, 0.1, 1 and 10μg/ml) of microcystin-LR (MCLR) induced a dose- and time-dependent increase in DNA damage, as measured with the comet assay. Digestion of DNA from MCLR-treated HPBLs with purified formamidopyrimidine-DNA glycosylase (Fpg) displayed a greater number of DNA strand-breaks than non-digested DNA, confirming the evidence that MCLR induces oxidative DNA damage. With the cytokinesis-block micronucleus assay no statistically significant induction of micronuclei, nucleoplasmic bridges and nuclear buds was observed after a 24-h exposure to MCLR. At the molecular level, no changes in the expression of selected genes involved in the cellular response to DNA damage and oxidative stress were observed after a 4-h exposure to MCLR (1μg/ml). After 24h, DNA damage-responsive genes (p53, mdm2, gadd45a, cdkn1a), a gene involved in apoptosis (bax) and oxidative stress-responsive genes (cat, gpx1, sod1, gsr, gclc) were up-regulated. These results provide strong support that MCLR is an indirectly genotoxic agent, acting via induction of oxidative stress, and that lymphocytes are also the target of microcystin-induced toxicity.

  10. DNA damage response induces structural alterations in histone H3–H4

    PubMed Central

    Izumi, Yudai; Fujii, Kentaro; Yamamoto, Satoshi; Matsuo, Koichi; Namatame, Hirofumi; Taniguchi, Masaki; Yokoya, Akinari

    2017-01-01

    Synchrotron-radiation circular-dichroism spectroscopy was used to reveal that the DNA damage response induces a decrement of α-helix and an increment of β-strand contents of histone H3–H4 extracted from X-ray–irradiated human HeLa cells. The trend of the structural alteration was qualitatively opposite to that of our previously reported results for histone H2A–H2B. These results strongly suggest that histones share roles in DNA damage responses, particularly in DNA repair processes and chromatin remodeling, via a specific structural alteration of each histone. PMID:27672100

  11. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    SciTech Connect

    Kim, G. J.; Lee, J. K.; Kim, W.; Kim, K. T.

    2010-01-11

    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  12. Exposure to 1800 MHz radiofrequency radiation induces oxidative damage to mitochondrial DNA in primary cultured neurons.

    PubMed

    Xu, Shangcheng; Zhou, Zhou; Zhang, Lei; Yu, Zhengping; Zhang, Wei; Wang, Yuan; Wang, Xubu; Li, Maoquan; Chen, Yang; Chen, Chunhai; He, Mindi; Zhang, Guangbin; Zhong, Min

    2010-01-22

    Increasing evidence indicates that oxidative stress may be involved in the adverse effects of radiofrequency (RF) radiation on the brain. Because mitochondrial DNA (mtDNA) defects are closely associated with various nervous system diseases and mtDNA is particularly susceptible to oxidative stress, the purpose of this study was to determine whether radiofrequency radiation can cause oxidative damage to mtDNA. In this study, we exposed primary cultured cortical neurons to pulsed RF electromagnetic fields at a frequency of 1800 MHz modulated by 217 Hz at an average special absorption rate (SAR) of 2 W/kg. At 24 h after exposure, we found that RF radiation induced a significant increase in the levels of 8-hydroxyguanine (8-OHdG), a common biomarker of DNA oxidative damage, in the mitochondria of neurons. Concomitant with this finding, the copy number of mtDNA and the levels of mitochondrial RNA (mtRNA) transcripts showed an obvious reduction after RF exposure. Each of these mtDNA disturbances could be reversed by pretreatment with melatonin, which is known to be an efficient antioxidant in the brain. Together, these results suggested that 1800 MHz RF radiation could cause oxidative damage to mtDNA in primary cultured neurons. Oxidative damage to mtDNA may account for the neurotoxicity of RF radiation in the brain.

  13. DNA damage and estrogenic activity induced by the environmental pollutant 2-nitrotoluene and its metabolite

    PubMed Central

    Watanabe, Chigusa; Egami, Takashi; Midorikawa, Kaoru; Hiraku, Yusuke; Oikawa, Shinji; Kawanishi, Shosuke

    2010-01-01

    Objectives The environmental pollutant 2-nitrotoluene (2-NO2-T) is carcinogenic and reproductively toxic in animals. In this study, we elucidated the mechanisms of its carcinogenicity and reproductive toxicity. Methods We examined DNA damage induced by 2-NO2-T and its metabolite, 2-nitrosotoluene (2-NO-T), using 32P-5′-end-labeled DNA. We measured 8-oxo-7, 8-dihydro-2′-deoxyguanosine (8-oxodG), an indicator of oxidative DNA damage, in calf thymus DNA and cellular DNA in cultured human leukemia (HL-60) cells treated with 2-NO2-T and 2-NO-T. 8-Oxoguanine DNA glycosylase (OGG1) gene expression in HL-60 cells was measured by real-time polymerase chain reaction (PCR). We examined estrogenic activity using an E-screen assay and a surface plasmon resonance (SPR) sensor. Results In experiments with isolated DNA fragments, 2-NO-T induced oxidative DNA damage in the presence of Cu (II) and β-nicotinamide adenine dinucleotide disodium salt (reduced form) (NADH), while 2-NO2-T did not. 2-NO-T significantly increased levels of 8-oxodG in HL-60 cells. Real-time polymerase chain reaction (PCR) analysis revealed upregulation of OGG1 gene expression induced by 2-NO-T. An E-screen assay using the human breast cancer cell line MCF-7 revealed that 2-NO2-T induced estrogen-dependent cell proliferation. In contrast, 2-NO-T decreased the cell number and suppressed 17β-estradiol-induced cell proliferation. The data obtained with the SPR sensor using estrogen receptor α and the estrogen response element supported the results of the E-screen assay. Conclusions Oxidative DNA damage caused by 2-NO-T and estrogen-disrupting effects caused by 2-NO2-T and 2-NO-T may play a role in the reproductive toxicity and carcinogenicity of these entities. PMID:21432561

  14. Aflatoxin B1-Induced Developmental and DNA Damage in Caenorhabditis elegans

    PubMed Central

    Feng, Wei-Hong; Xue, Kathy S.; Tang, Lili; Williams, Phillip L.; Wang, Jia-Sheng

    2016-01-01

    Aflatoxin B1 (AFB1) is a ubiquitous mycotoxin produced by toxicogenic Aspergillus species. AFB1 has been reported to cause serious adverse health effects, such as cancers and abnormal development and reproduction, in animals and humans. AFB1 is also a potent genotoxic mutagen that causes DNA damage in vitro and in vivo. However, the link between DNA damage and abnormal development and reproduction is unclear. To address this issue, we examined the DNA damage, germline apoptosis, growth, and reproductive toxicity following exposure to AFB1, using Caenorhabditis elegans as a study model. Results found that AFB1 induced DNA damage and germline apoptosis, and significantly inhibited growth and reproduction of the nematodes in a concentration-dependent manner. Exposure to AFB1 inhibited growth or reproduction more potently in the DNA repair-deficient xpa-1 nematodes than the wild-type N2 strain. According to the relative expression level of pathway-related genes measured by real-time PCR, the DNA damage response (DDR) pathway was found to be associated with AFB1-induced germline apoptosis, which further played an essential role in the dysfunction of growth and reproduction in C. elegans. PMID:28035971

  15. The basic chemistry of exercise-induced DNA oxidation: oxidative damage, redox signaling, and their interplay.

    PubMed

    Cobley, James N; Margaritelis, Nikos V; Morton, James P; Close, Graeme L; Nikolaidis, Michalis G; Malone, John K

    2015-01-01

    Acute exercise increases reactive oxygen and nitrogen species generation. This phenomenon is associated with two major outcomes: (1) redox signaling and (2) macromolecule damage. Mechanistic knowledge of how exercise-induced redox signaling and macromolecule damage are interlinked is limited. This review focuses on the interplay between exercise-induced redox signaling and DNA damage, using hydroxyl radical ((·)OH) and hydrogen peroxide (H2O2) as exemplars. It is postulated that the biological fate of H2O2 links the two processes and thus represents a bifurcation point between redox signaling and damage. Indeed, H2O2 can participate in two electron signaling reactions but its diffusion and chemical properties permit DNA oxidation following reaction with transition metals and (·)OH generation. It is also considered that the sensing of DNA oxidation by repair proteins constitutes a non-canonical redox signaling mechanism. Further layers of interaction are provided by the redox regulation of DNA repair proteins and their capacity to modulate intracellular H2O2 levels. Overall, exercise-induced redox signaling and DNA damage may be interlinked to a greater extent than was previously thought but this requires further investigation.

  16. Spatiotemporal kinetics of γ-H2AX protein on charged particles induced DNA damage

    NASA Astrophysics Data System (ADS)

    Niu, H.; Chang, H. C.; Cho, I. C.; Chen, C. H.; Liu, C. S.; Chou, W. T.

    2014-08-01

    In several researches, it has been demonstrated that charged particles can induce more complex DNA damages. These complex damages have higher ability to cause the cell death or cell carcinogenesis. For this reason, clarifying the DNA repair mechanism after charged particle irradiation plays an important role in the development of charged particle therapy and space exploration. Unfortunately, the detail spatiotemporal kinetic of DNA damage repair is still unclear. In this study, we used γ-H2AX protein to investigate the spatiotemporal kinetics of DNA double strand breaks in alpha-particle irradiated HeLa cells. The result shows that the intensity of γ-H2AX foci increased gradually, and reached to its maximum at 30 min after irradiation. A good linear relationship can be observed between foci intensity and radiation dose. After 30 min, the γ-H2AX foci intensity was decreased with time passed, but remained a large portion (∼50%) at 48 h passed. The data show that the dissolution rate of γ-H2AX foci agreed with two components DNA repairing model. These results suggest that charged particles can induce more complex DNA damages and causing the retardation of DNA repair.

  17. Exit from dormancy provokes DNA-damage-induced attrition in haematopoietic stem cells.

    PubMed

    Walter, Dagmar; Lier, Amelie; Geiselhart, Anja; Thalheimer, Frederic B; Huntscha, Sina; Sobotta, Mirko C; Moehrle, Bettina; Brocks, David; Bayindir, Irem; Kaschutnig, Paul; Muedder, Katja; Klein, Corinna; Jauch, Anna; Schroeder, Timm; Geiger, Hartmut; Dick, Tobias P; Holland-Letz, Tim; Schmezer, Peter; Lane, Steven W; Rieger, Michael A; Essers, Marieke A G; Williams, David A; Trumpp, Andreas; Milsom, Michael D

    2015-04-23

    Haematopoietic stem cells (HSCs) are responsible for the lifelong production of blood cells. The accumulation of DNA damage in HSCs is a hallmark of ageing and is probably a major contributing factor in age-related tissue degeneration and malignant transformation. A number of accelerated ageing syndromes are associated with defective DNA repair and genomic instability, including the most common inherited bone marrow failure syndrome, Fanconi anaemia. However, the physiological source of DNA damage in HSCs from both normal and diseased individuals remains unclear. Here we show in mice that DNA damage is a direct consequence of inducing HSCs to exit their homeostatic quiescent state in response to conditions that model physiological stress, such as infection or chronic blood loss. Repeated activation of HSCs out of their dormant state provoked the attrition of normal HSCs and, in the case of mice with a non-functional Fanconi anaemia DNA repair pathway, led to a complete collapse of the haematopoietic system, which phenocopied the highly penetrant bone marrow failure seen in Fanconi anaemia patients. Our findings establish a novel link between physiological stress and DNA damage in normal HSCs and provide a mechanistic explanation for the universal accumulation of DNA damage in HSCs during ageing and the accelerated failure of the haematopoietic system in Fanconi anaemia patients.

  18. Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.

    PubMed

    Schellenberg, Matthew J; Perera, Lalith; Strom, Christina N; Waters, Crystal A; Monian, Brinda; Appel, C Denise; Vilas, Caroline K; Williams, Jason G; Ramsden, Dale A; Williams, R Scott

    2016-05-05

    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA-protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg(2+)-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg(2+) binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons.

  19. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu

    2015-01-01

    Living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, affects on the cellular response to DNA damage induced by exposures to radiation or other toxic chemicals will have an impact on the radiation risks for the astronauts, as well as on the mutation rate in microorganisms, is still an open question. Although the possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate the effects of spaceflight on the cellular response to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induces DNA damages including the double strand breaks (DSB) similar to the ionizing radiation. Damage in the DNA was measured by the phosphorylation of a histone protein H2AX (-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in the DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ti-67 signals. Our results suggested that the difference in -H2AX between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect the response of the DNA damage response genes to bleomycin treatment.

  20. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu

    2015-01-01

    Outside the protection of the geomagnetic field, astronauts and other living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, have effects on cellular responses to DNA damage induced by exposure to radiation or cytotoxic chemicals is still unknown, as is their impact on the radiation risks for astronauts and on the mutation rate in microorganisms. Although possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on cellular responses to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induced DNA damages including double-strand breaks (DSB) similar to the ionizing radiation. Damages in the DNA were measured by the phosphorylation of a histone protein H2AX (g-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ki-67 signals. Our results suggested that the difference in g-H2AX focus counts between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect initial transcriptional responses of the DNA damage response genes to

  1. Listeria monocytogenes induces host DNA damage and delays the host cell cycle to promote infection

    PubMed Central

    Leitão, Elsa; Costa, Ana Catarina; Brito, Cláudia; Costa, Lionel; Pombinho, Rita; Cabanes, Didier; Sousa, Sandra

    2014-01-01

    Listeria monocytogenes (Lm) is a human intracellular pathogen widely used to uncover the mechanisms evolved by pathogens to establish infection. However, its capacity to perturb the host cell cycle was never reported. We show that Lm infection affects the host cell cycle progression, increasing its overall duration but allowing consecutive rounds of division. A complete Lm infectious cycle induces a S-phase delay accompanied by a slower rate of DNA synthesis and increased levels of host DNA strand breaks. Additionally, DNA damage/replication checkpoint responses are triggered in an Lm dose-dependent manner through the phosphorylation of DNA-PK, H2A.X, and CDC25A and independently from ATM/ATR. While host DNA damage induced exogenously favors Lm dissemination, the override of checkpoint pathways limits infection. We propose that host DNA replication disturbed by Lm infection culminates in DNA strand breaks, triggering DNA damage/replication responses, and ensuring a cell cycle delay that favors Lm propagation. PMID:24552813

  2. Damage to dry plasmid DNA induced by nanosecond XUV-laser pulses

    NASA Astrophysics Data System (ADS)

    Nováková, Eva; Davídková, Marie; Vyšín, Ludék; Burian, Tomáš; Grisham, Michael E.; Heinbuch, Scott; Rocca, Jorge J.; Juha, Libor

    2011-06-01

    Ionizing radiation induces a variety of DNA damages including single-strand breaks (SSBs), double-strand breaks (DSBs), abasic sites, modified sugar and bases. Most theoretical and experimental studies have been focused on DNA strand scissions, in particular production of DNA double-strand breaks. DSBs have been proven to be a key damage at a molecular level responsible for the formation of chromosomal aberrations, leading often to cell death. The complexity of lesions produced in DNA by ionizing radiations is thought to depend on the amount of energy deposited at the site of each lesion. We have studied the nature of DNA damage induced directly by the pulsed 46.9 nm radiation provided by a capillary-discharge Ne-like Ar laser (CDL). Different surface doses were delivered with a repetition rate of a few Hz and an average pulse energy ~ 1 μJ. A simple model DNA molecule, i.e., dried closed-circular plasmid DNA (pBR322), was irradiated. The agarose gel electrophoresis method was used for determination of both SSB and DSB yields. Results are compared with a previous study of plasmid DNA irradiated with a single sub-nanosecond 1-keV X-ray pulse produced by a large-scale, double-stream gas puff target, illuminated by sub-kJ, near-infrared (NIR) focused laser pulses at the PALS facility (Prague Asterix Laser System).

  3. Mfd is required for rapid recovery of transcription following UV-induced DNA damage but not oxidative DNA damage in Escherichia coli.

    PubMed

    Schalow, Brandy J; Courcelle, Charmain T; Courcelle, Justin

    2012-05-01

    Transcription-coupled repair (TCR) is a cellular process by which some forms of DNA damage are repaired more rapidly from transcribed strands of active genes than from nontranscribed strands or the overall genome. In humans, the TCR coupling factor, CSB, plays a critical role in restoring transcription following both UV-induced and oxidative DNA damage. It also contributes indirectly to the global repair of some forms of oxidative DNA damage. The Escherichia coli homolog, Mfd, is similarly required for TCR of UV-induced lesions. However, its contribution to the restoration of transcription and to global repair of oxidative damage has not been examined. Here, we report the first direct study of transcriptional recovery following UV-induced and oxidative DNA damage in E. coli. We observed that mutations in mfd or uvrA reduced the rate that transcription recovered following UV-induced damage. In contrast, no difference was detected in the rate of transcription recovery in mfd, uvrA, fpg, nth, or polB dinB umuDC mutants relative to wild-type cells following oxidative damage. mfd mutants were also fully resistant to hydrogen peroxide (H(2)O(2)) and removed oxidative lesions from the genome at rates comparable to wild-type cells. The results demonstrate that Mfd promotes the rapid recovery of gene expression following UV-induced damage in E. coli. In addition, these findings imply that Mfd may be functionally distinct from its human CSB homolog in that it does not detectably contribute to the recovery of gene expression or global repair following oxidative damage.

  4. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.

    PubMed

    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh

    2014-01-01

    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury.

  5. Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells.

    PubMed

    Zhang, Zhuhong; Chen, Si; Mei, Hu; Xuan, Jiekun; Guo, Xiaoqing; Couch, Letha; Dobrovolsky, Vasily N; Guo, Lei; Mei, Nan

    2015-09-30

    Ginkgo biloba leaf extract has been shown to increase the incidence in liver tumors in mice in a 2-year bioassay conducted by the National Toxicology Program. In this study, the DNA damaging effects of Ginkgo biloba leaf extract and many of its constituents were evaluated in human hepatic HepG2 cells and the underlying mechanism was determined. A molecular docking study revealed that quercetin, a flavonoid constituent of Ginkgo biloba, showed a higher potential to interact with topoisomerase II (Topo II) than did the other Ginkgo biloba constituents; this in silico prediction was confirmed by using a biochemical assay to study Topo II enzyme inhibition. Moreover, as measured by the Comet assay and the induction of γ-H2A.X, quercetin, followed by keampferol and isorhamnetin, appeared to be the most potent DNA damage inducer in HepG2 cells. In Topo II knockdown cells, DNA damage triggered by Ginkgo biloba leaf extract or quercetin was dramatically decreased, indicating that DNA damage is directly associated with Topo II. DNA damage was also observed when cells were treated with commercially available Ginkgo biloba extract product. Our findings suggest that Ginkgo biloba leaf extract- and quercetin-induced in vitro genotoxicity may be the result of Topo II inhibition.

  6. Study on DNA Damage Induced by Neon Beam Irradiation in Saccharomyces Cerevisiae

    NASA Astrophysics Data System (ADS)

    Lu, Dong; Li, Wenjian; Wu, Xin; Wang, Jufang; Ma, Shuang; Liu, Qingfang; He, Jinyu; Jing, Xigang; Ding, Nan; Dai, Zhongying; Zhou, Jianping

    2010-12-01

    Yeast strain Saccharomyces cerevisiae was irradiated with different doses of 85 MeV/u 20Ne10+ to investigate DNA damage induced by heavy ion beam in eukaryotic microorganism. The survival rate, DNA double strand breaks (DSBs) and DNA polymorphic were tested after irradiation. The results showed that there were substantial differences in DNA between the control and irradiated samples. At the dose of 40 Gy, the yeast cell survival rate approached 50%, DNA double-strand breaks were barely detectable, and significant DNA polymorphism was observed. The alcohol dehydrogenase II gene was amplified and sequenced. It was observed that base changes in the mutant were mainly transversions of T→G and T→C. It can be concluded that heavy ion beam irradiation can lead to change in single gene and may be an effective way to induce mutation.

  7. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton

    SciTech Connect

    Malloy, K.D.; Holman, M.A.; Mitchell, D.

    1997-02-18

    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlated with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. 54 refs., 4 figs., 2 tabs.

  8. Chlorogenic acid prevents isoproterenol-induced DNA damage in vascular smooth muscle cells

    PubMed Central

    Wang, Jingshuai; Li, Jiyang; Liu, Jie; Xu, Mengjiao; Tong, Xiaowen; Wang, Jianjun

    2016-01-01

    Numerous clinical therapeutic agents have been identified as DNA damaging. The present study revealed that isoproterenol (Iso) resulted in DNA damage in vascular smooth muscle cells (VSMCs) and increased the levels of intracellular oxygen free radicals. Administration of chlorogenic acid (CGA) inhibited this effect. Pretreatment with CGA abrogated the increase in protein expression levels of γ-H2A histone family member X, phosphorylated ataxia telangiectasia mutated, phosphorylated Rad3-related protein, breast cancer 1 and C-terminal Src homologous kinase induced by Iso. In addition, the increase in levels of intracellular reactive oxygen species (ROS) induced by Iso was inhibited by CGA pretreatment in a dose-dependent manner. The results of the present study suggest that CGA may inhibit Iso-induced VSMC damage via the suppression of ROS generation. Therefore, CGA may be a novel agent for the treatment of vascular diseases. PMID:27634104

  9. PTEN Activation by DNA Damage Induces Protective Autophagy in Response to Cucurbitacin B in Hepatocellular Carcinoma Cells

    PubMed Central

    Niu, Yanan; Sun, Wen; Lu, Jin-Jian; Pei, Lixia

    2016-01-01

    Cucurbitacin B (Cuc B), a natural product, induced both protective autophagy and DNA damage mediated by ROS while the detailed mechanisms remain unclear. This study explored the mechanism of Cuc B-induced DNA damage and autophagy. Cuc B decreased cell viability in concentration- and time-dependent manners. Cuc B caused long comet tails and increased expression of γ-H2AX, phosphorylation of ATM/ATR, and Chk1/Chk2. Cuc B induced autophagy as evidenced by monodansylcadaverine (MDC) staining, increased expression of LC3II, phosphorylated ULK1, and decreased expression of phosphorylated AKT, mTOR. Cuc B induced apoptosis mediated by Bcl-2 family proteins and caspase activation. Furthermore, Cuc B induced ROS formation, which was inhibited by N-acetyl-L-cysteine (NAC). NAC pretreatment dramatically reversed Cuc B-induced DNA damage, autophagy, and apoptosis. Cuc B-induced apoptosis was reversed by NAC but enhanced by 3-methyladenine (3-MA), chloroquine (CQ), and silencing phosphatase and tensin homolog (PTEN). 3-MA and CQ showed no effect on Cuc B-induced DNA damage. In addition, Cuc B increased PTEN phosphorylation and silence PTEN restored Cuc B-induced autophagic protein expressions without affecting DNA damage. In summary, Cuc B induced DNA damage, apoptosis, and protective autophagy mediated by ROS. PTEN activation in response to DNA damage bridged DNA damage and prosurvival autophagy. PMID:28042385

  10. Parvovirus B19 Nonstructural Protein-Induced Damage of Cellular DNA and Resultant Apoptosis

    PubMed Central

    Poole, Brian D.; Kivovich, Violetta; Gilbert, Leona; Naides, Stanley J.

    2011-01-01

    Parvovirus B19 is a widespread virus with diverse clinical presentations. The viral nonstructural protein, NS1, binds to and cleaves the viral genome, and induces apoptosis when transfected into nonpermissive cells, such as hepatocytes. We hypothesized that the cytotoxicity of NS1 in such cells results from chromosomal DNA damage caused by the DNA-nicking and DNA-attaching activities of NS1. Upon testing this hypothesis, we found that NS1 covalently binds to cellular DNA and is modified by PARP, an enzyme involved in repairing single-stranded DNA nicks. We furthermore discovered that the DNA nick repair pathway initiated by poly(ADPribose)polymerase and the DNA repair pathways initiated by ATM/ATR are necessary for efficient apoptosis resulting from NS1 expression. PMID:21278893

  11. ORGANIC AND INORGANIC ARSENICALS SENSITIZE HUMAN BRONCHIAL EPITHELIAL CELLS TO HYDROGEN PEROXIDE-INDUCED DNA DAMAGE

    EPA Science Inventory

    The lungs are a target organ for arsenic carcinogenesis, however, its mechanism of action remains unclear. Furthermore, it has been suggested that inorganic arsenic (iAs) can potentiate DNA damage induced by other agents. Once inside the human body iAs generally undergoes two ...

  12. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells.

    PubMed

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-06-24

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague-Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo.

  13. Chromatin Modifications during Repair of Environmental Exposure-Induced DNA Damage: A Potential Mechanism for Stable Epigenetic Alterations

    PubMed Central

    O’Hagan, Heather M.

    2014-01-01

    Exposures to environmental toxicants and toxins cause epigenetic changes that likely play a role in the development of diseases associated with exposure. The mechanism behind these exposure-induced epigenetic changes is currently unknown. One commonality between most environmental exposures is that they cause DNA damage either directly or through causing an increase in reactive oxygen species, which can damage DNA. Like transcription, DNA damage repair must occur in the context of chromatin requiring both histone modifications and ATP-dependent chromatin remodeling. These chromatin changes aid in DNA damage accessibility and signaling. Several proteins and complexes involved in epigenetic silencing during both development and cancer have been found to be localized to sites of DNA damage. The chromatin-based response to DNA damage is considered a transient event, with chromatin being restored to normal as DNA damage repair is completed. However, in individuals chronically exposed to environmental toxicants or with chronic inflammatory disease, repeated DNA damage-induced chromatin rearrangement may ultimately lead to permanent epigenetic alterations. Understanding the mechanism behind exposure-induced epigenetic changes will allow us to develop strategies to prevent or reverse these changes. This review focuses on epigenetic changes and DNA damage induced by environmental exposures, the chromatin changes that occur around sites of DNA damage, and how these transient chromatin changes may lead to heritable epigenetic alterations at sites of chronic exposure. PMID:24259318

  14. DNA damage induced by chronic inflammation contributes to colon carcinogenesis in mice

    PubMed Central

    Meira, Lisiane B.; Bugni, James M.; Green, Stephanie L.; Lee, Chung-Wei; Pang, Bo; Borenshtein, Diana; Rickman, Barry H.; Rogers, Arlin B.; Moroski-Erkul, Catherine A.; McFaline, Jose L.; Schauer, David B.; Dedon, Peter C.; Fox, James G.; Samson, Leona D.

    2008-01-01

    Chronic inflammation increases cancer risk. While it is clear that cell signaling elicited by inflammatory cytokines promotes tumor development, the impact of DNA damage production resulting from inflammation-associated reactive oxygen and nitrogen species (RONS) on tumor development has not been directly tested. RONS induce DNA damage that can be recognized by alkyladenine DNA glycosylase (Aag) to initiate base excision repair. Using a mouse model of episodic inflammatory bowel disease by repeated administration of dextran sulfate sodium in the drinking water, we show that Aag-mediated DNA repair prevents colonic epithelial damage and reduces the severity of dextran sulfate sodium–induced colon tumorigenesis. Importantly, DNA base lesions expected to be induced by RONS and recognized by Aag accumulated to higher levels in Aag-deficient animals following stimulation of colonic inflammation. Finally, as a test of the generality of this effect we show that Aag-deficient animals display more severe gastric lesions that are precursors of gastric cancer after chronic infection with Helicobacter pylori. These data demonstrate that the repair of DNA lesions formed by RONS during chronic inflammation is important for protection against colon carcinogenesis. PMID:18521188

  15. The DNA damage response induced by infection with human cytomegalovirus and other viruses.

    PubMed

    Xiaofei, E; Kowalik, Timothy F

    2014-05-23

    Viruses use different strategies to overcome the host defense system. Recent studies have shown that viruses can induce DNA damage response (DDR). Many of these viruses use DDR signaling to benefit their replication, while other viruses block or inactivate DDR signaling. This review focuses on the effects of DDR and DNA repair on human cytomegalovirus (HCMV) replication. Here, we review the DDR induced by HCMV infection and its similarities and differences to DDR induced by other viruses. As DDR signaling pathways are critical for the replication of many viruses, blocking these pathways may represent novel therapeutic opportunities for the treatment of certain infectious diseases. Lastly, future perspectives in the field are discussed.

  16. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B.

    PubMed

    Wemhoff, Sabrina; Klassen, Roland; Beetz, Anja; Meinhardt, Friedhelm

    2016-01-01

    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity.

  17. Impaired repair of ionizing radiation-induced DNA damage in Cockayne syndrome cells.

    PubMed

    Cramers, Patricia; Verhoeven, Esther E; Filon, A Ronald; Rockx, Davy A P; Santos, Susy J; van der Leer, Anneke A; Kleinjans, Jos C S; van Zeeland, Albert A; Mullenders, Leon H F

    2011-04-01

    Cockayne syndrome (CS) cells are defective in transcription-coupled repair (TCR) and sensitive to oxidizing agents, including ionizing radiation. We examined the hypothesis that TCR plays a role in ionizing radiation-induced oxidative DNA damage repair or alternatively that CS plays a role in transcription elongation after irradiation. Irradiation with doses up to 100 Gy did not inhibit RNA polymerase II-dependent transcription in normal and CS-B fibroblasts. In contrast, RNA polymerase I-dependent transcription was severely inhibited at 5 Gy in normal cells, indicating different mechanisms of transcription response to X rays. The frequency of radiation-induced base damage was 2 × 10(-7) lesions/base/Gy, implying that 150 Gy is required to induce one lesion/30-kb transcription unit; no TCR of X-ray-induced base damage in the p53 gene was observed. Therefore, it is highly unlikely that defective TCR underlies the sensitivity of CS to ionizing radiation. Overall genome repair levels of radiation-induced DNA damage measured by repair replication were significantly reduced in CS-A and CS-B cells. Taken together, the results do not provide evidence for a key role of TCR in repair of radiation-induced oxidative damages in human cells; rather, impaired repair of oxidative lesions throughout the genome may contribute to the CS phenotype.

  18. Clustered DNA damages induced in human hematopoietic cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Bennett, Paula V.; Cintron-Torres, Nela; Hada, Megumi; Trunk, John; Monteleone, Denise; Sutherland, John C.; Laval, Jacques; Stanislaus, Marisha; Gewirtz, Alan

    2002-01-01

    Ionizing radiation induces clusters of DNA damages--oxidized bases, abasic sites and strand breaks--on opposing strands within a few helical turns. Such damages have been postulated to be difficult to repair, as are double strand breaks (one type of cluster). We have shown that low doses of low and high linear energy transfer (LET) radiation induce such damage clusters in human cells. In human cells, DSB are about 30% of the total of complex damages, and the levels of DSBs and oxidized pyrimidine clusters are similar. The dose responses for cluster induction in cells can be described by a linear relationship, implying that even low doses of ionizing radiation can produce clustered damages. Studies are in progress to determine whether clusters can be produced by mechanisms other than ionizing radiation, as well as the levels of various cluster types formed by low and high LET radiation.

  19. Persistent and heritable structural damage induced in heterochromatic DNA from rat liver by N-nitrosodimethylamine

    SciTech Connect

    Ward, E.J.; Stewart, B.W.

    1987-03-24

    Analysis, by benzoylated DEAE-cellulose chromatography, has been made of structural change in eu- and heterochromatic DNA from rat liver following administration of the carcinogen N-nitrosodimethylamine. Either hepatic DNA was prelabeled with (/sup 3/H)thymidine administered 2-3 weeks before injection of the carcinogen or the labeled precursor was given during regenerative hyperplasia in rats treated earlier with N-nitrosodimethylamine. Following phenol extraction of either whole liver homogenate or nuclease-fractionated eu- and heterochromatin, carcinogen-modified DNA was examined by stepwise or caffeine gradient elution from benzoylated DEAE-cellulose. In whole DNA, nitrosamine-induced single-stranded character was maximal 4-24 h after treatment, declining rapidly thereafter; gradient elution of these DNA preparations also provided short-term evidence of structural change. Caffeine gradient chromatography suggested short-term nitrosamine-induced structural change in euchromatic DNA, while increased binding of heterochromatic DNA was evident for up to 3 months after carcinogen treatment. Preparations of newly synthesized heterochromatic DNA from animals subjected to hepatectomy up to 2 months after carcinogen treatment provided evidence of heritable structural damage. Carcinogen-induced binding of heterochromatic DNA to benzoylated DEAE-cellulose was indicative of specific structural lesions whose affinity equalled that of single-stranded DNA up to 1.0 kilobase in length. The data suggest that structural lesions in heterochromatin, which may be a consequence of incomplete repair, are preferentially degraded by endogenous nuclease(s).

  20. The protective effect of clay minerals against damage to adsorbed DNA induced by cadmium and mercury.

    PubMed

    Hou, Yakun; Wu, Pingxiao; Zhu, Nengwu

    2014-01-01

    The adsorption of Salmon Sperm DNA on three kinds of raw clay (rectorite, montmorillonite and sericite) was investigated as a function of pH, ionic strength and the concentrations of DNA and phosphate ions in solution. The DNA adsorption was reduced in the following order: rectorite>montmorillonite>sericite. Based on these findings, there is a strong evidence that the mechanisms for DNA adsorption on clay involve electrostatic forces, cation bridging and ligand exchange. Cyclic voltammetry (CV) and UV-vis absorption and fluorescence spectroscopy were used to compare the properties of unbound DNA and the absorbed DNA on rectorite, both in the absence and presence of Cd(2+) and Hg(2+) inaqueous solutions. The interaction of heavy metals with the unbound DNA was evidenced by the disappearance of reduction peaks in CV, a small bathochromic shift in UV-vis spectroscopy and an incomplete quenching in the emission spectra. Such changes were not observed in the DNA-rectorite hybrids, which is evidence that adsorption on the clay can reduce the extent of the DNA damage caused by heavy metals. Therefore, in these experience the rectorite played an important role in protecting DNA against Cd(2+) and Hg(2+) induced damage.

  1. Static magnetic fields modulate X-ray-induced DNA damage in human glioblastoma primary cells

    PubMed Central

    Teodori, Laura; Giovanetti, Anna; Albertini, Maria Cristina; Rocchi, Marco; Perniconi, Barbara; Valente, Maria Giovanna; Coletti, Dario

    2014-01-01

    Although static magnetic fields (SMFs) are used extensively in the occupational and medical fields, few comprehensive studies have investigated their possible genotoxic effect and the findings are controversial. With the advent of magnetic resonance imaging-guided radiation therapy, the potential effects of SMFs on ionizing radiation (IR) have become increasingly important. In this study we focused on the genotoxic effect of 80 mT SMFs, both alone and in combination with (i.e. preceding or following) X-ray (XR) irradiation, on primary glioblastoma cells in culture. The cells were exposed to: (i) SMFs alone; (ii) XRs alone; (iii) XR, with SMFs applied during recovery; (iv) SMFs both before and after XR irradiation. XR-induced DNA damage was analyzed by Single Cell Gel Electrophoresis assay (comet assay) using statistical tools designed to assess the tail DNA (TD) and tail length (TL) as indicators of DNA fragmentation. Mitochondrial membrane potential, known to be affected by IR, was assessed using the JC-1 mitochondrial probe. Our results showed that exposure of cells to 5 Gy of XR irradiation alone led to extensive DNA damage, which was significantly reduced by post-irradiation exposure to SMFs. The XR-induced loss of mitochondrial membrane potential was to a large extent averted by exposure to SMFs. These data suggest that SMFs modulate DNA damage and/or damage repair, possibly through a mechanism that affects mitochondria. PMID:24345558

  2. Static magnetic fields modulate X-ray-induced DNA damage in human glioblastoma primary cells.

    PubMed

    Teodori, Laura; Giovanetti, Anna; Albertini, Maria Cristina; Rocchi, Marco; Perniconi, Barbara; Valente, Maria Giovanna; Coletti, Dario

    2014-03-01

    Although static magnetic fields (SMFs) are used extensively in the occupational and medical fields, few comprehensive studies have investigated their possible genotoxic effect and the findings are controversial. With the advent of magnetic resonance imaging-guided radiation therapy, the potential effects of SMFs on ionizing radiation (IR) have become increasingly important. In this study we focused on the genotoxic effect of 80 mT SMFs, both alone and in combination with (i.e. preceding or following) X-ray (XR) irradiation, on primary glioblastoma cells in culture. The cells were exposed to: (i) SMFs alone; (ii) XRs alone; (iii) XR, with SMFs applied during recovery; (iv) SMFs both before and after XR irradiation. XR-induced DNA damage was analyzed by Single Cell Gel Electrophoresis assay (comet assay) using statistical tools designed to assess the tail DNA (TD) and tail length (TL) as indicators of DNA fragmentation. Mitochondrial membrane potential, known to be affected by IR, was assessed using the JC-1 mitochondrial probe. Our results showed that exposure of cells to 5 Gy of XR irradiation alone led to extensive DNA damage, which was significantly reduced by post-irradiation exposure to SMFs. The XR-induced loss of mitochondrial membrane potential was to a large extent averted by exposure to SMFs. These data suggest that SMFs modulate DNA damage and/or damage repair, possibly through a mechanism that affects mitochondria.

  3. DNA Damage-induced Heterogeneous Nuclear Ribonucleoprotein K SUMOylation Regulates p53 Transcriptional Activation*

    PubMed Central

    Pelisch, Federico; Pozzi, Berta; Risso, Guillermo; Muñoz, Manuel Javier; Srebrow, Anabella

    2012-01-01

    Heterogeneous nuclear ribonucleoprotein (hnRNP) K is a nucleocytoplasmic shuttling protein that is a key player in the p53-triggered DNA damage response, acting as a cofactor for p53 in response to DNA damage. hnRNP K is a substrate of the ubiquitin E3 ligase MDM2 and, upon DNA damage, is de-ubiquitylated. In sharp contrast with the role and consequences of the other post-translational modifications, nothing is known about the role of SUMO conjugation to hnRNP K in p53 transcriptional co-activation. In the present work, we show that hnRNP K is modified by SUMO in lysine 422 within its KH3 domain, and sumoylation is regulated by the E3 ligase Pc2/CBX4. Most interestingly, DNA damage stimulates hnRNP K sumoylation through Pc2 E3 activity, and this modification is required for p53 transcriptional activation. Abrogation of hnRNP K sumoylation leads to an aberrant regulation of the p53 target gene p21. Our findings link the DNA damage-induced Pc2 activation to the p53 transcriptional co-activation through hnRNP K sumoylation. PMID:22825850

  4. TGF-{beta}{sub 1}-induced cardiac myofibroblasts are nonproliferating functional cells carrying DNA damages

    SciTech Connect

    Petrov, Victor V. Pelt, Jos F. van; Vermeesch, Joris R.; Van Duppen, Viktor J.; Vekemans, Katrien; Fagard, Robert H.; Lijnen, Paul J.

    2008-04-15

    TGF-{beta}{sub 1} induces differentiation and total inhibition of cardiac MyoFb cell division and DNA synthesis. These effects of TGF-{beta}{sub 1} are irreversible. Inhibition of MyoFb proliferation is accompanied with the expression of Smad1, Mad1, p15Ink4B and total inhibition of telomerase activity. Surprisingly, TGF-{beta}{sub 1}-activated MyoFbs are growth-arrested not only at G1-phase but also at S-phase of the cell cycle. Staining with TUNEL indicates that these cells carry DNA damages. However, the absolute majority of MyoFbs are non-apoptotic cells as established with two apoptosis-specific methods, flow cytometry and caspase-dependent cleavage of cytokeratin 18. Expression in MyoFbs of proliferative cell nuclear antigen even in the absence of serum confirms that these MyoFbs perform repair of DNA damages. These results suggest that TGF-{beta}{sub 1}-activated MyoFbs can be growth-arrested by two checkpoints, the G1/S checkpoint, which prevents cells from entering S-phase and the intra-S checkpoint, which is activated by encountering DNA damage during the S phase or by unrepaired damage that escapes the G1/S checkpoint. Despite carrying of the DNA damages TGF-{beta}{sub 1}-activated MyoFbs are highly functional cells producing lysyl oxidase and contracting the collagen matrix.

  5. Repair of DNA Damage Induced by the Cytidine Analog Zebularine Requires ATR and ATM in Arabidopsis[OPEN

    PubMed Central

    Liu, Chun-Hsin; Finke, Andreas; Díaz, Mariana; Rozhon, Wilfried; Poppenberger, Brigitte; Baubec, Tuncay; Pecinka, Ales

    2015-01-01

    DNA damage repair is an essential cellular mechanism that maintains genome stability. Here, we show that the nonmethylable cytidine analog zebularine induces a DNA damage response in Arabidopsis thaliana, independent of changes in DNA methylation. In contrast to genotoxic agents that induce damage in a cell cycle stage-independent manner, zebularine induces damage specifically during strand synthesis in DNA replication. The signaling of this damage is mediated by additive activity of ATAXIA TELANGIECTASIA MUTATED AND RAD3-RELATED and ATAXIA TELANGIECTASIA MUTATED kinases, which cause postreplicative cell cycle arrest and increased endoreplication. The repair requires a functional STRUCTURAL MAINTENANCE OF CHROMOSOMES5 (SMC5)-SMC6 complex and is accomplished predominantly by synthesis-dependent strand-annealing homologous recombination. Here, we provide insight into the response mechanism for coping with the genotoxic effects of zebularine and identify several components of the zebularine-induced DNA damage repair pathway. PMID:26023162

  6. Heavy ion induced damage to plasmid DNA: plateau region vs. spread out Bragg-peak

    NASA Astrophysics Data System (ADS)

    Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlathölter, T.

    2011-08-01

    We have investigated the damage of synthetic plasmid pBR322 DNA in dilute aqueous solutions induced by fast carbon ions. The relative contribution of indirect damage and direct damage to the DNA itself is expected to vary with linear energy transfer along the ion track, with the direct damage contribution increasing towards the Bragg peak. Therefore, 12C ions at the spread-out Bragg peak (dose averaged LET∞ = 189 ± 15 keV/ μm) and in the plateau region of the Bragg curve (LET = 40 keV/ μm) were employed and the radical scavenger concentration in the plasmid solution was varied to quantify the indirect effect. In order to minimize the influence of 12C break-up fragments, a relatively low initial energy of 90 MeV/nucleon was employed for the carbon ions. DNA damage has been quantified by subsequent electrophoresis on agarose gels. We find that strand breaks due to both indirect and direct effects are systematically higher in the plateau region as compared to the Bragg peak region with the difference being smallest at high scavenging capacities. In view of the fact that the relative biological effectiveness for many biological endpoints is maximum at the Bragg peak our findings imply that DNA damage at the Bragg peak is qualitatively most severe.

  7. DNA damage and oxidative stress induced by acetylsalicylic acid in Daphnia magna.

    PubMed

    Gómez-Oliván, Leobardo Manuel; Galar-Martínez, Marcela; Islas-Flores, Hariz; García-Medina, Sandra; SanJuan-Reyes, Nely

    2014-08-01

    Acetylsalicylic acid is a nonsteroidal anti-inflammatory widely used due to its low cost and high effectiveness. This compound has been found in water bodies worldwide and is toxic to aquatic organisms; nevertheless its capacity to induce oxidative stress in bioindicators like Daphnia magna remains unknown. This study aimed to evaluate toxicity in D. magna induced by acetylsalicylic acid in water, using oxidative stress and DNA damage biomarkers. An acute toxicity test was conducted in order to determine the median lethal concentration (48-h LC50) and the concentrations to be used in the subsequent subacute toxicity test in which the following biomarkers were evaluated: lipid peroxidation, oxidized protein content, activity of the antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase, and level of DNA damage. Lipid peroxidation level and oxidized protein content were significantly increased (p<0.05), and antioxidant enzymes significantly altered with respect to controls; while the DNA damage were significantly increased (p<0.05) too. In conclusion, acetylsalicylic acid induces oxidative stress and DNA damage in D. magna.

  8. ELF magnetic fields do not affect cell survival and DNA damage induced by ultraviolet B.

    PubMed

    Mizuno, Kohei; Narita, Eijiro; Yamada, Masaru; Shinohara, Naoki; Miyakoshi, Junji

    2014-02-01

    We investigated whether extremely low frequency (ELF) magnetic field exposure has modification effects on cell survival after ultraviolet B (UV-B) irradiation and on repair process of DNA damage induced by UV-B irradiation in WI38VA13 subcloned 2RA and XP2OS(SV) cells. The ELF magnetic field exposure was conducted using a Helmholtz coil-based system that was designed to generate a sinusoidal magnetic field at 5 mT and 60 Hz. Cell survival was assessed by WST assay after UV-B irradiation at 20-80 J/m(2) , ELF magnetic field exposure for 24 h, followed by incubation for 48 h. DNA damage was assessed by quantification of cyclobutane pyrimidine dimer formation and 6-4 photoproduct formation using ELISA after UV-B irradiation at 20-80 J/m(2) followed by ELF magnetic field exposure for 24 h. No significant changes were observed in cell survival between ELF magnetic field and sham exposures. Similarly, DNA damage induced by UV-B irradiation did not change significantly following ELF magnetic field exposure. Our results suggest that ELF magnetic field exposure at 5 mT does not have modification effect on cell survival after UV-B irradiation and on repair process of DNA damage induced by UV-B irradiation.

  9. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  10. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. II. Experimental detection

    SciTech Connect

    Rydberg, B.

    1996-02-01

    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single {delta} rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA. In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [{sup 3}H]thymidine and exposed at 0{degrees}C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/pm. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated {open_quotes}regionally multiply damaged sites.{close_quotes} Postirradiation incubation at 37{degrees}C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown. 34 refs., 6 figs., 1 tab.

  11. Baicalein protects mice against radiation-induced DNA damages and genotoxicity.

    PubMed

    Gandhi, Nitin Motilal

    2013-07-01

    Baicalein is the major flavonoid extracted from the root of Scutellaria baicaleins. This flavonoid is used extensively in Chinese herbal medicine. In the present study baicalein is evaluated for its radioprotective properties. Human blood cells when exposed to the γ-radiation ex vivo in presence of baicalein underwent the reduced DNA damage compared to the control. Baicalein administration prior to the whole-body γ-radiation (4 Gy) exposure of mice resulted in protecting the damage to the DNA as measured in their blood cells by alkaline comet assay. Mice when exposed to the radiation (whole body; 1.7 Gy) resulted in damage to the bone marrow as measured by micronucleated reticulocyte (MNRET) formation. Baicalein pre-treatment reduces the radiation induced damage to the bone marrow cells, as there was decrease in the percentage MNRET formation. These findings indicate radio-protecting ability of baicalein.

  12. Involvement of DNA polymerase beta in repairing oxidative damages induced by antitumor drug adriamycin

    SciTech Connect

    Liu Shukun; Wu Mei; Zhang Zunzhen

    2010-08-01

    Adriamycin (ADM) is a widely used antineoplastic drug. However, the increasing cellular resistance has become a serious limitation to ADM clinical application. The most important mechanism related to ADM-induced cell death is oxidative DNA damage mediated by reactive oxygen species (ROS). Base excision repair (BER) is a major pathway in the repair of DNA single strand break (SSB) and oxidized base. In this study, we firstly applied the murine embryo fibroblasts wild-type (pol {beta} +/+) and homozygous pol {beta} null cell (pol {beta} -/-) as a model to investigate ADM DNA-damaging effects and the molecular basis underlying these effects. Here, cellular sensitivity to ADM was examined using colorimetric assay and colony forming assay. ADM-induced cellular ROS level and the alteration of superoxide dismutase (SOD) activity were measured by commercial kits. Further, DNA strand break, chromosomal damage and gene mutation were assessed by comet assay, micronucleus test and hprt gene mutation assay, respectively. The results showed that pol {beta} -/- cells were more sensitive to ADM compared with pol {beta} +/+ cells and more severe SSB and chromosomal damage as well as higher hprt gene mutation frequency were observed in pol {beta} -/- cells. ROS level in pol {beta} -/- cells increased along with decreased activity of SOD. These results demonstrated that pol {beta} deficiency could enable ROS accumulation with SOD activity decrease, further elevate oxidative DNA damage, and subsequently result in SSB, chromosome cleavage as well as gene mutation, which may be partly responsible for the cytotoxicity of ADM and the hypersensitivity of pol {beta} -/- cells to ADM. These findings suggested that pol {beta} is vital for repairing oxidative damage induced by ADM.

  13. Stress-induced DNA damage: a case study in diffuse large B-cell lymphoma

    PubMed Central

    Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Castañeda-Priego, Ramón; Hernández-Lemus, Enrique

    2014-01-01

    DNA damage is one of the mechanisms of mutagenesis. Sequence integrity may be affected by the action of thermal changes, chemical agents, both endogenous and exogenous, and other environmental issues. Abnormally high mutation rates are referred to as genomic instability: a phenomenon closely related to the onset of cancer. Mutant genotypes may be able to confer some kind of selective advantage on subclonal cell populations, leading them to multiply until dominance in a localized tissue environment that later becomes the tumour. Cellular stress, especially that of oxidative and ionic nature, is a recognized trigger for DNA-damaging processes. A physico-chemical model has shown that high hysteresis rates in DNA denaturation curves may be indicative of dissipative processes inducing DNA damage, thus potentially leading to uncontrolled mutagenesis and genome instability. We here study selectively to what extent this phenomenon may occur by analysing the sequence length and composition effects on the thermodynamic behaviour and the presence of hysteresis in pressure-driven DNA denaturation; pronounced hysteresis in the denaturation/renaturation curves may indicate thermal susceptibility to DNA damage. In particular, we consider highly mutated regions of the genome characterized in diffuse large B-cell lymphoma on a recent whole exome next-generation sequencing effort. PMID:25209404

  14. NAD(+) administration decreases doxorubicin-induced liver damage of mice by enhancing antioxidation capacity and decreasing DNA damage.

    PubMed

    Wang, Ban; Ma, Yingxin; Kong, Xiaoni; Ding, Xianting; Gu, Hongchen; Chu, Tianqing; Ying, Weihai

    2014-04-05

    One of the major obstacles for cancer treatment is the toxic side effects of anti-cancer drugs. Doxorubicin (DOX) is one of the most widely used anti-cancer drugs, which produces significant toxic side effects on the heart and such organs as the liver. Because NAD(+) can decrease cellular or tissue damage under multiple conditions, we hypothesized that NAD(+) administration may decrease DOX-induced hepatotoxicity. In this study we tested this hypothesis by using a mouse model, showing that NAD(+) administration can significantly attenuate DOX-induced increase in serum glutamate oxaloacetate transaminase activity and decrease in liver weight. The NAD(+) administration also attenuated the DOX-induced increases in the levels of double-strand DNA (dsDNA) damage, TUNEL signals, and active caspase-3. Furthermore, our data has suggested that the NAD(+) administration could produce protective effects at least partially by restoring the antioxidation capacity of the liver, because NAD(+) administration can attenuate the decreases in both the GSH levels and the glutathione reductase activity of the DOX-treated liver, which could play a significant role in the DOX-induced hepatotoxicity. This finding has provided the first evidence indicating that NAD(+) is capable of increasing the antioxidation capacity of tissues. Collectively, our study has found that NAD(+) can significantly decrease DOX-induced liver damage at least partially by enhancing antioxidation capacity and decreasing dsDNA damage. Because it can also selectively decrease tumor cell survival, NAD(+) may have significant merits over antioxidants for applying jointly with DOX to decrease the toxic side effects of DOX.

  15. Oxidative DNA damage induced by benz[a]anthracene dihydrodiols in the presence of dihydrodiol dehydrogenase.

    PubMed

    Seike, Kazuharu; Murata, Mariko; Hirakawa, Kazutaka; Deyashiki, Yoshihiro; Kawanishi, Shosuke

    2004-11-01

    Tobacco smoke and polluted air are risk factors for lung cancer and contain many kinds of polycyclic aromatic hydrocarbons (PAHs) including benzo[a]pyrene (B[a]P) and benz[a]anthracene (BA). BA, as well as B[a]P, is assessed as probably carcinogenic to humans (IARC group 2A). BA is metabolized to several dihydrodiols. Dihydrodiol dehydrogenase (DD), a member of the aldo-keto reductase superfamily, catalyzes NAD(P)+-linked oxidation of dihydrodiols of aromatic hydrocarbons to corresponding catechols. To clarify the role of DD on PAH carcinogenesis, we examined oxidative DNA damage induced by trans-dihydrodiols of BA and B[a]P treated with DD using 32P-5'-end-labeled DNA fragments obtained from the human p53 tumor suppressor gene. In addition, we investigated the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), an indicator of oxidative DNA damage, in calf thymus DNA by using HPLC with an electrochemical detector. DD-catalyzed BA-1,2-dihydrodiol caused Cu(II)-mediated DNA damage including 8-oxodG formation in the presence of NAD+. BA-1,2-dihydrodiol induced a Fpg sensitive and piperidine labile G lesion at the 5'-ACG-3' sequence complementary to codon 273 of the human p53 tumor suppressor gene, which is known as a hotspot. DNA damage was inhibited by catalase and bathocuproine, suggesting the involvement of H2O2 and Cu(I). The observation of NADH production by UV-visible spectroscopy suggested that DD catalyzed BA-1,2-dihydrodiol most efficiently to the corresponding catechol among the PAH-dihydrodiols tested. A time-of-flight mass spectroscopic study showed that the catechol form of BA-1,2-dihydrodiol formed after DD treatment. In conclusion, BA-1,2-dihydrodiol can induce DNA damage more efficiently than B[a]P-7,8-dihydrodiol and other BA-dihydrodiols in the presence of DD. The reaction mechanism on oxidative DNA damage may be explained by theoretical calculations with an enthalpy change of dihydrodiols and oxidation potential of their catechol forms. DD

  16. Berberine induces apoptosis and DNA damage in MG-63 human osteosarcoma cells

    PubMed Central

    ZHU, YU; MA, NAN; LI, HUI-XIANG; TIAN, LIN; BA, YU-FENG; HAO, BIN

    2014-01-01

    Berberine, an isoquinoline alkaloid extracted from the dry root of Coptidis Rhizoma, has been found to exhibit marked anticancer effects on a panel of established cancer cells. Among the human osteosarcoma lines treated, MG-63 cells were found to be the most sensitive. The present study investigated the potential genotoxic effect of berberine on MG-63 human osteosarcoma cells. The effect of berberine on cell viability was determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and cell apoptosis was analyzed by flow cytometry and a DNA ladder assay. γH2AX focus formation was used to detect DNA damage in MG-63 cells. Berberine induced a significant increase in apoptosis in MG-63 cells in a concentration- and time-dependent manner, as determined by DNA fragmentation analysis and flow cytometry. Furthermore, berberine induced significant concentration- and time-dependent increases in DNA damage compared with that in the negative control. In conclusion, these observations indicated that berberine induced apoptosis and DNA damage in MG-63 cells. PMID:25050485

  17. Berberine induces apoptosis and DNA damage in MG‑63 human osteosarcoma cells.

    PubMed

    Zhu, Yu; Ma, Nan; Li, Hui-Xiang; Tian, Lin; Ba, Yu-Feng; Hao, Bin

    2014-10-01

    Berberine, an isoquinoline alkaloid extracted from the dry root of Coptidis Rhizoma, has been found to exhibit marked anticancer effects on a panel of established cancer cells. Among the human osteosarcoma lines treated, MG‑63 cells were found to be the most sensitive. The present study investigated the potential genotoxic effect of berberine on MG‑63 human osteosarcoma cells. The effect of berberine on cell viability was determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5‑diphenyltetrazolium bromide assay and cell apoptosis was analyzed by flow cytometry and a DNA ladder assay. γH2AX focus formation was used to detect DNA damage in MG-63 cells. Berberine induced a significant increase in apoptosis in MG-63 cells in a concentration- and time-dependent manner, as determined by DNA fragmentation analysis and flow cytometry. Furthermore, berberine induced significant concentration- and time-dependent increases in DNA damage compared with that in the negative control. In conclusion, these observations indicated that berberine induced apoptosis and DNA damage in MG‑63 cells.

  18. Effect of intercellular contact on DNA conformation, radiation-induced DNA damage, and mutation in Chinese hamster V79 cells

    SciTech Connect

    Olive, P.L.; Durand, R.E.

    1985-01-01

    Chinese hamster V79 cells, when grown as small spheroids in suspension culture, are more resistant to killing by ionizing radiation than when grown as monolayers. The authors have attempted to determine whether this enhanced survival following irradiation is reflected in DNA damage and repair at the structural level (by measuring alkali-induced DNA unwinding rates from strand breaks) and at the functional level (by measuring resistance to forward mutation at the HGPRT locus). For a given dose of radiation, the unwinding of DNA in high salt/weak alkali was less complete for spheroid DNA than for monolayer DNA, and the rate of repair of radiation damage was faster in spheroid DNA. These differential responses were lost 8 hr after separation of spheroids into single cells, coinciding with loss of radioresistance measured by clonogenicity. In addition, spheroid cells showed fewer numbers of induced mutants per Gray, although, for a given level of survival, the mutation frequency for monolayers and spheroids was identical. These results suggest that conformational changes in DNA resulting from cell growth as spheroids might enhance repair of radiation-induced lesions.

  19. Repair of oxidatively induced DNA damage by DNA glycosylases: Mechanisms of action, substrate specificities and excision kinetics.

    PubMed

    Dizdaroglu, Miral; Coskun, Erdem; Jaruga, Pawel

    Endogenous and exogenous reactive species cause oxidatively induced DNA damage in living organisms by a variety of mechanisms. As a result, a plethora of mutagenic and/or cytotoxic products are formed in cellular DNA. This type of DNA damage is repaired by base excision repair, although nucleotide excision repair also plays a limited role. DNA glycosylases remove modified DNA bases from DNA by hydrolyzing the glycosidic bond leaving behind an apurinic/apyrimidinic (AP) site. Some of them also possess an accompanying AP-lyase activity that cleaves the sugar-phosphate chain of DNA. Since the first discovery of a DNA glycosylase, many studies have elucidated the mechanisms of action, substrate specificities and excision kinetics of these enzymes present in all living organisms. For this purpose, most studies used single- or double-stranded oligodeoxynucleotides with a single DNA lesion embedded at a defined position. High-molecular weight DNA with multiple base lesions has been used in other studies with the advantage of the simultaneous investigation of many DNA base lesions as substrates. Differences between the substrate specificities and excision kinetics of DNA glycosylases have been found when these two different substrates were used. Some DNA glycosylases possess varying substrate specificities for either purine-derived lesions or pyrimidine-derived lesions, whereas others exhibit cross-activity for both types of lesions. Laboratory animals with knockouts of the genes of DNA glycosylases have also been used to provide unequivocal evidence for the substrates, which had previously been found in in vitro studies, to be the actual substrates in vivo as well. On the basis of the knowledge gained from the past studies, efforts are being made to discover small molecule inhibitors of DNA glycosylases that may be used as potential drugs in cancer therapy.

  20. Mitochondria regulate DNA damage and genomic instability induced by high LET radiation

    NASA Astrophysics Data System (ADS)

    Zhang, Bo; Davidson, Mercy M.; Hei, Tom K.

    2014-04-01

    High linear energy transfer (LET) radiation including α particles and heavy ions is the major type of radiation found in space and is considered a potential health risk for astronauts. Even though the chance that these high LET particles traversing through the cytoplasm of cells is higher than that through the nuclei, the contribution of targeted cytoplasmic irradiation to the induction of genomic instability and other chromosomal damages induced by high LET radiation is not known. In the present study, we investigated whether mitochondria are the potential cytoplasmic target of high LET radiation in mediating cellular damage using a mitochondrial DNA (mtDNA) depleted (ρ0) human small airway epithelial (SAE) cell model and a precision charged particle microbeam with a beam width of merely one micron. Targeted cytoplasmic irradiation by high LET α particles induced DNA oxidative damage and double strand breaks in wild type ρ+ SAE cells. Furthermore, there was a significant increase in autophagy and micronuclei, which is an indication of genomic instability, together with the activation of nuclear factor kappa-B (NF-κB) and mitochondrial inducible nitric oxide synthase (iNOS) signaling pathways in ρ+ SAE cells. In contrast, ρ0 SAE cells exhibited a significantly lower response to these same endpoints examined after cytoplasmic irradiation with high LET α particles. The results indicate that mitochondria are essential in mediating cytoplasmic radiation induced genotoxic damage in mammalian cells. Furthermore, the findings may shed some light in the design of countermeasures for space radiation.

  1. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    SciTech Connect

    Han, Xu; Ptasinska, Sylwia; Klas, Matej; Liu, Yueying; Sharon Stack, M.

    2013-06-10

    The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

  2. Clustered DNA damages induced by high and low LET radiation, including heavy ions

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Schenk, H.; Sidorkina, O.; Laval, J.; Trunk, J.; Monteleone, D.; Sutherland, J.; Lowenstein, D. I. (Principal Investigator)

    2001-01-01

    Clustered DNA damages--here defined as two or more lesions (strand breaks, oxidized purines, oxidized pyrimidines or abasic sites) within a few helical turns--have been postulated as difficult to repair accurately, and thus highly significant biological lesions. Further, attempted repair of clusters may produce double strand breaks (DSBs). However, until recently, there was no way to measure ionizing radiation-induced clustered damages, except DSB. We recently described an approach for measuring classes of clustered damages (oxidized purine clusters, oxidized pyrimidine clusters, abasic clusters, along with DSB). We showed that ionizing radiation (gamma rays and Fe ions, 1 GeV/amu) does induce such clusters in genomic DNA in solution and in human cells. These studies also showed that each damage cluster results from one radiation hit (and its track), thus indicating that they can be induced by very low doses of radiation, i.e. two independent hits are not required for cluster induction. Further, among all complex damages, double strand breaks comprise--at most-- 20%, with the other clustered damages being at least 80%.

  3. Protection of cisplatin-induced spermatotoxicity, DNA damage and chromatin abnormality by selenium nano-particles

    SciTech Connect

    Rezvanfar, Mohammad Amin; Rezvanfar, Mohammad Ali; Shahverdi, Ahmad Reza; Ahmadi, Abbas; Baeeri, Maryam; Mohammadirad, Azadeh; Abdollahi, Mohammad

    2013-02-01

    Cisplatin (CIS), an anticancer alkylating agent, induces DNA adducts and effectively cross links the DNA strands and so affects spermatozoa as a male reproductive toxicant. The present study investigated the cellular/biochemical mechanisms underlying possible protective effect of selenium nano-particles (Nano-Se) as an established strong antioxidant with more bioavailability and less toxicity, on reproductive toxicity of CIS by assessment of sperm characteristics, sperm DNA integrity, chromatin quality and spermatogenic disorders. To determine the role of oxidative stress (OS) in the pathogenesis of CIS gonadotoxicity, the level of lipid peroxidation (LPO), antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and peroxynitrite (ONOO) as a marker of nitrosative stress (NS) and testosterone (T) concentration as a biomarker of testicular function were measured in the blood and testes. Thirty-two male Wistar rats were equally divided into four groups. A single IP dose of CIS (7 mg/kg) and protective dose of Nano-Se (2 mg/kg/day) were administered alone or in combination. The CIS-exposed rats showed a significant increase in testicular and serum LPO and ONOO level, along with a significant decrease in enzymatic antioxidants levels, diminished serum T concentration and abnormal histologic findings with impaired sperm quality associated with increased DNA damage and decreased chromatin quality. Coadministration of Nano-Se significantly improved the serum T, sperm quality, and spermatogenesis and reduced CIS-induced free radical toxic stress and spermatic DNA damage. In conclusion, the current study demonstrated that Nano-Se may be useful to prevent CIS-induced gonadotoxicity through its antioxidant potential. Highlights: ► Cisplatin (CIS) affects spermatozoa as a male reproductive toxicant. ► Effect of Nano-Se on CIS-induced spermatotoxicity was investigated. ► CIS-exposure induces oxidative sperm DNA damage

  4. Spatiotemporal dynamics of DNA repair proteins following laser microbeam induced DNA damage - when is a DSB not a DSB?

    PubMed

    Reynolds, Pamela; Botchway, Stanley W; Parker, Anthony W; O'Neill, Peter

    2013-08-30

    The formation of DNA lesions poses a constant threat to cellular stability. Repair of endogenously and exogenously produced lesions has therefore been extensively studied, although the spatiotemporal dynamics of the repair processes has yet to be fully understood. One of the most recent advances to study the kinetics of DNA repair has been the development of laser microbeams to induce and visualize recruitment and loss of repair proteins to base damage in live mammalian cells. However, a number of studies have produced contradictory results that are likely caused by the different laser systems used reflecting in part the wavelength dependence of the damage induced. Additionally, the repair kinetics of laser microbeam induced DNA lesions have generally lacked consideration of the structural and chemical complexity of the DNA damage sites, which are known to greatly influence their reparability. In this review, we highlight the key considerations when embarking on laser microbeam experiments and interpreting the real time data from laser microbeam irradiations. We compare the repair kinetics from live cell imaging with biochemical and direct quantitative cellular measurements for DNA repair.

  5. ERCC2/XPD Lys751Gln alter DNA repair efficiency of platinum-induced DNA damage through P53 pathway.

    PubMed

    Zhang, Guopei; Guan, Yangyang; Zhao, Yuejiao; van der Straaten, Tahar; Xiao, Sha; Xue, Ping; Zhu, Guolian; Liu, Qiufang; Cai, Yuan; Jin, Cuihong; Yang, Jinghua; Wu, Shengwen; Lu, Xiaobo

    2017-02-01

    Platinum-based treatment causes Pt-DNA adducts which lead to cell death. The platinum-induced DNA damage is recognized and repaired by the nucleotide excision repair (NER) system of which ERCC2/XPD is a critical enzyme. Single nucleotide polymorphisms in ERCC2/XPD have been found to be associated with platinum resistance. The aim of the present study was to investigate whether ERCC2/XPD Lys751Gln (rs13181) polymorphism is causally related to DNA repair capacity of platinum-induced DNA damage. First, cDNA clones expressing different genotypes of the polymorphism was transfected to an ERCC2/XPD defective CHO cell line (UV5). Second, all cells were treated with cisplatin. Cellular survival rate were investigated by MTT growth inhibition assay, DNA damage levels were investigated by comet assay and RAD51 staining. The distribution of cell cycle and the change of apoptosis rates were detected by a flow cytometric method (FCM). Finally, P53mRNA and phospho-P53 protein levels were further investigated in order to explore a possible explanation. As expected, there was a significantly increased in viability of UV5(ERCC2 (AA)) as compared to UV5(ERCC2 (CC)) after cisplatin treatment. The DNA damage level of UV5(ERCC2 (AA)) was significant decreased compared to UV5(ERCC2 (CC)) at 24 h of treatment. Mutation of ERCC2rs13181 AA to CC causes a prolonged S phase in cell cycle. UV5(ERCC2 (AA)) alleviated the apoptosis compared to UV5(ERCC2 (CC)), meanwhile P53mRNA levels in UV(ERCC2 (AA)) was also lower when compared UV5(ERCC2 (CC)). It co-incides with a prolonged high expression of phospho-P53, which is relevant for cell cycle regulation, apoptosis, and the DNA damage response (DDR). We concluded that ERCC2/XPD rs13181 polymorphism is possibly related to the DNA repair capacity of platinum-induced DNA damage. This functional study provides some clues to clarify the relationship between cisplatin resistance and ERCC2/XPDrs13181 polymorphism.

  6. Rofecoxib prevents ctdsDNA against damage induced by copper sulfate and ultraviolet B radiation in vitro study.

    PubMed

    Al-Nimer, Marwan S M; Al-Deen, Suad M; Abdul Lateef, Zainab W

    2010-12-01

    Rofecoxib is a selective cyclooxygenase COX-2 enzyme inhibitor with chemoprotective effect against cancer in experimental models. This study aimed to investigate the effect of rofecoxib against ctds DNA damage induced by copper ions or ultraviolet (UV)B radiation. Aliquot ctdsDNA samples were incubated with copper sulfate solution (50 nmol) and rofecoxib (0.8 mol) was added either before or after the admixing the ctdsDNA with copper sulfate. In another experimental series, aliquot of ctdsDNA were exposed to UVB radiation for 30 min in absence or presence of rofecoxib. Rofecoxib significantly attenuated the separation of double strands of DNA (detected by increase the absorbance of DNA at 260 nm) induced by Cu ions. Rofecoxib significantly offered protection against UVB-induced DNA damage. It is concluded that rofecoxib offered protection against copper ions or UVB induced-DNA damage via different mechanisms not related to the inhibition COX-2.

  7. Hydrogen sulfide induces oxidative damage to RNA and DNA in a sulfide-tolerant marine invertebrate.

    PubMed

    Joyner-Matos, Joanna; Predmore, Benjamin L; Stein, Jenny R; Leeuwenburgh, Christiaan; Julian, David

    2010-01-01

    Hydrogen sulfide acts as an environmental toxin across a range of concentrations and as a cellular signaling molecule at very low concentrations. Despite its toxicity, many animals, including the mudflat polychaete Glycera dibranchiata, are periodically or continuously exposed to sulfide in their environment. We tested the hypothesis that a broad range of ecologically relevant sulfide concentrations induces oxidative stress and oxidative damage to RNA and DNA in G. dibranchiata. Coelomocytes exposed in vitro to sulfide (0-3 mmol L(-1) for 1 h) showed dose-dependent increases in oxidative stress (as 2',7'-dichlorofluorescein fluorescence) and superoxide production (as dihydroethidine fluorescence). Coelomocytes exposed in vitro to sulfide (up to 0.73 mmol L(-1) for 2 h) also acquired increased oxidative damage to RNA (detected as 8-oxo-7,8-dihydroguanosine) and DNA (detected as 8-oxo-7,8-dihydro-2'-deoxyguanosine). Worms exposed in vivo to sulfide (0-10 mmol L(-1) for 24 h) acquired elevated oxidative damage to RNA and DNA in both coelomocytes and body wall tissue. While the consequences of RNA and DNA oxidative damage are poorly understood, oxidatively damaged deoxyguanosine bases preferentially bind thymine, causing G-T transversions and potentially causing heritable point mutations. This suggests that sulfide can be an environmental mutagen in sulfide-tolerant invertebrates.

  8. Low energy electron induced damage to plasmid DNA pQE30

    SciTech Connect

    Kumar, S. V. K.; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D.; Rao, Basuthkar J.

    2012-07-28

    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and {approx}18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  9. Low energy electron induced damage to plasmid DNA pQE30

    NASA Astrophysics Data System (ADS)

    Kumar, S. V. K.; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D.; Rao, Basuthkar J.

    2012-07-01

    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and ˜18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  10. Cadmium Chloride Induces DNA Damage and Apoptosis of Human Liver Carcinoma Cells via Oxidative Stress.

    PubMed

    Skipper, Anthony; Sims, Jennifer N; Yedjou, Clement G; Tchounwou, Paul B

    2016-01-02

    Cadmium is a heavy metal that has been shown to cause its toxicity in humans and animals. Many documented studies have shown that cadmium produces various genotoxic effects such as DNA damage and chromosomal aberrations. Ailments such as bone disease, renal damage, and several forms of cancer are attributed to overexposure to cadmium. Although there have been numerous studies examining the effects of cadmium in animal models and a few case studies involving communities where cadmium contamination has occurred, its molecular mechanisms of action are not fully elucidated. In this research, we hypothesized that oxidative stress plays a key role in cadmium chloride-induced toxicity, DNA damage, and apoptosis of human liver carcinoma (HepG₂) cells. To test our hypothesis, cell viability was determined by MTT assay. Lipid hydroperoxide content stress was estimated by lipid peroxidation assay. Genotoxic damage was tested by the means of alkaline single cell gel electrophoresis (Comet) assay. Cell apoptosis was measured by flow cytometry assessment (Annexin-V/PI assay). The result of MTT assay indicated that cadmium chloride induces toxicity to HepG₂ cells in a concentration-dependent manner, showing a 48 hr-LD50 of 3.6 µg/mL. Data generated from lipid peroxidation assay resulted in a significant (p < 0.05) increase of hydroperoxide production, specifically at the highest concentration tested. Data obtained from the Comet assay indicated that cadmium chloride causes DNA damage in HepG₂ cells in a concentration-dependent manner. A strong concentration-response relationship (p < 0.05) was recorded between annexin V positive cells and cadmium chloride exposure. In summary, these in vitro studies provide clear evidence that cadmium chloride induces oxidative stress, DNA damage, and programmed cell death in human liver carcinoma (HepG₂) cells.

  11. Delayed repair of radiation induced clustered DNA damage: Friend or foe?

    PubMed Central

    Eccles, Laura J.; O’Neill, Peter; Lomax, Martine E.

    2011-01-01

    A signature of ionizing radiation exposure is the induction of DNA clustered damaged sites, defined as two or more lesions within one to two helical turns of DNA by passage of a single radiation track. Clustered damage is made up of double strand breaks (DSB) with associated base lesions or abasic (AP) sites, and non-DSB clusters comprised of base lesions, AP sites and single strand breaks. This review will concentrate on the experimental findings of the processing of non-DSB clustered damaged sites. It has been shown that non-DSB clustered damaged sites compromise the base excision repair pathway leading to the lifetime extension of the lesions within the cluster, compared to isolated lesions, thus the likelihood that the lesions persist to replication and induce mutation is increased. In addition certain non-DSB clustered damaged sites are processed within the cell to form additional DSB. The use of E. coli to demonstrate that clustering of DNA lesions is the major cause of the detrimental consequences of ionizing radiation is also discussed. The delayed repair of non-DSB clustered damaged sites in humans can be seen as a “friend”, leading to cell killing in tumour cells or as a “foe”, resulting in the formation of mutations and genetic instability in normal tissue. PMID:21130102

  12. ATM induces MacroD2 nuclear export upon DNA damage

    PubMed Central

    Golia, Barbara; Moeller, Giuliana Katharina; Jankevicius, Gytis; Schmidt, Andreas; Hegele, Anna; Preißer, Julia; Tran, Mai Ly; Imhof, Axel; Timinszky, Gyula

    2017-01-01

    ADP-ribosylation is a dynamic post-translation modification that regulates the early phase of various DNA repair pathways by recruiting repair factors to chromatin. ADP-ribosylation levels are defined by the activities of specific transferases and hydrolases. However, except for the transferase PARP1/ARDT1 little is known about regulation of these enzymes. We found that MacroD2, a mono-ADP-ribosylhydrolase, is exported from the nucleus upon DNA damage, and that this nuclear export is induced by ATM activity. We show that the export is dependent on the phosphorylation of two SQ/TQ motifs, suggesting a novel direct interaction between ATM and ADP-ribosylation. Lastly, we show that MacroD2 nuclear export temporally restricts its recruitment to DNA lesions, which may decrease the net ADP-ribosylhydrolase activity at the site of DNA damage. Together, our results identify a novel feedback regulation between two crucial DNA damage-induced signaling pathways: ADP-ribosylation and ATM activation. PMID:28069995

  13. Use of RAPD to detect sodium arsenite-induced DNA damage in human lymphoblastoid cells.

    PubMed

    Lee, Yuan-Cho; Yang, Vivian C; Wang, Tsu-Shing

    2007-09-24

    Inorganic arsenic is a known human carcinogen, yet its mechanism of action remains unclear. Our previous study showed that arsenite significantly induces oxidative DNA adducts and DNA-protein cross-links in several mammalian cell lines. In the present study, we used the random amplified polymorphic DNA (RAPD) assay to evaluate the possible target in the genomic DNA of human lymphoblastoid cells that were exposed to sodium arsenite. Treatment with both 10 and 80 microM arsenite for 4h induced significant changes in RAPD profiles compared with the control pattern. Two 10-mer RAPD primers (D11 and F1) produced the most distinguishable banding profiles between arsenite-treated and control genomic DNA. The sequencing of four arsenite-sensitive RAPD bands showed that the RB1CC1 and PACE4 genes might be the DNA targets of sodium arsenite treatment. We propose that arsenite may induce sequence- or gene-specific damage and then change the RAPD profile in human lymphoblastoid cells. The results of our study also show that RAPD combined with other techniques is a good tool for detecting alterations in genomic DNA and for the direct screening of new molecular markers related to arsenite-induced carcinogenesis.

  14. Polo-like kinase 1 depletion induces DNA damage in early S prior to caspase activation.

    PubMed

    Yim, Hyungshin; Erikson, Raymond L

    2009-05-01

    Polo-like kinase 1 (Plk1) plays several roles in mitosis, and it has been suggested to have a role in tumorigenesis. We have previously reported that Plk1 depletion results in cell death in cancer cells, whereas normal cells survive similar depletion. However, Plk1 depletion together with p53 depletion induces cell death in normal cells as well. This communication presents evidence on the sequence of events that leads to cell death in cancer cells. DNA damage is detected at the first S phase following Plk1 depletion and is more severe in Plk1-depleted p53-null cancer cells. As a consequence of Plk1 depletion using lentivirus-based small interfering RNA techniques, prereplicative complex (pre-RC) formation is disrupted at the G(1)/S transition, and DNA synthesis is reduced during S phase of the first cycle after depletion. The levels of geminin, an inhibitor of DNA pre-RC, and Emi1, an inhibitor of anaphase-promoting complex/cyclosome, are elevated in Plk1-depleted cells. The rate of cell cycling is slower in Plk1-depleted cells than in control cells when synchronized by serum starvation. Plk1 depletion results in disrupted DNA pre-RC formation, reduced DNA synthesis, and DNA damage before cells display severe mitotic catastrophe or apoptosis. Our data suggest that Plk1 is required for cell cycle progression not only in mitosis but also for DNA synthesis, maintenance of DNA integrity, and prevention of cell death.

  15. Aag DNA glycosylase promotes alkylation-induced tissue damage mediated by Parp1.

    PubMed

    Calvo, Jennifer A; Moroski-Erkul, Catherine A; Lake, Annabelle; Eichinger, Lindsey W; Shah, Dharini; Jhun, Iny; Limsirichai, Prajit; Bronson, Roderick T; Christiani, David C; Meira, Lisiane B; Samson, Leona D

    2013-04-01

    Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER) is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG) mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag⁻/⁻ mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage.

  16. Involvement of DNA-PK and ATM in radiation- and heat-induced DNA damage recognition and apoptotic cell death.

    PubMed

    Tomita, Masanori

    2010-01-01

    Exposure to ionizing radiation and hyperthermia results in important biological consequences, e.g. cell death, chromosomal aberrations, mutations, and DNA strand breaks. There is good evidence that the nucleus, specifically cellular DNA, is the principal target for radiation-induced cell lethality. DNA double-strand breaks (DSBs) are considered to be the most serious type of DNA damage induced by ionizing radiation. On the other hand, verifiable mechanisms which can lead to heat-induced cell death are damage to the plasma membrane and/or inactivation of heat-labile proteins caused by protein denaturation and subsequent aggregation. Recently, several reports have suggested that DSBs can be induced after hyperthermia because heat-induced phosphorylated histone H2AX (γ-H2AX) foci formation can be observed in several mammalian cell lines. In mammalian cells, DSBs are repaired primarily through two distinct and complementary mechanisms: non-homologous end joining (NHEJ), and homologous recombination (HR) or homology-directed repair (HDR). DNA-dependent protein kinase (DNA-PK) and ataxia-telangiectasia mutated (ATM) are key players in the initiation of DSB repair and phosphorylate and/or activate many substrates, including themselves. These phosphorylated substrates have important roles in the functioning of cell cycle checkpoints and in cell death, as well as in DSB repair. Apoptotic cell death is a crucial cell suicide mechanism during development and in the defense of homeostasis. If DSBs are unrepaired or misrepaired, apoptosis is a very important system which can protect an organism against carcinogenesis. This paper reviews recently obtained results and current topics concerning the role of DNA-PK and ATM in heat- or radiation-induced apoptotic cell death.

  17. Monitoring ultraviolet-B-induced DNA damage in individual diatom cells by immunofluorescent thymine dimer detection

    SciTech Connect

    Buma, A.G.J.; Van Hannen, E.J.; Roza, L.

    1995-04-01

    We developed a method to investigate the effect of ultraviolet-B radiation (UVBR) on the formation of thymine dimers in microalgal DNA that can be used for both laboratory and in situ research. Antibody labeling of dimers was followed by a secondary antibody (fluorescein isothiocyanate) staining to allow visualization of DNA damage with flow cytometry or fluorescence microscopy. Thymine dimer-specific fluorescence in nuclear DNA of the marine diatom Cyclotella sp. was linearly related to the UVBR dose. Simultaneous measurements of cellular DNA content showed that the vulnerability of G2 cells to DNA damage did not differ significantly from the vulnerability of G1 cells. The formation and removal of thymine dimers in Cyclotella sp. cells was monitored for 3 consecutive days at two realistic UVBR irradiance levels. Thymine dimers were removed within 24 h when exposed to a saturating photosynthetically active radiation intensity following the UVBR treatment. This new method allows the study of UVBR-induced DNA damage on a cell-to-cell basis. It is also feasible for field studies because cells remain intact and can be recognized readily after antibody treatment. 40 refs., 7 figs.

  18. Oxidative stress-induced CREB upregulation promotes DNA damage repair prior to neuronal cell death protection.

    PubMed

    Pregi, Nicolás; Belluscio, Laura María; Berardino, Bruno Gabriel; Castillo, Daniela Susana; Cánepa, Eduardo Tomás

    2017-01-01

    cAMP response element-binding (CREB) protein is a cellular transcription factor that mediates responses to different physiological and pathological signals. Using a model of human neuronal cells we demonstrate herein, that CREB is phosphorylated after oxidative stress induced by hydrogen peroxide. This phosphorylation is largely independent of PKA and of the canonical phosphoacceptor site at ser-133, and is accompanied by an upregulation of CREB expression at both mRNA and protein levels. In accordance with previous data, we show that CREB upregulation promotes cell survival and that its silencing results in an increment of apoptosis after oxidative stress. Interestingly, we also found that CREB promotes DNA repair after treatment with hydrogen peroxide. Using a cDNA microarray we found that CREB is responsible for the regulation of many genes involved in DNA repair and cell survival after oxidative injury. In summary, the neuroprotective effect mediated by CREB appears to follow three essential steps following oxidative injury. First, the upregulation of CREB expression that allows sufficient level of activated and phosphorylated protein is the primordial event that promotes the induction of genes of the DNA Damage Response. Then and when the DNA repair is effective, CREB induces detoxification and survival genes. This kinetics seems to be important to completely resolve oxidative-induced neuronal damages.

  19. Human Telomeres Are Hypersensitive to UV-Induced DNA Damage and Refractory to Repair

    PubMed Central

    Rochette, Patrick J.; Brash, Douglas E.

    2010-01-01

    Telomeric repeats preserve genome integrity by stabilizing chromosomes, a function that appears to be important for both cancer and aging. In view of this critical role in genomic integrity, the telomere's own integrity should be of paramount importance to the cell. Ultraviolet light (UV), the preeminent risk factor in skin cancer development, induces mainly cyclobutane pyrimidine dimers (CPD) which are both mutagenic and lethal. The human telomeric repeat unit (5′TTAGGG/CCCTAA3′) is nearly optimal for acquiring UV-induced CPD, which form at dipyrimidine sites. We developed a ChIP–based technique, immunoprecipitation of DNA damage (IPoD), to simultaneously study DNA damage and repair in the telomere and in the coding regions of p53, 28S rDNA, and mitochondrial DNA. We find that human telomeres in vivo are 7-fold hypersensitive to UV-induced DNA damage. In double-stranded oligonucleotides, this hypersensitivity is a property of both telomeric and non-telomeric repeats; in a series of telomeric repeat oligonucleotides, a phase change conferring UV-sensitivity occurs above 4 repeats. Furthermore, CPD removal in the telomere is almost absent, matching the rate in mitochondria known to lack nucleotide excision repair. Cells containing persistent high levels of telomeric CPDs nevertheless proliferate, and chronic UV irradiation of cells does not accelerate telomere shortening. Telomeres are therefore unique in at least three respects: their biophysical UV sensitivity, their prevention of excision repair, and their tolerance of unrepaired lesions. Utilizing a lesion-tolerance strategy rather than repair would prevent double-strand breaks at closely-opposed excision repair sites on opposite strands of a damage-hypersensitive repeat. PMID:20442874

  20. Ku70 inhibits gemcitabine-induced DNA damage and pancreatic cancer cell apoptosis.

    PubMed

    Ma, Jiali; Hui, Pingping; Meng, Wenying; Wang, Na; Xiang, Shihao

    2017-03-18

    The current study focused on the role of Ku70, a DNA-dependent protein kinase (DNA-PK) complex protein, in pancreatic cancer cell resistance to gemcitabine. In both established cell lines (Mia-PaCa-2 and PANC-1) and primary human pancreatic cancer cells, shRNA/siRNA-mediated knockdown of Ku70 significantly sensitized gemcitabine-induced cell death and proliferation inhibition. Meanwhile, gemcitabine-induced DNA damage and subsequent pancreatic cancer cell apoptosis were also potentiated with Ku70 knockdown. On the other hand, exogenous overexpression of Ku70 in Mia-PaCa-2 cells suppressed gemcitabine-induced DNA damage and subsequent cell apoptosis. In a severe combined immune deficient (SCID) mice Mia-PaCa-2 xenograft model, gemcitabine-induced anti-tumor activity was remarkably pontificated when combined with Ku70 shRNA knockdown in the xenografts. The results of this preclinical study imply that Ku70 might be a primary resistance factor of gemcitabine, and Ku70 silence could significantly chemo-sensitize gemcitabine in pancreatic cancer cells.

  1. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.

    PubMed

    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth

    2012-09-01

    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound.

  2. Plasma induced DNA damage: Comparison with the effects of ionizing radiation

    NASA Astrophysics Data System (ADS)

    Lazović, S.; Maletić, D.; Leskovac, A.; Filipović, J.; Puač, N.; Malović, G.; Joksić, G.; Petrović, Z. Lj.

    2014-09-01

    We use human primary fibroblasts for comparing plasma and gamma rays induced DNA damage. In both cases, DNA strand breaks occur, but of fundamentally different nature. Unlike gamma exposure, contact with plasma predominantly leads to single strand breaks and base-damages, while double strand breaks are mainly consequence of the cell repair mechanisms. Different cell signaling mechanisms are detected confirming this (ataxia telangiectasia mutated - ATM and ataxia telangiectasia and Rad3 related - ATR, respectively). The effective plasma doses can be tuned to match the typical therapeutic doses of 2 Gy. Tailoring the effective dose through plasma power and duration of the treatment enables safety precautions mainly by inducing apoptosis and consequently reduced frequency of micronuclei.

  3. Low Dose Iron Treatments Induce a DNA Damage Response in Human Endothelial Cells within Minutes

    PubMed Central

    Mollet, Inês G.; Giess, Adam; Paschalaki, Koralia; Periyasamy, Manikandan; Lidington, Elaine C.; Mason, Justin C.; Jones, Michael D.; Game, Laurence; Ali, Simak; Shovlin, Claire L.

    2016-01-01

    , and induce a DNA damage response. PMID:26866805

  4. Differential colon DNA damage induced by azo food additives between rats and mice.

    PubMed

    Shimada, Chihiro; Kano, Kiyoshi; Sasaki, Yu F; Sato, Itaru; Tsudua, Shuji

    2010-08-01

    Azo dyes, amaranth, allura red and new coccine, which are currently used as food color additives in Japan, have been reported to cause colon specific DNA damage in mice. To examine species difference in the DNA damage between rats and mice, each of dyes was administered to male mice (1 and 10 mg/kg) and male rats (10, 100 and 1,000 mg/kg) by gavage. Brain, lung, liver, kidney, glandular stomach, colon, urinary bladder and bone marrow were sampled 3 hr (for mice) and 3, 6, 12 and 24 hr (for rats) after the treatment. The alkaline comet assay showed DNA damage in the mouse colon 3 hr after the administration of all of the dyes at 10 mg/kg. In rats, however, none of the dyes damaged DNA. Azo dyes should undergo metabolic reduction in the colon to be adducted to DNA. To determine transit time of the dyes to the colon after their administration, gastric emptying and intestinal transport in mice and rats were examined using brilliant blue FCF (BB) as an indicator. The half times of gastric emptying were 70 and 80 min for mice and rats, respectively; and about 60% of the BB was removed from the stomach 1 hr after the gastric intubation in both mice and rats. BB reached the mouse and rat colon 1 and 3 hr after the administration, respectively. Considering the wide dose range and sampling times well covering the transit time to the colon, rats may be insensitive to these azo dye-induced DNA damage.

  5. DNA damage-induced translocation of S100A11 into the nucleus regulates cell proliferation

    PubMed Central

    2010-01-01

    Background Proteins are able to react in response to distinct stress stimuli by alteration of their subcellular distribution. The stress-responsive protein S100A11 belongs to the family of multifunctional S100 proteins which have been implicated in several key biological processes. Previously, we have shown that S100A11 is directly involved in DNA repair processes at damaged chromatin in the nucleus. To gain further insight into the underlying mechanism subcellular trafficking of S100A11 in response to DNA damage was analyzed. Results We show that DNA damage induces a nucleolin-mediated translocation of S100A11 from the cytoplasm into the nucleus. This translocation is impeded by inhibition of the phosphorylation activity of PKCα. Translocation of S100A11 into the nucleus correlates with an increased cellular p21 protein level. Depletion of nucleolin by siRNA severely impairs translocation of S100A11 into the nucleus resulting in a decreased p21 protein level. Additionally, cells lacking nucleolin showed a reduced colony forming capacity. Conclusions These observations suggest that regulation of the subcellular distribution of S100A11 plays an important role in the DNA damage response and p21-mediated cell cycle control. PMID:21167017

  6. Comparison of cytotoxicity and DNA damage potential induced by ent-kaurene diterpenoids from Isodon plant.

    PubMed

    Ding, Lan; Zhou, Qiyin; Wang, Li; Wang, Wei; Zhang, Shidong; Liu, Bo

    2011-09-01

    The cytotoxicity of six ent-kaurene diterpenoids isolated from the leaves of Isodon japonica (Burm.f.) Hara var. galaucocalyx (maxin) Hara was evaluated against three human tumour HepG2, GLC-82 and HL-60 cell lines through SRB assay, and their DNA damage potential (against HepG2 cell line) was assessed by comet assay. Among the six ent-kaurene diterpenoids, Rabdosin B was most cytotoxic, followed by Oridonin, Epinodosin, Rabdosinate, Lasiokaurin and Epinodosinol. All of the six ent-kaurene diterpenoids induced significant DNA damage (p < 0.05) to HepG2 cells in a time- and dose-dependent manner except Lasiokaurin and Eponodosinol at 6 µmol L⁻¹ for 24 h. The structure-activity relationships (SARs) were discussed and it was found that exo-methylene cyclopentanone in the molecular structure was important for maintaining the cytotoxicity and DNA damage potential of the compounds.-OAc group at site C-1 in Lasiokaurin had a higher stereospecific blockade, which made the compound have less cytotoxicity and DNA damage potential than Oridonin (-OH at C-1).

  7. Preferential repair of UV damage in highly transcribed DNA diminishes UV-induced intrachromosomal recombination in mammalian cells.

    PubMed Central

    Deng, W P; Nickoloff, J A

    1994-01-01

    The relationships among transcription, recombination, DNA damage, and repair in mammalian cells were investigated. We monitored the effects of transcription on UV-induced intrachromosomal recombination between neomycin repeats including a promoterless allele and an inducible heteroallele regulated by the mouse mammary tumor virus promoter. Although transcription and UV light separately stimulated recombination, increasing transcription levels reduced UV-induced recombination. Preferential repair of UV damage in transcribed strands was shown in highly transcribed DNA, suggesting that recombination is stimulated by unrepaired UV damage and that increased DNA repair in highly transcribed alleles removes recombinogenic lesions. This study indicates that the genetic consequences of DNA damage depend on transcriptional states and provides a basis for understanding tissue- and gene-specific responses to DNA-damaging agents. Images PMID:8264606

  8. Resveratrol affects DNA damage induced by ionizing radiation in human lymphocytes in vitro.

    PubMed

    Basso, Emiliano; Regazzo, Giulia; Fiore, Mario; Palma, Valentina; Traversi, Gianandrea; Testa, Antonella; Degrassi, Francesca; Cozzi, Renata

    2016-08-01

    Resveratrol (3,4',5-trihydroxystilbene; RSV) acts on cancer cells in several ways, inducing cell cycle delay and apoptotic death, and enhancing ionizing radiation (IR)-mediated responses. However, fewer studies have examined RSV effects on normal cells. We have treated human lymphocytes in vitro with RSV, either alone or combined with IR, to evaluate its potential use as a radioprotector. We measured the effects of RSV on induction of DNA damage, repair kinetics, and modulation of histone deacetylase activity.

  9. Regulation of BRCA1 Function by DNA Damage-Induced Site-Specific Phosphorylation

    DTIC Science & Technology

    2005-06-01

    Rad51p proteins, the lat - end-joining. BRCA-2 complexed with machinery. ter a member of the RAD-52 epi- RAD-51 is active in strand exchange BRCA- 1 has...AD Award Number: DAMD17-02- 1 -0584 TITLE: Regulation of BRCAl Function by DNA Damage-Induced Site- Specific Phosphorylation PRINCIPAL INVESTIGATOR...ApprovedREPORT DOCUMENTATION PAGE OMB No. 0704-0188 Public reporting burden for this collection of Information Is estimated to average 1 hour per

  10. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells

    PubMed Central

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng

    2015-01-01

    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague–Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  11. Laser microbeam-induced DNA damage inhibits cell division in fertilized eggs and early embryos

    PubMed Central

    Wang, Zhong-Wei; Ma, Xue-Shan; Ma, Jun-Yu; Luo, Yi-Bo; Lin, Fei; Wang, Zhen-Bo; Fan, Heng-Yu; Schatten, Heide; Sun, Qing-Yuan

    2013-01-01

    DNA double-strand breaks are caused by both intracellular physiological processes and environmental stress. In this study, we used laser microbeam cut (abbreviated microcut or cut), which allows specific DNA damage in the pronucleus of a fertilized egg and in individual blastomere(s) of an early embryo, to investigate the response of early embryos to DNA double-strand breaks. Line type γH2AX foci were detected in the cut region, while Chk2 phosphorylation staining was observed in the whole nuclear region of the cut pronuclei or blastomeres. Zygotes with cut male or female pronucleus showed poor developmental capability: the percentage of cleavage embryos was significantly decreased, and the embryos failed to complete further development to blastocysts. The cut blastomeres in 2-cell, 4-cell, and 8-cell embryos ceased cleavage, and they failed to incorporate into compacted morulae, but instead underwent apoptosis and cell death at the blastocyst stage; the uncut part of embryos could develop to blastocysts, with a reduced percentage or decreased cell number. When both blastomeres of the 2-cell embryos were cut by laser microbeam, cell death occurred 24 h earlier, suggesting important functions of the uncut blastomere in delaying cell death of the cut blastomere. Taken together, we conclude that microbeam-induced DNA damage in early embryos causes compromised development, and that embryos may have their own mechanisms to exclude DNA-damaged blastomeres from participating in further development. PMID:24036543

  12. Co-transcriptional R-loops are the main cause of estrogen-induced DNA damage.

    PubMed

    Stork, Caroline Townsend; Bocek, Michael; Crossley, Madzia P; Sollier, Julie; Sanz, Lionel A; Chédin, Frédéric; Swigut, Tomek; Cimprich, Karlene A

    2016-08-23

    The hormone estrogen (E2) binds the estrogen receptor to promote transcription of E2-responsive genes in the breast and other tissues. E2 also has links to genomic instability, and elevated E2 levels are tied to breast cancer. Here, we show that E2 stimulation causes a rapid, global increase in the formation of R-loops, co-transcriptional RNA-DNA products, which in some instances have been linked to DNA damage. We show that E2-dependent R-loop formation and breast cancer rearrangements are highly enriched at E2-responsive genomic loci and that E2 induces DNA replication-dependent double-strand breaks (DSBs). Strikingly, many DSBs that accumulate in response to E2 are R-loop dependent. Thus, R-loops resulting from the E2 transcriptional response are a significant source of DNA damage. This work reveals a novel mechanism by which E2 stimulation leads to genomic instability and highlights how transcriptional programs play an important role in shaping the genomic landscape of DNA damage susceptibility.

  13. Co-transcriptional R-loops are the main cause of estrogen-induced DNA damage

    PubMed Central

    Stork, Caroline Townsend; Bocek, Michael; Crossley, Madzia P; Sollier, Julie; Sanz, Lionel A; Chédin, Frédéric; Swigut, Tomek; Cimprich, Karlene A

    2016-01-01

    The hormone estrogen (E2) binds the estrogen receptor to promote transcription of E2-responsive genes in the breast and other tissues. E2 also has links to genomic instability, and elevated E2 levels are tied to breast cancer. Here, we show that E2 stimulation causes a rapid, global increase in the formation of R-loops, co-transcriptional RNA-DNA products, which in some instances have been linked to DNA damage. We show that E2-dependent R-loop formation and breast cancer rearrangements are highly enriched at E2-responsive genomic loci and that E2 induces DNA replication-dependent double-strand breaks (DSBs). Strikingly, many DSBs that accumulate in response to E2 are R-loop dependent. Thus, R-loops resulting from the E2 transcriptional response are a significant source of DNA damage. This work reveals a novel mechanism by which E2 stimulation leads to genomic instability and highlights how transcriptional programs play an important role in shaping the genomic landscape of DNA damage susceptibility. DOI: http://dx.doi.org/10.7554/eLife.17548.001 PMID:27552054

  14. Ganglioside GT1b protects human spermatozoa from hydrogen peroxide-induced DNA and membrane damage.

    PubMed

    Gavella, Mirjana; Garaj-Vrhovac, Verica; Lipovac, Vaskresenija; Antica, Mariastefania; Gajski, Goran; Car, Nikica

    2010-06-01

    We have reported previously that various gangliosides, the sialic acid containing glycosphingolipids, provide protection against sperm injury caused by reactive oxygen species (ROS). In this study, we investigated the effect of treatment of human spermatozoa with ganglioside GT1b on hydrogen peroxide (H(2)O(2))-induced DNA fragmentation and plasma membrane damage. Single-cell gel electrophoresis (Comet assay) used in the assessment of sperm DNA integrity showed that in vitro supplemented GT1b (100 microm) significantly reduced DNA damage induced by H(2)O(2) (200 microm) (p < 0.05). Measurements of Annexin V binding in combination with the propidium iodide vital dye labelling demonstrated that the spermatozoa pre-treated with GT1b exhibited a significant increase (p < 0.05) in the percentage of live cells with intact membrane and decreased phosphatidylserine translocation after exposure to H(2)O(2). Flow cytometry using the intracellular ROS-sensitive fluorescence dichlorodihydrofluorescein diacetate dye employed to investigate the transport of the extracellularly supplied H(2)O(2) into the cell interior revealed that ganglioside GT1b completely inhibited the passage of H(2)O(2) through the sperm membrane. These results suggest that ganglioside GT1b may protect human spermatozoa from H(2)O(2)-induced damage by rendering sperm membrane more hydrophobic, thus inhibiting the diffusion of H(2)O(2) across the membrane.

  15. A pathway of targeted autophagy is induced by DNA damage in budding yeast

    PubMed Central

    Eapen, Vinay V.; Waterman, David P.; Bernard, Amélie; Schiffmann, Nathan; Sayas, Enrich; Kamber, Roarke; Lemos, Brenda; Memisoglu, Gonen; Ang, Jessie; Mazella, Allison; Chuartzman, Silvia G.; Loewith, Robbie J.; Schuldiner, Maya; Denic, Vladimir; Klionsky, Daniel J.; Haber, James E.

    2017-01-01

    Autophagy plays a central role in the DNA damage response (DDR) by controlling the levels of various DNA repair and checkpoint proteins; however, how the DDR communicates with the autophagy pathway remains unknown. Using budding yeast, we demonstrate that global genotoxic damage or even a single unrepaired double-strand break (DSB) initiates a previously undescribed and selective pathway of autophagy that we term genotoxin-induced targeted autophagy (GTA). GTA requires the action primarily of Mec1/ATR and Rad53/CHEK2 checkpoint kinases, in part via transcriptional up-regulation of central autophagy proteins. GTA is distinct from starvation-induced autophagy. GTA requires Atg11, a central component of the selective autophagy machinery, but is different from previously described autophagy pathways. By screening a collection of ∼6,000 yeast mutants, we identified genes that control GTA but do not significantly affect rapamycin-induced autophagy. Overall, our findings establish a pathway of autophagy specific to the DNA damage response. PMID:28154131

  16. A pathway of targeted autophagy is induced by DNA damage in budding yeast.

    PubMed

    Eapen, Vinay V; Waterman, David P; Bernard, Amélie; Schiffmann, Nathan; Sayas, Enrich; Kamber, Roarke; Lemos, Brenda; Memisoglu, Gonen; Ang, Jessie; Mazella, Allison; Chuartzman, Silvia G; Loewith, Robbie J; Schuldiner, Maya; Denic, Vladimir; Klionsky, Daniel J; Haber, James E

    2017-02-14

    Autophagy plays a central role in the DNA damage response (DDR) by controlling the levels of various DNA repair and checkpoint proteins; however, how the DDR communicates with the autophagy pathway remains unknown. Using budding yeast, we demonstrate that global genotoxic damage or even a single unrepaired double-strand break (DSB) initiates a previously undescribed and selective pathway of autophagy that we term genotoxin-induced targeted autophagy (GTA). GTA requires the action primarily of Mec1/ATR and Rad53/CHEK2 checkpoint kinases, in part via transcriptional up-regulation of central autophagy proteins. GTA is distinct from starvation-induced autophagy. GTA requires Atg11, a central component of the selective autophagy machinery, but is different from previously described autophagy pathways. By screening a collection of ∼6,000 yeast mutants, we identified genes that control GTA but do not significantly affect rapamycin-induced autophagy. Overall, our findings establish a pathway of autophagy specific to the DNA damage response.

  17. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].

    PubMed

    Smetanina, N M; Pustovalova, M V; Osipov, A N

    2013-01-01

    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells.

  18. Oxidative Stress Induces Persistent Telomeric DNA Damage Responsible for Nuclear Morphology Change in Mammalian Cells

    PubMed Central

    Coluzzi, Elisa; Colamartino, Monica; Cozzi, Renata; Leone, Stefano; Meneghini, Carlo; O’Callaghan, Nathan; Sgura, Antonella

    2014-01-01

    One main function of telomeres is to maintain chromosome and genome stability. The rate of telomere shortening can be accelerated significantly by chemical and physical environmental agents. Reactive oxygen species are a source of oxidative stress and can produce modified bases (mainly 8-oxoG) and single strand breaks anywhere in the genome. The high incidence of guanine residues in telomeric DNA sequences makes the telomere a preferred target for oxidative damage. Our aim in this work is to evaluate whether chromosome instability induced by oxidative stress is related specifically to telomeric damage. We treated human primary fibroblasts (MRC-5) in vitro with hydrogen peroxide (100 and 200 µM) for 1 hr and collected data at several time points. To evaluate the persistence of oxidative stress-induced DNA damage up to 24 hrs after treatment, we analysed telomeric and genomic oxidative damage by qPCR and a modified comet assay, respectively. The results demonstrate that the genomic damage is completely repaired, while the telomeric oxidative damage persists. The analysis of telomere length reveals a significant telomere shortening 48 hrs after treatment, leading us to hypothesise that residual telomere damage could be responsible for the telomere shortening observed. Considering the influence of telomere length modulation on genomic stability, we quantified abnormal nuclear morphologies (Nucleoplasmic Bridges, Nuclear Buds and Micronuclei) and observed an increase of chromosome instability in the same time frame as telomere shortening. At subsequent times (72 and 96 hrs), we observed a restoration of telomere length and a reduction of chromosome instability, leaving us to conjecture a correlation between telomere shortening/dysfunction and chromosome instability. We can conclude that oxidative base damage leads to abnormal nuclear morphologies and that telomere dysfunction is an important contributor to this effect. PMID:25354277

  19. Study of terahertz-radiation-induced DNA damage in human blood leukocytes

    SciTech Connect

    Angeluts, A A; Esaulkov, M N; Kosareva, O G; Solyankin, P M; Shkurinov, A P; Gapeyev, A B; Pashovkin, T N; Matyunin, S N; Nazarov, M M; Cherkasova, O P

    2014-03-28

    We have carried out the studies aimed at assessing the effect of terahertz radiation on DNA molecules in human blood leukocytes. Genotoxic testing of terahertz radiation was performed in three different oscillation regimes, the blood leukocytes from healthy donors being irradiated for 20 minutes with the mean intensity of 8 – 200 μW cm{sup -2} within the frequency range of 0.1 – 6.5 THz. Using the comet assay it is shown that in the selected regimes such radiation does not induce a direct DNA damage in viable human blood leukocytes. (biophotonics)

  20. Study of terahertz-radiation-induced DNA damage in human blood leukocytes

    NASA Astrophysics Data System (ADS)

    Angeluts, A. A.; Gapeyev, A. B.; Esaulkov, M. N.; Kosareva, O. G.; Matyunin, S. N.; Nazarov, M. M.; Pashovkin, T. N.; Solyankin, P. M.; Cherkasova, O. P.; Shkurinov, A. P.

    2014-03-01

    We have carried out the studies aimed at assessing the effect of terahertz radiation on DNA molecules in human blood leukocytes. Genotoxic testing of terahertz radiation was performed in three different oscillation regimes, the blood leukocytes from healthy donors being irradiated for 20 minutes with the mean intensity of 8 - 200 μW cm-2 within the frequency range of 0.1 - 6.5 THz. Using the comet assay it is shown that in the selected regimes such radiation does not induce a direct DNA damage in viable human blood leukocytes.

  1. DNA damage and repair in tumour and non-tumour tissues of mice induced by nicotinamide.

    PubMed Central

    Olsson, A. R.; Sheng, Y.; Pero, R. W.; Chaplin, D. J.; Horsman, M. R.

    1996-01-01

    In vivo DNA damage and repair was induced by nicotinamide (NAM) in adenotype 12 virus-induced mouse sarcoma A12B3 and sarcoma F inoculated into CBA mice. DNA damage, NAM and NAD concentrations were measured after in vivo exposure to NAM, in tumours and spleens by alkaline elution and by HPLC analysis. Our results indicate that NAM between 100-1000 mg kg-1 causes a high level of in vivo DNA strand breaks in tumours and normal tissues in mice bearing the immunogenic sarcoma A12B3 but not in the non-immunogenic sarcoma F. The repair process was also delayed by the NAM treatment probably owing to inhibition of the DNA repair enzyme, poly(ADP-ribose)polymerase, as evidenced by accumulation of NAM and NAD. These data are consistent with NAM having a mechanism of action as a radiosensitiser at least in part by DNA repair inhibition. In addition, it should also be considered that high doses of NAM might cause considerable complications to normal tissue in tumour-bearing individuals. PMID:8695350

  2. N-nitroso-N-ethylurea activates DNA damage surveillance pathways and induces transformation in mammalian cells

    PubMed Central

    2014-01-01

    Background The DNA damage checkpoint signalling cascade sense damaged DNA and coordinates cell cycle arrest, DNA repair, and/or apoptosis. However, it is still not well understood how the signalling system differentiates between different kinds of DNA damage. N-nitroso-N-ethylurea (NEU), a DNA ethylating agent induces both transversions and transition mutations. Methods Immunoblot and comet assays were performed to detect DNA breaks and activation of the canonical checkpoint signalling kinases following NEU damage upto 2 hours. To investigate whether mismatch repair played a role in checkpoint activation, knock-down studies were performed while flow cytometry analysis was done to understand whether the activation of the checkpoint kinases was cell cycle phase specific. Finally, breast epithelial cells were grown as 3-dimensional spheroid cultures to study whether NEU can induce upregulation of vimentin as well as disrupt cell polarity of the breast acini, thus causing transformation of epithelial cells in culture. Results We report a novel finding that NEU causes activation of major checkpoint signalling kinases, Chk1 and Chk2. This activation is temporally controlled with Chk2 activation preceding Chk1 phosphorylation, and absence of cross talk between the two parallel signalling pathways, ATM and ATR. Damage caused by NEU leads to the temporal formation of both double strand and single strand breaks. Activation of checkpoints following NEU damage is cell cycle phase dependent wherein Chk2 is primarily activated during G2-M phase whilst in S phase, there is immediate Chk1 phosphorylation and delayed Chk2 response. Surprisingly, the mismatch repair system does not play a role in checkpoint activation, at doses and duration of NEU used in the experiments. Interestingly, NEU caused disruption of the well-formed polarised spheroid archithecture and upregulation of vimentin in three-dimensional breast acini cultures of non-malignant breast epithelial cells upon NEU

  3. Zingerone protects against stannous chloride-induced and hydrogen peroxide-induced oxidative DNA damage in vitro.

    PubMed

    Rajan, Iyappan; Narayanan, Nithya; Rabindran, Remitha; Jayasree, P R; Manish Kumar, P R

    2013-12-01

    In this paper, we report the dose-dependent antioxidant activity and DNA protective effects of zingerone. At 500 μg/mL, the DPPH radical scavenging activity of zingerone and ascorbic acid as a standard was found to be 86.7 and 94.2 % respectively. At the same concentration, zingerone also showed significant reducing power (absorbance 0.471) compared to that of ascorbic acid (absorbance 0.394). The in vitro toxicity of stannous chloride (SnCl2) was evaluated using genomic and plasmid DNA. SnCl2-induced degradation of genomic DNA was found to occur at a concentration of 0.8 mM onwards with complete degradation at 1.02 mM and above. In the case of plasmid DNA, conversion of supercoiled DNA into the open circular form indicative of DNA nicking activity was observed at a concentration of 0.2 mM onwards; complete conversion was observed at a concentration of 1.02 mM and above. Zingerone was found to confer protection against SnCl2-induced oxidative damage to genomic and plasmid DNA at concentrations of 500 and 750 μg/mL onwards, respectively. This protective effect was further confirmed in the presence of UV/H2O2-a known reactive oxygen species (ROS) generating system-wherein protection by zingerone against ROS-mediated DNA damage was observed at a concentration of 250 μg/mL onwards in a dose-dependent manner. This study clearly indicated the in vitro DNA protective property of zingerone against SnCl2-induced, ROS-mediated DNA damage.

  4. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    SciTech Connect

    Holley, W.R.; Chatterjee, A.

    1996-02-01

    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and {delta} rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of {circ}OH, {circ}H, e{sub aq}, etc.; {circ}OH attack on sugar molecules leading to strand breaks; {circ}OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs.

  5. DNA damage, apoptosis and langerhans cells--Activators of UV-induced immune tolerance.

    PubMed

    Timares, Laura; Katiyar, Santosh K; Elmets, Craig A

    2008-01-01

    Solar UVR is highly mutagenic but is only partially absorbed by the outer stratum corneum of the epidermis. UVR can penetrate into the deeper layers of the epidermis, depending on melanin content, where it induces DNA damage and apoptosis in epidermal cells, including those in the germinative basal layer. The cellular decision to initiate either cellular repair or undergo apoptosis has evolved to balance the acute need to maintain skin barrier function with the long-term risk of retaining precancerous cells. Langerhans cells (LCs) are positioned suprabasally, where they may sense UV damage directly, or indirectly through recognition of apoptotic vesicles and soluble mediators derived from surrounding keratinocytes. Apoptotic vesicles will contain UV-induced altered proteins that may be presented to the immune system as foreign. The observation that UVR induces immune tolerance to skin-associated antigens suggests that this photodamage response has evolved to preserve the skin barrier by protecting it from autoimmune attack. LC involvement in this process is not clear and controversial. We will highlight some basic concepts of photobiology and review recent advances pertaining to UV-induced DNA damage, apoptosis regulation, novel immunomodulatory mechanisms and the role of LCs in generating antigen-specific regulatory T cells.

  6. Oxidative stress induces DNA damage and inhibits the repair of DNA lesions induced by N-acetoxy-2-acetylaminofluorene in human peripheral mononuclear leukocytes.

    PubMed

    Pero, R W; Anderson, M W; Doyle, G A; Anna, C H; Romagna, F; Markowitz, M; Bryngelsson, C

    1990-08-01

    Human mononuclear leukocytes were exposed to prooxidants such as H2O2, phorbol-12-myristate-13-acetate, and 4-nitroquinoline-N-oxide, and the effects on induction of DNA damage and repair were evaluated. ADP ribosylation was activated by prooxidant exposure and the response was bimodal with peaks of activation occurring at about 30 min and 4-5 h. Other evidence for prooxidant-induced DNA damage was provided by nucleoid sedimentation assays. Unscheduled DNA synthesis (UDS) was only slightly induced by prooxidant exposure which suggested that either the DNA lesions were repaired by a short patch mechanism involving little UDS, or the repair process was inhibited by prooxidant exposures, or some combination of both. This point was clarified by the fact that the repair of DNA lesions induced by N-acetoxy-2-acetylaminofluorene, an inducer of large patch DNA repair, was inhibited in a dose-dependent manner by exposure to H2O2 and the inhibition was dependent on ADP ribosylation. In contrast, the repair of DNA strand breaks induced by prooxidant exposures as identified above were complete within about 8 h and the repair was independent of ADP ribosylation. Both ADP ribosylation and N-acetoxy-2-acetylaminofluorene-induced UDS were shown to be up- and down-regulated by the redox state of human mononuclear leukocytes indicating a unique mechanism of cellular control over DNA repair.

  7. The thyroid hormone receptor β induces DNA damage and premature senescence

    PubMed Central

    Zambrano, Alberto; García-Carpizo, Verónica; Gallardo, María Esther; Villamuera, Raquel; Gómez-Ferrería, Maria Ana; Pascual, Angel; Buisine, Nicolas; Sachs, Laurent M.; Garesse, Rafael

    2014-01-01

    There is increasing evidence that the thyroid hormone (TH) receptors (THRs) can play a role in aging, cancer and degenerative diseases. In this paper, we demonstrate that binding of TH T3 (triiodothyronine) to THRB induces senescence and deoxyribonucleic acid (DNA) damage in cultured cells and in tissues of young hyperthyroid mice. T3 induces a rapid activation of ATM (ataxia telangiectasia mutated)/PRKAA (adenosine monophosphate–activated protein kinase) signal transduction and recruitment of the NRF1 (nuclear respiratory factor 1) and THRB to the promoters of genes with a key role on mitochondrial respiration. Increased respiration leads to production of mitochondrial reactive oxygen species, which in turn causes oxidative stress and DNA double-strand breaks and triggers a DNA damage response that ultimately leads to premature senescence of susceptible cells. Our findings provide a mechanism for integrating metabolic effects of THs with the tumor suppressor activity of THRB, the effect of thyroidal status on longevity, and the occurrence of tissue damage in hyperthyroidism. PMID:24395638

  8. Impact of the Circadian Clock on UV-Induced DNA Damage Response and Photocarcinogenesis.

    PubMed

    Dakup, Panshak; Gaddameedhi, Shobhan

    2017-01-01

    The skin is in constant exposure to various external environmental stressors, including solar ultraviolet (UV) radiation. Various wavelengths of UV light are absorbed by the DNA and other molecules in the skin to cause DNA damage and induce oxidative stress. The exposure to excessive ultraviolet (UV) radiation and/or accumulation of damage over time can lead to photocarcinogenesis and photoaging. The nucleotide excision repair (NER) system is the sole mechanism for removing UV photoproduct damage from DNA, and genetic disruption of this repair pathway leads to the photosensitive disorder xeroderma pigmentosum (XP). Interestingly, recent work has shown that NER is controlled by the circadian clock, the body's natural time-keeping mechanism, through regulation of the rate-limiting repair factor xeroderma pigmentosum group A (XPA). Studies have shown reduced UV-induced skin cancer after UV exposure in the evening compared to the morning, which corresponds with times of high and low repair capacities, respectively. However, most studies of the circadian clock-NER connection have utilized murine models, and it is therefore important to translate these findings to humans to improve skin cancer prevention and chronotherapy.

  9. Buckwheat Honey Attenuates Carbon Tetrachloride-Induced Liver and DNA Damage in Mice

    PubMed Central

    Cheng, Ni; Wu, Liming; Zheng, Jianbin; Cao, Wei

    2015-01-01

    Buckwheat honey, which is widely consumed in China, has a characteristic dark color. The objective of this study was to investigate the protective effects of buckwheat honey on liver and DNA damage induced by carbon tetrachloride in mice. The results revealed that buckwheat honey had high total phenolic content, and rutin, hesperetin, and p-coumaric acid were the main phenolic compounds present. Buckwheat honey possesses super DPPH radical scavenging activity and strong ferric reducing antioxidant power. Administration of buckwheat honey for 10 weeks significantly inhibited serum lipoprotein oxidation and increased serum oxygen radical absorbance capacity. Moreover, buckwheat honey significantly inhibited aspartate aminotransferase and alanine aminotransferase activities, which are enhanced by carbon tetrachloride. Hepatic malondialdehyde decreased and hepatic antioxidant enzymes (superoxide dismutase and glutathione peroxidase) increased in the presence of buckwheat honey. In a comet assay, lymphocyte DNA damage induced by carbon tetrachloride was significantly inhibited by buckwheat honey. Therefore, buckwheat honey has a hepatoprotective effect and inhibits DNA damage, activities that are primarily attributable to its high antioxidant capacity. PMID:26508989

  10. Oxidative stress and DNA damage induced by imidacloprid in zebrafish (Danio rerio).

    PubMed

    Ge, Weili; Yan, Saihong; Wang, Jinhua; Zhu, Lusheng; Chen, Aimei; Wang, Jun

    2015-02-18

    Imidacloprid is a neonicotinoid insecticide that can have negative effects on nontarget animals. The present study was conducted to assess the toxicity of various imidacloprid doses (0.3, 1.25, and 5 mg/mL) on zebrafish sampled after 7, 14, 21, and 28 days of exposure. The levels of catalase (CAT), superoxide dismutase (SOD), reactive oxygen species (ROS), glutathione-S-transferase (GST), and malondialdehyde (MDA) and the extent of DNA damage were measured to evaluate the toxicity of imidacloprid on zebrafish. SOD and GST activities were noticeably increased during early exposure but were inhibited toward the end of the exposure period. In addition, the CAT levels decreased to the control level following their elevation during early exposure. High concentrations of imidacloprid (1.25 and 5 mg/L) induced excessive ROS production and markedly increased MDA content on the 21st day of exposure. DNA damage was dose- and time-dependent. In conclusion, the present study showed that imidacloprid can induce oxidative stress and DNA damage in zebrafish.

  11. Energy Thresholds of DNA Damage Induced by UV Radiation: An XPS Study.

    PubMed

    Gomes, P J; Ferraria, A M; Botelho do Rego, A M; Hoffmann, S V; Ribeiro, P A; Raposo, M

    2015-04-30

    This work stresses on damage at the molecular level caused by ultraviolet radiation (UV) in the range from 3.5 to 8 eV, deoxyribonucleic acid (DNA) films observed by X-ray photoelectron spectroscopy (XPS). Detailed quantitative XPS analysis, in which all the amounts are relative to sodium-assumed not to be released from the samples, of the carbon, oxygen, and particularly, nitrogen components, reveals that irradiation leads to sugar degradation with CO-based compounds release for energies above 6.9 eV and decrease of nitrogen groups which are not involved in hydrogen bonding at energies above 4.2 eV. Also the phosphate groups are seen to decrease to energies above 4.2 eV. Analysis of XPS spectra allowed to conclude that the damage on bases peripheral nitrogen atoms are following the damage on phosphates. It suggests that very low kinetic energy photoelectrons are ejected from the DNA bases, as a result of UV light induced breaking of the phosphate ester groups which forms a transient anion with resonance formation and whereby most of the nitrogen DNA peripheral groups are removed. The degree of ionization of DNA was observed to increase with radiation energy, indicating that the ionized phosphate groups are kept unchanged. This result was interpreted by the shielding of phosphate groups caused by water molecules hydration near sodium atoms.

  12. Mitochondrial DNA damage and a hypoxic response are induced by CoCl2 in rat neuronal PC12 cells

    PubMed Central

    Wang, Guichun; Hazra, Tapas K.; Mitra, Sankar; Lee, Heung-Man; Englander, Ella W.

    2000-01-01

    Generation of reactive oxygen species (ROS) and activation of a transcriptional program that mimics the hypoxic response have been documented in cultured cells in the presence of cobalt chloride. We found that in the presence of hypoxia-mimicking concentrations of CoCl2, mitochondrial but not nuclear DNA damage is induced in rat neuronal, PC12 cells. To our knowledge, this is the first documentation of induction of mitochondrial DNA (mtDNA) damage under these conditions. Likewise, we provide the first evidence for elevation of MYH, the mammalian homolog of the Escherichia coli MutY DNA glycosylase, in mammalian cells. Recently, the human MYH was implicated in repair of oxidative DNA damage and shown to carry a mitochondrial localization sequence. Here, an induction of mtDNA damage and a time-dependent increase in the MYH level were detected with exposure of cells to 100 µM CoCl2. In addition, the levels of proteins involved in cellular responses to hypoxia, ROS and nuclear DNA damage; hypoxia-inducible factor 1α (HIF-1α), p53, p21 and PCNA were also modulated temporally. Earlier studies suggested that the mtDNA is a primary target for oxidative damage. Our findings extend these observations and suggest that activation of DNA repair processes is associated with the presence of mtDNA damage. PMID:10773083

  13. Mitochondrial DNA damage and a hypoxic response are induced by CoCl(2) in rat neuronal PC12 cells.

    PubMed

    Wang, G; Hazra, T K; Mitra, S; Lee, H M; Englander, E W

    2000-05-15

    Generation of reactive oxygen species (ROS) and activation of a transcriptional program that mimics the hypoxic response have been documented in cultured cells in the presence of cobalt chloride. We found that in the presence of hypoxia-mimicking concentrations of CoCl(2), mitochondrial but not nuclear DNA damage is induced in rat neuronal, PC12 cells. To our knowledge, this is the first documentation of induction of mitochondrial DNA (mtDNA) damage under these conditions. Likewise, we provide the first evidence for elevation of MYH, the mammalian homolog of the Escherichia coli MutY DNA glycosylase, in mammalian cells. Recently, the human MYH was implicated in repair of oxidative DNA damage and shown to carry a mitochondrial localization sequence. Here, an induction of mtDNA damage and a time-dependent increase in the MYH level were detected with exposure of cells to 100 microM CoCl(2). In addition, the levels of proteins involved in cellular responses to hypoxia, ROS and nuclear DNA damage; hypoxia-inducible factor 1alpha(HIF-1alpha), p53, p21 and PCNA were also modulated temporally. Earlier studies suggested that the mtDNA is a primary target for oxidative damage. Our findings extend these observations and suggest that activation of DNA repair processes is associated with the presence of mtDNA damage.

  14. High-throughput genotoxicity assay identifies antioxidants as inducers of DNA damage response and cell death

    PubMed Central

    Fox, Jennifer T.; Sakamuru, Srilatha; Huang, Ruili; Teneva, Nedelina; Simmons, Steven O.; Xia, Menghang; Tice, Raymond R.; Austin, Christopher P.; Myung, Kyungjae

    2012-01-01

    Human ATAD5 is a biomarker for identifying genotoxic compounds because ATAD5 protein levels increase posttranscriptionally in response to DNA damage. We screened over 4,000 compounds with a cell-based quantitative high-throughput ATAD5-luciferase assay detecting genotoxic compounds. We identified 22 antioxidants, including resveratrol, genistein, and baicalein, that are currently used or investigated for the treatment of cardiovascular disease, type 2 diabetes, osteopenia, osteoporosis, and chronic hepatitis, as well as for antiaging. Treatment of dividing cells with these compounds induced DNA damage and resulted in cell death. Despite their genotoxic effects, resveratrol, genistein, and baicalein did not cause mutagenesis, which is a major side effect of conventional anticancer drugs. Furthermore, resveratrol and genistein killed multidrug-resistant cancer cells. We therefore propose that resveratrol, genistein, and baicalein are attractive candidates for improved chemotherapeutic agents. PMID:22431602

  15. [Study of blue light induced DNA damage of retinal pigment epithelium(RPE) cells and the protection of vitamin C].

    PubMed

    Zhou, Jian Wei; Ren, Guo Liang; Zhang, Xiao Ming; Zhu, Xi; Lin, Hai Yan; Zhou, Ji Lin

    2003-10-01

    To evaluate protection of vitamin C on blue light-induced DNA damage of human retinal pigment epithelium (RPE) cells. The cultured RPE cells were divided into 3 groups: Control group (no blue light exposure), blue light exposure group (blue light exposure for 20 minutes) and blue light exposure + vitamin C group (blue light exposure + 100 mumol/L vitamin C). Travigen's comet assay kit and Euclid comet assay software were used to assay the DNA damage levels. The DNA percentage in the tail of electrophoretogram in the three groups were 18.44%, 54.42% and 32.43% respectively (p < 0.01). Tail moments were 8.2, 48.3, and 18.4 respectively (p < 0.01). Blue light could induce DNA damage to RPE cells but vitamin C could protect the RPE cells from the blue light-induced DNA damage.

  16. The poly(ADP-ribose)-dependent chromatin remodeler Alc1 induces local chromatin relaxation upon DNA damage

    PubMed Central

    Sellou, Hafida; Lebeaupin, Théo; Chapuis, Catherine; Smith, Rebecca; Hegele, Anna; Singh, Hari R.; Kozlowski, Marek; Bultmann, Sebastian; Ladurner, Andreas G.; Timinszky, Gyula; Huet, Sébastien

    2016-01-01

    Chromatin relaxation is one of the earliest cellular responses to DNA damage. However, what determines these structural changes, including their ATP requirement, is not well understood. Using live-cell imaging and laser microirradiation to induce DNA lesions, we show that the local chromatin relaxation at DNA damage sites is regulated by PARP1 enzymatic activity. We also report that H1 is mobilized at DNA damage sites, but, since this mobilization is largely independent of poly(ADP-ribosyl)ation, it cannot solely explain the chromatin relaxation. Finally, we demonstrate the involvement of Alc1, a poly(ADP-ribose)- and ATP-dependent remodeler, in the chromatin-relaxation process. Deletion of Alc1 impairs chromatin relaxation after DNA damage, while its overexpression strongly enhances relaxation. Altogether our results identify Alc1 as an important player in the fast kinetics of the NAD+- and ATP-dependent chromatin relaxation upon DNA damage in vivo. PMID:27733626

  17. Methotrexate induces DNA damage and inhibits homologous recombination repair in choriocarcinoma cells

    PubMed Central

    Xie, Lisha; Zhao, Tiancen; Cai, Jing; Su, You; Wang, Zehua; Dong, Weihong

    2016-01-01

    Objective The objective of this study was to investigate the mechanism of sensitivity to methotrexate (MTX) in human choriocarcinoma cells regarding DNA damage response. Methods Two choriocarcinoma cancer cell lines, JAR and JEG-3, were utilized in this study. An MTX-sensitive osteosarcoma cell line MG63, an MTX-resistant epithelial ovarian cancer cell line A2780 and an MTX-resistant cervical adenocarcinoma cell line Hela served as controls. Cell viability assay was carried out to assess MTX sensitivity of cell lines. MTX-induced DNA damage was evaluated by comet assay. Quantitative reverse transcription polymerase chain reaction was used to detect the mRNA levels of BRCA1, BRCA2, RAD51 and RAD52. The protein levels of γH2AX, RAD 51 and p53 were analyzed by Western blot. Results Remarkable DNA strand breaks were observed in MTX-sensitive cell lines (JAR, JEG-3 and MG63) but not in MTX-resistant cancer cells (A2780 and Hela) after 48 h of MTX treatment. Only in the choriocarcinoma cells, the expression of homologous recombination (HR) repair gene RAD51 was dramatically suppressed by MTX in a dose- and time-dependent manner, accompanied with the increase in p53. Conclusion The MTX-induced DNA strand breaks accompanied by deficiencies in HR repair may contribute to the hypersensitivity to chemotherapy in choriocarcinoma. PMID:27895503

  18. Quercetin ameliorates polychlorinated biphenyls-induced testicular DNA damage in rats.

    PubMed

    Lovato, F L; de Oliveira, C R; Adedara, I A; Barbisan, F; Moreira, K L S; Dalberto, M; da Rocha, M I U M; Marroni, N P; da Cruz, I B; Costabeber, I B

    2016-02-01

    Polychlorinated biphenyls (PCBs) are a group of environmental contaminants widely reported to cause gonadal toxicity in both humans and animals. This study investigated the amelioratory role of quercetin in PCBs-induced DNA damage in male Wistar rats. Polychlorinated biphenyls were administered intraperitoneally at a dose of 2 mg kg(-1) alone or in combination with quercetin (orally) at 50 mg kg(-1) for 25 days. Quercetin modulation of PCBs-induced gonadal toxicity was evaluated using selected oxidative stress indices, comet assay, measurement of DNA concentration and histology of the testes. Administration of PCBs alone caused a significant (P < 0.05) depletion in the total thiol level in testes of treated rats. Conversely, the levels of reactive oxygen species (ROS) and thiobarbituric acid reactive substances (TBARS) production were markedly elevated in testes of PCBs-treated rats compared with control. Further, PCBs exposure produced statistically significant increases in DNA tail migration, degraded double-stranded DNA (dsDNA) concentration and histological alterations of testes of the treated rats compared to control. Quercetin cotreatment significantly improved the testicular antioxidant status, decreased DNA fragmentation and restored the testicular histology, thus demonstrating the protective effect of quercetin in PCBs-treated rats.

  19. Oxidative stress induced sperm DNA damage, a possible reason for male infertility

    PubMed Central

    Hosen, Md Bayejid; Islam, Md Rakibul; Begum, Firoza; Kabir, Yearul; Howlader, M Zakir Hossain

    2015-01-01

    Background: Sperm DNA damage is an important factor in the etiology of male infertility. Objective: The aim of the study was to evaluate the association of oxidative stress induced sperm DNA damage with the pathogenesis of male infertility. Materials and Methods: The study comprised a total of 66 subjects, including fertile men (n=25) and infertile men (n=41) matched by age. Seminal malondialdehyde (MDA), phospholipid hydroperoxide (PHP), superoxide dismutase (SOD), total antioxidant status (TAS) and 8-hydroxy-2'-deoxy guanosine (8-OHdG) were estimated by spectrophotometric and ELISA based methods and the association with the sperm parameters was assessed. Results: The percentages of motile and morphologically normal cells were significantly lower (p < 0.001, p <0.001, respectivly) in infertile men. Seminal levels of MDA, PHP and 8-OHdG were significantly higher (p < 0.001, p < 0.001, and p=0. 02, respectively) while the SOD and TAS were significantly lower (p=0. 0003, p< 0.001, respectively) in infertile men. Sperm parameters were negatively correlated with MDA, PHP and 8-OHdG while positively correlated with SOD and TAS. A positive correlation of 8-OHdG with MDA and PHP and a negative correlation with TAS and SOD were also found. Conclusion: These results suggested that oxidative stress induced sperm DNA damage might have a critical effect on the etiology of infertility. Therefore, evaluation of oxidative status, antioxidant defense systems and DNA damage, together with sperm parameters might be a useful tool for diagnosis and treatment of male infertility. PMID:26568756

  20. Inhibition of uracil DNA glycosylase sensitizes cancer cells to 5-fluorodeoxyuridine through replication fork collapse-induced DNA damage

    PubMed Central

    Yan, Yan; Han, Xiangzi; Qing, Yulan; Condie, Allison G.; Gorityala, Shashank; Yang, Shuming; Xu, Yan; Zhang, Youwei; Gerson, Stanton L.

    2016-01-01

    5-fluorodeoxyuridine (5-FdU, floxuridine) is active against multiple cancers through the inhibition of thymidylate synthase, which consequently introduces uracil and 5-FU incorporation into the genome. Uracil DNA glycosylase (UDG) is one of the main enzymes responsible for the removal of uracil and 5-FU. However, how exactly UDG mediates cellular sensitivity to 5-FdU, and if so whether it is through its ability to remove uracil and 5-FU have not been well characterized. In this study, we report that UDG depletion led to incorporation of uracil and 5-FU in DNA following 5-FdU treatment and significantly enhanced 5-FdU's cytotoxicity in cancer cell lines. Co-treatment, but not post-treatment with thymidine prevented cell death of UDG depleted cells by 5-FdU, indicating that the enhanced cytotoxicity is due to the retention of uracil and 5-FU in genomic DNA in the absence of UDG. Furthermore, UDG depleted cells were arrested at late G1 and early S phase by 5-FdU, followed by accumulation of sub-G1 population indicating cell death. Mechanistically, 5-FdU dramatically reduced DNA replication speed in UDG depleted cells. UDG depletion also greatly enhanced DNA damage as shown by γH2AX foci formation. Notably, the increased γH2AX foci formation was not suppressed by caspase inhibitor treatment, suggesting that DNA damage precedes cell death induced by 5-FdU. Together, these data provide novel mechanistic insights into the roles of UDG in DNA replication, damage repair, and cell death in response to 5-FdU and suggest that UDG is a target for improving the anticancer effect of this agent. PMID:27517750

  1. Oxidative Stress and DNA Damage Induced by Chromium in Liver and Kidney of Goldfish, Carassius auratus

    PubMed Central

    Velma, Venkatramreddy; Tchounwou, Paul B.

    2013-01-01

    Chromium (Cr) is an abundant element in the Earth’s crust. It exhibits various oxidation states, from divalent to hexavalent forms. Cr has diverse applications in various industrial processes and inadequate treatment of the industrial effluents leads to the contamination of the surrounding water resources. Hexavalent chromium (Cr (VI)) is the most toxic form, and its toxicity has been associated with oxidative stress. The present study was designed to investigate the toxic potential of Cr (VI) in fish. In this research, we investigated the role of oxidative stress in chromium-induced genotoxicity in the liver and kidney cells of goldfish, Carassius auratus. Goldfish were acclimatized to the laboratory conditions and exposed them to 5% and 10% of 96 hr-LC50 (85.7 mg/L) of aqueous Cr (VI) in a continuous flow through system. Fish were sampled every 7 days for a period of 28 days to analyze the lipid hydroperoxides (LHP) levels and genotoxic potentials in the liver and kidney. LHP levels were analyzed by spectrophotometry while genotoxicity was assessed by single cell gel electrophoresis (comet) assay. LHP levels in the liver increased significantly at week 1, followed by a decrease. LHP levels in the kidney increased significantly at weeks 1, 2, and 3, and decreased at week 4 compared to the control. The percentage of DNA damage increased in both liver and kidney at both test concentrations. The results clearly indicate that Cr (VI) induces significant levels of DNA damage in liver and kidney cells of goldfish. The induced LHP levels in both organs were concentration-dependent and were directly correlated with the levels of DNA damage. The two tested Cr (VI) concentrations induced significant levels of oxidative stress in both organs, however the kidney appears to be more vulnerable and sensitive to Cr-induced toxicity than the liver. PMID:23700361

  2. Electrochemical and spectroscopic studies of ssDNA damage induced by hydrogen peroxide using graphene based nanomaterials.

    PubMed

    Berghian-Grosan, Camelia; Biris, Alexandru Radu; Coros, Maria; Pogacean, Florina; Pruneanu, Stela

    2015-06-01

    The oxidative damage of deoxyribonucleic acid (DNA) has been intensively studied due to its role in the occurrence of some diseases. The hydrogen peroxide (H2O2) is one of the reactive oxygen species (ROS). It can induce oxidation of DNA bases, sugar lesions or DNA strand breaks. The Pt/Gr-Au-3 modified electrode was employed for the analysis of four ssDNA samples: single-stranded DNA (ssDNA), ssDNA pre-treated with hydrogen peroxide (ssDNA-H2O2), ssDNA pre-treated with graphene-gold nanoparticles (ssDNA-Gr-Au) and ssDNA-Gr-Au complex pre-treated with hydrogen peroxide (ssDNA-Gr-Au-H2O2). By monitoring the changes of the purine oxidation peaks currents, we obtained valuable information about the damage induced by the hydrogen peroxide onto the un-treated or graphene pre-treated ssDNA and also about the interaction between ssDNA and graphene-based nanomaterial. The FTIR analysis has been also used to obtain information about the ssDNA damage. These findings allowed us to prove the utility of graphene-based nanomaterials (mainly Gr-Au-3) not only for the investigation of the oxidative damage induced by a non-radical oxidant, but also for the determination of the type of interaction between ssDNA and graphene surface. The stability of the ssDNA-Gr-Au-3 complex against the damage induced by H2O2, in the absence of reduced transition metals, was also established.

  3. Plant Nuclei Move to Escape Ultraviolet-Induced DNA Damage and Cell Death.

    PubMed

    Iwabuchi, Kosei; Hidema, Jun; Tamura, Kentaro; Takagi, Shingo; Hara-Nishimura, Ikuko

    2016-02-01

    A striking feature of plant nuclei is their light-dependent movement. In Arabidopsis (Arabidopsis thaliana) leaf mesophyll cells, the nuclei move to the side walls of cells within 1 to 3 h after blue-light reception, although the reason is unknown. Here, we show that the nuclear movement is a rapid and effective strategy to avoid ultraviolet B (UVB)-induced damages. Mesophyll nuclei were positioned on the cell bottom in the dark, but sudden exposure of these cells to UVB caused severe DNA damage and cell death. The damage was remarkably reduced in both blue-light-treated leaves and mutant leaves defective in the actin cytoskeleton. Intriguingly, in plants grown under high-light conditions, the mesophyll nuclei remained on the side walls even in the dark. These results suggest that plants have two strategies for reducing UVB exposure: rapid nuclear movement against acute exposure and nuclear anchoring against chronic exposure.

  4. DETECTION OF LOW DOSE RADIATION-AND CHEMICALLY-INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAYS

    EPA Science Inventory

    Rapid, sensitive and simple assays for radiation- and chemically-induced DNA damage can be of significant benefit to a number of fields including radiation biology, clinical research, and environmental monitoring. Although temperature-induced DNA strand separation has been use...

  5. Ginsenoside-Rg5 induces apoptosis and DNA damage in human cervical cancer cells

    PubMed Central

    LIANG, LI-DAN; HE, TAO; DU, TING-WEI; FAN, YONG-GANG; CHEN, DIAN-SEN; WANG, YAN

    2015-01-01

    Panax ginseng is traditionally used as a remedy for cancer, inflammation, stress and aging, and ginsenoside-Rg5 is a major bioactive constituent of steamed ginseng. The present study aimed to evaluate whether ginsenoside-Rg5 had any marked cytotoxic, apoptotic or DNA-damaging effects in human cervical cancer cells. Five human cervical cancer cell lines (HeLa, MS751, C33A, Me180 and HT-3) were used to investigate the cytotoxicity of ginsenoside-Rg5 using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Additionally, the effects of ginsenoside-Rg5 on the apoptosis of HeLa and MS751 cells were detected using DNA ladder assays and flow cytometry. DNA damage was assessed in the HeLa and MS751 cells using alkaline comet assays and by detection of γH2AX focus formation. The HeLa and MS751 cells were significantly more sensitive to ginsenoside-Rg5 treatment compared with the C-33A, HT-3 and Me180 cells. As expected, ginsenoside-Rg5 induced significant concentration- and time-dependent increases in apoptosis. In addition, ginsenoside-Rg5 induced significant concentration-dependent increases in the level of DNA damage compared with the negative control. Consistent with the comet assay data, the percentage of γH2AX-positive HeLa and MS751 cells also revealed that ginsenoside-Rg5 caused DNA double-strands to break in a concentration-dependent manner. In conclusion, ginsenoside-Rg5 had marked genotoxic effects in the HeLa and MS751 cells and, thus, demonstrates potential as a genotoxic or cytotoxic drug for the treatment of cervical cancer. PMID:25355274

  6. Synergic Effect of Genistein and Daidzein on UVB-Induced DNA Damage: An Effective Photoprotective Combination

    PubMed Central

    Iovine, Barbara; Iannella, Maria Luigia; Gasparri, Franco; Monfrecola, Giuseppe; Bevilacqua, Maria Assunta

    2011-01-01

    The anti-inflammatory effects and antioxidant activities of individual isoflavones are well established although little is known about the photoprotective effect of their combination. The aim of this study was to investigate the photoprotective effects of different concentrations of genistein and daidzein individually or combined. We measured the expression levels of the cyclo-oxygenase-2 (COX-2) and growth arrest and DNA-damage inducible (Gadd45) genes, which are involved in inflammation and DNA repair, respectively, in BJ-5ta human skin fibroblasts irradiated with 60 mJ/cm2 UVB. We also determined the cellular response to UVB-induced DNA damage by Comet assay. We report that genistein and daidzein when administered combined, and at a specific concentration and ratio, exerted a synergistic photoprotective effect that was greater than the effect obtained with each isoflavone alone. The results reported herein suggest that low concentrations of genistein and daidzein combined may be good candidate ingredients for protective agents against UV-induced photodamage. PMID:21785564

  7. Synergic Effect of Genistein and Daidzein on UVB-Induced DNA Damage: An Effective Photoprotective Combination.

    PubMed

    Iovine, Barbara; Iannella, Maria Luigia; Gasparri, Franco; Monfrecola, Giuseppe; Bevilacqua, Maria Assunta

    2011-01-01

    The anti-inflammatory effects and antioxidant activities of individual isoflavones are well established although little is known about the photoprotective effect of their combination. The aim of this study was to investigate the photoprotective effects of different concentrations of genistein and daidzein individually or combined. We measured the expression levels of the cyclo-oxygenase-2 (COX-2) and growth arrest and DNA-damage inducible (Gadd45) genes, which are involved in inflammation and DNA repair, respectively, in BJ-5ta human skin fibroblasts irradiated with 60 mJ/cm(2) UVB. We also determined the cellular response to UVB-induced DNA damage by Comet assay. We report that genistein and daidzein when administered combined, and at a specific concentration and ratio, exerted a synergistic photoprotective effect that was greater than the effect obtained with each isoflavone alone. The results reported herein suggest that low concentrations of genistein and daidzein combined may be good candidate ingredients for protective agents against UV-induced photodamage.

  8. Fundamental mechanisms of DNA radiosensitization: damage induced by low-energy electrons in brominated oligonucleotide trimers.

    PubMed

    Park, Yeunsoo; Polska, Katarzyna; Rak, Janusz; Wagner, J Richard; Sanche, Léon

    2012-08-16

    The replacement of nucleobases with brominated analogs enhances DNA radiosensitivity. We examine the chemistry of low-energy electrons (LEEs) in this sensitization process by experiments with thin films of the oligonucleotide trimers TBrXT, where BrX = 5-BrU (5-bromouracil), 5-BrC (5-bromocytosine), 8-BrA (8-bromoadenine), or 8-BrG (8-bromoguanine). The products induced from irradiation of thin (∼ 2.5 nm) oligonucleotide films, with 10 eV electrons, under ultrahigh vacuum (UHV) are analyzed by HPLC-UV. The number of damaged brominated trimers ranges from about 12 to 15 × 10(-3) molecules per incident electron, whereas under the identical conditions, these numbers drop to 4-7 × 10(-3) for the same, but nonbrominated oligonucleotides. The results of HPLC analysis show that the main degradation pathway of trinucleotides containing brominated bases involve debromination (i.e., loss of the bromine atom and its replacement with a hydrogen atom). The electron-induced sum of products upon bromination increases by factors of 2.1 for the pyrimidines and 3.2 for the purines. Thus, substitution of any native nucleobase with a brominated one in simple models of DNA increases LEE-induced damage to DNA and hence its radiosensitivity. Furthermore, besides the brominated pyrimidines that have already been tested in clinical trials, brominated purines not only appear to be promising sensitizers for radiotherapy, but could provide a higher degree of radiosensitization.

  9. The relative roles of DNA damage induced by UVA irradiation in human cells.

    PubMed

    Cortat, Barbara; Garcia, Camila Carrião Machado; Quinet, Annabel; Schuch, André Passaglia; de Lima-Bessa, Keronninn Moreno; Menck, Carlos Frederico Martins

    2013-08-01

    UVA light (320-400 nm) represents approximately 95% of the total solar UV radiation that reaches the Earth's surface. UVA light induces oxidative stress and the formation of DNA photoproducts in skin cells. These photoproducts such as pyrimidine dimers (cyclobutane pyrimidine dimers, CPDs, and pyrimidine (6-4) pyrimidone photoproducts, 6-4PPs) are removed by nucleotide excision repair (NER). In this repair pathway, the XPA protein is recruited to the damage removal site; therefore, cells deficient in this protein are unable to repair the photoproducts. The aim of this study was to investigate the involvement of oxidative stress and the formation of DNA photoproducts in UVA-induced cell death. In fact, similar levels of oxidative stress and oxidised bases were detected in XP-A and NER-proficient cells exposed to UVA light. Interestingly, CPDs were detected in both cell lines; however, 6-4PPs were detected only in DNA repair-deficient cells. XP-A cells were also observed to be significantly more sensitive to UVA light compared to NER-proficient cells, with an increased induction of apoptosis, while necrosis was similarly observed in both cell lines. The induction of apoptosis and necrosis in XP-A cells using adenovirus-mediated transduction of specific photolyases was investigated and we confirm that both types of photoproducts are the primary lesions responsible for inducing cell death in XP-A cells and may trigger the skin-damaging effects of UVA light, particularly skin ageing and carcinogenesis.

  10. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion

    PubMed Central

    Rodier, Francis; Muñoz, Denise P.; Teachenor, Robert; Chu, Victoria; Le, Oanh; Bhaumik, Dipa; Coppé, Jean-Philippe; Campeau, Eric; Beauséjour, Christian M.; Kim, Sahn-Ho; Davalos, Albert R.; Campisi, Judith

    2011-01-01

    DNA damage can induce a tumor suppressive response termed cellular senescence. Damaged senescent cells permanently arrest growth, secrete inflammatory cytokines and other proteins and harbor persistent nuclear foci that contain DNA damage response (DDR) proteins. To understand how persistent damage foci differ from transient foci that mark repairable DNA lesions, we identify sequential events that differentiate transient foci from persistent foci, which we term ‘DNA segments with chromatin alterations reinforcing senescence’ (DNA-SCARS). Unlike transient foci, DNA-SCARS associate with PML nuclear bodies, lack the DNA repair proteins RPA and RAD51, lack single-stranded DNA and DNA synthesis and accumulate activated forms of the DDR mediators CHK2 and p53. DNA-SCARS form independently of p53, pRB and several other checkpoint and repair proteins but require p53 and pRb to trigger the senescence growth arrest. Importantly, depletion of the DNA-SCARS-stabilizing component histone H2AX did not deplete 53BP1 from DNA-SCARS but diminished the presence of MDC1 and activated CHK2. Furthermore, depletion of H2AX reduced both the p53-dependent senescence growth arrest and p53-independent cytokine secretion. DNA-SCARS were also observed following severe damage to multiple human cell types and mouse tissues, suggesting that they can be used in combination with other markers to identify senescent cells. Thus, DNA-SCARS are dynamically formed distinct structures that functionally regulate multiple aspects of the senescent phenotype. PMID:21118958

  11. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY TOXIC INDUSTRIAL CHEMICALS

    EPA Science Inventory

    One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...

  12. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY STYRENE OXIDE

    EPA Science Inventory

    A rapid and simple assay to detect DNA damage to calf thymus DNA caused by styrene oxide (SO) is reported. This assay is based on changes observed in the melting and annealing behavior of the damaged DNA. The melting annealing process was monitored using a fluorescence indicat...

  13. L-Serine deaminase activity is induced by exposure of Escherichia coli K-12 to DNA-damaging agents.

    PubMed Central

    Newman, E B; Ahmad, D; Walker, C

    1982-01-01

    The synthesis of L-serine deaminase in Escherichia coli K-12 was induced after exposure of cells to a variety of DNA-damaging agents, including UV irradiation, nalidixic acid, and mitomycin C. Synthesis was also induced during growth at high temperature. A mutant constitutive for SOS functions showed an elevated level of L-serine deaminase activity. The response to DNA-damaging agents thus may be mediated via the SOS system. PMID:6813312

  14. Oxidative DNA damage induced by activation of polychlorinated biphenyls (PCBs): implications for PCB-induced oxidative stress in breast cancer.

    PubMed

    Oakley, G G; Devanaboyina, U; Robertson, L W; Gupta, R C

    1996-12-01

    We have previously reported that mono- and dichlorinated biphenyls (PCBs) can be metabolized to dihydroxy compounds and further oxidized to reactive metabolites which form adducts with nitrogen and sulfur nucleophiles including DNA [Amaro et al. (1966) Chem. Res. Toxicol. 9, 623-629; Oakley et al. (1996) Carcinogenesis 17, 109-114]. The former studies also demonstrated that during the metabolism of PCBs superoxide may be produced. We have therefore examined the abilities of PCB metabolites to induce free radical-mediated oxidative DNA damage using a newly developed, highly sensitive, 32P-postlabeling assay for 8-oxode-oxyguanosine (8-oxodG) [Devanaboyina, U., and Gupta, R. (1996) Carcinogenesis 17, 917-924]. The incubation of 3,4-dichloro-2'5'-dihydroxybiphenyl (100 microM) with calf thymus DNA (300 micrograms/microL) in the presence of the breast tissue and milk-associated enzyme, lactoperoxidase (10 mU/mL), and H2O2 (0.5 mM) resulted in a significant increase in free radical-induced DNA damage (253 8-oxodG/10(6) nucleotides) as compared to vehicle-treated DNA (118 8-oxodG/10(6) nucleotides). Substituting CuCl(2) (100 microM) for lactoperoxidase/H2O2, however, resulted in a substantial increase in 8-oxodG content (2669 8-oxodG/10(6) nucleotides). FeCl(3) was ineffective, suggesting that CuCl(2) but not FeCl(3) mediates oxidation of PCB dihydroxy metabolites, resulting in oxidative DNA damage. The addition of catalase (100 U/mL) and sodium azide (0.1 M) reduced the effect of CuCl(2) (849 and 896 8-oxodG/10(6) nucleotides, respectively), while superoxide dismutase (600 U/mL) moderately stimulated and glutathione (100 microM) substantially stimulated 8-oxodG formation (3014 and 4415 8-oxodG/10(6) nucleotides, respectively). The effect of various buffers as well as the effects of PCB structure on Cu(II)-mediated oxidative DNA damage were examined. These results demonstrate that free radicals and oxidative DNA damage are produced during oxidation of lower chlorinated

  15. Protection of cisplatin-induced spermatotoxicity, DNA damage and chromatin abnormality by selenium nano-particles.

    PubMed

    Rezvanfar, Mohammad Amin; Rezvanfar, Mohammad Ali; Shahverdi, Ahmad Reza; Ahmadi, Abbas; Baeeri, Maryam; Mohammadirad, Azadeh; Abdollahi, Mohammad

    2013-02-01

    Cisplatin (CIS), an anticancer alkylating agent, induces DNA adducts and effectively cross links the DNA strands and so affects spermatozoa as a male reproductive toxicant. The present study investigated the cellular/biochemical mechanisms underlying possible protective effect of selenium nano-particles (Nano-Se) as an established strong antioxidant with more bioavailability and less toxicity, on reproductive toxicity of CIS by assessment of sperm characteristics, sperm DNA integrity, chromatin quality and spermatogenic disorders. To determine the role of oxidative stress (OS) in the pathogenesis of CIS gonadotoxicity, the level of lipid peroxidation (LPO), antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and peroxynitrite (ONOO) as a marker of nitrosative stress (NS) and testosterone (T) concentration as a biomarker of testicular function were measured in the blood and testes. Thirty-two male Wistar rats were equally divided into four groups. A single IP dose of CIS (7 mg/kg) and protective dose of Nano-Se (2 mg/kg/day) were administered alone or in combination. The CIS-exposed rats showed a significant increase in testicular and serum LPO and ONOO level, along with a significant decrease in enzymatic antioxidants levels, diminished serum T concentration and abnormal histologic findings with impaired sperm quality associated with increased DNA damage and decreased chromatin quality. Coadministration of Nano-Se significantly improved the serum T, sperm quality, and spermatogenesis and reduced CIS-induced free radical toxic stress and spermatic DNA damage. In conclusion, the current study demonstrated that Nano-Se may be useful to prevent CIS-induced gonadotoxicity through its antioxidant potential.

  16. YAP activation protects urothelial cell carcinoma from treatment-induced DNA damage

    PubMed Central

    Ciamporcero, Eric; Shen, He; Ramakrishnan, Swathi; Ku, Sheng Yu; Chintala, Sreenivasulu; Shen, Li; Adelaiye, Remi; Miles, Kiersten Marie; Ullio, Chiara; Pizzimenti, Stefania; Daga, Martina; Azabdaftari, Gissou; Attwood, Kris; Johnson, Candace; Zhang, Jianmin; Barrera, Giuseppina; Pili, Roberto

    2015-01-01

    Current standard of care for muscle-invasive urothelial cell carcinoma (UCC) is surgery along with perioperative platinum-based chemotherapy. UCC is sensitive to cisplatin-based regimens, but acquired resistance eventually occurs, and a subset of tumors is intrinsically resistant. Thus, there is an unmet need for new therapeutic approaches to target chemotherapy-resistant UCC. Yes-associated protein (YAP) is a transcriptional co-activator that has been associated with bladder cancer progression and cisplatin resistance in ovarian cancer. In contrast, YAP has been shown to induce DNA damage associated apoptosis in non-small cell lung carcinoma. However, no data have been reported on the YAP role in UCC chemo-resistance. Thus, we have investigated the potential dichotomous role of YAP in UCC response to chemotherapy utilizing two patient-derived xenograft models recently established. Constitutive expression and activation of YAP inversely correlated with in vitro and in vivo cisplatin sensitivity. YAP overexpression protected while YAP knock-down sensitized UCC cells to chemotherapy and radiation effects via increased accumulation of DNA damage and apoptosis. Furthermore, pharmacological YAP inhibition with verteporfin inhibited tumor cell proliferation and restored sensitivity to cisplatin. In addition, nuclear YAP expression was associated with poor outcome in UCC patients who received perioperative chemotherapy. In conclusion, these results suggest that YAP activation exerts a protective role and represents a pharmacological target to enhance the anti-tumor effects of DNA damaging modalities in the treatment of UCC. PMID:26119935

  17. Quantitative Analysis of Clustered DNA Damages Induced by Silicon Beams of Different Kinetic Energy

    SciTech Connect

    Keszenman D. J.; Keszenman, D.J.; Bennett, P.V.; Sutherland, B.M.; Wilson, P.F.

    2013-05-14

    Humans may b exposed to highly energetic charged particle radiation as a result of medical treatments, occupational activitie or accidental events. In recent years, our increasing presence and burgeoning interest in space exploration beyond low Earth orbit has led to a large increase in the research of the biological effects ofcharged particle radiation typical of that encountered in the space radiation environment. The study of the effects of these types of radiation qualities in terms ofDNA damage induction and repair is fundamental to understand mechanisms both underlying their greater biological effectiveness as we)) as the short and long term risks of health effects such as carcinogenesis, degen rative diseases and premature aging. Charged particle radiation induces a variety of DNA alterations, notably bistranded clustered damages, defined as two or more closely-opposed strand break , oxidized bases or abasic sites within a few helical turns. The induction of such highly complex DNA damage enhances the probability of incorrect or incomplete repair and thus constitutes greater potential for genomic instability, cell death and transformation.

  18. Investigation of Mechanism(s) of DNA Damage Induced by 4-Monochlorobiphenyl (PCB3) Metabolites

    PubMed Central

    Xie, Wei; Wang, Kai; Robertson, Larry W.; Ludewig, Gabriele

    2010-01-01

    4-Monochlorobiphenyl (PCB3) is readily converted by xenobiotic-metabolizing enzymes to dihydroxy-metabolites and quinones. The PCB3 hydroquinone (PCB3-HQ; 2-(4’-chlorophenyl)-1,4-hydroquinone) induces chromosome loss in Chinese Hamster V79 cells, whereas the para-quinone (PCB3-pQ; 2-(4’-chlorophenyl)-1,4-benzoquinone) very efficiently induces gene mutations and chromosome breaks. Apparently, each of these two metabolites, which are a redox pair, has a different spectrum of genotoxic effects due to different, metabolite-specific mechanisms. We hypothesized that the HQ requires enzymatic activation by peroxidases with the formation of reactive oxygen species (ROS) as the ultimate genotoxin, whereas the pQ reacts directly with nucleophilic sites in DNA and/or proteins. To examine this hypothesis, we employed two cell lines with different myeloperoxidase (MPO) activities, MPO-rich HL-60 and MPO-deficient Jurkat cells, and measured cytotoxicity, DNA damage (COMET assay), MPO activity, intracellular levels of reactive oxygen species (ROS) and intracellular free –SH groups (monochlorobimane assay, MCB) and free GSH contents (enzyme recycling method) after treatment with PCB3-HQ and PCB3-pQ. We also examined the modulation of these effects by normal/low temperature, pre-treatment with an MPO inhibitor (succinylacetone, SA), or GSH depletion. PCB3-p-Q increased intracellular ROS levels and induced DNA damage in both HL-60 and Jurkat cells at 37 °C and 6 °C, indicating a direct, MPO-independent mode of activity. It also strongly reduced intracellular free –SH groups and GSH levels in normal and GSH-depleted cells. Thus the ROS increase could be caused by reduced protection by GSH or non-enzymatic autoxidation of the resulting PCB3-HQ-GSH adduct. PCB3-HQ did not produce a significant reduction of intracellular GSH in HL-60 cells and reduced intracellular free –SH groups only at the highest concentration tested in GSH depleted cells. Moreover, PCB3-HQ induced DNA

  19. The Effect of a Grape Seed Extract on Radiation-Induced DNA Damage in Human Lymphocytes

    NASA Astrophysics Data System (ADS)

    Dicu, Tiberius; Postescu, Ion D.; Foriş, Vasile; Brie, Ioana; Fischer-Fodor, Eva; Cernea, Valentin; Moldovan, Mircea; Cosma, Constantin

    2009-05-01

    Plant-derived antioxidants due to their phenolic compounds content are reported as potential candidates for reducing the levels of oxidative stress in living organisms. Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Hydroethanolic (50/50, v/v) standardized extract was obtained from red grape seed (Vitis vinifera, variety Burgund Mare—BM). The total polyphenols content was evaluated by Folin-Ciocalteu procedure and expressed as μEq Gallic Acid/ml. The aim of this study was to evaluate the potential antioxidant effects of different concentrations of BM extract against 60Co γ-rays induced DNA damage in human lymphocytes. Samples of human lymphocytes were incubated with BM extract (12.5, 25.0 and 37.5 μEq GA/ml, respectively) administered at 30 minutes before in vitro irradiation with γ-rays (2 Gy). The DNA damage and repair in lymphocytes were evaluated using alkaline comet assay. Using the lesion score, the radiation-induced DNA damage was found to be significantly different (p<0.05) from control, both in the absence and presence of BM extract (except the lymphocytes treated with 37.5 μEq GA/ml BM extract). DNA repair analyzed by incubating the irradiated cells at 37° C and 5% CO2 atmosphere for 2 h, indicated a significant difference (p<0.05) in the lymphocytes group treated with 25.0 μEq GA/ml BM extract, immediately and two hours after irradiation. These results suggest radioprotective effects after treatment with BM extract in human lymphocytes.

  20. Acetylation dynamics of human nuclear proteins during the ionizing radiation-induced DNA damage response.

    PubMed

    Bennetzen, Martin V; Larsen, Dorthe Helena; Dinant, Christoffel; Watanabe, Sugiko; Bartek, Jiri; Lukas, Jiri; Andersen, Jens S

    2013-06-01

    Genotoxic insults, such as ionizing radiation (IR), cause DNA damage that evokes a multifaceted cellular DNA damage response (DDR). DNA damage signaling events that control protein activity, subcellular localization, DNA binding, protein-protein interactions, etc. rely heavily on time-dependent posttranslational modifications (PTMs). To complement our previous analysis of IR-induced temporal dynamics of nuclear phosphoproteome, we now identify a range of human nuclear proteins that are dynamically regulated by acetylation, and predominantly deacetylation, during IR-induced DDR by using mass spectrometry-based proteomic approaches. Apart from cataloging acetylation sites through SILAC proteomic analyses before IR and at 5 and 60 min after IR exposure of U2OS cells, we report that: (1) key components of the transcriptional machinery, such as EP300 and CREBBP, are dynamically acetylated; (2) that nuclear acetyltransferases themselves are regulated, not on the protein abundance level, but by (de)acetylation; and (3) that the recently reported p53 co-activator and methyltransferase MLL3 is acetylated on five lysines during the DDR. For selected examples, protein immunoprecipitation and immunoblotting were used to assess lysine acetylation status and thereby validate the mass spectrometry data. We thus present evidence that nuclear proteins, including those known to regulate cellular functions via epigenetic modifications of histones, are regulated by (de)acetylation in a timely manner upon cell's exposure to genotoxic insults. Overall, these results present a resource of temporal profiles of a spectrum of protein acetylation sites during DDR and provide further insights into the highly dynamic nature of regulatory PTMs that help orchestrate the maintenance of genome integrity.

  1. Estrogen induces RAD51C expression and localization to sites of DNA damage.

    PubMed

    Alayev, Anya; Salamon, Rachel S; Manna, Subrata; Schwartz, Naomi S; Berman, Adi Y; Holz, Marina K

    2016-12-01

    Homologous recombination (HR) is a conserved process that maintains genome stability and cell survival by repairing DNA double-strand breaks (DSBs). The RAD51-related family of proteins is involved in repair of DSBs; consequently, deregulation of RAD51 causes chromosomal rearrangements and stimulates tumorigenesis. RAD51C has been identified as a potential tumor suppressor and a breast and ovarian cancer susceptibility gene. Recent studies have also implicated estrogen as a DNA-damaging agent that causes DSBs. We found that in ERα-positive breast cancer cells, estrogen transcriptionally regulates RAD51C expression in ERα-dependent mechanism. Moreover, estrogen induces RAD51C assembly into nuclear foci at DSBs, which is a precursor to RAD51 complex recruitment to the nucleus. Additionally, disruption of ERα signaling by either anti-estrogens or siRNA prevented estrogen induced upregulation of RAD51C. We have also found an association of a worse clinical outcome between RAD51C expression and ERα status of tumors. These findings provide insight into the mechanism of genomic instability in ERα-positive breast cancer and suggest that individuals with mutations in RAD51C that are exposed to estrogen would be more susceptible to accumulation of DNA damage, leading to cancer progression.

  2. Switch telomerase to ALT mechanism by inducing telomeric DNA damages and dysfunction of ATRX and DAXX.

    PubMed

    Hu, Yang; Shi, Guang; Zhang, Laichen; Li, Feng; Jiang, Yuanling; Jiang, Shuai; Ma, Wenbin; Zhao, Yong; Songyang, Zhou; Huang, Junjiu

    2016-08-31

    Activation of telomerase or alternative lengthening of telomeres (ALT) is necessary for tumours to escape from dysfunctional telomere-mediated senescence. Anti-telomerase drugs might be effective in suppressing tumour growth in approximately 85-90% of telomerase-positive cancer cells. However, there are still chances for these cells to bypass drug treatment after switching to the ALT mechanism to maintain their telomere integrity. But the mechanism underlying this switch is unknown. In this study, we used telomerase-positive cancer cells (HTC75) to discover the mechanism of the telomerase-ALT switch by inducing telomere-specific DNA damage, alpha-thalassemia X-linked syndrome protein (ATRX) knockdown and deletion of death associated protein (DAXX). Surprisingly, two important ALT hallmarks in the ALT-like HTC75 cells were observed after treatments: ALT-associated promyelocytic leukaemia bodies (APBs) and extrachromosomal circular DNA of telomeric repeats. Moreover, knocking out hTERT by utilizing the CRISPR/Cas9 technique led to telomere elongation in a telomerase-independent manner in ALT-like HTC75 cells. In summary, this is the first report to show that inducing telomeric DNA damage, disrupting the ATRX/DAXX complex and inhibiting telomerase activity in telomerase-positive cancer cells lead to the ALT switch.

  3. Inhibiting the repair of DNA damage induced by gamma irradiation in rat thymocytes

    SciTech Connect

    Smit, J.A.; Stark, J.H.

    1994-01-01

    This study assessed the ability of 11 established and potential radiosensitizing agents to retard the repair of radiation-induced DNA damage with a view to enhancing the immunosuppressive effects of in vivo lymphoid irradiation. The capability of irradiated rat thymocytes to repair DNA damage was assessed by an adaptation of the fluorimetric unwinding method. Three compounds, 3-aminobenzamide (3-AB), novobiocin and flavone-8-acetic acid (FAA), inhibited repair significantly. We also report the effect of low-dose irradiation combined with repair inhibitors on the relationship between DNA strand breaks, fragmentation, cell viability and use of nicotinamide adenine dinucleotide (NAD). DNA fragmentation was increased by 1 mM/l FAA, 1 mM/l novobiocin and 50 {mu}M/l RS-61443 within 3 h of incubation. The latter two compounds also proved cytotoxic. All three drugs augmented the effect of ionizing radiation on the use of NAD. Of the agents investigated, FAA showed the most promise for augmenting the immunosuppressive action of irradiation at nontoxic, pharmacokinetically achievable concentrations. 33 refs., 1 fig., 2 tabs.

  4. DNA damage and oxidative stress induced by imidacloprid exposure in the earthworm Eisenia fetida.

    PubMed

    Wang, Juan; Wang, Jinhua; Wang, Guangchi; Zhu, Lusheng; Wang, Jun

    2016-02-01

    To investigate the soil ecological effect of imidacloprid, earthworm Eisenia fetida was exposed to various concentrations of imidacloprid (0.10, 0.50, and 1.00 mg kg(-1) soil) respectively after 7, 14, 21, and 28 d. The effect of imidacloprid on reactive oxygen species (ROS) generation, antioxidant enzymes activity [superoxide dismutase (SOD) and catalase (CAT), glutathione S-transferase enzyme (GST)], malondialdehyde (MDA) content and DNA damage of the E. fetida was investigated. Significant increase of the ROS level was observed. The SOD and GST activity were significantly induced at most exposure intervals. CAT activity was inhibited and reflected a dose-dependent relationship on days 7, 14 and 21. High MDA levels were observed and the olive tail moment (OTM) as well as the percentage of DNA in the comet tail (tail DNA%) in comet assay declined with increasing concentrations and exposure time after 7 d. Our results suggested that the sub-chronic exposure of imidacloprid caused DNA damage and lipid peroxidation (LPO) leading to antioxidant responses in earthworm E. fetida.

  5. A possible mechanism for combined arsenic and fluoride induced cellular and DNA damage in mice.

    PubMed

    Flora, Swaran J S; Mittal, Megha; Pachauri, Vidhu; Dwivedi, Nidhi

    2012-01-01

    arsenic- or fluoride-induced oxidative stress, DNA damage and protein interaction as the major determinants of toxicity, along with the differential toxic effects during arsenic-fluoride interaction during co-exposure. The study further corroborates our earlier observations that at the higher concentration co-exposures to these toxicants do not elicit synergistic toxicity.

  6. Optical detection of DNA damage

    NASA Astrophysics Data System (ADS)

    Rogers, Kim R.; Apostol, A.; Cembrano, J.

    1999-02-01

    A rapid and sensitive fluorescence assay for oxidative damage to calf thymus DNA is reported. A decrease in the transition temperature for strand separation resulted from exposure of the DNA to the reactive decomposition products of 3- morpholinosydnonimine (SIN-1) (i.e., nitric oxide, superoxide, peroxynitrite, hydrogen peroxide, and hydroxyl radicals). A decrease in melting temperature of 12 degrees Celsius was indicative of oxidative damage including single strand chain breaks. Double stranded (ds) and single stranded (ss) forms of DNA were determined using the indicator dyes ethidium bromide and PicoGreen. The change in DNA 'melting' curves was dependant on the concentration of SIN-1 and was most pronounced at 75 degrees Celsius. This chemically induced damage was significantly inhibited by sodium citrate, tris(hydroxymethyl)aminomethane (Tris), and diethylenetriaminepentaacetic acid (DTPA), but was unaffected by superoxide dismutase (SOD), catalase, ethylenediamine tetraacietic acid (EDTA), or deferoxamine. Lowest observable effect level for SIN-1-induced damage was 200 (mu) M.

  7. Resveratrol Protects Sepsis-Induced Oxidative DNA Damage in Liver and Kidney of Rats

    PubMed Central

    Aydın, Sevtap; Şahin, Tevfik Tolga; Bacanlı, Merve; Taner, Gökçe; Başaran, Arif Ahmet; Aydın, Mehtap; Başaran, Nurşen

    2016-01-01

    Background The increases of free radicals have been proposed to be involved in the pathogenesis of sepsis, which leads to multiple-organ dysfunction syndromes. The uses of antioxidants as a complementary tool in the medical care of oxidative stress-related diseases have attracted attention of researchers. Resveratrol (RV) has suggested being antioxidant, anti-proliferative, and anti-inflammatory effects in various experimental models and clinical settings. Aims This study was undertaken to evaluate the protective effects of RV on oxidative DNA damage induced by sepsis in the liver and kidney tissues of Wistar albino rats. Study Design Animal experimentation. Methods Four experimental groups consisting of eight animals for each was created using a total of thirty-two male Wistar albino rats. Sham group was given 0.5 mL of saline intra-peritoneal (ip) only following laparatomy. Sepsis group was given 0.5 mL saline ip only following the induction of sepsis. RV-treated group was given a dose of 100 mg/kg ip RV in 0.5 mL saline following laparatomy. RV-treated sepsis group was given 100 mg/kg ip RV in 0.5 mL saline following the induction of sepsis. A model of sepsis was created by cecal ligation and puncture technique. In the liver and kidney tissues, oxidative stress parameters (malondialdehyde (MDA), reduced glutathione (GSH), superoxide dismutase (SOD), glutathione peroxidase (GPX)) and a proinflammatory cytokine (tumor necrosis factor alpha (TNF-alpha)), were evaluated spectrophotometrically and DNA damage was determined by the alkaline single cell gel electrophoresis (comet assay) technique using formamidopyrimidine DNA glycosylase protein. Results In the RV-treated sepsis group, the levels of MDA and TNF-alpha were lower and GSH levels, SOD and GPX activities were higher than in the septic rats (p<0.05). RV treatment significantly reduced the sepsis-induced oxidative DNA damage in the liver and kidney cells (p<0.05). Conclusion It is suggested that RV treatment

  8. All-trans-retinal induces Bax activation via DNA damage to mediate retinal cell apoptosis

    PubMed Central

    Sawada, Osamu; Perusek, Lindsay; Kohno, Hideo; Howell, Scott J.; Maeda, Akiko; Matsuyama, Shigemi; Maeda, Tadao

    2014-01-01

    The current study investigates the cellular events which trigger activation of proapoptotic Bcl-2-associated X protein (Bax) in retinal cell death induced by all-trans-retinal (atRAL). Cellular events which activate Bax, such as DNA damage by oxidative stress and phosphorylation of p53, were evaluated by immunochemical and biochemical methods using ARPE-19 cells, 661W cells, cultured neural retinas and a retinal degeneration model, Abca4−/−Rdh8−/− mice. atRAL-induced Bax activation in cultured neural retinas was examined by pharmacological and genetic methods. Other Bax-related cellular events were also evaluated by pharmacological and biochemical methods. Production of 8-OHdG, a DNA damage indicator, and the phosphorylation of p53 at Ser 46 were detected prior to Bax activation in ARPE-19 cells incubated with atRAL. Light exposure to Abca4−/−Rdh8−/− mice also caused the above mentioned events in conditions of short term intense light exposure and regular room lighting conditions. Incubation with Bax inhibiting peptide and deletion of the Bax gene partially protected retinal cells from atRAL toxicity in cultured neural retina. Necrosis was demonstrated not to be the main pathway in atRAL mediated cell death. Bcl-2-interacting mediator and Bcl-2 expression levels were not altered by atRAL in vitro. atRAL-induced oxidative stress results in DNA damage leading to the activation of Bax by phosphorylated p53. This cascade is closely associated with an apoptotic cell death mechanism rather than necrosis. PMID:24726920

  9. Rapamycin‐induced autophagy sensitizes A549 cells to radiation associated with DNA damage repair inhibition

    PubMed Central

    Li, Yong; Liu, Fen; Wang, Yong; Li, Donghai; Guo, Fei; Xu, Liyao; Zeng, Zhengguo; Zhong, Xiaojun

    2016-01-01

    Abstract Background Autophagy has been reported to increase in cancer cells after radiation. However, it remains unknown whether increased autophagy as a result of radiation affects DNA damage repair and sensitizes cancer cells. In this study, the radiosensitization effect of rapamycin, a mammalian target of rapamycin inhibitor that induces autophagy, on human lung adenocarcinoma A549 cells was investigated. Methods A549 cells were treated with different concentrations of rapamycin. Cell viability was evaluated by methyl‐thiazolyl‐tetrazolium assay. Survival fraction values of A549 cells after radiotherapy were detected by colony formation assay. Autophagosome was observed by a transmission electron microscope. Furthermore, Western blot was employed to examine alterations in autophagy protein LC3 and p62, DNA damage protein γ–H2AX, and DNA damage repair proteins Rad51, Ku70, and Ku80. Rad51, Ku70, and Ku80 messenger ribonucleic acid (mRNA) expression levels were examined by real‐time polymerase chain reaction. Results Rapamycin suppressed A549 cell proliferation in dose and time‐dependent manners. An inhibitory concentration (IC) 10 dose of rapamycin could induce autophagy in A549 cells. Rapamycin combined with radiation significantly decreased the colony forming ability of cells, compared with rapamycin or radiation alone. Rapamycin and radiation combined increased γ–H2AX expression levels and decreased Rad51 and Ku80 expression levels, compared with single regimens. However, rapamycin treatment did not induce any change in Rad51, Ku70, and Ku80 mRNA levels, regardless of radiation. Conclusions These findings indicate that increasing autophagy sensitizes lung cancer cells to radiation. PMID:27385978

  10. 6-Hydroxydopamine and lipopolysaccharides induced DNA damage in astrocytes: involvement of nitric oxide and mitochondria.

    PubMed

    Gupta, Sonam; Goswami, Poonam; Biswas, Joyshree; Joshi, Neeraj; Sharma, Sharad; Nath, C; Singh, Sarika

    2015-01-15

    The present study was conducted to investigate the effect of the neurotoxins 6-hydroxydopamine and lipopolysaccharide on astrocytes. Rat astrocyte C6 cells were treated with different concentration of 6-hydroxydopamine (6-OHDA)/lipopolysaccharides (LPS) for 24 h. Both neurotoxins significantly decreased the viability of astrocytes, augmented the expression of inducible nitric oxide synthase (iNOS) and the astrocyte marker--glial fibrillar acidic protein. A significantly decreased mitochondrial dehydrogenase activity, mitochondrial membrane potential, augmented reactive oxygen species (ROS) level, caspase-3 mRNA level, chromatin condensation and DNA damage was observed in 6-OHDA/LPS treated astroglial cells. 6-OHDA/LPS treatment also caused the significantly increased expression of iNOS and nitrite level. Findings showed that 6-OHDA/LPS treatment caused mitochondrial dysfunction mediated death of astrocytes, which significantly involve the nitric oxide. Since we have observed significantly increased level of iNOS along with mitochondrial impairment and apoptotic cell death in astrocytes, therefore to validate the role of iNOS, the cells were co-treated with iNOS inhibitor aminoguanidine (AG, 100 μM). Co-treatment of AG significantly attenuated the 6-OHDA/LPS induced cell death, mitochondrial activity, augmented ROS level, chromatin condensation and DNA damage. GFAP and caspase-3 expression were also inhibited with co-treatment of AG, although the extent of inhibition was different in both experimental sets. In conclusion, the findings showed that iNOS mediated increased level of nitric oxide acts as a key regulatory molecule in 6-OHDA/LPS induced mitochondrial dysfunction, DNA damage and apoptotic death of astrocytes.

  11. Hot water extract of Chlorella vulgaris induced DNA damage and apoptosis

    PubMed Central

    Yusof, Yasmin Anum Mohd; Md. Saad, Suhana; Makpol, Suzana; Shamaan, Nor Aripin; Ngah, Wan Zurinah Wan

    2010-01-01

    OBJECTIVES: The aim of this study was to determine the antiproliferative and apoptotic effects of hot water extracts of Chlorella vulgaris on hepatoma cell line HepG2. INTRODUCTION: The search for food and spices that can induce apoptosis in cancer cells has been a major study interest in the last decade. Chlorella vulgaris, a unicellular green algae, has been reported to have antioxidant and anti‐cancer properties. However, its chemopreventive effects in inhibiting the growth of cancer cells have not been studied in great detail. METHODS: HepG2 liver cancer cells and WRL68 normal liver cells were treated with various concentrations (0‐4 mg/ml) of hot water extract of C. vulgaris after 24 hours incubation. Apoptosis rate was evaluated by TUNEL assay while DNA damage was assessed by Comet assay. Apoptosis proteins were evaluated by Western blot analysis. RESULTS: Chlorella vulgaris decreased the number of viable HepG2 cells in a dose dependent manner (p < 0.05), with an IC50 of 1.6 mg/ml. DNA damage as measured by Comet assay was increased in HepG2 cells at all concentrations of Chlorella vulgaris tested. Evaluation of apoptosis by TUNEL assay showed that Chlorella vulgaris induced a higher apoptotic rate (70%) in HepG2 cells compared to normal liver cells, WRL68 (15%). Western blot analysis showed increased expression of pro‐ apoptotic proteins P53, Bax and caspase‐3 in the HepG2 cells compared to normal liver cells WRL68, and decreased expression of the anti‐apoptotic protein Bcl‐2. CONCLUSIONS: Chlorella vulgaris may have anti‐cancer effects by inducing apoptosis signaling cascades via an increased expression of P53, Bax and caspase‐3 proteins and through a reduction of Bcl‐2 protein, which subsequently lead to increased DNA damage and apoptosis. PMID:21340229

  12. Genoprotective effect of hyaluronic acid against benzalkonium chloride-induced DNA damage in human corneal epithelial cells

    PubMed Central

    Wu, Han; Zhang, Huina; Wang, Changjun; Wu, Yihua; Xie, Jiajun; Jin, Xiuming; Yang, Jun

    2011-01-01

    Purpose The aim of this study was to investigate hyaluronic acid (HA) protection on cultured human corneal epithelial cells (HCEs) against benzalkonium chloride (BAC)-induced DNA damage and intracellular reactive oxygen species (ROS) increase. Methods Cells were incubated with different concentrations of BAC with or without the presence of 0.2% HA for 30 min. DNA damage to HCEs was examined by alkaline comet assay and by immunofluorescence microscopic detection of the phosphorylated form of histone variant H2AX (γH2AX) foci. ROS production was assessed by the fluorescent probe, 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). Cell apoptosis was determined with annexin V staining by flow cytometry. Results HA significantly reduced BAC-induced DNA damage as indicated by the tail length (TL) and tail moment (TM) of alkaline comet assay and by γH2AX foci formation, respectively. Moreover, HA significantly decreased BAC-induced ROS increase and cell apoptosis. However, exposure to HA alone did not produce any significant change in DNA damage, ROS generation, or cell apoptosis. Conclusions BAC could induce DNA damage and cell apoptosis in HCEs, probably through increasing oxidative stress. Furthermore, HA was an effective protective agent that had antioxidant properties and could decrease DNA damage and cell apoptosis induced by BAC. PMID:22219631

  13. Ku80-deletion suppresses spontaneous tumors and induces a p53-mediated DNA damage response

    PubMed Central

    Holcomb, Valerie B.; Rodier, Francis; Choi, Yong Jun; Busuttil, Rita A.; Vogel, Hannes; Vijg, Jan; Campisi, Judith; Hasty, Paul

    2014-01-01

    Ku80 facilitates DNA repair and therefore should suppress cancer. However, ku80−/− mice exhibit reduced cancer, although they age prematurely and have a shortened life span. We tested the hypothesis that Ku80 deletion suppresses cancer by enhancing cellular tumor suppressive responses to inefficiently repaired DNA damage. In support of this hypothesis, Ku80 deletion ameliorated tumor burden in APCMIN mice, and increased a p53-mediated DNA damage response, DNA lesions, and chromosomal rearrangements. Thus, contrary to its assumed role as a caretaker tumor suppressor, Ku80 facilitates tumor growth most likely by dampening baseline cellular DNA damage responses. PMID:19010925

  14. Characteristics and modifying factors of asbestos-induced oxidative DNA damage.

    PubMed

    Jiang, Li; Nagai, Hirotaka; Ohara, Hiroki; Hara, Shigeo; Tachibana, Mitsuhiro; Hirano, Seishiro; Shinohara, Yasushi; Kohyama, Norihiko; Akatsuka, Shinya; Toyokuni, Shinya

    2008-11-01

    Respiratory exposure to asbestos has been linked with mesothelioma in humans. However, its carcinogenic mechanism is still unclear. Here we studied the ability of chrysotile, crocidolite and amosite fibers to induce oxidative DNA damage and the modifying factors using four distinct approaches. Electron spin resonance analyses revealed that crocidolite and amosite containing high amounts of iron, but not chrysotile, catalyzed hydroxyl radical generation in the presence of H(2)O(2), which was enhanced by an iron chelator, nitrilotriacetic acid, and suppressed by desferal. Natural iron chelators, such as citrate, adenosine 5'-triphosphate and guanosine 5'-triphosphate, did not inhibit this reaction. Second, we used time-lapse video microscopy to evaluate how cells cope with asbestos fibers. RAW264.7 cells, MeT-5 A and HeLa cells engulfed asbestos fibers, which reached not only cytoplasm but also the nucleus. Third, we utilized supercoiled plasmid DNA to evaluate the ability of each asbestos to induce DNA double strand breaks (DSB). Crocidolite and amosite, but not chrysotile, induced DNA DSB in the presence of iron chelators. We cloned the fragments to identify break sites. DSB occurred preferentially within repeat sequences and between two G:C sequences. Finally, i.p. administration of each asbestos to rats induced not only formation of nuclear 8-hydroxy-2'-deoxyguanosine in the mesothelia, spleen, liver and kidney but also significant iron deposits in the spleen. Together with the established carcinogenicity of i.p. chrysotile, our data suggest that asbestos-associated catalytic iron, whether constitutional or induced by other mechanisms, plays an important role in asbestos-induced carcinogenesis and that chemoprevention may be possible through targeting the catalytic iron.

  15. Effects of melatonin on DNA damage induced by cyclophosphamide in rats

    PubMed Central

    Ferreira, S.G.; Peliciari-Garcia, R.A.; Takahashi-Hyodo, S.A.; Rodrigues, A.C.; Amaral, F.G.; Berra, C.M.; Bordin, S.; Curi, R.; Cipolla-Neto, J.

    2013-01-01

    The antioxidant and free radical scavenger properties of melatonin have been well described in the literature. In this study, our objective was to determine the protective effect of the pineal gland hormone against the DNA damage induced by cyclophosphamide (CP), an anti-tumor agent that is widely applied in clinical practice. DNA damage was induced in rats by a single intraperitoneal injection of CP (20 or 50 mg/kg). Animals received melatonin during the dark period for 15 days (1 mg/kg in the drinking water). Rat bone marrow cells were used for the determination of chromosomal aberrations and of formamidopyrimidine DNA glycosylase enzyme (Fpg)-sensitive sites by the comet technique and of Xpf mRNA expression by qRT-PCR. The number (mean ± SE) of chromosomal aberrations in pinealectomized (PINX) animals treated with melatonin and CP (2.50 ± 0.50/100 cells) was lower than that obtained for PINX animals injected with CP (12 ± 1.8/100 cells), thus showing a reduction of 85.8% in the number of chromosomal aberrations. This melatonin-mediated protection was also observed when oxidative lesions were analyzed by the Fpg-sensitive assay, both 24 and 48 h after CP administration. The expression of Xpf mRNA, which is involved in the DNA nucleotide excision repair machinery, was up-regulated by melatonin. The results indicate that melatonin is able to protect bone marrow cells by completely blocking CP-induced chromosome aberrations. Therefore, melatonin administration could be an alternative and effective treatment during chemotherapy. PMID:23471360

  16. Effects of melatonin on DNA damage induced by cyclophosphamide in rats.

    PubMed

    Ferreira, S G; Peliciari-Garcia, R A; Takahashi-Hyodo, S A; Rodrigues, A C; Amaral, F G; Berra, C M; Bordin, S; Curi, R; Cipolla-Neto, J

    2013-03-01

    The antioxidant and free radical scavenger properties of melatonin have been well described in the literature. In this study, our objective was to determine the protective effect of the pineal gland hormone against the DNA damage induced by cyclophosphamide (CP), an anti-tumor agent that is widely applied in clinical practice. DNA damage was induced in rats by a single intraperitoneal injection of CP (20 or 50 mg/kg). Animals received melatonin during the dark period for 15 days (1 mg/kg in the drinking water). Rat bone marrow cells were used for the determination of chromosomal aberrations and of formamidopyrimidine DNA glycosylase enzyme (Fpg)-sensitive sites by the comet technique and of Xpf mRNA expression by qRT-PCR. The number (mean ± SE) of chromosomal aberrations in pinealectomized (PINX) animals treated with melatonin and CP (2.50 ± 0.50/100 cells) was lower than that obtained for PINX animals injected with CP (12 ± 1.8/100 cells), thus showing a reduction of 85.8% in the number of chromosomal aberrations. This melatonin-mediated protection was also observed when oxidative lesions were analyzed by the Fpg-sensitive assay, both 24 and 48 h after CP administration. The expression of Xpf mRNA, which is involved in the DNA nucleotide excision repair machinery, was up-regulated by melatonin. The results indicate that melatonin is able to protect bone marrow cells by completely blocking CP-induced chromosome aberrations. Therefore, melatonin administration could be an alternative and effective treatment during chemotherapy.

  17. Cre recombinase induces DNA damage and tetraploidy in the absence of loxP sites.

    PubMed

    Janbandhu, Vaibhao C; Moik, Daniel; Fässler, Reinhard

    2014-01-01

    The spatiotemporal manipulations of gene expression by the Cre recombinase (Cre) of bacteriophage P1 has become an essential asset to understanding mammalian genetics. Accumulating evidence suggests that Cre activity can, in addition to excising targeted loxP sites, induce cytotoxic effects, including abnormal cell cycle progression, genomic instability, and apoptosis, which can accelerate cancer progression. It is speculated that these defects are caused by Cre-induced DNA damage at off-target sites. Here we report the formation of tetraploid keratinocytes in the epidermis of keratin 5 and/or keratin 14 promoter-driven Cre (KRT5- and KRT14-Cre) expressing mouse skin. Biochemical analyses and flow cytometry demonstrated that Cre expression also induces DNA damage, genomic instability, and tetraploidy in HCT116 cells, and live-cell imaging revealed an extension of the G 2 cell cycle phase followed by defective or skipping of mitosis as cause for the tetraploidy. Since tetraploidy eventually leads to aneuploidy, a hallmark of cancer, our findings highlight the importance of distinguishing non-specific cytopathic effects from specific Cre/loxP-driven genetic manipulations when using Cre-mediated gene deletions.

  18. Prion-induced neurotoxicity: Possible role for cell cycle activity and DNA damage response.

    PubMed

    Bujdoso, Raymond; Landgraf, Matthias; Jackson, Walker S; Thackray, Alana M

    2015-08-12

    Protein misfolding neurodegenerative diseases arise through neurotoxicity induced by aggregation of host proteins. These conditions include Alzheimer's disease, Huntington's disease, Parkinson's disease, motor neuron disease, tauopathies and prion diseases. Collectively, these conditions are a challenge to society because of the increasing aged population and through the real threat to human food security by animal prion diseases. It is therefore important to understand the cellular and molecular mechanisms that underlie protein misfolding-induced neurotoxicity as this will form the basis for designing strategies to alleviate their burden. Prion diseases are an important paradigm for neurodegenerative conditions in general since several of these maladies have now been shown to display prion-like phenomena. Increasingly, cell cycle activity and the DNA damage response are recognised as cellular events that participate in the neurotoxic process of various neurodegenerative diseases, and their associated animal models, which suggests they are truly involved in the pathogenic process and are not merely epiphenomena. Here we review the role of cell cycle activity and the DNA damage response in neurodegeneration associated with protein misfolding diseases, and suggest that these events contribute towards prion-induced neurotoxicity. In doing so, we highlight PrP transgenic Drosophila as a tractable model for the genetic analysis of transmissible mammalian prion disease.

  19. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    SciTech Connect

    Yoshimura, Akari; Kobayashi, Yume; Tada, Shusuke; Seki, Masayuki; Enomoto, Takemi

    2014-09-12

    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  20. Enhanced susceptibility of ovaries from obese mice to 7,12-dimethylbenz[a]anthracene-induced DNA damage

    SciTech Connect

    Ganesan, Shanthi Nteeba, Jackson Keating, Aileen F.

    2014-12-01

    7,12-Dimethylbenz[a]anthracene (DMBA) depletes ovarian follicles and induces DNA damage in extra-ovarian tissues, thus, we investigated ovarian DMBA-induced DNA damage. Additionally, since obesity is associated with increased offspring birth defect incidence, we hypothesized that a DMBA-induced DNA damage response (DDR) is compromised in ovaries from obese females. Wild type (lean) non agouti (a/a) and KK.Cg-Ay/J heterozygote (obese) mice were dosed with sesame oil or DMBA (1 mg/kg; intraperitoneal injection) at 18 weeks of age, for 14 days. Total ovarian RNA and protein were isolated and abundance of Ataxia telangiectasia mutated (Atm), X-ray repair complementing defective repair in Chinese hamster cells 6 (Xrcc6), breast cancer type 1 (Brca1), Rad 51 homolog (Rad51), poly [ADP-ribose] polymerase 1 (Parp1) and protein kinase, DNA-activated, catalytic polypeptide (Prkdc) were quantified by RT-PCR or Western blot. Phosphorylated histone H2AX (γH2AX) level was determined by Western blotting. Obesity decreased (P < 0.05) basal protein abundance of PRKDC and BRCA1 proteins but increased (P < 0.05) γH2AX and PARP1 proteins. Ovarian ATM, XRCC6, PRKDC, RAD51 and PARP1 proteins were increased (P < 0.05) by DMBA exposure in lean mice. A blunted DMBA-induced increase (P < 0.05) in XRCC6, PRKDC, RAD51 and BRCA1 was observed in ovaries from obese mice, relative to lean counterparts. Taken together, DMBA exposure induced γH2AX as well as the ovarian DDR, supporting that DMBA causes ovarian DNA damage. Additionally, ovarian DDR was partially attenuated in obese females raising concern that obesity may be an additive factor during chemical-induced ovotoxicity. - Highlights: • DMBA induces markers of ovarian DNA damage. • Obesity induces low level ovarian DNA damage. • DMBA-induced DNA repair response is altered by obesity.

  1. Cohesin Is limiting for the suppression of DNA damage-induced recombination between homologous chromosomes.

    PubMed

    Covo, Shay; Westmoreland, James W; Gordenin, Dmitry A; Resnick, Michael A

    2010-07-01

    Double-strand break (DSB) repair through homologous recombination (HR) is an evolutionarily conserved process that is generally error-free. The risk to genome stability posed by nonallelic recombination or loss-of-heterozygosity could be reduced by confining HR to sister chromatids, thereby preventing recombination between homologous chromosomes. Here we show that the sister chromatid cohesion complex (cohesin) is a limiting factor in the control of DSB repair and genome stability and that it suppresses DNA damage-induced interactions between homologues. We developed a gene dosage system in tetraploid yeast to address limitations on various essential components in DSB repair and HR. Unlike RAD50 and RAD51, which play a direct role in HR, a 4-fold reduction in the number of essential MCD1 sister chromatid cohesion subunit genes affected survival of gamma-irradiated G(2)/M cells. The decreased survival reflected a reduction in DSB repair. Importantly, HR between homologous chromosomes was strongly increased by ionizing radiation in G(2)/M cells with a single copy of MCD1 or SMC3 even at radiation doses where survival was high and DSB repair was efficient. The increased recombination also extended to nonlethal doses of UV, which did not induce DSBs. The DNA damage-induced recombinants in G(2)/M cells included crossovers. Thus, the cohesin complex has a dual role in protecting chromosome integrity: it promotes DSB repair and recombination between sister chromatids, and it suppresses damage-induced recombination between homologues. The effects of limited amounts of Mcd1and Smc3 indicate that small changes in cohesin levels may increase the risk of genome instability, which may lead to genetic diseases and cancer.

  2. Calculation on spectrum of direct DNA damage induced by low-energy electrons including dissociative electron attachment.

    PubMed

    Liu, Wei; Tan, Zhenyu; Zhang, Liming; Champion, Christophe

    2017-03-01

    In this work, direct DNA damage induced by low-energy electrons (sub-keV) is simulated using a Monte Carlo method. The characteristics of the present simulation are to consider the new mechanism of DNA damage due to dissociative electron attachment (DEA) and to allow determining damage to specific bases (i.e., adenine, thymine, guanine, or cytosine). The electron track structure in liquid water is generated, based on the dielectric response model for describing electron inelastic scattering and on a free-parameter theoretical model and the NIST database for calculating electron elastic scattering. Ionization cross sections of DNA bases are used to generate base radicals, and available DEA cross sections of DNA components are applied for determining DNA-strand breaks and base damage induced by sub-ionization electrons. The electron elastic scattering from DNA components is simulated using cross sections from different theoretical calculations. The resulting yields of various strand breaks and base damage in cellular environment are given. Especially, the contributions of sub-ionization electrons to various strand breaks and base damage are quantitatively presented, and the correlation between complex clustered DNA damage and the corresponding damaged bases is explored. This work shows that the contribution of sub-ionization electrons to strand breaks is substantial, up to about 40-70%, and this contribution is mainly focused on single-strand break. In addition, the base damage induced by sub-ionization electrons contributes to about 20-40% of the total base damage, and there is an evident correlation between single-strand break and damaged base pair A-T.

  3. Role of platinum DNA damage-induced transcriptional inhibition in chemotherapy-induced neuronal atrophy and peripheral neurotoxicity.

    PubMed

    Yan, Fang; Liu, Johnson J; Ip, Virginia; Jamieson, Stephen M F; McKeage, Mark J

    2015-12-01

    Platinum-based anticancer drugs cause peripheral neurotoxicity by damaging sensory neurons within the dorsal root ganglia (DRG), but the mechanisms are incompletely understood. The roles of platinum DNA binding, transcription inhibition and altered cell size were investigated in primary cultures of rat DRG cells. Click chemistry quantitative fluorescence imaging of RNA-incorporated 5-ethynyluridine showed high, but wide ranging, global levels of transcription in individual neurons that correlated with their cell body size. Treatment with platinum drugs reduced neuronal transcription and cell body size to an extent that corresponded to the amount of preceding platinum DNA binding, but without any loss of neuronal cells. The effects of platinum drugs on neuronal transcription and cell body size were inhibited by blocking platinum DNA binding with sodium thiosulfate, and mimicked by treatment with a model transcriptional inhibitor, actinomycin D. In vivo oxaliplatin treatment depleted the total RNA content of DRG tissue concurrently with altering DRG neuronal size. These findings point to a mechanism of chemotherapy-induced peripheral neurotoxicity, whereby platinum DNA damage induces global transcriptional arrest leading in turn to neuronal atrophy. DRG neurons may be particularly vulnerable to this mechanism of toxicity because of their requirements for high basal levels of global transcriptional activity. Findings point to a new stepwise mechanism of chemotherapy-induced peripheral neurotoxicity, whereby platinum DNA damage induces global transcriptional arrest leading in turn to neuronal atrophy. Dorsal root ganglion neurons may be particularly vulnerable to this neurotoxicity because of their high global transcriptional outputs, demonstrated in this study by click chemistry quantitative fluorescence imaging.

  4. XPC is essential for nucleotide excision repair of zidovudine-induced DNA damage in human hepatoma cells

    SciTech Connect

    Wu Qiangen; Beland, Frederick A.; Chang, Ching-Wei; Fang Jialong

    2011-03-01

    Zidovudine (3'-azido-3'-dexoythymidine, AZT), a nucleoside reverse transcriptase inhibitor, can be incorporated into DNA and cause DNA damage. The mechanisms underlying the repair of AZT-induced DNA damage are unknown. To investigate the pathways involved in the recognition and repair of AZT-induced DNA damage, human hepatoma HepG2 cells were incubated with AZT for 2 weeks and the expression of DNA damage signaling pathways was determined using a pathway-based real-time PCR array. Compared to control cultures, damaged DNA binding and nucleotide excision repair (NER) pathways showed significantly increased gene expression. Further analysis indicated that AZT treatment increased the expression of genes associated with NER, including XPC, XPA, RPA1, GTF2H1, and ERCC1. Western blot analysis demonstrated that the protein levels of XPC and GTF2H1 were also significantly up-regulated. To explore further the function of XPC in the repair of AZT-induced DNA damage, XPC expression was stably knocked down by 71% using short hairpin RNA interference. In the XPC knocked-down cells, 100 {mu}M AZT treatment significantly increased [{sup 3}H]AZT incorporation into DNA, decreased the total number of viable cells, increased the release of lactate dehydrogenase, induced apoptosis, and caused a more extensive G2/M cell cycle arrest when compared to non-transfected HepG2 cells or HepG2 cells transfected with a scrambled short hairpin RNA sequence. Overall, these data indicate that XPC plays an essential role in the NER repair of AZT-induced DNA damage.

  5. Protective Effect against Hydroxyl-induced DNA Damage and Antioxidant Activity of Radix Glycyrrhizae (Liquorice Root)

    PubMed Central

    Li, Xican; Chen, Weikang; Chen, Dongfeng

    2013-01-01

    Purpose: As a typical Chinese herbal medicine, Radix Glycyrrhizae (RG) possesses various pharmacological effects involved in antioxidant ability. However, its antioxidant has not been explored so far. The aim of the study was to investigate its antioxidant ability, then further discuss the antioxidant mechanism. Methods: RG was extracted by ethanol to obtain ethanolic extract of Radix Glycyrrhizae (ERG). ERG was then determined by various antioxidant methods, including DNA damage assay, DPPH assay, ABTS assay, Fe3+-reducing assay and Cu2+-reducing assay. Finally, the contents of total phenolics and total flavonoids were analyzed by spectrophotometric methods. Results: Our results revealed that ERG could effectively protect against hydroxyl-induced DNA damage (IC50 517.28±26.61μg/mL). In addition, ERG could scavenge DPPH· radical (IC50165.18±6.48μg/mL) and ABTS+• radical (IC507.46±0.07μg/mL), reduce Fe3+ (IC50 97.23±2.88 μg/mL) and Cu2+ (IC50 59.21±0.18 μg/mL). Chemical analysis demonstrated that the contents of total phenolics and flavonoids in ERG were 111.48±0.88 and 218.26±8.57 mg quercetin/g, respectively. Conclusion: Radix Glycyrrhizae can effectively protect against hydroxyl-induced DNA damage. One mechanism of protective effect may be radical-scavenging which is via donating hydrogen atom (H·), donating electron (e). Its antioxidant ability can be mainly attributed to the flavonoids or total phenolics. PMID:24312831

  6. Protective Effect against Hydroxyl-induced DNA Damage and Antioxidant Activity of Citri reticulatae Pericarpium

    PubMed Central

    Li, Xican; Huang, Yanping; Chen, Dongfeng

    2013-01-01

    Purpose: As a typical Chinese herbal medicine, Citri reticulatae pericarpium (CRP) possesses various pharmacological effects involved in antioxidant ability. However, its antioxidant effects have not been reported yet. The objective of this work was to investigate its antioxidant ability, then further discuss the antioxidant mechanism. Methods: CRP was extracted by ethanol to obtain ethanol extract of Citri reticulatae pericarpium (ECRP). ECRP was then measured by various antioxidant methods, including DNA damage assay, DPPH assay, ABTS assay, Fe3+-reducing assay and Cu2+-reducing assay. Finally, the content of total flavonoids was analyzed by spectrophotometric method. Results: Our results revealed that ECRP could effectively protect against hydroxyl-induced DNA damage (IC50 944.47±147.74 μg/mL). In addition, it could also scavenge DPPH· radical (IC50349.67±1.91 μg/mL) and ABTS+• radical (IC5011.33±0.10 μg/mL), reduce Fe3+ (IC50 140.95±2.15 μg/mL) and Cu2+ (IC50 70.46±1.77 μg/mL). Chemical analysis demonstrated that the content of total flavonoids in ECRP was 198.29±12.24 mg quercetin/g. Conclusion: Citri reticulatae pericarpium can effectively protect against hydroxyl-induced DNA damage. One mechanism of protective effect may be radical-scavenging which is via donating hydrogen atom (H·), donating electron (e). Its antioxidant ability can be mainly attributed to the flavonoids, especially hesperidin and narirutin. PMID:24312832

  7. Diethylstilbestrol induces oxidative DNA damage, resulting in apoptosis of spermatogonial stem cells in vitro.

    PubMed

    Habas, Khaled; Brinkworth, Martin H; Anderson, Diana

    2017-03-14

    The spermatogonial stem cells (SSCs) are the only germline stem cells in adults that are responsible for the transmission of genetic information from mammals to the next generation. SSCs play a very important role in the maintenance of progression of spermatogenesis and help provide an understanding of the reproductive biology of future gametes and a strategy for diagnosis and treatment of infertility and male reproductive toxicity. Androgens/oestrogens are very important for the suitable maintenance of male germ cells. There is also evidence confirming the damaging effects of oestrogen-like compounds on male reproductive health. We investigated the effects in vitro, of diethylstilbestrol (DES) on mouse spermatogonial stem cells separated using Staput unit-gravity velocity sedimentation, evaluating any DNA damage using the Comet assay and apoptotic cells in the TUNEL assay. Immunocytochemistry assays showed that the purity of isolated mouse spermatogonial cells was 90%, and the viability of these isolated cells was over 96%. Intracellular superoxide anion production (O2(-)) in SSCs was detected using p-Nitro Blue Tetrazolium (NBT) assay. The viability of cells after DES treatment was examined in the CCK8 (cell counting kit-8) cytotoxicity assay. The results showed that DES-induced DNA damage causes an increase in intracellular superoxide anions which are reduced by the flavonoid, quercetin. Investigating the molecular mechanisms and biology of SSCs provides a better understanding of spermatogonial stem cell regulation in the testis.

  8. Inhibition of etoposide-induced DNA damage and cytotoxicity in L1210 cells by dehydrogenase inhibitors and other agents.

    PubMed

    Wozniak, A J; Glisson, B S; Hande, K R; Ross, W E

    1984-02-01

    The mechanism of action of 4'-demethylepipodophyllotoxin-9-(4,6-O-ethylidene-beta-D-glucopyra noside) (VP-16), an important antitumor agent, is unclear. There is evidence that DNA may be the target of action because VP-16 causes single-strand and double-strand breaks in DNA and produces cytotoxicity over a similar dose range. We have hypothesized that an enzyme system, such as dehydrogenase, catalyzes an oxidation-reduction reaction involving the pendant phenolic group which forms an active metabolite that causes the DNA damage and cytotoxicity. To test our hypothesis, we investigated the effect of disulfiram, an aldehyde dehydrogenase inhibitor, and its metabolite, diethyldithiocarbamate, on VP-16-induced DNA damage in L1210 cells. Using the alkaline elution technique to assay DNA damage, we found that disulfiram and diethyldithiocerbamate inhibited VP-16-induced single-strand breaks. Both compounds were also capable of significantly reducing VP-16-induced cytotoxicity. Oxalic acid, pyrophosphate, and malonic acid, competitive inhibitors of succinate dehydrogenase, and the naturally occurring dehydrogenase substrates, succinic acid, beta-glycerophosphate, and isocitric acid, also blocked the effects of VP-16. Free-radical scavengers were also studied. While sodium benzoate was particularly effective in preventing drug-induced DNA damage and cytotoxicity, a number of other scavengers were not. Our data are consistent with the hypothesis that VP-16 is activated by an enzyme such as a dehydrogenase which transforms it into an active intermediate resulting in DNA damage and, consequently, cell death.

  9. Levetiracetam mitigates doxorubicin-induced DNA and synaptic damage in neurons

    PubMed Central

    Manchon, Jose Felix Moruno; Dabaghian, Yuri; Uzor, Ndidi-Ese; Kesler, Shelli R.; Wefel, Jeffrey S.; Tsvetkov, Andrey S.

    2016-01-01

    Neurotoxicity may occur in cancer patients and survivors during or after chemotherapy. Cognitive deficits associated with neurotoxicity can be subtle or disabling and frequently include disturbances in memory, attention, executive function and processing speed. Searching for pathways altered by anti-cancer treatments in cultured primary neurons, we discovered that doxorubicin, a commonly used anti-neoplastic drug, significantly decreased neuronal survival. The drug promoted the formation of DNA double-strand breaks in primary neurons and reduced synaptic and neurite density. Pretreatment of neurons with levetiracetam, an FDA-approved anti-epileptic drug, enhanced survival of chemotherapy drug-treated neurons, reduced doxorubicin-induced formation of DNA double-strand breaks, and mitigated synaptic and neurite loss. Thus, levetiracetam might be part of a valuable new approach for mitigating synaptic damage and, perhaps, for treating cognitive disturbances in cancer patients and survivors. PMID:27168474

  10. Demethoxycurcumin-induced DNA Damage Decreases DNA Repair-associated Protein Expression Levels in NCI-H460 Human Lung Cancer Cells.

    PubMed

    Ko, Yang-Ching; Lien, Jin-Cherng; Liu, Hsin-Chung; Hsu, Shu-Chun; Lin, Hui-Yi; Chueh, Fu-Shin; Ji, Bin-Chuan; Yang, Mei-Due; Hsu, Wu-Huei; Chung, Jing-Gung

    2015-05-01

    Demethoxycurcumin (DMC) is a key component of Chinese medicine (Turmeric) and has been proven effective in killing various cancer cells. Its role in inducing cytotoxic effects in many cancer cells has been reported, but its role regarding DNA damage on lung cancer cells has not been studied in detail. In the present study, we demonstrated DMC-induced DNA damage and condensation in NCI-H460 cells by using the Comet assay and DAPI staining examinations, respectively. Western blotting indicated that DMC suppressed the protein levels associated with DNA damage and repair, such as 14-3-3σ (an important checkpoint keeper of DNA damage response), DNA repair proteins breast cancer 1, early onset (BRCA1), O6-methylguanine-DNA methyltransferase (MGMT), mediator of DNA damage checkpoint 1 (MDC1), and p53 (tumor suppressor protein). DMC activated phosphorylated p53 and p-H2A.X (phospho Ser140) in NCI-H460 cells. Furthermore, we used confocal laser systems microscopy to examine the protein translocation. The results showed that DMC promotes the translocation of p-p53 and p-H2A.X from the cytosol to the nuclei in NCI-H460 cells. Taken together, DMC induced DNA damage and affected DNA repair proteins in NCI-H460 cells in vitro.

  11. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE: INDUCED BY RADIATION, CHEMICALS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This assay is based on the ability of certain dyes to fluoresce upon intercalation with dsDNA. Damage caused by ultraviolet (UV) radiation, chemicals or restriction enzymes is detected using this assay. UV radiation at...

  12. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY RADIATION, CHEMICAL MUTAGENS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This novel assay is based on changes in melting/annealing behavior and facilitated using certain dyes that increase their fluorescence upon association with double stranded (ds)DNA. Damage caused by ultraviolet (UV) ra...

  13. Cyclin D1 depletion induces DNA damage in mantle cell lymphoma lines.

    PubMed

    Mohanty, Suchismita; Mohanty, Atish; Sandoval, Natalie; Tran, Thai; Bedell, Victoria; Wu, Jun; Scuto, Anna; Murata-Collins, Joyce; Weisenburger, Dennis D; Ngo, Vu N

    2017-03-01

    Elevated cyclin D1 (CCND1) expression levels in mantle cell lymphoma (MCL) are associated with aggressive clinical manifestations related to chemoresistance, but little is known about how this important proto-oncogene contributes to the resistance of MCL. Here, we showed that RNA interference-mediated depletion of CCND1 increased caspase-3 activities and induced apoptosis in the human MCL lines UPN-1 and JEKO-1. In vitro and xenotransplant studies revealed that the toxic effect of CCND1 depletion in MCL cells was likely due to increase in histone H2AX phosphorylation, a DNA damage marker. DNA fiber analysis suggested deregulated replication initiation after CCND1 depletion as a potential cause of DNA damage. Finally, in contrast to depletion or inhibition of cyclin-dependent kinase 4, CCND1 depletion increased chemosensitivity of MCL cells to replication inhibitors hydroxyurea and cytarabine. Our findings have an important implication for CCND1 as a potential therapeutic target in MCL patients who are refractory to standard chemotherapy.

  14. Mechanisms of neurotoxicity induced in the developing brain of mice and rats by DNA-damaging chemicals.

    PubMed

    Doi, Kunio

    2011-01-01

    It is not widely known how the developing brain responds to extrinsic damage, although the developing brain is considered to be sensitive to diverse environmental factors including DNA-damaging agents. This paper reviews the mechanisms of neurotoxicity induced in the developing brain of mice and rats by six chemicals (ethylnitrosourea, hydroxyurea, 5-azacytidine, cytosine arabinoside, 6-mercaptopurine and etoposide), which cause DNA damage in different ways, especially from the viewpoints of apoptosis and cell cycle arrest in neural progenitor cells. In addition, this paper also reviews the repair process following damage in the developing brain.

  15. Biomolecular Damage Induced by Ionizing Radiation: The Direct and Indirect Effects of Low-Energy Electrons on DNA

    NASA Astrophysics Data System (ADS)

    Alizadeh, Elahe; Orlando, Thomas M.; Sanche, Léon

    2015-04-01

    Many experimental and theoretical advances have recently allowed the study of direct and indirect effects of low-energy electrons (LEEs) on DNA damage. In an effort to explain how LEEs damage the human genome, researchers have focused efforts on LEE interactions with bacterial plasmids, DNA bases, sugar analogs, phosphate groups, and longer DNA moieties. Here, we summarize the current understanding of the fundamental mechanisms involved in LEE-induced damage of DNA and complex biomolecule films. Results obtained by several laboratories on films prepared and analyzed by different methods and irradiated with different electron-beam current densities and fluencies are presented. Despite varied conditions (e.g., film thicknesses and morphologies, intrinsic water content, substrate interactions, and extrinsic atmospheric compositions), comparisons show a striking resemblance in the types of damage produced and their yield functions. The potential of controlling this damage using molecular and nanoparticle targets with high LEE yields in targeted radiation-based cancer therapies is also discussed.

  16. Biomolecular damage induced by ionizing radiation: the direct and indirect effects of low-energy electrons on DNA.

    PubMed

    Alizadeh, Elahe; Orlando, Thomas M; Sanche, Léon

    2015-04-01

    Many experimental and theoretical advances have recently allowed the study of direct and indirect effects of low-energy electrons (LEEs) on DNA damage. In an effort to explain how LEEs damage the human genome, researchers have focused efforts on LEE interactions with bacterial plasmids, DNA bases, sugar analogs, phosphate groups, and longer DNA moieties. Here, we summarize the current understanding of the fundamental mechanisms involved in LEE-induced damage of DNA and complex biomolecule films. Results obtained by several laboratories on films prepared and analyzed by different methods and irradiated with different electron-beam current densities and fluencies are presented. Despite varied conditions (e.g., film thicknesses and morphologies, intrinsic water content, substrate interactions, and extrinsic atmospheric compositions), comparisons show a striking resemblance in the types of damage produced and their yield functions. The potential of controlling this damage using molecular and nanoparticle targets with high LEE yields in targeted radiation-based cancer therapies is also discussed.

  17. Spatiotemporal characterization of ionizing radiation induced DNA damage foci and their relation to chromatin organization

    SciTech Connect

    Costes, Sylvain V; Chiolo, Irene; Pluth, Janice M.; Barcellos-Hoff, Mary Helen; Jakob, Burkhard

    2009-09-15

    DNA damage sensing proteins have been shown to localize to the sites of DSB within seconds to minutes following ionizing radiation (IR) exposure, resulting in the formation of microscopically visible nuclear domains referred to as radiation-induced foci (RIF). This review characterizes the spatio-temporal properties of RIF at physiological doses, minutes to hours following exposure to ionizing radiation, and it proposes a model describing RIF formation and resolution as a function of radiation quality and nuclear densities. Discussion is limited to RIF formed by three interrelated proteins ATM (Ataxia telangiectasia mutated), 53BP1 (p53 binding protein 1) and ?H2AX (phosphorylated variant histone H2AX). Early post-IR, we propose that RIF mark chromatin reorganization, leading to a local nuclear scaffold rigid enough to keep broken DNA from diffusing away, but open enough to allow the repair machinery. We review data indicating clear kinetic and physical differences between RIF emerging from dense and uncondensed regions of the nucleus. At later time post-IR, we propose that persistent RIF observed days following exposure to ionizing radiation are nuclear ?scars? marking permanent disruption of the chromatin architecture. When DNA damage is resolved, such chromatin modifications should not necessarily lead to growth arrest and it has been shown that persistent RIF can replicate during mitosis. Thus, heritable persistent RIF spanning over tens of Mbp may affect the transcriptome of a large progeny of cells. This opens the door for a non DNA mutation-based mechanism of radiation-induced phenotypes.

  18. Selective protection of zidovudine-induced DNA-damage by the antioxidants WR-1065 and tempol.

    PubMed

    Olivero, Ofelia A; Ongele, Michael O; Braun, Hannan M; Marrogi, Ariadna; Divi, Kathyiani; Mitchell, James B; Poirier, Miriam C

    2014-08-01

    The cytokinesis-block micronucleus cytome (CBMN) assay, introduced by Fenech, was used to demonstrate different types of DNA damage in MOLT-3 human lymphoblastoid cells exposed to 10 μM zidovudine (AZT). In addition, we explored the cytoprotective potential of two antioxidants, WR-1065 and Tempol, to decrease AZT-induced genotoxicity. Binucleated cells, arrested by Cytochalasin B (Cyt B), were evaluated for micronuclei (MN), caused by DNA damage or chromosomal loss, and chromatin nucleoplasmic bridges (NPBs), caused by telomere attrition. Additionally, nuclear buds (NBUDs), caused by amplified DNA, and apoptotic and necrotic (A/N) cells were scored. We hypothesized that AZT exposure would increase the frequency of genotoxic end points, and that the antioxidants Tempol and WR-1065 would protect against AZT-induced genotoxicity. MOLT-3 cells were exposed to 0 or 10 µM AZT for a total of 76 hr. After the first 24 hr, 0 or 5 µM WR-1065 and/or 0 or 200 µM Tempol were added for the remainder of the experiment. For the last 28 hr (of 76 hr), Cyt B was added to arrest replication after one cell division, leaving a predominance of binucleated cells. The nuclear division index (NDI) was similar for all treatment groups, indicating that the exposures did not alter cell viability. MOLT-3 cells exposed to AZT alone had significant (P < 0.05) increases in MN and NBs, compared to unexposed cells. Both Tempol and WR-1065 protected against AZT-induced MN formation (P < 0.003 for both), and WR-1065, but not Tempol, reduced the levels of A/N (P = 0.041). In cells exposed to AZT/Tempol there were significantly reduced levels of NBUDs, compared to cells exposed to AZT alone (P = 0.015). Cells exposed to AZT/WR-1065 showed reduced levels of NPBs, compared to cells exposed to AZT alone (P = 0.037). Thus WR-1065 and Tempol protected MOLT-3 cells against specific types of AZT-induced DNA damage.

  19. Oxidative damage of DNA induced by X-irradiation decreases the uterine endometrial receptivity which involves mitochondrial and lysosomal dysfunction

    PubMed Central

    Gao, Wei; Liang, Jin-Xiao; Liu, Shuai; Liu, Chang; Liu, Xiao-Fang; Wang, Xiao-Qi; Yan, Qiu

    2015-01-01

    X irradiation may lead to female infertility and the mechanism is still not clear. After X irradiation exposure, significantly morphological changes and functional decline in endometrial epithelial cells were observed. The mitochondrial and lysosomal dysfunction and oxidative DNA damage were noticed after X irradiation. In addition, pretreatment with NAC, NH4Cl or Pep A reduced the X irradiation induced damages. These studies demonstrate that the oxidative DNA damage which involved dysfunctional lysosomal and mitochondrial contribute to X irradiation-induced impaired receptive state of uterine endometrium and proper protective reagents can be helpful in improving endometrial function. PMID:26064230

  20. DDB2 association with PCNA is required for its degradation after UV-induced DNA damage.

    PubMed

    Cazzalini, Ornella; Perucca, Paola; Mocchi, Roberto; Sommatis, Sabrina; Prosperi, Ennio; Stivala, Lucia Anna

    2014-01-01

    DDB2 is a protein playing an essential role in the lesion recognition step of the global genome sub-pathway of nucleotide excision repair (GG-NER) process. Among the proteins involved in the DNA damage response, p21(CDKN1A) (p21) has been reported to participate in NER, but also to be removed by proteolytic degradation, thanks to its association with PCNA. DDB2 is involved in the CUL4-DDB1 complex mediating p21 degradation; however, the direct interaction between DDB2, p21 and PCNA has been never investigated. Here, we show that DDB2 co-localizes with PCNA and p21 at local UV-induced DNA-damage sites, and these proteins co-immunoprecipitate in the same complex. In addition, we provide evidence that p21 is not able to bind directly DDB2, but, to this end, the presence of PCNA is required. Direct physical association of recombinant DDB2 protein with PCNA is mediated by a conserved PIP-box present in the N-terminal region of DDB2. Mutation of the PIP-box resulted in the loss of protein interaction. Interestingly, the same mutation, or depletion of PCNA by RNA interference, greatly impaired DDB2 degradation induced by UV irradiation. These results indicate that DDB2 is a PCNA-binding protein, and that this association is required for DDB2 proteolytic degradation.

  1. Ellipticine induces apoptosis in T-cell lymphoma via oxidative DNA damage.

    PubMed

    Savorani, Cecilia; Manfé, Valentina; Biskup, Edyta; Gniadecki, Robert

    2015-03-01

    The tumor suppressor p53 is often mutated in human cancers. Restoring its antitumor activity has been shown to be a promising therapeutic approach for cancer treatment. Here we analyzed the activity and mechanism of a p53 reactivator, ellipticine, in a cellular model of cutaneous T-cell lymphoma (CTCL), a disease that is progressive, chemoresistant and refractory to treatment. We tested the effect of ellipticine in three cell lines with different p53 status: MyLa2000 (p53(wt/wt)), SeAx ((G245S)p53) and Hut-78 ((R196Stop)p53). Ellipticine caused apoptosis in MyLa2000 and SeAx and restored the transcriptional activity of (G245S)p53 in SeAx. However, p53 siRNA knockdown experiments revealed that p53 was not required for ellipticine-induced apoptosis in CTCL. The lipophilic antioxidant α-tocopherol inhibited ellipticine-dependent apoptosis and we linked the apoptotic response to the oxidative DNA damage. Our results provide evidence that ellipticine-induced apoptosis is exerted through DNA damage and does not require p53 activation in T-cell lymphoma.

  2. Effect of β-carotene on catechol-induced genotoxicity in vitro: evidence of both enhanced and reduced DNA damage.

    PubMed

    Åsgård, R; Hellman, B

    2013-09-01

    Intake of antioxidants from the diet has been recognized to have beneficial health effects, but the potential benefit of taking antioxidants such as β-carotene as supplements is controversial. The aim of the present study was to evaluate the potential protective effects of a physiologically relevant concentration (2 μM) of β-carotene on the DNA damaging effects of catechol in mouse lymphoma L5178Y cells. Two different exposure protocols were used: simultaneous exposure to β-carotene and catechol for 3 h; and exposure to catechol for 3 h after 18 h pre-treatment with the vitamin. DNA damage was evaluated using the comet assay (employing one procedure for general damage, and another procedure, which also included oxidative DNA damage). Independent of exposure protocol and procedure for comet assay, β-carotene did not increase the basal level of DNA damage. However, at the highest concentration of catechol (1 mM), β-carotene was found to clearly increase the level of catechol-induced DNA damage, especially in the pre-treated cells. Interestingly, an opposite effect was observed at lower concentrations of catechol, but the β-carotene related reduction of catechol-induced genotoxicity was significant (P < 0.05) only for the procedure including oxidative damage induced by 0.5 mM catechol. Taken together our results indicate that β- carotene can both reduce and enhance the DNA damaging effects of a genotoxic agent such as catechol. This indicates that it is the level of catechol-induced DNA damage that seems to determine whether β-carotene should be regarded as a beneficial or detrimental agent when it comes to its use as a dietary supplement.

  3. DNA-damage-induced differentiation of leukaemic cells as an anti-cancer barrier

    PubMed Central

    Santos, Margarida A.; Faryabi, Robert B.; Ergen, Aysegul V.; Day, Amanda M.; Malhowski, Amy; Canela, Andres; Onozawa, Masahiro; Lee, Ji-Eun; Callen, Elsa; Gutierrez-Martinez, Paula; Chen, Hua-Tang; Wong, Nancy; Finkel, Nadia; Deshpande, Aniruddha; Sharrow, Susan; Rossi, Derrick J.; Ito, Keisuke; Ge, Kai; Aplan, Peter D.; Armstrong, Scott A.; Nussenzweig, André

    2015-01-01

    Self-renewal is the hallmark feature both of normal stem cells and cancer stem cells1. Since the regenerative capacity of normal haematopoietic stem cells is limited by the accumulation of reactive oxygen species and DNA double-strand breaks2–4, we speculated that DNA damage might also constrain leukaemic self-renewal and malignant haematopoiesis. Here we show that the histone methyl-transferase MLL4, a suppressor of B-cell lymphoma5,6, is required for stem-cell activity and an aggressive form of acute myeloid leukaemia harbouring the MLL–AF9 oncogene. Deletion of MLL4 enhances myelopoiesis and myeloid differentiation of leukaemic blasts, which protects mice from death related to acute myeloid leukaemia. MLL4 exerts its function by regulating transcriptional programs associated with the antioxidant response. Addition of reactive oxygen species scavengers or ectopic expression of FOXO3 protects MLL4−/− MLL–AF9 cells from DNA damage and inhibits myeloid maturation. Similar to MLL4 deficiency, loss of ATM or BRCA1 sensitizes transformed cells to differentiation, suggesting that myeloid differentiation is promoted by loss of genome integrity. Indeed, we show that restriction-enzyme-induced double-strand breaks are sufficient to induce differentiation of MLL–AF9 blasts, which requires cyclin-dependent kinase inhibitor p21Cip1 (Cdkn1a) activity. In summary, we have uncovered an unexpected tumour-promoting role of genome guardians in enforcing the oncogene-induced differentiation blockade in acute myeloid leukaemia. PMID:25079327

  4. Low intensity microwave radiation induced oxidative stress, inflammatory response and DNA damage in rat brain.

    PubMed

    Megha, Kanu; Deshmukh, Pravin Suryakantrao; Banerjee, Basu Dev; Tripathi, Ashok Kumar; Ahmed, Rafat; Abegaonkar, Mahesh Pandurang

    2015-12-01

    Over the past decade people have been constantly exposed to microwave radiation mainly from wireless communication devices used in day to day life. Therefore, the concerns over potential adverse effects of microwave radiation on human health are increasing. Until now no study has been proposed to investigate the underlying causes of genotoxic effects induced by low intensity microwave exposure. Thus, the present study was undertaken to determine the influence of low intensity microwave radiation on oxidative stress, inflammatory response and DNA damage in rat brain. The study was carried out on 24 male Fischer 344 rats, randomly divided into four groups (n=6 in each group): group I consisted of sham exposed (control) rats, group II-IV consisted of rats exposed to microwave radiation at frequencies 900, 1800 and 2450 MHz, specific absorption rates (SARs) 0.59, 0.58 and 0.66 mW/kg, respectively in gigahertz transverse electromagnetic (GTEM) cell for 60 days (2h/day, 5 days/week). Rats were sacrificed and decapitated to isolate hippocampus at the end of the exposure duration. Low intensity microwave exposure resulted in a frequency dependent significant increase in oxidative stress markers viz. malondialdehyde (MDA), protein carbonyl (PCO) and catalase (CAT) in microwave exposed groups in comparison to sham exposed group (p<0.05). Whereas, levels of reduced glutathione (GSH) and superoxide dismutase (SOD) were found significantly decreased in microwave exposed groups (p<0.05). A significant increase in levels of pro-inflammatory cytokines (IL-2, IL-6, TNF-α, and IFN-γ) was observed in microwave exposed animal (p<0.05). Furthermore, significant DNA damage was also observed in microwave exposed groups as compared to their corresponding values in sham exposed group (p<0.05). In conclusion, the present study suggests that low intensity microwave radiation induces oxidative stress, inflammatory response and DNA damage in brain by exerting a frequency dependent effect

  5. In vivo antigenotoxic activity of watercress juice (Nasturtium officinale) against induced DNA damage.

    PubMed

    Casanova, Natalia A; Ariagno, Julia I; López Nigro, Marcela M; Mendeluk, Gabriela R; de los A Gette, María; Petenatti, Elisa; Palaoro, Luis A; Carballo, Marta A

    2013-09-01

    The present study was carried out to investigate the genotoxicity as well as possible protective activity against damage induced by cyclophosphamide (CP) of the aqueous juice of watercress (Nasturtium officinale, W.T. Aiton) in vivo. Male and female Swiss mice 7-8 weeks old (N = 48) were treated by gavage with 1 g kg(-1) body weight and 0.5 g kg(-1) body weight of watercress juice during 15 consecutive days. Genotoxicity and its possible protective effect were tested by the comet assay in peripheral blood cells and the micronucleus test in bone marrow. In addition, biopsies of the bladder, epididymis and testicles of mice were performed to extend the experimental design. Watercress juice per se did not induce genetic damage according to the comet assay and micronucleus study, exhibiting a protective activity against CP (P < 0.05 and P < 0.001, respectively). The comparative analysis of bladder histological changes obtained in the watercress plus CP group against those treated with CP alone suggests a probable protective effect. Further studies are needed in order to establish the protective role of watercress juice against DNA damage.

  6. Molecular Analysis of Base Damage Clustering Associated with a Site-Specific Radiation-Induced DNA Double-Strand Break

    PubMed Central

    Datta, Kamal; Jaruga, Pawel; Dizdaroglu, Miral; Neumann, Ronald D.; Winters, Thomas A.

    2010-01-01

    Base damage flanking a radiation-induced DNA double-strand break (DSB) may contribute to DSB complexity and affect break repair. However, to date, an isolated radiation-induced DSB has not been assessed for such structures at the molecular level. In this study, an authentic site-specific radiation-induced DSB was produced in plasmid DNA by triplex forming oligonucleotide-targeted 125I decay. A restriction fragment terminated by the DSB was isolated and probed for base damage with the E. coli DNA repair enzymes, endonuclease III and formamidopyrimidine-DNA glycosylase. Our results demonstrate base damage clustering within 8 bases of the 125I-targeted base in the DNA duplex. An increased yield of base damage (purine>pyrimidine) was observed for DSBs formed by irradiation in the absence of DMSO. An internal control fragment 1354 bp upstream from the targeted base was insensitive to enzymatic probing, indicating the damage detected proximal to the DSB was produced by the 125I decay that formed the DSB. Gas chromatography-mass spectrometry identified three types of damaged bases in the ~32 bp region proximal to the DSB. These base lesions were 8-hydroxyguanine, 8-hydroxyadenine, and 5-hydroxycytosine. Finally, evidence is presented for base damage >24 bp upstream from the 125I-decay site that may form via a charge migration mechanism. PMID:17067210

  7. Emodin, aloe-emodin and rhein induced DNA damage and inhibited DNA repair gene expression in SCC-4 human tongue cancer cells.

    PubMed

    Chen, Ya-Yin; Chiang, Su-Yin; Lin, Jaung-Geng; Yang, Jai-Sing; Ma, Yi-Shih; Liao, Ching-Lung; Lai, Tung-Yuan; Tang, Nou-Ying; Chung, Jing-Gung

    2010-03-01

    In our primary studies, we have shown that emodin, aloe-emodin and rhein induced cytotoxic effects, including cell cycle arrest and apoptosis in SCC-4 human tongue cancer cells. However, details regarding their effects on DNA damage and repair gene expression in SCC-4 cells are not clear. We investigated whether or not emodin, aloe-emodin and rhein induced DNA damage and inhibited DNA repair gene expression in SCC-4 cells. Comet assay (single cell electrophoresis) indicated that incubation of SCC-4 cells with 0, 20, 30 and 40 microM of emodin, 0, 25, 50 and 100 microM of aloe-emodin or rhein led to a longer DNA migration smear (comet tail). This means that all examined agents induced DNA damage in SCC-4 cells and these effects are dose-dependent but emodin is stronger than that of aloe-emodin or rhein. The results from real-time PCR assay demonstrated that 30 microM of emodin or aloe-emodin used for 24 and 48 h treatment in SCC-4 cells significantly inhibited expression of genes associated with DNA damage and repair [ataxia telangiectasia mutated (ATM); ataxia-telangiectasia and Rad3-related (ATR); 14-3-3sigma (14-3-3sigma); breast cancer 1, early onset (BRCA1); and DNA-dependent serine/threonine protein kinase (DNA-PK)]; only rhein suppressed the expression of O(6)-methylguanine-DNA methyltransferase (MGMT) mRNA with 48 h treatment, but had no effect on ATM expression. On 24 h treatment, only aloe-emodin significantly affected ATM expression. These effects may be the vital factors for emodin, aloe-emodin and rhein induction of DNA damage in vitro. In conclusion, these agents induced DNA damage followed by the inhibition of DNA repair-associated gene expressions, including ATM, ATR, 14-3-3sigma, BRCA1, DNA-PK and MGMT in SCC-4 human tongue cancer cells.

  8. Cell cycle-dependent DNA damage signaling induced by ICRF-193 involves ATM, ATR, CHK2, and BRCA1

    SciTech Connect

    Park, Iha; Avraham, Hava Karsenty . E-mail: havraham@bidmc.harvard.edu

    2006-07-01

    Topoisomerase II is essential for cell proliferation and survival and has been a target of various anticancer drugs. ICRF-193 has long been used as a catalytic inhibitor to study the function of topoisomerase II. Here, we show that ICRF-193 treatment induces DNA damage signaling. Treatment with ICRF-193 induced G2 arrest and DNA damage signaling involving {gamma}-H2AX foci formation and CHK2 phosphorylation. DNA damage by ICRF-193 was further demonstrated by formation of the nuclear foci of 53BP1, NBS1, BRCA1, MDC1, and FANCD2 and increased comet tail moment. The DNA damage signaling induced by ICRF-193 was mediated by ATM and ATR and was restricted to cells in specific cell cycle stages such as S, G2, and mitosis including late and early G1 phases. Downstream signaling of ATM and ATR involved the phosphorylation of CHK2 and BRCA1. Altogether, our results demonstrate that ICRF-193 induces DNA damage signaling in a cell cycle-dependent manner and suggest that topoisomerase II might be essential for the progression of the cell cycle at several stages including DNA decondensation.

  9. 3,3'-Dihydroxyisorenieratene and isorenieratene prevent UV-induced DNA damage in human skin fibroblasts.

    PubMed

    Wagener, Sarah; Völker, Tanja; De Spirt, Silke; Ernst, Hansgeorg; Stahl, Wilhelm

    2012-08-01

    Skin cancer is among the most frequent neoplastic malignancies and exposure to UV irradiation is a major risk factor. In addition to topical sunscreens, photoprotection by dietary antioxidants such as carotenoids or polyphenols has been suggested as a means of prevention. Isorenieratene (IR) and dihydroxyisorenieratene (DHIR) are aromatic carotenoids with particular antioxidant properties produced by Brevibacterium linens. The aim of this study was to investigate the photoprotective and antioxidant activities of DHIR and IR in comparison to the nonaromatic carotenoid lutein in human dermal fibroblasts. Incubation of the cells with DHIR and IR significantly decreased the UV-induced formation of cyclobutane pyrimidine dimers and formation of DNA strand breaks. Lipid oxidation was lowered as determined by the formation of malondialdehyde as a biomarker. Both aromatic carotenoids also prevented oxidatively generated damage to DNA as demonstrated by a decrease in DNA strand breaks associated with the formation of oxidized DNA bases. These data highlight the multifunctional photoprotective properties of aromatic carotenoids, which may be suitable natural compounds for the prevention of skin cancer.

  10. Nuclear localization of Beclin 1 promotes radiation-induced DNA damage repair independent of autophagy

    PubMed Central

    Xu, Fei; Fang, Yixuan; Yan, Lili; Xu, Lan; Zhang, Suping; Cao, Yan; Xu, Li; Zhang, Xiaoying; Xie, Jialing; Jiang, Gaoyue; Ge, Chaorong; An, Ni; Zhou, Daohong; Yuan, Na; Wang, Jianrong

    2017-01-01

    Beclin 1 is a well-established core mammalian autophagy protein that is embryonically indispensable and has been presumed to suppress oncogenesis via an autophagy-mediated mechanism. Here, we show that Beclin 1 is a prenatal primary cytoplasmic protein but rapidly relocated into the nucleus during postnatal development in mice. Surprisingly, deletion of beclin1 in in vitro human cells did not block an autophagy response, but attenuated the expression of several DNA double-strand break (DSB) repair proteins and formation of repair complexes, and reduced an ability to repair DNA in the cells exposed to ionizing radiation (IR). Overexpressing Beclin 1 improved the repair of IR-induced DSB, but did not restore an autophagy response in cells lacking autophagy gene Atg7, suggesting that Beclin 1 may regulate DSB repair independent of autophagy in the cells exposed to IR. Indeed, we found that Beclin 1 could directly interact with DNA topoisomerase IIβ and was recruited to the DSB sites by the interaction. These findings reveal a novel function of Beclin 1 in regulation of DNA damage repair independent of its role in autophagy particularly when the cells are under radiation insult. PMID:28345663

  11. Nuclear localization of Beclin 1 promotes radiation-induced DNA damage repair independent of autophagy.

    PubMed

    Xu, Fei; Fang, Yixuan; Yan, Lili; Xu, Lan; Zhang, Suping; Cao, Yan; Xu, Li; Zhang, Xiaoying; Xie, Jialing; Jiang, Gaoyue; Ge, Chaorong; An, Ni; Zhou, Daohong; Yuan, Na; Wang, Jianrong

    2017-03-27

    Beclin 1 is a well-established core mammalian autophagy protein that is embryonically indispensable and has been presumed to suppress oncogenesis via an autophagy-mediated mechanism. Here, we show that Beclin 1 is a prenatal primary cytoplasmic protein but rapidly relocated into the nucleus during postnatal development in mice. Surprisingly, deletion of beclin1 in in vitro human cells did not block an autophagy response, but attenuated the expression of several DNA double-strand break (DSB) repair proteins and formation of repair complexes, and reduced an ability to repair DNA in the cells exposed to ionizing radiation (IR). Overexpressing Beclin 1 improved the repair of IR-induced DSB, but did not restore an autophagy response in cells lacking autophagy gene Atg7, suggesting that Beclin 1 may regulate DSB repair independent of autophagy in the cells exposed to IR. Indeed, we found that Beclin 1 could directly interact with DNA topoisomerase IIβ and was recruited to the DSB sites by the interaction. These findings reveal a novel function of Beclin 1 in regulation of DNA damage repair independent of its role in autophagy particularly when the cells are under radiation insult.

  12. Mitochondria-targeted Ogg1 and aconitase-2 prevent oxidant-induced mitochondrial DNA damage in alveolar epithelial cells.

    PubMed

    Kim, Seok-Jo; Cheresh, Paul; Williams, David; Cheng, Yuan; Ridge, Karen; Schumacker, Paul T; Weitzman, Sigmund; Bohr, Vilhelm A; Kamp, David W

    2014-02-28

    Mitochondria-targeted human 8-oxoguanine DNA glycosylase (mt-hOgg1) and aconitase-2 (Aco-2) each reduce oxidant-induced alveolar epithelial cell (AEC) apoptosis, but it is unclear whether protection occurs by preventing AEC mitochondrial DNA (mtDNA) damage. Using quantitative PCR-based measurements of mitochondrial and nuclear DNA damage, mtDNA damage was preferentially noted in AEC after exposure to oxidative stress (e.g. amosite asbestos (5-25 μg/cm(2)) or H2O2 (100-250 μM)) for 24 h. Overexpression of wild-type mt-hOgg1 or mt-long α/β 317-323 hOgg1 mutant incapable of DNA repair (mt-hOgg1-Mut) each blocked A549 cell oxidant-induced mtDNA damage, mitochondrial p53 translocation, and intrinsic apoptosis as assessed by DNA fragmentation and cleaved caspase-9. In contrast, compared with controls, knockdown of Ogg1 (using Ogg1 shRNA in A549 cells or primary alveolar type 2 cells from ogg1(-/-) mice) augmented mtDNA lesions and intrinsic apoptosis at base line, and these effects were increased further after exposure to oxidative stress. Notably, overexpression of Aco-2 reduced oxidant-induced mtDNA lesions, mitochondrial p53 translocation, and apoptosis, whereas siRNA for Aco-2 (siAco-2) enhanced mtDNA damage, mitochondrial p53 translocation, and apoptosis. Finally, siAco-2 attenuated the protective effects of mt-hOgg1-Mut but not wild-type mt-hOgg1 against oxidant-induced mtDNA damage and apoptosis. Collectively, these data demonstrate a novel role for mt-hOgg1 and Aco-2 in preserving AEC mtDNA integrity, thereby preventing oxidant-induced mitochondrial dysfunction, p53 mitochondrial translocation, and intrinsic apoptosis. Furthermore, mt-hOgg1 chaperoning of Aco-2 in preventing oxidant-mediated mtDNA damage and apoptosis may afford an innovative target for the molecular events underlying oxidant-induced toxicity.

  13. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.

    PubMed

    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke

    2014-07-01

    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles.

  14. Kinetics of the UV-induced DNA damage response in relation to cell cycle phase. Correlation with DNA replication

    PubMed Central

    Zhao, Hong; Traganos, Frank; Darzynkiewicz, Zbigniew

    2010-01-01

    It has been reported that exposure to UV light triggers DNA damage response (DDR) seen as induction of γH2AX not only in S- but also in G1- phase cells. In the present study, in addition to γH2AX, we assessed other markers of DDR, namely phosphorylation of ATM on Ser1981, of ATM/ATR substrate on Ser/Thr at SQ/TQ cluster domains and of the tumor suppressor p53 on Ser15, in human pulmonary carcinoma A549 cells irradiated with 50 J/m2 of UV-B. Phosphorylation of these proteins detected with phospho-specific Abs and measured by laser scanning cytometry in relation the cell cycle phase was found to be selective to S-phase cells. The kinetics of phosphorylation of ATM was strikingly similar to that of ATM/ATR substrate, peaking at 30 min after UV irradiation and followed by rapid dephosphorylation. The peak of H2AX phosphorylation was seen at 2 h and the peak of p53 phosphorylation at 4 h after exposure to UV light. Local high spatial density of these phospho-proteins reported by intensity of maximal pixel of immunofluorescence in the DDR nuclear foci was distinctly more pronounced in the early compared to late portion of S-phase. Exposure of cells to UV following 1 h pulse-labeling of their DNA with 5-ethynyl-2′deoxyuridine (EdU) made it possible to correlate the extent of DNA replication during the pulse with the extent of the UV-induced H2AX phosphorylation within the same cells. This correlation was very strong (R2= 0.98) and the cells that did not incorporate EdU showed no evidence of H2AX phosphorylation. The data are consistent with the mechanism in which stalling of DNA replication forks upon collision with the primary UV-induced DNA lesions and likely formation of double-strand DNA breaks triggers DDR. The prior reports (including our own) on induction of γH2AX in G1 cells by UV may have erroneously identified cells initiating DNA replication following UV exposure as G1 cells due to the fact that their DNA content did not significantly differ from that of G

  15. Therapeutic effect of green tea extract on alcohol induced hepatic mitochondrial DNA damage in albino wistar rats.

    PubMed

    Reddyvari, Hymavathi; Govatati, Suresh; Matha, Sumanth Kumar; Korla, Swapna Vahini; Malempati, Sravanthi; Pasupuleti, Sreenivasa Rao; Bhanoori, Manjula; Nallanchakravarthula, Varadacharyulu

    2017-05-01

    The present study principally sought to investigate the effect of green tea extract (GTE) supplementation on hepatic mitochondrial DNA (mtDNA) damage in alcohol receiving rats. MtDNA was isolated from hepatic tissues of albino wistar rats after alcohol treatment with and without GTE supplementation. Entire displacement loop (D-loop) of mtDNA was screened by PCR-Sanger's sequencing method. In addition, mtDNA deletions and antioxidant activity were measured in hepatic tissue of all rats. Results showed increased frequency of D-loop mutations in alcoholic rats (ALC). DNA mfold analysis predicted higher free energy for 15507C and 16116C alleles compared to their corresponding wild alleles which represents less stable secondary structures with negative impact on overall mtDNA function. Interestingly, D-loop mutations observed in ALC rats were successfully restored on GTE supplementation. MtDNA deletions were observed in ALC rats, but intact native mtDNA was found in ALC + GTE group suggesting alcohol induced oxidative damage of mtDNA and ameliorative effect of GTE. Furthermore, markedly decreased activities of glutathione peroxidise, superoxide dismutase, catalase and glutathione content were identified in ALC rats; however, GTE supplementation significantly (P < 0.05) restored these levels close to normal. In conclusion, green tea could be used as an effective nutraceutical against alcohol induced mitochondrial DNA damage.

  16. Critical role for IL-1β in DNA damage-induced mucositis

    PubMed Central

    Kanarek, Naama; Grivennikov, Sergei I.; Leshets, Michael; Lasry, Audrey; Alkalay, Irit; Horwitz, Elad; Shaul, Yoav D.; Stachler, Matthew; Voronov, Elena; Apte, Ron N.; Pagano, Michele; Pikarsky, Eli; Karin, Michael; Ghosh, Sankar; Ben-Neriah, Yinon

    2014-01-01

    β-TrCP, the substrate recognition subunit of SCF-type ubiquitin ligases, is ubiquitously expressed from two distinct paralogs, targeting for degradation many regulatory proteins, among which is the NF-κB inhibitor IκB. To appreciate tissue-specific roles of β-TrCP, we studied the consequences of inducible ablation of three or all four alleles of the E3 in the mouse gut. The ablation resulted in mucositis, a destructive gut mucosal inflammation, which is a common complication of different cancer therapies and represents a major obstacle to successful chemoradiation therapy. We identified epithelial-derived IL-1β as the culprit of mucositis onset, inducing mucosal barrier breach. Surprisingly, epithelial IL-1β is induced by DNA damage via an NF-κB–independent mechanism. Tissue damage caused by gut barrier disruption is exacerbated in the absence of NF-κB, with failure to express the endogenous IL-1β receptor antagonist IL-1Ra upon four-allele loss. Antibody neutralization of IL-1β prevents epithelial tight junction dysfunction and alleviates mucositis in β-TrCP–deficient mice. IL-1β antagonists should thus be considered for prevention and treatment of severe morbidity associated with mucositis. PMID:24469832

  17. Protein kinase Cη activates NF-κB in response to camptothecin-induced DNA damage.

    PubMed

    Raveh-Amit, Hadas; Hai, Naama; Rotem-Dai, Noa; Shahaf, Galit; Gopas, Jacob; Livneh, Etta

    2011-08-26

    The nuclear factor κB (NF-κB) family of transcription factors participates in the regulation of genes involved in innate- and adaptive-immune responses, cell death and inflammation. The involvement of the Protein kinase C (PKC) family in the regulation of NF-κB in inflammation and immune-related signaling has been extensively studied. However, not much is known on the role of PKC in NF-κB regulation in response to DNA damage. Here we demonstrate for the first time that PKC-eta (PKCη) regulates NF-κB upstream signaling by activating the IκB kinase (IKK) and the degradation of IκB. Furthermore, PKCη enhances the nuclear translocation and transactivation of NF-κB under non-stressed conditions and in response to the anticancer drug camptothecin. We and others have previously shown that PKCη confers protection against DNA damage-induced apoptosis. Our present study suggests that PKCη is involved in NF-κB signaling leading to drug resistance.

  18. Protective effect of cyanidin against glucose- and methylglyoxal-induced protein glycation and oxidative DNA damage.

    PubMed

    Suantawee, Tanyawan; Cheng, Henrique; Adisakwattana, Sirichai

    2016-12-01

    Cyanidin, a natural anthocyanin abundant in fruits and vegetables, has shown the health benefits due to its pharmacological properties. However, there was no evidence regarding anti-glycation activity of cyanidin. The aim of the study was to investigate the inhibitory effect of cyanidin on methylglyoxal (MG)- and glucose-induced protein glycation in bovine serum albumin (BSA) as well as oxidative DNA damage. Free radical scavenging activity and the MG-trapping ability of cyanidin were also investigated. The results demonstrated that cyanidin (0.125-1mM) significantly inhibited the formation of fluorescent and non-fluorescent AGEs in BSA/MG and BSA/glucose systems. There was a significantly improved protein thiol in BSA/MG and BSA/glucose when incubated with cyanidin. Correspondingly, cyanidin decreased the level of protein carbonyl content in BSA/glucose system. Moreover, cyanidin (0.5-1mM) prevented lysine/MG-mediated oxidative DNA damage in the absence or presence of copper ion. The results demonstrated that cyanidin showed the MG-trapping ability in a concentration-dependent manner. Cyanidin also reduced superoxide anion and hydroxyl radical generation in lysine/MG system. The mechanism by which cyanidin inhibited protein glycation was the MG-trapping ability and the free radical scavenging activity. The present study suggests that cyanidin might be a promising antiglycation agent for preventing or ameliorating AGEs-mediated diabetic complications.

  19. Intracellular accumulation of indium ions released from nanoparticles induces oxidative stress, proinflammatory response and DNA damage.

    PubMed

    Tabei, Yosuke; Sonoda, Akinari; Nakajima, Yoshihiro; Biju, Vasudevanpillai; Makita, Yoji; Yoshida, Yasukazu; Horie, Masanori

    2016-02-01

    Due to the widespread use of indium tin oxide (ITO), it is important to investigate its effect on human health. In this study, we evaluated the cellular effects of ITO nanoparticles (NPs), indium chloride (InCl3) and tin chloride (SnCl3) using human lung epithelial A549 cells. Transmission electron microscopy and inductively coupled plasma mass spectrometry were employed to study cellular ITO NP uptake. Interestingly, greater uptake of ITO NPs was observed, as compared with soluble salts. ITO NP species released could be divided into two types: 'indium release ITO' or 'tin release ITO'. We incubated A549 cells with indium release ITO, tin release ITO, InCl3 or SnCl2 and investigated oxidative stress, proinflammatory response, cytotoxicity and DNA damage. We found that intracellular reactive oxygen species were increased in cells incubated with indium release ITO, but not tin release ITO, InCl3 or SnCl2. Messenger RNA and protein levels of the inflammatory marker, interleukin-8, also increased following exposure to indium release ITO. Furthermore, the alkaline comet assay revealed that intracellular accumulation of indium ions induced DNA damage. Our results demonstrate that the accumulation of ionic indium, but not ionic tin, from ITO NPs in the intracellular matrix has extensive cellular effects.

  20. SIRT6 Depletion Suppresses Tumor Growth by Promoting Cellular Senescence Induced by DNA Damage in HCC

    PubMed Central

    Lee, Namgyu; Ryu, Hye Guk; Kwon, Jung-Hee; Kim, Dae-Kyum; Kim, Sae Rom; Wang, Hee Jung; Kim, Kyong-Tai; Choi, Kwan Yong

    2016-01-01

    The role of Sirtuin 6 (SIRT6) as a tumor suppressor or oncogene in liver cancer remains controversial. Thus, we identified the specific role of SIRT6 in the progression of hepatocellular carcinoma (HCC). SIRT6 expression was significantly higher in HCC cell lines and HCC tissues from 138 patients than in an immortalized hepatocyte cell line, THLE-2 and non-tumor tissues, respectively. SIRT6 knockdown by shRNA suppressed the growth of HCC cells and inhibited HCC tumor growth in vivo. In addition, SIRT6 silencing significantly prevented the growth of HCC cell lines by inducing cellular senescence in the p16/Rb- and p53/p21-pathway independent manners. Microarray analysis revealed that the expression of genes involved in nucleosome assembly was apparently altered in SIRT6-depleted Hep3B cells. SIRT6 knockdown promoted G2/M phase arrest and downregulation of genes encoding histone variants associated with nucleosome assembly, which could be attributed to DNA damage. Taken together, our findings suggest that SIRT6 acts as a tumor promoter by preventing DNA damage and cellular senescence, indicating that SIRT6 represents a potential therapeutic target for the treatment of HCC. PMID:27824900

  1. Intracellular accumulation of indium ions released from nanoparticles induces oxidative stress, proinflammatory response and DNA damage

    PubMed Central

    Tabei, Yosuke; Sonoda, Akinari; Nakajima, Yoshihiro; Biju, Vasudevanpillai; Makita, Yoji; Yoshida, Yasukazu; Horie, Masanori

    2016-01-01

    Due to the widespread use of indium tin oxide (ITO), it is important to investigate its effect on human health. In this study, we evaluated the cellular effects of ITO nanoparticles (NPs), indium chloride (InCl3) and tin chloride (SnCl3) using human lung epithelial A549 cells. Transmission electron microscopy and inductively coupled plasma mass spectrometry were employed to study cellular ITO NP uptake. Interestingly, greater uptake of ITO NPs was observed, as compared with soluble salts. ITO NP species released could be divided into two types: ‘indium release ITO’ or ‘tin release ITO’. We incubated A549 cells with indium release ITO, tin release ITO, InCl3 or SnCl2 and investigated oxidative stress, proinflammatory response, cytotoxicity and DNA damage. We found that intracellular reactive oxygen species were increased in cells incubated with indium release ITO, but not tin release ITO, InCl3 or SnCl2. Messenger RNA and protein levels of the inflammatory marker, interleukin-8, also increased following exposure to indium release ITO. Furthermore, the alkaline comet assay revealed that intracellular accumulation of indium ions induced DNA damage. Our results demonstrate that the accumulation of ionic indium, but not ionic tin, from ITO NPs in the intracellular matrix has extensive cellular effects. PMID:26378248

  2. DNA damage induces N-acetyltransferase NAT10 gene expression through transcriptional activation.

    PubMed

    Liu, Haijing; Ling, Yun; Gong, Yilei; Sun, Ying; Hou, Lin; Zhang, Bo

    2007-06-01

    NAT10 (N-acetyltransferase 10) is a protein with histone acetylation activity and primarily identified to be involved in regulation of telomerase activity. The presented research shows its transcriptional activation by genotoxic agents and possible role in DNA damage. NAT10 mRNA could be markedly increased by using hydrogen peroxide (H2O2) or cisplatin in a dose- and time-dependent way, and the immunofluorescent staining revealed that the treatment of H2O2 or cisplatin induced focal accumulation of NAT10 protein in cellular nuclei. Both H2O2 and cisplatin could stimulate the transcriptional activity of the NAT10 promoter through the upstream sequences from -615 bp to +110 bp, with which some nuclear proteins interacted. Ectopic expression of NAT10 could enhance the number of survival cells in the presence of H2O2 or cisplatin. The above results suggested that NAT10 could be involved in DNA damage response and increased cellular resistance to genotoxicity.

  3. Age-dependent oxidative stress-induced DNA damage in Down's lymphocytes

    SciTech Connect

    Zana, Marianna . E-mail: mzana@freemail.hu; Szecsenyi, Anita; Czibula, Agnes; Bjelik, Annamaria; Juhasz, Anna; Rimanoczy, Agnes; Vetro, Agnes; Pakaski, Magdolna; Janka, Zoltan; Kalman, Janos; Szabo, Krisztina; Szucs, Peter; Varkonyi, Agnes; Boda, Krisztina; Rasko, Istvan

    2006-06-30

    The aim of the present study was to investigate the oxidative status of lymphocytes from children (n = 7) and adults (n = 18) with Down's syndrome (DS). The basal oxidative condition, the vulnerability to in vitro hydrogen peroxide exposure, and the repair capacity were measured by means of the damage-specific alkaline comet assay. Significantly and age-independently elevated numbers of single strand breaks and oxidized bases (pyrimidines and purines) were found in the nuclear DNA of the lymphocytes in the DS group in the basal condition. These results may support the role of an increased level of endogenous oxidative stress in DS and are similar to those previously demonstrated in Alzheimer's disease. In the in vitro oxidative stress-induced state, a markedly higher extent of DNA damage was observed in DS children as compared with age- and gender-matched healthy controls, suggesting that young trisomic lymphocytes are more sensitive to oxidative stress than normal ones. However, the repair ability itself was not found to be deteriorated in either DS children or DS adults.

  4. Role of inducible nitrogen oxide synthase in benzene-induced oxidative DNA damage in the bone marrow of mice.

    PubMed

    Vestergaard, Sys; Loft, Steffen; Møller, Peter

    2002-03-01

    We investigated the interaction of BZ and lipolysaccharide (LPS), a well-known inflammation-promoting agent, in wild-type and inducible nitrogen oxide synthase (iNOS) knockout mice. BZ generated DNA strand breaks (SB) in the liver of both wild-type and iNOS-deficient mice. In the bone marrow (BM) BZ and LPS generated SB only in wild-type mice. The effects were additive, suggesting that both a redox cycling and an iNOS-dependent pathway may be involved. Formamidopyrimidine DNA glycosylase sensitive sites were elevated by BZ in the BM in both types of mice, whereas endonuclease III sensitive sites were not affected by any treatment. Since BZ is associated with leukemia in humans, it suggests that oxidative DNA base damage rather than SB may be important in the development of leukemia.

  5. Evaluation of DNA damage and antioxidant system induced by di-n-butyl phthalates exposure in earthworms (Eisenia fetida).

    PubMed

    Du, Li; Li, Guangde; Liu, Mingming; Li, Yanqiang; Yin, Suzhen; Zhao, Jie; Zhang, Xinyi

    2015-05-01

    Di-n-butyl phthalates (DBP) are recognized as ubiquitous contaminants in soil and adversely impact the health of organisms. The effect of DBP on the activity of antioxidant enzymes (superoxide dismutase, SOD; catalase, CAT), malondialdehyde (MDA) content and DNA damage were used as biomarkers to analyze the relationship between DNA damage and oxidative stress and to evaluate the genotoxic effect of DBP on earthworms (Eisenia fetida). DBP was added to artificial soil in the amounts of 0, 5, 10, 50 and 100mg per kg of soil. Earthworm tissues exposed to each treatment were collected on the 7th, 14th, 21st, and 28th day of the treatment. The results showed that SOD and CAT levels were significantly inhibited in the 100mgkg(-1) treatment group on day 28. MDA content in treatment groups was higher than in the control group throughout the exposure time, suggesting that DBP may lead to oxidative stress in cells. A dose-response relationship existed between DNA damage and total soil DBP levels. The comet assay showed that increasing concentrations of DBP resulted in a gradual increase in the OTM, Comet Tail Length and Tail DNA %. The degree of DNA damage was increased with increasing concentration of DBP. These results suggested that DBP induced serious oxidative damage on earthworms and induced the formation of reactive oxygen species (ROS) in earthworms. The excessive generation of ROS caused damage to vital macromolecules including lipids and DNA. DBP in the soils were responsible for the exerting genotoxic effects on earthworms.

  6. Effects of motexafin gadolinium on DNA damage and X-ray-induced DNA damage repair, as assessed by the Comet assay

    SciTech Connect

    Donnelly, Erling T.; Liu Yanfeng; Paul, Tracy K.; Rockwell, Sara . E-mail: sara.rockwell@yale.edu

    2005-07-15

    Purpose: To investigate the effects of motexafin gadolinium (MGd) on the levels of reactive oxygen species (ROS), glutathione (GSH), and DNA damage in EMT6 mouse mammary carcinoma cells. The ability of MGd to alter radiosensitivity and to inhibit DNA damage repair after X-ray irradiation was also evaluated. Methods and Materials: Reactive oxygen species and GSH levels were assessed by 2,7-dichlorofluorescein fluorescence flow cytometry and the Tietze method, respectively. Cellular radiosensitivity was assessed by clonogenic assays. Deoxyribonucleic acid damage and DNA damage repair were assessed in plateau-phase EMT6 cells by the Comet assay and clonogenic assays. Results: Cells treated with 100 {mu}mol/L MGd plus equimolar ascorbic acid (AA) had significantly increased levels of ROS and a 58.9% {+-} 3.4% decrease in GSH levels, relative to controls. Motexafin gadolinium plus AA treatment increased the hypoxic, but not the aerobic, radiosensitivity of EMT6 cells. There were increased levels of single-strand breaks in cells treated with 100 {mu}mol/L MGd plus equimolar AA, as evidenced by changes in the alkaline tail moment (MGd + AA, 6 h: 14.7 {+-} 1.8; control: 2.8 {+-} 0.9). The level of single-strand breaks was dependent on the length of treatment. Motexafin gadolinium plus AA did not increase double-strand breaks. The repair of single-strand breaks at 2 h, but not at 4 h and 6 h, after irradiation was altered significantly in cells treated with MGd plus AA (MGd + AA, 2 h: 15.8 {+-} 3.4; control: 5.8 {+-} 0.6). Motexafin gadolinium did not alter the repair of double-strand breaks at any time after irradiation with 10 Gy. Conclusions: Motexafin gadolinium plus AA generated ROS, which in turn altered GSH homeostasis and induced DNA strand breaks. The MGd plus AA-mediated alteration of GSH levels increased the hypoxic, but not aerobic, radiosensitivity of EMT6 cells. Motexafin gadolinium altered the kinetics of single-strand break repair soon after irradiation but

  7. DNA damage in oral cancer and normal cells induced by nitrogen atmospheric pressure plasma jets

    NASA Astrophysics Data System (ADS)

    Han, Xu; Kapaldo, James; Liu, Yueying; Stack, M. Sharon; Ptasinska, Sylwia

    2015-09-01

    Nitrogen atmospheric pressure plasma jets (APPJs) have been shown to effectively induce DNA double strand breaks in SCC25 oral cancer cells. The APPJ source constructed in our laboratory operates based on dielectric barrier discharge. It consists of two copper electrodes alternatively wrapping around a fused silica tube with nitrogen as a feed gas. It is generally more challenging to ignite plasma in N2 atmosphere than in noble gases. However, N2 provides additional advantages such as lower costs compared to noble gases, thus this design can be beneficial for the future long-term clinical use. To compare the effects of plasma on cancer cells (SCC25) and normal cells (OKF), the cells from both types were treated at the same experimental condition for various treatment times. The effective area with different damage levels after the treatment was visualized as 3D maps. The delayed damage effects were also explored by varying the incubation times after the treatment. All of these studies are critical for a better understanding of the damage responses of cellular systems exposed to the plasma radiation, thus are useful for the development of the advanced plasma cancer therapy. The research described herein was supported by the Division of Chemical Sciences, Geosciences and Biosciences, Basic Energy Sciences, Office of Science, United States Department of Energy through Grant No. DE-FC02-04ER15533.

  8. Role of AtMSH7 in UV-B-induced DNA damage recognition and recombination.

    PubMed

    Lario, Luciana Daniela; Botta, Pablo; Casati, Paula; Spampinato, Claudia Patricia

    2015-06-01

    The mismatch repair (MMR) system maintains genome integrity by correcting replication-associated errors and inhibiting recombination between divergent DNA sequences. The basic features of the pathway have been highly conserved throughout evolution, although the nature and number of the proteins involved in this DNA repair system vary among organisms. Plants have an extra mismatch recognition protein, MutSγ, which is a heterodimer: MSH2-MSH7. To further understand the role of MSH7 in vivo, we present data from this protein in Arabidopsis thaliana. First, we generated transgenic plants that express β-glucuronidase (GUS) under the control of the MSH7 promoter. Histochemical staining of the transgenic plants indicated that MSH7 is preferentially expressed in proliferating tissues. Then, we identified msh7 T-DNA insertion mutants. Plants deficient in MSH7 show increased levels of UV-B-induced cyclobutane pyrimidine dimers relative to wild-type (WT) plants. Consistent with the patterns of MSH7 expression, we next analysed the role of the protein during somatic and meiotic recombination. The frequency of somatic recombination between homologous or homeologous repeats (divergence level of 1.6%) was monitored using a previously described GUS recombination reporter assay. Disruption of MSH7 has no effect on the rates of somatic homologous or homeologous recombination under control conditions or after UV-B exposure. However, the rate of meiotic recombination between two genetically linked seed-specific fluorescent markers was 97% higher in msh7 than in WT plants. Taken together, these results suggest that MSH7 is involved in UV-B-induced DNA damage recognition and in controlling meiotic recombination.

  9. Liver fluke-induced hepatic oxysterols stimulate DNA damage and apoptosis in cultured human cholangiocytes.

    PubMed

    Jusakul, Apinya; Loilome, Watcharin; Namwat, Nisana; Haigh, W Geoffrey; Kuver, Rahul; Dechakhamphu, Somkid; Sukontawarin, Pradit; Pinlaor, Somchai; Lee, Sum P; Yongvanit, Puangrat

    2012-03-01

    Oxysterols are cholesterol oxidation products that are generated by enzymatic reactions through cytochrome P450 family enzymes or by non-enzymatic reactions involving reactive oxygen and nitrogen species. Oxysterols have been identified in bile in the setting of chronic inflammation, suggesting that biliary epithelial cells are chronically exposed to these compounds in certain clinical settings. We hypothesized that biliary oxysterols resulting from liver fluke infection participate in cholangiocarcinogenesis. Using gas chromatography/mass spectrometry, we identified oxysterols in livers from hamsters infected with Opisthorchis viverrini that develop cholangiocarcinoma. Five oxysterols were found: 7-keto-cholesta-3,5-diene (7KD), 3-keto-cholest-4-ene (3K4), 3-keto-cholest-7-ene (3K7), 3-keto-cholesta-4,6-diene (3KD), and cholestan-3β,5α,6β-triol (Triol). Triol and 3K4 were found at significantly higher levels in the livers of hamsters with O. viverrini-induced cholangiocarcinoma. We therefore investigated the effects of Triol and 3K4 on induction of cholangiocarcinogenesis using an in vitro human cholangiocyte culture model. Triol- and 3K4-treated cells underwent apoptosis. Western blot analysis showed significantly increased levels of Bax and decreased levels of Bcl-2 in these cells. Increased cytochrome c release from mitochondria was found following treatment with Triol and 3K4. Triol and 3K4 also induced formation of the DNA adducts 1,N(6)-etheno-2'-deoxyadenosine, 3,N(4)-etheno-2'-deoxycytidine and 8-oxo-7,8-dihydro-2'-deoxyguanosine in cholangiocytes. The data suggest that Triol and 3K4 cause DNA damage via oxidative stress. Chronic liver fluke infection increases production of the oxysterols Triol and 3K4 in the setting of chronic inflammation in the biliary system. These oxysterols induce apoptosis and DNA damage in cholangiocytes. Insufficient and impaired DNA repair of such mutated cells may enhance clonal expansion and further drive the change in

  10. The protective effects of hydroxytyrosol against ortho-phenylphenol-induced DNA damage in HepG2 cells.

    PubMed

    Li, Jianqing; Yang, Guang; Wang, Shaopeng; Jiang, Liping; Liu, Xiaofang; Geng, Chengyan; Zhong, Laifu; Chen, Min

    2012-07-01

    Ortho-phenylphenol (OPP) has been found to cause carcinomas in the urinary tract of rats. Since OPP is a potent genotoxic compound, and used as fungicides and antibacterial agents in fruits and fruit products, search for newer, better agents for protection against toxicity of OPP is required. In this study, the chemoprotective effect of hydroxytyrosol (HT) against OPP-induced DNA damage in HepG2 cells was investigated. Comet assay was used to detect the DNA damage induced by OPP. To elucidate the possible mechanisms, we tested lysosomal membrane stability, mitochondrial membrane potential, intracellular generation of reactive oxygen species (ROS), and reduced glutathione (GSH). Results showed that HT significantly reduced the DNA strand breaks caused by OPP. Moreover, HT effectively suppressed OPP-induced ROS formation, and increased the GSH level. Lysosomal membrane and mitochondrial membrane were also protected when cells were pretreated with HT. These results suggested that the disruption of lysosomal membrane integrity and the oxidative stress, leading to DNA fragmentation, may be the mechanism of DNA damage induced by OPP. The antioxidant activity of HT may play an important part in attenuating the DNA damage of OPP.

  11. Methamphetamine induces DNA damage in specific regions of the female rat brain.

    PubMed

    Johnson, Zane; Venters, Jace; Guarraci, Fay A; Zewail-Foote, Maha

    2015-06-01

    Methamphetamine (METH) is a highly addictive psychostimulant that has been shown to produce neurotoxicity. Methamphetamine increases the release of dopamine by reversing the direction of monoamine transporter proteins, leading to the formation of reactive oxygen species in the brain. In this study, we examined the effect of METH on DNA damage in vivo using the single cell gel electrophoresis assay (comet assay) under two different conditions. Rats treated with multiple doses of METH (10 mg/kg × 4) showed significant levels of DNA damage in the nucleus accumbens and striatum, both dopamine-rich areas. In contrast, a single dose of METH did not lead to significant levels of DNA damage in any of the dopamine-rich brain regions that were tested. Overall, the results of our study demonstrate that METH produces greater oxidative DNA damage in brain areas that receive greater dopamine innervation.

  12. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    NASA Astrophysics Data System (ADS)

    Han, Xu; Klas, Matej; Liu, Yueying; Stack, M. Sharon; Ptasinska, Sylwia

    2013-09-01

    The nitrogen atmospheric pressure plasma jet (APPJ) has been shown to effectively induce DNA double strand breaks in SCC-25 oral cancer cells. The APPJ source constructed in our laboratory consists of two external electrodes wrapping around a quartz tube and nitrogen as a feed gas and operates based on dielectric barrier gas discharge. Generally, it is more challenging to ignite plasma in N2 atmosphere than in noble gases. However, this design provides additional advantages such as lower costs compared to the noble gases for future clinical operation. Different parameters of the APPJ configuration were tested in order to determine radiation dosage. To explore the effects of delayed damage and cell self-repairing, various incubation times of cells after plasma treatment were also performed. Reactive species generated in plasma jet and in liquid environment are essential to be identified and quantified, with the aim of unfolding the mystery of detailed mechanisms for plasma-induced cell apoptosis. Moreover, from the comparison of plasma treatment effect on normal oral cells OKF6T, an insight to the selectivity for cancer treatment by APPJ can be explored. All of these studies are critical to better understand the damage responses of normal and abnormal cellular systems to plasma radiation, which are useful for the development of advanced plasma therapy for cancer treatment at a later stage.

  13. Characterization of repair of bleomycin-induced DNA damage in human chromatin

    SciTech Connect

    Sidik, K.

    1989-01-01

    The characteristics of bleomycin-induced DNA damage and repair in intact human fibroblasts, and in fibroblasts that were reversibly permeabilized by short exposure to lysophosphatidylcholine (LPC), were examined. LPC treatment dramatically increases the dose effectiveness of bleomycin (BLM). Sufficient levels of single- and double-strand breaks were introduced into the DNA of permeabilized cells to yield a nucleosomal DNA pattern. We demonstrated that BLM is a short patch agent, since excision repair of BLM induced strand breaks involved the removal and reinsertion of less than 10 bases, as compared to >20 bases for long patch agents (e.g., UV radiation and bulky chemicals). Measurements of the initial nuclease sensitivity and subsequent nucleosome rearrangement of newly repaired regions of chromatin in intact and permeabilized cells following treatment with BLM were done in the presence and absence of aphidicolin (APC), an inhibitor of polymerase {alpha}. In intact cells, nucleosome rearrangement was not observed in the presence of APC. In the absence of APC, nucleosome rearrangement was also not observed if hydroxyurea (HU) was present after the insertion of repair patches (chased). If HU was absent during the chase period, rearrangement of chromatin structure at repair sites was observed. However, the rate of rearrangement was considerably slower than that observed for repair of long-patch agents. The slow rate of nucleosome rearrangement was also observed during repair induced by 1 {mu}g/ml BLM in the permeabilized cells. However, when higher concentrations of BLM were used, the rapid phase of nucleosome rearrangement was observed in permeabilized cells indicating nucleosome unfolding had taken place. These results suggest that, unlike long patch repair, significant nucleosome rearrangement does not occur during short-patch repair when the lesions are located primarily in linker regions of nucleosomes.

  14. Escherichia coli induces DNA damage in vivo and triggers genomic instability in mammalian cells

    PubMed Central

    Cuevas-Ramos, Gabriel; Petit, Claude R.; Marcq, Ingrid; Boury, Michèle; Oswald, Eric; Nougayrède, Jean-Philippe

    2010-01-01

    Escherichia coli is a normal inhabitant of the human gut. However, E. coli strains of phylogenetic group B2 harbor a genomic island called “pks” that codes for the production of a polyketide-peptide genotoxin, Colibactin. Here we report that in vivo infection with E. coli harboring the pks island, but not with a pks isogenic mutant, induced the formation of phosphorylated H2AX foci in mouse enterocytes. We show that a single, short exposure of cultured mammalian epithelial cells to live pks+ E. coli at low infectious doses induced a transient DNA damage response followed by cell division with signs of incomplete DNA repair, leading to anaphase bridges and chromosome aberrations. Micronuclei, aneuploidy, ring chromosomes, and anaphase bridges persisted in dividing cells up to 21 d after infection, indicating occurrence of breakage–fusion–bridge cycles and chromosomal instability. Exposed cells exhibited a significant increase in gene mutation frequency and anchorage-independent colony formation, demonstrating the infection mutagenic and transforming potential. Therefore, colon colonization with these E. coli strains harboring the pks island could contribute to the development of sporadic colorectal cancer. PMID:20534522

  15. Metallothionein blocks oxidative DNA damage induced by acute inorganic arsenic exposure

    SciTech Connect

    Qu, Wei Waalkes, Michael P.

    2015-02-01

    We studied how protein metallothionein (MT) impacts arsenic-induced oxidative DNA damage (ODD) using cells that poorly express MT (MT-I/II double knockout embryonic cells; called MT-null cells) and wild-type (WT) MT competent cells. Arsenic (as NaAsO{sub 2}) was less cytolethal over 24 h in WT cells (LC{sub 50} = 11.0 ± 1.3 μM; mean ± SEM) than in MT-null cells (LC{sub 50} = 5.6 ± 1.2 μM). ODD was measured by the immuno-spin trapping method. Arsenic (1 or 5 μM; 24 h) induced much less ODD in WT cells (121% and 141% of control, respectively) than in MT-null cells (202% and 260%). In WT cells arsenic caused concentration-dependent increases in MT expression (transcript and protein), and in the metal-responsive transcription factor-1 (MTF-1), which is required to induce the MT gene. In contrast, basal MT levels were not detectable in MT-null cells and unaltered by arsenic exposure. Transfection of MT-I gene into the MT-null cells markedly reduced arsenic-induced ODD levels. The transport genes, Abcc1 and Abcc2 were increased by arsenic in WT cells but either showed no or very limited increases in MT-null cells. Arsenic caused increases in oxidant stress defense genes HO-1 and GSTα2 in both WT and MT-null cells, but to much higher levels in WT cells. WT cells appear more adept at activating metal transport systems and oxidant response genes, although the role of MT in these responses is unclear. Overall, MT protects against arsenic-induced ODD in MT competent cells by potential sequestration of scavenging oxidant radicals and/or arsenic. - Highlights: • Metallothionein blocks arsenic toxicity. • Metallothionein reduces arsenic-induced DNA damage. • Metallothionein may bind arsenic or radicals produced by arsenic.

  16. p53 pathway determines the cellular response to alcohol-induced DNA damage in MCF-7 breast cancer cells

    PubMed Central

    Zhao, Ming; Howard, Erin W.; Guo, Zhiying; Parris, Amanda B.; Yang, Xiaohe

    2017-01-01

    Alcohol consumption is associated with increased breast cancer risk; however, the underlying mechanisms that contribute to mammary tumor initiation and progression are unclear. Alcohol is known to induce oxidative stress and DNA damage; likewise, p53 is a critical modulator of the DNA repair pathway and ensures genomic integrity. p53 mutations are frequently detected in breast and other tumors. The impact of alcohol on p53 is recognized, yet the role of p53 in alcohol-induced mammary carcinogenesis remains poorly defined. In our study, we measured alcohol-mediated oxidative DNA damage in MCF-7 cells using 8-OHdG and p-H2AX foci formation assays. p53 activity and target gene expression after alcohol exposure were determined using p53 luciferase reporter assay, qPCR, and Western blotting. A mechanistic study delineating the role of p53 in DNA damage response and cell cycle arrest was based on isogenic MCF-7 cells stably transfected with control (MCF-7/Con) or p53-targeting siRNA (MCF-7/sip53), and MCF-7 cells that were pretreated with Nutlin-3 (Mdm2 inhibitor) to stabilize p53. Alcohol treatment resulted in significant DNA damage in MCF-7 cells, as indicated by increased levels of 8-OHdG and p-H2AX foci number. A p53-dependent signaling cascade was stimulated by alcohol-induced DNA damage. Moderate to high concentrations of alcohol (0.1–0.8% v/v) induced p53 activation, as indicated by increased p53 phosphorylation, reporter gene activity, and p21/Bax gene expression, which led to G0/G1 cell cycle arrest. Importantly, compared to MCF-7/Con cells, alcohol-induced DNA damage was significantly enhanced, while alcohol-induced p21/Bax expression and cell cycle arrest were attenuated in MCF-7/sip53 cells. In contrast, inhibition of p53 degradation via Nutlin-3 reinforced G0/G1 cell cycle arrest in MCF-7 control cells. Our study suggests that functional p53 plays a critical role in cellular responses to alcohol-induced DNA damage, which protects the cells from DNA damage

  17. A novel cis-acting element required for DNA damage-inducible expression of yeast DIN7

    SciTech Connect

    Yoshitani, Ayako; Yoshida, Minoru; Ling Feng

    2008-01-04

    Din7 is a DNA damage-inducible mitochondrial nuclease that modulates the stability of mitochondrial DNA (mtDNA) in Saccharomyces cerevisiae. How DIN7 gene expression is regulated, however, has remained largely unclear. Using promoter sequence alignment, we found a highly conserved 19-bp sequence in the promoter regions of DIN7 and NTG1, which encodes an oxidative stress-inducible base-excision-repair enzyme. Deletion of the 19-bp sequence markedly reduced the hydroxyurea (HU)-enhanced DIN7 promoter activity. In addition, nuclear fractions prepared from HU-treated cells were used in in vitro band shift assays to reveal the presence of currently unidentified trans-acting factor(s) that preferentially bound to the 19-bp region. These results suggest that the 19-bp sequence is a novel cis-acting element that is required for the regulation of DIN7 expression in response to HU-induced DNA damage.

  18. Theoretical analyses on a flipping mechanism of UV-induced DNA damage

    PubMed Central

    Sato, Ryuma; Harada, Ryuhei; Shigeta, Yasuteru

    2016-01-01

    As for UV-induced DNA damage, which may induce skin cancer in animals and growth inhibition in plants, there are two types of photoproducts, namely cis-sin cyclobutane pyrimidine dimers (CPD) and pyrimidine-pyrimidone (6-4) photoproducts. When they are to be repaired, base-flipping occurs, and they bind to enzymes. However, this process remains relatively unknown at a molecular level. We analyze conformation and interaction energy changes upon base-flipping using classical molecular dynamics (CMD) simulations and ab initio electronic structure calculations. CMD simulations starting with a CPD in the flipped-in and flipped-out states showed that both states were unchanged for 500 ns, indicating the flipped-in and flipped-out processes do not occur spontaneously (without any help of the enzyme) after photo-damage. To deeply understand the reasons, we investigated interaction energy changes among bases upon structure changes during the flipped-in and flipped-out processes using Parallel Cascade Selection-MD (PaCS-MD) simulations at 400 K, followed by a fragment molecular orbital (FMO) method. The total inter-fragment interaction energy (IFIE) between CPD and other bases at the flipped-in state is estimated to be −60.08 kcal/mol. In particular, four bases strongly interact with CPD with interaction energies being −10.96, −13.70, −21.52, and −14.46 kcal/mol each. On the other hand, the total IFIE at the obtained flipped-out state increased to −10.40 kcal/mol by partly losing hydrogen bonds and π-π stacking interactions, respectively. These results clearly indicate that the base-flipping process of DNA lesions occurs with the help of external forces like interactions with appropriate enzymes such as photolyases.

  19. The EEL-1 ubiquitin ligase promotes DNA damage-induced germ cell apoptosis in C. elegans

    PubMed Central

    Ross, A J; Li, M; Yu, B; Gao, M X; Derry, W B

    2011-01-01

    E3 ubiquitin ligases target a growing number of pro- and anti-apoptotic proteins, including tumour suppressor p53, caspases, and the Bcl-2 family. The core apoptosis pathway is well conserved between mammals and Caenorhabditis elegans, but the extent to which ubiquitin ligases regulate apoptotic cell death is not known. To investigate the role of E3 ligases in apoptosis, we inhibited 108 of the 165 predicted E3 ubiquitin ligase genes by RNA interference and quantified apoptosis in the C. elegans germline after genotoxic stress. From this screen, we identified the homologous to E6-associated protein C terminus-domain E3 ligase EEL-1 as a positive regulator of apoptosis. Intriguingly, the human homologue of EEL-1, Huwe1/ARF-BP1/Mule/HectH9, has been reported to possess both pro- and anti-apoptotic functions through its ability to stimulate Mcl-1 and p53 degradation, respectively. Here, we demonstrate that eel-1 is required to promote DNA damage-induced germ cell apoptosis, but does not have a role in physiological germ cell apoptosis or developmental apoptosis in somatic tissue. Furthermore, eel-1 acts in parallel to the p53-like gene cep-1 and intersects the core apoptosis pathway upstream of the Bcl-2/Mcl-1 orthologue ced-9. Although ee1-1 mutants exhibit hypersensitivity to genotoxic stress they do not appear to be defective in DNA repair, suggesting a distinct role for EEL-1 in promoting damage-induced apoptosis in the germline. PMID:21233842

  20. The EEL-1 ubiquitin ligase promotes DNA damage-induced germ cell apoptosis in C. elegans.

    PubMed

    Ross, A J; Li, M; Yu, B; Gao, M X; Derry, W B

    2011-07-01

    E3 ubiquitin ligases target a growing number of pro- and anti-apoptotic proteins, including tumour suppressor p53, caspases, and the Bcl-2 family. The core apoptosis pathway is well conserved between mammals and Caenorhabditis elegans, but the extent to which ubiquitin ligases regulate apoptotic cell death is not known. To investigate the role of E3 ligases in apoptosis, we inhibited 108 of the 165 predicted E3 ubiquitin ligase genes by RNA interference and quantified apoptosis in the C. elegans germline after genotoxic stress. From this screen, we identified the homologous to E6-associated protein C terminus-domain E3 ligase EEL-1 as a positive regulator of apoptosis. Intriguingly, the human homologue of EEL-1, Huwe1/ARF-BP1/Mule/HectH9, has been reported to possess both pro- and anti-apoptotic functions through its ability to stimulate Mcl-1 and p53 degradation, respectively. Here, we demonstrate that eel-1 is required to promote DNA damage-induced germ cell apoptosis, but does not have a role in physiological germ cell apoptosis or developmental apoptosis in somatic tissue. Furthermore, eel-1 acts in parallel to the p53-like gene cep-1 and intersects the core apoptosis pathway upstream of the Bcl-2/Mcl-1 orthologue ced-9. Although ee1-1 mutants exhibit hypersensitivity to genotoxic stress they do not appear to be defective in DNA repair, suggesting a distinct role for EEL-1 in promoting damage-induced apoptosis in the germline.

  1. Yields of clustered DNA damage induced by charged-particle radiations of similar kinetic energy per nucleon: LET dependence in different DNA microenvironments

    SciTech Connect

    Keszenman, D.J.; Sutherland, B. M.

    2010-08-01

    To determine the linear energy transfer (LET) dependence of the biological effects of densely ionizing radiation in relation to changes in the ionization density along the track, we measured the yields and spectrum of clustered DNA damages induced by charged particles of different atomic number but similar kinetic energy per nucleon in different DNA microenvironments. Yeast DNA embedded in agarose in solutions of different free radical scavenging capacity was irradiated with 1 GeV protons, 1 GeV/nucleon oxygen ions, 980 MeV/nucleon titanium ions or 968 MeV/nucleon iron ions. The frequencies of double-strand breaks (DSBs), abasic sites and oxypurine clusters were quantified. The total DNA damage yields per absorbed dose induced in non-radioquenching solution decreased with LET, with minor variations in radioquenching conditions being detected. However, the total damage yields per particle fluence increased with LET in both conditions, indicating a higher efficiency per particle to induce clustered DNA damages. The yields of DSBs and non-DSB clusters as well as the damage spectra varied with LET and DNA milieu, suggesting the involvement of more than one mechanism in the formation of the different types of clustered damages.

  2. Site-specific DNA damage induced by sulfite in the presence of cobalt(II) ion. Role of sulfate radical.

    PubMed

    Kawanishi, S; Yamamoto, K; Inoue, S

    1989-10-15

    The reactivities of sulfite (SO23-) with DNA in the presence of metal ions were investigated by a DNA sequencing technique using 32P-labeled DNA fragments obtained from human c-Ha-ras-1 protooncogene. Sulfite caused DNA damage in the presence of Co2+, Cu2+ and Mn2+, although sulfite alone or metal ion alone did not. The order of inducing effect on sulfite-dependent DNA damage (Co2+ much greater than Cu2+ greater than Mn2+ Fe3+) was consistent with that of accelerating effect on the initial oxygen consumption rate of sulfite autoxidation. The DNA damage induced by sulfite plus Co2+ was inhibited by 3,5-dibromo-4-nitrobenzenesulfonate, primary and secondary alchols, whereas it was not inhibited by SOD, catalase and tert-butyl alcohol. Incubation of DNA with sulfite plus Co2+ followed by the piperidine treatment led to the predominant cleavage at the positions of guanine especially located 5' to guanine. Sulfite plus Cu2+ gave a DNA cleavage pattern different from that induced by sulfite plus Co2+. The photolysis of peroxydisulfate (S2O28-), which is known to produce SO-4 radicals, gave a DNA cleavage pattern similar to that induced by sulfite plus Co2+. ESR studies using spin-trapping reagent revealed the production of spin adduct possibly of SO-3 radical in a solution of sulfite plus Cu2+, whereas much less spin adduct was produced by sulfite plus Co2+. The results suggest that sulfite is rapidly autoxidized in the presence of Co2+ to produce SO4- radical causing site-specific DNA damage.

  3. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    PubMed Central

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Background. Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis. PMID:26273425

  4. Metformin does not prevent DNA damage in lymphocytes despite its antioxidant properties against cumene hydroperoxide-induced oxidative stress.

    PubMed

    Onaran, Ilhan; Guven, Gulgun S; Ozdaş, Sule Beyhan; Kanigur, Gonul; Vehid, Suphi

    2006-12-10

    Metformin (1-(diaminomethylidene)-3,3-dimethyl-guanidine), which is the most commonly prescribed oral antihyperglycaemic drug in the world, was reported to have several antioxidant properties such as the inhibition of advanced glycation end-products. In addition to its use in the treatment of diabetes, it has been suggested that metformin may be a promising anti-aging agent. The present work was aimed at assessing the possible protective effects of metformin against DNA-damage induction by oxidative stress in vitro. The effects of metformin were compared with those of N-acetylcysteine (NAC). For this purpose, peripheral blood lymphocytes from aged (n=10) and young (n=10) individuals were pre-incubated with various concentrations of metformin (10-50microM), followed by incubation with 15microM cumene hydroperoxide (CumOOH) for 48h, under conditions of low oxidant level, which do not induce cell death. Protection against oxidative DNA damage was evaluated by use of the Comet assay and the cytokinesis-block micronucleus technique. Changes in the levels of malondialdehyde+4-hydroxy-alkenals, an index of oxidative stress, were also measured in lymphocytes. At concentrations ranging from 10microM to 50microM, metformin did not protect the lymphocytes from DNA damage, while 50microM NAC possessed an effective protective effect against CumOOH-induced DNA damage. Furthermore, NAC, but not metformin, inhibited DNA fragmentation induced by CumOOH. In contrast to the lack of protection against oxidative damage in lymphocyte cultures, metformin significantly protected the cells from lipid peroxidation in both age groups, although not as effective as NAC in preventing the peroxidative damage at the highest doses. Within the limitations of this study, the results indicate that pharmacological concentrations of metformin are unable to protect against DNA damage induced by a pro-oxidant stimulus in cultured human lymphocytes, despite its antioxidant properties.

  5. Resistant starch prevents colonic DNA damage induced by high dietary cooked red meat or casein in rats.

    PubMed

    Toden, Shusuke; Bird, Anthony R; Topping, David L; Conlon, Michael A

    2006-03-01

    In a previous study we have shown that high levels of dietary protein (as casein) result in increased levels of colonic DNA damage, measured by the comet assay, and thinning of the colonic mucus layer in rats when dietary resistant starch (RS) is negligible. Feeding RS abolishes these effects. This study aimed to establish whether a diet high in protein as cooked red meat would have similar effects and whether RS was protective. Rats were fed a diet containing 15% or 25% casein or 25% cooked lean red beef, each with or without the addition of 48% high amylose maize starch (a rich source of RS) for four weeks. As expected, high dietary casein caused a 2-fold increase in colonic DNA damage compared with a low casein diet and reduced the thickness of the colonic mucus layer by 41%. High levels of cooked meat caused 26% greater DNA damage than the high casein diet but reduced mucus thickness to a similar degree to casein. Addition of RS to the diet abolished the increase in DNA damage and the loss of colonic mucus thickness induced by either high protein diet. Cecal and fecal short chain fatty acid pools were also increased by inclusion of RS in the diet. Because DNA damage is an early step in the initiation of cancer, these findings suggest that increased DNA damage due to high dietary protein as cooked red meat or casein could increase colorectal cancer risk but inclusion of resistant starch in the diet could significantly reduce that risk.

  6. Casticin induces DNA damage and inhibits DNA repair-associated protein expression in B16F10 mouse melanoma cancer cells.

    PubMed

    Shih, Yung-Luen; Chou, Jason; Yeh, Ming-Yang; Chou, Hsiao-Min; Chou, Hsiu-Chen; Lu, Hsu-Feng; Shang, Hung-Sheng; Chueh, Fu-Shin; Chu, Yung-Lin; Hsueh, Shu-Ching; Chung, Jing-Gung

    2016-10-01

    Casticin, a polymethoxyflavone, has been demonstrated to possess anticancer activities, yet no study has shown in detail that casticin induces DNA damage in lung cancer cells. The purpose of this study was to investigate the possible molecular mechanisms of casticin which induce DNA damage and nuclear condensation in murine melanoma cancer B16F10 cells. In this study, by examining and capturing images using phase contrast microscopy, we found that casticin induced cell morphological changes. Moreover, it decreased the total number of viable cells which was measured by flow cytometry. Casticin-induced DNA damage and nuclear DNA condensation were measured by DAPI staining, respectively. Western blotting indicated that casticin decreased the protein levels of O6‑methylguanine-DNA methyltransferase (MGMT), breast cancer 1, early onset (BRCA1), mediator of DNA damage checkpoint 1 (MDC1), DNA-dependent protein kinase (DNA-PK) but increased phospho-p53 tumor suppressor protein (p-p53), phospho-ataxia telangiectasia mutated kinase (p-ATM), phospho-histone H2A.X (Ser139) and poly(ADP-ribose) polymerase (PARP) in the B16F10 cells. Furthermore, we used confocal laser system microscopy to examine the protein expression levels and we found that casticin increased the expression of p-p53 and p-H2A.X in the B16F10 cells. Collectively, casticin induced DNA damage and affected DNA repair proteins in the B16F10 cells in vitro.

  7. Arsenic Biotransformation as a Cancer Promoting Factor by Inducing DNA Damage and Disruption of Repair Mechanisms

    PubMed Central

    Martinez, Victor D.; Vucic, Emily A.; Adonis, Marta; Gil, Lionel; Lam, Wan L.

    2011-01-01

    Chronic exposure to arsenic in drinking water poses a major global health concern. Populations exposed to high concentrations of arsenic-contaminated drinking water suffer serious health consequences, including alarming cancer incidence and death rates. Arsenic is biotransformed through sequential addition of methyl groups, acquired from s-adenosylmethionine (SAM). Metabolism of arsenic generates a variety of genotoxic and cytotoxic species, damaging DNA directly and indirectly, through the generation of reactive oxidative species and induction of DNA adducts, strand breaks and cross links, and inhibition of the DNA repair process itself. Since SAM is the methyl group donor used by DNA methyltransferases to maintain normal epigenetic patterns in all human cells, arsenic is also postulated to affect maintenance of normal DNA methylation patterns, chromatin structure, and genomic stability. The biological processes underlying the cancer promoting factors of arsenic metabolism, related to DNA damage and repair, will be discussed here. PMID:22091411

  8. Electromagnetic noise inhibits radiofrequency radiation-induced DNA damage and reactive oxygen species increase in human lens epithelial cells

    PubMed Central

    Wu, Wei; Wang, KaiJun; Ni, Shuang; Ye, PanPan; Yu, YiBo; Ye, Juan; Sun, LiXia

    2008-01-01

    Purpose The goal of this study was to investigate whether superposing of electromagnetic noise could block or attenuate DNA damage and intracellular reactive oxygen species (ROS) increase of cultured human lens epithelial cells (HLECs) induced by acute exposure to 1.8 GHz radiofrequency field (RF) of the Global System for Mobile Communications (GSM). Methods An sXc-1800 RF exposure system was used to produce a GSM signal at 1.8 GHz (217 Hz amplitude-modulated) with the specific absorption rate (SAR) of 1, 2, 3, and 4 W/kg. After 2 h of intermittent exposure, the ROS level was assessed by the fluorescent probe, 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). DNA damage to HLECs was examined by alkaline comet assay and the phosphorylated form of histone variant H2AX (γH2AX) foci formation assay. Results After exposure to 1.8 GHz RF for 2 h, HLECs exhibited significant intracellular ROS increase in the 2, 3, and 4 W/kg groups. RF radiation at the SAR of 3 W/kg and 4 W/kg could induce significant DNA damage, examined by alkaline comet assay, which was used to detect mainly single strand breaks (SSBs), while no statistical difference in double strand breaks (DSBs), evaluated by γH2AX foci, was found between RF exposure (SAR: 3 and 4 W/kg) and sham exposure groups. When RF was superposed with 2 μT electromagnetic noise could block RF-induced ROS increase and DNA damage. Conclusions DNA damage induced by 1.8 GHz radiofrequency field for 2 h, which was mainly SSBs, may be associated with the increased ROS production. Electromagnetic noise could block RF-induced ROS formation and DNA damage. PMID:18509546

  9. DNA damage-inducible genes as biomarkers for exposures to environmental agents.

    PubMed Central

    Johnson, N F; Carpenter, T R; Jaramillo, R J; Liberati, T A

    1997-01-01

    A biodosimetric approach to determine alpha-particle dose to the respiratory tract epithelium from known exposures to radon has been developed in the rat. Cytotoxicity assays have been used to obtain dose-conversion factors for cumulative exposures typical of those encountered by underground uranium miners. However, this approach is not sensitive enough to derive dose-conversion factors for indoor radon exposures. The expression of DNA damage-inducible genes is being investigated as a biomarker of exposure to radon progeny. Exposure of cultures of A549 cells to alpha particles resulted in an increase in the protein levels of the DNA damage-inducible genes, p53, Cip1, and Gadd45. These protein changes were associated with a transient arrest of cells passing through the cell cycle. This arrest was typified by an increase in the number of cells in the G1 and G2 phases and a decrease in the number of cells in the S phase. The effect of inhaled alpha particles (radon progeny) in rats was examined in the epithelial cells of the lateral well of the anterior nasal cavity. Exposures to radon progeny resulted in a significant increase in the number of cells in the G1 phase and a decrease in the number of cells in the S phase. These cell-cycle changes were concomitant with an increase in the number of cells containing DNA strand breaks. These results suggest a commonality between cell-cycle events in vitro and in vivo following exposure to ionizing radiation. In addition to ionizing radiation, A549 cells were exposed to 4-nitroquinoline-1-oxide, methyl methanesulphonate, crocidolite asbestos, and glass microfiber. These studies showed that physical and chemical agents induce different expression patterns of p53, Cip1, and Gadd153 proteins and they could be used to discriminate between toxic and nontoxic materials such as asbestos and glass microfiber. The measurement of gene expression in A549 cells may provide a means to identify a broad spectrum of physical and chemical

  10. DNA damage-inducible genes as biomarkers for exposures to environmental agents.

    PubMed

    Johnson, N F; Carpenter, T R; Jaramillo, R J; Liberati, T A

    1997-06-01

    A biodosimetric approach to determine alpha-particle dose to the respiratory tract epithelium from known exposures to radon has been developed in the rat. Cytotoxicity assays have been used to obtain dose-conversion factors for cumulative exposures typical of those encountered by underground uranium miners. However, this approach is not sensitive enough to derive dose-conversion factors for indoor radon exposures. The expression of DNA damage-inducible genes is being investigated as a biomarker of exposure to radon progeny. Exposure of cultures of A549 cells to alpha particles resulted in an increase in the protein levels of the DNA damage-inducible genes, p53, Cip1, and Gadd45. These protein changes were associated with a transient arrest of cells passing through the cell cycle. This arrest was typified by an increase in the number of cells in the G1 and G2 phases and a decrease in the number of cells in the S phase. The effect of inhaled alpha particles (radon progeny) in rats was examined in the epithelial cells of the lateral well of the anterior nasal cavity. Exposures to radon progeny resulted in a significant increase in the number of cells in the G1 phase and a decrease in the number of cells in the S phase. These cell-cycle changes were concomitant with an increase in the number of cells containing DNA strand breaks. These results suggest a commonality between cell-cycle events in vitro and in vivo following exposure to ionizing radiation. In addition to ionizing radiation, A549 cells were exposed to 4-nitroquinoline-1-oxide, methyl methanesulphonate, crocidolite asbestos, and glass microfiber. These studies showed that physical and chemical agents induce different expression patterns of p53, Cip1, and Gadd153 proteins and they could be used to discriminate between toxic and nontoxic materials such as asbestos and glass microfiber. The measurement of gene expression in A549 cells may provide a means to identify a broad spectrum of physical and chemical

  11. Cadmium-induced DNA damage and mutations in Arabidopsis plantlet shoots identified by DNA fingerprinting.

    PubMed

    Liu, Wan; Sun, Lizong; Zhong, Ming; Zhou, Qixing; Gong, Zongqiang; Li, Peijun; Tai, Peidong; Li, Xiaojun

    2012-11-01

    Random amplified polymorphic DNA (RAPD) test is a feasible method to evaluate the toxicity of environmental pollutants on vegetal organisms. Herein, Arabidopsis thaliana (Arabidopsis) plantlets following Cadmium (Cd) treatment for 26 d were screened for DNA genetic alterations by DNA fingerprinting. Four primers amplified 20-23 mutated RAPD fragments in 0.125-3.0 mg L(-1) Cd-treated Arabidopsis plantlets, respectively. Cloning and sequencing analysis of eight randomly selected mutated fragments revealed 99-100% homology with the genes of VARICOSE-Related, SLEEPY1 F-box, 40S ribosomal protein S3, phosphoglucomutase, and noncoding regions in Arabidopsis genome correspondingly. The results show the ability of RAPD analysis to detect significant genetic alterations in Cd-exposed seedlings. Although the exact functional importance of the other mutated bands is unknown, the presence of mutated loci in Cd-treated seedlings, prior to the onset of significant physiological effects, suggests that these altered loci are the early events in Cd-treated Arabidopsis seedlings and would greatly improve environmental risk assessment.

  12. EndoG Links Bnip3-Induced Mitochondrial Damage and Caspase-Independent DNA Fragmentation in Ischemic Cardiomyocytes

    PubMed Central

    Zhang, Jisheng; Ye, Junmei; Altafaj, Albert; Cardona, Maria; Bahi, Núria; Llovera, Marta; Cañas, Xavier; Cook, Stuart A.; Comella, Joan X.; Sanchis, Daniel

    2011-01-01

    Mitochondrial dysfunction, caspase activation and caspase-dependent DNA fragmentation are involved in cell damage in many tissues. However, differentiated cardiomyocytes repress the expression of the canonical apoptotic pathway and their death during ischemia is caspase-independent. The atypical BH3-only protein Bnip3 is involved in the process leading to caspase-independent DNA fragmentation in cardiomyocytes. However, the pathway by which DNA degradation ensues following Bnip3 activation is not resolved. To identify the mechanism involved, we analyzed the interdependence of Bnip3, Nix and EndoG in mitochondrial damage and DNA fragmentation during experimental ischemia in neonatal rat ventricular cardiomyocytes. Our results show that the expression of EndoG and Bnip3 increases in the heart throughout development, while the caspase-dependent machinery is silenced. TUNEL-positive DNA damage, which depends on caspase activity in other cells, is caspase-independent in ischemic cardiomyocytes and ischemia-induced DNA high and low molecular weight fragmentation is blocked by repressing EndoG expression. Ischemia-induced EndoG translocation and DNA degradation are prevented by silencing the expression of Bnip3, but not Nix, or by overexpressing Bcl-xL. These data establish a link between Bnip3 and EndoG-dependent, TUNEL-positive, DNA fragmentation in ischemic cardiomyocytes in the absence of caspases, defining an alternative cell death pathway in postmitotic cells. PMID:21437288

  13. Mechanistic Modelling of DNA Repair and Cellular Survival Following Radiation-Induced DNA Damage

    NASA Astrophysics Data System (ADS)

    McMahon, Stephen J.; Schuemann, Jan; Paganetti, Harald; Prise, Kevin M.

    2016-09-01

    Characterising and predicting the effects of ionising radiation on cells remains challenging, with the lack of robust models of the underlying mechanism of radiation responses providing a significant limitation to the development of personalised radiotherapy. In this paper we present a mechanistic model of cellular response to radiation that incorporates the kinetics of different DNA repair processes, the spatial distribution of double strand breaks and the resulting probability and severity of misrepair. This model enables predictions to be made of a range of key biological endpoints (DNA repair kinetics, chromosome aberration and mutation formation, survival) across a range of cell types based on a set of 11 mechanistic fitting parameters that are common across all cells. Applying this model to cellular survival showed its capacity to stratify the radiosensitivity of cells based on aspects of their phenotype and experimental conditions such as cell cycle phase and plating delay (correlation between modelled and observed Mean Inactivation Doses R2 > 0.9). By explicitly incorporating underlying mechanistic factors, this model can integrate knowledge from a wide range of biological studies to provide robust predictions and may act as a foundation for future calculations of individualised radiosensitivity.

  14. Ferulic acid prevents methylglyoxal-induced protein glycation, DNA damage, and apoptosis in pancreatic β-cells.

    PubMed

    Sompong, Weerachat; Cheng, Henrique; Adisakwattana, Sirichai

    2017-02-01

    Methylglyoxal (MG) can react with amino acids of proteins to induce protein glycation and consequently the formation of advanced glycation end-products (AGEs). Previous studies reported that ferulic acid (FA) prevented glucose-, fructose-, and ribose-induced protein glycation. In this study, FA (0.1-1 mM) inhibited MG-induced protein glycation and oxidative protein damage in bovine serum albumin (BSA). Furthermore, FA (0.0125-0.2 mM) protected against lysine/MG-mediated oxidative DNA damage, thereby inhibiting superoxide anion and hydroxyl radical generation during lysine and MG reaction. In addition, FA did not have the ability to trap MG. Finally, FA (0.1 mM) pretreatment attenuated MG-induced decrease in cell viability and prevented MG-induced cell apoptosis in pancreatic β-cells. The results suggest that FA is capable of protecting β-cells from MG-induced cell damage during diabetes.

  15. DNA damage induced by occupational and environmental exposure to miscellaneous chemicals.

    PubMed

    da Silva, Juliana

    Epidemiological studies for hazardous situations resulting from the risk of environmental and/or occupational exposure to miscellaneous chemicals present several difficulties. Biomonitoring of human populations can provide an early detection system for the initiation of cell dysregulation in the development of cancer, which would help develop an efficient prevention program. Recently, the cytokinesis-block micronucleus (CBMN) assay in lymphocyte cells has become an important tool for assessing DNA damage in exposed populations. This is the method of choice for population-based studies of occupational and/or environmental exposure to different agents. In this review, human populations exposed to coal, dyes, paints, organic solvents in a complex mixture, and others miscellaneous chemicals were analyzed. Data from 28 studies was evaluated in relation to the effect of complex mixture exposition on micronucleus (MN) frequency. Other biomarkers and the background factors were evaluated as well, such as gender, age, or smoking habit. Most of these studies (75%) showed a significant increase of micronucleated cells to exposed groups in relation to the control groups, besides chromosomal aberrations (CA), sister chromatid exchanging (SCE) and comet cells (comet assay). The studies from this review about miscellaneous chemicals exposures using CBMN assay have indicated some time and dose-dependent effects. Overall, the findings suggest that the responses resulting from exposure to complex mixtures are varied and complicated. However, they are also an important mechanism of DNA damage concerning disruption of metal ion homeostasis that may lead to oxidative stress, a state where increased formation of reactive oxygen species (ROS) overwhelms body antioxidant protection and subsequently could induce cancer.

  16. Modulating effects of pycnogenol® on oxidative stress and DNA damage induced by sepsis in rats.

    PubMed

    Taner, Gökçe; Aydın, Sevtap; Bacanlı, Merve; Sarıgöl, Zehra; Sahin, Tolga; Başaran, A Ahmet; Başaran, Nurşen

    2014-11-01

    The aim of this study was to evaluate the protective effects of Pycnogenol® (Pyc), a complex plant extract from the bark of French maritime pine, on oxidative stress parameters (superoxide dismutase (SOD), and glutathione peroxidase (GPx) activities and total glutathione (GSH) and malondialdehyde (MDA) levels), an inflammatory cytokine (tumor necrosis factor alpha (TNF-α) level) and also DNA damage in Wistar albino rats. Rats were treated with 100 mg/kg intraperitonally Pyc following the induction of sepsis by cecal ligation and puncture. The decreases in MDA levels and increases in GSH levels, and SOD and GPx activities were observed in the livers and kidneys of Pyc-treated septic rats. Plasma TNF-α level was found to be decreased in the Pyc-treated septic rats. In the lymphocytes, kidney, and liver tissue cells of the sepsis-induced rats, Pyc treatment significantly decreased the DNA damage and oxidative base damage using standard alkaline assay and formamidopyrimidine DNA glycosylase-modified comet assay, respectively. In conclusion, Pyc treatment might have a role in the prevention of sepsis-induced oxidative damage not only by decreasing DNA damage but also increasing the antioxidant status and DNA repair capacity in rats.

  17. Effects of antidepressants on DSP4/CPT-induced DNA damage response in neuroblastoma SH-SY5Y cells

    PubMed Central

    Wang, Yan; Hilton, Benjamin A.; Cui, Kui; Zhu, Meng-Yang

    2015-01-01

    DNA damage is a form of cell stress and injury. Increased systemic DNA damage is related to the pathogenic development of neurodegenerative diseases. Depression occurs in a relatively high percentage of patients suffering from degenerative diseases, for whom antidepressants are often used to relieve depressive symptoms. However, few studies have attempted to elucidate why different groups of antidepressants have similar effects on relieving symptoms of depression. Previously, we demonstrated that neurotoxins N-(2-chloroethyl)-N-ethyl-2-bromobenzylamine (DSP4)- and camptothecin (CPT)-induced the DNA damage response in SH-SY5Y cells, and DSP4 caused cell cycle arrest which was predominately in the S-phase. The present study shows that CPT treatment also resulted in similar cell cycle arrest. Some classic antidepressants could reduce the DNA damage response induced by DSP4 or CPT in SH-SY5Y cells. Cell viability examination demonstrated that both DSP4 and CPT caused cell death, which was prevented by spontaneous administration of some tested antidepressants. Flow cytometric analysis demonstrated that a majority of the tested antidepressants protect cells from being arrested in S-phase. These results suggest that blocking the DNA damage response may be an important pharmacologic characteristic of antidepressants. Exploring the underlying mechanisms may allow for advances in the effort to improve therapeutic strategies for depression appearing in degenerative and psychiatric diseases. PMID:26038195

  18. Ionizing Radiation-Induced DNA Damage and Its Repair in Human Cells

    SciTech Connect

    Dizdaroglu, Miral

    1999-05-12

    DNA damage in mammalian chromatin in vitro and in cultured mammalian cells including human cells was studied. In the first phase of these studies, a cell culture laboratory was established. Necessary equipment including an incubator, a sterile laminar flow hood and several centrifuges was purchased. We have successfully grown several cell lines such as murine hybridoma cells, V79 cells and human K562 leukemia cells. This was followed by the establishment of a methodology for the isolation of chromatin from cells. This was a very important step, because a routine and successful isolation of chromatin was a prerequisite for the success of the further studies in this project, the aim of which was the measurement of DNA darnage in mammalian chromatin in vitro and in cultured cells. Chromatin isolation was accomplished using a slightly modified procedure of the one described by Mee & Adelstein (1981). For identification and quantitation of DNA damage in cells, analysis of chromatin was preferred over the analysis of "naked DNA" for the following reasons: i. DNA may not be extracted efficiently from nucleoprotein in exposed cells, due to formation of DNA-protein cross-links, ii. the extractability of DNA is well known to decrease with increasing doses of radiation, iii. portions of DNA may not be extracted due to fragmentation, iv. unextracted DNA may contain a significant portion of damaged DNA bases and DNA-protein cross-links. The technique of gas chromatography/mass spectrometry (GC/MS), which was used in the present project, permits the identification and quantitation of modified DNA bases in chromatin in the presence of proteins without the necessity of first isolating DNA from chromatin. This has been demonstrated previously by the results from our laboratory and by the results obtained during the course of the present project. The quality of isolated chromatin was tested by measurement of its content of DNA, proteins, and RNA, by analysis of its protein

  19. Use of molecular beacons for the rapid analysis of DNA damage induced by exposure to an atmospheric pressure plasma jet

    SciTech Connect

    Kurita, Hirofumi E-mail: mizuno@ens.tut.ac.jp; Miyachika, Saki; Yasuda, Hachiro; Takashima, Kazunori; Mizuno, Akira E-mail: mizuno@ens.tut.ac.jp

    2015-12-28

    A rapid method for evaluating the damage caused to DNA molecules upon exposure to plasma is demonstrated. Here, we propose the use of a molecular beacon for rapid detection of DNA strand breaks induced by atmospheric pressure plasma jet (APPJ) irradiation. Scission of the molecular beacon by APPJ irradiation leads to separation of the fluorophore-quencher pair, resulting in an increase in fluorescence that directly correlates with the DNA strand breaks. The results show that the increase in fluorescence intensity is proportional to the exposure time and the rate of fluorescence increase is proportional to the discharge power. This simple and rapid method allows the estimation of DNA damage induced by exposure to a non-thermal plasma.

  20. Effects of Spaceflight on Molecular and Cellular Responses to Bleomycin-induced DNA Damages in Confluent Human Fibroblasts

    NASA Astrophysics Data System (ADS)

    Lu, Tao; Wu, Honglu; Karouia, Fathi; Stodieck, Louis; Zhang, Ye; Wong, Michael

    2016-07-01

    Spaceflights expose human beings to various risk factors. Among them are microgravity related physiological stresses in immune, cytoskeletal, and cardiovascular systems, and space radiation related elevation of cancer risk. Cosmic radiation consists of energetic protons and other heavier charged particles that induce DNA damages. Effective DNA damage response and repair mechanism is important to maintain genomic integrity and reduce cancer risk. There were studies on effects of spaceflight and microgravity on DNA damage response in cell and animal models, but the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on molecular and cellular responses to DNA damages, bleomycin, an anti-cancer drug and radiomimetic reagent, was used to induce DNA damages in confluent human fibroblasts flown to the International Space Station (ISS) and on ground. After exposure to 1.0 mg/ml bleomycin for 3 hours, cells were fixed for immunofluorescence assays and for RNA preparation. Extents of DNA damages were quantified by focus pattern and focus number counting of phosphorylated histone protein H2AX (γg-H2AX). The cells on the ISS showed modestly increased average focus counts per nucleus while the distribution of patterns was similar to that on the ground. PCR array analysis showed that expressions of several genes, including CDKN1A and PCNA, were significantly changed in response to DNA damages induced by bleomycin in both flight and ground control cells. However, there were no significant differences in the overall expression profiles of DNA damage response genes between the flight and ground samples. Analysis of cellular proliferation status with Ki-67 staining showed a slightly higher proliferating population in cells on the ISS than those on ground. Our results suggested that the difference in γg-H2AX focus counts between flight and ground was due to the higher percentage of proliferating cells in space, but spaceflight did not

  1. Pulsewidth-dependent nature of laser-induced DNA damage in RPE cells

    NASA Astrophysics Data System (ADS)

    Hall, Rebecca M.; Glickman, Randolph D.; Rockwell, Benjamin A.; Kumar, Neeru; Noojin, Gary D.

    2001-07-01

    Ultrashort pulse laser radiation may produce cellular damage through unique mechanisms. Primary cultures of bovine retinal pigment epithelial (RPE) cells were exposed to the out put of a Ti:Sapphire laser producing 30 fs (mode-locked) pulses, 44 amplified fs pulses, or continuous wave exposures at 800 nm. Laser exposures at and below the damage threshold were studied. DNA damage was detected using single cell gel electrophoresis (comet assay). Unexposed (control) cells produced short tails with low tail moments. In contrast, all laser-exposed cells showed some degree of DNA fragmentation, but the size and shape of the resulting comets differed among the various modalities. CW-exposed cells produced generally light and relatively compact tails, suggesting fewer and larger DNA fragments, while mode-locked laser exposures (30 fs pulses) resulted in large and diffuse comets, indicating the DNA was fragmented into many very small pieces. Work is continuing to define the relationship of laser pulsewidth and intensity with the degree of DNA fragmentation. These results suggest that DNA damage may result from multiple mechanisms of laser-cell interaction, including multiphoton absorption.

  2. Protection of radiation induced DNA and membrane damages by total triterpenes isolated from Ganoderma lucidum (Fr.) P. Karst.

    PubMed

    Smina, T P; Maurya, D K; Devasagayam, T P A; Janardhanan, K K

    2015-05-25

    The total triterpenes isolated from the fruiting bodies of Ganoderma lucidum was examined for its potential to prevent γ-radiation induced membrane damage in rat liver mitochondria and microsomes. The effects of total triterpenes on γ-radiation-induced DNA strand breaks in pBR 322 plasmid DNA in vitro and human peripheral blood lymphocytes ex vivo were evaluated. The protective effect of total triterpenes against γ-radiation-induced micronuclei formations in mice bone marrow cells in vivo were also evaluated. The results indicated the significant effectiveness of Ganoderma triterpenes in protecting the DNA and membrane damages consequent to the hazardous effects of radiation. The findings suggest the potential use of Ganoderma triterpenes in radio therapy.

  3. DNA damage response curtails detrimental replication stress and chromosomal instability induced by the dietary carcinogen PhIP

    PubMed Central

    Mimmler, Maximilian; Peter, Simon; Kraus, Alexander; Stroh, Svenja; Nikolova, Teodora; Seiwert, Nina; Hasselwander, Solveig; Neitzel, Carina; Haub, Jessica; Monien, Bernhard H.; Nicken, Petra; Steinberg, Pablo; Shay, Jerry W.; Kaina, Bernd; Fahrer, Jörg

    2016-01-01

    PhIP is an abundant heterocyclic aromatic amine (HCA) and important dietary carcinogen. Following metabolic activation, PhIP causes bulky DNA lesions at the C8-position of guanine. Although C8-PhIP-dG adducts are mutagenic, their interference with the DNA replication machinery and the elicited DNA damage response (DDR) have not yet been studied. Here, we analyzed PhIP-triggered replicative stress and elucidated the role of the apical DDR kinases ATR, ATM and DNA-PKcs in the cellular defense response. First, we demonstrate that PhIP induced C8-PhIP-dG adducts and DNA strand breaks. This stimulated ATR-CHK1 signaling, phosphorylation of histone 2AX and the formation of RPA foci. In proliferating cells, PhIP treatment increased the frequency of stalled replication forks and reduced fork speed. Inhibition of ATR in the presence of PhIP-induced DNA damage strongly promoted the formation of DNA double-strand breaks, activation of the ATM-CHK2 pathway and hyperphosphorylation of RPA. The abrogation of ATR signaling potentiated the cell death response and enhanced chromosomal aberrations after PhIP treatment, while ATM and DNA-PK inhibition had only marginal effects. These results strongly support the notion that ATR plays a key role in the defense against cancer formation induced by PhIP and related HCAs. PMID:27599846

  4. Aloe-emodin induced DNA damage through generation of reactive oxygen species in human lung carcinoma cells.

    PubMed

    Lee, Hong-Zin; Lin, Ching-Ju; Yang, Wen-Hui; Leung, Wing-Cheung; Chang, Shen-Pen

    2006-07-28

    The DNA aggregation was found in aloe-emodin-induced H460 cell apoptosis in this study. Aloe-emodin (40microM)-induced DNA single strand breaks were observed by comet assay. Aloe-emodin induced decreases in the mRNA of DNA repair enzymes such as hMTH1, hOGG1 and APE. Although the activity of the radical-scavenging enzyme SOD was enhanced by aloe-emodin, the effects of aloe-emodin on H460 cell apoptosis were suspected to result from the prooxidant. These results suggest that aloe-emodin induced DNA damage through generation of reactive oxygen species in human lung carcinoma cells.

  5. Day and night variations in the repair of ionizing-radiation-induced DNA damage in mouse splenocytes.

    PubMed

    Palombo, Philipp; Moreno-Villanueva, Maria; Mangerich, Aswin

    2015-04-01

    In mammals, biological rhythms synchronize physiological and behavioral processes to the 24-h light-dark (LD) cycle. At the molecular level, self-sustaining processes, such as oscillations of transcription-translation feedback loops, control the circadian clock, which in turn regulates a wide variety of cellular processes, including gene expression and cell cycle progression. Furthermore, previous studies reported circadian oscillations in the repair capacity of DNA lesions specifically repaired by nucleotide excision repair (NER). However, it is so far only poorly understood if DNA repair pathways other than NER are under circadian control, in particular base excision and DNA strand break repair. In the present study, we analyzed potential day and night variations in the repair of DNA lesions induced by ionizing radiation (i.e., mainly oxidative damage and DNA strand breaks) in living mouse splenocytes using a modified protocol of the automated FADU assay. Our results reveal that splenocytes isolated from mice during the light phase (ZT06) displayed higher DNA repair activity than those of the dark phase (ZT18). As analyzed by highly sensitive and accurate qPCR arrays, these alterations were accompanied by significant differences in expression profiles of genes involved in the circadian clock and DNA repair. Notably, the majority of the DNA repair genes were expressed at higher levels during the light phase (ZT06). This included genes of all major DNA repair pathways with the strongest differences observed for genes of base excision and DNA double strand break repair. In conclusion, here we provide novel evidence that mouse splenocytes exhibit significant differences in the repair of IR-induced DNA damage during the LD cycle, both on a functional and on a gene expression level. It will be interesting to test if these findings could be exploited for therapeutic purposes, e.g. time-of-the-day-specific application of DNA-damaging treatments used against blood

  6. Oxidative DNA damage is a preliminary step during rat tongue carcinogenesis induced by 4-nitroquinoline 1-oxide.

    PubMed

    Miranda, Sandra Regina; Noguti, Juliana; Carvalho, Juliana Gonçalves; Oshima, Celina Tijuko Fujiyama; Ribeiro, Daniel Araki

    2011-04-01

    The aim of this study was to investigate oxidative DNA damage during 4-nitroquinoline 1-oxide (4NQO)-induced rat tongue carcinogenesis. For this purpose, male Wistar rats were distributed into three groups of 10 animals each and treated with 50 ppm 4NQO solution through their drinking water for 4, 12, and 20 weeks. Ten animals were used as negative control. The alkaline Comet assay modified with lesion-specific enzymes was used to detect single and double strand breaks, labile sites (SBs), and oxidised purines and pyrimidines. Although no histopathological abnormalities were induced in the epithelium after 4 weeks of carcinogen exposure, oxidative DNA damage was detected in the 'normal' oral epithelium. In pre-neoplastic lesions and squamous cell carcinomas induced after 12 and 20 weeks following carcinogen exposure, respectively, oxidative DNA damage was also increased (P < 0.05) when compared to negative control. In conclusion, our results suggest that oxidative DNA damage is an early event during multistep carcinogenesis assay induced by 4NQO. This kind of approach should be considered to persons with high risk of oral cancer, such as in smokers or alcohol consumers.

  7. Cucurbitacin B induces DNA damage and autophagy mediated by reactive oxygen species (ROS) in MCF-7 breast cancer cells.

    PubMed

    Ren, Guowen; Sha, Tongye; Guo, Jiajie; Li, Wenxue; Lu, Jinjian; Chen, Xiuping

    2015-10-01

    Cucurbitacin B (Cuc B), a natural compound extracted from cucurbitaceous plants, demonstrated potent anticancer activities, while the underlying mechanisms remain unclear. We investigated the anticancer effect of Cuc B on MCF-7 breast cancer cells. Cuc B drastically decreased cell viability in a concentration-dependent manner. Cuc B treatment caused DNA damage, as shown by long tails in the comet assay and increased γH2AX protein expression. Immunofluorescence staining showed that Cuc B treatment induced nuclear γH2AX foci. Cuc B activated DNA damage pathways by phosphorylation of ATM/ATR [two large phosphatidylinositol-3-kinase-like kinase family (PIKKs) members]. Furthermore, it also induced autophagy, as evidenced by monodansylcadaverine (MDC) staining and autophagic protein expression. In addition, Cuc B treatment led to increased reactive oxygen species (ROS) formation, which was inhibited by N-acetyl-L-cysteine (NAC) pretreatment. NAC pretreatment inhibited Cuc-B-induced DNA damage and autophagy. Taken together, these results suggest that ROS-mediated Cuc-B-induced DNA damage and autophagy in MCF-7 cells, which provides new insights into the anticancer molecular mechanism of Cuc B.

  8. Black soybean seed coat polyphenols prevent AAPH-induced oxidative DNA-damage in HepG2 cells

    PubMed Central

    Yoshioka, Yasukiyo; Li, Xiu; Zhang, Tianshun; Mitani, Takakazu; Yasuda, Michiko; Nanba, Fumio; Toda, Toshiya; Yamashita, Yoko; Ashida, Hitoshi

    2017-01-01

    Black soybean seed coat extract (BE), which contains abundant polyphenols such as procyanidins, cyanidin 3-glucoside, (+)-catechin, and (−)­epicatechin, has been reported on health beneficial functions such as antioxidant activity, anti-inflammatory, anti-obesity, and anti-diabetic activities. In this study, we investigated that prevention of BE and its polyphenols on 2,2'-azobis(2-methylpropionamide) dihydrochloride (AAPH)-induced oxidative DNA damage, and found that these polyphenols inhibited AAPH-induced formation of 8-hydroxy-2'-deoxyguanosine (8-OHdG) as a biomarker for oxidative DNA damage in HepG2 cells. Under the same conditions, these polyphenols also inhibited AAPH-induced accumulation of reactive oxygen species (ROS) in the cells. Inhibition of ROS accumulation was observed in both cytosol and nucleus. It was confirmed that these polyphenols inhibited formation of AAPH radical using oxygen radical absorbance capacity assay under the cell-free conditions. These results indicate that polyphenols in BE inhibit free radical-induced oxidative DNA damages by their potent antioxidant activity. Thus, BE is an effective food material for prevention of oxidative stress and oxidative DNA damages. PMID:28366989

  9. Endogenous c-Myc is essential for p53-induced apoptosis in response to DNA damage in vivo.

    PubMed

    Phesse, T J; Myant, K B; Cole, A M; Ridgway, R A; Pearson, H; Muncan, V; van den Brink, G R; Vousden, K H; Sears, R; Vassilev, L T; Clarke, A R; Sansom, O J

    2014-06-01

    Recent studies have suggested that C-MYC may be an excellent therapeutic cancer target and a number of new agents targeting C-MYC are in preclinical development. Given most therapeutic regimes would combine C-MYC inhibition with genotoxic damage, it is important to assess the importance of C-MYC function for DNA damage signalling in vivo. In this study, we have conditionally deleted the c-Myc gene in the adult murine intestine and investigated the apoptotic response of intestinal enterocytes to DNA damage. Remarkably, c-Myc deletion completely abrogated the immediate wave of apoptosis following both ionizing irradiation and cisplatin treatment, recapitulating the phenotype of p53 deficiency in the intestine. Consistent with this, c-Myc-deficient intestinal enterocytes did not upregulate p53. Mechanistically, this was linked to an upregulation of the E3 Ubiquitin ligase Mdm2, which targets p53 for degradation in c-Myc-deficient intestinal enterocytes. Further, low level overexpression of c-Myc, which does not impact on basal levels of apoptosis, elicited sustained apoptosis in response to DNA damage, suggesting c-Myc activity acts as a crucial cell survival rheostat following DNA damage. We also identify the importance of MYC during DNA damage-induced apoptosis in several other tissues, including the thymus and spleen, using systemic deletion of c-Myc throughout the adult mouse. Together, we have elucidated for the first time in vivo an essential role for endogenous c-Myc in signalling DNA damage-induced apoptosis through the control of the p53 tumour suppressor protein.

  10. Deoxycholic acid causes DNA damage while inducing apoptotic resistance through NF-κB activation in benign Barrett's epithelial cells.

    PubMed

    Huo, Xiaofang; Juergens, Stefanie; Zhang, Xi; Rezaei, Davood; Yu, Chunhua; Strauch, Eric D; Wang, Jian-Ying; Cheng, Edaire; Meyer, Frank; Wang, David H; Zhang, Qiuyang; Spechler, Stuart J; Souza, Rhonda F

    2011-08-01

    Gastroesophageal reflux is associated with adenocarcinoma in Barrett's esophagus, but the incidence of this tumor is rising, despite widespread use of acid-suppressing medications. This suggests that refluxed material other than acid might contribute to carcinogenesis. We looked for potentially carcinogenetic effects of two bile acids, deoxycholic acid (DCA) and ursodeoxycholic acid (UDCA), on Barrett's epithelial cells in vitro and in vivo. We exposed Barrett's (BAR-T) cells to DCA or UDCA and studied the generation of reactive oxygen/nitrogen species (ROS/RNS); expression of phosphorylated H2AX (a marker of DNA damage), phosphorylated IkBα, and phosphorylated p65 (activated NF-κB pathway proteins); and apoptosis. During endoscopy in patients, we took biopsy specimens of Barrett's mucosa before and after esophageal perfusion with DCA or UDCA and assessed DNA damage and NF-κB activation. Exposure to DCA, but not UDCA, resulted in ROS/RNS production, DNA damage, and NF-κB activation but did not increase the rate of apoptosis in BAR-T cells. Pretreatment with N-acetyl-l-cysteine (a ROS scavenger) prevented DNA damage after DCA exposure, and DCA did induce apoptosis in cells treated with NF-κB inhibitors (BAY 11-7085 or AdIκB superrepressor). DNA damage and NF-κB activation were detected in biopsy specimens of Barrett's mucosa taken after esophageal perfusion with DCA, but not UDCA. These data show that, in Barrett's epithelial cells, DCA induces ROS/RNS production, which causes genotoxic injury, and simultaneously induces activation of the NF-κB pathway, which enables cells with DNA damage to resist apoptosis. We have demonstrated molecular mechanisms whereby bile reflux might contribute to carcinogenesis in Barrett's esophagus.

  11. Detection of in vivo DNA damage induced by ethanol in multiple organs of pregnant mice using the alkaline single cell gel electrophoresis (Comet) assay.

    PubMed

    Kido, Ryoko; Sato, Itaru; Tsuda, Shuji

    2006-01-01

    Ethanol is principal ingredient of alcohol beverage, but considered as human carcinogen, and has neurotoxicity. Alcohol consumption during pregnancy often causes fetal alcohol syndrome. The DNA damage is one of the important factors in carcinogenicity or teratogenicity. To detect the DNA damage induced by ethanol, we used an in vivo alkaline single cell gel electrophoresis (Comet) assay in pregnant mice organs and embryos. Pregnant ICR mice on Day 7 of gestation were treated with 2, 4 or 8 g/kg ethanol, and maternal organs/tissues and embryos were subjected to the Comet assay at 4, 8, 12 and 24 hr after ethanol treatment. Four and 8 g/kg ethanol induced DNA damage in brain, lung and embryos at 4 or 8 hr after the treatment. Two g/kg ethanol did not cause any DNA damage, and 8 g/kg ethanol only increased the duration of DNA damage without distinct increase in the degree of the damage. No significant DNA damage was observed in the liver. To detect the effect of acetaldehyde, disulfiram, acetaldehyde dehydrogenase inhibitor, was administered before 4 g/kg ethanol treatment. No significant increase of DNA damage was observed in the disulfiram pre-treated group. These data indicate that ethanol induces DNA damage, which might be related to ethanol toxicity. Since pre-treatment of disulfiram did not increase DNA damage, DNA damage observed in this study might not be the effect of acetaldehyde.

  12. Acute DNA damage activates the tumour suppressor p53 to promote radiation-induced lymphoma

    PubMed Central

    Lee, Chang-Lung; Castle, Katherine D.; Moding, Everett J.; Blum, Jordan M.; Williams, Nerissa; Luo, Lixia; Ma, Yan; Borst, Luke B.; Kim, Yongbaek; Kirsch, David G.

    2015-01-01

    Genotoxic cancer therapies, such as chemoradiation, cause haematological toxicity primarily by activating the tumour suppressor p53. While inhibiting p53-mediated cell death during cancer therapy ameliorates haematologic toxicity, whether it also impacts carcinogenesis remains unclear. Here we utilize a mouse model of inducible p53 short hairpin RNA (shRNA) to show that temporarily blocking p53 during total-body irradiation (TBI) not only ameliorates acute toxicity, but also improves long-term survival by preventing lymphoma development. Using KrasLA1 mice, we show that TBI promotes the expansion of a rare population of thymocytes that express oncogenic KrasG12D. However, blocking p53 during TBI significantly suppresses the expansion of KrasG12D-expressing thymocytes. Mechanistically, bone marrow transplant experiments demonstrate that TBI activates p53 to decrease the ability of bone marrow cells to suppress lymphoma development through a non-cell-autonomous mechanism. Together, our results demonstrate that the p53 response to acute DNA damage promotes the development of radiation-induced lymphoma. PMID:26399548

  13. Exposure to 50Hz-sinusoidal electromagnetic field induces DNA damage-independent autophagy.

    PubMed

    Shen, Yunyun; Xia, Ruohong; Jiang, Hengjun; Chen, Yanfeng; Hong, Ling; Yu, Yunxian; Xu, Zhengping; Zeng, Qunli

    2016-08-01

    As electromagnetic field (EMF) is commonly encountered within our daily lives, the biological effects of EMF are of great concern. Autophagy is a key process for maintaining cellular homeostasis, and it can also reveal cellular responses to environmental stimuli. In this study, we aim to investigate the biological effects of a 50Hz-sinusoidal electromagnetic field on autophagy and we identified its mechanism of action in Chinese Hamster Lung (CHL) cells. CHL cells were exposed to a 50Hz sinusoidal EMF at 0.4mT for 30min or 24h. In this study, we found that a 0.4mT EMF resulted in: (i) an increase in LC3-II expression and increased autophagosome formation; (ii) no significant difference in the incidence of γH2AX foci between the sham and exposure groups; (iii) reorganized actin filaments and increased pseudopodial extensions without promoting cell migration; and (iv) enhanced cell apoptosis when autophagy was blocked by Bafilomycin A1. These results implied that DNA damage was not directly involved in the autophagy induced by a 0.4mT 50Hz EMF. In addition, an EMF induced autophagy balanced the cellular homeostasis to protect the cells from severe adverse biological consequences.

  14. Effect of aspirin on chromosome aberration and DNA damage induced by X-rays in mice

    NASA Astrophysics Data System (ADS)

    Niikawa, M.; Chuuriki, K.; Shibuya, K.; Seo, M.; Nagase, H.

    In order to reveal the anticlastogenic potency of aspirin, we evaluated the suppressive ability of aspirin on chromosome aberrations induced by X-ray. Aspirin at doses of 0.5, 5 and 50 mg/kg was administrated intraperitoneally or orally at 0.5 h after or before the X-ray irradiation. The anticlastogenic activity of aspirin on chromosome aberrations induced by X-ray was determined in the mouse micronucleus test and alkaline single cell gel electrophoresis (SCG) assay in vivo. The frequency by polychromatic erythrocytes with micronuclei (MNPCEs) was decreased by about 19-61% at 0.5 h after and about 23-62% at 0.5 h before the X-ray irradiation. DNA damage by X-ray was significantly decreased by oral administration of aspirin at 0.5 h after or before the X-ray irradiation for the SCG assay. We consider aspirin can be used as preventive agents against exposure of X-ray.

  15. Cytotoxicity, apoptosis and DNA damage induced by Alpinia galanga rhizome extract.

    PubMed

    Muangnoi, P; Lu, M; Lee, J; Thepouyporn, A; Mirzayans, R; Le, X C; Weinfeld, M; Changbumrung, S

    2007-07-01

    Alpinia galanga, or galangal, has been a popular condiment used in Thai and Asian cuisine for many years. However, relatively little is known of the potential beneficial or adverse health effects of this spice. This study was conducted to analyze the capacity of galangal extract to induce cytotoxicity and DNA damage in six different human cell lines including normal and p53-inactive fibroblasts, normal epithelial and tumour mammary cells and a lung adenocarcinoma cell line. We deliberately focused on treatment with the crude aqueous extract of galangal rhizomes, rather than compounds extracted into an organic solvent, to more closely reflect the mode of dietary consumption of galangal. The cell lines displayed a broad range of cytotoxicity. There was no evidence for preferential cytotoxicity of tumour cells, but there was an indication that p53-active cell lines may be more sensitive than their p53-inactive counterparts. The contribution of apoptosis to total cell killing was only appreciable after exposure to 300 microg/mL of extract. Apoptosis appeared to be independent of p53 expression. Exposure to as little as 100 microg/mL galangal extract generated a significant level of DNA single-strand breaks as judged by the single-cell gel electrophoresis technique (comet assay). The three major UV-absorbing compounds in the aqueous extract were identified by mass spectrometry as 1'-acetoxychavicol acetate and its deacetylated derivatives. However, when tested in A549 human lung adenocarcinoma cells, these compounds were not responsible for the cytotoxicity induced by the complete aqueous extract.

  16. Inhibition of autophagy enhances DNA damage-induced apoptosis by disrupting CHK1-dependent S phase arrest

    SciTech Connect

    Liou, Jong-Shian; Wu, Yi-Chen; Yen, Wen-Yen; Tang, Yu-Shuan; Kakadiya, Rajesh B.; Su, Tsann-Long; Yih, Ling-Huei

    2014-08-01

    DNA damage has been shown to induce autophagy, but the role of autophagy in the DNA damage response and cell fate is not fully understood. BO-1012, a bifunctional alkylating derivative of 3a-aza-cyclopenta[a]indene, is a potent DNA interstrand cross-linking agent with anticancer activity. In this study, BO-1012 was found to reduce DNA synthesis, inhibit S phase progression, and induce phosphorylation of histone H2AX on serine 139 (γH2AX) exclusively in S phase cells. Both CHK1 and CHK2 were phosphorylated in response to BO-1012 treatment, but only depletion of CHK1, but not CHK2, impaired BO-1012-induced S phase arrest and facilitated the entry of γH2AX-positive cells into G2 phase. CHK1 depletion also significantly enhanced BO-1012-induced cell death and apoptosis. These results indicate that BO-1012-induced S phase arrest is a CHK1-dependent pro-survival response. BO-1012 also resulted in marked induction of acidic vesicular organelle (AVO) formation and microtubule-associated protein 1 light chain 3 (LC3) processing and redistribution, features characteristic of autophagy. Depletion of ATG7 or co-treatment of cells with BO-1012 and either 3-methyladenine or bafilomycin A1, two inhibitors of autophagy, not only reduced CHK1 phosphorylation and disrupted S phase arrest, but also increased cleavage of caspase-9 and PARP, and cell death. These results suggest that cells initiate S phase arrest and autophagy as pro-survival responses to BO-1012-induced DNA damage, and that suppression of autophagy enhances BO-1012-induced apoptosis via disruption of CHK1-dependent S phase arrest. - Highlights: • Autophagy inhibitors enhanced the cytotoxicity of a DNA alkylating agent, BO-1012. • BO-1012-induced S phase arrest was a CHK1-dependent pro-survival response. • Autophagy inhibition enhanced BO-1012 cytotoxicity via disrupting the S phase arrest.

  17. Cisplatin-induced self-assembly of graphene oxide sheets into spherical nanoparticles for damaging sub-cellular DNA.

    PubMed

    Nandi, Aditi; Mallick, Abhik; More, Piyush; Sengupta, Poulomi; Ballav, Nirmalya; Basu, Sudipta

    2017-01-24

    This report describes the hitherto unobserved cisplatin induced self-assembly of 2D-graphene oxide sheets into 3D-spherical nano-scale particles. These nanoparticles can encompass dual DNA damaging drugs simultaneously. A combination of confocal microscopy, gel electrophoresis and flow cytometry studies clearly demonstrated that these novel nanoparticles can internalize into cancer cells by endocytosis, localize into lysosomes, and damage DNA, leading to apoptosis. Cell viability assays indicated that these nanoparticles were more cytotoxic towards cancer cells compared to healthy cells.

  18. Cantharidin induces DNA damage and inhibits DNA repair-associated protein levels in NCI-H460 human lung cancer cells.

    PubMed

    Hsia, Te-Chun; Lin, Ju-Hwa; Hsu, Shu-Chun; Tang, Nou-Ying; Lu, Hsu-Feng; Wu, Shin-Hwar; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-09-01

    Cantharidin is one of the major compounds from mylabris and it has cytotoxic effects in many different types of human cancer cells. Previously, we found that cantharidin induced cell death through cell cycle arrest and apoptosis induction in human lung cancer NCI-H460 cells. However, cantharidin-affected DNA damage, repair, and associated protein levels in NCI-H460 cells have not been examined. In this study, we determined whether cantharidin induced DNA damage and condensation and altered levels of proteins in NCI-H460 cells in vitro. Incubation of NCI-H460 cells with 0, 2.5, 5, 10, and 15 μM of cantharidin caused a longer DNA migration smear (comet tail). Cantharidin also increased DNA condensation. These effects were dose-dependent. Cantharidin (5, 10, and 15 μM) treatment of NCI-H460 cells reduced protein levels of ataxia telangiectasia mutated (ATM), breast cancer 1, early onset (BRCA-1), 14-3-3 proteins sigma (14-3-3σ), DNA-dependent serine/threonine protein kinase (DNA-PK), O(6) -methylguanine-DNA methyltransferase (MGMT), and mediator of DNA damage checkpoint protein 1 (MDC1). Protein translocation of p-p53, p-H2A.X (S140), and MDC1 from cytoplasm to nucleus was induced by cantharidin in NCI-H460 cells. Taken together, this study showed that cantharidin caused DNA damage and inhibited levels of DNA repair-associated proteins. These effects may contribute to cantharidin-induced cell death in vitro.

  19. Gold nanoparticles induce DNA damage in the blood and liver of rats

    NASA Astrophysics Data System (ADS)

    Cardoso, Eria; Londero, Eduardo; Ferreira, Gabriela Kozuchovski; Rezin, Gislaine Tezza; Zanoni, Elton Torres; de Souza Notoya, Frederico; Leffa, Daniela Dimer; Damiani, Adriani Paganini; Daumann, Francine; Rohr, Paula; da Silva, Luciano; Andrade, Vanessa M.; da Silva Paula, Marcos Marques

    2014-11-01

    The potential of gold nanoparticles (GNPs) for use in different biological applications has led to a strong interest in the study of their possible deleterious effects in biological systems and how these effects may be mitigated. This study was undertaken to investigate the effects of the acute and chronic administration of GNPs with mean diameters of 10 and 30 nm on deoxyribonucleic acid (DNA) damage in the blood and liver of adult rats. For the acute administration, Wistar adult rats received a single intraperitoneal injection of either GNPs or a saline solution. For the chronic administration, Wistar adult rats received a daily single injection of the same GNPs or saline solution for 28 days. Twenty-four hours after either the single (acute) or final injection (chronic), the rats were euthanised by decapitation, and the blood and liver were isolated for the evaluation of DNA damage. In this study, we demonstrated that the acute and chronic administration of GNPs 10 and 30 nm in size increased the frequency of DNA damage and the damage index in the blood and liver of adult rats. These findings suggest that the DNA damage may be caused by oxidative stress, which occurred regardless of the type of administration and GNP size.

  20. Assessment of gamma ray-induced DNA damage in Lasioderma serricorne using the comet assay

    NASA Astrophysics Data System (ADS)

    Kameya, Hiromi; Miyanoshita, Akihiro; Imamura, Taro; Todoriki, Setsuko

    2012-03-01

    We attempted a DNA comet assay under alkaline conditions to verify the irradiation treatment of pests. Lasioderma serricorne (Fabricius) were chosen as test insects and irradiated with gamma rays from a 60Co source at 1 kGy. We conducted the comet assay immediately after irradiation and over time for 7 day. Severe DNA fragmentation in L. serricorne cells was observed just after irradiation and the damage was repaired during the post-irradiation period in a time-dependent manner. The parameters of the comet image analysis were calculated, and the degree of DNA damage and repair were evaluated. Values for the Ratio (a percentage determined by fluorescence in the damaged area to overall luminance, including intact DNA and the damaged area of a comet image) of individual cells showed that no cells in the irradiated group were included in the Ratio<0.1 category, the lowest grade. This finding was observed consistently throughout the 7-day post-irradiation period. We suggest that the Ratio values of individual cells can be used as an index of irradiation history and conclude that the DNA comet assay under alkaline conditions, combined with comet image analysis, can be used to identify irradiation history.

  1. DNA repair efficiency in germ cells and early mouse embryos and consequences for radiation-induced transgenerational genomic damage

    SciTech Connect

    Marchetti, Francesco; Wyrobek, Andrew J.

    2009-01-18

    Exposure to ionizing radiation and other environmental agents can affect the genomic integrity of germ cells and induce adverse health effects in the progeny. Efficient DNA repair during gametogenesis and the early embryonic cycles after fertilization is critical for preventing transmission of DNA damage to the progeny and relies on maternal factors stored in the egg before fertilization. The ability of the maternal repair machinery to repair DNA damage in both parental genomes in the fertilizing egg is especially crucial for the fertilizing male genome that has not experienced a DNA repair-competent cellular environment for several weeks prior to fertilization. During the DNA repair-deficient period of spermatogenesis, DNA lesions may accumulate in sperm and be carried into the egg where, if not properly repaired, could result in the formation of heritable chromosomal aberrations or mutations and associated birth defects. Studies with female mice deficient in specific DNA repair genes have shown that: (i) cell cycle checkpoints are activated in the fertilized egg by DNA damage carried by the sperm; and (ii) the maternal genotype plays a major role in determining the efficiency of repairing genomic lesions in the fertilizing sperm and directly affect the risk for abnormal reproductive outcomes. There is also growing evidence that implicates DNA damage carried by the fertilizing gamete as a mediator of postfertilization processes that contribute to genomic instability in subsequent generations. Transgenerational genomic instability most likely involves epigenetic mechanisms or error-prone DNA repair processes in the early embryo. Maternal and embryonic DNA repair processes during the early phases of mammalian embryonic development can have far reaching consequences for the genomic integrity and health of subsequent generations.

  2. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    PubMed

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation.

  3. Gene 33/Mig6 inhibits hexavalent chromium-induced DNA damage and cell transformation in human lung epithelial cells

    PubMed Central

    Park, Soyoung; Li, Cen; Zhao, Hong; Darzynkiewicz, Zbigniew; Xu, Dazhong

    2016-01-01

    Hexavalent Chromium [Cr(VI)] compounds are human lung carcinogens and environmental/occupational hazards. The molecular mechanisms of Cr(VI) carcinogenesis appear to be complex and are poorly defined. In this study, we investigated the potential role of Gene 33 (ERRFI1, Mig6), a multifunctional adaptor protein, in Cr(VI)-mediated lung carcinogenesis. We show that the level of Gene 33 protein is suppressed by both acute and chronic Cr(VI) treatments in a dose- and time-dependent fashion in BEAS-2B lung epithelial cells. The inhibition also occurs in A549 lung bronchial carcinoma cells. Cr(VI) suppresses Gene 33 expression mainly through post-transcriptional mechanisms, although the mRNA level of gene 33 also tends to be lower upon Cr(VI) treatments. Cr(VI)-induced DNA damage appears primarily in the S phases of the cell cycle despite the high basal DNA damage signals at the G2M phase. Knockdown of Gene 33 with siRNA significantly elevates Cr(VI)-induced DNA damage in both BEAS-2B and A549 cells. Depletion of Gene 33 also promotes Cr(VI)-induced micronucleus (MN) formation and cell transformation in BEAS-2B cells. Our results reveal a novel function of Gene 33 in Cr(VI)-induced DNA damage and lung epithelial cell transformation. We propose that in addition to its role in the canonical EGFR signaling pathway and other signaling pathways, Gene 33 may also inhibit Cr(VI)-induced lung carcinogenesis by reducing DNA damage triggered by Cr(VI). PMID:26760771

  4. Autophagy Promotes the Repair of Radiation-Induced DNA Damage in Bone Marrow Hematopoietic Cells via Enhanced STAT3 Signaling.

    PubMed

    Xu, Fei; Li, Xin; Yan, Lili; Yuan, Na; Fang, Yixuan; Cao, Yan; Xu, Li; Zhang, Xiaoying; Xu, Lan; Ge, Chaorong; An, Ni; Jiang, Gaoyue; Xie, Jialing; Zhang, Han; Jiang, Jiayi; Li, Xiaotian; Yao, Lei; Zhang, Suping; Zhou, Daohong; Wang, Jianrong

    2017-03-01

    Autophagy protects hematopoietic cells from radiation damage in part by promoting DNA damage repair. However, the molecular mechanisms by which autophagy regulates DNA damage repair remain largely elusive. Here, we report that this radioprotective effect of autophagy depends on STAT3 signaling in murine bone marrow mononuclear cells (BM-MNCs). Specifically, we found that STAT3 activation and nuclear translocation in BM-MNCs were increased by activation of autophagy with an mTOR inhibitor and decreased by knockout of the autophagy gene Atg7. The autophagic regulation of STAT3 activation is likely mediated by induction of KAP1 degradation, because we showed that KAP1 directly interacted with STAT3 in the cytoplasm and knockdown of KAP1 increased the phosphorylation and nuclear translocation of STAT3. Subsequently, activated STAT3 transcriptionally upregulated the expression of BRCA1, which increased the ability of BM-MNCs to repair radiation-induced DNA damage. This novel finding that activation of autophagy can promote DNA damage repair in BM-MNCs via the ATG-KAP1-STAT3-BRCA1 pathway suggests that autophagy plays an important role in maintaining genomic integrity of BM-MNCs and its activation may confer protection of BM-MNCs against radiation-induced genotoxic stress.

  5. A novel ruthenium(II)-polypyridyl complex inhibits cell proliferation and induces cell apoptosis by impairing DNA damage repair.

    PubMed

    Yang, Qingyuan; Zhang, Zhao; Mei, Wenjie; Sun, Fenyong

    2014-08-01

    Ruthenium complexes are widely recognized as one of the most promising DNA damaging chemotherapeutic drugs. The main goal of this study was to explore the anticancer activity and underlying mechanisms of [Ru(phen)(2)(p-BrPIP)](ClO(4))(2), a novel chemically synthesized ruthenium (Ru) complex. To this end, we employed MTT assays to determine the anticancer activity of the complex, and performed single-cell gel electrophoresis (SCGE) and Western blotting to evaluate DNA damage. Our results showed that the Ru(II)-poly complex caused severe DNA damage, possibly by downregulating key factors involved in DNA repair pathways, such as proliferating cell nuclear antigen (PCNA) and ring finger protein 8 (RNF8). In addition, this complex induced cell apoptosis by upregulating both p21 and p53. Taken together, our findings demonstrate that the Ru(II)-poly complex exhibits antitumour activity by inducing cell apoptosis, which results from the accumulation of large amounts of unrepaired DNA damage.

  6. Cadmium Induced Cell Apoptosis, DNA Damage, Decreased DNA Repair Capacity, and Genomic Instability during Malignant Transformation of Human Bronchial Epithelial Cells

    PubMed Central

    Zhou, Zhiheng; Wang, Caixia; Liu, Haibai; Huang, Qinhai; Wang, Min; Lei, Yixiong

    2013-01-01

    Cadmium and its compounds are well-known human carcinogens, but the mechanisms underlying the carcinogenesis are not entirely understood. Our study was designed to elucidate the mechanisms of DNA damage in cadmium-induced malignant transformation of human bronchial epithelial cells. We analyzed cell cycle, apoptosis, DNA damage, gene expression, genomic instability, and the sequence of exons in DNA repair genes in several kinds of cells. These cells consisted of untreated control cells, cells in the fifth, 15th, and 35th passage of cadmium-treated cells, and tumorigenic cells from nude mice using flow cytometry, Hoechst 33258 staining, comet assay, quantitative real-time polymerase chain reaction (PCR), Western blot analysis, random amplified polymorphic DNA (RAPD)-PCR, and sequence analysis. We observed a progressive increase in cell population of the G0/G1 phase of the cell cycle and the rate of apoptosis, DNA damage, and cadmium-induced apoptotic morphological changes in cerebral cortical neurons during malignant transformation. Gene expression analysis revealed increased expression of cell proliferation (PCNA), cell cycle (CyclinD1), pro-apoptotic activity (Bax), and DNA damage of the checkpoint genes ATM, ATR, Chk1, Chk2, Cdc25A. Decreased expression of the anti-apoptotic gene Bcl-2 and the DNA repair genes hMSH2, hMLH1, ERCC1, ERCC2, and hOGG1 was observed. RAPD-PCR revealed genomic instability in cadmium-exposed cells, and sequence analysis showed mutation of exons in hMSH2, ERCC1, XRCC1, and hOGG1 in tumorigenic cells. This study suggests that Cadmium can increase cell apoptosis and DNA damage, decrease DNA repair capacity, and cause mutations, and genomic instability leading to malignant transformation. This process could be a viable mechanism for cadmium-induced cancers. PMID:24046522

  7. Reversal of DNA damage induced Topoisomerase 2 DNA–protein crosslinks by Tdp2

    PubMed Central

    Schellenberg, Matthew J.; Perera, Lalith; Strom, Christina N.; Waters, Crystal A.; Monian, Brinda; Appel, C. Denise; Vilas, Caroline K.; Williams, Jason G.; Ramsden, Dale A.; Williams, R. Scott

    2016-01-01

    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA–protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg2+-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg2+ binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons. PMID:27060144

  8. Lanatoside C suppressed colorectal cancer cell growth by inducing mitochondrial dysfunction and increased radiation sensitivity by impairing DNA damage repair.

    PubMed

    Kang, Mi Ae; Kim, Mi-Sook; Kim, Wonwoo; Um, Jee-Hyun; Shin, Young-Joo; Song, Jie-Young; Jeong, Jae-Hoon

    2016-02-02

    Cardiac glycosides are clinically used for cardiac arrhythmias. In this study, we investigated the mechanism responsible for anti-cancer and radiosensitizing effects of lanatoside C in colorectal cancer cells. Lanatoside C-treated cells showed classic patterns of autophagy, which may have been caused by lanatoside C-induced mitochondrial aggregation or degeneration. This mitochondrial dysfunction was due to disruption of K+ homeostasis, possibly through inhibition of Na+/K+-ATPase activity. In addition, lanatoside C sensitized HCT116 cells (but not HT-29 cells) to radiation in vitro. γ-H2AX, a representative marker of DNA damage, were sustained longer after combination of irradiation with lanatoside C, suggesting lanatoside C impaired DNA damage repair processes. Recruitment of 53BP1 to damaged DNA, a critical initiation step for DNA damage repair signaling, was significantly suppressed in lanatoside C-treated HCT116 cells. This may have been due to defects in the RNF8- and RNF168-dependent degradation of KDM4A/JMJD2A that increases 53BP1 recruitment to DNA damage sites. Although lanatoside C alone reduced tumor growth in the mouse xenograft tumor model, combination of lanatoside C and radiation inhibited tumor growth more than single treatments. Thus, lanatoside C could be a potential molecule for anti-cancer drugs and radiosensitizing agents.

  9. Lanatoside C suppressed colorectal cancer cell growth by inducing mitochondrial dysfunction and increased radiation sensitivity by impairing DNA damage repair

    PubMed Central

    Kang, Mi Ae; Kim, Mi-Sook; Kim, Wonwoo; Um, Jee-Hyun; Shin, Young-Joo; Song, Jie-Young; Jeong, Jae-Hoon

    2016-01-01

    Cardiac glycosides are clinically used for cardiac arrhythmias. In this study, we investigated the mechanism responsible for anti-cancer and radiosensitizing effects of lanatoside C in colorectal cancer cells. Lanatoside C-treated cells showed classic patterns of autophagy, which may have been caused by lanatoside C-induced mitochondrial aggregation or degeneration. This mitochondrial dysfunction was due to disruption of K+ homeostasis, possibly through inhibition of Na+/K+-ATPase activity. In addition, lanatoside C sensitized HCT116 cells (but not HT-29 cells) to radiation in vitro. γ-H2AX, a representative marker of DNA damage, were sustained longer after combination of irradiation with lanatoside C, suggesting lanatoside C impaired DNA damage repair processes. Recruitment of 53BP1 to damaged DNA, a critical initiation step for DNA damage repair signaling, was significantly suppressed in lanatoside C-treated HCT116 cells. This may have been due to defects in the RNF8- and RNF168-dependent degradation of KDM4A/JMJD2A that increases 53BP1 recruitment to DNA damage sites. Although lanatoside C alone reduced tumor growth in the mouse xenograft tumor model, combination of lanatoside C and radiation inhibited tumor growth more than single treatments. Thus, lanatoside C could be a potential molecule for anti-cancer drugs and radiosensitizing agents. PMID:26756216

  10. Inhibition of root growth by narciclasine is caused by DNA damage-induced cell cycle arrest in lettuce seedlings.

    PubMed

    Hu, Yanfeng; Li, Jiaolong; Yang, Lijing; Nan, Wenbin; Cao, Xiaoping; Bi, Yurong

    2014-09-01

    Narciclasine (NCS) is an Amaryllidaceae alkaloid isolated from Narcissus tazetta bulbs. Its phytotoxic effects on plant growth were examined in lettuce (Lactuca sativa L.) seedlings. Results showed that high concentrations (0.5-5 μM) of NCS restricted the growth of lettuce roots in a dose-dependent manner. In NCS-treated lettuce seedlings, the following changes were detected: reduction of mitotic cells and cell elongation in the mature region, inhibition of proliferation of meristematic cells, and cell cycle. Moreover, comet assay and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay indicated that higher levels NCS (0.5-5 μM) induced DNA damage in root cells of lettuce. The decrease in meristematic cells and increase in DNA damage signals in lettuce roots in responses to NCS are in a dose-dependent manner. NCS-induced reactive oxygen species accumulation may explain an increase in DNA damage in lettuce roots. Thus, the restraint of root growth is due to cell cycle arrest which is caused by NCS-induced DNA damage. In addition, it was also found that NCS (0.5-5 μM) inhibited the root hair development of lettuce seedlings. Further investigations on the underlying mechanism revealed that both auxin and ethylene signaling pathways are involved in the response of root hairs to NCS.

  11. Troglitazone, but not rosiglitazone, damages mitochondrial DNA and induces mitochondrial dysfunction and cell death in human hepatocytes

    SciTech Connect

    Rachek, Lyudmila I.; Yuzefovych, Larysa V.; LeDoux, Susan P.; Julie, Neil L.; Wilson, Glenn L.

    2009-11-01

    Thiazolidinediones (TZDs), such as troglitazone (TRO) and rosiglitazone (ROSI), improve insulin resistance by acting as ligands for the nuclear receptor peroxisome proliferator-activated receptor-gamma (PPARgamma). TRO was withdrawn from the market because of reports of serious hepatotoxicity. A growing body of evidence suggests that TRO caused mitochondrial dysfunction and induction of apoptosis in human hepatocytes but its mechanisms of action remain unclear. We hypothesized that damage to mitochondrial DNA (mtDNA) is an initiating event involved in TRO-induced mitochondrial dysfunction and hepatotoxicity. Primary human hepatocytes were exposed to TRO and ROSI. The results obtained revealed that TRO, but not ROSI at equimolar concentrations, caused a substantial increase in mtDNA damage and decreased ATP production and cellular viability. The reactive oxygen species (ROS) scavenger, N-acetyl cystein (NAC), significantly diminished the TRO-induced cytotoxicity, suggesting involvement of ROS in TRO-induced hepatocyte cytotoxicity. The PPARgamma antagonist (GW9662) did not block the TRO-induced decrease in cell viability, indicating that the TRO-induced hepatotoxicity is PPARgamma-independent. Furthermore, TRO induced hepatocyte apoptosis, caspase-3 cleavage and cytochrome c release. Targeting of a DNA repair protein to mitochondria by protein transduction using a fusion protein containing the DNA repair enzyme Endonuclease III (EndoIII) from Escherichia coli, a mitochondrial translocation sequence (MTS) and the protein transduction domain (PTD) from HIV-1 TAT protein protected hepatocytes against TRO-induced toxicity. Overall, our results indicate that significant mtDNA damage caused by TRO is a prime initiator of the hepatoxicity caused by this drug.

  12. The use of ultraviolet resonance Raman spectroscopy in the analysis of ionizing-radiation-induced damage in DNA.

    PubMed

    Shaw, C P; Jirasek, A

    2009-04-01

    Ultraviolet resonance Raman spectroscopy (UVRRS) was used to determine damage done in both calf-thymus DNA (CT-DNA) and a short stranded DNA oligomer (SS-DNA) due to ionizing radiation from a medical (60)Co radiation therapy unit used in the treatment of cancer. Spectra were acquired at incident UV wavelengths of 248, 257, and 264 nm in order to utilize the differences in UVRR cross-sections of the bases with wavelength. Through the analysis of difference spectra between irradiated and unirradiated DNA at each of the incident UV wavelengths, damage to CT- and SS-DNA was observed and identified. Significant radiation-induced increases in the difference spectra of the CT-DNA indicated disruption of the stable, stacked structure of its bases, as well as the disruption of Watson-Crick hydrogen bonds between the base pairs. Base unstacking was not as evident in the SS-DNA, while radiation-induced spectral decreases suggest disruption of the structure of the nucleotides. As demonstrated, UVRRS has the ability to highlight contributions from specific moieties with the use of varying incident UV wavelengths, thus enhancing the already information-rich content of the Raman spectra.

  13. Mechanisms of Damage to DNA Labeled with Electrophilic Nucleobases Induced by Ionizing or UV Radiation.

    PubMed

    Rak, Janusz; Chomicz, Lidia; Wiczk, Justyna; Westphal, Kinga; Zdrowowicz, Magdalena; Wityk, Paweł; Żyndul, Michał; Makurat, Samanta; Golon, Łukasz

    2015-07-02

    Hypoxia--a hallmark of solid tumors--makes hypoxic cells radioresistant. On the other hand, DNA, the main target of anticancer therapy, is not sensitive to the near UV photons and hydrated electrons, one of the major products of water radiolysis under hypoxic conditions. A possible way to overcome these obstacles to the efficient radio- and photodynamic therapy of cancer is to sensitize the cellular DNA to electrons and/or ultraviolet radiation. While incorporated into genomic DNA, modified nucleosides, 5-bromo-2'-deoxyuridine in particular, sensitize cells to both near-ultraviolet photons and γ rays. It is believed that, in both sensitization modes, the reactive nucleobase radical is formed as a primary product which swiftly stabilizes, leading to serious DNA damage, like strand breaks or cross-links. However, despite the apparent similarity, such radio- and photosensitization of DNA seems to be ruled by fundamentally different mechanisms. In this review, we demonstrate that the most important factors deciding on radiodamage to the labeled DNA are (i) the electron affinity (EA) of modified nucleoside (mNZ), (ii) the local surroundings of the label that significantly influences the EA of mNZ, and (iii) the strength of the chemical bond holding together the substituent and a nucleobase. On the other hand, we show that the UV damage to sensitized DNA is governed by long-range photoinduced electron transfer, the efficiency of which is controlled by local DNA sequences. A critical review of the literature mechanisms concerning both types of damage to the labeled biopolymer is presented. Ultimately, the perspectives of studies on DNA sensitization in the context of cancer therapy are discussed.

  14. Reduction of DNA damage induced by titanium dioxide nanoparticles through Nrf2 in vitro and in vivo.

    PubMed

    Shi, Zhiqin; Niu, Yujie; Wang, Qian; Shi, Lei; Guo, Huicai; Liu, Yi; Zhu, Yue; Liu, Shufeng; Liu, Chao; Chen, Xin; Zhang, Rong

    2015-11-15

    Titanium dioxide nanoparticles (Nano-TiO2) are widely used to additives in cosmetics, pharmaceutical, paints and foods. Recent studies have demonstrated that Nano-TiO2 induces DNA damage and increased the risk of cancer and the mechanism might relate with oxidative stress. The aim of this study was to evaluate the effects of Nuclear factor erythroid 2 (NF-E2)-related factor 2 (Nrf2), an anti-oxidative mediator, on DNA damage induced by Nano-TiO2. Wildtype, Nrf2 knockout (Nrf2(-/-)) and tert-butylhydroquinone (tBHQ) pre-treated HepG2 cells and mice were treated with Nano-TiO2. And then the oxidative stress and DNA damage were evaluated. Our data showed that DNA damage, reactive oxygen species (ROS) generation and MDA content in Nano-TiO2 exposed cells were significantly increased than those of control in dose dependent manners. Nrf2/ARE droved the downstream genes including NAD(P)H dehydrogenase [quinine] 1(NQO1), heme oxygenase 1 (HO-1) and glutamate-cysteine ligase catalytic subunit (GCLC) expression were significantly higher in wildtype HepG2 cells after Nano-TiO2 treatment. After treatment with Nano-TiO2, the DNA damages were significantly increased in Nrf(-/-) cells and mice whereas significantly decreased in tBHQ pre-treatment cells and mice, compared with the wildtype HepG2 cells and mice, respectively. Our results indicated that the acquired of Nrf2 leads to a decreased susceptibility to DNA damages induction by Nano-TiO2 and decreasing of risk of cancer which would provide a strategy for a more efficacious sensitization of against of Nano-TiO2 toxication.

  15. Characterization of Pph3-mediated dephosphorylation of Rad53 during methyl methanesulfonate-induced DNA damage repair in Candida albicans.

    PubMed

    Yao, Guangyin; Wan, Junhua; Liu, Qizheng; Mu, Chunhua; Wang, Yue; Sang, Jianli

    2017-02-09

    Genotoxic stress causes DNA damage or stalled DNA replication and filamentous growth in the pathogenic fungus Candida albicans The DNA checkpoint kinase Rad53 critically regulates by phosphorylation effectors that execute the stress response. Rad53 itself is activated by phosphorylation and inactivated by dephosphorylation. Previous studies have suggested that the phosphatase Pph3 dephosphorylates Rad53. Here, we used mass spectrometry and mutagenesis to identify Pph3 dephosphorylation sites on Rad53 in C. albicans We found that serine residues 351, 461, and 477, which were dephosphorylated in wild-type cells during the recovery from DNA damage caused by methyl methanesulfonate (MMS), remained phosphorylated in pph3Δ/Δ cells. Phosphomimetic mutation of the three residues ( rad53-3D ) impaired Rad53 dephosphorylation, exit from cell cycle arrest, dephosphorylation of two Rad53 effectors Dun1 and Dbf4, and the filament-to-yeast growth transition during the recovery from MMS-induced DNA damage. The phenotypes observed in the rad53-3D mutant also occurred in the pph3Δ/Δ mutant. Together, our findings reveal a molecular mechanism by which Pph3 controls DNA damage response in C. albicans.

  16. Evaluation of γ-radiation-induced DNA damage in two species of bivalves and their relative sensitivity using comet assay.

    PubMed

    Praveen Kumar, M K; Shyama, S K; Sonaye, B S; Naik, U Roshini; Kadam, S B; Bipin, P D; D'costa, A; Chaubey, R C

    2014-05-01

    Ionizing radiation is known to induce genetic damage in diverse groups of organisms. Under accidental situations, large quantities of radioactive elements get released into the environment and radiation emitted from these radionuclides may adversely affect both the man and the non-human biota. The present study is aimed (a) to know the genotoxic effect of gamma radiation on aquatic fauna employing two species of selected bivalves, (b) to evaluate the possible use of 'Comet assay' for detecting genetic damage in haemocytes of bivalves as a biomarker for environmental biomonitoring and also (c) to compare the relative sensitivity of two species of bivalves viz. Paphia malabarica and Meretrix casta to gamma radiation. The comet assays was optimized and validated using different concentrations (18, 32 and 56 mg/L) of ethyl methanesulfonate (EMS), a direct-acting reference genotoxic agent, to which the bivalves were exposed for various times (24, 48 and 72 h). Bivalves were irradiated (single acute exposure) with 5 different doses (viz. 2, 4, 6, 8 and 10 Gy) of gamma radiation and their genotoxic effects on the haemocytes were studied using the comet assay. Haemolymph was collected from the adductor muscle at 24, 48 and 72 h of both EMS-exposed and irradiated bivalves and comet assay was carried out using standard protocol. A significant increase in DNA damage was observed as indicated by an increase in % tail DNA damage at different concentrations of EMS and all the doses of gamma radiation as compared to controls in both bivalve species. This showed a dose-dependent increase of genetic damage induced in bivalves by EMS as well as gamma radiation. Further, the highest DNA damage was observed at 24h. The damage gradually decreased with time, i.e. was smaller at 48 and 72 h than at 24h post irradiation in both species of bivalves. This may indicate repair of the damaged DNA and/or loss of heavily damaged cells as the post irradiation time advanced. The present study

  17. Base damage within single-strand DNA underlies in vivo hypermutability induced by a ubiquitous environmental agent.

    PubMed

    Chan, Kin; Sterling, Joan F; Roberts, Steven A; Bhagwat, Ashok S; Resnick, Michael A; Gordenin, Dmitry A

    2012-01-01

    Chromosomal DNA must be in single-strand form for important transactions such as replication, transcription, and recombination to occur. The single-strand DNA (ssDNA) is more prone to damage than double-strand DNA (dsDNA), due to greater exposure of chemically reactive moieties in the nitrogenous bases. Thus, there can be agents that damage regions of ssDNA in vivo while being inert toward dsDNA. To assess the potential hazard posed by such agents, we devised an ssDNA-specific mutagenesis reporter system in budding yeast. The reporter strains bear the cdc13-1 temperature-sensitive mutation, such that shifting to 37°C results in telomere uncapping and ensuing 5' to 3' enzymatic resection. This exposes the reporter region, containing three closely-spaced reporter genes, as a long 3' ssDNA overhang. We validated the ability of the system to detect mutagenic damage within ssDNA by expressing a modified human single-strand specific cytosine deaminase, APOBEC3G. APOBEC3G induced a high density of substitutions at cytosines in the ssDNA overhang strand, resulting in frequent, simultaneous inactivation of two reporter genes. We then examined the mutagenicity of sulfites, a class of reactive sulfur oxides to which humans are exposed frequently via respiration and food intake. Sulfites, at a concentration similar to that found in some foods, induced a high density of mutations, almost always as substitutions at cytosines in the ssDNA overhang strand, resulting in simultaneous inactivation of at least two reporter genes. Furthermore, sulfites formed a long-lived adducted 2'-deoxyuracil intermediate in DNA that was resistant to excision by uracil-DNA N-glycosylase. This intermediate was bypassed by error-prone translesion DNA synthesis, frequently involving Pol ζ, during repair synthesis. Our results suggest that sulfite-induced lesions in DNA can be particularly deleterious, since cells might not possess the means to repair or bypass such lesions accurately.

  18. Enhanced susceptibility of ovaries from obese mice to 7,12-dimethylbenz[a]anthracene-induced DNA damage

    PubMed Central

    Ganesan, Shanthi; Nteeba, Jackson; Keating, Aileen F.

    2014-01-01

    7,12-dimethylbenz[a]anthracene (DMBA) depletes ovarian follicles and induces DNA damage in extra-ovarian tissues, thus, we investigated ovarian DMBA-induced DNA damage. Additionally, since obesity is associated with increased offspring birth defect incidence, we hypothesized that a DMBA-induced DNA damage response (DDR) is compromised in ovaries from obese females. Wild type (lean) non agouti (a/a) and KK.Cg-Ay/J heterozygote (obese) mice were dosed with sesame oil or DMBA (1mg/kg; intraperitoneal injection) at 18 wks of age, for 14 days. Total ovarian RNA and protein were isolated and abundance of Ataxia telangiectasia mutated (Atm), X-ray repair complementing defective repair in chinese hamster cells 6 (Xrcc6), Breast cancer type 1 (Brca1), Rad 51 homolog (Rad51), Poly [ADP-ribose] polymerase 1 (Parp1) and Protein kinase, DNA-activated, catalytic polypeptide (Prkdc) were quantified by RT-PCR or Western blot. Phosphorylated histone H2AX (γH2AX) level was determined by Western blotting. Obesity decreased (P < 0.05) basal protein abundance of PRKDC and BRCA1 proteins but increased (P < 0.05) γH2AX and PARP1 proteins. Ovarian ATM, XRCC6, PRKDC, RAD51 and PARP1 proteins were increased (P < 0.05) by DMBA exposure in lean mice. A blunted DMBA-induced increase (P < 0.05) in XRCC6, PRKDC, RAD51 and BRCA1 was observed in ovaries from obese mice, relative to lean counterparts. Taken together, DMBA exposure induced γH2AX as well as the ovarian DDR, supporting that DMBA causes ovarian DNA damage. Additionally, ovarian DDR was partially attenuated in obese females raising concern that obesity may be an additive factor during chemical-induced ovotoxicity. PMID:25448685

  19. Albendazole induces oxidative stress and DNA damage in the parasitic protozoan Giardia duodenalis

    PubMed Central

    Martínez-Espinosa, Rodrigo; Argüello-García, Raúl; Saavedra, Emma; Ortega-Pierres, Guadalupe

    2015-01-01

    The control of Giardia duodenalis infections is carried out mainly by drugs, among these albendazole (ABZ) is commonly used. Although the cytotoxic effect of ABZ usually involves binding to β-tubulin, it has been suggested that oxidative stress may also play a role in its parasiticidal mechanism. In this work the effect of ABZ in Giardia clones that are susceptible or resistant to different concentrations (1.35, 8, and 250 μM) of this drug was analyzed. Reactive oxygen species (ROS) were induced by ABZ in susceptible clones and this was associated with a decrease in growth that was alleviated by cysteine supplementation. Remarkably, ABZ-resistant clones exhibited partial cross-resistance to H2O2, whereas a Giardia H2O2-resistant strain can grow in the presence of ABZ. Lipid oxidation and protein carbonylation in ABZ-treated parasites did not show significant differences as compared to untreated parasites; however, ABZ induced the formation of 8OHdG adducts and DNA degradation, indicating nucleic acid oxidative damage. This was supported by observations of histone H2AX phosphorylation in ABZ-susceptible trophozoites treated with 250 μM ABZ. Flow cytometry analysis showed that ABZ partially arrested cell cycle in drug-susceptible clones at G2/M phase at the expense of cells in G1 phase. Also, ABZ treatment resulted in phosphatidylserine exposure on the parasite surface, an event related to apoptosis. All together these data suggest that ROS induced by ABZ affect Giardia genetic material through oxidative stress mechanisms and subsequent induction of apoptotic-like events. PMID:26300866

  20. The role of intracellular zinc in chromium(VI)-induced oxidative stress, DNA damage and apoptosis.

    PubMed

    Rudolf, Emil; Cervinka, Miroslav

    2006-09-25

    Several studies have demonstrated that zinc is required for the optimal functioning of the skin. Changes in intracellular zinc concentrations have been associated with both improved protection of skin cells against various noxious factors as well as with increased susceptibility to external stress. Still, little is known about the role of intracellular zinc in hexavalent chromium (Cr(VI))-induced skin injury. To address this question, the effects of zinc deficiency or supplementation on Cr(VI)-induced cytotoxicity, oxidative stress, DNA injury and cell death were investigated in human diploid dermal fibroblasts during 48 h. Zinc levels in fibroblasts were manipulated by pretreatment of cells with 100 microM ZnSO4 and 4 or 25 microM zinc chelator TPEN. Cr(VI) (50, 10 and 1 microM) was found to produce time- and dose-dependent cytotoxicity resulting in oxidative stress, suppression of antioxidant systems and activation of p53-dependent apoptosis which is reported for the first time in this model in relation to environmental Cr(VI). Increased intracellular zinc partially attenuated Cr(VI)-induced cytotoxicity, oxidative stress and apoptosis by enhancing cellular antioxidant systems while inhibiting Cr(VI)-dependent apoptosis by preventing the activation of caspase-3. Decreased intracellular zinc enhanced cytotoxic effects of all the tested Cr(VI) concentrations, leading to rapid loss of cell membrane integrity and nuclear dispersion--hallmarks of necrosis. These new findings suggest that Cr(VI) as a model environmental toxin may damage in deeper regions residing skin fibroblasts whose susceptibility to such toxin depends among others on their intracellular Zn levels. Further investigation of the impact of Zn status on skin cells as well as any other cell populations exposed to Cr(VI) or other heavy metals is warranted.

  1. Sodium perbarate and benzalkonium chloride induce DNA damage in Chang conjunctival epithelial cells.

    PubMed

    Zhang, Huina; Wu, Han; Yang, Jun; Ye, Juan

    2017-02-06

    Content and objective: To investigate and compare the toxic effects of benzalkonium chloride (BAC) and new type oxidative preservative sodium perborate (NaBO3) on DNA damage, reactive oxygen species (ROS), and cell survival in immortalized human Chang conjunctival cells.

  2. Differential chromatin proteomics of the MMS-induced DNA damage response in yeast

    PubMed Central

    2011-01-01

    Background Protein enrichment by sub-cellular fractionation was combined with differential-in-gel-electrophoresis (DIGE) to address the detection of the low abundance chromatin proteins in the budding yeast proteome. Comparisons of whole-cell extracts and chromatin fractions were used to provide a measure of the degree of chromatin association for individual proteins, which could be compared across sample treatments. The method was applied to analyze the effect of the DNA damaging agent methyl methanesulfonate (MMS) on levels of chromatin-associated proteins. Results Up-regulation of several previously characterized DNA damage checkpoint-regulated proteins, such as Rnr4, Rpa1 and Rpa2, was observed. In addition, several novel DNA damage responsive proteins were identified and assessed for genotoxic sensitivity using either DAmP (decreased abundance by mRNA perturbation) or knockout strains, including Acf2, Arp3, Bmh1, Hsp31, Lsp1, Pst2, Rnr4, Rpa1, Rpa2, Ste4, Ycp4 and Yrb1. A strain in which the expression of the Ran-GTPase binding protein Yrb1 was reduced was found to be hypersensitive to genotoxic stress. Conclusion The described method was effective at unveiling chromatin-associated proteins that are less likely to be detected in the absence of fractionation. Several novel proteins with altered chromatin abundance were identified including Yrb1, pointing to a role for this nuclear import associated protein in DNA damage response. PMID:21967861

  3. High-throughput genotoxicity assay identifies antioxidants as inducers of DNA damage response and cell death

    EPA Science Inventory

    Human ATAD5 is an excellent biomarker for identifying genotoxic compounds because ATADS protein levels increase post-transcriptionally following exposure to a variety of DNA damaging agents. Here we report a novel quantitative high-throughput ATAD5-Iuciferase assay that can moni...

  4. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair

    PubMed Central

    Sterpone, Silvia; Cozzi, Renata

    2010-01-01

    It is well known that ionizing radiation (IR) can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs) of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER). In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer. PMID:20798883

  5. Influence of cysteamine on the protection and repair of radiation-induced damage to DNA

    NASA Astrophysics Data System (ADS)

    Ambroż, Hanna B.; Kornacka, Ewa M.; Przybytniak, Grażyna K.

    2004-08-01

    Studies of the influence of cysteamine on damage to DNA by ionising radiation, using two methods of examination: EPR and gel-electrophoresis under air and oxygen-free conditions, and at cryogenic and ambient temperatures, enabled us to draw some conclusions as to the most probable reaction pathways in the complicated system of DNA/thiol/oxygen. The DNA-peroxyl radicals formed in the presence of oxygen seem to be effectively deactivated by cysteamine as they were not detected by EPR at higher thiol concentration. The peroxyl radicals, if formed, increase double strand breaks of DNA. The competitive reactions of oxygen/DNA and oxygen/thiol, and their non-linear dependence on the thiol concentration, observed previously, are confirmed by the results of electrophoresis.

  6. NDR1 modulates the UV-induced DNA-damage checkpoint and nucleotide excision repair

    SciTech Connect

    Park, Jeong-Min; Choi, Ji Ye; Yi, Joo Mi; Chung, Jin Woong; Leem, Sun-Hee; Koh, Sang Seok; Kang, Tae-Hong

    2015-06-05

    Nucleotide excision repair (NER) is the sole mechanism of UV-induced DNA lesion repair in mammals. A single round of NER requires multiple components including seven core NER factors, xeroderma pigmentosum A–G (XPA–XPG), and many auxiliary effector proteins including ATR serine/threonine kinase. The XPA protein helps to verify DNA damage and thus plays a rate-limiting role in NER. Hence, the regulation of XPA is important for the entire NER kinetic. We found that NDR1, a novel XPA-interacting protein, modulates NER by modulating the UV-induced DNA-damage checkpoint. In quiescent cells, NDR1 localized mainly in the cytoplasm. After UV irradiation, NDR1 accumulated in the nucleus. The siRNA knockdown of NDR1 delayed the repair of UV-induced cyclobutane pyrimidine dimers in both normal cells and cancer cells. It did not, however, alter the expression levels or the chromatin association levels of the core NER factors following UV irradiation. Instead, the NDR1-depleted cells displayed reduced activity of ATR for some set of its substrates including CHK1 and p53, suggesting that NDR1 modulates NER indirectly via the ATR pathway. - Highlights: • NDR1 is a novel XPA-interacting protein. • NDR1 accumulates in the nucleus in response to UV irradiation. • NDR1 modulates NER (nucleotide excision repair) by modulating the UV-induced DNA-damage checkpoint response.

  7. Is lack of sleep capable of inducing DNA damage in aged skin?

    PubMed

    Kahan, V; Ribeiro, D A; Egydio, F; Barros, L A; Tomimori, J; Tufik, S; Andersen, M L

    2014-01-01

    Skin naturally changes with age, becoming more fragile. Various stimuli can alter skin integrity. The aim of this study was to evaluate whether sleep deprivation affects the integrity of DNA in skin and exacerbates the effects of aging. Fifteen-month old female Hairless mice underwent 72 h of paradoxical sleep deprivation or 15 days of chronic sleep restriction. Punch biopsies of the skin were taken to evaluate DNA damage by single cell gel (comet) assay. Neither paradoxical sleep deprivation nor sleep restriction increased genetic damage, measured by tail movement and tail intensity values. Taken together, the findings are consistent with the notion that aging overrides the effect of sleep loss on the genetic damage in elderly mice.

  8. Plumbagin alters telomere dynamics, induces DNA damage and cell death in human brain tumour cells.

    PubMed

    Khaw, Aik Kia; Sameni, Safoura; Venkatesan, Shriram; Kalthur, Guruprasad; Hande, M Prakash

    2015-11-01

    Natural plant products may possess much potential in palliative therapy and supportive strategies of current cancer treatments with lesser cytotoxicity to normal cells compared to conventional chemotherapy. In the current study, anti-cancer properties of plumbagin, a plant-derived naphthoquinone, on brain cancer cells were determined. Plumbagin treatment resulted in the induction of DNA damage, cell cycle arrest and apoptosis, followed by suppression of the colony forming ability of the brain tumour cells. These effects were substantiated by upregulation of PTEN, TNFRSF1A and downregulation of E2F1 genes, along with a drop in MDM2, cyclin B1, survivin and BCL2 protein expression. Plumbagin induced elevated levels of caspase-3/7 activity as well. For the first time, we show here that plumbagin inhibits telomerase in brain tumour cells and results in telomere shortening following chronic long-term treatment. This observation implies considerable cytotoxicity of plumbagin towards cancer cells with higher telomerase activity. Collectively, our findings suggest plumbagin as a potential chemotherapeutic phytochemical in brain tumour treatment modalities.

  9. Antigenotoxic Effect Against Ultraviolet Radiation-induced DNA Damage of the Essential Oils from Lippia Species.

    PubMed

    Quintero Ruiz, Nathalia; Córdoba Campo, Yuri; Stashenko, Elena E; Fuentes, Jorge Luis

    2017-02-08

    The antigenotoxicity against ultraviolet radiation (UV)-induced DNA damage of essential oils (EO) from Lippia species was studied using SOS Chromotest. Based on the minimum concentration that significantly inhibits genotoxicity, the genoprotective potential of EO from highest to lowest was Lippia graveolens, thymol-RC ≈ Lippia origanoides, carvacrol-RC ≈ L. origanoides, thymol-RC > Lippia alba, citral-RC ≈ Lippia citriodora, citral-RC ≈ Lippia micromera, thymol-RC > L. alba, myrcenone-RC. EO from L. alba, carvone/limonene-RC, L. origanoides, α-phellandrene-RC and L. dulcis, trans-β-caryophyllene-RC did not reduce the UV genotoxicity at any of the doses tested. A gas chromatography with flame ionization detection analysis (GC-FID) was conducted to evaluate the solubility of the major EO constituents under our experimental conditions. GC-FID analysis showed that, at least partially, major EO constituents were water-soluble and therefore, they were related with the antigenotoxicity detected for EO. Constituents such as p-cymene, geraniol, carvacrol, thymol, citral and 1,8-cineole showed antigenotoxicity. The antioxidant activity of EO constituents was also determined using the oxygen radical antioxidant capacity (ORAC) assay. The results showed that the antigenotoxicity of the EO constituents was unconnected with their antioxidant activity. The antigenotoxicity to different constituent binary mixtures suggests that synergistic effects can occur in some of the studied EO.

  10. Repair of gamma-ray-induced DNA base damage in xeroderma pigmentosum cells

    SciTech Connect

    Fornace, A.J. Jr.; Dobson, P.P.; Kinsella, T.J.

    1986-04-01

    The repair of DNA damage produced by /sup 137/Cs gamma irradiation was measured with a preparation from Micrococcus luteus containing DNA damage-specific endonucleases in combination with alkaline elution. The frequency of these endonuclease sensitive sites (ESS) was determined after 54 or 110 Gy of oxic irradiation in normal and xeroderma pigmentosum (XP) fibroblasts from complementation groups A, C, D, and G. Repair was rapid in all cell strains with greater than 50% repair after 1.5 h of repair incubation. At later repair times, 12-17 h, more ESS remained in XP than in normal cells. The frequency of excess ESS in XP cells was approximately 0.04 per 10(9) Da of DNA per Gy which was equivalent to 10% of the initial ESS produced. The removal of ESS was comparable in XP cells with normal radiosensitivity and XP3BR cells which have been reported to be moderately radiosensitive.

  11. Effect of bromodeoxyuridine on radiation-induced DNA damage and repair based on DNA fragment size using pulsed-field gel electrophoresis

    SciTech Connect

    Lawrence, T.S.; Davis, M.A.; Normolle, D.P.

    1995-12-01

    We have used biphasic linear ramping pulsed-field gel electrophoresis (PFGE) to understand the effect of incorporation of bromodeoxyuridine (BrdUrd) on radiation-induced DNA damage and repair. This technique permits a determination of the fragment size distribution produced immediately after irradiation as well as during the repair period. We found that incorporation of BrdUrd increased the induction and decreased the repair of radiation damage. The fragment size distribution was consistent with a random breakage model. When we found that significantly more damage was detected after irradiation of deproteinized DNA compared to intact cells, we studied the effects of BrdUrd incorporation on the radiation response of cells or DNA at various phases of preparation for electrophoresis: cells adherent to the culture dish (A), trypsinized cells (B), agarose-embedded cells (C) and deproteinized DNA (D). Although there was a general tendency to detect more damage when irradiation was performed later in the preparation process, steps B and C were the only successive steps which were significantly different. These findings demonstrate that incorporation of BrdUrd randomly increases the induction of radiation damage and decreases its repair at the level of 200 kbp to 5 Mbp fragments. Furthermore, they confirm that the amount of damage detected depends upon the conditions of the cells or DNA at the time of irradiation. 34 refs., 5 figs., 2 tabs.

  12. Inhibition of autophagy enhances DNA damage-induced apoptosis by disrupting CHK1-dependent S phase arrest.

    PubMed

    Liou, Jong-Shian; Wu, Yi-Chen; Yen, Wen-Yen; Tang, Yu-Shuan; Kakadiya, Rajesh B; Su, Tsann-Long; Yih, Ling-Huei

    2014-08-01

    DNA damage has been shown to induce autophagy, but the role of autophagy in the DNA damage response and cell fate is not fully understood. BO-1012, a bifunctional alkylating derivative of 3a-aza-cyclopenta[a]indene, is a potent DNA interstrand cross-linking agent with anticancer activity. In this study, BO-1012 was found to reduce DNA synthesis, inhibit S phase progression, and induce phosphorylation of histone H2AX on serine 139 (γH2AX) exclusively in S phase cells. Both CHK1 and CHK2 were phosphorylated in response to BO-1012 treatment, but only depletion of CHK1, but not CHK2, impaired BO-1012-induced S phase arrest and facilitated the entry of γH2AX-positive cells into G2 phase. CHK1 depletion also significantly enhanced BO-1012-induced cell death and apoptosis. These results indicate that BO-1012-induced S phase arrest is a CHK1-dependent pro-survival response. BO-1012 also resulted in marked induction of acidic vesicular organelle (AVO) formation and microtubule-associated protein 1 light chain 3 (LC3) processing and redistribution, features characteristic of autophagy. Depletion of ATG7 or co-treatment of cells with BO-1012 and either 3-methyladenine or bafilomycin A1, two inhibitors of autophagy, not only reduced CHK1 phosphorylation and disrupted S phase arrest, but also increased cleavage of caspase-9 and PARP, and cell death. These results suggest that cells initiate S phase arrest and autophagy as pro-survival responses to BO-1012-induced DNA damage, and that suppression of autophagy enhances BO-1012-induced apoptosis via disruption of CHK1-dependent S phase arrest.

  13. Implications of caspase-dependent proteolytic cleavage of cyclin A1 in DNA damage-induced cell death

    SciTech Connect

    Woo, Sang Hyeok; Seo, Sung-Keum; An, Sungkwan; Choe, Tae-Boo; Hong, Seok-Il; Lee, Yun-Han; Park, In-Chul

    2014-10-24

    Highlights: • Caspase-1 mediates doxorubicin-induced downregulation of cyclin A1. • Active caspase-1 effectively cleaved cyclin A1 at D165. • Cyclin A1 expression is involved in DNA damage-induced cell death. - Abstract: Cyclin A1 is an A-type cyclin that directly binds to CDK2 to regulate cell-cycle progression. In the present study, we found that doxorubicin decreased the expression of cyclin A1 at the protein level in A549 lung cancer cells, while markedly downregulating its mRNA levels. Interestingly, doxorubicin upregulated caspase-1 in a concentration-dependent manner, and z-YAVD-fmk, a specific inhibitor of caspase-1, reversed the doxorubicin-induced decrease in cyclin A1 in A549 lung cancer and MCF7 breast cancer cells. Active caspase-1 effectively cleaved cyclin A1 at D165 into two fragments, which in vitro cleavage assays showed were further cleaved by caspase-3. Finally, we found that overexpression of cyclin A1 significantly reduced the cytotoxicity of doxorubicin, and knockdown of cyclin A1 by RNA interference enhanced the sensitivity of cells to ionizing radiation. Our data suggest a new mechanism for the downregulation of cyclin A1 by DNA-damaging stimuli that could be intimately involved in the cell death induced by DNA damage-inducing stimuli, including doxorubicin and ionizing radiation.

  14. Extremely Low Frequency Magnetic Fields Do Not Induce DNA Damage in Human Lens Epithelial Cells In Vitro.

    PubMed

    Zhu, Kan; Lv, Ye; Cheng, Qian; Hua, Jianing; Zeng, Qunli

    2016-05-01

    Non-ionizing radiations, e.g., radiofrequency electromagnetic fields, could induce DNA damage and oxidative stress in human lens epithelial cells (LECs) which can be early events in cataractogenesis. Extremely low frequency magnetic fields (ELF MF) as another common form of man-made electromagnetic fields has been considered as suspected human carcinogen by International Agency for Research on Cancer (IARC) and become a focus that people play more and more attentions to. This study aimed to determine whether ELF MF can induce DNA damage in cultured human LECs at a relatively low intensity. Human LECs were exposed or sham-exposed to a 50 Hz ELF MF which produced by a well-designed exposure system at the intensity of 0.4 mT. DNA damage in human LECs was examined by the phosphorylated form of histone variant H2AX (γH2AX) foci formation assay and further explored with western blot, flow cytometry, and alkaline comet assay. Immunofluorescence analysis showed that 0.4 mT ELF MF did not significantly increase γH2AX foci formation in human LECs after 2, 6, 12, 24, or 48 hr exposure. No significant differences had been detected in γH2AX expression level between the ELF MF- and sham-exposure groups, while no obvious chromosomal DNA fragmentation was detected by alkaline comet assay after ELF MF exposure. The results indicate an absence of genotoxicity in ELF MF-exposed human epithelial cells and do not support the hypothesis that environmental ELF MF might be causally led to genomic instability via chromosomal damage response processes. Neither short nor long term continuous exposure to 50 Hz ELF MF at 0.4 mT could induce DNA damage in human lens epithelial cells in vitro.

  15. REC-2006-A Fractionated Extract of Podophyllum hexandrum Protects Cellular DNA from Radiation-Induced Damage by Reducing the Initial Damage and Enhancing Its Repair In Vivo.

    PubMed

    Chaudhary, Pankaj; Shukla, Sandeep Kumar; Sharma, Rakesh Kumar

    2011-01-01

    Podophyllum hexandrum, a perennial herb commonly known as the Himalayan May Apple, is well known in Indian and Chinese traditional systems of medicine. P. hexandrum has been widely used for the treatment of venereal warts, skin infections, bacterial and viral infections, and different cancers of the brain, lung and bladder. This study aimed at elucidating the effect of REC-2006, a bioactive fractionated extract from the rhizome of P. hexandrum, on the kinetics of induction and repair of radiation-induced DNA damage in murine thymocytes in vivo. We evaluated its effect on non-specific radiation-induced DNA damage by the alkaline halo assay in terms of relative nuclear spreading factor (RNSF) and gene-specific radiation-induced DNA damage via semi-quantitative polymerase chain reaction. Whole body exposure of animals with gamma rays (10 Gy) caused a significant amount of DNA damage in thymocytes (RNSF values 17.7 ± 0.47, 12.96 ± 1.64 and 3.3 ± 0.014) and a reduction in the amplification of β-globin gene to 0, 28 and 43% at 0, 15 and 60 min, respectively. Administrating REC-2006 at a radioprotective concentration (15 mg kg(-1) body weight) 1 h before irradiation resulted in time-dependent reduction of DNA damage evident as a decrease in RNSF values 6.156 ± 0.576, 1.647 ± 0.534 and 0.496 ± 0.012, and an increase in β-globin gene amplification 36, 95 and 99%, at 0, 15 and 60 min, respectively. REC-2006 scavenged radiation-induced hydroxyl radicals in a dose-dependent manner stabilized DPPH free radicals and also inhibited superoxide anions. Various polyphenols and flavonoides present in REC-2006 might contribute to scavenging of radiation-induced free radicals, thereby preventing DNA damage and stimulating its repair.

  16. Chromatin structure and DNA damage

    SciTech Connect

    Gale, J.M.

    1987-01-01

    This dissertation examines the structure and structural transitions of chromatin in relation to DNA damage. The ability of intact and histone H1 depleted chromatin fibers to fold into higher ordered structures in vitro was examined following DNA photodamage introduced by two different agents. (1) 254-nm UV radiation and (2) trimethylpsoralen (plus near-UV radiation). Both agents are highly specific for DNA and form adducts predicted to cause different degrees of distortion in the DNA helix. The salt-induced structural transitions of intact and histone H1 depleted chromatin fibers were monitored by both analytical ultracentrifugation and light scattering. Our results show that even in the presence of extremely large, nonphysiological amounts of photodamage by either agent the ability of chromatin to fold into higher ordered structures is not affected. The compact, 30 nm fiber must therefore be able to accommodate a large amount of DNA damage without any measurable changes in the overall size or degree of compaction of this structure. The distribution of pyrimidine dimers was mapped at the single nucleotide level in nucleosome core DNA from UV-irradiated mononucleosomes, chromatin fibers, and human cells in culture using the 3' ..-->.. 5' exonuclease activity of T4 DNA polymerase.

  17. Small RNA-mediated repair of UV-induced DNA lesions by the DNA DAMAGE-BINDING PROTEIN 2 and ARGONAUTE 1.

    PubMed

    Schalk, Catherine; Cognat, Valérie; Graindorge, Stéfanie; Vincent, Timothée; Voinnet, Olivier; Molinier, Jean

    2017-04-04

    As photosynthetic organisms, plants need to prevent irreversible UV-induced DNA lesions. Through an unbiased, genome-wide approach, we have uncovered a previously unrecognized interplay between Global Genome Repair and small interfering RNAs (siRNAs) in the recognition of DNA photoproducts, prevalently in intergenic regions. Genetic and biochemical approaches indicate that, upon UV irradiation, the DNA DAMAGE-BINDING PROTEIN 2 (DDB2) and ARGONAUTE 1 (AGO1) of Arabidopsis thaliana form a chromatin-bound complex together with 21-nt siRNAs, which likely facilitates recognition of DNA damages in an RNA/DNA complementary strand-specific manner. The biogenesis of photoproduct-associated siRNAs involves the noncanonical, concerted action of RNA POLYMERASE IV, RNA-DEPENDENT RNA POLYMERASE-2, and DICER-LIKE-4. Furthermore, the chromatin association/dissociation of the DDB2-AGO1 complex is under the control of siRNA abundance and DNA damage signaling. These findings reveal unexpected nuclear functions for DCL4 and AGO1, and shed light on the interplay between small RNAs and DNA repair recognition factors at damaged sites.

  18. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    PubMed

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  19. Protective effects of guarana (Paullinia cupana Mart. var. Sorbilis) against DEN-induced DNA damage on mouse liver.

    PubMed

    Fukumasu, H; Avanzo, J L; Heidor, R; Silva, T C; Atroch, A; Moreno, F S; Dagli, M L Z

    2006-06-01

    Guarana (Paullinia cupana Mart. var. Sorbilis) is a plant originally from Brazil, which is rich in tannins. Some tannins are known to present protective effects against DNA damage. This study was performed to investigate the anti-genotoxic/cytotoxic properties of guarana in hepatocytes of mice injected with N-nitrosodiethylamine (DEN). The protective effect of guarana was evaluated both by comet assay and DNA smear fragmentation technique in two month-old female BALB/c mice. These were treated previously with 2.0 mg/g bw of guarana for 16 days and then injected with DEN (160 microg/g body weight) to induce DNA damage. The DEN-only treated group presented higher comet image length than the guarana plus DEN and untreated groups (116.06+/-5.0 microm, 104.09+/-3.3 microm and 93.28+/-14.4 microm, respectively; p<0.01). Guarana treatment presented a 52.54% reduction in comet image length when animals were exposed to DEN (p<0.05). DNA samples from the guarana plus DEN group clearly showed less EtBr fluorescence intensity when compared to the DEN-only group, reinforcing the comet assay data. These results show, for the first time, that guarana has a protective effect against DEN-induced DNA damage in mouse liver.

  20. (-)-Anonaine induces DNA damage and inhibits growth and migration of human lung carcinoma h1299 cells.

    PubMed

    Chen, Bing-Hung; Chang, Hsueh-Wei; Huang, Hsuan-Min; Chong, Inn-Wen; Chen, Jia-Shing; Chen, Chung-Yi; Wang, Hui-Min

    2011-03-23

    The anticancer effects of (-)-anonaine were investigated in this current study. (-)-Anonaine at concentration ranges of 50-200 μM exhibited significant inhibition to cell growth and migration activities on human lung cancer H1299 cells at 24 h, albeit cell cycle analyses showed that (-)-anonaine at the above concentration ranges did not cause any significant changes in cell-cycle distributions. Significant nuclear damages of H1299 cells were observed with 10-200 μM (-)-anonaine treatment in a comet assay, whereas higher concentrations (6 and 30 mM) of (-)-anonaine concentrations were required to cause DNA damages in an in vitro plasmid cleavage assay. In summary, our results demonstrated that (-)-anonaine exhibited dose-dependent antiproliferatory, antimigratory, and DNA-damaging effects on H1299 cells. We inferred that (-)-anonaine can cause cell-cycle arrest and DNA damage to hamper the physiological behavior of cancer cells at 72 h, and therefore, it can be useful as one of the potential herbal supplements for chemoprevention of human lung cancer.

  1. Aryl Hydrocarbon Receptor Ligand 5F 203 Induces Oxidative Stress That Triggers DNA Damage in Human Breast Cancer Cells

    PubMed Central

    McLean, Lancelot S.; Watkins, Cheri N.; Campbell, Petreena; Zylstra, Dain; Rowland, Leah; Amis, Louisa H.; Scott, Lia; Babb, Crystal E.; Livingston, W. Joel; Darwanto, Agus; Davis, Willie L.; Senthil, Maheswari; Sowers, Lawrence C.; Brantley, Eileen

    2015-01-01

    Breast tumors often show profound sensitivity to exogenous oxidative stress. Investigational agent 2-(4-amino-3-methylphenyl)-5-fluorobenzothiazole (5F 203) induces aryl hydrocarbon receptor (AhR)-mediated DNA damage in certain breast cancer cells. Since AhR agonists often elevate intracellular oxidative stress, we hypothesize that 5F 203 increases reactive oxygen species (ROS) to induce DNA damage, which thwarts breast cancer cell growth. We found that 5F 203 induced single-strand break formation. 5F 203 enhanced oxidative DNA damage that was specific to breast cancer cells sensitive to its cytotoxic actions, as it did not increase oxidative DNA damage or ROS formation in nontumorigenic MCF-10A breast epithelial cells. In contrast, AhR agonist and procarcinogen benzo[a]pyrene and its metabolite, 1,6-benzo[a]pyrene quinone, induced oxidative DNA damage and ROS formation, respectively, in MCF-10A cells. In sensitive breast cancer cells, 5F 203 activated ROS-responsive kinases: c-Jun-N-terminal kinase (JNK) and p38 mitogen activated protein kinase (p38). AhR antagonists (alpha-naphthoflavone, CH223191) or antioxidants (N-acetyl-l-cysteine, EUK-134) attenuated 5F 203-mediated JNK and p38 activation, depending on the cell type. Pharmacological inhibition of AhR, JNK, or p38 attenuated 5F 203-mediated increases in intracellular ROS, apoptosis, and single-strand break formation. 5F 203 induced the expression of cytoglobin, an oxidative stress-responsive gene and a putative tumor suppressor, which was diminished with AhR, JNK, or p38 inhibition. Additionally, 5F 203-mediated increases in ROS production and cytoglobin were suppressed in AHR100 cells (AhR ligand-unresponsive MCF-7 breast cancer cells). Our data demonstrate 5F 203 induces ROS-mediated DNA damage at least in part via AhR, JNK, or p38 activation and modulates the expression of oxidative stress-responsive genes such as cytoglobin to confer its anticancer action. PMID:25781201

  2. DNA damage in germ cells induces an innate immune response that triggers systemic stress resistance.

    PubMed

    Ermolaeva, Maria A; Segref, Alexandra; Dakhovnik, Alexander; Ou, Hui-Ling; Schneider, Jennifer I; Utermöhlen, Olaf; Hoppe, Thorsten; Schumacher, Björn

    2013-09-19

    DNA damage responses have been well characterized with regard to their cell-autonomous checkpoint functions leading to cell cycle arrest, senescence and apoptosis. In contrast, systemic responses to tissue-specific genome instability remain poorly understood. In adult Caenorhabditis elegans worms germ cells undergo mitotic and meiotic cell divisions, whereas somatic tissues are entirely post-mitotic. Consequently, DNA damage checkpoints function specifically in the germ line, whereas somatic tissues in adult C. elegans are highly radio-resistant. Some DNA repair systems such as global-genome nucleotide excision repair (GG-NER) remove lesions specifically in germ cells. Here we investigated how genome instability in germ cells affects somatic tissues in C. elegans. We show that exogenous and endogenous DNA damage in germ cells evokes elevated resistance to heat and oxidative stress. The somatic stress resistance is mediated by the ERK MAP kinase MPK-1 in germ cells that triggers the induction of putative secreted peptides associated with innate immunity. The innate immune response leads to activation of the ubiquitin-proteasome system (UPS) in somatic tissues, which confers enhanced proteostasis and systemic stress resistance. We propose that elevated systemic stress resistance promotes endurance of somatic tissues to allow delay of progeny production when germ cells are genomically compromised.

  3. Profiling DNA damage-induced phosphorylation in budding yeast reveals diverse signaling networks.

    PubMed

    Zhou, Chunshui; Elia, Andrew E H; Naylor, Maria L; Dephoure, Noah; Ballif, Bryan A; Goel, Gautam; Xu, Qikai; Ng, Aylwin; Chou, Danny M; Xavier, Ramnik J; Gygi, Steven P; Elledge, Stephen J

    2016-06-28

    The DNA damage response (DDR) is regulated by a protein kinase signaling cascade that orchestrates DNA repair and other processes. Identifying the substrate effectors of these kinases is critical for understanding the underlying physiology and mechanism of the response. We have used quantitative mass spectrometry to profile DDR-dependent phosphorylation in budding yeast and genetically explored the dependency of these phosphorylation events on the DDR kinases MEC1, RAD53, CHK1, and DUN1. Based on these screens, a database containing many novel DDR-regulated phosphorylation events has been established. Phosphorylation of many of these proteins has been validated by quantitative peptide phospho-immunoprecipitation and examined for functional relevance to the DDR through large-scale analysis of sensitivity to DNA damage in yeast deletion strains. We reveal a link between DDR signaling and the metabolic pathways of inositol phosphate and phosphatidyl inositol synthesis, which are required for resistance to DNA damage. We also uncover links between the DDR and TOR signaling as well as translation regulation. Taken together, these data shed new light on the organization of DDR signaling in budding yeast.

  4. Profiling DNA damage-induced phosphorylation in budding yeast reveals diverse signaling networks

    PubMed Central

    Zhou, Chunshui; Elia, Andrew E. H.; Naylor, Maria L.; Ballif, Bryan A.; Goel, Gautam; Xu, Qikai; Ng, Aylwin; Chou, Danny M.; Xavier, Ramnik J.; Gygi, Steven P.; Elledge, Stephen J.

    2016-01-01

    The DNA damage response (DDR) is regulated by a protein kinase signaling cascade that orchestrates DNA repair and other processes. Identifying the substrate effectors of these kinases is critical for understanding the underlying physiology and mechanism of the response. We have used quantitative mass spectrometry to profile DDR-dependent phosphorylation in budding yeast and genetically explored the dependency of these phosphorylation events on the DDR kinases MEC1, RAD53, CHK1, and DUN1. Based on these screens, a database containing many novel DDR-regulated phosphorylation events has been established. Phosphorylation of many of these proteins has been validated by quantitative peptide phospho-immunoprecipitation and examined for functional relevance to the DDR through large-scale analysis of sensitivity to DNA damage in yeast deletion strains. We reveal a link between DDR signaling and the metabolic pathways of inositol phosphate and phosphatidyl inositol synthesis, which are required for resistance to DNA damage. We also uncover links between the DDR and TOR signaling as well as translation regulation. Taken together, these data shed new light on the organization of DDR signaling in budding yeast. PMID:27298372

  5. Optical control of filamentation-induced damage to DNA by intense, ultrashort, near-infrared laser pulses

    NASA Astrophysics Data System (ADS)

    Dharmadhikari, J. A.; Dharmadhikari, A. K.; Kasuba, K. C.; Bharambe, H.; D’Souza, J. S.; Rathod, K. D.; Mathur, D.

    2016-06-01

    We report on damage to DNA in an aqueous medium induced by ultrashort pulses of intense laser light of 800 nm wavelength. Focusing of such pulses, using lenses of various focal lengths, induces plasma formation within the aqueous medium. Such plasma can have a spatial extent that is far in excess of the Rayleigh range. In the case of water, the resulting ionization and dissociation gives rise to in situ generation of low-energy electrons and OH-radicals. Interactions of these with plasmid DNA produce nicks in the DNA backbone: single strand breaks (SSBs) are induced as are, at higher laser intensities, double strand breaks (DSBs). Under physiological conditions, the latter are not readily amenable to repair. Systematic quantification of SSBs and DSBs at different values of incident laser energy and under different external focusing conditions reveals that damage occurs in two distinct regimes. Numerical aperture is the experimental handle that delineates the two regimes, permitting simple optical control over the extent of DNA damage.

  6. Optical control of filamentation-induced damage to DNA by intense, ultrashort, near-infrared laser pulses

    PubMed Central

    Dharmadhikari, J. A.; Dharmadhikari, A. K.; Kasuba, K. C.; Bharambe, H.; D’Souza, J. S.; Rathod, K. D.; Mathur, D.

    2016-01-01

    We report on damage to DNA in an aqueous medium induced by ultrashort pulses of intense laser light of 800 nm wavelength. Focusing of such pulses, using lenses of various focal lengths, induces plasma formation within the aqueous medium. Such plasma can have a spatial extent that is far in excess of the Rayleigh range. In the case of water, the resulting ionization and dissociation gives rise to in situ generation of low-energy electrons and OH-radicals. Interactions of these with plasmid DNA produce nicks in the DNA backbone: single strand breaks (SSBs) are induced as are, at higher laser intensities, double strand breaks (DSBs). Under physiological conditions, the latter are not readily amenable to repair. Systematic quantification of SSBs and DSBs at different values of incident laser energy and under different external focusing conditions reveals that damage occurs in two distinct regimes. Numerical aperture is the experimental handle that delineates the two regimes, permitting simple optical control over the extent of DNA damage. PMID:27279565

  7. DNA fragmentation induced by Fe ions in human cells: shielding influence on spatially correlated damage

    NASA Technical Reports Server (NTRS)

    Antonelli, F.; Belli, M.; Campa, A.; Chatterjee, A.; Dini, V.; Esposito, G.; Rydberg, B.; Simone, G.; Tabocchini, M. A.

    2004-01-01

    Outside the magnetic field of the Earth, high energy heavy ions constitute a relevant part of the biologically significant dose to astronauts during the very long travels through space. The typical pattern of energy deposition in the matter by heavy ions on the microscopic scale is believed to produce spatially correlated damage in the DNA which is critical for radiobiological effects. We have investigated the influence of a lucite shielding on the initial production of very small DNA fragments in human fibroblasts irradiated with 1 GeV/u iron (Fe) ions. We also used gamma rays as reference radiation. Our results show: (1) a lower effect per incident ion when the shielding is used; (2) an higher DNA Double Strand Breaks (DSB) induction by Fe ions than by gamma rays in the size range 1-23 kbp; (3) a non-random DNA DSB induction by Fe ions. c2004 COSPAR. Published by Elsevier Ltd. All rights reserved.

  8. DNA fragmentation induced by fe ions in human cells: shielding influence on spatially correlated damage

    SciTech Connect

    Antonelli, F.; Belli, M.; Campa, A.; Chatterjee, A.; Dini, V.; Esposito, G.; Rydberg, B.; Simone, G.; Tabocchini, M.A.

    2003-11-19

    Outside the magnetic field of the Earth, high energy heavy ions constitute a relevant part of the biologically significant dose to astronauts during the very long travels through space. The typical pattern of energy deposition in the matter by heavy ions on the microscopic scale is believed to produce spatially correlated damage in the DNA which is critical for radiobiological effects. We have investigated the influence of a lucite shielding on the initial production of very small DNA fragments in human fibroblasts irradiated with 1 GeV/u iron (Fe) ions. We also used small gamma, Greek-rays as reference radiation. Our results show: (1) a lower effect per incident ion when the shielding is used; (2) an higher DNA Double Strand Breaks (DSB) induction by Fe ions than by small gamma, Greek-rays in the size range 123 kbp; (3) a non-random DNA DSB induction by Fe ions.

  9. Ionizing radiation-induced DNA injury and damage detection in patients with breast cancer

    PubMed Central

    Borrego-Soto, Gissela; Ortiz-López, Rocío; Rojas-Martínez, Augusto

    2015-01-01

    Abstract Breast cancer is the most common malignancy in women. Radiotherapy is frequently used in patients with breast cancer, but some patients may be more susceptible to ionizing radiation, and increased exposure to radiation sources may be associated to radiation adverse events. This susceptibility may be related to deficiencies in DNA repair mechanisms that are activated after cell-radiation, which causes DNA damage, particularly DNA double strand breaks. Some of these genetic susceptibilities in DNA-repair mechanisms are implicated in the etiology of hereditary breast/ovarian cancer (pathologic mutations in the BRCA 1 and 2 genes), but other less penetrant variants in genes involved in sporadic breast cancer have been described. These same genetic susceptibilities may be involved in negative radiotherapeutic outcomes. For these reasons, it is necessary to implement methods for detecting patients who are susceptible to radiotherapy-related adverse events. This review discusses mechanisms of DNA damage and repair, genes related to these functions, and the diagnosis methods designed and under research for detection of breast cancer patients with increased radiosensitivity. PMID:26692152

  10. 3-Nitrobenzanthrone and 3-aminobenzanthrone induce DNA damage and cell signalling in Hepa1c1c7 cells.

    PubMed

    Landvik, N E; Arlt, V M; Nagy, E; Solhaug, A; Tekpli, X; Schmeiser, H H; Refsnes, M; Phillips, D H; Lagadic-Gossmann, D; Holme, J A

    2010-02-03

    3-Nitrobenzanthrone (3-NBA) is a mutagenic and carcinogenic environmental pollutant found in diesel exhaust and urban air pollution. In the present work we have characterised the effects of 3-NBA and its metabolite 3-aminobenzanthrone (3-ABA) on cell death and cytokine release in mouse hepatoma Hepa1c1c7 cells. These effects were related to induced DNA damage and changes in cell signalling pathways. 3-NBA resulted in cell death and caused most DNA damage as judged by the amount of DNA adducts ((32)P-postlabelling assay), single strand (ss)DNA breaks and oxidative DNA lesions (comet assay) detected. An increased phosphorylation of H2AX, chk1, chk2 and partly ATM was observed using flow cytometry and/or Western blotting. Both compounds increased phosphorylation of p53 and MAPKs (ERK, p38 and JNK). However, only 3-NBA caused an accumulation of p53 in the nucleus and a translocation of Bax to the mitochondria. The p53 inhibitor pifithrin-alpha inhibited 3-NBA-induced apoptosis, indicating that cell death was a result of the triggering of DNA signalling pathways. The highest phosphorylation of Akt and degradation of IkappaB-alpha (suggesting activation of NF-kappaB) were also seen after treatment with 3-NBA. In contrast 3-ABA increased IL-6 release, but caused little or no toxicity. Cytokine release was inhibited by PD98059 and curcumin, suggesting that ERK and NF-kappaB play a role in this process. In conclusion, 3-NBA seems to have a higher potency to induce DNA damage compatible with its cytotoxic effects, while 3-ABA seems to have a greater effect on the immune system.

  11. DNA-damage response gene GADD45A induces differentiation in hematopoietic stem cells without inhibiting cell cycle or survival.

    PubMed

    Wingert, Susanne; Thalheimer, Frederic B; Haetscher, Nadine; Rehage, Maike; Schroeder, Timm; Rieger, Michael A

    2016-03-01

    Hematopoietic stem cells (HSCs) maintain blood cell production life-long by their unique abilities of self-renewal and differentiation into all blood cell lineages. Growth arrest and DNA-damage-inducible 45 alpha (GADD45A) is induced by genotoxic stress in HSCs. GADD45A has been implicated in cell cycle control, cell death and senescence, as well as in DNA-damage repair. In general, GADD45A provides cellular stability by either arresting the cell cycle progression until DNA damage is repaired or, in cases of fatal damage, by inducing apoptosis. However, the function of GADD45A in hematopoiesis remains controversial. We revealed the changes in murine HSC fate control orchestrated by the expression of GADD45A at single cell resolution. In contrast to other cellular systems, GADD45A expression did not cause a cell cycle arrest or an alteration in the decision between cell survival and apoptosis in HSCs. Strikingly, GADD45A strongly induced and accelerated the differentiation program in HSCs. Continuous tracking of individual HSCs and their progeny via time-lapse microscopy elucidated that once GADD45A was expressed, HSCs differentiate into committed progenitors within 29 hours. GADD45A-expressing HSCs failed to long-term reconstitute the blood of recipients by inducing multilineage differentiation in vivo. Importantly, γ-irradiation of HSCs induced their differentiation by upregulating endogenous GADD45A. The differentiation induction by GADD45A was transmitted by activating p38 Mitogen-activated protein kinase (MAPK) signaling and allowed the generation of megakaryocytic-erythroid, myeloid, and lymphoid lineages. These data indicate that genotoxic stress-induced GADD45A expression in HSCs prevents their fatal transformation by directing them into differentiation and thereby clearing them from the system.

  12. Oxidative stress contributes to cobalt oxide nanoparticles-induced cytotoxicity and DNA damage in human hepatocarcinoma cells

    PubMed Central

    Alarifi, Saud; Ali, Daoud; Y, Al Omar Suliman; Ahamed, Maqusood; Siddiqui, Maqsood A; Al-Khedhairy, Abdulaziz A

    2013-01-01

    Background Cobalt oxide nanoparticles (Co3O4NPs) are increasingly recognized for their utility in biological applications, magnetic resonance imaging, and drug delivery. However, little is known about the toxicity of Co3O4NPs in human cells. Methods We investigated the possible mechanisms of genotoxicity induced by Co3O4NPs in human hepatocarcinoma (HepG2) cells. Cell viability, reactive oxygen species (ROS), glutathione, thiobarbituric acid reactive substance, apoptosis, and DNA damage were assessed in HepG2 cells after Co3O4NPs and Co2+ exposure. Results Co3O4NPs elicited a significant (P < 0.01) reduction in glutathione with a concomitant increase in lipid hydroperoxide, ROS generation, superoxide dismutase, and catalase activity after 24- and 48-hour exposure. Co3O4NPs had a mild cytotoxic effect in HepG2 cells; however, it induced ROS and oxidative stress, leading to DNA damage, a probable mechanism of genotoxicity. The comet assay showed a statistically significant (P < 0.01) dose- and time-related increase in DNA damage for Co3O4NPs, whereas Co2+ induced less change than Co3O4NPs but significantly more than control. Conclusion Our results demonstrated that Co3O4NPs induced cytotoxicity and genotoxicity in HepG2 cells through ROS and oxidative stress. PMID:23326189

  13. Preventive effects of quercetin against benzo[a]pyrene-induced DNA damages and pulmonary precancerous pathologic changes in mice.

    PubMed

    Jin, Nian-zu; Zhu, Yan-ping; Zhou, Jian-wei; Mao, Li; Zhao, Ren-cheng; Fang, Tai-hui; Wang, Xin-ru

    2006-06-01

    The aim of this study was to investigate the preventive effects of quercetin against benzo[a]pyrene-induced blood lymphocyte DNA damages and pulmonary precancerous pathologic changes in mice, and to reveal the potential mechanism behind these effects. In this study, mice in quercetin-treated groups were given quercetin for 90 days. After one week of treatment, mice in the quercetin-treated groups and the positive control group received a single intraperitoneal dose of benzo[a]pyrene (100 mg/kg body weight). The results of single cell gel electrophoresis assay showed that the average lengths of the comet cell tail and DNA damage in the peripheral blood lymphocytes of mice induced by benzo[a]pyrene decreased significantly as a result of quercetin treatment dose-dependently. Light microscopic examination showed that the degrees of pulmonary precancerous pathologic changes in the quercetin-treated groups decreased significantly compared with those in the positive control group. Meanwhile, the cytochrome P4501A1-linked 7-ethoxyresorufin O-dealkylase activities in lung microsomes of mice decreased as the dose of quercetin increased. The results of this in vivo study revealed that quercetin had a significant preventive effect on benzo[a]pyrene-induced DNA damage, and had a potential chemopreventive effect on the carcinogenesis of lung cancer induced by benzo[a]pyrene. The mechanism of these effects of quercetin could be related to the inhibition of cytochrome P4501A1 activity.

  14. The oxygen-rich postnatal environment induces cardiomyocyte cell-cycle arrest through DNA damage response.

    PubMed

    Puente, Bao N; Kimura, Wataru; Muralidhar, Shalini A; Moon, Jesung; Amatruda, James F; Phelps, Kate L; Grinsfelder, David; Rothermel, Beverly A; Chen, Rui; Garcia, Joseph A; Santos, Celio X; Thet, SuWannee; Mori, Eiichiro; Kinter, Michael T; Rindler, Paul M; Zacchigna, Serena; Mukherjee, Shibani; Chen, David J; Mahmoud, Ahmed I; Giacca, Mauro; Rabinovitch, Peter S; Aroumougame, Asaithamby; Shah, Ajay M; Szweda, Luke I; Sadek, Hesham A

    2014-04-24

    The mammalian heart has a remarkable regenerative capacity for a short period of time after birth, after which the majority of cardiomyocytes permanently exit cell cycle. We sought to determine the primary postnatal event that results in cardiomyocyte cell-cycle arrest. We hypothesized that transition to the oxygen-rich postnatal environment is the upstream signal that results in cell-cycle arrest of cardiomyocytes. Here, we show that reactive oxygen species (ROS), oxidative DNA damage, and DNA damage response (DDR) markers significantly increase in the heart during the first postnatal week. Intriguingly, postnatal hypoxemia, ROS scavenging, or inhibition of DDR all prolong the postnatal proliferative window of cardiomyocytes, whereas hyperoxemia and ROS generators shorten it. These findings uncover a protective mechanism that mediates cardiomyocyte cell-cycle arrest in exchange for utilization of oxygen-dependent aerobic metabolism. Reduction of mitochondrial-dependent oxidative stress should be an important component of cardiomyocyte proliferation-based therapeutic approaches.

  15. 17β-estradiol prevents experimentally-induced oxidative damage to membrane lipids and nuclear DNA in porcine ovary.

    PubMed

    Stepniak, Jan; Karbownik-Lewinska, Malgorzata

    2016-01-01

    Estrogens, with their principle representative 17β-estradiol, contribute to the redox state of cells showing both pro- and antioxidative properties. In the ovary, being the main source of estrogens, maintaining balance between the production and detoxification of ROS is crucial. Whereas ovary estrogen concentration is difficult to estimate, its circulating concentration in women may reach the nanomolar level. The aim of the study was to evaluate the effects of 17β-estradiol on oxidative damage to membrane lipids (lipid peroxidation, LPO) and to nuclear DNA in the porcine ovary under basal conditions and in the presence of Fenton reaction (Fe(2+)+H2O2→Fe(3+)+(•)OH + OH(-)) substrates. Ovary homogenates and DNA were incubated in the presence of 17β-estradiol (1 mM-1 pM), without/with FeSO4 (30 μM) + H2O2 (0.5 mM). Malondialdehyde + 4-hydroxyalkenals (MDA + 4-HDA) concentration (LPO index) was measured spectrophotometrically. The concentration of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) (DNA damage index) was measured by HPLC. We observed that 17β-estradiol did not alter the basal level of oxidative damage, but reduced Fe(2+)+H2O2-induced oxidative damage to membrane lipids when ≥10 nM and to DNA at concentrations ≥1 nM. In the ovary at near physiological concentration, 17β-estradiol prevents experimentally induced oxidative damage. This suggests that under physiological conditions this hormone may contribute to protecting the ovary against oxidative damage.

  16. Regulation of BRCA1 Function by DNA Damage-Induced Site-Specific Phosphorylation

    DTIC Science & Technology

    2007-06-01

    AD_________________ Award Number: DAMD17-02- 1 -0584 TITLE: Regulation of BRCA1 Function by DNA Damage...estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining...it does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1 . REPORT DATE 01-06-2007 2

  17. Ursolic Acid-Regulated Energy Metabolism—Reliever or Propeller of Ultraviolet-Induced Oxidative Stress and DNA Damage?

    PubMed Central

    Lee, Yuan-Hao; Sun, Youping; Glickman, Randolph D.

    2014-01-01

    Ultraviolet (UV) light is a leading cause of diseases, such as skin cancers and cataracts. A main process mediating UV-induced pathogenesis is the production of reactive oxygen species (ROS). Excessive ROS levels induce the formation of DNA adducts (e.g., pyrimidine dimers) and result in stalled DNA replication forks. In addition, ROS promotes phosphorylation of tyrosine kinase-coupled hormone receptors and alters downstream energy metabolism. With respect to the risk of UV-induced photocarcinogenesis and photodamage, the antitumoral and antioxidant functions of natural compounds become important for reducing UV-induced adverse effects. One important question in the field is what determines the differential sensitivity of various types of cells to UV light and how exogenous molecules, such as phytochemicals, protect normal cells from UV-inflicted damage while potentiating tumor cell death, presumably via interaction with intracellular target molecules and signaling pathways. Several endogenous molecules have emerged as possible players mediating UV-triggered DNA damage responses. Specifically, UV activates the PIKK (phosphatidylinositol 3-kinase-related kinase) family members, which include DNA-PKcs, ATM (ataxia telangiectasia mutated) and mTOR (mammalian target of rapamycin), whose signaling can be affected by energy metabolism; however, it remains unclear to what extent the activation of hormone receptors regulates PIKKs and whether this crosstalk occurs in all types of cells in response to UV. This review focuses on proteomic descriptions of the relationships between cellular photosensitivity and the phenotypic expression of the insulin/insulin-like growth receptor. It covers the cAMP-dependent pathways, which have recently been shown to regulate the DNA repair machinery through interactions with the PIKK family members. Finally, this review provides a strategic illustration of how UV-induced mitogenic activity is modulated by the insulin sensitizer, ursolic

  18. Protective effect of enzymatic extracts from microalgae against DNA damage induced by H2O2.

    PubMed

    Karawita, Rohan; Senevirathne, Mahinda; Athukorala, Yasantha; Affan, Abu; Lee, Young-Jae; Kim, Se-Kwon; Lee, Joon-Baek; Jeon, You-Jin

    2007-01-01

    The enzymatic extracts from seven species of microalgae (Pediastrum duplex, Dactylococcopsis fascicularis, Halochlorococcum porphyrae, Oltmannsiellopsis unicellularis, Achnanthes longipes, Navicula sp. and Amphora coffeaeformis) collected from three habitats (freshwater, tidal pool, and coastal benthic) at Jeju Island in Korea were investigated for their antioxidant activity. Of the extracts tested, the AMG 300 L (an exo 1, 4-alpha-D-glucosidase) extract of P. duplex, the Viscozyme extract of Navicula sp., and the Celluclast extract of A. longipes provided the most potential as antioxidants. Meanwhile, the Termamyl extract of P. duplex in an H(2)O(2) scavenging assay exhibited an approximate 60% scavenging effect. In this study, we report that the DNA damage inhibitory effects of P. duplex (Termamyl extract) and D. fascicularis (Kojizyme extract) were nearly 80% and 69% respectively at a concentration of 100 microg/ml. Thus, it is suggested that the microalgae tested in this study yield promising DNA damage inhibitory properties on mouse lymphoma L 5178 cells that are treated with H(2)O(2). Therefore, microalgae such as P. duplex may be an excellent source of naturally occurring antioxidant compounds with potent DNA damage inhibition potential.

  19. Arsenosugar induced blood and brain oxidative stress, DNA damage and neurobehavioral impairments.

    PubMed

    Bin Sayeed, Muhammad Shahdaat; Ratan, Md; Hossen, Farhad; Hassan, Faizule; Faisal, Mohammad; Kadir, Mohammad Fahim

    2013-02-01

    The effect of Arsenosugar on motor function and contextual memory-related to place and event; the extent of DNA damage and oxidative stress in male swiss albino mice was investigated. Passive avoidance test was used for memory test; rota motor test was used for motor function. Several biochemical parameters were used for assessing oxidative stress due to arsenosugar ingestion. Decreased passive avoidance time and decreased retention time in rotating rod indicated disruption of normal neurobehavior. Significant dose-dependent DNA damage was found in mice blood and brain. Decreased super oxide dismutase, increased lipid peroxidation, decreased protein sulfohydryl content, increased protein carbonyl content in blood and hippocampal tissue; glutathione in blood and glutathione peroxidase in hippocampal tissue indicated the ability of arsenosugar to cause oxidative stress. This study concludes with evidence that arsenosugar ingestion causes higher oxidative stress, increases DNA damage in the blood and hippocampus in vivo. This might be responsible for the dysfunction of cognitive and motor functions. However, further investigation is suggested for deciphering the biomolecular mechanism.

  20. Dimethoate-induced oxidative stress and DNA damage in Oncorhynchus mykiss.

    PubMed

    Dogan, Demet; Can, Canan; Kocyigit, Abdurrahim; Dikilitas, Murat; Taskin, Abdullah; Bilinc, Hasan

    2011-06-01

    The present study was conducted in order to investigate pro-oxidant activity of dimethoate in liver and brain tissues following sublethal pesticide exposure for 5, 15 and 30 d by using SOD, GPx, CAT enzyme activities and lipid peroxidation as biomarkers as well as DNA damaging potential via detecting% Tail DNA, Tail moment and Olive tail moment as endpoints in erythrocytes of Oncorhynchus mykiss in an in vitro experiment. Antioxidant enzyme activities were found to elicit two staged response which was an initial induction followed by a sharp inhibition in liver tissue while a sustained increase in GPx activity and slight stimulation in SOD activity were detected in brain tissue. Lipid peroxidation showed an ascending pattern throughout the exposure period in both tissues and a decreasing trend was determined in tissue protein levels which was proved to be positively correlated with duration. Similar findings were obtained from outcomes preferred to quantify DNA damage and TM was decided to reflect the extent of damage more sensitively because of determined positive correlation with concentrations applied. Considering these results, it can be concluded that oxidative stress condition evoked by dimethoate could not be responded effectively and genotoxic nature of pesticide was proven by determined clastogenic effect possibly via being an alkylation agent or stimulating the production of reactive species.

  1. DGCR8 Mediates Repair of UV-Induced DNA Damage Independently of RNA Processing.

    PubMed

    Calses, Philamer C; Dhillon, Kiranjit K; Tucker, Nyka; Chi, Yong; Huang, Jen-Wei; Kawasumi, Masaoki; Nghiem, Paul; Wang, Yemin; Clurman, Bruce E; Jacquemont, Celine; Gafken, Philip R; Sugasawa, Kaoru; Saijo, Masafumi; Taniguchi, Toshiyasu

    2017-04-04

    Ultraviolet (UV) radiation is a carcinogen that generates DNA lesions. Here, we demonstrate an unexpected role for DGCR8, an RNA binding protein that canonically functions with Drosha to mediate microRNA processing, in the repair of UV-induced DNA lesions. Treatment with UV induced phosphorylation on serine 153 (S153) of DGCR8 in both human and murine cells. S153 phosphorylation was critical for cellular resistance to UV, the removal of UV-induced DNA lesions, and the recovery of RNA synthesis after UV exposure but not for microRNA expression. The RNA-binding and Drosha-binding activities of DGCR8 were not critical for UV resistance. DGCR8 depletion was epistatic to defects in XPA, CSA, and CSB for UV sensitivity. DGCR8 physically interacted with CSB and RNA polymerase II. JNKs were involved in the UV-induced S153 phosphorylation. These findings suggest that UV-induced S153 phosphorylation mediates transcription-coupled nucleotide excision repair of UV-induced DNA lesions in a manner independent of microRNA processing.

  2. Exposure to 1800 MHz radiofrequency electromagnetic radiation induces oxidative DNA base damage in a mouse spermatocyte-derived cell line.

    PubMed

    Liu, Chuan; Duan, Weixia; Xu, Shangcheng; Chen, Chunhai; He, Mindi; Zhang, Lei; Yu, Zhengping; Zhou, Zhou

    2013-03-27

    Whether exposure to radiofrequency electromagnetic radiation (RF-EMR) emitted from mobile phones can induce DNA damage in male germ cells remains unclear. In this study, we conducted a 24h intermittent exposure (5 min on and 10 min off) of a mouse spermatocyte-derived GC-2 cell line to 1800 MHz Global System for Mobile Communication (GSM) signals in GSM-Talk mode at specific absorption rates (SAR) of 1 W/kg, 2 W/kg or 4 W/kg. Subsequently, through the use of formamidopyrimidine DNA glycosylase (FPG) in a modified comet assay, we determined that the extent of DNA migration was significantly increased at a SAR of 4 W/kg. Flow cytometry analysis demonstrated that levels of the DNA adduct 8-oxoguanine (8-oxoG) were also increased at a SAR of 4 W/kg. These increases were concomitant with similar increases in the generation of reactive oxygen species (ROS); these phenomena were mitigated by co-treatment with the antioxidant α-tocopherol. However, no detectable DNA strand breakage was observed by the alkaline comet assay. Taking together, these findings may imply the novel possibility that RF-EMR with insufficient energy for the direct induction of DNA strand breaks may produce genotoxicity through oxidative DNA base damage in male germ cells.

  3. Surface Etching and DNA Damage Induced by Low-Energy Ion Irradiation in Yeast

    NASA Astrophysics Data System (ADS)

    Liu, Xuelan; Xu, An; Dai, Yin; Yuan, Hang; Yu, Zengliang

    2011-06-01

    Bio-effects of survival and etching damage on cell surface and DNA strand breaks were investigated in the yeast saccharomyces cerevisiae after exposure by nitrogen ion with an energy below 40 keV. The result showed that 16% of trehalose provided definite protection for cells against vacuum stress compared with glycerol. In contrast to vacuum control, significant morphological damage and DNA strand breaks were observed, in yeast cells bombarded with low-energy nitrogen, by scanning electron microscopy (SEM) and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) immunofluorescence assays. Moreover, PI (propidium iodide) fluorescent staining indicated that cell integrity could be destroyed by ion irradiation. Cell damage eventually affected cell viability and free radicals were involved in cell damage as shown by DMSO (dimethyl sulfoxide) rescue experiment. Our primary experiments demonstrated that yeast cells can be used as an optional experimental model to study the biological effects of low energy ions and be applied to further investigate the mechanism(s) underlying the bio-effects of eukaryotic cells.

  4. Nucleolar disruption and cajal body disassembly are nuclear hallmarks of DNA damage-induced neurodegeneration in purkinje cells.

    PubMed

    Baltanás, Fernando C; Casafont, Iñigo; Weruaga, Eduardo; Alonso, José R; Berciano, María T; Lafarga, Miguel

    2011-07-01

    The Purkinje cell (PC) degeneration (pcd) phenotype results from mutation in nna1 gene and is associated with the degeneration and death of PCs during the postnatal life. Although the pcd mutation is a model of the ataxic mouse, it shares clinical and pathological characteristics of inherited human spinocerebellar ataxias. PC degeneration in pcd mice provides a useful neuronal system to study nuclear mechanisms involved in DNA damage-dependent neurodegeneration, particularly the contribution of nucleoli and Cajal bodies (CBs). Both nuclear structures are engaged in housekeeping functions for neuronal survival, the biogenesis of ribosomes and the maturation of snRNPs and snoRNPs required for pre-mRNA and pre-rRNA processing, respectively. In this study, we use ultrastructural analysis, in situ transcription assay and molecular markers for DNA damage, nucleoli and CB components to demonstrate that PC degeneration involves the progressive accumulation of nuclear DNA damage associated with disruption of nucleoli and CBs, disassembly of polyribosomes into monoribosomes, ribophagy and shut down of nucleolar and extranucleolar transcription. Microarray analysis reveals that four genes encoding repressors of nucleolar rRNA synthesis (p53, Rb, PTEN and SNF2) are upregulated in the cerebellum of pcd mice. Collectively, these data support that nucleolar and CB alterations are hallmarks of DNA damage-induced neurodegeneration.

  5. Prediction of cellular radiosensitivity from DNA damage induced by gamma-rays and carbon ion irradiation in canine tumor cells.

    PubMed

    Wada, Seiichi; Van Khoa, Tran; Kobayashi, Yasuhiko; Funayama, Tomoo; Ogihara, Kikumi; Ueno, Shunji; Ito, Nobuhiko

    2005-11-01

    Diseases of companion animals are shifting from infectious diseases to neoplasms (cancer), and since radiation therapy is one of the effective choices available for cancer treatment, the application of radiotherapy in veterinary medicine is likely to increase. However tumor tissues have different radiosensitivities, and therefore it is important to determine the intrinsic radiosensitivity of tumors in individual patients in advance of radiotherapy. We have studied the relationship between the surviving cell fraction measured by a clonogenic assay and DNA double strand breaks detected by a comet assay under neutral conditions in three canine tumor cell lines, after gamma-ray and carbon ion irradiation. In all the cell lines, cell death assessed by the clonogenic assay was much higher following irradiation with carbon ions than with gamma-rays. The initial and residual (4 hr) DNA damage due to gamma-ray and carbon ion irradiation were higher in a radiosensitive cell line than in a radioresistant cell line. The surviving cell fraction at 2 Gy (SF2) showed a tendency for correlation with both the initial and residual DNA damage. In particular, the residual damage per Gy was significantly correlated with SF2, regardless of the type of radiation. This indicates that cellular radiosensitivity can be predicted by detection of radiation-induced residual DNA damage.

  6. Sodium fluoride induces apoptosis in the kidney of rats through caspase-mediated pathways and DNA damage.

    PubMed

    Song, Guo Hua; Gao, Ji Ping; Wang, Chun Fang; Chen, Chao Yang; Yan, Xiao Yan; Guo, Min; Wang, Yu; Huang, Fu Bing

    2014-09-01

    Long-term excessive sodium fluoride (NaF) intake can cause many bone diseases and nonskeletal fluorosis. The kidneys are the primary organs involved in the excretion and retention of NaF. The objective of the present study was to determine the effects of NaF treatment on renal cell apoptosis, DNA damage, and the protein expression levels of cytosolic cytochrome C (Cyt C) and cleaved caspases 9, 8, and 3 in vivo. Male Sprague-Dawley rats were divided randomly into four groups (control, low fluoride, medium fluoride, and high fluoride) and administered 0, 50, 100, and 200 mg/L of NaF, respectively, via drinking water for 120 days. Histopathological changes in the kidneys were visualized using hematoxylin and eosin staining. Renal cell apoptosis was examined using flow cytometry, and renal cell DNA damage was detected using the comet assay. Cytosolic Cyt C and cleaved caspases 9, 8, and 3 protein expression levels were visualized using immunohistochemistry and Western blotting. The results showed that NaF treatment increased apoptosis and DNA damage. In addition, NaF treatment increased the protein expression levels of cytosolic Cyt C and cleaved caspases 9, 8, and 3. These results indicated that NaF induces apoptosis in the kidney of rats through caspase-mediated pathway, and DNA damage may be involved in this process.

  7. Squalene Inhibits ATM-Dependent Signaling in γIR-Induced DNA Damage Response through Induction of Wip1 Phosphatase.

    PubMed

    Tatewaki, Naoto; Konishi, Tetsuya; Nakajima, Yuki; Nishida, Miyako; Saito, Masafumi; Eitsuka, Takahiro; Sakamaki, Toshiyuki; Ikekawa, Nobuo; Nishida, Hiroshi

    2016-01-01

    Ataxia telangiectasia mutated (ATM) kinase plays a crucial role as a master controller in the cellular DNA damage response. Inhibition of ATM leads to inhibition of the checkpoint signaling pathway. Hence, addition of checkpoint inhibitors to anticancer therapies may be an effective targeting strategy. A recent study reported that Wip1, a protein phosphatase, de-phosphorylates serine 1981 of ATM during the DNA damage response. Squalene has been proposed to complement anticancer therapies such as chemotherapy and radiotherapy; however, there is little mechanistic information supporting this idea. Here, we report the inhibitory effect of squalene on ATM-dependent DNA damage signals. Squalene itself did not affect cell viability and the cell cycle of A549 cells, but it enhanced the cytotoxicity of gamma-irradiation (γIR). The in vitro kinase activity of ATM was not altered by squalene. However, squalene increased Wip1 expression in cells and suppressed ATM activation in γIR-treated cells. Consistent with the potential inhibition of ATM by squalene, IR-induced phosphorylation of ATM effectors such as p53 (Ser15) and Chk1 (Ser317) was inhibited by cell treatment with squalene. Thus, squalene inhibits the ATM-dependent signaling pathway following DNA damage through intracellular induction of Wip1 expression.

  8. Disruption of the mevalonate pathway induces dNTP depletion and DNA damage.

    PubMed

    Martín Sánchez, Covadonga; Pérez Martín, José Manuel; Jin, Jong-Sik; Dávalos, Alberto; Zhang, Wei; de la Peña, Gema; Martínez-Botas, Javier; Rodríguez-Acebes, Sara; Suárez, Yajaira; Hazen, María José; Gómez-Coronado, Diego; Busto, Rebeca; Cheng, Yung-Chi; Lasunción, Miguel A

    2015-09-01

    The mevalonate pathway is tightly linked to cell division. Mevalonate derived non-sterol isoprenoids and cholesterol are essential for cell cycle progression and mitosis completion respectively. In the present work, we studied the effects of fluoromevalonate, a competitive inhibitor of mevalonate diphosphate decarboxylase, on cell proliferation and cell cycle progression in both HL-60 and MOLT-4 cells. This enzyme catalyzes the synthesis of isopentenyl diphosphate, the first isoprenoid in the cholesterol biosynthesis pathway, consuming ATP at the same time. Inhibition of mevalonate diphosphate decarboxylase was followed by a rapid accumulation of mevalonate diphosphate and the reduction of ATP concentrations, while the cell content of cholesterol was barely affected. Strikingly, mevalonate diphosphate decarboxylase inhibition also resulted in the depletion of dNTP pools, which has never been reported before. These effects were accompanied by inhibition of cell proliferation and cell cycle arrest at S phase, together with the appearance of γ-H2AX foci and Chk1 activation. Inhibition of Chk1 in cells treated with fluoromevalonate resulted in premature entry into mitosis and massive cell death, indicating that the inhibition of mevalonate diphosphate decarboxylase triggered a DNA damage response. Notably, the supply of exogenously deoxyribonucleosides abolished γ-H2AX formation and prevented the effects of mevalonate diphosphate decarboxylase inhibition on DNA replication and cell growth. The results indicate that dNTP pool depletion caused by mevalonate diphosphate decarboxylase inhibition hampered DNA replication with subsequent DNA damage, which may have important consequences for replication stress and genomic instability.

  9. NIST gold nanoparticle reference materials do not induce oxidative DNA damage.

    PubMed

    Nelson, Bryant C; Petersen, Elijah J; Marquis, Bryce J; Atha, Donald H; Elliott, John T; Cleveland, Danielle; Watson, Stephanie S; Tseng, I-Hsiang; Dillon, Andrew; Theodore, Mellisa; Jackman, Joany

    2013-02-01

    One primary challenge in nanotoxicology studies is the lack of well-characterised nanoparticle reference materials which could be used as positive or negative nanoparticle controls. The National Institute of Standards and Technology (NIST) has developed three gold nanoparticle (AuNP) reference materials (10, 30 and 60 nm). The genotoxicity of these nanoparticles was tested using HepG2 cells and calf-thymus DNA. DNA damage was assessed based on the specific and sensitive measurement of four oxidatively-modified DNA lesions (8-hydroxy-2´-deoxyguanosine, 8-hydroxy-2´-deoxyadenosine, (5´S)-8,5´-cyclo-2´-deoxyadenosine and (5´R)-8,5´-cyclo-2´-deoxyadenosine) using liquid chromatography/tandem mass spectrometry. Significantly elevated, dose-dependent DNA damage was not detected at concentrations up to 0.2 μg/ml, and free radicals were not detected using electron paramagnetic resonance spectroscopy. These data suggest that the NIST AuNPs could potentially serve as suitable negative-control nanoparticle reference materials for in vitro and in vivo genotoxicity studies. NIST AuNPs thus hold substantial promise for improving the reproducibility and reliability of nanoparticle genotoxicity studies.

  10. The study on space-flight induced DNA damage in Arabidopsis thaliana and the protective effect of hydrogen

    NASA Astrophysics Data System (ADS)

    Sun, Qiao; Liu, Min; Zhao, Hui

    2016-07-01

    Ionizing radiation (IR) is a known mutagen responsible for causing DNA strand breaks in all living organisms. Strand breaks thus created can be repaired by different mechanisms, including homologous recombination (HR), one of the key mechanisms maintaining genome stability. Here, we used previously generated Arabidopsis thaliana, transgenic for homologous recombination reporter system, in which homologous recombination frequency(HRF) was used as mutagenic end points. Based on the system, effect of DNA damage by space-flight during the Shenzhou-9 mission was investigated and the results showed that 13 days space-flight exposure of seedlings induced a significant increase in HRF compared with its ground-base three-dimensional clinostat controls and ground 1g controls. We also observed three-dimensional clinostat induced a significant increase in HRF compared with ground 1g controls. Molecular hydrogen (H2) has antioxidant activities by selectively reducing hydroxylradical ( •OH) and peroxynitrite(ONOO-), so we investigated the effect of hydrogen on IR-induced HRF. Treatment with hydrogen-rich water dramatically reduced the HR frequency induced by exposure of seedlings to 0 to 80 Gy 60Co radiation , suggesting that hydrogen represents a potentially novel preventative strategy for radiation-induced DNA damage in plants.

  11. Cellular responses to environmental DNA damage

    SciTech Connect

    Not Available

    1994-08-01

    This volume contains the proceedings of the conference entitled Cellular Responses to Environmental DNA Damage held in Banff,Alberta December 1--6, 1991. The conference addresses various aspects of DNA repair in sessions titled DNA repair; Basic Mechanisms; Lesions; Systems; Inducible Responses; Mutagenesis; Human Population Response Heterogeneity; Intragenomic DNA Repair Heterogeneity; DNA Repair Gene Cloning; Aging; Human Genetic Disease; and Carcinogenesis. Individual papers are represented as abstracts of about one page in length.

  12. Inhibition of REV3 Expression Induces Persistent DNA Damage and Growth Arrest in Cancer Cells12

    PubMed Central

    Knobel, Philip A; Kotov, Ilya N; Felley-Bosco, Emanuela; Stahel, Rolf A; Marti, Thomas M

    2011-01-01

    REV3 is the catalytic subunit of DNA translesion synthesis polymerase ζ. Inhibition of REV3 expression increases the sensitivity of human cells to a variety of DNA-damaging agents and reduces the formation of resistant cells. Surprisingly, we found that short hairpin RNA-mediated depletion of REV3 per se suppresses colony formation of lung (A549, Calu-3), breast (MCF-7, MDA-MB-231), mesothelioma (IL45 and ZL55), and colon (HCT116 +/-p53) tumor cell lines, whereas control cell lines (AD293, LP9-hTERT) and the normal mesothelial primary culture (SDM104) are less affected. Inhibition of REV3 expression in cancer cells leads to an accumulation of persistent DNA damage as indicated by an increase in phospho-ATM, 53BP1, and phospho-H2AX foci formation, subsequently leading to the activation of the ATM-dependent DNA damage response cascade. REV3 depletion in p53-proficient cancer cell lines results in a G1 arrest and induction of senescence as indicated by the accumulation of p21 and an increase in senescence-associated β-galactosidase activity. In contrast, inhibition of REV3 expression in p53-deficient cells results in growth inhibition and a G2/M arrest. A small fraction of the p53-deficient cancer cells can overcome the G2/M arrest, which results in mitotic slippage and aneuploidy. Our findings reveal that REV3 depletion per se suppresses growth of cancer cell lines from different origin, whereas control cell lines and a mesothelial primary culture were less affected. Thus, our findings indicate that depletion of REV3 not only can amend cisplatin-based cancer therapy but also can be applied for susceptible cancers as a potential monotherapy. PMID:22028621

  13. Ultraviolet Radiation-Induced Skin Aging: The Role of DNA Damage and Oxidative Stress in Epidermal Stem Cell Damage Mediated Skin Aging

    PubMed Central

    Panich, Uraiwan; Sittithumcharee, Gunya; Rathviboon, Natwarath

    2016-01-01

    Skin is the largest human organ. Skin continually reconstructs itself to ensure its viability, integrity, and ability to provide protection for the body. Some areas of skin are continuously exposed to a variety of environmental stressors that can inflict direct and indirect damage to skin cell DNA. Skin homeostasis is maintained by mesenchymal stem cells in inner layer dermis and epidermal stem cells (ESCs) in the outer layer epidermis. Reduction of skin stem cell number and function has been linked to impaired skin homeostasis (e.g., skin premature aging and skin cancers). Skin stem cells, with self-renewal capability and multipotency, are frequently affected by environment. Ultraviolet radiation (UVR), a major cause of stem cell DNA damage, can contribute to depletion of stem cells (ESCs and mesenchymal stem cells) and damage of stem cell niche, eventually leading to photoinduced skin aging. In this review, we discuss the role of UV-induced DNA damage and oxidative stress in the skin stem cell aging in order to gain insights into the pathogenesis and develop a way to reduce photoaging of skin cells. PMID:27148370

  14. Acute and chronic watercress supplementation attenuates exercise-induced peripheral mononuclear cell DNA damage and lipid peroxidation.

    PubMed

    Fogarty, Mark C; Hughes, Ciara M; Burke, George; Brown, John C; Davison, Gareth W

    2013-01-28

    Pharmacological antioxidant vitamins have previously been investigated for a prophylactic effect against exercise-induced oxidative stress. However, large doses are often required and may lead to a state of pro-oxidation and oxidative damage. Watercress contains an array of nutritional compounds such as β-carotene and α-tocopherol which may increase protection against exercise-induced oxidative stress. The present randomised controlled investigation was designed to test the hypothesis that acute (consumption 2 h before exercise) and chronic (8 weeks consumption) watercress supplementation can attenuate exercise-induced oxidative stress. A total of ten apparently healthy male subjects (age 23 (SD 4) years, stature 179 (SD 10) cm and body mass 74 (SD 15) kg) were recruited to complete the 8-week chronic watercress intervention period (and then 8 weeks of control, with no ingestion) of the experiment before crossing over in order to compete the single-dose acute phase (with control, no ingestion). Blood samples were taken at baseline (pre-supplementation), at rest (pre-exercise) and following exercise. Each subject completed an incremental exercise test to volitional exhaustion following chronic and acute watercress supplementation or control. The main findings show an exercise-induced increase in DNA damage and lipid peroxidation over both acute and chronic control supplementation phases (P< 0.05 v. supplementation), while acute and chronic watercress attenuated DNA damage and lipid peroxidation and decreased H₂O₂ accumulation following exhaustive exercise (P< 0.05 v. control). A marked increase in the main lipid-soluble antioxidants (α-tocopherol, γ-tocopherol and xanthophyll) was observed following watercress supplementation (P< 0.05 v. control) in both experimental phases. These findings suggest that short- and long-term watercress ingestion has potential antioxidant effects against exercise-induced DNA damage and lipid peroxidation.

  15. Influence of organic ions on DNA damage induced by 1 eV to 60 keV electrons.

    PubMed

    Zheng, Yi; Sanche, Léon

    2010-10-21

    We report the results of a study on the influence of organic salts on the induction of single strand breaks (SSBs) and double strand breaks (DSBs) in DNA by electrons of 1 eV to 60 keV. Plasmid DNA films are prepared with two different concentrations of organic salts, by varying the amount of the TE buffer (Tris-HCl and EDTA) in the films with ratio of 1:1 and 6:1 Tris ions to DNA nucleotide. The films are bombarded with electrons of 1, 10, 100, and 60 000 eV under vacuum. The damage to the 3197 base-pair plasmid is analyzed ex vacuo by agarose gel electrophoresis. The highest yields are reached at 100 eV and the lowest ones at 60 keV. The ratios of SSB to DSB are surprisingly low at 10 eV (∼4.3) at both salt concentrations, and comparable to the ratios measured with 100 eV electrons. At all characteristic electron energies, the yields of SSB and DSB are found to be higher for the DNA having the lowest salt concentration. However, the organic salts are more efficient at protecting DNA against the damage induced by 1 and 10 eV electrons. DNA damage and protection by organic ions are discussed in terms of mechanisms operative at each electron energy. It is suggested that these ions create additional electric fields within the groove of DNA, which modify the resonance parameter of 1 and 10 eV electrons, namely, by reducing the electron capture cross-section of basic DNA units and the lifetime of corresponding transient anions. An interstrand electron transfer mechanism is proposed to explain the low ratios for the yields of SSB to those of DSB produced by 10 eV electrons.

  16. Influence of organic ions on DNA damage induced by 1 eV to 60 keV electrons

    SciTech Connect

    Zheng Yi; Sanche, Leon

    2010-10-21

    We report the results of a study on the influence of organic salts on the induction of single strand breaks (SSBs) and double strand breaks (DSBs) in DNA by electrons of 1 eV to 60 keV. Plasmid DNA films are prepared with two different concentrations of organic salts, by varying the amount of the TE buffer (Tris-HCl and EDTA) in the films with ratio of 1:1 and 6:1 Tris ions to DNA nucleotide. The films are bombarded with electrons of 1, 10, 100, and 60 000 eV under vacuum. The damage to the 3197 base-pair plasmid is analyzed ex vacuo by agarose gel electrophoresis. The highest yields are reached at 100 eV and the lowest ones at 60 keV. The ratios of SSB to DSB are surprisingly low at 10 eV ({approx}4.3) at both salt concentrations, and comparable to the ratios measured with 100 eV electrons. At all characteristic electron energies, the yields of SSB and DSB are found to be higher for the DNA having the lowest salt concentration. However, the organic salts are more efficient at protecting DNA against the damage induced by 1 and 10 eV electrons. DNA damage and protection by organic ions are discussed in terms of mechanisms operative at each electron energy. It is suggested that these ions create additional electric fields within the groove of DNA, which modify the resonance parameter of 1 and 10 eV electrons, namely, by reducing the electron capture cross-section of basic DNA units and the lifetime of corresponding transient anions. An interstrand electron transfer mechanism is proposed to explain the low ratios for the yields of SSB to those of DSB produced by 10 eV electrons.

  17. Influence of organic ions on DNA damage induced by 1 eV to 60 keV electrons

    NASA Astrophysics Data System (ADS)

    Zheng, Yi; Sanche, Léon

    2010-10-01

    We report the results of a study on the influence of organic salts on the induction of single strand breaks (SSBs) and double strand breaks (DSBs) in DNA by electrons of 1 eV to 60 keV. Plasmid DNA films are prepared with two different concentrations of organic salts, by varying the amount of the TE buffer (Tris-HCl and EDTA) in the films with ratio of 1:1 and 6:1 Tris ions to DNA nucleotide. The films are bombarded with electrons of 1, 10, 100, and 60 000 eV under vacuum. The damage to the 3197 base-pair plasmid is analyzed ex vacuo by agarose gel electrophoresis. The highest yields are reached at 100 eV and the lowest ones at 60 keV. The ratios of SSB to DSB are surprisingly low at 10 eV (˜4.3) at both salt concentrations, and comparable to the ratios measured with 100 eV electrons. At all characteristic electron energies, the yields of SSB and DSB are found to be higher for the DNA having the lowest salt concentration. However, the organic salts are more efficient at protecting DNA against the damage induced by 1 and 10 eV electrons. DNA damage and protection by organic ions are discussed in terms of mechanisms operative at each electron energy. It is suggested that these ions create additional electric fields within the groove of DNA, which modify the resonance parameter of 1 and 10 eV electrons, namely, by reducing the electron capture cross-section of basic DNA units and the lifetime of corresponding transient anions. An interstrand electron transfer mechanism is proposed to explain the low ratios for the yields of SSB to those of DSB produced by 10 eV electrons.

  18. DNA Damage Signaling Is Induced in the Absence of Epstein-Barr Virus (EBV) Lytic DNA Replication and in Response to Expression of ZEBRA.

    PubMed

    Wang'ondu, Ruth; Teal, Stuart; Park, Richard; Heston, Lee; Delecluse, Henri; Miller, George

    2015-01-01

    Epstein Barr virus (EBV), like other oncogenic viruses, modulates the activity of cellular DNA damage responses (DDR) during its life cycle. Our aim was to characterize the role of early lytic proteins and viral lytic DNA replication in activation of DNA damage signaling during the EBV lytic cycle. Our data challenge the prevalent hypothesis that activation of DDR pathways during the EBV lytic cycle occurs solely in response to large amounts of exogenous double stranded DNA products generated during lytic viral DNA replication. In immunofluorescence or immunoblot assays, DDR activation markers, specifically phosphorylated ATM (pATM), H2AX (γH2AX), or 53BP1 (p53BP1), were induced in the presence or absence of viral DNA amplification or replication compartments during the EBV lytic cycle. In assays with an ATM inhibitor and DNA damaging reagents in Burkitt lymphoma cell lines, γH2AX induction was necessary for optimal expression of early EBV genes, but not sufficient for lytic reactivation. Studies in lytically reactivated EBV-positive cells in which early EBV proteins, BGLF4, BGLF5, or BALF2, were not expressed showed that these proteins were not necessary for DDR activation during the EBV lytic cycle. Expression of ZEBRA, a viral protein that is necessary for EBV entry into the lytic phase, induced pATM foci and γH2AX independent of other EBV gene products. ZEBRA mutants deficient in DNA binding, Z(R183E) and Z(S186E), did not induce foci of pATM. ZEBRA co-localized with HP1β, a heterochromatin associated protein involved in DNA damage signaling. We propose a model of DDR activation during the EBV lytic cycle in which ZEBRA induces ATM kinase phosphorylation, in a DNA binding dependent manner, to modulate gene expression. ATM and H2AX phosphorylation induced prior to EBV replication may be critical for creating a microenvironment of viral and cellular gene expression that enables lytic cycle progression.

  19. Developmental toxicity and DNA damage to zebrafish induced by perfluorooctane sulfonate in the presence of ZnO nanoparticles.

    PubMed

    Du, Jia; Wang, Shutao; You, Hong; Jiang, Rui; Zhuang, Changlu; Zhang, Xiaohui

    2016-03-01

    Perfluorooctane sulfonate (PFOS) and ZnO nanoparticles (ZnO-NPs) are frequently detected in the environment, but few studies have assessed their joint toxicity. In this study, the acute toxicity and chronic toxicity to zebrafish (Danio rerio) induced by PFOS in the presence of ZnO-NPs were investigated, including developmental toxicity and DNA damage. The embryos were exposed to PFOS (only) (0.4, 0.8, and 1.6 mg/L) and PFOS plus ZnO-NPs (0.4 + 50, 0.8 + 50, and 1.6 + 50 mg/L) solutions to evaluate mortality (96 h), body length (96 h), hatch rate (72 h), heart rate (48 h),and malformation rate (96 h). The results revealed that the co-treatment could cause more severe developmental toxicity compared with the control and single-treatments, and the toxic effects generally increased in a dose-response manner. In addition, adult zebrafish were exposed to single and mixed solutions of PFOS and ZnO-NPs (at the concentrations mentioned above) for 30 days. DNA damage to zebrafish was evaluated by the comet assay and micronucleus test. We found that the PFOS single-treatment at all doses (0.4, 0.8, and 1.6 mg/L) could strongly induce DNA damage to peripheral blood cells and that ZnO-NPs could aggravate the formation of DNA damage in co-treatments. Histological examination of liver, testicle, and ovary showed that the presence of ZnO-NPs (50 mg/L) could also cause more serious histological damage to adult zebrafish than PFOS alone. As a result, the synergistic effects played an important role during joint exposure. Our observations provide a basic understanding of the joint toxicity of PFOS and ZnO-NPs to aquatic organisms.

  20. Nitrative DNA damage induced by multi-walled carbon nanotube via endocytosis in human lung epithelial cells

    SciTech Connect

    Guo, Feiye; Ma, Ning; Horibe, Yoshiteru; Kawanishi, Shosuke; Murata, Mariko; Hiraku, Yusuke

    2012-04-15

    Carbon nanotube (CNT) has a promising usage in the field of material science for industrial purposes because of its unique physicochemical property. However, intraperitoneal administration of CNT was reported to cause mesothelioma in experimental animals. Chronic inflammation may contribute to carcinogenesis induced by fibrous materials. 8-Nitroguanine is a mutagenic DNA lesion formed during inflammation and may play a role in CNT-induced carcinogenesis. In this study, we examined 8-nitroguanine formation in A549 human lung alveolar epithelial cells treated with multi-walled CNT (MWCNT) by fluorescent immunocytochemistry. Both MWCNTs with diameter of 20–30 nm (CNT20) and 40–70 nm (CNT40) significantly induced 8-nitroguanine formation at 5 and 10 μg/ml (p < 0.05), which persisted for 24 h, although there was no significant difference in DNA-damaging abilities of these MWCNTs. MWCNTs significantly induced the expression of inducible nitric oxide synthase (iNOS) for 24 h (p < 0.05). MWCNTs also significantly increased the level of nitrite, a hydrolysis product of oxidized NO, in the culture supernatant at 4 and 8 h (p < 0.05). MWCNT-induced 8-nitroguanine formation and iNOS expression were largely suppressed by inhibitors of iNOS (1400 W), nuclear factor-κB (Bay11-7082), actin polymerization (cytochalasin D), caveolae-mediated endocytosis (methyl-β-cyclodextrin, MBCD) and clathrin-mediated endocytosis (monodansylcadaverine, MDC). Electron microscopy revealed that MWCNT was mainly located in vesicular structures in the cytoplasm, and its cellular internalization was reduced by MBCD and MDC. These results suggest that MWCNT is internalized into cells via clathrin- and caveolae-mediated endocytosis, leading to inflammatory reactions including iNOS expression and resulting nitrative DNA damage, which may contribute to carcinogenesis. Highlights: ►Multi-walled carbon nanotube (MWCNT) caused DNA damage in A549 cells. ►MWCNT formed 8-nitroguanine, a DNA lesion

  1. Protection by organic ions against DNA damage induced by low energy electrons

    NASA Astrophysics Data System (ADS)

    Dumont, A.; Zheng, Y.; Hunting, D.; Sanche, L.

    2010-01-01

    It is well known that electrons below 15 eV induce strand breaks in DNA essentially via the formation of transient anions which decay by dissociative electron attachment (DEA) or into dissociative electronics states. The present article reports the results of a study on the influence of organic ions on this mechanism. tris and EDTA are incorporated at various concentrations within DNA films of different thicknesses. The amino group of tris molecules and the carboxylic acid function of ethylenediamine tetra-acetic acid (EDTA) molecules together can be taken as simple model for the amino acids components of proteins, such as histones, which are intimately associated with the DNA of eukaryotic cells. The yield of single strand breaks induced by 10 eV electrons is found to decrease dramatically as a function of the number of organic ions/nucleotide. As few as 2 organic ions/nucleotide are sufficient to decrease the yield of single strand breaks by 70%. This effect is partly explained by an increase in multiple inelastic electrons scattering with film thickness but changes in the resonance parameters can also contribute to DNA protection. This can occur if the electron captures cross section and the lifetime of the transient anions (i.e., core-excited resonances) formed at 10 eV are reduced by the presence of organic ions within the grooves of DNA. Moreover, it is proposed that the tris molecules may participate in the repair of DNA anions [such as G(-H)-] induced by DEA on DNA bases.

  2. G-quadruplex ligand-induced DNA damage response coupled with telomere dysfunction and replication stress in glioma stem cells

    PubMed Central

    Hasegawa, Daiki; Okabe, Sachiko; Okamoto, Keiji; Nakano, Ichiro; Shin-ya, Kazuo; Seimiya, Hiroyuki

    2016-01-01

    Glioblastoma (GBM) is an invariably fatal brain tumor in which a small subpopulation of self-renewable glioma stem cells (GSCs) contributes to tumor propagation and relapse. Targeting GSCs could therefore have a significant clinical impact for GBM. Telomes