Sample records for induced dna damages

  1. DNA Damage Induced Neuronal Death

    DTIC Science & Technology


    Experiments are proposed to examine the molecular mechanism by which mustard chemical warfare agents induce neuronal cell death . DNA damage is the...proposed underlying mechanism of mustard-induced neuronal cell death . We propose a novel research strategy to test this hypothesis by using mice with...perturbed DNA repair to explore the relationship between mustard-induced DNA damage and neuronal cell death . Initial in vitro studies (Years 1, 2 & 3

  2. Triplex-induced DNA damage response.


    Rogers, Faye A; Tiwari, Meetu Kaushik


    Cellular DNA damage response is critical to preserving genomic integrity following exposure to genotoxic stress. A complex series of networks and signaling pathways become activated after DNA damage and trigger the appropriate cellular response, including cell cycle arrest, DNA repair, and apoptosis. The response elicited is dependent upon the type and extent of damage sustained, with the ultimate goal of preventing propagation of the damaged DNA. A major focus of our studies is to determine the cellular pathways involved in processing damage induced by altered helical structures, specifically triplexes. Our lab has demonstrated that the TFIIH factor XPD occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. We have shown that XPD co-localizes with γH2AX, and its presence is required for the phosphorylation of H2AX tyrosine142, which stimulates the signaling pathway to recruit pro-apoptotic factors to the damage site. Herein, we examine the cellular pathways activated in response to triplex formation and discuss our finding that suggests that XPD-dependent apoptosis plays a role in preserving genomic integrity in the presence of excessive structurally induced DNA damage.

  3. Acrylonitrile-induced oxidative DNA damage in rat astrocytes.


    Pu, Xinzhu; Kamendulis, Lisa M; Klaunig, James E


    Chronic administration of acrylonitrile results in a dose-related increase in astrocytomas in rat brain, but the mechanism of acrylonitrile carcinogenicity is not fully understood. The potential of acrylonitrile or its metabolites to induce direct DNA damage as a mechanism for acrylonitrile carcinogenicity has been questioned, and recent studies indicate that the mechanism involves the induction of oxidative stress in rat brain. The present study examined the ability of acrylonitrile to induce DNA damage in the DI TNC1 rat astrocyte cell line using the alkaline Comet assay. Oxidized DNA damage also was evaluated using formamidopyrimidine DNA glycosylase treatment in the modified Comet assay. No increase in direct DNA damage was seen in astrocytes exposed to sublethal concentrations of acrylonitrile (0-1.0 mM) for 24 hr. However, acrylonitrile treatment resulted in a concentration-related increase in oxidative DNA damage after 24 hr. Antioxidant supplementation in the culture media (alpha-tocopherol, (-)-epigallocathechin-3 gallate, or trolox) reduced acrylonitrile-induced oxidative DNA damage. Depletion of glutathione using 0.1 mM DL-buthionine-[S,R]-sulfoximine increased acrylonitrile-induced oxidative DNA damage (22-46%), while cotreatment of acrylonitrile with 2.5 mM L-2-oxothiazolidine-4-carboxylic acid, a precursor for glutathione biosynthesis, significantly reduced acrylonitrile-induced oxidative DNA damage (7-47%). Cotreatment of acrylonitrile with 0.5 mM 1-aminobenzotriazole, a suicidal inhibitor of cytochrome P450, prevented the oxidative DNA damage produced by acrylonitrile. Cyanide (0.1-0.5 mM) increased oxidative DNA damage (44-160%) in astrocytes. These studies demonstrate that while acrylonitrile does not directly damage astrocyte DNA, it does increase oxidative DNA damage. The oxidative DNA damage following acrylonitrile exposure appears to arise mainly through the P450 metabolic pathway; moreover, glutathione depletion may contribute to the

  4. Mitochondrial DNA damage by bleomycin induces AML cell death.


    Yeung, ManTek; Hurren, Rose; Nemr, Carine; Wang, Xiaoming; Hershenfeld, Samantha; Gronda, Marcela; Liyanage, Sanduni; Wu, Yan; Augustine, Jeevan; Lee, Eric A; Spagnuolo, Paul A; Southall, Noel; Chen, Catherine; Zheng, Wei; Jeyaraju, Danny V; Minden, Mark D; Laposa, Rebecca; Schimmer, Aaron D


    Mitochondria contain multiple copies of their own 16.6 kb circular genome. To explore the impact of mitochondrial DNA (mtDNA) damage on mitochondrial (mt) function and viability of AML cells, we screened a panel of DNA damaging chemotherapeutic agents to identify drugs that could damage mtDNA. We identified bleomycin as an agent that damaged mtDNA in AML cells at concentrations that induced cell death. Bleomycin also induced mtDNA damage in primary AML samples. Consistent with the observed mtDNA damage, bleomycin reduced mt mass and basal oxygen consumption in AML cells. We also demonstrated that the observed mtDNA damage was functionally important for bleomycin-induced cell death. Finally, bleomycin delayed tumor growth in xenograft mouse models of AML and anti-leukemic concentrations of the drug induced mtDNA damage in AML cells preferentially over normal lung tissue. Taken together, mtDNA-targeted therapy may be an effective strategy to target AML cells and bleomycin could be useful in the treatment of this disease.

  5. RNF111-dependent neddylation activates DNA damage-induced ubiquitination

    PubMed Central

    Ma, Teng; Chen, Yibin; Zhang, Feng; Yang, Chao-Yie; Wang, Shaomeng; Yu, Xiaochun


    Summary Ubiquitin-like proteins have been shown to be covalently conjugated to targets. However, the functions of these ubiquitin-like proteins are largely unknown. Here, we have screened most known ubiquitin-like proteins after DNA damage and found that NEDD8 is involved in the DNA damage response. Following various DNA damage stimuli, NEDD8 accumulated at DNA damage sites, and this accumulation was dependent on an E2 enzyme UBE2M and an E3 ubiquitin ligase RNF111. We further found that histone H4 was polyneddylated in response to DNA damage, and NEDD8 was conjugated to the N-terminal lysine residues of H4. Interestingly, the DNA damage-induced polyneddylation chain could be recognized by the MIU (Motif Interacting with Ubiquitin) domain of RNF168. Loss of DNA damage-induced neddylation negatively regulated DNA damage-induced foci formation of RNF168 and its downstream functional partners, such as 53BP1 and BRCA1, thus affecting the normal DNA damage repair process. PMID:23394999

  6. UV and ionizing radiations induced DNA damage, differences and similarities

    NASA Astrophysics Data System (ADS)

    Ravanat, Jean-Luc; Douki, Thierry


    Both UV and ionizing radiations damage DNA. Two main mechanisms, so-called direct and indirect pathways, are involved in the degradation of DNA induced by ionizing radiations. The direct effect of radiation corresponds to direct ionization of DNA (one electron ejection) whereas indirect effects are produced by reactive oxygen species generated through water radiolysis, including the highly reactive hydroxyl radicals, which damage DNA. UV (and visible) light damages DNA by again two distinct mechanisms. UVC and to a lesser extend UVB photons are directly absorbed by DNA bases, generating their excited states that are at the origin of the formation of pyrimidine dimers. UVA (and visible) light by interaction with endogenous or exogenous photosensitizers induce the formation of DNA damage through photosensitization reactions. The excited photosensitizer is able to induce either a one-electron oxidation of DNA (type I) or to produce singlet oxygen (type II) that reacts with DNA. In addition, through an energy transfer from the excited photosensitizer to DNA bases (sometime called type III mechanism) formation of pyrimidine dimers could be produced. Interestingly it has been shown recently that pyrimidine dimers are also produced by direct absorption of UVA light by DNA, even if absorption of DNA bases at these wavelengths is very low. It should be stressed that some excited photosensitizers (such as psoralens) could add directly to DNA bases to generate adducts. The review will described the differences and similarities in terms of damage formation (structure and mechanisms) between these two physical genotoxic agents.

  7. DNA damage in cells exhibiting radiation-induced genomic instability

    SciTech Connect

    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.


    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesis that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.

  8. DNA damage in cells exhibiting radiation-induced genomic instability


    Keszenman, Deborah J.; Kolodiuk, Lucia; Baulch, Janet E.


    Cells exhibiting radiation induced genomic instability exhibit varied spectra of genetic and chromosomal aberrations. Even so, oxidative stress remains a common theme in the initiation and/or perpetuation of this phenomenon. Isolated oxidatively modified bases, abasic sites, DNA single strand breaks and clustered DNA damage are induced in normal mammalian cultured cells and tissues due to endogenous reactive oxygen species generated during normal cellular metabolism in an aerobic environment. While sparse DNA damage may be easily repaired, clustered DNA damage may lead to persistent cytotoxic or mutagenic events that can lead to genomic instability. In this study, we tested the hypothesismore » that DNA damage signatures characterised by altered levels of endogenous, potentially mutagenic, types of DNA damage and chromosomal breakage are related to radiation-induced genomic instability and persistent oxidative stress phenotypes observed in the chromosomally unstable progeny of irradiated cells. The measurement of oxypurine, oxypyrimidine and abasic site endogenous DNA damage showed differences in non-double-strand breaks (DSB) clusters among the three of the four unstable clones evaluated as compared to genomically stable clones and the parental cell line. These three unstable clones also had increased levels of DSB clusters. The results of this study demonstrate that each unstable cell line has a unique spectrum of persistent damage and lead us to speculate that alterations in DNA damage signaling and repair may be related to the perpetuation of genomic instability.« less

  9. An inducible long noncoding RNA amplifies DNA damage signaling.


    Schmitt, Adam M; Garcia, Julia T; Hung, Tiffany; Flynn, Ryan A; Shen, Ying; Qu, Kun; Payumo, Alexander Y; Peres-da-Silva, Ashwin; Broz, Daniela Kenzelmann; Baum, Rachel; Guo, Shuling; Chen, James K; Attardi, Laura D; Chang, Howard Y


    Long noncoding RNAs (lncRNAs) are prevalent genes with frequently precise regulation but mostly unknown functions. Here we demonstrate that lncRNAs guide the organismal DNA damage response. DNA damage activated transcription of the DINO (Damage Induced Noncoding) lncRNA via p53. DINO was required for p53-dependent gene expression, cell cycle arrest and apoptosis in response to DNA damage, and DINO expression was sufficient to activate damage signaling and cell cycle arrest in the absence of DNA damage. DINO bound to p53 protein and promoted its stabilization, mediating a p53 auto-amplification loop. Dino knockout or promoter inactivation in mice dampened p53 signaling and ameliorated acute radiation syndrome in vivo. Thus, inducible lncRNA can create a feedback loop with its cognate transcription factor to amplify cellular signaling networks.

  10. An inducible long noncoding RNA amplifies DNA damage signaling

    PubMed Central

    Schmitt, Adam M.; Garcia, Julia T.; Hung, Tiffany; Flynn, Ryan A.; Shen, Ying; Qu, Kun; Payumo, Alexander Y.; Peres-da-Silva, Ashwin; Broz, Daniela Kenzelmann; Baum, Rachel; Guo, Shuling; Chen, James K.; Attardi, Laura D.; Chang, Howard Y.


    Long noncoding RNAs (lncRNAs) are prevalent genes with frequently exquisite regulation but mostly unknown functions. Here we demonstrate a role of lncRNAs in guiding organismal DNA damage response. DNA damage activates transcription of DINO (Damage Induced NOncoding) via p53. DINO is required for p53-dependent gene expression, cell cycle arrest, and apoptosis in response to DNA damage, and DINO expression suffice to activate damage signaling and cell cycle arrest in the absence of DNA damage. DINO binds to and promotes p53 protein stabilization, mediating a p53 auto-amplification loop. Dino knockout or promoter inactivation in mice dampens p53 signaling and ameliorates acute radiation syndrome in vivo. Thus, inducible lncRNA can create a feedback loop with its cognate transcription factor to amplify cellular signaling networks. PMID:27668660

  11. Plasmid DNA damage induced by helium atmospheric pressure plasma jet

    NASA Astrophysics Data System (ADS)

    Han, Xu; Cantrell, William A.; Escobar, Erika E.; Ptasinska, Sylwia


    A helium atmospheric pressure plasma jet (APPJ) is applied to induce damage to aqueous plasmid DNA. The resulting fractions of the DNA conformers, which indicate intact molecules or DNA with single- or double-strand breaks, are determined using agarose gel electrophoresis. The DNA strand breaks increase with a decrease in the distance between the APPJ and DNA samples under two working conditions of the plasma source with different parameters of applied electric pulses. The damage level induced in the plasmid DNA is also enhanced with increased plasma irradiation time. The reactive species generated in the APPJ are characterized by optical emission spectra, and their roles in possible DNA damage processes occurring in an aqueous environment are also discussed.

  12. Hydroxyl radical Thymine adduct induced DNA damages

    NASA Astrophysics Data System (ADS)

    Schyman, Patric; Eriksson, Leif A.; Zhang, Ru bo; Laaksonen, Aatto


    DNA damages caused by a 5-hydroxy-5,6-dihydrothymine-6-yl radical (5-OHT-6yl) abstracting a C2‧ hydrogen from a neighboring sugar (inter-H abstraction) have been theoretically investigated using hybrid DFT in gas phase and in water solution. The inter-H abstraction was here shown to be comparable in energy (24 kcal mol-1) with the intra-H abstraction in which the 5-OHT-6yl abstracts a C2‧ hydrogen from its own sugar. The effect of a neutrally or a negatively charged phosphate group was also studied and the results show no significant impact on the activation energy of the hydrogen abstraction whereas base release and strand break reactions are affected.

  13. Inducible repair of oxidative DNA damage in Escherichia coli.


    Demple, B; Halbrook, J

    Hydrogen peroxide is lethal to many cell types, including the bacterium Escherichia coli. Peroxides yield transient radical species that can damage DNA and cause mutations. Such partially reduced oxygen species are occasionally released during cellular respiration and are generated by lethal and mutagenic ionizing radiation. Because cells live in an environment where the threat of oxidative DNA damage is continual, cellular mechanisms may have evolved to avoid and repair this damage. Enzymes are known which evidently perform these functions. We report here that resistance to hydrogen peroxide toxicity can be induced in E. coli, that this novel induction is specific and occurs, in part, at the level of DNA repair.

  14. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)


    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  15. Radiation-induced DNA damage and chromatin structure

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)


    DNA lesions induced by ionizing radiation in cells are clustered and not randomly distributed. For low linear energy transfer (LET) radiation this clustering occurs mainly on the small scales of DNA molecules and nucleosomes. For example, experimental evidence suggests that both strands of DNA on the nucleosomal surface can be damaged in single events and that this damage occurs with a 10-bp modulation because of protection by histones. For high LET radiation, clustering also occurs on a larger scale and depends on chromatin organization. A particularly significant clustering occurs when an ionizing particle traverses the 30 nm chromatin fiber with generation of heavily damaged DNA regions with an average size of about 2 kbp. On an even larger scale, high LET radiation can produce several DNA double-strand breaks in closer proximity than expected from randomness. It is suggested that this increases the probability of misrejoining of DNA ends and generation of lethal chromosome aberrations.

  16. Tyrosine-dependent oxidative DNA damage induced by carcinogenic tetranitromethane.


    Murata, Mariko; Kurimoto, Saori; Kawanishi, Shosuke


    Tetranitromethane (TNM) is used as an oxidizer in rocket propellants and explosives and as an additive to increase the cetane number of diesel fuel. TNM was reported to induce pulmonary adenocarcinomas and squamous cell carcinomas in mice and rats. However, the mechanisms underlying carcinogenesis induced by TNM has not yet been clarified. We previously revealed that nitroTyr and nitroTyr-containing peptides caused Cu(II)-dependent DNA damage in the presence of P450 reductase, which is considered to yield nitroreduction. Since TNM is a reagent for nitration of Tyr in proteins and peptides, we have hypothesized that TNM-treated Tyr and Tyr-containing peptides induce DNA damage by the modification of Tyr. We examined DNA damage induced by TNM-treated amino acids or peptides using (32)P-5'-end-labeled DNA fragments obtained from the human p53 tumor suppressor gene and the c-Ha-ras-1 protooncogene. TNM-treated Tyr and Lys-Tyr-Lys induced DNA damage including the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine in the presence of Cu(II) and NADH. DNA damage was inhibited by catalase and bathocuproine, indicating the involvement of H(2)O(2) and Cu(I). The cytosine residue of the ACG sequence complementary to codon 273, well-known hotspots of the p53 gene, was cleaved with piperidine and Fpg treatments. On the other hand, nitroTyr and Lys-nitroTyr-Lys did not induce DNA damage in the presence of Cu(II) and NADH. Time-of-flight mass spectrometry confirmed that reactions between Lys-Tyr-Lys and TNM yielded not only Lys-nitroTyr-Lys but also Lys-nitrosoTyr-Lys. Therefore, it is speculated that the nitrosotyrosine residue can induce oxidative DNA damage in the presence of Cu(II) and NADH. It is concluded that Tyr-dependent DNA damage may play an important role in the carcinogenicity of TNM. TNM is a new type of carcinogen that induces DNA damage not by itself but via Tyr modification.

  17. Oxidatively induced DNA damage and its repair in cancer.


    Dizdaroglu, Miral


    Oxidatively induced DNA damage is caused in living organisms by endogenous and exogenous reactive species. DNA lesions resulting from this type of damage are mutagenic and cytotoxic and, if not repaired, can cause genetic instability that may lead to disease processes including carcinogenesis. Living organisms possess DNA repair mechanisms that include a variety of pathways to repair multiple DNA lesions. Mutations and polymorphisms also occur in DNA repair genes adversely affecting DNA repair systems. Cancer tissues overexpress DNA repair proteins and thus develop greater DNA repair capacity than normal tissues. Increased DNA repair in tumors that removes DNA lesions before they become toxic is a major mechanism for development of resistance to therapy, affecting patient survival. Accumulated evidence suggests that DNA repair capacity may be a predictive biomarker for patient response to therapy. Thus, knowledge of DNA protein expressions in normal and cancerous tissues may help predict and guide development of treatments and yield the best therapeutic response. DNA repair proteins constitute targets for inhibitors to overcome the resistance of tumors to therapy. Inhibitors of DNA repair for combination therapy or as single agents for monotherapy may help selectively kill tumors, potentially leading to personalized therapy. Numerous inhibitors have been developed and are being tested in clinical trials. The efficacy of some inhibitors in therapy has been demonstrated in patients. Further development of inhibitors of DNA repair proteins is globally underway to help eradicate cancer.

  18. DNA damage-induced cell death: from specific DNA lesions to the DNA damage response and apoptosis.


    Roos, Wynand P; Kaina, Bernd


    DNA damaging agents are potent inducers of cell death triggered by apoptosis. Since these agents induce a plethora of different DNA lesions, it is firstly important to identify the specific lesions responsible for initiating apoptosis before the apoptotic executing pathways can be elucidated. Here, we describe specific DNA lesions that have been identified as apoptosis triggers, their repair and the signaling provoked by them. We discuss methylating agents such as temozolomide, ionizing radiation and cisplatin, all of them are important in cancer therapy. We show that the potentially lethal events for the cell are O(6)-methylguanine adducts that are converted by mismatch repair into DNA double-strand breaks (DSBs), non-repaired N-methylpurines and abasic sites as well as bulky adducts that block DNA replication leading to DSBs that are also directly induced following ionizing radiation. Transcriptional inhibition may also contribute to apoptosis. Cells are equipped with sensors that detect DNA damage and relay the signal via kinases to executors, who on their turn evoke a process that inhibits cell cycle progression and provokes DNA repair or, if this fails, activate the receptor and/or mitochondrial apoptotic cascade. The main DNA damage recognition factors MRN and the PI3 kinases ATM, ATR and DNA-PK, which phosphorylate a multitude of proteins and thus induce the DNA damage response (DDR), will be discussed as well as the downstream players p53, NF-κB, Akt and survivin. We review data and models describing the signaling from DNA damage to the apoptosis executing machinery and discuss the complex interplay between cell survival and death. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  19. Modulation of irinotecan-induced genomic DNA damage by theanine.


    Attia, Sabry


    The possible chemoprotective activity of theanine against irinotecan-induced genomic DNA damage towards mouse bone marrow cells was investigated. Chromosomal aberrations, DNA damage, micronuclei formation and mitotic activity were studied in the current study as markers of genomic damage. Oxidative DNA stress markers such as 8-hydroxydeoxyguanosine, lipid peroxidation, reduced and oxidized glutathione levels were assessed as a possible mechanism underlying this amelioration. Theanine was neither genotoxic nor cytotoxic in mice at doses equivalent to 30 or 60 mg/kg for 12 days. Pretreatment of mice with theanine significantly reduced irinotecan-induced genomic damage in the bone marrow cells and these effects were dose dependent. Irinotecan induced marked biochemical alterations characteristic of oxidative DNA stress, including increased 8-hydroxydeoxyguanosine, enhanced lipid peroxidation and reduction in the reduced/oxidized glutathione ratio. Prior administration of theanine ahead of irinotecan challenge ameliorated these oxidative DNA stress markers. Overall, this study provides for the first time that theanine has a protective role in the abatement of irinotecan-induced genomic damage in the bone marrow cells of mice that resides, at least in part, on its ability to modulate the cellular antioxidant levels and consequently protect bone marrow from irinotecan genotoxicity.

  20. Oxidant-induced DNA damage of target cells.

    PubMed Central

    Schraufstätter, I; Hyslop, P A; Jackson, J H; Cochrane, C G


    In this study we examined the leukocytic oxidant species that induce oxidant damage of DNA in whole cells. H2O2 added extracellularly in micromolar concentrations (10-100 microM) induced DNA strand breaks in various target cells. The sensitivity of a specific target cell was inversely correlated to its catalase content and the rate of removal of H2O2 by the target cell. Oxidant species produced by xanthine oxidase/purine or phorbol myristate acetate-stimulated monocytes induced DNA breakage of target cells in proportion to the amount of H2O2 generated. These DNA strand breaks were prevented by extracellular catalase, but not by superoxide dismutase. Cytotoxic doses of HOCl, added to target cells, did not induce DNA strand breakage, and myeloperoxidase added extracellularly in the presence of an H2O2-generating system, prevented the formation of DNA strand breaks in proportion to its H2O2 degrading capacity. The studies also indicated that H2O2 formed hydroxyl radical (.OH) intracellularly, which appeared to be the most likely free radical responsible for DNA damage: .OH was detected in cells exposed to H2O2; the DNA base, deoxyguanosine, was hydroxylated in cells exposed to H2O2; and intracellular iron was essential for induction of DNA strand breaks. PMID:2843565

  1. Mechanism of site-specific DNA damage induced by ozone.


    Ito, Kimiko; Inoue, Sumiko; Hiraku, Yusuke; Kawanishi, Shosuke


    Ozone has been shown to induce lung tumors in mice. The reactivity of ozone with DNA in an aqueous solution was investigated by a DNA sequencing technique using 32P-labeled DNA fragments. Ozone induced cleavages in the deoxyribose-phosphate backbone of double-stranded DNA, which were reduced by hydroxyl radical scavengers, suggesting the participation of hydroxyl radicals in the cleavages. The ozone-induced DNA cleavages were enhanced with piperidine treatment, which induces cleavages at sites of base modification, but the inhibitory effect of hydroxyl radical scavengers on the piperidine-induced cleavages was limited. Main piperidine-labile sites were guanine and thymine residues. Cleavages at some guanine and thymine residues after piperidine treatment became more predominant with denatured single-stranded DNA. Exposure of calf thymus DNA to ozone resulted in a dose-dependent increase of the 8-oxo-7,8-dihydro-2'-deoxyguanosine formation, which was partially inhibited by hydroxyl radical scavengers. ESR studies using 5,5-dimethylpyrroline-N-oxide (DMPO) showed that aqueous ozone produced the hydroxyl radical adduct of DMPO. In addition, the fluorescein-dependent chemiluminescence was detected during the decomposition of ozone in a buffer solution and the enhancing effect of D2O was observed, suggesting the formation of singlet oxygen. However, no or little enhancing effect of D2O on the ozone-induced DNA damage was observed. These results suggest that DNA backbone cleavages were caused by ozone via the production of hydroxyl radicals, while DNA base modifications were mainly caused by ozone itself and the participation of hydroxyl radicals and/or singlet oxygen in base modifications is small, if any. A possible link of ozone-induced DNA damage to inflammation-associated carcinogenesis as well as air pollution-related carcinogenesis is discussed.

  2. Mitochondrial and nuclear DNA damage induced by 5-aminolevulinic acid.


    Onuki, Janice; Chen, Yiming; Teixeira, Priscila C; Schumacher, Robert I; Medeiros, Marisa H G; Van Houten, Bennett; Di Mascio, Paolo


    5-Aminolevulinic acid (ALA) is a heme precursor accumulated in plasma and in organs in acute intermittent porphyria (AIP), a disease associated with neuromuscular dysfunction and increased incidence of hepatocellular carcinoma (HCC). Liver biopsies of AIP patients showed odd-shaped mitochondria and autophagic vacuoles containing well-preserved mitochondria. ALA yields reactive oxygen species upon metal-catalyzed oxidation and causes in vivo and in vitro impairment of rat liver mitochondria and DNA damage. Using a quantitative polymerase chain reaction assay, we demonstrated that ALA induces a dose-dependent damage in nuclear and mitochondrial DNA in human SVNF fibroblasts and rat PC12 cells. CHO cells treated with ALA also show nuclear DNA damage and human HepG2 cells entered in apoptosis and necrosis induced by ALA and its dimerization product, DHPY. The present data provide additional information on the genotoxicity of ALA, reinforcing the hypothesis that it may be involved in the development of HCC in AIP patients.

  3. Phosphoinositide 3-kinase inhibitors induce DNA damage through nucleoside depletion

    PubMed Central

    Juvekar, Ashish; Hu, Hai; Yadegarynia, Sina; Lyssiotis, Costas A.; Ullas, Soumya; Lien, Evan C.; Bellinger, Gary; Son, Jaekyoung; Hok, Rosanna C.; Seth, Pankaj; Daly, Michele B.; Kim, Baek; Scully, Ralph; Asara, John M.; Cantley, Lewis C.; Wulf, Gerburg M.


    We previously reported that combining a phosphoinositide 3-kinase (PI3K) inhibitor with a poly-ADP Rib polymerase (PARP)-inhibitor enhanced DNA damage and cell death in breast cancers that have genetic aberrations in BRCA1 and TP53. Here, we show that enhanced DNA damage induced by PI3K inhibitors in this mutational background is a consequence of impaired production of nucleotides needed for DNA synthesis and DNA repair. Inhibition of PI3K causes a reduction in all four nucleotide triphosphates, whereas inhibition of the protein kinase AKT is less effective than inhibition of PI3K in suppressing nucleotide synthesis and inducing DNA damage. Carbon flux studies reveal that PI3K inhibition disproportionately affects the nonoxidative pentose phosphate pathway that delivers Rib-5-phosphate required for base ribosylation. In vivo in a mouse model of BRCA1-linked triple-negative breast cancer (K14-Cre BRCA1f/fp53f/f), the PI3K inhibitor BKM120 led to a precipitous drop in DNA synthesis within 8 h of drug treatment, whereas DNA synthesis in normal tissues was less affected. In this mouse model, combined PI3K and PARP inhibition was superior to either agent alone to induce durable remissions of established tumors. PMID:27402769

  4. Platinum nanoparticles induce damage to DNA and inhibit DNA replication

    PubMed Central

    Nejdl, Lukas; Kudr, Jiri; Moulick, Amitava; Hegerova, Dagmar; Ruttkay-Nedecky, Branislav; Gumulec, Jaromir; Cihalova, Kristyna; Smerkova, Kristyna; Dostalova, Simona; Krizkova, Sona; Novotna, Marie; Kopel, Pavel


    Sparsely tested group of platinum nanoparticles (PtNPs) may have a comparable effect as complex platinum compounds. The aim of this study was to observe the effect of PtNPs in in vitro amplification of DNA fragment of phage λ, on the bacterial cultures (Staphylococcus aureus), human foreskin fibroblasts and erythrocytes. In vitro synthesized PtNPs were characterized by dynamic light scattering (PtNPs size range 4.8–11.7 nm), zeta potential measurements (-15 mV at pH 7.4), X-ray fluorescence, UV/vis spectrophotometry and atomic absorption spectrometry. The PtNPs inhibited the DNA replication and affected the secondary structure of DNA at higher concentrations, which was confirmed by polymerase chain reaction, DNA sequencing and DNA denaturation experiments. Further, cisplatin (CisPt), as traditional chemotherapy agent, was used in all parallel experiments. Moreover, the encapsulation of PtNPs in liposomes (LipoPtNPs) caused an approximately 2.4x higher of DNA damage in comparison with CisPt, LipoCisPt and PtNPs. The encapsulation of PtNPs in liposomes also increased their antibacterial, cytostatic and cytotoxic effect, which was determined by the method of growth curves on S. aureus and HFF cells. In addition, both the bare and encapsulated PtNPs caused lower oxidative stress (determined by GSH/GSSG ratio) in the human erythrocytes compared to the bare and encapsulated CisPt. CisPt was used in all parallel experiments as traditional chemotherapy agent. PMID:28704436

  5. Chemical-induced DNA damage and human cancer risk.


    Poirier, Miriam C


    For more than 200 years human cancer induction has been known to be associated with a large variety of chemical exposures. Most exposures to chemical carcinogens occur as a result of occupation, pollution in the ambient environment, lifestyle choices, or pharmaceutical use. Scientific investigations have revealed that the majority of cancer causing chemicals, or chemical carcinogens, act through "genotoxic" or DNA damaging mechanisms, which involve covalent binding of the chemical to DNA (DNA adduct formation). Cancer-inducing exposures are typically frequent and/or chronic over years, and the accumulation of DNA damage or DNA adduct formation is considered to be a necessary requirement for tumor induction. Studies in animal models have indicated that the ability to reduce DNA damage will also result in reduction of tumor risk, leading to the hypothesis that individuals having the highest levels of DNA adducts may have an increased cancer risk, compared to individuals with the lowest levels of DNA adducts. Here we have reviewed twelve investigations showing 2- to 9-fold increased Relative Risks (RR) or Odds Ratios (OR) for cancer in (the 25% of) individuals having the highest DNA adduct levels, compared to (the 25% of) matched individuals with the lowest DNA adducts. These studies also provided preliminary evidence that multiple types of DNA adducts combined, or DNA adducts combined with other risk factors (such as infection or inflammation), may be associated with more than 10-fold higher cancer risks (RR = 34-60), compared to those found with a single carcinogen. Taken together the data suggest that a reduction in human DNA adduct level is likely to produce a reduction in human cancer risk.

  6. Multiomic Analysis of the UV-Induced DNA Damage Response.


    Boeing, Stefan; Williamson, Laura; Encheva, Vesela; Gori, Ilaria; Saunders, Rebecca E; Instrell, Rachael; Aygün, Ozan; Rodriguez-Martinez, Marta; Weems, Juston C; Kelly, Gavin P; Conaway, Joan W; Conaway, Ronald C; Stewart, Aengus; Howell, Michael; Snijders, Ambrosius P; Svejstrup, Jesper Q


    In order to facilitate the identification of factors and pathways in the cellular response to UV-induced DNA damage, several descriptive proteomic screens and a functional genomics screen were performed in parallel. Numerous factors could be identified with high confidence when the screen results were superimposed and interpreted together, incorporating biological knowledge. A searchable database, bioLOGIC, which provides access to relevant information about a protein or process of interest, was established to host the results and facilitate data mining. Besides uncovering roles in the DNA damage response for numerous proteins and complexes, including Integrator, Cohesin, PHF3, ASC-1, SCAF4, SCAF8, and SCAF11, we uncovered a role for the poorly studied, melanoma-associated serine/threonine kinase 19 (STK19). Besides effectively uncovering relevant factors, the multiomic approach also provides a systems-wide overview of the diverse cellular processes connected to the transcription-related DNA damage response.

  7. Mitochondrial DNA damage induces apoptosis in senescent cells

    PubMed Central

    Laberge, R-M; Adler, D; DeMaria, M; Mechtouf, N; Teachenor, R; Cardin, G B; Desprez, P-Y; Campisi, J; Rodier, F


    Senescence is a cellular response to damage and stress. The senescence response prevents cancer by suppressing the proliferation of cells with a compromised genome and contributes to optimal wound healing in normal tissues. Persistent senescent cells are also thought to drive aging and age-associated pathologies through their secretion of inflammatory factors that modify the tissue microenvironment and alter the function of nearby normal or transformed cells. Understanding how senescent cells alter the microenvironment would be aided by the ability to induce or eliminate senescent cells at will in vivo. Here, we combine the use of the synthetic nucleoside analog ganciclovir (GCV) with herpes simplex virus thymidine kinase (HSVtk) activity to create or eliminate senescent human cells. We show that low concentrations of GCV induce senescence through the accumulation of nuclear DNA damage while higher concentrations of GCV, similar to those used in vivo, kill non-dividing senescent cells via mitochondrial DNA (mtDNA) damage and caspase-dependent apoptosis. Using this system, we effectively eliminated xenografted normal human senescent fibroblasts or induced senescence in human breast cancer cells in vivo. Thus, cellular senescence and mtDNA damage are outcomes of synthetic nucleoside analog treatment, indicating that the GCV–HSVtk combination can be used effectively to promote the targeted formation or eradication of senescent cells. PMID:23868060

  8. Mitochondrial DNA damage induces apoptosis in senescent cells.


    Laberge, R-M; Adler, D; DeMaria, M; Mechtouf, N; Teachenor, R; Cardin, G B; Desprez, P-Y; Campisi, J; Rodier, F


    Senescence is a cellular response to damage and stress. The senescence response prevents cancer by suppressing the proliferation of cells with a compromised genome and contributes to optimal wound healing in normal tissues. Persistent senescent cells are also thought to drive aging and age-associated pathologies through their secretion of inflammatory factors that modify the tissue microenvironment and alter the function of nearby normal or transformed cells. Understanding how senescent cells alter the microenvironment would be aided by the ability to induce or eliminate senescent cells at will in vivo. Here, we combine the use of the synthetic nucleoside analog ganciclovir (GCV) with herpes simplex virus thymidine kinase (HSVtk) activity to create or eliminate senescent human cells. We show that low concentrations of GCV induce senescence through the accumulation of nuclear DNA damage while higher concentrations of GCV, similar to those used in vivo, kill non-dividing senescent cells via mitochondrial DNA (mtDNA) damage and caspase-dependent apoptosis. Using this system, we effectively eliminated xenografted normal human senescent fibroblasts or induced senescence in human breast cancer cells in vivo. Thus, cellular senescence and mtDNA damage are outcomes of synthetic nucleoside analog treatment, indicating that the GCV-HSVtk combination can be used effectively to promote the targeted formation or eradication of senescent cells.

  9. Viral Carcinogenesis: Factors Inducing DNA Damage and Virus Integration

    PubMed Central

    Chen, Yan; Williams, Vonetta; Filippova, Maria; Filippov, Valery; Duerksen-Hughes, Penelope


    Viruses are the causative agents of 10%–15% of human cancers worldwide. The most common outcome for virus-induced reprogramming is genomic instability, including accumulation of mutations, aberrations and DNA damage. Although each virus has its own specific mechanism for promoting carcinogenesis, the majority of DNA oncogenic viruses encode oncogenes that transform infected cells, frequently by targeting p53 and pRB. In addition, integration of viral DNA into the human genome can also play an important role in promoting tumor development for several viruses, including HBV and HPV. Because viral integration requires the breakage of both the viral and the host DNA, the integration rate is believed to be linked to the levels of DNA damage. DNA damage can be caused by both endogenous and exogenous factors, including inflammation induced by either the virus itself or by co-infections with other agents, environmental agents and other factors. Typically, cancer develops years to decades following the initial infection. A better understanding of virus-mediated carcinogenesis, the networking of pathways involved in transformation and the relevant risk factors, particularly in those cases where tumorigenesis proceeds by way of virus integration, will help to suggest prophylactic and therapeutic strategies to reduce the risk of virus-mediated cancer. PMID:25340830

  10. Photo-induced DNA damage, DNA repair and cell lethality

    SciTech Connect

    Cool, B.L.


    DNA lesion induction and repair was measured in DNA repair proficient and deficient cells after exposures to far-UV, mid-UV, near-UV and visible light and an attempt was made to relate these molecular phenomena to the biological endpoint of cell lethality. Pyrimidine dimer and strand break induction, DNA repair and cell killing were measured after cell exposure to polychromatic but narrow bandwidth light sources with peak emissions at 254, 305, 353, 369, and 445 nm. Pyrimidine dimers were detected using specific endonuclease that nicks DNA adjacent to dimers, while strand breaks were measured using an alkaline unwinding assay. The induction efficiencies of both lesions declined with increasing wavelength; however, the decrease in strand break induction was not as rapid as that of dimer induction. The ratio of strand breaks to dimers following cell exposure to 254 or 369 nm radiation was, respectively, 1.8 x 10/sup -4/ or 0.19. The kinetics of dimer repair as well as the size of repair synthesized patches remained constant with increasing wavelength, indicating a similar repair mechanism for dimers induced by all wavelengths tested. However, consistent with the detected decline in dimer induction with increasing wavelength the proportion of dimer repair to total DNA repair decreased with increasing wavelength. The efficiency of cell killing, determined using chlonagenic survival assays, dropped rapidly, but not as rapidly as that of dimer induction, with increasing wavelength. In addition, dimer repair deficient xeroderma pigmentosum cells became less lethally hypersensitive with increasing wavelength. These data suggest a decline in dimer induced cell lethality and the existence of non-dimer lethal lesions at longer wavelengths.

  11. Novel DNA damage checkpoint in mitosis: Mitotic DNA damage induces re-replication without cell division in various cancer cells.


    Hyun, Sun-Yi; Rosen, Eliot M; Jang, Young-Joo


    DNA damage induces multiple checkpoint pathways to arrest cell cycle progression until damage is repaired. In our previous reports, when DNA damage occurred in prometaphase, cells were accumulated in 4 N-DNA G1 phase, and mitosis-specific kinases were inactivated in dependent on ATM/Chk1 after a short incubation for repair. We investigated whether or not mitotic DNA damage causes cells to skip-over late mitotic periods under prolonged incubation in a time-lapse study. 4 N-DNA-damaged cells re-replicated without cell division and accumulated in 8 N-DNA content, and the activities of apoptotic factors were increased. The inhibition of DNA replication reduced the 8 N-DNA cell population dramatically. Induction of replication without cell division was not observed upon depletion of Chk1 or ATM. Finally, mitotic DNA damage induces mitotic slippage and that cells enter G1 phase with 4 N-DNA content and then DNA replication is occurred to 8 N-DNA content before completion of mitosis in the ATM/Chk1-dependent manner, followed by caspase-dependent apoptosis during long-term repair.

  12. Nitrous acid induced damage in T7 DNA and phage

    SciTech Connect

    Scearce, L.M.; Masker, W.E.


    The response of bacteriophage T7 to nitrous acid damage was investigated. The T7 system allows in vitro mimicry of most aspects of in vivo DNA metabolism. Nitrous acid is of special interest since it has been previously shown to induce deletions and point mutations as well as novel adducts in DNA. T7 phage was exposed to 56 mM nitrous acid at pH 4.6 in vivo, causing a time dependent 98% decrease in survival for each 10 min duration of exposure to nitrous acid. These studies were extended to include examination of pure T7 DNA exposed in vitro to nitrous acid conditions identical to those used in the in vivo survival studies. The treated DNA was dialyzed to remove the nitrous acid and the DNA was encapsulated into empty phage heads. These in vitro packaged phage showed a survival curve analogous to the in vivo system. There was no change in survival when either in vitro or in vivo exposed phage were grown on wild type E. coli or on E. coli strains deficient in DNA repair due to mutations in DNA polymerase I, exonuclease III or a uvrA mutation. Survival was not increased when nitrous acid treated T7 were grown on E. coli induced for SOS repair. In vitro replication of nitrous acid treated DNA showed a time dependent decrease in the total amount of DNA synthesized.

  13. DNA damage response induced by HZE particles in human cells

    NASA Astrophysics Data System (ADS)

    Chen, David; Aroumougame, Asaithamby

    Convincing evidences indicate that high-linear energy transfer (LET) ionizing radiation (IR) induced complex DNA lesions are more difficult to repair than isolated DNA lesions induced by low-LET IR; this has been associated with the increased RBE for cell killing, chromosomal aberrations, mutagenesis, and carcinogenesis in high energy charged-particle irradiated human cells. We have employed an in situ method to directly monitor induction and repair of clustered DNA lesions at the single-cell level. We showed, consistent with biophysical modeling, that the kinetics of loss of clustered DNA lesions was substantially compromised in human fibroblasts. The unique spatial distribution of different types of DNA lesions within the clustered damages determined the cellular ability to repair these damages. Importantly, examination of metaphase cells derived from HZE particle irradiated cells revealed that the extent of chromosome aberrations directly correlated with the levels of unrepaired clustered DNA lesions. In addition, we used a novel organotypic human lung three-dimensional (3D) model to investigate the biological significance of unrepaired DNA lesions in differentiated lung epithelial cells. We found that complex DNA lesions induced by HZE particles were even more difficult to be repaired in organotypic 3D culture, resulting enhanced cell killing and chromosome aberrations. Our data suggest that DNA repair capability in differentiated cells renders them vulnerable to DSBs, promoting genome instability that may lead to carcinogenesis. As the organotypic 3D model mimics human lung, it opens up new experimental approaches to explore the effect of radiation in vivo and will have important implications for evaluating radiation risk in human tissues.

  14. Torin2 Suppresses Ionizing Radiation-Induced DNA Damage Repair.


    Udayakumar, Durga; Pandita, Raj K; Horikoshi, Nobuo; Liu, Yan; Liu, Qingsong; Wong, Kwok-Kin; Hunt, Clayton R; Gray, Nathanael S; Minna, John D; Pandita, Tej K; Westover, Kenneth D


    Several classes of inhibitors of the mammalian target of rapamycin (mTOR) have been developed based on its central role in sensing growth factor and nutrient levels to regulate cellular metabolism. However, its ATP-binding site closely resembles other phosphatidylinositol 3-kinase-related kinase (PIKK) family members, resulting in reactivity with these targets that may also be therapeutically useful. The ATP-competitive mTOR inhibitor, Torin2, shows biochemical activity against the DNA repair-associated proteins ATM, ATR and DNA-PK, which raises the possibility that Torin2 and related compounds might radiosensitize cancerous tumors. In this study Torin2 was also found to enhance ionizing radiation-induced cell killing in conditions where ATM was dispensable, confirming the requirement for multiple PIKK targets. Moreover, Torin2 did not influence the initial appearance of γ-H2AX foci after irradiation but significantly delayed the disappearance of radiation-induced γ-H2AX foci, indicating a DNA repair defect. Torin2 increased the number of radiation-induced S-phase specific chromosome aberrations and reduced the frequency of radiation-induced CtIP and Rad51 foci formation, suggesting that Torin2 works by blocking homologous recombination (HR)-mediated DNA repair resulting in an S-phase specific DNA repair defect. Accordingly, Torin2 reduced HR-mediated repair of I-Sce1-induced DNA damage and contributed to replication fork stalling. We conclude that radiosensitization of tumor cells by Torin2 is associated with disrupting ATR- and ATM-dependent DNA damage responses. Our findings support the concept of developing combination cancer therapies that incorporate ionizing radiation therapy and Torin2 or compounds with similar properties.

  15. Single-molecule visualization of ROS-induced DNA damage in large DNA molecules.


    Lee, Jinyong; Kim, Yongkyun; Lim, Sangyong; Jo, Kyubong


    We present a single molecule visualization approach for the quantitative analysis of reactive oxygen species (ROS) induced DNA damage, such as base oxidation and single stranded breaks in large DNA molecules. We utilized the Fenton reaction to generate DNA damage with subsequent enzymatic treatment using a mixture of three types of glycosylases to remove oxidized bases, and then fluorescent labeling on damaged lesions via nick translation. This single molecule analytical platform provided the capability to count one or two damaged sites per λ DNA molecule (48.5 kb), which were reliably dependent on the concentrations of hydrogen peroxide and ferrous ion at the micromolar level. More importantly, the labeled damaged sites that were visualized under a microscope provided positional information, which offered the capability of comparing DNA damaged sites with the in silico genomic map to reveal sequence specificity that GTGR is more sensitive to oxidative damage. Consequently, single DNA molecule analysis provides a sensitive analytical platform for ROS-induced DNA damage and suggests an interesting biochemical insight that the genome primarily active during the lysogenic cycle may have less probability for oxidative DNA damage.

  16. Bile-Induced DNA Damage in Salmonella enterica

    PubMed Central

    Prieto, Ana I.; Ramos-Morales, Francisco; Casadesús, Josep


    In the absence of DNA adenine methylase, growth of Salmonella enterica serovar Typhimurium is inhibited by bile. Mutations in any of the mutH, mutL, and mutS genes suppress bile sensitivity in a Dam− background, indicating that an active MutHLS system renders Dam− mutants bile sensitive. However, inactivation of the MutHLS system does not cause bile sensitivity. An analogy with Escherichia coli, in which the MutHLS system sensitizes Dam− mutants to DNA-injuring agents, suggested that bile might cause DNA damage. In support of this hypothesis, we show that bile induces the SOS response in S. enterica and increases the frequency of point mutations and chromosomal rearrangements. Mutations in mutH, mutL, or mutS cause partial relief of virulence attenuation in a Dam− background (50- to 100-fold by the oral route and 10-fold intraperitoneally), suggesting that an active MutHLS system reduces the ability of Salmonella Dam− mutants to cope with DNA-damaging agents (bile and others) encountered during the infection process. The DNA-damaging ability of bile under laboratory conditions raises the possibility that the phenomenon may be relevant in vivo, since high bile concentrations are found in the gallbladder, the niche for chronic Salmonella infections. PMID:15611156

  17. The Cartography of UV-induced DNA Damage Formation and DNA Repair.


    Hu, Jinchuan; Adar, Sheera


    DNA damage presents a barrier to DNA-templated biochemical processes, including gene expression and faithful DNA replication. Compromised DNA repair leads to mutations, enhancing the risk for genetic diseases and cancer development. Conventional experimental approaches to study DNA damage required a researcher to choose between measuring bulk damage over the entire genome, with little or no resolution regarding a specific location, and obtaining data specific to a locus of interest, without a global perspective. Recent advances in high-throughput genomic tools overcame these limitations and provide high-resolution measurements simultaneously across the genome. In this review, we discuss the available methods for measuring DNA damage and their repair, focusing on genomewide assays for pyrimidine photodimers, the major types of damage induced by ultraviolet irradiation. These new genomic assays will be a powerful tool in identifying key components of genome stability and carcinogenesis. © 2016 The American Society of Photobiology.

  18. Mitochondrial DNA damage induced autophagy, cell death, and disease.


    Van Houten, Bennett; Hunter, Senyene E; Meyer, Joel N


    Mammalian mitochondria contain multiple small genomes. While these organelles have efficient base excision removal of oxidative DNA lesions and alkylation damage, many DNA repair systems that work on nuclear DNA damage are not active in mitochondria. What is the fate of DNA damage in the mitochondria that cannot be repaired or that overwhelms the repair system? Some forms of mitochondrial DNA damage can apparently trigger mitochondrial DNA destruction, either via direct degradation or through specific forms of autophagy, such as mitophagy. However, accumulation of certain types of mitochondrial damage, in the absence of DNA ligase III (Lig3) or exonuclease G (EXOG), can directly trigger cell death. This review examines the cellular effects of persistent damage to mitochondrial genomes and discusses the very different cell fates that occur in response to different kinds of damage.

  19. Silica radical-induced DNA damage and lipid peroxidation.

    PubMed Central

    Shi, X; Mao, Y; Daniel, L N; Saffiotti, U; Dalal, N S; Vallyathan, V


    In recent years, more attention has been given to the mechanism of disease induction caused by the surface properties of minerals. In this respect, specific research needs to be focused on the biologic interactions of oxygen radicals generated by mineral particles resulting in cell injury and DNA damage leading to fibrogenesis and carcinogenesis. In this investigation, we used electron spin resonance (ESR) and spin trapping to study oxygen radical generation from aqueous suspensions of freshly fractured crystalline silica. Hydroxyl radical (.OH), superoxide radical (O2.-) and singlet oxygen (1O2) were all detected. Superoxide dismutase (SOD) partially inhibited .OH yield, whereas catalase abolished .OH generation. H2O2 enhanced .OH generation while deferoxamine inhibited it, indicating that .OH is generated via a Haber-Weiss type reaction. These spin trapping measurements provide the first evidence that aqueous suspensions of silica particles generate O2.- and 1O2. Oxygen consumption measurements indicate that freshly fractured silica uses molecular oxygen to generate O2.- and 1O2. Electrophoretic assays of in vitro DNA strand breakages showed that freshly fractured silica induced DNA strand breakage, which was inhibited by catalase and enhanced by H2O2. In an argon atmosphere, DNA damage was suppressed, showing that molecular oxygen is required for the silica-induced DNA damage. Incubation of freshly fractured silica with linoleic acid generated linoleic acid-derived free radicals and caused dose-dependent lipid peroxidation as measured by ESR spin trapping and malondialdehyde formation. SOD, catalase, and sodium benzoate inhibited lipid peroxidation by 49, 52, and 75%, respectively, again showing the role of oxygen radicals in silica-induced lipid peroxidation.(ABSTRACT TRUNCATED AT 250 WORDS) Images Figure 7. PMID:7705289

  20. DNA damage and mutations induced by arachidonic acid peroxidation.


    Lim, Punnajit; Sadre-Bazzaz, Kianoush; Shurter, Jesse; Sarasin, Alain; Termini, John


    Endogenous cellular oxidation of omega6-polyunsaturated fatty acids (PUFAs) has long been recognized as a contributing factor in the development of various cancers. The accrual of DNA damage as a result of reaction with free radical and electrophilic aldehyde products of lipid peroxidation is believed to be involved; however, the genotoxic and mutation-inducing potential of specific membrane PUFAs remains poorly defined. In the present study we have examined the ability of peroxidizing arachidonic acid (AA, 20:4omega6) to induce DNA strand breaks, base modifications, and mutations. The time-dependent induction of single-strand breaks and oxidative base modifications by AA in genomic DNA was quantified using denaturing glyoxal gel electrophoresis. Mutation spectra were determined in XP-G fibroblasts and a repair-proficient line corrected for this defect by c-DNA complementation (XP-G(+)). Mutation frequencies were elevated from approximately 5- to 30-fold over the background following reaction of DNA with AA for various times. The XPG gene product was found to be involved in the suppression of mutations after extended reaction of DNA with AA. Arachidonic acid-induced base substitutions were consistent with the presence of both oxidized and aldehyde base adducts in DNA. The frequency of multiple-base substitutions induced by AA was significantly reduced upon correction for the XPG defect (14% vs 2%, P = 0.0015). Evidence is also presented which suggests that the induced frequency of multiple mutations is lesion dependent. These results are compared to published data for mutations stimulated by alpha,beta-unsaturated aldehydes identified as products of lipid peroxidation.

  1. Pyrosequencing: Applicability for Studying DNA Damage-induced Mutagenesis

    PubMed Central

    Minko, Irina G.; Earley, Lauriel F.; Larlee, Kimberly E.; Lin, Ying-Chih; Lloyd, R. Stephen


    Site-specifically modified DNAs are routinely used in the study of DNA damage-induced mutagenesis. These analyses involve the creation of DNA vectors containing a lesion at a predetermined position, DNA replication, and detection of mutations at the target site. The final step has previously required the isolation of individual DNA clones, hybridization with radioactively-labeled probes, and verification of mutations by Sanger sequencing. In search for an alternative procedure that would allow direct quantification of sequence variants in a mixed population of DNA molecules, we evaluated the applicability of pyrosequencing to site-specific mutagenesis assays. The progeny DNAs were analyzed that originated from replication of N6-(deoxy-D-erythro-pentofuranosyl)-2,6-diamino-3,4-dihydro-4-oxo-5-N-methylformamidopyrimidine (MeFapy-dG)-containing vectors in primate cells, with the lesion being positioned in the 5′-GCNGG-3′ sequence context. Pyrosequencing detected ~8% G to T transversions and ~3.5% G to A transitions, a result that was in excellent agreement with frequencies previously measured by the standard procedure [Earley et al., 2013]. However, ~3.5% G to C transversions and ~2.0% deletions could not be detected by pyrosequencing. Consistent with these observations, the sensitivity of pyrosequencing for measuring the single deoxynucleotide variants differed depending on the deoxynucleotide identity, and in the given sequence contexts, was determined to be ~1-2% for A and T and ~5% for C. Pyrosequencing of other DNA isolates that were obtained following replication of MeFapy-dG-containing vectors in primate cells or Escherichia coli, identified several additional limitations. Collectively, our data demonstrated that pyrosequencing can be used for studying DNA damage-induced mutagenesis as an effective complementary experimental approach to current protocols. PMID:24962778

  2. DNA damage profiles induced by sunlight at different latitudes.


    Schuch, André Passaglia; Yagura, Teiti; Makita, Kazuo; Yamamoto, Hiromasa; Schuch, Nelson Jorge; Agnez-Lima, Lucymara Fassarella; MacMahon, Ricardo Monreal; Menck, Carlos Frederico Martins


    Despite growing knowledge on the biological effects of ultraviolet (UV) radiation on human health and ecosystems, it is still difficult to predict the negative impacts of the increasing incidence of solar UV radiation in a scenario of global warming and climate changes. Hence, the development and application of DNA-based biological sensors to monitor the solar UV radiation under different environmental conditions is of increasing importance. With a mind to rendering a molecular view-point of the genotoxic impact of sunlight, field experiments were undertaken with a DNA-dosimeter system in parallel with physical photometry of solar UVB/UVA radiation, at various latitudes in South America. On applying biochemical and immunological approaches based on specific DNA-repair enzymes and antibodies, for evaluating sunlight-induced DNA damage profiles, it became clear that the genotoxic potential of sunlight does indeed vary according to latitude. Notwithstanding, while induction of oxidized DNA bases is directly dependent on an increase in latitude, the generation of 6-4PPs is inversely so, whereby the latter can be regarded as a biomolecular marker of UVB incidence. This molecular DNA lesion-pattern largely reflects the relative incidence of UVA and UVB energy at any specific latitude. Hereby is demonstrated the applicability of this DNA-based biosensor for additional, continuous field experiments, as a means of registering variations in the genotoxic impact of solar UV radiation. © 2012 Wiley Periodicals, Inc.

  3. DNA Damage and Genomic Instability Induced by Inappropriate DNA Re-Replication

    DTIC Science & Technology


    ml a that sustained rereplication leads to a dramatic decrease factor. Samples were fixed in 67% ethanol (vol/vol), washed twice with PBS, and...significant decrease in cell viability and a cellular DNA damage response. Strikingly, we have observed DNA damage in the absence of a classical...genome re-replicates. In this reporting period, we have shown that re-replication induces a rapid and significant decrease in cell viability and a

  4. Bleomycin-induced alterations in DNA replication: relationship to DNA damage.


    Dziegielewski, J; Melendy, T; Beerman, T A


    Bleomycin (BLM), a well-known DNA scission agent, is assumed to inhibit intracellular DNA replication by damaging the DNA template (cis-acting mechanism), although other DNA damaging compounds can alter DNA replication through modulation of crucial replication factor(s) (trans-acting mechanism). The present study examines the relationship between DNA damage and inhibition of replication caused by BLM in the well-defined simian virus 40 (SV40) intracellular and cell-free in vitro systems. Treatment of SV40-infected BSC-1 cells for 2 h with BLM at 50 microg/mL, induced 0.3 break/viral genome. Under the same treatment conditions, analysis of replication intermediates on two-dimensional gels showed a decrease in both mass of SV40 replication intermediates and replication activity. The mass of SV40 intermediates was decreased to about 30%, whereas replication activity was reduced to less than 5%. These results suggest that BLM inhibits both initiation and elongation phases of SV40 replication. In a cell-free DNA replication system, extracts from BLM-treated cells (50 micro/mL) were able to support SV40 DNA replication by only 50%. In this study, non-drug-treated DNA template was used, implying that BLM can induce a trans-acting effect. Finally, the drug-induced effects on SV40 DNA replication in cell-free and intracellular viral systems were compared to the effects on genomic DNA replication in BSC-1 cells. Overall, the results support the concept that BLM-induced inhibition of DNA replication occurs by both trans- (inhibition of replication of nondamaged template) and cis-acting mechanisms (template damage).

  5. Ultraviolet induced DNA damage and hereditary skin cancer

    SciTech Connect

    Regan, J.D.; Carrier, W.L.; Francis, A.A.


    Clearly, cells from normal individuals possess the ability to repair a variety of damage to DNA. Numerous studies indicate that defects in DNA repair may increase an individual's susceptibility to cancer. It is hoped that continued studies of the exact structural changes produced in the DNA by environmental insults, and the correlation of specific DNA changes with particulr cellular events, such as DNA repair, will lead to a better understanding of cell-killing, mutagenesis and carbinogenesis. 1 figure, 2 tables.

  6. Stress-induced DNA damage biomarkers: applications and limitations

    PubMed Central

    Nikitaki, Zacharenia; Hellweg, Christine E.; Georgakilas, Alexandros G.; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data. PMID:26082923

  7. Stress-induced DNA damage biomarkers: applications and limitations.


    Nikitaki, Zacharenia; Hellweg, Christine E; Georgakilas, Alexandros G; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism's endogenous processes such as replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damage plays a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g., X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e., single, complex DNA lesions etc. that can be used as DNA damage biomarkers. We critically compare DNA damage detection methods and their limitations. In addition, we suggest the use of DNA repair gene products as biomarkes for identification of different types of stresses i.e., radiation, oxidative, or replication stress, based on bioinformatic approaches and meta-analysis of literature data.

  8. Stress-induced DNA Damage biomarkers: Applications and limitations

    NASA Astrophysics Data System (ADS)

    Nikitaki, Zacharenia; Hellweg, Christine; Georgakilas, Alexandros; Ravanat, Jean-Luc


    A variety of environmental stresses like chemicals, UV and ionizing radiation and organism’s endogenous processes like replication stress and metabolism can lead to the generation of reactive oxygen and nitrogen species (ROS/RNS) that can attack cellular vital components like DNA, proteins and lipid membranes. Among them, much attention has been focused on DNA since DNA damages play a role in several biological disorders and aging processes. Thus, DNA damage can be used as a biomarker in a reliable and accurate way to quantify for example radiation exposure and can indicate its possible long term effects and cancer risk. Based on the type of DNA lesions detected one can hypothesize on the most probable mechanisms involved in the formation of these lesions for example in the case of UV and ionizing radiation (e.g. X- or α-, γ-rays, energetic ions, neutrons). In this review we describe the most accepted chemical pathways for DNA damage induction and the different types of DNA lesions, i.e. single, complex DNA lesions etc. that can be used as biomarkers. We critically compare DNA damage detection methods and their limitations. In addition to such DNA damage products, we suggest possible gene inductions that can be used to characterize responses to different types of stresses i.e. radiation, oxidative and replication stress, based on bioinformatic approaches and stringent meta-analysis of literature data.

  9. Electrochemical DNA biosensor for detection of DNA damage induced by hydroxyl radicals.


    Hájková, Andrea; Barek, Jiří; Vyskočil, Vlastimil


    A simple electrochemical DNA biosensor based on a glassy carbon electrode (GCE) was prepared by adsorbing double-stranded DNA (dsDNA) onto the GCE surface and subsequently used for the detection of dsDNA damage induced by hydroxyl radicals. Investigation of the mutual interaction between hydroxyl radicals and dsDNA was conducted using a combination of several electrochemical detection techniques: square-wave voltammetry for direct monitoring the oxidation of dsDNA bases, and cyclic voltammetry and electrochemical impedance spectroscopy as indirect electrochemical methods making use of the redox-active indicator [Fe(CN)6](4-/3-). Hydroxyl radicals were generated electrochemically on the surface of a boron-doped diamond electrode and chemically (via the Fenton's reaction or the auto-oxidation of Fe(II)). The extent of dsDNA damage by electrochemically generated hydroxyl radicals depended on the current density applied to the generating electrode: by applying 5, 10, and 50mAcm(-2), selected relative biosensor responses decreased after 3min incubation from 100% to 38%, 27%, and 3%, respectively. Chemically generated hydroxyl radicals caused less pronounced dsDNA damage, and their damaging activity depended on the form of Fe(II) ions: decreases to 49% (Fenton's reaction; Fe(II) complexed with EDTA) and 33% (auto-oxidation of Fe(II); Fe(II) complexed with dsDNA) were observed after 10min incubation. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Calculation of complex DNA damage induced by ions

    NASA Astrophysics Data System (ADS)

    Surdutovich, Eugene; Gallagher, David C.; Solov'yov, Andrey V.


    This paper is devoted to the analysis of the complex damage of DNA irradiated by ions. The assessment of complex damage is important because cells in which it occurs are less likely to survive because the DNA repair mechanisms may not be sufficiently effective. We study the flux of secondary electrons through the surface of nucleosomes and calculate the radial dose and the distribution of clustered damage around the ion's path. The calculated radial dose distribution is compared to simulations. The radial distribution of the complex damage is found to be different from that of the dose. A comparison with experiments may solve the question of what is more lethal for the cell, damage complexity or absorbed energy. We suggest a way to calculate the probability of cell death based on the complexity of the damage. This work is done within the framework of the phenomenon-based multiscale approach to radiation damage by ions.

  11. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation

    PubMed Central

    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang


    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92–1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research. PMID:27187621

  12. Both Complexity and Location of DNA Damage Contribute to Cellular Senescence Induced by Ionizing Radiation.


    Zhang, Xurui; Ye, Caiyong; Sun, Fang; Wei, Wenjun; Hu, Burong; Wang, Jufang


    Persistent DNA damage is considered as a main cause of cellular senescence induced by ionizing radiation. However, the molecular bases of the DNA damage and their contribution to cellular senescence are not completely clear. In this study, we found that both heavy ions and X-rays induced senescence in human uveal melanoma 92-1 cells. By measuring senescence associated-β-galactosidase and cell proliferation, we identified that heavy ions were more effective at inducing senescence than X-rays. We observed less efficient repair when DNA damage was induced by heavy ions compared with X-rays and most of the irreparable damage was complex of single strand breaks and double strand breaks, while DNA damage induced by X-rays was mostly repaired in 24 hours and the remained damage was preferentially associated with telomeric DNA. Our results suggest that DNA damage induced by heavy ion is often complex and difficult to repair, thus presents as persistent DNA damage and pushes the cell into senescence. In contrast, persistent DNA damage induced by X-rays is preferentially associated with telomeric DNA and the telomere-favored persistent DNA damage contributes to X-rays induced cellular senescence. These findings provide new insight into the understanding of high relative biological effectiveness of heavy ions relevant to cancer therapy and space radiation research.

  13. Increased Sensitivity of DNA Damage Response-Deficient Cells to Stimulated Microgravity-Induced DNA Lesions

    PubMed Central

    Li, Nan; An, Lili; Hang, Haiying


    Microgravity is a major stress factor that astronauts have to face in space. In the past, the effects of microgravity on genomic DNA damage were studied, and it seems that the effect on genomic DNA depends on cell types and the length of exposure time to microgravity or simulated microgravity (SMG). In this study we used mouse embryonic stem (MES) and mouse embryonic fibroblast (MEF) cells to assess the effects of SMG on DNA lesions. To acquire the insight into potential mechanisms by which cells resist and/or adapt to SMG, we also included Rad9-deleted MES and Mdc1-deleted MEF cells in addition to wild type cells in this study. We observed significant SMG-induced DNA double strand breaks (DSBs) in Rad9-/- MES and Mdc1-/- MEF cells but not in their corresponding wild type cells. A similar pattern of DNA single strand break or modifications was also observed in Rad9-/- MES. As the exposure to SMG was prolonged, Rad9-/- MES cells adapted to the SMG disturbance by reducing the induced DNA lesions. The induced DNA lesions in Rad9-/- MES were due to SMG-induced reactive oxygen species (ROS). Interestingly, Mdc1-/- MEF cells were only partially adapted to the SMG disturbance. That is, the induced DNA lesions were reduced over time, but did not return to the control level while ROS returned to a control level. In addition, ROS was only partially responsible for the induced DNA lesions in Mdc1-/- MEF cells. Taken together, these data suggest that SMG is a weak genomic DNA stress and can aggravate genomic instability in cells with DNA damage response (DDR) defects. PMID:25915950

  14. Novobiocin Inhibits the Antimicrobial Resistance Acquired through DNA Damage-Induced Mutagenesis in Acinetobacter baumannii

    PubMed Central

    Jara, Luis M.; Pérez-Varela, María; Corral, Jordi; Arch, Marta; Cortés, Pilar; Bou, Germán; Barbé, Jordi


    Acinetobacter baumannii, a worldwide emerging nosocomial pathogen, acquires antimicrobial resistances in response to DNA-damaging agents, which increase the expression of multiple error-prone DNA polymerase components. Here we show that the aminocoumarin novobiocin, which inhibits the DNA damage response in Gram-positive bacteria, also inhibits the expression of error-prone DNA polymerases in this Gram-negative multidrug-resistant pathogen and, consequently, its potential acquisition of antimicrobial resistance through DNA damage-induced mutagenesis. PMID:26503651

  15. Comparative DNA damage and repair induced by misonidazole, CB 1954 and RSU 1069.


    Dale, L D; Widdick, D A; Edwards, D I; Biol, G I


    We have studied the ability of CB 1954, misonidazole, and RSU 1069 to induce biologically relevant DNA damage in single- and double-stranded phi X174 DNA under oxic, anoxic, and anoxic reductive conditions using a double transfection technique. In addition, the ability of the three drugs to induce the SOS repair response in E. coli under the same conditions was measured. Whereas the relative order of DNA damage was RSU 1069 greater than CB 1954 greater than misonidazole the order in inducing SOS repair was RSU 1069 greater than misonidazole greater than CB 1954. Drug-induced damage by RSU 1069 involves enhanced damage by endonuclease III suggesting drug-induced pyrimidine damage. There appears to be no correlation between drug-induced damage and the degree of SOS repair induction. Thus it appears that enzymes other than, or in addition to, those of the SOS repair system are involved in the repair of DNA damage induced by these drugs.

  16. Inflammation-Induced Cell Proliferation Potentiates DNA Damage-Induced Mutations In Vivo

    PubMed Central

    Kiraly, Orsolya; Gong, Guanyu; Olipitz, Werner; Muthupalani, Sureshkumar; Engelward, Bevin P.


    Mutations are a critical driver of cancer initiation. While extensive studies have focused on exposure-induced mutations, few studies have explored the importance of tissue physiology as a modulator of mutation susceptibility in vivo. Of particular interest is inflammation, a known cancer risk factor relevant to chronic inflammatory diseases and pathogen-induced inflammation. Here, we used the fluorescent yellow direct repeat (FYDR) mice that harbor a reporter to detect misalignments during homologous recombination (HR), an important class of mutations. FYDR mice were exposed to cerulein, a potent inducer of pancreatic inflammation. We show that inflammation induces DSBs (γH2AX foci) and that several days later there is an increase in cell proliferation. While isolated bouts of inflammation did not induce HR, overlap between inflammation-induced DNA damage and inflammation-induced cell proliferation induced HR significantly. To study exogenously-induced DNA damage, animals were exposed to methylnitrosourea, a model alkylating agent that creates DNA lesions relevant to both environmental exposures and cancer chemotherapy. We found that exposure to alkylation damage induces HR, and importantly, that inflammation-induced cell proliferation and alkylation induce HR in a synergistic fashion. Taken together, these results show that, during an acute bout of inflammation, there is a kinetic barrier separating DNA damage from cell proliferation that protects against mutations, and that inflammation-induced cell proliferation greatly potentiates exposure-induced mutations. These studies demonstrate a fundamental mechanism by which inflammation can act synergistically with DNA damage to induce mutations that drive cancer and cancer recurrence. PMID:25647331

  17. In cellulo phosphorylation of XRCC4 Ser320 by DNA-PK induced by DNA damage

    PubMed Central

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Samarth, Ravindra Mahadeo; Tomita, Masanori; Matsumoto, Yoshihisa


    XRCC4 is a protein associated with DNA Ligase IV, which is thought to join two DNA ends at the final step of DNA double-strand break repair through non-homologous end joining. In response to treatment with ionizing radiation or DNA damaging agents, XRCC4 undergoes DNA-PK-dependent phosphorylation. Furthermore, Ser260 and Ser320 (or Ser318 in alternatively spliced form) of XRCC4 were identified as the major phosphorylation sites by purified DNA-PK in vitro through mass spectrometry. However, it has not been clear whether these sites are phosphorylated in vivo in response to DNA damage. In the present study, we generated an antibody that reacts with XRCC4 phosphorylated at Ser320 and examined in cellulo phosphorylation status of XRCC4 Ser320. The phosphorylation of XRCC4 Ser320 was induced by γ-ray irradiation and treatment with Zeocin. The phosphorylation of XRCC4 Ser320 was detected even after 1 Gy irradiation and increased in a manner dependent on radiation dose. The phosphorylation was observed immediately after irradiation and remained mostly unchanged for up to 4 h. The phosphorylation was inhibited by DNA-PK inhibitor NU7441 and was undetectable in DNA-PKcs-deficient cells, indicating that the phosphorylation was mainly mediated by DNA-PK. These results suggested potential usefulness of the phosphorylation status of XRCC4 Ser320 as an indicator of DNA-PK functionality in living cells. PMID:26666690

  18. RNase H enables efficient repair of R-loop induced DNA damage

    PubMed Central

    Amon, Jeremy D; Koshland, Douglas


    R-loops, three-stranded structures that form when transcripts hybridize to chromosomal DNA, are potent agents of genome instability. This instability has been explained by the ability of R-loops to induce DNA damage. Here, we show that persistent R-loops also compromise DNA repair. Depleting endogenous RNase H activity impairs R-loop removal in Saccharomyces cerevisiae, causing DNA damage that occurs preferentially in the repetitive ribosomal DNA locus (rDNA). We analyzed the repair kinetics of this damage and identified mutants that modulate repair. We present a model that the persistence of R-loops at sites of DNA damage induces repair by break-induced replication (BIR). This R-loop induced BIR is particularly susceptible to the formation of lethal repair intermediates at the rDNA because of a barrier imposed by RNA polymerase I. DOI: PMID:27938663

  19. Repair Machinery for Radiation-Induced DNA Damage

    DTIC Science & Technology


    significant defect in the repair of certain DNA damages, but of which damages needs to be determined. We have selected Chinese Hamster Ovary ( CHO ) as...chromosome (BAC) genomic fragment, which we isolated from a CHO BAC library, revealed that APE1 exists as a single copy gene in AA8 (see Appendix, Figure... cells , we first determined the APE1 gene copy number in the CHO AA8 cell line. Fluorescence in situ hybridization with an APE1 bacterial artificial

  20. High glucose induces DNA damage in cultured human endothelial cells.

    PubMed Central

    Lorenzi, M; Montisano, D F; Toledo, S; Barrieux, A


    Morphologic and functional abnormalities of vascular endothelium are well recognized in diabetes. In view of our previous finding that high glucose concentrations accelerate death and hamper replication of cultured human endothelial cells, we have investigated in the same model the possibility that exposure to high glucose may result in DNA damage. DNA from human endothelial cells--but not from fibroblasts--exposed to 30 mM glucose for 9-14 d manifested an accelerated rate of unwinding in alkali indicative of an increased number of single strand breaks (P less than 0.001 vs. control). Endothelial cells exposed to high glucose also manifested an increased amount of hydroxy-urea-resistant thymidine incorporation (333 +/- 153 cpm/10(5) cells vs. 88 +/- 42 in control cells, mean +/- SD, P = 0.04), which is indicative of increased DNA repair synthesis. Neither DNA damage nor repair synthesis were increased by medium hypertonicity achieved with 30 mM mannitol. These findings suggest the possibility that, under conditions of high ambient glucose, excess glucose entry in cells that are insulin independent for glucose transport may, directly or indirectly, perturb DNA function. Further, they suggest the possibility that different individual capabilities to repair DNA damage--a process that is under genetic control--may represent a mechanism for different individual susceptibilities to development of diabetic vascular complication. PMID:3944257

  1. DNA damage response in peripheral nervous system: coping with cancer therapy-induced DNA lesions.


    Englander, Ella W


    In the absence of blood brain barrier (BBB) the DNA of peripheral nervous system (PNS) neurons is exposed to a broader spectrum of endogenous and exogenous threats compared to that of the central nervous system (CNS). Hence, while CNS and PNS neurons cope with many similar challenges inherent to their high oxygen consumption and vigorous metabolism, PNS neurons are also exposed to circulating toxins and inflammatory mediators due to relative permeability of PNS blood nerve barrier (BNB). Consequently, genomes of PNS neurons incur greater damage and the question awaiting investigation is whether specialized repair mechanisms for maintenance of DNA integrity have evolved to meet the additional needs of PNS neurons. Here, I review data showing how PNS neurons manage collateral DNA damage incurred in the course of different anti-cancer treatments designed to block DNA replication in proliferating tumor cells. Importantly, while PNS neurotoxicity and concomitant chemotherapy-induced peripheral neuropathy (CIPN) are among major dose limiting barriers in achieving therapy goals, CIPN is partially reversible during post-treatment nerve recovery. Clearly, cell recovery necessitates mobilization of the DNA damage response and underscores the need for systematic investigation of the scope of DNA repair capacities in the PNS to help predict post-treatment risks to recovering neurons.

  2. DNA damage induced by red food dyes orally administered to pregnant and male mice.


    Tsuda, S; Murakami, M; Matsusaka, N; Kano, K; Taniguchi, K; Sasaki, Y F


    We determined the genotoxicity of synthetic red tar dyes currently used as food color additives in many countries, including JAPAN: For the preliminary assessment, we treated groups of 4 pregnant mice (gestational day 11) once orally at the limit dose (2000 mg/kg) of amaranth (food red No. 2), allura red (food red No. 40), or acid red (food red No. 106), and we sampled brain, lung, liver, kidney, glandular stomach, colon, urinary bladder, and embryo 3, 6, and 24 h after treatment. We used the comet (alkaline single cell gel electrophoresis) assay to measure DNA damage. The assay was positive in the colon 3 h after the administration of amaranth and allura red and weakly positive in the lung 6 h after the administration of amaranth. Acid red did not induce DNA damage in any sample at any sampling time. None of the dyes damaged DNA in other organs or the embryo. We then tested male mice with amaranth, allura red, and a related color additive, new coccine (food red No. 18). The 3 dyes induced DNA damage in the colon starting at 10 mg/kg. Twenty ml/kg of soaking liquid from commercial red ginger pickles, which contained 6.5 mg/10 ml of new coccine, induced DNA damage in colon, glandular stomach, and bladder. The potencies were compared to those of other rodent carcinogens. The rodent hepatocarcinogen p-dimethylaminoazobenzene induced colon DNA damage at 1 mg/kg, whereas it damaged liver DNA only at 500 mg/kg. Although 1 mg/kg of N-nitrosodimethylamine induced DNA damage in liver and bladder, it did not induce colon DNA damage. N-nitrosodiethylamine at 14 mg/kg did not induce DNA damage in any organs examined. Because the 3 azo additives we examined induced colon DNA damage at a very low dose, more extensive assessment of azo additives is warranted.

  3. Non-Problematic Risks from Low-Dose Radiation-Induced DNA Damage Clusters

    PubMed Central

    Hayes, Daniel P.


    Radiation-induced DNA damage clusters have been proposed and are usually considered to pose the threat of serious biological damage. This has been attributed to DNA repair debilitation or cessation arising from the complexity of cluster damage. It will be shown here, contrary to both previous suggestions and perceived wisdom, that radiation induced damage clusters contribute to non-problematic risks in the low-dose, low-LET regime. The very complexity of cluster damage which inhibits and/or compromises DNA repair will ultimately be responsible for the elimination and/or diminution of precancer-ous and cancerous cells. PMID:18648573


    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...


    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...


    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...


    EPA Science Inventory

    A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

  8. Simplified qPCR method for detecting excessive mtDNA damage induced by exogenous factors.


    Gureev, Artem P; Shaforostova, Ekaterina A; Starkov, Anatoly A; Popov, Vasily N


    Damage to mitochondrial DNA (mtDNA) is a meaningful biomarker for evaluating genotoxicity of drugs and environmental toxins. Existing PCR methods utilize long mtDNA fragments (∼8-10kb), which complicates detecting exact sites of mtDNA damage. To identify the mtDNA regions most susceptible to damage, we have developed and validated a set of primers to amplify ∼2kb long fragments, while covering over 95% of mouse mtDNA. We have modified the detection method by greatly increasing the enrichment of mtDNA, which allows us solving the problem of non-specific primer annealing to nuclear DNA. To validate our approach, we have determined the most damage-susceptible mtDNA regions in mice treated in vivo and in vitro with rotenone and H2O2. The GTGR-sequence-enriched mtDNA segments located in the D-loop region were found to be especially susceptible to damage. Further, we demonstrate that H2O2-induced mtDNA damage facilitates the relaxation of mtDNA supercoiled conformation, making the sequences with minimal damage more accessible to DNA polymerase, which, in turn, results in a decrease in threshold cycle value. Overall, our modified PCR method is simpler and more selective to the specific sites of damage in mtDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)


    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  10. Clustered DNA damages induced in isolated DNA and in human cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Sidorkina, O.; Laval, J.; Lowenstein, D. I. (Principal Investigator)


    Clustered DNA damages-two or more closely spaced damages (strand breaks, abasic sites, or oxidized bases) on opposing strands-are suspects as critical lesions producing lethal and mutagenic effects of ionizing radiation. However, as a result of the lack of methods for measuring damage clusters induced by ionizing radiation in genomic DNA, neither the frequencies of their production by physiological doses of radiation, nor their repairability, nor their biological effects are known. On the basis of methods that we developed for quantitating damages in large DNAs, we have devised and validated a way of measuring ionizing radiation-induced clustered lesions in genomic DNA, including DNA from human cells. DNA is treated with an endonuclease that induces a single-strand cleavage at an oxidized base or abasic site. If there are two closely spaced damages on opposing strands, such cleavage will reduce the size of the DNA on a nondenaturing gel. We show that ionizing radiation does induce clustered DNA damages containing abasic sites, oxidized purines, or oxidized pyrimidines. Further, the frequency of each of these cluster classes is comparable to that of frank double-strand breaks; among all complex damages induced by ionizing radiation, double-strand breaks are only about 20%, with other clustered damage constituting some 80%. We also show that even low doses (0.1-1 Gy) of high linear energy transfer ionizing radiation induce clustered damages in human cells.

  11. Clerocidin selectively modifies the gyrase-DNA gate to induce irreversible and reversible DNA damage

    PubMed Central

    Pan, Xiao Su; Dias, Miriam; Palumbo, Manlio; Fisher, L. Mark


    Clerocidin (CL), a microbial diterpenoid, reacts with DNA via its epoxide group and stimulates DNA cleavage by type II DNA topoisomerases. The molecular basis of CL action is poorly understood. We establish by genetic means that CL targets DNA gyrase in the Gram-positive bacterium Streptococcus pneumoniae, and promotes gyrase-dependent single- and double-stranded DNA cleavage in vitro. CL-stimulated DNA breakage exhibited a strong preference for guanine preceding the scission site (−1 position). Mutagenesis of −1 guanines to A, C or T abrogated CL cleavage at a strong pBR322 site. Surprisingly, for double-strand breaks, scission on one strand consistently involved a modified (piperidine-labile) guanine and was not reversed by heat, salt or EDTA, whereas complementary strand scission occurred at a piperidine-stable −1 nt and was reversed by EDTA. CL did not induce cleavage by a mutant gyrase (GyrA G79A) identified here in CL-resistant pneumococci. Indeed, mutations at G79 and at the neighbouring S81 residue in the GyrA breakage-reunion domain discriminated poisoning by CL from that of antibacterial quinolones. The results suggest a novel mechanism of enzyme inhibition in which the −1 nt at the gyrase-DNA gate exhibit different CL reactivities to produce both irreversible and reversible DNA damage. PMID:18723572

  12. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    SciTech Connect

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.


    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the Hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. - Highlights: • Low levels of arsenite enhance UV-induced DNA damage in human keratinocytes. • UV-initiated HPRT mutation frequency is enhanced by arsenite. • Zinc supplementation offsets DNA damage and mutation frequency enhanced by arsenite. • Zinc-dependent reduction of arsenite enhanced DNA damage is confirmed in vivo.

  13. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.


    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung


    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1.

  14. DNA-damage response during mitosis induces whole-chromosome missegregation.


    Bakhoum, Samuel F; Kabeche, Lilian; Murnane, John P; Zaki, Bassem I; Compton, Duane A


    Many cancers display both structural (s-CIN) and numerical (w-CIN) chromosomal instabilities. Defective chromosome segregation during mitosis has been shown to cause DNA damage that induces structural rearrangements of chromosomes (s-CIN). In contrast, whether DNA damage can disrupt mitotic processes to generate whole chromosomal instability (w-CIN) is unknown. Here, we show that activation of the DNA-damage response (DDR) during mitosis selectively stabilizes kinetochore-microtubule (k-MT) attachments to chromosomes through Aurora-A and PLK1 kinases, thereby increasing the frequency of lagging chromosomes during anaphase. Inhibition of DDR proteins, ATM or CHK2, abolishes the effect of DNA damage on k-MTs and chromosome segregation, whereas activation of the DDR in the absence of DNA damage is sufficient to induce chromosome segregation errors. Finally, inhibiting the DDR during mitosis in cancer cells with persistent DNA damage suppresses inherent chromosome segregation defects. Thus, the DDR during mitosis inappropriately stabilizes k-MTs, creating a link between s-CIN and w-CIN. The genome-protective role of the DDR depends on its ability to delay cell division until damaged DNA can be fully repaired. Here, we show that when DNA damage is induced during mitosis, the DDR unexpectedly induces errors in the segregation of entire chromosomes, thus linking structural and numerical chromosomal instabilities. ©2014 American Association for Cancer Research.

  15. The ATM Kinase Induces MicroRNA Biogenesis in the DNA Damage Response

    PubMed Central

    Zhang, Xinna; Wan, Guohui; Berger, Franklin G.; He, Xiaoming; Lu, Xiongbin


    SUMMARY The DNA damage response involves a complex network of processes that detect and repair DNA damage. Here we show that miRNA biogenesis is globally induced upon DNA damage in an ATM-dependent manner. About one fourth of miRNAs are significantly up-regulated after DNA damage, while loss of ATM abolishes their induction. KSRP (KH-type splicing regulatory protein) is a key player that translates DNA damage signaling to miRNA biogenesis. The ATM kinase directly binds to and phosphorylates KSRP, leading to enhanced interaction between KSRP and pri-miRNAs and increased KSRP activity in miRNA processing. Mutations of the ATM phosphorylation sites of KSRP impaired its activity in regulating miRNAs. These findings reveal a mechanism by which DNA damage signaling is linked to miRNA biogenesis. PMID:21329876

  16. Guanidine-reactive agent phenylglyoxal induces DNA damage and cancer cell death.


    Calderón-Montaño, José M; Burgos-Morón, Estefanía; Orta, Manuel L; Pastor, Nuria; Perez-Guerrero, Concepción; Austin, Caroline A; Mateos, Santiago; López-Lázaro, Miguel


    DNA-damaging compounds (e.g., alkylating agents, cytotoxic antibiotics and DNA topoisomerase poisons) are the most widely used anticancer drugs. The inability of tumor cells to properly repair some types of DNA damage may explain why specific DNA-damaging drugs can selectively kill tumor cells. Phenylglyoxal is a dicarbonyl compound known to react with guanidine groups such as that of the DNA base guanine, therefore suggesting that phenylglyoxal could induce DNA damage and have anticancer activity. Cellular DNA damage was measured by the alkaline comet assay and the γH2AX focus assay. Formation of topoisomerase I- and topoisomerase II-DNA complexes was assessed by the TARDIS assay, an immunofluorescence technique that employs specific antibodies to DNA topo I or topo II to detect the protein covalently bound to the DNA in individual cells. Cell growth inhibition and cytotoxicity were determined by XTT, MTT and clonogenic assays. Apoptosis was assessed by the Annexin V flow cytometry assay. Phenylglyoxal induced cellular DNA damage and formation of high levels of topoisomerase I- and topoisomerase II-DNA complexes in cells. These topoisomerase-DNA complexes were abolished by catalase pretreatment and correlated well with the induction of apoptosis. Phenylglyoxal-induced cell death was partially prevented by catalase pretreatment and was higher in lung cancer cells (A549) than in normal lung fibroblasts (MRC5). Mammalian cell lines defective in nucleotide excision repair (NER), homologous recombination (HR) and non-homologous end joining (NHEJ) were more sensitive to phenylglyoxal than parental cells; this suggests that phenylglyoxal may induce bulky distortions in the shape of the DNA double helix (which are repaired by the NER pathway) and DNA double-strand breaks (which are repaired by HR and NHEJ). This report shows that phenylglyoxal is a new DNA-damaging agent with anticancer activity, and suggests that tumor cells with defects in NER, HR and NHEJ may be

  17. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    PubMed Central

    Ganesan, Shanthi; Keating, Aileen F.


    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. PMID:25497287

  18. Genetic and Functional Studies of Genes that Regulate DNA-Damage-Induced Cell Death

    DTIC Science & Technology


    AD Award Number: DAMD17-01-1-0145 TITLE: Genetic and Functional Studies of Genes that Regulate DNA-damage-induced Cell Death PRINCIPAL INVESTIGATOR...and Functional Studies of Genes that Regulate DAMD17-01-1-0145 DNA-damage-induced Cell Death 6. A UTHOR(S) Zhou Songyang, Ph.D. 7. PERFORMING ORGANIZA...mechanisms of genes that regulate DNA damage induced cell death are much less well studied. We have proposed to establish a genetic system to screen for

  19. How to Cope with DNA Damage Induced by Ionizing Radiation and Anti-Cancer Drugs?

    NASA Astrophysics Data System (ADS)

    Enomoto, A.; Miyagawa, K.

    Ionizing radiation and chemotherapeutic agents induce many types of DNA lesions, of which DNA double-strand breaks (DSBs) are assumed to be the most deleterious. DNA damage response mechanisms encompass pathways of DNA damage signaling, DNA repair, cell cycle checkpoint arrest, and apoptosis. Increasing evidence suggests that these pathways function co-operatively to maintain genomic stability in the face of exogenous and endogenous DNA damage. The relative impact of one mechanism over another probably depends on the kinds of lesions, the cell cycle phase, and the cell or tissue type. The inability to respond properly to or to repair DSBs may lead to hypersensitivity to DNA damaging agents and genomic instability including chromosomal aberrations. Chromosomal instability, a state of continuous accumulation of chromosomal change, is a common feature of many human cancers and of chromosome instability syndromes with increased cancer susceptibility. Here, we review the DNA da mage response and the links between deficiencies in response to DSBs and chromosomal instability.

  20. Biological consequences of radiation-induced DNA damage: relevance to radiotherapy.


    Lomax, M E; Folkes, L K; O'Neill, P


    DNA damage of exposed tumour tissue leading to cell death is one of the detrimental effects of ionising radiation that is exploited, with beneficial consequences, for radiotherapy. The pattern of the discrete energy depositions during passage of the ionising track of radiation defines the spatial distribution of lesions induced in DNA with a fraction of the DNA damage sites containing clusters of lesions, formed over a few nanometres, against a background of endogenously induced individual lesions. These clustered DNA damage sites, which may be considered as a signature of ionising radiation, underlie the deleterious biological consequences of ionising radiation. The concepts developed rely in part on the fact that ionising radiation creates significant levels of clustered DNA damage, including complex double-strand breaks (DSB), to kill tumour cells as clustered damage sites are difficult to repair. This reduced repairability of clustered DNA damage using specific repair pathways is exploitable in radiotherapy for the treatment of cancer. We discuss some potential strategies to enhance radiosensitivity by targeting the repair pathways of radiation-induced clustered damage and complex DNA DSB, through inhibition of specific proteins that are not required in the repair pathways for endogenous damage. The variety and severity of DNA damage from ionising radiation is also influenced by the tumour microenvironment, being especially sensitive to the oxygen status of the cells. For instance, nitric oxide is known to influence the types of damage induced by radiation under hypoxic conditions. A potential strategy based on bioreductive activation of pro-drugs to release nitric oxide is discussed as an approach to deliver nitric oxide to hypoxic tumours during radiotherapy. The ultimate aim of this review is to stimulate thinking on how knowledge of the complexity of radiation-induced DNA damage may contribute to the development of adjuncts to radiotherapy. Copyright

  1. DNA damage induced by low energy electron collision and new experimental setup for further studying DNA damage by plasma

    NASA Astrophysics Data System (ADS)

    Park, Yeunsoo; Sanche, Leon; Wagner, Richard


    Low energy electrons (LEEs; below 10 eV) are the most abundant among the radiolytic species generated along the high energy radiation track in living cell. And these electrons are also one of major components with ions and photon in plasma. Interestingly, it has turned out that LEEs can create DNA damages such as base release, single- and double- strand breaks (SSB and DSB) via indirect action named dissociative electron attachment (DEA). The purposes of this study are to further find out exact mechanisms of DNA damage by LEEs at the molecular level and to verify new DNA damage like structural alteration on DNA subunits. And we will expand our study to DNA damage by plasma source to develop plasma-based new medical and biological applications. We are currently setting new experimental system for reaching our goals. We will show some recent results about new finding DNA modification damage and some experimental designs and working principles.

  2. Acrylonitrile-Induced Oxidative Stress and Oxidative DNA Damage in Male Sprague-Dawley Rats

    PubMed Central

    Kamendulis, Lisa M.; Klaunig, James E.


    Studies have demonstrated that the induction of oxidative stress may be involved in brain tumor induction in rats by acrylonitrile. The present study examined whether acrylonitrile induces oxidative stress and DNA damage in rats and whether blood can serve as a valid surrogate for the biomonitoring of oxidative stress induced by acrylonitrile in the exposed population. Male Sprague-Dawley rats were treated with 0, 3, 30, 100, and 200 ppm acrylonitrile in drinking water for 28 days. One group of rats were also coadministered N-acetyl cysteine (NAC) (0.3% in diet) with acrylonitrile (200 ppm in drinking water) to examine whether antioxidant supplementation was protective against acrylonitrile-induced oxidative stress. Direct DNA strand breakage in white blood cells (WBC) and brain was measured using the alkaline comet assay. Oxidative DNA damage in WBC and brain was evaluated using formamidopyrimidine DNA glycosylase (fpg)-modified comet assay and with high-performance liquid chromatography-electrochemical detection. No significant increase in direct DNA strand breaks was observed in brain and WBC from acrylonitrile-treated rats. However, oxidative DNA damage (fpg comet and 8′hydroxyl-2-deoxyguanosine) in brain and WBC was increased in a dose-dependent manner. In addition, plasma levels of reactive oxygen species (ROS) increased in rats administered acrylonitrile. Dietary supplementation with NAC prevented acrylonitrile-induced oxidative DNA damage in brain and WBC. A slight, but significant, decrease in the GSH:GSSG ratio was seen in brain at acrylonitrile doses > 30 ppm. These results provide additional support that the mode of action for acrylonitrile-induced astrocytomas involves the induction of oxidative stress and damage. Significant associations were seen between oxidative DNA damage in WBC and brain, ROS formation in plasma, and the reported tumor incidences. Since oxidative DNA damage in brain correlated with oxidative damage in WBC, these results suggest

  3. Toxoplasma gondii infection can induce retinal DNA damage: an experimental study

    PubMed Central

    El-Sayed, Nagwa Mostafa; Aly, Eman Mohamed


    AIM To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage. METHODS A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups: control group (non-infected animals); T. gondii infected group; immunosuppressed infected group; and infected group treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment. RESULTS The obtained results showed that T. gondii infection induced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there was significant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups. CONCLUSION T. gondii infection can induce DNA damage in mice retinal cells. PMID:24967186

  4. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.


    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji


    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV.

  5. DNA damage as an indicator of pollutant-induced genotoxicity

    SciTech Connect

    Shugart, L.R.


    Biological monitoring is an approach of considerable interest to scientists in the field of environmental genotoxicity who are investigating the effects of hazardous substances on the biota. In essence the technique involves an evaluation of various types of responses in living organisms for their potential to identify exposure to dangerous substances and to define or to predict subsequent deleterious effects. The rationale for the selection of DNA damage as an indicator of exposure to genotoxic agents is based mainly on the mechanisms of action of chemicals that are known mutagens and carcinogens. An alkaline unwinding assay that detects excess strand breakage within the DNA polymer was applied to sunfish in a local stream as a biological monitor for environmental genotoxicity due to industrial pollution. The study was conducted over a period of 15 months and the temporal and spatial aspects of the data were evaluated for the effect of remedial action. 16 refs., 4 figs., 4 tabs.

  6. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    SciTech Connect

    Ganesan, Shanthi Keating, Aileen F.


    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  7. Guanine-specific DNA damage induced by γ-irradiated histone

    PubMed Central


    In γ-irradiation, •OH is directly generated from water and causes DNA damage leading to carcinogenesis. Exposure of proteins to γ-irradiation, in the presence of oxygen, gives high yields of hydroperoxides. To clarify whether these hydroperoxides, particularly those formed on DNA-binding histone proteins, participate in γ-irradiation-induced carcinogenesis, experiments using 32P-labelled DNA fragments obtained from human cancer-related genes were undertaken. Histone protein-hydroperoxides induced significant DNA damage in the presence of Cu(I). Histone H1- and H3-hydroperoxides showed stronger DNA damage compared with histone H2A- and H4-hydroperoxides at 0.7 μM. Histone H1-hydroperoxides caused Cu(I)-dependent DNA damage predominantly at guanine residues, especially at 5′-GGC-3′, 5′-GGA-3′, 5′-GGT-3′ and single G bases. In contrast, histone H3-hydroperoxides/Cu(I) induced DNA damage at 5′-G in GG sequences; this sequence specificity is identical with that generated by 2,2′-azobis (2-amidinopropane) dihydrochloride, which is known to produce peroxyl radicals (RO2•). The difference in site specificity of DNA damage induced by histone H1- and H3-hydroperoxides may arise from their amino acid composition or their mode of binding to DNA. The histone H1-hydroperoxides/Cu(I) system also induced 8-oxo-7,8-dihydro-2′-deoxyguanosine formation in calf thymus DNA. It is concluded that histone protein-hydroperoxides can induce guanine-specific DNA damage, which may contribute to γ-irradiation-induced carcinogenesis. PMID:15698381

  8. RNA m(6)A methylation regulates the ultraviolet-induced DNA damage response.


    Xiang, Yang; Laurent, Benoit; Hsu, Chih-Hung; Nachtergaele, Sigrid; Lu, Zhike; Sheng, Wanqiang; Xu, Chuanyun; Chen, Hao; Ouyang, Jian; Wang, Siqing; Ling, Dominic; Hsu, Pang-Hung; Zou, Lee; Jambhekar, Ashwini; He, Chuan; Shi, Yang


    Cell proliferation and survival require the faithful maintenance and propagation of genetic information, which are threatened by the ubiquitous sources of DNA damage present intracellularly and in the external environment. A system of DNA repair, called the DNA damage response, detects and repairs damaged DNA and prevents cell division until the repair is complete. Here we report that methylation at the 6 position of adenosine (m(6)A) in RNA is rapidly (within 2 min) and transiently induced at DNA damage sites in response to ultraviolet irradiation. This modification occurs on numerous poly(A)(+) transcripts and is regulated by the methyltransferase METTL3 (methyltransferase-like 3) and the demethylase FTO (fat mass and obesity-associated protein). In the absence of METTL3 catalytic activity, cells showed delayed repair of ultraviolet-induced cyclobutane pyrimidine adducts and elevated sensitivity to ultraviolet, demonstrating the importance of m(6)A in the ultraviolet-responsive DNA damage response. Multiple DNA polymerases are involved in the ultraviolet response, some of which resynthesize DNA after the lesion has been excised by the nucleotide excision repair pathway, while others participate in trans-lesion synthesis to allow replication past damaged lesions in S phase. DNA polymerase κ (Pol κ), which has been implicated in both nucleotide excision repair and trans-lesion synthesis, required the catalytic activity of METTL3 for immediate localization to ultraviolet-induced DNA damage sites. Importantly, Pol κ overexpression qualitatively suppressed the cyclobutane pyrimidine removal defect associated with METTL3 loss. Thus, we have uncovered a novel function for RNA m(6)A modification in the ultraviolet-induced DNA damage response, and our findings collectively support a model in which m(6)A RNA serves as a beacon for the selective, rapid recruitment of Pol κ to damage sites to facilitate repair and cell survival.

  9. Bisdemethoxycurcumin induces DNA damage and inhibits DNA repair associated protein expressions in NCI-H460 human lung cancer cells.


    Yu, Chien-Chih; Yang, Su-Tso; Huang, Wen-Wen; Peng, Shu-Fen; Huang, An-Cheng; Tang, Nou-Ying; Liu, Hsin-Chung; Yang, Mei-Due; Lai, Kuang-Chi; Chung, Jing-Gung


    Nonsmall cell lung carcinoma (NSCLC) is a devastating primary lung tumor resistant to conventional therapies. Bisdemethoxycurcumin (BDMC) is one of curcumin derivate from Turmeric and has been shown to induce NSCLC cell death. Although there is one report to show BDMC induced DNA double strand breaks, however, no available information to show BDMC induced DNA damage action with inhibited DNA repair protein in lung cancer cells in detail. In this study, we tested BDMC-induced DNA damage and condensation in NCI-H460 cells by using Comet assay and DAPI staining examinations, respectively and we found BDMC induced DNA damage and condension. Western blotting was used to examine the effects of BDMC on protein expression associated with DNA damage and repair and results indicated that BDMC suppressed the protein levels associated with DNA damage and repair, such as 14-3-3σ (an important checkpoint keeper of DDR), O6-methylguanine-DNA methyltransferase, DNA repair proteins breast cancer 1, early onset, mediator of DNA damage checkpoint 1 but activate phosphorylated p53 and p-H2A.X (phospho Ser140) in NCI-H460 cells. Confocal laser systems microscopy was used for examining the protein translocation and results show that BDMC increased the translocation of p-p53 and p-H2A.X (phospho Ser140) from cytosol to nuclei in NCI-H460 cells. In conclusion, BDMC induced DNA damage and condension and affect DNA repair proteins in NCI-H460 cells in vitro. © 2015 Wiley Periodicals, Inc. Environ Toxicol, 2015.

  10. Characterization of UVC-induced DNA damage in bloodstains: forensic implications.


    Hall, Ashley; Ballantyne, Jack


    The ability to detect DNA polymorphisms using molecular genetic techniques has revolutionized the forensic analysis of biological evidence. DNA typing now plays a critical role within the criminal justice system, but one of the limiting factors with the technology is that DNA isolated from biological stains recovered from the crime scene is sometimes so damaged as to be intractable to analysis. Potential remedies for damaged DNA are likely to be dependent upon the precise nature of the DNA damage present in any particular sample but, unfortunately, current knowledge of the biochemical nature, and the extent, of such DNA damage in dried biological stains is rudimentary. As a model for DNA damage assessment in biological stains recovered from crime scenes, we have subjected human bloodstains and naked DNA in the hydrated and dehydrated states to varying doses of UVC radiation. It was possible to damage the DNA sufficiently in a bloodstain to cause a standard autosomal short tandem repeat (STR) profile to be lost. However, a detailed analysis of the process, based upon assays developed to detect bipyrimidine photoproducts (BPPPs), single- and double-strand breaks, and DNA-DNA crosslinks, produced some unexpected findings. Contrary to the situation with living tissues or cells in culture, the predominant UVC-induced damage to DNA in bloodstains appears not to be pyrimidine dimers. Although some evidence for the presence of BPPPs and DNA crosslinks was obtained, the major form of UVC damage causing genetic profile loss appeared to be single-strand breaks. It was not possible, however, to preclude the possibility that a combination of damage types was responsible for the profile loss observed. We demonstrate here that a significant measure of protection against UVC-mediated genetic profile loss in dried biological stain material is afforded by the dehydrated state of the DNA and, to a lesser extent, the DNA cellular milieu.

  11. Determination of the Action Spectrum of UVR-Induced Mitochondrial DNA Damage in Human Skin Cells.


    Latimer, Jennifer A; Lloyd, James J; Diffey, Brian L; Matts, Paul J; Birch-Machin, Mark A


    Biological responses of human skin to UVR including cancer and aging are largely wavelength-dependent, as shown by the action spectra of UVR-induced erythema and nuclear DNA (nDNA) damage. A molecular dosimeter of UVR exposure is therefore required. Although mitochondrial DNA (mtDNA) damage has been shown to be a reliable and sensitive biomarker of UVR exposure in human skin, its wavelength dependency is unknown. The current study solves this problem by determining the action spectrum of UVR-induced mtDNA damage in human skin. Human neonatal dermal fibroblasts and primary human adult keratinocyte cells were irradiated with increasing doses of UVR. Dose-response curves of mtDNA damage were produced for each of the UVR sources and cell types, and an action spectrum for each cell type was determined by mathematical induction. Similarities between these mtDNA damage action spectra and previously determined nDNA damage were observed, with the most detrimental effects occurring over the shorter UVR wavelengths. Notably, a statistically significant (P<0.0001) greater sensitivity to mtDNA damage was observed in dermal fibroblasts compared with keratinocytes at wavelengths >300 nm, possibly indicating a wider picture of depth dependence in sensitivity. This finding has implications for disease/photodamage mechanisms and interventions.

  12. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells

    PubMed Central

    Song, Eun Ah; Kim, Hyeyoung


    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells’ molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies. PMID:27527148

  13. Docosahexaenoic Acid Induces Oxidative DNA Damage and Apoptosis, and Enhances the Chemosensitivity of Cancer Cells.


    Song, Eun Ah; Kim, Hyeyoung


    The human diet contains low amounts of ω-3 polyunsaturated fatty acids (PUFAs) and high amounts of ω-6 PUFAs, which has been reported to contribute to the incidence of cancer. Epidemiological studies have shown that a high consumption of fish oil or ω-3 PUFAs reduced the risk of colon, pancreatic, and endometrial cancers. The ω-3 PUFA, docosahexaenoic acid (DHA), shows anticancer activity by inducing apoptosis of some human cancer cells without toxicity against normal cells. DHA induces oxidative stress and oxidative DNA adduct formation by depleting intracellular glutathione (GSH) and decreasing the mitochondrial function of cancer cells. Oxidative DNA damage and DNA strand breaks activate DNA damage responses to repair the damaged DNA. However, excessive DNA damage beyond the capacity of the DNA repair processes may initiate apoptotic signaling pathways and cell cycle arrest in cancer cells. DHA shows a variable inhibitory effect on cancer cell growth depending on the cells' molecular properties and degree of malignancy. It has been shown to affect DNA repair processes including DNA-dependent protein kinases and mismatch repair in cancer cells. Moreover, DHA enhanced the efficacy of anticancer drugs by increasing drug uptake and suppressing survival pathways in cancer cells. In this review, DHA-induced oxidative DNA damage, apoptotic signaling, and enhancement of chemosensitivity in cancer cells will be discussed based on recent studies.

  14. Organic honey supplementation reverses pesticide-induced genotoxicity by modulating DNA damage response.


    Alleva, Renata; Manzella, Nicola; Gaetani, Simona; Ciarapica, Veronica; Bracci, Massimo; Caboni, Maria Fiorenza; Pasini, Federica; Monaco, Federica; Amati, Monica; Borghi, Battista; Tomasetti, Marco


    Glyphosate (GLY) and organophosphorus insecticides such as chlorpyrifos (CPF) may cause DNA damage and cancer in exposed individuals through mitochondrial dysfunction. Polyphenols ubiquitously present in fruits and vegetables, have been viewed as antioxidant molecules, but also influence mitochondrial homeostasis. Here, honey containing polyphenol compounds was evaluated for its potential protective effect on pesticide-induced genotoxicity. Honey extracts from four floral organic sources were evaluated for their polyphenol content, antioxidant activity, and potential protective effects on pesticide-related mitochondrial destabilization, reactive oxygen and nitrogen species formation, and DNA damage response in human bronchial epithelial and neuronal cells. The protective effect of honey was, then evaluated in a residential population chronically exposed to pesticides. The four honey types showed a different polyphenol profile associated with a different antioxidant power. The pesticide-induced mitochondrial dysfunction parallels ROS formation from mitochondria (mtROS) and consequent DNA damage. Honey extracts efficiently inhibited pesticide-induced mtROS formation, and reduced DNA damage by upregulation of DNA repair through NFR2. Honey supplementation enhanced DNA repair activity in a residential population chronically exposed to pesticides, which resulted in a marked reduction of pesticide-induced DNA lesions. These results provide new insight regarding the effect of honey containing polyphenols on pesticide-induced DNA damage response. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Alleviation of Aflatoxin B1-Induced Genomic Damage by Proanthocyanidins via Modulation of DNA Repair.


    Bakheet, Saleh A; Alhuraishi, Ahmed M; Al-Harbi, Naif O; Al-Hosaini, Khaled A; Al-Sharary, Shakir D; Attia, Mohammed M; Alhoshani, Ali R; Al-Shabanah, Othman A; Al-Harbi, Mohammed M; Imam, Faisal; Ahmad, Sheikh F; Attia, Sabry M


    In order to study the mechanisms underlying the alleviation of aflatoxin B1-induced genomic damage by proanthocyanidins (PAs), we examined the modulation of oxidative DNA damage induced by aflatoxin B1 in PAs-pretreated animals. The effects of PAs on changes in the expression of DNA damage and repair genes induced by aflatoxin B1 were also evaluated in rat marrow cells. Administration of PAs before aflatoxin B1 significantly mitigated aflatoxin B1-induced oxidative DNA damage in a dose-dependent manner. Aflatoxin B1 treatment induced significant alterations in the expression of specific DNA repair genes, and the pre-treatment of rats with PAs ameliorated the altered expression of these genes. Conclusively, PAs protect against aflatoxin B1-induced oxidative DNA damage in rats. These protective effects are attributed to the antioxidant effects of PA and enhanced DNA repair through modulation of DNA repair gene expression. Therefore, PAs are a promising chemoprotective agent for averting genotoxic risks associated with aflatoxin B1 exposure.

  16. The yield, processing, and biological consequences of clustered DNA damage induced by ionizing radiation.


    Shikazono, Naoya; Noguchi, Miho; Fujii, Kentaro; Urushibara, Ayumi; Yokoya, Akinari


    After living cells are exposed to ionizing radiation, a variety of chemical modifications of DNA are induced either directly by ionization of DNA or indirectly through interactions with water-derived radicals. The DNA lesions include single strand breaks (SSB), base lesions, sugar damage, and apurinic/apyrimidinic sites (AP sites). Clustered DNA damage, which is defined as two or more of such lesions within one to two helical turns of DNA induced by a single radiation track, is considered to be a unique feature of ionizing radiation. A double strand break (DSB) is a type of clustered DNA damage, in which single strand breaks are formed on opposite strands in close proximity. Formation and repair of DSBs have been studied in great detail over the years as they have been linked to important biological endpoints, such as cell death, loss of genetic material, chromosome aberration. Although non-DSB clustered DNA damage has received less attention, there is growing evidence of its biological significance. This review focuses on the current understanding of (1) the yield of non-DSB clustered damage induced by ionizing radiation (2) the processing, and (3) biological consequences of non-DSB clustered DNA damage.

  17. Estrogens protect against hydrogen peroxide and arachidonic acid induced DNA damage.


    Tang, M; Subbiah, M T


    The ability of estrogens to protect against DNA damage induced by either hydrogen peroxide or arachidonic acid alone or in combination with Cu2+ was investigated. DNA strand breaks were determined by conversion of double stranded supercoiled OX-174 RFI DNA to double stranded open circular DNA and linear single stranded DNA. Estradiol-17 beta significantly decreased the formation of single and double strand breaks in DNA induced by H2O2 alone or with Cu2+. Equilin (an equine estrogen) was more effective than estradiol-17 beta at the doses tested. Arachidonic acid in the presence of Cu2+ caused the formation of high levels of linear DNA which was protected by estrogen with equilen being more effective. These studies suggest that estrogens through this protective effect on DNA damage might contribute to cardioprotection.

  18. Cantharidin induces DNA damage and inhibits DNA repair-associated protein expressions in TSGH8301 human bladder cancer cell.


    Kuo, Jehn-Hwa; Shih, Ting-Ying; Lin, Jing-Pin; Lai, Kuang-Chi; Lin, Meng-Liang; Yang, Mei-Due; Chung, Jing-Gung


    Cantharidin is an active component of mylabris, which has been used as a traditional Chinese medicine. Cantharidin has been shown to have antitumor activity against several types of human cancers in vitro and in animal models in vivo. We investigated whether cantharidin induces DNA damage and affects DNA damage repair-associated protein levels in TSGH8301 human bladder cancer cells. Using flow cytometry to measure viable cells, cantharidin was found to reduce the number of viable cells in a dose-dependent manner. Comet assay, 4',6-diamidino-2-phenylindole (DAPI) staining and DNA gel electrophoresis were used to measure DNA damage and condensation; the results indicated that cantharidin induced DNA damage (comet tail), DNA condensation (white DAPI staining) and DNA damage (DNA smear). Results from western blotting showed that cantharidin inhibited the expression of DNA-dependent serine/threonine protein kinase, poly-ADP ribose polymerase, phosphate-ataxia-telangiectasia and RAD3-related, O-6-methylguanine-DNA methyltransferase, breast cancer susceptibility protein 1, mediator of DNA damage checkpoint protein 1, phospho-histone H2A.X, but increased that of phosphorylated p53 following 6 and 24 h treatment. Confocal laser microscopy was used to examine the protein translocation; cantharidin suppressed the levels of p-H2A.X and MDC1 but increased the levels of p-p53 in TSGH8301 cells. In conclusion, we found that cantharidin-induced cell death may occur through the induction of DNA damage and suppression of DNA repair-associated protein expression in TSGH8301 cells. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  19. Oleandrin induces DNA damage responses in cancer cells by suppressing the expression of Rad51

    PubMed Central

    Bao, Zhengqiang; Tian, Baoping; Wang, Xiaohui; Feng, Hanrong; Liang, Ye; Chen, Zhihua; Li, Wen; Shen, Huahao; Ying, Songmin


    Oleandrin is a monomeric compound extracted from leaves and seeds of Nerium oleander. It had been reported that oleandrin could effectively inhibit the growth of human cancer cells. However, the specific mechanisms of the oleandrin-induced anti-tumor effects remain largely unclear. Genomic instability is one of the main features of cancer cells, it can be the combined effect of DNA damage and tumour-specific DNA repair defects. DNA damage plays important roles during tumorigenesis. In fact, most of the current chemotherapy agents were designed to kill cancer cells by inducing DNA damage. In this study, we found that oleandrin was effective to induce apoptosis in cancer cells, and cause rapid DNA damage response, represented by nuclear RPA (Replication Protein A, a single strand DNA binding protein) and γH2AX(a marker for DNA double strand breaks) foci formation. Interestingly, expression of RAD51, a key protein involved in homologous recombination (HR), was suppressed while XRCC1 was up-regulated in oleandrin treated cancer cells. These results suggested that XRCC1 may play a predominant role in repairing oleandrin-induced DNA damage. Collectively, oleandrin may be a potential anti-tumor agent by suppressing the expression of Rad51. PMID:27449097

  20. The DNA damage response in viral-induced cellular transformation.


    Nikitin, P A; Luftig, M A


    The DNA damage response (DDR) has emerged as a critical tumour suppressor pathway responding to cellular DNA replicative stress downstream of aberrant oncogene over-expression. Recent studies have now implicated the DDR as a sensor of oncogenic virus infection. In this review, we discuss the mechanisms by which tumour viruses activate and also suppress the host DDR. The mechanism of tumour virus induction of the DDR is intrinsically linked to the need for these viruses to promote an S-phase environment to replicate their nucleic acid during infection. However, inappropriate expression of viral oncoproteins can also activate the DDR through various mechanisms including replicative stress, direct interaction with DDR components and induction of reactive oxygen species. Given the growth-suppressive consequences of activating the DDR, tumour viruses have also evolved mechanisms to attenuate these pathways. Aberrant expression of viral oncoproteins may therefore promote tumourigenesis through increased somatic mutation and aneuploidy due to DDR inactivation. This review will focus on the interplay between oncogenic viruses and the DDR with respect to cellular checkpoint control and transformation.

  1. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.


    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A


    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity.

  2. Radiation-induced damage to cellular DNA: measurement and biological role

    NASA Astrophysics Data System (ADS)

    Cadet, Jean; Douki, Thierry; Gasparutto, Didier; Ravanat, Jean-Luc


    Emphasis is placed in this short review on recent developments concerning several aspects of the chemical and biochemical effects of ionizing radiation on both isolated and cellular DNA. This includes the mechanism of formation of single and tandem DNA lesions upon one-electron oxidation and one hydroxyl radical hit only. Information is also provided on the specificity of DNA repair enzymes and the measurement of radiation-induced damage in cellular DNA.

  3. Zinc protects HepG2 cells against the oxidative damage and DNA damage induced by ochratoxin A

    SciTech Connect

    Zheng, Juanjuan; Zhang, Yu; Xu, Wentao; Luo, YunBo; Hao, Junran; Shen, Xiao Li; Yang, Xuan; Li, Xiaohong; Huang, Kunlun


    Oxidative stress and DNA damage are the most studied mechanisms by which ochratoxin A (OTA) induces its toxic effects, which include nephrotoxicity, hepatotoxicity, immunotoxicity and genotoxicity. Zinc, which is an essential trace element, is considered a potential antioxidant. The aim of this paper was to investigate whether zinc supplement could inhibit OTA-induced oxidative damage and DNA damage in HepG2 cells and the mechanism of inhibition. The results indicated that that exposure of OTA decreased the intracellular zinc concentration; zinc supplement significantly reduced the OTA-induced production of reactive oxygen species (ROS) and decrease in superoxide dismutase (SOD) activity but did not affect the OTA-induced decrease in the mitochondrial membrane potential (Δψ{sub m}). Meanwhile, the addition of the zinc chelator N,N,N′,N′-tetrakis(2-pyridylmethyl)ethylenediamine (TPEN) strongly aggravated the OTA-induced oxidative damage. This study also demonstrated that zinc helped to maintain the integrity of DNA through the reduction of OTA-induced DNA strand breaks, 8-hydroxy-2′-deoxyguanosine (8-OHdG) formation and DNA hypomethylation. OTA increased the mRNA expression of metallothionein1-A (MT1A), metallothionein2-A (MT2A) and Cu/Zn superoxide dismutase (SOD1). Zinc supplement further enhanced the mRNA expression of MT1A and MT2A, but it had no effect on the mRNA expression of SOD1 and catalase (CAT). Zinc was for the first time proven to reduce the cytotoxicity of OTA through inhibiting the oxidative damage and DNA damage, and regulating the expression of zinc-associated genes. Thus, the addition of zinc can potentially be used to reduce the OTA toxicity of contaminated feeds. - Highlights: ► OTA decreased the intracellular zinc concentration. ► OTA induced the formation of 8-OHdG in HepG2 cells. ► It was testified for the first time that OTA induced DNA hypomethylation. ► Zinc protects against the oxidative damage and DNA damage induced by

  4. UV-induced DNA damage in Cyclops abyssorum tatricus populations from clear and turbid alpine lakes

    PubMed Central

    Tartarotti, Barbara; Saul, Nadine; Chakrabarti, Shumon; Trattner, Florian; Steinberg, Christian E. W.; Sommaruga, Ruben


    Zooplankton from clear alpine lakes thrive under high levels of solar UV radiation (UVR), but in glacially turbid ones they are more protected from this damaging radiation. Here, we present results from experiments done with Cyclops abyssorum tatricus to assess UV-induced DNA damage and repair processes using the comet assay. Copepods were collected from three alpine lakes of differing UV transparency ranging from clear to glacially turbid, and exposed to artificial UVR. In addition, photoprotection levels [mycosporine-like amino acids (MAAs) and lipophilic antioxidant capacity] were estimated in the test populations. Similar UV-induced DNA damage levels were observed among the copepods from all lakes, but background DNA damage (time zero and dark controls) was lowest in the copepods from the glacially turbid lake, resulting in a higher relative DNA damage accumulation. Most DNA strand breaks were repaired after recovery in the dark. Low MAA concentrations were found in the copepods from the glacially turbid lake, while the highest levels were observed in the population from the most UV transparent lake. However, the highest lipophilic antioxidant capacities were measured in the copepods from the lake with intermediate UV transparency. Photoprotection and the ability to repair DNA damage, and consequently reducing UV-induced damage, are part of the response mechanisms in zooplankton to changes in water transparency caused by glacier retreat. PMID:24616551

  5. Modification of tumour cell metabolism modulates sensitivity to Chk1 inhibitor-induced DNA damage

    PubMed Central

    Massey, Andrew J.


    Chk1 kinase inhibitors are currently under clinical investigation as potentiators of cytotoxic chemotherapy and demonstrate potent activity in combination with anti-metabolite drugs that increase replication stress through the inhibition of nucleotide or deoxyribonucleotide biosynthesis. Inhibiting other metabolic pathways critical for the supply of building blocks necessary to support DNA replication may lead to increased DNA damage and synergy with an inhibitor of Chk1. A screen of small molecule metabolism modulators identified combinatorial activity between a Chk1 inhibitor and chloroquine or the LDHA/LDHB inhibitor GSK 2837808A. Compounds, such as 2-deoxyglucose or 6-aminonicotinamide, that reduced the fraction of cells undergoing active replication rendered tumour cells more resistant to Chk1 inhibitor-induced DNA damage. Withdrawal of glucose or glutamine induced G1 and G2/M arrest without increasing DNA damage and reduced Chk1 expression and activation through autophosphorylation. This suggests the expression and activation of Chk1 kinase is associated with cells undergoing active DNA replication. Glutamine starvation rendered tumour cells more resistant to Chk1 inhibitor-induced DNA damage and reversal of the glutamine starvation restored the sensitivity of tumour cells to Chk1 inhibitor-induced DNA damage. Chk1 inhibitors may be a potentially useful therapeutic treatment for patients whose tumours contain a high fraction of replicating cells. PMID:28106079

  6. The tumor suppressor PML specifically accumulates at RPA/Rad51-containing DNA damage repair foci but is nonessential for DNA damage-induced fibroblast senescence.


    Münch, Sandra; Weidtkamp-Peters, Stefanie; Klement, Karolin; Grigaravicius, Paulius; Monajembashi, Shamci; Salomoni, Paolo; Pandolfi, Pier Paolo; Weißhart, Klaus; Hemmerich, Peter


    The PML tumor suppressor has been functionally implicated in DNA damage response and cellular senescence. Direct evidence for such a role based on PML knockdown or knockout approaches is still lacking. We have therefore analyzed the irradiation-induced DNA damage response and cellular senescence in human and mouse fibroblasts lacking PML. Our data show that PML nuclear bodies (NBs) nonrandomly associate with persistent DNA damage foci in unperturbed human skin and in high-dose-irradiated cell culture systems. PML bodies do not associate with transient γH2AX foci after low-dose gamma irradiation. Superresolution microscopy reveals that all PML bodies within a nucleus are engaged at Rad51- and RPA-containing repair foci during ongoing DNA repair. The lack of PML (i) does not majorly affect the DNA damage response, (ii) does not alter the efficiency of senescence induction after DNA damage, and (iii) does not affect the proliferative potential of primary mouse embryonic fibroblasts during serial passaging. Thus, while PML NBs specifically accumulate at Rad51/RPA-containing lesions and senescence-derived persistent DNA damage foci, they are not essential for DNA damage-induced and replicative senescence of human and murine fibroblasts.

  7. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.


    UVA has long been known for generating an oxidative stress in cells. In this paper we review the different types of DNA damage induced by UVA, i.e. strand breaks, bipyrimidine photoproducts, and oxidatively damaged bases. Emphasis is given to the mechanism of formation that is further illustrated by the presentation of new in vitro data. Examples of oxidation of proteins involved in DNA metabolism are also given.

  8. Melatonin attenuates brain mitochondria DNA damage induced by potassium cyanide in vivo and in vitro.


    Yamamoto, Hiro-aki; Mohanan, Parayanthala V


    The effect of potassium cyanide on mitochondria DNA (mtDNA) in mouse brain was investigated in vivo and in vitro. When potassium cyanide (0, 0.1, 1.0 or 2.0 mM) was incubated with a crude mitochondria fraction prepared from mouse brain at 37 degrees C for 60 min, the damage of mtDNA was observed in a concentration-dependent manner. However, the mtDNA damage was prevented by a co-treatment with melatonin (1.5 mM), a scavenger of hydroxyl radicals (*OH). Furthermore, a subcutaneous injection of potassium cyanide (7mg/kg) caused both brain mtDNA damage and severe seizures in mouse. The damage of mtDNA and seizures induced by potassium cyanide were abolished by the pre-injection of melatonin (20 mg/kg). Hydrogen peroxide (1.5 mM) inflicted damage to brain mtDNA in the presence of Fe(2+) (3.0 microM). The damage was abolished by the co-treatment with melatonin. Furthermore, when cyanide (0, 0.1 or 1.0 mM) was incubated with the crude mitochondria fraction prepared from mouse brain, the lipid peroxidation was significantly increased in a concentration-dependent manner. The increased lipid peroxidation was completely inhibited by the co-treatment with melatonin (1.0 mM). These results suggest that reactive oxygen species including the *OH may play a cardinal role for mtDNA damage induced by potassium cyanide. Hence, the present study concluded that melatonin protects against DNA damage induced by the *OH produced by cyanide or hydrogen peroxide.

  9. Gallic acid induces DNA damage and inhibits DNA repair-associated protein expression in human oral cancer SCC-4 cells.


    Weng, Shu-Wen; Hsu, Shu-Chun; Liu, Hsin-Chung; Ji, Bin-Chuan; Lien, Jin-Cherng; Yu, Fu-Shun; Liu, Kuo-Ching; Lai, Kuang-Chi; Lin, Jing-Pin; Chung, Jing-Gung


    Gallic acid (GA), a phenolic compound naturally present in plants, used as an antioxidant additive in food and in the pharmaceutical industry, may have cancer chemopreventive properties. In the present study, we investigated whether GA induced DNA damage and affected DNA repair-associated protein expression in human oral cancer SCC-4 cells. Flow cytometry assays were used to measure total viable cells and results indicated that GA decreased viable cells dose-dependently. The comet assay and 4',6-Diamidino-2-phenylindole dihydrochloride (DAPI) staining were used to measure DNA damage, as well as condensation and it was shown that GA induced DNA damage (comet tail) and DNA condensation in a dose-dependent manner. DNA gel electrophoresis was used to examine DNA fragmentation and we found that GA induced DNA ladder (fragmentation). Using western blotting it was shown that GA inhibited the protein expressions of MDC1, O(6)-methylguanine-DNA methyltransferase (MGMT), p-H2A.X, p53, DNA-dependent serine/threonine protein kinase (DNA-PK) and 14-3-3 proteins sigma (14-3-3σ) but increased p-p53, phosphate-ataxia-telangiectasia (p-H2A.X) and ataxia telangiectasia mutated and Rad3-related (p-ATR), phosphate-ataxia telangiectasia mutated (p-ATM) and breast cancer susceptibility protein 1 (BRCA1) in a 24-h treatment. The protein translocation was examined by confocal laser microscopy and results indicated that GA increased the levels of p-H2A.X, MDC1 and p-p53 in SCC-4 cells. In conclusion, we found that GA-induced cell death may proceed through the induced DNA damage and suppressed DNA repair-associated protein expression in SCC-4 cells. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  10. Complex DNA Damage: A Route to Radiation-Induced Genomic Instability and Carcinogenesis.


    Mavragani, Ifigeneia V; Nikitaki, Zacharenia; Souli, Maria P; Aziz, Asef; Nowsheen, Somaira; Aziz, Khaled; Rogakou, Emmy; Georgakilas, Alexandros G


    Cellular effects of ionizing radiation (IR) are of great variety and level, but they are mainly damaging since radiation can perturb all important components of the cell, from the membrane to the nucleus, due to alteration of different biological molecules ranging from lipids to proteins or DNA. Regarding DNA damage, which is the main focus of this review, as well as its repair, all current knowledge indicates that IR-induced DNA damage is always more complex than the corresponding endogenous damage resulting from endogenous oxidative stress. Specifically, it is expected that IR will create clusters of damage comprised of a diversity of DNA lesions like double strand breaks (DSBs), single strand breaks (SSBs) and base lesions within a short DNA region of up to 15-20 bp. Recent data from our groups and others support two main notions, that these damaged clusters are: (1) repair resistant, increasing genomic instability (GI) and malignant transformation and (2) can be considered as persistent "danger" signals promoting chronic inflammation and immune response, causing detrimental effects to the organism (like radiation toxicity). Last but not least, the paradigm shift for the role of radiation-induced systemic effects is also incorporated in this picture of IR-effects and consequences of complex DNA damage induction and its erroneous repair.

  11. Complex DNA Damage: A Route to Radiation-Induced Genomic Instability and Carcinogenesis

    PubMed Central

    Mavragani, Ifigeneia V.; Nikitaki, Zacharenia; Souli, Maria P.; Aziz, Asef; Nowsheen, Somaira; Aziz, Khaled; Rogakou, Emmy


    Cellular effects of ionizing radiation (IR) are of great variety and level, but they are mainly damaging since radiation can perturb all important components of the cell, from the membrane to the nucleus, due to alteration of different biological molecules ranging from lipids to proteins or DNA. Regarding DNA damage, which is the main focus of this review, as well as its repair, all current knowledge indicates that IR-induced DNA damage is always more complex than the corresponding endogenous damage resulting from endogenous oxidative stress. Specifically, it is expected that IR will create clusters of damage comprised of a diversity of DNA lesions like double strand breaks (DSBs), single strand breaks (SSBs) and base lesions within a short DNA region of up to 15–20 bp. Recent data from our groups and others support two main notions, that these damaged clusters are: (1) repair resistant, increasing genomic instability (GI) and malignant transformation and (2) can be considered as persistent “danger” signals promoting chronic inflammation and immune response, causing detrimental effects to the organism (like radiation toxicity). Last but not least, the paradigm shift for the role of radiation-induced systemic effects is also incorporated in this picture of IR-effects and consequences of complex DNA damage induction and its erroneous repair. PMID:28718816

  12. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells.


    Ganesan, Shanthi; Keating, Aileen F


    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6μM) for 24 or 48h. Cell viability was reduced (P<0.05) after 48h of exposure to 3 or 6μM PM. The NOR-G-OH DNA adduct was detected after 24h of 6μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. DNA damage induces nuclear actin filament assembly by Formin -2 and Spire-½ that promotes efficient DNA repair. [corrected].


    Belin, Brittany J; Lee, Terri; Mullins, R Dyche


    Actin filaments assemble inside the nucleus in response to multiple cellular perturbations, including heat shock, protein misfolding, integrin engagement, and serum stimulation. We find that DNA damage also generates nuclear actin filaments-detectable by phalloidin and live-cell actin probes-with three characteristic morphologies: (i) long, nucleoplasmic filaments; (ii) short, nucleolus-associated filaments; and (iii) dense, nucleoplasmic clusters. This DNA damage-induced nuclear actin assembly requires two biologically and physically linked nucleation factors: Formin-2 and Spire-1/Spire-2. Formin-2 accumulates in the nucleus after DNA damage, and depletion of either Formin-2 or actin's nuclear import factor, importin-9, increases the number of DNA double-strand breaks (DSBs), linking nuclear actin filaments to efficient DSB clearance. Nuclear actin filaments are also required for nuclear oxidation induced by acute genotoxic stress. Our results reveal a previously unknown role for nuclear actin filaments in DNA repair and identify the molecular mechanisms creating these nuclear filaments.

  14. Unbalanced oxidant-induced DNA damage and repair in COPD: a link towards lung cancer.


    Caramori, Gaetano; Adcock, Ian M; Casolari, Paolo; Ito, Kazuhiro; Jazrawi, Elen; Tsaprouni, Loukia; Villetti, Gino; Civelli, Maurizio; Carnini, Chiara; Chung, Kian Fan; Barnes, Peter J; Papi, Alberto


    Chronic obstructive pulmonary disease (COPD) is characterised by oxidative stress and increased risk of lung carcinoma. Oxidative stress causes DNA damage which can be repaired by DNA-dependent protein kinase complex. To investigate DNA damage/repair balance and DNA-dependent protein kinase complex in COPD lung and in an animal model of smoking-induced lung damage and to evaluate the effects of oxidative stress on Ku expression and function in human bronchial epithelial cells. Protein expression was quantified using immunohistochemistry and/or western blotting. DNA damage/repair was measured using colorimetric assays. 8-OH-dG, a marker of oxidant-induced DNA damage, was statistically significantly increased in the peripheral lung of smokers (with and without COPD) compared with non-smokers, while the number of apurinic/apyrimidinic (AP) sites (DNA damage and repair) was increased in smokers compared with non-smokers (p = 0.0012) and patients with COPD (p < 0.0148). Nuclear expression of Ku86, but not of DNA-PKcs, phospho-DNA-PKcs, Ku70 or γ-H2AFX, was reduced in bronchiolar epithelial cells from patients with COPD compared with normal smokers and non-smokers (p < 0.039). Loss of Ku86 expression was also observed in a smoking mouse model (p < 0.012) and prevented by antioxidants. Oxidants reduced (p < 0.0112) Ku86 expression in human bronchial epithelial cells and Ku86 knock down modified AP sites in response to oxidative stress. Ineffective DNA repair rather than strand breakage per se accounts for the reduced AP sites observed in COPD and this is correlated with a selective decrease of the expression of Ku86 in the bronchiolar epithelium. DNA damage/repair imbalance may contribute to increased risk of lung carcinoma in COPD.

  15. Reduction of arsenite-enhanced ultraviolet radiation-induced DNA damage by supplemental zinc

    PubMed Central

    Cooper, Karen L.; King, Brenee S.; Sandoval, Monica M.; Liu, Ke Jian; Hudson, Laurie G.


    Arsenic is a recognized human carcinogen and there is evidence that arsenic augments the carcinogenicity of DNA damaging agents such as ultraviolet radiation (UVR) thereby acting as a co-carcinogen. Inhibition of DNA repair is one proposed mechanism to account for the co-carcinogenic actions of arsenic. We and others find that arsenite interferes with the function of certain zinc finger DNA repair proteins. Furthermore, we reported that zinc reverses the effects of arsenite in cultured cells and a DNA repair target protein, poly (ADP-ribose) polymerase-1. In order to determine whether zinc ameliorates the effects of arsenite on UVR-induced DNA damage in human keratinocytes and in an in vivo model, normal human epidermal keratinocytes and SKH-1 hairless mice were exposed to arsenite, zinc or both before solar-simulated (ss) UVR exposure. Poly (ADP-ribose) polymerase activity, DNA damage and mutation frequencies at the hprt locus were measured in each treatment group in normal human keratinocytes. DNA damage was assessed in vivo by immunohistochemical staining of skin sections isolated from SKH-1 hairless mice. Cell-based findings demonstrate that ssUVR-induced DNA damage and mutagenesis are enhanced by arsenite, and supplemental zinc partially reverses the arsenite effect. In vivo studies confirm that zinc supplementation decreases arsenite-enhanced DNA damage in response to ssUVR exposure. From these data we can conclude that zinc offsets the impact of arsenic on ssUVR-stimulated DNA damage in cells and in vivo suggesting that zinc supplementation may provide a strategy to improve DNA repair capacity in arsenic exposed human populations. PMID:23523584

  16. DNA-damage-inducible (din) loci are transcriptionally activated in competent Bacillus subtilis

    SciTech Connect

    Love, P.E.; Lyle, M.J.; Yasbin, R.E.


    DNA damage-inducible (din) operon fusions were generated in Bacillus subtilis by transpositional mutagenesis. These YB886(din::Tn917-lacZ) fusion isolates produced increased ..beta..-galactosidase when exposed to mitomycin C, UV radiation, or ethyl methanesulfonate, indicating that the lacZ structural gene had inserted into host transcriptional units that are induced by a variety of DNA-damaging agents. One of the fusion strains was DNA-repair deficient and phenotypically resembled a UV-sensitive mutant of B. subtilis. Induction of ..beta..-galactosidase also occurred in the competent subpopulation of each of the din fusion strains, independent of exposure to DNA-damaging agents. Both the DNA-damage-inducible and competence-inducible components of ..beta..-galactosidase expression were abolished by the recE4 mutation, which inhibits SOS-like (SOB) induction but does not interfere with the development of the component state. The results indicate that gene expression is stimulated at specific loci within the B. subtilis chromosome both by DNA-damaging agents and by the development of competence and that this response is under the control of the SOB regulatory system. Furthermore, they demonstrate that at the molecular level SOB induction and the development of competence are interrelated cellular events.

  17. Single-cell analysis challenges the connection between autophagy and senescence induced by DNA damage.


    Filippi-Chiela, Eduardo Cremonese; Bueno e Silva, Mardja Manssur; Thomé, Marcos Paulo; Lenz, Guido


    Autophagy and senescence have been described as central features of cell biology, but the interplay between these mechanisms remains obscure. Using a therapeutically relevant model of DNA damage-induced senescence in human glioma cells, we demonstrated that acute treatment with temozolomide induces DNA damage, a transitory activation of PRKAA/AMPK-ULK1 and MAPK14/p38 and the sustained inhibition of AKT-MTOR. This produced a transient induction of autophagy, which was followed by senescence. However, at the single cell level, this coordinated transition was not observed, and autophagy and senescence were triggered in a very heterogeneous manner. Indeed, at a population level, autophagy was highly negatively correlated with senescence markers, while in single cells this correlation did not exist. The inhibition of autophagy triggered apoptosis and decreased senescence, while its activation increased temozolomide-induced senescence, showing that DNA damage-induced autophagy acts by suppressing apoptosis.

  18. Regulation of DNA damage-induced apoptosis by the c-Abl tyrosine kinase

    PubMed Central

    Yuan, Zhi-Min; Huang, Yinyin; Ishiko, Takatoshi; Kharbanda, Surender; Weichselbaum, Ralph; Kufe, Donald


    Activation of the c-Abl protein tyrosine kinase by certain DNA-damaging agents contributes to down-regulation of Cdk2 and G1 arrest by a p53-dependent mechanism. The present work investigates the potential role of c-Abl in apoptosis induced by DNA damage. Transient transfection studies with wild-type, but not kinase-inactive, c-Abl demonstrate induction of apoptosis. Cells that stably express inactive c-Abl exhibit resistance to ionizing radiation-induced loss of clonogenic survival and apoptosis. Cells null for c-abl are also impaired in the apoptotic response to ionizing radiation. We further show that cells deficient in p53 undergo apoptosis in response to expression of c-Abl and exhibit decreases in radiation-induced apoptosis when expressing inactive c-Abl. These findings suggest that c-Abl kinase regulates DNA damage-induced apoptosis. PMID:9037071

  19. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.


    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L


    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma.

  20. Electronic cigarette aerosols suppress cellular antioxidant defenses and induce significant oxidative DNA damage

    PubMed Central

    Ganapathy, Vengatesh; Manyanga, Jimmy; Brame, Lacy; McGuire, Dehra; Sadhasivam, Balaji; Floyd, Evan; Rubenstein, David A.; Ramachandran, Ilangovan; Wagener, Theodore


    Background Electronic cigarette (EC) aerosols contain unique compounds in addition to toxicants and carcinogens traditionally found in tobacco smoke. Studies are warranted to understand the public health risks of ECs. Objective The aim of this study was to determine the genotoxicity and the mechanisms induced by EC aerosol extracts on human oral and lung epithelial cells. Methods Cells were exposed to EC aerosol or mainstream smoke extracts and DNA damage was measured using the primer anchored DNA damage detection assay (q-PADDA) and 8-oxo-dG ELISA assay. Cell viability, reactive oxygen species (ROS) and total antioxidant capacity (TAC) were measured using standard methods. mRNA and protein expression were evaluated by RT-PCR and western blot, respectively. Results EC aerosol extracts induced DNA damage in a dose-dependent manner, but independently of nicotine concentration. Overall, EC aerosol extracts induced significantly less DNA damage than mainstream smoke extracts, as measured by q-PADDA. However, the levels of oxidative DNA damage, as indicated by the presence of 8-oxo-dG, a highly mutagenic DNA lesion, were similar or slightly higher after exposure to EC aerosol compared to mainstream smoke extracts. Mechanistically, while exposure to EC extracts significantly increased ROS, it decreased TAC as well as the expression of 8-oxoguanine DNA glycosylase (OGG1), an enzyme essential for the removal of oxidative DNA damage. Conclusions Exposure to EC aerosol extracts suppressed the cellular antioxidant defenses and led to significant DNA damage. These findings emphasize the urgent need to investigate the potential long-term cancer risk of exposure to EC aerosol for vapers and the general public. PMID:28542301

  1. Ultrasound-induced DNA damage and signal transductions indicated by gammaH2AX

    NASA Astrophysics Data System (ADS)

    Furusawa, Yukihiro; Fujiwara, Yoshisada; Zhao, Qing-Li; Hassan, Mariame Ali; Ogawa, Ryohei; Tabuchi, Yoshiaki; Takasaki, Ichiro; Takahashi, Akihisa; Ohnishi, Takeo; Kondo, Takashi


    Ultrasound (US) has been shown to induce cancer cell death via different forms including apoptosis. Here, we report the potential of low-intensity pulsed US (LIPUS) to induce genomic DNA damage and subsequent DNA damage response. Using the ionizing radiation-induced DNA double-strand breaks (DSBs) as the positive control, we were able to observe the induction of DSBs (as neutral comet tails) and the subsequent formation of gammaH2AX-positive foci (by immunofluorescence detection) in human leukemia cells following exposure to LIPUS. The LIPUS-induced DNA damage arose most likely from the mechanical, but not sonochemical, effect of cavitation, based on our observation that the suppression of inertial cavitation abrogated the gammH2AX foci formation, whereas scavenging of free radical formation (e.g., hydroxyl radical) had no protective effect on it. Treatment with the specific kinase inhibitor of ATM or DNA-PKcs, which can phosphorylate H2AX Ser139, revealed that US-induced gammaH2AX was inhibited more effectively by the DNA-PK inhibitor than ATM kinase inhibitor. Notably, these inhibitor effects were opposite to those with radiation-induced gammH2AX. In conclusion, we report, for the first time that US can induce DNA damage and the DNA damage response as indicated by gammaH2AX was triggered by the cavitational mechanical effects. Thus, it is expected that the data shown here may provide a better understanding of the cellular responses to US.

  2. Dynamics of DNA Damage Induced Pathways to Cancer

    PubMed Central

    Tian, Kun; Rajendran, Ramkumar; Doddananjaiah, Manjula


    Chemotherapy is commonly used in cancer treatments, however only 25% of cancers are responsive and a significant proportion develops resistance. The p53 tumour suppressor is crucial for cancer development and therapy, but has been less amenable to therapeutic applications due to the complexity of its action, reflected in 66,000 papers describing its function. Here we provide a systematic approach to integrate this information by constructing a large-scale logical model of the p53 interactome using extensive database and literature integration. The model contains 206 nodes representing genes or proteins, DNA damage input, apoptosis and cellular senescence outputs, connected by 738 logical interactions. Predictions from in silico knock-outs and steady state model analysis were validated using literature searches and in vitro based experiments. We identify an upregulation of Chk1, ATM and ATR pathways in p53 negative cells and 61 other predictions obtained by knockout tests mimicking mutations. The comparison of model simulations with microarray data demonstrated a significant rate of successful predictions ranging between 52% and 71% depending on the cancer type. Growth factors and receptors FGF2, IGF1R, PDGFRB and TGFA were identified as factors contributing selectively to the control of U2OS osteosarcoma and HCT116 colon cancer cell growth. In summary, we provide the proof of principle that this versatile and predictive model has vast potential for use in cancer treatment by identifying pathways in individual patients that contribute to tumour growth, defining a sub population of “high” responders and identification of shifts in pathways leading to chemotherapy resistance. PMID:24023735

  3. Development of a qPCR Method to Measure Mitochondrial and Genomic DNA Damage with Application to Chemotherapy-Induced DNA Damage and Cryopreserved Cells.


    Evans, Stephen O; Jameson, Michael B; Cursons, Ray T M; Peters, Linda M; Bird, Steve; Jacobson, Gregory M


    DNA damage quantitation assays such as the comet assay have focused on the measurement of total nuclear damage per cell. The adoption of PCR-based techniques to quantify DNA damage has enabled sequence- and organelle-specific assessment of DNA lesions. Here we report on an adaptation of a qPCR technique to assess DNA damage in nuclear and mitochondrial targets relative to control. Novel aspects of this assay include application of the assay to the Rotor-Gene platform with optimized DNA polymerase/fluorophore/primer set combination in a touchdown PCR protocol. Assay validation was performed using ultraviolet C radiation in A549 and THP1 cancer cell lines. A comparison was made to the comet assay applied to peripheral blood mononuclear cells, and an estimation of the effects of cryopreservation on ultraviolet C-induced DNA damage was carried out. Finally, dose responses for DNA damage were measured in peripheral blood mononuclear cells following exposure to the cytotoxic agents bleomycin and cisplatin. We show reproducible experimental outputs across the tested conditions and concordance with published findings with respect to mitochondrial and nuclear genotoxic susceptibilities. The application of this DNA damage assay to a wide range of clinical and laboratory-derived samples is both feasible and resource-efficient.

  4. Development of a qPCR Method to Measure Mitochondrial and Genomic DNA Damage with Application to Chemotherapy-Induced DNA Damage and Cryopreserved Cells

    PubMed Central

    Evans, Stephen O.; Jameson, Michael B.; Cursons, Ray T. M.; Peters, Linda M.; Bird, Steve; Jacobson, Gregory M.


    DNA damage quantitation assays such as the comet assay have focused on the measurement of total nuclear damage per cell. The adoption of PCR-based techniques to quantify DNA damage has enabled sequence- and organelle-specific assessment of DNA lesions. Here we report on an adaptation of a qPCR technique to assess DNA damage in nuclear and mitochondrial targets relative to control. Novel aspects of this assay include application of the assay to the Rotor-Gene platform with optimized DNA polymerase/fluorophore/primer set combination in a touchdown PCR protocol. Assay validation was performed using ultraviolet C radiation in A549 and THP1 cancer cell lines. A comparison was made to the comet assay applied to peripheral blood mononuclear cells, and an estimation of the effects of cryopreservation on ultraviolet C-induced DNA damage was carried out. Finally, dose responses for DNA damage were measured in peripheral blood mononuclear cells following exposure to the cytotoxic agents bleomycin and cisplatin. We show reproducible experimental outputs across the tested conditions and concordance with published findings with respect to mitochondrial and nuclear genotoxic susceptibilities. The application of this DNA damage assay to a wide range of clinical and laboratory-derived samples is both feasible and resource-efficient. PMID:27740596

  5. NEK8 regulates DNA damage-induced RAD51 foci formation and replication fork protection

    PubMed Central

    Abeyta, Antonio; Castella, Maria; Jacquemont, Celine; Taniguchi, Toshiyasu


    ABSTRACT Proteins essential for homologous recombination play a pivotal role in the repair of DNA double strand breaks, DNA inter-strand crosslinks and replication fork stability. Defects in homologous recombination also play a critical role in the development of cancer and the sensitivity of these cancers to chemotherapy. RAD51, an essential factor for homologous recombination and replication fork protection, accumulates and forms immunocytochemically detectable nuclear foci at sites of DNA damage. To identify kinases that may regulate RAD51 localization to sites of DNA damage, we performed a human kinome siRNA library screen, using DNA damage-induced RAD51 foci formation as readout. We found that NEK8, a NIMA family kinase member, is required for efficient DNA damage-induced RAD51 foci formation. Interestingly, knockout of Nek8 in murine embryonic fibroblasts led to cellular sensitivity to the replication inhibitor, hydroxyurea, and inhibition of the ATR kinase. Furthermore, NEK8 was required for proper replication fork protection following replication stall with hydroxyurea. Loading of RAD51 to chromatin was decreased in NEK8-depleted cells and Nek8-knockout cells. Single-molecule DNA fiber analyses revealed that nascent DNA tracts were degraded in the absence of NEK8 following treatment with hydroxyurea. Consistent with this, Nek8-knockout cells showed increased chromosome breaks following treatment with hydroxyurea. Thus, NEK8 plays a critical role in replication fork stability through its regulation of the DNA repair and replication fork protection protein RAD51. PMID:27892797

  6. DNA damage-induced centrosome amplification occurs via excessive formation of centriolar satellites.


    Löffler, H; Fechter, A; Liu, F Y; Poppelreuther, S; Krämer, A


    Centrosome amplification is a frequent phenomenon in malignancies and may facilitate tumorigenesis by promoting chromosomal instability. On the other hand, a centrosome inactivation checkpoint comprising centrosome amplification leading to elimination of cells by mitotic catastrophe has been described in response to DNA damage by ionizing radiation or cytostatic drugs. So far, the exact nature of DNA damage-induced centrosome amplification, which might be overduplication or fragmentation of existing centrosomes, has been controversial. To solve this controversy, we have established a method to distinguish between these two possibilities using A549 cells expressing photoconvertible CETN2-Dendra2. In response to various DNA-damaging treatments, centrosome amplification but not fragmentation was observed. Moreover, centrosome amplification was preceded by excessive formation of centrin-containing centriolar satellites, which were identified as de novo-generated atypical centrin dots staining positive for centriolar satellite markers but negative or only weakly positive for other established centrosomal markers, and which could be verified as centriolar satellites using immunogold electron microscopy. In line with this notion, disruption of dynein-mediated recruitment of centrosomal proteins via centriolar satellites suppressed centrosome amplification after DNA damage, and excessive formation of centriolar satellites could be inhibited by interference with Chk1, a known mediator of centrosome amplification in response to DNA damage. In conclusion, we provide a model in which a Chk1-mediated DNA damage checkpoint induces excessive formation of centriolar satellites constituting assembly platforms for centrosomal proteins, which subsequently leads to centrosome amplification.

  7. Phosphorylation of Daxx by ATM Contributes to DNA Damage-Induced p53 Activation

    PubMed Central

    Cheng, Qian; Qu, Like; Brewer, Michael D.; Chen, Jiandong; Yang, Xiaolu


    p53 plays a central role in tumor suppression. It does so by inducing anti-proliferative processes as a response to various tumor-promoting stresses. p53 is regulated by the ubiquitin ligase Mdm2. The optimal function of Mdm2 requires Daxx, which stabilizes Mdm2 through the deubiquitinase Hausp/USP7 and also directly promotes Mdm2’s ubiquitin ligase activity towards p53. The Daxx-Mdm2 interaction is disrupted upon DNA damage. However, both the mechanisms and the consequence of the Daxx-Mdm2 dissociation are not understood. Here we show that upon DNA damage Daxx is phosphorylated in a manner that is dependent on ATM, a member of the PI 3-kinase family that orchestrates the DNA damage response. The main phosphorylation site of Daxx is identified to be Ser564, which is a direct target of ATM. Phosphorylation of endogenous Daxx at Ser564 occurs rapidly during the DNA damage response and precedes p53 activation. Blockage of this phosphorylation event prevents the separation of Daxx from Mdm2, stabilizes Mdm2, and inhibits DNA damage-induced p53 activation. These results suggest that phosphorylation of Daxx by ATM upon DNA damage disrupts the Daxx-Mdm2 interaction and facilitates p53 activation. PMID:23405218

  8. A DNA Damage-Induced, SOS-Independent Checkpoint Regulates Cell Division in Caulobacter crescentus

    PubMed Central

    Modell, Joshua W.; Kambara, Tracy K.; Perchuk, Barrett S.; Laub, Michael T.


    Cells must coordinate DNA replication with cell division, especially during episodes of DNA damage. The paradigm for cell division control following DNA damage in bacteria involves the SOS response where cleavage of the transcriptional repressor LexA induces a division inhibitor. However, in Caulobacter crescentus, cells lacking the primary SOS-regulated inhibitor, sidA, can often still delay division post-damage. Here we identify didA, a second cell division inhibitor that is induced by DNA damage, but in an SOS-independent manner. Together, DidA and SidA inhibit division, such that cells lacking both inhibitors divide prematurely following DNA damage, with lethal consequences. We show that DidA does not disrupt assembly of the division machinery and instead binds the essential division protein FtsN to block cytokinesis. Intriguingly, mutations in FtsW and FtsI, which drive the synthesis of septal cell wall material, can suppress the activity of both SidA and DidA, likely by causing the FtsW/I/N complex to hyperactively initiate cell division. Finally, we identify a transcription factor, DriD, that drives the SOS-independent transcription of didA following DNA damage. PMID:25350732

  9. Correlation between helium atmospheric pressure plasma jet (APPJ) variables and plasma induced DNA damage

    NASA Astrophysics Data System (ADS)

    Adhikari, Ek R.; Ptasinska, Sylwia


    A helium atmospheric pressure plasma jet (APPJ) source with a dielectric capillary and two tubular electrodes was used to induce damage in aqueous plasmid DNA. The fraction of different types of DNA damage (i.e., intact or undamaged, double strand breaks (DSBs), and single strand breaks (SSBs)) that occurred as the result of plasma irradiation was quantified through analysis of agarose gel electrophoresis images. The total DNA damage increased with an increase in both flow rate and duration of irradiation, but decreased with an increase in distance between the APPJ and sample. The average power of the plasma was calculated and the length of APPJ was measured for various flow rates and voltages applied. The possible effects of plasma power and reactive species on DNA damage are discussed.

  10. The DNA damage-induced cell death response: a roadmap to kill cancer cells.


    Matt, Sonja; Hofmann, Thomas G


    Upon massive DNA damage cells fail to undergo productive DNA repair and trigger the cell death response. Resistance to cell death is linked to cellular transformation and carcinogenesis as well as radio- and chemoresistance, making the underlying signaling pathways a promising target for therapeutic intervention. Diverse DNA damage-induced cell death pathways are operative in mammalian cells and finally culminate in the induction of programmed cell death via activation of apoptosis or necroptosis. These signaling routes affect nuclear, mitochondria- and plasma membrane-associated key molecules to activate the apoptotic or necroptotic response. In this review, we highlight the main signaling pathways, molecular players and mechanisms guiding the DNA damage-induced cell death response.

  11. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi


    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  12. The production and repair of aflatoxin B sub 1 -induced DNA damage

    SciTech Connect

    Leadon, S.A.


    To investigate the influence of function or activity of a DNA sequence on its repair, we have studied excision repair of aflatoxin B{sub 1} (AFB{sub 1})-induced damage in the nontranscribed, heterochromatic alpha DNA of monkey cells and in the metallothionein genes of human cells. In confluent cells, AFB{sub 1} adducts are produced in similar frequencies in alpha and in the rest of the DNA, but removal from alpha DNA is severely deficient, however, removal of AFB{sub 1} adducts from alpha DNA is enhanced by small doses of UV. The repair deficiencies are not observed in actively growing cells. We have also shown that there is preferential repair of AFB{sub 1} damage in active genes. AFB{sub 1} damage is efficiently repaired in the active human metallothionein (hMT) genes, but deficiently repaired in inactive hMT genes. 51 refs., 3 tabs.

  13. Detection of DNA damage induced by space radiation in Mir and space shuttle.


    Ohnishi, Takeo; Ohnishi, Ken; Takahashi, Akihisa; Taniguchi, Yoshitaka; Sato, Masaru; Nakano, Tamotsu; Nagaoka, Shunji


    Although physical monitoring of space radiation has been accomplished, we aim to measure exact DNA damage as caused by space radiation. If DNA damage is caused by space radiation, we can detect DNA damage dependent on the length of the space flight periods by using post-labeling methods. To detect DNA damage caused by space radiation, we placed fixed human cervical carcinoma (HeLa) cells in the Russian Mir space station for 40 days and in an American space shuttle for 9 days. After landing, we labeled space-radiation-induced DNA strand breaks by enzymatic incorporation of [3H]-dATP with terminal deoxyribo-nucleotidyl transferase (TdT). We detected DNA damage as many grains on fixed silver emulsion resulting from beta-rays emitted from 3H-atoms in the nuclei of the cells placed in the Mir-station (J/Mir mission, STS-89), but detected hardly any in the ground control sample. In the space shuttle samples (S/MM-8), the number of cells having many grains was lower than that in the J/Mir mission samples. These results suggest that DNA damage is caused by space radiation and that it is dependent on the length of the space flight.

  14. Kaempferol induces DNA damage and inhibits DNA repair associated protein expressions in human promyelocytic leukemia HL-60 cells.


    Wu, Lung-Yuan; Lu, Hsu-Feng; Chou, Yu-Cheng; Shih, Yung-Luen; Bau, Da-Tian; Chen, Jaw-Chyun; Hsu, Shu-Chun; Chung, Jing-Gung


    Numerous evidences have shown that plant flavonoids (naturally occurring substances) have been reported to have chemopreventive activities and protect against experimental carcinogenesis. Kaempferol, one of the flavonoids, is widely distributed in fruits and vegetables, and may have cancer chemopreventive properties. However, the precise underlying mechanism regarding induced DNA damage and suppressed DNA repair system are poorly understood. In this study, we investigated whether kaempferol induced DNA damage and affected DNA repair associated protein expression in human leukemia HL-60 cells in vitro. Percentages of viable cells were measured via a flow cytometry assay. DNA damage was examined by Comet assay and DAPI staining. DNA fragmentation (ladder) was examined by DNA gel electrophoresis. The changes of protein levels associated with DNA repair were examined by Western blotting. Results showed that kaempferol dose-dependently decreased the viable cells. Comet assay indicated that kaempferol induced DNA damage (Comet tail) in a dose-dependent manner and DAPI staining also showed increased doses of kaempferol which led to increased DNA condensation, these effects are all of dose-dependent manners. Western blotting indicated that kaempferol-decreased protein expression associated with DNA repair system, such as phosphate-ataxia-telangiectasia mutated (p-ATM), phosphate-ataxia-telangiectasia and Rad3-related (p-ATR), 14-3-3 proteins sigma (14-3-3σ), DNA-dependent serine/threonine protein kinase (DNA-PK), O(6)-methylguanine-DNA methyltransferase (MGMT), p53 and MDC1 protein expressions, but increased the protein expression of p-p53 and p-H2AX. Protein translocation was examined by confocal laser microscopy, and we found that kaempferol increased the levels of p-H2AX and p-p53 in HL-60 cells. Taken together, in the present study, we found that kaempferol induced DNA damage and suppressed DNA repair and inhibited DNA repair associated protein expression in HL-60

  15. Molecular mechanisms of DNA damage induced by procarbazine in the presence of Cu(II).


    Ogawa, Kazuhiko; Hiraku, Yusuke; Oikawa, Shinji; Murata, Mariko; Sugimura, Yoshiki; Kawamura, Juichi; Kawanishi, Shosuke


    Procarbazine [N-isopropyl-alpha-(2-methylhydrazino)-p-toluamide], a hydrazine derivative, which has been shown to have effective antineoplastic activity, induces cancer in some experimental animals and humans. To clarify a new mechanism for its carcinogenic effect, we examined DNA damage induced by procarbazine in the presence of metal ion, using 32P-5'-end-labeled DNA fragments obtained from the human p53 tumor suppressor gene and the c-Ha-ras-1 protooncogene. Procarbazine plus Cu(II) induced piperidine-labile and formamidopyrimidine-DNA glycosylase-sensitive lesions at the 5'-ACG-3' sequence, complementary to a hotspot of the p53 gene, and the 5'-TG-3' sequence. Catalase partially inhibited DNA damage, suggesting that not only H(2)O(2) but also other reactive species are involved. Procarbazine plus Cu(II) significantly increased the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine, which was completely inhibited by calatase. Electron spin resonance spin-trapping experiments revealed that methyl radicals were generated from procarbazine and Cu(II). On the basis of these findings, it is considered that procarbazine causes DNA damage through non-enzymatic formation of the Cu(I)-hydroperoxo complex and methyl radicals. In conclusion, in addition to alkylation, oxidative DNA damage may play important roles in not only antitumor effects but also mutagenesis and carcinogenesis induced by procarbazine.

  16. A human cellular sequence implicated in trk oncogene activation is DNA damage inducible

    SciTech Connect

    Ben-Ishai, R.; Scharf, R.; Sharon, R.; Kapten, I. )


    Xeroderma pigmentosum cells, which are deficient in the repair of UV light-induced DNA damage, have been used to clone DNA-damage-inducible transcripts in human cells. The cDNA clone designated pC-5 hybridizes on RNA gel blots to a 1-kilobase transcript, which is moderately abundant in nontreated cells and whose synthesis is enhanced in human cells following UV irradiation or treatment with several other DNA-damaging agents. UV-enhanced transcription of C-5 RNA is transient and occurs at lower fluences and to a greater extent in DNA-repair-deficient than in DNA-repair-proficient cells. Southern blot analysis indicates that the C-5 gene belongs to a multigene family. A cDNA clone containing the complete coding sequence of C-5 was isolated. Sequence analysis revealed that it is homologous to a human cellular sequence encoding the amino-terminal activating sequence of the trk-2h chimeric oncogene. The presence of DNA-damage-responsive sequences at the 5' end of a chimeric oncogene could result in enhanced expression of the oncogene in response to carcinogens.

  17. Analysis of the Contribution of Charge Transport in Iodine-125 induced DNA Damage

    PubMed Central

    Ndlebe, Thabisile; Panyutin, Igor; Neumann, Ronald


    Auger electron emitters, like iodine-125, are the radionuclides of choice for gene-targeted radiotherapy. The highly localized damage they induced in DNA is produced by three mechanisms: direct damage by the emitted Auger electrons, indirect damage by diffusible free radicals produced by Auger electrons travelling in water, and charge neutralization of the residual, highly positively charged, tellurium daughter atom by stripping electrons from covalent bonds of neighboring residues. The purpose of our work was to determine whether these mechanisms proceed through an intermediate energy transfer step along DNA. It was proposed that this intermediate step proceeds through the charge transport mechanism in DNA. Conventional charge transport has been described as either a hopping mechanism initiated by charge injection into DNA and propagated by charge migration along the DNA, or a tunneling mechanism in which charge moves directly from a donor to an acceptor within DNA. Well-known barriers for the hopping mechanism were used to probe the role of charge transport in 125I induced DNA damage. We studied their effect on the distribution of DNA breaks produced by the decay of iodine-125 in samples frozen at −80°C. We found that these barriers had no measurable effect on the iodine-125 breaks distribution. PMID:20041764

  18. Microcystin-LR induced DNA damage in human peripheral blood lymphocytes.


    Zegura, B; Gajski, G; Straser, A; Garaj-Vrhovac, V; Filipič, M


    Human exposure to microcystins, which are produced by freshwater cyanobacterial species, is of growing concern due to increasing appearance of cyanobacterial blooms as a consequence of global warming and increasing water eutrophication. Although microcystins are considered to be liver-specific, there is evidence that they may also affect other tissues. These substances have been shown to induce DNA damage in vitro and in vivo, but the mechanisms of their genotoxic activity remain unclear. In human peripheral blood lymphocytes (HPBLs) exposure to non-cytotoxic concentrations (0, 0.1, 1 and 10μg/ml) of microcystin-LR (MCLR) induced a dose- and time-dependent increase in DNA damage, as measured with the comet assay. Digestion of DNA from MCLR-treated HPBLs with purified formamidopyrimidine-DNA glycosylase (Fpg) displayed a greater number of DNA strand-breaks than non-digested DNA, confirming the evidence that MCLR induces oxidative DNA damage. With the cytokinesis-block micronucleus assay no statistically significant induction of micronuclei, nucleoplasmic bridges and nuclear buds was observed after a 24-h exposure to MCLR. At the molecular level, no changes in the expression of selected genes involved in the cellular response to DNA damage and oxidative stress were observed after a 4-h exposure to MCLR (1μg/ml). After 24h, DNA damage-responsive genes (p53, mdm2, gadd45a, cdkn1a), a gene involved in apoptosis (bax) and oxidative stress-responsive genes (cat, gpx1, sod1, gsr, gclc) were up-regulated. These results provide strong support that MCLR is an indirectly genotoxic agent, acting via induction of oxidative stress, and that lymphocytes are also the target of microcystin-induced toxicity.

  19. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    NASA Astrophysics Data System (ADS)

    Kim, G. J.; Kim, W.; Kim, K. T.; Lee, J. K.


    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  20. DNA damage and mitochondria dysfunction in cell apoptosis induced by nonthermal air plasma

    SciTech Connect

    Kim, G. J.; Lee, J. K.; Kim, W.; Kim, K. T.


    Nonthermal plasma is known to induce animal cell death but the mechanism is not yet clear. Here, cellular and biochemical regulation of cell apoptosis is demonstrated for plasma treated cells. Surface type nonthermal air plasma triggered apoptosis of B16F10 mouse melanoma cancer cells causing DNA damage and mitochondria dysfunction. Plasma treatment activated caspase-3, apoptosis executioner. The plasma treated cells also accumulated gamma-H2A.X, marker for DNA double strand breaks, and p53 tumor suppressor gene as a response to DNA damage. Interestingly, cytochrome C was released from mitochondria and its membrane potential was changed significantly.

  1. DNA damage response induces structural alterations in histone H3–H4

    PubMed Central

    Izumi, Yudai; Fujii, Kentaro; Yamamoto, Satoshi; Matsuo, Koichi; Namatame, Hirofumi; Taniguchi, Masaki; Yokoya, Akinari


    Synchrotron-radiation circular-dichroism spectroscopy was used to reveal that the DNA damage response induces a decrement of α-helix and an increment of β-strand contents of histone H3–H4 extracted from X-ray–irradiated human HeLa cells. The trend of the structural alteration was qualitatively opposite to that of our previously reported results for histone H2A–H2B. These results strongly suggest that histones share roles in DNA damage responses, particularly in DNA repair processes and chromatin remodeling, via a specific structural alteration of each histone. PMID:27672100

  2. Investigation of perfluorooctanoic acid induced DNA damage using electrogenerated chemiluminescence associated with charge transfer in DNA.


    Lu, Liping; Guo, Linqing; Li, Meng; Kang, Tianfang; Cheng, Shuiyuan; Miao, Wujian


    An electrogenerated chemiluminescence (ECL)-DNA sensor was designed and fabricated for the investigation of DNA damage by a potential environmental pollutant, perfluorooctanoic acid (PFOA). The ECL-DNA sensor consisted of a Au electrode that had a self-assembled monolayer of 15 base-pair double-stranded (ds) DNA oligonucleotides with covalently attached semiconductor CdSe quantum dots (QDs) at the distal end of the DNA. Characterization of the ECL-DNA sensor was conducted with X-ray photoelectron spectroscopy (XPS), electrochemical impedance spectroscopy (EIS), ECL, and cyclic voltammetry before and after the exposure of the sensor to PFOA. Consistent data revealed that the dsDNA on Au was severely damaged upon the incubation of the electrode in PFOA, causing significant increase in charge (or electron) transfer (CT) resistance within DNA strands. Consequently, the cathodic coreactant ECL responses of the Au/dsDNA-QDs electrode in the presence of K2S2O8 were markedly decreased. The strong interaction between DNA and PFOA via the hydrophobic interaction, especially the formation of F···H hydrogen bonds by insertion of the difluoro-methylene group of PFOA into the DNA base pairs, was believed to be responsible for the dissociation or loosening of dsDNA structure, which inhibited the CT through DNA. A linear relationship between the ECL signal of the sensor and the logarithmical concentration of PFOA displayed a dynamic range of 1.00 × 10(-14)-1.00 × 10(-4) M, with a limit of detection of 1.00 × 10(-15) M at a signal-to-noise ratio of 3. Graphical Abstract Illustration of ECL detection of PFOA on a Au/dsDNA-QDs ECL-DNA sensor.

  3. Exposure to 1800 MHz radiofrequency radiation induces oxidative damage to mitochondrial DNA in primary cultured neurons.


    Xu, Shangcheng; Zhou, Zhou; Zhang, Lei; Yu, Zhengping; Zhang, Wei; Wang, Yuan; Wang, Xubu; Li, Maoquan; Chen, Yang; Chen, Chunhai; He, Mindi; Zhang, Guangbin; Zhong, Min


    Increasing evidence indicates that oxidative stress may be involved in the adverse effects of radiofrequency (RF) radiation on the brain. Because mitochondrial DNA (mtDNA) defects are closely associated with various nervous system diseases and mtDNA is particularly susceptible to oxidative stress, the purpose of this study was to determine whether radiofrequency radiation can cause oxidative damage to mtDNA. In this study, we exposed primary cultured cortical neurons to pulsed RF electromagnetic fields at a frequency of 1800 MHz modulated by 217 Hz at an average special absorption rate (SAR) of 2 W/kg. At 24 h after exposure, we found that RF radiation induced a significant increase in the levels of 8-hydroxyguanine (8-OHdG), a common biomarker of DNA oxidative damage, in the mitochondria of neurons. Concomitant with this finding, the copy number of mtDNA and the levels of mitochondrial RNA (mtRNA) transcripts showed an obvious reduction after RF exposure. Each of these mtDNA disturbances could be reversed by pretreatment with melatonin, which is known to be an efficient antioxidant in the brain. Together, these results suggested that 1800 MHz RF radiation could cause oxidative damage to mtDNA in primary cultured neurons. Oxidative damage to mtDNA may account for the neurotoxicity of RF radiation in the brain.

  4. Measurement of oxidatively induced DNA damage and its repair, by mass spectrometric techniques.


    Dizdaroglu, M; Coskun, E; Jaruga, P


    Oxidatively induced damage caused by free radicals and other DNA-damaging agents generate a plethora of products in the DNA of living organisms. There is mounting evidence for the involvement of this type of damage in the etiology of numerous diseases including carcinogenesis. For a thorough understanding of the mechanisms, cellular repair, and biological consequences of DNA damage, accurate measurement of resulting products must be achieved. There are various analytical techniques, with their own advantages and drawbacks, which can be used for this purpose. Mass spectrometric techniques with isotope dilution, which include gas chromatography (GC) and liquid chromatography (LC), provide structural elucidation of products and ascertain accurate quantification, which are absolutely necessary for reliable measurement. Both gas chromatography-mass spectrometry (GC-MS) or liquid chromatography-mass spectrometry (LC-MS), in single or tandem versions, have been used for the measurement of numerous DNA products such as sugar and base lesions, 8,5'-cyclopurine-2'-deoxynucleosides, base-base tandem lesions, and DNA-protein crosslinks, in vitro and in vivo. This article reviews these techniques and their applications in the measurement of oxidatively induced DNA damage and its repair.

  5. Aflatoxin B1-Induced Developmental and DNA Damage in Caenorhabditis elegans

    PubMed Central

    Feng, Wei-Hong; Xue, Kathy S.; Tang, Lili; Williams, Phillip L.; Wang, Jia-Sheng


    Aflatoxin B1 (AFB1) is a ubiquitous mycotoxin produced by toxicogenic Aspergillus species. AFB1 has been reported to cause serious adverse health effects, such as cancers and abnormal development and reproduction, in animals and humans. AFB1 is also a potent genotoxic mutagen that causes DNA damage in vitro and in vivo. However, the link between DNA damage and abnormal development and reproduction is unclear. To address this issue, we examined the DNA damage, germline apoptosis, growth, and reproductive toxicity following exposure to AFB1, using Caenorhabditis elegans as a study model. Results found that AFB1 induced DNA damage and germline apoptosis, and significantly inhibited growth and reproduction of the nematodes in a concentration-dependent manner. Exposure to AFB1 inhibited growth or reproduction more potently in the DNA repair-deficient xpa-1 nematodes than the wild-type N2 strain. According to the relative expression level of pathway-related genes measured by real-time PCR, the DNA damage response (DDR) pathway was found to be associated with AFB1-induced germline apoptosis, which further played an essential role in the dysfunction of growth and reproduction in C. elegans. PMID:28035971

  6. DNA damage and estrogenic activity induced by the environmental pollutant 2-nitrotoluene and its metabolite

    PubMed Central

    Watanabe, Chigusa; Egami, Takashi; Midorikawa, Kaoru; Hiraku, Yusuke; Oikawa, Shinji; Kawanishi, Shosuke


    Objectives The environmental pollutant 2-nitrotoluene (2-NO2-T) is carcinogenic and reproductively toxic in animals. In this study, we elucidated the mechanisms of its carcinogenicity and reproductive toxicity. Methods We examined DNA damage induced by 2-NO2-T and its metabolite, 2-nitrosotoluene (2-NO-T), using 32P-5′-end-labeled DNA. We measured 8-oxo-7, 8-dihydro-2′-deoxyguanosine (8-oxodG), an indicator of oxidative DNA damage, in calf thymus DNA and cellular DNA in cultured human leukemia (HL-60) cells treated with 2-NO2-T and 2-NO-T. 8-Oxoguanine DNA glycosylase (OGG1) gene expression in HL-60 cells was measured by real-time polymerase chain reaction (PCR). We examined estrogenic activity using an E-screen assay and a surface plasmon resonance (SPR) sensor. Results In experiments with isolated DNA fragments, 2-NO-T induced oxidative DNA damage in the presence of Cu (II) and β-nicotinamide adenine dinucleotide disodium salt (reduced form) (NADH), while 2-NO2-T did not. 2-NO-T significantly increased levels of 8-oxodG in HL-60 cells. Real-time polymerase chain reaction (PCR) analysis revealed upregulation of OGG1 gene expression induced by 2-NO-T. An E-screen assay using the human breast cancer cell line MCF-7 revealed that 2-NO2-T induced estrogen-dependent cell proliferation. In contrast, 2-NO-T decreased the cell number and suppressed 17β-estradiol-induced cell proliferation. The data obtained with the SPR sensor using estrogen receptor α and the estrogen response element supported the results of the E-screen assay. Conclusions Oxidative DNA damage caused by 2-NO-T and estrogen-disrupting effects caused by 2-NO2-T and 2-NO-T may play a role in the reproductive toxicity and carcinogenicity of these entities. PMID:21432561

  7. The basic chemistry of exercise-induced DNA oxidation: oxidative damage, redox signaling, and their interplay.


    Cobley, James N; Margaritelis, Nikos V; Morton, James P; Close, Graeme L; Nikolaidis, Michalis G; Malone, John K


    Acute exercise increases reactive oxygen and nitrogen species generation. This phenomenon is associated with two major outcomes: (1) redox signaling and (2) macromolecule damage. Mechanistic knowledge of how exercise-induced redox signaling and macromolecule damage are interlinked is limited. This review focuses on the interplay between exercise-induced redox signaling and DNA damage, using hydroxyl radical ((·)OH) and hydrogen peroxide (H2O2) as exemplars. It is postulated that the biological fate of H2O2 links the two processes and thus represents a bifurcation point between redox signaling and damage. Indeed, H2O2 can participate in two electron signaling reactions but its diffusion and chemical properties permit DNA oxidation following reaction with transition metals and (·)OH generation. It is also considered that the sensing of DNA oxidation by repair proteins constitutes a non-canonical redox signaling mechanism. Further layers of interaction are provided by the redox regulation of DNA repair proteins and their capacity to modulate intracellular H2O2 levels. Overall, exercise-induced redox signaling and DNA damage may be interlinked to a greater extent than was previously thought but this requires further investigation.

  8. The catalytic topoisomerase II inhibitor dexrazoxane induces DNA breaks, ATF3 and the DNA damage response in cancer cells

    PubMed Central

    Deng, Shiwei; Yan, Tiandong; Nikolova, Teodora; Fuhrmann, Dominik; Nemecek, Andrea; Gödtel-Armbrust, Ute; Kaina, Bernd; Wojnowski, Leszek


    Background and Purpose The catalytic topoisomerase II inhibitor dexrazoxane has been associated not only with improved cancer patient survival but also with secondary malignancies and reduced tumour response. Experimental Approach We investigated the DNA damage response and the role of the activating transcription factor 3 (ATF3) accumulation in tumour cells exposed to dexrazoxane. Key Results Dexrazoxane exposure induced topoisomerase IIα (TOP2A)-dependent cell death, γ-H2AX accumulation and increased tail moment in neutral comet assays. Dexrazoxane induced DNA damage responses, shown by enhanced levels of γ-H2AX/53BP1 foci, ATM (ataxia telangiectasia mutated), ATR (ATM and Rad3-related), Chk1 and Chk2 phosphorylation, and by p53 accumulation. Dexrazoxane-induced γ-H2AX accumulation was dependent on ATM. ATF3 protein was induced by dexrazoxane in a concentration- and time-dependent manner, which was abolished in TOP2A-depleted cells and in cells pre-incubated with ATM inhibitor. Knockdown of ATF3 gene expression by siRNA triggered apoptosis in control cells and diminished the p53 protein level in both control and dexrazoxane -treated cells. This was accompanied by increased γ-H2AX accumulation. ATF3 knockdown also delayed the repair of dexrazoxane -induced DNA double-strand breaks. Conclusions and Implications As with other TOP2A poisons, dexrazoxane induced DNA double-strand breaks followed by activation of the DNA damage response. The DNA damage-triggered ATF3 controlled p53 accumulation and generation of double-strand breaks and is proposed to serve as a switch between DNA damage and cell death following dexrazoxane treatment. These findings suggest a mechanistic explanation for the diverse clinical observations associated with dexrazoxane. PMID:25521189

  9. Spatiotemporal kinetics of γ-H2AX protein on charged particles induced DNA damage

    NASA Astrophysics Data System (ADS)

    Niu, H.; Chang, H. C.; Cho, I. C.; Chen, C. H.; Liu, C. S.; Chou, W. T.


    In several researches, it has been demonstrated that charged particles can induce more complex DNA damages. These complex damages have higher ability to cause the cell death or cell carcinogenesis. For this reason, clarifying the DNA repair mechanism after charged particle irradiation plays an important role in the development of charged particle therapy and space exploration. Unfortunately, the detail spatiotemporal kinetic of DNA damage repair is still unclear. In this study, we used γ-H2AX protein to investigate the spatiotemporal kinetics of DNA double strand breaks in alpha-particle irradiated HeLa cells. The result shows that the intensity of γ-H2AX foci increased gradually, and reached to its maximum at 30 min after irradiation. A good linear relationship can be observed between foci intensity and radiation dose. After 30 min, the γ-H2AX foci intensity was decreased with time passed, but remained a large portion (∼50%) at 48 h passed. The data show that the dissolution rate of γ-H2AX foci agreed with two components DNA repairing model. These results suggest that charged particles can induce more complex DNA damages and causing the retardation of DNA repair.

  10. Methylmalonic acid administration induces DNA damage in rat brain and kidney.


    Andrade, Vanessa M; Dal Pont, Hugo S; Leffa, Daniela D; Damiani, Adriani P; Scaini, Giselli; Hainzenreder, Giana; Streck, Emilio L; Ferreira, Gustavo C; Schuck, Patrícia F


    Accumulation of methylmalonic acid (MMA) in tissues and biological fluids is the biochemical hallmark of methylmalonic aciduria. Affected patients present renal failure and severe neurological findings. Considering that the underlying pathomechanisms of tissue damage are not yet understood, in the present work we assessed the in vivo e in vitro effects of MMA on DNA damage in brain and kidney, as well as on p53 and caspase 3 levels, in the presence or absence of gentamicin (acute renal failure model). For in vitro studies, tissue prisms were incubated in the presence of different concentrations of MMA and/or gentamicin for one hour. For in vivo studies, animals received a single injection of gentamicin (70 mg/kg) and/or three injections of MMA (1.67 μmol/g; 11 h interval between injections). The animals were killed 1 h after the last MMA injection. Controls received saline in the same volumes. DNA damage was analyzed by the comet assay. We found that MMA and gentamicin alone or combined in vitro increased DNA damage in cerebral cortex and kidney of rats. Furthermore, MMA administration increased DNA damage in both brain and kidney. Gentamicin per se induced DNA damage only in kidney, and the association of MMA plus gentamicin also caused DNA damage in cerebral cortex and kidney. On the other hand, p53 and caspase 3 levels were not altered by the administration of MMA and/or gentamicin. Our findings provide evidence that DNA damage may contribute to the neurological and renal damage found in patients affected by methylmalonic aciduria.

  11. Exit from dormancy provokes DNA-damage-induced attrition in haematopoietic stem cells.


    Walter, Dagmar; Lier, Amelie; Geiselhart, Anja; Thalheimer, Frederic B; Huntscha, Sina; Sobotta, Mirko C; Moehrle, Bettina; Brocks, David; Bayindir, Irem; Kaschutnig, Paul; Muedder, Katja; Klein, Corinna; Jauch, Anna; Schroeder, Timm; Geiger, Hartmut; Dick, Tobias P; Holland-Letz, Tim; Schmezer, Peter; Lane, Steven W; Rieger, Michael A; Essers, Marieke A G; Williams, David A; Trumpp, Andreas; Milsom, Michael D


    Haematopoietic stem cells (HSCs) are responsible for the lifelong production of blood cells. The accumulation of DNA damage in HSCs is a hallmark of ageing and is probably a major contributing factor in age-related tissue degeneration and malignant transformation. A number of accelerated ageing syndromes are associated with defective DNA repair and genomic instability, including the most common inherited bone marrow failure syndrome, Fanconi anaemia. However, the physiological source of DNA damage in HSCs from both normal and diseased individuals remains unclear. Here we show in mice that DNA damage is a direct consequence of inducing HSCs to exit their homeostatic quiescent state in response to conditions that model physiological stress, such as infection or chronic blood loss. Repeated activation of HSCs out of their dormant state provoked the attrition of normal HSCs and, in the case of mice with a non-functional Fanconi anaemia DNA repair pathway, led to a complete collapse of the haematopoietic system, which phenocopied the highly penetrant bone marrow failure seen in Fanconi anaemia patients. Our findings establish a novel link between physiological stress and DNA damage in normal HSCs and provide a mechanistic explanation for the universal accumulation of DNA damage in HSCs during ageing and the accelerated failure of the haematopoietic system in Fanconi anaemia patients.

  12. Reversal of DNA damage induced Topoisomerase 2 DNA-protein crosslinks by Tdp2.


    Schellenberg, Matthew J; Perera, Lalith; Strom, Christina N; Waters, Crystal A; Monian, Brinda; Appel, C Denise; Vilas, Caroline K; Williams, Jason G; Ramsden, Dale A; Williams, R Scott


    Mammalian Tyrosyl-DNA phosphodiesterase 2 (Tdp2) reverses Topoisomerase 2 (Top2) DNA-protein crosslinks triggered by Top2 engagement of DNA damage or poisoning by anticancer drugs. Tdp2 deficiencies are linked to neurological disease and cellular sensitivity to Top2 poisons. Herein, we report X-ray crystal structures of ligand-free Tdp2 and Tdp2-DNA complexes with alkylated and abasic DNA that unveil a dynamic Tdp2 active site lid and deep substrate binding trench well-suited for engaging the diverse DNA damage triggers of abortive Top2 reactions. Modeling of a proposed Tdp2 reaction coordinate, combined with mutagenesis and biochemical studies support a single Mg(2+)-ion mechanism assisted by a phosphotyrosyl-arginine cation-π interface. We further identify a Tdp2 active site SNP that ablates Tdp2 Mg(2+) binding and catalytic activity, impairs Tdp2 mediated NHEJ of tyrosine blocked termini, and renders cells sensitive to the anticancer agent etoposide. Collectively, our results provide a structural mechanism for Tdp2 engagement of heterogeneous DNA damage that causes Top2 poisoning, and indicate that evaluation of Tdp2 status may be an important personalized medicine biomarker informing on individual sensitivities to chemotherapeutic Top2 poisons.

  13. Comet-FISH with rDNA probes for the analysis of mutagen-induced DNA damage in plant cells.


    Kwasniewska, Jolanta; Grabowska, Marta; Kwasniewski, Miroslaw; Kolano, Bozena


    We used comet-fluorescence in situ hybridization (FISH) in the model plant species Crepis capillaris following exposure of seedlings to maleic hydrazide (MH). FISH with 5S and 25S rDNA probes was applied to comets obtained under alkaline conditions to establish whether these DNA regions were preferentially involved in comet tail formation. MH treatment induced significant fragmentation of nuclear DNA and of rDNA loci. A 24-h post-treatment recovery period allowed a partial reversibility of MH-induced damage on nuclear and rDNA regions. Analyses of FISH signals demonstrated that rDNA sequences were always involved in tail formation and that 5S rDNA was more frequently present in the tail than 25S rDNA, regardless of treatment. The involvement of 25S rDNA in nucleolus formation and differences in chromatin structure between the two loci may explain the different susceptibility of the 25S and 5S rDNA regions to migrate into the tail. This work is the first report on the application of FISH to comet preparations from plants to analyze the distribution and repair of DNA damage within specific genomic regions after mutagenic treatment. Moreover, our work suggests that comet-FISH in plants may be a useful tool for environmental monitoring assessment. Copyright © 2012 Wiley Periodicals, Inc.

  14. Nuclear aggregates of polyamines in a radiation-induced DNA damage model.


    Iacomino, Giuseppe; Picariello, Gianluca; Stillitano, Ilaria; D'Agostino, Luciano


    Polyamines (PA) are believed to protect DNA minimizing the effect of radiation damage either by inducing DNA compaction and aggregation or acting as scavengers of free radicals. Using an in vitro pDNA double strand breakage assay based on gel electrophoretic mobility, we compared the protective capability of PA against γ-radiation with that of compounds generated by the supramolecular self-assembly of nuclear polyamines and phosphates, named Nuclear Aggregates of Polyamines (NAPs). Both unassembled PA and in vitro produced NAPs (ivNAPs) were ineffective in conferring pDNA protection at the sub-mM concentration. Single PA showed an appreciable protective effect only at high (mM) concentrations. However, concentrations of spermine (4+) within a critical range (0.481 mM) induced pDNA precipitation, an event that was not observed with NAPs-pDNA interaction. We conclude that the interaction of individual PA is ineffective to assure DNA protection, simultaneously preserving the flexibility and charge density of the double strand. Furthermore, data obtained by testing polyamine and ivNAPS with the current radiation-induced DNA damage model support the concept that PA-phosphate aggregates are the only forms through which PA interact with DNA.

  15. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu


    Living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, affects on the cellular response to DNA damage induced by exposures to radiation or other toxic chemicals will have an impact on the radiation risks for the astronauts, as well as on the mutation rate in microorganisms, is still an open question. Although the possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate the effects of spaceflight on the cellular response to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induces DNA damages including the double strand breaks (DSB) similar to the ionizing radiation. Damage in the DNA was measured by the phosphorylation of a histone protein H2AX (-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in the DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ti-67 signals. Our results suggested that the difference in -H2AX between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect the response of the DNA damage response genes to bleomycin treatment.

  16. Cellular Response to Bleomycin-Induced DNA Damage in Human Fibroblast Cells in Space

    NASA Technical Reports Server (NTRS)

    Lu, Tao; Zhang, Ye; Wong, Michael; Stodieck, Louis; Karouia, Fathi; Wu, Honglu


    Outside the protection of the geomagnetic field, astronauts and other living organisms are constantly exposed to space radiation that consists of energetic protons and other heavier charged particles. Whether spaceflight factors, microgravity in particular, have effects on cellular responses to DNA damage induced by exposure to radiation or cytotoxic chemicals is still unknown, as is their impact on the radiation risks for astronauts and on the mutation rate in microorganisms. Although possible synergistic effects of space radiation and other spaceflight factors have been investigated since the early days of the human space program, the published results were mostly conflicting and inconsistent. To investigate effects of spaceflight on cellular responses to DNA damages, human fibroblast cells flown to the International Space Station (ISS) were treated with bleomycin for three hours in the true microgravity environment, which induced DNA damages including double-strand breaks (DSB) similar to the ionizing radiation. Damages in the DNA were measured by the phosphorylation of a histone protein H2AX (g-H2AX), which showed slightly more foci in the cells on ISS than in the ground control. The expression of genes involved in DNA damage response was also analyzed using the PCR array. Although a number of the genes, including CDKN1A and PCNA, were significantly altered in the cells after bleomycin treatment, no significant difference in the expression profile of DNA damage response genes was found between the flight and ground samples. At the time of the bleomycin treatment, the cells on the ISS were found to be proliferating faster than the ground control as measured by the percentage of cells containing positive Ki-67 signals. Our results suggested that the difference in g-H2AX focus counts between flight and ground was due to the faster growth rate of the cells in space, but spaceflight did not affect initial transcriptional responses of the DNA damage response genes to

  17. Listeria monocytogenes induces host DNA damage and delays the host cell cycle to promote infection

    PubMed Central

    Leitão, Elsa; Costa, Ana Catarina; Brito, Cláudia; Costa, Lionel; Pombinho, Rita; Cabanes, Didier; Sousa, Sandra


    Listeria monocytogenes (Lm) is a human intracellular pathogen widely used to uncover the mechanisms evolved by pathogens to establish infection. However, its capacity to perturb the host cell cycle was never reported. We show that Lm infection affects the host cell cycle progression, increasing its overall duration but allowing consecutive rounds of division. A complete Lm infectious cycle induces a S-phase delay accompanied by a slower rate of DNA synthesis and increased levels of host DNA strand breaks. Additionally, DNA damage/replication checkpoint responses are triggered in an Lm dose-dependent manner through the phosphorylation of DNA-PK, H2A.X, and CDC25A and independently from ATM/ATR. While host DNA damage induced exogenously favors Lm dissemination, the override of checkpoint pathways limits infection. We propose that host DNA replication disturbed by Lm infection culminates in DNA strand breaks, triggering DNA damage/replication responses, and ensuring a cell cycle delay that favors Lm propagation. PMID:24552813

  18. Damage to dry plasmid DNA induced by nanosecond XUV-laser pulses

    NASA Astrophysics Data System (ADS)

    Nováková, Eva; Davídková, Marie; Vyšín, Ludék; Burian, Tomáš; Grisham, Michael E.; Heinbuch, Scott; Rocca, Jorge J.; Juha, Libor


    Ionizing radiation induces a variety of DNA damages including single-strand breaks (SSBs), double-strand breaks (DSBs), abasic sites, modified sugar and bases. Most theoretical and experimental studies have been focused on DNA strand scissions, in particular production of DNA double-strand breaks. DSBs have been proven to be a key damage at a molecular level responsible for the formation of chromosomal aberrations, leading often to cell death. The complexity of lesions produced in DNA by ionizing radiations is thought to depend on the amount of energy deposited at the site of each lesion. We have studied the nature of DNA damage induced directly by the pulsed 46.9 nm radiation provided by a capillary-discharge Ne-like Ar laser (CDL). Different surface doses were delivered with a repetition rate of a few Hz and an average pulse energy ~ 1 μJ. A simple model DNA molecule, i.e., dried closed-circular plasmid DNA (pBR322), was irradiated. The agarose gel electrophoresis method was used for determination of both SSB and DSB yields. Results are compared with a previous study of plasmid DNA irradiated with a single sub-nanosecond 1-keV X-ray pulse produced by a large-scale, double-stream gas puff target, illuminated by sub-kJ, near-infrared (NIR) focused laser pulses at the PALS facility (Prague Asterix Laser System).

  19. Spermine oxidation induced by Helicobacter pylori results in apoptosis and DNA damage: implications for gastric carcinogenesis.


    Xu, Hangxiu; Chaturvedi, Rupesh; Cheng, Yulan; Bussiere, Francoise I; Asim, Mohammad; Yao, Micheal D; Potosky, Darryn; Meltzer, Stephen J; Rhee, Juong G; Kim, Sung S; Moss, Steven F; Hacker, Amy; Wang, Yanlin; Casero, Robert A; Wilson, Keith T


    Oxidative stress is linked to carcinogenesis due to its ability to damage DNA. The human gastric pathogen Helicobacter pylori exerts much of its pathogenicity by inducing apoptosis and DNA damage in host gastric epithelial cells. Polyamines are abundant in epithelial cells, and when oxidized by the inducible spermine oxidase SMO(PAOh1) H(2)O(2) is generated. Here, we report that H. pylori up-regulates mRNA expression, promoter activity, and enzyme activity of SMO(PAOh1) in human gastric epithelial cells, resulting in DNA damage and apoptosis. H. pylori-induced H(2)O(2) generation and apoptosis in these cells was equally attenuated by an inhibitor of SMO(PAOh1), by catalase, and by transient transfection with small interfering RNA targeting SMO(PAOh1). Conversely, SMO(PAOh1) overexpression induced apoptosis to the same levels as caused by H. pylori. Importantly, in H. pylori-infected tissues, there was increased expression of SMO(PAOh1) in both human and mouse gastritis. Laser capture microdissection of human gastric epithelial cells demonstrated expression of SMO(PAOh1) that was significantly attenuated by H. pylori eradication. These results identify a pathway for oxidative stress-induced epithelial cell apoptosis and DNA damage due to SMO(PAOh1) activation by H. pylori that may contribute to the pathogenesis of the infection and development of gastric cancer.

  20. Rapid communications: antiperspirant induced DNA damage in canine cells by comet assay.


    Yiu, Gloria


    Abstract Millions of people around the world use antiperspirants to decrease or eliminate body odors. Most antiperspirants contain aluminum zirconium or another form of aluminum as its active ingredient. The present investigation applied Comet assay to detect if Secret Platinum for women, Old Spice for men, or Crystal Natural produced DNA damage in Madin-Darby canine kidney cells (MDCKII). This study has shown that antiperspirants cause DNA damage on a single-cell level. Additionally, our data showed us that in general, Secret Platinum for women and Old Spice for men, produced equivalent damage. Crystal Natural, marketed as being safer or less damaging, induced the most extensive damage of all three antiperspirants tested.

  1. Mfd is required for rapid recovery of transcription following UV-induced DNA damage but not oxidative DNA damage in Escherichia coli.


    Schalow, Brandy J; Courcelle, Charmain T; Courcelle, Justin


    Transcription-coupled repair (TCR) is a cellular process by which some forms of DNA damage are repaired more rapidly from transcribed strands of active genes than from nontranscribed strands or the overall genome. In humans, the TCR coupling factor, CSB, plays a critical role in restoring transcription following both UV-induced and oxidative DNA damage. It also contributes indirectly to the global repair of some forms of oxidative DNA damage. The Escherichia coli homolog, Mfd, is similarly required for TCR of UV-induced lesions. However, its contribution to the restoration of transcription and to global repair of oxidative damage has not been examined. Here, we report the first direct study of transcriptional recovery following UV-induced and oxidative DNA damage in E. coli. We observed that mutations in mfd or uvrA reduced the rate that transcription recovered following UV-induced damage. In contrast, no difference was detected in the rate of transcription recovery in mfd, uvrA, fpg, nth, or polB dinB umuDC mutants relative to wild-type cells following oxidative damage. mfd mutants were also fully resistant to hydrogen peroxide (H(2)O(2)) and removed oxidative lesions from the genome at rates comparable to wild-type cells. The results demonstrate that Mfd promotes the rapid recovery of gene expression following UV-induced damage in E. coli. In addition, these findings imply that Mfd may be functionally distinct from its human CSB homolog in that it does not detectably contribute to the recovery of gene expression or global repair following oxidative damage.

  2. ATM-activated autotaxin (ATX) propagates inflammation and DNA damage in lung epithelial cells; a new mode of action for silica-induced DNA damage?


    Zheng, Huiyuan; Högberg, Johan; Stenius, Ulla


    Silica exposure is a common risk factor for lung cancer. It has been claimed that key elements in cancer development are activation of inflammatory cells that indirectly induce DNA damage and proliferative stimuli in respiratory epithelial cells. We studied DNA damage induced by silica particles in respiratory epithelial cells and focused the role of the signaling enzyme autotaxin (ATX). A549 and 16HBE lung epithelial cells were exposed silica particles. Reactive oxidative species (ROS), NLRP3 inflammasome activation, ATX, ataxia telangiectasia mutated (ATM), and DNA damage (γH2AX, pCHK1, pCHK2, comet assay) were endpoints. Low doses of silica induced NLRP3 activation, DNA damage accumulation and ATM phosphorylation. A novel finding was that ATM induced ATX generation and secretion. Not only silica but rotenone, camptothecin and H2O2 activated ATX via ATM, suggesting that ATX is part of a generalized ATM response to double strand breaks (DSBs). Surprisingly, ATX inhibition mitigated DNA damage accumulation at later time points (6 - 16h), and ATX transfection caused NLRP3 activation and DNA damage. Furthermore, the product of ATX enzymatic activity, lysophosphatidic acid, recapitulated the effects of ATX transfection. These data indicate an ATM-ATX-dependent loop that propagates inflammation and DSB accumulation, making low doses of silica effective inducers of DSBs in epithelial cells. We conclude that an ATM-ATX axis interconnects DSBs with silica-induced inflammation and propagates these effects in epithelial cells. Further studies of this adverse outcome pathway (AOP) may give an accurate assessment of the lowest doses of silica that causes cancer. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email:

  3. Activation of DNA damage repair pathways in response to nitrogen mustard-induced DNA damage and toxicity in skin keratinocytes.


    Inturi, Swetha; Tewari-Singh, Neera; Agarwal, Chapla; White, Carl W; Agarwal, Rajesh


    Nitrogen mustard (NM), a structural analog of chemical warfare agent sulfur mustard (SM), forms adducts and crosslinks with DNA, RNA and proteins. Here we studied the mechanism of NM-induced skin toxicity in response to double strand breaks (DSBs) resulting in cell cycle arrest to facilitate DNA repair, as a model for developing countermeasures against vesicant-induced skin injuries. NM exposure of mouse epidermal JB6 cells decreased cell growth and caused S-phase arrest. Consistent with these biological outcomes, NM exposure also increased comet tail extent moment and the levels of DNA DSB repair molecules phospho H2A.X Ser139 and p53 Ser15 indicating NM-induced DNA DSBs. Since DNA DSB repair occurs via non homologous end joining pathway (NHEJ) or homologous recombination repair (HRR) pathways, next we studied these two pathways and noted their activation as defined by an increase in phospho- and total DNA-PK levels, and the formation of Rad51 foci, respectively. To further analyze the role of these pathways in the cellular response to NM-induced cytotoxicity, NHEJ and HRR were inhibited by DNA-PK inhibitor NU7026 and Rad51 inhibitor BO2, respectively. Inhibition of NHEJ did not sensitize cells to NM-induced decrease in cell growth and cell cycle arrest. However, inhibition of the HRR pathway caused a significant increase in cell death, and prolonged G2M arrest following NM exposure. Together, our findings, indicating that HRR is the key pathway involved in the repair of NM-induced DNA DSBs, could be useful in developing new therapeutic strategies against vesicant-induced skin injury.

  4. Ginkgo biloba leaf extract induces DNA damage by inhibiting topoisomerase II activity in human hepatic cells.


    Zhang, Zhuhong; Chen, Si; Mei, Hu; Xuan, Jiekun; Guo, Xiaoqing; Couch, Letha; Dobrovolsky, Vasily N; Guo, Lei; Mei, Nan


    Ginkgo biloba leaf extract has been shown to increase the incidence in liver tumors in mice in a 2-year bioassay conducted by the National Toxicology Program. In this study, the DNA damaging effects of Ginkgo biloba leaf extract and many of its constituents were evaluated in human hepatic HepG2 cells and the underlying mechanism was determined. A molecular docking study revealed that quercetin, a flavonoid constituent of Ginkgo biloba, showed a higher potential to interact with topoisomerase II (Topo II) than did the other Ginkgo biloba constituents; this in silico prediction was confirmed by using a biochemical assay to study Topo II enzyme inhibition. Moreover, as measured by the Comet assay and the induction of γ-H2A.X, quercetin, followed by keampferol and isorhamnetin, appeared to be the most potent DNA damage inducer in HepG2 cells. In Topo II knockdown cells, DNA damage triggered by Ginkgo biloba leaf extract or quercetin was dramatically decreased, indicating that DNA damage is directly associated with Topo II. DNA damage was also observed when cells were treated with commercially available Ginkgo biloba extract product. Our findings suggest that Ginkgo biloba leaf extract- and quercetin-induced in vitro genotoxicity may be the result of Topo II inhibition.

  5. Study on DNA Damage Induced by Neon Beam Irradiation in Saccharomyces Cerevisiae

    NASA Astrophysics Data System (ADS)

    Lu, Dong; Li, Wenjian; Wu, Xin; Wang, Jufang; Ma, Shuang; Liu, Qingfang; He, Jinyu; Jing, Xigang; Ding, Nan; Dai, Zhongying; Zhou, Jianping


    Yeast strain Saccharomyces cerevisiae was irradiated with different doses of 85 MeV/u 20Ne10+ to investigate DNA damage induced by heavy ion beam in eukaryotic microorganism. The survival rate, DNA double strand breaks (DSBs) and DNA polymorphic were tested after irradiation. The results showed that there were substantial differences in DNA between the control and irradiated samples. At the dose of 40 Gy, the yeast cell survival rate approached 50%, DNA double-strand breaks were barely detectable, and significant DNA polymorphism was observed. The alcohol dehydrogenase II gene was amplified and sequenced. It was observed that base changes in the mutant were mainly transversions of T→G and T→C. It can be concluded that heavy ion beam irradiation can lead to change in single gene and may be an effective way to induce mutation.

  6. Solar UVB-induced DNA damage and photoenzymatic DNA repair in antarctic zooplankton

    SciTech Connect

    Malloy, K.D.; Holman, M.A.; Mitchell, D.


    The detrimental effects of elevated intensities of mid-UV radiation (UVB), a result of stratospheric ozone depletion during the austral spring, on the primary producers of the Antarctic marine ecosystem have been well documented. Here we report that natural populations of Antarctic zooplankton also sustain significant DNA damage [measured as cyclobutane pyrimidine dimers (CPDs)] during periods of increased UVB flux. This is the first direct evidence that increased solar UVB may result in damage to marine organisms other than primary producers in Antarctica. The extent of DNA damage in pelagic icefish eggs correlated with daily incident UVB irradiance, reflecting the difference between acquisition and repair of CPDs. Patterns of DNA damage in fish larvae did not correlated with daily UVB flux, possibly due to different depth distributions and/or different capacities for DNA repair. Clearance of CPDs by Antarctic fish and krill was mediated primarily by the photoenzymatic repair system. Although repair rates were large for all species evaluated, they were apparently inadequate to prevent the transient accumulation of substantial CPD burdens. The capacity for DNA repair in Antarctic organisms was highest in those species whose early life history stages occupy the water column during periods of ozone depletion (austral spring) and lowest in fish species whose eggs and larvae are abundant during winter. Although the potential reduction in fitness of Antarctic zooplankton resulting from DNA damage is unknown, we suggest that increased solar UV may reduce recruitment and adversely affect trophic transfer of productivity by affecting heterotrophic species as well as primary producers. 54 refs., 4 figs., 2 tabs.

  7. Clemens von Sonntag and the early history of radiation-induced sugar damage in DNA.


    Dizdaroglu, Miral


    This article reviews the early history of ionizing radiation-induced sugar damage in DNA in dedication to Prof. Clemens von Sonntag, who recently passed away. It covers the time between 1968 and 1978, during which most of the work on the ionizing radiation-induced damage to polyalcohols, carbohydrates and the 2'-deoxyribose moiety in DNA was performed. Methodologies using gas chromatography-mass spectrometry (GC-MS) were developed to identify and quantify the radiation-induced products that had previously remained elusive. Products were identified by GC-MS either directly or after reduction of samples with NaBH(4) or NaBD(4). Incorporation of deuterium atoms by NaBD(4)-reduction facilitated the identification of aldehyde, keto, carboxyl and deoxy groups in the molecules. Numerous products of a polyalcohol and carbohydrates were identified and quantified. Mechanisms of product formation were proposed. Several products of the 2'-deoxyribose moiety in DNA were identified, indicating that they were released from DNA strand, not bound to it. Alkali labile sites and products still remaining within DNA or bound to DNA as end groups were also elucidated by first reducing irradiated samples with NaBD(4) followed by alkali treatment and GC-MS analysis. The knowledge of the products of the 2'-deoxyribose moiety in DNA led to the first mechanistic understanding of various pathways of hydroxyl radical-induced DNA strand breakage. To this date, some of these mechanisms still remain the most-widely studied mechanisms of DNA damage. Prof. von Sonntag's contributions to the understanding of the radiation chemistry of carbohydrates and DNA helped shape this field of science for years to come.

  8. Mitotic DNA damages induced by carbon-ion radiation incur additional chromosomal breaks in polyploidy.


    Li, Ping; Zhou, Libin; Liu, Xiongxiong; Jin, Xiaodong; Zhao, Ting; Ye, Fei; Liu, Xinguo; Hirayama, Ryoichi; Li, Qiang


    Compared with low linear energy transfer (LET) radiation, carbon-ion radiation has been proved to induce high frequency of more complex DNA damages, including DNA double strands (DSBs) and non-DSB clustered DNA lesions. Chemotherapeutic drug doxorubicin has been reported to elicit additional H2AX phosphorylation in polyploidy. Here, we investigated whether mitotic DNA damage induced by high-LET carbon-ion radiation could play the same role. We demonstrate that impairment of post-mitotic G1 and S arrest and abrogation of post-mitotic G2-M checkpoint failed to prevent mis-replication of damaged DNA and mis-separation of chromosomes. Meanwhile, mitotic slippage only nocodazole-related, cytokinesis failure and cell fusion collectively contributed to the formation of binucleated cells. Chk1 and Cdh1 activation was inhibited when polyploidy emerged in force, both of which are critical components for mitotic exit and cytokinesis. Carbon-ion radiation irrelevant of nocodazole incurred additional DNA breaks in polyploidy, manifesting as structural and numerical karyotype changes. The proliferation of cells given pre-synchronization and radiation was completely inhibited and cells were intensely apoptotic. Since increased chromosomal damage resulted in extensive H2AX phosphorylation during polyploidy, we propose that the additional γ-H2AX during polyploidy incurred by carbon-ion radiation provides a final opportunity for these dangerous and chromosomally unstable cells to be eliminated. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  9. Repair of DNA Damage Induced by Bile Salts in Salmonella enterica

    PubMed Central

    Prieto, Ana I.; Ramos-Morales, Francisco; Casadesús, Josep


    Exposure of Salmonella enterica to sodium cholate, sodium deoxycholate, sodium chenodeoxycholate, sodium glychocholate, sodium taurocholate, or sodium glycochenodeoxycholate induces the SOS response, indicating that the DNA-damaging activity of bile resides in bile salts. Bile increases the frequency of GC → AT transitions and induces the expression of genes belonging to the OxyR and SoxRS regulons, suggesting that bile salts may cause oxidative DNA damage. S. enterica mutants lacking both exonuclease III (XthA) and endonuclease IV (Nfo) are bile sensitive, indicating that S. enterica requires base excision repair (BER) to overcome DNA damage caused by bile salts. Bile resistance also requires DinB polymerase, suggesting the need of SOS-associated translesion DNA synthesis. Certain recombination functions are also required for bile resistance, and a key factor is the RecBCD enzyme. The extreme bile sensitivity of RecB−, RecC−, and RecA− RecD− mutants provides evidence that bile-induced damage may impair DNA replication. PMID:16888329

  10. Chlorogenic acid prevents isoproterenol-induced DNA damage in vascular smooth muscle cells

    PubMed Central

    Wang, Jingshuai; Li, Jiyang; Liu, Jie; Xu, Mengjiao; Tong, Xiaowen; Wang, Jianjun


    Numerous clinical therapeutic agents have been identified as DNA damaging. The present study revealed that isoproterenol (Iso) resulted in DNA damage in vascular smooth muscle cells (VSMCs) and increased the levels of intracellular oxygen free radicals. Administration of chlorogenic acid (CGA) inhibited this effect. Pretreatment with CGA abrogated the increase in protein expression levels of γ-H2A histone family member X, phosphorylated ataxia telangiectasia mutated, phosphorylated Rad3-related protein, breast cancer 1 and C-terminal Src homologous kinase induced by Iso. In addition, the increase in levels of intracellular reactive oxygen species (ROS) induced by Iso was inhibited by CGA pretreatment in a dose-dependent manner. The results of the present study suggest that CGA may inhibit Iso-induced VSMC damage via the suppression of ROS generation. Therefore, CGA may be a novel agent for the treatment of vascular diseases. PMID:27634104

  11. PTEN Activation by DNA Damage Induces Protective Autophagy in Response to Cucurbitacin B in Hepatocellular Carcinoma Cells

    PubMed Central

    Niu, Yanan; Sun, Wen; Lu, Jin-Jian; Pei, Lixia


    Cucurbitacin B (Cuc B), a natural product, induced both protective autophagy and DNA damage mediated by ROS while the detailed mechanisms remain unclear. This study explored the mechanism of Cuc B-induced DNA damage and autophagy. Cuc B decreased cell viability in concentration- and time-dependent manners. Cuc B caused long comet tails and increased expression of γ-H2AX, phosphorylation of ATM/ATR, and Chk1/Chk2. Cuc B induced autophagy as evidenced by monodansylcadaverine (MDC) staining, increased expression of LC3II, phosphorylated ULK1, and decreased expression of phosphorylated AKT, mTOR. Cuc B induced apoptosis mediated by Bcl-2 family proteins and caspase activation. Furthermore, Cuc B induced ROS formation, which was inhibited by N-acetyl-L-cysteine (NAC). NAC pretreatment dramatically reversed Cuc B-induced DNA damage, autophagy, and apoptosis. Cuc B-induced apoptosis was reversed by NAC but enhanced by 3-methyladenine (3-MA), chloroquine (CQ), and silencing phosphatase and tensin homolog (PTEN). 3-MA and CQ showed no effect on Cuc B-induced DNA damage. In addition, Cuc B increased PTEN phosphorylation and silence PTEN restored Cuc B-induced autophagic protein expressions without affecting DNA damage. In summary, Cuc B induced DNA damage, apoptosis, and protective autophagy mediated by ROS. PTEN activation in response to DNA damage bridged DNA damage and prosurvival autophagy. PMID:28042385

  12. Radiation-induced damage to DNA: mechanistic aspects and measurement of base lesions

    NASA Astrophysics Data System (ADS)

    Cadet, J.; Douki, T.; Gasparutto, D.; Gromova, M.; Pouget, J.-P.; Ravanat, J.-L.; Romieu, A.; Sauvaigo, S.


    Emphasis has been placed in the present survey on mechanistic aspects of the radiation-induced decomposition of the guanine moiety of DNA and model compounds. An almost complete description of the radical reactions induced by both rad OH radicals (indirect effects) and one-electron oxidation (direct effects) in aerated aqueous solution is now possible. This was inferred from both earliest investigations of the transient radicals of these reactions and detailed structural determination of the final decomposition products. Information is also provided on several tandem lesions whose formation results from one initial radical event involving either the sugar moiety or the base residue of nucleosides. It should be noted that there is a paucity of information on the radiation-induced formation of base damage within cellular DNA. A critical evaluation of the available methods aimed at monitoring the levels of oxidative base damage to cellular DNA is made in the second part of the review article.

  13. Parvovirus B19 Nonstructural Protein-Induced Damage of Cellular DNA and Resultant Apoptosis

    PubMed Central

    Poole, Brian D.; Kivovich, Violetta; Gilbert, Leona; Naides, Stanley J.


    Parvovirus B19 is a widespread virus with diverse clinical presentations. The viral nonstructural protein, NS1, binds to and cleaves the viral genome, and induces apoptosis when transfected into nonpermissive cells, such as hepatocytes. We hypothesized that the cytotoxicity of NS1 in such cells results from chromosomal DNA damage caused by the DNA-nicking and DNA-attaching activities of NS1. Upon testing this hypothesis, we found that NS1 covalently binds to cellular DNA and is modified by PARP, an enzyme involved in repairing single-stranded DNA nicks. We furthermore discovered that the DNA nick repair pathway initiated by poly(ADPribose)polymerase and the DNA repair pathways initiated by ATM/ATR are necessary for efficient apoptosis resulting from NS1 expression. PMID:21278893

  14. Free-Radical-Induced DNA Damage as Approached by Quantum-Mechanical and Monte Carlo Calculations

    NASA Astrophysics Data System (ADS)

    von Sonntag, Clemens

    The free-radical chemistry of DNA and its model systems has been widely studied by experimentalists as well as theoreticians. In the present paper, the important contributions of theory to a better understanding of this complex matter has been reviewed by an experimentalist with an emphasis on the following topics: modeling of DNA damage induced by ionizing radiation, pattern of -OH attack on DNA, ionization potentials and electron affinities of the nucleobases (reduction potentials), hole and electron transfer through DNA, tautomerization and isomerization reactions of DNA radicals, regioselectivity of -OH attack on the nucleobases, selectivity of free-radical attack at the sugar moiety, reactions of alkyl radicals, assignment of transients by quantum-chemical calculations of their electronic transitions, reduction potentials of DNA radicals, and DNA stability and repair. Some pending questions that may be tackled by theoreticians are addressed.


    EPA Science Inventory

    The lungs are a target organ for arsenic carcinogenesis, however, its mechanism of action remains unclear. Furthermore, it has been suggested that inorganic arsenic (iAs) can potentiate DNA damage induced by other agents. Once inside the human body iAs generally undergoes two ...


    EPA Science Inventory

    The lungs are a target organ for arsenic carcinogenesis, however, its mechanism of action remains unclear. Furthermore, it has been suggested that inorganic arsenic (iAs) can potentiate DNA damage induced by other agents. Once inside the human body iAs generally undergoes two ...

  17. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells.


    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng


    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague-Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo.

  18. Effect of superposed electromagnetic noise on DNA damage of lens epithelial cells induced by microwave radiation.


    Yao, Ke; Wu, Wei; Yu, Yibo; Zeng, Qunli; He, Jiliang; Lu, Deqiang; Wang, Kaijun


    To investigate the influence of the 1.8-GHz radiofrequency fields (RFs) of the Global System for Mobile Communications on DNA damage, intracellular reactive oxygen species (ROS) formation, cell cycle, and apoptosis in human lens epithelial cells (hLECs) and whether the effects induced by RF could be blocked by superposing of electromagnetic noise. After 24-hour intermittent exposure at the specific absorption rate of 1 W/kg, 2 W/kg, 3 W/kg, and 4 W/kg, the DNA damage of hLECs was examined by alkaline comet assay and immunofluorescence microscope detection of the phosphorylated form of histone variant H2AX (gammaH2AX) foci, respectively. ROS production was quantified by the fluorescent probe 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). Cell cycle and cell apoptosis were determined by flow cytometry. DNA damage examined by alkaline comet assay was significantly increased after 3 W/kg and 4 W/kg radiation (P < 0.05), whereas the double-strand breaks (DSBs) evaluated by gammaH2AX foci were significantly increased only after 4 W/kg radiation (P < 0.05). Significantly elevated intracellular ROS levels were also detected in the 3-W/kg and 4-W/kg groups (P < 0.05). After exposure to 4 W/kg for 24 hours, hLECs exhibited significant G(0)/G(1) arrest (P < 0.05). There was no detectable difference in cell apoptosis between the microwave radiation and sham exposure groups (P > 0.05). All the effects mentioned were blocked when the RF was superposed with 2 muT electromagnetic noise. Microwave radiation induced hLEC DNA damage after G(0)/G(1) arrest does not lead to cell apoptosis. The increased ROS observed may be associated with DNA damage. Superposed electromagnetic noise blocks microwave radiation-induced DNA damage, ROS formation, and cell cycle arrest.

  19. DNA damage induced by chronic inflammation contributes to colon carcinogenesis in mice

    PubMed Central

    Meira, Lisiane B.; Bugni, James M.; Green, Stephanie L.; Lee, Chung-Wei; Pang, Bo; Borenshtein, Diana; Rickman, Barry H.; Rogers, Arlin B.; Moroski-Erkul, Catherine A.; McFaline, Jose L.; Schauer, David B.; Dedon, Peter C.; Fox, James G.; Samson, Leona D.


    Chronic inflammation increases cancer risk. While it is clear that cell signaling elicited by inflammatory cytokines promotes tumor development, the impact of DNA damage production resulting from inflammation-associated reactive oxygen and nitrogen species (RONS) on tumor development has not been directly tested. RONS induce DNA damage that can be recognized by alkyladenine DNA glycosylase (Aag) to initiate base excision repair. Using a mouse model of episodic inflammatory bowel disease by repeated administration of dextran sulfate sodium in the drinking water, we show that Aag-mediated DNA repair prevents colonic epithelial damage and reduces the severity of dextran sulfate sodium–induced colon tumorigenesis. Importantly, DNA base lesions expected to be induced by RONS and recognized by Aag accumulated to higher levels in Aag-deficient animals following stimulation of colonic inflammation. Finally, as a test of the generality of this effect we show that Aag-deficient animals display more severe gastric lesions that are precursors of gastric cancer after chronic infection with Helicobacter pylori. These data demonstrate that the repair of DNA lesions formed by RONS during chronic inflammation is important for protection against colon carcinogenesis. PMID:18521188

  20. Chromatin Modifications during Repair of Environmental Exposure-Induced DNA Damage: A Potential Mechanism for Stable Epigenetic Alterations

    PubMed Central

    O’Hagan, Heather M.


    Exposures to environmental toxicants and toxins cause epigenetic changes that likely play a role in the development of diseases associated with exposure. The mechanism behind these exposure-induced epigenetic changes is currently unknown. One commonality between most environmental exposures is that they cause DNA damage either directly or through causing an increase in reactive oxygen species, which can damage DNA. Like transcription, DNA damage repair must occur in the context of chromatin requiring both histone modifications and ATP-dependent chromatin remodeling. These chromatin changes aid in DNA damage accessibility and signaling. Several proteins and complexes involved in epigenetic silencing during both development and cancer have been found to be localized to sites of DNA damage. The chromatin-based response to DNA damage is considered a transient event, with chromatin being restored to normal as DNA damage repair is completed. However, in individuals chronically exposed to environmental toxicants or with chronic inflammatory disease, repeated DNA damage-induced chromatin rearrangement may ultimately lead to permanent epigenetic alterations. Understanding the mechanism behind exposure-induced epigenetic changes will allow us to develop strategies to prevent or reverse these changes. This review focuses on epigenetic changes and DNA damage induced by environmental exposures, the chromatin changes that occur around sites of DNA damage, and how these transient chromatin changes may lead to heritable epigenetic alterations at sites of chronic exposure. PMID:24259318

  1. DNA Damage Responses Are Induced by tRNA Anticodon Nucleases and Hygromycin B.


    Wemhoff, Sabrina; Klassen, Roland; Beetz, Anja; Meinhardt, Friedhelm


    Previous studies revealed DNA damage to occur during the toxic action of PaT, a fungal anticodon ribonuclease (ACNase) targeting the translation machinery via tRNA cleavage. Here, we demonstrate that other translational stressors induce DNA damage-like responses in yeast as well: not only zymocin, another ACNase from the dairy yeast Kluyveromyces lactis, but also translational antibiotics, most pronouncedly hygromycin B (HygB). Specifically, DNA repair mechanisms BER (base excision repair), HR (homologous recombination) and PRR (post replication repair) provided protection, whereas NHEJ (non-homologous end-joining) aggravated toxicity of all translational inhibitors. Analysis of specific BER mutants disclosed a strong HygB, zymocin and PaT protective effect of the endonucleases acting on apurinic sites. In cells defective in AP endonucleases, inactivation of the DNA glycosylase Ung1 increased tolerance to ACNases and HygB. In addition, Mag1 specifically contributes to the repair of DNA lesions caused by HygB. Consistent with DNA damage provoked by translation inhibitors, mutation frequencies were elevated upon exposure to both fungal ACNases and HygB. Since polymerase ζ contributed to toxicity in all instances, error-prone lesion-bypass probably accounts for the mutagenic effects. The finding that differently acting inhibitors of protein biosynthesis induce alike cellular responses in DNA repair mutants is novel and suggests the dependency of genome stability on translational fidelity.

  2. The DNA damage response induced by infection with human cytomegalovirus and other viruses.


    Xiaofei, E; Kowalik, Timothy F


    Viruses use different strategies to overcome the host defense system. Recent studies have shown that viruses can induce DNA damage response (DDR). Many of these viruses use DDR signaling to benefit their replication, while other viruses block or inactivate DDR signaling. This review focuses on the effects of DDR and DNA repair on human cytomegalovirus (HCMV) replication. Here, we review the DDR induced by HCMV infection and its similarities and differences to DDR induced by other viruses. As DDR signaling pathways are critical for the replication of many viruses, blocking these pathways may represent novel therapeutic opportunities for the treatment of certain infectious diseases. Lastly, future perspectives in the field are discussed.

  3. Clustered DNA damages induced in human hematopoietic cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Bennett, Paula V.; Cintron-Torres, Nela; Hada, Megumi; Trunk, John; Monteleone, Denise; Sutherland, John C.; Laval, Jacques; Stanislaus, Marisha; Gewirtz, Alan


    Ionizing radiation induces clusters of DNA damages--oxidized bases, abasic sites and strand breaks--on opposing strands within a few helical turns. Such damages have been postulated to be difficult to repair, as are double strand breaks (one type of cluster). We have shown that low doses of low and high linear energy transfer (LET) radiation induce such damage clusters in human cells. In human cells, DSB are about 30% of the total of complex damages, and the levels of DSBs and oxidized pyrimidine clusters are similar. The dose responses for cluster induction in cells can be described by a linear relationship, implying that even low doses of ionizing radiation can produce clustered damages. Studies are in progress to determine whether clusters can be produced by mechanisms other than ionizing radiation, as well as the levels of various cluster types formed by low and high LET radiation.

  4. Clustered DNA damages induced in human hematopoietic cells by low doses of ionizing radiation

    NASA Technical Reports Server (NTRS)

    Sutherland, Betsy M.; Bennett, Paula V.; Cintron-Torres, Nela; Hada, Megumi; Trunk, John; Monteleone, Denise; Sutherland, John C.; Laval, Jacques; Stanislaus, Marisha; Gewirtz, Alan


    Ionizing radiation induces clusters of DNA damages--oxidized bases, abasic sites and strand breaks--on opposing strands within a few helical turns. Such damages have been postulated to be difficult to repair, as are double strand breaks (one type of cluster). We have shown that low doses of low and high linear energy transfer (LET) radiation induce such damage clusters in human cells. In human cells, DSB are about 30% of the total of complex damages, and the levels of DSBs and oxidized pyrimidine clusters are similar. The dose responses for cluster induction in cells can be described by a linear relationship, implying that even low doses of ionizing radiation can produce clustered damages. Studies are in progress to determine whether clusters can be produced by mechanisms other than ionizing radiation, as well as the levels of various cluster types formed by low and high LET radiation.

  5. Studies of soft X-ray-induced Auger effect on the induction of DNA damage.


    Yokoya, A; Fuji, K; Shikazono, N; Akamatsu, K; Urushibara, A; Watanabe, R


    To understand the characteristics of DNA damage induced by Auger effect in DNA by ultrasoft X-irradiation. In situ electron paramagnetic resonance (EPR) spectroscopy as well as biochemical analysis has been applied to examine the DNA damage induction in both viewpoints of intermediate species and final products. Unpaired electron species induced in a calf thymus DNA film irradiated with monochromatic ultrasoft X-rays (270-580 eV) was observed using an X-band EPR spectrometer installed in a synchrotron beamline. To determine the yield of single strand break (SSB), pUC18 plasmid DNA was irradiated and then analyzed by agarose gel electrophoresis. To analyze molecular change in a single strand DNA, a new technique using DNA-denaturation-treatment has been applied to quantify multiple SSB arising in both DNA strands. Short-lived EPR spectra were observed during irradiation. The intensity of transient EPR spectrum shows the similar energy dependence with that of the SSB yield around oxygen K-edge in particular. The fraction of the single-strand plasmid DNA (SS-DNA) after irradiation could be determined using a low-temperature-denaturation condition. The obtained slope of the dose-response for SS-DNA shows half of that of closed circular DNA as expected under the diluted solution condition. The availability of an EPR apparatus installed in a synchrotron beamline is demonstrated by detecting very short-lived unpaired electron species. Transient EPR spectra of DNA show the similar energy dependence to that of the SSB yield. The proposed DNA-denaturation assay works as expected using the low-temperature-denaturation condition.

  6. Lead-induced DNA damage in Vicia faba root cells: potential involvement of oxidative stress.


    Pourrut, Bertrand; Jean, Séverine; Silvestre, Jérôme; Pinelli, Eric


    Genotoxic effects of lead (0-20μM) were investigated in whole-plant roots of Vicia faba L., grown hydroponically under controlled conditions. Lead-induced DNA damage in V. faba roots was evaluated by use of the comet assay, which allowed the detection of DNA strand-breakage and with the V. faba micronucleus test, which revealed chromosome aberrations. The results clearly indicate that lead induced DNA fragmentation in a dose-dependant manner with a maximum effect at 10μM. In addition, at this concentration, DNA damage time-dependently increased until 12h. Then, a decrease in DNA damages was recorded. The significant induction of micronucleus formation also reinforced the genotoxic character of this metal. Direct interaction of lead with DNA was also evaluated with the a-cellular comet assay. The data showed that DNA breakages were not associated with a direct effect of lead on DNA. In order to investigate the relationship between lead genotoxicity and oxidative stress, V. faba were exposed to lead in the presence or absence of the antioxidant Vitamin E, or the NADPH-oxidase inhibitor dephenylene iodonium (DPI). The total inhibition of the genotoxic effects of lead (DNA breakage and micronucleus formation) by these compounds reveals the major role of reactive oxygen species (ROS) in the genotoxicity of lead. These results highlight, for the first time in vivo and in whole-plant roots, the relationship between ROS, DNA strand-breaks and chromosome aberrations induced by lead. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Persistent and heritable structural damage induced in heterochromatic DNA from rat liver by N-nitrosodimethylamine

    SciTech Connect

    Ward, E.J.; Stewart, B.W.


    Analysis, by benzoylated DEAE-cellulose chromatography, has been made of structural change in eu- and heterochromatic DNA from rat liver following administration of the carcinogen N-nitrosodimethylamine. Either hepatic DNA was prelabeled with (/sup 3/H)thymidine administered 2-3 weeks before injection of the carcinogen or the labeled precursor was given during regenerative hyperplasia in rats treated earlier with N-nitrosodimethylamine. Following phenol extraction of either whole liver homogenate or nuclease-fractionated eu- and heterochromatin, carcinogen-modified DNA was examined by stepwise or caffeine gradient elution from benzoylated DEAE-cellulose. In whole DNA, nitrosamine-induced single-stranded character was maximal 4-24 h after treatment, declining rapidly thereafter; gradient elution of these DNA preparations also provided short-term evidence of structural change. Caffeine gradient chromatography suggested short-term nitrosamine-induced structural change in euchromatic DNA, while increased binding of heterochromatic DNA was evident for up to 3 months after carcinogen treatment. Preparations of newly synthesized heterochromatic DNA from animals subjected to hepatectomy up to 2 months after carcinogen treatment provided evidence of heritable structural damage. Carcinogen-induced binding of heterochromatic DNA to benzoylated DEAE-cellulose was indicative of specific structural lesions whose affinity equalled that of single-stranded DNA up to 1.0 kilobase in length. The data suggest that structural lesions in heterochromatin, which may be a consequence of incomplete repair, are preferentially degraded by endogenous nuclease(s).

  8. The protective effect of clay minerals against damage to adsorbed DNA induced by cadmium and mercury.


    Hou, Yakun; Wu, Pingxiao; Zhu, Nengwu


    The adsorption of Salmon Sperm DNA on three kinds of raw clay (rectorite, montmorillonite and sericite) was investigated as a function of pH, ionic strength and the concentrations of DNA and phosphate ions in solution. The DNA adsorption was reduced in the following order: rectorite>montmorillonite>sericite. Based on these findings, there is a strong evidence that the mechanisms for DNA adsorption on clay involve electrostatic forces, cation bridging and ligand exchange. Cyclic voltammetry (CV) and UV-vis absorption and fluorescence spectroscopy were used to compare the properties of unbound DNA and the absorbed DNA on rectorite, both in the absence and presence of Cd(2+) and Hg(2+) inaqueous solutions. The interaction of heavy metals with the unbound DNA was evidenced by the disappearance of reduction peaks in CV, a small bathochromic shift in UV-vis spectroscopy and an incomplete quenching in the emission spectra. Such changes were not observed in the DNA-rectorite hybrids, which is evidence that adsorption on the clay can reduce the extent of the DNA damage caused by heavy metals. Therefore, in these experience the rectorite played an important role in protecting DNA against Cd(2+) and Hg(2+) induced damage.

  9. Facilitation of DNA damage-induced apoptosis by endoplasmic reticulum protein mitsugumin23

    SciTech Connect

    Yamazaki, Tetsuo; Sasaki, Nozomi; Nishi, Miyuki; Takeshima, Hiroshi


    The endoplasmic reticulum (ER) emanates context-dependent signals, thereby mediating cellular response to a variety of stresses. However, the underlying molecular mechanisms have been enigmatic. To better understand the signaling capacity of the ER, we focused on roles played by mitsugumin23 (MG23), a protein residing predominantly in this organelle. Overexpression of MG23 in human embryonic kidney 293T cells specifically enhanced apoptosis triggered by etoposide, a DNA-damaging anti-cancer drug. Conversely, genetic deletion of MG23 reduced susceptibility of thymocytes to DNA damage-induced apoptosis, which was demonstrated by whole-body irradiation experiments. In this setting, induction of the tumor-suppressor gene p53 was attenuated in MG23-knockout thymocytes as compared with their wild-type counterparts, consistent with the elevated radioresistance. It is therefore suggested that MG23 is an essential component of ER-generated lethal signals provoked upon DNA damage, specifying cell fate under pathophysiological conditions.

  10. Evaluation of DNA damage induced by Auger electrons from (137)Cs.


    Watanabe, Ritsuko; Hattori, Yuya; Kai, Takeshi


    To understand the biological effect of external and internal exposure from (137)Cs, DNA damage spectrum induced by directly emitted electrons (γ-rays, internal conversion electrons, Auger electrons) from (137)Cs was compared with that induced by (137)Cs γ-rays. Monte Carlo track simulation method was used to calculate the microscopic energy deposition pattern in liquid water. Simulation was performed for the two simple target systems in microscale. Radiation sources were placed inside for one system and outside for another system. To simulate the energy deposition by directly emitted electrons from (137)Cs placed inside the system, the multiple ejections of electrons after internal conversion were considered. In the target systems, induction process of DNA damage was modeled and simulated for both direct energy deposition and the water radical reaction on the DNA. The yield and spatial distribution of simple and complex DNA damage including strand breaks and base lesions were calculated for irradiation by electrons and γ-rays from (137)Cs. The simulation showed that the significant difference in DNA damage spectrum was not caused by directly ejected electrons and γ-rays from (137)Cs. The result supports the existing perception that the biological effects by internal and external exposure by (137)Cs are equivalent.

  11. Static magnetic fields modulate X-ray-induced DNA damage in human glioblastoma primary cells.


    Teodori, Laura; Giovanetti, Anna; Albertini, Maria Cristina; Rocchi, Marco; Perniconi, Barbara; Valente, Maria Giovanna; Coletti, Dario


    Although static magnetic fields (SMFs) are used extensively in the occupational and medical fields, few comprehensive studies have investigated their possible genotoxic effect and the findings are controversial. With the advent of magnetic resonance imaging-guided radiation therapy, the potential effects of SMFs on ionizing radiation (IR) have become increasingly important. In this study we focused on the genotoxic effect of 80 mT SMFs, both alone and in combination with (i.e. preceding or following) X-ray (XR) irradiation, on primary glioblastoma cells in culture. The cells were exposed to: (i) SMFs alone; (ii) XRs alone; (iii) XR, with SMFs applied during recovery; (iv) SMFs both before and after XR irradiation. XR-induced DNA damage was analyzed by Single Cell Gel Electrophoresis assay (comet assay) using statistical tools designed to assess the tail DNA (TD) and tail length (TL) as indicators of DNA fragmentation. Mitochondrial membrane potential, known to be affected by IR, was assessed using the JC-1 mitochondrial probe. Our results showed that exposure of cells to 5 Gy of XR irradiation alone led to extensive DNA damage, which was significantly reduced by post-irradiation exposure to SMFs. The XR-induced loss of mitochondrial membrane potential was to a large extent averted by exposure to SMFs. These data suggest that SMFs modulate DNA damage and/or damage repair, possibly through a mechanism that affects mitochondria.

  12. Static magnetic fields modulate X-ray-induced DNA damage in human glioblastoma primary cells

    PubMed Central

    Teodori, Laura; Giovanetti, Anna; Albertini, Maria Cristina; Rocchi, Marco; Perniconi, Barbara; Valente, Maria Giovanna; Coletti, Dario


    Although static magnetic fields (SMFs) are used extensively in the occupational and medical fields, few comprehensive studies have investigated their possible genotoxic effect and the findings are controversial. With the advent of magnetic resonance imaging-guided radiation therapy, the potential effects of SMFs on ionizing radiation (IR) have become increasingly important. In this study we focused on the genotoxic effect of 80 mT SMFs, both alone and in combination with (i.e. preceding or following) X-ray (XR) irradiation, on primary glioblastoma cells in culture. The cells were exposed to: (i) SMFs alone; (ii) XRs alone; (iii) XR, with SMFs applied during recovery; (iv) SMFs both before and after XR irradiation. XR-induced DNA damage was analyzed by Single Cell Gel Electrophoresis assay (comet assay) using statistical tools designed to assess the tail DNA (TD) and tail length (TL) as indicators of DNA fragmentation. Mitochondrial membrane potential, known to be affected by IR, was assessed using the JC-1 mitochondrial probe. Our results showed that exposure of cells to 5 Gy of XR irradiation alone led to extensive DNA damage, which was significantly reduced by post-irradiation exposure to SMFs. The XR-induced loss of mitochondrial membrane potential was to a large extent averted by exposure to SMFs. These data suggest that SMFs modulate DNA damage and/or damage repair, possibly through a mechanism that affects mitochondria. PMID:24345558

  13. DNA Damage-induced Heterogeneous Nuclear Ribonucleoprotein K SUMOylation Regulates p53 Transcriptional Activation*

    PubMed Central

    Pelisch, Federico; Pozzi, Berta; Risso, Guillermo; Muñoz, Manuel Javier; Srebrow, Anabella


    Heterogeneous nuclear ribonucleoprotein (hnRNP) K is a nucleocytoplasmic shuttling protein that is a key player in the p53-triggered DNA damage response, acting as a cofactor for p53 in response to DNA damage. hnRNP K is a substrate of the ubiquitin E3 ligase MDM2 and, upon DNA damage, is de-ubiquitylated. In sharp contrast with the role and consequences of the other post-translational modifications, nothing is known about the role of SUMO conjugation to hnRNP K in p53 transcriptional co-activation. In the present work, we show that hnRNP K is modified by SUMO in lysine 422 within its KH3 domain, and sumoylation is regulated by the E3 ligase Pc2/CBX4. Most interestingly, DNA damage stimulates hnRNP K sumoylation through Pc2 E3 activity, and this modification is required for p53 transcriptional activation. Abrogation of hnRNP K sumoylation leads to an aberrant regulation of the p53 target gene p21. Our findings link the DNA damage-induced Pc2 activation to the p53 transcriptional co-activation through hnRNP K sumoylation. PMID:22825850

  14. DNA damage induces the accumulation of Tiam1 by blocking β-TrCP-dependent degradation.


    Zhu, Guixin; Fan, Zhongyun; Ding, Miao; Mu, Libing; Liang, Juan; Ding, Yajie; Fu, Yu; Huang, Binlu; Wu, Wei


    The Rac1/JNK cascade plays important roles in DNA damage-induced apoptosis. However, how this cascade is activated upon DNA damage remains to be fully understood. We show here that, in untreated cells, Tiam1, a Rac1-specific guanine nucleotide exchange factor, is phosphorylated by casein kinase 1 (CK1) at its C terminus, leading to Skp, Cullin, F-box-containing(β-TrCP) recognition, ubiquitination, and proteasome-mediated degradation. Upon DNA-damaging anticancer drug treatment, CK1/β-TrCP-mediated Tiam1 degradation is abolished, and the accumulated Tiam1 contributes to downstream activation of Rac1/JNK. Consistently, tumor cells overexpressing Tiam1 are hypersensitive to DNA-damaging drug treatment. In xenograft mice, Tiam1-high cells are more susceptible to doxorubicin treatment. Thus, our results uncover that inhibition of proteasome-mediated Tiam1 degradation is an upstream event leading to Rac1/JNK activation and cell apoptosis in response to DNA-damaging drug treatment. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. DNA Damage Induces the Accumulation of Tiam1 by Blocking β-TrCP-dependent Degradation*

    PubMed Central

    Zhu, Guixin; Fan, Zhongyun; Ding, Miao; Mu, Libing; Liang, Juan; Ding, Yajie; Fu, Yu; Huang, Binlu; Wu, Wei


    The Rac1/JNK cascade plays important roles in DNA damage-induced apoptosis. However, how this cascade is activated upon DNA damage remains to be fully understood. We show here that, in untreated cells, Tiam1, a Rac1-specific guanine nucleotide exchange factor, is phosphorylated by casein kinase 1 (CK1) at its C terminus, leading to Skp, Cullin, F-box-containingβ-TrCP recognition, ubiquitination, and proteasome-mediated degradation. Upon DNA-damaging anticancer drug treatment, CK1/β-TrCP-mediated Tiam1 degradation is abolished, and the accumulated Tiam1 contributes to downstream activation of Rac1/JNK. Consistently, tumor cells overexpressing Tiam1 are hypersensitive to DNA-damaging drug treatment. In xenograft mice, Tiam1-high cells are more susceptible to doxorubicin treatment. Thus, our results uncover that inhibition of proteasome-mediated Tiam1 degradation is an upstream event leading to Rac1/JNK activation and cell apoptosis in response to DNA-damaging drug treatment. PMID:24737324

  16. TGF-{beta}{sub 1}-induced cardiac myofibroblasts are nonproliferating functional cells carrying DNA damages

    SciTech Connect

    Petrov, Victor V. Pelt, Jos F. van; Vermeesch, Joris R.; Van Duppen, Viktor J.; Vekemans, Katrien; Fagard, Robert H.; Lijnen, Paul J.


    TGF-{beta}{sub 1} induces differentiation and total inhibition of cardiac MyoFb cell division and DNA synthesis. These effects of TGF-{beta}{sub 1} are irreversible. Inhibition of MyoFb proliferation is accompanied with the expression of Smad1, Mad1, p15Ink4B and total inhibition of telomerase activity. Surprisingly, TGF-{beta}{sub 1}-activated MyoFbs are growth-arrested not only at G1-phase but also at S-phase of the cell cycle. Staining with TUNEL indicates that these cells carry DNA damages. However, the absolute majority of MyoFbs are non-apoptotic cells as established with two apoptosis-specific methods, flow cytometry and caspase-dependent cleavage of cytokeratin 18. Expression in MyoFbs of proliferative cell nuclear antigen even in the absence of serum confirms that these MyoFbs perform repair of DNA damages. These results suggest that TGF-{beta}{sub 1}-activated MyoFbs can be growth-arrested by two checkpoints, the G1/S checkpoint, which prevents cells from entering S-phase and the intra-S checkpoint, which is activated by encountering DNA damage during the S phase or by unrepaired damage that escapes the G1/S checkpoint. Despite carrying of the DNA damages TGF-{beta}{sub 1}-activated MyoFbs are highly functional cells producing lysyl oxidase and contracting the collagen matrix.

  17. Heavy ion induced damage to plasmid DNA: plateau region vs. spread out Bragg-peak

    NASA Astrophysics Data System (ADS)

    Dang, H. M.; van Goethem, M. J.; van der Graaf, E. R.; Brandenburg, S.; Hoekstra, R.; Schlathölter, T.


    We have investigated the damage of synthetic plasmid pBR322 DNA in dilute aqueous solutions induced by fast carbon ions. The relative contribution of indirect damage and direct damage to the DNA itself is expected to vary with linear energy transfer along the ion track, with the direct damage contribution increasing towards the Bragg peak. Therefore, 12C ions at the spread-out Bragg peak (dose averaged LET∞ = 189 ± 15 keV/ μm) and in the plateau region of the Bragg curve (LET = 40 keV/ μm) were employed and the radical scavenger concentration in the plasmid solution was varied to quantify the indirect effect. In order to minimize the influence of 12C break-up fragments, a relatively low initial energy of 90 MeV/nucleon was employed for the carbon ions. DNA damage has been quantified by subsequent electrophoresis on agarose gels. We find that strand breaks due to both indirect and direct effects are systematically higher in the plateau region as compared to the Bragg peak region with the difference being smallest at high scavenging capacities. In view of the fact that the relative biological effectiveness for many biological endpoints is maximum at the Bragg peak our findings imply that DNA damage at the Bragg peak is qualitatively most severe.

  18. Repair of DNA Damage Induced by the Cytidine Analog Zebularine Requires ATR and ATM in Arabidopsis[OPEN

    PubMed Central

    Liu, Chun-Hsin; Finke, Andreas; Díaz, Mariana; Rozhon, Wilfried; Poppenberger, Brigitte; Baubec, Tuncay; Pecinka, Ales


    DNA damage repair is an essential cellular mechanism that maintains genome stability. Here, we show that the nonmethylable cytidine analog zebularine induces a DNA damage response in Arabidopsis thaliana, independent of changes in DNA methylation. In contrast to genotoxic agents that induce damage in a cell cycle stage-independent manner, zebularine induces damage specifically during strand synthesis in DNA replication. The signaling of this damage is mediated by additive activity of ATAXIA TELANGIECTASIA MUTATED AND RAD3-RELATED and ATAXIA TELANGIECTASIA MUTATED kinases, which cause postreplicative cell cycle arrest and increased endoreplication. The repair requires a functional STRUCTURAL MAINTENANCE OF CHROMOSOMES5 (SMC5)-SMC6 complex and is accomplished predominantly by synthesis-dependent strand-annealing homologous recombination. Here, we provide insight into the response mechanism for coping with the genotoxic effects of zebularine and identify several components of the zebularine-induced DNA damage repair pathway. PMID:26023162

  19. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)


    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  20. Clusters of DNA damage induced by ionizing radiation: formation of short DNA fragments. II. Experimental detection

    NASA Technical Reports Server (NTRS)

    Rydberg, B.; Chatterjee, A. (Principal Investigator)


    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single delta rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA (see the accompanying paper: W.R. Holley and A. Chatterjee, Radiat. Res. 145, 188-199, 1996). In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [3H]thymidine and exposed at 0 degrees C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/microns. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated "regionally multiply damaged sites." Postirradiation incubation at 37 degrees C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown.

  1. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. II. Experimental detection

    SciTech Connect

    Rydberg, B.


    The basic 30-nm chromatin fiber in the mammalian cell consists of an unknown (possibly helical) arrangement of nucleosomes, with about 1.2 kb of DNA per 10-nm length of fiber. Track-structure considerations suggest that interactions of single {delta} rays or high-LET particles with the chromatin fiber might result in the formation of multiple lesions spread over a few kilobases of DNA. In particular, multiple DNA double-strand breaks and single-strand breaks may form. To test this experimentally, primary human fibroblasts were labeled with [{sup 3}H]thymidine and exposed at 0{degrees}C to X rays or accelerated nitrogen or iron ions in the LET range of 97-440 keV/pm. DNA was isolated inside agarose plugs and subjected to agarose gel electrophoresis under conditions that allowed good separation of 0.1-2 kb size DNA. The bulk of DNA remained in the well or migrated only a small distance into the gel. It was found that DNA fragments in the expected size range were formed linearly with dose with an efficiency that increased with LET. A comparison of the yield of such fragments with the yield of total DNA double-strand breaks suggests that for the high-LET ions a substantial proportion (20-90%) of DNA double-strand breaks are accompanied within 0.1-2 kb by at least one additional DNA double-strand break. It is shown that these results are in good agreement with theoretical calculations based on treating the 30-nm chromatin fiber as the target for ionizing particles. Theoretical considerations also predict that the clusters will contain numerous single-strand breaks and base damages. It is proposed that such clusters be designated {open_quotes}regionally multiply damaged sites.{close_quotes} Postirradiation incubation at 37{degrees}C resulted in a decline in the number of short DNA fragments, suggesting a repair activity. The biological significance of regionally multiply damaged sites is presently unknown. 34 refs., 6 figs., 1 tab.

  2. DNA damage-induced nuclear translocation of Apaf-1 is mediated by nucleoporin Nup107

    PubMed Central

    Jagot-Lacoussiere, Léonard; Faye, Audrey; Bruzzoni-Giovanelli, Heriberto; Villoutreix, Bruno O; Rain, Jean-Christophe; Poyet, Jean-Luc


    Beside its central role in the mitochondria-dependent cell death pathway, the apoptotic protease activating factor 1 (Apaf-1) is involved in the DNA damage response through cell-cycle arrest induced by genotoxic stress. This non-apoptotic function requires a nuclear translocation of Apaf-1 during the G1-to-S transition. However, the mechanisms that trigger the nuclear accumulation of Apaf-1 upon DNA damage remain to be investigated. Here we show that the main 4 isoforms of Apaf-1 can undergo nuclear translocation and restore Apaf-1 deficient MEFs cell cycle arrest in the S phase following genotoxic stress through activation of Chk-1. Interestingly, DNA damage-dependent nuclear accumulation of Apaf-1 occurs independently of p53 and the retinoblastoma (pRb) pathway. We demonstrated that Apaf-1 associates with the nucleoporin Nup107 and this association is necessary for Apaf-1 nuclear import. The CED-4 domain of Apaf-1 directly binds to the central domain of Nup107 in an ATR-regulated, phosphorylation-dependent manner. Interestingly, expression of the Apaf-1-interacting domain of Nup107 interfered with Apaf-1 nuclear translocation upon genotoxic stress, resulting in a marked reduction of Chk-1 activation and cell cycle arrest. Thus, our results confirm the crucial role of Apaf-1 nuclear relocalization in mediating cell-cycle arrest induced by genotoxic stress and implicate Nup107 as a critical regulator of the DNA damage-induced intra-S phase checkpoint response. PMID:25695197

  3. ELF magnetic fields do not affect cell survival and DNA damage induced by ultraviolet B.


    Mizuno, Kohei; Narita, Eijiro; Yamada, Masaru; Shinohara, Naoki; Miyakoshi, Junji


    We investigated whether extremely low frequency (ELF) magnetic field exposure has modification effects on cell survival after ultraviolet B (UV-B) irradiation and on repair process of DNA damage induced by UV-B irradiation in WI38VA13 subcloned 2RA and XP2OS(SV) cells. The ELF magnetic field exposure was conducted using a Helmholtz coil-based system that was designed to generate a sinusoidal magnetic field at 5 mT and 60 Hz. Cell survival was assessed by WST assay after UV-B irradiation at 20-80 J/m(2) , ELF magnetic field exposure for 24 h, followed by incubation for 48 h. DNA damage was assessed by quantification of cyclobutane pyrimidine dimer formation and 6-4 photoproduct formation using ELISA after UV-B irradiation at 20-80 J/m(2) followed by ELF magnetic field exposure for 24 h. No significant changes were observed in cell survival between ELF magnetic field and sham exposures. Similarly, DNA damage induced by UV-B irradiation did not change significantly following ELF magnetic field exposure. Our results suggest that ELF magnetic field exposure at 5 mT does not have modification effect on cell survival after UV-B irradiation and on repair process of DNA damage induced by UV-B irradiation.

  4. DNA damage and oxidative stress induced by acetylsalicylic acid in Daphnia magna.


    Gómez-Oliván, Leobardo Manuel; Galar-Martínez, Marcela; Islas-Flores, Hariz; García-Medina, Sandra; SanJuan-Reyes, Nely


    Acetylsalicylic acid is a nonsteroidal anti-inflammatory widely used due to its low cost and high effectiveness. This compound has been found in water bodies worldwide and is toxic to aquatic organisms; nevertheless its capacity to induce oxidative stress in bioindicators like Daphnia magna remains unknown. This study aimed to evaluate toxicity in D. magna induced by acetylsalicylic acid in water, using oxidative stress and DNA damage biomarkers. An acute toxicity test was conducted in order to determine the median lethal concentration (48-h LC50) and the concentrations to be used in the subsequent subacute toxicity test in which the following biomarkers were evaluated: lipid peroxidation, oxidized protein content, activity of the antioxidant enzymes superoxide dismutase, catalase, and glutathione peroxidase, and level of DNA damage. Lipid peroxidation level and oxidized protein content were significantly increased (p<0.05), and antioxidant enzymes significantly altered with respect to controls; while the DNA damage were significantly increased (p<0.05) too. In conclusion, acetylsalicylic acid induces oxidative stress and DNA damage in D. magna.

  5. Baicalein protects mice against radiation-induced DNA damages and genotoxicity.


    Gandhi, Nitin Motilal


    Baicalein is the major flavonoid extracted from the root of Scutellaria baicaleins. This flavonoid is used extensively in Chinese herbal medicine. In the present study baicalein is evaluated for its radioprotective properties. Human blood cells when exposed to the γ-radiation ex vivo in presence of baicalein underwent the reduced DNA damage compared to the control. Baicalein administration prior to the whole-body γ-radiation (4 Gy) exposure of mice resulted in protecting the damage to the DNA as measured in their blood cells by alkaline comet assay. Mice when exposed to the radiation (whole body; 1.7 Gy) resulted in damage to the bone marrow as measured by micronucleated reticulocyte (MNRET) formation. Baicalein pre-treatment reduces the radiation induced damage to the bone marrow cells, as there was decrease in the percentage MNRET formation. These findings indicate radio-protecting ability of baicalein.

  6. Correlation of binding efficacies of DNA to flavonoids and their induced cellular damage.


    Das, Asmita; Majumder, Debashis; Saha, Chabita


    Flavonoids are dietary intakes which are bestowed with several health benefits. The most studied property of flavonoids is their antioxidant efficacy. Among the chosen flavonoids Quercetin, Kaempferol and Myricetin is catagorized as flavonols whereas Apigenin and Luteolin belong to the flavone group. In the present study anti-cancer properties of flavonoids are investigated on the basis of their binding efficacy to ct-DNA and their ability to induce cytotoxicity in K562 leukaemic cells. The binding affinities of the flavonoids with calf thymus DNA (ct-DNA) are in the order Quercetin>Myricetin>Luteolin>Kaempferol>Apigenin. Quercetin with fewer OH than myricetin has higher affinity towards DNA suggesting that the number and position of OH influence the binding efficacies of flavonoids to ct-DNA. CD spectra and EtBr displacement studies evidence myricetin and apigenin to be stronger intercalators of DNA compared to quercetin. From comet assay results it is observed that quercetin and myricetin when used in combination induce higher DNA damage in K562 leukemic cells than when tested individually. Higher binding efficacy has been recorded for quercetin to DNA at lower pH, which is the micro environment of cancerous cells, and hence quercetin can act as a potential anti-cancer agent. Presence of Cu also increases cellular damage as recorded by comet assay. Copyright © 2017. Published by Elsevier B.V.

  7. NAD(+) administration decreases doxorubicin-induced liver damage of mice by enhancing antioxidation capacity and decreasing DNA damage.


    Wang, Ban; Ma, Yingxin; Kong, Xiaoni; Ding, Xianting; Gu, Hongchen; Chu, Tianqing; Ying, Weihai


    One of the major obstacles for cancer treatment is the toxic side effects of anti-cancer drugs. Doxorubicin (DOX) is one of the most widely used anti-cancer drugs, which produces significant toxic side effects on the heart and such organs as the liver. Because NAD(+) can decrease cellular or tissue damage under multiple conditions, we hypothesized that NAD(+) administration may decrease DOX-induced hepatotoxicity. In this study we tested this hypothesis by using a mouse model, showing that NAD(+) administration can significantly attenuate DOX-induced increase in serum glutamate oxaloacetate transaminase activity and decrease in liver weight. The NAD(+) administration also attenuated the DOX-induced increases in the levels of double-strand DNA (dsDNA) damage, TUNEL signals, and active caspase-3. Furthermore, our data has suggested that the NAD(+) administration could produce protective effects at least partially by restoring the antioxidation capacity of the liver, because NAD(+) administration can attenuate the decreases in both the GSH levels and the glutathione reductase activity of the DOX-treated liver, which could play a significant role in the DOX-induced hepatotoxicity. This finding has provided the first evidence indicating that NAD(+) is capable of increasing the antioxidation capacity of tissues. Collectively, our study has found that NAD(+) can significantly decrease DOX-induced liver damage at least partially by enhancing antioxidation capacity and decreasing dsDNA damage. Because it can also selectively decrease tumor cell survival, NAD(+) may have significant merits over antioxidants for applying jointly with DOX to decrease the toxic side effects of DOX.

  8. Lead-, cadmium-, and arsenic-induced DNA damage in rat germinal cells.


    Nava-Hernández, Martha P; Hauad-Marroquín, Leticia A; Bassol-Mayagoitia, Susana; García-Arenas, Guadalupe; Mercado-Hernández, Roberto; Echávarri-Guzmán, Miguel A; Cerda-Flores, Ricardo M


    Toxic agents can interfere with the male reproductive system at many targets. One of the major unresolved questions concerning male infertility is identification of its molecular origins. Clinical and animal studies indicate that abnormalities of spermatogenesis result from exposure to three toxic metals (lead acetate, cadmium chloride, and arsenic trioxide), but the effects on primary spermatocyte DNA of the male rat after chronic exposure to these metals have not been identified. The aims of this study were to analyze, in three independent experiments, the DNA damage induced by lead (Pb), cadmium (Cd), and arsenic (As) in rat germinal cells during three time periods, and to determine the relationship between DNA damage and blood Pb, blood Cd, and urine As levels. For lead acetate and cadmium chloride experiments, blood was collected by cardiac puncture, while for arsenic trioxide a 24-h urine sample was collected. Afterward, the animals were sacrificed by decapitation. Pachytene spermatocytes from rat testes were purified by trypsin digestion followed by centrifugal elutriation. After establishment of cell purity and viability, DNA damage (tail length) was measured employing a single cell gel/comet assay. Significant DNA damage was found in primary spermatocytes from rats with chronic exposure (13 weeks) to toxic metals. In conclusion, these findings indicate that exposure to toxic metals affects primary spermatocyte DNA and are suggestive of possible direct testicular toxicity.

  9. A nanodosimetric model of radiation-induced clustered DNA damage yields.


    Garty, G; Schulte, R; Shchemelinin, S; Leloup, C; Assaf, G; Breskin, A; Chechik, R; Bashkirov, V; Milligan, J; Grosswendt, B


    We present a nanodosimetric model for predicting the yield of double strand breaks (DSBs) and non-DSB clustered damages induced in irradiated DNA. The model uses experimental ionization cluster size distributions measured in a gas model by an ion counting nanodosimeter or, alternatively, distributions simulated by a Monte Carlo track structure code developed to simulate the nanodosimeter. The model is based on a straightforward combinatorial approach translating ionizations, as measured or simulated in a sensitive gas volume, to lesions in a DNA segment of one-two helical turns considered equivalent to the sensitive volume of the nanodosimeter. The two model parameters, corresponding to the probability that a single ion detected by the nanodosimeter corresponds to a single strand break or a single lesion (strand break or base damage) in the equivalent DNA segment, were tuned by fitting the model-predicted yields to previously measured double-strand break and double-strand lesion yields in plasmid DNA irradiated with protons and helium nuclei. Model predictions were also compared to both yield data simulated by the PARTRAC code for protons of a wide range of different energies and experimental DSB and non-DSB clustered DNA damage yield data from the literature. The applicability and limitations of this model in predicting the LET dependence of clustered DNA damage yields are discussed.

  10. Simulated microgravity conditions and carbon ion irradiation induce spermatogenic cell apoptosis and sperm DNA damage.


    Li, Hong Yan; Zhang, Hong; Miao, Guo Ying; Xie, Yi; Sun, Chao; Di, Cui Xia; Liu, Yang; Liu, Yuan Yuan; Zhang, Xin; Ma, Xiao Fei; Xu, Shuai; Gan, Lu; Zhou, Xin


    To investigate the effect of simulated microgravity and carbon ion irradiation (CIR) on spermatogenic cell apoptosis and sperm DNA damage to the testis of male Swiss Webster mice, and assess the risk associated with space environment. Sperm DNA damage indicated by DNA fragmentation index (DFI) and high DNA stainability (HDS) was measured by sperm chromatin structure assay (SCSA). Apoptosis of spermatogenic cells was detected by annexin V-propidium iodide assay. Bax (the expression levels of p53) and proliferating cell nuclear antigen (PCNA) were measured by immunoblotting; p53 and PCNA were located by immunohistology. HDS, DFI, apoptosis index, and the expression levels of p53 and Bax were detected to be significantly higher in the experimental groups (P<0.05) compared with those in the control group; however, the PCNA expression varied to a certain degree. p53- and PCNA- positive expression were detected in each group, mainly in relation to the spermatogonic cells and spermatocytes. The findings of the present study demonstrated that simulated microgravity and CIR can induce spermatogenic cell apoptosis and sperm DNA damage. Sperm DNA damage may be one of the underlying mechanisms behind male fertility decline under space environment. These findings may provide a scientific basis for protecting astronauts and space traveler's health and safety. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  11. Stress-induced DNA damage: a case study in diffuse large B-cell lymphoma

    PubMed Central

    Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Castañeda-Priego, Ramón; Hernández-Lemus, Enrique


    DNA damage is one of the mechanisms of mutagenesis. Sequence integrity may be affected by the action of thermal changes, chemical agents, both endogenous and exogenous, and other environmental issues. Abnormally high mutation rates are referred to as genomic instability: a phenomenon closely related to the onset of cancer. Mutant genotypes may be able to confer some kind of selective advantage on subclonal cell populations, leading them to multiply until dominance in a localized tissue environment that later becomes the tumour. Cellular stress, especially that of oxidative and ionic nature, is a recognized trigger for DNA-damaging processes. A physico-chemical model has shown that high hysteresis rates in DNA denaturation curves may be indicative of dissipative processes inducing DNA damage, thus potentially leading to uncontrolled mutagenesis and genome instability. We here study selectively to what extent this phenomenon may occur by analysing the sequence length and composition effects on the thermodynamic behaviour and the presence of hysteresis in pressure-driven DNA denaturation; pronounced hysteresis in the denaturation/renaturation curves may indicate thermal susceptibility to DNA damage. In particular, we consider highly mutated regions of the genome characterized in diffuse large B-cell lymphoma on a recent whole exome next-generation sequencing effort. PMID:25209404

  12. Involvement of DNA polymerase beta in repairing oxidative damages induced by antitumor drug adriamycin

    SciTech Connect

    Liu Shukun; Wu Mei; Zhang Zunzhen


    Adriamycin (ADM) is a widely used antineoplastic drug. However, the increasing cellular resistance has become a serious limitation to ADM clinical application. The most important mechanism related to ADM-induced cell death is oxidative DNA damage mediated by reactive oxygen species (ROS). Base excision repair (BER) is a major pathway in the repair of DNA single strand break (SSB) and oxidized base. In this study, we firstly applied the murine embryo fibroblasts wild-type (pol {beta} +/+) and homozygous pol {beta} null cell (pol {beta} -/-) as a model to investigate ADM DNA-damaging effects and the molecular basis underlying these effects. Here, cellular sensitivity to ADM was examined using colorimetric assay and colony forming assay. ADM-induced cellular ROS level and the alteration of superoxide dismutase (SOD) activity were measured by commercial kits. Further, DNA strand break, chromosomal damage and gene mutation were assessed by comet assay, micronucleus test and hprt gene mutation assay, respectively. The results showed that pol {beta} -/- cells were more sensitive to ADM compared with pol {beta} +/+ cells and more severe SSB and chromosomal damage as well as higher hprt gene mutation frequency were observed in pol {beta} -/- cells. ROS level in pol {beta} -/- cells increased along with decreased activity of SOD. These results demonstrated that pol {beta} deficiency could enable ROS accumulation with SOD activity decrease, further elevate oxidative DNA damage, and subsequently result in SSB, chromosome cleavage as well as gene mutation, which may be partly responsible for the cytotoxicity of ADM and the hypersensitivity of pol {beta} -/- cells to ADM. These findings suggested that pol {beta} is vital for repairing oxidative damage induced by ADM.

  13. Oxidative DNA damage induced by benz[a]anthracene dihydrodiols in the presence of dihydrodiol dehydrogenase.


    Seike, Kazuharu; Murata, Mariko; Hirakawa, Kazutaka; Deyashiki, Yoshihiro; Kawanishi, Shosuke


    Tobacco smoke and polluted air are risk factors for lung cancer and contain many kinds of polycyclic aromatic hydrocarbons (PAHs) including benzo[a]pyrene (B[a]P) and benz[a]anthracene (BA). BA, as well as B[a]P, is assessed as probably carcinogenic to humans (IARC group 2A). BA is metabolized to several dihydrodiols. Dihydrodiol dehydrogenase (DD), a member of the aldo-keto reductase superfamily, catalyzes NAD(P)+-linked oxidation of dihydrodiols of aromatic hydrocarbons to corresponding catechols. To clarify the role of DD on PAH carcinogenesis, we examined oxidative DNA damage induced by trans-dihydrodiols of BA and B[a]P treated with DD using 32P-5'-end-labeled DNA fragments obtained from the human p53 tumor suppressor gene. In addition, we investigated the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), an indicator of oxidative DNA damage, in calf thymus DNA by using HPLC with an electrochemical detector. DD-catalyzed BA-1,2-dihydrodiol caused Cu(II)-mediated DNA damage including 8-oxodG formation in the presence of NAD+. BA-1,2-dihydrodiol induced a Fpg sensitive and piperidine labile G lesion at the 5'-ACG-3' sequence complementary to codon 273 of the human p53 tumor suppressor gene, which is known as a hotspot. DNA damage was inhibited by catalase and bathocuproine, suggesting the involvement of H2O2 and Cu(I). The observation of NADH production by UV-visible spectroscopy suggested that DD catalyzed BA-1,2-dihydrodiol most efficiently to the corresponding catechol among the PAH-dihydrodiols tested. A time-of-flight mass spectroscopic study showed that the catechol form of BA-1,2-dihydrodiol formed after DD treatment. In conclusion, BA-1,2-dihydrodiol can induce DNA damage more efficiently than B[a]P-7,8-dihydrodiol and other BA-dihydrodiols in the presence of DD. The reaction mechanism on oxidative DNA damage may be explained by theoretical calculations with an enthalpy change of dihydrodiols and oxidation potential of their catechol forms. DD

  14. Berberine induces apoptosis and DNA damage in MG‑63 human osteosarcoma cells.


    Zhu, Yu; Ma, Nan; Li, Hui-Xiang; Tian, Lin; Ba, Yu-Feng; Hao, Bin


    Berberine, an isoquinoline alkaloid extracted from the dry root of Coptidis Rhizoma, has been found to exhibit marked anticancer effects on a panel of established cancer cells. Among the human osteosarcoma lines treated, MG‑63 cells were found to be the most sensitive. The present study investigated the potential genotoxic effect of berberine on MG‑63 human osteosarcoma cells. The effect of berberine on cell viability was determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5‑diphenyltetrazolium bromide assay and cell apoptosis was analyzed by flow cytometry and a DNA ladder assay. γH2AX focus formation was used to detect DNA damage in MG-63 cells. Berberine induced a significant increase in apoptosis in MG-63 cells in a concentration- and time-dependent manner, as determined by DNA fragmentation analysis and flow cytometry. Furthermore, berberine induced significant concentration- and time-dependent increases in DNA damage compared with that in the negative control. In conclusion, these observations indicated that berberine induced apoptosis and DNA damage in MG‑63 cells.

  15. Berberine induces apoptosis and DNA damage in MG-63 human osteosarcoma cells

    PubMed Central



    Berberine, an isoquinoline alkaloid extracted from the dry root of Coptidis Rhizoma, has been found to exhibit marked anticancer effects on a panel of established cancer cells. Among the human osteosarcoma lines treated, MG-63 cells were found to be the most sensitive. The present study investigated the potential genotoxic effect of berberine on MG-63 human osteosarcoma cells. The effect of berberine on cell viability was determined using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and cell apoptosis was analyzed by flow cytometry and a DNA ladder assay. γH2AX focus formation was used to detect DNA damage in MG-63 cells. Berberine induced a significant increase in apoptosis in MG-63 cells in a concentration- and time-dependent manner, as determined by DNA fragmentation analysis and flow cytometry. Furthermore, berberine induced significant concentration- and time-dependent increases in DNA damage compared with that in the negative control. In conclusion, these observations indicated that berberine induced apoptosis and DNA damage in MG-63 cells. PMID:25050485

  16. Iron(III)-salen damages DNA and induces apoptosis in human cell via mitochondrial pathway.


    Woldemariam, Getachew A; Mandal, Subhrangsu S


    We synthesized a water soluble Fe(III)-salen complex and investigated its biochemical effects on DNA in vitro and on cultured human cells. We showed that Fe(III)-salen produces free radicals in the presence of reducing agent dithiothreitol (DTT) and induces DNA damage in vitro. Interestingly, upon treatment with Fe(III)-salen at concentration as low as 10microM, HEK293 human cells showed morphological changes, nuclear fragmentation, and nuclear condensation that are typical features of apoptotic cell death. The cytotoxicity measurement showed that IC(50) of Fe(III)-salen is 2.0microM for HEK293 cells. Furthermore, treatment with Fe(III)-salen resulted in translocation of cytochrome c from mitochondria to cytosol affecting mitochondrial membrane permeability. Our results demonstrated that Fe(III)-salen not only damages DNA in vitro, but also induces apoptosis in human cells via mitochondrial pathway.

  17. Effect of intercellular contact on DNA conformation, radiation-induced DNA damage, and mutation in Chinese hamster V79 cells

    SciTech Connect

    Olive, P.L.; Durand, R.E.


    Chinese hamster V79 cells, when grown as small spheroids in suspension culture, are more resistant to killing by ionizing radiation than when grown as monolayers. The authors have attempted to determine whether this enhanced survival following irradiation is reflected in DNA damage and repair at the structural level (by measuring alkali-induced DNA unwinding rates from strand breaks) and at the functional level (by measuring resistance to forward mutation at the HGPRT locus). For a given dose of radiation, the unwinding of DNA in high salt/weak alkali was less complete for spheroid DNA than for monolayer DNA, and the rate of repair of radiation damage was faster in spheroid DNA. These differential responses were lost 8 hr after separation of spheroids into single cells, coinciding with loss of radioresistance measured by clonogenicity. In addition, spheroid cells showed fewer numbers of induced mutants per Gray, although, for a given level of survival, the mutation frequency for monolayers and spheroids was identical. These results suggest that conformational changes in DNA resulting from cell growth as spheroids might enhance repair of radiation-induced lesions.

  18. Repair of oxidatively induced DNA damage by DNA glycosylases: Mechanisms of action, substrate specificities and excision kinetics.


    Dizdaroglu, Miral; Coskun, Erdem; Jaruga, Pawel

    Endogenous and exogenous reactive species cause oxidatively induced DNA damage in living organisms by a variety of mechanisms. As a result, a plethora of mutagenic and/or cytotoxic products are formed in cellular DNA. This type of DNA damage is repaired by base excision repair, although nucleotide excision repair also plays a limited role. DNA glycosylases remove modified DNA bases from DNA by hydrolyzing the glycosidic bond leaving behind an apurinic/apyrimidinic (AP) site. Some of them also possess an accompanying AP-lyase activity that cleaves the sugar-phosphate chain of DNA. Since the first discovery of a DNA glycosylase, many studies have elucidated the mechanisms of action, substrate specificities and excision kinetics of these enzymes present in all living organisms. For this purpose, most studies used single- or double-stranded oligodeoxynucleotides with a single DNA lesion embedded at a defined position. High-molecular weight DNA with multiple base lesions has been used in other studies with the advantage of the simultaneous investigation of many DNA base lesions as substrates. Differences between the substrate specificities and excision kinetics of DNA glycosylases have been found when these two different substrates were used. Some DNA glycosylases possess varying substrate specificities for either purine-derived lesions or pyrimidine-derived lesions, whereas others exhibit cross-activity for both types of lesions. Laboratory animals with knockouts of the genes of DNA glycosylases have also been used to provide unequivocal evidence for the substrates, which had previously been found in in vitro studies, to be the actual substrates in vivo as well. On the basis of the knowledge gained from the past studies, efforts are being made to discover small molecule inhibitors of DNA glycosylases that may be used as potential drugs in cancer therapy. Published by Elsevier B.V.

  19. Mitochondria regulate DNA damage and genomic instability induced by high LET radiation

    NASA Astrophysics Data System (ADS)

    Zhang, Bo; Davidson, Mercy M.; Hei, Tom K.


    High linear energy transfer (LET) radiation including α particles and heavy ions is the major type of radiation found in space and is considered a potential health risk for astronauts. Even though the chance that these high LET particles traversing through the cytoplasm of cells is higher than that through the nuclei, the contribution of targeted cytoplasmic irradiation to the induction of genomic instability and other chromosomal damages induced by high LET radiation is not known. In the present study, we investigated whether mitochondria are the potential cytoplasmic target of high LET radiation in mediating cellular damage using a mitochondrial DNA (mtDNA) depleted (ρ0) human small airway epithelial (SAE) cell model and a precision charged particle microbeam with a beam width of merely one micron. Targeted cytoplasmic irradiation by high LET α particles induced DNA oxidative damage and double strand breaks in wild type ρ+ SAE cells. Furthermore, there was a significant increase in autophagy and micronuclei, which is an indication of genomic instability, together with the activation of nuclear factor kappa-B (NF-κB) and mitochondrial inducible nitric oxide synthase (iNOS) signaling pathways in ρ+ SAE cells. In contrast, ρ0 SAE cells exhibited a significantly lower response to these same endpoints examined after cytoplasmic irradiation with high LET α particles. The results indicate that mitochondria are essential in mediating cytoplasmic radiation induced genotoxic damage in mammalian cells. Furthermore, the findings may shed some light in the design of countermeasures for space radiation.

  20. Clustered DNA damages induced by high and low LET radiation, including heavy ions

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Schenk, H.; Sidorkina, O.; Laval, J.; Trunk, J.; Monteleone, D.; Sutherland, J.; Lowenstein, D. I. (Principal Investigator)


    Clustered DNA damages--here defined as two or more lesions (strand breaks, oxidized purines, oxidized pyrimidines or abasic sites) within a few helical turns--have been postulated as difficult to repair accurately, and thus highly significant biological lesions. Further, attempted repair of clusters may produce double strand breaks (DSBs). However, until recently, there was no way to measure ionizing radiation-induced clustered damages, except DSB. We recently described an approach for measuring classes of clustered damages (oxidized purine clusters, oxidized pyrimidine clusters, abasic clusters, along with DSB). We showed that ionizing radiation (gamma rays and Fe ions, 1 GeV/amu) does induce such clusters in genomic DNA in solution and in human cells. These studies also showed that each damage cluster results from one radiation hit (and its track), thus indicating that they can be induced by very low doses of radiation, i.e. two independent hits are not required for cluster induction. Further, among all complex damages, double strand breaks comprise--at most-- 20%, with the other clustered damages being at least 80%.

  1. Clustered DNA damages induced by high and low LET radiation, including heavy ions

    NASA Technical Reports Server (NTRS)

    Sutherland, B. M.; Bennett, P. V.; Schenk, H.; Sidorkina, O.; Laval, J.; Trunk, J.; Monteleone, D.; Sutherland, J.; Lowenstein, D. I. (Principal Investigator)


    Clustered DNA damages--here defined as two or more lesions (strand breaks, oxidized purines, oxidized pyrimidines or abasic sites) within a few helical turns--have been postulated as difficult to repair accurately, and thus highly significant biological lesions. Further, attempted repair of clusters may produce double strand breaks (DSBs). However, until recently, there was no way to measure ionizing radiation-induced clustered damages, except DSB. We recently described an approach for measuring classes of clustered damages (oxidized purine clusters, oxidized pyrimidine clusters, abasic clusters, along with DSB). We showed that ionizing radiation (gamma rays and Fe ions, 1 GeV/amu) does induce such clusters in genomic DNA in solution and in human cells. These studies also showed that each damage cluster results from one radiation hit (and its track), thus indicating that they can be induced by very low doses of radiation, i.e. two independent hits are not required for cluster induction. Further, among all complex damages, double strand breaks comprise--at most-- 20%, with the other clustered damages being at least 80%.

  2. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    SciTech Connect

    Han, Xu; Ptasinska, Sylwia; Klas, Matej; Liu, Yueying; Sharon Stack, M.


    The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

  3. DNA damage in oral cancer cells induced by nitrogen atmospheric pressure plasma jets

    NASA Astrophysics Data System (ADS)

    Han, Xu; Klas, Matej; Liu, Yueying; Sharon Stack, M.; Ptasinska, Sylwia


    The nitrogen atmospheric pressure plasma jet (APPJ) was applied to induce DNA damage of SCC-25 oral cancer cells. Optical emission spectra were taken to characterize the reactive species produced in APPJ. In order to explore the spatial distribution of plasma effects, cells were placed onto photo-etched grid slides and the antibody H2A.X was used to locate double strand breaks of DNA inside nuclei using an immunofluorescence assay. The number of cells with double strand breaks in DNA was observed to be varied due to the distance from the irradiation center and duration of plasma treatment.

  4. Protection of cisplatin-induced spermatotoxicity, DNA damage and chromatin abnormality by selenium nano-particles

    SciTech Connect

    Rezvanfar, Mohammad Amin; Rezvanfar, Mohammad Ali; Shahverdi, Ahmad Reza; Ahmadi, Abbas; Baeeri, Maryam; Mohammadirad, Azadeh; Abdollahi, Mohammad


    Cisplatin (CIS), an anticancer alkylating agent, induces DNA adducts and effectively cross links the DNA strands and so affects spermatozoa as a male reproductive toxicant. The present study investigated the cellular/biochemical mechanisms underlying possible protective effect of selenium nano-particles (Nano-Se) as an established strong antioxidant with more bioavailability and less toxicity, on reproductive toxicity of CIS by assessment of sperm characteristics, sperm DNA integrity, chromatin quality and spermatogenic disorders. To determine the role of oxidative stress (OS) in the pathogenesis of CIS gonadotoxicity, the level of lipid peroxidation (LPO), antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and peroxynitrite (ONOO) as a marker of nitrosative stress (NS) and testosterone (T) concentration as a biomarker of testicular function were measured in the blood and testes. Thirty-two male Wistar rats were equally divided into four groups. A single IP dose of CIS (7 mg/kg) and protective dose of Nano-Se (2 mg/kg/day) were administered alone or in combination. The CIS-exposed rats showed a significant increase in testicular and serum LPO and ONOO level, along with a significant decrease in enzymatic antioxidants levels, diminished serum T concentration and abnormal histologic findings with impaired sperm quality associated with increased DNA damage and decreased chromatin quality. Coadministration of Nano-Se significantly improved the serum T, sperm quality, and spermatogenesis and reduced CIS-induced free radical toxic stress and spermatic DNA damage. In conclusion, the current study demonstrated that Nano-Se may be useful to prevent CIS-induced gonadotoxicity through its antioxidant potential. Highlights: ► Cisplatin (CIS) affects spermatozoa as a male reproductive toxicant. ► Effect of Nano-Se on CIS-induced spermatotoxicity was investigated. ► CIS-exposure induces oxidative sperm DNA damage

  5. Nicotine overrides DNA damage-induced G1/S restriction in lung cells.


    Nishioka, Takashi; Yamamoto, Daisuke; Zhu, Tongbo; Guo, Jinjin; Kim, Sung-Hoon; Chen, Chang Yan


    As an addictive substance, nicotine has been suggested to facilitate pro-survival activities (such as anchorage-independent growth or angiogenesis) and the establishment of drug resistance to anticancer therapy. Tobacco smoking consists of a variety of carcinogens [such as benzopyrene (BP) and nitrosamine derivatives] that are able to cause DNA double strand breaks. However, the effect of nicotine on DNA damage-induced checkpoint response induced by genotoxins remains unknown. In this study, we investigated the events occurred during G(1) arrest induced by γ-radiation or BP in nicotine-treated murine or human lung epithelial cells. DNA synthesis was rapidly inhibited after exposure to γ-radiation or BP treatment, accompanied with the activation of DNA damage checkpoint. When these cells were co-treated with nicotine, the growth restriction was compromised, manifested by upregulation of cyclin D and A, and attenuation of Chk2 phosphorylation. Knockdown of cyclin D or Chk2 by the siRNAs blocked nicotine-mediated effect on DNA damage checkpoint activation. However, nicotine treatment appeared to play no role in nocodazole-induced mitotic checkpoint activation. Overall, our study presented a novel observation, in which nicotine is able to override DNA damage checkpoint activated by tobacco-related carcinogen BP or γ-irradiation. The results not only indicates the potentially important role of nicotine in facilitating the establishment of genetic instability to promote lung tumorigenesis, but also warrants a dismal prognosis for cancer patients who are smokers, heavily exposed second-hand smokers or nicotine users.

  6. Spatiotemporal dynamics of DNA repair proteins following laser microbeam induced DNA damage - when is a DSB not a DSB?


    Reynolds, Pamela; Botchway, Stanley W; Parker, Anthony W; O'Neill, Peter


    The formation of DNA lesions poses a constant threat to cellular stability. Repair of endogenously and exogenously produced lesions has therefore been extensively studied, although the spatiotemporal dynamics of the repair processes has yet to be fully understood. One of the most recent advances to study the kinetics of DNA repair has been the development of laser microbeams to induce and visualize recruitment and loss of repair proteins to base damage in live mammalian cells. However, a number of studies have produced contradictory results that are likely caused by the different laser systems used reflecting in part the wavelength dependence of the damage induced. Additionally, the repair kinetics of laser microbeam induced DNA lesions have generally lacked consideration of the structural and chemical complexity of the DNA damage sites, which are known to greatly influence their reparability. In this review, we highlight the key considerations when embarking on laser microbeam experiments and interpreting the real time data from laser microbeam irradiations. We compare the repair kinetics from live cell imaging with biochemical and direct quantitative cellular measurements for DNA repair.

  7. Relationship between the repair of radiation-induced DNA damage and recovery from potentially lethal damage in 9L rat brain tumor cells. [Gamma radiation

    SciTech Connect

    vanAnkeren, S.C.; Wheeler, K.T.


    The kinetics of repair of radiation-induced DNA damage and recovery from radiation-induced potentially lethal damage (PLD) for fed plateau-phase 9L/Ro rat brain tumor cells were compared after single doses of gamma-radiation and after combined treatment with 3 micrograms of 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU)/ml given 16 hr prior to irradiation. DNA damage and repair were assayed using alkaline filter elution, while cell survival was assayed by colony formation. Repair of radiation-induced DNA damage and recovery from radiation-induced PLD followed statistically identical biphasic kinetics; the fast-phase half-times were 4.1 +/- 0.3 (S.D.) min and 4.0 +/- 0.8 min, while the slow-phase half-times were 59.7 +/- 11.2 min and 78.7 +/- 34.1 min, respectively. Treatment with BCNU prior to irradiation resulted in both additional DNA damage and increased cell kill. When DNA damage and cell survival after the combined treatment were corrected for the contribution from BCNU given alone, no inhibition of either repair of radiation-induced DNA damage or of recovery from radiation-induced PLD was observed. However, postirradiation hypertonic treatment inhibited both DNA repair and recovery from radiation-induced PLD. These correlations between the kinetics of the molecular and cellular repair processes support a role for repair of radiation-induced DNA damage in recovery from radiation-induced PLD. The lack of inhibition by BCNU of both repair of radiation-induced DNA damage and of recovery from radiation-induced PLD also demonstrates that these are not the mechanisms by which BCNU enhances radiation-induced cytotoxicity in 9L cells.

  8. ERCC2/XPD Lys751Gln alter DNA repair efficiency of platinum-induced DNA damage through P53 pathway.


    Zhang, Guopei; Guan, Yangyang; Zhao, Yuejiao; van der Straaten, Tahar; Xiao, Sha; Xue, Ping; Zhu, Guolian; Liu, Qiufang; Cai, Yuan; Jin, Cuihong; Yang, Jinghua; Wu, Shengwen; Lu, Xiaobo


    Platinum-based treatment causes Pt-DNA adducts which lead to cell death. The platinum-induced DNA damage is recognized and repaired by the nucleotide excision repair (NER) system of which ERCC2/XPD is a critical enzyme. Single nucleotide polymorphisms in ERCC2/XPD have been found to be associated with platinum resistance. The aim of the present study was to investigate whether ERCC2/XPD Lys751Gln (rs13181) polymorphism is causally related to DNA repair capacity of platinum-induced DNA damage. First, cDNA clones expressing different genotypes of the polymorphism was transfected to an ERCC2/XPD defective CHO cell line (UV5). Second, all cells were treated with cisplatin. Cellular survival rate were investigated by MTT growth inhibition assay, DNA damage levels were investigated by comet assay and RAD51 staining. The distribution of cell cycle and the change of apoptosis rates were detected by a flow cytometric method (FCM). Finally, P53mRNA and phospho-P53 protein levels were further investigated in order to explore a possible explanation. As expected, there was a significantly increased in viability of UV5(ERCC2 (AA)) as compared to UV5(ERCC2 (CC)) after cisplatin treatment. The DNA damage level of UV5(ERCC2 (AA)) was significant decreased compared to UV5(ERCC2 (CC)) at 24 h of treatment. Mutation of ERCC2rs13181 AA to CC causes a prolonged S phase in cell cycle. UV5(ERCC2 (AA)) alleviated the apoptosis compared to UV5(ERCC2 (CC)), meanwhile P53mRNA levels in UV(ERCC2 (AA)) was also lower when compared UV5(ERCC2 (CC)). It co-incides with a prolonged high expression of phospho-P53, which is relevant for cell cycle regulation, apoptosis, and the DNA damage response (DDR). We concluded that ERCC2/XPD rs13181 polymorphism is possibly related to the DNA repair capacity of platinum-induced DNA damage. This functional study provides some clues to clarify the relationship between cisplatin resistance and ERCC2/XPDrs13181 polymorphism.

  9. Cocaine induces DNA damage in distinct brain areas of female rats under different hormonal conditions.


    de Souza, Marilise F; Gonçales, Tierre A; Steinmetz, Aline; Moura, Dinara J; Saffi, Jenifer; Gomez, Rosane; Barros, Helena M T


    We evaluated levels of neuronal DNA damage after acute or repeated cocaine treatment in different brain areas of female rats after ovariectomy or sham surgery. Rats in the control and acute groups were given saline i.p., whereas in the repeated group were given 15 mg/kg, i.p., cocaine for 8 days. After a 10 day washout period, the control group was given saline i.p., whereas rats in the acute and repeated groups were given a challenge dose of 15 mg/kg, i.p., cocaine. After behavioural assessment, rats were killed and the cerebellum, hippocampus, hypothalamus, prefrontal cortex and striatum were dissected for the Comet assay. Acute cocaine exposure induced DNA damage in all brain areas. This effect persisted after repeated administration, except in the hypothalamus, where repeated treatment did not cause increased DNA damage. Sexual hormones exhibited a neuroprotective effect, decreasing cocaine-induced DNA damage in cycling rats in all brain areas. © 2014 Wiley Publishing Asia Pty Ltd.

  10. Alcohol induces DNA damage and the Fanconi anemia D2 protein implicating FANCD2 in the DNA damage response pathways in brain.


    Rulten, S L; Hodder, E; Ripley, T L; Stephens, D N; Mayne, L V


    The largest cause of neurological damage to children is prenatal exposure to alcohol and chronic alcohol use in adults is associated with neurodegeneration, dementia and long-term behavioral changes. Microarray analysis identified the DNA damage response (DDR) gene, Fanconi anemia (Fanc) D2, to be robustly upregulated in mouse midbrain following 24-hour in vivo exposure to ethanol. In this study, we investigate the ability of ethanol to generate DNA strand breaks, predicted substrates for the Fanc pathway and the potential role of FANCD2 in the DDR to ethanol in brain. The effect of ethanol on FANCD2 mRNA levels was measured by quantitative real time PCR using mouse brain and human neuronal cells. FANCD2 protein levels and ubiquitination were measured by Western blotting and immunocytochemistry. DNA damage induction by ethanol/acetaldehyde was measured using the Comet assay and gamma H2AX immunocytochemistry. Levels of DNA and RNA synthesis were measured in cell strains using (3)H-thymidine or (3)H-uridine up-take. Chronic exposure to ethanol induced FANCD2 in mouse midbrain in vivo and in the nucleus of human neuronal cells in culture. However, there was no concomitant increase in the amount of ubiquitinated FANCD2. Acetaldehyde also induced nonubiquitinated FANCD2 protein, and we were able to demonstrate the ability of acetaldehyde to generate DNA double strand breaks, lesions which normally induce ubiquitination of FANCD2. Ethanol also inhibited both RNA and DNA synthesis in proliferating cells consistent with effects on transcription and replication. In contrast to other DNA damaging agents, ethanol/acetaldehyde generated DNA strand breaks without inducing ubiquitination of FANCD2, despite increasing protein levels in the nucleus. These data are consistent with recent reports that suggest the Fanconi anemia pathway plays an important role in the adult brain in response to DNA damage. Further work is required to establish what this role is, in particular the

  11. Hydrogen sulfide induces oxidative damage to RNA and DNA in a sulfide-tolerant marine invertebrate.


    Joyner-Matos, Joanna; Predmore, Benjamin L; Stein, Jenny R; Leeuwenburgh, Christiaan; Julian, David


    Hydrogen sulfide acts as an environmental toxin across a range of concentrations and as a cellular signaling molecule at very low concentrations. Despite its toxicity, many animals, including the mudflat polychaete Glycera dibranchiata, are periodically or continuously exposed to sulfide in their environment. We tested the hypothesis that a broad range of ecologically relevant sulfide concentrations induces oxidative stress and oxidative damage to RNA and DNA in G. dibranchiata. Coelomocytes exposed in vitro to sulfide (0-3 mmol L(-1) for 1 h) showed dose-dependent increases in oxidative stress (as 2',7'-dichlorofluorescein fluorescence) and superoxide production (as dihydroethidine fluorescence). Coelomocytes exposed in vitro to sulfide (up to 0.73 mmol L(-1) for 2 h) also acquired increased oxidative damage to RNA (detected as 8-oxo-7,8-dihydroguanosine) and DNA (detected as 8-oxo-7,8-dihydro-2'-deoxyguanosine). Worms exposed in vivo to sulfide (0-10 mmol L(-1) for 24 h) acquired elevated oxidative damage to RNA and DNA in both coelomocytes and body wall tissue. While the consequences of RNA and DNA oxidative damage are poorly understood, oxidatively damaged deoxyguanosine bases preferentially bind thymine, causing G-T transversions and potentially causing heritable point mutations. This suggests that sulfide can be an environmental mutagen in sulfide-tolerant invertebrates.

  12. Low energy electron induced damage to plasmid DNA pQE30.


    Kumar, S V K; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D; Rao, Basuthkar J


    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and ∼18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  13. Low energy electron induced damage to plasmid DNA pQE30

    SciTech Connect

    Kumar, S. V. K.; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D.; Rao, Basuthkar J.


    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and {approx}18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  14. Low energy electron induced damage to plasmid DNA pQE30

    NASA Astrophysics Data System (ADS)

    Kumar, S. V. K.; Pota, Tasneem; Peri, Dinakar; Dongre, Anushka D.; Rao, Basuthkar J.


    Low energy electrons (LEEs) are produced in copious amounts by the primary radiation used in radiation therapy. The damage caused to the DNA by these secondary electrons in the energy range 5-22 eV has been studied to understand their possible role in radiation induced damage. Electrons are irradiated on dried films of plasmid DNA (pQE30) and analysed using agarose gel electrophoresis. Single strand breaks (SSBs) induced by LEE to supercoiled plasmid DNA show resonance structures at 7, 12, and 15 eV for low doses and 6, 10, and ˜18 eV at saturation doses. The present measurements have an overall agreement with the literature that LEEs resonantly induce SSBs in DNA. Resonant peaks in the SSBs induced by LEEs at 7, 12, and 15 eV with the lowest employed dose in the current study are somewhat different from those reported earlier by two groups. The observed differences are perhaps related to the irradiation dose, conditions and the nature of DNA employed, which is further elaborated.

  15. Rofecoxib prevents ctdsDNA against damage induced by copper sulfate and ultraviolet B radiation in vitro study.


    Al-Nimer, Marwan S M; Al-Deen, Suad M; Abdul Lateef, Zainab W


    Rofecoxib is a selective cyclooxygenase COX-2 enzyme inhibitor with chemoprotective effect against cancer in experimental models. This study aimed to investigate the effect of rofecoxib against ctds DNA damage induced by copper ions or ultraviolet (UV)B radiation. Aliquot ctdsDNA samples were incubated with copper sulfate solution (50 nmol) and rofecoxib (0.8 mol) was added either before or after the admixing the ctdsDNA with copper sulfate. In another experimental series, aliquot of ctdsDNA were exposed to UVB radiation for 30 min in absence or presence of rofecoxib. Rofecoxib significantly attenuated the separation of double strands of DNA (detected by increase the absorbance of DNA at 260 nm) induced by Cu ions. Rofecoxib significantly offered protection against UVB-induced DNA damage. It is concluded that rofecoxib offered protection against copper ions or UVB induced-DNA damage via different mechanisms not related to the inhibition COX-2.

  16. Lysophospholipids secreted by splenic macrophages induce chemotherapy resistance via interference with the DNA damage response.


    Houthuijzen, Julia M; Daenen, Laura G M; Roodhart, Jeanine M L; Oosterom, Ilse; van Jaarsveld, Marijn T M; Govaert, Klaas M; Smith, Michelle E; Sadatmand, Sahar J; Rosing, Hilde; Kruse, Fabian; Helms, Bernd J; van Rooijen, Nico; Beijnen, Jos H; Haribabu, Bodduluri; van de Lest, Chris H A; Voest, Emile E


    Host responses to systemic anti-cancer treatment play important roles in the development of anti-cancer drug resistance. Here we show that F4/80(+)/CD11b(low) splenocytes mediate the resistance to DNA-damaging chemotherapeutics induced by two platinum-induced fatty acids (PIFAs), 12-S-keto-5,8,10-heptadecatrienoic acid and 4,7,10,13-hexadecatetraenoic acid (16:4(n-3)) in xenograft mouse models. Splenectomy or depletion of splenic macrophages by liposomal clodronate protects against PIFA-induced chemoresistance. In addition, we find that 12-S-HHT, but not 16:4(n-3), functions via leukotriene B4 receptor 2 (BLT2). Genetic loss or chemical inhibition of BLT2 prevents 12-S-HHT-mediated resistance. Mass spectrometry analysis of conditioned medium derived from PIFA-stimulated splenic macrophages identifies several lysophosphatidylcholines as the resistance-inducing molecules. When comparing cisplatin and PIFA-treated tumours with cisplatin alone treated tumours we found overall less γH2AX, a measure for DNA damage. Taken together, we have identified an intricate network of lysophospholipid signalling by splenic macrophages that induces systemic chemoresistance in vivo via an altered DNA damage response.

  17. Cadmium Chloride Induces DNA Damage and Apoptosis of Human Liver Carcinoma Cells via Oxidative Stress.


    Skipper, Anthony; Sims, Jennifer N; Yedjou, Clement G; Tchounwou, Paul B


    Cadmium is a heavy metal that has been shown to cause its toxicity in humans and animals. Many documented studies have shown that cadmium produces various genotoxic effects such as DNA damage and chromosomal aberrations. Ailments such as bone disease, renal damage, and several forms of cancer are attributed to overexposure to cadmium. Although there have been numerous studies examining the effects of cadmium in animal models and a few case studies involving communities where cadmium contamination has occurred, its molecular mechanisms of action are not fully elucidated. In this research, we hypothesized that oxidative stress plays a key role in cadmium chloride-induced toxicity, DNA damage, and apoptosis of human liver carcinoma (HepG₂) cells. To test our hypothesis, cell viability was determined by MTT assay. Lipid hydroperoxide content stress was estimated by lipid peroxidation assay. Genotoxic damage was tested by the means of alkaline single cell gel electrophoresis (Comet) assay. Cell apoptosis was measured by flow cytometry assessment (Annexin-V/PI assay). The result of MTT assay indicated that cadmium chloride induces toxicity to HepG₂ cells in a concentration-dependent manner, showing a 48 hr-LD50 of 3.6 µg/mL. Data generated from lipid peroxidation assay resulted in a significant (p < 0.05) increase of hydroperoxide production, specifically at the highest concentration tested. Data obtained from the Comet assay indicated that cadmium chloride causes DNA damage in HepG₂ cells in a concentration-dependent manner. A strong concentration-response relationship (p < 0.05) was recorded between annexin V positive cells and cadmium chloride exposure. In summary, these in vitro studies provide clear evidence that cadmium chloride induces oxidative stress, DNA damage, and programmed cell death in human liver carcinoma (HepG₂) cells.

  18. High molecular weight hyaluronan decreases oxidative DNA damage induced by EDTA in human corneal epithelial cells

    PubMed Central

    Ye, J; Wu, H; Wu, Y; Wang, C; Zhang, H; Shi, X; Yang, J


    Purpose To investigate the toxic effects of ethylenediaminetetraacetic acid disodium salt (EDTA), a corneal penetration enhancer in topical ophthalmic formulations, on DNA in human corneal epithelial cells (HCEs), and to investigate whether the effect induced by EDTA can be inhibited by high molecular weight hyaluronan (HA). Methods Cells were exposed to EDTA in concentrations ranging from 0.00001 to 0.01% for 60 min, or 30 min high molecular weight HA pretreatment followed by EDTA treatment. The cell viability was measured by the MTT test. Cell apoptosis was determined with annexin V staining by flow cytometry. The DNA single- and double-strand breaks of HCEs were examined by alkaline comet assay and by immunofluorescence microscope detection of the phosphorylated form of histone variant H2AX (γH2AX) foci, respectively. Reactive oxygen species (ROS) production was assessed by the fluorescent probe, 2′, 7′-dichlorodihydrofluorescein diacetate. Results EDTA exhibited no adverse effect on cell viability and did not induce cell apoptosis in human corneal epithelial cells at concentrations lower than 0.01%. However, a significant increase of DNA single- and double-strand breaks was observed in a dose-dependent manner with all the concentrations of EDTA tested in HCEs. In addition, EDTA treatment led to elevated ROS generation. Moreover, 30 min preincubation with high molecular weight HA significantly decreased EDTA-induced ROS generation and DNA damage. Conclusions EDTA could induce DNA damage in HCEs, probably through oxidative stress. Furthermore, high molecular weight HA was an effective protective agent that had antioxidant properties and decreased DNA damage induced by EDTA. PMID:22595911

  19. Delayed repair of radiation induced clustered DNA damage: Friend or foe?

    PubMed Central

    Eccles, Laura J.; O’Neill, Peter; Lomax, Martine E.


    A signature of ionizing radiation exposure is the induction of DNA clustered damaged sites, defined as two or more lesions within one to two helical turns of DNA by passage of a single radiation track. Clustered damage is made up of double strand breaks (DSB) with associated base lesions or abasic (AP) sites, and non-DSB clusters comprised of base lesions, AP sites and single strand breaks. This review will concentrate on the experimental findings of the processing of non-DSB clustered damaged sites. It has been shown that non-DSB clustered damaged sites compromise the base excision repair pathway leading to the lifetime extension of the lesions within the cluster, compared to isolated lesions, thus the likelihood that the lesions persist to replication and induce mutation is increased. In addition certain non-DSB clustered damaged sites are processed within the cell to form additional DSB. The use of E. coli to demonstrate that clustering of DNA lesions is the major cause of the detrimental consequences of ionizing radiation is also discussed. The delayed repair of non-DSB clustered damaged sites in humans can be seen as a “friend”, leading to cell killing in tumour cells or as a “foe”, resulting in the formation of mutations and genetic instability in normal tissue. PMID:21130102

  20. ATM induces MacroD2 nuclear export upon DNA damage

    PubMed Central

    Golia, Barbara; Moeller, Giuliana Katharina; Jankevicius, Gytis; Schmidt, Andreas; Hegele, Anna; Preißer, Julia; Tran, Mai Ly; Imhof, Axel; Timinszky, Gyula


    ADP-ribosylation is a dynamic post-translation modification that regulates the early phase of various DNA repair pathways by recruiting repair factors to chromatin. ADP-ribosylation levels are defined by the activities of specific transferases and hydrolases. However, except for the transferase PARP1/ARDT1 little is known about regulation of these enzymes. We found that MacroD2, a mono-ADP-ribosylhydrolase, is exported from the nucleus upon DNA damage, and that this nuclear export is induced by ATM activity. We show that the export is dependent on the phosphorylation of two SQ/TQ motifs, suggesting a novel direct interaction between ATM and ADP-ribosylation. Lastly, we show that MacroD2 nuclear export temporally restricts its recruitment to DNA lesions, which may decrease the net ADP-ribosylhydrolase activity at the site of DNA damage. Together, our results identify a novel feedback regulation between two crucial DNA damage-induced signaling pathways: ADP-ribosylation and ATM activation. PMID:28069995

  1. Use of RAPD to detect sodium arsenite-induced DNA damage in human lymphoblastoid cells.


    Lee, Yuan-Cho; Yang, Vivian C; Wang, Tsu-Shing


    Inorganic arsenic is a known human carcinogen, yet its mechanism of action remains unclear. Our previous study showed that arsenite significantly induces oxidative DNA adducts and DNA-protein cross-links in several mammalian cell lines. In the present study, we used the random amplified polymorphic DNA (RAPD) assay to evaluate the possible target in the genomic DNA of human lymphoblastoid cells that were exposed to sodium arsenite. Treatment with both 10 and 80 microM arsenite for 4h induced significant changes in RAPD profiles compared with the control pattern. Two 10-mer RAPD primers (D11 and F1) produced the most distinguishable banding profiles between arsenite-treated and control genomic DNA. The sequencing of four arsenite-sensitive RAPD bands showed that the RB1CC1 and PACE4 genes might be the DNA targets of sodium arsenite treatment. We propose that arsenite may induce sequence- or gene-specific damage and then change the RAPD profile in human lymphoblastoid cells. The results of our study also show that RAPD combined with other techniques is a good tool for detecting alterations in genomic DNA and for the direct screening of new molecular markers related to arsenite-induced carcinogenesis.

  2. Time-Restricted Feeding Shifts the Skin Circadian Clock and Alters UVB-Induced DNA Damage.


    Wang, Hong; van Spyk, Elyse; Liu, Qiang; Geyfman, Mikhail; Salmans, Michael L; Kumar, Vivek; Ihler, Alexander; Li, Ning; Takahashi, Joseph S; Andersen, Bogi


    The epidermis is a highly regenerative barrier protecting organisms from environmental insults, including UV radiation, the main cause of skin cancer and skin aging. Here, we show that time-restricted feeding (RF) shifts the phase and alters the amplitude of the skin circadian clock and affects the expression of approximately 10% of the skin transcriptome. Furthermore, a large number of skin-expressed genes are acutely regulated by food intake. Although the circadian clock is required for daily rhythms in DNA synthesis in epidermal progenitor cells, RF-induced shifts in clock phase do not alter the phase of DNA synthesis. However, RF alters both diurnal sensitivity to UVB-induced DNA damage and expression of the key DNA repair gene, Xpa. Together, our findings indicate regulation of skin function by time of feeding and emphasize a link between circadian rhythm, food intake, and skin health. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  3. Aag DNA glycosylase promotes alkylation-induced tissue damage mediated by Parp1.


    Calvo, Jennifer A; Moroski-Erkul, Catherine A; Lake, Annabelle; Eichinger, Lindsey W; Shah, Dharini; Jhun, Iny; Limsirichai, Prajit; Bronson, Roderick T; Christiani, David C; Meira, Lisiane B; Samson, Leona D


    Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER) is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG) mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag⁻/⁻ mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage.

  4. Monitoring ultraviolet-B-induced DNA damage in individual diatom cells by immunofluorescent thymine dimer detection

    SciTech Connect

    Buma, A.G.J.; Van Hannen, E.J.; Roza, L.


    We developed a method to investigate the effect of ultraviolet-B radiation (UVBR) on the formation of thymine dimers in microalgal DNA that can be used for both laboratory and in situ research. Antibody labeling of dimers was followed by a secondary antibody (fluorescein isothiocyanate) staining to allow visualization of DNA damage with flow cytometry or fluorescence microscopy. Thymine dimer-specific fluorescence in nuclear DNA of the marine diatom Cyclotella sp. was linearly related to the UVBR dose. Simultaneous measurements of cellular DNA content showed that the vulnerability of G2 cells to DNA damage did not differ significantly from the vulnerability of G1 cells. The formation and removal of thymine dimers in Cyclotella sp. cells was monitored for 3 consecutive days at two realistic UVBR irradiance levels. Thymine dimers were removed within 24 h when exposed to a saturating photosynthetically active radiation intensity following the UVBR treatment. This new method allows the study of UVBR-induced DNA damage on a cell-to-cell basis. It is also feasible for field studies because cells remain intact and can be recognized readily after antibody treatment. 40 refs., 7 figs.

  5. Involvement of DNA-PK and ATM in radiation- and heat-induced DNA damage recognition and apoptotic cell death.


    Tomita, Masanori


    Exposure to ionizing radiation and hyperthermia results in important biological consequences, e.g. cell death, chromosomal aberrations, mutations, and DNA strand breaks. There is good evidence that the nucleus, specifically cellular DNA, is the principal target for radiation-induced cell lethality. DNA double-strand breaks (DSBs) are considered to be the most serious type of DNA damage induced by ionizing radiation. On the other hand, verifiable mechanisms which can lead to heat-induced cell death are damage to the plasma membrane and/or inactivation of heat-labile proteins caused by protein denaturation and subsequent aggregation. Recently, several reports have suggested that DSBs can be induced after hyperthermia because heat-induced phosphorylated histone H2AX (γ-H2AX) foci formation can be observed in several mammalian cell lines. In mammalian cells, DSBs are repaired primarily through two distinct and complementary mechanisms: non-homologous end joining (NHEJ), and homologous recombination (HR) or homology-directed repair (HDR). DNA-dependent protein kinase (DNA-PK) and ataxia-telangiectasia mutated (ATM) are key players in the initiation of DSB repair and phosphorylate and/or activate many substrates, including themselves. These phosphorylated substrates have important roles in the functioning of cell cycle checkpoints and in cell death, as well as in DSB repair. Apoptotic cell death is a crucial cell suicide mechanism during development and in the defense of homeostasis. If DSBs are unrepaired or misrepaired, apoptosis is a very important system which can protect an organism against carcinogenesis. This paper reviews recently obtained results and current topics concerning the role of DNA-PK and ATM in heat- or radiation-induced apoptotic cell death.

  6. DNA damage induces nuclear actin filament assembly by Formin-2 and Spire-1/2 that promotes efficient DNA repair

    PubMed Central

    Belin, Brittany J; Lee, Terri; Mullins, R Dyche


    Actin filaments assemble inside the nucleus in response to multiple cellular perturbations, including heat shock, protein misfolding, integrin engagement, and serum stimulation. We find that DNA damage also generates nuclear actin filaments—detectable by phalloidin and live-cell actin probes—with three characteristic morphologies: (i) long, nucleoplasmic filaments; (ii) short, nucleolus-associated filaments; and (iii) dense, nucleoplasmic clusters. This DNA damage-induced nuclear actin assembly requires two biologically and physically linked nucleation factors: Formin-2 and Spire-1/Spire-2. Formin-2 accumulates in the nucleus after DNA damage, and depletion of either Formin-2 or actin's nuclear import factor, importin-9, increases the number of DNA double-strand breaks (DSBs), linking nuclear actin filaments to efficient DSB clearance. Nuclear actin filaments are also required for nuclear oxidation induced by acute genotoxic stress. Our results reveal a previously unknown role for nuclear actin filaments in DNA repair and identify the molecular mechanisms creating these nuclear filaments. DOI: PMID:26287480

  7. Effects of (+)-catechin and (-)-epicatechin on heterocyclic amines-induced oxidative DNA damage.


    Haza, Ana Isabel; Morales, Paloma


    The aim of the present study was to evaluate the protective effect of (+)-catechin and (-)-epicatechin against 2-amino-3,8- dimethylimidazo[4,5-f]quinoxaline (8-MeIQx), 2-amino-3,4,8-trimethylimidazo[4,5-f]-quinoxaline (4,8-diMeIQx) and 2-amino-1-methyl-6-phenyl-imidazo[4,5-b]pyridine (PhIP)-induced DNA damage in human hepatoma cells (HepG2). DNA damage (strand breaks and oxidized purines/pyrimidines) was evaluated by the alkaline single-cell gel electrophoresis or comet assay. Increasing concentrations of 8-MeIQx, 4,8-diMeIQx and PhIP induced a significant increase in DNA strand breaks and oxidized purines and pyrimidines in a dose-dependent manner. Among those, PhIP (300 µm) exerted the highest genotoxicity. (+)-Catechin exerted protection against oxidized purines induced by 8-MeIQx, 4,8-diMeIQx and PhIP. Oxidized pyrimidines and DNA strand breaks induced by PhIP were also prevented by (+)-catechin. Otherwise, (-)-epicatechin protected against the oxidized pyrimidines induced by PhIP and the oxidized purines induced by 8-MeIQx and 4,8-diMeIQx. One feasible mechanism by which (+)-catechin and (-)-epicatechin exert their protective effect towards heterocyclic amines-induced oxidative DNA damage may be by modulation of phase I and II enzyme activities. The ethoxyresorufin O-deethylation (CYP1A1) activity was moderately inhibited by (+)-catechin, while little effect was observed by (-)-epicatechin. However, (+)-catechin showed the greatest increase in UDP-glucuronyltransferase activity. In conclusion, our results clearly indicate that (+)-catechin was more efficient than (-)-epicatechin in preventing DNA damage (strand breaks and oxidized purines/pyrimidines) induced by PhIP than that induced by 8-MeIQx and 4,8-diMeIQx. Copyright © 2010 John Wiley & Sons, Ltd.

  8. Oxidative stress-induced CREB upregulation promotes DNA damage repair prior to neuronal cell death protection.


    Pregi, Nicolás; Belluscio, Laura María; Berardino, Bruno Gabriel; Castillo, Daniela Susana; Cánepa, Eduardo Tomás


    cAMP response element-binding (CREB) protein is a cellular transcription factor that mediates responses to different physiological and pathological signals. Using a model of human neuronal cells we demonstrate herein, that CREB is phosphorylated after oxidative stress induced by hydrogen peroxide. This phosphorylation is largely independent of PKA and of the canonical phosphoacceptor site at ser-133, and is accompanied by an upregulation of CREB expression at both mRNA and protein levels. In accordance with previous data, we show that CREB upregulation promotes cell survival and that its silencing results in an increment of apoptosis after oxidative stress. Interestingly, we also found that CREB promotes DNA repair after treatment with hydrogen peroxide. Using a cDNA microarray we found that CREB is responsible for the regulation of many genes involved in DNA repair and cell survival after oxidative injury. In summary, the neuroprotective effect mediated by CREB appears to follow three essential steps following oxidative injury. First, the upregulation of CREB expression that allows sufficient level of activated and phosphorylated protein is the primordial event that promotes the induction of genes of the DNA Damage Response. Then and when the DNA repair is effective, CREB induces detoxification and survival genes. This kinetics seems to be important to completely resolve oxidative-induced neuronal damages.

  9. Nanodosimetric Simulation of Direct Ion-Induced DNA Damage Using Different Chromatin Geometry Models.


    Henthorn, N T; Warmenhoven, J W; Sotiropoulos, M; Mackay, R I; Kirkby, K J; Merchant, M J


    Monte Carlo based simulation has proven useful in investigating the effect of proton-induced DNA damage and the processes through which this damage occurs. Clustering of ionizations within a small volume can be related to DNA damage through the principles of nanodosimetry. For simulation, it is standard to construct a small volume of water and determine spatial clusters. More recently, realistic DNA geometries have been used, tracking energy depositions within DNA backbone volumes. Traditionally a chromatin fiber is built within the simulation and identically replicated throughout a cell nucleus, representing the cell in interphase. However, the in vivo geometry of the chromatin fiber is still unknown within the literature, with many proposed models. In this work, the Geant4-DNA toolkit was used to build three chromatin models: the solenoid, zig-zag and cross-linked geometries. All fibers were built to the same chromatin density of 4.2 nucleosomes/11 nm. The fibers were then LET proton irradiated (5-80 keV/μm) or LET alpha-particle irradiated (63-226 keV/μm). Nanodosimetric parameters were scored for each fiber after each LET and used as a comparator among the models. Statistically significant differences were observed in the double-strand break backbone size distributions among the models, although nonsignificant differences were noted among the nanodosimetric parameters. From the data presented in this article, we conclude that selection of the solenoid, zig-zag or cross-linked chromatin model does not significantly affect the calculated nanodosimetric parameters. This allows for a simulation-based cell model to make use of any of these chromatin models for the scoring of direct ion-induced DNA damage.

  10. Human Telomeres Are Hypersensitive to UV-Induced DNA Damage and Refractory to Repair

    PubMed Central

    Rochette, Patrick J.; Brash, Douglas E.


    Telomeric repeats preserve genome integrity by stabilizing chromosomes, a function that appears to be important for both cancer and aging. In view of this critical role in genomic integrity, the telomere's own integrity should be of paramount importance to the cell. Ultraviolet light (UV), the preeminent risk factor in skin cancer development, induces mainly cyclobutane pyrimidine dimers (CPD) which are both mutagenic and lethal. The human telomeric repeat unit (5′TTAGGG/CCCTAA3′) is nearly optimal for acquiring UV-induced CPD, which form at dipyrimidine sites. We developed a ChIP–based technique, immunoprecipitation of DNA damage (IPoD), to simultaneously study DNA damage and repair in the telomere and in the coding regions of p53, 28S rDNA, and mitochondrial DNA. We find that human telomeres in vivo are 7-fold hypersensitive to UV-induced DNA damage. In double-stranded oligonucleotides, this hypersensitivity is a property of both telomeric and non-telomeric repeats; in a series of telomeric repeat oligonucleotides, a phase change conferring UV-sensitivity occurs above 4 repeats. Furthermore, CPD removal in the telomere is almost absent, matching the rate in mitochondria known to lack nucleotide excision repair. Cells containing persistent high levels of telomeric CPDs nevertheless proliferate, and chronic UV irradiation of cells does not accelerate telomere shortening. Telomeres are therefore unique in at least three respects: their biophysical UV sensitivity, their prevention of excision repair, and their tolerance of unrepaired lesions. Utilizing a lesion-tolerance strategy rather than repair would prevent double-strand breaks at closely-opposed excision repair sites on opposite strands of a damage-hypersensitive repeat. PMID:20442874

  11. Low Dose Iron Treatments Induce a DNA Damage Response in Human Endothelial Cells within Minutes

    PubMed Central

    Mollet, Inês G.; Giess, Adam; Paschalaki, Koralia; Periyasamy, Manikandan; Lidington, Elaine C.; Mason, Justin C.; Jones, Michael D.; Game, Laurence; Ali, Simak; Shovlin, Claire L.


    , and induce a DNA damage response. PMID:26866805

  12. Differential colon DNA damage induced by azo food additives between rats and mice.


    Shimada, Chihiro; Kano, Kiyoshi; Sasaki, Yu F; Sato, Itaru; Tsudua, Shuji


    Azo dyes, amaranth, allura red and new coccine, which are currently used as food color additives in Japan, have been reported to cause colon specific DNA damage in mice. To examine species difference in the DNA damage between rats and mice, each of dyes was administered to male mice (1 and 10 mg/kg) and male rats (10, 100 and 1,000 mg/kg) by gavage. Brain, lung, liver, kidney, glandular stomach, colon, urinary bladder and bone marrow were sampled 3 hr (for mice) and 3, 6, 12 and 24 hr (for rats) after the treatment. The alkaline comet assay showed DNA damage in the mouse colon 3 hr after the administration of all of the dyes at 10 mg/kg. In rats, however, none of the dyes damaged DNA. Azo dyes should undergo metabolic reduction in the colon to be adducted to DNA. To determine transit time of the dyes to the colon after their administration, gastric emptying and intestinal transport in mice and rats were examined using brilliant blue FCF (BB) as an indicator. The half times of gastric emptying were 70 and 80 min for mice and rats, respectively; and about 60% of the BB was removed from the stomach 1 hr after the gastric intubation in both mice and rats. BB reached the mouse and rat colon 1 and 3 hr after the administration, respectively. Considering the wide dose range and sampling times well covering the transit time to the colon, rats may be insensitive to these azo dye-induced DNA damage.

  13. Plasma induced DNA damage: Comparison with the effects of ionizing radiation

    NASA Astrophysics Data System (ADS)

    Lazović, S.; Maletić, D.; Leskovac, A.; Filipović, J.; Puač, N.; Malović, G.; Joksić, G.; Petrović, Z. Lj.


    We use human primary fibroblasts for comparing plasma and gamma rays induced DNA damage. In both cases, DNA strand breaks occur, but of fundamentally different nature. Unlike gamma exposure, contact with plasma predominantly leads to single strand breaks and base-damages, while double strand breaks are mainly consequence of the cell repair mechanisms. Different cell signaling mechanisms are detected confirming this (ataxia telangiectasia mutated - ATM and ataxia telangiectasia and Rad3 related - ATR, respectively). The effective plasma doses can be tuned to match the typical therapeutic doses of 2 Gy. Tailoring the effective dose through plasma power and duration of the treatment enables safety precautions mainly by inducing apoptosis and consequently reduced frequency of micronuclei.

  14. Plasma induced DNA damage: Comparison with the effects of ionizing radiation

    SciTech Connect

    Lazović, S.; Maletić, D.; Puač, N.; Malović, G.; Petrović, Z. Lj.; Leskovac, A.; Filipović, J.; Joksić, G.


    We use human primary fibroblasts for comparing plasma and gamma rays induced DNA damage. In both cases, DNA strand breaks occur, but of fundamentally different nature. Unlike gamma exposure, contact with plasma predominantly leads to single strand breaks and base-damages, while double strand breaks are mainly consequence of the cell repair mechanisms. Different cell signaling mechanisms are detected confirming this (ataxia telangiectasia mutated - ATM and ataxia telangiectasia and Rad3 related - ATR, respectively). The effective plasma doses can be tuned to match the typical therapeutic doses of 2 Gy. Tailoring the effective dose through plasma power and duration of the treatment enables safety precautions mainly by inducing apoptosis and consequently reduced frequency of micronuclei.

  15. The small molecule calactin induces DNA damage and apoptosis in human leukemia cells.


    Lee, Chien-Chih; Lin, Yi-Hsiung; Chang, Wen-Hsin; Wu, Yang-Chang; Chang, Jan-Gowth


    We purified calactin from the roots of the Chinese herb Asclepias curassavica L. and analyzed its biologic effects in human leukemia cells. Our results showed that calactin treatment caused DNA damage and resulted in apoptosis. Increased phosphorylation levels of Chk2 and H2AX were observed and were reversed by the DNA damage inhibitor caffeine in calactin-treated cells. In addition, calactin treatment showed that a decrease in the expression of cell cycle regulatory proteins Cyclin B1, Cdk1, and Cdc25C was consistent with a G2/M phase arrest. Furthermore, calactin induced extracellular signal-regulated kinase (ERK) phosphorylation, activation of caspase-3, caspase-8, and caspase-9, and PARP cleavage. Pretreatment with the ERK inhibitor PD98059 significantly blocked the loss of viability in calactin-treated cells. It is indicated that calactin-induced apoptosis may occur through an ERK signaling pathway. Our data suggest that calactin is a potential anticancer compound.

  16. DNA damage-induced translocation of S100A11 into the nucleus regulates cell proliferation

    PubMed Central


    Background Proteins are able to react in response to distinct stress stimuli by alteration of their subcellular distribution. The stress-responsive protein S100A11 belongs to the family of multifunctional S100 proteins which have been implicated in several key biological processes. Previously, we have shown that S100A11 is directly involved in DNA repair processes at damaged chromatin in the nucleus. To gain further insight into the underlying mechanism subcellular trafficking of S100A11 in response to DNA damage was analyzed. Results We show that DNA damage induces a nucleolin-mediated translocation of S100A11 from the cytoplasm into the nucleus. This translocation is impeded by inhibition of the phosphorylation activity of PKCα. Translocation of S100A11 into the nucleus correlates with an increased cellular p21 protein level. Depletion of nucleolin by siRNA severely impairs translocation of S100A11 into the nucleus resulting in a decreased p21 protein level. Additionally, cells lacking nucleolin showed a reduced colony forming capacity. Conclusions These observations suggest that regulation of the subcellular distribution of S100A11 plays an important role in the DNA damage response and p21-mediated cell cycle control. PMID:21167017

  17. Comparison of cytotoxicity and DNA damage potential induced by ent-kaurene diterpenoids from Isodon plant.


    Ding, Lan; Zhou, Qiyin; Wang, Li; Wang, Wei; Zhang, Shidong; Liu, Bo


    The cytotoxicity of six ent-kaurene diterpenoids isolated from the leaves of Isodon japonica (Burm.f.) Hara var. galaucocalyx (maxin) Hara was evaluated against three human tumour HepG2, GLC-82 and HL-60 cell lines through SRB assay, and their DNA damage potential (against HepG2 cell line) was assessed by comet assay. Among the six ent-kaurene diterpenoids, Rabdosin B was most cytotoxic, followed by Oridonin, Epinodosin, Rabdosinate, Lasiokaurin and Epinodosinol. All of the six ent-kaurene diterpenoids induced significant DNA damage (p < 0.05) to HepG2 cells in a time- and dose-dependent manner except Lasiokaurin and Eponodosinol at 6 µmol L⁻¹ for 24 h. The structure-activity relationships (SARs) were discussed and it was found that exo-methylene cyclopentanone in the molecular structure was important for maintaining the cytotoxicity and DNA damage potential of the compounds.-OAc group at site C-1 in Lasiokaurin had a higher stereospecific blockade, which made the compound have less cytotoxicity and DNA damage potential than Oridonin (-OH at C-1).

  18. Preferential repair of UV damage in highly transcribed DNA diminishes UV-induced intrachromosomal recombination in mammalian cells.

    PubMed Central

    Deng, W P; Nickoloff, J A


    The relationships among transcription, recombination, DNA damage, and repair in mammalian cells were investigated. We monitored the effects of transcription on UV-induced intrachromosomal recombination between neomycin repeats including a promoterless allele and an inducible heteroallele regulated by the mouse mammary tumor virus promoter. Although transcription and UV light separately stimulated recombination, increasing transcription levels reduced UV-induced recombination. Preferential repair of UV damage in transcribed strands was shown in highly transcribed DNA, suggesting that recombination is stimulated by unrepaired UV damage and that increased DNA repair in highly transcribed alleles removes recombinogenic lesions. This study indicates that the genetic consequences of DNA damage depend on transcriptional states and provides a basis for understanding tissue- and gene-specific responses to DNA-damaging agents. Images PMID:8264606

  19. [Endonuclease modified comet assay for oxidative DNA damage induced by detection of genetic toxicants].


    Zhao, Jian; Li, Hongli; Zhai, Qingfeng; Qiu, Yugang; Niu, Yong; Dai, Yufei; Zheng, Yuxin; Duan, Huawei


    The aim of this study was to investigate the use of the lesion-specific endonucleases-modified comet assay for analysis of DNA oxidation in cell lines. DNA breaks and oxidative damage were evaluated by normal alkaline and formamidopyrimidine-DNA-glycosylase (FPG) modified comet assays. Cytotoxicity were assessed by MTT method. The human bronchial epithelial cell (16HBE) were treated with benzo (a) pyrene (B(a)P), methyl methanesulfonate (MMS), colchicine (COL) and vincristine (VCR) respectively, and the dose is 20 µmol/L, 25 mg/ml, 5 mg/L and 0.5 mg/L for 24 h, respectively. Oxidative damage was also detected by levels of reactive oxygen species in treated cells. Four genotoxicants give higher cytotoxicity and no significant changes on parameters of comet assay treated by enzyme buffer. Cell survival rate were (59.69 ± 2.60) %, (54.33 ± 2.81) %, (53.11 ± 4.00) %, (51.43 ± 3.92) % in four groups, respectively. There was the direct DNA damage induced by test genotoxicants presented by tail length, Olive tail moment (TM) and tail DNA (%) in the comet assay. The presence of FPG in the assays increased DNA migration in treated groups when compared to those without it, and the difference was statistically significant which indicated that the clastogen and aneugen could induce oxidative damage in DNA strand. In the three parameters, the Olive TM was changed most obviously after genotoxicants treatment. In the contrast group, the Olive TM of B(a) P,MMS, COL,VCR in the contrast groups were 22.99 ± 17.33, 31.65 ± 18.86, 19.86 ± 9.56 and 17.02 ± 9.39, respectively, after dealing with the FPG, the Olive TM were 34.50 ± 17.29, 43.80 ± 10.06, 33.10 ± 12.38, 28.60 ± 10.53, increased by 58.94%, 38.48%, 66.86% and 68.21%, respectively (t value was 3.91, 3.89, 6.66 and 3.87, respectively, and all P < 0.05), and the correlation between Olive TM and reactive oxygen species was better than other parameters (r = 0.77, P < 0.05). This study indicates that FPG-comet assay

  20. Atrazine Triggers DNA Damage Response and Induces DNA Double-Strand Breaks in MCF-10A Cells

    PubMed Central

    Huang, Peixin; Yang, John; Ning, Jie; Wang, Michael; Song, Qisheng


    Atrazine, a pre-emergent herbicide in the chloro-s-triazine family, has been widely used in crop lands and often detected in agriculture watersheds, which is considered as a potential threat to human health. Although atrazine and its metabolites showed an elevated incidence of mammary tumors in female Sprague–Dawley (SD) rats, no molecular evidence was found relevant to its carcinogenesis in humans. This study aims to determine whether atrazine could induce the expression of DNA damage response-related proteins in normal human breast epithelial cells (MCF-10A) and to examine the cytotoxicity of atrazine at a molecular level. Our results indicate that a short-term exposure of MCF-10A to an environmentally-detectable concentration of atrazine (0.1 µg/mL) significantly increased the expression of tumor necrosis factor receptor-1 (TNFR1) and phosphorylated Rad17 in the cells. Atrazine treatment increased H2AX phosphorylation (γH2AX) and the formation of γH2AX foci in the nuclei of MCF-10A cells. Atrazine also sequentially elevated DNA damage checkpoint proteins of ATM- and RAD3-related (ATR), ATRIP and phospho-Chk1, suggesting that atrazine could induce DNA double-strand breaks and trigger the DNA damage response ATR-Chk1 pathway in MCF-10A cells. Further investigations are needed to determine whether atrazine-triggered DNA double-strand breaks and DNA damage response ATR-Chk1 pathway occur in vivo. PMID:26114388

  1. Molecular and sensory mechanisms to mitigate sunlight-induced DNA damage in treefrog tadpoles.


    Schuch, André P; Lipinski, Victor M; Santos, Mauricio B; Santos, Caroline P; Jardim, Sinara S; Cechin, Sonia Z; Loreto, Elgion L S


    The increased incidence of solar ultraviolet B (UVB) radiation has been proposed as an environmental stressor, which may help to explain the enigmatic decline of amphibian populations worldwide. Despite growing knowledge regarding the UV-induced biological effects in several amphibian models, little is known about the efficacy of DNA repair pathways. In addition, little attention has been given to the interplay between these molecular mechanisms with other physiological strategies that avoid the damage induced by sunlight. Here, DNA lesions induced by environmental doses of solar UVB and UVA radiation were detected in genomic DNA samples of treefrog tadpoles (Hypsiboas pulchellus) and their DNA repair activity was evaluated. These data were complemented by monitoring the induction of apoptosis in blood cells and tadpole survival. Furthermore, the tadpoles' ability to perceive and escape from UV wavelengths was evaluated as an additional strategy of photoprotection. The results show that tadpoles are very sensitive to UVB light, which could be explained by the slow DNA repair rates for both cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6,4) pyrimidone photoproducts (6,4PPs). However, they were resistant to UVA, probably as a result of the activation of photolyases during UVA irradiation. Surprisingly, a sensory mechanism that triggers their escape from UVB and UVA light avoids the generation of DNA damage and helps to maintain the genomic integrity. This work demonstrates the genotoxic impact of both UVB and UVA radiation on tadpoles and emphasizes the importance of the interplay between molecular and sensory mechanisms to minimize the damage caused by sunlight. © 2015. Published by The Company of Biologists Ltd.

  2. Hyperprolinemia induces DNA, protein and lipid damage in blood of rats: antioxidant protection.


    Ferreira, Andréa G K; Scherer, Emilene B; da Cunha, Aline A; Manfredini, Vanusa; Biancini, Giovana Brondani; Vanzin, Camila Simioni; Vargas, Carmen R; Wyse, Angela T S


    The present study investigated the effects of hyperprolinemia on oxidative damage to biomolecules (protein, lipids and DNA) and the antioxidant status in blood of rats. The influence of the antioxidants on the effects elicited by proline was also examined. Wistar rats received two daily injections of proline and/or vitamin E plus C (6th-28th day of life) and were killed 12h after the last injection. Results showed that hyperprolinemia induced a significant oxidative damage to proteins, lipids and DNA demonstrated by increased carbonyl content, malondialdehyde levels and a greater damage index in comet assay, respectively. The concomitant antioxidants administration to proline treatment completely prevented oxidative damage to proteins, but partially prevented lipids and DNA damage. We also observed that the non-enzymatic antioxidant potential was decreased by proline treatment and partially prevented by antioxidant supplementation. The plasma levels of vitamins E and C significantly increased in rats treated exogenously with these vitamins but, interestingly, when proline was administered concomitantly with vitamin E plus C, the levels of these vitamins were similar to those found in plasma of control and proline rats. Our findings suggest that hyperprolinemia promotes oxidative damage to the three major classes of macromolecules in blood of rats. These effects were accomplished by decrease in non-enzymatic antioxidant potential and decrease in vitamins administered exogenously, which significantly decreased oxidative damage to biomolecules studied. These data suggest that antioxidants may be an effective adjuvant therapeutic to limit oxidative damage caused by proline. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Experimental setup and first measurement of DNA damage induced along and around an antiproton beam

    NASA Astrophysics Data System (ADS)

    Kavanagh, J. N.; Currell, F. J.; Timson, D. J.; Holzscheiter, M. H.; Bassler, N.; Herrmann, R.; Prise, K. M.; Schettino, G.


    Radiotherapy employs ionizing radiation to induce lethal DNA lesions in cancer cells while minimizing damage to healthy tissues. Due to their pattern of energy deposition, better therapeutic outcomes can, in theory, be achieved with ions compared to photons. Antiprotons have been proposed to offer a further enhancement due to their annihilation at the end of the path. The work presented here aimed to establish and validate an experimental procedure for the quantification of plasmid and genomic DNA damage resulting from antiproton exposure. Immunocytochemistry was used to assess DNA damage in directly and indirectly exposed human fibroblasts irradiated in both plateau and Bragg peak regions of a 126 MeV antiproton beam at CERN. Cells were stained post irradiation with an anti- γ-H2AX antibody. Quantification of the γ-H2AX foci-dose relationship is consistent with a linear increase in the Bragg peak region. A qualitative analysis of the foci detected in the Bragg peak and plateau region indicates significant differences highlighting the different severity of DNA lesions produced along the particle path. Irradiation of desalted plasmid DNA with 5 Gy antiprotons at the Bragg peak resulted in a significant portion of linear plasmid in the resultant solution.

  4. Laser microbeam-induced DNA damage inhibits cell division in fertilized eggs and early embryos.


    Wang, Zhong-Wei; Ma, Xue-Shan; Ma, Jun-Yu; Luo, Yi-Bo; Lin, Fei; Wang, Zhen-Bo; Fan, Heng-Yu; Schatten, Heide; Sun, Qing-Yuan


    DNA double-strand breaks are caused by both intracellular physiological processes and environmental stress. In this study, we used laser microbeam cut (abbreviated microcut or cut), which allows specific DNA damage in the pronucleus of a fertilized egg and in individual blastomere(s) of an early embryo, to investigate the response of early embryos to DNA double-strand breaks. Line type γH2AX foci were detected in the cut region, while Chk2 phosphorylation staining was observed in the whole nuclear region of the cut pronuclei or blastomeres. Zygotes with cut male or female pronucleus showed poor developmental capability: the percentage of cleavage embryos was significantly decreased, and the embryos failed to complete further development to blastocysts. The cut blastomeres in 2-cell, 4-cell, and 8-cell embryos ceased cleavage, and they failed to incorporate into compacted morulae, but instead underwent apoptosis and cell death at the blastocyst stage; the uncut part of embryos could develop to blastocysts, with a reduced percentage or decreased cell number. When both blastomeres of the 2-cell embryos were cut by laser microbeam, cell death occurred 24 h earlier, suggesting important functions of the uncut blastomere in delaying cell death of the cut blastomere. Taken together, we conclude that microbeam-induced DNA damage in early embryos causes compromised development, and that embryos may have their own mechanisms to exclude DNA-damaged blastomeres from participating in further development.

  5. Co-transcriptional R-loops are the main cause of estrogen-induced DNA damage.


    Stork, Caroline Townsend; Bocek, Michael; Crossley, Madzia P; Sollier, Julie; Sanz, Lionel A; Chédin, Frédéric; Swigut, Tomek; Cimprich, Karlene A


    The hormone estrogen (E2) binds the estrogen receptor to promote transcription of E2-responsive genes in the breast and other tissues. E2 also has links to genomic instability, and elevated E2 levels are tied to breast cancer. Here, we show that E2 stimulation causes a rapid, global increase in the formation of R-loops, co-transcriptional RNA-DNA products, which in some instances have been linked to DNA damage. We show that E2-dependent R-loop formation and breast cancer rearrangements are highly enriched at E2-responsive genomic loci and that E2 induces DNA replication-dependent double-strand breaks (DSBs). Strikingly, many DSBs that accumulate in response to E2 are R-loop dependent. Thus, R-loops resulting from the E2 transcriptional response are a significant source of DNA damage. This work reveals a novel mechanism by which E2 stimulation leads to genomic instability and highlights how transcriptional programs play an important role in shaping the genomic landscape of DNA damage susceptibility.

  6. Co-transcriptional R-loops are the main cause of estrogen-induced DNA damage

    PubMed Central

    Stork, Caroline Townsend; Bocek, Michael; Crossley, Madzia P; Sollier, Julie; Sanz, Lionel A; Chédin, Frédéric; Swigut, Tomek; Cimprich, Karlene A


    The hormone estrogen (E2) binds the estrogen receptor to promote transcription of E2-responsive genes in the breast and other tissues. E2 also has links to genomic instability, and elevated E2 levels are tied to breast cancer. Here, we show that E2 stimulation causes a rapid, global increase in the formation of R-loops, co-transcriptional RNA-DNA products, which in some instances have been linked to DNA damage. We show that E2-dependent R-loop formation and breast cancer rearrangements are highly enriched at E2-responsive genomic loci and that E2 induces DNA replication-dependent double-strand breaks (DSBs). Strikingly, many DSBs that accumulate in response to E2 are R-loop dependent. Thus, R-loops resulting from the E2 transcriptional response are a significant source of DNA damage. This work reveals a novel mechanism by which E2 stimulation leads to genomic instability and highlights how transcriptional programs play an important role in shaping the genomic landscape of DNA damage susceptibility. DOI: PMID:27552054

  7. Laser microbeam-induced DNA damage inhibits cell division in fertilized eggs and early embryos

    PubMed Central

    Wang, Zhong-Wei; Ma, Xue-Shan; Ma, Jun-Yu; Luo, Yi-Bo; Lin, Fei; Wang, Zhen-Bo; Fan, Heng-Yu; Schatten, Heide; Sun, Qing-Yuan


    DNA double-strand breaks are caused by both intracellular physiological processes and environmental stress. In this study, we used laser microbeam cut (abbreviated microcut or cut), which allows specific DNA damage in the pronucleus of a fertilized egg and in individual blastomere(s) of an early embryo, to investigate the response of early embryos to DNA double-strand breaks. Line type γH2AX foci were detected in the cut region, while Chk2 phosphorylation staining was observed in the whole nuclear region of the cut pronuclei or blastomeres. Zygotes with cut male or female pronucleus showed poor developmental capability: the percentage of cleavage embryos was significantly decreased, and the embryos failed to complete further development to blastocysts. The cut blastomeres in 2-cell, 4-cell, and 8-cell embryos ceased cleavage, and they failed to incorporate into compacted morulae, but instead underwent apoptosis and cell death at the blastocyst stage; the uncut part of embryos could develop to blastocysts, with a reduced percentage or decreased cell number. When both blastomeres of the 2-cell embryos were cut by laser microbeam, cell death occurred 24 h earlier, suggesting important functions of the uncut blastomere in delaying cell death of the cut blastomere. Taken together, we conclude that microbeam-induced DNA damage in early embryos causes compromised development, and that embryos may have their own mechanisms to exclude DNA-damaged blastomeres from participating in further development. PMID:24036543

  8. Using ultra-sensitive next generation sequencing to dissect DNA damage-induced mutagenesis

    PubMed Central

    Wang, Kaile; Ma, Xiaolu; Zhang, Xue; Wu, Dafei; Sun, Chenyi; Sun, Yazhou; Lu, Xuemei; Wu, Chung-I; Guo, Caixia; Ruan, Jue


    Next generation sequencing (NGS) technologies have dramatically improved studies in biology and biomedical science. However, no optimal NGS approach is available to conveniently analyze low frequency mutations caused by DNA damage treatments. Here, by developing an exquisite ultra-sensitive NGS (USNGS) platform “EasyMF” and incorporating it with a widely used supF shuttle vector-based mutagenesis system, we can conveniently dissect roles of lesion bypass polymerases in damage-induced mutagenesis. In this improved mutagenesis analysis pipeline, the initial steps are the same as in the supF mutation assay, involving damaging the pSP189 plasmid followed by its transfection into human 293T cells to allow replication to occur. Then “EasyMF” is employed to replace downstream MBM7070 bacterial transformation and other steps for analyzing damage-induced mutation frequencies and spectra. This pipeline was validated by using UV damaged plasmid after its replication in lesion bypass polymerase-deficient 293T cells. The increased throughput and reduced cost of this system will allow us to conveniently screen regulators of translesion DNA synthesis pathway and monitor environmental genotoxic substances, which can ultimately provide insight into the mechanisms of genome stability and mutagenesis. PMID:27122023

  9. Visible light may directly induce nuclear DNA damage triggering the death pathway in RGC-5 cells.


    Li, Guang-Yu; Fan, Bin; Ma, Tong-Hui


    Visible light has been previously demonstrated to induce retinal ganglion cell (RGC)-5 cell death through the mitochondrial pathway. The present study was designed to determine whether visible light might also directly trigger the death pathway by damaging nuclear DNA. RGC-5 cells were exposed to various intensities and durations of visible light exposure. Cell viability and death were monitored with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and propidium iodide staining. Nuclear DNA damage caused by light was determined with the plasmid assay, genome DNA assay, and in situ terminal deoxynucleotidyl transferase dUTP nick end labeling. The subsequent activation of nuclear enzyme poly(ADP-ribose) polymerase-1 (PARP-1) was measured with western blot, and PARP-1's role in the death pathway was assessed by using specific inhibitors. Poly (ADP-ribose) glycohydrolase and apoptosis-inducing factor (AIF) inhibitors were used to show their influence on light-induced cell death. Calcium influx was examined with the fura-2 assay and calcium channel blocker. We found that visible light induced RGC-5 cell death in a time- and intensity-dependent manner. After the light intensity was increased to 2,600 lx, activation of the death pathway in RGC-5 cells was clearly observed by detecting double-strand DNA breaks and nuclear DNA damage in vitro. Nuclear enzyme PARP-1 was promptly activated after exposure to 2,600 lx of light for 2 days, and specific inhibitors of PARP-1 had significant neuroprotective effects. The poly(ADP-ribose) glycohydrolase inhibitor tannic acid and AIF inhibitor N-phenylmaleimide partially protected RGC-5 cells from light injury. A massive calcium influx was detected after 2 days of light exposure, and a calcium channel blocker partially protected cells against light injury. These results suggest that visible light exposure may directly cause nuclear DNA damage, which consequently activates PARP-1. In addition, RGC-5 cells damaged

  10. Visible light may directly induce nuclear DNA damage triggering the death pathway in RGC-5 cells

    PubMed Central

    Fan, Bin; Ma, Tong-Hui


    Purpose Visible light has been previously demonstrated to induce retinal ganglion cell (RGC)-5 cell death through the mitochondrial pathway. The present study was designed to determine whether visible light might also directly trigger the death pathway by damaging nuclear DNA. Methods RGC-5 cells were exposed to various intensities and durations of visible light exposure. Cell viability and death were monitored with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and propidium iodide staining. Nuclear DNA damage caused by light was determined with the plasmid assay, genome DNA assay, and in situ terminal deoxynucleotidyl transferase dUTP nick end labeling. The subsequent activation of nuclear enzyme poly(ADP-ribose) polymerase-1 (PARP-1) was measured with western blot, and PARP-1’s role in the death pathway was assessed by using specific inhibitors. Poly (ADP-ribose) glycohydrolase and apoptosis-inducing factor (AIF) inhibitors were used to show their influence on light-induced cell death. Calcium influx was examined with the fura-2 assay and calcium channel blocker. Results We found that visible light induced RGC-5 cell death in a time- and intensity-dependent manner. After the light intensity was increased to 2,600 lx, activation of the death pathway in RGC-5 cells was clearly observed by detecting double-strand DNA breaks and nuclear DNA damage in vitro. Nuclear enzyme PARP-1 was promptly activated after exposure to 2,600 lx of light for 2 days, and specific inhibitors of PARP-1 had significant neuroprotective effects. The poly(ADP-ribose) glycohydrolase inhibitor tannic acid and AIF inhibitor N-phenylmaleimide partially protected RGC-5 cells from light injury. A massive calcium influx was detected after 2 days of light exposure, and a calcium channel blocker partially protected cells against light injury. Conclusions These results suggest that visible light exposure may directly cause nuclear DNA damage, which consequently activates

  11. A pathway of targeted autophagy is induced by DNA damage in budding yeast

    PubMed Central

    Eapen, Vinay V.; Waterman, David P.; Bernard, Amélie; Schiffmann, Nathan; Sayas, Enrich; Kamber, Roarke; Lemos, Brenda; Memisoglu, Gonen; Ang, Jessie; Mazella, Allison; Chuartzman, Silvia G.; Loewith, Robbie J.; Schuldiner, Maya; Denic, Vladimir; Klionsky, Daniel J.; Haber, James E.


    Autophagy plays a central role in the DNA damage response (DDR) by controlling the levels of various DNA repair and checkpoint proteins; however, how the DDR communicates with the autophagy pathway remains unknown. Using budding yeast, we demonstrate that global genotoxic damage or even a single unrepaired double-strand break (DSB) initiates a previously undescribed and selective pathway of autophagy that we term genotoxin-induced targeted autophagy (GTA). GTA requires the action primarily of Mec1/ATR and Rad53/CHEK2 checkpoint kinases, in part via transcriptional up-regulation of central autophagy proteins. GTA is distinct from starvation-induced autophagy. GTA requires Atg11, a central component of the selective autophagy machinery, but is different from previously described autophagy pathways. By screening a collection of ∼6,000 yeast mutants, we identified genes that control GTA but do not significantly affect rapamycin-induced autophagy. Overall, our findings establish a pathway of autophagy specific to the DNA damage response. PMID:28154131

  12. Ganglioside GT1b protects human spermatozoa from hydrogen peroxide-induced DNA and membrane damage.


    Gavella, Mirjana; Garaj-Vrhovac, Verica; Lipovac, Vaskresenija; Antica, Mariastefania; Gajski, Goran; Car, Nikica


    We have reported previously that various gangliosides, the sialic acid containing glycosphingolipids, provide protection against sperm injury caused by reactive oxygen species (ROS). In this study, we investigated the effect of treatment of human spermatozoa with ganglioside GT1b on hydrogen peroxide (H(2)O(2))-induced DNA fragmentation and plasma membrane damage. Single-cell gel electrophoresis (Comet assay) used in the assessment of sperm DNA integrity showed that in vitro supplemented GT1b (100 microm) significantly reduced DNA damage induced by H(2)O(2) (200 microm) (p < 0.05). Measurements of Annexin V binding in combination with the propidium iodide vital dye labelling demonstrated that the spermatozoa pre-treated with GT1b exhibited a significant increase (p < 0.05) in the percentage of live cells with intact membrane and decreased phosphatidylserine translocation after exposure to H(2)O(2). Flow cytometry using the intracellular ROS-sensitive fluorescence dichlorodihydrofluorescein diacetate dye employed to investigate the transport of the extracellularly supplied H(2)O(2) into the cell interior revealed that ganglioside GT1b completely inhibited the passage of H(2)O(2) through the sperm membrane. These results suggest that ganglioside GT1b may protect human spermatozoa from H(2)O(2)-induced damage by rendering sperm membrane more hydrophobic, thus inhibiting the diffusion of H(2)O(2) across the membrane.

  13. A pathway of targeted autophagy is induced by DNA damage in budding yeast.


    Eapen, Vinay V; Waterman, David P; Bernard, Amélie; Schiffmann, Nathan; Sayas, Enrich; Kamber, Roarke; Lemos, Brenda; Memisoglu, Gonen; Ang, Jessie; Mazella, Allison; Chuartzman, Silvia G; Loewith, Robbie J; Schuldiner, Maya; Denic, Vladimir; Klionsky, Daniel J; Haber, James E


    Autophagy plays a central role in the DNA damage response (DDR) by controlling the levels of various DNA repair and checkpoint proteins; however, how the DDR communicates with the autophagy pathway remains unknown. Using budding yeast, we demonstrate that global genotoxic damage or even a single unrepaired double-strand break (DSB) initiates a previously undescribed and selective pathway of autophagy that we term genotoxin-induced targeted autophagy (GTA). GTA requires the action primarily of Mec1/ATR and Rad53/CHEK2 checkpoint kinases, in part via transcriptional up-regulation of central autophagy proteins. GTA is distinct from starvation-induced autophagy. GTA requires Atg11, a central component of the selective autophagy machinery, but is different from previously described autophagy pathways. By screening a collection of ∼6,000 yeast mutants, we identified genes that control GTA but do not significantly affect rapamycin-induced autophagy. Overall, our findings establish a pathway of autophagy specific to the DNA damage response.

  14. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].



    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells.

  15. [Modified DNA-halo method for assessment of DNA damage induced by various genotoxic agents].


    Smetanina, N M; Pustovalova, M V; Osipov, A N


    Using a modified DNA-halo method single-strand breaks and DNA alkaline-labile site induction were stud- ied in human peripheral blood lymphocytes after a short-term (up to 10 min) exposure in vitro to X-rays, hy- drogen peroxide and long-wave ultraviolet light (365 ± 10 nm). It was shown that the dose-effect dependence in thee X-ray dose range of 0.3-2 Gy approximates by a linear function of y = 0.25 + 0.42x (R2 = 0.98), where y is a DNA-halo index in standardized units, x--a radiation dose in Gy. The effect of "saturation" was ob- served in the range of 2-5 Gy. Under exposure to hydrogen peroxide up to a concentration of 25 μmol/L, the dose-effect is described by a linear function y = 0.23 + 0.033x (R2 = 0.96), where y is the DNA-halo index in standardized units, x--hydrogen peroxide concentration in μmol/L. UV exposure induced a linear in- crease of the DNA-halo index in the dose range of 2-10 kJ/m2 (y = 0.26 + 0.032x (R2 = 0.99), where y is theDNA-halo index in standardized units, x--a radiation dose in kJ/m2). In summary, the described modi- fication of the DNA-halo method provides a simple, sensitive, well reproducible and rapid assay for the anal- ysis of DNA single-strand breaks and alkaline-labile sites in living cells.

  16. Oxidative Stress Induces Persistent Telomeric DNA Damage Responsible for Nuclear Morphology Change in Mammalian Cells

    PubMed Central

    Coluzzi, Elisa; Colamartino, Monica; Cozzi, Renata; Leone, Stefano; Meneghini, Carlo; O’Callaghan, Nathan; Sgura, Antonella


    One main function of telomeres is to maintain chromosome and genome stability. The rate of telomere shortening can be accelerated significantly by chemical and physical environmental agents. Reactive oxygen species are a source of oxidative stress and can produce modified bases (mainly 8-oxoG) and single strand breaks anywhere in the genome. The high incidence of guanine residues in telomeric DNA sequences makes the telomere a preferred target for oxidative damage. Our aim in this work is to evaluate whether chromosome instability induced by oxidative stress is related specifically to telomeric damage. We treated human primary fibroblasts (MRC-5) in vitro with hydrogen peroxide (100 and 200 µM) for 1 hr and collected data at several time points. To evaluate the persistence of oxidative stress-induced DNA damage up to 24 hrs after treatment, we analysed telomeric and genomic oxidative damage by qPCR and a modified comet assay, respectively. The results demonstrate that the genomic damage is completely repaired, while the telomeric oxidative damage persists. The analysis of telomere length reveals a significant telomere shortening 48 hrs after treatment, leading us to hypothesise that residual telomere damage could be responsible for the telomere shortening observed. Considering the influence of telomere length modulation on genomic stability, we quantified abnormal nuclear morphologies (Nucleoplasmic Bridges, Nuclear Buds and Micronuclei) and observed an increase of chromosome instability in the same time frame as telomere shortening. At subsequent times (72 and 96 hrs), we observed a restoration of telomere length and a reduction of chromosome instability, leaving us to conjecture a correlation between telomere shortening/dysfunction and chromosome instability. We can conclude that oxidative base damage leads to abnormal nuclear morphologies and that telomere dysfunction is an important contributor to this effect. PMID:25354277

  17. Study of terahertz-radiation-induced DNA damage in human blood leukocytes

    SciTech Connect

    Angeluts, A A; Esaulkov, M N; Kosareva, O G; Solyankin, P M; Shkurinov, A P; Gapeyev, A B; Pashovkin, T N; Matyunin, S N; Nazarov, M M; Cherkasova, O P


    We have carried out the studies aimed at assessing the effect of terahertz radiation on DNA molecules in human blood leukocytes. Genotoxic testing of terahertz radiation was performed in three different oscillation regimes, the blood leukocytes from healthy donors being irradiated for 20 minutes with the mean intensity of 8 – 200 μW cm{sup -2} within the frequency range of 0.1 – 6.5 THz. Using the comet assay it is shown that in the selected regimes such radiation does not induce a direct DNA damage in viable human blood leukocytes. (biophotonics)

  18. Study of terahertz-radiation-induced DNA damage in human blood leukocytes

    NASA Astrophysics Data System (ADS)

    Angeluts, A. A.; Gapeyev, A. B.; Esaulkov, M. N.; Kosareva, O. G.; Matyunin, S. N.; Nazarov, M. M.; Pashovkin, T. N.; Solyankin, P. M.; Cherkasova, O. P.; Shkurinov, A. P.


    We have carried out the studies aimed at assessing the effect of terahertz radiation on DNA molecules in human blood leukocytes. Genotoxic testing of terahertz radiation was performed in three different oscillation regimes, the blood leukocytes from healthy donors being irradiated for 20 minutes with the mean intensity of 8 - 200 μW cm-2 within the frequency range of 0.1 - 6.5 THz. Using the comet assay it is shown that in the selected regimes such radiation does not induce a direct DNA damage in viable human blood leukocytes.

  19. DNA damage and repair in tumour and non-tumour tissues of mice induced by nicotinamide.

    PubMed Central

    Olsson, A. R.; Sheng, Y.; Pero, R. W.; Chaplin, D. J.; Horsman, M. R.


    In vivo DNA damage and repair was induced by nicotinamide (NAM) in adenotype 12 virus-induced mouse sarcoma A12B3 and sarcoma F inoculated into CBA mice. DNA damage, NAM and NAD concentrations were measured after in vivo exposure to NAM, in tumours and spleens by alkaline elution and by HPLC analysis. Our results indicate that NAM between 100-1000 mg kg-1 causes a high level of in vivo DNA strand breaks in tumours and normal tissues in mice bearing the immunogenic sarcoma A12B3 but not in the non-immunogenic sarcoma F. The repair process was also delayed by the NAM treatment probably owing to inhibition of the DNA repair enzyme, poly(ADP-ribose)polymerase, as evidenced by accumulation of NAM and NAD. These data are consistent with NAM having a mechanism of action as a radiosensitiser at least in part by DNA repair inhibition. In addition, it should also be considered that high doses of NAM might cause considerable complications to normal tissue in tumour-bearing individuals. PMID:8695350

  20. N-nitroso-N-ethylurea activates DNA damage surveillance pathways and induces transformation in mammalian cells

    PubMed Central


    Background The DNA damage checkpoint signalling cascade sense damaged DNA and coordinates cell cycle arrest, DNA repair, and/or apoptosis. However, it is still not well understood how the signalling system differentiates between different kinds of DNA damage. N-nitroso-N-ethylurea (NEU), a DNA ethylating agent induces both transversions and transition mutations. Methods Immunoblot and comet assays were performed to detect DNA breaks and activation of the canonical checkpoint signalling kinases following NEU damage upto 2 hours. To investigate whether mismatch repair played a role in checkpoint activation, knock-down studies were performed while flow cytometry analysis was done to understand whether the activation of the checkpoint kinases was cell cycle phase specific. Finally, breast epithelial cells were grown as 3-dimensional spheroid cultures to study whether NEU can induce upregulation of vimentin as well as disrupt cell polarity of the breast acini, thus causing transformation of epithelial cells in culture. Results We report a novel finding that NEU causes activation of major checkpoint signalling kinases, Chk1 and Chk2. This activation is temporally controlled with Chk2 activation preceding Chk1 phosphorylation, and absence of cross talk between the two parallel signalling pathways, ATM and ATR. Damage caused by NEU leads to the temporal formation of both double strand and single strand breaks. Activation of checkpoints following NEU damage is cell cycle phase dependent wherein Chk2 is primarily activated during G2-M phase whilst in S phase, there is immediate Chk1 phosphorylation and delayed Chk2 response. Surprisingly, the mismatch repair system does not play a role in checkpoint activation, at doses and duration of NEU used in the experiments. Interestingly, NEU caused disruption of the well-formed polarised spheroid archithecture and upregulation of vimentin in three-dimensional breast acini cultures of non-malignant breast epithelial cells upon NEU

  1. Zingerone protects against stannous chloride-induced and hydrogen peroxide-induced oxidative DNA damage in vitro.


    Rajan, Iyappan; Narayanan, Nithya; Rabindran, Remitha; Jayasree, P R; Manish Kumar, P R


    In this paper, we report the dose-dependent antioxidant activity and DNA protective effects of zingerone. At 500 μg/mL, the DPPH radical scavenging activity of zingerone and ascorbic acid as a standard was found to be 86.7 and 94.2 % respectively. At the same concentration, zingerone also showed significant reducing power (absorbance 0.471) compared to that of ascorbic acid (absorbance 0.394). The in vitro toxicity of stannous chloride (SnCl2) was evaluated using genomic and plasmid DNA. SnCl2-induced degradation of genomic DNA was found to occur at a concentration of 0.8 mM onwards with complete degradation at 1.02 mM and above. In the case of plasmid DNA, conversion of supercoiled DNA into the open circular form indicative of DNA nicking activity was observed at a concentration of 0.2 mM onwards; complete conversion was observed at a concentration of 1.02 mM and above. Zingerone was found to confer protection against SnCl2-induced oxidative damage to genomic and plasmid DNA at concentrations of 500 and 750 μg/mL onwards, respectively. This protective effect was further confirmed in the presence of UV/H2O2-a known reactive oxygen species (ROS) generating system-wherein protection by zingerone against ROS-mediated DNA damage was observed at a concentration of 250 μg/mL onwards in a dose-dependent manner. This study clearly indicated the in vitro DNA protective property of zingerone against SnCl2-induced, ROS-mediated DNA damage.

  2. Clusters of DNA damage induced by ionizing radiation: Formation of short DNA fragments. I. Theoretical modeling

    SciTech Connect

    Holley, W.R.; Chatterjee, A.


    We have developed a general theoretical model for the interaction of ionizing radiation with chromatin. Chromatin is modeled as a 30-nm-diameter solenoidal fiber composed of 20 turns of nucleosomes, 6 nucleosomes per turn. Charged-particle tracks are modeled by partitioning the energy deposition between primary track core, resulting from glancing collisions with 100 eV or less per event, and {delta} rays due to knock-on collisions involving energy transfers > 100 eV. A Monte Carlo simulation incorporates damages due to the following molecular mechanisms: (1) ionization of water molecules leading to the formation of {circ}OH, {circ}H, e{sub aq}, etc.; {circ}OH attack on sugar molecules leading to strand breaks; {circ}OH attack on bases; direct ionization of the sugar molecules leading to strand breaks; direct ionization of the bases. Our calculations predict significant clustering of damage both locally, over regions up to 40 hp and over regions extending to several kilobase pairs. A characteristic feature of the regional damage predicted by our model is the production of short fragments of DNA associated with multiple nearby strand breaks. Such fragments have subsequently been detected experimentally and are reported in an accompanying paper after exposure to both high- and low-LET radiation. The overall measured yields agree well quantitatively with the theoretical predictions. Our theoretical results predict the existence of a strong peak at about 85 bp, which represents the revolution period about the nucleosome. Other peaks at multiples of about 1,000 bp correspond to the periodicity of the particular solenoid model of chromatin used in these calculations. Theoretical results in combination with experimental data on fragmentation spectra may help determine the consensus or average structure of the chromatin fibers in mammalian DNA. 27 refs., 7 figs.

  3. Sodium chlorate induces DNA damage and DNA-protein cross-linking in rat intestine: A dose dependent study.


    Ali, Shaikh Nisar; Ansari, Fariheen Aisha; Arif, Hussain; Mahmood, Riaz


    Sodium chlorate (NaClO3) is widely used in paper and pulp industries and as a non-selective herbicide. It is also a major by-product generated upon disinfection of drinking water by chlorine dioxide. In this study, we have investigated the genotoxicity of NaClO3 on the small intestine of rats. Adult male rats were divided into 5 groups: one control and four NaClO3 treated groups. The NaClO3 treated groups were given a single acute oral dose of NaClO3 (100, 250, 500 and 750 mg/kg body weight) and sacrificed 24 h later. Administration of NaClO3 caused significant DNA damage in a dose dependent manner in the rat intestine. This was evident from the comet assay which showed DNA strand breaks and was further confirmed by agarose gel electrophoresis and release of free nucleotides. Increased DNA protein cross-linking in NaClO3 administered groups showed formation of a critical lesion which hampers activities of proteins/enzymes involved in DNA repair, transcription and replication. Thus, oral administration of NaClO3 induces DNA damage in the rat intestine, probably through chlorate induced production of reactive oxygen species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. DNA damage, apoptosis and langerhans cells--Activators of UV-induced immune tolerance.


    Timares, Laura; Katiyar, Santosh K; Elmets, Craig A


    Solar UVR is highly mutagenic but is only partially absorbed by the outer stratum corneum of the epidermis. UVR can penetrate into the deeper layers of the epidermis, depending on melanin content, where it induces DNA damage and apoptosis in epidermal cells, including those in the germinative basal layer. The cellular decision to initiate either cellular repair or undergo apoptosis has evolved to balance the acute need to maintain skin barrier function with the long-term risk of retaining precancerous cells. Langerhans cells (LCs) are positioned suprabasally, where they may sense UV damage directly, or indirectly through recognition of apoptotic vesicles and soluble mediators derived from surrounding keratinocytes. Apoptotic vesicles will contain UV-induced altered proteins that may be presented to the immune system as foreign. The observation that UVR induces immune tolerance to skin-associated antigens suggests that this photodamage response has evolved to preserve the skin barrier by protecting it from autoimmune attack. LC involvement in this process is not clear and controversial. We will highlight some basic concepts of photobiology and review recent advances pertaining to UV-induced DNA damage, apoptosis regulation, novel immunomodulatory mechanisms and the role of LCs in generating antigen-specific regulatory T cells.

  5. Oxidative stress induces DNA damage and inhibits the repair of DNA lesions induced by N-acetoxy-2-acetylaminofluorene in human peripheral mononuclear leukocytes.


    Pero, R W; Anderson, M W; Doyle, G A; Anna, C H; Romagna, F; Markowitz, M; Bryngelsson, C


    Human mononuclear leukocytes were exposed to prooxidants such as H2O2, phorbol-12-myristate-13-acetate, and 4-nitroquinoline-N-oxide, and the effects on induction of DNA damage and repair were evaluated. ADP ribosylation was activated by prooxidant exposure and the response was bimodal with peaks of activation occurring at about 30 min and 4-5 h. Other evidence for prooxidant-induced DNA damage was provided by nucleoid sedimentation assays. Unscheduled DNA synthesis (UDS) was only slightly induced by prooxidant exposure which suggested that either the DNA lesions were repaired by a short patch mechanism involving little UDS, or the repair process was inhibited by prooxidant exposures, or some combination of both. This point was clarified by the fact that the repair of DNA lesions induced by N-acetoxy-2-acetylaminofluorene, an inducer of large patch DNA repair, was inhibited in a dose-dependent manner by exposure to H2O2 and the inhibition was dependent on ADP ribosylation. In contrast, the repair of DNA strand breaks induced by prooxidant exposures as identified above were complete within about 8 h and the repair was independent of ADP ribosylation. Both ADP ribosylation and N-acetoxy-2-acetylaminofluorene-induced UDS were shown to be up- and down-regulated by the redox state of human mononuclear leukocytes indicating a unique mechanism of cellular control over DNA repair.

  6. The thyroid hormone receptor β induces DNA damage and premature senescence

    PubMed Central

    Zambrano, Alberto; García-Carpizo, Verónica; Gallardo, María Esther; Villamuera, Raquel; Gómez-Ferrería, Maria Ana; Pascual, Angel; Buisine, Nicolas; Sachs, Laurent M.; Garesse, Rafael


    There is increasing evidence that the thyroid hormone (TH) receptors (THRs) can play a role in aging, cancer and degenerative diseases. In this paper, we demonstrate that binding of TH T3 (triiodothyronine) to THRB induces senescence and deoxyribonucleic acid (DNA) damage in cultured cells and in tissues of young hyperthyroid mice. T3 induces a rapid activation of ATM (ataxia telangiectasia mutated)/PRKAA (adenosine monophosphate–activated protein kinase) signal transduction and recruitment of the NRF1 (nuclear respiratory factor 1) and THRB to the promoters of genes with a key role on mitochondrial respiration. Increased respiration leads to production of mitochondrial reactive oxygen species, which in turn causes oxidative stress and DNA double-strand breaks and triggers a DNA damage response that ultimately leads to premature senescence of susceptible cells. Our findings provide a mechanism for integrating metabolic effects of THs with the tumor suppressor activity of THRB, the effect of thyroidal status on longevity, and the occurrence of tissue damage in hyperthyroidism. PMID:24395638

  7. Oxidative stress and DNA damage induced by imidacloprid in zebrafish (Danio rerio).


    Ge, Weili; Yan, Saihong; Wang, Jinhua; Zhu, Lusheng; Chen, Aimei; Wang, Jun


    Imidacloprid is a neonicotinoid insecticide that can have negative effects on nontarget animals. The present study was conducted to assess the toxicity of various imidacloprid doses (0.3, 1.25, and 5 mg/mL) on zebrafish sampled after 7, 14, 21, and 28 days of exposure. The levels of catalase (CAT), superoxide dismutase (SOD), reactive oxygen species (ROS), glutathione-S-transferase (GST), and malondialdehyde (MDA) and the extent of DNA damage were measured to evaluate the toxicity of imidacloprid on zebrafish. SOD and GST activities were noticeably increased during early exposure but were inhibited toward the end of the exposure period. In addition, the CAT levels decreased to the control level following their elevation during early exposure. High concentrations of imidacloprid (1.25 and 5 mg/L) induced excessive ROS production and markedly increased MDA content on the 21st day of exposure. DNA damage was dose- and time-dependent. In conclusion, the present study showed that imidacloprid can induce oxidative stress and DNA damage in zebrafish.

  8. Buckwheat Honey Attenuates Carbon Tetrachloride-Induced Liver and DNA Damage in Mice

    PubMed Central

    Cheng, Ni; Wu, Liming; Zheng, Jianbin; Cao, Wei


    Buckwheat honey, which is widely consumed in China, has a characteristic dark color. The objective of this study was to investigate the protective effects of buckwheat honey on liver and DNA damage induced by carbon tetrachloride in mice. The results revealed that buckwheat honey had high total phenolic content, and rutin, hesperetin, and p-coumaric acid were the main phenolic compounds present. Buckwheat honey possesses super DPPH radical scavenging activity and strong ferric reducing antioxidant power. Administration of buckwheat honey for 10 weeks significantly inhibited serum lipoprotein oxidation and increased serum oxygen radical absorbance capacity. Moreover, buckwheat honey significantly inhibited aspartate aminotransferase and alanine aminotransferase activities, which are enhanced by carbon tetrachloride. Hepatic malondialdehyde decreased and hepatic antioxidant enzymes (superoxide dismutase and glutathione peroxidase) increased in the presence of buckwheat honey. In a comet assay, lymphocyte DNA damage induced by carbon tetrachloride was significantly inhibited by buckwheat honey. Therefore, buckwheat honey has a hepatoprotective effect and inhibits DNA damage, activities that are primarily attributable to its high antioxidant capacity. PMID:26508989

  9. ATG5 is induced by DNA-damaging agents and promotes mitotic catastrophe independent of autophagy

    PubMed Central

    Maskey, Dipak; Yousefi, Shida; Schmid, Inès; Zlobec, Inti; Perren, Aurel; Friis, Robert; Simon, Hans-Uwe


    Anticancer drug therapy activates both molecular cell death and autophagy pathways. Here we show that even sublethal concentrations of DNA-damaging drugs, such as etoposide and cisplatin, induce the expression of autophagy-related protein 5 (ATG5), which is both necessary and sufficient for the subsequent induction of mitotic catastrophe. We demonstrate that ATG5 translocates to the nucleus, where it physically interacts with survivin in response to DNA-damaging agents both in vitro and in carcinoma tissues obtained from patients who had undergone radiotherapy and/or chemotherapy. As a consequence, elements of the chromosomal passenger complex are displaced during mitosis, resulting in chromosome misalignment and segregation defects. Pharmacological inhibition of autophagy does not prevent ATG5-dependent mitotic catastrophe, but shifts the balance to an early caspase-dependent cell death. Our data suggest a dual role for ATG5 in response to drug-induced DNA damage, where it acts in two signalling pathways in two distinct cellular compartments, the cytosol and the nucleus. PMID:23945651

  10. Assessment of ultraviolet-radiation-induced DNA damage within melanocytes in skin of different constitutive pigmentation.


    Del Bino, S; Sok, J; Bernerd, F


    Melanoma incidence and pigmentary disorders are known to be related to the degree of skin pigmentation, but few data exist on the specific impact of ultraviolet radiation (UVR) on melanocytes in skin of different constitutive pigmentation. To analyse UVR-induced DNA damage within melanocytes in different skin-colour types. Skin samples were objectively classified into light, intermediate, tan, brown and dark skin according to their individual typology angle (°ITA), based on colorimetric parameters. Samples were exposed to increasing doses of solar simulated radiation. Detection of DNA damage specifically in melanocytes was achieved by cyclobutane thymine dimer (CPD)-tyrosinase-related protein 1 double staining. For light, intermediate and tan skin, accumulation of CPDs in melanocytes was detected at the lowest dose, with a steep increase with dose. At estimated erythemally equivalent doses, around 80-100% of melanocytes were positive for CPDs in tan, intermediate and light skin types. In contrast, in dark and brown skin types, CPDs were found in only approximately 15% of melanocytes at the highest dose. This work demonstrates that melanocytes from constitutively highly pigmented skin types are less impacted in terms of UVR-induced DNA damage than those from lighter skin types, even those that are moderately pigmented. © 2013 The Authors. BJD © 2013 British Association of Dermatologists.

  11. Impact of the Circadian Clock on UV-Induced DNA Damage Response and Photocarcinogenesis.


    Dakup, Panshak; Gaddameedhi, Shobhan


    The skin is in constant exposure to various external environmental stressors, including solar ultraviolet (UV) radiation. Various wavelengths of UV light are absorbed by the DNA and other molecules in the skin to cause DNA damage and induce oxidative stress. The exposure to excessive ultraviolet (UV) radiation and/or accumulation of damage over time can lead to photocarcinogenesis and photoaging. The nucleotide excision repair (NER) system is the sole mechanism for removing UV photoproduct damage from DNA, and genetic disruption of this repair pathway leads to the photosensitive disorder xeroderma pigmentosum (XP). Interestingly, recent work has shown that NER is controlled by the circadian clock, the body's natural time-keeping mechanism, through regulation of the rate-limiting repair factor xeroderma pigmentosum group A (XPA). Studies have shown reduced UV-induced skin cancer after UV exposure in the evening compared to the morning, which corresponds with times of high and low repair capacities, respectively. However, most studies of the circadian clock-NER connection have utilized murine models, and it is therefore important to translate these findings to humans to improve skin cancer prevention and chronotherapy.

  12. The DNA Damage Response Induced by Infection with Human Cytomegalovirus and Other Viruses

    PubMed Central

    E, Xiaofei; Kowalik, Timothy F.


    Viruses use different strategies to overcome the host defense system. Recent studies have shown that viruses can induce DNA damage response (DDR). Many of these viruses use DDR signaling to benefit their replication, while other viruses block or inactivate DDR signaling. This review focuses on the effects of DDR and DNA repair on human cytomegalovirus (HCMV) replication. Here, we review the DDR induced by HCMV infection and its similarities and differences to DDR induced by other viruses. As DDR signaling pathways are critical for the replication of many viruses, blocking these pathways may represent novel therapeutic opportunities for the treatment of certain infectious diseases. Lastly, future perspectives in the field are discussed. PMID:24859341

  13. Energy Thresholds of DNA Damage Induced by UV Radiation: An XPS Study.


    Gomes, P J; Ferraria, A M; Botelho do Rego, A M; Hoffmann, S V; Ribeiro, P A; Raposo, M


    This work stresses on damage at the molecular level caused by ultraviolet radiation (UV) in the range from 3.5 to 8 eV, deoxyribonucleic acid (DNA) films observed by X-ray photoelectron spectroscopy (XPS). Detailed quantitative XPS analysis, in which all the amounts are relative to sodium-assumed not to be released from the samples, of the carbon, oxygen, and particularly, nitrogen components, reveals that irradiation leads to sugar degradation with CO-based compounds release for energies above 6.9 eV and decrease of nitrogen groups which are not involved in hydrogen bonding at energies above 4.2 eV. Also the phosphate groups are seen to decrease to energies above 4.2 eV. Analysis of XPS spectra allowed to conclude that the damage on bases peripheral nitrogen atoms are following the damage on phosphates. It suggests that very low kinetic energy photoelectrons are ejected from the DNA bases, as a result of UV light induced breaking of the phosphate ester groups which forms a transient anion with resonance formation and whereby most of the nitrogen DNA peripheral groups are removed. The degree of ionization of DNA was observed to increase with radiation energy, indicating that the ionized phosphate groups are kept unchanged. This result was interpreted by the shielding of phosphate groups caused by water molecules hydration near sodium atoms.

  14. NEIL2 protects against oxidative DNA damage induced by sidestream smoke in human cells.


    Sarker, Altaf H; Chatterjee, Arpita; Williams, Monique; Lin, Sabrina; Havel, Christopher; Jacob, Peyton; Boldogh, Istvan; Hazra, Tapas K; Talbot, Prudence; Hang, Bo


    Secondhand smoke (SHS) is a confirmed lung carcinogen that introduces thousands of toxic chemicals into the lungs. SHS contains chemicals that have been implicated in causing oxidative DNA damage in the airway epithelium. Although DNA repair is considered a key defensive mechanism against various environmental attacks, such as cigarette smoking, the associations of individual repair enzymes with susceptibility to lung cancer are largely unknown. This study investigated the role of NEIL2, a DNA glycosylase excising oxidative base lesions, in human lung cells treated with sidestream smoke (SSS), the main component of SHS. To do so, we generated NEIL2 knockdown cells using siRNA-technology and exposed them to SSS-laden medium. Representative SSS chemical compounds in the medium were analyzed by mass spectrometry. An increased production of reactive oxygen species (ROS) in SSS-exposed cells was detected through the fluorescent detection and the induction of HIF-1α. The long amplicon-quantitative PCR (LA-QPCR) assay detected significant dose-dependent increases of oxidative DNA damage in the HPRT gene of cultured human pulmonary fibroblasts (hPF) and BEAS-2B epithelial cells exposed to SSS for 24 h. These data suggest that SSS exposure increased oxidative stress, which could contribute to SSS-mediated toxicity. siRNA knockdown of NEIL2 in hPF and HEK 293 cells exposed to SSS for 24 h resulted in significantly more oxidative DNA damage in HPRT and POLB than in cells with control siRNA. Taken together, our data strongly suggest that decreased repair of oxidative DNA base lesions due to an impaired NEIL2 expression in non-smokers exposed to SSS would lead to accumulation of mutations in genomic DNA of lung cells over time, thus contributing to the onset of SSS-induced lung cancer.

  15. Mitochondrial DNA damage and a hypoxic response are induced by CoCl2 in rat neuronal PC12 cells

    PubMed Central

    Wang, Guichun; Hazra, Tapas K.; Mitra, Sankar; Lee, Heung-Man; Englander, Ella W.


    Generation of reactive oxygen species (ROS) and activation of a transcriptional program that mimics the hypoxic response have been documented in cultured cells in the presence of cobalt chloride. We found that in the presence of hypoxia-mimicking concentrations of CoCl2, mitochondrial but not nuclear DNA damage is induced in rat neuronal, PC12 cells. To our knowledge, this is the first documentation of induction of mitochondrial DNA (mtDNA) damage under these conditions. Likewise, we provide the first evidence for elevation of MYH, the mammalian homolog of the Escherichia coli MutY DNA glycosylase, in mammalian cells. Recently, the human MYH was implicated in repair of oxidative DNA damage and shown to carry a mitochondrial localization sequence. Here, an induction of mtDNA damage and a time-dependent increase in the MYH level were detected with exposure of cells to 100 µM CoCl2. In addition, the levels of proteins involved in cellular responses to hypoxia, ROS and nuclear DNA damage; hypoxia-inducible factor 1α (HIF-1α), p53, p21 and PCNA were also modulated temporally. Earlier studies suggested that the mtDNA is a primary target for oxidative damage. Our findings extend these observations and suggest that activation of DNA repair processes is associated with the presence of mtDNA damage. PMID:10773083

  16. Mitochondrial DNA damage and a hypoxic response are induced by CoCl(2) in rat neuronal PC12 cells.


    Wang, G; Hazra, T K; Mitra, S; Lee, H M; Englander, E W


    Generation of reactive oxygen species (ROS) and activation of a transcriptional program that mimics the hypoxic response have been documented in cultured cells in the presence of cobalt chloride. We found that in the presence of hypoxia-mimicking concentrations of CoCl(2), mitochondrial but not nuclear DNA damage is induced in rat neuronal, PC12 cells. To our knowledge, this is the first documentation of induction of mitochondrial DNA (mtDNA) damage under these conditions. Likewise, we provide the first evidence for elevation of MYH, the mammalian homolog of the Escherichia coli MutY DNA glycosylase, in mammalian cells. Recently, the human MYH was implicated in repair of oxidative DNA damage and shown to carry a mitochondrial localization sequence. Here, an induction of mtDNA damage and a time-dependent increase in the MYH level were detected with exposure of cells to 100 microM CoCl(2). In addition, the levels of proteins involved in cellular responses to hypoxia, ROS and nuclear DNA damage; hypoxia-inducible factor 1alpha(HIF-1alpha), p53, p21 and PCNA were also modulated temporally. Earlier studies suggested that the mtDNA is a primary target for oxidative damage. Our findings extend these observations and suggest that activation of DNA repair processes is associated with the presence of mtDNA damage.

  17. DNA vaccination protects mice against Zika virus-induced damage to the testes.


    Griffin, Bryan D; Muthumani, Kar; Warner, Bryce M; Majer, Anna; Hagan, Mable; Audet, Jonathan; Stein, Derek R; Ranadheera, Charlene; Racine, Trina; De La Vega, Marc-Antoine; Piret, Jocelyne; Kucas, Stephanie; Tran, Kaylie N; Frost, Kathy L; De Graff, Christine; Soule, Geoff; Scharikow, Leanne; Scott, Jennifer; McTavish, Gordon; Smid, Valerie; Park, Young K; Maslow, Joel N; Sardesai, Niranjan Y; Kim, J Joseph; Yao, Xiao-Jian; Bello, Alexander; Lindsay, Robbin; Boivin, Guy; Booth, Stephanie A; Kobasa, Darwyn; Embury-Hyatt, Carissa; Safronetz, David; Weiner, David B; Kobinger, Gary P


    Zika virus (ZIKV) is an emerging pathogen causally associated with serious sequelae in fetuses, inducing fetal microcephaly and other neurodevelopment defects. ZIKV is primarily transmitted by mosquitoes, but can persist in human semen and sperm, and sexual transmission has been documented. Moreover, exposure of type-I interferon knockout mice to ZIKV results in severe damage to the testes, epididymis and sperm. Candidate ZIKV vaccines have shown protective efficacy in preclinical studies carried out in animal models, and several vaccines have entered clinical trials. Here, we report that administration of a synthetic DNA vaccine encoding ZIKV pre-membrane and envelope (prME) completely protects mice against ZIKV-associated damage to the testes and sperm and prevents viral persistence in the testes following challenge with a contemporary strain of ZIKV. These data suggest that DNA vaccination merits further investigation as a potential means to reduce ZIKV persistence in the male reproductive tract.

  18. DNA vaccination protects mice against Zika virus-induced damage to the testes

    PubMed Central

    Griffin, Bryan D.; Muthumani, Kar; Warner, Bryce M.; Majer, Anna; Hagan, Mable; Audet, Jonathan; Stein, Derek R.; Ranadheera, Charlene; Racine, Trina; De La Vega, Marc-Antoine; Piret, Jocelyne; Kucas, Stephanie; Tran, Kaylie N.; Frost, Kathy L.; De Graff, Christine; Soule, Geoff; Scharikow, Leanne; Scott, Jennifer; McTavish, Gordon; Smid, Valerie; Park, Young K.; Maslow, Joel N.; Sardesai, Niranjan Y.; Kim, J. Joseph; Yao, Xiao-jian; Bello, Alexander; Lindsay, Robbin; Boivin, Guy; Booth, Stephanie A.; Kobasa, Darwyn; Embury-Hyatt, Carissa; Safronetz, David; Weiner, David B.; Kobinger, Gary P.


    Zika virus (ZIKV) is an emerging pathogen causally associated with serious sequelae in fetuses, inducing fetal microcephaly and other neurodevelopment defects. ZIKV is primarily transmitted by mosquitoes, but can persist in human semen and sperm, and sexual transmission has been documented. Moreover, exposure of type-I interferon knockout mice to ZIKV results in severe damage to the testes, epididymis and sperm. Candidate ZIKV vaccines have shown protective efficacy in preclinical studies carried out in animal models, and several vaccines have entered clinical trials. Here, we report that administration of a synthetic DNA vaccine encoding ZIKV pre-membrane and envelope (prME) completely protects mice against ZIKV-associated damage to the testes and sperm and prevents viral persistence in the testes following challenge with a contemporary strain of ZIKV. These data suggest that DNA vaccination merits further investigation as a potential means to reduce ZIKV persistence in the male reproductive tract. PMID:28589934

  19. High-throughput genotoxicity assay identifies antioxidants as inducers of DNA damage response and cell death

    PubMed Central

    Fox, Jennifer T.; Sakamuru, Srilatha; Huang, Ruili; Teneva, Nedelina; Simmons, Steven O.; Xia, Menghang; Tice, Raymond R.; Austin, Christopher P.; Myung, Kyungjae


    Human ATAD5 is a biomarker for identifying genotoxic compounds because ATAD5 protein levels increase posttranscriptionally in response to DNA damage. We screened over 4,000 compounds with a cell-based quantitative high-throughput ATAD5-luciferase assay detecting genotoxic compounds. We identified 22 antioxidants, including resveratrol, genistein, and baicalein, that are currently used or investigated for the treatment of cardiovascular disease, type 2 diabetes, osteopenia, osteoporosis, and chronic hepatitis, as well as for antiaging. Treatment of dividing cells with these compounds induced DNA damage and resulted in cell death. Despite their genotoxic effects, resveratrol, genistein, and baicalein did not cause mutagenesis, which is a major side effect of conventional anticancer drugs. Furthermore, resveratrol and genistein killed multidrug-resistant cancer cells. We therefore propose that resveratrol, genistein, and baicalein are attractive candidates for improved chemotherapeutic agents. PMID:22431602

  20. [Study of blue light induced DNA damage of retinal pigment epithelium(RPE) cells and the protection of vitamin C].


    Zhou, Jian Wei; Ren, Guo Liang; Zhang, Xiao Ming; Zhu, Xi; Lin, Hai Yan; Zhou, Ji Lin


    To evaluate protection of vitamin C on blue light-induced DNA damage of human retinal pigment epithelium (RPE) cells. The cultured RPE cells were divided into 3 groups: Control group (no blue light exposure), blue light exposure group (blue light exposure for 20 minutes) and blue light exposure + vitamin C group (blue light exposure + 100 mumol/L vitamin C). Travigen's comet assay kit and Euclid comet assay software were used to assay the DNA damage levels. The DNA percentage in the tail of electrophoretogram in the three groups were 18.44%, 54.42% and 32.43% respectively (p < 0.01). Tail moments were 8.2, 48.3, and 18.4 respectively (p < 0.01). Blue light could induce DNA damage to RPE cells but vitamin C could protect the RPE cells from the blue light-induced DNA damage.

  1. The poly(ADP-ribose)-dependent chromatin remodeler Alc1 induces local chromatin relaxation upon DNA damage

    PubMed Central

    Sellou, Hafida; Lebeaupin, Théo; Chapuis, Catherine; Smith, Rebecca; Hegele, Anna; Singh, Hari R.; Kozlowski, Marek; Bultmann, Sebastian; Ladurner, Andreas G.; Timinszky, Gyula; Huet, Sébastien


    Chromatin relaxation is one of the earliest cellular responses to DNA damage. However, what determines these structural changes, including their ATP requirement, is not well understood. Using live-cell imaging and laser microirradiation to induce DNA lesions, we show that the local chromatin relaxation at DNA damage sites is regulated by PARP1 enzymatic activity. We also report that H1 is mobilized at DNA damage sites, but, since this mobilization is largely independent of poly(ADP-ribosyl)ation, it cannot solely explain the chromatin relaxation. Finally, we demonstrate the involvement of Alc1, a poly(ADP-ribose)- and ATP-dependent remodeler, in the chromatin-relaxation process. Deletion of Alc1 impairs chromatin relaxation after DNA damage, while its overexpression strongly enhances relaxation. Altogether our results identify Alc1 as an important player in the fast kinetics of the NAD+- and ATP-dependent chromatin relaxation upon DNA damage in vivo. PMID:27733626

  2. Oxidative stress induced sperm DNA damage, a possible reason for male infertility

    PubMed Central

    Hosen, Md Bayejid; Islam, Md Rakibul; Begum, Firoza; Kabir, Yearul; Howlader, M Zakir Hossain


    Background: Sperm DNA damage is an important factor in the etiology of male infertility. Objective: The aim of the study was to evaluate the association of oxidative stress induced sperm DNA damage with the pathogenesis of male infertility. Materials and Methods: The study comprised a total of 66 subjects, including fertile men (n=25) and infertile men (n=41) matched by age. Seminal malondialdehyde (MDA), phospholipid hydroperoxide (PHP), superoxide dismutase (SOD), total antioxidant status (TAS) and 8-hydroxy-2'-deoxy guanosine (8-OHdG) were estimated by spectrophotometric and ELISA based methods and the association with the sperm parameters was assessed. Results: The percentages of motile and morphologically normal cells were significantly lower (p < 0.001, p <0.001, respectivly) in infertile men. Seminal levels of MDA, PHP and 8-OHdG were significantly higher (p < 0.001, p < 0.001, and p=0. 02, respectively) while the SOD and TAS were significantly lower (p=0. 0003, p< 0.001, respectively) in infertile men. Sperm parameters were negatively correlated with MDA, PHP and 8-OHdG while positively correlated with SOD and TAS. A positive correlation of 8-OHdG with MDA and PHP and a negative correlation with TAS and SOD were also found. Conclusion: These results suggested that oxidative stress induced sperm DNA damage might have a critical effect on the etiology of infertility. Therefore, evaluation of oxidative status, antioxidant defense systems and DNA damage, together with sperm parameters might be a useful tool for diagnosis and treatment of male infertility. PMID:26568756

  3. Inhibition of uracil DNA glycosylase sensitizes cancer cells to 5-fluorodeoxyuridine through replication fork collapse-induced DNA damage

    PubMed Central

    Yan, Yan; Han, Xiangzi; Qing, Yulan; Condie, Allison G.; Gorityala, Shashank; Yang, Shuming; Xu, Yan; Zhang, Youwei; Gerson, Stanton L.


    5-fluorodeoxyuridine (5-FdU, floxuridine) is active against multiple cancers through the inhibition of thymidylate synthase, which consequently introduces uracil and 5-FU incorporation into the genome. Uracil DNA glycosylase (UDG) is one of the main enzymes responsible for the removal of uracil and 5-FU. However, how exactly UDG mediates cellular sensitivity to 5-FdU, and if so whether it is through its ability to remove uracil and 5-FU have not been well characterized. In this study, we report that UDG depletion led to incorporation of uracil and 5-FU in DNA following 5-FdU treatment and significantly enhanced 5-FdU's cytotoxicity in cancer cell lines. Co-treatment, but not post-treatment with thymidine prevented cell death of UDG depleted cells by 5-FdU, indicating that the enhanced cytotoxicity is due to the retention of uracil and 5-FU in genomic DNA in the absence of UDG. Furthermore, UDG depleted cells were arrested at late G1 and early S phase by 5-FdU, followed by accumulation of sub-G1 population indicating cell death. Mechanistically, 5-FdU dramatically reduced DNA replication speed in UDG depleted cells. UDG depletion also greatly enhanced DNA damage as shown by γH2AX foci formation. Notably, the increased γH2AX foci formation was not suppressed by caspase inhibitor treatment, suggesting that DNA damage precedes cell death induced by 5-FdU. Together, these data provide novel mechanistic insights into the roles of UDG in DNA replication, damage repair, and cell death in response to 5-FdU and suggest that UDG is a target for improving the anticancer effect of this agent. PMID:27517750

  4. Methotrexate induces DNA damage and inhibits homologous recombination repair in choriocarcinoma cells

    PubMed Central

    Xie, Lisha; Zhao, Tiancen; Cai, Jing; Su, You; Wang, Zehua; Dong, Weihong


    Objective The objective of this study was to investigate the mechanism of sensitivity to methotrexate (MTX) in human choriocarcinoma cells regarding DNA damage response. Methods Two choriocarcinoma cancer cell lines, JAR and JEG-3, were utilized in this study. An MTX-sensitive osteosarcoma cell line MG63, an MTX-resistant epithelial ovarian cancer cell line A2780 and an MTX-resistant cervical adenocarcinoma cell line Hela served as controls. Cell viability assay was carried out to assess MTX sensitivity of cell lines. MTX-induced DNA damage was evaluated by comet assay. Quantitative reverse transcription polymerase chain reaction was used to detect the mRNA levels of BRCA1, BRCA2, RAD51 and RAD52. The protein levels of γH2AX, RAD 51 and p53 were analyzed by Western blot. Results Remarkable DNA strand breaks were observed in MTX-sensitive cell lines (JAR, JEG-3 and MG63) but not in MTX-resistant cancer cells (A2780 and Hela) after 48 h of MTX treatment. Only in the choriocarcinoma cells, the expression of homologous recombination (HR) repair gene RAD51 was dramatically suppressed by MTX in a dose- and time-dependent manner, accompanied with the increase in p53. Conclusion The MTX-induced DNA strand breaks accompanied by deficiencies in HR repair may contribute to the hypersensitivity to chemotherapy in choriocarcinoma. PMID:27895503

  5. Quercetin ameliorates polychlorinated biphenyls-induced testicular DNA damage in rats.


    Lovato, F L; de Oliveira, C R; Adedara, I A; Barbisan, F; Moreira, K L S; Dalberto, M; da Rocha, M I U M; Marroni, N P; da Cruz, I B; Costabeber, I B


    Polychlorinated biphenyls (PCBs) are a group of environmental contaminants widely reported to cause gonadal toxicity in both humans and animals. This study investigated the amelioratory role of quercetin in PCBs-induced DNA damage in male Wistar rats. Polychlorinated biphenyls were administered intraperitoneally at a dose of 2 mg kg(-1) alone or in combination with quercetin (orally) at 50 mg kg(-1) for 25 days. Quercetin modulation of PCBs-induced gonadal toxicity was evaluated using selected oxidative stress indices, comet assay, measurement of DNA concentration and histology of the testes. Administration of PCBs alone caused a significant (P < 0.05) depletion in the total thiol level in testes of treated rats. Conversely, the levels of reactive oxygen species (ROS) and thiobarbituric acid reactive substances (TBARS) production were markedly elevated in testes of PCBs-treated rats compared with control. Further, PCBs exposure produced statistically significant increases in DNA tail migration, degraded double-stranded DNA (dsDNA) concentration and histological alterations of testes of the treated rats compared to control. Quercetin cotreatment significantly improved the testicular antioxidant status, decreased DNA fragmentation and restored the testicular histology, thus demonstrating the protective effect of quercetin in PCBs-treated rats.

  6. Myricetin, quercetin, (+)-catechin and (-)-epicatechin protect against N-nitrosamines-induced DNA damage in human hepatoma cells.


    Delgado, M E; Haza, A I; García, A; Morales, P


    The aim of this study was to investigate the protective effect of myricetin, quercetin, (+)-catechin and (-)-epicatechin, against N-nitrosodibutylamine (NDBA) and N-nitrosopiperidine (NPIP)-induced DNA damage in human hepatoma cells (HepG2). DNA damage (strand breaks and oxidized purines/pyrimidines) was evaluated by the alkaline single-cell gel electrophoresis or Comet assay. (+)-Catechin at the lowest concentration (10 microM) showed the maximum reduction of DNA strand breaks (23%), the formation of endonuclease III (Endo III, 19-21%) and formamidopyrimidine-DNA glycosylase (Fpg, 28-40%) sensitive sites induced by NDBA or NPIP. (-)-Epicatechin also decreased DNA strand breaks (10 microM, 20%) and the oxidized pyrimidines/purines (33-39%) induced by NDBA or NPIP, respectively. DNA strand breaks induced by NDBA or NPIP were weakly reduced by myricetin at the lowest concentration (0.1 microM, 10-19%, respectively). Myricetin also reduced the oxidized purines (0.1 microM, 17%) and pyrimidines (0.1 microM, 15%) induced by NDBA, but not the oxidized pyrimidines induced by NPIP. Quercetin did not protect against NDBA-induced DNA damage, but it reduced the formation of Endo III and Fpg sensitive sites induced by NPIP (0.1 microM, 17-20%, respectively). In conclusion, our results indicate that (+)-catechin and (-)-epicatechin at the concentrations tested protect human derived cells against oxidative DNA damage effects of NDBA and NPIP. However, myricetin at the concentrations tested only protects human cells against oxidative DNA damage induced by NDBA and quercetin against oxidative DNA damage induced by NPIP.

  7. Oxidative Stress and DNA Damage Induced by Chromium in Liver and Kidney of Goldfish, Carassius auratus

    PubMed Central

    Velma, Venkatramreddy; Tchounwou, Paul B.


    Chromium (Cr) is an abundant element in the Earth’s crust. It exhibits various oxidation states, from divalent to hexavalent forms. Cr has diverse applications in various industrial processes and inadequate treatment of the industrial effluents leads to the contamination of the surrounding water resources. Hexavalent chromium (Cr (VI)) is the most toxic form, and its toxicity has been associated with oxidative stress. The present study was designed to investigate the toxic potential of Cr (VI) in fish. In this research, we investigated the role of oxidative stress in chromium-induced genotoxicity in the liver and kidney cells of goldfish, Carassius auratus. Goldfish were acclimatized to the laboratory conditions and exposed them to 5% and 10% of 96 hr-LC50 (85.7 mg/L) of aqueous Cr (VI) in a continuous flow through system. Fish were sampled every 7 days for a period of 28 days to analyze the lipid hydroperoxides (LHP) levels and genotoxic potentials in the liver and kidney. LHP levels were analyzed by spectrophotometry while genotoxicity was assessed by single cell gel electrophoresis (comet) assay. LHP levels in the liver increased significantly at week 1, followed by a decrease. LHP levels in the kidney increased significantly at weeks 1, 2, and 3, and decreased at week 4 compared to the control. The percentage of DNA damage increased in both liver and kidney at both test concentrations. The results clearly indicate that Cr (VI) induces significant levels of DNA damage in liver and kidney cells of goldfish. The induced LHP levels in both organs were concentration-dependent and were directly correlated with the levels of DNA damage. The two tested Cr (VI) concentrations induced significant levels of oxidative stress in both organs, however the kidney appears to be more vulnerable and sensitive to Cr-induced toxicity than the liver. PMID:23700361

  8. Electrochemical and spectroscopic studies of ssDNA damage induced by hydrogen peroxide using graphene based nanomaterials.


    Berghian-Grosan, Camelia; Biris, Alexandru Radu; Coros, Maria; Pogacean, Florina; Pruneanu, Stela


    The oxidative damage of deoxyribonucleic acid (DNA) has been intensively studied due to its role in the occurrence of some diseases. The hydrogen peroxide (H2O2) is one of the reactive oxygen species (ROS). It can induce oxidation of DNA bases, sugar lesions or DNA strand breaks. The Pt/Gr-Au-3 modified electrode was employed for the analysis of four ssDNA samples: single-stranded DNA (ssDNA), ssDNA pre-treated with hydrogen peroxide (ssDNA-H2O2), ssDNA pre-treated with graphene-gold nanoparticles (ssDNA-Gr-Au) and ssDNA-Gr-Au complex pre-treated with hydrogen peroxide (ssDNA-Gr-Au-H2O2). By monitoring the changes of the purine oxidation peaks currents, we obtained valuable information about the damage induced by the hydrogen peroxide onto the un-treated or graphene pre-treated ssDNA and also about the interaction between ssDNA and graphene-based nanomaterial. The FTIR analysis has been also used to obtain information about the ssDNA damage. These findings allowed us to prove the utility of graphene-based nanomaterials (mainly Gr-Au-3) not only for the investigation of the oxidative damage induced by a non-radical oxidant, but also for the determination of the type of interaction between ssDNA and graphene surface. The stability of the ssDNA-Gr-Au-3 complex against the damage induced by H2O2, in the absence of reduced transition metals, was also established. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Role of mitochondria, ROS, and DNA damage in arsenic induced carcinogenesis.


    Lee, Chih-Hung; Yu, Hsin-Su


    The International Agency for Research on Cancer (IARC) declared arsenic a class I carcinogen. Arsenic exposure induces several forms of human cancers, including cancers of skin, lung, liver, and urinary bladder. The majority of the arsenic-induced cancers occur in skin. Among these, the most common is Bowen's disease, characterized by epidermal hyperplasia, full layer epidermal dysplasia, leading to intraepidermal carcinoma as well as apoptosis, and moderate dermal infiltrates, which require the participation of mitochondria. The exact mechanism underlying arsenic induced carcinogenesis remains unclear, although increased reactive oxidative stresses, leading to chromosome abnormalities and uncontrolled growth, and aberrant immune regulations might be involved. Here, we highlight how increased mitochondrial biogenesis and oxidative stress lead to mitochondrial DNA damage and mutation in arsenic induced cancers. We also provide therapeutic rationale for targeting mitochondria in the treatment of arsenic induced cancers.

  10. Plant Nuclei Move to Escape Ultraviolet-Induced DNA Damage and Cell Death.


    Iwabuchi, Kosei; Hidema, Jun; Tamura, Kentaro; Takagi, Shingo; Hara-Nishimura, Ikuko


    A striking feature of plant nuclei is their light-dependent movement. In Arabidopsis (Arabidopsis thaliana) leaf mesophyll cells, the nuclei move to the side walls of cells within 1 to 3 h after blue-light reception, although the reason is unknown. Here, we show that the nuclear movement is a rapid and effective strategy to avoid ultraviolet B (UVB)-induced damages. Mesophyll nuclei were positioned on the cell bottom in the dark, but sudden exposure of these cells to UVB caused severe DNA damage and cell death. The damage was remarkably reduced in both blue-light-treated leaves and mutant leaves defective in the actin cytoskeleton. Intriguingly, in plants grown under high-light conditions, the mesophyll nuclei remained on the side walls even in the dark. These results suggest that plants have two strategies for reducing UVB exposure: rapid nuclear movement against acute exposure and nuclear anchoring against chronic exposure.

  11. Ginsenoside-Rg5 induces apoptosis and DNA damage in human cervical cancer cells

    PubMed Central



    Panax ginseng is traditionally used as a remedy for cancer, inflammation, stress and aging, and ginsenoside-Rg5 is a major bioactive constituent of steamed ginseng. The present study aimed to evaluate whether ginsenoside-Rg5 had any marked cytotoxic, apoptotic or DNA-damaging effects in human cervical cancer cells. Five human cervical cancer cell lines (HeLa, MS751, C33A, Me180 and HT-3) were used to investigate the cytotoxicity of ginsenoside-Rg5 using a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Additionally, the effects of ginsenoside-Rg5 on the apoptosis of HeLa and MS751 cells were detected using DNA ladder assays and flow cytometry. DNA damage was assessed in the HeLa and MS751 cells using alkaline comet assays and by detection of γH2AX focus formation. The HeLa and MS751 cells were significantly more sensitive to ginsenoside-Rg5 treatment compared with the C-33A, HT-3 and Me180 cells. As expected, ginsenoside-Rg5 induced significant concentration- and time-dependent increases in apoptosis. In addition, ginsenoside-Rg5 induced significant concentration-dependent increases in the level of DNA damage compared with the negative control. Consistent with the comet assay data, the percentage of γH2AX-positive HeLa and MS751 cells also revealed that ginsenoside-Rg5 caused DNA double-strands to break in a concentration-dependent manner. In conclusion, ginsenoside-Rg5 had marked genotoxic effects in the HeLa and MS751 cells and, thus, demonstrates potential as a genotoxic or cytotoxic drug for the treatment of cervical cancer. PMID:25355274

  12. Hesperidin attenuates cisplatin-induced acute renal injury by decreasing oxidative stress, inflammation and DNA damage.


    Sahu, Bidya Dhar; Kuncha, Madhusudana; Sindhura, G Jeevana; Sistla, Ramakrishna


    Nephrotoxicity is an important complication in cancer patients undergoing cisplatin therapy. Oxidative stress, inflammation and apoptosis/necrosis are the major patho-mechanisms of cisplatin induced nephrotoxicity. In the present study, hesperidin, a naturally-occurring bioflavonoid has been demonstrated to have protective effect on cisplatin-induced renal injury in rats. Cisplatin intoxication resulted in structural and functional renal impairment which was revealed by massive histopathological changes and elevated blood urea nitrogen and serum creatinine levels, respectively. Renal injury was associated with oxidative stress/lipid peroxidation as evident by increased reactive oxygen species (ROS) and malondialdehyde (MDA) formation with decreased levels of antioxidants such as reduced glutathione, vitamin C, catalase, superoxide dismutase, glutathione reductase, glutathione peroxidase and glutathione-S-transferase. Cisplatin administration also triggered inflammatory response in rat kidneys by inducing pro-inflammatory cytokine, TNF-α, with the increased expression of myeloperoxidase (MPO). Furthermore, cisplatin increased the activity of caspase-3 and DNA damage with decreased tissue nitric oxide levels. Hesperidin treatment significantly attenuated the cisplatin-induced oxidative stress/lipid peroxidation, inflammation (infiltration of leukocytes and pro-inflammatory cytokine), apoptosis/necrosis (caspase-3 activity with DNA damage) as well as increased expression of nitric oxide in the kidney and improved renal function. Thus, our results suggest that hesperidin co-administration may serve as a novel and promising preventive strategy against cisplatin-induced nephrotoxicity. Copyright © 2012 Elsevier GmbH. All rights reserved.


    EPA Science Inventory

    Rapid, sensitive and simple assays for radiation- and chemically-induced DNA damage can be of significant benefit to a number of fields including radiation biology, clinical research, and environmental monitoring. Although temperature-induced DNA strand separation has been use...


    EPA Science Inventory

    Rapid, sensitive and simple assays for radiation- and chemically-induced DNA damage can be of significant benefit to a number of fields including radiation biology, clinical research, and environmental monitoring. Although temperature-induced DNA strand separation has been use...

  15. The relative roles of DNA damage induced by UVA irradiation in human cells.


    Cortat, Barbara; Garcia, Camila Carrião Machado; Quinet, Annabel; Schuch, André Passaglia; de Lima-Bessa, Keronninn Moreno; Menck, Carlos Frederico Martins


    UVA light (320-400 nm) represents approximately 95% of the total solar UV radiation that reaches the Earth's surface. UVA light induces oxidative stress and the formation of DNA photoproducts in skin cells. These photoproducts such as pyrimidine dimers (cyclobutane pyrimidine dimers, CPDs, and pyrimidine (6-4) pyrimidone photoproducts, 6-4PPs) are removed by nucleotide excision repair (NER). In this repair pathway, the XPA protein is recruited to the damage removal site; therefore, cells deficient in this protein are unable to repair the photoproducts. The aim of this study was to investigate the involvement of oxidative stress and the formation of DNA photoproducts in UVA-induced cell death. In fact, similar levels of oxidative stress and oxidised bases were detected in XP-A and NER-proficient cells exposed to UVA light. Interestingly, CPDs were detected in both cell lines; however, 6-4PPs were detected only in DNA repair-deficient cells. XP-A cells were also observed to be significantly more sensitive to UVA light compared to NER-proficient cells, with an increased induction of apoptosis, while necrosis was similarly observed in both cell lines. The induction of apoptosis and necrosis in XP-A cells using adenovirus-mediated transduction of specific photolyases was investigated and we confirm that both types of photoproducts are the primary lesions responsible for inducing cell death in XP-A cells and may trigger the skin-damaging effects of UVA light, particularly skin ageing and carcinogenesis.

  16. Fundamental mechanisms of DNA radiosensitization: damage induced by low-energy electrons in brominated oligonucleotide trimers.


    Park, Yeunsoo; Polska, Katarzyna; Rak, Janusz; Wagner, J Richard; Sanche, Léon


    The replacement of nucleobases with brominated analogs enhances DNA radiosensitivity. We examine the chemistry of low-energy electrons (LEEs) in this sensitization process by experiments with thin films of the oligonucleotide trimers TBrXT, where BrX = 5-BrU (5-bromouracil), 5-BrC (5-bromocytosine), 8-BrA (8-bromoadenine), or 8-BrG (8-bromoguanine). The products induced from irradiation of thin (∼ 2.5 nm) oligonucleotide films, with 10 eV electrons, under ultrahigh vacuum (UHV) are analyzed by HPLC-UV. The number of damaged brominated trimers ranges from about 12 to 15 × 10(-3) molecules per incident electron, whereas under the identical conditions, these numbers drop to 4-7 × 10(-3) for the same, but nonbrominated oligonucleotides. The results of HPLC analysis show that the main degradation pathway of trinucleotides containing brominated bases involve debromination (i.e., loss of the bromine atom and its replacement with a hydrogen atom). The electron-induced sum of products upon bromination increases by factors of 2.1 for the pyrimidines and 3.2 for the purines. Thus, substitution of any native nucleobase with a brominated one in simple models of DNA increases LEE-induced damage to DNA and hence its radiosensitivity. Furthermore, besides the brominated pyrimidines that have already been tested in clinical trials, brominated purines not only appear to be promising sensitizers for radiotherapy, but could provide a higher degree of radiosensitization.

  17. Synergic Effect of Genistein and Daidzein on UVB-Induced DNA Damage: An Effective Photoprotective Combination

    PubMed Central

    Iovine, Barbara; Iannella, Maria Luigia; Gasparri, Franco; Monfrecola, Giuseppe; Bevilacqua, Maria Assunta


    The anti-inflammatory effects and antioxidant activities of individual isoflavones are well established although little is known about the photoprotective effect of their combination. The aim of this study was to investigate the photoprotective effects of different concentrations of genistein and daidzein individually or combined. We measured the expression levels of the cyclo-oxygenase-2 (COX-2) and growth arrest and DNA-damage inducible (Gadd45) genes, which are involved in inflammation and DNA repair, respectively, in BJ-5ta human skin fibroblasts irradiated with 60 mJ/cm2 UVB. We also determined the cellular response to UVB-induced DNA damage by Comet assay. We report that genistein and daidzein when administered combined, and at a specific concentration and ratio, exerted a synergistic photoprotective effect that was greater than the effect obtained with each isoflavone alone. The results reported herein suggest that low concentrations of genistein and daidzein combined may be good candidate ingredients for protective agents against UV-induced photodamage. PMID:21785564

  18. Synergic Effect of Genistein and Daidzein on UVB-Induced DNA Damage: An Effective Photoprotective Combination.


    Iovine, Barbara; Iannella, Maria Luigia; Gasparri, Franco; Monfrecola, Giuseppe; Bevilacqua, Maria Assunta


    The anti-inflammatory effects and antioxidant activities of individual isoflavones are well established although little is known about the photoprotective effect of their combination. The aim of this study was to investigate the photoprotective effects of different concentrations of genistein and daidzein individually or combined. We measured the expression levels of the cyclo-oxygenase-2 (COX-2) and growth arrest and DNA-damage inducible (Gadd45) genes, which are involved in inflammation and DNA repair, respectively, in BJ-5ta human skin fibroblasts irradiated with 60 mJ/cm(2) UVB. We also determined the cellular response to UVB-induced DNA damage by Comet assay. We report that genistein and daidzein when administered combined, and at a specific concentration and ratio, exerted a synergistic photoprotective effect that was greater than the effect obtained with each isoflavone alone. The results reported herein suggest that low concentrations of genistein and daidzein combined may be good candidate ingredients for protective agents against UV-induced photodamage.

  19. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion

    PubMed Central

    Rodier, Francis; Muñoz, Denise P.; Teachenor, Robert; Chu, Victoria; Le, Oanh; Bhaumik, Dipa; Coppé, Jean-Philippe; Campeau, Eric; Beauséjour, Christian M.; Kim, Sahn-Ho; Davalos, Albert R.; Campisi, Judith


    DNA damage can induce a tumor suppressive response termed cellular senescence. Damaged senescent cells permanently arrest growth, secrete inflammatory cytokines and other proteins and harbor persistent nuclear foci that contain DNA damage response (DDR) proteins. To understand how persistent damage foci differ from transient foci that mark repairable DNA lesions, we identify sequential events that differentiate transient foci from persistent foci, which we term ‘DNA segments with chromatin alterations reinforcing senescence’ (DNA-SCARS). Unlike transient foci, DNA-SCARS associate with PML nuclear bodies, lack the DNA repair proteins RPA and RAD51, lack single-stranded DNA and DNA synthesis and accumulate activated forms of the DDR mediators CHK2 and p53. DNA-SCARS form independently of p53, pRB and several other checkpoint and repair proteins but require p53 and pRb to trigger the senescence growth arrest. Importantly, depletion of the DNA-SCARS-stabilizing component histone H2AX did not deplete 53BP1 from DNA-SCARS but diminished the presence of MDC1 and activated CHK2. Furthermore, depletion of H2AX reduced both the p53-dependent senescence growth arrest and p53-independent cytokine secretion. DNA-SCARS were also observed following severe damage to multiple human cell types and mouse tissues, suggesting that they can be used in combination with other markers to identify senescent cells. Thus, DNA-SCARS are dynamically formed distinct structures that functionally regulate multiple aspects of the senescent phenotype. PMID:21118958


    EPA Science Inventory

    A rapid and simple assay to detect DNA damage to calf thymus DNA caused by styrene oxide (SO) is reported. This assay is based on changes observed in the melting and annealing behavior of the damaged DNA. The melting annealing process was monitored using a fluorescence indicat...


    EPA Science Inventory

    One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...


    EPA Science Inventory

    A rapid and simple assay to detect DNA damage to calf thymus DNA caused by styrene oxide (SO) is reported. This assay is based on changes observed in the melting and annealing behavior of the damaged DNA. The melting annealing process was monitored using a fluorescence indicat...


    EPA Science Inventory

    One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...

  4. L-Serine deaminase activity is induced by exposure of Escherichia coli K-12 to DNA-damaging agents.

    PubMed Central

    Newman, E B; Ahmad, D; Walker, C


    The synthesis of L-serine deaminase in Escherichia coli K-12 was induced after exposure of cells to a variety of DNA-damaging agents, including UV irradiation, nalidixic acid, and mitomycin C. Synthesis was also induced during growth at high temperature. A mutant constitutive for SOS functions showed an elevated level of L-serine deaminase activity. The response to DNA-damaging agents thus may be mediated via the SOS system. PMID:6813312

  5. Quantitative analysis of isolated and clustered DNA damage induced by gamma-rays, carbon ion beams, and iron ion beams.


    Terato, Hiroaki; Tanaka, Ruri; Nakaarai, Yusuke; Nohara, Tomonori; Doi, Yusuke; Iwai, Shigenori; Hirayama, Ryoichi; Furusawa, Yoshiya; Ide, Hiroshi


    Ionizing radiation induces multiple damaged sites (clustered damage) together with isolated lesions in DNA. Clustered damage consists of closely spaced lesions within a few helical turns of DNA and is considered to be crucial for understanding the biological consequences of ionizing radiation. In the present study, two types of DNA, supercoiled plasmid DNA and linear lambda DNA, were irradiated with gamma-rays, carbon ion beams, and iron ion beams, and the spectra and yield of isolated DNA damage and bistranded clustered DNA damage were fully analyzed. Despite using different methods for damage analysis, the experiments with plasmid and lambda DNA gave largely consistent results. The spectra of both isolated and clustered damage were essentially independent of the quality of the ionizing radiation used for irradiation. The yields of clustered damage as well as of isolated damage decreased with the different radiation beams in the order gamma> C > Fe, thus exhibiting an inverse correlation with LET [gamma (0.2 keV/microm) < C (13 keV/microm) < Fe (200 keV/microm)]. Consistent with in vitro data, the yield of chromosomal DNA DSBs decreased with increasing LET in Chinese hamster cells irradiated with carbon ion beams with different LETs, suggesting that the decrease in the yield of clustered damage with increasing LET is not peculiar to in vitro irradiation of DNA, but is common for both in vitro and in vivo irradiation. These results suggest that the adverse biological effect of the ionizing radiation is not simply accounted for by the yield of clustered DNA damage, and that the complexity of the clustered damage needs to be considered to understand the biological consequences of ionizing radiation.

  6. Oxidative DNA damage induced by activation of polychlorinated biphenyls (PCBs): implications for PCB-induced oxidative stress in breast cancer.


    Oakley, G G; Devanaboyina, U; Robertson, L W; Gupta, R C


    We have previously reported that mono- and dichlorinated biphenyls (PCBs) can be metabolized to dihydroxy compounds and further oxidized to reactive metabolites which form adducts with nitrogen and sulfur nucleophiles including DNA [Amaro et al. (1966) Chem. Res. Toxicol. 9, 623-629; Oakley et al. (1996) Carcinogenesis 17, 109-114]. The former studies also demonstrated that during the metabolism of PCBs superoxide may be produced. We have therefore examined the abilities of PCB metabolites to induce free radical-mediated oxidative DNA damage using a newly developed, highly sensitive, 32P-postlabeling assay for 8-oxode-oxyguanosine (8-oxodG) [Devanaboyina, U., and Gupta, R. (1996) Carcinogenesis 17, 917-924]. The incubation of 3,4-dichloro-2'5'-dihydroxybiphenyl (100 microM) with calf thymus DNA (300 micrograms/microL) in the presence of the breast tissue and milk-associated enzyme, lactoperoxidase (10 mU/mL), and H2O2 (0.5 mM) resulted in a significant increase in free radical-induced DNA damage (253 8-oxodG/10(6) nucleotides) as compared to vehicle-treated DNA (118 8-oxodG/10(6) nucleotides). Substituting CuCl(2) (100 microM) for lactoperoxidase/H2O2, however, resulted in a substantial increase in 8-oxodG content (2669 8-oxodG/10(6) nucleotides). FeCl(3) was ineffective, suggesting that CuCl(2) but not FeCl(3) mediates oxidation of PCB dihydroxy metabolites, resulting in oxidative DNA damage. The addition of catalase (100 U/mL) and sodium azide (0.1 M) reduced the effect of CuCl(2) (849 and 896 8-oxodG/10(6) nucleotides, respectively), while superoxide dismutase (600 U/mL) moderately stimulated and glutathione (100 microM) substantially stimulated 8-oxodG formation (3014 and 4415 8-oxodG/10(6) nucleotides, respectively). The effect of various buffers as well as the effects of PCB structure on Cu(II)-mediated oxidative DNA damage were examined. These results demonstrate that free radicals and oxidative DNA damage are produced during oxidation of lower chlorinated

  7. Protection of cisplatin-induced spermatotoxicity, DNA damage and chromatin abnormality by selenium nano-particles.


    Rezvanfar, Mohammad Amin; Rezvanfar, Mohammad Ali; Shahverdi, Ahmad Reza; Ahmadi, Abbas; Baeeri, Maryam; Mohammadirad, Azadeh; Abdollahi, Mohammad


    Cisplatin (CIS), an anticancer alkylating agent, induces DNA adducts and effectively cross links the DNA strands and so affects spermatozoa as a male reproductive toxicant. The present study investigated the cellular/biochemical mechanisms underlying possible protective effect of selenium nano-particles (Nano-Se) as an established strong antioxidant with more bioavailability and less toxicity, on reproductive toxicity of CIS by assessment of sperm characteristics, sperm DNA integrity, chromatin quality and spermatogenic disorders. To determine the role of oxidative stress (OS) in the pathogenesis of CIS gonadotoxicity, the level of lipid peroxidation (LPO), antioxidant enzymes including superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) and peroxynitrite (ONOO) as a marker of nitrosative stress (NS) and testosterone (T) concentration as a biomarker of testicular function were measured in the blood and testes. Thirty-two male Wistar rats were equally divided into four groups. A single IP dose of CIS (7 mg/kg) and protective dose of Nano-Se (2 mg/kg/day) were administered alone or in combination. The CIS-exposed rats showed a significant increase in testicular and serum LPO and ONOO level, along with a significant decrease in enzymatic antioxidants levels, diminished serum T concentration and abnormal histologic findings with impaired sperm quality associated with increased DNA damage and decreased chromatin quality. Coadministration of Nano-Se significantly improved the serum T, sperm quality, and spermatogenesis and reduced CIS-induced free radical toxic stress and spermatic DNA damage. In conclusion, the current study demonstrated that Nano-Se may be useful to prevent CIS-induced gonadotoxicity through its antioxidant potential.

  8. YAP activation protects urothelial cell carcinoma from treatment-induced DNA damage

    PubMed Central

    Ciamporcero, Eric; Shen, He; Ramakrishnan, Swathi; Ku, Sheng Yu; Chintala, Sreenivasulu; Shen, Li; Adelaiye, Remi; Miles, Kiersten Marie; Ullio, Chiara; Pizzimenti, Stefania; Daga, Martina; Azabdaftari, Gissou; Attwood, Kris; Johnson, Candace; Zhang, Jianmin; Barrera, Giuseppina; Pili, Roberto


    Current standard of care for muscle-invasive urothelial cell carcinoma (UCC) is surgery along with perioperative platinum-based chemotherapy. UCC is sensitive to cisplatin-based regimens, but acquired resistance eventually occurs, and a subset of tumors is intrinsically resistant. Thus, there is an unmet need for new therapeutic approaches to target chemotherapy-resistant UCC. Yes-associated protein (YAP) is a transcriptional co-activator that has been associated with bladder cancer progression and cisplatin resistance in ovarian cancer. In contrast, YAP has been shown to induce DNA damage associated apoptosis in non-small cell lung carcinoma. However, no data have been reported on the YAP role in UCC chemo-resistance. Thus, we have investigated the potential dichotomous role of YAP in UCC response to chemotherapy utilizing two patient-derived xenograft models recently established. Constitutive expression and activation of YAP inversely correlated with in vitro and in vivo cisplatin sensitivity. YAP overexpression protected while YAP knock-down sensitized UCC cells to chemotherapy and radiation effects via increased accumulation of DNA damage and apoptosis. Furthermore, pharmacological YAP inhibition with verteporfin inhibited tumor cell proliferation and restored sensitivity to cisplatin. In addition, nuclear YAP expression was associated with poor outcome in UCC patients who received perioperative chemotherapy. In conclusion, these results suggest that YAP activation exerts a protective role and represents a pharmacological target to enhance the anti-tumor effects of DNA damaging modalities in the treatment of UCC. PMID:26119935

  9. Quantitative Analysis of Clustered DNA Damages Induced by Silicon Beams of Different Kinetic Energy

    SciTech Connect

    Keszenman D. J.; Keszenman, D.J.; Bennett, P.V.; Sutherland, B.M.; Wilson, P.F.


    Humans may b exposed to highly energetic charged particle radiation as a result of medical treatments, occupational activitie or accidental events. In recent years, our increasing presence and burgeoning interest in space exploration beyond low Earth orbit has led to a large increase in the research of the biological effects ofcharged particle radiation typical of that encountered in the space radiation environment. The study of the effects of these types of radiation qualities in terms ofDNA damage induction and repair is fundamental to understand mechanisms both underlying their greater biological effectiveness as we)) as the short and long term risks of health effects such as carcinogenesis, degen rative diseases and premature aging. Charged particle radiation induces a variety of DNA alterations, notably bistranded clustered damages, defined as two or more closely-opposed strand break , oxidized bases or abasic sites within a few helical turns. The induction of such highly complex DNA damage enhances the probability of incorrect or incomplete repair and thus constitutes greater potential for genomic instability, cell death and transformation.

  10. Withaferin A Induces Oxidative Stress-Mediated Apoptosis and DNA Damage in Oral Cancer Cells.


    Chang, Hsueh-Wei; Li, Ruei-Nian; Wang, Hui-Ru; Liu, Jing-Ru; Tang, Jen-Yang; Huang, Hurng-Wern; Chan, Yu-Hsuan; Yen, Ching-Yu


    Withaferin A (WFA) is one of the most active steroidal lactones with reactive oxygen species (ROS) modulating effects against several types of cancer. ROS regulation involves selective killing. However, the anticancer and selective killing effects of WFA against oral cancer cells remain unclear. We evaluated whether the killing ability of WFA is selective, and we explored its mechanism against oral cancer cells. An MTS tetrazolium cell proliferation assay confirmed that WFA selectively killed two oral cancer cells (Ca9-22 and CAL 27) rather than normal oral cells (HGF-1). WFA also induced apoptosis of Ca9-22 cells, which was measured by flow cytometry for subG1 percentage, annexin V expression, and pan-caspase activity, as well as western blotting for caspases 1, 8, and 9 activations. Flow cytometry analysis shows that WFA-treated Ca9-22 oral cancer cells induced G2/M cell cycle arrest, ROS production, mitochondrial membrane depolarization, and phosphorylated histone H2A.X (γH2AX)-based DNA damage. Moreover, pretreating Ca9-22 cells with N-acetylcysteine (NAC) rescued WFA-induced selective killing, apoptosis, G2/M arrest, oxidative stress, and DNA damage. We conclude that WFA induced oxidative stress-mediated selective killing of oral cancer cells.

  11. Investigation of Mechanism(s) of DNA Damage Induced by 4-Monochlorobiphenyl (PCB3) Metabolites

    PubMed Central

    Xie, Wei; Wang, Kai; Robertson, Larry W.; Ludewig, Gabriele


    4-Monochlorobiphenyl (PCB3) is readily converted by xenobiotic-metabolizing enzymes to dihydroxy-metabolites and quinones. The PCB3 hydroquinone (PCB3-HQ; 2-(4’-chlorophenyl)-1,4-hydroquinone) induces chromosome loss in Chinese Hamster V79 cells, whereas the para-quinone (PCB3-pQ; 2-(4’-chlorophenyl)-1,4-benzoquinone) very efficiently induces gene mutations and chromosome breaks. Apparently, each of these two metabolites, which are a redox pair, has a different spectrum of genotoxic effects due to different, metabolite-specific mechanisms. We hypothesized that the HQ requires enzymatic activation by peroxidases with the formation of reactive oxygen species (ROS) as the ultimate genotoxin, whereas the pQ reacts directly with nucleophilic sites in DNA and/or proteins. To examine this hypothesis, we employed two cell lines with different myeloperoxidase (MPO) activities, MPO-rich HL-60 and MPO-deficient Jurkat cells, and measured cytotoxicity, DNA damage (COMET assay), MPO activity, intracellular levels of reactive oxygen species (ROS) and intracellular free –SH groups (monochlorobimane assay, MCB) and free GSH contents (enzyme recycling method) after treatment with PCB3-HQ and PCB3-pQ. We also examined the modulation of these effects by normal/low temperature, pre-treatment with an MPO inhibitor (succinylacetone, SA), or GSH depletion. PCB3-p-Q increased intracellular ROS levels and induced DNA damage in both HL-60 and Jurkat cells at 37 °C and 6 °C, indicating a direct, MPO-independent mode of activity. It also strongly reduced intracellular free –SH groups and GSH levels in normal and GSH-depleted cells. Thus the ROS increase could be caused by reduced protection by GSH or non-enzymatic autoxidation of the resulting PCB3-HQ-GSH adduct. PCB3-HQ did not produce a significant reduction of intracellular GSH in HL-60 cells and reduced intracellular free –SH groups only at the highest concentration tested in GSH depleted cells. Moreover, PCB3-HQ induced DNA

  12. Repair of radiation-induced DNA damage in nondividing populations of human diploid fibroblasts

    SciTech Connect

    Kantor, G.J.; Petty, R.S.; Warner, C.; Phillips, D.J.H.; Hull, D.R.


    The occurrence of DNA repair in uv- (254 nm) and x-irradiated normal human diploid fibroblasts maintained in a quiescent, nondividing state using low serum (0.5%) medium was ascertained. Techniques that detect different steps of the excision repair process were used so that the extent of completion of repair at single sites could be determined. These included measuring the disappearance of pyrimidine dimers by chromatography, detecting repair synthesis by density-gradient and autoradiographic methods and detecting the rejoining of repaired regions and repair of x-ray-induced single-strand DNA breaks using alkaline sucrose gradients. Results show that dimer excision occurs and the subsequent steps of repair synthesis and ligation are completed. About 50% of the dimers formed by exposure to 20 J/m/sup 2/ is excised in the initial 24-h post-uv period. DNA repair (unscheduled DNA synthesis) can be detected through a 5-d post-uv period. The fraction of damaged sites eventually repaired is not known. X-ray-induced single-strand DNA breaks are repaired rapidly.

  13. Lycopene inhibits Helicobacter pylori-induced ATM/ATR-dependent DNA damage response in gastric epithelial AGS cells.


    Jang, Sung Hee; Lim, Joo Weon; Morio, Tomohiro; Kim, Hyeyoung


    Oxidative stress linked to DNA damage is involved in the pathogenesis of Helicobacter pylori-associated gastric diseases. The DNA damage response (DDR) coordinates cell-cycle transitions, DNA repair, and apoptosis through the activation of ataxia-telangiectasia-mutated (ATM) and ATM and Rad3-related (ATR) and their target proteins. However, neither H. pylori-induced DDR nor the effects of antioxidants on the DNA damage have been established. This study aimed to investigate the detailed process of H. pylori-induced DNA damage and to examine whether lycopene, a natural antioxidant, inhibits DNA damage and cellular response of gastric epithelial AGS cells infected with H. pylori. AGS cells were cultured with H. pylori in Korean isolates and treated with or without lycopene. Cell viability, DNA damage indices, levels of 8-OH-dG, and reactive oxygen species (ROS) as well as cell-cycle distributions were determined. The activation of ATM, ATR, Chk1, and Chk2; histone H2AX focus formation; activation and induction of p53; and levels of Bax and Bcl-2 and poly(ADP-ribose) polymerase-1 (PARP-1) were assessed. The results showed that H. pylori induced apoptosis in AGS cells with increased Bax and decreased Bcl-2 expression as well as PARP-1 cleavage. Culture with H. pylori led to increases in intracellular ROS, 8-OH-dG, double-strand DNA breaks (DSBs), and DNA fragmentation. H. pylori induced activation of the ATM/Chk2 and ATR/Chk1 pathways, phosphorylation of H2AX and p53, and a delay in the progression of the cells entering the S phase. Lycopene inhibited H. pylori-induced increases in ROS, apoptosis, alterations in cell-cycle distribution, DSBs, and ATM- and ATR-mediated DDR in AGS cells. In conclusion, lycopene may be beneficial for treatment of H. pylori-induced gastric diseases associated with oxidative DNA damage.

  14. Protective effect of N-acetylcysteine against radiation induced DNA damage and hepatic toxicity in rats.


    Mansour, Heba H; Hafez, Hafez F; Fahmy, Nadia M; Hanafi, Nemat


    The present study was designed to evaluate the radioprotective effect of N- acetylcysteine (NAC) on gamma-radiation induced toxicity in hepatic tissue in rat. The cellular changes were estimated using malondialdehyde (MDA, an index of lipid peroxidation), superoxide dismutase (SOD), glutathione peroxidase (GSHPx), reduced glutathione (GSH), and total nitrate/nitrite (NO(x)) as markers of hepatic oxidative stress in rats following gamma-irradiation. The DNA damage was determined by agarose gel electrophoresis. To achieve the ultimate goal of this study, 40 adult rats were randomly divided into 4 groups of 10 animals each. Group I was injected intraperitoneally with saline solution for 7 consecutive days and served as control group. Group II was irradiated with a single dose of 6Gy gamma-radiation. Group III was daily injected with NAC (1g/kg, i.p.) for 7 consecutive days. Group IV received a daily i.p. injection of NAC (1g/kg, i.p.) for 7 consecutive days and 1h after the last dose, rats were irradiated with a single dose (6Gy) gamma-radiation. The animals were sacrificed after 24h. DNA damage was observed in tissue after total body irradiation with a single dose of 6Gy. Malondialdehyde and total nitrate/nitrite were increased significantly whereas the levels of GSH and antioxidant enzymes were significantly decreased in gamma-irradiated group. Pretreatment with NAC showed a significant decrease in the levels of MDA, NO(x) and DNA damage. The antioxidant enzymes increased significantly along with the levels of GSH. Moreover, histopathological examination of liver tissues confirmed the biochemical data. Thus, our results show that pretreatment with N-acetylcysteine offers protection against gamma-radiation induced cellular damage.

  15. IR and IGF-1R expression affects insulin induced proliferation and DNA damage.


    Othman, Eman Maher; Altabaa, Tahanee; Hintzsche, Henning; Stopper, Helga


    Diabetes mellitus type 2 is in its prediagnostic and early phase characterized by hyperinsulinemia. Previously, we pointed out hyperinsulinemia as a potential link between diabetes mellitus and the increased cancer risk that is associated with this disease through its induction of oxidative stress and DNA damage. In the present study, we address the relationship between the induction of proliferation and genomic damage in vitro in cell lines with different expression of the insulin and the IGF-1 receptors after treating the cells with insulin and the insulin analog glargine. Contribution of the IGF-1 receptor was further examined by application of the IGF-1R inhibitor ((5R,5aS,8aR,9R)-9-hydroxy-5,8,8a,9-tetrahydro-5-(3,4,5-trimethoxyphenyl)-furo[3_,4_:6,7]-naphtho[2,3-d]-1,3-dioxol-6(5aH)-one) (PPP). Insulin as well as insulin glargine stimulated cell proliferation in IGF-receptor-dominated MCF-7 cells and not in insulin receptor-dominated BT-474 cells and PPP attenuated this effect. Both insulins induced DNA damage which was reduced by PPP in MCF-7 cells only. Overall, we showed in this study that high levels of insulin and insulin glargine can enhance cell proliferation in cells which highly express IGF-1 receptor and induce DNA damage in cells with high and also in those with low IGF-1 receptor levels. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Ultraviolet light induces Stat3 activation in human keratinocytes and fibroblasts through reactive oxygen species and DNA damage.


    Bito, Toshinori; Sumita, Naoko; Masaki, Taro; Shirakawa, Toshiro; Ueda, Masato; Yoshiki, Ryutaro; Tokura, Yoshiki; Nishigori, Chikako


    Stat3 is activated by the outer stressors, such as ultraviolet (UV) exposure. In this study, we investigated the Stat3 response to UV irradiation in human epidermal keratinocytes and dermal fibroblasts. Results indicated that UVB and UVC differentially activate Stat3 in these cells. The UV-induced Stat3 activation was mediated by both reactive oxygen species (ROS) and DNA damage, and the dominancy of ROS and DNA damage to activate Stat3 depended on the wavelength of UV. By using fibroblasts from a patient with xeroderma pigmentosum A (XP-A) and those transfected with human XPA gene, we found that UVB activates Stat3 via both ROS and DNA damage, while UVC does so mainly via DNA damage. The present data suggest that Stat3 activation in UV-exposed human skin is one of the initial events where DNA damage and ROS are involved.

  17. Acetylation dynamics of human nuclear proteins during the ionizing radiation-induced DNA damage response.


    Bennetzen, Martin V; Larsen, Dorthe Helena; Dinant, Christoffel; Watanabe, Sugiko; Bartek, Jiri; Lukas, Jiri; Andersen, Jens S


    Genotoxic insults, such as ionizing radiation (IR), cause DNA damage that evokes a multifaceted cellular DNA damage response (DDR). DNA damage signaling events that control protein activity, subcellular localization, DNA binding, protein-protein interactions, etc. rely heavily on time-dependent posttranslational modifications (PTMs). To complement our previous analysis of IR-induced temporal dynamics of nuclear phosphoproteome, we now identify a range of human nuclear proteins that are dynamically regulated by acetylation, and predominantly deacetylation, during IR-induced DDR by using mass spectrometry-based proteomic approaches. Apart from cataloging acetylation sites through SILAC proteomic analyses before IR and at 5 and 60 min after IR exposure of U2OS cells, we report that: (1) key components of the transcriptional machinery, such as EP300 and CREBBP, are dynamically acetylated; (2) that nuclear acetyltransferases themselves are regulated, not on the protein abundance level, but by (de)acetylation; and (3) that the recently reported p53 co-activator and methyltransferase MLL3 is acetylated on five lysines during the DDR. For selected examples, protein immunoprecipitation and immunoblotting were used to assess lysine acetylation status and thereby validate the mass spectrometry data. We thus present evidence that nuclear proteins, including those known to regulate cellular functions via epigenetic modifications of histones, are regulated by (de)acetylation in a timely manner upon cell's exposure to genotoxic insults. Overall, these results present a resource of temporal profiles of a spectrum of protein acetylation sites during DDR and provide further insights into the highly dynamic nature of regulatory PTMs that help orchestrate the maintenance of genome integrity.

  18. The Effect of a Grape Seed Extract on Radiation-Induced DNA Damage in Human Lymphocytes

    NASA Astrophysics Data System (ADS)

    Dicu, Tiberius; Postescu, Ion D.; Foriş, Vasile; Brie, Ioana; Fischer-Fodor, Eva; Cernea, Valentin; Moldovan, Mircea; Cosma, Constantin


    Plant-derived antioxidants due to their phenolic compounds content are reported as potential candidates for reducing the levels of oxidative stress in living organisms. Grape seed extracts are very potent antioxidants and exhibit numerous interesting pharmacologic activities. Hydroethanolic (50/50, v/v) standardized extract was obtained from red grape seed (Vitis vinifera, variety Burgund Mare—BM). The total polyphenols content was evaluated by Folin-Ciocalteu procedure and expressed as μEq Gallic Acid/ml. The aim of this study was to evaluate the potential antioxidant effects of different concentrations of BM extract against 60Co γ-rays induced DNA damage in human lymphocytes. Samples of human lymphocytes were incubated with BM extract (12.5, 25.0 and 37.5 μEq GA/ml, respectively) administered at 30 minutes before in vitro irradiation with γ-rays (2 Gy). The DNA damage and repair in lymphocytes were evaluated using alkaline comet assay. Using the lesion score, the radiation-induced DNA damage was found to be significantly different (p<0.05) from control, both in the absence and presence of BM extract (except the lymphocytes treated with 37.5 μEq GA/ml BM extract). DNA repair analyzed by incubating the irradiated cells at 37° C and 5% CO2 atmosphere for 2 h, indicated a significant difference (p<0.05) in the lymphocytes group treated with 25.0 μEq GA/ml BM extract, immediately and two hours after irradiation. These results suggest radioprotective effects after treatment with BM extract in human lymphocytes.

  19. Optical detection of DNA damage

    NASA Astrophysics Data System (ADS)

    Rogers, Kim R.; Apostol, A.; Cembrano, J.


    A rapid and sensitive fluorescence assay for oxidative damage to calf thymus DNA is reported. A decrease in the transition temperature for strand separation resulted from exposure of the DNA to the reactive decomposition products of 3- morpholinosydnonimine (SIN-1) (i.e., nitric oxide, superoxide, peroxynitrite, hydrogen peroxide, and hydroxyl radicals). A decrease in melting temperature of 12 degrees Celsius was indicative of oxidative damage including single strand chain breaks. Double stranded (ds) and single stranded (ss) forms of DNA were determined using the indicator dyes ethidium bromide and PicoGreen. The change in DNA 'melting' curves was dependant on the concentration of SIN-1 and was most pronounced at 75 degrees Celsius. This chemically induced damage was significantly inhibited by sodium citrate, tris(hydroxymethyl)aminomethane (Tris), and diethylenetriaminepentaacetic acid (DTPA), but was unaffected by superoxide dismutase (SOD), catalase, ethylenediamine tetraacietic acid (EDTA), or deferoxamine. Lowest observable effect level for SIN-1-induced damage was 200 (mu) M.

  20. Switch telomerase to ALT mechanism by inducing telomeric DNA damages and dysfunction of ATRX and DAXX.


    Hu, Yang; Shi, Guang; Zhang, Laichen; Li, Feng; Jiang, Yuanling; Jiang, Shuai; Ma, Wenbin; Zhao, Yong; Songyang, Zhou; Huang, Junjiu


    Activation of telomerase or alternative lengthening of telomeres (ALT) is necessary for tumours to escape from dysfunctional telomere-mediated senescence. Anti-telomerase drugs might be effective in suppressing tumour growth in approximately 85-90% of telomerase-positive cancer cells. However, there are still chances for these cells to bypass drug treatment after switching to the ALT mechanism to maintain their telomere integrity. But the mechanism underlying this switch is unknown. In this study, we used telomerase-positive cancer cells (HTC75) to discover the mechanism of the telomerase-ALT switch by inducing telomere-specific DNA damage, alpha-thalassemia X-linked syndrome protein (ATRX) knockdown and deletion of death associated protein (DAXX). Surprisingly, two important ALT hallmarks in the ALT-like HTC75 cells were observed after treatments: ALT-associated promyelocytic leukaemia bodies (APBs) and extrachromosomal circular DNA of telomeric repeats. Moreover, knocking out hTERT by utilizing the CRISPR/Cas9 technique led to telomere elongation in a telomerase-independent manner in ALT-like HTC75 cells. In summary, this is the first report to show that inducing telomeric DNA damage, disrupting the ATRX/DAXX complex and inhibiting telomerase activity in telomerase-positive cancer cells lead to the ALT switch.

  1. Estrogen induces RAD51C expression and localization to sites of DNA damage.


    Alayev, Anya; Salamon, Rachel S; Manna, Subrata; Schwartz, Naomi S; Berman, Adi Y; Holz, Marina K


    Homologous recombination (HR) is a conserved process that maintains genome stability and cell survival by repairing DNA double-strand breaks (DSBs). The RAD51-related family of proteins is involved in repair of DSBs; consequently, deregulation of RAD51 causes chromosomal rearrangements and stimulates tumorigenesis. RAD51C has been identified as a potential tumor suppressor and a breast and ovarian cancer susceptibility gene. Recent studies have also implicated estrogen as a DNA-damaging agent that causes DSBs. We found that in ERα-positive breast cancer cells, estrogen transcriptionally regulates RAD51C expression in ERα-dependent mechanism. Moreover, estrogen induces RAD51C assembly into nuclear foci at DSBs, which is a precursor to RAD51 complex recruitment to the nucleus. Additionally, disruption of ERα signaling by either anti-estrogens or siRNA prevented estrogen induced upregulation of RAD51C. We have also found an association of a worse clinical outcome between RAD51C expression and ERα status of tumors. These findings provide insight into the mechanism of genomic instability in ERα-positive breast cancer and suggest that individuals with mutations in RAD51C that are exposed to estrogen would be more susceptible to accumulation of DNA damage, leading to cancer progression.

  2. DNA damage and oxidative stress induced by imidacloprid exposure in the earthworm Eisenia fetida.


    Wang, Juan; Wang, Jinhua; Wang, Guangchi; Zhu, Lusheng; Wang, Jun


    To investigate the soil ecological effect of imidacloprid, earthworm Eisenia fetida was exposed to various concentrations of imidacloprid (0.10, 0.50, and 1.00 mg kg(-1) soil) respectively after 7, 14, 21, and 28 d. The effect of imidacloprid on reactive oxygen species (ROS) generation, antioxidant enzymes activity [superoxide dismutase (SOD) and catalase (CAT), glutathione S-transferase enzyme (GST)], malondialdehyde (MDA) content and DNA damage of the E. fetida was investigated. Significant increase of the ROS level was observed. The SOD and GST activity were significantly induced at most exposure intervals. CAT activity was inhibited and reflected a dose-dependent relationship on days 7, 14 and 21. High MDA levels were observed and the olive tail moment (OTM) as well as the percentage of DNA in the comet tail (tail DNA%) in comet assay declined with increasing concentrations and exposure time after 7 d. Our results suggested that the sub-chronic exposure of imidacloprid caused DNA damage and lipid peroxidation (LPO) leading to antioxidant responses in earthworm E. fetida.

  3. Inhibiting the repair of DNA damage induced by gamma irradiation in rat thymocytes

    SciTech Connect

    Smit, J.A.; Stark, J.H.


    This study assessed the ability of 11 established and potential radiosensitizing agents to retard the repair of radiation-induced DNA damage with a view to enhancing the immunosuppressive effects of in vivo lymphoid irradiation. The capability of irradiated rat thymocytes to repair DNA damage was assessed by an adaptation of the fluorimetric unwinding method. Three compounds, 3-aminobenzamide (3-AB), novobiocin and flavone-8-acetic acid (FAA), inhibited repair significantly. We also report the effect of low-dose irradiation combined with repair inhibitors on the relationship between DNA strand breaks, fragmentation, cell viability and use of nicotinamide adenine dinucleotide (NAD). DNA fragmentation was increased by 1 mM/l FAA, 1 mM/l novobiocin and 50 {mu}M/l RS-61443 within 3 h of incubation. The latter two compounds also proved cytotoxic. All three drugs augmented the effect of ionizing radiation on the use of NAD. Of the agents investigated, FAA showed the most promise for augmenting the immunosuppressive action of irradiation at nontoxic, pharmacokinetically achievable concentrations. 33 refs., 1 fig., 2 tabs.

  4. A possible mechanism for combined arsenic and fluoride induced cellular and DNA damage in mice.


    Flora, Swaran J S; Mittal, Megha; Pachauri, Vidhu; Dwivedi, Nidhi


    arsenic- or fluoride-induced oxidative stress, DNA damage and protein interaction as the major determinants of toxicity, along with the differential toxic effects during arsenic-fluoride interaction during co-exposure. The study further corroborates our earlier observations that at the higher concentration co-exposures to these toxicants do not elicit synergistic toxicity. This journal is © The Royal Society of Chemistry 2012

  5. Resveratrol Protects Sepsis-Induced Oxidative DNA Damage in Liver and Kidney of Rats

    PubMed Central

    Aydın, Sevtap; Şahin, Tevfik Tolga; Bacanlı, Merve; Taner, Gökçe; Başaran, Arif Ahmet; Aydın, Mehtap; Başaran, Nurşen


    Background The increases of free radicals have been proposed to be involved in the pathogenesis of sepsis, which leads to multiple-organ dysfunction syndromes. The uses of antioxidants as a complementary tool in the medical care of oxidative stress-related diseases have attracted attention of researchers. Resveratrol (RV) has suggested being antioxidant, anti-proliferative, and anti-inflammatory effects in various experimental models and clinical settings. Aims This study was undertaken to evaluate the protective effects of RV on oxidative DNA damage induced by sepsis in the liver and kidney tissues of Wistar albino rats. Study Design Animal experimentation. Methods Four experimental groups consisting of eight animals for each was created using a total of thirty-two male Wistar albino rats. Sham group was given 0.5 mL of saline intra-peritoneal (ip) only following laparatomy. Sepsis group was given 0.5 mL saline ip only following the induction of sepsis. RV-treated group was given a dose of 100 mg/kg ip RV in 0.5 mL saline following laparatomy. RV-treated sepsis group was given 100 mg/kg ip RV in 0.5 mL saline following the induction of sepsis. A model of sepsis was created by cecal ligation and puncture technique. In the liver and kidney tissues, oxidative stress parameters (malondialdehyde (MDA), reduced glutathione (GSH), superoxide dismutase (SOD), glutathione peroxidase (GPX)) and a proinflammatory cytokine (tumor necrosis factor alpha (TNF-alpha)), were evaluated spectrophotometrically and DNA damage was determined by the alkaline single cell gel electrophoresis (comet assay) technique using formamidopyrimidine DNA glycosylase protein. Results In the RV-treated sepsis group, the levels of MDA and TNF-alpha were lower and GSH levels, SOD and GPX activities were higher than in the septic rats (p<0.05). RV treatment significantly reduced the sepsis-induced oxidative DNA damage in the liver and kidney cells (p<0.05). Conclusion It is suggested that RV treatment

  6. Rapamycin‐induced autophagy sensitizes A549 cells to radiation associated with DNA damage repair inhibition

    PubMed Central

    Li, Yong; Liu, Fen; Wang, Yong; Li, Donghai; Guo, Fei; Xu, Liyao; Zeng, Zhengguo; Zhong, Xiaojun


    Abstract Background Autophagy has been reported to increase in cancer cells after radiation. However, it remains unknown whether increased autophagy as a result of radiation affects DNA damage repair and sensitizes cancer cells. In this study, the radiosensitization effect of rapamycin, a mammalian target of rapamycin inhibitor that induces autophagy, on human lung adenocarcinoma A549 cells was investigated. Methods A549 cells were treated with different concentrations of rapamycin. Cell viability was evaluated by methyl‐thiazolyl‐tetrazolium assay. Survival fraction values of A549 cells after radiotherapy were detected by colony formation assay. Autophagosome was observed by a transmission electron microscope. Furthermore, Western blot was employed to examine alterations in autophagy protein LC3 and p62, DNA damage protein γ–H2AX, and DNA damage repair proteins Rad51, Ku70, and Ku80. Rad51, Ku70, and Ku80 messenger ribonucleic acid (mRNA) expression levels were examined by real‐time polymerase chain reaction. Results Rapamycin suppressed A549 cell proliferation in dose and time‐dependent manners. An inhibitory concentration (IC) 10 dose of rapamycin could induce autophagy in A549 cells. Rapamycin combined with radiation significantly decreased the colony forming ability of cells, compared with rapamycin or radiation alone. Rapamycin and radiation combined increased γ–H2AX expression levels and decreased Rad51 and Ku80 expression levels, compared with single regimens. However, rapamycin treatment did not induce any change in Rad51, Ku70, and Ku80 mRNA levels, regardless of radiation. Conclusions These findings indicate that increasing autophagy sensitizes lung cancer cells to radiation. PMID:27385978

  7. 6-Hydroxydopamine and lipopolysaccharides induced DNA damage in astrocytes: involvement of nitric oxide and mitochondria.


    Gupta, Sonam; Goswami, Poonam; Biswas, Joyshree; Joshi, Neeraj; Sharma, Sharad; Nath, C; Singh, Sarika


    The present study was conducted to investigate the effect of the neurotoxins 6-hydroxydopamine and lipopolysaccharide on astrocytes. Rat astrocyte C6 cells were treated with different concentration of 6-hydroxydopamine (6-OHDA)/lipopolysaccharides (LPS) for 24 h. Both neurotoxins significantly decreased the viability of astrocytes, augmented the expression of inducible nitric oxide synthase (iNOS) and the astrocyte marker--glial fibrillar acidic protein. A significantly decreased mitochondrial dehydrogenase activity, mitochondrial membrane potential, augmented reactive oxygen species (ROS) level, caspase-3 mRNA level, chromatin condensation and DNA damage was observed in 6-OHDA/LPS treated astroglial cells. 6-OHDA/LPS treatment also caused the significantly increased expression of iNOS and nitrite level. Findings showed that 6-OHDA/LPS treatment caused mitochondrial dysfunction mediated death of astrocytes, which significantly involve the nitric oxide. Since we have observed significantly increased level of iNOS along with mitochondrial impairment and apoptotic cell death in astrocytes, therefore to validate the role of iNOS, the cells were co-treated with iNOS inhibitor aminoguanidine (AG, 100 μM). Co-treatment of AG significantly attenuated the 6-OHDA/LPS induced cell death, mitochondrial activity, augmented ROS level, chromatin condensation and DNA damage. GFAP and caspase-3 expression were also inhibited with co-treatment of AG, although the extent of inhibition was different in both experimental sets. In conclusion, the findings showed that iNOS mediated increased level of nitric oxide acts as a key regulatory molecule in 6-OHDA/LPS induced mitochondrial dysfunction, DNA damage and apoptotic death of astrocytes.

  8. All-trans-retinal induces Bax activation via DNA damage to mediate retinal cell apoptosis.


    Sawada, Osamu; Perusek, Lindsay; Kohno, Hideo; Howell, Scott J; Maeda, Akiko; Matsuyama, Shigemi; Maeda, Tadao


    The current study investigates the cellular events which trigger activation of proapoptotic Bcl-2-associated × protein (Bax) in retinal cell death induced by all-trans-retinal (atRAL). Cellular events which activate Bax, such as DNA damage by oxidative stress and phosphorylation of p53, were evaluated by immunochemical and biochemical methods using ARPE-19 cells, 661 W cells, cultured neural retinas and a retinal degeneration model, Abca4(-/-)Rdh8(-/-) mice. atRAL-induced Bax activation in cultured neural retinas was examined by pharmacological and genetic methods. Other Bax-related cellular events were also evaluated by pharmacological and biochemical methods. Production of 8-OHdG, a DNA damage indicator, and the phosphorylation of p53 at Ser46 were detected prior to Bax activation in ARPE-19 cells incubated with atRAL. Light exposure to Abca4(-/-)Rdh8(-/-) mice also caused the above mentioned events in conditions of short term intense light exposure and regular room lighting conditions. Incubation with Bax inhibiting peptide and deletion of the Bax gene partially protected retinal cells from atRAL toxicity in cultured neural retina. Necrosis was demonstrated not to be the main pathway in atRAL mediated cell death. Bcl-2-interacting mediator and Bcl-2 expression levels were not altered by atRAL in vitro. atRAL-induced oxidative stress results in DNA damage leading to the activation of Bax by phosphorylated p53. This cascade is closely associated with an apoptotic cell death mechanism rather than necrosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. All-trans-retinal induces Bax activation via DNA damage to mediate retinal cell apoptosis

    PubMed Central

    Sawada, Osamu; Perusek, Lindsay; Kohno, Hideo; Howell, Scott J.; Maeda, Akiko; Matsuyama, Shigemi; Maeda, Tadao


    The current study investigates the cellular events which trigger activation of proapoptotic Bcl-2-associated X protein (Bax) in retinal cell death induced by all-trans-retinal (atRAL). Cellular events which activate Bax, such as DNA damage by oxidative stress and phosphorylation of p53, were evaluated by immunochemical and biochemical methods using ARPE-19 cells, 661W cells, cultured neural retinas and a retinal degeneration model, Abca4−/−Rdh8−/− mice. atRAL-induced Bax activation in cultured neural retinas was examined by pharmacological and genetic methods. Other Bax-related cellular events were also evaluated by pharmacological and biochemical methods. Production of 8-OHdG, a DNA damage indicator, and the phosphorylation of p53 at Ser 46 were detected prior to Bax activation in ARPE-19 cells incubated with atRAL. Light exposure to Abca4−/−Rdh8−/− mice also caused the above mentioned events in conditions of short term intense light exposure and regular room lighting conditions. Incubation with Bax inhibiting peptide and deletion of the Bax gene partially protected retinal cells from atRAL toxicity in cultured neural retina. Necrosis was demonstrated not to be the main pathway in atRAL mediated cell death. Bcl-2-interacting mediator and Bcl-2 expression levels were not altered by atRAL in vitro. atRAL-induced oxidative stress results in DNA damage leading to the activation of Bax by phosphorylated p53. This cascade is closely associated with an apoptotic cell death mechanism rather than necrosis. PMID:24726920

  10. Hot water extract of Chlorella vulgaris induced DNA damage and apoptosis

    PubMed Central

    Yusof, Yasmin Anum Mohd; Md. Saad, Suhana; Makpol, Suzana; Shamaan, Nor Aripin; Ngah, Wan Zurinah Wan


    OBJECTIVES: The aim of this study was to determine the antiproliferative and apoptotic effects of hot water extracts of Chlorella vulgaris on hepatoma cell line HepG2. INTRODUCTION: The search for food and spices that can induce apoptosis in cancer cells has been a major study interest in the last decade. Chlorella vulgaris, a unicellular green algae, has been reported to have antioxidant and anti‐cancer properties. However, its chemopreventive effects in inhibiting the growth of cancer cells have not been studied in great detail. METHODS: HepG2 liver cancer cells and WRL68 normal liver cells were treated with various concentrations (0‐4 mg/ml) of hot water extract of C. vulgaris after 24 hours incubation. Apoptosis rate was evaluated by TUNEL assay while DNA damage was assessed by Comet assay. Apoptosis proteins were evaluated by Western blot analysis. RESULTS: Chlorella vulgaris decreased the number of viable HepG2 cells in a dose dependent manner (p < 0.05), with an IC50 of 1.6 mg/ml. DNA damage as measured by Comet assay was increased in HepG2 cells at all concentrations of Chlorella vulgaris tested. Evaluation of apoptosis by TUNEL assay showed that Chlorella vulgaris induced a higher apoptotic rate (70%) in HepG2 cells compared to normal liver cells, WRL68 (15%). Western blot analysis showed increased expression of pro‐ apoptotic proteins P53, Bax and caspase‐3 in the HepG2 cells compared to normal liver cells WRL68, and decreased expression of the anti‐apoptotic protein Bcl‐2. CONCLUSIONS: Chlorella vulgaris may have anti‐cancer effects by inducing apoptosis signaling cascades via an increased expression of P53, Bax and caspase‐3 proteins and through a reduction of Bcl‐2 protein, which subsequently lead to increased DNA damage and apoptosis. PMID:21340229

  11. Genoprotective effect of hyaluronic acid against benzalkonium chloride-induced DNA damage in human corneal epithelial cells

    PubMed Central

    Wu, Han; Zhang, Huina; Wang, Changjun; Wu, Yihua; Xie, Jiajun; Jin, Xiuming; Yang, Jun


    Purpose The aim of this study was to investigate hyaluronic acid (HA) protection on cultured human corneal epithelial cells (HCEs) against benzalkonium chloride (BAC)-induced DNA damage and intracellular reactive oxygen species (ROS) increase. Methods Cells were incubated with different concentrations of BAC with or without the presence of 0.2% HA for 30 min. DNA damage to HCEs was examined by alkaline comet assay and by immunofluorescence microscopic detection of the phosphorylated form of histone variant H2AX (γH2AX) foci. ROS production was assessed by the fluorescent probe, 2',7'-dichlorodihydrofluorescein diacetate (DCFH-DA). Cell apoptosis was determined with annexin V staining by flow cytometry. Results HA significantly reduced BAC-induced DNA damage as indicated by the tail length (TL) and tail moment (TM) of alkaline comet assay and by γH2AX foci formation, respectively. Moreover, HA significantly decreased BAC-induced ROS increase and cell apoptosis. However, exposure to HA alone did not produce any significant change in DNA damage, ROS generation, or cell apoptosis. Conclusions BAC could induce DNA damage and cell apoptosis in HCEs, probably through increasing oxidative stress. Furthermore, HA was an effective protective agent that had antioxidant properties and could decrease DNA damage and cell apoptosis induced by BAC. PMID:22219631

  12. XPD-dependent activation of apoptosis in response to triplex-induced DNA damage

    PubMed Central

    Kaushik Tiwari, Meetu; Rogers, Faye A.


    DNA sequences capable of forming triplexes are prevalent in the human genome and have been found to be intrinsically mutagenic. Consequently, a balance between DNA repair and apoptosis is critical to counteract their effect on genomic integrity. Using triplex-forming oligonucleotides to synthetically create altered helical distortions, we have determined that pro-apoptotic pathways are activated by the formation of triplex structures. Moreover, the TFIIH factor, XPD, occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. Here, we show that triplexes are capable of inducing XPD-independent double strand breaks, which result in the formation of γH2AX foci. XPD was subsequently recruited to the triplex-induced double strand breaks and co-localized with γH2AX at the damage site. Furthermore, phosphorylation of H2AX tyrosine 142 was found to stimulate the signaling pathway of XPD-dependent apoptosis. We suggest that this mechanism may play an active role in minimizing genomic instability induced by naturally occurring noncanonical structures, perhaps protecting against cancer initiation. PMID:23913414

  13. Ku80-deletion suppresses spontaneous tumors and induces a p53-mediated DNA damage response

    PubMed Central

    Holcomb, Valerie B.; Rodier, Francis; Choi, Yong Jun; Busuttil, Rita A.; Vogel, Hannes; Vijg, Jan; Campisi, Judith; Hasty, Paul


    Ku80 facilitates DNA repair and therefore should suppress cancer. However, ku80−/− mice exhibit reduced cancer, although they age prematurely and have a shortened life span. We tested the hypothesis that Ku80 deletion suppresses cancer by enhancing cellular tumor suppressive responses to inefficiently repaired DNA damage. In support of this hypothesis, Ku80 deletion ameliorated tumor burden in APCMIN mice, and increased a p53-mediated DNA damage response, DNA lesions, and chromosomal rearrangements. Thus, contrary to its assumed role as a caretaker tumor suppressor, Ku80 facilitates tumor growth most likely by dampening baseline cellular DNA damage responses. PMID:19010925

  14. Resveratrol affects DNA damage induced by ionizing radiation in human lymphocytes in vitro.


    Basso, Emiliano; Regazzo, Giulia; Fiore, Mario; Palma, Valentina; Traversi, Gianandrea; Testa, Antonella; Degrassi, Francesca; Cozzi, Renata


    Resveratrol (3,4',5-trihydroxystilbene; RSV) acts on cancer cells in several ways, inducing cell cycle delay and apoptotic death, and enhancing ionizing radiation (IR)-mediated responses. However, fewer studies have examined RSV effects on normal cells. We have treated human lymphocytes in vitro with RSV, either alone or combined with IR, to evaluate its potential use as a radioprotector. We measured the effects of RSV on induction of DNA damage, repair kinetics, and modulation of histone deacetylase activity. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Characteristics and modifying factors of asbestos-induced oxidative DNA damage.


    Jiang, Li; Nagai, Hirotaka; Ohara, Hiroki; Hara, Shigeo; Tachibana, Mitsuhiro; Hirano, Seishiro; Shinohara, Yasushi; Kohyama, Norihiko; Akatsuka, Shinya; Toyokuni, Shinya


    Respiratory exposure to asbestos has been linked with mesothelioma in humans. However, its carcinogenic mechanism is still unclear. Here we studied the ability of chrysotile, crocidolite and amosite fibers to induce oxidative DNA damage and the modifying factors using four distinct approaches. Electron spin resonance analyses revealed that crocidolite and amosite containing high amounts of iron, but not chrysotile, catalyzed hydroxyl radical generation in the presence of H(2)O(2), which was enhanced by an iron chelator, nitrilotriacetic acid, and suppressed by desferal. Natural iron chelators, such as citrate, adenosine 5'-triphosphate and guanosine 5'-triphosphate, did not inhibit this reaction. Second, we used time-lapse video microscopy to evaluate how cells cope with asbestos fibers. RAW264.7 cells, MeT-5 A and HeLa cells engulfed asbestos fibers, which reached not only cytoplasm but also the nucleus. Third, we utilized supercoiled plasmid DNA to evaluate the ability of each asbestos to induce DNA double strand breaks (DSB). Crocidolite and amosite, but not chrysotile, induced DNA DSB in the presence of iron chelators. We cloned the fragments to identify break sites. DSB occurred preferentially within repeat sequences and between two G:C sequences. Finally, i.p. administration of each asbestos to rats induced not only formation of nuclear 8-hydroxy-2'-deoxyguanosine in the mesothelia, spleen, liver and kidney but also significant iron deposits in the spleen. Together with the established carcinogenicity of i.p. chrysotile, our data suggest that asbestos-associated catalytic iron, whether constitutional or induced by other mechanisms, plays an important role in asbestos-induced carcinogenesis and that chemoprevention may be possible through targeting the catalytic iron.

  16. WRNIP1 functions upstream of DNA polymerase η in the UV-induced DNA damage response

    SciTech Connect

    Yoshimura, Akari; Kobayashi, Yume; Tada, Shusuke; Seki, Masayuki; Enomoto, Takemi


    Highlights: • The UV sensitivity of POLH{sup −/−} cells was suppressed by disruption of WRNIP1. • In WRNIP1{sup −/−/−}/POLH{sup −/−} cells, mutation frequencies and SCE after irradiation reduced. • WRNIP1 defect recovered rate of fork progression after irradiation in POLH{sup −/−} cells. • WRNIP1 functions upstream of Polη in the translesion DNA synthesis pathway. - Abstract: WRNIP1 (WRN-interacting protein 1) was first identified as a factor that interacts with WRN, the protein that is defective in Werner syndrome (WS). WRNIP1 associates with DNA polymerase η (Polη), but the biological significance of this interaction remains unknown. In this study, we analyzed the functional interaction between WRNIP1 and Polη by generating knockouts of both genes in DT40 chicken cells. Disruption of WRNIP1 in Polη-disrupted (POLH{sup −/−}) cells suppressed the phenotypes associated with the loss of Polη: sensitivity to ultraviolet light (UV), delayed repair of cyclobutane pyrimidine dimers (CPD), elevated frequency of mutation, elevated levels of UV-induced sister chromatid exchange (SCE), and reduced rate of fork progression after UV irradiation. These results suggest that WRNIP1 functions upstream of Polη in the response to UV irradiation.

  17. Effects of melatonin on DNA damage induced by cyclophosphamide in rats

    PubMed Central

    Ferreira, S.G.; Peliciari-Garcia, R.A.; Takahashi-Hyodo, S.A.; Rodrigues, A.C.; Amaral, F.G.; Berra, C.M.; Bordin, S.; Curi, R.; Cipolla-Neto, J.


    The antioxidant and free radical scavenger properties of melatonin have been well described in the literature. In this study, our objective was to determine the protective effect of the pineal gland hormone against the DNA damage induced by cyclophosphamide (CP), an anti-tumor agent that is widely applied in clinical practice. DNA damage was induced in rats by a single intraperitoneal injection of CP (20 or 50 mg/kg). Animals received melatonin during the dark period for 15 days (1 mg/kg in the drinking water). Rat bone marrow cells were used for the determination of chromosomal aberrations and of formamidopyrimidine DNA glycosylase enzyme (Fpg)-sensitive sites by the comet technique and of Xpf mRNA expression by qRT-PCR. The number (mean ± SE) of chromosomal aberrations in pinealectomized (PINX) animals treated with melatonin and CP (2.50 ± 0.50/100 cells) was lower than that obtained for PINX animals injected with CP (12 ± 1.8/100 cells), thus showing a reduction of 85.8% in the number of chromosomal aberrations. This melatonin-mediated protection was also observed when oxidative lesions were analyzed by the Fpg-sensitive assay, both 24 and 48 h after CP administration. The expression of Xpf mRNA, which is involved in the DNA nucleotide excision repair machinery, was up-regulated by melatonin. The results indicate that melatonin is able to protect bone marrow cells by completely blocking CP-induced chromosome aberrations. Therefore, melatonin administration could be an alternative and effective treatment during chemotherapy. PMID:23471360

  18. Effects of melatonin on DNA damage induced by cyclophosphamide in rats.


    Ferreira, S G; Peliciari-Garcia, R A; Takahashi-Hyodo, S A; Rodrigues, A C; Amaral, F G; Berra, C M; Bordin, S; Curi, R; Cipolla-Neto, J


    The antioxidant and free radical scavenger properties of melatonin have been well described in the literature. In this study, our objective was to determine the protective effect of the pineal gland hormone against the DNA damage induced by cyclophosphamide (CP), an anti-tumor agent that is widely applied in clinical practice. DNA damage was induced in rats by a single intraperitoneal injection of CP (20 or 50 mg/kg). Animals received melatonin during the dark period for 15 days (1 mg/kg in the drinking water). Rat bone marrow cells were used for the determination of chromosomal aberrations and of formamidopyrimidine DNA glycosylase enzyme (Fpg)-sensitive sites by the comet technique and of Xpf mRNA expression by qRT-PCR. The number (mean ± SE) of chromosomal aberrations in pinealectomized (PINX) animals treated with melatonin and CP (2.50 ± 0.50/100 cells) was lower than that obtained for PINX animals injected with CP (12 ± 1.8/100 cells), thus showing a reduction of 85.8% in the number of chromosomal aberrations. This melatonin-mediated protection was also observed when oxidative lesions were analyzed by the Fpg-sensitive assay, both 24 and 48 h after CP administration. The expression of Xpf mRNA, which is involved in the DNA nucleotide excision repair machinery, was up-regulated by melatonin. The results indicate that melatonin is able to protect bone marrow cells by completely blocking CP-induced chromosome aberrations. Therefore, melatonin administration could be an alternative and effective treatment during chemotherapy.

  19. Quercetin and hyperthermia modulate cisplatin-induced DNA damage in tumor and normal tissues in vivo.


    Oršolić, Nada; Car, Nikola


    Nephrotoxicity, hepatotoxicity, myelosuppression, and genotoxicity are the major limitation for the clinical use of cisplatin as an anti-tumoural drug. Hyperthermia enhances the clastogenicity of cisplatin. In addition, hyperthermia is a promising approach for cancer therapy because it not only kills cancer cells directly, but also activates anti-cancer immunity as an indirect effect. The aim of this study was to determine whether preventive treatment with quercetin (QU) can reduce cisplatin-induced DNA damage in liver, kidney and blood cells and whether QU has the potential to serve as a beneficial supplement before cisplatin hyperthermal intraperitoneal chemotherapy (HIPEC) in order to gain immunomodulatory responses of mice to the tumor. Preventive treatment of mice with QU (50 mg kg(-1)) had a protective effect on cisplatin-induced DNA damage in normal cells, except kidney cells, in both normothermic and hyperthermic conditions without interfering with the antitumor efficacy of the combined regimen. Immunostimulation by QU is stressed as an important factor in the tumor-inhibiting effect of hyperthermia in addition to the well known selective heat killing of neoplastic cells. In conclusion, these results suggested that preventive treatment with QU could protect the blood, liver and kidney cells of mice against HIPEC-induced injury and increase survival of mice by improving the antitumor adaptive immunity with hyperthermia.

  20. Cre recombinase induces DNA damage and tetraploidy in the absence of loxP sites.


    Janbandhu, Vaibhao C; Moik, Daniel; Fässler, Reinhard


    The spatiotemporal manipulations of gene expression by the Cre recombinase (Cre) of bacteriophage P1 has become an essential asset to understanding mammalian genetics. Accumulating evidence suggests that Cre activity can, in addition to excising targeted loxP sites, induce cytotoxic effects, including abnormal cell cycle progression, genomic instability, and apoptosis, which can accelerate cancer progression. It is speculated that these defects are caused by Cre-induced DNA damage at off-target sites. Here we report the formation of tetraploid keratinocytes in the epidermis of keratin 5 and/or keratin 14 promoter-driven Cre (KRT5- and KRT14-Cre) expressing mouse skin. Biochemical analyses and flow cytometry demonstrated that Cre expression also induces DNA damage, genomic instability, and tetraploidy in HCT116 cells, and live-cell imaging revealed an extension of the G 2 cell cycle phase followed by defective or skipping of mitosis as cause for the tetraploidy. Since tetraploidy eventually leads to aneuploidy, a hallmark of cancer, our findings highlight the importance of distinguishing non-specific cytopathic effects from specific Cre/loxP-driven genetic manipulations when using Cre-mediated gene deletions.

  1. Prion-induced neurotoxicity: Possible role for cell cycle activity and DNA damage response.


    Bujdoso, Raymond; Landgraf, Matthias; Jackson, Walker S; Thackray, Alana M


    Protein misfolding neurodegenerative diseases arise through neurotoxicity induced by aggregation of host proteins. These conditions include Alzheimer's disease, Huntington's disease, Parkinson's disease, motor neuron disease, tauopathies and prion diseases. Collectively, these conditions are a challenge to society because of the increasing aged population and through the real threat to human food security by animal prion diseases. It is therefore important to understand the cellular and molecular mechanisms that underlie protein misfolding-induced neurotoxicity as this will form the basis for designing strategies to alleviate their burden. Prion diseases are an important paradigm for neurodegenerative conditions in general since several of these maladies have now been shown to display prion-like phenomena. Increasingly, cell cycle activity and the DNA damage response are recognised as cellular events that participate in the neurotoxic process of various neurodegenerative diseases, and their associated animal models, which suggests they are truly involved in the pathogenic process and are not merely epiphenomena. Here we review the role of cell cycle activity and the DNA damage response in neurodegeneration associated with protein misfolding diseases, and suggest that these events contribute towards prion-induced neurotoxicity. In doing so, we highlight PrP transgenic Drosophila as a tractable model for the genetic analysis of transmissible mammalian prion disease.

  2. Enhanced susceptibility of ovaries from obese mice to 7,12-dimethylbenz[a]anthracene-induced DNA damage

    SciTech Connect

    Ganesan, Shanthi Nteeba, Jackson Keating, Aileen F.


    7,12-Dimethylbenz[a]anthracene (DMBA) depletes ovarian follicles and induces DNA damage in extra-ovarian tissues, thus, we investigated ovarian DMBA-induced DNA damage. Additionally, since obesity is associated with increased offspring birth defect incidence, we hypothesized that a DMBA-induced DNA damage response (DDR) is compromised in ovaries from obese females. Wild type (lean) non agouti (a/a) and KK.Cg-Ay/J heterozygote (obese) mice were dosed with sesame oil or DMBA (1 mg/kg; intraperitoneal injection) at 18 weeks of age, for 14 days. Total ovarian RNA and protein were isolated and abundance of Ataxia telangiectasia mutated (Atm), X-ray repair complementing defective repair in Chinese hamster cells 6 (Xrcc6), breast cancer type 1 (Brca1), Rad 51 homolog (Rad51), poly [ADP-ribose] polymerase 1 (Parp1) and protein kinase, DNA-activated, catalytic polypeptide (Prkdc) were quantified by RT-PCR or Western blot. Phosphorylated histone H2AX (γH2AX) level was determined by Western blotting. Obesity decreased (P < 0.05) basal protein abundance of PRKDC and BRCA1 proteins but increased (P < 0.05) γH2AX and PARP1 proteins. Ovarian ATM, XRCC6, PRKDC, RAD51 and PARP1 proteins were increased (P < 0.05) by DMBA exposure in lean mice. A blunted DMBA-induced increase (P < 0.05) in XRCC6, PRKDC, RAD51 and BRCA1 was observed in ovaries from obese mice, relative to lean counterparts. Taken together, DMBA exposure induced γH2AX as well as the ovarian DDR, supporting that DMBA causes ovarian DNA damage. Additionally, ovarian DDR was partially attenuated in obese females raising concern that obesity may be an additive factor during chemical-induced ovotoxicity. - Highlights: • DMBA induces markers of ovarian DNA damage. • Obesity induces low level ovarian DNA damage. • DMBA-induced DNA repair response is altered by obesity.

  3. Cohesin Is limiting for the suppression of DNA damage-induced recombination between homologous chromosomes.


    Covo, Shay; Westmoreland, James W; Gordenin, Dmitry A; Resnick, Michael A


    Double-strand break (DSB) repair through homologous recombination (HR) is an evolutionarily conserved process that is generally error-free. The risk to genome stability posed by nonallelic recombination or loss-of-heterozygosity could be reduced by confining HR to sister chromatids, thereby preventing recombination between homologous chromosomes. Here we show that the sister chromatid cohesion complex (cohesin) is a limiting factor in the control of DSB repair and genome stability and that it suppresses DNA damage-induced interactions between homologues. We developed a gene dosage system in tetraploid yeast to address limitations on various essential components in DSB repair and HR. Unlike RAD50 and RAD51, which play a direct role in HR, a 4-fold reduction in the number of essential MCD1 sister chromatid cohesion subunit genes affected survival of gamma-irradiated G(2)/M cells. The decreased survival reflected a reduction in DSB repair. Importantly, HR between homologous chromosomes was strongly increased by ionizing radiation in G(2)/M cells with a single copy of MCD1 or SMC3 even at radiation doses where survival was high and DSB repair was efficient. The increased recombination also extended to nonlethal doses of UV, which did not induce DSBs. The DNA damage-induced recombinants in G(2)/M cells included crossovers. Thus, the cohesin complex has a dual role in protecting chromosome integrity: it promotes DSB repair and recombination between sister chromatids, and it suppresses damage-induced recombination between homologues. The effects of limited amounts of Mcd1and Smc3 indicate that small changes in cohesin levels may increase the risk of genome instability, which may lead to genetic diseases and cancer.

  4. Calculation on spectrum of direct DNA damage induced by low-energy electrons including dissociative electron attachment.


    Liu, Wei; Tan, Zhenyu; Zhang, Liming; Champion, Christophe


    In this work, direct DNA damage induced by low-energy electrons (sub-keV) is simulated using a Monte Carlo method. The characteristics of the present simulation are to consider the new mechanism of DNA damage due to dissociative electron attachment (DEA) and to allow determining damage to specific bases (i.e., adenine, thymine, guanine, or cytosine). The electron track structure in liquid water is generated, based on the dielectric response model for describing electron inelastic scattering and on a free-parameter theoretical model and the NIST database for calculating electron elastic scattering. Ionization cross sections of DNA bases are used to generate base radicals, and available DEA cross sections of DNA components are applied for determining DNA-strand breaks and base damage induced by sub-ionization electrons. The electron elastic scattering from DNA components is simulated using cross sections from different theoretical calculations. The resulting yields of various strand breaks and base damage in cellular environment are given. Especially, the contributions of sub-ionization electrons to various strand breaks and base damage are quantitatively presented, and the correlation between complex clustered DNA damage and the corresponding damaged bases is explored. This work shows that the contribution of sub-ionization electrons to strand breaks is substantial, up to about 40-70%, and this contribution is mainly focused on single-strand break. In addition, the base damage induced by sub-ionization electrons contributes to about 20-40% of the total base damage, and there is an evident correlation between single-strand break and damaged base pair A-T.

  5. HDAC Inhibition Synergistically Enhances Alkylator-induced DNA Damage Responses and Apoptosis in Multiple Myeloma Cells

    PubMed Central

    Lee, Choon-Kee; Wang, Shuiliang; Huang, Xiaoping; Ryder, John; Liu, Bolin


    Histone deacetylase (HDAC) inhibitors induce chromatin destabilization. We sought to determine whether HDAC inhibition may amplify alkylator-induced mitotic cell death in multiple myeloma (MM) cells. The combination of SNDX-275, a class I HDAC inhibitor, with melphalan, showed a powerful synergism on growth inhibition with the combination index ranged from 0.27 to 0.75 in MM1.S and RPMI8226 cells. Their combinations as compared with either agent alone promoted much more caspase-dependent apoptosis. Flow cytometry analysis showed that SNDX-275 had minimal effects on cell cycle progression of MM1.S cells, but clearly increased the percentage of S phase in RPMI8226 cells associated with an upregulation in p21waf1 and a reduction in cyclin D1 and E2F1. Melphalan alone significantly arrested both MM1.S and RPMI8226 cells at S phase and enhanced expression of p53 and p21waf1. Furthermore, studies on DNA damage response revealed that phospho-histone H2A.X (γH2A.X), a hall marker of DNA double strand break, along with phosphorylated CHK1 (P-CHK1) and CHK2 (P-CHK2) was dramatically induced by SNDX-275 or melphalan. The increase in γH2A.X and P-CHK1 was considerably higher on combination than either agent alone. These molecular changes correlated well with the significant increase in mitotic catastrophe. Our data indicate that SNDX-275 synergistically enhances melphalan-induced apoptosis in MM cells via intensification of DNA damage, suggesting that SNDX-275 in combination with melphalan may be a novel therapeutic strategy for MM. PMID:20447761

  6. Role of platinum DNA damage-induced transcriptional inhibition in chemotherapy-induced neuronal atrophy and peripheral neurotoxicity.


    Yan, Fang; Liu, Johnson J; Ip, Virginia; Jamieson, Stephen M F; McKeage, Mark J


    Platinum-based anticancer drugs cause peripheral neurotoxicity by damaging sensory neurons within the dorsal root ganglia (DRG), but the mechanisms are incompletely understood. The roles of platinum DNA binding, transcription inhibition and altered cell size were investigated in primary cultures of rat DRG cells. Click chemistry quantitative fluorescence imaging of RNA-incorporated 5-ethynyluridine showed high, but wide ranging, global levels of transcription in individual neurons that correlated with their cell body size. Treatment with platinum drugs reduced neuronal transcription and cell body size to an extent that corresponded to the amount of preceding platinum DNA binding, but without any loss of neuronal cells. The effects of platinum drugs on neuronal transcription and cell body size were inhibited by blocking platinum DNA binding with sodium thiosulfate, and mimicked by treatment with a model transcriptional inhibitor, actinomycin D. In vivo oxaliplatin treatment depleted the total RNA content of DRG tissue concurrently with altering DRG neuronal size. These findings point to a mechanism of chemotherapy-induced peripheral neurotoxicity, whereby platinum DNA damage induces global transcriptional arrest leading in turn to neuronal atrophy. DRG neurons may be particularly vulnerable to this mechanism of toxicity because of their requirements for high basal levels of global transcriptional activity. Findings point to a new stepwise mechanism of chemotherapy-induced peripheral neurotoxicity, whereby platinum DNA damage induces global transcriptional arrest leading in turn to neuronal atrophy. Dorsal root ganglion neurons may be particularly vulnerable to this neurotoxicity because of their high global transcriptional outputs, demonstrated in this study by click chemistry quantitative fluorescence imaging.

  7. XRCC1 Arg399Gln was associated with repair capacity for DNA damage induced by occupational chromium exposure

    PubMed Central


    Background Occupational chromium exposure may induce DNA damage and lead to lung cancer and other work-related diseases. DNA repair gene polymorphisms, which may alter the efficiency of DNA repair, thus may contribute to genetic susceptibility of DNA damage. The aim of this study was to test the hypothesis that the genetic variations of 9 major DNA repair genes could modulate the hexavalent chromium (Cr (VI))-induced DNA damage. Findings The median (P25-P75) of Olive tail moment was 0.93 (0.58–1.79) for individuals carrying GG genotype of XRCC1 Arg399Gln (G/A), 0.73 (0.46–1.35) for GA heterozygote and 0.50 (0.43–0.93) for AA genotype. Significant difference was found among the subjects with three different genotypes (P = 0.048) after adjusting the confounding factors. The median of Olive tail moment of the subjects carrying A allele (the genotypes of AA and GA) was 0.66 (0.44–1.31), which was significantly lower than that of subjects with GG genotype (P = 0.043). The A allele conferred a significantly reduced risk of DNA damage with the OR of 0.39 (95% CI: 0.15–0.99, P = 0.048). No significant association was found between the XRCC1Arg194Trp, ERCC1 C8092A, ERCC5 His1104Asp, ERCC6 Gly399Asp, GSTP1 Ile105Val, OGG1 Ser326Cys, XPC Lys939Gln, XPD Lys751Gln and DNA damage. Conclusion The polymorphism of Arg399Gln in XRCC1 was associated with the Cr (VI)- induced DNA damage. XRCC1 Arg399Gln may serve as a genetic biomarker of susceptibility for Cr (VI)- induced DNA damage. PMID:22642904

  8. XPC is essential for nucleotide excision repair of zidovudine-induced DNA damage in human hepatoma cells

    SciTech Connect

    Wu Qiangen; Beland, Frederick A.; Chang, Ching-Wei; Fang Jialong


    Zidovudine (3'-azido-3'-dexoythymidine, AZT), a nucleoside reverse transcriptase inhibitor, can be incorporated into DNA and cause DNA damage. The mechanisms underlying the repair of AZT-induced DNA damage are unknown. To investigate the pathways involved in the recognition and repair of AZT-induced DNA damage, human hepatoma HepG2 cells were incubated with AZT for 2 weeks and the expression of DNA damage signaling pathways was determined using a pathway-based real-time PCR array. Compared to control cultures, damaged DNA binding and nucleotide excision repair (NER) pathways showed significantly increased gene expression. Further analysis indicated that AZT treatment increased the expression of genes associated with NER, including XPC, XPA, RPA1, GTF2H1, and ERCC1. Western blot analysis demonstrated that the protein levels of XPC and GTF2H1 were also significantly up-regulated. To explore further the function of XPC in the repair of AZT-induced DNA damage, XPC expression was stably knocked down by 71% using short hairpin RNA interference. In the XPC knocked-down cells, 100 {mu}M AZT treatment significantly increased [{sup 3}H]AZT incorporation into DNA, decreased the total number of viable cells, increased the release of lactate dehydrogenase, induced apoptosis, and caused a more extensive G2/M cell cycle arrest when compared to non-transfected HepG2 cells or HepG2 cells transfected with a scrambled short hairpin RNA sequence. Overall, these data indicate that XPC plays an essential role in the NER repair of AZT-induced DNA damage.

  9. Protective Effect against Hydroxyl-induced DNA Damage and Antioxidant Activity of Radix Glycyrrhizae (Liquorice Root)

    PubMed Central

    Li, Xican; Chen, Weikang; Chen, Dongfeng


    Purpose: As a typical Chinese herbal medicine, Radix Glycyrrhizae (RG) possesses various pharmacological effects involved in antioxidant ability. However, its antioxidant has not been explored so far. The aim of the study was to investigate its antioxidant ability, then further discuss the antioxidant mechanism. Methods: RG was extracted by ethanol to obtain ethanolic extract of Radix Glycyrrhizae (ERG). ERG was then determined by various antioxidant methods, including DNA damage assay, DPPH assay, ABTS assay, Fe3+-reducing assay and Cu2+-reducing assay. Finally, the contents of total phenolics and total flavonoids were analyzed by spectrophotometric methods. Results: Our results revealed that ERG could effectively protect against hydroxyl-induced DNA damage (IC50 517.28±26.61μg/mL). In addition, ERG could scavenge DPPH· radical (IC50165.18±6.48μg/mL) and ABTS+• radical (IC507.46±0.07μg/mL), reduce Fe3+ (IC50 97.23±2.88 μg/mL) and Cu2+ (IC50 59.21±0.18 μg/mL). Chemical analysis demonstrated that the contents of total phenolics and flavonoids in ERG were 111.48±0.88 and 218.26±8.57 mg quercetin/g, respectively. Conclusion: Radix Glycyrrhizae can effectively protect against hydroxyl-induced DNA damage. One mechanism of protective effect may be radical-scavenging which is via donating hydrogen atom (H·), donating electron (e). Its antioxidant ability can be mainly attributed to the flavonoids or total phenolics. PMID:24312831

  10. Protective Effect against Hydroxyl-induced DNA Damage and Antioxidant Activity of Citri reticulatae Pericarpium

    PubMed Central

    Li, Xican; Huang, Yanping; Chen, Dongfeng


    Purpose: As a typical Chinese herbal medicine, Citri reticulatae pericarpium (CRP) possesses various pharmacological effects involved in antioxidant ability. However, its antioxidant effects have not been reported yet. The objective of this work was to investigate its antioxidant ability, then further discuss the antioxidant mechanism. Methods: CRP was extracted by ethanol to obtain ethanol extract of Citri reticulatae pericarpium (ECRP). ECRP was then measured by various antioxidant methods, including DNA damage assay, DPPH assay, ABTS assay, Fe3+-reducing assay and Cu2+-reducing assay. Finally, the content of total flavonoids was analyzed by spectrophotometric method. Results: Our results revealed that ECRP could effectively protect against hydroxyl-induced DNA damage (IC50 944.47±147.74 μg/mL). In addition, it could also scavenge DPPH· radical (IC50349.67±1.91 μg/mL) and ABTS+• radical (IC5011.33±0.10 μg/mL), reduce Fe3+ (IC50 140.95±2.15 μg/mL) and Cu2+ (IC50 70.46±1.77 μg/mL). Chemical analysis demonstrated that the content of total flavonoids in ECRP was 198.29±12.24 mg quercetin/g. Conclusion: Citri reticulatae pericarpium can effectively protect against hydroxyl-induced DNA damage. One mechanism of protective effect may be radical-scavenging which is via donating hydrogen atom (H·), donating electron (e). Its antioxidant ability can be mainly attributed to the flavonoids, especially hesperidin and narirutin. PMID:24312832

  11. Diethylstilbestrol induces oxidative DNA damage, resulting in apoptosis of spermatogonial stem cells in vitro.


    Habas, Khaled; Brinkworth, Martin H; Anderson, Diana


    The spermatogonial stem cells (SSCs) are the only germline stem cells in adults that are responsible for the transmission of genetic information from mammals to the next generation. SSCs play a very important role in the maintenance of progression of spermatogenesis and help provide an understanding of the reproductive biology of future gametes and a strategy for diagnosis and treatment of infertility and male reproductive toxicity. Androgens/oestrogens are very important for the suitable maintenance of male germ cells. There is also evidence confirming the damaging effects of oestrogen-like compounds on male reproductive health. We investigated the effects in vitro, of diethylstilbestrol (DES) on mouse spermatogonial stem cells separated using Staput unit-gravity velocity sedimentation, evaluating any DNA damage using the Comet assay and apoptotic cells in the TUNEL assay. Immunocytochemistry assays showed that the purity of isolated mouse spermatogonial cells was 90%, and the viability of these isolated cells was over 96%. Intracellular superoxide anion production (O2(-)) in SSCs was detected using p-Nitro Blue Tetrazolium (NBT) assay. The viability of cells after DES treatment was examined in the CCK8 (cell counting kit-8) cytotoxicity assay. The results showed that DES-induced DNA damage causes an increase in intracellular superoxide anions which are reduced by the flavonoid, quercetin. Investigating the molecular mechanisms and biology of SSCs provides a better understanding of spermatogonial stem cell regulation in the testis.

  12. Role of TRPM2 and TRPV1 cation channels in cellular responses to radiation-induced DNA damage.


    Masumoto, Kanako; Tsukimoto, Mitsutoshi; Kojima, Shuji


    Radiation exposure causes DNA damage, and DNA repair systems are essential to rescue damaged cells. Although DNA damage or oxidative stress activates transient receptor potential melastatin 2 (TRPM2) and vanilloid 1 (TRPV1) cation channels, it has not been established whether these TRP channels are involved in cellular responses to radiation-induced DNA damage. Here, we investigated the contribution of TRPM2 and TRPV1 channels to γ-irradiation- and UVB-induced DNA damage responses in human lung cancer A549 cells. A549 cells were irradiated with γ-rays (2.0Gy) or UVB (5-10mJ/cm(2)). γH2AX foci, ATM activation, 53BP1 accumulation and EGFR expression were evaluated by immunofluorescence staining. Extracellular ATP concentration was measured by luciferin-luciferase assay. Knockdown of TRPM2 and TRPV1 expression was done by siRNA transfection. γ-Irradiation-induced γH2AX focus formation, ATM activation, 53BP1 accumulation and EGFR nuclear translocation, which are all associated with DNA repair, were suppressed by knockdown of TRPM2 and TRPV1 channels in A549 cells. Release of ATP, which mediates DNA damage response-associated activation of P2Y receptors, was suppressed by pre-treatment with catalase or knockdown of TRPM2 channel, but not TRPV1 channel. Similarly, UVB-induced γH2AX focus formation was suppressed in TRPM2- and TRPV1-knockdown cells, while UVB-induced ATP release was blocked in TRPM2- but not TRPV1-knockdown cells. Our results suggest that the activation of TRPM2 channel, which mediates ATP release, and TRPV1 channel plays significant roles in the cellular responses to DNA damage induced by γ-irradiation and UVB irradiation. Our results provide a new insight into the function of TRP channels from the viewpoint of radiation biology. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Levetiracetam mitigates doxorubicin-induced DNA and synaptic damage in neurons

    PubMed Central

    Manchon, Jose Felix Moruno; Dabaghian, Yuri; Uzor, Ndidi-Ese; Kesler, Shelli R.; Wefel, Jeffrey S.; Tsvetkov, Andrey S.


    Neurotoxicity may occur in cancer patients and survivors during or after chemotherapy. Cognitive deficits associated with neurotoxicity can be subtle or disabling and frequently include disturbances in memory, attention, executive function and processing speed. Searching for pathways altered by anti-cancer treatments in cultured primary neurons, we discovered that doxorubicin, a commonly used anti-neoplastic drug, significantly decreased neuronal survival. The drug promoted the formation of DNA double-strand breaks in primary neurons and reduced synaptic and neurite density. Pretreatment of neurons with levetiracetam, an FDA-approved anti-epileptic drug, enhanced survival of chemotherapy drug-treated neurons, reduced doxorubicin-induced formation of DNA double-strand breaks, and mitigated synaptic and neurite loss. Thus, levetiracetam might be part of a valuable new approach for mitigating synaptic damage and, perhaps, for treating cognitive disturbances in cancer patients and survivors. PMID:27168474

  14. Effects of trypsin on cellular, chromosomal and DNA damage induced by X-rays

    NASA Astrophysics Data System (ADS)

    Sprunt, Elizabeth A.

    When cells are trypsinized before irradiation, potentiation of cell killing is seen; this is known as the 'trypsin effect'. The trypsin effect is re-examined here in the light of experiments in which enzymatic modifications of DNA in permeabilized cells has become a powerful experimental tool (Bryant et al, 1978, Ahnstrom and Bryant,1982; Natarajan et al, 1980; Bryant, 1984, 1985; Natarajan and Obe, 1984) and where in some cases it is suspected that trypsinization as part of the technique could significantly alter cell membrane permeability and chromatin structure (Obe et al, 1985; Obe and Winkel, 1985; Bryant and Christie, 1989). The trypsin effect was investigated at various cellular levels, assaying for cell survival (to verify the potentiation), anaphase chromosomal aberrations, DNA damage and repair and lastly using a nucleoid assay to investigate the effect of trypsin on DNA-nuclear matrix interactions. Each of these are considered in separate chapters as individual studies, then all compared in the final discussion. A small potentiation effect of X-ray damage on cell killing was seen when using Chinese Hamster Ovary (CHO) cells but no potentiating effect was found in the murine Ehrlich ascites tumour (EAT) cell line. Trypsinization was found to increase the number of X-ray induced chromosomal anaphase abnormalities in EAT cells. To investigate the possibility that the basis of the trypsin effect lies in its action at the DNA level, further experiments were performed to monitor DNA damage and repair using the DNA unwinding and neutral elution techniques. No difference was seen in the unwinding kinetics or in the DNA unwinding dose-effect curves for induction of DNA single strand breakage (ssb); when using neutral elution however. treatment of cells with trypsin or buffer alone increased the incidence of X-ray induced double strand breaks (dsb) at higher doses. Trypsinized EAT cells were found to repair ssb after 12 Gy less rapidly than those treated with


    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This novel assay is based on changes in melting/annealing behavior and facilitated using certain dyes that increase their fluorescence upon association with double stranded (ds)DNA. Damage caused by ultraviolet (UV) ra...


    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This assay is based on the ability of certain dyes to fluoresce upon intercalation with dsDNA. Damage caused by ultraviolet (UV) radiation, chemicals or restriction enzymes is detected using this assay. UV radiation at...


    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This assay is based on the ability of certain dyes to fluoresce upon intercalation with dsDNA. Damage caused by ultraviolet (UV) radiation, chemicals or restriction enzymes is detected using this assay. UV radiation at...


    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This novel assay is based on changes in melting/annealing behavior and facilitated using certain dyes that increase their fluorescence upon association with double stranded (ds)DNA. Damage caused by ultraviolet (UV) ra...

  19. Roles of PCNA ubiquitination and TLS polymerases κ and η in the bypass of methyl methanesulfonate-induced DNA damage

    PubMed Central

    Wit, Niek; Buoninfante, Olimpia Alessandra; van den Berk, Paul C.M.; Jansen, Jacob G.; Hogenbirk, Marc A.; de Wind, Niels; Jacobs, Heinz


    Translesion synthesis (TLS) provides a highly conserved mechanism that enables DNA synthesis on a damaged template. TLS is performed by specialized DNA polymerases of which polymerase (Pol) κ is important for the cellular response to DNA damage induced by benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), ultraviolet (UV) light and the alkylating agent methyl methanesulfonate (MMS). As TLS polymerases are intrinsically error-prone, tight regulation of their activity is required. One level of control is provided by ubiquitination of the homotrimeric DNA clamp PCNA at lysine residue 164 (PCNA-Ub). We here show that Polκ can function independently of PCNA modification and that Polη can function as a backup during TLS of MMS-induced lesions. Compared to cell lines deficient for PCNA modification (PcnaK164R) or Polκ, double mutant cell lines display hypersensitivity to MMS but not to BPDE or UV-C. Double mutant cells also displayed delayed post-replicative TLS, accumulate higher levels of replication stress and delayed S-phase progression. Furthermore, we show that Polη and Polκ are redundant in the DNA damage bypass of MMS-induced DNA damage. Taken together, we provide evidence for PCNA-Ub-independent activation of Polκ and establish Polη as an important backup polymerase in the absence of Polκ in response to MMS-induced DNA damage. PMID:25505145

  20. Inhibition of etoposide-induced DNA damage and cytotoxicity in L1210 cells by dehydrogenase inhibitors and other agents.


    Wozniak, A J; Glisson, B S; Hande, K R; Ross, W E


    The mechanism of action of 4'-demethylepipodophyllotoxin-9-(4,6-O-ethylidene-beta-D-glucopyra noside) (VP-16), an important antitumor agent, is unclear. There is evidence that DNA may be the target of action because VP-16 causes single-strand and double-strand breaks in DNA and produces cytotoxicity over a similar dose range. We have hypothesized that an enzyme system, such as dehydrogenase, catalyzes an oxidation-reduction reaction involving the pendant phenolic group which forms an active metabolite that causes the DNA damage and cytotoxicity. To test our hypothesis, we investigated the effect of disulfiram, an aldehyde dehydrogenase inhibitor, and its metabolite, diethyldithiocarbamate, on VP-16-induced DNA damage in L1210 cells. Using the alkaline elution technique to assay DNA damage, we found that disulfiram and diethyldithiocerbamate inhibited VP-16-induced single-strand breaks. Both compounds were also capable of significantly reducing VP-16-induced cytotoxicity. Oxalic acid, pyrophosphate, and malonic acid, competitive inhibitors of succinate dehydrogenase, and the naturally occurring dehydrogenase substrates, succinic acid, beta-glycerophosphate, and isocitric acid, also blocked the effects of VP-16. Free-radical scavengers were also studied. While sodium benzoate was particularly effective in preventing drug-induced DNA damage and cytotoxicity, a number of other scavengers were not. Our data are consistent with the hypothesis that VP-16 is activated by an enzyme such as a dehydrogenase which transforms it into an active intermediate resulting in DNA damage and, consequently, cell death.

  1. Demethoxycurcumin-induced DNA Damage Decreases DNA Repair-associated Protein Expression Levels in NCI-H460 Human Lung Cancer Cells.


    Ko, Yang-Ching; Lien, Jin-Cherng; Liu, Hsin-Chung; Hsu, Shu-Chun; Lin, Hui-Yi; Chueh, Fu-Shin; Ji, Bin-Chuan; Yang, Mei-Due; Hsu, Wu-Huei; Chung, Jing-Gung


    Demethoxycurcumin (DMC) is a key component of Chinese medicine (Turmeric) and has been proven effective in killing various cancer cells. Its role in inducing cytotoxic effects in many cancer cells has been reported, but its role regarding DNA damage on lung cancer cells has not been studied in detail. In the present study, we demonstrated DMC-induced DNA damage and condensation in NCI-H460 cells by using the Comet assay and DAPI staining examinations, respectively. Western blotting indicated that DMC suppressed the protein levels associated with DNA damage and repair, such as 14-3-3σ (an important checkpoint keeper of DNA damage response), DNA repair proteins breast cancer 1, early onset (BRCA1), O6-methylguanine-DNA methyltransferase (MGMT), mediator of DNA damage checkpoint 1 (MDC1), and p53 (tumor suppressor protein). DMC activated phosphorylated p53 and p-H2A.X (phospho Ser140) in NCI-H460 cells. Furthermore, we used confocal laser systems microscopy to examine the protein translocation. The results showed that DMC promotes the translocation of p-p53 and p-H2A.X from the cytosol to the nuclei in NCI-H460 cells. Taken together, DMC induced DNA damage and affected DNA repair proteins in NCI-H460 cells in vitro.

  2. Cyclin D1 depletion induces DNA damage in mantle cell lymphoma lines.


    Mohanty, Suchismita; Mohanty, Atish; Sandoval, Natalie; Tran, Thai; Bedell, Victoria; Wu, Jun; Scuto, Anna; Murata-Collins, Joyce; Weisenburger, Dennis D; Ngo, Vu N


    Elevated cyclin D1 (CCND1) expression levels in mantle cell lymphoma (MCL) are associated with aggressive clinical manifestations related to chemoresistance, but little is known about how this important proto-oncogene contributes to the resistance of MCL. Here, we showed that RNA interference-mediated depletion of CCND1 increased caspase-3 activities and induced apoptosis in the human MCL lines UPN-1 and JEKO-1. In vitro and xenotransplant studies revealed that the toxic effect of CCND1 depletion in MCL cells was likely due to increase in histone H2AX phosphorylation, a DNA damage marker. DNA fiber analysis suggested deregulated replication initiation after CCND1 depletion as a potential cause of DNA damage. Finally, in contrast to depletion or inhibition of cyclin-dependent kinase 4, CCND1 depletion increased chemosensitivity of MCL cells to replication inhibitors hydroxyurea and cytarabine. Our findings have an important implication for CCND1 as a potential therapeutic target in MCL patients who are refractory to standard chemotherapy.

  3. Mechanisms of neurotoxicity induced in the developing brain of mice and rats by DNA-damaging chemicals.


    Doi, Kunio


    It is not widely known how the developing brain responds to extrinsic damage, although the developing brain is considered to be sensitive to diverse environmental factors including DNA-damaging agents. This paper reviews the mechanisms of neurotoxicity induced in the developing brain of mice and rats by six chemicals (ethylnitrosourea, hydroxyurea, 5-azacytidine, cytosine arabinoside, 6-mercaptopurine and etoposide), which cause DNA damage in different ways, especially from the viewpoints of apoptosis and cell cycle arrest in neural progenitor cells. In addition, this paper also reviews the repair process following damage in the developing brain.

  4. Biomolecular damage induced by ionizing radiation: the direct and indirect effects of low-energy electrons on DNA.


    Alizadeh, Elahe; Orlando, Thomas M; Sanche, Léon


    Many experimental and theoretical advances have recently allowed the study of direct and indirect effects of low-energy electrons (LEEs) on DNA damage. In an effort to explain how LEEs damage the human genome, researchers have focused efforts on LEE interactions with bacterial plasmids, DNA bases, sugar analogs, phosphate groups, and longer DNA moieties. Here, we summarize the current understanding of the fundamental mechanisms involved in LEE-induced damage of DNA and complex biomolecule films. Results obtained by several laboratories on films prepared and analyzed by different methods and irradiated with different electron-beam current densities and fluencies are presented. Despite varied conditions (e.g., film thicknesses and morphologies, intrinsic water content, substrate interactions, and extrinsic atmospheric compositions), comparisons show a striking resemblance in the types of damage produced and their yield functions. The potential of controlling this damage using molecular and nanoparticle targets with high LEE yields in targeted radiation-based cancer therapies is also discussed.

  5. Biomolecular Damage Induced by Ionizing Radiation: The Direct and Indirect Effects of Low-Energy Electrons on DNA

    NASA Astrophysics Data System (ADS)

    Alizadeh, Elahe; Orlando, Thomas M.; Sanche, Léon


    Many experimental and theoretical advances have recently allowed the study of direct and indirect effects of low-energy electrons (LEEs) on DNA damage. In an effort to explain how LEEs damage the human genome, researchers have focused efforts on LEE interactions with bacterial plasmids, DNA bases, sugar analogs, phosphate groups, and longer DNA moieties. Here, we summarize the current understanding of the fundamental mechanisms involved in LEE-induced damage of DNA and complex biomolecule films. Results obtained by several laboratories on films prepared and analyzed by different methods and irradiated with different electron-beam current densities and fluencies are presented. Despite varied conditions (e.g., film thicknesses and morphologies, intrinsic water content, substrate interactions, and extrinsic atmospheric compositions), comparisons show a striking resemblance in the types of damage produced and their yield functions. The potential of controlling this damage using molecular and nanoparticle targets with high LEE yields in targeted radiation-based cancer therapies is also discussed.

  6. Spatiotemporal characterization of ionizing radiation induced DNA damage foci and their relation to chromatin organization

    SciTech Connect

    Costes, Sylvain V; Chiolo, Irene; Pluth, Janice M.; Barcellos-Hoff, Mary Helen; Jakob, Burkhard


    DNA damage sensing proteins have been shown to localize to the sites of DSB within seconds to minutes following ionizing radiation (IR) exposure, resulting in the formation of microscopically visible nuclear domains referred to as radiation-induced foci (RIF). This review characterizes the spatio-temporal properties of RIF at physiological doses, minutes to hours following exposure to ionizing radiation, and it proposes a model describing RIF formation and resolution as a function of radiation quality and nuclear densities. Discussion is limited to RIF formed by three interrelated proteins ATM (Ataxia telangiectasia mutated), 53BP1 (p53 binding protein 1) and ?H2AX (phosphorylated variant histone H2AX). Early post-IR, we propose that RIF mark chromatin reorganization, leading to a local nuclear scaffold rigid enough to keep broken DNA from diffusing away, but open enough to allow the repair machinery. We review data indicating clear kinetic and physical differences between RIF emerging from dense and uncondensed regions of the nucleus. At later time post-IR, we propose that persistent RIF observed days following exposure to ionizing radiation are nuclear ?scars? marking permanent disruption of the chromatin architecture. When DNA damage is resolved, such chromatin modifications should not necessarily lead to growth arrest and it has been shown that persistent RIF can replicate during mitosis. Thus, heritable persistent RIF spanning over tens of Mbp may affect the transcriptome of a large progeny of cells. This opens the door for a non DNA mutation-based mechanism of radiation-induced phenotypes.

  7. Formation, Accumulation, and Hydrolysis of Endogenous and Exogenous Formaldehyde-Induced DNA Damage

    PubMed Central

    Yu, Rui; Lai, Yongquan; Hartwell, Hadley J.; Moeller, Benjamin C.; Doyle-Eisele, Melanie; Kracko, Dean; Bodnar, Wanda M.; Starr, Thomas B.; Swenberg, James A.


    Formaldehyde is not only a widely used chemical with well-known carcinogenicity but is also a normal metabolite of living cells. It thus poses unique challenges for understanding risks associated with exposure. N2-hydroxymethyl-dG (N2-HOMe-dG) is the main formaldehyde-induced DNA mono-adduct, which together with DNA-protein crosslinks (DPCs) and toxicity-induced cell proliferation, play important roles in a mutagenic mode of action for cancer. In this study, N2-HOMe-dG was shown to be an excellent biomarker for direct adduction of formaldehyde to DNA and the hydrolysis of DPCs. The use of inhaled [13CD2]-formaldehyde exposures of rats and primates coupled with ultrasensitive nano ultra performance liquid chromatography-tandem mass spectrometry permitted accurate determinations of endogenous and exogenous formaldehyde DNA damage. The results show that inhaled formaldehyde only reached rat and monkey noses, but not tissues distant to the site of initial contact. The amounts of exogenous adducts were remarkably lower than those of endogenous adducts in exposed nasal epithelium. Moreover, exogenous adducts accumulated in rat nasal epithelium over the 28-days exposure to reach steady-state concentrations, followed by elimination with a half-life (t1/2) of 7.1 days. Additionally, we examined artifact formation during DNA preparation to ensure the accuracy of nonlabeled N2-HOMe-dG measurements. These novel findings provide critical new data for understanding major issues identified by the National Research Council Review of the 2010 Environmental Protection Agency’s Draft Integrated Risk Information System Formaldehyde Risk Assessment. They support a data-driven need for reflection on whether risks have been overestimated for inhaled formaldehyde, whereas underappreciating endogenous formaldehyde as the primary source of exposure that results in bone marrow toxicity and leukemia in susceptible humans and rodents deficient in DNA repair. PMID:25904104

  8. Gamma radiation induced cell cycle perturbations and DNA damage in Catla Catla as measured by flow cytometry.


    Anbumani, S; Mohankumar, Mary N


    Gamma radiation induced cell cycle perturbations and DNA damage in Catla catla were analyzed in erythrocytes at different time points using flow cytometry (FCM). Protracted exposure to radiation induced damage between days 12 and 45. Disturbances in cell cycle machinery, i.e., proportional increase and decrease in Gap0 or quiescent/Gap1 (G0/G1), Synthesis (S) and Gap2/Mitotic (G2/M) phases were observed at both acute and protracted treatments. Both acute and protracted exposures induced apoptosis with a notable significance between days 3 and 6 at protracted and on day 45 at acute doses. Fish exposed protractedly avail some DNA repair mechanisms than acutely exposed. This is the first study to analyze radiation induced DNA damage under laboratory conditions and suggests that flow cytometry can also be an alternate tool to screen genotoxicity induced by ionizing radiation in fish. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Selective protection of zidovudine-induced DNA-damage by the antioxidants WR-1065 and tempol.


    Olivero, Ofelia A; Ongele, Michael O; Braun, Hannan M; Marrogi, Ariadna; Divi, Kathyiani; Mitchell, James B; Poirier, Miriam C


    The cytokinesis-block micronucleus cytome (CBMN) assay, introduced by Fenech, was used to demonstrate different types of DNA damage in MOLT-3 human lymphoblastoid cells exposed to 10 μM zidovudine (AZT). In addition, we explored the cytoprotective potential of two antioxidants, WR-1065 and Tempol, to decrease AZT-induced genotoxicity. Binucleated cells, arrested by Cytochalasin B (Cyt B), were evaluated for micronuclei (MN), caused by DNA damage or chromosomal loss, and chromatin nucleoplasmic bridges (NPBs), caused by telomere attrition. Additionally, nuclear buds (NBUDs), caused by amplified DNA, and apoptotic and necrotic (A/N) cells were scored. We hypothesized that AZT exposure would increase the frequency of genotoxic end points, and that the antioxidants Tempol and WR-1065 would protect against AZT-induced genotoxicity. MOLT-3 cells were exposed to 0 or 10 µM AZT for a total of 76 hr. After the first 24 hr, 0 or 5 µM WR-1065 and/or 0 or 200 µM Tempol were added for the remainder of the experiment. For the last 28 hr (of 76 hr), Cyt B was added to arrest replication after one cell division, leaving a predominance of binucleated cells. The nuclear division index (NDI) was similar for all treatment groups, indicating that the exposures did not alter cell viability. MOLT-3 cells exposed to AZT alone had significant (P < 0.05) increases in MN and NBs, compared to unexposed cells. Both Tempol and WR-1065 protected against AZT-induced MN formation (P < 0.003 for both), and WR-1065, but not Tempol, reduced the levels of A/N (P = 0.041). In cells exposed to AZT/Tempol there were significantly reduced levels of NBUDs, compared to cells exposed to AZT alone (P = 0.015). Cells exposed to AZT/WR-1065 showed reduced levels of NPBs, compared to cells exposed to AZT alone (P = 0.037). Thus WR-1065 and Tempol protected MOLT-3 cells against specific types of AZT-induced DNA damage.

  10. Oxidative damage of DNA induced by X-irradiation decreases the uterine endometrial receptivity which involves mitochondrial and lysosomal dysfunction

    PubMed Central

    Gao, Wei; Liang, Jin-Xiao; Liu, Shuai; Liu, Chang; Liu, Xiao-Fang; Wang, Xiao-Qi; Yan, Qiu


    X irradiation may lead to female infertility and the mechanism is still not clear. After X irradiation exposure, significantly morphological changes and functional decline in endometrial epithelial cells were observed. The mitochondrial and lysosomal dysfunction and oxidative DNA damage were noticed after X irradiation. In addition, pretreatment with NAC, NH4Cl or Pep A reduced the X irradiation induced damages. These studies demonstrate that the oxidative DNA damage which involved dysfunctional lysosomal and mitochondrial contribute to X irradiation-induced impaired receptive state of uterine endometrium and proper protective reagents can be helpful in improving endometrial function. PMID:26064230

  11. Oxidative damage of DNA induced by X-irradiation decreases the uterine endometrial receptivity which involves mitochondrial and lysosomal dysfunction.


    Gao, Wei; Liang, Jin-Xiao; Liu, Shuai; Liu, Chang; Liu, Xiao-Fang; Wang, Xiao-Qi; Yan, Qiu


    X irradiation may lead to female infertility and the mechanism is still not clear. After X irradiation exposure, significantly morphological changes and functional decline in endometrial epithelial cells were observed. The mitochondrial and lysosomal dysfunction and oxidative DNA damage were noticed after X irradiation. In addition, pretreatment with NAC, NH4Cl or Pep A reduced the X irradiation induced damages. These studies demonstrate that the oxidative DNA damage which involved dysfunctional lysosomal and mitochondrial contribute to X irradiation-induced impaired receptive state of uterine endometrium and proper protective reagents can be helpful in improving endometrial function.

  12. DDB2 association with PCNA is required for its degradation after UV-induced DNA damage.


    Cazzalini, Ornella; Perucca, Paola; Mocchi, Roberto; Sommatis, Sabrina; Prosperi, Ennio; Stivala, Lucia Anna


    DDB2 is a protein playing an essential role in the lesion recognition step of the global genome sub-pathway of nucleotide excision repair (GG-NER) process. Among the proteins involved in the DNA damage response, p21(CDKN1A) (p21) has been reported to participate in NER, but also to be removed by proteolytic degradation, thanks to its association with PCNA. DDB2 is involved in the CUL4-DDB1 complex mediating p21 degradation; however, the direct interaction between DDB2, p21 and PCNA has been never investigated. Here, we show that DDB2 co-localizes with PCNA and p21 at local UV-induced DNA-damage sites, and these proteins co-immunoprecipitate in the same complex. In addition, we provide evidence that p21 is not able to bind directly DDB2, but, to this end, the presence of PCNA is required. Direct physical association of recombinant DDB2 protein with PCNA is mediated by a conserved PIP-box present in the N-terminal region of DDB2. Mutation of the PIP-box resulted in the loss of protein interaction. Interestingly, the same mutation, or depletion of PCNA by RNA interference, greatly impaired DDB2 degradation induced by UV irradiation. These results indicate that DDB2 is a PCNA-binding protein, and that this association is required for DDB2 proteolytic degradation.

  13. Ellipticine induces apoptosis in T-cell lymphoma via oxidative DNA damage.


    Savorani, Cecilia; Manfé, Valentina; Biskup, Edyta; Gniadecki, Robert


    The tumor suppressor p53 is often mutated in human cancers. Restoring its antitumor activity has been shown to be a promising therapeutic approach for cancer treatment. Here we analyzed the activity and mechanism of a p53 reactivator, ellipticine, in a cellular model of cutaneous T-cell lymphoma (CTCL), a disease that is progressive, chemoresistant and refractory to treatment. We tested the effect of ellipticine in three cell lines with different p53 status: MyLa2000 (p53(wt/wt)), SeAx ((G245S)p53) and Hut-78 ((R196Stop)p53). Ellipticine caused apoptosis in MyLa2000 and SeAx and restored the transcriptional activity of (G245S)p53 in SeAx. However, p53 siRNA knockdown experiments revealed that p53 was not required for ellipticine-induced apoptosis in CTCL. The lipophilic antioxidant α-tocopherol inhibited ellipticine-dependent apoptosis and we linked the apoptotic response to the oxidative DNA damage. Our results provide evidence that ellipticine-induced apoptosis is exerted through DNA damage and does not require p53 activation in T-cell lymphoma.

  14. DNA damage and oxidative stress induced by endosulfan exposure in zebrafish (Danio rerio).


    Shao, Bo; Zhu, Lusheng; Dong, Miao; Wang, Jun; Wang, Jinhua; Xie, Hui; Zhang, Qingming; Du, Zhongkun; Zhu, Shaoyuan


    Endosulfan (6,7,8,9,10,10-hexachloro-1,5,5a,6,9,9a-hexahydro-6,9-methano-2,4,3-benzo-dioxathiepin-3-oxide), an organochlorine pesticide, is prevalently used all around the world. It is considered to be a new candidate for the persistent organic pollutants group. Endosulfan residues in the environment may cause serious damage to ecosystems, especially in aquatic environments. The present study was conducted to investigate the effect of endosulfan on antioxidant enzymes [catalase (CAT) and superoxide dismutase (SOD)], reactive oxygen species (ROS) generation and DNA damage in zebrafish. Male and female zebrafish were separated and exposed to a control solution and four concentrations of endosulfan (0.01, 0.1, 1, and 10 μg L⁻¹) and were sampled after 7, 14, 21, and 28 days. It is noteworthy that the present research explored the correlation among the three indicators induced by endosulfan. Low endosulfan concentrations (0.01 μg L⁻¹) induced a slight increase of SOD and CAT activity, which kept ROS in a stable level. High endosulfan concentration (10 μg L⁻¹) induced excessive ROS production which exceeded the capacity of the cellular antioxidants and exhausted the enzyme including CAT and SOD. The DNA damage of zebrafish was evaluated by single-cell gel electrophoresis and was enhanced with increasing endosulfan concentration. In conclusion, the present study showed that endosulfan (0.01-10 μg L⁻¹) has toxic effects on zebrafish.

  15. Effect of β-carotene on catechol-induced genotoxicity in vitro: evidence of both enhanced and reduced DNA damage.


    Åsgård, R; Hellman, B


    Intake of antioxidants from the diet has been recognized to have beneficial health effects, but the potential benefit of taking antioxidants such as β-carotene as supplements is controversial. The aim of the present study was to evaluate the potential protective effects of a physiologically relevant concentration (2 μM) of β-carotene on the DNA damaging effects of catechol in mouse lymphoma L5178Y cells. Two different exposure protocols were used: simultaneous exposure to β-carotene and catechol for 3 h; and exposure to catechol for 3 h after 18 h pre-treatment with the vitamin. DNA damage was evaluated using the comet assay (employing one procedure for general damage, and another procedure, which also included oxidative DNA damage). Independent of exposure protocol and procedure for comet assay, β-carotene did not increase the basal level of DNA damage. However, at the highest concentration of catechol (1 mM), β-carotene was found to clearly increase the level of catechol-induced DNA damage, especially in the pre-treated cells. Interestingly, an opposite effect was observed at lower concentrations of catechol, but the β-carotene related reduction of catechol-induced genotoxicity was significant (P < 0.05) only for the procedure including oxidative damage induced by 0.5 mM catechol. Taken together our results indicate that β- carotene can both reduce and enhance the DNA damaging effects of a genotoxic agent such as catechol. This indicates that it is the level of catechol-induced DNA damage that seems to determine whether β-carotene should be regarded as a beneficial or detrimental agent when it comes to its use as a dietary supplement.

  16. DNA-damage-induced differentiation of leukaemic cells as an anti-cancer barrier

    PubMed Central

    Santos, Margarida A.; Faryabi, Robert B.; Ergen, Aysegul V.; Day, Amanda M.; Malhowski, Amy; Canela, Andres; Onozawa, Masahiro; Lee, Ji-Eun; Callen, Elsa; Gutierrez-Martinez, Paula; Chen, Hua-Tang; Wong, Nancy; Finkel, Nadia; Deshpande, Aniruddha; Sharrow, Susan; Rossi, Derrick J.; Ito, Keisuke; Ge, Kai; Aplan, Peter D.; Armstrong, Scott A.; Nussenzweig, André


    Self-renewal is the hallmark feature both of normal stem cells and cancer stem cells1. Since the regenerative capacity of normal haematopoietic stem cells is limited by the accumulation of reactive oxygen species and DNA double-strand breaks2–4, we speculated that DNA damage might also constrain leukaemic self-renewal and malignant haematopoiesis. Here we show that the histone methyl-transferase MLL4, a suppressor of B-cell lymphoma5,6, is required for stem-cell activity and an aggressive form of acute myeloid leukaemia harbouring the MLL–AF9 oncogene. Deletion of MLL4 enhances myelopoiesis and myeloid differentiation of leukaemic blasts, which protects mice from death related to acute myeloid leukaemia. MLL4 exerts its function by regulating transcriptional programs associated with the antioxidant response. Addition of reactive oxygen species scavengers or ectopic expression of FOXO3 protects MLL4−/− MLL–AF9 cells from DNA damage and inhibits myeloid maturation. Similar to MLL4 deficiency, loss of ATM or BRCA1 sensitizes transformed cells to differentiation, suggesting that myeloid differentiation is promoted by loss of genome integrity. Indeed, we show that restriction-enzyme-induced double-strand breaks are sufficient to induce differentiation of MLL–AF9 blasts, which requires cyclin-dependent kinase inhibitor p21Cip1 (Cdkn1a) activity. In summary, we have uncovered an unexpected tumour-promoting role of genome guardians in enforcing the oncogene-induced differentiation blockade in acute myeloid leukaemia. PMID:25079327

  17. Low intensity microwave radiation induced oxidative stress, inflammatory response and DNA damage in rat brain.


    Megha, Kanu; Deshmukh, Pravin Suryakantrao; Banerjee, Basu Dev; Tripathi, Ashok Kumar; Ahmed, Rafat; Abegaonkar, Mahesh Pandurang


    Over the past decade people have been constantly exposed to microwave radiation mainly from wireless communication devices used in day to day life. Therefore, the concerns over potential adverse effects of microwave radiation on human health are increasing. Until now no study has been proposed to investigate the underlying causes of genotoxic effects induced by low intensity microwave exposure. Thus, the present study was undertaken to determine the influence of low intensity microwave radiation on oxidative stress, inflammatory response and DNA damage in rat brain. The study was carried out on 24 male Fischer 344 rats, randomly divided into four groups (n=6 in each group): group I consisted of sham exposed (control) rats, group II-IV consisted of rats exposed to microwave radiation at frequencies 900, 1800 and 2450 MHz, specific absorption rates (SARs) 0.59, 0.58 and 0.66 mW/kg, respectively in gigahertz transverse electromagnetic (GTEM) cell for 60 days (2h/day, 5 days/week). Rats were sacrificed and decapitated to isolate hippocampus at the end of the exposure duration. Low intensity microwave exposure resulted in a frequency dependent significant increase in oxidative stress markers viz. malondialdehyde (MDA), protein carbonyl (PCO) and catalase (CAT) in microwave exposed groups in comparison to sham exposed group (p<0.05). Whereas, levels of reduced glutathione (GSH) and superoxide dismutase (SOD) were found significantly decreased in microwave exposed groups (p<0.05). A significant increase in levels of pro-inflammatory cytokines (IL-2, IL-6, TNF-α, and IFN-γ) was observed in microwave exposed animal (p<0.05). Furthermore, significant DNA damage was also observed in microwave exposed groups as compared to their corresponding values in sham exposed group (p<0.05). In conclusion, the present study suggests that low intensity microwave radiation induces oxidative stress, inflammatory response and DNA damage in brain by exerting a frequency dependent effect

  18. STK295900, a dual inhibitor of topoisomerase 1 and 2, induces G(2) arrest in the absence of DNA damage.


    Kim, Sun-Ok; Sakchaisri, Krisada; Thimmegowda, N R; N R, Thimmegowda; Soung, Nak Kyun; Jang, Jae-Hyuk; Kim, Young Sang; Lee, Kyung Sang; Kwon, Yong Tae; Asami, Yukihiro; Ahn, Jong Seog; Erikson, Raymond Leo; Kim, Bo Yeon


    STK295900, a small synthetic molecule belonging to a class of symmetric bibenzimidazoles, exhibits antiproliferative activity against various human cancer cell lines from different origins. Examining the effect of STK295900 in HeLa cells indicates that it induces G(2) phase arrest without invoking DNA damage. Further analysis shows that STK295900 inhibits DNA relaxation that is mediated by topoisomerase 1 (Top 1) and topoisomerase 2 (Top 2) in vitro. In addition, STK295900 also exhibits protective effect against DNA damage induced by camptothecin. However, STK295900 does not affect etoposide-induced DNA damage. Moreover, STK295900 preferentially exerts cytotoxic effect on cancer cell lines while camptothecin, etoposide, and Hoechst 33342 affected both cancer and normal cells. Therefore, STK295900 has a potential to be developed as an anticancer chemotherapeutic agent.

  19. STK295900, a Dual Inhibitor of Topoisomerase 1 and 2, Induces G2 Arrest in the Absence of DNA Damage

    PubMed Central

    N. R., Thimmegowda; Soung, Nak Kyun; Jang, Jae-Hyuk; Kim, Young Sang; Lee, Kyung Sang; Kwon, Yong Tae; Asami, Yukihiro; Ahn, Jong Seog; Erikson, Raymond Leo; Kim, Bo Yeon


    STK295900, a small synthetic molecule belonging to a class of symmetric bibenzimidazoles, exhibits antiproliferative activity against various human cancer cell lines from different origins. Examining the effect of STK295900 in HeLa cells indicates that it induces G2 phase arrest without invoking DNA damage. Further analysis shows that STK295900 inhibits DNA relaxation that is mediated by topoisomerase 1 (Top 1) and topoisomerase 2 (Top 2) in vitro. In addition, STK295900 also exhibits protective effect against DNA damage induced by camptothecin. However, STK295900 does not affect etoposide-induced DNA damage. Moreover, STK295900 preferentially exerts cytotoxic effect on cancer cell lines while camptothecin, etoposide, and Hoechst 33342 affected both cancer and normal cells. Therefore, STK295900 has a potential to be developed as an anticancer chemotherapeutic agent. PMID:23349762

  20. Nuclear DNA damage-triggered NLRP3 inflammasome activation promotes UVB-induced inflammatory responses in human keratinocytes

    SciTech Connect

    Hasegawa, Tatsuya Nakashima, Masaya; Suzuki, Yoshiharu


    Ultraviolet (UV) radiation in sunlight can result in DNA damage and an inflammatory reaction of the skin commonly known as sunburn, which in turn can lead to cutaneous tissue disorders. However, little has been known about how UV-induced DNA damage mediates the release of inflammatory mediators from keratinocytes. Here, we show that UVB radiation intensity-dependently increases NLRP3 gene expression and IL-1β production in human keratinocytes. Knockdown of NLRP3 with siRNA suppresses UVB-induced production of not only IL-1β, but also other inflammatory mediators, including IL-1α, IL-6, TNF-α, and PGE{sub 2}. In addition, inhibition of DNA damage repair by knockdown of XPA, which is a major component of the nucleotide excision repair system, causes accumulation of cyclobutane pyrimidine dimer (CPD) and activation of NLRP3 inflammasome. In vivo immunofluorescence analysis confirmed that NLRP3 expression is also elevated in UV-irradiated human epidermis. Overall, our findings indicate that UVB-induced DNA damage initiates NLRP3 inflammasome activation, leading to release of various inflammatory mediators from human keratinocytes. - Highlights: • UVB radiation induces NLRP3 inflammasome activation in human keratinocytes. • NLRP3 knockdown suppresses production of UVB-induced inflammatory mediators. • UVB-induced DNA damage triggers NLRP3 inflammasome activation. • NLRP3 expression in human epidermis is elevated in response to UV radiation.

  1. In vivo antigenotoxic activity of watercress juice (Nasturtium officinale) against induced DNA damage.


    Casanova, Natalia A; Ariagno, Julia I; López Nigro, Marcela M; Mendeluk, Gabriela R; de los A Gette, María; Petenatti, Elisa; Palaoro, Luis A; Carballo, Marta A


    The present study was carried out to investigate the genotoxicity as well as possible protective activity against damage induced by cyclophosphamide (CP) of the aqueous juice of watercress (Nasturtium officinale, W.T. Aiton) in vivo. Male and female Swiss mice 7-8 weeks old (N = 48) were treated by gavage with 1 g kg(-1) body weight and 0.5 g kg(-1) body weight of watercress juice during 15 consecutive days. Genotoxicity and its possible protective effect were tested by the comet assay in peripheral blood cells and the micronucleus test in bone marrow. In addition, biopsies of the bladder, epididymis and testicles of mice were performed to extend the experimental design. Watercress juice per se did not induce genetic damage according to the comet assay and micronucleus study, exhibiting a protective activity against CP (P < 0.05 and P < 0.001, respectively). The comparative analysis of bladder histological changes obtained in the watercress plus CP group against those treated with CP alone suggests a probable protective effect. Further studies are needed in order to establish the protective role of watercress juice against DNA damage. Copyright © 2012 John Wiley & Sons, Ltd.

  2. Molecular Analysis of Base Damage Clustering Associated with a Site-Specific Radiation-Induced DNA Double-Strand Break

    PubMed Central

    Datta, Kamal; Jaruga, Pawel; Dizdaroglu, Miral; Neumann, Ronald D.; Winters, Thomas A.


    Base damage flanking a radiation-induced DNA double-strand break (DSB) may contribute to DSB complexity and affect break repair. However, to date, an isolated radiation-induced DSB has not been assessed for such structures at the molecular level. In this study, an authentic site-specific radiation-induced DSB was produced in plasmid DNA by triplex forming oligonucleotide-targeted 125I decay. A restriction fragment terminated by the DSB was isolated and probed for base damage with the E. coli DNA repair enzymes, endonuclease III and formamidopyrimidine-DNA glycosylase. Our results demonstrate base damage clustering within 8 bases of the 125I-targeted base in the DNA duplex. An increased yield of base damage (purine>pyrimidine) was observed for DSBs formed by irradiation in the absence of DMSO. An internal control fragment 1354 bp upstream from the targeted base was insensitive to enzymatic probing, indicating the damage detected proximal to the DSB was produced by the 125I decay that formed the DSB. Gas chromatography-mass spectrometry identified three types of damaged bases in the ~32 bp region proximal to the DSB. These base lesions were 8-hydroxyguanine, 8-hydroxyadenine, and 5-hydroxycytosine. Finally, evidence is presented for base damage >24 bp upstream from the 125I-decay site that may form via a charge migration mechanism. PMID:17067210

  3. Platelet-activating factor induces cell cycle arrest and disrupts the DNA damage response in mast cells

    PubMed Central

    Puebla-Osorio, N; Damiani, E; Bover, L; Ullrich, S E


    Platelet-activating factor (PAF) is a potent phospholipid modulator of inflammation that has diverse physiological and pathological functions. Previously, we demonstrated that PAF has an essential role in ultraviolet (UV)-induced immunosuppression and reduces the repair of damaged DNA, suggesting that UV-induced PAF is contributing to skin cancer initiation by inducing immune suppression and also affecting a proper DNA damage response. The exact role of PAF in modulating cell proliferation, differentiation or transformation is unclear. Here, we investigated the mechanism(s) by which PAF affects the cell cycle and impairs early DNA damage response. PAF arrests proliferation in transformed and nontransformed human mast cells by reducing the expression of cyclin-B1 and promoting the expression of p21. PAF-treated cells show a dose-dependent cell cycle arrest mainly at G2–M, and a decrease in the DNA damage response elements MCPH1/BRIT-1 and ataxia telangiectasia and rad related (ATR). In addition, PAF disrupts the localization of p-ataxia telangiectasia mutated (p-ATM), and phosphorylated-ataxia telangiectasia and rad related (p-ATR) at the site of DNA damage. Whereas the potent effect on cell cycle arrest may imply a tumor suppressor activity for PAF, the impairment of proper DNA damage response might implicate PAF as a tumor promoter. The outcome of these diverse effects may be dependent on specific cues in the microenvironment. PMID:25950475

  4. Emodin, aloe-emodin and rhein induced DNA damage and inhibited DNA repair gene expression in SCC-4 human tongue cancer cells.


    Chen, Ya-Yin; Chiang, Su-Yin; Lin, Jaung-Geng; Yang, Jai-Sing; Ma, Yi-Shih; Liao, Ching-Lung; Lai, Tung-Yuan; Tang, Nou-Ying; Chung, Jing-Gung


    In our primary studies, we have shown that emodin, aloe-emodin and rhein induced cytotoxic effects, including cell cycle arrest and apoptosis in SCC-4 human tongue cancer cells. However, details regarding their effects on DNA damage and repair gene expression in SCC-4 cells are not clear. We investigated whether or not emodin, aloe-emodin and rhein induced DNA damage and inhibited DNA repair gene expression in SCC-4 cells. Comet assay (single cell electrophoresis) indicated that incubation of SCC-4 cells with 0, 20, 30 and 40 microM of emodin, 0, 25, 50 and 100 microM of aloe-emodin or rhein led to a longer DNA migration smear (comet tail). This means that all examined agents induced DNA damage in SCC-4 cells and these effects are dose-dependent but emodin is stronger than that of aloe-emodin or rhein. The results from real-time PCR assay demonstrated that 30 microM of emodin or aloe-emodin used for 24 and 48 h treatment in SCC-4 cells significantly inhibited expression of genes associated with DNA damage and repair [ataxia telangiectasia mutated (ATM); ataxia-telangiectasia and Rad3-related (ATR); 14-3-3sigma (14-3-3sigma); breast cancer 1, early onset (BRCA1); and DNA-dependent serine/threonine protein kinase (DNA-PK)]; only rhein suppressed the expression of O(6)-methylguanine-DNA methyltransferase (MGMT) mRNA with 48 h treatment, but had no effect on ATM expression. On 24 h treatment, only aloe-emodin significantly affected ATM expression. These effects may be the vital factors for emodin, aloe-emodin and rhein induction of DNA damage in vitro. In conclusion, these agents induced DNA damage followed by the inhibition of DNA repair-associated gene expressions, including ATM, ATR, 14-3-3sigma, BRCA1, DNA-PK and MGMT in SCC-4 human tongue cancer cells.

  5. Oxidative DNA damage caused by inflammation may link to stress-induced non-targeted effects

    PubMed Central

    Sprung, Carl N.; Ivashkevich, Alesia; Forrester, Helen B.; Redon, Christophe E.; Georgakilas, Alexandros; Martin, Olga A.


    A spectrum of radiation-induced non-targeted effects has been reported during the last two decades since Nagasawa and Little first described a phenomenon in cultured cells that was later called the “bystander effect”. These non-targeted effects include radiotherapy-related abscopal effects, where changes in organs or tissues occur distant from the irradiated region. The spectrum of non-targeted effects continue to broaden over time and now embrace many types of exogenous and endogenous stressors that induce a systemic genotoxic response including a widely studied tumor microenvironment. Here we discuss processes and factors leading to DNA damage induction in non-targeted cells and tissues and highlight similarities in the regulation of systemic effects caused by different stressors. PMID:24041866

  6. Molecular hydrogen attenuates radiation-induced nucleobase damage to DNA in aerated aqueous solutions.


    Abou-Hamdan, Mhamad; Gardette, Bernard; Cadet, Jean; Gharib, Bouchra; De Reggi, Max; Douki, Thierry; Triantaphylides, Christian


    The main aim of the present study is to gain mechanistic insights into the modulating effect of molecular hydrogen on the γ-radiation-induced alteration pathways of DNA nucleobases. Aerated aqueous solutions of calf thymus DNA were exposed to a (60)Co source at doses ranging from 0 to 55 Gy under normoxic conditions, in the presence or not of 0.7 MPa hydrogen or helium. The measurement of several modified bases was performed using HPLC associated with electrospray ionization tandem pass spectrometry (HPLC-ESI-MS/MS). Bleaching of aqueous solutions of p-nitrosodimethylaniline (p-NDA) solutions was also used to allow the quantification of hydroxyl radical (•OH) formation. pNDA bleaching was significantly reduced in the presence of hyperbaric hydrogen. This is undoubtedly due to (•)OH scavenging by H2 since, under the same conditions, He had no effect. Similarly, base alterations were significantly reduced in the presence of hydrogen, as compared to controls under normal atmosphere or in the presence of helium. The relative proportions of modified nucleobases were not changed, showing that the only effect of H2 is to scavenge (•)OH without exhibiting reducing properties. Our findings demonstrate that H2 exerts a significant protection against radiation-induced DNA base damage in aqueous solutions, (•)OH scavenging being the only mechanism involved.

  7. Cell cycle-dependent DNA damage signaling induced by ICRF-193 involves ATM, ATR, CHK2, and BRCA1

    SciTech Connect

    Park, Iha; Avraham, Hava Karsenty . E-mail:


    Topoisomerase II is essential for cell proliferation and survival and has been a target of various anticancer drugs. ICRF-193 has long been used as a catalytic inhibitor to study the function of topoisomerase II. Here, we show that ICRF-193 treatment induces DNA damage signaling. Treatment with ICRF-193 induced G2 arrest and DNA damage signaling involving {gamma}-H2AX foci formation and CHK2 phosphorylation. DNA damage by ICRF-193 was further demonstrated by formation of the nuclear foci of 53BP1, NBS1, BRCA1, MDC1, and FANCD2 and increased comet tail moment. The DNA damage signaling induced by ICRF-193 was mediated by ATM and ATR and was restricted to cells in specific cell cycle stages such as S, G2, and mitosis including late and early G1 phases. Downstream signaling of ATM and ATR involved the phosphorylation of CHK2 and BRCA1. Altogether, our results demonstrate that ICRF-193 induces DNA damage signaling in a cell cycle-dependent manner and suggest that topoisomerase II might be essential for the progression of the cell cycle at several stages including DNA decondensation.

  8. 3,3'-Dihydroxyisorenieratene and isorenieratene prevent UV-induced DNA damage in human skin fibroblasts.


    Wagener, Sarah; Völker, Tanja; De Spirt, Silke; Ernst, Hansgeorg; Stahl, Wilhelm


    Skin cancer is among the most frequent neoplastic malignancies and exposure to UV irradiation is a major risk factor. In addition to topical sunscreens, photoprotection by dietary antioxidants such as carotenoids or polyphenols has been suggested as a means of prevention. Isorenieratene (IR) and dihydroxyisorenieratene (DHIR) are aromatic carotenoids with particular antioxidant properties produced by Brevibacterium linens. The aim of this study was to investigate the photoprotective and antioxidant activities of DHIR and IR in comparison to the nonaromatic carotenoid lutein in human dermal fibroblasts. Incubation of the cells with DHIR and IR significantly decreased the UV-induced formation of cyclobutane pyrimidine dimers and formation of DNA strand breaks. Lipid oxidation was lowered as determined by the formation of malondialdehyde as a biomarker. Both aromatic carotenoids also prevented oxidatively generated damage to DNA as demonstrated by a decrease in DNA strand breaks associated with the formation of oxidized DNA bases. These data highlight the multifunctional photoprotective properties of aromatic carotenoids, which may be suitable natural compounds for the prevention of skin cancer.

  9. Nuclear localization of Beclin 1 promotes radiation-induced DNA damage repair independent of autophagy.


    Xu, Fei; Fang, Yixuan; Yan, Lili; Xu, Lan; Zhang, Suping; Cao, Yan; Xu, Li; Zhang, Xiaoying; Xie, Jialing; Jiang, Gaoyue; Ge, Chaorong; An, Ni; Zhou, Daohong; Yuan, Na; Wang, Jianrong


    Beclin 1 is a well-established core mammalian autophagy protein that is embryonically indispensable and has been presumed to suppress oncogenesis via an autophagy-mediated mechanism. Here, we show that Beclin 1 is a prenatal primary cytoplasmic protein but rapidly relocated into the nucleus during postnatal development in mice. Surprisingly, deletion of beclin1 in in vitro human cells did not block an autophagy response, but attenuated the expression of several DNA double-strand break (DSB) repair proteins and formation of repair complexes, and reduced an ability to repair DNA in the cells exposed to ionizing radiation (IR). Overexpressing Beclin 1 improved the repair of IR-induced DSB, but did not restore an autophagy response in cells lacking autophagy gene Atg7, suggesting that Beclin 1 may regulate DSB repair independent of autophagy in the cells exposed to IR. Indeed, we found that Beclin 1 could directly interact with DNA topoisomerase IIβ and was recruited to the DSB sites by the interaction. These findings reveal a novel function of Beclin 1 in regulation of DNA damage repair independent of its role in autophagy particularly when the cells are under radiation insult.

  10. Nuclear localization of Beclin 1 promotes radiation-induced DNA damage repair independent of autophagy

    PubMed Central

    Xu, Fei; Fang, Yixuan; Yan, Lili; Xu, Lan; Zhang, Suping; Cao, Yan; Xu, Li; Zhang, Xiaoying; Xie, Jialing; Jiang, Gaoyue; Ge, Chaorong; An, Ni; Zhou, Daohong; Yuan, Na; Wang, Jianrong


    Beclin 1 is a well-established core mammalian autophagy protein that is embryonically indispensable and has been presumed to suppress oncogenesis via an autophagy-mediated mechanism. Here, we show that Beclin 1 is a prenatal primary cytoplasmic protein but rapidly relocated into the nucleus during postnatal development in mice. Surprisingly, deletion of beclin1 in in vitro human cells did not block an autophagy response, but attenuated the expression of several DNA double-strand break (DSB) repair proteins and formation of repair complexes, and reduced an ability to repair DNA in the cells exposed to ionizing radiation (IR). Overexpressing Beclin 1 improved the repair of IR-induced DSB, but did not restore an autophagy response in cells lacking autophagy gene Atg7, suggesting that Beclin 1 may regulate DSB repair independent of autophagy in the cells exposed to IR. Indeed, we found that Beclin 1 could directly interact with DNA topoisomerase IIβ and was recruited to the DSB sites by the interaction. These findings reveal a novel function of Beclin 1 in regulation of DNA damage repair independent of its role in autophagy particularly when the cells are under radiation insult. PMID:28345663

  11. Targeting of DNA Damage Signaling Pathway Induced Senescence and Reduced Migration of Cancer cells.


    Gao, Ran; Singh, Rumani; Kaul, Zeenia; Kaul, Sunil C; Wadhwa, Renu


    The heat shock 70 family protein, mortalin, has pancytoplasmic distribution pattern in normal and perinuclear in cancer human cells. Cancer cells when induced to senesce by either chemicals or stress showed shift in mortalin staining pattern from perinuclear to pancytoplasmic type. Using such shift in mortalin staining as a reporter, we screened human shRNA library and identified nine senescence-inducing siRNA candidates. An independent Comparative Genomic Hybridization analysis of 35 breast cancer cell lines revealed that five (NBS1, BRCA1, TIN2, MRE11A, and KPNA2) of the nine genes located on chromosome regions identified as the gain of locus in more than 80% cell lines. By gene-specific PCR, these five genes were found to be frequently amplified in cancer cell lines. Bioinformatics revealed that the identified targets were connected to MRN (MRE11-RAD50-NBS1) complex, the DNA damage-sensing complex. We demonstrate that the identified shRNAs triggered DNA damage response and induced the expression of tumor suppressor protein p16(INK4A) causing growth arrest of cancer cells. Furthermore, cells showed decreased migration, mediated by decrease in matrix metalloproteases. Taken together, we demonstrate that the MRN complex is a potential target of cancer cell proliferation and migration, and staining pattern of mortalin could serve as an assay to identify senescence-inducing/anticancer reagents. © The Author 2014. Published by Oxford University Press on behalf of the Gerontological Society of America. All rights reserved. For permissions, please email:

  12. Mitochondria-targeted Ogg1 and aconitase-2 prevent oxidant-induced mitochondrial DNA damage in alveolar epithelial cells.


    Kim, Seok-Jo; Cheresh, Paul; Williams, David; Cheng, Yuan; Ridge, Karen; Schumacker, Paul T; Weitzman, Sigmund; Bohr, Vilhelm A; Kamp, David W


    Mitochondria-targeted human 8-oxoguanine DNA glycosylase (mt-hOgg1) and aconitase-2 (Aco-2) each reduce oxidant-induced alveolar epithelial cell (AEC) apoptosis, but it is unclear whether protection occurs by preventing AEC mitochondrial DNA (mtDNA) damage. Using quantitative PCR-based measurements of mitochondrial and nuclear DNA damage, mtDNA damage was preferentially noted in AEC after exposure to oxidative stress (e.g. amosite asbestos (5-25 μg/cm(2)) or H2O2 (100-250 μM)) for 24 h. Overexpression of wild-type mt-hOgg1 or mt-long α/β 317-323 hOgg1 mutant incapable of DNA repair (mt-hOgg1-Mut) each blocked A549 cell oxidant-induced mtDNA damage, mitochondrial p53 translocation, and intrinsic apoptosis as assessed by DNA fragmentation and cleaved caspase-9. In contrast, compared with controls, knockdown of Ogg1 (using Ogg1 shRNA in A549 cells or primary alveolar type 2 cells from ogg1(-/-) mice) augmented mtDNA lesions and intrinsic apoptosis at base line, and these effects were increased further after exposure to oxidative stress. Notably, overexpression of Aco-2 reduced oxidant-induced mtDNA lesions, mitochondrial p53 translocation, and apoptosis, whereas siRNA for Aco-2 (siAco-2) enhanced mtDNA damage, mitochondrial p53 translocation, and apoptosis. Finally, siAco-2 attenuated the protective effects of mt-hOgg1-Mut but not wild-type mt-hOgg1 against oxidant-induced mtDNA damage and apoptosis. Collectively, these data demonstrate a novel role for mt-hOgg1 and Aco-2 in preserving AEC mtDNA integrity, thereby preventing oxidant-induced mitochondrial dysfunction, p53 mitochondrial translocation, and intrinsic apoptosis. Furthermore, mt-hOgg1 chaperoning of Aco-2 in preventing oxidant-mediated mtDNA damage and apoptosis may afford an innovative target for the molecular events underlying oxidant-induced toxicity.

  13. Alpha particle induced DNA damage and repair in normal cultured thyrocytes of different proliferation status.


    Lyckesvärd, Madeleine Nordén; Delle, Ulla; Kahu, Helena; Lindegren, Sture; Jensen, Holger; Bäck, Tom; Swanpalmer, John; Elmroth, Kecke


    Childhood exposure to ionizing radiation increases the risk of developing thyroid cancer later in life and this is suggested to be due to higher proliferation of the young thyroid. The interest of using high-LET alpha particles from Astatine-211 ((211)At), concentrated in the thyroid by the same mechanism as (131)I [1], in cancer treatment has increased during recent years because of its high efficiency in inducing biological damage and beneficial dose distribution when compared to low-LET radiation. Most knowledge of the DNA damage response in thyroid is from studies using low-LET irradiation and much less is known of high-LET irradiation. In this paper we investigated the DNA damage response and biological consequences to photons from Cobolt-60 ((60)Co) and alpha particles from (211)At in normal primary thyrocytes of different cell cycle status. For both radiation qualities the intensity levels of γH2AX decreased during the first 24h in both cycling and stationary cultures and complete repair was seen in all cultures but cycling cells exposed to (211)At. Compared to stationary cells alpha particles were more harmful for cycling cultures, an effect also seen at the pChk2 levels. Increasing ratios of micronuclei per cell nuclei were seen up to 1Gy (211)At. We found that primary thyrocytes were much more sensitive to alpha particle exposure compared with low-LET photons. Calculations of the relative biological effectiveness yielded higher RBE for cycling cells compared with stationary cultures at a modest level of damage, clearly demonstrating that cell cycle status influences the relative effectiveness of alpha particles. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Kinetics of the UV-induced DNA damage response in relation to cell cycle phase. Correlation with DNA replication

    PubMed Central

    Zhao, Hong; Traganos, Frank; Darzynkiewicz, Zbigniew


    It has been reported that exposure to UV light triggers DNA damage response (DDR) seen as induction of γH2AX not only in S- but also in G1- phase cells. In the present study, in addition to γH2AX, we assessed other markers of DDR, namely phosphorylation of ATM on Ser1981, of ATM/ATR substrate on Ser/Thr at SQ/TQ cluster domains and of the tumor suppressor p53 on Ser15, in human pulmonary carcinoma A549 cells irradiated with 50 J/m2 of UV-B. Phosphorylation of these proteins detected with phospho-specific Abs and measured by laser scanning cytometry in relation the cell cycle phase was found to be selective to S-phase cells. The kinetics of phosphorylation of ATM was strikingly similar to that of ATM/ATR substrate, peaking at 30 min after UV irradiation and followed by rapid dephosphorylation. The peak of H2AX phosphorylation was seen at 2 h and the peak of p53 phosphorylation at 4 h after exposure to UV light. Local high spatial density of these phospho-proteins reported by intensity of maximal pixel of immunofluorescence in the DDR nuclear foci was distinctly more pronounced in the early compared to late portion of S-phase. Exposure of cells to UV following 1 h pulse-labeling of their DNA with 5-ethynyl-2′deoxyuridine (EdU) made it possible to correlate the extent of DNA replication during the pulse with the extent of the UV-induced H2AX phosphorylation within the same cells. This correlation was very strong (R2= 0.98) and the cells that did not incorporate EdU showed no evidence of H2AX phosphorylation. The data are consistent with the mechanism in which stalling of DNA replication forks upon collision with the primary UV-induced DNA lesions and likely formation of double-strand DNA breaks triggers DDR. The prior reports (including our own) on induction of γH2AX in G1 cells by UV may have erroneously identified cells initiating DNA replication following UV exposure as G1 cells due to the fact that their DNA content did not significantly differ from that of G

  15. Therapeutic effect of green tea extract on alcohol induced hepatic mitochondrial DNA damage in albino wistar rats.


    Reddyvari, Hymavathi; Govatati, Suresh; Matha, Sumanth Kumar; Korla, Swapna Vahini; Malempati, Sravanthi; Pasupuleti, Sreenivasa Rao; Bhanoori, Manjula; Nallanchakravarthula, Varadacharyulu


    The present study principally sought to investigate the effect of green tea extract (GTE) supplementation on hepatic mitochondrial DNA (mtDNA) damage in alcohol receiving rats. MtDNA was isolated from hepatic tissues of albino wistar rats after alcohol treatment with and without GTE supplementation. Entire displacement loop (D-loop) of mtDNA was screened by PCR-Sanger's sequencing method. In addition, mtDNA deletions and antioxidant activity were measured in hepatic tissue of all rats. Results showed increased frequency of D-loop mutations in alcoholic rats (ALC). DNA mfold analysis predicted higher free energy for 15507C and 16116C alleles compared to their corresponding wild alleles which represents less stable secondary structures with negative impact on overall mtDNA function. Interestingly, D-loop mutations observed in ALC rats were successfully restored on GTE supplementation. MtDNA deletions were observed in ALC rats, but intact native mtDNA was found in ALC + GTE group suggesting alcohol induced oxidative damage of mtDNA and ameliorative effect of GTE. Furthermore, markedly decreased activities of glutathione peroxidise, superoxide dismutase, catalase and glutathione content were identified in ALC rats; however, GTE supplementation significantly (P < 0.05) restored these levels close to normal. In conclusion, green tea could be used as an effective nutraceutical against alcohol induced<