Science.gov

Sample records for infects immature stages

  1. Efficacy of milbemycin oxime in combination with spinosad in the treatment of larval and immature adult stages of Ancylostoma caninum and Toxocara canis in experimentally infected dogs.

    PubMed

    Bowman, Dwight D; Reinemeyer, Craig R; Wiseman, Scott; Snyder, Daniel E

    2014-09-15

    Ancylostoma caninum and Toxocara canis are two important zoonotic parasites of dogs. The primary objective of these studies were to confirm the oral effectiveness of milbemycin oxime (MO) and spinosad in dogs experimentally infected with immature (L4 and immature adult) stages of T. canis or A. caninum. Both trials were conducted as randomized, blinded, placebo-controlled dose confirmation studies. Treatments using the intended European commercial tablet formulation of Trifexis were administered in a timeframe relative to inoculation so that effectiveness could be assessed against specific immature stages of A. caninum or T. canis. In each study on Day 0, each of 32, 3-4 month old dogs were inoculated with 250 infective eggs of T. canis or 300 infective L3 of the hookworm, A. caninum. All dogs were weighed before their scheduled treatment, randomized to 1 of the 4 treatment groups in each study (8 dogs/group). All dogs were fed just prior to dosing. For T. canis, dogs were treated orally with an MO/spinosad tablet on Day 14 or Day 24. For A. caninum, dogs were treated orally with an MO/spinosad tablet on Day 7 or Day 11. Corresponding control groups in each study received a placebo tablet. Dogs were necropsied 5 or 6 days after their respective treatments. The digestive tract was removed and processed to recover, count, and identify all stages. The GM worm count for the MO/spinosad tablet on Day 14 (L4 T. canis) was 0.0, with efficacy calculated as 100%; however, only 3 of 8 control dogs had adequate infections. The GM worm count for the MO/spinosad tablet on Day 24 (immature adult stage) was 0.30; efficacy calculated at 96.15%. This is based on 5 of the 8 control dogs with adequate infections. In the two A. caninum studies, GM worm counts for the MO/spinosad tablets on Day 7 (L4 efficacy) was 2.37 and 0.8 with efficacy calculated as 98.92% and 99.25%, respectively. The GM count for the group treated with the MO/spinosad combination on Day 11 (immature adult) was 6

  2. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    PubMed

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  3. Immature Stages of the Neotropical Cracker Butterfly, Hamadryas epinome

    PubMed Central

    Leite, Luis Anderson Ribeiro; Dias, Fernando Maia Silva; Carneiro, Eduardo; Casagrande, Mirna Martins; Mielke, Olaf Hermann Hendrik

    2012-01-01

    The external morphology of the immature stages of Hamadryas epinome (C. Felder & R. Felder, 1867) (Lepidoptera : Nymphalidae : Biblidinae) is described, including drawings, photos and scanning electron micrographs. PMID:23414072

  4. [Immature stages of Caligo illioneus illioneus (Cramer) (Nymphalidae: Morphinae: Brassolini)].

    PubMed

    Specht, Maria J S; Paluch, Márlon

    2009-01-01

    The biology and external morphology of the immature stages of Caligo illioneus illioneus (Cramer) are described from ovipositions collected on leaves of Heliconia velloziana (Heliconiaceae) in the Atlantic Forest in Pernambuco state, Brazil.

  5. Stages of HIV Infection

    MedlinePlus

    ... Infection Subscribe Translate Text Size Print Stages of HIV Infection How Does HIV Progress in Your Body? Without treatment, HIV advances ... are the three stages of HIV infection: Acute HIV Infection Stage Within 2-4 weeks after HIV ...

  6. Efficacy of a milbemycin oxime-praziquantel combination product against adult and immature stages of Toxocara cati in cats and kittens after induced infection.

    PubMed

    Schenker, R; Bowman, D; Epe, C; Cody, R; Seewald, W; Strehlau, G; Junquera, P

    2007-04-10

    Two studies were performed to examine the efficacy of milbemycin oxime against fourth-stage larvae or adults of Toxocara cati. In the study to determine efficacy against fourth-stage larvae, 20 domestic shorthair cats were inoculated with 500 embryonated eggs. Four weeks after inoculation, the animals were allocated to two groups, and cats in one group were treated with medicated tablets containing 4 mg milbemycin oxime and 10mg praziquantel (MILBEMAX) and cats in the other group with placebo tablets. Seven days after treatment the animals were euthanatized and necropsied for worm counting. The number of worms found was significantly (p=0.0002) lower in cats treated with medicated tablets than in cats treated with placebo tablets. The reduction in the number of worms was 96.53%. In the study to determine efficacy against mature adult worms, 13 kittens were inoculated with T. cati embryonated eggs. On day 45 after inoculation and after the infection had been confirmed through faecal examinations for 11 out of the 13 animals, the 11 infected animals were allocated to two groups and treated as in the first study. Seven days after treatment, all animals were euthanatized and necropsied for worm counting. The number of worms found was significantly (p=0.0043) lower in kittens treated with medicated tablets than in kittens treated with placebo tablets. The reduction in the number of worms was 95.90%. No adverse effects were recorded during either study. It is concluded that the milbemycin oxime-praziquantel tablets that were used are efficacious for the control of T. cati infections in cats.

  7. Immature Stages of the Neotropical Butterfly, Dynamine agacles agacles

    PubMed Central

    Leite, Luis Anderson Ribeiro; Casagrande, Mirna Martins; Mielke, Olaf Hermann Hendrik; Freitas, André Victor Lucci

    2012-01-01

    The external morphology of the immature stages of Dynamine agacles agacles (Dalman, 1823) (Lepidoptera: Nymphalidae: Biblidinae) is described, including photos, drawings, and scanning electron micrographs. Data on the adult and larval behavior are given based on observations in the host plant Dalechampia triphylla Lam. (Malpighiales : Euphorbiaceae). The results are compared and discussed with other described species of Biblidinae, allowing to make further observations on the natural history and evolution of Dynamine. PMID:22943467

  8. Life-history studies on two molecular strains of mesocestoides (Cestoda: Mesocestoididae): identification of sylvatic hosts and infectivity of immature life stages.

    PubMed

    Padgett, Kerry A; Boyce, Walter M

    2004-02-01

    Life-cycle studies were conducted on 2 molecular strains of Mesocestoides tapeworms that represent different evolutionary lineages (clades A and B). Wild carnivores, reptiles, and rodents were examined for tapeworm infections at 2 enzootic sites: (1) San Miguel Island (SMI), a small island off the coast of southern California and (2) Hopland Research and Extension Center (HREC), a field station in northern California. Results indicate that deer mice (Peromyscus maniculatus) and coyotes (Canis latrans) may play an important role in the life cycles of Mesocestoides (clades A and B) in California. Over half the coyotes at HREC and at least a third of the population of island fox (Urocyon littoralis) at SMI were found to harbor clade A adult Mesocestoides spp. One of every 4 Mesocestoides-infected coyotes had tapeworms representing both clades A and B. Experimental inoculations revealed that proglottids (clades A and B) were not directly infectious to rodents, reptiles, or dogs. On the other hand, mice, lizards, and hamsters fed tetrathyridia of Mesocestoides spp. (clades A or B) developed peritoneal tetrathyridial infections. A dog that was fed tetrathyridia (clade B) developed an adult tapeworm infection. Acephalic metacestodes given orally to western fence lizards, laboratory mice, or domestic dogs did not result in metacestode or adult tapeworm infections. Whereas most clade A acephalic metacestodes from dogs were asexually proliferative, clade A tetrathyridia isolated from wild deer mice did not show evidence of asexual replication. Our study supports the hypothesis that a second, as of yet unidentified, intermediate host is necessary to complete the life cycles of Mesocestoides spp., and that acephalic metacestodes represent an aberrant form, incapable of further development.

  9. Engineering insect flight metabolics using immature stage implanted microfluidics.

    PubMed

    Chung, Aram J; Erickson, David

    2009-03-07

    Small-scale insect inspired aircraft represent a promising approach to downscaling traditional aircraft designs. Despite advancements in microfabrication, however, it has proven difficult to fully replicate the mechanical complexities that enable these natural systems. As an alternative, recent efforts have used implanted electrical, optical or acoustic microsystems to exert direct control over insect flight. Here we demonstrate, for the first time, a method of directly and reversibly engineering insect flight metabolics using immature stage implanted microfluidics. We present our technique and device for on-command modulation of the internal levels of l-glutamic and l-aspartate acids and quantify the resulting changes in metabolic activity by monitoring respiratory CO(2) output. Microfluidic devices implanted 1 to 2 days prior to insects' emergence achieved survivability and flight-capable rates of 96% and 36%, respectively. Behavior ranging from retarded motion to complete, reversible paralysis, over timescales ranging from minutes to hours is demonstrated.

  10. Catalog of known immature stages of Camptosomate leaf beetles (Coleoptera: Chrysomelidae: Cryptocephalinae and Lamprosomatinae)

    USDA-ARS?s Scientific Manuscript database

    Lack of syntheses of knowledge on immature stages of insects impedes accurate understanding of their diversity, biology and evolution. In Chrysomelidae, this information gap undermines basic explanations of this lineage’s radiation. Literature describing and discussing known immature stages of cas...

  11. Morphology of immature stages of Megaselia spiracularis Schmitz (Diptera: Phoridae).

    PubMed

    Dian-Xing, Feng; Guang-Chun, Liu

    2012-09-01

    In addition to causing myiasis in humans, Megaselia spiracularis Schmitz has also been reported as a forensically important fly. In this study, we presented the morphology of all larval instars and puparium of M. spiracularis using scanning electron microscopy. The first instar larva was composed of 12 segments. Antennae and maxillary palp complex were visible. Two spiracular slits could be seen at the posterior spiracle. The branch of posterior spiracular hairs was approximately equal to the palm-formed base in length. Second and third larval instars were very similar to first instar, except for the presence of anterior spiracle. The labium of the second instar larva was triangular and ventrally curved, whereas it was a bilobed structure and the tip forked in the first instar. The bubble membrance comprised of ≈40 globules presented at the third instar larvae. Puparia showed a retracted cephalic region and a pair of pupal respiratory horns on the dorsum. A comparison of the morphological features between immature stages of M. spiracularis and M. scalaris, a forensically important fly indoors in Germany, Malaysia, and China, was discussed.

  12. Flukicidal action of closantel against immature and mature Fasciola hepatica in experimentally infected rats and sheep.

    PubMed

    Maes, L; Lauwers, H; Deckers, W; Vanparijs, O

    1988-03-01

    The relative importance of peak level- and residual level-related flukicidal activity of closantel against immature and mature Fasciola hepatica was evaluated in a comparative efficacy trial using two animal species with a different plasma elimination pattern, that is, the rat and the sheep with an elimination half-life of less than one week and of two to three weeks, respectively. The rats were dosed orally with closantel at 20 mg kg-1 at two, four, six, eight and 10 weeks; the sheep at 10 mg kg-1 at eight, 10 and 12 weeks after artificial infection. Necropsy was performed either one week after treatment or 12 weeks after infection. Efficacy rates and the length of the recovered flukes were evaluated. It was demonstrated that the flukicidal effect of closantel is directly related to its peak plasma levels and less to its residual plasma concentrations. In the rat, a high efficacy (P less than 0.001) could be demonstrated against immature stages of four weeks or older. The two-week immature stages were less markedly affected. No significant differences in efficacy and size of the flukes were noted between the animals autopsied one week after treatment and those autopsied 12 weeks after infection. In the sheep, the efficacy against six-week and eight-week-old immature stages varied between 70.3 and 76.8 per cent and between 92.8 and 96.5 per cent, respectively. As in the rats, no marked differences in efficacy were noted between the animals autopsied one week after treatment and those autopsied 12 weeks after infection.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. Endodontic regeneration and tooth revitalization in immature infected sheep teeth.

    PubMed

    Altaii, M; Cathro, P; Broberg, M; Richards, L

    2017-05-01

    To examine the response of immature sheep teeth with infected root canal systems to a commonly used pulp regeneration/revitalization protocol. Immature mandibular right first incisors in four sheep were mechanically exposed and the pulps infected. The mandibular left first incisors remained intact as controls. Five weeks later, the experimental root canals were chemo-mechanically cleaned and dressed with a triple-antibiotic paste for 4 weeks, before bleeding was induced inside the canal by mechanically irritating the periapical tissues. A collagen dressing was packed coronally onto the blood clot and the canal orifice sealed with mineral trioxide aggregate and glass ionomer cement. Six months later, the mandibles were collected and the teeth with associated periapical tissues were analysed radiographically, with CT scanning, and by histology. The changes in root length, dentine thickness in the apical third (mesially and distally), and apical diameter were analysed using Student's t-test. Radiographs revealed significant increases in root length, root wall thickness and narrowing of the apical diameter of the canals after treatment (P < 0.05), with no significant differences in root diameters found between the experimental and the control teeth (P > 0.05) on both radiographic and CT results. Root maturation and thickening of the walls due to hard tissue deposition was confirmed by histology in all experimental teeth. Hard tissues in the apical portion of the root were more developed than in the coronal portion. Endodontic regeneration and tooth revitalization procedures in immature infected sheep teeth showed positive outcomes with similar increases in root length and development to the control teeth. © 2016 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  14. Wolbachia infections that reduce immature insect survival: Predicted impacts on population replacement

    PubMed Central

    2011-01-01

    Background The evolutionary success of Wolbachia bacteria, infections of which are widespread in invertebrates, is largely attributed to an ability to manipulate host reproduction without imposing substantial fitness costs. Here, we describe a stage-structured model with deterministic immature lifestages and a stochastic adult female lifestage. Simulations were conducted to better understand Wolbachia invasions into uninfected host populations. The model includes conventional Wolbachia parameters (the level of cytoplasmic incompatibility, maternal inheritance, the relative fecundity of infected females, and the initial Wolbachia infection frequency) and a new parameter termed relative larval viability (RLV), which is the survival of infected larvae relative to uninfected larvae. Results The results predict the RLV parameter to be the most important determinant for Wolbachia invasion and establishment. Specifically, the fitness of infected immature hosts must be close to equal to that of uninfected hosts before population replacement can occur. Furthermore, minute decreases in RLV inhibit the invasion of Wolbachia despite high levels of cytoplasmic incompatibility, maternal inheritance, and low adult fitness costs. Conclusions The model described here takes a novel approach to understanding the spread of Wolbachia through a population with explicit dynamics. By combining a stochastic female adult lifestage and deterministic immature/adult male lifestages, the model predicts that even those Wolbachia infections that cause minor decreases in immature survival are unlikely to invade and spread within the host population. The results are discussed in relation to recent theoretical and empirical studies of natural population replacement events and proposed applied research, which would use Wolbachia as a tool to manipulate insect populations. PMID:21975225

  15. Costs and benefits of Wolbachia infection in immature Aedes albopictus depend upon sex and competition level.

    PubMed

    Gavotte, Laurent; Mercer, David R; Stoeckle, John J; Dobson, Stephen L

    2010-11-01

    Bacterial endosymbionts induce various effects on hosts and can dramatically impact host fitness and development. An example is provided by obligate, maternally-inherited Wolbachia, which infect a broad range of invertebrates. Wolbachia are capable of altering host reproduction, thereby promoting infection spread. Wolbachia also pose direct physiological costs and benefits to hosts, complicating their categorization as parasites or mutualists. This study examines for an effect of Wolbachia infection in intra-specific larval competition by Aedes albopictus mosquitoes, with the goal of examining for an impact of Wolbachia infection in mixed populations. Similar to prior work examining for an influence of Wolbachia infection on the fitness of A. albopictus in adults, the results presented here support the hypothesized impact of Wolbachia across all life stages, including immatures. The differential competitiveness of infected larvae detected in our experiments indicates that Wolbachia infected A. albopictus females are less competitive relative to uninfected females when competing under highly competitive conditions. In contrast, under low competitive pressures, infected females experience higher survivorship. Thus, Wolbachia infection shifts from parasitism to mutualism as a function of developmental conditions. Results are discussed in relation to the invasion and persistence of Wolbachia in A. albopictus populations. The results are important to the evolution of stable Wolbachia symbioses, including Wolbachia invasion of an uninfected population. The resulting infection dynamics that occur in an infected population are discussed.

  16. Immature stages and larval chaetotaxy of Notofairchildia stenygros (Quate & Alexander) (Diptera: Psychodidae: Bruchomyiinae).

    PubMed

    Alencar, Ronildo Baiatone; Barrett, Toby Vincent; Scarpassa, Vera Margarete

    2016-09-21

    Some authors have hypothesized that Bruchomyiinae is "the most plesiomorphic subfamily of Psychodidae" and its members "are among the most primitive living Diptera". Although Bruchomyiinae is of no medical importance, it is of great evolutionary significance, having long been placed as the sister group of Phlebotominae. In general, species of this subfamily are rarely collected in their natural environment; therefore, adults and, even more so, the immature stages of these flies are poorly known. We describe the egg, larvae and pupae of Notofairchildia stenygros and provide nomenclatural notes on larval chaetotaxy based on analyses using scanning electron microscopy (SEM) and optic microscopy. The morphology of immature Nt. stenygros is compared with other Bruchomyiinae and Psychodidae species, especially with species of Phlebotominae that are superficially similar to Bruchomyiinae. Results of this study revealed striking morphological differences between the immature stages of Bruchomyiinae and Phlebotominae; the former are lacking abdominal pseudopods and microtrichia on the cephalic integument, both of which are present in the larvae of Phlebotominae. These morphological differences observed in the immature stages between members of the two subfamilies support the findings of recent molecular studies indicating that Bruchomyiinae and Phlebtominae are evolutionarily not closely related. Notofairchildia stenygros is now the fourth species of Bruchomyiinae for which the immature stages are described.

  17. Toxicity of Insecticides Targeting Rice Planthoppers to Adult and Immature Stages of Trichogramma chilonis (Hymenoptera: Trichogrammatidae).

    PubMed

    Ko, Ko; Liu, Yudi; Hou, Maolin; Babendreier, Dirk; Zhang, Feng; Song, Kai

    2015-02-01

    Planthopper-targeting insecticides, pymetrozine, thiamethoxam, buprofezin, and nitenpyram, were tested under laboratory conditions for toxicity to adults and immatures of Trichogramma chilonis Ishii, using standard tests described by International Organization for Biological Control (IOBC). In the dry film residue test, all insecticides resulted in >90% mortality in T. chilonis adults and were ranked as moderately harmful. Persistent toxicity tests revealed that nitenpyram was short-lived and the other three insecticides were of slightly persistent toxicity to the wasp adults. Effects of the insecticides on egg, larval, and prepupal stages of T. chilonis were investigated with striped stem borer as host. At the three stages of T. chilonis (within the host egg), all the insecticides reduced parasitism rate, but nitenpyram and pymetrozine applied at egg stage, buprofezin and nitenpyram at larval stage, and buprofezin and thiamethoxam at prepupal stage of T. chilonis reduced parasitism by <30% in comparison with the control, and were thus ranked as harmless. Although insecticide treatment of the three immature stages of T. chilonis all reduced wasp emergence from host eggs, only thiamethoxam applied at larval stage and buprofezin at prepupal stage resulted in >30% reduction in emergence rate as compared with the control and were categorized as harmful. Immature duration of T. chilonis was only significantly extended by nitenpyram applied to egg stage than the control. Sex ratio of emerged wasps was not affected by the treatment to immature stages. The data are of significance for IPM programs incorporating inundative release of T. chilonis for control of lepidopteran rice pests where there is heavy co-occurrence of planthoppers. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  18. Mesocyclops longisetus effects on survivorship of Aedes aegypti immature stages in car tyres.

    PubMed

    Manrique-Saide, P; Ibáñez-Bernal, S; Delfín-González, H; Parra Tabla, V

    1998-10-01

    The effect of the introduction of the entomophagous copepod Mesocyclops longisetus (Acuacultura F.C.B. strain) on the survival of Aedes aegypti immature stages in car tyres was evaluated under semi-natural conditions in the municipality of Merida, Yucatan, Mexico. Life tables were constructed for the immature stages of the mosquito in the presence and absence of M. longisetus, and the survival data were compared using log-linear models. The data set was adjusted using the GLIM statistical package and the quality of adjustment was evaluated with a chi-squared test. Survivorship curves were constructed for each treatment. In the absence of M. longisetus, the survivorship of Ae. aegypti immature stages averaged 9%. The highest mortality rate was observed during the fourth larval instar (54%) and the resulting survival pattern corresponded to a type II survivorship curve. The mortality rate of Ae. aegypti first-instar larvae (fifty per tyre) increased more than 200-fold in the presence of M. longisetus (twenty per tyre) and the highest mortality was during the first two larval instars, where it reached 98.9%, with a resulting survivorship of 0.2%. Overall mortality was sixfold greater in the presence of the copepod than in its absence. The survival pattern of immature stages of Ae. aegypti in the presence of the copepod corresponded to a type III survivorship curve. As M. longisetus was so effective against Ae. aegypti immature stages in tyres under seminatural conditions, its long-term effectiveness should be evaluated under socially and ecologically realistic field conditions in Mexico.

  19. Fasciola immature stages sought in Lymnaea species and Biomphalaria species in the water bodies of Dakahlia Governorate.

    PubMed

    el-Shazly, Atef M; Helmy, Moshira M F; Haridy, Fouad M; el-Sharkawy, Eman M A; Morsy, Tosson A

    2002-04-01

    Examination of the five different water bodies in Dakahlia governorate, revealed four species of Lymnaea. These were L. natalensis (68.4%). L. truncatula (16%), L. stagnalis (12.2%) and L. columella (3.4%). Also, two species of Biomphalaria were recovered. These were B. alexandrina (54.7%) and B. glabrata (45.3%). Examination of all these snails showed natural infection with immature stages of Fasciola sp. in 5.5% of L. natalensis (= cailliaudi), 3.1% in L. truncatula and 0.67% in B. alexandrina. The importance of these snails in dissemination and spreading of fascioliasis was discussed.

  20. Lethal effects of selected novel pesticides on immature stages of Trichogramma pretiosum (Hymenoptera: Trichogrammatidae).

    PubMed

    Khan, Muhammad Ashraf; Ruberson, John R

    2017-06-10

    Trichogramma pretiosum Riley is an important egg parasitoid and biological control agent of caterpillar pests. We studied the acute toxicity of 20 pesticides (14 insecticides/miticides, three fungicides and three herbicides) exposed to recommended field rates. Egg, larval, and pupal stages of the parasitoid in their hosts were dipped in formulated solutions of the pesticides and evaluated 10 days later for percentage of host eggs with holes, number of parasitoids emerged per egg with holes, and stage-specific mortality of immature as well as adult wasps within the host eggs. Seven insecticides (buprofezin, chlorantraniliprole, spirotetramat, flonicamid, flubendiamide) and miticides (spiromesifen, cyflumetofen), one herbicide (nicosulfuron), and three fungicides (myclobutanil, pyraclostrobin, trifloxystrobin + tebuconazole) caused no significant mortality to immature stages or pre-emergent adult parasitoids relative to controls. By contrast, seven insecticides/miticides (abamectin, acetamiprid, dinotefuran, fipronil, novaluron, spinetoram, tolfenpyrad) adversely affected immature and pre-emergent adult T. pretiosum, with tolfenpyrad being particularly lethal. Two herbicides had moderate (glufosinate ammonium) to severe (s-metolachlor) acute lethal effects on the immature parasitoids. This study corroborates earlier findings with adult T. pretiosum. Over half of the pesticides - and all the fungicides - tested in the current study would appear to be compatible with the use of T. pretiosum in integrated pest management programs, with respect to acute parasitoid mortality. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  1. Efficacy of emodepside plus praziquantel tablets (Profender tablets for dogs) against mature and immature cestode infections in dogs.

    PubMed

    Schroeder, Iris; Altreuther, Gertraut; Schimmel, Annette; Deplazes, Peter; Kok, Dawid J; Schnyder, Manuela; Krieger, Klemens J

    2009-08-01

    The efficacy of a novel flavoured tablet formulation of emodepside plus praziquantel (Profender tablets for dogs) against intestinal cestodes was investigated in four randomised, blinded placebo-controlled dose confirmation studies in dogs experimentally infected with Echinococcus granulosus or E. multilocularis and in dogs naturally infected with Dipylidium caninum or Taenia spp. The tablets were used at the minimum recommended dose of 1 mg emodepside and 5 mg praziquantel per kg body weight. The studies demonstrated 100% efficacy against mature and immature E. granulosus and E. multilocularis and mature Taenia spp. and D. caninum. Additionally, one of the studies demonstrated non-interference of emodepside with the efficacy of praziquantel against D. caninum. No side effects of the treatment were observed. It is concluded that emodepside plus praziquantel tablets are safe and effective against mature and immature stages of E. granulosus and E. multilocularis and mature stages of Taenia spp. and D. caninum.

  2. Antibodies against the Envelope Glycoprotein Promote Infectivity of Immature Dengue Virus Serotype 2

    PubMed Central

    da Silva Voorham, Júlia M.; Rodenhuis-Zybert, Izabela A.; Ayala Nuñez, Nilda Vanesa; Colpitts, Tonya M.; van der Ende-Metselaar, Heidi; Fikrig, Erol; Diamond, Michael S.; Wilschut, Jan; Smit, Jolanda M.

    2012-01-01

    Cross-reactive dengue virus (DENV) antibodies directed against the envelope (E) and precursor membrane (prM) proteins are believed to contribute to the development of severe dengue disease by facilitating antibody-dependent enhancement of infection. We and others recently demonstrated that anti-prM antibodies render essentially non-infectious immature DENV infectious in Fcγ-receptor-expressing cells. Immature DENV particles are abundantly present in standard (st) virus preparations due to inefficient processing of prM to M during virus maturation. Structural analysis has revealed that the E protein is exposed in immature particles and this prompted us to investigate whether antibodies to E render immature particles infectious. To this end, we analyzed the enhancing properties of 27 anti-E antibodies directed against distinct structural domains. Of these, 23 bound to immature particles, and 15 enhanced infectivity of immature DENV in a furin-dependent manner. The significance of these findings was subsequently tested in vivo using the well-established West Nile virus (WNV) mouse model. Remarkably, mice injected with immature WNV opsonized with anti-E mAbs or immune serum produced a lethal infection in a dose-dependent manner, whereas in the absence of antibody immature WNV virions caused no morbidity or mortality. Furthermore, enhancement infection studies with standard (st) DENV preparations opsonized with anti-E mAbs in the presence or absence of furin inhibitor revealed that prM-containing particles present within st virus preparations contribute to antibody-dependent enhancement of infection. Taken together, our results support the notion that antibodies against the structural proteins prM and E both can promote pathogenesis by enhancing infectivity of prM-containing immature and partially mature flavivirus particles. PMID:22431958

  3. Description of the Immature Stages of the Planthopper Lacertinella australis (Hemiptera: Delphacidae)

    PubMed Central

    Batiz, M. F. Rossi; Lenicov, A. M. Marino de Remes

    2014-01-01

    The five immature stages of the planthopper Lacertinella australis (Remes Lenicov and Rossi Batiz) (Hemiptera: Delphacidae: Saccharosydnini) are described and illustrated. The main characters that allowed us to distinguish the various stages were body size, number of tarsomeres and metatibial spines, and number of teeth on the spur. New biological data based on laboratory rearing and field observations showed that L. australis can carry out its biological cycle successfully on the graminaceous pampas grass (Cortaderia spp. Stapf (Poales: Poaceae)). In addition, the efficient rearing in captivity, the high survivorship registered, and overwintering only on this host plant suggests that L. australis is a potential biocontrol agent of this invasive graminaceous weed. This study provides information about the immature stages, including a key for their identification, based on laboratory reared specimens and field observations. PMID:25199992

  4. Delay equation models for populations that experience competition at immature life stages

    NASA Astrophysics Data System (ADS)

    Gourley, Stephen A.; Liu, Rongsong

    2015-09-01

    We consider stage-structured population models of intra- and inter-specific competition at immature life stages. A prototype delay model is derived for a single species that experiences larval competition. Its solutions are bounded for any birth function. Other ways of modelling the birth rate can lead to nonlinear integral equations. In some situations the technique of reducing an age-structured model to a system of delay equations applies. In the case of immature competition the delay equations cannot always be written down explicitly because their right hand sides depend on the solutions of the nonlinear ordinary differential equations that arise when one solves the nonlinear age-structured equations that determine the maturation rates in terms of the birth rates. This situation arises in the case of competition between two strains or species. However, in our two-strain competition model, vital properties of those right hand sides can be indirectly inferred using monotone systems theory.

  5. Efficacy of emodepside plus praziquantel tablets (Profender tablets for dogs) against mature and immature adult Trichuris vulpis infections in dogs.

    PubMed

    Schimmel, Annette; Altreuther, Gertraut; Schroeder, Iris; Charles, Samuel; Cruthers, Larry; Kok, Dawid J; Kraemer, Friederike; Krieger, Klemens J

    2009-08-01

    This paper reports on the efficacy of a novel flavoured tablet formulation of emodepside plus praziquantel (Profender tablets for dogs) against mature and immature adult whipworms (Trichuris vulpis) at the proposed minimum dose of 1 mg emodepside and 5 mg praziquantel per kg body weight in dogs. Three randomised, blinded and controlled laboratory studies with naturally or experimentally infected dogs were performed. The first study was conducted as a dose determination study in experimentally infected dogs using three different dose levels, i.e., 0.5x, 1x and 2x the minimum therapeutic dose. Two further studies confirmed the efficacy of emodepside plus praziquantel tablets against mature and immature adult T. vulpis at the recommended minimum dose. In all three studies, the efficacy against mature and immature adult T. vulpis was >99%. No side effects of the treatment were observed. It is concluded that the emodepside plus praziquantel tablet is an effective and safe treatment against mature and immature adult stages of T. vulpis in dogs.

  6. Efficacy of emodepside plus praziquantel tablets (Profender tablets for dogs) against mature and immature infections with Toxocara canis and Toxascaris leonina in dogs.

    PubMed

    Altreuther, Gertraut; Schimmel, Annette; Schroeder, Iris; Bach, Thomas; Charles, Samuel; Kok, Dawid J; Kraemer, Friederike; Wolken, Sonja; Young, David; Krieger, Klemens J

    2009-08-01

    The efficacy of emodepside plus praziquantel tablets (Profender tablets for dogs) against mature adult, immature adult and larval stages of Toxocara canis and Toxascaris leonina was evaluated in ten randomised, blinded and placebo-controlled dose confirmation studies in naturally or experimentally infected dogs. The tablets were used at the proposed minimum dose of 1 mg emodepside and 5 mg praziquantel per kg body weight. Efficacy was calculated based on worm counts after necropsy. Five studies demonstrated >99% efficacy against mature adult, >92% efficacy against immature adult, >98% efficacy against L4 and >94% efficacy against L3 larval stages of T. canis. Another five studies demonstrated >99% efficacy against mature and immature adult and >95% efficacy against L4 larval stages of T. leonina. No side effects of the treatment were observed. Emodepside plus praziquantel tablets thus provide a comprehensive new treatment option for ascarid infections in the dog.

  7. Description of the immature stages and life history of Euselasia (Lepidoptera: Riodinidae) on Miconia (Melastomataceae) in Costa Rica

    Treesearch

    K. Nishida

    2010-01-01

    The immature stages and life histories of Euselasia chrysippe (Bates, 1866) and E. bettina (Hewitson, 1869) are described, providing the first detailed morphological characters for the subfamily Euselasiinae. The larvae of Euselasia chrysippe and E. bettina ...

  8. Tracking through Life Stages: Adult, Immature and Juvenile Autumn Migration in a Long-Lived Seabird

    PubMed Central

    Péron, Clara; Grémillet, David

    2013-01-01

    Seasonal long-distance migration is likely to be experienced in a contrasted manner by juvenile, immature and adult birds, leading to variations in migratory routes, timing and behaviour. We provide the first analysis of late summer movements and autumn migration in these three life stages, which were tracked concurrently using satellite tags, geolocators or GPS recorders in a long-ranging migratory seabird, the Scopoli’s shearwater (formerly named Cory’s shearwater, Calonectrisdiomedea) breeding on two French Mediterranean islands. During the late breeding season, immatures foraged around their colony like breeding adults, but they were the only group showing potential prospecting movements around non-natal colonies. Global migration routes were broadly comparable between the two populations and the three life stages, with all individuals heading towards the Atlantic Ocean through the strait of Gibraltar and travelling along the West African coast, up to 8000 km from their colony. However, detailed comparison of timing, trajectory and oceanographic conditions experienced by the birds revealed remarkable age-related differences. Compared to adults and immatures, juveniles made a longer stop-over in the Balearic Sea (10 days vs 4 days in average), showed lower synchrony in crossing the Gibraltar strait, had more sinuous pathways and covered longer daily distances (240 km.d-1 vs 170 km.d-1). Analysis of oceanographic habitats along migratory routes revealed funnelling selection of habitat towards coastal and more productive waters with increasing age. Younger birds may have reduced navigational ability and learn progressively fine-scale migration routes towards the more profitable travelling and wintering areas. Our study demonstrates the importance of tracking long-lived species through the stages, to better understand migratory behavior and assess differential exposure to at-sea threats. Shared distribution between life stages and populations make Scopoli

  9. Temporal Variations of Microbiota Associated with the Immature Stages of Two Florida Culex Mosquito Vectors.

    PubMed

    Duguma, Dagne; Hall, Michael W; Smartt, Chelsea T; Neufeld, Josh D

    2017-05-11

    Microbiota associated with mosquito vector populations impact several traits of mosquitoes, including survival, reproduction, control, and immunity against pathogens. The influence of seasonal variations and mosquito species on mosquito gut microbiota is poorly understood. We sought to determine whether the mosquito microbiota associated with immature stages of two congeners (Culex coronator and Culex nigripalpus) differ temporally and between the two species. Using high throughput 16S rRNA gene sequence analysis, we characterized bacterial and archaeal communities found in the immature stages of the two Culex mosquito species sampled over three seasons to compare the diversity of bacteria between the two species. Beta diversity analyses of the larval microbiota sequences revealed that the two Culex species differed significantly, both temporally within each species and between the two species. Bacteria in Cx. coronator larvae were dominated by Alphaproteobacteria, mainly associated with Roseoccocus and unidentified species of Rhizobiales, and two unidentified species of Cyanobacteria. In contrast, Cx. nigripalpus was dominated by Thorsellia anophelis (Gammaproteobacteria), Clostridium, an unidentified species of Ruminococcacae (Clostridiales), and additional unidentified species associated with Erysipelotrichaceae (Erysipelotrichales), Bacteroidales, and Mollicutes. Results of our study revealed both seasonal and interspecies differences in bacterial community composition associated with the immature stages of Cx. coronator and Cx. nigripalpus vector populations in Florida. These results have important implications for our understanding of the underlying factors of variations in disease transmission among seasons, susceptibility to various pesticides, and other biotic factors, including the role of the microbiota on the spread of invasive species. In addition, our results suggest close associations of certain bacteria species with each of the two Culex species

  10. A new species, new immature stages, and new synonymy in Australian Dasybasis flies (Diptera: Tabanidae: Diachlorini).

    PubMed

    Ferguson, David J; Yeates, David K

    2015-04-09

    Australian beach sand is a productive habitat for lower brachyceran fly larvae but often overlooked by collectors. We collected two species of tabanid larvae from coastal beach sand in southern New South Wales in August 2013. Both species belong to the Dasybasis macrophthalma species-group of Mackerras (1959), one a new species, and the other D. exulans (Erichson, 1842). We describe both new immature stages and the new species adult as Dasybasis rieki sp. nov. (Diptera: Tabanidae: Diachlorini). Trojan (1994b) elevated the D. macrophthalma species group to the genus Sznablius. We review the evidence for the generic status of Sznablius, and synonymize it with Dasybasis.

  11. Effect of temperature on developmental rate of Sesamia cretica (Lepidoptera: Noctuidae) immature stages.

    PubMed

    Soltani Orang, Fatemeh; Aghdam, Hossein Ranjbar; Abbasipour, Habib; Askarianzadeh, Alireza

    2014-01-01

    Effect of temperature on development of pink stem borer, Sesamia cretica Lederer, was studied at eight constant temperatures (15, 18, 20.5, 24, 27, 30, 34, and 38°C), a photoperiod of 16:8 (L:D) h, and 50-60% rela\\tive humidity. The larvae of pink stem borer were reared on cutting stems of maize. The results showed that temperature had statistically significant effect on developmental times of the all developmental stages. The most commonly used six nonlinear models applied for modeling developmental rate of immature stages as a function of temperature. Evaluation of the models fit to data took place based on the coefficient of determination, residual sum of squires, adjusted coefficient of determination, and Akaike information criterion. Besides statistical criteria, biological significance was used to determine the best model. All the examined models statistically fit the data well. In addition, Briere-2 was selected as the best model considering biological significance of the estimated values for the biologically interpretable parameters of models. Based on the results, the values of the lower temperature threshold were 10.82, 11.81, 9.35, and 10.67°C, the optimal temperature were 35.50, 31.80, 33.35, and 32.22°C, and the upper temperature threshold were 38.93, 39.19, 37.41, and 36.55°C, for incubation period, larva, pupa, and overall immature stages of pink stem borer, respectively.

  12. Lipid droplet distribution of immature canine oocytes in relation to their size and the reproductive stage.

    PubMed

    Ariu, Federica; Strina, Alessandro; Murrone, Ombretta; Falchi, Laura; Bebbere, Daniela; Ledda, Sergio; Zedda, Maria Teresa; Pau, Salvatore; Bogliolo, Luisa

    2016-01-01

    This study investigated the distribution of lipid droplets (LD) in immature canine oocytes in relation to their size and the reproductive stage. Oocytes were collected from the ovaries of bitches at different estrous stages, divided according to their size (110-120 µm; >120 µm), and stained with Nile Red to detect lipid droplet distribution. At the follicular phase most of the oocytes displayed a diffuse pattern of LD distribution, whereas at anestrus and luteal phase oocytes showed LD mainly in a peripheral/ perinuclear LD distribution. A significantly higher intensity of LD has been recorded in the oocytes > 120 µm compared to those of smaller size (110 - 120 µm) at all stages of the estrous cycle. At follicular phase, oocytes > 120 µm displayed LD intensity similar to that of oocytes > 120 µm at luteal phase and higher compared to the oocytes of the other groups.

  13. Wolbachia Infection and Resource Competition Effects on Immature Aedes albopictus (Diptera: Culicidae)

    PubMed Central

    Gavotte, Laurent; Mercer, David R.; Vandyke, Rhonda; Mains, James W.; Dobson, Stephen L.

    2009-01-01

    Wolbachia pipientis Hertig and Wolbach (Rickettsiales: Rickettsiaceae) are intracellular α-proteobacteria that occur naturally in Aedes albopictus (Skuse) (Diptera: Culicidae) and numerous other invertebrates. These endosymbionts can invade host populations by manipulating host reproduction. Wolbachia infections have been shown to impart both costs and benefits to hosts in terms of development, survival, and fecundity. Here, we monitor intraspecific competition among independent cohorts of infected or uninfected larvae. Levels of competition are manipulated by varying initial larval densities and food levels. Although larval density is observed to have major impacts on immature survivorship, sex ratio of eclosing adults, and developmental rates, the Wolbachia infection status had minimal impact on male immatures and no effect on immature females under these experimental conditions. Female and male immatures were observed to respond differently to competitive pressure, with the functional relationships of females and males consistent with scramble and contest competition, respectively. The results are discussed in relation to the evolution of naturally occurring Wolbachia infections in Ae. albopictus (i.e., natural population replacement events) and public health strategies that propose the manipulation of Wolbachia infections in Ae. albopictus populations. PMID:19496412

  14. Classification of immature stage habitats of Culicidae (Diptera) collected in Córdoba, Argentina.

    PubMed

    Almirón, W R; Brewer, M E

    1996-01-01

    In order to classify mosquito immature stage habitats, samples were taken in 42 localities of Córdoba Province, Argentina, representing the phytogeographic regions of Chaco, Espinal and Pampa. Immature stage habitats were described and classified according to the following criteria: natural or artificial; size; location related to light and neighboring houses; vegetation; water; permanence, movement, turbidity and pH. Four groups of species were associated based on the habitat similarity by means of cluster analysis: Aedes albifasciatus, Culex saltanensis, Cx. mollis, Cx. brethesi, Psorophora ciliata, Anopheles albitarsis, and Uranotaenia lowii (Group A); Cx. acharistus, Cx. quinquefasciatus, Cx. bidens, Cx. dolosus, Cx. maxi and Cx. apicinus (Group B); Cx. coronator, Cx. chidesteri, Mansonia titillans and Ps. ferox (Group C); Ae. fluviatilis and Ae. milleri (Group D). The principal component analysis (ordination method) pointed out that the different types of habitats, their nature (natural or artificial), plant species, water movement and depth are the main characters explaining the observed variation among the mosquito species. The distribution of mosquito species by phytogeographic region did not affect the species groups, since species belonging to different groups were collected in the same region.

  15. Life Cycle and Immature Stages of the Arctiid Moth, Phoenicoprocta capistrata

    PubMed Central

    Rodríguez-Loeches, Laura; Barro, Alejandro

    2008-01-01

    Phoenicoprocta capistrata (Fabricius 1775) (Lepidoptera: Arctiidae) is an arctiid moth reported for the Caribbean and Brazil, whose immature stages and life cycle are unknown. In this study, and for the first time, a host plant is registered and the immature stages and the captivity life cycle are described using a Cuban population. Larvae feed on fowlsfoot, Serjania diversifolia (Jacq.) Radlk (Sapindales: Sapindaceae). One complete cohort was obtained from December of 2004 to February of 2005 and about 57 days lapsed from oviposition to adult emergence. The egg is light green-yellowish and semi-spherical. Most larvae developed through 6 or 7 instars, although there were individuals with 8 instars. The last instar has a cephalic capsule width of 2.04 ± 0.06 mm (n = 29) irrespective of the number of instars. The cephalic capsule growth curves of the larvae with 6 and 7 instars have different slopes, but both follow a geometric pattern consistent with the Dyar's rule. In each larval molt the setae types and the larvae coloration change. Adult females have two color morphs, one orange-reddish and the other blue. Female descendants of blue and red females differ in the proportion of color morphs, which could indicate the existence of a female-limited polymorphism phenomenon in this species. PMID:20345309

  16. Life cycle and immature stages of the arctiid moth, Phoenicoprocta capistrata.

    PubMed

    Rodríguez-Loeches, Laura; Barro, Alejandro

    2008-01-01

    Phoenicoprocta capistrata (Fabricius 1775) (Lepidoptera: Arctiidae) is an arctiid moth reported for the Caribbean and Brazil, whose immature stages and life cycle are unknown. In this study, and for the first time, a host plant is registered and the immature stages and the captivity life cycle are described using a Cuban population. Larvae feed on fowlsfoot, Serjania diversifolia (Jacq.) Radlk (Sapindales: Sapindaceae). One complete cohort was obtained from December of 2004 to February of 2005 and about 57 days lapsed from oviposition to adult emergence. The egg is light green-yellowish and semi-spherical. Most larvae developed through 6 or 7 instars, although there were individuals with 8 instars. The last instar has a cephalic capsule width of 2.04 +/- 0.06 mm (n = 29) irrespective of the number of instars. The cephalic capsule growth curves of the larvae with 6 and 7 instars have different slopes, but both follow a geometric pattern consistent with the Dyar's rule. In each larval molt the setae types and the larvae coloration change. Adult females have two color morphs, one orange-reddish and the other blue. Female descendants of blue and red females differ in the proportion of color morphs, which could indicate the existence of a female-limited polymorphism phenomenon in this species.

  17. Toxic effect of citrus peel constituents on Anastrepha fraterculus Wiedemann and Ceratitis capitata Wiedemann immature stages.

    PubMed

    Ruiz, María J; Juárez, María L; Alzogaray, Raúl A; Arrighi, Federico; Arroyo, Lorena; Gastaminza, Gerardo; Willink, Eduardo; Bardón, Alicia del Valle; Vera, Teresa

    2014-10-15

    The toxicity of essential oils from the citrus peel has been proposed as the major resistance mechanism offered by citrus to fruit fly infestation. We evaluated the insecticidal activity of the ether extracts from the lemon (Citrus limon [L.] Burm.) and grapefruit (C. paradisi Macfadyen) peel as well as from limonene and citral against Anastrepha fraterculus (Wiedemann) and Ceratitis capitata (Wiedemann) immature stages. We also evaluated the toxicity of the extracts at two ripening stages. Extracts proved toxic to A. fraterculus egg and larvae. The lemon and grapefruit extracts showed the same toxicity in both fruit fly species. For A. fraterculus eggs, citral was more toxic than limonene; for larvae, they showed equal toxicity. Anastrepha fraterculus eggs were more sensitive than C. capitata eggs. In conclusion, we provide evidence of chemical resistance mechanisms that could account for the nonhost condition of lemon for A. fraterculus.

  18. Morphology of immature stages of Hemipyrellia ligurriens (Wiedemann) (Diptera: Calliphoridae) for use in forensic entomology applications.

    PubMed

    Sukontason, Kabkaew L; Sribanditmongkol, Pongruk; Chaiwong, Tarinee; Vogtsberger, Roy C; Piangjai, Somsak; Sukontason, Kom

    2008-09-01

    In forensic investigations, all immature stages of flies (egg, larvae, and puparium) can serve as entomological evidence at death scenes. These insects are primarily used to estimate the post mortem interval (PMI), but can also be involved in the analysis of toxic substances, determining manner of death, and in indicating relocation of a corpse in homicide cases. In this study, we present the morphology of the egg, larvae, and puparium of Hemipyrellia ligurriens, a blow fly species of forensic importance in Thailand. Examination was conducted using scanning electron microscopy (SEM). The egg stage was found to display a relatively wide plastron region (or median hatch line area) that spans almost the entire length of the egg. The median hatch line is oriented in an upright position. External chorionic sculpture of the egg is present in a hexagonal pattern whose reticular boundaries are slightly elevated. In the larval stages, the most prominent morphological changes were detected upon comparison of the first to the second instar; whereas, the differences between second and third instar larvae were less obvious outside of the increase in number of posterior spiracular slits. Most of the major differences involve body size and structure of the anterior and posterior spiracles. Each anterior spiracle in both the second and third instars projects five to seven papillae apically. Each posterior spiracular disc of a third instar exhibits a complete peritreme, three spiracular slits, and a prominent button that is ventromedially located. The puparium is coarctate and features a clustered bubble membrane comprised of approximately 57 mammillate structures positioned dorsolaterally on each side of the first abdominal segment in young puparia. This feature is replaced by short, tubular respiratory horns in aged puparia. This study provides more detailed exposure of important morphological features that can be used for accurate identification of immature stages of H

  19. Immature stages of Spodoptera eridania (Lepidoptera: Noctuidae): developmental parameters and host plants.

    PubMed

    Montezano, Débora Goulart; Specht, Alexandre; Sosa-Gómez, Daniel Ricardo; Roque-Specht, Vânia Ferreira; de Barros, Neiva Monteiro

    2014-01-01

    This study aimed to detail the temporal and morphological parameters of the immature stages of southern armyworm Spodoptera eridania (Stoll, 1782) with larvae feed on artificial diet, under controlled conditions (25 ± 1°C, 70 ± 10% relative humidity and 14-h photophase) and gather information about their larval host plants. The viability of the egg, larval, pupal, and prepupal stages was 97.82, 93.62, 96.42, and 97.03%, respectively. The average duration of the egg, larval, pupal, and pre-pupal stages was 4.00, 16.18, 1.58, and 9.17 d, respectively. During the larval stage, 43.44% of females passed through seven instars, observing that the female's development was significant slower than males. The female larvae that developed through six and seven instars exhibited a mean growth rate of 1.52 and 1.44, respectively. Female pupae were significantly larger, exhibiting faster development than males. The rearing method proved to be adequate, providing more detailed observations of the biological cycle, especially at the larval stage, and resulting in an overall survival of almost 85%. Two hundred two plant species belonging to 58 families are listed as natural hosts for S. eridania, mainly including Asteraceae, Fabaceae, Solanaceae, Poaceae, Amaranthaceae, and Malvaceae. © The Author 2014. Published by Oxford University Press on behalf of the Entomological Society of America.

  20. Description of immature stages of Scymnus (Neopullus) sinuanodulus Yu and Yao (Coleoptera: Coccinellidae) with notes on life history

    Treesearch

    Wenhua Lu; Phetsamon Souphanya; Michael E. Montgomery

    2002-01-01

    We describe for the first time immature stages of the Scymnus subgenus Neopullus; namely the egg, larval (4 instars), and pupal stages of Scymnus (Neopullus) sinuanodulus Yu and Yao (Coleoptera: Coccinellidae), which is indigenous to China. This lady beetle was imported to...

  1. Ultrastructure of immature stages of the blowfly Chrysomya putoria (Wiedemann, 1818) (Diptera: Calliphoridae).

    PubMed

    Mendonça, Paloma Martins; Dos Santos-Mallet, Jacenir Reis; De Carvalho Queiroz, Margareth Maria

    2012-02-01

    Forensic entomology is an area of science that serves as a tool in crime scene investigations. Usually, flies are the first insects to reach a carcass and can oviposit just a few hours after arrival. Therefore, the knowledge of immature stages is essential for correct identification of the species found on corpses. Scanning electron microscopy (SEM) gives detailed information about morphological characters helping to identify the immature forms of flies. Chrysomya putoria (Wiedemann) is a very important fly for forensic entomology, because it has high population densities and is easily found in colonizing carcasses, moreover, it is also a possible causative agent for secondary myiasis. The aim of this study is to identify larvae and puparia of C. putoria using SEM. The first instar larvae were composed of 12 smooth segments separated by spines. Antennae and maxillary palps were visible. Anterior spiracle was absent and only one spiracular opening could be seen at the posterior spiracle. Second and third larval instars were similar to first instar, except for the presence of anterior spiracle that is composed by 11-12 spiracular ramifications. At the anal segment, two spiracular openings were found in second instars and three openings in third instar larvae. Puparia showed a retracted cephalic region and none of the head structures were visible.

  2. Dysfunctions in the migratory phenotype and properties of circulating immature transitional B cells during HIV-1 infection.

    PubMed

    Amu, Sylvie; Fievez, Virginie; Nozza, Silvia; Lopalco, Lucia; Chiodi, Francesca

    2016-09-10

    The frequency of immature transitional B cells is increased in blood of HIV-1-infected individuals. We investigated whether HIV-1 infection affects expression and function of chemokine receptors important for egress of immature transitional B cells from bone marrow and migration to lymphoid organs. This is a cross-sectional study analysing the migratory phenotype and function of immature transitional B cells in HIV-1-infected individuals, in relation to antiretroviral treatment and age. Frequency of blood immature transitional B cells and their phenotypic characteristics, including chemokine receptors and a maturation marker, were determined by immunostainings. Migratory capacities were studied in a migration assay. The increased frequency of immature transitional B cells in untreated HIV-1 infection was normalized in patients receiving antiretroviral treatment; in our cohorts, age did not have an impact on the frequency of circulating immature transitional B cells. Immature transitional B cells from nontreated patients expressed low levels of CD21 molecule. We found an elevated frequency of CXCR3 and CXCR4 expressing immature transitional B cells in treated and nontreated patients. CXCR4 receptor was unresponsive to CXCL12 ligand in in-vitro migration and internalization assays. In addition, CXCR5 expression was downregulated on immature transitional B cells from infected patients, and these cells migrated poorly in response to CXCR5 ligand. Circulating immature transitional B cells from HIV-1-infected patients are not fully mature, probably due to premature egress from bone marrow; these cells showed a phenotype which could impair entry into secondary lymphoid organs. Changes in migratory capacity of immature transitional B cells may affect B-cell maturation during HIV-1 infection.

  3. Description of Immature Stages and Life Cycle of the Treehopper, Guayaquila projecta

    PubMed Central

    Linares, Mario Alfredo; Neder, Lilia Estela; Dietrich, Chris

    2010-01-01

    Immature stages of the membracid Guayaquila projecta (Funkhouser) (Hemiptera: Cicadomorpha: Membracidae), collected in San Salvador de Jujuy, Argentina on Bougainvillea glabra Choisy (Caryophyllales: Nyctaginaceae), are described in detail based on specimens reared in the laboratory. Like other membracids, this species has five nymphal instars, not seven as previously reported. Morphological characters for identifying the different instars of G. projecta, determining the sex of later instars and distinguishing this species from other members of the Guayaquila pugnax group, are discussed. At 19 ±± 4°°C, RH 59 ±± 9%, and a 12:12 L:D photoperiod, the time required for development from egg to adult emergence was 73 ±± 5 days. PMID:21268700

  4. Descriptions of the Immature Stages of Lutzomyia (Tricholateralis) cruciata (Coquillett) (Diptera: Psychodidae, Phlebotominae).

    PubMed

    Montes de Oca-Aguilar, A C; Rebollar-Téllez, E A; Piermarini, P M; Ibáñez-Bernal, S

    2017-02-01

    The present study presents morphological and chaetotaxic descriptions of the immature stages of Lutzomyia (Tricholateralis) cruciata (Coquillett), a probable vector of leishmaniasis in Mexico. The egg exochorion is consistent with the species already known as Lu. (Tricholaterialis), but different from the Lu. cruciata egg of Chiapas, Mexico. The fourth instar larva of Lu. (Tricholateralis) cruciata possesses a novel antenna, combining morphological characteristics of categories 2 and 3 for neotropical sandflies. Differences between the chaetotaxy of first and fourth instar larvae of Lu. cruciata with those of Lu. (Lutzomyia) and Lu. (Tricholaterlis) are compared and discussed. This is the first time in which the chaetotaxy and morphology of pupa of a species belonging to Lutzomyia (Tricholateralis) sensu Galati have been described, and we recorded for the first time the anterior prothorax setae, which was previously only considered for Old World species.

  5. Micromorphology of immature stages of Sarcophaga (Liopygia) cultellata Pandellé, 1896 (Diptera: Sarcophagidae), a forensically important fly.

    PubMed

    Ubero-Pascal, Nicolás; Paños, Ángela; García, María-Dolores; Presa, Juan-José; Torres, Belén; Arnaldos, María-Isabel

    2015-02-01

    The Sarcophagidae are one of the most numerous groups of Diptera in the world, consisting of many species of forensic interest, whose immature stages are useful in the estimation of postmortem interval. The immature stages of some species of forensic importance still remain unknown or undescribed, like in the case of Sarcophaga (Liopygia) cultellata Pandellé, 1986, a species restricted to the Iberian Peninsula, south of France and north of Italy, which shares a ecological niche with species of the same subgenus, e.g., Sarcophaga (Liopygia) argyrostoma (Robineau-Desvoidy, 1830) and Sarcophaga (Liopygia) crassipalpis Macquart, 1839, making it necessary to lay the groundwork for a proper specific differentiation before it can be successfully applied in forensic practice. This study provides the first micromorphological description of all preimaginal stages of S. (L.) cultellata using light microscopy and scanning electron microscopy (SEM), the results of which allow the morphology of the main features to be followed during the immature life cycle. We propose a combination of features for distinguishing Liopygia from other sarcophagid subgenera, based on the current level of morphological knowledge of immature stages. S. (L.) cultellata can be differentiated from S. (L.) argyrostoma and S. (L.) crassipalpis in every immature stage by both light microscopy and SEM. The presence of tegumental warts and a fan-shaped anterior spiracle with a single row of 15-18 respiratory papillae allow distinguishing the third instar larvae of S. (L.) cultellata from other Sarcophaga species described hitherto by SEM. Identification keys based on light microscopy observations are provided, covering all the immature stages of Liopygia subgenus occurring in the Iberian Peninsula.

  6. Histological observations of pulpal replacement tissue in immature dog teeth after revascularization of infected pulps.

    PubMed

    Saoud, Tarek Mohamed A; Zaazou, Ashraf; Nabil, Ahmed; Moussa, Sybel; Aly, Hanaa Mohamed; Okazaki, Katsushi; Rosenberg, Paul A; Lin, Louis M

    2015-06-01

    Many studies have examined the nature of tissue formed in the canals of immature necrotic teeth, following revascularization in animals and humans. While speculations have been made that regeneration of the pulp tissue might take place in the canal, the tissue has been found to be cementum-like, bone-like, and periodontal ligament-like. The purpose of this study was to histologically examine the tissue in the root canals in immature dog teeth that had been artificially infected and then revascularized. Two 4- to 5-month-old mongrel dogs with immature teeth were used in the study. In one dog, four maxillary and four mandibular anterior teeth, and in another dog, four maxillary and five mandibular anterior teeth were used in the experiment. Pulp infection was artificially induced in the immature teeth. Revascularization was performed on all teeth by disinfecting the root canals with sodium hypochlorite irrigation and triple antibiotic intracanal dressing, completed with induction of intracanal bleeding, and sealed with an MTA plug. The access cavity was restored with silver amalgam. The animals were sacrificed 3 months after revascularization procedures. The revascularized teeth and surrounding periodontal tissues were removed and prepared for histological examination. Besides cementum-like, bone-like, and periodontal ligament-like tissues formed in the canals, residual remaining pulp tissue was observed in two revascularized teeth. In four teeth, ingrowth of alveolar bone into the canals was seen; presence of bone in the root canals has the potential for ankylosis. Within the limitation of this study, it can be concluded that residual pulp tissue can remain in the canals after revascularization procedures of immature teeth with artificially induced pulp infection. This can lead to the misinterpretation that true pulpal regeneration has occurred. Ingrowth of apical bone into the root canals undergoing revascularization can interfere with normal tooth eruption if

  7. Photosensitizing effect of hematoporphyrin IX on immature stages of Ceratitis capitata (Diptera: Tephritidae).

    PubMed

    Pujol-Lereis, Luciana Mercedes; Massaldi, Ana; Rabossi, Alejandro; Quesada-Allué, Luis Alberto

    2010-01-01

    Immature stages of Ceratitis capitata were tested as a model for hematoporphyrin IX (HP IX) phototoxicity. The lethal concentration 50 (LC(50)) of HP IX in the food was determined during postembryonic development until adult emergence as 0.173 mm (95% CI: 0.138-0.209). The corresponding HP IX LC(50) during the dispersal period alone was 0.536 mm (95% CI: 0.450-0.633). HP IX toxicity was compared against Phloxine B (PhB) (0.5 mm). HP IX elicited a mortality of 90.87%, which was mainly concentrated during prepupal and early pupal stages. PhB mortality was much lower (56.88%) and occurred mainly during the adult pharate stage. A direct correlation between light-dependent HP IX mortality, evidence of reactive oxygen species (ROS) and lipid peroxidation (conjugated dienes and thiobarbituric acid reactive substances) was established in C. capitata larvae. ROS were found to be very significant in both the brain and in the gut.

  8. The immature stages of Dermestes maculatus, Sarcophaga sp. and Phaenicia sericata as potential paratenic hosts for Trichinella spiralis in nature.

    PubMed

    Riva, Eliana; Fiel, César; Steffan, Pedro

    2015-01-01

    The role of some insect populations in the transmission of Trichinella sp. has been demonstrated. However, most of the studies have been conducted under controlled conditions which may influence the real role that they could play as a paratenic host in nature. To enlight this issue, a series of studies to determine the infective capability of the muscle larva of Trichinella spiralis recovered from immature stages of insect populations that fed on infected tissues exposed to natural conditions were carried out. Mice harbouring T. spiralis muscle larvae (ML) were sacrificed and deposited on a pitfall trap which was established in an open and safe area through 25 days in summer. Necrophilous and necrophagous insects that fed on corpses were recovered, identified and processed to search for live ML of T. spiralis. A complementary study in which maggots of Dermestes maculatus recovered from nature were induced to feed on muscle tissues harbouring T. spiralis larvae was also performed. The muscle larvae recovered from insects at different times of exposition were counted and inoculated to mice to determine the reproductive capability index (RCI). At day 3 of exposition, 29 live ML of T. spiralis were recovered from maggots of Phaenicia sericata. The RCI for these larvae was 133.6. On day 5 of exposition, maggots of Sarcophaga sp. were identified and 17 live T. spiralis larvae were recovered; the RCI of these larvae was 43.4. The T. spiralis ML recovered from maggots of D. maculatus obtained after 2 days of feeding on experimentally infected tissue showed a RCI of 24. The results suggest that larval stages of P. sericata, Sarcophaga sp. and D. maculatus might have an important role as a paratenic host of T. spiralis, which, in terms, may influence the epidemiology of this nematode in endemic areas of trichinellosis.

  9. Case report: pulp revascularization of a necrotic, infected, immature, permanent tooth.

    PubMed

    Thibodeau, Blayne

    2009-01-01

    The purpose of this report is to present the case of a patient wherein revascularization of the necrotic infected pulp space of an immature permanent maxillary central incisor tooth was induced in vivo by stimulation of a blood clot from the periapical tissues into the canal space. This was achieved after disinfecting the canal space with a topical antibiotic paste followed by inducing a blood clot scaffold from the periapical tissues. This treatment approach offers great potential to avoid the need for traditional apexification with calcium hydroxide or the need to achieve an artificial apical barrier with mineral trioxide aggregate. Furthermore, this treatment approach can help rescue infected immature teeth by physiologically strengthening the root walls.

  10. The Immature Stages and Natural History of Veladyris pardalis (Salvin, 1869) in Eastern Ecuador (Lepidoptera: Nymphalidae: Lthomiinae)

    PubMed Central

    Greeney, Harold F.; Hill, Ryan I.; Rosendo Simbaña, Wilmer; Gentry, Grant

    2009-01-01

    We describe the immature stages and oviposition behavior of Veladyris pardalis (Salvin, 1869) from northeastern Ecuador. An unidentified species of Solanum (Solanaceae) is the larval food plant. Eggs are laid singly on leaves, stems or epiphytes growing on the host. Veladyris pardalis has four larval stadia, and takes 64–70 days to mature from oviposition to adult. PMID:19619012

  11. The Immature Stages and Shelter Building Behavior of Falgo Jeconia Ombra Evans, 1955 in eastern Ecuador (Lepidoptera: Hesperiidae: Hesperiinae)

    PubMed Central

    Greeney, Harold F.; Warren, Andrew D.

    2009-01-01

    We describe the immature stages and shelter building behavior of Falga jeconia ombra Evans, 1955 from eastern Ecuador. Chusquea scandens (Poaceae, Bambusoidea) is the larval food plant. Larvae in all stadia build shelters and forcibly eject frass with the aid of an anal comb. Later instars possess an eversible prothoracic “neck” gland. Larvae are associated with moving water. PMID:19613872

  12. The life history and immature stages of the weevil Anthonomus monostigma Champion (Coleoptera: Curculiondidae) on Miconia calvescens DC (Melastomataceae)

    Treesearch

    Eduardo Chacón-Madrigal; M.Tracy Johnson; Paul. Hanson

    2012-01-01

    We describe and illustrate the life history and immature stages of Anthonomus monostigma Champion (Curculionidae: Curculioninae: Anthonomini). This weevil is a fruit borer in Miconia calvescens DC (Melastomataceae), a Neotropical tree that is invasive in Pacific islands. The larva has three instars, and development from egg to...

  13. The immature stages and shelter building behavior of Falgo Jeconia Ombra Evans, 1955 in eastern Ecuador (Lepidoptera: Hesperiidae: Hesperiinae).

    PubMed

    Greeney, Harold F; Warren, Andrew D

    2009-01-01

    We describe the immature stages and shelter building behavior of Falga jeconia ombra Evans, 1955 from eastern Ecuador. Chusquea scandens (Poaceae, Bambusoidea) is the larval food plant. Larvae in all stadia build shelters and forcibly eject frass with the aid of an anal comb. Later instars possess an eversible prothoracic "neck" gland. Larvae are associated with moving water.

  14. Biology and external morphology of the immature stages of the butterfly Callicore pygas eucale, with comments on the taxonomy of the genus Callicore (Nymphalidae: Biblidinae).

    PubMed

    Dias, Fernando Maia Silva; Casagrande, Mirna Martins; Mielke, Olaf Hermann Hendrik

    2014-01-01

    The biology and the external morphology of the immature stages of Callicore pygas eucale (Fruhstorfer, 1916) (Lepidoptera: Nymphalidae: Biblidinae) are described. Immatures were collected on Allophylus edulis (Radlkofer) (Sapindales: Sapindaceae) in Curitiba, Paraná, Brazil, and reared in the laboratory. Morphological descriptions and illustrations are given based on observations through electronic, stereoscopic, and optic microscopes, the latter two attached to a camera lucida. Results are compared and discussed with the immature stages of other species of the subtribe Callicorina. Immature stages data provide further evidence that Callicore is paraphyletic and that generic limits within the Callicorina need revision.

  15. Biology and External Morphology of the Immature Stages of the Butterfly Callicore pygas eucale, with Comments on the Taxonomy of the Genus Callicore (Nymphalidae: Biblidinae)

    PubMed Central

    Dias, Fernando Maia Silva; Casagrande, Mirna Martins; Mielke, Olaf Hermann Hendrik

    2014-01-01

    The biology and the external morphology of the immature stages of Callicore pygas eucale (Fruhstorfer, 1916) (Lepidoptera: Nymphalidae: Biblidinae) are described. Immatures were collected on Allophylus edulis (Radlkofer) (Sapindales: Sapindaceae) in Curitiba, Paraná, Brazil, and reared in the laboratory. Morphological descriptions and illustrations are given based on observations through electronic, stereoscopic, and optic microscopes, the latter two attached to a camera lucida. Results are compared and discussed with the immature stages of other species of the subtribe Callicorina. Immature stages data provide further evidence that Callicore is paraphyletic and that generic limits within the Callicorina need revision. PMID:25368047

  16. Survival and development of immature stages of the Mediterranean fruit fly (Diptera: Tephritidae) in citrus fruit.

    PubMed

    Papachristos, Dimitrios P; Papadopoulos, Nikos T; Nanos, George D

    2008-06-01

    We studied, under laboratory conditions, the performance of the Mediterranean fruit fly, Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), immature stages in intact whole fruit of three sweet orange varieties, lemon, and bitter oranges. Both citrus variety and fruit part (flavedo, albedo, and pulp) had strong effects on larval performance, smaller effects on pupae, and no effects on eggs. Fruit peel was the most critical parameter for larval development and survival, drastically affecting larval survival (inducing very high mortality rates). Among fruit regions, survival of larvae placed in flavedo was zero for all varieties tested except for bitter orange (22.5% survival), whereas survival in albedo was very low (9.8-17.4%) for all varieties except for bitter orange (76%). Survival of pupae obtained from larvae placed in the above-mentioned fruit regions was high for all varieties tested (81.1-90.7%). Fruit pulp of all citrus fruit tested was favorable for larval development. The highest survival was observed on bitter oranges, but the shortest developmental times and heaviest pupae were obtained from orange cultivars. Pulp chemical properties, such as soluble solid contents, acidity, and pH had rather small effects on larval and pupal survival and developmental time (except for juice pH on larvae developmental duration), but they had significant effects on pupal weight.

  17. Seasonal infestation of birds with immature stages of Ixodes ricinus and Ixodes arboricola.

    PubMed

    Kocianová, Elena; Rusňáková Tarageľová, Veronika; Haruštiaková, Danka; Špitalská, Eva

    2017-03-01

    This study assessed the parasitization of cavity-nesting birds and ground-nesting/foraging birds with larvae and nymphs of two Ixodes species, Ixodes ricinus and Ixodes arboricola. Totals of 679 (52.3%) I. ricinus and 619 (47.7%) I. arboricola ticks were collected from 15 species of passerine birds which were caught during the nesting and non-nesting periods of 2003-2006, in the south-eastern part of the Czech Republic, the Drahanská Vrchovina Uplands. In the non-nesting period from October to March, 6.8% (101/1492) of birds were infested with ticks, mainly with I. arboricola larvae. In the non-nesting period, the average intensity of infestation by I. arboricola and I. ricinus was 8.5 and 1.5 individuals per infested bird, respectively. In the nesting period from April to June, 21.6% (50/232) of birds were infested by both tick species but mainly with I. ricinus nymphs. The average intensity of infestation by I. ricinus and I. arboricola was 13.3 and 10.8 individuals per infested bird, respectively. Altogether, 23.2% of the infested birds were parasitized by both immature life stages of one or both tick species. From an enzootic perspective, co-feeding and co-infestation of I. ricinus and I. arboricola subadults on passerine birds might happen and may be important for the dissemination of tick-borne agents.

  18. Rearing and observation of immature stages of the hoverfly Microdon katsurai (Diptera, Syrphidae)

    PubMed Central

    Iwai, Hironori; Arakawa, Kazuharu; Tomita, Masaru; Komatsu, Takashi

    2016-01-01

    Abstract Background The hoverfly Microdon (Chymophila) katsurai Maruyama et Hironaga 2004 was speculated to be a myrmecophilous species associated with the ant Polyrhachis lamellidens based on observations of adults near the ant nest. However, there have been no reports regarding the observation of immature stages of this species in association with P. lamellidens. New information For the first time, we found three M. katsurai larvae inside a P. lamellidens nest and conducted rearing experiments on the larval M. katsurai. P. lamellidens workers did not show any inspection or attack behavior against the M. katsurai larvae under rearing conditions, suggesting that M. katsurai larvae can survive inside a P. lamellidens nest. Although no predatory behavior by the M. katsurai larvae was observed, all the M. katsurai larvae pupated and emerged in a rearing environment. The dorsal surface of the larval M. katsurai has a distinct pale green color with a uniform reticular structure. The puparium of M. katsurai shows several morphological features that are characteristic of the subgenus Chymophila. We conclude that M. katsurai is likely a myrmecophilous species that utilizes P. lamellidens as a specific host and that classification of M. katsurai based on puparium morphology is concordant with that based on adult morphology. PMID:28174503

  19. Parasitism of immature stages of Haemaphysalis sulcata (Acari: Ixodidae) on some reptiles in Turkey.

    PubMed

    Keskin, Adem; Bursali, Ahmet; Kumlutas, Yusuf; Ilgaz, Cetin; Tekin, Saban

    2013-10-01

    Reptiles may contribute to maintaining tick populations by feeding larvae, nymphs, and adults. The life cycles and tick-host associations of many Turkish ticks are still poorly known, and only 3 ixodid tick species have been reported on 7 reptile species in Turkey. In this study, we performed a tick survey on reptiles in the Southeastern Anatolia Region of Turkey. In 2005, 57 reptiles (52 lizards and 5 snakes) comprising 10 species from 5 families were captured and examined for tick infestation. A total of 427 ticks was collected. The majority of ticks found on lizards was the immature stages of Haemaphysalis sulcata, 420 larvae and 4 nymphs. The only adult ticks recorded on the agamid lizard, Laudakia stellio, were Hyalomma aegyptium (1 ♂, 2 ♀). The highest tick infestation rate was recorded on specimens of Timon princeps. This study is the first detailed investigation on ticks infesting reptiles in Turkey. To the best of our knowledge, these tick-host associations have never been documented in the literature.

  20. Morphology and development rate of the immature stages of Glyphidops (Oncopsia) flavifrons (Bigot, 1886) (Diptera, Neriidae) under natural conditions

    PubMed Central

    Mondragón, Andrés Felipe Vinasco; Gironza, Nancy Soraya Carrejo

    2016-01-01

    Abstract Of the 116 Neriidae species known to date, 113 species have not been studied in their immature stages. Here, we examine the development of the immature stages of Glyphidops (Oncopsia) flavifrons (Bigot, 1886), which has one of the broadest distributions of Neriidae in southern North America, Central America, and South America; offering excellent opportunities for biological studies. A population of this species was monitored over a five month period. The following characteristics were tracked for a population located on the University of Valle campus in Cali, Colombia: oviposition duration, number of eggs per egg mass and lifespan of each immature stage (egg, larva, and puparium) under natural conditions (in situ). The external morphology of the egg, larva, and puparium were described; their stages lasted 58 (± 4) hours, 10 (± 1) days and 13 (± 1) days, respectively. The lapse of time for each larval instar was statistically supported by using Tukey comparisons and cluster analysis of hypopharyngeal sclerite length and mandibular area. In addition, it was also sustained throughout the morphological study of structural changes in mouth hook, and anterior and posterior spiracles. Finally, the presence of the labial and epipharyngeal sclerites are reported as new characters of Nerioidea. Natural history data are provided. PMID:27551201

  1. Biology and immature stages of Pherbellia limbata (Diptera: Sciomyzidae), a parasitoid of the terrestrial snail Granaria frumentum.

    PubMed

    Nerudová-Horsáková, Jana; Murphy, William L; Vala, Jean-Claude

    2016-05-30

    The very rare Palaearctic Pherbellia limbata (Meigen, 1830) lives in limestone steppes and other xerothermic habitats in central and southern Europe. For the first time, the egg, first-, second- and third-instar larvae and the puparium are described. Scanning electron micrographs of various morphological features of immature stages are provided. Larvae of P. limbata are parasitoids exclusively of the terrestrial snail Granaria frumentum (Draparnaud, 1801). Results of this study are integrated with those of previous studies of the biology, ecology, immature stages, and mollusc-prey habitat of the other 28 (of 96) Pherbellia species for which life cycles have been completely or partially elucidated. Recent published taxonomic approaches to clarifying the phylogeny of the Sciomyzidae are discussed, particularly those involving DNA analyses of Pherbellia species.

  2. A new genus and species of demodecid mites from the tongue of a house mouse Mus musculus: description of adult and immature stages with data on parasitism.

    PubMed

    Izdebska, J N; Rolbiecki, L

    2016-06-01

    The study of the parasitofauna of the house mouse Mus musculus (Rodentia: Muridae) Linnaeus is particularly important owing to its multiple relationships with humans - as a cosmopolitan, synanthropic rodent, bred for pets, food for other animals or laboratory animal. This article proposes and describes a new genus and species of the parasitic mite based on adult and immature stages from the house mouse. Glossicodex musculi gen. n., sp. n. is a medium-sized demodecid mite (adult stages on average 199 µm in length) found in mouse tissue of the tongue. It is characterized by two large, hooked claws on each tarsus of the legs; the legs are relatively massive, consisting of large, non-overlapping segments. The palps consist of three slender, clearly separated, relatively narrow segments, wherein their coxal segments are also quite narrow and spaced. Also, segments of the palps of larva and nymphs are clearly isolated, and on the terminal segment, trident claws that resemble legs' claws can be found. On the ventral side, in immature stages, triangular scuta, topped with sclerotized spur, can be also observed. Glossicodex musculi was noted in 10.8% of mice with a mean infection intensity of 2.2 parasites per host.

  3. Delimitation and description of the immature stages of a pollinating fig wasp, Ceratosolen solmsi marchali Mayr (Hymenoptera: Agaonidae).

    PubMed

    Jia, Ling-Yi; Xiao, Jin-Hua; Niu, Li-Ming; Ma, Guang-Chang; Fu, Yue-Guan; Dunn, Derek W; Huang, Da-Wei

    2014-04-01

    The mutualism between fig trees and their wasp pollinators is a model system for many ecological and evolutionary studies. However, the immature stages of pollinating fig wasps have rarely been studied. We monitored developing fig wasps of known ages and performed a series of dissections at 24 h intervals to identify key developmental traits of Ceratosolen solmsi marchali Mayr (Hymenoptera: Agaonidae), a pollinator of Ficus hispida L. (Moraceae). We identified where in the Ficus ovary eggs were deposited and time to hatch. We were also able to identify the timing and key underlying characters of five larval instars, three sub-pupal stages, and a single prepupal stage. We provide detailed morphological descriptions for the key stages and report some behavioral observations of the wasps in the several developmental stages we recorded. Scanning electron microscope images were taken.

  4. Taxonomic value of morphological and morphometrical characters in the immature stages of four species of Kampimodromus Nesbitt (Acari: Phytoseiidae) from Italy and Croatia.

    PubMed

    Cargnus, Elena; Zandigiacomo, Pietro

    2014-08-28

    The immature stages of four species of Kampimodromus Nesbitt (Acari: Phytoseiidae) from Italy and Croatia have been studied and identified both at stage and species level. Larval stages of Kampimodromus corylosus Kolodochka and all immature stages of Kampimodromus ericinus Ragusa di Chiara & Tsolakis and Kampimodromus langei Wainstein & Arutunjan are described for the first time. The relative length of the posterior dorsal setae Z4 make the larvae of Kampimodromus aberrans (Oudemans) easy to separate from those of the other three species. Nymphs of each species had similar diagnostics to the adults of the respective species. Ontogeny of the idiosomal and leg setation of the Kampimodromus immatures studied in comparison to the available data from immatures of other phytoseiid species is discussed. The length of seta Z4 in the K. aberrans larva, and the number of setae on leg IV of the deutonymphs of the four Kampimodromus species, are proposed as additional taxonomic traits for Phytoseiidae. 

  5. Redescription of eutogenes vicinus summers and price, a predatory polymorphic, cheyletid mite with descriptions of males and immature stages (Acarina: Cheyletidae)

    Treesearch

    Robert L. Smiley; John C. Moser

    1975-01-01

    Eutogenes vicinus Summer and Price is redescribed. Illustrations and descriptions are presented for the first time of the male and immature stages of this polymorphic species. Variation in length of palpi of the heteromorphic males is discussed.

  6. Identification of Erwinia amylovora Genes Induced during Infection of Immature Pear Tissue

    PubMed Central

    Zhao, Youfu; Blumer, Sara E.; Sundin, George W.

    2005-01-01

    The enterobacterium Erwinia amylovora is a devastating plant pathogen causing necrotrophic fire blight disease of apple, pear, and other rosaceous plants. In this study, we used a modified in vivo expression technology system to identify E. amylovora genes that are activated during infection of immature pear tissue, a process that requires the major pathogenicity factors of this organism. We identified 394 unique pear fruit-induced (pfi) genes on the basis of sequence similarity to known genes and separated them into nine putative function groups including host-microbe interactions (3.8%), stress response (5.3%), regulation (11.9%), cell surface (8.9%), transport (13.5%), mobile elements (1.0%), metabolism (20.3%), nutrient acquisition and synthesis (15.5%), and unknown or hypothetical proteins (19.8%). Known virulence genes, including hrp/hrc components of the type III secretion system, the major effector gene dspE, type II secretion, levansucrase (lsc), and regulators of levansucrase and amylovoran biosynthesis, were upregulated during pear tissue infection. Known virulence factors previously identified in E. (Pectobacterium) carotovora and Pseudomonas syringae were identified for the first time in E. amylovora and included HecA hemagglutinin family adhesion, Peh polygalacturonase, new effector HopPtoCEA, and membrane-bound lytic murein transglycosylase MltEEA. An insertional mutation within hopPtoCEA did not result in reduced virulence; however, an mltEEA knockout mutant was reduced in virulence and growth in immature pears. This study suggests that E. amylovora utilizes a variety of strategies during plant infection and to overcome the stressful and poor nutritional environment of its plant hosts. PMID:16291682

  7. Identification of Erwinia amylovora genes induced during infection of immature pear tissue.

    PubMed

    Zhao, Youfu; Blumer, Sara E; Sundin, George W

    2005-12-01

    The enterobacterium Erwinia amylovora is a devastating plant pathogen causing necrotrophic fire blight disease of apple, pear, and other rosaceous plants. In this study, we used a modified in vivo expression technology system to identify E. amylovora genes that are activated during infection of immature pear tissue, a process that requires the major pathogenicity factors of this organism. We identified 394 unique pear fruit-induced (pfi) genes on the basis of sequence similarity to known genes and separated them into nine putative function groups including host-microbe interactions (3.8%), stress response (5.3%), regulation (11.9%), cell surface (8.9%), transport (13.5%), mobile elements (1.0%), metabolism (20.3%), nutrient acquisition and synthesis (15.5%), and unknown or hypothetical proteins (19.8%). Known virulence genes, including hrp/hrc components of the type III secretion system, the major effector gene dspE, type II secretion, levansucrase (lsc), and regulators of levansucrase and amylovoran biosynthesis, were upregulated during pear tissue infection. Known virulence factors previously identified in E. (Pectobacterium) carotovora and Pseudomonas syringae were identified for the first time in E. amylovora and included HecA hemagglutinin family adhesion, Peh polygalacturonase, new effector HopPtoC(EA), and membrane-bound lytic murein transglycosylase MltE(EA). An insertional mutation within hopPtoC(EA) did not result in reduced virulence; however, an mltE(EA) knockout mutant was reduced in virulence and growth in immature pears. This study suggests that E. amylovora utilizes a variety of strategies during plant infection and to overcome the stressful and poor nutritional environment of its plant hosts.

  8. Description of the immature stages of four species of Macrodactylini (Coleoptera: Melolonthidae: Melolonthinae).

    PubMed

    Neita-Moreno, J C; Morón, M A; Zuluaga-Correa, C A

    2012-04-01

    The third instar of the genera Ceraspis, Clavipalpus, Isonychus and Manopus (Melolonthidae: Melolonthinae: Macrodactylini) are described for the first time. Descriptions are based on the larvae of Ceraspis innotata (Blanchard), Clavipalpus ursinus Blanchard, Isonychus maculatus Waterhouse and Manopus biguttatus Laporte. The pupae of C. ursinus, I. maculatus and M. biguttatus are also described. A key to the larvae of nine genera of Macrodactylini and a list of the species with immature descriptions are provided.

  9. The immature stages of Micropygomyia (Coquillettimyia) chiapanensis (Dampf) (Diptera: Psychodidae, Phlebotominae).

    PubMed

    Oca-Aguilar, Ana Celia Montes De; Rebollar-Téllez, Eduardo A; Ibáñez-Bernal, Sergio

    2016-04-25

    The egg exochorion, larval instars and pupa of the phlebotomine sand fly Micropygomyia (Coquillettimyia) chiapanensis (Dampf) are described and illustrated based on specimens collected in the locality of Farallón, municipality of Actopan, Veracruz, Mexico. Morphology of fourth instar larval mouthparts, particularly the incisor lobe and molar lobe shape of mandible, could be important for species identification of immature Phlebotominae. In this work is compared the pupal chaetotaxy of Mi. chiapanensis with other species previously described. The fourth instar larva of Mi. chiapanensis is compared with other species of this genus, the most important differentiating characters being the size, shape and position of the abdominal dorsal internal seta.

  10. Larval and female footprints as feeding deterrent cues for immature stages of two congeneric ladybird predators (Coleoptera: Coccinellidae).

    PubMed

    Kumar, B; Mishra, G; Omkar

    2014-10-01

    In the present study predation parameters, i.e. consumption rate, conversion efficiency and growth rate, and total developmental duration of immature stages of two congeneric ladybirds, Coccinella septempunctata (L.) and Coccinella transversalis F., have been evaluated in presence of conspecific and heterospecific fourth instar larval and adult female tracks. We hypothesized that the semiochemicals within larval/adult female tracks might act as foraging/feeding deterrent pheromones (FDPs) and would reduce the predation parameters; and would prolong total developmental duration of ladybird predators. Results of the study positively affirmed our hypothesis. The deterrence in prey consumption and reduction in conversion efficiency and growth rate was density dependent with species-specific variations. Consumption rate, conversion efficiency, and growth rate of larval instars decreased and the total developmental duration of immature stages increased when exposed to an increasing density of zero, two, three, and four conspecific/heterospecific larval/adult female tracks. Between ladybird species, C. septempunctata had higher consumption rate, growth rate, and total developmental durations, whereas conversion efficiency was higher in C. transversalis. Despite the presence of semiochemical tracks as foraging barriers, early instars showed higher conversion efficiencies and growth rates, whereas fourth instars had highest consumption rate in all experimental treatments. The present study, therefore, suggests that semiochemical tracks significantly reduce the predation potential and prolong developmental duration of conspecifics and heterospecifics. They, thus behave as FDP.

  11. Comparative Morphological Analysis of the Immature Stages of the Grass Blue Butterflies Zizeeria and Zizina (Lepidoptera: Lycaenidae).

    PubMed

    Gurung, Raj D; Iwata, Masaki; Hiyama, Atsuki; Taira, Wataru; Degnan, Bernard; Degnan, Sandie; Otaki, Joji M

    2016-08-01

    The pale grass blue butterfly has been used to assess the biological effects of the Fukushima nuclear accident. Zizeeria and Zizina are two closely related genera of grass blue butterflies that are widely distributed in tropical to temperate Asia, Australia, and Africa, making them suitable environmental indicators for these areas. However, the morphological features of the immature stages have been examined only in fragmentary fashion. Here, we reared Zizeeria maha argia, Zizeeria maha okinawana, Zizeeria karsandra karsandra, Zizina emelina emelina, Zizina otis labradus, and Zizina otis riukuensis using a standard rearing method that was developed for Zizeeria maha, and comparatively identified morphological traits to effectively classify the immature stages of species or subspecies. Morphological information on these and other subspecies including Zizeeria knysna knysna and Zizina otis antanossa from Africa was also collected from literature. The subspecies were all reared successfully. The subspecies all had dorsal nectary and tentacle organs with similar morphology. For the subspecies of Zizeeria maha, only minor morphological differences were noted. Similarly, the subspecies of Zizina otis shared many traits. Most importantly, Zizeeria and Zizina differed in the shape of the sensory hairs that accompany the dorsal nectary organ; Zizeeriahad pointed hairs, and Zizina had blunt or rounded hairs. However, Zizina emelina exhibited several intermediate features between these two genera. Overall, the morphological traits did not completely reflect the conventional systematic relationships. This comparative study describes the efficient rearing of the grass blue butterflies and provides a morphological basis for the use of these species as environmental indicators.

  12. Immature stages and ecology of two species of the South African genus Stripsipher Gory & Percheron, 1833 (Coleoptera, Scarabaeidae, Cetoniinae, Trichiini)

    PubMed Central

    Šípek, Petr; Ricchiardi, Enrico; Perissinotto, Renzo

    2012-01-01

    Abstract Based on the study of newly accessible type material, Stripsipher drakensbergi Ricchiardi, 1998, is demoted to a junior synonym of Stripsipher jansoni Péringuey, 1908. The genus Stripsipher Gory & Percheron, 1833, thus, currently includes 12 species, but for none of these are larval stages and/or pupae currently known. The immature stages of Stripsipher orientalis Ricchiardi, 2008 and Stripsipher jansoni are described here for the first time and updated observations on distribution and ecology of both species are provided. Morphological affinities of Stripsipher with other Trichiini larvae are presented and the main diagnostic differences discussed. The larvae of both species are very similar to those of other representatives of the tribe Trichiini, with key differences found on the epipharynx. Based on the morphology of larvae and adults, it is suggested that Stripsipher is a member of the clade composed of Valgini, Trichiini and Cryptodontini. PMID:22539904

  13. Altered Expression of Galectin-3 Induces Cortical Thymocyte Depletion and Premature Exit of Immature Thymocytes during Trypanosoma cruzi Infection

    PubMed Central

    Silva-Monteiro, Elizangela; Reis Lorenzato, Luciana; Kenji Nihei, Oscar; Junqueira, Mara; Rabinovich, Gabriel Adrián; Hsu, Daniel Kaiyuan; Liu, Fu-Tong; Savino, Wilson; Chammas, Roger; Villa-Verde, Déa Maria Serra

    2007-01-01

    During acute infection with Trypanosoma cruzi, the causative agent of Chagas’ disease, the thymus undergoes intense atrophy followed by a premature escape of CD4+CD8+ immature cortical thymocytes. Here we report a pivotal role for the endogenous lectin galectin-3 in accelerating death of thymocytes and migration of these cells away from the thymus after T. cruzi infection. We observed a pronounced increase in galectin-3 expression that paralleled the extensive depletion of CD4+CD8+ immature thymocytes after infection. In vitro, recombinant galectin-3 induced increased levels of death in cortical immature thymocytes. Consistent with the role of galectin-3 in promoting cell death, thymuses from gal-3−/− mice did not show cortical thymocyte depletion after parasite infection in vivo. In addition, galectin-3 accelerated laminin-driven CD4+CD8+ thymocyte migration in vitro and in vivo induced exportation of CD4+CD8+ cells from the thymus to the peripheral compartment. Our findings provide evidence of a novel role for galectin-3 in the regulation of thymus physiology and identify a potential mechanism based on protein-glycan interactions in thymic atrophy associated with acute T. cruzi infection. PMID:17255323

  14. Altered expression of galectin-3 induces cortical thymocyte depletion and premature exit of immature thymocytes during Trypanosoma cruzi infection.

    PubMed

    Silva-Monteiro, Elizangela; Reis Lorenzato, Luciana; Kenji Nihei, Oscar; Junqueira, Mara; Rabinovich, Gabriel Adrián; Hsu, Daniel Kaiyuan; Liu, Fu-Tong; Savino, Wilson; Chammas, Roger; Villa-Verde, Déa Maria Serra

    2007-02-01

    During acute infection with Trypanosoma cruzi, the causative agent of Chagas' disease, the thymus undergoes intense atrophy followed by a premature escape of CD4+CD8+ immature cortical thymocytes. Here we report a pivotal role for the endogenous lectin galectin-3 in accelerating death of thymocytes and migration of these cells away from the thymus after T. cruzi infection. We observed a pronounced increase in galectin-3 expression that paralleled the extensive depletion of CD4+CD8+ immature thymocytes after infection. In vitro, recombinant galectin-3 induced increased levels of death in cortical immature thymocytes. Consistent with the role of galectin-3 in promoting cell death, thymuses from gal-3-/- mice did not show cortical thymocyte depletion after parasite infection in vivo. In addition, galectin-3 accelerated laminin-driven CD4+CD8+ thymocyte migration in vitro and in vivo induced exportation of CD4+CD8+ cells from the thymus to the peripheral compartment. Our findings provide evidence of a novel role for galectin-3 in the regulation of thymus physiology and identify a potential mechanism based on protein-glycan interactions in thymic atrophy associated with acute T. cruzi infection.

  15. Ultramorphological characteristics of immature stages of Chrysomya albiceps (Wiedemann 1819) (Diptera: Calliphoridae), a fly specie of forensic importance.

    PubMed

    Mendonça, Paloma Martins; Dos Santos-Mallet, Jacenir Reis; Queiroz, Margareth Maria De Carvalho

    2010-08-01

    Forensic entomology is an area of science that serves as a tool in crime scene investigations. Usually, flies are the first insects to reach a dead body and can oviposit just a few hours after arrival. Therefore the knowledge of immature stages is essential for correct identification of the species found on corpses. Scanning electron microscopy gives detailed information about morphological characters helping to identify the immature forms and consequently serves as a tool in crime scene investigations. C. albiceps is a very important fly for forensic entomologists because its larvae are almost always present on a dead body and it is facultative predators and therefore can alter the composition of species present at the carcass. The aim of this study is to identify eggs, larvae, and puparia of C. albiceps using SEM. Eggs were elongated with the anterior region ending in a "Y" shape and the posterior end was tapered. The micropyle was a well-adorned orifice with some projections around it. The first instar larva was composed of 12 segments separated by spines. Only one spiracular opening could be seen at the posterior spiracle. Body tegument was smooth and tubercles were not seen. Antennae and maxillary palps were visible. Second and third larval instars were very similar to first instar, except for the presence of anterior spiracle. However, body tegument was composed of net-like patches and tubercles were visible. Tubercles present at the third instar larvae were robust and erect. Puparia showed a retracted cephalic region and curved tubercles.

  16. Ultrastructure of immature stages of Cochliomyia macellaria (Diptera: Calliphoridae), a fly of medical and veterinary importance.

    PubMed

    Mendonça, Paloma Martins; Barbosa, Rodrigo Rocha; Cortinhas, Lucas Barbosa; dos Santos-Mallet, Jacenir Reis; de Carvalho Queiroz, Margareth Maria

    2014-10-01

    Cochliomyia macellaria (Diptera: Calliphoridae) is known as the secondary screwworm because it causes secondary or facultative myiasis when the larvae feed on necrotic tissues. This fly has a significant medical and veterinary importance since it has been reported to transport eggs of Dermatobia hominis (human botfly), which can cause significant economic losses to livestock. Since this screwworm has been collected colonizing both pig carcasses and human cadavers, it is considered one of the most important species for forensic entomology studies. Scanning electron microscopy (SEM) gives detailed information on the morphological characteristics which can help identify the immature forms of the flies. The aim of this study was to describe and analyze the morphological characteristics of the eggs, all the larval instars, and the puparia of Cochliomyia macellaria using SEM. The egg is ellipsoid and the dorsal surface is concave. The islands inside the median area had no anastomosis, but some perforations could be observed. From the second larval instar onwards, besides the intersegmental spines, other bands of spines were observed at the abdominal segments. Two spiracular openings were visible on the first and second larval instars, which were not expected. These characteristics are specific to Cochliomyia genus. The number and the general aspect of the spine tips in the cephalic region, the intersegmental bands on the abdomen, and the number of the spiracular openings could together help identify C. macellaria.

  17. Sensing of Immature Particles Produced by Dengue Virus Infected Cells Induces an Antiviral Response by Plasmacytoid Dendritic Cells

    PubMed Central

    Hillaire, Marine L. B.; Dejnirattisai, Wanwisa; Mongkolsapaya, Juthathip; Screaton, Gavin R.; Davidson, Andrew D.; Dreux, Marlène

    2014-01-01

    Dengue virus (DENV) is the leading cause of mosquito-borne viral illness and death in humans. Like many viruses, DENV has evolved potent mechanisms that abolish the antiviral response within infected cells. Nevertheless, several in vivo studies have demonstrated a key role of the innate immune response in controlling DENV infection and disease progression. Here, we report that sensing of DENV infected cells by plasmacytoid dendritic cells (pDCs) triggers a robust TLR7-dependent production of IFNα, concomitant with additional antiviral responses, including inflammatory cytokine secretion and pDC maturation. We demonstrate that unlike the efficient cell-free transmission of viral infectivity, pDC activation depends on cell-to-cell contact, a feature observed for various cell types and primary cells infected by DENV, as well as West Nile virus, another member of the Flavivirus genus. We show that the sensing of DENV infected cells by pDCs requires viral envelope protein-dependent secretion and transmission of viral RNA. Consistently with the cell-to-cell sensing-dependent pDC activation, we found that DENV structural components are clustered at the interface between pDCs and infected cells. The actin cytoskeleton is pivotal for both this clustering at the contacts and pDC activation, suggesting that this structural network likely contributes to the transmission of viral components to the pDCs. Due to an evolutionarily conserved suboptimal cleavage of the precursor membrane protein (prM), DENV infected cells release uncleaved prM containing-immature particles, which are deficient for membrane fusion function. We demonstrate that cells releasing immature particles trigger pDC IFN response more potently than cells producing fusion-competent mature virus. Altogether, our results imply that immature particles, as a carrier to endolysosome-localized TLR7 sensor, may contribute to regulate the progression of dengue disease by eliciting a strong innate response. PMID

  18. Descriptions of the immature stages of Dampfomyia (Coromyia) beltrani (Vargas & Díaz-Nájera) (Diptera: Psychodidae), with notes on morphology and chaetotaxy nomenclature.

    PubMed

    De Oca-Aguilar, Ana Celia Montes; Rebollar-Téllez, Eduardo; Ibáñez-Bernal, Sergio

    2014-11-25

    All immature stages of the phlebotomine sandfly Dampfomyia (Coromyia) beltrani (Vargas & Díaz-Nájera) [= Lutzomyia (Coromyia) beltrani, sensu Young & Duncan 1994] are described and illustrated based on reared specimens from founder females collected from the type-locality in Veracruz, Mexico. These represent the first description of egg, and the third of larva instars and pupa of a species of the subgenus Coromyia, only preceded by Da. vespertilionis (Fairchild & Hertig) and Da. isovespertilionis (Fairchild & Hertig). Some morphological nomenclature clarifications are suggested toward the standardization of immature descriptions, which, in turn, would allow detection of homologies for future integration of these developmental stages characters into a phylogenetic analyses.

  19. SEM studies on immature stages of the drone flies (diptera, syrphidae): Eristalis similis (Fallen, 1817) and Eristalis tenax (Linnaeus, 1758).

    PubMed

    Pérez-Bañón, Celeste; Hurtado, Pilar; García-Gras, Elena; Rojo, Santos

    2013-08-01

    Adult drone flies (Syrphidae: Eristalis spp.) resemble male honeybees in appearance. Their immature stages are commonly known as rat-tailed maggots due to the presence of a very long anal segment and a telescopic breathing tube. The larvae are associated with decaying organic material in liquid or semi-liquid media, as in the case of other saprophagous eristalines. Biological and morphological data were obtained from both laboratory cultures and sampling in the field. Drone flies are important pollinators for wild flowers and crops. In fact, mass rearing protocols of Eristalis species are being developed to be used as efficient alternative pollinators. However, deeper knowledge of larval morphology and biology is required to improve artificial rearing. The production quality control of artificial rearing must manage the consistency and reliability of the production output avoiding, for example contamination with similar species. This article presents the first description of the larva and puparium of E. similis, including a comparative morphological study of preimaginal stages of the anthropophilic and ubiquitous European hoverfly species E. tenax. Scanning electron microscopy has been used for the first time to describe larvae and puparia of both species. Moreover, the preimaginal morphology of E. similis has been compared with all known descriptions of the genus Eristalis. The main diagnostic characters of the preimaginal stages of E. similis are the morphology of the anterior spiracles (shape of clear area and arrangement of facets) and pupal spiracles (length, shape, and arrangement of tubercles).

  20. Efficacy of revascularization to induce apexification/apexogensis in infected, nonvital, immature teeth: a pilot clinical study.

    PubMed

    Shah, Naseem; Logani, Ajay; Bhaskar, Uday; Aggarwal, Vivek

    2008-08-01

    Endodontic treatment options for immature, nonvital teeth conventionally include surgical endodontics, apexification with calcium hydroxide, or single visit mineral trioxide aggregate plug. A new treatment option of revascularization has recently been introduced. It involves disinfecting the root canal system, providing a matrix of blood clot into which cells could grow, and sealing of the coronal access. The present pilot clinical study was undertaken to evaluate the efficacy of revascularization in 14 cases of infected, immature teeth. Endodontic treatment was initiated, and after infection control, revascularization was performed. The access cavity was sealed with glass ionomer cement. The cases were followed up at regular intervals of 3 months; the range in follow-up was 0.5-3.5 years. The outcomes were as follows. Radiographic resolution of periradicular radiolucencies was judged to be good to excellent in 93% (13 of 14) of the cases. In the majority of cases, a narrowing of the wide apical opening was evident. In 3 cases, thickening of apical dentinal walls and increased root length were observed. The striking finding was complete resolution of clinical signs and symptoms and appreciable healing of periapical lesions in 78% (11 of 14) of cases. Thickening of lateral dentinal walls was evident in 57% (8/14) of cases, and increased root length was observed in 71% (10/14) of cases. None of the cases presented with pain, reinfection, or radiographic enlargement of preexisting apical pathology. This pilot study documented a favorable outcome of revascularization procedures conducted in immature nonvital, infected permanent teeth.

  1. Impairment in natural killer cells editing of immature dendritic cells by infection with a virulent Trypanosoma cruzi population.

    PubMed

    Batalla, Estela I; Pino Martínez, Agustina M; Poncini, Carolina V; Duffy, Tomás; Schijman, Alejandro G; González Cappa, Stella M; Alba Soto, Catalina D

    2013-01-01

    Early interactions between natural killer (NK) and dendritic cells (DC) shape the immune response at the frontier of innate and adaptive immunity. Activated NK cells participate in maturation or deletion of DCs that remain immature. We previously demonstrated that infection with a high virulence (HV) population of the protozoan parasite Trypanosoma cruzi downmodulates DC maturation and T-cell activation capacity. Here, we evaluated the role of NK cells in regulating the maturation level of DCs. Shortly after infection with HV T. cruzi, DCs in poor maturation status begin to accumulate in mouse spleen. Although infection induces NK cell cytotoxicity and cytokine production, NK cells from mice infected with HV T. cruzi exhibit reduced ability to lyse and fail to induce maturation of bone marrow-derived immature DCs (iDCs). NK-mediated lysis of iDCs is restored by in vitro blockade of the IL-10 receptor during NK-DC interaction or when NK cells are obtained from T. cruzi-infected IL-10 knockout mice. These results suggest that infection with a virulent T. cruzi strain alters NK cell-mediated regulation of the adaptive immune response induced by DCs. This regulatory circuit where IL-10 appears to participate might lead to parasite persistence but can also limit the induction of a vigorous tissue-damaging T-cell response.

  2. Suitability and accessibility of immature Agrilus planipennis (Coleoptera: Buprestidae) stages to Tetrastichus planipennisi (Hymenoptera: Eulophidae).

    PubMed

    Ulyshen, Michael D; Duan, Jian J; Bauer, Leah S; Fraser, Ivich

    2010-08-01

    Tetrastichus planipennisi Yang (Hymenoptera: Eulophidae), a gregarious larval endo-parasitoid, is one of three biocontrol agents from Asia currently being released in the United States to combat the invasive emerald ash borer, Agrilus planipennis Fairmaire (Coleoptera: Buprestidae). The current protocol for rearing T. planipennisi involves presenting the wasps with artificially infested ash sticks made by placing field-collected larvae into shallow grooves beneath flaps of bark. Although third and fourth instars are readily accepted by T. planipennisi in these exposures, the suitability of younger or older developmental stages, which are often more readily available in the field, has not been tested. In this study, we used both artificially infested ash sticks and naturally infested ash logs to test which emerald ash borer developmental stages (second to fourth instars, J larvae [preprepupae], prepupae, and pupae) are most suitable for rearing T. planipennisi. T. planipennisi parasitized all stages except for pupae, but parasitized fewer J larvae and prepupae in naturally infested logs than in artificially infested ash sticks. This is probably because, in naturally infested ash logs, these stages were confined to pupal chambers excavated in the sapwood and may have been largely beyond the reach of ovipositing T. planipennisi. The number of T. planipennisi progeny produced was positively correlated (logarithmic) with host weight, but this relationship was stronger when J larvae and prepupae were excluded from the data set. Fourth instars yielded the most parasitoid progeny, followed by, in approximately equal numbers, J larvae, prepupae, and third instars. Second instars yielded too few parasitoid progeny to benefit rearing efforts.

  3. Feeding preferences of the immature stages of three western north American ixodid ticks (Acari) for avian, reptilian, or rodent hosts.

    PubMed

    Slowik, Ted J; Lane, Robert S

    2009-01-01

    Larval and nymphal Ixodes pacificus Cooley and Kohls, I. (Ixodes) jellisoni Cooley and Kohls, and Dermacentor occidentalis Marx were tested for host preference when simultaneously presented with a deer mouse (Peromyscus maniculatus Wagner), California kangaroo rat (Dipodomys californicus Merriam), western fence lizard (Sceloporus occidentalis Baird and Girard), and California towhee (Pipilo crissalis Vigors) in an experimental apparatus. Differences were observed in the preferences among the three species and between life stages. More larvae of all species approached and contacted hosts than did nymphs. Subadult I. pacificus entered all host-containing chambers in the highest numbers and remained on lizards most often after contact. Subadult I. jellisoni entered and remained in the chambers containing kangaroo rats, while rejecting mice, lizards, and birds as hosts. Subadult D. occidentalis most frequently entered rodent-containing chambers and contacted these hosts. After overnight exposure to all nonavian hosts, only I. pacificus parasitized and fed successfully on all three animals. I. jellisoni fed only on kangaroo rats and D. occidentalis fed only on rodents. Molting success ranged from approximately 66 to 95% among tick species and stages. We concluded that, under laboratory conditions, I. pacificus larvae and nymphs prefer western fence lizards, but also will parasitize rodents. Dermacentor occidentalis immatures use deer mice and kangaroo rats similarly, whereas I. jellisoni subadults exclusively parasitize kangaroo rats. California towhees are considerably less attractive as hosts for these three ticks. These host preferences are consistent with what is known about the natural feeding habits of all three ticks.

  4. A high-fat diet impairs reproduction by decreasing the IL1β level in mice treated at immature stage.

    PubMed

    Zhang, Jie; Li, Kai; Yuan, Miao; Zhang, Jie; Huang, Guizen; Ao, Jie; Tan, Haoze; Li, Yanyan; Gong, Di; Li, Jun; Kang, Lei; An, Nini; Li, Fei; Lin, Ping; Huang, Lugang

    2017-04-03

    Obesity causes low-grade inflammation that is involved in male infertility. Interleukin 1 beta (IL1β) plays an important role in this process. A high-fat diet (HFD) is the most common cause of obesity. However, the effect of a HFD on IL1β and its consequence in reproduction remain unclear. We established a HFD model in mice treated at immature stage (mice-TIS) and mice treated at mature stage (mice-TMS). Surprisingly, we found that a HFD decreased IL1β levels and was accompanied by an increase in testosterone in mice-TIS, while the reverse results were observed in mice-TMS. In addition, a HFD caused a reduction in testis macrophages and in the expression of inflammasome-related genes and proteins in mice-TIS. Furthermore, we found that IL1β inhibited testosterone secretion through down-regulating the gene expression of P450SCC and P450c17. However, the influence on mice-TIS that were induced by a HFD was recovered by stopping the HFD. In this study, we are the first to report that a HFD impairs the reproductive system by decreasing IL1β and enhancing testosterone levels in mice-TIS, which are different from the effects in mice-TMS. This provides new ideas for the treatment of obesity-induced infertility.

  5. Description of the Immature Stages of Anopheles (Nyssorhynchus) rondoni (Neiva & Pinto) (Diptera: Culicidae)

    DTIC Science & Technology

    1997-05-01

    length of 2-C; setae 1,2-P rarely sharing a common tubercle; seta 1 -P with narrow leaflets. The pupal stage is distinguished from other Nyssorhynchus...by having setae 1 -IV-VII and 5-V-VII branched. Only minor variation was found in setal counts between specimens from Peixoto de Azevedo, State of Mato...described. Peyton (1993) considered An. trinkae Partial support was provided by Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) (grant no. 95

  6. A comparison of a new centrifuge sugar flotation technique with the agar method for the extraction of immature Culicoides (Diptera: Ceratopogonidae) life stages from salt marsh soils.

    USDA-ARS?s Scientific Manuscript database

    Two sampling techniques, agar extraction (AE) and centrifuge sugar flotation extraction (CSFE) were compared to determine their relative efficacy to recover immature stages of Culicoides spp from salt marsh substrates. Three types of samples (seeded with known numbers of larvae, homogenized field s...

  7. Eremocoris juquilianus a new bug species from the mountains in Oaxaca, Mexico (Hemiptera: Rhyparochromidae: Drymini): with description of the immature stages.

    PubMed

    Peredo, Luis Cervantes; Brailovsky, Harry; Santacruz, Jezabel Baez; Brailovsky, Harry; Santacruz, Jezabel Baez

    2015-08-18

    The genus Eremocoris Fieber is represented by 43 species, and three subspecies, 14 and 3 are Palearctic, 5 Oriental, 3 Afrotropical and 21 Nearctic. 14 species are recorded in Mexico.  This contribution contains descriptions and illustrations of the adult and all immature stages of Eremocoris juquilianus sp. nov. and notes on its biology, habitat, and distribution in Mexico.

  8. Description of the immature stages of Kuwanina betula Wu & Liu, with a discussion of its placement in the Acanthococcidae family group (Hemiptera: Coccoidea).

    PubMed

    Wu, San-An; Nan, Nan

    2015-03-09

    The immature stages of Kuwanina betula Wu & Liu are described and illustrated. Based on morphological and molecular data (18S and 28S rDNA), it is argued that K. betula is closer to Pseudochermes Nitsche than to Kuwanina Cockerell in Fernald and so this species is transferred to Pseudochermes as P. betula (Wu & Liu) comb. nov..

  9. Effect of attractant sex pheromone on immature larval stages of ixodid tick species.

    PubMed

    Ranju, R S; Latha, Bhaskaran Ravi; Leela, V; Basith, S Abdul

    2012-10-01

    Attractant sex pheromone (ASP) 2,6-dichloro phenol was used in the current study to evaluate the percentage attraction and the behavioural responses of the five ixodid tick species namely Rhipicephalus sanguineus, Rhipicephalus microplus (Boophilus microplus), Haemaphysalis bispinosa, Rhipicephalus haemaphysaloides and Hyalomma marginatum using petridish bioassay. Two concentrations of 2,6-DCP (0.1 M and 0.05 M) was used for the larval stages of all five ixodid tick species of which 0.1 M concentration was found to have maximum attraction. Trials with 0.1 M ASP revealed highest per cent of attraction in R. sanguineus larvae (71 %) followed by H. bispinosa (55 %) and R. microplus (55 %). With 0.1 M ASP R. haemaphysaloides and H. marginatum showed least attraction (39 % each). However the per cent of attraction of R. haemaphysaloides was higher (46 %) with 0.05 M ASP. Statistical analysis revealed a highly significant difference in per cent of attraction between the different tick larvae using 0.05 and 0.1 M ASP. The larvae also exhibited behavioural responses such as feeding, probing, resting and questing posture.

  10. Investigation of the immature stage of the cord blood banks and their regulation in China.

    PubMed

    Liu, Yinliang

    2008-12-01

    Cord blood banks (CBBs) collect umbilical cord blood and isolate therefrom the stem cells which may be transplanted into patients serving treatment of many kinds of serious diseases. As one kind of health resource, CBBs need regulation to guarantee its fair development and safe application. During the past decade, several CBBs have been established in China and related measures have been administered to regulate their establishment and manipulation. How about the actual situation of CBBs in China, including, how are they regulated and what are the problems with the CBBs in practice? Upon introduction to cord blood and the CBBs, this paper investigates the practical situation of the CBBs in China and their regulation, and explores the corresponding problems which need to be dealt with. It is held that the CBB system in China is still at an initial stage, not only for its establishment and operation, but for its regulation as well; and, therefore, justification of a more sustainable CBB system for a better development is needed in China.

  11. Laboratory Evaluation of Isaria fumosorosea CCM 8367 and Steinernema feltiae Ustinov against Immature Stages of the Colorado Potato Beetle

    PubMed Central

    Hussein, Hany M.; Skoková Habuštová, Oxana; Půža, Vladimír; Zemek, Rostislav

    2016-01-01

    The Colorado potato beetle, Leptinotarsa decemlineata, has developed resistance to most registered pesticides and has become one of the most difficult insect pests to control. Development of new biopesticides targeting this pest might solve the resistance problem and contribute to sustainable crop production. Laboratory experiments were conducted to assess the efficacy of Isaria fumosorosea (syn. Paecilomyces fumosoroseus) strain CCM 8367 against L. decemlineata when applied alone or combined with the entomopathogenic nematode Steinernema feltiae. The last-instar larvae of the Colorado potato beetle showed the highest susceptibility to I. fumosorosea followed by pre-pupae and pupae. The median lethal concentration (LC50) was estimated to be 1.03×106 blastospores/ml. The strain CCM 8367 was more virulent, causing 92.6% mortality of larvae (LT50 = 5.0 days) compared to the reference strain Apopka 97, which caused 54.5% mortality (LT50 = 7.0 days). The combined application of the fungus with the nematodes increased the mortality up to 98.0%. The best results were obtained when S. feltiae was applied simultaneously with I. fumosorosea (LT50 = 2.0 days); later application negatively affected both the penetration rate and the development of the nematodes. We can conclude that the strain CCM 8367 of I. fumosorosea is a prospective biocontrol agent against immature stages of L. decemlineata. For higher efficacy, application together with an entomopathogenic nematode is recommended. PMID:27015633

  12. [Seasonal variation of immature stages of Phyllocnistis citrella Stainton (Lepidoptera: Gracillariidae) in Citrus sinensis orchards under two management systems].

    PubMed

    Greve, Caroline; Redaelli, Luiza R

    2006-01-01

    Phyllocnistis citrella Stainton is considered an important pest of citrus, causing both direct (reduction on the photosynthetic area) and indirect damage (facilitation of invasion by bacteria that cause citrus canker). The lack of information about the population dynamics of P. citrella, considering the cultivation systems and varieties grown in citrus orchards in Rio Grande do Sul, Brazil, motivated this study. It aimed to evaluate the seasonal variation of immature stages of P. citrella, from June 2002 to July 2003, in two orchards of Citrus sinensis, cv. 'Valencia', one maintained according to organic management principles and the other under conventional ones. Fortnightly samplings were carried out, being one shoot collected from each one of 27 randomly chosen plants. The leaves were analyzed for the presence of eggs, larvae, pupae and mines of P. citrella. Leafminer was recorded from October 2002 to April 2003 in the organic orchard, and from November 2002 to July 2003 in the conventional one. A relationship between population size and resource availability (young leaves) was observed. However, population establishment does not depend exclusively on the existence of resources, but also on suitable climatic conditions. This was evidenced by the absence of attacks on the first shooting, which began in late winter. Meteorological factors and resource availability as a whole explain about 64% and 53% of the observed variation in the population size of P. citrella, respectively in the organic and conventional orchards.

  13. Description of the natural history and immature stages of Postplatyptilia caribica Gielis in Puerto Rico (Lepidoptera: Pterophoridae).

    PubMed

    Matthews, Deborah L; Pérez, Mervin E

    2014-06-23

    Observations of the life history of a plume moth, Postplatyptilia caribica Gielis are presented along with an adult diagnosis and descriptions of the final instar larva and pupa. The species was previously known only from two female specimens. Illustrations are provided for the adults and immatures, including both male and female genitalia. Morphological characters of the adults and immatures are discussed and compared with other members of the tribe Platyptiliini. Identification of adults and immatures is especially important because one of the larval hostplants, Gesneria pauciflora Urb., is a threatened endemic species of Puerto Rico. The plant family Gesneriaceae is a new addition to the known plant families used by Pterophoridae.

  14. Efficacy of emodepside plus praziquantel tablets (Profender tablets for dogs) against mature and immature adult Ancylostoma caninum and Uncinaria stenocephala infections in dogs.

    PubMed

    Schimmel, Annette; Altreuther, Gertraut; Schroeder, Iris; Charles, Samuel; Cruthers, Larry; Ketzis, Jennifer; Kok, Dawid J; Kraemer, Friederike; McCall, John W; Krieger, Klemens J

    2009-08-01

    This paper reports the efficacy of a novel flavoured tablet formulation of emodepside plus praziquantel (Profender tablets for dogs) against mature and immature adult hookworms (Ancylostoma caninum and Uncinaria stenocephala) in dogs. The tablets were used at the minimum recommended dose of 1 mg emodepside and 5 mg praziquantel per kg body weight. Four randomised, blinded and controlled laboratory studies demonstrated >95% efficacy against mature and immature adult stages of U. stenocephala and four randomised, blinded and controlled laboratory studies demonstrated >98% efficacy against mature and immature adult stages of A. caninum. No side effects of the treatment were observed. It is concluded that the emodepside plus praziquantel tablet is an effective and safe treatment against mature and immature hookworms.

  15. Occurrence of emerald ash borer (Coleoptera: Buprestidae) and biotic factors affecting its immature stages in the Russian Far East.

    PubMed

    Duan, Jian J; Yurchenko, Galina; Fuester, Roger

    2012-04-01

    Field surveys were conducted from 2008 to 2011 in the Khabarovsk and Vladivostok regions of Russia to investigate the occurrence of emerald ash borer, Agrilus planipennis Fairmaire, and mortality factors affecting its immature stages. We found emerald ash borer infesting both introduced North American green ash (Fraxinus pennsylvanica Marshall) and native oriental ashes (F. mandshurica Rupr. and F. rhynchophylla Hance) in both regions. Emerald ash borer densities (larvae/m(2) of phloem area) were markedly higher on green ash (11.3-76.7 in the Khabarovsk area and 77-245 in the Vladivostok area) than on artificially stressed Manchurian ash (2.2) or Oriental ash (10-59). Mortality of emerald ash borer larvae caused by different biotic factors (woodpecker predation, host plant resistance and/or undetermined diseases, and parasitism) varied with date, site, and ash species. In general, predation of emerald ash borer larvae by woodpeckers was low. While low rates (3-27%) of emerald ash borer larval mortality were caused by undetermined biotic factors on green ash between 2009 and 2011, higher rates (26-95%) of emerald ash borer larval mortality were caused by putative plant resistance in Oriental ash species in both regions. Little (<1%) parasitism of emerald ash borer larvae was observed in Khabarovsk; however, three hymenopteran parasitoids (Spathius sp., Atanycolus nigriventris Vojnovskaja-Krieger, and Tetrastichus planipennisi Yang) were observed attacking third - fourth instars of emerald ash borer in the Vladivostok area, parasitizing 0-8.3% of emerald ash borer larvae infesting Oriental ash trees and 7.3-62.7% of those on green ash trees (primarily by Spathius sp.) in two of the three study sites. Relevance of these findings to the classical biological control of emerald ash borer in newly invaded regions is discussed.

  16. Novel leukemic lymphoma with probable derivation from immature stage of natural killer (NK) lineage in an aged patient.

    PubMed

    Kawano, S; Tatsumi, E; Yoneda, N; Yamaguchi, N; Goji, J; Ito, H; Nagai, T; Nishikori, M; Okamura, A; Koiwai, O

    1995-01-01

    A 66-year-old male patient was admitted with dyspnea; physical examination revealed petechiae and systemic lymphadenopathy. Laboratory findings showed leukemia. The blasts in the peripheral blood were negative for cytochemical myeloperoxidase, and had condensed nuclear chromatin with a nucleolus. The histological diagnosis of the biopsied neck lymph node was lymphoblastic lymphoma. The leukemia cells expressed CD2, CD6, CD7, CD13low, CD56, beta chain of IL-2 receptorlow (IL-2R beta), and HLA-DR antigens, but not other pan-T (CD5, CD3, CD4, and CD8); pan-B (CD10, CD19, CD20, and CD24); natural killer (NK) (CD16, CD57); or myeloid (CD33) antigens. Electronmicroscopy revealed convoluted nuclei with conspicuous nucleoli and peripherally condensed heterochromatin. Membrane-bound granules containing an electron dense matrix were observed in the cytoplasm, indicating the NK cell nature of the neoplastic cells. While terminal deoxynucleotidyl transferase (TdT) and cytoplasmic CD3 were not detected by immunofluorescence on fixed smears, Northern blot analysis revealed the gene expression of CD3 epsilon, CD3 zeta, and TdT. Gene rearrangement analysis revealed that the beta, gamma, and delta chains of T-cell receptor (TCR) and immunoglobulin heavy chain (IgH) were of germline genotype. While the overall interpretation of the phenotype and genotype was difficult, the derivation of an immature stage of NK lineage was strongly suggested, based predominantly on the electronmicroscopic features. Despite initially successful chemotherapy, the patient died 14 months after initial presentation.

  17. The morphology of the immature stages of two rare Lixus species (Coleoptera, Curculionidae, Lixinae) and notes on their biology.

    PubMed

    Trnka, Filip; Stejskal, Robert; Skuhrovec, Jiří

    2016-01-01

    The mature larvae and pupae of Lixus (Ortholixus) bituberculatus Smreczyński, 1968 and Lixus (Dilixellus) neglectus Fremuth, 1983 (Curculionidae: Lixinae: Lixini) are described and compared with known larvae of 21 other Lixus and 2 Hypolixus taxa. The mature larva and pupa of Lixus bituberculatus are the first immature stages described representing the subgenus Ortholixus. The larva of Lixus neglectus, in the subgenus Dilixellus, is distinguished from the known larvae of four species in this subgenus by having more pigmented sclerites on the larval body. All descriptions of mature larvae from the tribe Lixini, as do all known species from the tribe Cleonini, fit the diagnosis of the mature larva of the Lixinae subfamily. Furthermore, new biological information of these species in the Czech Republic, Slovakia and Romania is provided. For Lixus bituberculatus, a chicory, Cichorium intybus L. (Asteraceae), is identified as a host plant, and Lixus neglectus is found on dock Rumex thyrsiflorus Fingerh. (Polygonaceae). Both species are probably monophagous or oligophagous. Adults of Lixus bituberculatus often inhabit host plants growing in active, dry and sunny pastures with sparse patches without vegetation, being mostly active during the night in April/May and then again in September, when the highest activity levels are observed. Adults of Lixus neglectus inhabit dry grasslands on sandy soils with host plants, being active during the day from May to September, with the highest level of activity in May/June and September. The larvae of both species are borers in the stem and root of the host plant, and they pupate in root or root neck. Adults leave the pupation cells at the end of summer and do not hibernate in the host plants. Finally, Romania is a new geographic record for Lixus bituberculatus.

  18. The morphology of the immature stages of two rare Lixus species (Coleoptera, Curculionidae, Lixinae) and notes on their biology

    PubMed Central

    Trnka, Filip; Stejskal, Robert; Skuhrovec, Jiří

    2016-01-01

    Abstract The mature larvae and pupae of Lixus (Ortholixus) bituberculatus Smreczyński, 1968 and Lixus (Dilixellus) neglectus Fremuth, 1983 (Curculionidae: Lixinae: Lixini) are described and compared with known larvae of 21 other Lixus and 2 Hypolixus taxa. The mature larva and pupa of Lixus bituberculatus are the first immature stages described representing the subgenus Ortholixus. The larva of Lixus neglectus, in the subgenus Dilixellus, is distinguished from the known larvae of four species in this subgenus by having more pigmented sclerites on the larval body. All descriptions of mature larvae from the tribe Lixini, as do all known species from the tribe Cleonini, fit the diagnosis of the mature larva of the Lixinae subfamily. Furthermore, new biological information of these species in the Czech Republic, Slovakia and Romania is provided. For Lixus bituberculatus, a chicory, Cichorium intybus L. (Asteraceae), is identified as a host plant, and Lixus neglectus is found on dock Rumex thyrsiflorus Fingerh. (Polygonaceae). Both species are probably monophagous or oligophagous. Adults of Lixus bituberculatus often inhabit host plants growing in active, dry and sunny pastures with sparse patches without vegetation, being mostly active during the night in April/May and then again in September, when the highest activity levels are observed. Adults of Lixus neglectus inhabit dry grasslands on sandy soils with host plants, being active during the day from May to September, with the highest level of activity in May/June and September. The larvae of both species are borers in the stem and root of the host plant, and they pupate in root or root neck. Adults leave the pupation cells at the end of summer and do not hibernate in the host plants. Finally, Romania is a new geographic record for Lixus bituberculatus. PMID:27551208

  19. Morphology of immature stages of blow fly, Lucilia sinensis Aubertin (Diptera: Calliphoridae), a potential species of forensic importance.

    PubMed

    Sanit, Sangob; Sukontason, Kom; Kurahashi, Hiromu; Tomberlin, Jeffery K; Wannasan, Anchalee; Kraisittipanit, Rungroj; Sukontason, Kabkaew L

    2017-09-20

    Lucilia sinensis Aubertin (Diptera: Calliphoridae) is a blow fly species of potential forensic importance since adults are attracted to, and colonize, decomposing vertebrate remains. Blow fly larvae associated with human corpses can be useful evidence in forensic investigations; however, their use is dependent in most cases on proper species identification and availability of developmental data. For identification, morphological information on each life stage is traditionally used. We used scanning electron microscopy (SEM) to examine the ultrastructure of eggs, all instars, and puparia, of L. sinensis. The important characteristics used to differentiate L. sinensis from other species are provided. Distinctive features of the eggs are the slight widening median area extending almost the entire length. The last abdominal segment of the first instar bears elongated outer ventral tubercles along the rim of the last abdominal segment. These tubercles, as well as the well developed median and outer dorsal tubercles, are more prominent in the second and third instars. The surface integument of the tubercles is equipped with circular rows of microtrichia. Pairs of inner dorsal tubercle are absent. Each anterior spiracle is comprised of 9-12 papillae arrange in a single row in the second and third instars. As for the third instar, the dorsal spines between the first and second thoracic segments are delicate, narrow, small, and close together (as row or set). The peristigmatic tufts adjacent to the posterior spiracle of the third instar are moderately branches of short, fine hairs, but minute in puparia. In conclusion, the prominent outer ventral tubercle in all instars and puparia is a new diagnostic feature of L. sinensis and helpful in differentiating it from other Lucilia species that are forensically important. The description of immature L. sinensis in this study will be useful for forensic entomologists in countries where this species exists. Copyright © 2017

  20. Stimulation of immature lung macrophages with intranasal interferon gamma in a novel neonatal mouse model of respiratory syncytial virus infection.

    PubMed

    Empey, Kerry M; Orend, Jacob G; Peebles, R Stokes; Egaña, Loreto; Norris, Karen A; Oury, Tim D; Kolls, Jay K

    2012-01-01

    Respiratory syncytial virus (RSV) is the leading cause of bronchiolitis and viral death in infants. Reduced CD8 T-cells and negligible interferon gamma (IFNγ) in the airway are associated with severe infant RSV disease, yet there is an abundance of alveolar macrophages (AM) and neutrophils. However, it is unclear, based on our current understanding of macrophage functional heterogeneity, if immature AM improve viral clearance or contribute to inflammation and airway obstruction in the IFNγ-deficient neonatal lung environment. The aim of the current study was to define the age-dependent AM phenotype during neonatal RSV infection and investigate their differentiation to classically activated macrophages (CAM) using i.n. IFNγ in the context of improving viral clearance. Neonatal and adult BALB/cJ mice were infected with 1×10(6) plaque forming units (PFU)/gram (g) RSV line 19 and their AM responses compared. Adult mice showed a rapid and robust CAM response, indicated by increases in major histocompatibility complex class II (MHC II), CD86, CCR7, and a reduction in mannose receptor (MR). Neonatal mice showed a delayed and reduced CAM response, likely due to undetectable IFNγ production. Intranasal (i.n.) treatment with recombinant mouse IFNγ (rIFNγ) increased the expression of CAM markers on neonatal AM, reduced viral lung titers, and improved weight gain compared to untreated controls with no detectable increase in CD4 or CD8 T-cell infiltration. In vitro infection of J774A.1 macrophages with RSV induced an alternatively activated macrophage (AAM) phenotype however, when macrophages were first primed with IFNγ, a CAM phenotype was induced and RSV spread to adjacent Hep-2 cells was reduced. These studies demonstrate that the neonatal AM response to RSV infection is abundant and immature, but can be exogenously stimulated to express the antimicrobial phenotype, CAM, with i.n. rIFNγ.

  1. Gr-1dimCD11b+ immature myeloid-derived suppressor cells but not neutrophils are markers of lethal tuberculosis infection in mice.

    PubMed

    Tsiganov, Evgeny N; Verbina, Elena M; Radaeva, Tatiana V; Sosunov, Vasily V; Kosmiadi, George A; Nikitina, Irina Yu; Lyadova, Irina V

    2014-05-15

    Tuberculosis (TB) disease may progress at different rates and have different outcomes. Neutrophils have been implicated in TB progression; however, data on their role during TB are controversial. In this study, we show that in mice, TB progression is associated with the accumulation of cells that express neutrophilic markers Gr-1 and Ly-6G but do not belong to conventional neutrophils. The cells exhibit unsegmented nuclei, have Gr-1(dim)Ly-6G(dim)CD11b(+) phenotype, and express F4/80, CD49d, Ly-6C, CD117, and CD135 markers characteristic not of neutrophils but of immature myeloid cells. The cells accumulate in the lungs, bone marrow, spleen, and blood at the advanced (prelethal) stage of Mycobacterium tuberculosis infection and represent a heterogeneous population of myeloid cells at different stages of their differentiation. The accumulation of Gr-1(dim)CD11b(+) cells is accompanied by the disappearance of conventional neutrophils (Gr-1(hi)Ly-6G(hi)-expressing cells). The Gr-1(dim)CD11b(+) cells suppress T cell proliferation and IFN-γ production in vitro via NO-dependent mechanisms, that is, they exhibit characteristics of myeloid-derived suppressor cells. These results document the generation of myeloid-derived suppressor cells during TB, suggesting their role in TB pathogenesis, and arguing that neutrophils do not contribute to TB pathology at the advanced disease stage.

  2. Evaluation of aqueous and ethanol extract of bioactive medicinal plant, Cassia didymobotrya (Fresenius) Irwin & Barneby against immature stages of filarial vector, Culex quinquefasciatus Say (Diptera: Culicidae)

    PubMed Central

    Nagappan, Raja

    2012-01-01

    Objective To evaluate aqueous and ethanol extract of Cassia didymobotrya leaves against immature stages of Culex quinquefasciatus. Methods The mortality rate of immature mosquitoes was tested in wide and narrow range concentration of the plant extract based on WHO standard protocol. The wide range concentration tested in the present study was 10 000, 1 000, 100, 10 and 1 mg/L and narrow range concentration was 50, 100, 150, 200 and 250 mg/L. Results 2nd instar larvae exposed to 100 mg/L and above concentration of ethanol extract showed 100% mortality. Remaining stages such as 3rd, 4th and pupa, 100% mortality was observed at 1 000 mg/L and above concentration after 24 h exposure period. In aqueous extract all the stages 100% mortality was recorded at 1 000 mg/L and above concentration. In narrow range concentration 2nd instar larvae 100% mortality was observed at 150 mg/L and above concentration of ethanol extract. The remaining stages 100% mortality was recorded at 250 mg/L. In aqueous extract all the tested immature stages 100% mortality was observed at 250 mg/L concentration after 24 h exposure period. The results clearly indicate that the rate of mortality was based dose of the plant extract and stage of the mosquitoes. Conclusions From this study it is confirmed and concluded that Cassia didymobotrya is having active principle which is responsible for controlling Culex quinquefasciatus. The isolation of bioactive molecules and development of simple formulation technique is important for large scale implementation. PMID:23569999

  3. Evaluation of aqueous and ethanol extract of bioactive medicinal plant, Cassia didymobotrya (Fresenius) Irwin & Barneby against immature stages of filarial vector, Culex quinquefasciatus Say (Diptera: Culicidae).

    PubMed

    Nagappan, Raja

    2012-09-01

    To evaluate aqueous and ethanol extract of Cassia didymobotrya leaves against immature stages of Culex quinquefasciatus. The mortality rate of immature mosquitoes was tested in wide and narrow range concentration of the plant extract based on WHO standard protocol. The wide range concentration tested in the present study was 10 000, 1 000, 100, 10 and 1 mg/L and narrow range concentration was 50, 100, 150, 200 and 250 mg/L. 2nd instar larvae exposed to 100 mg/L and above concentration of ethanol extract showed 100% mortality. Remaining stages such as 3rd, 4th and pupa, 100% mortality was observed at 1 000 mg/L and above concentration after 24 h exposure period. In aqueous extract all the stages 100% mortality was recorded at 1 000 mg/L and above concentration. In narrow range concentration 2nd instar larvae 100% mortality was observed at 150 mg/L and above concentration of ethanol extract. The remaining stages 100% mortality was recorded at 250 mg/L. In aqueous extract all the tested immature stages 100% mortality was observed at 250 mg/L concentration after 24 h exposure period. The results clearly indicate that the rate of mortality was based dose of the plant extract and stage of the mosquitoes. From this study it is confirmed and concluded that Cassia didymobotrya is having active principle which is responsible for controlling Culex quinquefasciatus. The isolation of bioactive molecules and development of simple formulation technique is important for large scale implementation.

  4. Under Cover of Darkness, Caterpillars Take Flight: The Immature Stages and Feeding Ecology of the Glasswinged Butterfly, Oleria baizana in Eastern Ecuador

    PubMed Central

    Walla, Thomas R.; Greeney, Harold F.

    2012-01-01

    This paper describes the morphology and behavior of the immature stages of Oleria baizana (Haensch) (Lepidoptera: Nymphalidae) from northeastern Ecuador. Brugmansia aurea Lagerh. (Solanales: Solanaceae) is the larval food plant. Eggs are laid singly, off of the host plant in the leaf litter. During the night, larvae climb a food plant seedling and sever a leaf petiole, parachuting with the leaf to the ground where they remain while feeding. Oleria baizana has five larval stadia, and individuals take 77 days to mature from oviposition to adult stage. PMID:23438050

  5. Description of the immature stages and redescription of the female of Ixodes schulzei Aragão & Fonseca, 1951 (Acari: Ixodidae), an endemic tick species of Brazil.

    PubMed

    Barros-Battesti, Darci M; Onofrio, Valeria C; Faccini, João L H; Labruna, Marcelo B; Arruda-Santos, Ana D; Giacomin, Flávia G

    2007-11-01

    Ixodes schulzei Aragão & Fonseca, 1951 is a tick endemic to Brazil, where nine species of Ixodes Latreille, 1796 are currently known to occur. Larvae, nymphs and females of I. schulzei were obtained from a laboratory colony originating from an engorged female collected on a free-living water rat Nectomys squamipes from the Santa Branca municipality, São Paulo State. Only female ticks were obtained from engorged nymphs. Unfed immature and female adult specimens were measured and the descriptions were based on optical and scanning electron microscopy, as were drawings of some features of the larva. Both immature stages present the very long palpi and basis capituli, and the female has large, contiguous porose areas. However, the basis capituli is triangular, with a slight central elevation in the larva and nymph, whereas in the female this area is depressed. The I. schulzei types deposited at the FIOCRUZ (Instituto Oswaldo Cruz) were also examined, as was other material from collections, such as the IBSP (Coleção Acarológica do Instituto Butantan), CNC-FMVZ/USP (Coleção Nacional de Carrapatos da Faculdade de Medicina Veterinária e Zootecnia da USP) and USNTC (United States National Tick Collection). In addition, the relationship between I. schulzei and other immature neotropical species of Ixodes is discussed.

  6. [Identification of species of Hyalomma asiaticum group (Ixodidae) in areas of their sympatry based on immature stages].

    PubMed

    Apanaskevich, D A

    2002-01-01

    Morphological characters of immature stages of three closely related tick species, Hyalomma asiaticum Schulze et Schlottke, 1929, H. dromedarii Koch, 1844 and H. schulzei Olenev, 1931, collected mainly in areas of their sympatry (Fig. 1) were investigated. The larvae and nymphs of these three species were collected in Egypt, Iran, Turkmenistan, Uzbekistan, Afghanistan and Tadjikistan: 159 larvae and 137 nymphs of H. asiaticum from 12 localities; 78 larvae and 167 nymphs of H. dromedarii from 5 localities; 30 larvae and 6 nymphs of H. schulzei from one locality. Both qualitative morphological features and measured character (in mkm) were used to discriminate these species. Main discriminant characters for larvae. H. asiaticum (Fig. 3). Scutum: length < 246, width < 389; base of capitulum: width < 158, dorsally hexagonal, apices of lateral projections directed forward; palpae (II and III segments): length < 106, width < 42; hypostome: length < 87, width < 25; the spur of coxa I small, equilateral triangular; patella: length < 154. H. dromedarii (Fig. 4). Scutum: length > 236, width > 379; base of capitulum: width > 158, dorsally almost triangular, apices of lateral projections directed laterally or backward; palpae: length > 110, width < 46; hypostome: length > 87, width < 26; the spur of coxa I large, isosceles triangular; patella: length > 115. H. schulzei (Fig. 5). Scutum: length > 249, width > 407; base of capitulum: width > 162, dorsally hexagonal, apices of lateral projections directed forward; palpae: length > 114, width > 44; hypostome: length > 89, width > 28; the spur of coxa I large, isosceles triangular; patella: length > 164. Main discriminant characters for nymphs: H. asiaticum (Fig. 3). Scutum: small, width < 650, length and width subequal, posterior margin widely rounded, lateral incisions weakly developed; spiracular plates with distinct, pointed dorsal projection, marginal row of perforations distant from the base of dorsal projection, submarginal

  7. Late Stage Infection in Sleeping Sickness

    PubMed Central

    Acker, Sven; Frey, Claudia; Meinert, Monika; Schönfeld, Caroline; Lazarus, Michael; Urade, Yoshihiro; Kubata, Bruno Kilunga; Duszenko, Michael

    2012-01-01

    At the turn of the 19th century, trypanosomes were identified as the causative agent of sleeping sickness and their presence within the cerebrospinal fluid of late stage sleeping sickness patients was described. However, no definitive proof of how the parasites reach the brain has been presented so far. Analyzing electron micrographs prepared from rodent brains more than 20 days after infection, we present here conclusive evidence that the parasites first enter the brain via the choroid plexus from where they penetrate the epithelial cell layer to reach the ventricular system. Adversely, no trypanosomes were observed within the parenchyma outside blood vessels. We also show that brain infection depends on the formation of long slender trypanosomes and that the cerebrospinal fluid as well as the stroma of the choroid plexus is a hostile environment for the survival of trypanosomes, which enter the pial space including the Virchow-Robin space via the subarachnoid space to escape degradation. Our data suggest that trypanosomes do not intend to colonize the brain but reside near or within the glia limitans, from where they can re-populate blood vessels and disrupt the sleep wake cycles. PMID:22496723

  8. Late stage infection in sleeping sickness.

    PubMed

    Wolburg, Hartwig; Mogk, Stefan; Acker, Sven; Frey, Claudia; Meinert, Monika; Schönfeld, Caroline; Lazarus, Michael; Urade, Yoshihiro; Kubata, Bruno Kilunga; Duszenko, Michael

    2012-01-01

    At the turn of the 19(th) century, trypanosomes were identified as the causative agent of sleeping sickness and their presence within the cerebrospinal fluid of late stage sleeping sickness patients was described. However, no definitive proof of how the parasites reach the brain has been presented so far. Analyzing electron micrographs prepared from rodent brains more than 20 days after infection, we present here conclusive evidence that the parasites first enter the brain via the choroid plexus from where they penetrate the epithelial cell layer to reach the ventricular system. Adversely, no trypanosomes were observed within the parenchyma outside blood vessels. We also show that brain infection depends on the formation of long slender trypanosomes and that the cerebrospinal fluid as well as the stroma of the choroid plexus is a hostile environment for the survival of trypanosomes, which enter the pial space including the Virchow-Robin space via the subarachnoid space to escape degradation. Our data suggest that trypanosomes do not intend to colonize the brain but reside near or within the glia limitans, from where they can re-populate blood vessels and disrupt the sleep wake cycles.

  9. Egg Hatching and Survival of Immature Stages of Aedes aegypti (Diptera: Culicidae) Under Natural Temperature Conditions During the Cold Season in Buenos Aires, Argentina.

    PubMed

    De Majo, María Sol; Montini, Pedro; Fischer, Sylvia

    2017-01-01

    In temperate regions, the seasonal dynamics of Aedes aegypti (L.) (Diptera: Culicidae) is mainly influenced by temperature. It is assumed that, during the winter season, the population remains as eggs and that the development and population growth of surviving eggs begin during the following spring. The aim of the current study was to assess egg hatching of Ae. aegypti during the winter in Buenos Aires city (Argentina), and analyze the survival of immature stages. The experiments consisted of immersing eggs and studying the development of immature stages of cohorts from June and September under natural temperature conditions. The proportion of hatched eggs was compared between weeks of immersion and related to environmental variables. Survival was compared among cohorts and the development rate was related to the mean temperature during development. The results showed that, with few exceptions, egg hatching was over 45% during the winter period. The proportion of hatched eggs was positively associated with immersion temperature, pre-immersion temperature and photoperiod. The immature stages completed the development during the cold season, with a trend toward increased survival of late-hatching cohorts. Survival was 30% at 13.2 °C and above 90% at 20 °C, whereas the development time at low temperatures was 49.4 d at 13.2 °C and 17.7 d at 20 °C. The high hatching and survival compared with other studies suggest that the local population might be adapting to winter conditions. The anticipated emergence of adults would be adaptive if they are able to reproduce successfully in the early spring.

  10. Descriptions of the immature stages and new host plant records of Notozulia entreriana (Berg) (Hemiptera: Cercopidae) pests of grasses in subtropical areas of the Americas.

    PubMed

    Foieri, Alvaro; Lenicov, Ana M Marino De Remes; Virla, Eduardo G

    2016-04-11

    Notozulia entreriana (Berg) (Hemiptera: Cercopidae) is one of the most common spittlebugs inhabiting the subtropical region of the America, inflicting important economic damage to grass crops. The immature stages are described and illustrated; the main characteristics that distinguish instars are the body size, color, number of flagellomeres, and number of tibial and metatarsomere spines. A key for identification of nymphs is provided as a tool to develop field studies.  Nine host plants, all belonging to Poaceae, are recorded as breeding and feeding host plants from different localities in northern Argentina.

  11. Description of the immature stages and new host plant records of Deois (Deois) mourei (Berg) (Hemiptera: Cercopidae), a species newly recorded from Argentina and Paraguay.

    PubMed

    Foieri, Alvaro; Lenicov, Ana M Marino De Remes; Virla, Eduardo G

    2016-09-06

    Deois (Deois) mourei Cavichioli & Sakakibara (Hemiptera: Cercopidae) is recorded for the first time from Argentina and Paraguay. The eggs and immature stages of the species are described and illustrated; the main characters that distinguish instars are body size, color, number of flagellomeres, and number of tibial and metatarsomere spines. A key for identification of nymphs of D. (D.) mourei and a key to differentiate nymphs of the sympatric species D. (D.) mourei and Notozulia entreriana Berg are provided. In addition, a list of host plants of D. (D.) mourei in Argentina is given.

  12. Association of immature stages of some caddisfly species from northwestern Argentina with description of a new species of Helicopsyche (Trichoptera: Helicopsychidae).

    PubMed

    Martín, Paola A Rueda; Miranda, Águeda Verónica Isa

    2015-04-24

    The adult, larva, and pupa of Helicopsyche obscura sp. nov. from northwestern Argentina are described and illustrated. Descriptions and illustrations of adults and associated pupae and larvae of Helicopsyche turbida Navás and Leptonema boliviense boliviense Mosely are included. The associations of immature stages were made using the metamorphotype method. Helicopsyche turbida is newly recorded from Tucumán province. The adult males of H. obscura sp. nov. and H. turbida have similar structure in the genital segments, however, the most clear differences are in the general color and size of the adult, and in the color, size, and morphology of the metanota in the larval stages as well as the shapes of mandibles, hook plates, and terminal segments of the pupal stages. The larva and pupa of L. boliviense boliviense are compared with those of L. columbianum and other previously described species, providing differences in color, chaetotaxy, and morphology.

  13. Ultrastructure analysis of the immature stages of Ravinia belforti (Diptera: Sarcophagidae), a species of medical-veterinary and forensic importance, by scanning electron microscopy.

    PubMed

    da-Silva-Xavier, Alexandre; de Carvalho Queiroz, Margareth Maria

    2016-07-01

    The postmortem interval is related to the age of immature species of flies found on corpses and can be estimated using data available in the literature on the biology of the species. The flesh fly Ravinia belforti is a carrier of enteric pathogens that can affect human and animal health as well as being of forensic importance. As the morphology of many immature Sarcophagidae is unknown, these immature forms must be collected and characterized after the emergence of the adult male. Here we describe and analyze the morphological characteristics of the larvae stages L1, L2, L3 and the puparium of R. belforti by scanning electron microscopy (SEM). Ten specimens of each stage were analyzed. Larvae of R. belforti follow the typical muscoid vermiform pattern with 12 segments. The anterior region is pointed, while the posterior region is thicker. The spines of the cephalic collar are flattened and with double, triple or quadruple points, different from the spines along the body that only have a single point. In L2, the anterior spiracle is present with a varying number of papillae (16-22), differing from other species. The posterior spiracles are located within the peritreme. The spiracular cavity is internalized in the posterior region, following the pattern that differs Sarcophagidae from other families. L3 features more visible and developed spines around the cephalic collar, getting thicker and denser near to the first thoracic segment. Puparium is similar to other species of Sarcophagidae. This paper presents important data on this family which has both health and forensic importance. Furthermore, R. belforti shows significant differences from other species of Sarcophagidae. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Durations of immature stage development period of Nasonia vitripennis (Walker) (Hymenoptera: Pteromalidae) under laboratory conditions: implications for forensic entomology.

    PubMed

    Mello, Renata da Silva; Aguiar-Coelho, Valéria M

    2009-01-01

    Some microhymenopterans are parasitoids of flies of forensic importance. Their parasitic habit can alter the duration of post-embryonic development of these flies, altering the postmortem interval. In order to analyze possible alterations occurring during the immature development period of Nasonia vitripennis, this study tested different quantitative associations between female parasitoids and pupae of Chrysomya megacephala, which were defined by: (a) one pupa was exposed to different numbers of female parasitoids (1:1, 1:3, 1:5, 1:7, 1:9, 1:11) and (b) different numbers of pupae were exposed to one female parasitoid (1:1, 2:1, 3:1, 4:1, 5:1). Analysis of variance (5% significance level) and Tukey's honestly significant difference tests were used for statistical analysis. There was a tendency of prolongation of the duration of parasitoid development, both by increasing the number of female parasitoids and by increasing the number of hosts in the associations. By increasing the number of female parasitoids per host, there is a possibility of increasing the occurrence of superparasitism, leading to competition for food source, then prolonging the duration of the immature development period. Increasing the number of hosts in the associations, females may distribute their postures among the available pupae and can cause reduction of the number of eggs per host. Since these insects are gregarious, the reduction of the number of eggs may delay the offspring development.

  15. The morphology of free-living stages and immature parasites of Rhabdias paraensis (Nematoda: Rhabdiasidae), a parasite of Rhinella marina (Anura: Bufonidae) in Brazil.

    PubMed

    Melo, Francisco Tiago de Vasconcelos; do Nascimento, Luciana de Cássia Silva; Macedo, Lilian Cristina; dos Santos, Jeannie Nascimento; Kuzmin, Yuriy

    2016-01-01

    Rhabdias paraensis Santos, Melo, Nascimento, Nascimento, Giese et Furtado, 2011 was described based on fully gravid worms. Further investigations on the free-living stages, immature worms and young individuals were facilitated by cultivation in the laboratory, which allowed us to add new information about the morphology and development of the species. Observations on the free-living development of R. paraensis showed that the life cycle is typical of Rhabdias, with alternation of gonochoristic and hermaphroditic generations and without homogony. Males of the free-living generation were different from those in several species of the genus studied previously. In the original description, the excretory glands and duct were absent in gravid specimens of R. paraensis, while in this study, distinct excretory glands and a duct were observed in immature and young individuals. Additionally, we recognised the separation of the buccal capsule walls into anterior and posterior portions and described the specific shapes of these portions in lateral and apical view. Studies on the morphology and development of free-living stages of Rhabdias spp. from Neotropical regions may provide additional information for species determination.

  16. [Five steps to decreasing nosocomial infections in large immature premature infants: A quasi-experimental study].

    PubMed

    García González, Ana; Leante Castellanos, José Luis; Fuentes Gutiérrez, Carmen; Lloreda García, José María; Fernández Fructuoso, José Ramón; Gómez Santos, Elisabet; García González, Verónica

    2017-07-01

    An evaluation is made of the impact of a series of five interventions on the incidence of hospital-related infections in a level iii neonatal unit. Quasi-experimental, pre-post intervention study, which included preterm infants weighing 1,500g at birth or delivered at <32 weeks gestation, admitted in the 12 months before and after the measures were implemented (January 2014). The measures consisted of: optimising hand washing, following a protocol for insertion and handling of central intravenous catheters, encouraging breastfeeding; applying a protocol for rational antibiotic use, and establishing a surveillance system for multi-resistant bacteria. The primary endpoint was to assess the incidence of hospital-acquired infections before and after implementing the interventions. Thirty-three matched patients were included in each period. There was an incidence of 8.7 and 2.7 hospital-related infections/1,000 hospital stay days in the pre- and post-intervention periods, respectively (P<.05). Additionally, patients in the treatment group showed a statistically-significant decrease in days on mechanical ventilation, use of blood products, and vasoactive drugs. The strategy, based on implementing five specific measures in a unit with a high rate of hospital-related infections, proved effective in reducing their incidence. This reduction could contribute to lowering the use of mechanical ventilation, blood products, and vasoactive drugs. Copyright © 2016 Asociación Española de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.

  17. Treating immature stands for wildlife

    Treesearch

    William M. Healy; Garry F. Houf

    1989-01-01

    Immature stands include those up to 60 years old or in the sapling, pole, and small sawtimber size-class. Immature stands, particularly in the sapling or pole stage, present a challenge to the wildlife manager. Compared to either younger regenerating stands or more mature stands, pole-size trees do not provide much mast or forage beneficial for wildlife (fig. 1).

  18. Dynamics of immature stages of Anopheles arabiensis and other mosquito species (Diptera: Culicidae) in relation to rice cropping in a rice agro-ecosystem in Kenya.

    PubMed

    Mwangangi, Joseph; Shililu, Josephat; Muturi, Ephantus; Gu, Weidong; Mbogo, Charles; Kabiru, Ephantus; Jacob, Benjamin; Githure, John; Novak, Robert

    2006-12-01

    We determined changes in species composition and densities of immature stages of Anopheles arabiensis mosquitoes in relation to rice growth cycle in order to generate data for developing larval control strategies in rice ecosystems. Experimental rice paddies (6.3m x 3.15m) exposed to natural colonization of mosquitoes were sampled weekly for two rice growing cycles between February 2004 and March 2005. Overall, 21,325 Anopheles larvae were collected, of which 91.9% were 1st and 2nd instars and 8.1% were 3rd and 4th instars. An. arabiensis was the predominant species (84.1%) with other species, An. pharoensis (13.5%), An. funestus (2.1%), An. coustani (0.3%), and An. maculipalpis (0.1%) accounting for only a small proportion of the anophelines collected. Culex quinquefasciatus (65.7%) was the predominant species among the non-anopheline species. Others species collected included: C. annulioris (9.9%), C. poicilipes (7.3%), C. tigripes (7.2%), C. duttoni (0.6%), Aedes aegypti (5.3%), Ae. cumminsii (3.5%), and Ae. vittatus (0.7%). The densities of the major anopheline species were closely related to rice stage and condition of the rice field. An. arabiensis, the predominant species, was most abundant over a three-week period after transplanting. Low densities of larvae were collected during the late vegetative, reproductive, and ripening phases of rice. An increase in larval density ten days post-transplanting was found to correlate with the application of fertilizer (sulphate of ammonia). Culicine and aedine species densities were significantly higher during the post-harvesting period. Our results suggest that the transplanting stage is favorable for the growth of immature stages of An. arabiensis and provides a narrow window for targeted larval intervention in rice.

  19. Extraction, quantification, and antioxidant activities of phenolics from pericarp and seeds of bitter melons (Momordica charantia) harvested at three maturity stages (immature, mature, and ripe).

    PubMed

    Horax, Ronny; Hettiarachchy, Navam; Chen, Pengyin

    2010-04-14

    Bitter melon (Momordica charantia) is an exotic vegetable used for consumption and medicinal purposes mainly throughout Asia. Phenolics were extracted from pericarp (fleshy portion) and seeds of bitter melons harvested at three maturation stages (immature, mature, and ripe) using ethanol and water solvent systems. Total phenolic assessment demonstrated 80% of ethanol to be the optimal solvent level to extract phenolics either from pericarp or seed. Main phenolic constituents in the extracts were catechin, gallic acid, gentisic acid, chlorogenic acid, and epicatechin. Free radical scavenging assay using 2,2-diphenyl-1-picrylhydrazyl (DPPH) demonstrated the bitter melon extracts as slow rate free radical scavenging agents. There were low correlations between the total phenolic contents and antiradical power values of the extracts, suggesting a possible interaction among the phenolic constituents occurred. Bitter melon phenolic extracts contain natural antioxidant substances, and could be used as antioxidant agents in suitable food products.

  20. Immature stages of giants: morphology and growth characteristics of Goliathus Lamarck, 1801 larvae indicate a predatory way of life (Coleoptera, Scarabaeidae, Cetoniinae)

    PubMed Central

    Vendl, Tomáš; Šípek, Petr

    2016-01-01

    Abstract The third larval instar of Goliathus goliatus (Drury, 1770), Goliathus orientalis Moser, 1909 and Goliathus albosignatus Boheman, 1857 are described and illustrated for the first time and compared with the immature stages of other Cetoniinae. Larval development of Goliathus goliatus is investigated under laboratory conditions, with particular emphasis on food requirements. These results support the obligatory requirement of proteins in the larval diet. The association between larval morphological traits (e. g., the shape of the mandibles and pretarsus, presence of well-developed stemmata) and larval biology is discussed. Based on observations and the data from captive breeds it is concluded that a possible shift from pure saprophagy to an obligatory predaceous way of larval life occurred within the larvae of this genus, which may explain why these beetles achieve such an enormous size. PMID:27829788

  1. Effect of buprofezin on survival of immature stages of Harmonia axyridis, Stethorus punctum picipes (Coleoptera: Coccinellidae), Orius tristicolor (Hemiptera: Anthocoridae), and Geocoris spp. (Hemiptera: Geocoridae).

    PubMed

    James, David G

    2004-06-01

    The effect of buprofezin, a chitin synthesis inhibitor, on development and survival of immature stages of Harmonia axyridis (Pallas), Stethortus punctum picipes Casey, Orius tristicolor (White), Geocoris pallens Stål, and Geocoris punctipes (Say), was examined in a series of laboratory bioassays. Very few H. axyridis larvae (3.1%) treated with buprofezin reached adulthood, although 65% of treated pupae emerged successfully. Buprofezin caused no mortality to eggs of S. punctum picipes but 71.1% of treated early instar larvae failed to complete development. Eighty percent of treated late instars and 92.3% of pupae produced viable adults. Early instar nymphs of O. tristicolor were unaffected by buprofezin, whereas 47.7 and 85% of G. punctipes and G. pallens nymphs, respectively, failed to complete development. Treated eggs of G. pallens hatched successfully. The use of buprofezin in integrated pest management in Washington state wine grapes is discussed.

  2. Efficacy of a novel topical combination of fipronil, (S)-methoprene, eprinomectin and praziquantel against adult and immature stages of the cat flea (Ctenocephalides felis) on cats.

    PubMed

    Baker, Christine; Tielemans, Eric; Prullage, Joseph B; Chester, S Theodore; Knaus, Martin; Rehbein, Steffen; Fourie, Josephus J; Young, David R; Everett, William R; Rosentel, Joseph K

    2014-04-28

    The efficacy of a novel topical combination of fipronil 8.3% (w/v), (S)-methoprene 10% (w/v), eprinomectin 0.4% (w/v) and praziquantel 8.3% (w/v) (BROADLINE(®)) was tested against adult and immature stages of Ctenocephalides felis fleas in six studies. For that purpose, fleas from different colonies from North America, Germany and South Africa were used to induce infestations in cats under laboratory conditions. In each study, between 12 and 16 cats were allocated randomly to 2 groups. Cats in Group 1 were not treated and served as controls. Cats in Group 2 were treated once on Day 0 with BROADLINE(®) at the minimum recommended dosage of 0.12 mg/kg body weight. In 4 studies, all animals were infested experimentally with unfed C. felis (100 ± 5) on Days 2 (or 1), 7, 14, 21, 28 and 35. Live fleas were counted 24h post-treatment or infestation. In 2 additional studies, animals were infested at the same frequency with gravid C. felis fleas (100 ± 5) that were fed previously on an untreated host. Forty-eight hours post-infestation, flea eggs were collected, counted and incubated for the evaluation of the reduction of emergence of adults. The combined curative efficacy against adult fleas at 24h after treatment was 94.3% and the combined preventive efficacy values remained greater than 95.9% at 24h after 5 subsequent weekly infestations. In addition, the product reduced dramatically the emergence of new adult fleas for at least 5 weeks (>98.1% for one month and 93.2% at 5 weeks after infestation), demonstrating its efficiency in preventing environmental contamination by immature stages. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  3. Hump-Shaped Density-Dependent Regulation of Mosquito Oviposition Site-Selection by Conspecific Immature Stages: Theory, Field Test with Aedes albopictus, and a Meta-Analysis

    PubMed Central

    Wasserberg, Gideon; Bailes, Nicholas; Davis, Christopher; Yeoman, Kim

    2014-01-01

    Oviposition site selection by gravid females is an important determinant of the distribution, abundance, and dynamics of dipteran hematophagous insects. The presence of conspecific immature stages in a potential oviposition site could, on the one hand, indicate the suitability of that site but on the other hand could indicate the potential for intraspecific competition. In this paper, we present a graphic model suggesting that the trade-off between these two opposing forces could result in a hump-shaped density-dependent relationship between oviposition rate and conspecific immature stage density (hereafter, the “Hump-shaped regulation model”) with positive effects of aggregation prevailing at low densities and negative effect of intraspecific competition prevailing at higher densities. We field-tested the predictions of this model at both the egg- and the larval levels with Aedes albopictus and evaluated if and how these relationships are affected by resource enrichment. We found support for the hump-shaped regulation model at both the larval and the egg levels. Using oviposition cups containing varying numbers of conspecific larvae, we showed that the oviposition activity of Ae. albopictus first increases and then decreases with larvae number. Medium enrichment resulted in higher hatching rate, and demonstrated linear relations for the no-enrichment treatment where larvae density range was low and hump-shaped relationship for the enriched medium that had a wider larvae density range. Using pairs of oviposition cups, we showed that at low egg densities mosquitoes laid more eggs on substrates containing pre-existing eggs. However, at higher egg densities, mosquitoes laid more eggs on a virgin substrate. Based on our results and on a meta-analysis, we suggest that due to study design or methodological shortcomings the hump-shaped regulation model is often left undetected and that it is likely to be more common than currently thought. PMID:24681526

  4. Stage 3 immature human natural killer cells found in secondary lymphoid tissue constitutively and selectively express the TH17 cytokine interleukin-22

    PubMed Central

    Hughes, Tiffany; Becknell, Brian; McClory, Susan; Briercheck, Edward; Freud, Aharon G.; Zhang, Xiaoli; Mao, Hsiaoyin; Nuovo, Gerard; Yu, Jianhua

    2009-01-01

    Considerable functional heterogeneity within human natural killer (NK) cells has been revealed through the characterization of distinct NK-cell subsets. Accordingly, a small subset of CD56+NKp44+NK cells, termed NK-22 cells, was recently described within secondary lymphoid tissue (SLT) as IL-22− when resting, with a minor fraction of this population becoming IL-22+ when activated. Here we discover that the vast majority of stage 3 immature NK (iNK) cells in SLT constitutively and selectively express IL-22, a TH17 cytokine important for mucosal immunity, whereas earlier and later stages of NK developmental intermediates do not express IL-22. These iNK cells have a surface phenotype of CD34−CD117+CD161+CD94−, largely lack expression of NKp44 and CD56, and do not produce IFN-γ or possess cytolytic activity. In summary, stage 3 iNK cells are highly enriched for IL-22 and IL-26 messenger RNA, and IL-22 protein production, but do not express IL-17A or IL-17F. PMID:19244159

  5. Laboratory Evaluations of the Fractions Efficacy of Annona senegalensis (Annonaceae) Leaf Extract on Immature Stage Development of Malarial and Filarial Mosquito Vectors

    PubMed Central

    Lame, Younoussa; Nukenine, Elias Nchiwan; Pierre, Danga Yinyang Simon; Elijah, Ajaegbu Eze; Esimone, Charles Okechukwu

    2015-01-01

    Background: Within the framework to control mosquitoes, ovicidal, larvicidal and pupicidal activity of Annona senegalensis leaf extract and its 4 fractions against Anopheles gambiae and Culex quinquefasciatus were evaluated in the laboratory conditions. Methods: Ovicidal test was performed by submitting at least 100 eggs of mosquitoes to 125, 250, 500, 1000 and 2000 ppm concentrations, while larvicidal and pupicidal effects were assessed by submitting 25 larvae or pupae to the concentrations of 2500, 1250, 625 and 312.5 ppm of plant extract or fractions of A. senegalensis. Results: The eggs of An. gambiae were most affected by N-hexane (0.00% hatchability) and chloroform (03.67% hatchability) fractions compared to Cx. quinquefasciatus where at least 25 % hatchability were recorded at 2000 ppm. For larvicidal test, N-hexane (LC50= 298.8 ppm) and chloroform (LC50= 418.3 ppm) fractions were more effective than other fractions on An. gambiae larvae while, a moderate effectiveness was also observed with N-hexane (LC50= 2087.6 ppm), chloroform (LC50= 9010.1 ppm) fractions on Cx. quinquefasciatus larvae. The highest mortality percent of the pupae were also recorded with N-hexane and chloroform fractions on An. gambiae at 2500 ppm. As for Cx. quinquefasciatus only 50 % and 36 % mortality were recorded with N-hexane and chloroform fractions respectively. Conclusion: The extract of A. senegalensis was toxic on immature stage of mosquito species tested. By splitting methanolic crude extract, only N-hexane and chloroform fractions were revealed to possess a mosquitocidal effects and could be considered and utilized for future immature mosquito vectors control. PMID:26623434

  6. Ultrastructure and description of the first immature stage of four different scale insect species (Hemiptera: Coccoidea) in Egypt.

    PubMed

    Beshr, Sahar M; Abdel-Razak, I Soad; Mourad, A K; Moursi, S Khadiga

    2009-01-01

    The first stage of four different species belonging to three families of the super family; Coccoidea were described and illustrated by using the scanning electron microscope. These species: Mycetaspis personata (Comstock) and Fiorinia fioriniae (Targioni Tozzetti), pertaining to the family Diaspididae; Pulvinaria psidii (Maskell) (Family: Coccidae) and lcerya seychellarum seychellarum (Westw.) of the family Margarodidae. The dimensions of the first stage (crawler), as well as some taxonomical aspects were examined and discussed. The obtained data showed that the first instar of the mealybug, I. seychellarum seychellarum gave the largest diameter of 299.33 +/- 0.94 pm in length and 183.44 +/- 0.17 microm in width followed by the diaspidid species, F. fioriniae recorded 208.1 +/- 0.78 microm in length and 178.96 +/- 2.34 pm in width; while the coccid species, P. psidii measured 119.17 +/- 0.85 microm in length and 74.83 +/- 1.03 microm in width and the smallest first stage crawler was for the diaspidid, M. personata measured 85.50 +/- 0.41 microm in length and 63.88 +/- 0.27 microm in width. The modes of assigned insects in protecting their eggs were also discussed briefly.

  7. Effects of superparasitism on immature and adult stages of Diachasmimorpha longicaudata Ashmead (Hymenoptera: Braconidae) reared on Ceratitis capitata Wiedemann (Diptera: Tephritidae).

    PubMed

    Devescovi, F; Bachmann, G E; Nussenbaum, A L; Viscarret, M M; Cladera, J L; Segura, D F

    2017-04-06

    The optimal use of available host by parasitoid insects should be favoured by natural selection. For solitary parasitoids, superparasitism (i.e. the egg-laying of several eggs/host) may represent a detrimental phenomenon both in a biological and an applied sense, but under certain circumstances it may be adaptive. Here, we studied the effects of increasing levels of superparasitism (LSPs, number of parasitoid larvae/host) on fitness-related parameters of the immature and adult stages of Diachasmimorpha longicaudata, a solitary endoparasitoid parasitizing Ceratitis capitata. We investigated the moment when supernumerary parasitoid larvae are eliminated and the effects produced by this process, together with its repercussion on female fecundity, parasitism rate, sex ratio, adult survival, flight ability and body size. Complete elimination of competitors occurred soon after larval hatching, before reaching the second larval stage. Elimination process took longer at higher LSPs, although a normal developmental (egg-adult) time was achieved. For LSPs 1, 2, 3 and 5 the effects on parasitoid emergence were mild, but LSP 10 led to the death of all developing parasitoids. Aside from this, to develop in superparasitized hosts did not significantly affect any of the evaluated parameters, and only a female-biased sex ratio was observed at higher LSPs. However, the effects of superparasitism on the adults may have a different outcome under more variable conditions in the field, once they are released for biological control purposes.

  8. Uterine Epithelial Cell Regulation of DC-SIGN Expression Inhibits Transmitted/Founder HIV-1 Trans Infection by Immature Dendritic Cells

    PubMed Central

    Ochiel, Daniel O.; Ochsenbauer, Christina; Kappes, John C.; Ghosh, Mimi; Fahey, John V.; Wira, Charles R.

    2010-01-01

    Background Sexual transmission accounts for the majority of HIV-1 infections. In over 75% of cases, infection is initiated by a single variant (transmitted/founder virus). However, the determinants of virus selection during transmission are unknown. Host cell-cell interactions in the mucosa may be critical in regulating susceptibility to infection. We hypothesized in this study that specific immune modulators secreted by uterine epithelial cells modulate susceptibility of dendritic cells (DC) to infection with HIV-1. Methodology/Principal Findings Here we report that uterine epithelial cell secretions (i.e. conditioned medium, CM) decreased DC-SIGN expression on immature dendritic cells via a transforming growth factor beta (TGF-β) mechanism. Further, CM inhibited dendritic cell-mediated trans infection of HIV-1 expressing envelope proteins of prototypic reference. Similarly, CM inhibited trans infection of HIV-1 constructs expressing envelopes of transmitted/founder viruses, variants that are selected during sexual transmission. In contrast, whereas recombinant TGF- β1 inhibited trans infection of prototypic reference HIV-1 by dendritic cells, TGF-β1 had a minimal effect on trans infection of transmitted/founder variants irrespective of the reporter system used to measure trans infection. Conclusions/Significance Our results provide the first direct evidence for uterine epithelial cell regulation of dendritic cell transmission of infection with reference and transmitted/founder HIV-1 variants. These findings have immediate implications for designing strategies to prevent sexual transmission of HIV-1. PMID:21179465

  9. Redescription of immature stages of central European fireflies, Part 1: Lampyris noctiluca (Linnaeus, 1758) larva, pupa and notes on its biology (Coleoptera: Lampyridae: Lampyrinae).

    PubMed

    Novák, Martin

    2017-03-28

    The mature larva of Lampyris noctiluca (Linnaeus, 1758) is redescribed and illustrated in detail, including scanning electron microscope images. Male and female pupae are briefly described, including notes on behaviour as well as light production of the immature stages. Observed structures, life cycle and behaviour of larvae and pupae are discussed.

  10. Spotted fever group rickettsiae detected in immature stages of ticks parasitizing on Iberian endemic lizard Lacerta schreiberi Bedriaga, 1878.

    PubMed

    Kubelová, Michaela; Papoušek, Ivo; Bělohlávek, Tomáš; de Bellocq, Joëlle Goüy; Baird, Stuart J E; Široký, Pavel

    2015-09-01

    Spotted fever rickettsioses are tick-borne diseases of growing public health concern. The prevalence of rickettsia-infected ticks and their ability to parasitize humans significantly influence the risk of human infection. Altogether 466 Ixodes ricinus ticks (428 nymphs and 38 larvae) collected from 73 Lacerta schreiberi lizards were examined by PCR targeting the citrate synthetase gene gltA for the presence of Rickettsia spp. Rickettsial DNA was detected in 47% of nymphs and 31.6% of larvae. They were subsequently subjected to a second PCR reaction using primers derived from the outer membrane protein rOmpA encoding gene (ompA) to detect spotted fever group rickettsiae (SFG). This analysis shows that 41.4% of nymphs and 7.9% of larvae collected from the lizards contain DNA of SFG rickettsiae. Sequencing of 43 randomly selected samples revealed two different haplotypes, both closely related to R. monacensis (39 and 4 samples, respectively). The remaining ompA negative Rickettsia spp. samples were determined to be R. helvetica based on sequencing of ompB and gltA fragments. Our results indicate that the role of Iberian endemic lizard L. schreiberi and its ectoparasites in the ecology and epidemiology of zoonotic SFG rickettsioses may be appreciable.

  11. High infection control rate and function after routine one-stage exchange for chronically infected TKA.

    PubMed

    Jenny, Jean-Yves; Barbe, Bruno; Gaudias, Jeannot; Boeri, Cyril; Argenson, Jean-Noël

    2013-01-01

    Many surgeons consider two-stage exchange the gold standard for treating chronic infection after TKA. One-stage exchange is an alternative for infection control and might provide better knee function, but the rates of infection control and levels of function are unclear. We asked whether a one-stage exchange protocol would lead to infection control rates and knee function similar to those after two-stage exchange. We followed all 47 patients with chronically infected TKAs treated with one-stage exchange between July 2004 and February 2007. We monitored for recurrence of infection and obtained Knee Society Scores. We followed patients a minimum of 3 years or until death or infection recurrence. Three of the 47 patients (6%) experienced a persistence or recurrence of the index infection with the same pathogen isolated. Three patients (6%) had control of the index infection but between 6 and 17 months experienced an infection with another pathogen. The 3-year survival rates were 87% for being free of any infection and 91% for being healed of the index infection. Twenty-five of the 45 patients (56%) had a Knee Society Score of more than 150 points. While routine one-stage exchange was not associated with a higher rate of infection recurrence failure, knee function was not improved compared to that of historical patients having two-stage exchange. One stage-exchange may be a reasonable alternative in chronically infected TKA as a more convenient approach for patients without the risks of two operations and hospitalizations and for reducing costs. The ideal one stage-exchange candidate should be identified in future studies.

  12. Infection of mouse bone marrow-derived immature dendritic cells with classical swine fever virus C-strain promotes cells maturation and lymphocyte proliferation.

    PubMed

    Zheng, Fu-Ying; Qiu, Chang-Qing; Jia, Huai-Jie; Chen, Guo-Hua; Zeng, Shuang; He, Xiao-Bing; Fang, Yong-Xiang; Lin, Guo-Zhen; Jing, Zhi-Zhong

    2013-12-01

    In this study, the interactions of classical swine fever virus (CSFV) C-strain and the virulent GSLZ strain with mouse bone marrow-derived immature dendritic cells (BM-imDCs) were investigated for the first time. Both the C-strain and the virulent GSLZ strain could effectively infect and replicate in mouse BM-imDCs. C-strain-infected BM-imDCs showed a greatly enhanced degree of maturation, and could effectively promote the expansion and proliferation of allogeneic naive T cells. The C-strain induced a stronger Th1 response. Infection with the virulent GSLZ strain had no obvious influence on cell maturation or lymphocyte proliferation, and failed to induce any obvious immune response. The results of this study provided initial information for research of the immunologic mechanisms of CSFV using mouse DCs as the model cells.

  13. TNF-α Is Involved in the Abnormal Thymocyte Migration during Experimental Trypanosoma cruzi Infection and Favors the Export of Immature Cells

    PubMed Central

    Pérez, Ana Rosa; Berbert, Luiz Ricardo; Lepletier, Ailin; Revelli, Silvia; Bottasso, Oscar; Silva-Barbosa, Suse Dayse; Savino, Wilson

    2012-01-01

    Previous studies revealed a significant production of inflammatory cytokines together with severe thymic atrophy and thymocyte migratory disturbances during experimental Chagas disease. Migratory activity of thymocytes and mature T cells seem to be finely tuned by cytokines, chemokines and extracellular matrix (ECM) components. Systemic TNF-α is enhanced during infection and appears to be crucial in the response against the parasite. However, it also seems to be involved in disease pathology, since it is implicated in the arrival of T cells to effector sites, including the myocardium. Herein, we analyzed the role of TNF-α in the migratory activity of thymocytes in Trypanosoma cruzi (T. cruzi) acutely-infected mice. We found increased expression and deposition of TNF-α in the thymus of infected animals compared to controls, accompanied by increased co-localization of fibronectin, a cell migration-related ECM molecule, whose contents in the thymus of infected mice is also augmented. In-vivo studies showed an enhanced export of thymocytes in T. cruzi-infected mice, as ascertained by intrathymic injection of FITC alone or in combination with TNF-α. The increase of immature CD4+CD8+ T cells in secondary lymphoid organs was even more clear-cut when TNF-α was co-injected with FITC. Ex-vivo transmigration assays also revealed higher number of migrating cells when TNF-α was added onto fibronectin lattices, with higher input of all thymocyte subsets, including immature CD4+CD8+. Infected animals also exhibit enhanced levels of expression of both mRNA TNF-α receptors in the CD4+CD8+ subpopulation. Our findings suggest that in T. cruzi acute infection, when TNF-α is complexed with fibronectin, it favours the altered migration of thymocytes, promoting the release of mature and immature T cells to different compartments of the immune system. Conceptually, this work reinforces the notion that thymocyte migration is a multivectorial biological event in health and disease

  14. Lipocalin 2 bolsters innate and adaptive immune responses to blood-stage malaria infection by reinforcing host iron metabolism.

    PubMed

    Zhao, Hong; Konishi, Aki; Fujita, Yukiko; Yagi, Masanori; Ohata, Keiichi; Aoshi, Taiki; Itagaki, Sawako; Sato, Shintaro; Narita, Hirotaka; Abdelgelil, Noha H; Inoue, Megumi; Culleton, Richard; Kaneko, Osamu; Nakagawa, Atsushi; Horii, Toshihiro; Akira, Shizuo; Ishii, Ken J; Coban, Cevayir

    2012-11-15

    Plasmodium parasites multiply within host erythrocytes, which contain high levels of iron, and parasite egress from these cells results in iron release and host anemia. Although Plasmodium requires host iron for replication, how host iron homeostasis and responses to these fluxes affect Plasmodium infection are incompletely understood. We determined that Lipocalin 2 (Lcn2), a host protein that sequesters iron, is abundantly secreted during human (P. vivax) and mouse (P. yoeliiNL) blood-stage malaria infections and is essential to control P. yoeliiNL parasitemia, anemia, and host survival. During infection, Lcn2 bolsters both host macrophage function and granulocyte recruitment and limits reticulocytosis, or the expansion of immature erythrocytes, which are the preferred target cell of P. yoeliiNL. Additionally, a chronic iron imbalance due to Lcn2 deficiency results in impaired adaptive immune responses against Plasmodium parasites. Thus, Lcn2 exerts antiparasitic effects by maintaining iron homeostasis and promoting innate and adaptive immune responses.

  15. The life cycle and immature stages of Kallima albofasciata, the endemic Oakleaf, in the Andaman Islands (Indian Ocean, Bay of Bengal).

    PubMed

    Kamalanathan, Veenakumari; Mohanraj, Prashanth

    2012-01-01

    Kallima albofasciata Moore 1877 (Lepidoptera: Nymphalidae), a species of Oakleaf butterfly reported for the first time from the Andaman Islands in 1874, was recognized as an insular endemic in 1877. Studies so far indicate that it is restricted to the contiguous islands of South and Middle Andamans. On these islands it apparently has a very localized distribution, giving rise to fears that it may be vulnerable and could face the threat of extinction with increasing developmental pressures on its habitat. Though it was reported to be extinct in 1993, its presence has since been documented and is currently protected by law in India. Nevertheless, nothing is known about the immature stages, its larval food plants or life history, and very little is known about its habitat and periods of occurrence on the islands. Here, details of all these aspects of this little-known butterfly of the Andaman Islands are presented. This should prove useful in the formulation of a conservation strategy for this iconic Oriental butterfly.

  16. Revision of the afrotropical species of Zaprionus (Diptera, Drosophilidae), with descriptions of two new species and notes on internal reproductive structures and immature stages

    PubMed Central

    Yassin, Amir; David, Jean R.

    2010-01-01

    Abstract A new classification of the subgenus Zaprionus is proposed in light of recent phylogenetic findings. The boundaries of the armatus and inermis species groups are redefined. The vittiger subgroup is upgraded to the level of a species group. The tuberculatus subgroup is transferred from the armatus to the inermis group. A new monotypic group, neglectus, is erected. Full morphological descriptions of four species belonging to the vittiger group are given: Zaprionus lachaisei sp. n. from Tanzania and Zaprionus santomensis sp. n. from São Tomé and Principé, and two cryptic species of the indianus complex, Zaprionus africanus Yassin & David and Zaprionus gabonicus Yassin & David. Three nominal species are synonymised: Zaprionus beninensis Chassagnard & Tsacas, syn. n. with Zaprionus koroleu Burla, Zaprionus simplex Chassagnard & McEvey, syn. n. with Zaprionus neglectus Collart, and Zaprionus megalorchis Chassagnard & Tsacas, syn. n. with Zaprionus ornatus Séguy. Half of the 46 species of the subgenus are available as laboratory strains and this has allowed full descriptions of the internal structure of their reproductive systems and their immature stages. PMID:21594121

  17. Effect of Temperature on the Development and Survival of Immature Stages of the Carambola Fruit Fly, Bactrocera carambolae, and the Asian Papaya Fruit Fly, Bactrocera papayae, Reared On Guava Diet

    PubMed Central

    Danjuma, Solomon; Thaochan, Narit; Permkam, Surakrai; Satasook, Chutamas

    2014-01-01

    Members of the Bactrocera dorsalis Hendel (Diptera: Tephritidae) complex constitute wellrecognized destructive pests of fruits in peninsular Thailand. The development and survival of immature stages of the carambola fruit fly, Bactrocera carambolae Drew & Hancock, and the Asian papaya fruit fly, Bactrocera papayae Drew & Hancock, were compared at six constant temperatures of 15, 20, 25, 27, 30, and 35°C, 70 ± 5% relative humidity, and a photoperiod of 12:12 (L:D). The objectives were to determine the effect of temperature on the developmental stages for optimizing rearing and to understand the geographical pattern of occurrence of these fruit fly species. A strong and positive linear relationship was observed between temperature and developmental rate of immature stages of B. carambolae. Similarly, a strong and positive linear relationship was observed between temperature and developmental rate of B. papayae. A temperature summation model was used to estimate the lower threshold temperature and the thermal constant. Bactrocera papayae was significantly faster in development and higher in survival and appeared to be better adapted to low temperatures than B. carambolae, as it exhibited the lowest threshold temperatures at all immature stages. The observed differences in response to various temperatures revealed to some extent the impact of temperature on these species' distribution in peninsular Thailand and other parts of the world. PMID:25368070

  18. Effect of temperature on the development and survival of immature stages of the carambola fruit fly, Bactrocera carambolae, and the Asian papaya fruit fly, Bactrocera papayae, reared on guava diet.

    PubMed

    Danjuma, Solomon; Thaochan, Narit; Permkam, Surakrai; Satasook, Chutamas

    2014-01-01

    Members of the Bactrocera dorsalis Hendel (Diptera: Tephritidae) complex constitute well-recognized destructive pests of fruits in peninsular Thailand. The development and survival of immature stages of the carambola fruit fly, Bactrocera carambolae Drew & Hancock, and the Asian papaya fruit fly, Bactrocera papayae Drew & Hancock, were compared at six constant temperatures of 15, 20, 25, 27, 30, and 35°C, 70 ± 5% relative humidity, and a photoperiod of 12:12 (L:D). The objectives were to determine the effect of temperature on the developmental stages for optimizing rearing and to understand the geographical pattern of occurrence of these fruit fly species. A strong and positive linear relationship was observed between temperature and developmental rate of immature stages of B. carambolae. Similarly, a strong and positive linear relationship was observed between temperature and developmental rate of B. papayae. A temperature summation model was used to estimate the lower threshold temperature and the thermal constant. Bactrocera papayae was significantly faster in development and higher in survival and appeared to be better adapted to low temperatures than B. carambolae, as it exhibited the lowest threshold temperatures at all immature stages. The observed differences in response to various temperatures revealed to some extent the impact of temperature on these species' distribution in peninsular Thailand and other parts of the world.

  19. Evaluation of the acaricidal activity of thymol incorporated in two formulations for topical use against immature stages of Rhipicephalus sanguineus sensu lato (Latreille, 1806) (Acari: Ixodidae).

    PubMed

    Delmonte, Camila; Cruz, Paula Barroso; Zeringóta, Viviane; de Mello, Valéria; Ferreira, Felipe; Amaral, Maria da Penha Henriques; Daemon, Erik

    2017-09-05

    The objective of this study was to assess, for the first time, the in vitro acaricidal activity of two topical formulations containing thymol, on immature stages of Rhipicephalus sanguineus sensu lato. For this purpose, two base formulations were prepared: an oil-in-water (O/W) emulsion and a hydroalcoholic solution, containing different thymol concentrations (0.5 to 20 mg/mL). We used the larval packet test for non-engorged larvae and nymphs, and the immersion test for engorged larvae and nymphs. For emulsion, a mortality rate of 94.2% was achieved at 0.75 mg/mL in non-engorged larvae. For engorged larvae, there was 95.0% mortality at 5.0 mg/mL. Non-engorged nymphs showed 83.3% mortality at 2.5 mg/mL, and for engorged nymphs, 86.0% mortality was verified at 5.0 mg/mL. For the hydroalcoholic solution, the mortality found for non-engorged larvae was 88.1% at 2.5 mg/mL. For engorged larvae, the highest mortality was 25.0% at 20 mg/mL; non-engorged nymphs had 91.0% mortality at 1.0 mg/mL and for engorged nymphs; the maximum value verified was 18.3% mortality at 20 mg/mL. Preliminary stability tests were carried, and the hydroalcoholic solution remained stable under all the conditions analyzed. The O/W emulsion showed signs of early instability at the concentration of 5.0 mg/mL. The results obtained indicate that the acaricidal activity of thymol, when included in the proposed formulations, was enhanced against non-engorged larvae with topical treatment in comparison with data in the literature. Although there were variations in toxicity between the different stages, these formulations are promising for future therapeutic use.

  20. Breeding sites of phlebotomine sand flies (Diptera: Psychodidae) and efficiency of extraction techniques for immature stages in terra-firme forest in Amazonas State, Brazil.

    PubMed

    Alencar, Ronildo Baiatone; de Queiroz, Raul Guerra; Barrett, Toby Vincent

    2011-06-01

    Information on natural breeding sites of phlebotomine sand flies is scanty, due to the difficulties of isolation of immatures from the soil where they occur. The present study investigated breeding sites in several microhabitats in a "terra-firme" forest in Pitinga, Amazonas State, Brazil. Results on the efficacy of different extraction techniques used for isolating sand flies, and the temperature and the pH of the samples collected, are presented. Samples of soil and organic matter from different microhabitats, processed by floatation-sieving, direct examination, Berlese-Tullgren, and emergence cages, revealed, for the first time in Amazonas, breeding sites in five microhabitats (tree bases, unsheltered forest floor, soil from under fallen logs, soil from under roots, and palm-tree bases). Overall, 138 immatures and 29 newly emerged adults were recovered from these microhabitats. The abundance of immatures in samples close to tree bases was significantly higher than in more open sites not adjacent to tree bases. Floatation-sieving and direct examination were the most effective techniques for immature extraction and survival, respectively. Eleven species of the genus Lutzomyia s.l. were identified, with Lutzomyia monstruosa (Floch & Abonnenc) and Lutzomyia georgii Freitas & Barrett being the most abundant. Differences in the specific composition and relative abundance of the immature and adult sand flies on tree bases suggest that breeding sites may be distant from resting or aggregation sites of adults. The pH, which revealed a slightly acidic soil, as well as the temperature, did not show any significant correlation with the number of immature sand flies collected.

  1. Regenerative Endodontic Treatment of an Infected Immature Dens Invaginatus with the Aid of Cone-Beam Computed Tomography

    PubMed Central

    Kaya-Büyükbayram, Işıl; Özalp, Şerife; Aydemir, Seda

    2014-01-01

    Dens invaginatus is a developmental anomaly that results in an enamel-lined cavity intruding into the crown or root before the mineralization phase. This report presents regenerative endodontic treatment of a necrotic immature tooth with Oehler's type III dens invaginatus of a nine-year-old female patient. A diagnosis of dens invaginatus (Oehler's type III) and a large periapical lesion was established with the aid of cone-beam computed tomography (CBCT). In the presented case contrary to the classic revascularization protocol, mechanical instrumentation was performed which apparently did not interfere with the regeneration process. After mechanical instrumentation of the invaginated canal by manual K-files, the invaginated canal space was disinfected by triple antibiotic paste followed by blood clot induction from the periapical tissues and the placement of mineral trioxide aggregate. At one-year follow-up, the tooth remained clinically asymptomatic. Radiographic examination revealed complete healing of the periapical lesion. At the 20-month follow-up, the radiographic examination also showed that the open apex was closed and the walls of the root canal were thickened. PMID:25530890

  2. Role of C/EBPβ-LAP and C/EBPβ-LIP in early adipogenic differentiation of human white adipose-derived progenitors and at later stages in immature adipocytes.

    PubMed

    Lechner, Stefan; Mitterberger, Maria C; Mattesich, Monika; Zwerschke, Werner

    2013-01-01

    We investigated the role of the major isoforms of CCAAT enhancer binding protein β (C/EBPβ), C/EBPβ-LAP and C/EBPβ-LIP, in adipogenesis of human white adipose-derived stromal/progenitor cells (ASC). C/EBPβ gene expression was transiently induced early in adipogenesis. At later stages, in immature adipocytes, the C/EBPβ mRNA and protein levels declined. The C/EBPβ-LIP protein steady-state level decreased considerably stronger than the C/EBPβ-LAP level and the C/EBPβ-LIP half-life was significantly shorter than the C/EBPβ-LAP half-life. The turn-over of both C/EBPβ-isoforms was regulated by ubiquitin/proteasome-dependent degradation. These data suggest that the protein stability of the C/EBPβ-isoforms is differentially regulated in the course of adipogenesis and in immature adipocytes. Constitutive overexpression of C/EBPβ-LIP had antiadipogenic activity in human ASC. C/EBPβ-LAP, which promotes adipogenesis in mouse 3T3-L1 preadipocytes by directly activating expression of the adipogenic keyregulator PPARγ2, induced the expression of PPARγ2 and of the adipocyte differentiation gene product FABP4 in confluent ASC in the absence of adipogenic hormones. At later stages after hormone cocktail-induced adipogenesis, in immature adipocytes, constitutive overexpression of C/EBPβ-LAP led to reduced expression of PPARγ2 and FABP4, C/EBPα expression was downregulated and the expression of the adipocyte differentiation gene products adiponectin and leptin was impaired. These findings suggest that constitutive overexpression of C/EBPβ-LAP induces adipogenesis in human ASC and negatively regulates the expression of adipogenic regulators and certain adipocyte differentiation gene products in immature adipocytes. We conclude the regulation of both C/EBPβ gene expression and C/EBPβ-LIP and C/EBPβ-LAP protein turn-over plays an important role for the expression of adipogenic regulators and/or adipocyte differentiation genes in early adipogenic differentiation of

  3. Description of the immature stages of Pentacomia (Mesochila) smaragdula Dejean 1825) (Coleoptera: Carabidae, Cicindelinae), with notes on the species distribution.

    PubMed

    Roza, André Silva; Mermudes, José Ricardo M

    2015-12-11

    The Atlantic Rainforest is one of the most threatened biomes of the world, with only 11-12 % of its original cover. The Cicindelinae are present in this biome with a relatively high diversity, but data of their immature forms are few. On the basis of six larvae and four pupae of Pentacomia (Mesochila) smaragdula we describe and illustrate the third larval instar of the larva and the pupa of this species. Notes on the species distribution are also given.

  4. Blood-stage malaria infection in diabetic mice.

    PubMed

    Elased, K; De Souza, J B; Playfair, J H

    1995-03-01

    Infection of mice with blood-stage Plasmodium yoelii and P. chabaudi malaria induced hypoglycaemia in normal mice and normalized the hyperglycaemia of mice made moderately diabetic with streptozotocin (STZ). Injection of parasite supernatants induced hypoglycaemia accompanied by hyperinsulinaemia in normal mice, and in STZ-diabetic mice induced a profound drop in blood glucose and restored insulin secretion; however, severely diabetic mice (two injections of STZ) remained hyperglycaemic with no change in insulin levels. We conclude that malaria infection and parasite-derived molecules lower blood glucose concentration, but only in the presence of some residual pancreatic function. Diabetic mice were less anaemic, exerted a significant control of parasitaemia, and showed enhanced phagocytic activity compared with normal mice.

  5. Proteomic profiling of the infective trophozoite stage of Acanthamoeba polyphaga.

    PubMed

    Caumo, Karin Silva; Monteiro, Karina Mariante; Ott, Thiely Rodrigues; Maschio, Vinicius José; Wagner, Glauber; Ferreira, Henrique Bunselmeyer; Rott, Marilise Brittes

    2014-12-01

    Acanthamoeba polyphaga is a free-living protozoan pathogen, whose infective trophozoite form is capable of causing a blinding keratitis and fatal granulomatous encephalitis in humans. The damage caused by A. polyphaga trophozoites in human corneal or brain infections is the result of several different pathogenic mechanisms that have not yet been elucidated at the molecular level. We performed a comprehensive analysis of the proteins expressed by A. polyphaga trophozoites, based on complementary 2-DE MS/MS and gel-free LC-MS/MS approaches. Overall, 202 non-redundant proteins were identified. An A. polyphaga proteomic map in the pH range 3-10 was produced, with protein identification for 184 of 370 resolved spots, corresponding to 142 proteins. Additionally, 94 proteins were identified by gel-free LC-MS/MS. Functional classification revealed several proteins with potential importance for pathogen survival and infection of mammalian hosts, including surface proteins and proteins related to defense mechanisms. Our study provided the first comprehensive proteomic survey of the trophozoite infective stage of an Acanthamoeba species, and established foundations for prospective, comparative and functional studies of proteins involved in mechanisms of survival, development, and pathogenicity in A. polyphaga and other pathogenic amoebae.

  6. Immature embryo rescue and culture.

    PubMed

    Shen, Xiuli; Gmitter, Fred G; Grosser, Jude W

    2011-01-01

    Embryo culture techniques have many significant applications in plant breeding, as well as basic studies in physiology and biochemistry. Immature embryo rescue and culture is a particularly attractive technique for recovering plants from sexual crosses where the majority of embryos cannot survive in vivo or become dormant for long periods of time. Overcoming embryo inviability is the most common reason for the application of embryo rescue techniques. Recently, fruit breeding programs have greatly increased the interest in exploiting interploid hybridization to combine desirable genetic traits of complementary parents at the triploid level for the purpose of developing improved seedless fruits. However, the success of this approach has only been reported in limited number of species due to various crossing barriers and embryo abortion at very early stages. Thus, immature embryo rescue provides an alternative means to recover triploid hybrids, which usually fail to completely develop in vivo. This chapter will provide a brief discussion of the utilization of interploid crosses between a monoembryonic diploid female with an allotetraploid male in a citrus cultivar improvement program, featuring a clear and comprehensive illustration of successful protocols for immature embryo rescue and culture. The protocols will cover the complete process from embryo excision to recovered plant in the greenhouse and can easily be adapted to other plant commodities. Factors affecting the success and failure of immature embryo rescue to recover triploid progeny from interploid crosses will be discussed.

  7. Description of immatures of the South American dictyopharid Taosa (C) longula (Hemiptera Fulgoroidea)

    USDA-ARS?s Scientific Manuscript database

    Immature stages of Taosa (Cuernavaca) longula Remes Lenicov (Dictyopharidae) are described and a key for their differentiation is provided. The descriptions and biological observations of immature stages were made on specimens collected on Eichhornia crassipes (Mart.) Solms-Laubach (Pontederiaceae) ...

  8. A case for one-stage revision in infected total knee arthroplasty?

    PubMed

    Parkinson, Richard W; Kay, Peter R; Rawal, Arvind

    2011-01-01

    Infection in total knee replacement is a rare but devastating complication. The current literature tends to support a two-stage revision as definitive treatment of established deep infection. Despite the fact that single stage revision is a well recognised treatment for the infected hip replacement, it has not gained the same level of support in the knee. This article reviews the literature of two-stage and single stage revision and reports the senior author's experience with the latter.

  9. Effect of liquid helium vitrification on the ultrastructure and related gene expression of mature bovine oocytes after vitrifying at immature stage.

    PubMed

    Wu, Hua; Yu, Xue-Li; Guo, Xian-Fei; Zhang, Fan; Pei, Xu-Zhe; Li, Xiao-Xia; Han, Wen-Xia; Li, Ying-Hua

    2017-01-01

    This study aimed to investigate the developmental potential of and the ultrastructural changes and gene expression differences resulting from liquid helium (LHe; -269 °C) vitrification in immature bovine oocytes. Immature oocytes were randomly divided into three groups: fresh oocytes (control, negative control), oocytes vitrified in liquid nitrogen (LN group, positive control), and oocytes vitrified in LHe (LHe group). In experiment 1, the rates of normal morphology, maturation, cleavage, and blastocyst in the LHe group were higher than those in the LN group (87.1% vs. 80.5%, 51% vs. 48%, 41.7% vs. 36.8%, and 13% vs. 8.5%, respectively; P < 0.05), and the rates of development in the control group (100%, 73.2%, 62%, and 39.8%) were higher than those in the treated groups (P < 0.05). In experiment 2, oocytes displayed various degrees of injury at the ultrastructural level after vitrification, but more severe degeneration was observed in the LN group, such as formation of several lipid droplets, swelling of mitochondria, and absence of cortical granules. Compared with the LN group, fewer lipid droplets, relatively intact mitochondria, and clustered cortical granules were distributed in the cytoplasm of oocytes in the LHe group. In experiment 3, the mRNA expression levels of p53, CDC20, Eg5, and Npm2 were investigated by real-time quantitative polymerase chain reaction. Expression levels of the kinesin Eg5 and the apoptotic gene p53 expression levels were higher in the LN group compared with the control and LHe groups (P < 0.05). CDC20 and Npm2 expression did not differ significantly between the LN and LHe groups (P > 0.05), the CDC20 expression in the LN and LHe groups were lower than control group (P < 0.05), the Npm2 expression in LHe group was lower than control group (P < 0.05), but there was no significant difference between the LN and control groups (P > 0.05). In conclusion, LHe vitrification decreased the negative effect of cryoinjury on the

  10. Parasitic infection in various stages life of cultured Acipenser persicus

    PubMed Central

    Adel, Milad; Safari, Reza; Yaghoubzadeh, Zahra; Fazli, Hassan; Khalili, Elham

    2016-01-01

    The present study was conducted to evaluate the status of the parasite fauna in Acipenser persicus at different development stages, in order to find prevention protocols for parasitic diseases in this valuable species. For this purpose, sampling from each sex breeder, 10 egg samples, 5-day-old larvae (n = 20), 20-day-old larvae (n = 80) and fingerling of A. persicus (n = 60) released in earthen ponds were done. After the bioassay and preparing wet mount from the internal and external organs, identification was done according to the keys. According to the results, no fauna parasites were isolated from egg samples and 5-day-old larvae; but Trichodina spp. was isolated from 20-day-old larvae. Also, the same protozoan was isolated from fingerling released in earthen ponds, the mean intensity, prevalence and range of contamination by fingerling were higher with compared to 20-day-old larvae. Trichodina sp. and Diplostomum spathaceum were isolated from skin and eyes of females, respectively. However, Trichodina sp. and Ichthyophthirius multifiliis were isolated from skin of male breeders. In this study, no parasites were isolated from internal organs of larves and fingerling but four intestinal parasites included: Cucullanus sphaerocephlaus, Anisakis sp., Skyrjabinopsilus semiarmatus, and Lepto-rhynchoides plagicephalu were isolated from internal organs of breeder. Based on a wide range of parasitic infection observed in various life stages of A. persicus, it seems necessary to consider hygienic and management measures. PMID:27226891

  11. Parasitic infection in various stages life of cultured Acipenser persicus.

    PubMed

    Adel, Milad; Safari, Reza; Yaghoubzadeh, Zahra; Fazli, Hassan; Khalili, Elham

    2016-01-01

    The present study was conducted to evaluate the status of the parasite fauna in Acipenser persicus at different development stages, in order to find prevention protocols for parasitic diseases in this valuable species. For this purpose, sampling from each sex breeder, 10 egg samples, 5-day-old larvae (n = 20), 20-day-old larvae (n = 80) and fingerling of A. persicus (n = 60) released in earthen ponds were done. After the bioassay and preparing wet mount from the internal and external organs, identification was done according to the keys. According to the results, no fauna parasites were isolated from egg samples and 5-day-old larvae; but Trichodina spp. was isolated from 20-day-old larvae. Also, the same protozoan was isolated from fingerling released in earthen ponds, the mean intensity, prevalence and range of contamination by fingerling were higher with compared to 20-day-old larvae. Trichodina sp. and Diplostomum spathaceum were isolated from skin and eyes of females, respectively. However, Trichodina sp. and Ichthyophthirius multifiliis were isolated from skin of male breeders. In this study, no parasites were isolated from internal organs of larves and fingerling but four intestinal parasites included: Cucullanus sphaerocephlaus, Anisakis sp., Skyrjabinopsilus semiarmatus, and Lepto-rhynchoides plagicephalu were isolated from internal organs of breeder. Based on a wide range of parasitic infection observed in various life stages of A. persicus, it seems necessary to consider hygienic and management measures.

  12. The efficacy of a topically applied imidacloprid 10 % / moxidectin 2.5 % formulation (Advocate®, Advantage® Multi, Bayer) against Immature and Adult Spirocerca lupi worms in experimentally infected dogs.

    PubMed

    Austin, Clinton M; Kok, Dawie J; Crafford, Dionne; Schaper, Roland

    2013-08-01

    This study investigated the efficacy and safety of an imidacloprid 10 %/moxidectin 2.5 % spot-on combination (Advocate®, Advantage® Multi, Bayer) against immature and mature stages of Spirocerca lupi in experimentally infected dogs. 24 dogs were allocated to 3 groups and infected with approximately 10 L3 larvae of S. lupi orally on study day (SD) +2, +14, +28 and +42. Group 1 remained as untreated control group. Group 2 dogs were treated on SD –28, 0, and thereafter monthly until Day 280 (12 treatments). Group 3 dogs were treated weekly on 19 occasions starting on SD +170. The dosage for all treatments was the licensed dose of 10–25 mg imidacloprid/2.5–6.25 mg moxidectin per kg body weight. All dogs were examined on SD +169 or +176 by endoscopy. Group 3 dogs were additionally examined approximately every two weeks up to Day 296. On Day +308 or +310, all dogs were necropsied to recover S. lupi worms and to quantify lesions in the thoracic aorta and oesophagus. Dogs in the control group were adequately infected with S. lupi, demonstrated by the extensive damage to the thoracic aorta, the nodules in the oesophagus and the large numbers of worms recovered. In total 144 worms were collected (geometric mean of 16.8 worms per dog). Dogs in group 2 had no or very slight damage to the thoracic aorta and no nodules or worms in the oesophagus, indicating 100 % efficacy of the monthly treatments. Dogs in group 3 were also adequately infected, showing nodules in the oesophagus before initiation of weekly treatment, and at necropsy extensive damage was seen in the thoracic aorta. After treatment, three dogs of 8 still had a few nodules and in total three worms (GM of 0.25 per dog) were recovered, demonstrating an efficacy of 98.5 % against adult S. lupi. All dogs tolerated the treatment well and no treatment- related adverse events occurred.

  13. Does cemented or cementless single-stage exchange arthroplasty of chronic periprosthetic hip infections provide similar infection rates to a two-stage? A systematic review.

    PubMed

    George, D A; Logoluso, N; Castellini, G; Gianola, S; Scarponi, S; Haddad, F S; Drago, L; Romano, C L

    2016-10-10

    The best surgical modality for treating chronic periprosthetic hip infections remains controversial, with a lack of randomised controlled studies. The aim of this systematic review is to compare the infection recurrence rate after a single-stage versus a two-stage exchange arthroplasty, and the rate of cemented versus cementless single-stage exchange arthroplasty for chronic periprosthetic hip infections. We searched for eligible studies published up to December 2015. Full text or abstract in English were reviewed. We included studies reporting the infection recurrence rate as the outcome of interest following single- or two-stage exchange arthroplasty, or both, with a minimum follow-up of 12 months. Two reviewers independently abstracted data and appraised quality assessment. After study selection, 90 observational studies were included. The majority of studies were focused on a two-stage hip exchange arthroplasty (65 %), 18 % on a single-stage exchange, and only a 17 % were comparative studies. There was no statistically significant difference between a single-stage versus a two-stage exchange in terms of recurrence of infection in controlled studies (pooled odds ratio of 1.37 [95 % CI = 0.68-2.74, I(2) = 45.5 %]). Similarly, the recurrence infection rate in cementless versus cemented single-stage hip exchanges failed to demonstrate a significant difference, due to the substantial heterogeneity among the studies. Despite the methodological limitations and the heterogeneity between single cohorts studies, if we considered only the available controlled studies no superiority was demonstrated between a single- and two-stage exchange at a minimum of 12 months follow-up. The overalapping of confidence intervals related to single-stage cementless and cemented hip exchanges, showed no superiority of either technique.

  14. Concentrations of procalcitonin and C-reactive protein, white blood cell count, and the immature-to-total neutrophil ratio in the blood of neonates with nosocomial infections: Gram-negative bacilli vs coagulase-negative staphylococci.

    PubMed

    Kordek, A

    2011-03-01

    This study was undertaken to determine whether concentrations of procalcitonin in the blood of neonates with nosocomial infections depend on the type of pathogen. Qualification for the study group was based on the clinical signs of infection. We found that infections with Gram-positive (chiefly coagulase-negative staphylococci) and Gram-negative bacteria are accompanied by elevated concentrations of procalcitonin. In the case of Gram-positive bacteria, other laboratory signs of infection studied by us (concentration of C-reactive protein, white blood cell count, immature-to-total neutrophil ratio) were not discriminatory, confirming the diagnostic usefulness of procalcitonin measurements in nosocomial infections of the neonate with Gram-negative or Gram-positive bacteria.

  15. Effect of Resin Ducts and Sap Content on Infestation and Development of Immature Stages of Anastrepha obliqua and Anastrepha ludens (Diptera: Tephritidae) in Four Mango (Sapindales: Anacardiaceae) Cultivars.

    PubMed

    Guillén, Larissa; Adaime, Ricardo; Birke, Andrea; Velázquez, Olinda; Angeles, Guillermo; Ortega, Fernando; Ruíz, Eliel; Aluja, Martín

    2017-01-10

    We determined the influence of resin ducts, sap content, and fruit physicochemical features of four mango cultivars (Criollo, Manila, Ataulfo, and Tommy Atkins) on their susceptibility to the attack of the two most pestiferous fruit fly species infesting mangoes in Mexico: Anastrepha ludens (Loew) and Anastrepha obliqua (Macquart). We performed three studies: 1) analysis of resin ducts in mango fruit exocarp to determine the density and area occupied by resin ducts in each mango cultivar, 2) assessment of mango physicochemical features including fruit sap content, and 3) a forced infestation trial under field conditions using enclosed fruit-bearing branches to expose mangoes to gravid A. ludens or A. obliqua females. Infestation rates, development time from egg to prepupae and pupae, pupal weight, and percent of adult emergence, were assessed. 'Ataulfo' and 'Tommy Atkins' cultivars exhibited the highest resin duct density and sap content, the lowest infestation rate, and had a negative effect on immature development and pupal weight. In sharp contrast, 'Manila' and 'Criollo' cultivars, with the lowest resin duct density and sap content, were highly susceptible to A. ludens and A. obliqua attack. We conclude that sap content and the number, size, and distribution of resin ducts as well as firmness in mango fruit exocarp are all involved in the resistance of mango to A. ludens and A. obliqua attack.

  16. Characteristics of infections in patients undergoing staged implantation for sacral nerve stimulation.

    PubMed

    Guralnick, Michael L; Benouni, Saraleen; O'Connor, R Corey; Edmiston, Charles

    2007-06-01

    To review clinical and surgical factors in patients who have undergone staged sacral nerve stimulator implantation and to determine whether there are any identifiable risk factors for infection. A retrospective chart review was performed on 76 consecutive patients undergoing staged implantation for sacral nerve stimulation for voiding dysfunction. Patients with postprocedural wound infections (after Stage 1 or Stage 2) were compared with those without infections with regard to demographic factors and surgical characteristics, such as operative time and duration of exposed lead wire. Organisms cultured were also documented. Lead infection occurred in 9 of 76 patients (12%). All cultures grew Staphylococcus aureus. Of 9 patients with lead infection, 6 had organisms sensitive to their perioperative antibiotic. Forty-five patients had an implantable pulse generator implanted, and 5 infections occurred (11%). Four cultures grew S. aureus (all sensitive to the perioperative antibiotic given), whereas one grew Pseudomonas. The only significant difference in clinical/surgical characteristics between infected and noninfected patients was a longer operative time for Stage 2 in infected patients. In addition, 3 patients with infection had one or more known risk factors for wound infection (steroid use, severe psoriasis, recurrent skin abscess). Apart from known risk factors for surgical wound infections, the only variable we could identify that might increase the risk for infection is a longer operative time for Stage 2. S. aureus was the organism most commonly cultured. Often it was sensitive to the perioperative antibiotic prophylaxis.

  17. Semen CD4+ T Cells and Macrophages Are Productively Infected at All Stages of SIV infection in Macaques

    PubMed Central

    Bernard-Stoecklin, Sibylle; Gommet, Céline; Corneau, Aurélien B.; Guenounou, Sabrina; Torres, Claire; Dejucq-Rainsford, Nathalie; Cosma, Antonio; Dereuddre-Bosquet, Nathalie; Le Grand, Roger

    2013-01-01

    The mucosal events of HIV transmission have been extensively studied, but the role of infected cells present in the genital and rectal secretions, and in the semen, in particular, remains a matter of debate. As a prerequisite to a thorough in vivo investigation of the early transmission events through infected cells, we characterized in detail by multi-parameter flow cytometry the changes in macaque seminal leukocytes during SIVmac251 infection, focusing on T cells, macrophages and dendritic cells. Using immunocytofluorescence targeting SIV proteins and real-time quantitative PCR targeting SIV DNA, we investigated the nature of the infected cells on sorted semen leukocytes from macaques at different stages of infection. Finally, we cocultured semen CD4+ T cells and macrophages with a cell line permissive to SIV infection to assess their infectivity in vitro. We found that primary infection induced strong local inflammation, which was associated with an increase in the number of leukocytes in semen, both factors having the potential to favor cell-associated virus transmission. Semen CD4+ T cells and macrophages were productively infected at all stages of infection and were infectious in vitro. Lymphocytes had a mucosal phenotype and expressed activation (CD69 & HLA-DR) and migration (CCR5, CXCR4, LFA-1) markers. CD69 expression was increased in semen T cells by SIV infection, at all stages of infection. Macrophages predominated at all stages and expressed CD4, CCR5, MAC-1 and LFA-1. Altogether, we demonstrated that semen contains the two major SIV-target cells (CD4+ T cells and macrophages). Both cell types can be productively infected at all stages of SIV infection and are endowed with markers that may facilitate transmission of infection during sexual exposure. PMID:24348253

  18. Functional Impairment of Myeloid Dendritic Cells during Advanced Stage of HIV-1 Infection: Role of Factors Regulating Cytokine Signaling.

    PubMed

    Sachdeva, Meenakshi; Sharma, Aman; Arora, Sunil K

    2015-01-01

    Severely immunocompromised state during advanced stage of HIV-1 infection has been linked to functionally defective antigen presentation by dendritic cells (DCs). The molecular mechanisms behind DC impairment are still obscure. We investigated changes in DC function and association of key regulators of cytokine signaling during different stages of HIV-1 infection and following antiretroviral therapy (ART). Phenotypic and functional characteristics of circulating myeloid DCs (mDCs) in 56 ART-naive patients (23 in early and 33 in advanced stage of disease), 36 on ART and 24 healthy controls were evaluated. Sixteen patients were studied longitudinally prior-to and 6 months after the start of ART. For functional studies, monocyte-derived DCs (Mo-DCs) were evaluated for endocytosis, allo-stimulation and cytokine secretion. The expression of suppressor of cytokine signaling (SOCS)-1 and other regulators of cytokine signaling was evaluated by real-time RT-PCR. The ability to respond to an antigenic stimulation was severely impaired in patients in advanced HIV-1 disease which showed partial recovery in the treated group. Mo-DCs from patients with advanced HIV-disease remained immature with low allo-stimulation and reduced cytokine secretion even after TLR-4 mediated stimulation ex-vivo. The cells had an increased expression of negative regulatory factors like SOCS-1, SOCS-3, SH2-containing phosphatase (SHP)-1 and a reduced expression of positive regulators like Janus kinase (JAK)2 and Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB)1. A functional recovery after siRNA mediated silencing of SOCS-1 in these mo-DCs confirms the role of negative regulatory factors in functional impairment of these cells. Functionally defective DCs in advanced stage of HIV-1 infection seems to be due to imbalanced state of negative and positive regulatory gene expression. Whether this is a cause or effect of increased viral replication at this stage of disease, needs

  19. Functional Impairment of Myeloid Dendritic Cells during Advanced Stage of HIV-1 Infection: Role of Factors Regulating Cytokine Signaling

    PubMed Central

    Sachdeva, Meenakshi; Sharma, Aman; Arora, Sunil K.

    2015-01-01

    Introduction Severely immunocompromised state during advanced stage of HIV-1 infection has been linked to functionally defective antigen presentation by dendritic cells (DCs). The molecular mechanisms behind DC impairment are still obscure. We investigated changes in DC function and association of key regulators of cytokine signaling during different stages of HIV-1 infection and following antiretroviral therapy (ART). Methods Phenotypic and functional characteristics of circulating myeloid DCs (mDCs) in 56 ART-naive patients (23 in early and 33 in advanced stage of disease), 36 on ART and 24 healthy controls were evaluated. Sixteen patients were studied longitudinally prior-to and 6 months after the start of ART. For functional studies, monocyte-derived DCs (Mo-DCs) were evaluated for endocytosis, allo-stimulation and cytokine secretion. The expression of suppressor of cytokine signaling (SOCS)-1 and other regulators of cytokine signaling was evaluated by real-time RT-PCR. Results The ability to respond to an antigenic stimulation was severely impaired in patients in advanced HIV-1 disease which showed partial recovery in the treated group. Mo-DCs from patients with advanced HIV-disease remained immature with low allo-stimulation and reduced cytokine secretion even after TLR-4 mediated stimulation ex-vivo. The cells had an increased expression of negative regulatory factors like SOCS-1, SOCS-3, SH2-containing phosphatase(SHP)-1 and a reduced expression of positive regulators like Janus kinase(JAK)2 and Nuclear factor kappa-light-chain-enhancer of activated B cells(NF-κB)1. A functional recovery after siRNA mediated silencing of SOCS-1 in these mo-DCs confirms the role of negative regulatory factors in functional impairment of these cells. Conclusions Functionally defective DCs in advanced stage of HIV-1 infection seems to be due to imbalanced state of negative and positive regulatory gene expression. Whether this is a cause or effect of increased viral

  20. A systematic review of the evidence for single stage and two stage revision of infected knee replacement

    PubMed Central

    2013-01-01

    Background Periprosthetic infection about the knee is a devastating complication that may affect between 1% and 5% of knee replacement. With over 79 000 knee replacements being implanted each year in the UK, periprosthetic infection (PJI) is set to become an important burden of disease and cost to the healthcare economy. One of the important controversies in treatment of PJI is whether a single stage revision operation is superior to a two-stage procedure. This study sought to systematically evaluate the published evidence to determine which technique had lowest reinfection rates. Methods A systematic review of the literature was undertaken using the MEDLINE and EMBASE databases with the aim to identify existing studies that present the outcomes of each surgical technique. Reinfection rate was the primary outcome measure. Studies of specific subsets of patients such as resistant organisms were excluded. Results 63 studies were identified that met the inclusion criteria. The majority of which (58) were reports of two-stage revision. Reinfection rated varied between 0% and 41% in two-stage studies, and 0% and 11% in single stage studies. No clinical trials were identified and the majority of studies were observational studies. Conclusions Evidence for both one-stage and two-stage revision is largely of low quality. The evidence basis for two-stage revision is significantly larger, and further work into direct comparison between the two techniques should be undertaken as a priority. PMID:23895421

  1. Toxoplasma gondii: the effects of infection at different stages of pregnancy on the offspring of mice.

    PubMed

    Wang, Tao; Liu, Min; Gao, Xiao-Jie; Zhao, Zhi-Jun; Chen, Xiao-Guang; Lun, Zhao-Rong

    2011-01-01

    Congenital toxoplasmosis can cause fetal damage in humans and domestic animals. This study was focused on the effects of Toxoplasma gondii (Prugniaud strain) infection at different stages of pregnancy on the offspring of mice. Results showed that newborn mice from all infected groups were significantly lower in weight than those from the control group but significant difference was not found among these groups at day 60 after birth. The survival rate of the offspring from the group of mice infected at the earlier stage of pregnancy was significantly lower than those of infected and control groups. The positive offspring (with cysts found in their brain tissues) born from the mice infected at the earlier and intermediate stages of pregnancy showed a shorter latency and greater number of errors in the step-through passive avoidance test than those born from the mice infected at the late stage of pregnancy, the control group and the negative offspring from the infected groups. The number of cysts in the brain tissue was significantly higher in the offspring born from the groups of mice infected at the earlier and intermediate stages of pregnancy than those from the group of mice infected at the late stage of pregnancy. In addition, our results indicated that a high congenital transmission rate (90%) occurred in this NIH mouse model. In conclusion, the earlier and intermediate maternal infection of T. gondii can result in severe congenital toxoplasmosis, exhibiting conditions such as stillbirth or non-viability, and learning or memory capability damage in this mouse model. These results not only provide useful data for better understanding the effects of T. gondii infection on the offspring of mice infected at different stages of pregnancy but also for better consideration of the effect of this infection on other mammalian hosts including humans.

  2. The natural history of HIV-1 infection: staging classifications of disease.

    PubMed

    Royce, R A; Luckmann, R S; Fusaro, R E; Winkelstein, W

    1991-04-01

    We evaluated and compared four staging classification systems for HIV infection in a population-based cohort: (1) a staging based on prodromal clinical criteria; (2) the Walter Reed Staging Classification (WRSC); (3) the immunologic staging system (ISS), and (4) a simple staging based on oral disease and CD4+ T-cell depletion. The staging systems were applied to 386 HIV-infected men in the San Francisco Men's Health Study cohort who did not have AIDS at the baseline examination. After 48-56 months of follow-up the cumulative incidence of AIDS and the cumulative mortality by stage was determined for each staging. Unlike the other systems, the WRSC could not classify a substantial proportion of HIV-infected men (51.9%). The WRSC and ISS include one or more stages which did not appear to be associated with a prognosis substantially different from that of adjacent stages. The simplified staging system based on CD4+ T-cell depletion and oral disease may be the most effective of the systems studied. A more complete understanding of the pathophysiology during the evolution of HIV infection will be required to define a more detailed staging of this disease.

  3. TREM-1 modulation during early stages of dengue virus infection.

    PubMed

    Ruiz-Pacheco, J A; Vivanco-Cid, H; Izaguirre-Hernández, I Y; Estrada-García, I; Arriaga-Pizano, L; Chacón-Salinas, R; Fonseca-Coronado, S; Vaughan, G; Tovar, K Ruiz; Rivera-Osorio, M P; Escobar-Gutiérrez, A

    2014-01-01

    Uncontrolled and intricate production of inflammatory factors is the characteristic feature of dengue infection. The triggering receptor expressed in myeloid cells-1 (TREM-1), expressed on the surface of monocytes and neutrophils, is capable of enhancing and regulating the inflammatory response via the production of different mediators in bacterial and viral infections. Here, both the expression of TREM-1 on human monocytes and neutrophils from peripheral blood of dengue infected individuals, as well as the levels of the soluble form of TREM-1 (sTREM-1) in the sera of these patients were compared against healthy controls. A significant reduction of TREM-1 expression was observed in neutrophils during the first days of infection, followed by a gradual recovery throughout the course of infection. Also, sera from DENV-infected patients exhibited significantly higher sTREM-1 levels than healthy individuals. The difference was more pronounced during the first 5 days after the onset of symptoms. These findings highlight the dynamic process of TREM-1 expression during DENV infection. We hypothesized that increment of free sTREM-1 could be a compensatory mechanism aiming to counteract the inflammatory process elicited during DENV infection. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. 1-stage primary arthroplasty of mechanically failed internally fixated of hip fractures with deep wound infection

    PubMed Central

    Klatte, Till O; O’Loughlin, Padraigh F; Citak, Mustafa; Rueger, Johannes M; Gehrke, Thorsten; Kendoff, Daniel

    2013-01-01

    Background and purpose Mechanically failed internal fixation following hip fracture is often treated by salvage arthroplasty. If deep wound infection is present, a 2-stage procedure is often used. We have used a 1-stage procedure in infected cases, and we now report the outcome. Patients and methods We reviewed 16 cases of deep wound infection after mechanically failed hip fracture fixation, treated between 1994 and 2010. In all patients, a joint prosthesis was implanted in a 1-stage procedure. Results After an average follow-up period of 12 (2–18) years, no reinfection was detected. In 4 cases, a hip dislocation occurred and 3 of these needed further surgery. Interpretation A 1-stage procedure for arthroplasty of an infected, mechanically failed hip fracture fixation is feasible and carries a low risk of infection. PMID:23799345

  5. The dynamics of infection of Tribolium confusum by Hymenolepis diminuta: the influence of infective-stage density and spatial distribution.

    PubMed

    Keymer, A E; Anderson, R M

    1979-10-01

    The mean parasite burden of a population of Tribolium confusum is shown to rise to a plateau as the exposure density of infective eggs of Hymenolepis diminuta increases. The level of this plateau is shown to be dependent on the nutritional status of the host population, being depressed from approximately 18 cysticeroids/beetle in hosts which have been starved prior to experimentation, to approximately 2 cysticercoids/beetle in satiated hosts. A simple model is used to describe the shape of this infection functional response in terms of the predator-prey interaction between hosts (T. confusum) and parasite infective stages (H. diminuta eggs). The distribution of successful infections/host is shown to be over-dispersed, even when hosts are exposed to infective stages arranged in a uniform spatial pattern. The over-dispersion of parasite numbers/host is shown to become more severe as the spatial pattern of infective stages changes from under-dispersed, through random, to over-dispersed. Experimental results are discussed in relation to the dynamics of parasite-host interactions, in which infection takes place by host ingestion of a free-living infective stage.

  6. Nitroheterocyclic drugs cure experimental Trypanosoma cruzi infections more effectively in the chronic stage than in the acute stage

    PubMed Central

    Francisco, Amanda Fortes; Jayawardhana, Shiromani; Lewis, Michael D.; White, Karen L.; Shackleford, David M.; Chen, Gong; Saunders, Jessica; Osuna-Cabello, Maria; Read, Kevin D.; Charman, Susan A.; Chatelain, Eric; Kelly, John M.

    2016-01-01

    The insect-transmitted protozoan parasite Trypanosoma cruzi is the causative agent of Chagas disease, and infects 5–8 million people in Latin America. Chagas disease is characterised by an acute phase, which is partially resolved by the immune system, but then develops as a chronic life-long infection. There is a consensus that the front-line drugs benznidazole and nifurtimox are more effective against the acute stage in both clinical and experimental settings. However, confirmative studies have been restricted by difficulties in demonstrating sterile parasitological cure. Here, we describe a systematic study of nitroheterocyclic drug efficacy using highly sensitive bioluminescence imaging of murine infections. Unexpectedly, we find both drugs are more effective at curing chronic infections, judged by treatment duration and therapeutic dose. This was not associated with factors that differentially influence plasma drug concentrations in the two disease stages. We also observed that fexinidazole and fexinidazole sulfone are more effective than benznidazole and nifurtimox as curative treatments, particularly for acute stage infections, most likely as a result of the higher and more prolonged exposure of the sulfone derivative. If these findings are translatable to human patients, they will have important implications for treatment strategies. PMID:27748443

  7. Two-stage Revision for Periprosthetic Hip and Knee Joint Infections

    PubMed Central

    Kini, Sunil Gurpur; Gabr, Ayman; Das, Rishi; Sukeik, Mohamed; Haddad, Fares Sami

    2016-01-01

    Background: Periprosthetic joint infection (PJI) continues to be one of the leading causes of failure following hip and knee surgery. The diagnostic workflow of PJI includes detailed clinical examination, serum markers, imaging and aspiration/biopsy of the affected joint. The goals of treatment are eradication of the infection, alleviation of pain, and restoration of joint function. Surgical management of PJI consists of debridement, antibiotics and implant retention (DAIR) and single or two-stage revision procedures. Two-stage revision remains the gold standard for treatment of PJIs. We aim to discuss the two stage procedure in this article and report the outcomes. Methods: The first stage of the two stages consists of removal of all components and associated cement with aggressive debridement and placement of an antibiotic-loaded cement spacer. Patients are then treated with variable periods of parenteral antibiotics, followed by an antibiotic free period to help ensure the infection has been eradicated. If the clinical evaluation and serum inflammatory markers suggest infection control, then the second stage can be undertaken and this involves removal of the cement spacer, repeat debridement, and placement of a new prosthesis. Results: Common themes around the two-stage revision procedure include timing of the second stage, antibiotics used in the interim period, length of the interim period before consideration of reimplantation and close liaising with microbiologists. Conclusion: Successful eradication of infection and good functional outcome using the two stage procedure is dependent on a multidisciplinary approach and having a standard reproducible startegy. PMID:28144371

  8. Two-stage Revision for Periprosthetic Hip and Knee Joint Infections.

    PubMed

    Kini, Sunil Gurpur; Gabr, Ayman; Das, Rishi; Sukeik, Mohamed; Haddad, Fares Sami

    2016-01-01

    Periprosthetic joint infection (PJI) continues to be one of the leading causes of failure following hip and knee surgery. The diagnostic workflow of PJI includes detailed clinical examination, serum markers, imaging and aspiration/biopsy of the affected joint. The goals of treatment are eradication of the infection, alleviation of pain, and restoration of joint function. Surgical management of PJI consists of debridement, antibiotics and implant retention (DAIR) and single or two-stage revision procedures. Two-stage revision remains the gold standard for treatment of PJIs. We aim to discuss the two stage procedure in this article and report the outcomes. The first stage of the two stages consists of removal of all components and associated cement with aggressive debridement and placement of an antibiotic-loaded cement spacer. Patients are then treated with variable periods of parenteral antibiotics, followed by an antibiotic free period to help ensure the infection has been eradicated. If the clinical evaluation and serum inflammatory markers suggest infection control, then the second stage can be undertaken and this involves removal of the cement spacer, repeat debridement, and placement of a new prosthesis. Common themes around the two-stage revision procedure include timing of the second stage, antibiotics used in the interim period, length of the interim period before consideration of reimplantation and close liaising with microbiologists. Successful eradication of infection and good functional outcome using the two stage procedure is dependent on a multidisciplinary approach and having a standard reproducible startegy.

  9. First Description of the Immature Stages and Redescription of the Adults of Cosmiomma hippopotamensis (Acari: Ixodidae) With Notes on Its Bionomics

    PubMed Central

    APANASKEVICH, DMITRY A.; WALKER, JANE B.; HEYNE, HELOISE; BEZUIDENHOUT, J. DÜRR; HORAK, IVAN G.

    2014-01-01

    Cosmiomma hippopotamensis (Denny, 1843) is one of the most unusual, beautiful, and rare tick species known to the world. All stages of this species possess a unique morphology, on the one hand making them easy to identify, while on the other they exhibit similarities to certain species of Amblyomma Koch, 1844, Dermacentor Koch, 1844, and Hyalomma Koch, 1844. Adults of C. hippopotamensis have been collected on only two occasions from their hosts, namely Hippopotamus amphibius L. and Diceros bicornis (L.), and have been recorded from only a few widely separated localities in East and southern Africa. Here, the larva and nymph are described and illustrated for the first time, while the male and female are illustrated and redescribed. Data on hosts, geographic distribution, and life cycle of C. hippopotamensis are also provided. PMID:23926768

  10. Infection recurrence factors in one- and two-stage total knee prosthesis exchanges.

    PubMed

    Massin, P; Delory, T; Lhotellier, L; Pasquier, G; Roche, O; Cazenave, A; Estellat, C; Jenny, J Y

    2016-10-01

    Revision of infected total knee replacements (TKR) is usually delayed for a period in which the joint space is filled with an antibiotic-loaded acrylic spacer. In contrast, one-stage re-implantation supposes immediate re-implantation. Formal comparisons between the two methods are scarce. A retrospective multi-centre study was conducted to investigate the effects of surgery type (one-stage vs. two-stage) on cure rates. It was hypothesised that this parameter would not influence the results. All infected TKR, treated consecutively between 2005 and 2010 by senior surgeons working in six referral hospitals, were included retrospectively. Two hundred and eighty-five patients, undergoing one-stage or two-stage TKR, with more than 2-year follow-up (clinical and radiological) were eligible for data collection and analysis. Of them, 108 underwent one-stage and 177 received two-stage TKR. Failure was defined as infection recurrence or persistence of the same or unknown pathogens. Factors linked with infection recurrence were analysed by uni- and multi-variate logistic regression with random intercept. Factors associated with infection recurrence were fistulae (odds ratio (OR) 3.4 [1.2-10.2], p = 0.03), infection by gram-negative bacteria (OR 3.3 [1.0-10.6], p = 0.05), and two-stage surgery with static spacers (OR 4.4 [1.1-17.9], p = 0.04). Gender and type of surgery interacted (p = 0.05). In men (133 patients), type of surgery showed no significant linkage with infection recurrence. In women (152 patients), two-stage surgery with static spacers was associated independently with infection recurrence (OR 5.9 [1.5-23.6], p = 0.01). Among patients without infection recurrence, International Knee Society scores were similar between those undergoing one-stage or two-stage exchanges. Two-stage procedures offered less benefit to female patients. It suggests that one-stage procedures are preferable, because they offer greater comfort without increasing the risk of

  11. Efficacy of agnique (mmf) monomolecular surface film against immature stages of Anopheles arabiensis patton and Culex spp (diptera: culicidae) in Khartoum, Sudan.

    PubMed

    Bashir, Al; Hassan, A Abu; Salmah, M R Che; Rahman, W A

    2008-03-01

    The efficacy of the larvicidal and pupicidal agent (Agnique) MMF was evaluated against larvae of An. arabiensis and Culex (Diptera: Culicidae) under field conditions in Bahary Locality, Khartoum, Sudan. At an applied dosage of 0.25 ml/m2, MMF resulted in 89.4, 79.8 and 88.2% reductions in L3-L4 instars An. arabiensis and 63.5% in Culex larvae (all stages) 24 to 72 hours post-treatment. Pupae were completely eliminated (100%) within 24 hours posttreatment. The earlier instars (L1-L2) of An. arabiensis were more tolerant with a 62.5% reduction at 72 hours post-treatment compared to (L3-L4) instars and pupae. At 7-days post-treatment Agnique gave a 57.5% reduction in L1-L2 and 92.6% in L3-L4 instar larvae of An. arabiensis and 57.3% and 86.4% in Culex larvae and pupae, respectively. We conclude that Agnique can perform effectively against L3-L4 instars and pupae of An. arabiensis for only 1 week, and 3 to 4 days against L1-L2 instars of Culex spp.

  12. Cementless two-stage exchange arthroplasty for infection after total hip arthroplasty.

    PubMed

    Masri, Bassam A; Panagiotopoulos, Kostas P; Greidanus, Nelson V; Garbuz, Donald S; Duncan, Clive P

    2007-01-01

    We retrospectively reviewed all patients at one center with an infected total hip arthroplasty treated with 2-stage revision using cementless components for the second stage and the PROSTALAC articulated spacer at the first stage. Twenty-nine patients were reviewed and followed for at least 2 years postoperatively. An isolated Staphylococcus species was cultured in 76% (22/29) of patients. Three (10.3%) of 29 patients had recurrent infection at the site of the prosthesis. One of the 3 patients ultimately underwent a Girdlestone arthroplasty. Another patient was managed with irrigation and debridement, whereas the final patient was treated with intravenous antibiotics alone. Treatment of infection at the site of a hip arthroplasty with 2-stage revision using cementless components and an articulated spacer yields recurrence rates similar to revisions where at least one of the components at the second stage is fixed with antibiotic-loaded cement.

  13. Cancer stage at diagnosis in patients infected with the human immunodeficiency virus and transplant recipients.

    PubMed

    Shiels, Meredith S; Copeland, Glenn; Goodman, Marc T; Harrell, Janna; Lynch, Charles F; Pawlish, Karen; Pfeiffer, Ruth M; Engels, Eric A

    2015-06-15

    It is unknown whether immunosuppression results in more aggressive, advanced stage cancers. Because cancer stage is influenced both by tumor biology and medical surveillance, the authors assessed cancer stage in individuals infected with the human immunodeficiency virus (HIV) and solid organ transplant recipients, 2 immunosuppressed groups with differences in their health care use. The authors used data on all cases of 15 cancer types diagnosed during 1996 through 2010 in 2 studies that linked US cancer registries with HIV and transplant registries. Odds ratios (ORs) for advanced (vs local) disease were estimated comparing HIV and transplant populations with immunocompetent individuals in polytomous logistic regression models adjusted for age, sex, race, registry, and year. A total of 8411 of 4.5 million cancer cases occurred in HIV-infected individuals and 7322 of 6.4 million cancer cases occurred in transplant recipients. Compared with immunocompetent patients with cancer, those infected with HIV were more likely to be diagnosed with distant stage lung (OR, 1.13), female breast (OR, 1.99), and prostate (OR, 1.57) cancers, whereas transplant recipients had fewer distant stage lung (OR, 0.54), female breast (OR, 0.75), and prostate (OR, 0.72) cancers. Both immunosuppressed populations had a shift toward advanced stage melanoma (ORs of 1.97 for HIV-infected individuals and 1.82 for transplant recipients) and bladder cancer (ORs of 1.42 for HIV-infected individuals and 1.54 for transplant recipients). Bladder cancer and melanoma were more likely to be diagnosed at a nonlocal stage in both HIV-infected individuals and transplant recipients, suggesting a role for immunosuppression in their progression. In addition, we observed a shift for some common cancers toward later stages in HIV-infected individuals and toward earlier stages in transplant recipients, which is consistent with differential access to medical care or surveillance. © 2015 American Cancer Society.

  14. Procalcitonin role in differential diagnosis of infection stages and non infection inflammation.

    PubMed

    Ghorbani, Gholamali

    2009-02-15

    The aim of this study is evaluation of procalcitonin role in the diagnosis of infectious and non infectious inflammation. This cross-sectional study was conducted in one hundred patients in Baqiyatallah Hospital of Iran in 2008. Patients suspected to infection were recruited to study. They were divided to four groups as: systemic inflammatory response syndrome, sepsis, sepsis syndrome and septic shock. Procalcitonin quantitative was assayed by immunoluminometric kit manufactured in Germany. Procalcitonin level was divided to four groups in < 0.5 ng mL(-1) compatible for SIRS, 0.5-2 ng mL(-1) for sepsis and 2-10 ng mL(-1) for sepsis syndrome and > 10 ng mL(-1) for septic shock. Data was analyzed by SPSS 13 for window software; T student test, ANOVA and Chi-square were used. In this study 53(53%) of subjects were men with mean age of 56.16 +/- 19.5 years old. The diagnosis was SIRS in 36%, sepsis in 38%, sepsis syndrome in 14% and septic shock in 12% of cases. Procalcitonin level was less than 0.5 ng mL(-1) in 61% and more than 10 ng mL(-1) in 10% of patients. Procalcitonin level showed significant association with septic shock, positive blood culture and mental dysfunction. Ultimately this study showed that high level of procalcitonin can differentiate septic shock from SIRS and other stages of infection. Dysfunction of mental status and high level of procalcitonin can determine septic shock.

  15. Routine one-stage exchange for chronic infection after total hip replacement.

    PubMed

    Jenny, Jean-Yves; Lengert, Régis; Diesinger, Yann; Gaudias, Jeannot; Boeri, Cyril; Kempf, Jean-François

    2014-12-01

    We hypothesized that a routine one-stage exchange for treatment of chronically infected total hip replacement (THR) will lead to (1) a higher rate of infection recurrence and (2) a poorer hip outcome than the published rates after two-stage exchange. Sixty-five cases have been treated consecutively with one-stage exchange. All patients have been followed for a period of three to six years or until death or infection recurrence. The five-year rate for infection recurrence was 16%. The five-year survival rate for recurrence of the index infection was 8%. Forty-two percent of the hips had a good or excellent PMA score, and 46% a good or excellent OH score. Routine one-stage exchange was not associated with a higher recurrence rate and a poorer hip function than previously published series of two-stage exchange. Therefore, there is little support to choose two-stage exchange as the routine treatment for management of chronically infected THR.

  16. BLOOD-STAGE DYNAMICS AND CLINICAL IMPLICATIONS OF MIXED PLASMODIUM VIVAX–PLASMODIUM FALCIPARUM INFECTIONS

    PubMed Central

    MASON, DANIEL P.; McKENZIE, F. ELLIS

    2008-01-01

    We present a mathematical model of the blood-stage dynamics of mixed Plasmodium vivax–Plasmodium falciparum malaria infections in humans. The model reproduces features of such infections found in nature and suggests several phenomena that may merit clinical attention, including the potential recrudescence of a long-standing, low-level P. falciparum infection following a P. vivax infection or relapse and the capacity of an existing P. vivax infection to reduce the peak parasitemia of a P. falciparum superinfection. We simulate the administration of anti-malarial drugs, and illustrate some potential complications in treating mixed-species malaria infections. Notably, our model indicates that when a mixed-species infection is misdiagnosed as a single-species P. vivax infection, treatment for P. vivax can lead to a surge in P. falciparum parasitemia. PMID:10497972

  17. Prospective Double-Blind Study of Zidovudine (AZT) in Early Stage HIV infection

    DTIC Science & Technology

    1988-05-01

    FRONT COVER FUNDING NO. 87PP7875 S L. TITLE: Prospective Double-Blind Study of Zidovudine (AZT) in Early Stage HIV Infection PRINCIPAL INVESTIGATOR...Prospective Double-Blind Study of Zidovudine (AZT) in Early State HIV Infection 12. PERSONAL AUTHOR(S) Shannon M. Harrison 13a. TYPE OF REPORT 113b...COSATI CODES 18. SUBJECT TERMS (Continue on reverse if necessary and identify by block number) FIELD GROUP SUBGROUP HIV , Zidovudine, Early, Infection 06

  18. Obesity is independently associated with infection in hospitalised patients with end-stage liver disease.

    PubMed

    Sundaram, V; Kaung, A; Rajaram, A; Lu, S C; Tran, T T; Nissen, N N; Klein, A S; Jalan, R; Charlton, M R; Jeon, C Y

    2015-12-01

    Infection is the most common cause of mortality in end-stage liver disease (ESLD). The impact of obesity on infection risk in ESLD is not established. To characterise the impact of obesity on infection risk in ESLD. We evaluated the association between infection and obesity in patients with ESLD. Patients grouped as non-obese, obesity class I-II and obesity class III were studied using the Nationwide Inpatient Sample. Validated diagnostic code based algorithms were utilised to determine weight category and infections, including bacteraemia, skin/soft tissue infection, urinary tract infection (UTI), pneumonia/respiratory infection, Clostridium difficile infection (CDI) and spontaneous bacterial peritonitis (SBP). Risk factors for infection and mortality were assessed using multivariable logistic regression analysis. Of 115 465 patients identified, 100 957 (87.5%) were non-obese and 14 508 (12.5%) were obese, with 9489 (8.2%) as obesity class I-II and 5019 (4.3%) as obesity class III. 37 117 patients (32.1%) had an infection diagnosis. Infection was most prevalent among obesity class III (44.0%), followed by obesity class I-II (38.9%) and then non-obese (31.9%). In multivariable modelling, class III obesity (OR = 1.41; 95% CI 1.32-1.51; P < 0.001), and class I-II obesity (OR = 1.08; 95% CI 1.01-1.15; P = 0.026) were associated with infection. Compared to non-obese patients, obese individuals had greater prevalence of bacteraemia, UTI, and skin/soft tissue infection as compared to non-obese patients. Obesity is newly identified to be independently associated with infection in end-stage liver disease. The distribution of infection sites varies based on weight category. © 2015 John Wiley & Sons Ltd.

  19. Human Cytomegalovirus Infection of Langerhans-Type Dendritic Cells Does Not Require the Presence of the gH/gL/UL128-131A Complex and Is Blocked after Nuclear Deposition of Viral Genomes in Immature Cells

    PubMed Central

    Lauron, Elvin J.; Yu, Dong; Fehr, Anthony R.

    2014-01-01

    Human cytomegalovirus (CMV) enters its host via the oral and genital mucosae. Langerhans-type dendritic cells (LC) are the most abundant innate immune cells at these sites, where they constitute a first line of defense against a variety of pathogens. We previously showed that immature LC (iLC) are remarkably resistant to CMV infection, while mature LC (mLC) are more permissive, particularly when exposed to clinical-strain-like strains of CMV, which display a pentameric complex consisting of the viral glycoproteins gH, gL, UL128, UL130, and UL131A on their envelope. This complex was recently shown to be required for the infection of immature monocyte-derived dendritic cells. We thus sought to establish if the presence of this complex is also necessary for virion penetration of LC and if defects in entry might be the source of iLC resistance to CMV. Here we report that the efficiency of LC infection is reduced, but not completely abolished, in the absence of the pentameric complex. While virion penetration and nuclear deposition of viral genomes are not impaired in iLC, the transcription of the viral immediate early genes UL122 and UL123 and of the delayed early gene UL50 is substantially lower than that in mLC. Together, these data show that the UL128, UL130, and UL131A proteins are dispensable for CMV entry into LC and that progression of the viral cycle in iLC is restricted at the step of viral gene expression. PMID:24155395

  20. One-stage Exchange Arthroplasty for Periprosthetic Hip and Knee Joint Infections

    PubMed Central

    Nguyen, Manny; Sukeik, Mohamed; Zahar, Akos; Nizam, Ikram; Haddad, Fares Sami

    2016-01-01

    Background: Periprosthetic joint infection (PJI) is a devastating complication of joint replacement surgery. In an aging population of the developed world, the increasing numbers of hip and knee replacements will inevitably lead to increasing incidence of PJI, carrying with (it) significant patient morbidity and cost to the health care system. Two-stage exchange arthroplasty is currently the gold standard but it is associated with multiple operations, prolonged hospitalization and impaired functionality. One-stage exchange arthroplasty is similar to the two-stage procedure but the interval between removal of the prosthesis and reimplantation of a new one is only a few minutes. It has the theoretical benefits of a single anesthetic, shorter hospitalization, less cost and improved function. Methods: We reviewed the current literature regarding the outcomes of one-stage exchange arthroplasties focusing on re-infection rates and functional outcomes. Results: Current themes around the one-stage exchange procedure include the indications for the procedure, definition of re-infection, surgical techniques used to provide fixation and differences in approach for hip and knee replacements. Conclusion: The current literature on one-stage exchange procedure is promising, with comparable results to two-stage revisions for hips and knees in selected patients. However, there is a great need for a large multi-centred randomized control trial, focusing on re-infection rates and functional scores postoperatively, to provide concrete guidelines in managing this complex condition. PMID:28144374

  1. Repeat Two-Stage Exchange Arthroplasty for Periprosthetic Knee Infection Is Dependent on Host Grade.

    PubMed

    Fehring, Keith A; Abdel, Matthew P; Ollivier, Matthieu; Mabry, Tad M; Hanssen, Arlen D

    2017-01-04

    Two-stage exchange arthroplasty after a previous, failed 2-stage exchange procedure is fraught with difficulties, and there are no clear guidelines for treatment or prognosis given the heterogeneous group of patients in whom this procedure has been performed. The Musculoskeletal Infection Society (MSIS) staging system was developed in an attempt to stratify patients according to infection type, host status, and local soft-tissue status. The purpose of this study was to report the results of 2-stage exchange arthroplasty following a previous, failed 2-stage exchange protocol for periprosthetic knee infection as well as to identify risk factors for failure. We retrospectively identified 45 patients who had undergone 2 or more 2-stage exchange arthroplasties for periprosthetic knee infection from 2000 to 2013. Patients were stratified according to the MSIS system, and risk factors for failure were analyzed. The minimum follow-up was 2 years (mean, 6 years; range, 24 to 132 months). At the time of follow-up, twenty-two (49%) of the patients had undergone another revision due to infection and 28 (62%) had undergone another revision for any reason. The infection recurred in 6 (75%) of 8 substantially immunocompromised hosts (MSIS type C) and in 3 (30%) of 10 uncompromised hosts (type A) following the second 2-stage exchange arthroplasty (p = 0.06). The infection recurred in 4 (80%) of 5 patients with compromise of the extremity (MSIS type 3) and 3 (33%) of 9 patients with an uncompromised extremity (type 1) (p = 0.27). Both extremely compromised hosts with an extremely compromised extremity (type C3) had recurrence of the infection whereas 3 (30%) of the 10 uncompromised patients with no or less compromise of the extremity (type A1 or A2) did. Five patients in the failure group underwent a third 2-stage exchange arthroplasty following reinfection, and 3 of them were infection-free at the time of the latest follow-up. Uncompromised hosts (MSIS type A) with an acceptable

  2. Cancer Stage at Diagnosis in HIV-infected People and Transplant Recipients

    PubMed Central

    Shiels, Meredith S.; Copeland, Glenn; Goodman, Marc T.; Harrell, Janna; Lynch, Charles F.; Pawlish, Karen; Pfeiffer, Ruth M.; Engels, Eric A.

    2015-01-01

    Background It is unknown whether immunosuppression results in more aggressive, advanced stage cancers. As cancer stage is influenced both by tumor biology and medical surveillance, we assessed cancer stage in HIV-infected individuals and solid organ transplant recipients, two immunosuppressed groups with differences in healthcare utilization. Methods We used data on all cases of 15 cancer types, diagnosed during 1996–2010 in two studies that linked U.S. cancer registries to HIV and transplant registries. Odds ratios (ORs) for advanced (vs. local) disease were estimated comparing HIV and transplant populations to immunocompetent people in polytomous logistic regression models, adjusted for age, sex, race, registry and year. Results A total of 8,411 of 4.5 million cancer cases occurred in HIV-infected people, and 7,322 of 6.4 million cancer cases occurred in transplant recipients. Compared to immunocompetent people with cancer, HIV-infected people were more likely to be diagnosed with distant stage lung (OR=1.13), female breast (OR=1.99), and prostate cancers (OR=1.57), while transplant recipients had fewer distant stage lung (OR=0.54), female breast (OR=0.75) and prostate cancers (OR=0.72). Both immunosuppressed populations had a shift toward advanced stage melanoma (ORs: HIV=1.97; transplant=1.82) and bladder cancer (ORs: HIV=1.42; transplant=1.54). Conclusions Bladder cancer and melanoma were more likely to be diagnosed at non-local stage in both HIV-infected people and transplant recipients, suggesting a role of immunosuppression in their progression. Additionally, we observed a shift for some common cancers toward later stages in HIV-infected individuals and toward earlier stages in transplant recipients, consistent with differential access to medical care or surveillance. PMID:25739496

  3. Durable infection control and function with the PROSTALAC spacer in two-stage revision for infected knee arthroplasty.

    PubMed

    Gooding, Christopher R; Masri, Bassam A; Duncan, Clive P; Greidanus, Nelson V; Garbuz, Donald S

    2011-04-01

    A two-stage revision total knee arthroplasty is recognized as the gold standard in the treatment of infection. However, traditional spacers limit function in the interval between the two stages and may cause instability, scarring, and bone erosion. The PROSTALAC knee spacer is an antibiotic-loaded cement articulating spacer that allows some movement of the knee between stages. Whether motion enhances long-term function is unknown. We therefore identify the rate of control of infection using the PROSTALAC exchange spacer and to assess the clinical outcome after implantation with a definitive implant. We retrospectively reviewed 115 knees that underwent two-stage exchange with the PROSTALAC spacer. Forty-eight of these had a minimum followup of 5 years (mean, 9 years; range, 5-12 years). At last review, 101 of the 115 knees (88%) had no evidence of infection. Of the 14 knees that became reinfected, four were from the same organism and 10 were with a different organism. After further intervention, using the two-stage approach again, the infection was controlled in 12 of the 14 initially reinfected cases, resulting in a failure to cure in only two cases. We observed improvements in mean WOMAC, Oxford, UCLA, and Patient Satisfaction scores at last review. The PROSTALAC functional spacer was associated with a 98% rate of control of infection and improvements in the quality-of-life outcomes in the treatment of chronically infected total knee arthroplasties. Level IV, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence.

  4. Distinct Cytokine/chemokine Network in Semen and Blood Characterize Different Stages of HIV Infection

    PubMed Central

    Vanpouille, C.; Introini, A.; Morris, S.R.; Margolis, L.; Daar, E.S.; Dube, M.P.; Little, S.J.; Smith, D.M.; Lisco, A.; Gianella, S.

    2016-01-01

    Objective The cytokine/chemokine network is the language used by the innate and adaptive immune system to orchestrate effective immune responses. Here, we describe the cross-sectional association between cytokine levels and stage of HIV infection to gain novel insights into HIV-1 immunopathogenesis and identify novel therapeutic targets. Design Concentrations of 31 cytokine/chemokines were retrospectively measured in blood and semen collected from 252 individuals enrolled in 4 well-characterized cohorts: HIV-uninfected, HIV-infected in early phase of infection, HIV-infected in late phase of infection, and HIV-infected on ART. Methods Cytokine/chemokine levels were measured by multiplex-bead-array. Comparisons between groups were performed by Mann-Whitney U-test and p-values were adjusted for multiple comparisons using the Benjamini-Hochberg method. Results HIV-infection skewed the cytokine/chemokine network towards a pro-inflammatory response in both blood and semen. Such changes emerged within the first weeks of infection and were maintained thereafter: among untreated HIV-infected individuals, none of the 31 measured cytokines were significantly different between early and later stages of infection. Suppression of plasma HIV-1-RNA with ART did not result in normalization of the levels of pro-inflammatory cytokines in blood. In contrast, in semen, several pro-inflammatory cytokines were even further up regulated in ART-treated compared to HIV-uninfected and HIV-untreated individuals. Conclusions The profound disruption in the cytokine network is evident in blood and semen from the earliest stage of HIV-infection shortly after the first detection of systemic viremia. These changes are maintained throughout the chronic phase of the infection and do not normalize despite ART and suppression of plasma HIV-1-RNA. PMID:26558730

  5. Exacerbation of autoimmune neuro-inflammation in mice cured from blood-stage Plasmodium berghei infection.

    PubMed

    Thomé, Rodolfo; Bombeiro, André Luis; Issayama, Luidy Kazuo; Rapôso, Catarina; Lopes, Stefanie Costa Pinto; da Costa, Thiago Alves; Di Gangi, Rosária; Ferreira, Isadora Tassinari; Longhini, Ana Leda Figueiredo; Oliveira, Alexandre Leite Rodrigues; da Cruz Höfling, Maria Alice; Costa, Fábio Trindade Maranhão; Verinaud, Liana

    2014-01-01

    The thymus plays an important role shaping the T cell repertoire in the periphery, partly, through the elimination of inflammatory auto-reactive cells. It has been shown that, during Plasmodium berghei infection, the thymus is rendered atrophic by the premature egress of CD4+CD8+ double-positive (DP) T cells to the periphery. To investigate whether autoimmune diseases are affected after Plasmodium berghei NK65 infection, we immunized C57BL/6 mice, which was previously infected with P. berghei NK65 and treated with chloroquine (CQ), with MOG35-55 peptide and the clinical course of Experimental Autoimmune Encephalomyelitis (EAE) was evaluated. Our results showed that NK65+CQ+EAE mice developed a more severe disease than control EAE mice. The same pattern of disease severity was observed in MOG35-55-immunized mice after adoptive transfer of P. berghei-elicited splenic DP-T cells. The higher frequency of IL-17+- and IFN-γ+-producing DP lymphocytes in the Central Nervous System of these mice suggests that immature lymphocytes contribute to disease worsening. To our knowledge, this is the first study to integrate the possible relationship between malaria and multiple sclerosis through the contribution of the thymus. Notwithstanding, further studies must be conducted to assert the relevance of malaria-induced thymic atrophy in the susceptibility and clinical course of other inflammatory autoimmune diseases.

  6. The stability analysis of a general viral infection model with distributed delays and multi-staged infected progression

    NASA Astrophysics Data System (ADS)

    Wang, Jinliang; Liu, Shengqiang

    2015-01-01

    We investigate an in-host model with general incidence and removal rate, as well as distributed delays in virus infections and in productions. By employing Lyapunov functionals and LaSalle's invariance principle, we define and prove the basic reproductive number R0 as a threshold quantity for stability of equilibria. It is shown that if R0 > 1 , then the infected equilibrium is globally asymptotically stable, while if R0 ⩽ 1 , then the infection free equilibrium is globally asymptotically stable under some reasonable assumptions. Moreover, n + 1 distributed delays describe (i) the time between viral entry and the transcription of viral RNA, (ii) the n - 1 -stage time needed for activated infected cells between viral RNA transcription and viral release, and (iii) the time necessary for the newly produced viruses to be infectious (maturation), respectively. The model can describe the viral infection dynamics of many viruses such as HIV-1, HCV and HBV.

  7. Sulphur and oxygen sequestration of n-C37 and n-C38 unsaturated ketones in an immature kerogen and the release of their carbon skeletons during early stages of thermal maturation

    USGS Publications Warehouse

    Koopmans, M.P.; Schaeffer-Reiss, C.; De Leeuw, J. W.; Lewan, M.D.; Maxwell, J.R.; Schaeffer, P.; Sinninghe, Damste J.S.

    1997-01-01

    Sedimentary rock from the Gessoso-solfifera Formation (Messinian) in the Vena del Gesso Basin (northern Italy) containing immature (Ro = 0.25%) S-rich organic matter was artificially matured by hydrous pyrolysis at temperatures from 160 to 330??C for 72 h to study the diagenetic fate of n-C37 and n-C38 di-and tri-unsaturated methyl and ethyl ketones (alkenones) biosynthesised by several prymnesiophyte algae. During early diagenesis, the alkenones are incorporated into the kerogen by both sulphur and oxygen cross-linking as indicated by chemical degradation experiments with the kerogen of the unheated sample. Heating at temperatures between 160 and 260??C, which still represents early stages of thermal maturation, produces large amounts (up to 1 mg/g TOC) of S-bound, O-bound, and both S-and O-bound n-C37 and n-C38 skeletons, saturated n-C37 and n-C38 methyl, ethyl, and mid-chain ketones, C37 and C38 mid-chain 2,5-di-n-alkylthiophenes, C37 and C38 1,2-di-n-alkylbenzenes, and C37 and C38 n-alkanes. With increasing thermal maturation, three forms of the n-C37 and n-C38 skeletons are relatively stable (saturated hydrocarbons, 1,2-di-n-alkylbenzenes and saturated ketones), whereas the S-and O-bound skeletons are relatively labile. These results suggest that in natural situations saturated ketones with an n-C37 and n-C38 skeleton can be expected as well as the corresponding hydrocarbons. Copyright ?? 1997 Elsevier Science Ltd.

  8. Hepcidin is regulated during blood-stage malaria and plays a protective role in malaria infection.

    PubMed

    Wang, Hai-Zhen; He, Ying-Xin; Yang, Chun-Ju; Zhou, Wei; Zou, Cheng-Gang

    2011-12-15

    Hepcidin is one of the regulators of iron metabolism. The expression of hepcidin is induced in spleens and livers of mice infected with pathogenic bacteria. Recent studies have indicated that serum hepcidin level is also increased in human subjects infected with Plasmodium falciparum. The mechanism of the regulation of hepcidin expression and its role in the infection of malaria remains unknown. In this study, we determined the expression of hepcidin in livers of mice infected with Plasmodium berghei. The expression of hepcidin in the liver was upregulated and downregulated during the early and late stages of malaria infection, respectively. Inflammation and erythropoietin, rather than the iron-sensing pathway, are involved in the regulation of hepcidin expression in livers of infected mice. Meanwhile, we investigated the effect of hepcidin on the survival of mice infected with P. berghei. Treatment of malaria-infected mice with anti-hepcidin neutralizing Abs promoted the rates of parasitemia and mortality. In contrast, lentiviral vector-mediated overexpression of hepcidin improved the outcome of P. berghei infection in mice. Our data demonstrate an important role of hepcidin in modulating the course and outcome of blood-stage malaria.

  9. Structure of the immature HIV-1 capsid in intact virus particles at 8.8 Å resolution

    NASA Astrophysics Data System (ADS)

    Schur, Florian K. M.; Hagen, Wim J. H.; Rumlová, Michaela; Ruml, Tomáš; Müller, Barbara; Kräusslich, Hans-Georg; Briggs, John A. G.

    2015-01-01

    Human immunodeficiency virus type 1 (HIV-1) assembly proceeds in two stages. First, the 55 kilodalton viral Gag polyprotein assembles into a hexameric protein lattice at the plasma membrane of the infected cell, inducing budding and release of an immature particle. Second, Gag is cleaved by the viral protease, leading to internal rearrangement of the virus into the mature, infectious form. Immature and mature HIV-1 particles are heterogeneous in size and morphology, preventing high-resolution analysis of their protein arrangement in situ by conventional structural biology methods. Here we apply cryo-electron tomography and sub-tomogram averaging methods to resolve the structure of the capsid lattice within intact immature HIV-1 particles at subnanometre resolution, allowing unambiguous positioning of all α-helices. The resulting model reveals tertiary and quaternary structural interactions that mediate HIV-1 assembly. Strikingly, these interactions differ from those predicted by the current model based on in vitro-assembled arrays of Gag-derived proteins from Mason-Pfizer monkey virus. To validate this difference, we solve the structure of the capsid lattice within intact immature Mason-Pfizer monkey virus particles. Comparison with the immature HIV-1 structure reveals that retroviral capsid proteins, while having conserved tertiary structures, adopt different quaternary arrangements during virus assembly. The approach demonstrated here should be applicable to determine structures of other proteins at subnanometre resolution within heterogeneous environments.

  10. Gestational Stage and IFN-λ Signaling Regulate ZIKV Infection In Utero.

    PubMed

    Jagger, Brett W; Miner, Jonathan J; Cao, Bin; Arora, Nitin; Smith, Amber M; Kovacs, Attila; Mysorekar, Indira U; Coyne, Carolyn B; Diamond, Michael S

    2017-09-13

    Although Zika virus (ZIKV)-induced congenital disease occurs more frequently during early stages of pregnancy, its basis remains undefined. Using established type I interferon (IFN)-deficient mouse models of ZIKV transmission in utero, we found that the placenta and fetus were more susceptible to ZIKV infection at earlier gestational stages. Whereas ZIKV infection at embryonic day 6 (E6) resulted in placental insufficiency and fetal demise, infections at midstage (E9) resulted in reduced cranial dimensions, and infection later in pregnancy (E12) caused no apparent fetal disease. In addition, we found that fetuses lacking type III IFN-λ signaling had increased ZIKV replication in the placenta and fetus when infected at E12, and reciprocally, treatment of pregnant mice with IFN-λ2 reduced ZIKV infection. IFN-λ treatment analogously diminished ZIKV infection in human midgestation fetal- and maternal-derived tissue explants. Our data establish a model of gestational stage dependence of ZIKV pathogenesis and IFN-λ-mediated immunity at the maternal-fetal interface. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Susceptibility of some vertebrate hosts to infection with early third-stage larvae of Gnathostoma hispidum.

    PubMed

    Sohn, W M; Lee, S H

    1997-09-01

    Susceptibility of some vertebrates was examined to the early third-stage larvae (EL3) of Gnathostoma hispidum. The larvae collected from the Chinese loaches were infected to 4 silk carps, 3 snake heads, 3 bullfrogs, 5 mice and 9 albino rats. No worms were detected in fish, silk carps and snake heads. In 3 bullfrogs fed 30 larvae, a total of 9 EL3 was recovered in the gastrointestinal tract (8 larvae) and liver (one). In 5 mice infected with 50 larvae, a total of 37 (74.0%) advanced third-stage larvae (AdL3) was recovered from the muscle (31 larvae), liver (5 larvae) and kidney at 4 weeks after infection. In 9 albino rats infected with 115 larvae, a total of 40 (34.8%) AdL3 was found in the muscle. The mammalian hosts were found susceptible to the EL3 of G. hispidum from Chinese loaches.

  12. Patient selection does not improve the success rate of infected TKA one stage exchange.

    PubMed

    Jenny, Jean-Yves; Barbe, Bruno; Cazenave, Alain; Roche, Olivier; Massin, Philippe

    2016-12-01

    One stage exchange of a chronically infected total knee arthroplasty (TKA) is recommended in selected cases only. However, there is little evidence regarding the usefulness of selection criteria. The goal of this retrospective study was to compare the results of two concomitant cohorts of patients with chronically infected TKA: one treated with a routine one-stage exchange (study group) and one treated with one-stage exchange in selected cases only (control group). The hypoyhesis tested was that the failure rate and repeat surgery rate were higher in the study group than in the control group. One hundred and thirty one cases were selected: 54 in the study group and 77 in the control group. There were 63 men and 68 women with a mean age of 70years. All patients were followed up for a minimal period of time of two years or until death or recurrence of infection. Twenty five cases had a recurrence of infection: 9/54 in the study group and 16/77 in the control group (NS). The survival rate for being free of infection after four years was 85% in the study group and 78% in the control group (NS). The repeat surgery rate was significantly higher in the control group. The tested hypothesis was rejected. When one stage exchange is considered, patient selection does not improve outcome. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Tools for the diagnosis of hepatitis C virus infection and hepatic fibrosis staging

    PubMed Central

    Saludes, Verónica; González, Victoria; Planas, Ramon; Matas, Lurdes; Ausina, Vicente; Martró, Elisa

    2014-01-01

    Hepatitis C virus (HCV) infection represents a major public health issue. Hepatitis C can be cured by therapy, but many infected individuals are unaware of their status. Effective HCV screening, fast diagnosis and characterization, and hepatic fibrosis staging are highly relevant for controlling transmission, treating infected patients and, consequently, avoiding end-stage liver disease. Exposure to HCV can be determined with high sensitivity and specificity with currently available third generation serology assays. Additionally, the use of point-of-care tests can increase HCV screening opportunities. However, active HCV infection must be confirmed by direct diagnosis methods. Additionally, HCV genotyping is required prior to starting any treatment. Increasingly, high-volume clinical laboratories use different types of automated platforms, which have simplified sample processing, reduced hands-on-time, minimized contamination risks and human error and ensured full traceability of results. Significant advances have also been made in the field of fibrosis stage assessment with the development of non-invasive methods, such as imaging techniques and serum-based tests. However, no single test is currently available that is able to completely replace liver biopsy. This review focuses on approved commercial tools used to diagnose HCV infection and the recommended hepatic fibrosis staging tests. PMID:24707126

  14. 2-stage revision of 120 deep infected hip and knee prostheses using gentamicin-PMMA beads.

    PubMed

    Janssen, Daniël M C; Geurts, Jan A P; Jütten, Liesbeth M C; Walenkamp, Geert H I M

    2016-08-01

    Background and purpose - A 2-stage revision is the most common treatment for late deep prosthesis-related infections and in all cases of septic loosening. However, there is no consensus about the optimal interval between the 2 stages. Patients and methods - We retrospectively studied 120 deep infections of total hip (n = 95) and knee (n = 25) prostheses that had occurred over a period of 25 years. The mean follow-up time was 5 (2-20) years. All infections had been treated with extraction, 1 or more debridements with systemic antibiotics, and implantation of gentamicin-PMMA beads. There had been different time intervals between extraction and reimplantation: median 14 (11-47) days for short-term treatment with uninterrupted hospital stay, and 7 (3-22) months for long-term treatment with temporary discharge. We analyzed the outcome regarding resolution of the infection and clinical results. Results - 88% (105/120) of the infections healed, with no difference in healing rate between short- and long-term treatment. 82 prostheses were reimplanted. In the most recent decade, we treated patients more often with a long-term treatment but reduced the length of time between the extraction and the reimplantation. More reimplantations were performed in long-term treatments than in short-term treatments, despite more having difficult-to-treat infections with worse soft-tissue condition. Interpretation - Patient, wound, and infection considerations resulted in an individualized treatment with different intervals between stages. The 2-stage revision treatment in combination with local gentamicin-PMMA beads gave good results even with difficult prosthesis infections and gentamicin-resistant bacteria.

  15. Interrogation of infected hepatocyte signaling reveals that suppression of host p53 is critical for Plasmodium liver stage infection

    PubMed Central

    Kaushansky, Alexis; Ye, Albert S.; Austin, Laura S.; Mikolajczak, Sebastian A.; Vaughan, Ashley M.; Camargo, Nelly; Metzger, Peter G.; Douglass, Alyse N.; MacBeath, Gavin; Kappe, Stefan H.I.

    2013-01-01

    Summary Plasmodium parasites infect the liver and replicate inside hepatocytes before they invade erythrocytes and trigger clinical malaria. Analysis of host signaling pathways affected by liver stage infection could provide critical insights into host-pathogen interactions and reveal targets for intervention. Using protein lysate microarrays we found that Plasmodium yoelii rodent malaria parasites perturb hepatocyte regulatory pathways involved in cell survival, proliferation and autophagy. Notably, the pro-death protein p53 was substantially decreased in infected hepatocytes, suggesting it could be targeted by the parasite to foster survival. Indeed, mice that express increased levels of p53 showed reduced liver stage parasite burden whereas p53 knockout mice suffered increased liver stage burden. Furthermore, boosting p53 levels using the small molecule Nutlin-3 dramatically reduced liver stage burden in vitro and in vivo. We conclude that perturbation of the hepatocyte p53 pathway critically impacts parasite survival. Thus, host pathways might constitute potential targets for host-based antimalarial prophylaxis. PMID:23478020

  16. DNA repair systems and the pathogenesis of Mycobacterium tuberculosis: varying activities at different stages of infection.

    PubMed

    Gorna, Alina E; Bowater, Richard P; Dziadek, Jaroslaw

    2010-05-25

    Mycobacteria, including most of all MTB (Mycobacterium tuberculosis), cause pathogenic infections in humans and, during the infectious process, are exposed to a range of environmental insults, including the host's immune response. From the moment MTB is exhaled by infected individuals, through an active and latent phase in the body of the new host, until the time they reach the reactivation stage, MTB is exposed to many types of DNA-damaging agents. Like all cellular organisms, MTB has efficient DNA repair systems, and these are believed to play essential roles in mycobacterial pathogenesis. As different stages of infection have great variation in the conditions in which mycobacteria reside, it is possible that different repair systems are essential for progression to specific phases of infection. MTB possesses homologues of DNA repair systems that are found widely in other species of bacteria, such as nucleotide excision repair, base excision repair and repair by homologous recombination. MTB also possesses a system for non-homologous end-joining of DNA breaks, which appears to be widespread in prokaryotes, although its presence is sporadic within different species within a genus. However, MTB does not possess homologues of the typical mismatch repair system that is found in most bacteria. Recent studies have demonstrated that DNA repair genes are expressed differentially at each stage of infection. In the present review, we focus on different DNA repair systems from mycobacteria and identify questions that remain in our understanding of how these systems have an impact upon the infection processes of these important pathogens.

  17. Susceptibility to Plasmodium liver stage infection is altered by hepatocyte polyploidy

    PubMed Central

    Austin, Laura S.; Kaushansky, Alexis; Kappe, Stefan H.I.

    2014-01-01

    Summary Plasmodium parasites infect hepatocytes of their mammalian hosts and within undergo obligate liver stage development. The specific host cell attributes that are important for liver infection remain largely unknown. Several host signaling pathways are perturbed in infected hepatocytes, some of which are important in the generation of hepatocyte polyploidy. To test the functional consequence of polyploidy in liver infection, we infected hepatocytes with the rodent malaria parasite Plasmodium yoelii both in vitro and in vivo and examined the ploidy of infected and uninfected hepatocytes by flow cytometry. In both hepatoma cell lines and in the mouse liver, the fraction of polyploid cells was higher in the infected cell population than in the uninfected cell population. When the data were reanalyzed by comparing the extent of Plasmodium infection within each ploidy subset, we found that infection rates were elevated in more highly polyploid cells and lower in diploid cells. Furthermore, we found that the parasite’s preference for host cells with high ploidy is conserved among rodent malaria species and the human malaria parasite Plasmodium falciparum. This parasite preference for host cells of high ploidy cannot be explained by differences in hepatocyte size or DNA replication. We conclude that Plasmodium preferentially infects and develops in polyploid hepatocytes. PMID:24612025

  18. Evaluation of a two-stage antibacterial hydrogel dressing for healing in an infected diabetic wound.

    PubMed

    He, Hong; Xia, Dong-Lin; Chen, Yan-Pei; Li, Xiao-Dong; Chen, Chao; Wang, Yu-Fei; Shen, Lingling; Hu, Yu-Lin; Gu, Hai-Ying

    2017-10-01

    Various types of wound dressings have been used to treat complex infections in diabetes mellitus. This study is the first to evaluate the healing effects using a two-stage dressing in infected diabetic wounds. A two-stage antibacterial hydrogel dressing (two-stage dressing) was established with two time phases, an antibacterial phase and a drug release phase. We established each phase by using a swelling and rate of drug release test. These results suggested that the antimicrobial phase is activated as soon as the two-stage dressing attaches to the skin. The drugs in the drug release layer of the dressing were released to a greater extent than expected 20-36 h after attachment to the skin, likely due to extensive water absorption. Histological analysis and measurement of vascular endothelial growth factor expression through in vivo testing suggested that the benefits of a two-stage dressing include rapid antibacterial properties, sustained drug release, and promotion of wound healing through cell proliferation as compared with the traditional composite antibacterial hydrogel dressing. Further in vivo tests confirmed that separation of the antibacterial and drug-releasing properties, along with biocompatibility and rapid wound closure rates made two-stage dressings suitable for healing of infected wounds. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1808-1817, 2017. © 2015 Wiley Periodicals, Inc.

  19. Immunodiagnostic Identification of Dairy Cows Infected with Prototheca zopfii at Various Clinical Stages and Discrimination between Infected and Uninfected Cows

    PubMed Central

    Roesler, Uwe; Scholz, Holger; Hensel, Andreas

    2001-01-01

    Protothecosis is a severe form of mastitis in cattle that is caused by colorless algae of the genus Prototheca. So far, no suitable serological test for the identification of infected animals is available for routine diagnosis. In this study an indirect enzyme-linked immunosorbent assay (ELISA) for the identification of infected cows and for discriminating among infected cows at various clinical stages was developed. Immunoglobulin G (IgG) in serum and IgA and IgG1 in whey were used as antibody isotypes. The ELISA was evaluated using serum and whey from animals at different clinical stages of infection. A total of 12 cows with acute clinical manifestation of protothecal mastitis, 22 cows with clinical signs of chronic mastitis, 40 Prototheca zopfii-negative cows, and 18 cows with chronic clinical signs and earlier cultures positive for P. zopfii but with presently negative culturing results were investigated. A sensitivity of 96% and a specificity of 94% were calculated for the ELISA based on IgA levels. Intra-assay and interassay variations were calculated to be 6.08 and 6.32%, respectively. Based on these data, this ELISA was found to be suitable for discrimination between infected and uninfected animals and might therefore be useful for screening affected herds. PMID:11158103

  20. Immunodiagnostic identification of dairy cows infected with Prototheca zopfii at various clinical stages and discrimination between infected and uninfected cows.

    PubMed

    Roesler, U; Scholz, H; Hensel, A

    2001-02-01

    Protothecosis is a severe form of mastitis in cattle that is caused by colorless algae of the genus Prototheca. So far, no suitable serological test for the identification of infected animals is available for routine diagnosis. In this study an indirect enzyme-linked immunosorbent assay (ELISA) for the identification of infected cows and for discriminating among infected cows at various clinical stages was developed. Immunoglobulin G (IgG) in serum and IgA and IgG1 in whey were used as antibody isotypes. The ELISA was evaluated using serum and whey from animals at different clinical stages of infection. A total of 12 cows with acute clinical manifestation of protothecal mastitis, 22 cows with clinical signs of chronic mastitis, 40 Prototheca zopfii-negative cows, and 18 cows with chronic clinical signs and earlier cultures positive for P. zopfii but with presently negative culturing results were investigated. A sensitivity of 96% and a specificity of 94% were calculated for the ELISA based on IgA levels. Intra-assay and interassay variations were calculated to be 6.08 and 6.32%, respectively. Based on these data, this ELISA was found to be suitable for discrimination between infected and uninfected animals and might therefore be useful for screening affected herds.

  1. Febrile temperatures induce cytoadherence of ring-stage Plasmodium falciparum-infected erythrocytes.

    PubMed

    Udomsangpetch, Rachanee; Pipitaporn, Busaba; Silamut, Kamolrat; Pinches, Robert; Kyes, Sue; Looareesuwan, Sornchai; Newbold, Christopher; White, Nicholas J

    2002-09-03

    In falciparum malaria, the malaria parasite induces changes at the infected red blood cell surface that lead to adherence to vascular endothelium and other red blood cells. As a result, the more mature stages of Plasmodium falciparum are sequestered in the microvasculature and cause vital organ dysfunction, whereas the ring stages circulate in the blood stream. Malaria is characterized by fever. We have studied the effect of febrile temperatures on the cytoadherence in vitro of P. falciparum-infected erythrocytes. Freshly obtained ring-stage-infected red blood cells from 10 patients with acute falciparum malaria did not adhere to the principle vascular adherence receptors CD36 or intercellular adhesion molecule-1 (ICAM-1). However, after a brief period of heating to 40 degrees C, all ring-infected red blood cells adhered to CD36, and some isolates adhered to ICAM-1, whereas controls incubated at 37 degrees C did not. Heating to 40 degrees C accelerated cytoadherence and doubled the maximum cytoadherence observed (P < 0.01). Erythrocytes infected by ring-stages of the ICAM-1 binding clone A4var also did not cytoadhere at 37 degrees C, but after heating to febrile temperatures bound to both CD36 and ICAM-1. Adherence of red blood cells infected with trophozoites was also increased considerably by brief heating. The factor responsible for heat induced adherence was shown to be the parasite derived variant surface protein PfEMP-1. RNA analysis showed that levels of var mRNA did not differ between heated and unheated ring-stage parasites. Thus fever-induced adherence appeared to involve increased trafficking of PfEMP-1 to the erythrocyte membrane. Fever induced cytoadherence is likely to have important pathological consequences and may explain both clinical deterioration with fever in severe malaria and the effects of antipyretics on parasite clearance.

  2. Alzheimer's disease Braak Stage progressions: reexamined and redefined as Borrelia infection transmission through neural circuits.

    PubMed

    MacDonald, Alan B

    2007-01-01

    Brain structure in health is a dynamic energized equation incorporating chemistry, neuronal structure, and circuitry components. The chemistry "piece" is represented by multiple neurotransmitters such as Acetylcholine, Serotonin, and Dopamine. The neuronal structure "piece" incorporates synapses and their connections. And finally circuits of neurons establish "architectural blueprints" of anatomic wiring diagrams of the higher order of brain neuron organizations. In Alzheimer's disease, there are progressive losses in all of these components. Brain structure crumbles. The deterioration in Alzheimer's is ordered, reproducible, and stepwise. Drs. Braak and Braak have described stages in the Alzheimer disease continuum. "Progressions" through Braak Stages benchmark "Regressions" in Cognitive function. Under the microscope, the Stages of Braak commence in brain regions near to the hippocampus, and over time, like a tsunami wave of destruction, overturn healthy brain regions, with neurofibrillary tangle damaged neurons "marching" through the temporal lobe, neocortex and occipital cortex. In effect the destruction ascends from the limbic regions to progressively destroy the higher brain centers. Rabies infection also "begins low and finishes high" in its wave of destruction of brain tissue. Herpes Zoster infections offer the paradigm of clinical latency of infection inside of nerves before the "marching commences". Varicella Zoster virus enters neurons in the pediatric years. Dormant virus remains inside the neurons for 50-80 years, tissue damage late in life (shingles) demonstrates the "march of the infection" down neural pathways (dermatomes) as linear areas of painful blisters loaded with virus from a childhood infection. Amalgamation of Zoster with Rabies models produces a hybrid model to explain all of the Braak Stages of Alzheimer's disease under a new paradigm, namely "Alzheimer's neuroborreliosis" in which latent Borrelia infections ascend neural circuits through

  3. Newborn Physiological Immaturity

    PubMed Central

    Fabrellas-Padrés, Núria; Delgado-Hito, Pilar; Hurtado-Pardos, Bárbara; Martí-Cavallé, Montserrat; Gironès-Nogué, Marta; García-Berman, Rosa-Maria; Alonso-Fernandez, Sergio

    2015-01-01

    Background: Most standardized nursing care plans for healthy neonates include multiple nursing diagnoses to reflect nurses' judgments on the infant's status; however scientific literature concerning this issue is scarce. Newborn physiological immaturity is a concept in the ATIC terminology (architecture, terminology, interface, information, nursing [infermeria], and knowledge [coneixement]) to represent the natural status of vulnerability of the healthy neonate. Purpose: To identify the essential attributes of the concept and provide its conceptual and operational definition, using the Wilsonian approach. Findings: The concept under analysis embeds a natural cluster of vulnerabilities and environmental interactions that enhance the evolving maturation process. Implications for Practice: The use of this diagnosis may simplify the process of charting the nursing care plans and reduce time needed for documentation while maintaining the integrity of the information. Implications for Research: Consistent development and use of nursing concepts is essential for knowledge building. Studies on the actual use of nursing diagnoses are needed to inform decision making. PMID:25822514

  4. Viral RNA at Two Stages of Reovirus Infection Is Required for the Induction of Necroptosis.

    PubMed

    Berger, Angela K; Hiller, Bradley E; Thete, Deepti; Snyder, Anthony J; Perez, Encarnacion; Upton, Jason W; Danthi, Pranav

    2017-03-15

    Necroptosis, a regulated form of necrotic cell death, requires the activation of the RIP3 kinase. Here, we identify that infection of host cells with reovirus can result in necroptosis. We find that necroptosis requires sensing of the genomic RNA within incoming virus particles via cytoplasmic RNA sensors to produce type I interferon (IFN). While these events that occur prior to the de novo synthesis of viral RNA are required for the induction of necroptosis, they are not sufficient. The induction of necroptosis also requires late stages of reovirus infection. Specifically, efficient synthesis of double-stranded RNA (dsRNA) within infected cells is required for necroptosis. These data indicate that viral RNA interfaces with host components at two different stages of infection to induce necroptosis. This work provides new molecular details about events in the viral replication cycle that contribute to the induction of necroptosis following infection with an RNA virus.IMPORTANCE An appreciation of how cell death pathways are regulated following viral infection may reveal strategies to limit tissue destruction and prevent the onset of disease. Cell death following virus infection can occur by apoptosis or a regulated form of necrosis known as necroptosis. Apoptotic cells are typically disposed of without activating the immune system. In contrast, necroptotic cells alert the immune system, resulting in inflammation and tissue damage. While apoptosis following virus infection has been extensively investigated, how necroptosis is unleashed following virus infection is understood for only a small group of viruses. Here, using mammalian reovirus, we highlight the molecular mechanism by which infection with a dsRNA virus results in necroptosis.

  5. Two-Stage Cementless Revision Total Hip Arthroplasty for Infected Primary Hip Arthroplasties.

    PubMed

    Camurcu, Yalkin; Sofu, Hakan; Buyuk, Abdul Fettah; Gursu, Sarper; Kaygusuz, Mehmet Akif; Sahin, Vedat

    2015-09-01

    The main purpose of the present study was to analyze the clinical features, the most common infective agents, and the results of two-stage total hip revision using a teicoplanin-impregnated spacer. Between January 2005 and July 2011, 41 patients were included. At the clinical status analysis, physical examination was performed, Harris hip score was noted, isolated microorganisms were recorded, and the radiographic evaluation was performed. The mean Harris hip score was improved from 38.9 ± 9.6 points to 81.8 ± 5.8 points (P<0.05). Infection was eradicated in 39 hips. Radiographic evidence of stability was noted in 37 acetabular revision components, and all femoral stems. Two-stage revision of the infected primary hip arthroplasty is a time-consuming but a reliable procedure with high rates of success. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Transmission of Crimean-Congo Hemorrhagic Fever Virus in Two Species of Hyalomma Ticks from Infected Adults to Cofeeding Immature Forms

    DTIC Science & Technology

    1993-01-01

    with irifected aduLts, chree(D.8")6of ý7O H. irkxcaturm Larvde;; ccntai :nea detect6a’~e CCHF viru-s (mean virus ti~iIter 1C .6pLaque-for-nira -nit:,-1...contained detectable CCHF \\irus (meanf .irus titer 10, " plaque-forming unistsPF1I tick). The viruswas traits- minted transstadiall\\ from infected larsac...mice in- level virus replication. oculated with the virus, we hawe not been able Our inability to detect CCHF virus in unfed to infect ticks on adult

  7. Dynamics of a Class of HIV Infection Models with Cure of Infected Cells in Eclipse Stage.

    PubMed

    Maziane, Mehdi; Lotfi, El Mehdi; Hattaf, Khalid; Yousfi, Noura

    2015-12-01

    In this paper, we propose two HIV infection models with specific nonlinear incidence rate by including a class of infected cells in the eclipse phase. The first model is described by ordinary differential equations (ODEs) and generalizes a set of previously existing models and their results. The second model extends our ODE model by taking into account the diffusion of virus. Furthermore, the global stability of both models is investigated by constructing suitable Lyapunov functionals. Finally, we check our theoretical results with numerical simulations.

  8. One-stage Revision With Catheter Infusion of Intraarticular Antibiotics Successfully Treats Infected THA.

    PubMed

    Whiteside, Leo A; Roy, M E

    2017-02-01

    Two-stage revision surgery for infected total hip arthroplasty (THA) is commonly advocated, but substantial morbidity and expense are associated with this technique. In certain cases of infected THA, treatment with one-stage revision surgery and intraarticular infusion of antibiotics may offer a reasonable alternative with the distinct advantage of providing a means of delivering the drug in high concentrations. We describe a protocol for intraarticular delivery of antibiotics to the hip through an indwelling catheter combined with one-stage revision surgery and examine (1) the success as judged by eradication of infection at 1 year when treating chronically infected cemented stems; (2) success in treating late-onset acute infections in well-ingrown cementless stems; and (3) what complications were associated with this approach in a small case series. Between January 2002 and July 2013, 30 patients (30 hips) presented to the senior author for treatment of infected THA. Of those, 21 patients (21 hips) with infected cemented THAs underwent débridement and single-stage revision to cementless total hip implants followed by catheter infusion of intraarticular antibiotics. Nine patients (nine hips) with late-onset acute infections in cementless THA had bone-ingrown implants. These patients were all more than 2 years from their original surgery and had acute symptoms of infection for 4 to 9 days. Seven had their original THA elsewhere, and two were the author's patients. All were symptom-free until the onset of their infection, and none had postoperative wound complications, fever, or prolonged pain suggestive of a more chronic process. They were treated with débridement and head and liner exchange, again followed by catheter infusion of intraarticular antibiotics. During this time period, this represented all infected THAs treated by the senior author, and all were treated with this protocol; no patient underwent two-stage exchange during this time, and no patients

  9. Fasciola hepatica induces eosinophil apoptosis in the migratory and biliary stages of infection in sheep.

    PubMed

    Escamilla, A; Bautista, M J; Zafra, R; Pacheco, I L; Ruiz, M T; Martínez-Cruz, S; Méndez, A; Martínez-Moreno, A; Molina-Hernández, V; Pérez, J

    2016-01-30

    The aim of the present work was to evaluate the number of apoptotic eosinophils in the livers of sheep experimentally infected with Fasciola hepatica during the migratory and biliary stages of infection. Four groups (n=5) of sheep were used; groups 1-3 were orally infected with 200 metacercariae (mc) and sacrificed at 8 and 28 days post-infection (dpi), and 17 weeks post-infection (wpi), respectively. Group 4 was used as an uninfected control. Apoptosis was detected using immunohistochemistry with a polyclonal antibody against anti-active caspase-3, and transmission electron microscopy (TEM). Eosinophils were identified using the Hansel stain in serial sections for caspase-3, and by ultrastructural features using TEM. At 8 and 28 dpi, numerous caspase-3(+) eosinophils were mainly found at the periphery of acute hepatic necrotic foci. The percentage of caspase -3(+) apoptotic eosinophils in the periphery of necrotic foci was high (46.1-53.9) at 8 and 28 dpi, respectively, and decreased in granulomas found at 28 dpi (6%). Transmission electron microscopy confirmed the presence of apoptotic eosinophils in hepatic lesions at 8 and 28 dpi. At 17 wpi, apoptotic eosinophils were detected in the infiltrate surrounding some enlarged bile ducts containing adult flukes. This is the first report of apoptosis induced by F. hepatica in sheep and the first study reporting apoptosis in eosinophils in hepatic inflammatory infiltrates in vivo. The high number of apoptotic eosinophils in acute necrotic tracts during the migratory and biliary stages of infection suggests that eosinophil apoptosis may play a role in F. hepatica survival during different stages of infection.

  10. Divergent evolution of arrested development in the dauer stage of Caenorhabditis elegans and the infective stage of Heterodera glycines

    PubMed Central

    Elling, Axel A; Mitreva, Makedonka; Recknor, Justin; Gai, Xiaowu; Martin, John; Maier, Thomas R; McDermott, Jeffrey P; Hewezi, Tarek; McK Bird, David; Davis, Eric L; Hussey, Richard S; Nettleton, Dan; McCarter, James P; Baum, Thomas J

    2007-01-01

    Background The soybean cyst nematode Heterodera glycines is the most important parasite in soybean production worldwide. A comprehensive analysis of large-scale gene expression changes throughout the development of plant-parasitic nematodes has been lacking to date. Results We report an extensive genomic analysis of H. glycines, beginning with the generation of 20,100 expressed sequence tags (ESTs). In-depth analysis of these ESTs plus approximately 1,900 previously published sequences predicted 6,860 unique H. glycines genes and allowed a classification by function using InterProScan. Expression profiling of all 6,860 genes throughout the H. glycines life cycle was undertaken using the Affymetrix Soybean Genome Array GeneChip. Our data sets and results represent a comprehensive resource for molecular studies of H. glycines. Demonstrating the power of this resource, we were able to address whether arrested development in the Caenorhabditis elegans dauer larva and the H. glycines infective second-stage juvenile (J2) exhibits shared gene expression profiles. We determined that the gene expression profiles associated with the C. elegans dauer pathway are not uniformly conserved in H. glycines and that the expression profiles of genes for metabolic enzymes of C. elegans dauer larvae and H. glycines infective J2 are dissimilar. Conclusion Our results indicate that hallmark gene expression patterns and metabolism features are not shared in the developmentally arrested life stages of C. elegans and H. glycines, suggesting that developmental arrest in these two nematode species has undergone more divergent evolution than previously thought and pointing to the need for detailed genomic analyses of individual parasite species. PMID:17919324

  11. Efficacy of fenbendazole and piperazine against developing stages of toxocara and toxascaris in dogs.

    PubMed

    Fisher, M A; Jacobs, D E; Hutchinson, M J; Abbott, E M

    1993-05-08

    In a series of controlled trials involving 59 naturally infected greyhounds, fenbendazole at a dose rate of 50 mg/kg/day for three consecutive days reduced the overall numbers of third and fourth stage Toxocara canis by 94.0 per cent and third stage, fourth stage and immature adult stages of Toxascaris leonina by 92.4 per cent. In contrast, piperazine at 100 mg/kg had little or no useful effect against the larval stages of T canis and T leonina and variable efficacy against immature adult T leonina. Fenbendazole was also 100 per cent effective against immature Trichuris vulpis. In a separate controlled experiment, puppies in three litters exposed to reinfection with T canis were treated with fenbendazole at two weeks old and again only after their mean faecal egg counts exceeded 200 epg. Between one and three doses were required to suppress the output of eggs during the puppies' first 12 weeks of life.

  12. Blastomycosis infection of the knee treated with staged total knee arthroplasty.

    PubMed

    MacLean, Ian S; Day, Shandra R; Moore, Christopher C; Browne, James A

    2015-12-01

    Blastomycosis is a rare fungal disease that can cause intraarticular infection and joint destruction requiring surgical reconstruction. We describe a patient who presented with destruction of the knee joint of unknown etiology. The patient was initially treated with debridement and spacer placement followed by antifungal therapy after cultures grew blastomycosis. Following adequate treatment of the infection, the patient was taken back to the operating room for reconstruction with a total knee arthroplasty. The patient had a successful outcome with no evidence of infection at two years following surgery. To our knowledge, this case report represents the first documented case in which a blastomycotic infection of a native knee was successfully treated with a two-stage total knee arthroplasty. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Mitochondrial Respiration Is Impaired during Late-Stage Hamster Prion Infection.

    PubMed

    Faris, Robert; Moore, Roger A; Ward, Anne; Sturdevant, Dan E; Priola, Suzette A

    2017-09-15

    Mitochondria are crucial to proper neuronal function and overall brain health. Mitochondrial dysfunction within the brain has been observed in many neurodegenerative diseases, including prion disease. Several markers of decreased mitochondrial activity during prion infection have been reported, yet the bioenergetic respiratory status of mitochondria from prion-infected animals is unknown. Here we show that clinically ill transgenic mice overexpressing hamster prion protein (Tg7) infected with the hamster prion strain 263K suffer from a severe deficit in mitochondrial oxygen consumption in response to the respiratory complex II substrate succinate. Characterization of the mitochondrial proteome of purified brain mitochondria from infected and uninfected Tg7 mice showed significant differences in the relative abundance of key mitochondrial electron transport proteins in 263K-infected animals relative to that in controls. Our results suggest that at clinical stages of prion infection, dysregulation of respiratory chain proteins may lead to impairment of mitochondrial respiration in the brain.IMPORTANCE Mitochondrial dysfunction is present in most major neurodegenerative diseases, and some studies have suggested that mitochondrial processes may be altered during prion disease. Here we show that hamster prion-infected transgenic mice overexpressing the hamster prion protein (Tg7 mice) suffer from mitochondrial respiratory deficits. Tg7 mice infected with the 263K hamster prion strain have little or no signs of mitochondrial dysfunction at the disease midpoint but suffer from a severe deficit in mitochondrial respiration at the clinical phase of disease. A proteomic analysis of the isolated brain mitochondria from clinically affected animals showed that several proteins involved in electron transport, mitochondrial dynamics, and mitochondrial protein synthesis were dysregulated. These results suggest that mitochondrial dysfunction, possibly exacerbated by prion protein

  14. Dynamics of an HIV Model with Multiple Infection Stages and Treatment with Different Drug Classes.

    PubMed

    Wang, Xia; Song, Xinyu; Tang, Sanyi; Rong, Libin

    2016-02-01

    Highly active antiretroviral therapy can effectively control HIV replication in infected individuals. Some clinical and modeling studies suggested that viral decay dynamics may depend on the inhibited stages of the viral replication cycle. In this paper, we develop a general mathematical model incorporating multiple infection stages and various drug classes that can interfere with specific stages of the viral life cycle. We derive the basic reproductive number and obtain the global stability results of steady states. Using several simple cases of the general model, we study the effect of various drug classes on the dynamics of HIV decay. When drugs are assumed to be 100% effective, drugs acting later in the viral life cycle lead to a faster or more rapid decay in viremia. This is consistent with some patient and experimental data, and also agrees with previous modeling results. When drugs are not 100% effective, the viral decay dynamics are more complicated. Without a second population of long-lived infected cells, the viral load decline can have two phases if drugs act at an intermediate stage of the viral replication cycle. The slopes of viral load decline depend on the drug effectiveness, the death rate of infected cells at different stages, and the transition rate of infected cells from one to the next stage. With a second population of long-lived infected cells, the viral load decline can have three distinct phases, consistent with the observation in patients receiving antiretroviral therapy containing the integrase inhibitor raltegravir. We also fit modeling prediction to patient data under efavirenz (a nonnucleoside reverse-transcriptase inhibitor) and raltegravir treatment. The first-phase viral load decline under raltegravir therapy is longer than that under efavirenz, resulting in a lower viral load at initiation of the second-phase decline in patients taking raltegravir. This explains why patients taking a raltegravir-based therapy were faster to achieve

  15. Hepatitis C virus infection in end-stage renal disease and kidney transplantation.

    PubMed

    Burra, Patrizia; Rodríguez-Castro, Kryssia I; Marchini, Francesco; Bonfante, Luciana; Furian, Lucrezia; Ferrarese, Alberto; Zanetto, Alberto; Germani, Giacomo; Russo, Francesco Paolo; Senzolo, Marco

    2014-09-01

    Liver disease secondary to chronic hepatitis C virus (HCV) infection is an important cause of morbidity and mortality in patients with end-stage renal disease (ESRD) on renal replacement therapy and after kidney transplantation (KT). Hemodialytic treatment (HD) for ESRD constitutes a risk factor for bloodborne infections because of prolonged vascular access and the potential for exposure to infected patients and contaminated equipment. Evaluation of HCV-positive/ESRD and HCV-positive/KT patients is warranted to determine the stage of disease and the appropriateness of antiviral therapy, despite such treatment is challenging especially due to tolerability issues. Antiviral treatment with interferon (IFN) is contraindicated after transplantation due to the risk of rejection, and therefore, treatment is recommended before KT. Newer treatment strategies of direct-acting antiviral agents in combination are revolutionizing HCV therapy, as a result of encouraging outcomes streaming from recent studies which report increased sustained viral response, low or no resistance, and good safety profiles, including preservation of renal function. KT has been demonstrated to yield better outcomes with respect to remaining on HD although survival after KT is penalized by the presence of HCV infection with respect to HCV-negative transplant recipients. Therefore, an appropriate, comprehensive, easily applicable set of clinical practice management guidelines is necessary in both ESRD and KT patients with HCV infection and HCV-related liver disease.

  16. The relationship between cognitive reserve and the clinical stage of HIV infection.

    PubMed

    Alvarez-Tostado, Pablo; Inozemtseva, Olga; Aguiñiga, Miguel A; López, Enrique; Matute, Esmeralda

    2016-01-01

    The objective of this study was to determine whether the effect of cognitive reserve (CR) on neuropsychological functioning differs according to the clinical stage of HIV infection. A sample of 34 HIV-positive individuals aged 23-49, with a minimum of 9 years of formal education, was assessed. Participants were grouped according to the Centers for Disease Control and Prevention's (CDC) clinical stages (A = 10, B = 16, C = 8). CR was calculated for each clinical stage group in accordance with estimates of premorbid IQ, years of education, and occupational attainment. The sum of these three variables was then transformed into z-scores. Individuals above the median were classified as having "High" CR (HCR), those below the median were classified as "Low" CR (LCR). Participants completed an evaluation of cognitive and executive functions based on selected, modified tasks from the HIV University of Miami Annotated Neuropsychological test in Spanish (HUMANS). Assessment included the following domains: attention, memory (visual, verbal, and working memory), executive functions (cognitive flexibility, switching), language (naming), and visual constructive skills (block design). HCR outperformed LCR in all cognitive domains. Comparison of HCR and LCR in each clinical stage revealed that the effect of CR was stronger in stage B than in stages A and C, suggesting that this effect does indeed vary among stages.

  17. Preoperative prediction of failure following two-stage revision for knee prosthetic joint infections.

    PubMed

    Sabry, Fady Youssef; Buller, Leonard; Ahmed, Sarim; Klika, Alison K; Barsoum, Wael K

    2014-01-01

    While two-stage revision is the gold standard for treatment of knee prosthetic joint infection (PJI), it is not without risk. The purpose of this study was to develop a tool to preoperatively predict the probability that a two-stage revision would fail to eradicate knee PJI. 3,809 surgical cases were retrospectively reviewed and data were collected from 314 charts. Overall, 105 (33.4%) cases failed to eradicate PJI using this procedure. Univariate analysis identified multiple variables independently associated with reinfection. Logistic regression was used to generate a model (bootstrap-corrected concordance index of 0.773) predicting failure of infection eradication. Preoperative knowledge of a high probability of failure may improve risk assessment, lead to more aggressive management, and allow for time to consider alternative therapies.

  18. Expression of a hydrophilic surface protein in infective stages of Leishmania major.

    PubMed

    Flinn, H M; Rangarajan, D; Smith, D F

    1994-06-01

    A family of differentially expressed genes from Leishmania major contains one sequence (Gene B) that encodes a novel, hydrophilic protein found on the surface of infective parasite stages. The 177-residue, acidic Gene B protein is characterised by an amino acid repetitive element, comprising 45% of the total molecule, that is related to the cell-wall binding domain of protein A from Staphylococcus aureus. No identifiable signal peptide, membrane-spanning domain or consensus for glycosylphosphatidylinositol anchor attachment to the cell surface is found elsewhere in the deduced protein sequence. In vitro, the Gene B protein fractionates with the parasite cell surface glycoconjugates, lipophosphoglycan and the glycoinositolphospholipids. This protein is the first characterised surface peptide marker for infective stages of the Leishmania life cycle.

  19. In vitro maturation of immature human oocytes for clinical application.

    PubMed

    Chian, Ri-Cheng; Cao, Yun-Xia

    2014-01-01

    Meiotic progression in the oocyte is defined as oocyte maturation from reinitiation of the first meiotic division from the germinal vesicle (GV) stage to the metaphase-II (M-II) stage (Fig. 1), (Cha and Chian, Hum Reprod Update 4:103-120, 1998). Priming with FSH or HCG prior to immature oocyte retrieval improves oocyte maturation and pregnancy rates. The size of follicles may be an important feature for IVM treatment. The combination of natural-cycle IVF with immature oocyte retrieval followed by IVM is an attractive treatment for young women with all types of infertility without recourse to ovarian stimulation with an acceptable pregnancy rate.

  20. Two-stage hierarchical group testing for multiple infections with application to the Infertility Prevention Project

    PubMed Central

    Tebbs, Joshua M.; McMahan, Christopher S.; Bilder, Christopher R.

    2015-01-01

    Summary Screening for sexually transmitted diseases has benefited greatly from the use of group testing (pooled testing) to lower costs. With the development of assays that detect multiple infections, screening practices now involve testing pools of individuals for multiple infections simultaneously. Building on the research for single infection group testing procedures, we examine the performance of group testing for multiple infections. Our work is motivated by chlamydia and gonorrhea testing for the Infertility Prevention Project (IPP), a national program in the United States. We consider a two-stage pooling algorithm currently used to perform testing for the IPP. We first derive the operating characteristics of this algorithm for classification purposes (e.g., expected number of tests, misclassification probabilities, etc.) and identify pool sizes that minimize the expected number of tests. We then develop an expectation-maximization algorithm to estimate probabilities of infection using both group and individual retest responses. Our research shows that group testing can offer large cost savings when classifying individuals for multiple infections and can provide prevalence estimates that are actually more efficient than those from individual testing. PMID:24117173

  1. Two-stage hierarchical group testing for multiple infections with application to the infertility prevention project.

    PubMed

    Tebbs, Joshua M; McMahan, Christopher S; Bilder, Christopher R

    2013-12-01

    Screening for sexually transmitted diseases (STDs) has benefited greatly from the use of group testing (pooled testing) to lower costs. With the development of assays that detect multiple infections, screening practices now involve testing pools of individuals for multiple infections simultaneously. Building on the research for single infection group testing procedures, we examine the performance of group testing for multiple infections. Our work is motivated by chlamydia and gonorrhea testing for the infertility prevention project (IPP), a national program in the United States. We consider a two-stage pooling algorithm currently used to perform testing for the IPP. We first derive the operating characteristics of this algorithm for classification purposes (e.g., expected number of tests, misclassification probabilities, etc.) and identify pool sizes that minimize the expected number of tests. We then develop an expectation-maximization (EM) algorithm to estimate probabilities of infection using both group and individual retest responses. Our research shows that group testing can offer large cost savings when classifying individuals for multiple infections and can provide prevalence estimates that are actually more efficient than those from individual testing. © 2013, The International Biometric Society.

  2. Cucumber Necrosis Virus Recruits Cellular Heat Shock Protein 70 Homologs at Several Stages of Infection

    PubMed Central

    Alam, Syed Benazir

    2015-01-01

    ABSTRACT RNA viruses often depend on host factors for multiplication inside cells due to the constraints of their small genome size and limited coding capacity. One such factor that has been exploited by several plant and animal viruses is heat shock protein 70 (HSP70) family homologs which have been shown to play roles for different viruses in viral RNA replication, viral assembly, disassembly, and cell-to-cell movement. Using next generation sequence analysis, we reveal that several isoforms of Hsp70 and Hsc70 transcripts are induced to very high levels during cucumber necrosis virus (CNV) infection of Nicotiana benthamiana and that HSP70 proteins are also induced by at least 10-fold. We show that HSP70 family protein homologs are co-opted by CNV at several stages of infection. We have found that overexpression of Hsp70 or Hsc70 leads to enhanced CNV genomic RNA, coat protein (CP), and virion accumulation, whereas downregulation leads to a corresponding decrease. Hsc70-2 was found to increase solubility of CNV CP in vitro and to increase accumulation of CNV CP independently of viral RNA replication during coagroinfiltration in N. benthamiana. In addition, virus particle assembly into virus-like particles in CP agroinfiltrated plants was increased in the presence of Hsc70-2. HSP70 was found to increase the targeting of CNV CP to chloroplasts during infection, reinforcing the role of HSP70 in chloroplast targeting of host proteins. Hence, our findings have led to the discovery of a highly induced host factor that has been co-opted to play multiple roles during several stages of the CNV infection cycle. IMPORTANCE Because of the small size of its RNA genome, CNV is dependent on interaction with host cellular components to successfully complete its multiplication cycle. We have found that CNV induces HSP70 family homologs to a high level during infection, possibly as a result of the host response to the high levels of CNV proteins that accumulate during infection

  3. Effects of High Ambient Temperature on Various Stages of Rabies Virus Infection in Mice

    PubMed Central

    Bell, J. F.; Moore, G. J.

    1974-01-01

    Effects of high ambient temperatures on various stages of rabies virus infection have been studied. Ambient temperature increased within the tolerated range was found to have little effect upon body temperature of normal mice, but caused marked elevation of temperature during illness. Temperatures at onset of patent illness in mice were lower than normal. Increased body temperature in the higher thermic ambience during the incubation period was associated with decreased mortality and frequent abortive infections. Exposure to high ambient temperature late in the incubation period delayed onset of illness, decreased mortality, and increased frequency of abortive infections, but exposure to high ambient temperature after onset of patent illness did not affect the course of the disease. PMID:4426698

  4. Transcriptomic Analysis of Calonectria pseudoreteaudii during Various Stages of Eucalyptus Infection.

    PubMed

    Ye, Xiaozhen; Liu, Hongyi; Jin, Yajie; Guo, Mengmeng; Huang, Aizhen; Chen, Quanzhu; Guo, Wenshuo; Zhang, Feiping; Feng, Lizhen

    2017-01-01

    Eucalyptus leaf blight caused by Calonectria spp. is a serious disease in Eucalyptus seedling and plantations. However, the molecular mechanisms of the infection process and pathogenesis of Calonectria to Eucalyptus is not well-studied. In this study, we analyzed the transcriptomes of C. pseudoreteaudii at three stages of Eucalyptus leaf infection, and in mycelium grown in potato dextrose broth using Illumina RNA-Seq technology. We identified 161 differentially expressed genes between C. pseudoreteaudii from leaf and mycelium grown in potato dextrose broth. GO and KEGG enrichment analyses of these genes suggested that they were mainly involved in oxidoreductase activity, hydrolase activity, and transmembrane transporter activity. Most of the differentially expressed genes at the early infection stage were upregulated. These upregulated genes were mainly involved in cell wall hydrolysis and toxin synthesis, suggesting a role for toxin and cell wall hydrolases in the establishment of Calonectria leaf blight. Genes related to detoxification of phytoalexins were continually upregulated during infection. The candidate effectors and putative pathogenicity determinants identified in this study will help in the functional analysis of C. pseudoreteaudii virulence and pathogenicity.

  5. Transcriptomic Analysis of Calonectria pseudoreteaudii during Various Stages of Eucalyptus Infection

    PubMed Central

    Ye, Xiaozhen; Liu, Hongyi; Jin, Yajie; Guo, Mengmeng; Huang, Aizhen; Chen, Quanzhu; Guo, Wenshuo; Zhang, Feiping; Feng, Lizhen

    2017-01-01

    Eucalyptus leaf blight caused by Calonectria spp. is a serious disease in Eucalyptus seedling and plantations. However, the molecular mechanisms of the infection process and pathogenesis of Calonectria to Eucalyptus is not well-studied. In this study, we analyzed the transcriptomes of C. pseudoreteaudii at three stages of Eucalyptus leaf infection, and in mycelium grown in potato dextrose broth using Illumina RNA-Seq technology. We identified 161 differentially expressed genes between C. pseudoreteaudii from leaf and mycelium grown in potato dextrose broth. GO and KEGG enrichment analyses of these genes suggested that they were mainly involved in oxidoreductase activity, hydrolase activity, and transmembrane transporter activity. Most of the differentially expressed genes at the early infection stage were upregulated. These upregulated genes were mainly involved in cell wall hydrolysis and toxin synthesis, suggesting a role for toxin and cell wall hydrolases in the establishment of Calonectria leaf blight. Genes related to detoxification of phytoalexins were continually upregulated during infection. The candidate effectors and putative pathogenicity determinants identified in this study will help in the functional analysis of C. pseudoreteaudii virulence and pathogenicity. PMID:28072879

  6. Two-stage revision of hip prosthesis infection using a hip spacer with stabilising proximal cementation.

    PubMed

    Gil Gonzalez, Sergi; Marqués López, Fernando; Rigol Ramon, Pau; Mestre Cortadellas, Carlos; Cáceres Palou, Enric; León García, Alfonso

    2010-01-01

    Two-stage revision hip arthroplasty for infection using an antibiotic-loaded cement spacer has been used frequently with good results. However, spacer instability is also frequent. Proximal cementation of the spacer could avoid spacer dislocation. We retrospectively assessed 35 patients in whom a 2-stage revision hip arthroplasty for infection was carried out using an antibiotic-loaded cement spacer with gentamicin (Spacer-G) in which the spacer was proximally cemented in 16 patients. The mean follow-up was 32 months. We assessed spacer stability and infection elimination. There were 8 spacer dislocations (22.9%), 5 in hips without proximal cementation and 2 in hips with proximal cementation (p>0.05). There was no fracture in any hip. Reinfection occurred in 5 hips (14.3%), in 3 with the same microorganism, while 2 had a different microorganism. Our results indicate that the proximal cementation of the spacer prevents its dislocation. Infection was eliminated in 86% of the hips.

  7. Infection Staging and Incidence Surveillance Applications of High Dynamic Range Diagnostic Immuno-Assay Platforms.

    PubMed

    Grebe, Eduard; Welte, Alex; Hall, Jake; Keating, Sheila M; Facente, Shelley N; Marson, Kara; Martin, Jeffrey N; Little, Susan J; Price, Matthew A; Kallas, Esper G; Busch, Michael P; Pilcher, Christopher D; Murphy, Gary

    2017-09-07

    Custom HIV staging assays, including the Sedia™ HIV-1 Limiting Antigen Avidity EIA (LAg) and avidity modifications of the Ortho VITROS® anti-HIV-1+2 and Abbott ARCHITECT HIV Ag/Ab Combo assays, are used to identify 'recent' infections in clinical settings and for cross-sectional HIV incidence estimation. However, the high dynamic range of chemiluminescent platforms allows differentiating recent and longstanding infection on signal intensity, and this raises the prospect of using unmodified diagnostic assays for infection timing and surveillance applications. We tested a panel of 2,500 well-characterised specimens with estimable duration of HIV infection with the three assays and the unmodified ARCHITECT. Regression models were used to estimate mean durations of recent infection (MDRI), context-specific false-recent rates (FRR) and correlation between diagnostic signal intensity and LAg measurements. Hypothetical epidemiological scenarios were constructed to evaluate utility in surveillance applications. Over a range of MDRIs (reflecting recency discrimination thresholds), a diluted ARCHITECT-based RITA produced lower FRRs than the VITROS platform (FRR ≈ 0.5% and 1.5% respectively at MDRI ≈ 200 days) and the unmodified diagnostic ARCHITECT produces incidence estimates with comparable precision to LAg (RSE ≈ 17.5% and 15% respectively at MDRI ≈ 200 days). ARCHITECT S/CO measurements were highly correlated with LAg ODn measurements (r = 0.80) and values below 200 are strongly predictive of LAg recency and duration of infection less than one year. Low quantitative measurements from the unmodified ARCHITECT obviate the need for additional recency testing and its use is feasible in clinical staging and incidence surveillance applications.This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Commercial License 4.0 (CCBY-NC), where it is permissible to download, share, remix, transform, and buildup the work provided

  8. [Evaluation of the triflumuron and the mixture of Bacillus thuringiensis plus Bacillus sphaericus for control of the immature stages of Aedes aegypti and Culex quinquefasciatus (Diptera: Culicidae) in catch basins].

    PubMed

    Giraldo-Calderón, Gloria I; Pérez, Mauricio; Morales, Carlos A; Ocampo, Clara B

    2008-06-01

    In Cali, Colombia, catch basins (streetside storm drains) are one of the main larval habitats of Aedes aegypti and Culex quinquefasciatus. Since 1999, these mosquitoes have been controlled by the Secretaría de Salud Municipal (Secretary of Municipal Public Health) using the larvicide triflumuron. Because of high densities of these mosquitoes that remain in the city, treatment failure was suspected -possibly insecticide resistance of the target species. The efficacy of triflumuron and VectoMax (biorational mixture of Bacillus thuringiensis var. israelensis plus Bacillus sphaericus) were evaluated in the control of A. aegypti and C. quinquefasciatus in catch basins. The residual effect of a single application of the biorational formulation was determined in catch basins during periods of high and low rainfall. The efficacy of the products was measured in 60 catch basins located in a residential neighborhood of Cali for a period of 90 days. The mean number of immature instars (A. aegypti and C. quinquefasciatus larvae and pupae of both species) was determined biweekly from 40 catch basins with insecticide intervention (20 treated with triflumuron, 20 with VectoMax) and 20 untreated (control group). The residual effect of the biorational larvicide was evaluated biweekly in 10 catch basins during each of the 2 climatic periods. Results. The catch basins treated with VectoMax presented a significantly lower mean number of immature instars of both species compared with the control ( p<0.01). In contrast, the triflumuron treatment significantly reduced only immature instars of A. aegypti compared with the control ( p<0.001). The residual effect of VectoMax was higher during low rainfall compared to the control ( p<0.001). Conclusion. The biorational formulation was the more effective treatment for the control of both species during the period of evaluation (15 days).

  9. Antibiotic-Loaded Spacer for Two-Stage Revision of Infected Total Knee Arthroplasty.

    PubMed

    Vecchini, Eugenio; Micheloni, Gian Mario; Perusi, Francesco; Scaglia, Marco; Maluta, Tommaso; Lavini, Franco; Bondi, Manuel; Dall'Oca, Carlo; Magnan, Bruno

    2017-03-01

    Infection of total knee arthroplasty (TKA) is a challenge in orthopedic surgery. In literature TKA infection is classified according to the time after surgery: acute postoperative; late chronic; acute hematogenous; positive intraoperative microbiological growth. The purpose of this study is to present the results of the use of a preformed antibiotic-loaded spacer in TKA infections, treated by a two-stage revision procedure. A series of 19 consecutive patients (20 knees) with a diagnosis of infected TKA were treated from January 2003 to February 2012. Two-stage reimplantation protocols were completed only in 16 patients and these data were included in the study. We lost three patients at follow-up. An antibiotic-loaded preformed articulating polymethylmethacrylate spacer was applied. Patients were observed 1, 3, and 6 months postoperatively and then yearly for clinical and radiographic examination. The mean American Knee Society Score improved from 68.4 preoperatively (range, from 34 to 108) to 112.7 at final follow-up (range, from 49 to 180). The pain was evaluated as part of clinical score. It improved from an average of 19.3 preoperatively (range, from 10 to 30) to 34.3 at final follow-up (range, from 10 to 50). The average range of motion improved from 40.1 degrees (range, from 6 to 90 degrees) to 79.3 degrees (range, from 45 to 125 degrees). The use of the spacer allows obtaining a reduction of pain, an improvement of quality of life in the period of time between the two surgical stages and an easier reimplantation of TKA.

  10. Separation of Plasmodium falciparum Late Stage-infected Erythrocytes by Magnetic Means

    PubMed Central

    Coronado, Lorena Michelle; Tayler, Nicole Michelle; Correa, Ricardo; Giovani, Rita Marissa; Spadafora, Carmenza

    2013-01-01

    Unlike other Plasmodium species, P. falciparum can be cultured in the lab, which facilitates its study 1. While the parasitemia achieved can reach the ≈40% limit, the investigator usually keeps the percentage at around 10%. In many cases it is necessary to isolate the parasite-containing red blood cells (RBCs) from the uninfected ones, to enrich the culture and proceed with a given experiment. When P. falciparum infects the erythrocyte, the parasite degrades and feeds from haemoglobin 2, 3. However, the parasite must deal with a very toxic iron-containing haem moiety 4, 5. The parasite eludes its toxicity by transforming the haem into an inert crystal polymer called haemozoin 6, 7. This iron-containing molecule is stored in its food vacuole and the metal in it has an oxidative state which differs from the one in haem 8. The ferric state of iron in the haemozoin confers on it a paramagnetic property absent in uninfected erythrocytes. As the invading parasite reaches maturity, the content of haemozoin also increases 9, which bestows even more paramagnetism on the latest stages of P. falciparum inside the erythrocyte. Based on this paramagnetic property, the latest stages of P. falciparum infected-red blood cells can be separated by passing the culture through a column containing magnetic beads. These beads become magnetic when the columns containing them are placed on a magnet holder. Infected RBCs, due to their paramagnetism, will then be trapped inside the column, while the flow-through will contain, for the most part, uninfected erythrocytes and those containing early stages of the parasite. Here, we describe the methodology to enrich the population of late stage parasites with magnetic columns, which maintains good parasite viability 10. After performing this procedure, the unattached culture can be returned to an incubator to allow the remaining parasites to continue growing. PMID:23486405

  11. The Brain NO Levels and NOS Activities Ascended in the Early and Middle Stages and Descended in the Terminal Stage in Scrapie-Infected Animal Models.

    PubMed

    Chen, Li-Na; Sun, Jing; Yang, Xiao-Dong; Xiao, Kang; Lv, Yan; Zhang, Bao-Yun; Zhou, Wei; Chen, Cao; Gao, Chen; Shi, Qi; Dong, Xiao-Ping

    2017-04-01

    The infections of prion agents may cause progressive and fatal neurodegenerative diseases in humans and a serial of animal species. Previous studies have proposed that the levels of nitric oxide (NO) and nitric oxide synthase (NOS) in the brains of some neurodegeneration diseases changed, while S-nitrosylation (SNO) of many brain proteins altered in prion diseases. To elucidate the potential changes of brain NO levels during prion infection, the NO levels and NOS activities in the brain tissues of three scrapie experimental rodents were measured, including scrapie agent 263 K-infected hamsters and 139A- and ME7-infected mice. Both NO levels and NOS activities, including total NOS (TNOS) and inducible NOS (iNOS), were increased at the terminal stages of scrapie-infected animals. Assays of the brain samples collected at different time points during scrapie infection showed that the NO levels and NOS activities started to increase at early stage, reached to the peak in the middle stage, and dropped down at late stage. Western blots for brain iNOS revealed increased firstly and decreased late, especially in the brains of 139A- and ME7-infected mice. In line with those alterations, the levels of the SNO forms of several selected brain proteins such as aquaporin-1 (AQP1), calcium/calmodulin-dependent protein kinase II (CaMKII), neurogranin, and opalin, underwent similar changing trends, while their total protein levels did not change obviously during scrapie infection. Our data here for the first time illustrate the changing profile of brain NO and NOS during prion infection. Time-dependent alterations of brain NO level and the associated protein S-nitrosylation process may contribute greatly to the neuropathological damage in prion diseases.

  12. Characterization of a 14,000 dalton antigen of Dirofilaria immitis infective third stage larvae

    SciTech Connect

    Fuller, S.A.; Cachia, P.J.; Wong, M.M.; Hurrell, J.G.R.

    1986-05-01

    Immunogenic proteins of Dirofilaria immitis (canine heartworm) were identified by probing extracts of adult worms or their excretory-secretory proteins (ESP) blotted to nitrocellulose following SDS-PAGE with control or infected dog sera. A 14,000 dalton antigen (a prominent component of ESP by protein staining) was consistently recognized both in extracts and ESP by dog sera as early as three months post infection. This indicates a larval origin for the antigen since no adult worms are present until approximately five months post infection. Monoclonal antibodies (MAbs) prepared against the 14,000 dalton antigen confirmed by immunoblotting that this antigen is expressed by infective third stage larvae, adults and microfilariae and is present intact in the sera of infected dogs. Surface-labelling of whole adult D. immitis with Na/sup 125/I produced radiolabelled antigens closely corresponding to those of ESP. An anti-14,000 dalton MAb was able to immunoprecipitate radiolabelled antigen which strongly suggest a surface or membrane location in the intact organism. Gel filtration data suggests that the protein is a native monomer. A MAb-affinity column has been used to purify the 14,000 dalton antigen to at least 98% homogeneity in one step from crude worm extracts. Further fractionation by HPLC yields a homogeneous preparation. Amino acid analysis and the N-terminal amino acid sequence data will be presented.

  13. Use of staged molecular analysis to determine causes of unexplained central nervous system infections.

    PubMed

    Hsu, Chien-Chin; Tokarz, Rafal; Briese, Thomas; Tsai, Hung-Chin; Quan, Phenix-Lan; Lipkin, W Ian

    2013-01-01

    No agent is implicated in most central nervous system (CNS) infections. To investigate cerebrospinal fluid samples from patients with CNS infections of unknown cause in 1 hospital in Taiwan, we used a staged molecular approach, incorporating techniques including multiplex MassTag PCR, 16S rRNA PCR, DNA microarray, and high-throughput pyrosequencing. We determined the infectious agent for 31 (24%) of 131 previously negative samples. Candidate pathogens were identified for 25 (27%) of 94 unexplained meningitis cases and 6 (16%) of 37 unexplained encephalitis cases. Epstein-Barr virus (18 infections) accounted for most of the identified agents in unexplained meningitis cases, followed by Escherichia coli (5), enterovirus (2), human herpesvirus 2 (1), and Mycobacterium tuberculosis. Herpesviruses were identified in samples from patients with unexplained encephalitis cases, including varicella-zoster virus (3 infections), human herpesvirus 1 (2), and cytomegalovirus (1). Our study confirms the power of multiplex MassTag PCR as a rapid diagnostic tool for identifying pathogens causing unexplained CNS infections.

  14. Raman spectroscopy based investigation of molecular changes associated with an early stage of dengue virus infection

    NASA Astrophysics Data System (ADS)

    Bilal, Maria; Bilal, Muhammad; Saleem, Muhammad; Khurram, Muhammad; Khan, Saranjam; Ullah, Rahat; Ali, Hina; Ahmed, Mushtaq; Shahzada, Shaista; Ullah Khan, Ehsan

    2017-04-01

    Raman spectroscopy based investigations of the molecular changes associated with an early stage of dengue virus infection (DENV) using a partial least squares (PLS) regression model is presented. This study is based on non-structural protein 1 (NS1) which appears after three days of DENV infection. In total, 39 blood sera samples were collected and divided into two groups. The control group contained samples which were the negative for NS1 and antibodies and the positive group contained those samples in which NS1 is positive and antibodies were negative. Out of 39 samples, 29 Raman spectra were used for the model development while the remaining 10 were kept hidden for blind testing of the model. PLS regression yielded a vector of regression coefficients as a function of Raman shift, which were analyzed. Cytokines in the region 775-875 cm-1, lectins at 1003, 1238, 1340, 1449 and 1672 cm-1, DNA in the region 1040-1140 cm-1 and alpha and beta structures of proteins in the region 933-967 cm-1 have been identified in the regression vector for their role in an early stage of DENV infection. Validity of the model was established by its R-square value of 0.891. Sensitivity, specificity and accuracy were 100% each and the area under the receiver operator characteristic curve was found to be 1.

  15. Usefulness of the recombinant liver stage antigen-3 for an early serodiagnosis of Plasmodium falciparum infection

    PubMed Central

    Lee, Hyeong-Woo; Moon, Sung-Ung; Ryu, Hye-Sun; Kim, Yeon-Joo; Cho, Shin-Hyeong; Chung, Gyung-Tae; Lin, Khin; Na, Byoung-Kuk; Kong, Yoon; Chung, Kyung-Suk

    2006-01-01

    In order to develop tools for an early serodiagnosis of Plasmodium falciparum infection, we evaluated the usefulness of P. falciparum liver stage antigen-3 (LSA-3) as a serodiagnostic antigen. A portion of LSA-3 gene was cloned, and its recombinant protein (rLSA-3) was expressed in Escherichia coli and purified by column chromatography. The purified rLSA-3 and 120 test blood/serum samples collected from inhabitants in malaria-endemic areas of Mandalay, Myanmar were used for this study. In microscopic examinations of blood samples, P. falciparum positive rate was 39.1% (47/120) in thin smear trials, and 33.3% (40/120) in thick smear trials. Although the positive rate associated with the rLSA-3 (30.8%) was lower than that of the blood stage antigens (70.8%), rLSA-3 based enzyme-linked immunosorbent assay could detect 12 seropositive cases (10.0%), in which blood stage antigens were not detected. These results indicate that the LSA-3 is a useful antigen for an early serodiagnosis of P. falciparum infection. PMID:16514282

  16. Usefulness of the recombinant liver stage antigen-3 for an early serodiagnosis of Plasmodium falciparum infection.

    PubMed

    Lee, Hyeong-Woo; Moon, Sung-Ung; Ryu, Hye-Sun; Kim, Yeon-Joo; Cho, Shin-Hyeong; Chung, Gyung-Tae; Lin, Khin; Na, Byoung-Kuk; Kong, Yoon; Chung, Kyung-Suk; Kim, Tong-Soo

    2006-03-01

    In order to develop tools for an early serodiagnosis of Plasmodium falciparum infection, we evaluated the usefulness of P. falciparum liver stage antigen-3 (LSA-3) as a serodiagnostic antigen. A portion of LSA-3 gene was cloned, and its recombinant protein (rLSA-3) was expressed in Escherichia coli and purified by column chromatography. The purified rLSA-3 and 120 test blood/serum samples collected from inhabitants in malaria-endemic areas of Mandalay, Myanmar were used for this study. In microscopic examinations of blood samples, P. falciparum positive rate was 39.1% (47/120) in thin smear trials, and 33.3% (40/120) in thick smear trials. Although the positive rate associated with the rLSA-3 (30.8%) was lower than that of the blood stage antigens (70.8%), rLSA-3 based enzyme-linked immunosorbent assay could detect 12 seropositive cases (10.0%), in which blood stage antigens were not detected. These results indicate that the LSA-3 is a useful antigen for an early serodiagnosis of P. falciparum infection.

  17. Exposure of the snail Potamopyrgus antipodarum to herbicide boosts output and survival of parasite infective stages.

    PubMed

    Hock, Sabrina D; Poulin, Robert

    2012-12-01

    Anthropogenic stressors such as pollutants can modulate levels of parasitic infections in aquatic animals by suppressing host immunity or through some other mechanisms. One such mechanism could involve increases in either the quantity or quality of infective stages produced by parasites. We investigated the effect of exposure of infected snails, Potamopyrgus antipodarum, to different concentrations of the widely-used herbicide glyphosate, on (i) the production of infective cercariae by three trematode species, Coitocaecum parvum, Apatemon sp. and an undescribed renicolid, and (ii) the survival of cercariae of the latter species. For all three trematode species, infected snails exposed over a month to low (0.36 mg a.i. L(-1)) or medium (3.6 mg a.i. L(-1)) formulated glyphosate concentrations released between 1.5 and 3 times more cercariae per day than snails under control conditions. The similar pattern seen in all trematodes suggests a general weakening of the host benefiting any of its parasites rather than some parasite species-specific mechanism. In addition, the survival of renicolid cercariae improved with increasing glyphosate concentrations, with cercariae living about 50% longer in the medium concentration (3.6 mg a.i. L(-1)) than in control conditions. Our results demonstrate a clear interaction between glyphosate pollution and parasitism by trematodes in freshwater systems, occurring at glyphosate concentrations recorded in aquatic habitats, and within the environmental exposure limit allowed in New Zealand freshwaters. Future risk assessments and toxicity tests need to consider indirect impacts resulting from infections to invertebrate and vertebrate species penetrated by cercariae and serving as second intermediate hosts of trematodes.

  18. End-Stage Renal Disease Among HIV-Infected Adults in North America

    PubMed Central

    Abraham, Alison G.; Althoff, Keri N.; Jing, Yuezhou; Estrella, Michelle M.; Kitahata, Mari M.; Wester, C. William; Bosch, Ronald J.; Crane, Heidi; Eron, Joseph; Gill, M. John; Horberg, Michael A.; Justice, Amy C.; Klein, Marina; Mayor, Angel M.; Moore, Richard D.; Palella, Frank J.; Parikh, Chirag R.; Silverberg, Michael J.; Golub, Elizabeth T.; Jacobson, Lisa P.; Napravnik, Sonia; Lucas, Gregory M.; Kirk, Gregory D.; Benson, Constance A.; Bosch, Ronald J.; Collier, Ann C.; Boswell, Stephen; Grasso, Chris; Mayer, Ken; Hogg, Robert S.; Harrigan, Richard; Montaner, Julio; Cescon, Angela; Brooks, John T.; Buchacz, Kate; Gebo, Kelly A.; Moore, Richard D.; Moore, Richard D.; Carey, John T.; Rodriguez, Benigno; Horberg, Michael A.; Silverberg, Michael J.; Thorne, Jennifer E.; Goedert, James J.; Jacobson, Lisa P.; Klein, Marina B.; Rourke, Sean B.; Burchell, Ann; Rachlis, Anita R.; Hunter-Mellado, Robert F.; Mayor, Angel M.; Gill, M. John; Deeks, Steven G.; Martin, Jeffrey N.; Saag, Michael S.; Mugavero, Michael J.; Willig, James; Eron, Joseph J.; Napravnik, Sonia; Kitahata, Mari M.; Crane, Heidi M.; Justice, Amy C.; Dubrow, Robert; Fiellin, David; Sterling, Timothy R.; Haas, David; Bebawy, Sally; Turner, Megan; Gange, Stephen J.; Anastos, Kathryn; Moore, Richard D.; Saag, Michael S.; Gange, Stephen J.; Althoff, Keri N.; Kitahata, Mari M.; McKaig, Rosemary G.; Justice, Amy C.; Freeman, Aimee M.; Moore, Richard D.; Freeman, Aimee M.; Lent, Carol; Kitahata, Mari M.; Van Rompaey, Stephen E.; Crane, Heidi M.; Webster, Eric; Morton, Liz; Simon, Brenda; Gange, Stephen J.; Althoff, Keri N.; Abraham, Alison G.; Lau, Bryan; Zhang, Jinbing; Jing, Jerry; Golub, Elizabeth; Modur, Shari; Hanna, David B.; Rebeiro, Peter; Wong, Cherise; Mendes, Adell

    2015-01-01

    Background. Human immunodeficiency virus (HIV)-infected adults, particularly those of black race, are at high-risk for end-stage renal disease (ESRD), but contributing factors are evolving. We hypothesized that improvements in HIV treatment have led to declines in risk of ESRD, particularly among HIV-infected blacks. Methods. Using data from the North American AIDS Cohort Collaboration for Research and Design from January 2000 to December 2009, we validated 286 incident ESRD cases using abstracted medical evidence of dialysis (lasting >6 months) or renal transplant. A total of 38 354 HIV-infected adults aged 18–80 years contributed 159 825 person-years (PYs). Age- and sex-standardized incidence ratios (SIRs) were estimated by race. Poisson regression was used to identify predictors of ESRD. Results. HIV-infected ESRD cases were more likely to be of black race, have diabetes mellitus or hypertension, inject drugs, and/or have a prior AIDS-defining illness. The overall SIR was 3.2 (95% confidence interval [CI], 2.8–3.6) but was significantly higher among black patients (4.5 [95% CI, 3.9–5.2]). ESRD incidence declined from 532 to 303 per 100 000 PYs and 138 to 34 per 100 000 PYs over the time period for blacks and nonblacks, respectively, coincident with notable increases in both the prevalence of viral suppression and the prevalence of ESRD risk factors including diabetes mellitus, hypertension, and hepatitis C virus coinfection. Conclusions. The risk of ESRD remains high among HIV-infected individuals in care but is declining with improvements in virologic suppression. HIV-infected black persons continue to comprise the majority of cases, as a result of higher viral loads, comorbidities, and genetic susceptibility. PMID:25409471

  19. End-stage renal disease among HIV-infected adults in North America.

    PubMed

    Abraham, Alison G; Althoff, Keri N; Jing, Yuezhou; Estrella, Michelle M; Kitahata, Mari M; Wester, C William; Bosch, Ronald J; Crane, Heidi; Eron, Joseph; Gill, M John; Horberg, Michael A; Justice, Amy C; Klein, Marina; Mayor, Angel M; Moore, Richard D; Palella, Frank J; Parikh, Chirag R; Silverberg, Michael J; Golub, Elizabeth T; Jacobson, Lisa P; Napravnik, Sonia; Lucas, Gregory M

    2015-03-15

    Human immunodeficiency virus (HIV)-infected adults, particularly those of black race, are at high-risk for end-stage renal disease (ESRD), but contributing factors are evolving. We hypothesized that improvements in HIV treatment have led to declines in risk of ESRD, particularly among HIV-infected blacks. Using data from the North American AIDS Cohort Collaboration for Research and Design from January 2000 to December 2009, we validated 286 incident ESRD cases using abstracted medical evidence of dialysis (lasting >6 months) or renal transplant. A total of 38 354 HIV-infected adults aged 18-80 years contributed 159 825 person-years (PYs). Age- and sex-standardized incidence ratios (SIRs) were estimated by race. Poisson regression was used to identify predictors of ESRD. HIV-infected ESRD cases were more likely to be of black race, have diabetes mellitus or hypertension, inject drugs, and/or have a prior AIDS-defining illness. The overall SIR was 3.2 (95% confidence interval [CI], 2.8-3.6) but was significantly higher among black patients (4.5 [95% CI, 3.9-5.2]). ESRD incidence declined from 532 to 303 per 100 000 PYs and 138 to 34 per 100 000 PYs over the time period for blacks and nonblacks, respectively, coincident with notable increases in both the prevalence of viral suppression and the prevalence of ESRD risk factors including diabetes mellitus, hypertension, and hepatitis C virus coinfection. The risk of ESRD remains high among HIV-infected individuals in care but is declining with improvements in virologic suppression. HIV-infected black persons continue to comprise the majority of cases, as a result of higher viral loads, comorbidities, and genetic susceptibility. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. A transgenic animal with antiviral properties that might inhibit multiple stages of infection.

    PubMed

    Jiang, Liang; Zhao, Ping; Cheng, Tingcai; Sun, Qiang; Peng, Zhengwen; Dang, Yinghui; Wu, Xiangwei; Wang, Genhong; Jin, Shengkai; Lin, Ping; Xia, Qingyou

    2013-05-01

    Bombyx mori nucleopolyhedrovirus (BmNPV) is the primary pathogen of silkworms, causing severe economic losses in sericulture. To create antiviral silkworm strains, we constructed a transgenic vector in which the dsRNA for five tandem BmNPV genes was controlled by the BmNPV hr3 enhancer and IE1 promoter. The antivirus gene Bmlipase-1 was driven by B. mori midgut-specific promoter P2. Transgenic strains (SW-H) were generated via embryo microinjection using the practical silkworm strain SW. After infection with a high dose of BmNPV, the survival rates of SW-H and non-transgenic SW were 64% and 13%, respectively. SW-H could be the first transgenic animal that is highly antiviral and that might inhibit the virus at multiple stages of infection. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Magnetic separation of malaria-infected red blood cells in various developmental stages.

    PubMed

    Nam, Jeonghun; Huang, Hui; Lim, Hyunjung; Lim, Chaeseung; Shin, Sehyun

    2013-08-06

    Malaria is a serious disease that threatens the public health, especially in developing countries. Various methods have been developed to separate malaria-infected red blood cells (i-RBCs) from blood samples for clinical diagnosis and biological and epidemiological research. In this study, we propose a simple and label-free method for separating not only late-stage but also early-stage i-RBCs on the basis of their paramagnetic characteristics due to the malaria byproduct, hemozoin, by using a magnetic field gradient. A polydimethylsiloxane (PDMS) microfluidic channel was fabricated and integrated with a ferromagnetic wire fixed on a glass slide. To evaluate the performance of the microfluidic device containing the ferromagnetic wire, lateral displacement of NaNO2-treated RBCs, which also have paramagnetic characteristics, was observed at various flow rates. The results showed excellent agreement with theoretically predicted values. The same device was applied to separate i-RBCs. Late-stage i-RBCs (trophozoites and schizonts), which contain optically visible black dots, were separated with a recovery rate of approximately 98.3%. In addition, using an optimal flow rate, early-stage (ring-stage) i-RBCs, which had been difficult to separate because of their low paramagnetic characteristics, were successfully separated with a recovery rate of 73%. The present technique, using permanent magnets and ferromagnetic wire in a microchannel, can effectively separate i-RBCs in various developmental stages so that it could provide a potential tool for studying the invasion mechanism of the malarial parasite, as well as performing antimalarial drug assays.

  2. Titanium-copper-nitride coated spacers for two-stage revision of infected total hip endoprostheses.

    PubMed

    Ellenrieder, Martin; Haenle, Maximilian; Lenz, Robert; Bader, Rainer; Mittelmeier, Wolfram

    2011-01-01

    Within the first two years after total hip arthroplasty implant-associated infection has become the second most common reason for a revision surgery. Two-stage implant exchange is frequently conducted using temporary spacers made of antibiotic-loaded cement in order to prevent a bacterial colonization on the spacer. Avoiding several disadvantages of cement spacers, a conventional hemi-endoprosthesis was equipped with a copper-containing implant coating for inhibition of bacterial biofilms. In the present paper details of this novel treatment concept are presented including a case report.

  3. Titanium-copper-nitride coated spacers for two-stage revision of infected total hip endoprostheses

    PubMed Central

    Ellenrieder, Martin; Haenle, Maximilian; Lenz, Robert; Bader, Rainer; Mittelmeier, Wolfram

    2011-01-01

    Within the first two years after total hip arthroplasty implant-associated infection has become the second most common reason for a revision surgery. Two-stage implant exchange is frequently conducted using temporary spacers made of antibiotic-loaded cement in order to prevent a bacterial colonization on the spacer. Avoiding several disadvantages of cement spacers, a conventional hemi-endoprosthesis was equipped with a copper-containing implant coating for inhibition of bacterial biofilms. In the present paper details of this novel treatment concept are presented including a case report. PMID:22242097

  4. Removal of Dolutegravir by Hemodialysis in HIV-Infected Patients with End-Stage Renal Disease.

    PubMed

    Moltó, José; Graterol, Fredzzia; Miranda, Cristina; Khoo, Saye; Bancu, Ioana; Amara, Alieu; Bonjoch, Anna; Clotet, Bonaventura

    2016-04-01

    Data on dolutegravir removal by hemodialysis are lacking. To study this, we measured dolutegravir plasma concentrations in samples of blood entering and leaving the dialyzer and of the resulting dialysate from 5 HIV-infected patients with end-stage renal disease. The median dolutegravir hemodialysis extraction ratio was 7%. The dolutegravir concentrations after the dialysis session remained far above the protein-binding-adjusted inhibitory concentration. Our results show minimal dolutegravir removal by hemodialysis, with no specific dolutegravir dosage adjustments required in this setting. (This study is registered at ClinicalTrials.gov under registration number NCT02487706.). Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  5. Removal of Dolutegravir by Hemodialysis in HIV-Infected Patients with End-Stage Renal Disease

    PubMed Central

    Graterol, Fredzzia; Miranda, Cristina; Khoo, Saye; Bancu, Ioana; Amara, Alieu; Bonjoch, Anna; Clotet, Bonaventura

    2016-01-01

    Data on dolutegravir removal by hemodialysis are lacking. To study this, we measured dolutegravir plasma concentrations in samples of blood entering and leaving the dialyzer and of the resulting dialysate from 5 HIV-infected patients with end-stage renal disease. The median dolutegravir hemodialysis extraction ratio was 7%. The dolutegravir concentrations after the dialysis session remained far above the protein-binding-adjusted inhibitory concentration. Our results show minimal dolutegravir removal by hemodialysis, with no specific dolutegravir dosage adjustments required in this setting. (This study is registered at ClinicalTrials.gov under registration number NCT02487706.) PMID:26856824

  6. Assessment of the efficacy of parasiticides for the control of tick infection in dogs under field conditions: what's new?

    PubMed

    Otranto, D

    2006-06-01

    For their biological and ecological characteristics, ticks are vectors of the widest variety of pathogens causing tick-borne diseases (TBDs). Little information is available about the ways in which time spent by ticks to feed on hosts, transmission times and TBD prevention are related and it is exclusively limited to laboratory reports on adult stages. In particular, the time required by immature stages to transmit pathogens has not been determined for most TBDs. Considering their importance for animal and human health, effective control of immature ticks is advisable to reduce the damage ticks cause. Recently, the efficacy of a combination of imidacloprid 10%/permethrin 50% was compared with that of fipronil 10%/S-methoprene 9% against ticks when administered to naturally infected dogs. A semi-quantitative method was used to assess the methodological parameters to calculate drug efficacy on immature stages. On adult ticks, the efficacy of both products was high and overall very similar, whereas for the immature stages the combination of imidacloprid 10% and permethrin 50% had a higher efficacy than fipronil 10% and methoprene 9% throughout the observation period (statistically significant difference on day + 28 only). The semi-quantitative method proposed for the evaluation of immature stages can be considered a useful tool for calculating the efficacy of a drug in the field. Due the important role of immatures in the spread of TBDs, the immature tick load should be calculated to assess the efficacy of acaricidal products both under laboratory and field conditions.

  7. Exogenous and endogenous stages of Eimeria perforans naturally infected domestic rabbit (Oryctolagus cuniculus) in Saudi Arabia: Light microscopic study

    PubMed Central

    Al-Quraishy, Saleh

    2011-01-01

    Exogenous and endogenous stages of Eimeria perforans naturally infected rabbits in Saudi Arabia were described. The prevalence of infection was 75%. Oocysts were ovoid to elliptical and measured 16 × 10 μm. The four dizoic sporocysts were ovoid and measured 7 × 5 μm. Endogenous stages were restricted to the duodenum. Meronts, microgamonts, macrogamonts and young oocysts were recorded and described. PMID:23961159

  8. Revitalization of traumatized immature tooth with platelet-rich fibrin

    PubMed Central

    Faizuddin, Umrana; Solomon, Raji Viola; Mattapathi, Jayadev; Guniganti, Sushma Shravani

    2015-01-01

    Endodontic treatment options for immature, nonvital teeth conventionally include surgical endodontics, apexification with calcium hydroxide, or single visit mineral trioxide aggregate plug. Regeneration is a new concept which is been introduced in the treatment of traumatized open apex tooth. Regeneration of pulp-dentin complex in an infected necrotic tooth with an open apex is possible if the canal is effectively disinfected. The purpose of this case report is to add a new vista in regenerative, endodontic therapy by using platelet-rich fibrin for revitalization of immature nonvital tooth. PMID:26681870

  9. One-stage treatment of deep infection following repair of Achilles tendon rupture with flexor hallucis longus transfer.

    PubMed

    Lee, Kang; Moon, Jeong Seok; Seo, Jeong Gook; Lee, Woo Chun

    2009-03-01

    We present one-stage treatment of deep infection following repair of Achilles tendon rupture using flexor hallucis longus transfer. Flexor hallucis longus was used not only to connect the defect in Achillles tendon, but also to control the soft tissue infection with its abundant blood supply, simultaneously. The clinical results for the two patients in this report were excellent without major complication.

  10. Immunization of broiler chicks by in ovo injection of infective stages of Eimeria.

    PubMed

    Weber, F H; Genteman, K C; LeMay, M A; Lewis, D O; Evans, N A

    2004-03-01

    Immunization of chickens by in ovo injection of infective stages of 5 species of Eimeria was investigated. Fertile Hubbard x Petersen broiler chicken eggs were injected through the air cell on d 18 of incubation with oocysts of E. acervulina, E. maxima, E. mitis, E. praecox, or E. brunetti. Injected doses of all species ranged from 1 x 10(2) to 1 x 10(6) sporulated oocysts per egg. Chicks receiving oocysts in ovo shed oocysts posthatch. After 2 wk in wire-floored cages, birds were given a challenge infection with the homologous Eimeria species. Chicks immunized by in ovo injection of oocysts had significantly reduced lesion scores, improved weight gain, or reduced oocyst output compared with their nonimmunized counterparts. In additional studies, eggs were injected with 1 x 10(5) sporozoites of E. tenella, E. maxima, or E. acervulina per egg. Sporozoites of E. acervulina were not infective for chick embryos when administered in phosphate-buffered saline, but if sporozoites were suspended in tissue culture medium when injected in ovo, hatched chicks shed oocysts with peak output occurring 3 to 4 d posthatch. Sporozoites of E. maxima and E. tenella were infective for 18-d-old embryos regardless of the vehicle. The results demonstrate that immunization of broiler chickens against several species of coccidia by in ovo injection of oocysts is feasible. The infectivity of sporozoites for 18-d-old chick embryos varied depending on the species of Eimeria and the vehicle in which the sporozoites were suspended prior to injection.

  11. The impact of patellar resurfacing in two-stage revision of the infected total knee arthroplasty.

    PubMed

    Glynn, Aaron; Huang, Ronald; Mortazavi, Javad; Parvizi, Javad

    2014-07-01

    Evidence for optimal management of the patellofemoral joint in revision surgery for the infected TKA is limited. We reviewed 69 infected TKAs undergoing two-stage revision. Fifty four patellae were resurfaced, 11 had patelloplasty performed, two were augmented with trabecular metal, one had impaction grafting, and one knee underwent patellectomy. Average follow-up was 4.5 years. The patients that received patellar resurfacing at re-implantation experienced statistically significant improvements in KSS pain score, functional KSS, and patellar score (P < 0.03). One further patient treated with impaction grafting improved significantly in terms of pain and function. Patients treated with patelloplasty, trabecular metal augmentation, or patellectomy did not have significant improvements in clinical or functional outcome. Patient age, use of dynamic vs. static spacer, use of extensor mechanism release, and differences in Charlson index did not seem to statistically affect outcome. We recommend that every effort should be made to minimize patellar bone loss in first stage resection, as inability to resurface the patella at time of reimplantation may adversely affect patient outcome.

  12. Silvicultural treatments in immature stands

    Treesearch

    Richard C. Schlesinger

    1989-01-01

    Silvicultural treatments for immature central hardwood stands include precommercial and commercial thinnings, lateral branch pruning, fertilization, cull tree deadening, and vine removal. The specifics of these treatments are discussed elsewhere in these Notes. This Note discusses some basic concepts in the selection and application of silvicultural treatments for...

  13. Potential gingival crevicular fluid and serum biomarkers by stage of HIV infection.

    PubMed

    Elizondo, Jesús Eduardo; Rocha-Pizaña, María Del Refugio; Treviño, Ana Cecilia; Violant, Deborah; Álvarez, Mario Moisés; Rivas-Estilla, Ana María

    2017-03-01

    This study evaluates the potential of gingival crevicular fluid and serum cytokines as HIV stage biomarkers. Gingival crevicular fluid (GCF) and serum samples from 78 HIV-positive adult male subjects (cases) and 39 HIV-negative male subjects (controls) from Mexico were examined for 17 cytokines using multiplex ELISA. Participants were divided into five subgroups by HIV stage of infection on age-specific CD4+ T-lymphocyte count and antiretroviral therapy (ART), and further correlated to the cytokine levels. GCF concentrations of IL-6, IL-7, IL-10, IL-12, G-CSF and MCP-1, as well as serum concentrations of IL-1β, IL-2 and IL-6 showed a statistically significant difference among subgroups. We found a significant effect size correlation on cytokines expression levels. Subjects who were not in ART showed significantly higher levels of some of the analyzed cytokines compared to the rest. We found that GCF IL-8 was a significant predictor for the Non-ART HIV status (p<0.05). We observed the same result for GCF G-CSF in the ART Short-term group and serum GM-CSF in the ART Long-term subgroup. Results indicate a high variability of GCF and serum cytokines concentrations and low frequency of their detection in different HIV/ART stages. However, within the limits of the present study, some GCF and serum cytokine concentrations correlate positively. Oral and periodontal innate immunity is affected by HIV viremia and ART. GCF IL-8, G-CSF, as well as serum IL-8, MCP-1 and GM-CSF may be useful biomarkers for the detection of disease presence and/or its severity due to HIV infection and ART use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. A cement spacer for two-stage revision of infected implants of the hip joint.

    PubMed

    Leunig, M; Chosa, E; Speck, M; Ganz, R

    1998-01-01

    We report the technical details and clinical results of twelve patients who had deep infections of implants in the hip joint and were treated by two-stage revision, using a gentamicin-loaded, hand-moulded cement spacer inserted for the period between resection and reimplantation arthroplasty. During management with the spacer, usually for 4 months, patients were almost free of pain and mobile with good leg control, spending 2/3 of the treatment period at home. Six of twelve spacers failed locally due to dislocation [5] or cement fracture [1], and more than two further episodes of surgery were required in 3 patients. Problems with dislocation of the spacer were significantly higher when the head to neck offset was lacking (P < 0.05) or when anchorage in the femoral shaft was poor. Nevertheless, infection after reimplantation arthroplasty did not occur by the time of follow-up (2.2 years). Based on these data, we consider that the use of the cement spacer is a promising approach to the treatment of complicated infections of the hip joint.

  15. Lipid droplet dynamics at early stages of Mycobacterium marinum infection in Dictyostelium.

    PubMed

    Barisch, Caroline; Paschke, Peggy; Hagedorn, Monica; Maniak, Markus; Soldati, Thierry

    2015-09-01

    Lipid droplets exist in virtually every cell type, ranging not only from mammals to plants, but also to eukaryotic and prokaryotic unicellular organisms such as Dictyostelium and bacteria. They serve among other roles as energy reservoir that cells consume in times of starvation. Mycobacteria and some other intracellular pathogens hijack these organelles as a nutrient source and to build up their own lipid inclusions. The mechanisms by which host lipid droplets are captured by the pathogenic bacteria are extremely poorly understood. Using the powerful Dictyostelium discoideum/Mycobacterium marinum infection model, we observed that, immediately after their uptake, lipid droplets translocate to the vicinity of the vacuole containing live but not dead mycobacteria. Induction of lipid droplets in Dictyostelium prior to infection resulted in a vast accumulation of neutral lipids and sterols inside the bacterium-containing compartment. Subsequently, under these conditions, mycobacteria accumulated much larger lipid inclusions. Strikingly, the Dictyostelium homologue of perilipin and the murine perilipin 2 surrounded bacteria that had escaped to the cytosol of Dictyostelium or microglial BV-2 cells respectively. Moreover, bacterial growth was inhibited in Dictyostelium plnA knockout cells. In summary, our results provide evidence that mycobacteria actively manipulate the lipid metabolism of the host from very early infection stages.

  16. Fruit maturity and post-harvest environmental conditions influence the pre-penetration stages of Monilinia infections in peaches.

    PubMed

    Garcia-Benitez, C; Melgarejo, P; De Cal, A

    2017-01-16

    Brown rot caused by the fungi Monilinia laxa (Aderhold and Ruhland) Honey, M. fructicola (Winter) Honey, or M. fructigena (Aderhold and Ruhland) is a serious fungal disease of peaches. The fungal infection process begins when fungal conidia germinate on the fruit surface to produce germ tubes and/or appressoria, and the incidence of brown rot increases as fruit approaches maturity. The interaction between the fungal infection process, peach maturity, and the environmental conditions is not well understood. Accordingly, the objectives of this investigation were to investigate germ tube and appressorial formation by M. laxa and M. fructicola when they were exposed to peach skin from mature and immature fruit at various temperatures and relative humidities (RHs). The greatest number of germ tubes was found when M. laxa or M. fructicola was incubated in culture medium which contained a skin extract of mature peaches. In contrast, the greatest number of appressoria was found when M. laxa or M. fructicola was incubated in culture medium which contained a skin extract of immature peaches. Although M. fructicola produced the same number of germ tubes and appressoria at 4°C, M. fructicola produced more germ tubes than appressoria at temperatures higher than 10°C. M. laxa produced more germ tubes than appressoria at any temperature, except when it was incubated for 48h on culture medium which contained a skin extract of immature peaches at 10°C at 80% or 100% RH, or at 25°C at 60% RH. M. laxa conidia germinated better than M. fructicola conidia at low temperatures. Germ tube and appressorial formation by Monilinia spp. were influenced by fruit postharvest handling. The number of germ tubes that were formed by M. laxa conidia was significantly greater than that for M. fructicola when the conidia were incubated at 100% RH, and this number increased after 3days of refrigeration. The number of appressoria that were formed by both Monilinia spp. also increased after 3

  17. Tantalum acetabular augments in one-stage exchange of infected total hip arthroplasty: a case-control study.

    PubMed

    Klatte, Till Orla; Kendoff, Daniel; Sabihi, Reza; Kamath, Atul F; Rueger, Johannes M; Gehrke, Thorsten

    2014-07-01

    During the one-stage exchange procedure for periprosthetic joint infection (PJI) after total hip arthroplasty (THA), acetabular defects challenge reconstructive options. Porous tantalum augments are an established tool for addressing acetabular destruction in aseptic cases, but their utility in septic exchange is unknown. This retrospective case-control study presents the initial results of tantalum augmentation during one-stage exchange for PJI. Primary endpoints were rates of re-infection and short-term complications associated with this technique. Study patients had no higher risk of re-infection with equivalent durability at early follow-up with a re-infection rate in both groups of 4%. In conclusion, tantalum augments are a viable option for addressing acetabular defects in one-stage exchange for septic THA. Further study is necessary to assess long-term durability when compared to traditional techniques for acetabular reconstruction. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Molecular differentiation of metastriate tick immatures.

    PubMed

    Anderson, Jennifer M; Ammerman, Nicole C; Norris, Douglas E

    2004-01-01

    Hard ticks, family Ixodidae, are divided into two groups, the Metastriata and the Prostriata, based on morphological differences. In the United States, there are four medically important genera of the Ixodidae: Ixodes, Amblyomma, Dermacentor, and Rhipicephalus. Ixodes is the only genus in and representative of the Prostriata, whereas the latter three genera are members of the Metastriata. All developmental stages of the Prostriata can be easily differentiated from the Metastriata using morphology. Similarly, the three Metastriate genera are highly identifiable as adults, yet as immatures, the discriminating characteristics can be difficult to use for differentiation, especially if the specimens are damaged or engorged with blood. All three Metastriate genera represent medically important vectors, thus accurate differentiation is necessary. To this end, we have developed a multiplexed-PCR diagnostic assay that, when combined with RFLP analysis will differentiate between the Metastriate genera--Amblyomma, Dermacentor, Rhipicephalus, and Haemaphysalis based on the length of the PCR amplicon and subsequent restriction digestion profile. The intended use for this diagnostic is to verify morphological identifications, especially of immatures, as well as to identify samples destroyed for molecular analysis, which will lead to more accurate field data as well as implication of vectors in disease transmission.

  19. One-stage or two-stage revision surgery for prosthetic hip joint infection--the INFORM trial: a study protocol for a randomised controlled trial.

    PubMed

    Strange, Simon; Whitehouse, Michael R; Beswick, Andrew D; Board, Tim; Burston, Amanda; Burston, Ben; Carroll, Fran E; Dieppe, Paul; Garfield, Kirsty; Gooberman-Hill, Rachael; Jones, Stephen; Kunutsor, Setor; Lane, Athene; Lenguerrand, Erik; MacGowan, Alasdair; Moore, Andrew; Noble, Sian; Simon, Joanne; Stockley, Ian; Taylor, Adrian H; Toms, Andrew; Webb, Jason; Whittaker, John-Paul; Wilson, Matthew; Wylde, Vikki; Blom, Ashley W

    2016-02-17

    Periprosthetic joint infection (PJI) affects approximately 1% of patients following total hip replacement (THR) and often results in severe physical and emotional suffering. Current surgical treatment options are debridement, antibiotics and implant retention; revision THR; excision of the joint and amputation. Revision surgery can be done as either a one-stage or two-stage operation. Both types of surgery are well-established practice in the NHS and result in similar rates of re-infection, but little is known about the impact of these treatments from the patient's perspective. The main aim of this randomised controlled trial is to determine whether there is a difference in patient-reported outcome measures 18 months after randomisation for one-stage or two-stage revision surgery. INFORM (INFection ORthopaedic Management) is an open, two-arm, multi-centre, randomised, superiority trial. We aim to randomise 148 patients with eligible PJI of the hip from approximately seven secondary care NHS orthopaedic units from across England and Wales. Patients will be randomised via a web-based system to receive either a one-stage revision or a two-stage revision THR. Blinding is not possible due to the nature of the intervention. All patients will be followed up for 18 months. The primary outcome is the WOMAC Index, which assesses hip pain, function and stiffness, collected by questionnaire at 18 months. Secondary outcomes include the following: cost-effectiveness, complications, re-infection rates, objective hip function assessment and quality of life. A nested qualitative study will explore patients' and surgeons' experiences, including their views about trial participation and randomisation. INFORM is the first ever randomised trial to compare two widely accepted surgical interventions for the treatment of PJI: one-stage and two-stage revision THR. The results of the trial will benefit patients in the future as the main focus is on patient-reported outcomes: pain, function

  20. Effect of different stages of Schistosoma mansoni infection on the parasite burden and immune response to Strongyloides venezuelensis in co-infected mice.

    PubMed

    de Rezende, Michelle Carvalho; Araújo, Emília Souza; Moreira, João Marcelo Peixoto; Rodrigues, Vanessa Fernandes; Rodrigues, Jailza Lima; Pereira, Cíntia A de Jesus; Negrão-Corrêa, Deborah

    2015-12-01

    Multiple schistosome and soil-transmitted nematode infections are frequently reported in human populations living in tropical areas of developing countries. In addition to exposure factors, the host immune response plays an important role in helminth control and morbidity in hosts with multiple infections; however, these aspects are difficult to evaluate in human populations. In the current study, female Swiss mice were simultaneously co-infected with Strongyloides venezuelensis and Schistosoma mansoni or infected with St. venezuelensis at 2, 4, or 14 weeks after Sc. mansoni infection. The simultaneously infected mice showed a similar parasite burden for St. venezuelensis compared with mono-infected mice. In contrast, there was a significant reduction of St. venezuelensis burden (primarily during the migration of the larvae) in mice that were previously infected with Sc. mansoni at the acute or chronic phase. Independent of the stage of Sc. mansoni infection, the St. venezuelensis co-infection was capable of inducing IL-4 production in the small intestine, increasing the IgE concentration in the serum and increasing eosinophilia in the lungs and intestine. This result suggests that the nematode infection stimulates local type 2 immune responses independently of the schistosomiasis stage. Moreover, previous Sc. mansoni infection stimulated early granulocyte infiltration in the lungs and trematode-specific IgM and IgG1 production that recognized antigens from St. venezuelensis infective larvae; these immune responses would act in the early control of St. venezuelensis larvae. Our data suggest that the effect of multiple helminth infections on host susceptibility and morbidity largely depends on the species of parasite and the immune response.

  1. Identification of regulated proteins in naked barley grains (Hordeum vulgare nudum) after Fusarium graminearum infection at different grain ripening stages.

    PubMed

    Trümper, Christina; Paffenholz, Katrin; Smit, Inga; Kössler, Philip; Karlovsky, Petr; Braun, Hans-Peter; Pawelzik, Elke

    2016-02-05

    We analyzed the effect of Fusarium graminearum infection on field-grown naked barley (Hordeum vulgare nudum). The ears were inoculated with F. graminearum spores during anthesis. In the course of ripening, grains in five phenological growth stages of naked barley from milk ripe to plant death were sampled. The albumin and globulin proteins of inoculated grains and untreated (control) grains were separated by two-dimensional gel electrophoresis. Forty-five spots composing of proteins that were changed in abundance due to F. graminearum infection were subsequently identified by mass spectrometry. Various proteins showing altered expression pattern after Fusarium infection were linked to stress response such as plant signal transduction pathways, fungal defense and oxidative burst. More proteins changed during early grain ripening stages than during later ripening stages. Protease inhibitors occurred at increased abundancy during milk ripe stage. A thaumatin-like protein accumulated at plant death stage. Proteins linked to nitrogen metabolism and protein biosynthesis were mainly reduced, whereas those linked to carbon metabolism were predominantly increased in infected grains. Fusarium graminearum infection can lead to significant contamination of grains with mycotoxins. With this 2D-based proteomics study we give an insight into plant–pathogen interactions between the non-model plant naked barley and the fungus F. graminearum during five stages of grain development. Over the multiple developmental stages we observed specific patterns of changes induced by the fungus: the primary plant metabolism and inhibition of fungal protease were predominantly affected during early grain development stages. During the entire grain development we found an induced accumulation of thaumatin-like proteins due to the fungal infection indicating their fundamental role for naked barley defense.

  2. [Lymphocytic alveolitis in the early stages of HIV infection: correlation with biological and prognostic factors].

    PubMed

    Quint, L; Autran, B; Guillon, J M; Parrot, A; Denis, M; Debre, P; Mayaud, C M; Akoun, G M

    1992-01-01

    Broncho-alveolar lavage was performed to assess the degree of pulmonary lymphocytic alveolitis in 32 asymptomatic patients who were infected with the Human Immunodeficiency Virus (VIH). The patients were stages II and III of the CDC classification and the aim of the study was to determine the frequency, nature and prognostic role of the findings. 62.5% of the subjects (20/32) presented with a lymphocytic alveolitis which consisted predominantly of CD8 lymphocyte (64.3 +/- 3.5%), in the absence of an opportunistic infection or broncho-pulmonary tumours. Two sub-populations of alveolar CD8 were shown at comparable levels, a) sub-population CD8+D44+ (22.1 +/- 5%), in whom we showed the possession of cytotoxic activity in particular specific for VIH; b) sub-population CD8+CD57+ (19.6 +/- 3%) which we have shown to be capable in vitro of inhibiting the effector phase of cytotoxic activity of CD8+D44+ alveolar cells specific for VIH. In this group of 32 patients the occurrence of an alveolitis was not correlated with the usual prognostic factors of infection by VIH measured simultaneously with broncho-alveolar lavage (the level of CD4+ blood lymphocytes, and the beta 2-plasma microglobulins and the presence of p24 antigenaemia). In addition the level of CD4 lymphocytes supperior to 400/mm3 and of beta 2-microglobulins less then 3 mg/l whether a lymphocytic alveolitis was there or not confirmed the relatively poorly developed state of the VIH infection in these asymptomatic patients. Also the occurrence of a lymphocytic alveolitis did not seem to be linked to progression of the disease in the group of patients studied.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. prM-antibody renders immature West Nile virus infectious in vivo.

    PubMed

    Colpitts, Tonya M; Rodenhuis-Zybert, Izabela; Moesker, Bastiaan; Wang, Penghua; Fikrig, Erol; Smit, Jolanda M

    2011-10-01

    West Nile virus (WNV) is a member of the family Flaviviridae and is a neurotropic pathogen responsible for severe human disease. Flavivirus-infected cells release virus particles that contain variable numbers of precursor membrane (prM) protein molecules at the viral surface. Consequently, antibodies are produced against the prM protein. These antibodies have been shown to activate the infectious potential of fully immature flavivirus particles in vitro. Here, we provide in vivo proof that prM antibodies render immature WNV infectious. Infection with antibody-opsonized immature WNV particles caused disease and death of mice, and infectious WNV was found in the brains and sera.

  4. Nocardia prosthetic knee infection successfully treated by one-stage exchange: case report and review.

    PubMed

    Laurent, F; Rodriguez-Villalobos, H; Cornu, O; Vandercam, B; Yombi, J C

    2015-08-01

    A 64-year-old man with a history of sarcoidosis on corticosteroids and azathioprine was admitted to our hospital with complaints of worsening left knee pain and swelling for the past 3 weeks. His past medical history is also significant for severe osteoarthritis requiring a cemented total left knee arthroplasty 1 year ago. Diagnostic investigation during his hospital admission eventually led to the diagnosis of Nocardia nova knee prosthetic joint infection in the setting of a disseminated nocardiosis. He was successful treated by one-stage complete hardware exchange in conjunction with an adapted antibiotic therapy regimen (meropenem and doxycycline followed by ceftriaxone and doxycycline). Two years later, his recovery was deemed excellent.

  5. Microbiomes associated with infective stages of root-knot and lesion nematodes in soil.

    PubMed

    Elhady, Ahmed; Giné, Ariadna; Topalovic, Olivera; Jacquiod, Samuel; Sørensen, Søren J; Sorribas, Francisco Javier; Heuer, Holger

    2017-01-01

    Endoparasitic root-knot (Meloidogyne spp.) and lesion (Pratylenchus spp.) nematodes cause considerable damage in agriculture. Before they invade roots to complete their life cycle, soil microbes can attach to their cuticle or surface coat and antagonize the nematode directly or by induction of host plant defenses. We investigated whether the nematode-associated microbiome in soil differs between infective stages of Meloidogyne incognita and Pratylenchus penetrans, and whether it is affected by variation in the composition of microbial communities among soils. Nematodes were incubated in suspensions of five organically and two integrated horticultural production soils, recovered by sieving and analyzed for attached bacteria and fungi after washing off loosely adhering microbes. Significant effects of the soil type and nematode species on nematode-associated fungi and bacteria were revealed as analyzed by community profiling using denaturing gradient gel electrophoresis. Attached microbes represented a small specific subset of the soil microbiome. Two organic soils had very similar bacterial and fungal community profiles, but one of them was strongly suppressive towards root-knot nematodes. They were selected for deep amplicon sequencing of bacterial 16S rRNA genes and fungal ITS. Significant differences among the microbiomes associated with the two species in both soils suggested specific surface epitopes. Among the 28 detected bacterial classes, Betaproteobacteria, Bacilli and Actinobacteria were the most abundant. The most frequently detected fungal genera were Malassezia, Aspergillus and Cladosporium. Attached microbiomes did not statistically differ between these two soils. However, Malassezia globosa and four fungal species of the family Plectosphaerellaceae, and the bacterium Neorhizobium galegae were strongly enriched on M. incognita in the suppressive soil. In conclusion, the highly specific attachment of microbes to infective stages of phytonematodes in

  6. Microbiomes associated with infective stages of root-knot and lesion nematodes in soil

    PubMed Central

    Elhady, Ahmed; Giné, Ariadna; Topalovic, Olivera; Jacquiod, Samuel; Sørensen, Søren J.; Sorribas, Francisco Javier

    2017-01-01

    Endoparasitic root-knot (Meloidogyne spp.) and lesion (Pratylenchus spp.) nematodes cause considerable damage in agriculture. Before they invade roots to complete their life cycle, soil microbes can attach to their cuticle or surface coat and antagonize the nematode directly or by induction of host plant defenses. We investigated whether the nematode-associated microbiome in soil differs between infective stages of Meloidogyne incognita and Pratylenchus penetrans, and whether it is affected by variation in the composition of microbial communities among soils. Nematodes were incubated in suspensions of five organically and two integrated horticultural production soils, recovered by sieving and analyzed for attached bacteria and fungi after washing off loosely adhering microbes. Significant effects of the soil type and nematode species on nematode-associated fungi and bacteria were revealed as analyzed by community profiling using denaturing gradient gel electrophoresis. Attached microbes represented a small specific subset of the soil microbiome. Two organic soils had very similar bacterial and fungal community profiles, but one of them was strongly suppressive towards root-knot nematodes. They were selected for deep amplicon sequencing of bacterial 16S rRNA genes and fungal ITS. Significant differences among the microbiomes associated with the two species in both soils suggested specific surface epitopes. Among the 28 detected bacterial classes, Betaproteobacteria, Bacilli and Actinobacteria were the most abundant. The most frequently detected fungal genera were Malassezia, Aspergillus and Cladosporium. Attached microbiomes did not statistically differ between these two soils. However, Malassezia globosa and four fungal species of the family Plectosphaerellaceae, and the bacterium Neorhizobium galegae were strongly enriched on M. incognita in the suppressive soil. In conclusion, the highly specific attachment of microbes to infective stages of phytonematodes in

  7. Hand motor control: maturing an immature science.

    PubMed

    Cole, Kelly J

    2015-04-01

    In the target article Mark Latash has argued that there is but a single bona-fide theory for hand motor control (referent configuration theory). If this is true, and research is often phenomenological, then we must admit that the science of hand motor control is immature. While describing observations under varying conditions is a crucial (but early) stage of the science of any field, it is also true that the key to maturing any science is to vigorously subject extant theories and budding laws to critical experimentation. If competing theories are absent at the present time is it time for scientists to focus their efforts on maturing the science of hand motor control through critical testing of this long-standing theory (and related collections of knowledge such as the uncontrolled manifold)?

  8. Type I Interferons Regulate Immune Responses in Humans with Blood-Stage Plasmodium falciparum Infection

    PubMed Central

    Montes de Oca, Marcela; Kumar, Rajiv; de Labastida Rivera, Fabian; Amante, Fiona H.; Sheel, Meru; Faleiro, Rebecca J.; Bunn, Patrick T.; Best, Shannon E.; Beattie, Lynette; Ng, Susanna S.; Edwards, Chelsea L.; Boyle, Glen M.; Price, Ric N.; Anstey, Nicholas M.; Loughland, Jessica R.; Burel, Julie; Doolan, Denise L.; Haque, Ashraful; McCarthy, James S.; Engwerda, Christian R.

    2016-01-01

    Summary The development of immunoregulatory networks is important to prevent disease. However, these same networks allow pathogens to persist and reduce vaccine efficacy. Here, we identify type I interferons (IFNs) as important regulators in developing anti-parasitic immunity in healthy volunteers infected for the first time with Plasmodium falciparum. Type I IFNs suppressed innate immune cell function and parasitic-specific CD4+ T cell IFNγ production, and they promoted the development of parasitic-specific IL-10-producing Th1 (Tr1) cells. Type I IFN-dependent, parasite-specific IL-10 production was also observed in P. falciparum malaria patients in the field following chemoprophylaxis. Parasite-induced IL-10 suppressed inflammatory cytokine production, and IL-10 levels after drug treatment were positively associated with parasite burdens before anti-parasitic drug administration. These findings have important implications for understanding the development of host immune responses following blood-stage P. falciparum infection, and they identify type I IFNs and related signaling pathways as potential targets for therapies or vaccine efficacy improvement. PMID:27705789

  9. Nonvirion Protein of Novirhabdovirus Suppresses Apoptosis at the Early Stage of Virus Infection

    PubMed Central

    Ammayappan, Arun; Vakharia, Vikram N.

    2011-01-01

    Viral hemorrhagic septicemia virus (VHSV) and infectious hematopoietic necrosis virus (IHNV) are members of the genus Novirhabdovirus within the Rhabdoviridae family, which can cause severe hemorrhagic disease in fresh- and saltwater fish worldwide. These viruses carry an additional nonvirion (NV) gene, which codes for the nonstructural NV protein that has been implicated to play a role in viral pathogenesis. To determine the precise biological function of this NV gene and its gene product, we generated NV-deficient and NV knockout recombinant VHSVs, using reverse genetics. Comparisons of the replication kinetics and markers for virus-induced apoptosis indicated that the NV-deficient and NV knockout mutant viruses induce apoptosis earlier in cell culture than the wild-type recombinant VHSV. These results suggest that the NV protein has an antiapoptotic function at the early stage of virus infection. Furthermore, we created a chimeric VHSV, in which the NV gene of VHSV was replaced by the IHNV NV gene, which was capable of suppressing apoptosis in cell culture. These results show that the NV protein of other members of Novirhabdovirus can restore the NV protein function. In this study, we also investigated the kinetics of VHSV replication during a single round of viral replication and examined the mechanism of VHSV-induced apoptosis. Our results show that VHSV infection induced caspases 3, 8 and 9 in cell culture. PMID:21653667

  10. Transcriptional dynamics of Phytophthora infestans during sequential stages of hemibiotrophic infection of tomato.

    PubMed

    Zuluaga, Andrea P; Vega-Arreguín, Julio C; Fei, Zhangjun; Ponnala, Lalit; Lee, Sang Jik; Matas, Antonio J; Patev, Sean; Fry, William E; Rose, Jocelyn K C

    2016-01-01

    Hemibiotrophic plant pathogens, such as the oomycete Phytophthora infestans, employ a biphasic infection strategy, initially behaving as biotrophs, where minimal symptoms are exhibited by the plant, and subsequently as necrotrophs, feeding on dead plant tissue. The regulation of this transition and the breadth of molecular mechanisms that modulate plant defences are not well understood, although effector proteins secreted by the pathogen are thought to play a key role. We examined the transcriptional dynamics of P. infestans in a compatible interaction with its host tomato (Solanum lycopersicum) at three infection stages: biotrophy; the transition from biotrophy to necrotrophy; and necrotrophy. The expression data suggest a tight temporal regulation of many pathways associated with the suppression of plant defence mechanisms and pathogenicity, including the induction of putative cytoplasmic and apoplastic effectors. Twelve of these were experimentally evaluated to determine their ability to suppress necrosis caused by the P. infestans necrosis-inducing protein PiNPP1.1 in Nicotiana benthamiana. Four effectors suppressed necrosis, suggesting that they might prolong the biotrophic phase. This study suggests that a complex regulation of effector expression modulates the outcome of the interaction.

  11. Coherent Brightfield Microscopy Provides the Spatiotemporal Resolution To Study Early Stage Viral Infection in Live Cells.

    PubMed

    Huang, Yi-Fan; Zhuo, Guan-Yu; Chou, Chun-Yu; Lin, Cheng-Hao; Chang, Wen; Hsieh, Chia-Lung

    2017-03-28

    Viral infection starts with a virus particle landing on a cell surface followed by penetration of the plasma membrane. Due to the difficulty of measuring the rapid motion of small-sized virus particles on the membrane, little is known about how a virus particle reaches an endocytic site after landing at a random location. Here, we use coherent brightfield (COBRI) microscopy to investigate early stage viral infection with ultrahigh spatiotemporal resolution. By detecting intrinsic scattered light via imaging-based interferometry, COBRI microscopy allows us to track the motion of a single vaccinia virus particle with nanometer spatial precision (<3 nm) in 3D and microsecond temporal resolution (up to 100,000 frames per second). We explore the possibility of differentiating the virus signal from cell background based on their distinct spatial and temporal behaviors via digital image processing. Through image postprocessing, relatively stationary background scattering of cellular structures is effectively removed, generating a background-free image of the diffusive virus particle for precise localization. Using our method, we unveil single virus particles exploring cell plasma membranes after attachment. We found that immediately after attaching to the membrane (within a second), the virus particle is locally confined within hundreds of nanometers where the virus particle diffuses laterally with a very high diffusion coefficient (∼1 μm(2)/s) at microsecond time scales. Ultrahigh-speed scattering-based optical imaging may provide opportunities for resolving rapid virus-receptor interactions with nanometer clarity.

  12. Host-cell sensors for Plasmodium activate innate immunity against liver-stage infection.

    PubMed

    Liehl, Peter; Zuzarte-Luís, Vanessa; Chan, Jennie; Zillinger, Thomas; Baptista, Fernanda; Carapau, Daniel; Konert, Madlen; Hanson, Kirsten K; Carret, Céline; Lassnig, Caroline; Müller, Mathias; Kalinke, Ulrich; Saeed, Mohsan; Chora, Angelo Ferreira; Golenbock, Douglas T; Strobl, Birgit; Prudêncio, Miguel; Coelho, Luis P; Kappe, Stefan H; Superti-Furga, Giulio; Pichlmair, Andreas; Vigário, Ana M; Rice, Charles M; Fitzgerald, Katherine A; Barchet, Winfried; Mota, Maria M

    2014-01-01

    Before they infect red blood cells and cause malaria, Plasmodium parasites undergo an obligate and clinically silent expansion phase in the liver that is supposedly undetected by the host. Here, we demonstrate the engagement of a type I interferon (IFN) response during Plasmodium replication in the liver. We identified Plasmodium RNA as a previously unrecognized pathogen-associated molecular pattern (PAMP) capable of activating a type I IFN response via the cytosolic pattern recognition receptor Mda5. This response, initiated by liver-resident cells through the adaptor molecule for cytosolic RNA sensors, Mavs, and the transcription factors Irf3 and Irf7, is propagated by hepatocytes in an interferon-α/β receptor-dependent manner. This signaling pathway is critical for immune cell-mediated host resistance to liver-stage Plasmodium infection, which we find can be primed with other PAMPs, including hepatitis C virus RNA. Together, our results show that the liver has sensor mechanisms for Plasmodium that mediate a functional antiparasite response driven by type I IFN.

  13. Neurocognitive Impairment Associated with Predominantly Early Stage HIV infection in Abuja, Nigeria

    PubMed Central

    Akolo, Christopher; Royal, Walter; Cherner, Mariana; Okwuasaba, Kanayo; Eyzaguirre, Lindsay; Adebiyi, Ruxton; Umlauf, Anya; Hendrix, Terence; Johnson, Joyce; Abimiku, Alashl’e; Blattner, William A.

    2014-01-01

    Detailed neuropsychological testing was performed on 134 HIV seropositive (SP) and 77 HIV seronegative (SN) individuals, 86% with early stage HIV infection in Nigeria, to determine the frequency of HIV-related neurocognitive impairment among the HIV-infected group. Twenty-two tests were administered to assess the following seven ability domains: speed of information processing (SIP); attention/working memory (AWM); executive functioning (EF); learning (LN); memory (MEM); verbal fluency (VF); and motor speed/dexterity (MSD). Demographically corrected individual test scores and scores for each domain or reflecting a global deficit (a global deficit score, or GDS) were compared for the SP and SN groups. SP participants were older, had fewer years of education, were more likely to be married, differed in ethnicity and had higher depression scores than SN individuals. On the testing, SP performed worse than SN on four tests that individually assessed LN, VF and MSD (the timed gait). SP subjects, however, performed better than SN on the finger-tapping test, also a motor task. Within the seven ability domains, SP performed worse than SN with respect to SIP, EF, LN, MEM and VF and also on the global measure. SP were also more frequently impaired on tests of SIP, and there was a borderline increase in the frequency of global impairment. Performance by SP subjects was not associated with CD4 counts. However, there were significant correlations between viral load measurements and individual tests of SIP, EF, LN and VF and with overall EF and a borderline correlation with the GDS. Depression scores for SP were associated with impairment on only a single test of EF. These results demonstrate that the ability of these assessments to identify areas of impairment that may be specifically linked to a history of HIV infection among individuals in Nigeria. Confirmation of these findings awaits analyses using data from a larger number of control subjects. PMID:24927825

  14. Ezrin Interacts with the SARS Coronavirus Spike Protein and Restrains Infection at the Entry Stage

    PubMed Central

    Millet, Jean Kaoru; Kien, François; Cheung, Chung-Yan; Siu, Yu-Lam; Chan, Wing-Lim; Li, Huiying; Leung, Hiu-Lan; Jaume, Martial; Bruzzone, Roberto; Malik Peiris, Joseph S.; Altmeyer, Ralf Marius; Nal, Béatrice

    2012-01-01

    Background Entry of Severe Acute Respiratory Syndrome coronavirus (SARS-CoV) and its envelope fusion with host cell membrane are controlled by a series of complex molecular mechanisms, largely dependent on the viral envelope glycoprotein Spike (S). There are still many unknowns on the implication of cellular factors that regulate the entry process. Methodology/Principal Findings We performed a yeast two-hybrid screen using as bait the carboxy-terminal endodomain of S, which faces the cytosol during and after opening of the fusion pore at early stages of the virus life cycle. Here we show that the ezrin membrane-actin linker interacts with S endodomain through the F1 lobe of its FERM domain and that both the eight carboxy-terminal amino-acids and a membrane-proximal cysteine cluster of S endodomain are important for this interaction in vitro. Interestingly, we found that ezrin is present at the site of entry of S-pseudotyped lentiviral particles in Vero E6 cells. Targeting ezrin function by small interfering RNA increased S-mediated entry of pseudotyped particles in epithelial cells. Furthermore, deletion of the eight carboxy-terminal amino acids of S enhanced S-pseudotyped particles infection. Expression of the ezrin dominant negative FERM domain enhanced cell susceptibility to infection by SARS-CoV and S-pseudotyped particles and potentiated S-dependent membrane fusion. Conclusions/Significance Ezrin interacts with SARS-CoV S endodomain and limits virus entry and fusion. Our data present a novel mechanism involving a cellular factor in the regulation of S-dependent early events of infection. PMID:23185364

  15. Screening of early antigen genes of adult-stage Trichinella spiralis using pig serum from different stages of early infection

    USDA-ARS?s Scientific Manuscript database

    The goal of this work was to identify novel, early antigens present in Trichinella spiralis. To this end, a cDNA library generated from 3-day old adult worms (Ad3) was immunologically screened using serum from a pig infected with 20,000 muscle larvae. The serum was obtained from multiple, time cours...

  16. Stage-specific activity in vitro on the Theileria infection process of serum from calves treated prophylactically with buparvaquone.

    PubMed

    Wilkie, G M; Kirvar, E; Thomas, E M; Sparagano, O; Brown, C G

    1998-12-31

    An in vitro method for testing activity of buparvaquone in serum on the infection and development of Theileria in its bovine host mononuclear cells is described and results compared with the effect exhibited in vivo. Serum samples were collected over a time course from calves in a clinical trial of 5 mg kg(-1) buparvaquone prophylaxis on Theileria annulata or T. parva experimental infection. To evaluate drug levels and persistence in each animal for a period of 14 days and its effect on the early infection stages, the sera were tested on established macroschizont infected cell lines and against the in vitro infection and development process of the sporozoite and trophozoite stages of the two Theileria species. Results from the in vitro assays show that buparvaquone in serum can completely prevent the establishment of Theileria infection during the first 48 h after administration at 5 mg kg(-1). After seven days, levels are sufficient to delay the establishment of infection. The drug is more effective in the prevention of the de novo development of the parasite in cells than against established macroschizont infected cell culture. At low concentrations, it is more effective against T. parva than against T. annulata. Drug effect peaks during the first 24 h but residual effect persists for 14 days, particularly against T. parva infection. These novel findings demonstrate how high doses of buparvaquone could over-protect calves if used in the 'infection-and-treatment' method of immunisation when drug is administered prophylactically at the same time as infection with live sporozoites. It is suggested that in certain high Theileria risk situations there may be potential for the immunoprophylactic use of buparvaquone without simultaneous infection. The in vitro assay itself has been shown to be of value as a model for Theileria establishment in cattle.

  17. The rodent malaria liver stage survives in the rapamycin-induced autophagosome of infected Hepa1–6 cells

    PubMed Central

    Zhao, Chenghao; Liu, Taiping; Zhou, Taoli; Fu, Yong; Zheng, Hong; Ding, Yan; Zhang, Kun; Xu, Wenyue

    2016-01-01

    It has been reported that non-selective autophagy of infected hepatocytes could facilitate the development of malaria in the liver stage, but the fate of parasites following selective autophagy of infected hepatocytes is still not very clear. Here, we confirmed that sporozoite infection can induce a selective autophagy-like process targeting EEFs (exo-erythrocytic forms) in Hepa1–6. Rapamycin treatment greatly enhanced this process in EEFs and non-selective autophagy of infected Hepa1-6 cells and enhanced the development of the malaria liver stage in vivo. Although rapamycin promoted the fusion of autophagosomes containing the malaria parasite with lysosomes, some parasites inside the autophagosome survived and replicated normally. Further study showed that the maturation of affected autolysosomes was greatly inhibited. Therefore, in addition to the previously described positive role of rapamycin-induced nonselective autophagy of hepatocytes, we provide evidence that the survival of EEFs in the autophagosome of the infected hepatocytes also contributes to rapamycin-enhanced development of the malaria liver stage, possibly due to the suppression of autolysosome maturation by EEFs. These data suggest that the inhibition of autolysosome maturation might be a novel escape strategy used by the malaria liver stage. PMID:27901110

  18. In vitro alterations do not reflect a requirement for host cell cycle progression during Plasmodium liver stage infection.

    PubMed

    Hanson, Kirsten K; March, Sandra; Ng, Shengyong; Bhatia, Sangeeta N; Mota, Maria M

    2015-01-01

    Prior to invading nonreplicative erythrocytes, Plasmodium parasites undergo their first obligate step in the mammalian host inside hepatocytes, where each sporozoite replicates to generate thousands of merozoites. While normally quiescent, hepatocytes retain proliferative capacity and can readily reenter the cell cycle in response to diverse stimuli. Many intracellular pathogens, including protozoan parasites, manipulate the cell cycle progression of their host cells for their own benefit, but it is not known whether the hepatocyte cell cycle plays a role during Plasmodium liver stage infection. Here, we show that Plasmodium parasites can be observed in mitotic hepatoma cells throughout liver stage development, where they initially reduce the likelihood of mitosis and ultimately lead to significant acquisition of a binucleate phenotype. However, hepatoma cells pharmacologically arrested in S phase still support robust and complete Plasmodium liver stage development, which thus does not require cell cycle progression in the infected cell in vitro. Furthermore, murine hepatocytes remain quiescent throughout in vivo infection with either Plasmodium berghei or Plasmodium yoelii, as do Plasmodium falciparum-infected primary human hepatocytes, demonstrating that the rapid and prodigious growth of liver stage parasites is accomplished independent of host hepatocyte cell cycle progression during natural infection.

  19. NK cells contribute to persistent airway inflammation and AHR during the later stage of RSV infection in mice.

    PubMed

    Long, Xiaoru; Xie, Jun; Zhao, Keting; Li, Wei; Tang, Wei; Chen, Sisi; Zang, Na; Ren, Luo; Deng, Yu; Xie, Xiaohong; Wang, Lijia; Fu, Zhou; Liu, Enmei

    2016-10-01

    RSV can lead to persistent airway inflammation and AHR and is intimately associated with childhood recurrent wheezing and asthma, but the underlying mechanisms remain unclear. There are high numbers of NK cells in the lung, which not only play important roles in the acute stage of RSV infection, but also are pivotal in regulating the pathogenesis of asthma. Therefore, in this study, we assumed that NK cells might contribute to persistent airway disease during the later stage of RSV infection. Mice were killed at serial time points after RSV infection to collect samples. Leukocytes in bronchoalveolar lavage fluid (BALF) were counted, lung histopathology was examined, and airway hyperresponsiveness (AHR) was measured by whole-body plethysmography. Cytokines were detected by ELISA, and NK cells were determined by flow cytometry. Rabbit anti-mouse asialo-GM-1 antibodies and resveratrol were used to deplete or suppress NK cells. Inflammatory cells in BALF, lung tissue damage and AHR were persistent for 60 days post-RSV infection. Type 2 cytokines and NK cells were significantly increased during the later stage of infection. When NK cells were decreased by the antibodies or resveratrol, type 2 cytokines, the persistent airway inflammation and AHR were all markedly reduced. NK cells can contribute to the RSV-associated persistent airway inflammation and AHR at least partially by promoting type 2 cytokines. Therefore, therapeutic targeting of NK cells may provide a novel approach to alleviating the recurrent wheezing subsequent to RSV infection.

  20. Association of Helicobacter pylori infection with chemotherapy-induced thrombocytopenia in patients with stage III colon cancer: a pilot study.

    PubMed

    Tanriverdi, Ozgur

    2014-01-01

    In this study, the effects of the pre-treatment presence of Helicobacter pylori (H. pylori) infection on chemotherapy-induced thrombocytopenia (CIT) were investigated in patients with stage III colon cancer (CC). A cohort of 74 patients with early stage CC was analysed through a review of clinical records and personal interviews. Helicobacter pylori infections were diagnosed in these patients prior to chemotherapy. The subjects were divided into two groups according to H. pylori infection status: Group 1, H. pylori-positive and Group 2, H. pylori-negative. In all patients, bone marrow toxicity and other study variables were compared. Helicobacter pylori infections were detected in 31 of the 74 CC patients. Helicobacter pylori-infected patients (Group 1) showed significantly higher incidences of CIT than did non-infected patients (Group 2; p = 0.029). Helicobacter pylori infection status correlated significantly with tumour location (r = 0.547; p = 0.043) and the most common location of CC in H. pylori-infected patients was the ascending colon (n = 13, 42%) in comparison to non-infected patients (n = 6, 14%; p= 0.042). The relationship between CIT and H. pylori infection status in CC was determined to be independent from the other study variables (p = 0.037; OR = 3.32, CI 95% = 1.16-9.70). In this study, the small number of patients resulted in an inadequate demonstration of the relationship between H. pylori infection and CIT. Therefore, clinical and molecular studies that include more patients are warranted.

  1. Malaria parasite-synthesized heme is essential in the mosquito and liver stages and complements host heme in the blood stages of infection.

    PubMed

    Nagaraj, Viswanathan Arun; Sundaram, Balamurugan; Varadarajan, Nandan Mysore; Subramani, Pradeep Annamalai; Kalappa, Devaiah Monnanda; Ghosh, Susanta Kumar; Padmanaban, Govindarajan

    2013-01-01

    Heme metabolism is central to malaria parasite biology. The parasite acquires heme from host hemoglobin in the intraerythrocytic stages and stores it as hemozoin to prevent free heme toxicity. The parasite can also synthesize heme de novo, and all the enzymes in the pathway are characterized. To study the role of the dual heme sources in malaria parasite growth and development, we knocked out the first enzyme, δ-aminolevulinate synthase (ALAS), and the last enzyme, ferrochelatase (FC), in the heme-biosynthetic pathway of Plasmodium berghei (Pb). The wild-type and knockout (KO) parasites had similar intraerythrocytic growth patterns in mice. We carried out in vitro radiolabeling of heme in Pb-infected mouse reticulocytes and Plasmodium falciparum-infected human RBCs using [4-(14)C] aminolevulinic acid (ALA). We found that the parasites incorporated both host hemoglobin-heme and parasite-synthesized heme into hemozoin and mitochondrial cytochromes. The similar fates of the two heme sources suggest that they may serve as backup mechanisms to provide heme in the intraerythrocytic stages. Nevertheless, the de novo pathway is absolutely essential for parasite development in the mosquito and liver stages. PbKO parasites formed drastically reduced oocysts and did not form sporozoites in the salivary glands. Oocyst production in PbALASKO parasites recovered when mosquitoes received an ALA supplement. PbALASKO sporozoites could infect mice only when the mice received an ALA supplement. Our results indicate the potential for new therapeutic interventions targeting the heme-biosynthetic pathway in the parasite during the mosquito and liver stages.

  2. Prevalence and intensity of infection with third stage larvae of Angiostrongylus cantonensis in mollusks from Northeast Thailand.

    PubMed

    Tesana, Smarn; Srisawangwong, Tuanchai; Sithithaworn, Paiboon; Laha, Thewarach; Andrews, Ross

    2009-06-01

    Prevalences and intensity of infection with Angiostrongylus cantonensis third stage larvae were examined in mollusks to determine whether they are potential intermediate hosts in eight provinces, northeast Thailand. Mollusk samples were collected from 24 reservoirs (3 reservoirs/province) in close to human cases during the previous year. Six out of 24 localities and 9 (3 new record species) out of 27 species were found with the infection. The highest intensity in infected species was found to be only one or two snails, whereas the majority had very low or no infection. The highest density was found in Pila pesmei and the lowest in Pila polita. The edible snails, P. polita, P. pesmei, and Hemiplecta distincta have the potential to transmit A. cantonensis to man. The varying density levels of larvae in infected snails may reflect observed variation in symptoms of people who traditionally eat a raw snail dish.

  3. Neurocognitive impairment associated with predominantly early stage HIV infection in Abuja, Nigeria.

    PubMed

    Akolo, Christopher; Royal, Walter; Cherner, Mariana; Okwuasaba, Kanayo; Eyzaguirre, Lindsay; Adebiyi, Ruxton; Umlauf, Anya; Hendrix, Terence; Johnson, Joyce; Abimiku, Alashl'e; Blattner, William A

    2014-08-01

    Detailed neuropsychological testing was performed on 133 human immunodeficiency virus (HIV) seropositive (SP) and 77 HIV seronegative (SN) individuals, 86 % with early stage HIV infection in Nigeria, to determine the frequency of HIV-related neurocognitive impairment among the HIV-infected group. The tests were administered to assess the following seven ability domains: speed of information processing, attention/working memory, executive functioning, learning, memory, verbal fluency, and motor function motor. Demographically corrected individual test scores and scores for each domain or reflecting a global deficit (a global deficit score, or GDS) were compared for the SP and SN groups. SP participants were older, had fewer years of education, were more likely to be married, differed in ethnicity, and had higher depression scores than SN individuals. Within the seven ability domains, SP performed worse than SN with respect to speed of information processing, executive function, learning, memory, and verbal fluency and also on the global measure. SP were also more frequently impaired on tests of SIP, and there was a borderline increase in the frequency of global impairment. On the individual tests, SP performed worse than SN on four tests that assessed learning, verbal fluency, memory, and motor function (the Timed Gait). SP subjects, however, performed better than SN on the Finger-tapping test, also a motor task. Performance by SP subjects was not associated on the timed gait which showed a borderline statistically significant correlation with CD4 counts. However, there were significant correlations between viral load measurements and individual tests of speed of information processing, executive function, learning, and verbal fluency and with overall executive function and a borderline correlation with the GDS. Depression scores for SP were associated with impairment on only a single test of executive function. These results demonstrate the ability of these

  4. Pulp revascularization of immature dog teeth with apical periodontitis.

    PubMed

    Thibodeau, Blayne; Teixeira, Fabricio; Yamauchi, Mitsuo; Caplan, Daniel J; Trope, Martin

    2007-06-01

    This study examined the ability of a collagen solution to aid revascularization of necrotic-infected root canals in immature dog teeth. Sixty immature teeth from 6 dogs were infected, disinfected, and randomized into experimental groups: 1: no further treatment; 2: blood in canal; 3: collagen solution in canal, 4: collagen solution + blood, and 5: negative controls (left for natural development). Uncorrected chi-square analysis of radiographic results showed no statistical differences (p >or= 0.05) between experimental groups regarding healing of radiolucencies but a borderline statistical difference (p = 0.058) for group 1 versus group 4 for radicular thickening. Group 2 showed significantly more apical closure than group 1 (p = 0.03) and a borderline statistical difference (p = 0.051) for group 3 versus group 1. Uncorrected chi-square analysis revealed that there were no statistical differences between experimental groups for histological results. However, some roots in each of groups 1 to 4 (previously infected) showed positive histologic outcomes (thickened walls in 43.9%, apical closure in 54.9%, and new luminal tissue in 29.3%). Revascularization of disinfected immature dog root canal systems is possible.

  5. Comparative susceptibility of larval stages of Amblyomma aureolatum, Amblyomma cajennense, and Rhipicephalus sanguineus to infection by Rickettsia rickettsii.

    PubMed

    Labruna, Marcelo B; Ogrzewalska, Maria; Martins, Thiago F; Pinter, Adriano; Horta, Maurício C

    2008-11-01

    The current study compared the susceptibility of larval stages of Amblyomma cajennense (F.), Amblyomma aureolatum (Pallas), and Rhipicephalus sanguineus (Latreille) to infection by a Brazilian strain of Rickettsia rickettsii. Guinea pigs experimentally infected by R. rickettsii were simultaneously infested by larvae of the three tick species. Recovered engorged larvae were allowed to molt to nymphs and held in an incubator at 23 degrees C and 85-90% RH. Subsequent flat nymphs were tested for rickettsial infection by polymerase chain reaction (PCR). Concomitant infestations with sibling ticks on noninfected guinea pigs (control) were done. While 10-60% of the A. cajennense nymphs were shown to be infected by R. rickettsii, both A. aureolatum and R. sanguineus were highly susceptible to R. rickettsii, since 80-100% of their nymphs were shown to be infected in the corresponding trials. Most of the engorged larvae (approximately 70-95%), regardless of being infected or not, successfully molted to nymphs. Mortality rates for engorged larvae tended to be statistically similar (P > 0.05) for ticks recovered from R. rickettsii-infected and noninfected guinea pigs, within each tick species. The only exceptions were the significantly higher mortalities (P < 0.05) for engorged A. cajennense larvae recovered from two infected guinea pigs. Therefore, A. cajennense was less susceptible to R. rickettsii infection than A. aureolatum and R. sanguineus, while feeding on rickettsemic guinea pigs. These two later species were similarly highly susceptible.

  6. Gamma-delta T cell responses in subclinical and clinical stages of Bovine Mycobacterium Avium Paratuberculosis infection

    USDA-ARS?s Scientific Manuscript database

    The early immune response to Mycobacterium avium subsp. paratuberculosis (MAP) in cattle is characterized by a Th1-like immune response effective in controlling bacterial proliferation during the subclinical stage of infection. In young calves nearly 60% of circulating lymphocytes are gamma delta T ...

  7. Revision of Infected Total Knee Arthroplasty: Two-Stage Reimplantation Using an Antibiotic-Impregnated Static Spacer

    PubMed Central

    Almeida, Fernando; Renovell, Pablo; Morante, Elena; López, Raúl

    2013-01-01

    Background A two-stage revision remains as the "gold standard" treatment for chronically infected total knee arthroplasties. Methods Forty-five septic knee prostheses were revised with a minimum follow-up of 5 years. Static antibiotic-impregnated cement spacers were used in all cases. Intravenous antibiotics according to sensitivity test of the culture were applied during patients' hospital stay. Oral antibiotics were given for another 5 weeks. Second-stage surgery was undertaken after control of infection with normal erythrocyte sedimentation rate and C-reactive protein values. Extensile techniques were used if needed and metallic augments were employed for bone loss in 32 femoral and 29 tibial revisions. Results The average interval between the first-stage resection and reimplantation was 4.4 months. Significant improvement was obtained with respect to visual analog scale pain and clinical and functional scores, and infection was eradicated in 95.6% of cases following a two-stage revision total knee arthroplasty. Radiographic evaluation showed suitable alignment without signs of mechanical loosening. Conclusions This technique is a reasonable procedure to eradicate chronic infection in knee arthroplasty and provides proper functional and clinical results. However, it sometimes requires extensile surgical approaches that could imply arduous surgeries. Metallic augments with cementless stems available in most of the knee revision systems are a suitable alternative to handle bone deficiencies, avoiding the use of bone allografts with its complications. PMID:24009903

  8. Radiolabeling of infective third-stage larvae of Strongyloides stercoralis by feeding ( sup 75 Se)selenomethionine-labeled Escherichia coli to first- and second-stage larvae

    SciTech Connect

    Aikens, L.M.; Schad, G.A. )

    1989-10-01

    A technique is described for radiolabeling Strongyloides stercoralis larvae with ({sup 75}Se)selenomethionine. Cultures of an auxotrophic methionine-dependent stain of Escherichia coli were grown in a medium containing Dulbecco's modified Eagle's medium supplemented with 5% nutrient broth, amino acids, and ({sup 75}Se)selenomethionine. When the {sup 75}Se-labeled bacterial populations were in the stationary phase of growth, cultures were harvested and the bacteria dispersed on agar plates to serve as food for S. stercoralis larvae. Use of nondividing bacteria is important for successful labeling because the isotope is not diluted by cell division and death of larvae attributable to overgrowth by bacteria is prevented. First-stage S. stercoralis larvae were recovered from feces of infected dogs and reared in humid air at 30 C on agar plates seeded with bacteria. After 7 days, infective third-stage larvae were harvested. The mean specific activity of 6 different batches of larvae ranged from 75 to 330 counts per min/larva with 91.8 +/- 9.5% of the population labeled sufficiently to produce an autoradiographic focus during a practicable, 6-wk period of exposure. Labeled infective larvae penetrated the skin of 10-day-old puppies and migrated to the small intestine, where the developed to adulthood.

  9. Generating a detailed protein profile of Fasciola hepatica during the chronic stage of infection in cattle.

    PubMed

    Haçarız, Orçun; Baykal, Ahmet Tarık; Akgün, Mete; Kavak, Pınar; Sağıroğlu, Mahmut Şamil; Sayers, Gearóid Patrick

    2014-06-01

    Fasciola hepatica is a trematode helminth causing a damaging disease, fasciolosis, in ruminants and humans. Comprehensive proteomic studies broaden our knowledge of the parasite's protein profile, and provide new insights into the development of more effective strategies to deal with fasciolosis. The objective of this study was to generate a comprehensive profile of F. hepatica proteins expressed during the chronic stage of infection in cattle by building on previous efforts in this area. The approach included an improved sample preparation procedure for surface and internal layers of the parasite, the application of nano-UPLC-ESI-qTOF-MS (nano-ultra-performance LC and ESI quadrupole TOF MS) integrated with different acquisition methods and in silico database search against various protein databases and a transcript database including a new assembly of publically available EST. Of a total of 776 identified proteins, 206 and 332 were specific to the surface and internal layers of the parasite, respectively. Furthermore, 238 proteins were common to both layers, with comparative differences of 172 proteins detected. Specific proteins not previously identified in F. hepatica, but shown to be immunomodulatory or potential drug targets for other parasites, are discussed.

  10. Investigation of sensitivity to microbial infection of diesel fuel at the refinery stage

    SciTech Connect

    Thomsen, E.S.; Petersen, S.

    1995-04-01

    In the practice of a company dealing with microbial problems of contaminated fuels, it was possible to use associations of microorganisms in research. These associations of {open_quotes}wild{close_quotes} microorganisms appeared successful in the environment of ship`s fuel tanks, causing severe problems at the consumer level. Fresh {open_quotes}raw{close_quotes} diesel fuel was treated with the cultures to investigate the sensitivity of the fuel to microbial contamination at the refinery stage. The fuel samples received from Danish refineries were specified as free of any additives or biocides. Before treatment the samples were tested for the presence of inhibiting substances or contamination. Samples of {open_quotes}raw{close_quotes} fuel were added at 1/10, 1/100 and 1/1000 of contaminated fuel, incubated at 27{degrees}C and observed for 14 days. Other samples were incubated at 5{degrees}C and combinations of periods at 5{degrees} and 27{degrees}C. In the absence of water or nutrients the contaminant did not appear to survive and colonize the {open_quotes}raw{close_quotes} fuel, although one sample did produce microbial growth in an order of magnitude corresponding to common definitions of fuel infections. The ability of the two relevant associations of {open_quotes}wild{close_quotes} microorganisms to contaminate the {open_quotes}raw{close_quotes} diesel fuel was not clearly demonstrated at this point.

  11. Inhibition of human coronavirus NL63 infection at early stages of the replication cycle.

    PubMed

    Pyrc, Krzysztof; Bosch, Berend Jan; Berkhout, Ben; Jebbink, Maarten F; Dijkman, Ronald; Rottier, Peter; van der Hoek, Lia

    2006-06-01

    Human coronavirus NL63 (HCoV-NL63), a recently discovered member of the Coronaviridae family, has spread worldwide and is associated with acute respiratory illness in young children and elderly and immunocompromised persons. Further analysis of HCoV-NL63 pathogenicity seems warranted, in particular because the virus uses the same cellular receptor as severe acute respiratory syndrome-associated coronavirus. As there is currently no HCoV-NL63-specific and effective vaccine or drug therapy available, we evaluated several existing antiviral drugs and new synthetic compounds as inhibitors of HCoV-NL63, targeting multiple stages of the replication cycle. Of the 28 compounds that we tested, 6 potently inhibited HCoV-NL63 at early steps of the replication cycle. Intravenous immunoglobulins, heptad repeat 2 peptide, small interfering RNA1 (siRNA1), siRNA2, beta-D-N(4)-hydroxycytidine, and 6-azauridine showed 50% inhibitory concentrations of 125 microg/ml, 2 microM, 5 nM, 3 nM, 400 nM, and 32 nM, respectively, and low 50% cytotoxicity concentrations (>10 mg/ml, >40 microM, >200 nM, >200 nM, >100 microM, and 80 microM, respectively). These agents may be investigated further for the treatment of coronavirus infections.

  12. Variation in infection prevention practices in dialysis facilities: results from the national opportunity to improve infection control in ESRD (End-Stage Renal Disease) project.

    PubMed

    Chenoweth, Carol E; Hines, Stephen C; Hall, Kendall K; Saran, Rajiv; Kalbfleisch, John D; Spencer, Teri; Frank, Kelly M; Carlson, Diane; Deane, Jan; Roys, Erik; Scholz, Natalie; Parrotte, Casey; Messana, Joseph M

    2015-07-01

    OBJECTIVE To observe patient care across hemodialysis facilities enrolled in the National Opportunity to Improve Infection Control in ESRD (end-stage renal disease) (NOTICE) project in order to evaluate adherence to evidence-based practices aimed at prevention of infection. SETTING AND PARTICIPANTS Thirty-four hemodialysis facilities were randomly selected from among 772 facilities in 4 end-stage renal disease participating networks. Facility selection was stratified on dialysis organization affiliation, size, socioeconomic status, and urban/rural status. MEASUREMENTS Trained infection control evaluators used an infection control worksheet to observe 73 distinct infection control practices at the hemodialysis facilities, from October 1, 2011, through January 31, 2012. RESULTS There was considerable variation in infection control practices across enrolled facilities. Overall adherence to recommended practices was 68% (range, 45%-92%) across all facilities. Overall adherence to expected hand hygiene practice was 72% (range, 10%-100%). Compliance to hand hygiene before and after procedures was high; however, during procedures hand hygiene compliance averaged 58%. Use of chlorhexidine as the specific agent for exit site care was 19% overall but varied from 0% to 35% by facility type. The 8 checklists varied in the frequency of perfect performance from 0% for meeting every item on the checklist for disinfection practices to 22% on the arteriovenous access practices at initiation. CONCLUSIONS Our findings suggest that there are many areas for improvement in hand hygiene and other infection prevention practices in end-stage renal disease. These NOTICE project findings will help inform the development of a larger quality improvement initiative at dialysis facilities.

  13. The Modified Static Spacers Using Antibiotic-Impregnated Cement Rod in Two-Stage Revision for Infected Total Knee Arthroplasty

    PubMed Central

    Yoo, Juhyung; Lee, Seungyup; Han, Changdong

    2011-01-01

    The two-stage exchange arthroplasty (one- or two-stage) is believed to be the gold standard for the management of infections following total knee arthroplasty. We herein report a novel two-stage exchange arthroplasty technique using an antibiotic-impregnated cement intramedullary nail, which can be easily prepared during surgery using a straight thoracic tube and a Steinmann pin, and may provide additional stability to the knee to maintain normal mechanical axis. In addition, there is less pain between the period of prosthesis removal and subsequent reimplantation. Less soft tissue contracture, less scar adhesion, easy removal of the cement intramedullary nail, and successful infection control are the advantages of this technique. PMID:21909473

  14. Breeding behavior of immature mourning doves

    USGS Publications Warehouse

    Irby, H.D.; Blankenship, L.H.

    1966-01-01

    Some immature mourning doves (Zenaidura mncroura) are capable of breeding in their first (calendar) year of life. The breeding activities of immatures observed in this study included calling, copulating, and nesting. Development of sexual structures such as cloacal papillae, oviduct openings, and gonads was also regarded as evidence of breeding potential. Immatures were identified principally by white-tipped wing coverts. Sexes were distinguished by behavioral characteristics. Males coo, perform flights, carry nest material, and attend nests during the day and females attend nests at night. Immatures were involved in at least ten nestings on two areas near Tucson, Arizona, in 1963. Five young fledged from these nests.

  15. Syphilis Infection Differentially Regulates the Phenotype and Function of γδ T Cells in HIV-1-Infected Patients Depends on the HIV-1 Disease Stage

    PubMed Central

    Li, Zhen; Lu, Xiaofan; Hu, Zhiliang; Luo, Zhenwu; Jiang, Wei; Wu, Hao; Gao, Yanqing; Yan, Junling; Zhang, Qiuyue; Song, Aixin; Huang, Xiaojie; Mou, Danlei; Su, Bin; Zhang, Tong

    2017-01-01

    A rapidly escalating outbreak of syphilis infection has been affected men who have sex with men, particularly those with HIV-1 infection. γδ T cells are unconventional immune cells with two main subsets, Vδ1 T cells and Vδ2 T cells, which possess a combination of innate and adaptive immune features allowing them against HIV-1. However, whether syphilis infection affects the phenotype and function of γδ T cells in HIV-1-infected patients remains unclear, especially in acute HIV-1 infection (AHI). In this study, we enrolled 57 HIV-1-infected patients (24 with HIV-1 infection only and 33 coinfected with syphilis) from an acute HIV-1-infected cohort in Beijing (PRIMO). A comprehensive analysis of γδ T-cell phenotype and function was performed by flow cytometry. We found syphilis coinfection could reverse the imbalance of Vδ1/Vδ2 ratio in AHI. Syphilis infection results in decreased γδ T-cell activation in AHI, but increased γδ T-cell activation in chronic HIV-1 infection (CHI). Moreover, patients with CHI had larger numbers of IL-17-producing γδ T cells than those with AHI, regardless of syphilis status. Thus, syphilis affected the γδ T-cell immune response differently in patients depending on the stages of HIV-1 disease. In addition, the percentage of IL-17-producing γδ T cells was positively correlated with the percentage of neutrophils. These results suggest that the γδ T-cell/IL-17/neutrophil axis is involved in HIV-1 pathogenesis and disease progression. Taken together, our observations provide new insight into the roles of γδ T cells in immunopathogenesis of syphilis and HIV-1 coinfection, particularly during AHI, and our findings may be helpful for the prevention of syphilis and other sexually transmitted infections and highlight the great significance on the remedy of patients coinfected with HIV-1. PMID:28871259

  16. Bilateral One-Stage Revision of Infected Total Hip Arthroplasties: Report of Two Cases and Management of Antibiotic Therapy

    PubMed Central

    Pommepuy, Thomas; Lons, Adrien; Benad, Kevin; Beltrand, Eric; Senneville, Eric; Migaud, Henri

    2016-01-01

    Recommendations for the management of chronic and bilateral total hip arthroplasty (THA) infection are lacking. However, this type of infection involves medical problems concerning the management of the antibiotic therapy. We report two cases of such infections operated as one-stage revision. For each case, both hips were infected with the same bacteria (Staphylococcus caprae for one patient and methicillin-sensitive Staphylococcus aureus for the other). The probabilistic antibiotic treatment started during the first side (after harvesting intraoperative samples) did not prevent the culture of the bacteriologic harvested during the intervention of the second side. Cultures were positive for the same bacteria for both sides in the two cases presented herein. After results of intraoperative cultures, patients received culture-guided antibiotic therapy for three months and were considered cured at the end of a two-year follow-up. Our results suggest one-stage bilateral change of infected THA is a viable option and that early intraoperative antibiotic, started during the first-side exchange, does not jeopardize microbiological documentation of the second side. This work brings indirect arguments, in favor of the use of prophylactic antibiotics during revision of infected THA. PMID:26904335

  17. Influence of Ribeiroia ondatrae (Trematoda: Digenea) infection on limb development and survival of northern leopard frogs (Rana pipiens): effects of host stage and parasite-exposure level

    USGS Publications Warehouse

    Schotthoefer, Anna M.; Koehler, Anson V.; Meteyer, Carol U.; Cole, Rebecca A.

    2003-01-01

    Recent evidence suggests that infection by larvae of the trematode Ribeiroia ondatrae accounts for a significant proportion of limb malformations currently observed in amphibian populations of North America. However, the effects of R. ondatrae infection on northern leopard frogs (Rana pipiens), one of the species most frequently reported with malformations, have not been adequately explored. Moreover, the risk factors associated with R. ondatrae-induced malformations have not been clearly identified. We examined the effects of timing of infection on tadpole survival and limb development. Rana pipiens tadpoles were individually exposed to R. ondatrae cercariae at the pre-limb-bud (Gosner stages 24 and 25), limb-bud (Gosner stages 27 and 28), or paddle (Gosner stages 31–33) stages of development and monitored through metamorphosis. The effects of infection were stage-specific. Infections acquired at the pre-limb-bud stage resulted in a high mortality rate (47.5–97.5%), whereas tadpoles infected at the limb-bud stage displayed a high malformation rate (16% overall), and the magnitude of effects increased with the level of exposure to cercariae. In contrast, infections acquired at the paddle stage had no effect on limb development or tadpole survival, which suggests that the timing of R. ondatrae infection in relation to the stage structure of tadpole populations in the wild is an important determinant of the degree to which populations are affected by R. ondatrae.

  18. Destabilization of the Gut Microbiome Marks the End-Stage of Simian Immunodeficiency Virus Infection in Wild Chimpanzees

    PubMed Central

    BARBIAN, HANNAH J.; LI, YINGYING; RAMIREZ, MIGUEL; KLASE, ZACHARY; LIPENDE, IDDI; MJUNGU, DEUS; MOELLER, ANDREW H.; WILSON, MICHAEL L.; PUSEY, ANNE E.; LONSDORF, ELIZABETH V.; BUSHMAN, FREDERIC D.; HAHN, BEATRICE H.

    2016-01-01

    Enteric dysbiosis is a characteristic feature of progressive human immunodeficiency virus type 1 (HIV-1) infection but has not been observed in simian immunodeficiency virus (SIVmac)-infected macaques, including in animals with end-stage disease. This has raised questions concerning the mechanisms underlying the HIV-1 associated enteropathy, with factors other than virus infection, such as lifestyle and antibiotic use, implicated as playing possible causal roles. Simian immunodeficiency virus of chimpanzees (SIVcpz) is also associated with increased mortality in wild-living communities, and like HIV-1 and SIVmac, can cause CD4+ T cell depletion and immunodeficiency in infected individuals. Given the central role of the intestinal microbiome in mammalian health, we asked whether gut microbial constituents could be identified that are indicative of SIVcpz status and/or disease progression. Here, we characterized the gut microbiome of SIVcpz-infected and -uninfected chimpanzees in Gombe National Park, Tanzania. Subjecting a small number of fecal samples (N = 9) to metagenomic (shotgun) sequencing, we found bacteria of the family Prevotellaceae to be enriched in SIVcpz-infected chimpanzees. However, 16S rRNA gene sequencing of a larger number of samples (N = 123) failed to show significant differences in both the composition and diversity (alpha and beta) of gut bacterial communities between infected (N = 24) and uninfected (N = 26) chimpanzees. Similarly, chimpanzee stool-associated circular virus (Chi-SCV) and chimpanzee adenovirus (ChAdV) identified by metagenomic sequencing were neither more prevalent nor more abundant in SIVcpz-infected individuals. However, fecal samples collected from SIVcpz-infected chimpanzees within 5 months before their AIDS-related death exhibited significant compositional changes in their gut bacteriome. These data indicate that SIVcpz-infected chimpanzees retain a stable gut microbiome throughout much of their natural infection course

  19. Quantitative and qualitative profiles of circulating monocytes may help identifying tuberculosis infection and disease stages

    PubMed Central

    La Manna, Marco Pio; Orlando, Valentina; Dieli, Francesco; Di Carlo, Paola; Cascio, Antonio; Cuzzi, Gilda; Palmieri, Fabrizio; Goletti, Delia

    2017-01-01

    Tuberculosis (TB) is one of the most important cause of morbidity and death among infectious diseases, and continuous efforts are needed to improve diagnostic tools and therapy. Previous published studies showed that the absolute cells number of monocytes or lymphocytes in peripheral blood or yet the ratio of monocytes to lymphocytes displayed the ability to predict the risk of active TB. In the present study we evaluated the ratio of monocytes to lymphocytes variation and we also analyzed the ex-vivo expression of CD64 on monocytes as tools to identify biomarkers for discriminating TB stages. Significant differences were found when the average ratio of monocytes to lymphocytes of active TB patients was compared with latent TB infection (LTBI) subjects, cured TB and healthy donors (HD). By the receiver operator characteristics (ROC) curve analysis the cut-off value of 0.285, allowed the discrimination of active TB from HD, with a sensitivity of 91.04% and a specificity of 93.55% (95% of confidence interval: 0.92–0.99). The ROC curve analysis comparing TB patients and LTBI groups, led to a sensitivity and the specificity of the assay of 85.07% and 85.71%, respectively (95% of confidence interval: 0.85 to 0.96). The upregulation of CD64 expression on circulating monocytes in active TB patients could represent an additional biomarker for diagnosis of active TB. In conclusion, we found that the ML ratio or monocyte absolute count or phenotypic measures show predictive value for active TB. PMID:28208160

  20. Quantitative and qualitative profiles of circulating monocytes may help identifying tuberculosis infection and disease stages.

    PubMed

    La Manna, Marco Pio; Orlando, Valentina; Dieli, Francesco; Di Carlo, Paola; Cascio, Antonio; Cuzzi, Gilda; Palmieri, Fabrizio; Goletti, Delia; Caccamo, Nadia

    2017-01-01

    Tuberculosis (TB) is one of the most important cause of morbidity and death among infectious diseases, and continuous efforts are needed to improve diagnostic tools and therapy. Previous published studies showed that the absolute cells number of monocytes or lymphocytes in peripheral blood or yet the ratio of monocytes to lymphocytes displayed the ability to predict the risk of active TB. In the present study we evaluated the ratio of monocytes to lymphocytes variation and we also analyzed the ex-vivo expression of CD64 on monocytes as tools to identify biomarkers for discriminating TB stages. Significant differences were found when the average ratio of monocytes to lymphocytes of active TB patients was compared with latent TB infection (LTBI) subjects, cured TB and healthy donors (HD). By the receiver operator characteristics (ROC) curve analysis the cut-off value of 0.285, allowed the discrimination of active TB from HD, with a sensitivity of 91.04% and a specificity of 93.55% (95% of confidence interval: 0.92-0.99). The ROC curve analysis comparing TB patients and LTBI groups, led to a sensitivity and the specificity of the assay of 85.07% and 85.71%, respectively (95% of confidence interval: 0.85 to 0.96). The upregulation of CD64 expression on circulating monocytes in active TB patients could represent an additional biomarker for diagnosis of active TB. In conclusion, we found that the ML ratio or monocyte absolute count or phenotypic measures show predictive value for active TB.

  1. Aggregation of Infective Stages of Parasites as an Adaptation and Its Implications for the Study of Parasite-Host Interactions.

    PubMed

    Morrill, André; Forbes, Mark R

    2016-02-01

    The causes and consequences of aggregation among conspecifics have received much attention. For infecting macroparasites, causes include variation among hosts in susceptibility and whether infective stages are aggregated in the environment. Here, we link these two phenomena and explore whether aggregation of infective stages in the environment is adaptive to parasites encountering host condition-linked defenses and what effect such aggregations have for parasite-host interactions. Using simulation models, we show that parasite fitness is increased by aggregates attacking a host, particularly when investment into defenses is high. The fitness benefit of aggregation remains despite inclusion of factors that should curb the benefits of aggregation, namely, mortality of low-condition hosts (those hosts expected to be most susceptible to parasitism) and costs of high coinfection. For sample sizes common in studies, aggregation of infective stages reduces the likelihood of detecting host condition-parasitism relations, even when host condition is the only other factor in models affecting parasitism. Thus, it is not surprising that the expected inverse relations between host condition and parasitism, commonly a premise in studies of parasite-host interactions, are inconsistently found. An understanding of how parasites encounter hosts is thus needed for developing theory for parasite-host ecological and evolutionary interactions.

  2. Most regions of mouse epididymis are able to phagocytose immature germ cells.

    PubMed

    Ramos-Ibeas, P; Pericuesta, E; Fernández-González, R; Ramírez, M A; Gutierrez-Adan, A

    2013-01-01

    The role of the epididymis as a quality control organ in preventing infertile gametes entering the ejaculate has been extensively explored, and it has been suggested that a specific region of mammalian epididymis is able to phagocytose abnormal germ cells. This study examines whether the epithelium of certain zones of the mouse epididymis can act as a selection barrier by removing immature germ cells from the lumen by phagocytosis. To detect the presence of immature germ cells in the epididymis, we generated transgenic mice expressing enhanced green fluorescent protein under the deleted in azoospermia-like (mDazl) promoter to easily identify immature germ cells under fluorescence microscopy. Using this technique, we observed that during the first stage of spermatogenesis in prepuberal mice, a wave of immature germ cells is released into the epididymis and that the immature epididymis is not able to react to this abnormal situation. By contrast, when immature germ cells were artificially released into the epididymis in adult mice, a phagocytic response was observed. Phagosomes appeared inside principal cells of the epididymal epithelium and were observed to contain immature germ cells at different degradation stages in different zones of the epididymis, following the main wave of immature germ cells. In this paper, we describe how the epididymal epithelium controls sperm quality by clearing immature germ cells in response to their artificially induced massive shedding into the epididymal lumen. Our observations indicate that this phenomenon is not restricted to a given epididymis region and that phagocytic capacity is gradually acquired during epididymal development.

  3. Dynamics of HIV viremia and antibody seroconversion in plasma donors: implications for diagnosis and staging of primary HIV infection.

    PubMed

    Fiebig, Eberhard W; Wright, David J; Rawal, Bhupat D; Garrett, Patricia E; Schumacher, Richard T; Peddada, Lorraine; Heldebrant, Charles; Smith, Richard; Conrad, Andrew; Kleinman, Steven H; Busch, Michael P

    2003-09-05

    The characterization of primary HIV infection by the analysis of serial plasma samples from newly infected persons using multiple standard viral assays. A retrospective study involving two sets of archived samples from HIV-infected plasma donors. (A) 435 samples from 51 donors detected by anti-HIV enzyme immunoassays donated during 1984-1994; (B) 145 specimens from 44 donors detected by p24 antigen screening donated during 1996-1998. Two US plasma products companies. The timepoints of appearance of HIV-1 markers and viral load concentrations during primary HIV infection. The pattern of sequential emergence of viral markers in the 'A' panels was highly consistent, allowing the definition and estimation of the duration of six sequential stages. From the 'B' panels, the viral load at p24 antigen seroconversion was estimated by regression analysis at 10 000 copies/ml (95% CI 2000-93 000) and the HIV replication rate at 0.35 log copies/ml/day, corresponding to a doubling time in the preseroconversion phase of 20.5 h (95% CI 18.2-23.4 h). Consequently, an RNA test with 50 copies/ml sensitivity would detect HIV infection approximately 7 days before a p24 antigen test, and 12 days before a sensitive anti-HIV test. The sequential emergence of assay reactivity allows the classification of primary HIV-1 infection into distinct laboratory stages, which may facilitate the diagnosis of recent infection and stratification of patients enrolled in clinical trials. Quantitative analysis of preseroconversion replication rates of HIV is useful for projecting the yield and predictive value of assays targeting primary HIV infection.

  4. Transcriptomic analysis of the host response to early stage salmonid alphavirus (SAV-1) infection in Atlantic salmon Salmo salar L.

    PubMed

    Herath, Tharangani K; Bron, James E; Thompson, Kim D; Taggart, John B; Adams, Alexandra; Ireland, Jacqueline H; Richards, Randolph H

    2012-05-01

    Salmon pancreas disease, caused by salmonid alphavirus (SAV) of the family Togaviridae, is an economically important disease affecting farmed Atlantic salmon (Salmo salar L.) in Scotland, Norway, and Ireland. The virus causes characteristic lesions in the pancreas, heart, kidney and skeletal muscle of infected fish. The mechanisms responsible for the pathology and the immune responses elicited in infected Atlantic salmon are not fully understood. A microarray-based study was therefore performed to evaluate the host transcriptomic response during the early stages of an experimentally-induced SAV-1 infection. Atlantic salmon parr were injected intra-peritoneally with viral cell culture supernatant or cell culture supernatant without virus. RNA, extracted from head kidney sampled from infected and control fish at 1, 3 and 5 days post-injection (d.p.i.), was interrogated with the 17 k TRAITS/SGP cDNA microarray. The greatest number of significantly differentially expressed genes was recorded at 3 d.p.i., mainly associated with immune and defence mechanisms, including genes involved in interferon I pathways and Major Histocompatibility Complex Class I and II responses. Genes associated with apoptosis and cellular stress were also found to be differentially expressed between infected and uninfected individuals, as were genes involved in inhibiting viral attachment and replication. The microarray results were validated by follow-on analysis of eight genes by real-time PCR. The findings of the study reflect mechanisms used by the host to protect itself during the early stages of SAV-1 infection. In particular, there was evidence of rapid induction of interferon-mediated responses similar to those seen during mammalian alphavirus infections, and also early involvement of an adaptive immune response. This study provides essential knowledge to assist in the development of effective control and management strategies for SAV-1 infection.

  5. White spot syndrome virus induces metabolic changes resembling the warburg effect in shrimp hemocytes in the early stage of infection.

    PubMed

    Chen, I-Tung; Aoki, Takashi; Huang, Yun-Tzu; Hirono, Ikuo; Chen, Tsan-Chi; Huang, Jiun-Yan; Chang, Geen-Dong; Lo, Chu-Fang; Wang, Han-Ching

    2011-12-01

    The Warburg effect is an abnormal glycolysis response that is associated with cancer cells. Here we present evidence that metabolic changes resembling the Warburg effect are induced by a nonmammalian virus. When shrimp were infected with white spot syndrome virus (WSSV), changes were induced in several metabolic pathways related to the mitochondria. At the viral genome replication stage (12 h postinfection [hpi]), glucose consumption and plasma lactate concentration were both increased in WSSV-infected shrimp, and the key enzyme of the pentose phosphate pathway, glucose-6-phosphate dehydrogenase (G6PDH), showed increased activity. We also found that at 12 hpi there was no alteration in the ADP/ATP ratio and that oxidative stress was lower than that in uninfected controls. All of these results are characteristic of the Warburg effect as it is present in mammals. There was also a significant decrease in triglyceride concentration starting at 12 hpi. At the late stage of the infection cycle (24 hpi), hemocytes of WSSV-infected shrimp showed several changes associated with cell death. These included the induction of mitochondrial membrane permeabilization (MMP), increased oxidative stress, decreased glucose consumption, and disrupted energy production. A previous study showed that WSSV infection led to upregulation of the voltage-dependent anion channel (VDAC), which is known to be involved in both the Warburg effect and MMP. Here we show that double-stranded RNA (dsRNA) silencing of the VDAC reduces WSSV-induced mortality and virion copy number. For these results, we hypothesize a model depicting the metabolic changes in host cells at the early and late stages of WSSV infection.

  6. Contrasting expression of immune genes in scaled and scaleless skin of Atlantic salmon infected with young stages of Lepeophtheirus salmonis.

    PubMed

    Holm, H Jodaa; Skugor, S; Bjelland, A K; Radunovic, S; Wadsworth, S; Koppang, E O; Evensen, Ø

    2017-02-01

    Atlantic salmon skin tissues with and without scales were taken from two preferred sites of salmon louse (Lepeophtheirus salmonis) attachment, behind the dorsal fin (scaled) and from the top of the head (scaleless), respectively. Tissues were profiled by qPCR of 32 genes to study responses to copepodids, 4 days post infection (dpi), and during the moult of copepodids to the chalimus stage, at 8 dpi. Basal/constitutive differences were found for many immune-related genes between the two skin sites; e.g., mannose binding protein C was over 100 fold higher expressed in the scaled skin from the back in comparison to the skin without scales from the head. With lice-infection, at 4 dpi most genes in both tissues showed lower values than in the non-infected control. By 8 dpi, the majority of responses increased towards the control levels, including cytokines of Th1, Th17 and Th2 pathways. Immunohistochemistry of three immune factors revealed an even distribution of MHC class II positive cells throughout epidermis, including the top layer of keratinocytes, marked compartmentalization of Mx(+) and CD8α(+) cells close to stratum basale, and an increase in numbers of CD8α(+) cells in response to infection. In conclusion, suppression of immune genes during the copepodid stage likely sets off a beneficial situation for the parasite. At the moult to chalimus stage 8 dpi, only few genes surpassed the non-infected control levels, including CD8α. The gene expression pattern was reflected in the increased number of CD8α expressing cells, thus revealing a relatively minor activation of skin T-cell defenses in Atlantic salmon in response to L. salmonis infection.

  7. TLR4 and TLR9 signals stimulate protective immunity against blood-stage Plasmodium yoelii infection in mice.

    PubMed

    Zhang, Yanjun; Zhu, Xiaotong; Feng, Yonghui; Pang, Wei; Qi, Zanmei; Cui, Liwang; Cao, Yaming

    2016-11-01

    The mechanisms regulating the induction of protective immunity against blood-stage malaria remain unclear. Resistant DBA/2 mouse develops a higher Th1 response compared with a susceptible BALB/c strain during Plasmodium yoelii (Py) infection. It is known that the T helper cell response is initiated and polarized by dendritic cells (DCs) of the innate immune system, during which TLR4 and TLR9 are important receptors for the innate recognition of the malaria parasite and its products. We hypothesized that TLR4/9 may play critical roles in the induction of protective immunity against Py infection. We used TLR4/9 antagonists and agonists to study their effects on mouse resistance to Py infection. We found that the administration of an antagonist prior to infection aggravated disease outcomes, impaired DC functions and suppressed the pro-inflammatory response to Py infection in resistant DBA/2 mice. Treatment with the TLR4 agonist lipopolysaccharide (LPS) but not TLR9 agonist significantly improved the survival rate of susceptible Py-infected BALB/c mice. LPS administration promoted the activation and expansion of DCs and drove a Th1-biased response. Our data demonstrate the important roles of TLR4/9 signals in inducing resistance to malaria parasites and provide evidence for the rational use of TLR agonists to potentiate protective immunity against Plasmodium infection. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Single-virus tracking approach to reveal the interaction of Dengue virus with autophagy during the early stage of infection

    NASA Astrophysics Data System (ADS)

    Chu, Li-Wei; Huang, Yi-Lung; Lee, Jin-Hui; Huang, Long-Ying; Chen, Wei-Jun; Lin, Ya-Hsuan; Chen, Jyun-Yu; Xiang, Rui; Lee, Chau-Hwang; Ping, Yueh-Hsin

    2014-01-01

    Dengue virus (DENV) is one of the major infectious pathogens worldwide. DENV infection is a highly dynamic process. Currently, no antiviral drug is available for treating DENV-induced diseases since little is known regarding how the virus interacts with host cells during infection. Advanced molecular imaging technologies are powerful tools to understand the dynamics of intracellular interactions and molecular trafficking. This study exploited a single-virus particle tracking technology to address whether DENV interacts with autophagy machinery during the early stage of infection. Using confocal microscopy and three-dimensional image analysis, we showed that DENV triggered the formation of green fluorescence protein-fused microtubule-associated protein 1A/1B-light chain 3 (GFP-LC3) puncta, and DENV-induced autophagosomes engulfed DENV particles within 15-min postinfection. Moreover, single-virus particle tracking revealed that both DENV particles and autophagosomes traveled together during the viral infection. Finally, in the presence of autophagy suppressor 3-methyladenine, the replication of DENV was inhibited and the location of DENV particles spread in cytoplasma. In contrast, the numbers of newly synthesized DENV were elevated and the co-localization of DENV particles and autophagosomes was detected while the cells were treated with autophagy inducer rapamycin. Taken together, we propose that DENV particles interact with autophagosomes at the early stage of viral infection, which promotes the replication of DENV.

  9. Fungal infection in patients with end-stage liver disease: low frequency or low index of suspicion.

    PubMed

    Hassan, Elham A; Abd El-Rehim, Abeer S; Hassany, Sahar M; Ahmed, Asmaa O; Elsherbiny, Nahla M; Mohammed, Mona H

    2014-06-01

    End-stage liver disease (ESLD) is associated with dysregulation of the immune system and increased susceptibility to infections. Although invasive fungal infection (IFI) is a growing public health problem, studies of IFI in ESLD are lacking. The aims of this study were to screen for IFI in ESLD and to assess risk factors and serum interleukin 17 (IL-17) as a marker of the cellular immune response. Both blood and ascitic fluid samples were collected from 46 patients with ESLD for fungal culture and PCR. Serum IL-17 levels were determined. Seven patients had isolated IFI (four had spontaneous fungal peritonitis, two had fungemia, and one had a disseminated fungal infection) and five cases had combined fungal and bacterial infections. Spontaneous fungal peritonitis was attributed to Candida species, while fungemia was caused by Aspergillus species. Patients with IFI had higher serum IL-17 levels and increased mortality compared to patients without IFI. A history of antibiotic use (p = 0.002), higher model for end-stage liver disease (MELD) scores (p = 0.04), and hepatorenal syndrome (p = 0.006) were risk factors for IFI. Patients with ESLD had a low frequency of IFI; however, in patients with these infections, delayed diagnosis and treatment may contribute to a high fatality rate. Thus, clinicians should have a high index of suspicion for this unusual but lethal entity, as prompt detection and appropriate treatment can improve the outcome. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. Can Taenia solium latent post-oncospheral stages be found in muscle tissue of cysticercosis-infected pigs (Sus scrofa)?

    PubMed

    Rodrìguez, Mary L; Rodriguez, Silvia; Gonzalez, Armando E; Verastegui, Manuela; Bernal, Teresa; Jimenez, Juan A; Garcia, Hector H

    2006-02-01

    The existence of latent Taenia solium post-oncospheral stages in the tissues of infected pigs has been postulated. To assess whether such structures exist and can be detected, we examined muscle samples from cysticercosis-infected and uninfected pigs. Pork samples were homogenized, centrifuged, and resuspended in saline solution. Round microscopic structures of approximately 10 microm with variable refringence were found in the pellets of all samples from both infected and uninfected pigs. These became homogeneously red after staining with Sudan IV and disappeared after ether extraction. The only difference between samples from infected and uninfected pigs was the presence of inflammatory cells and tissue necrosis debris in the former group. Taenia solium oncospheres were stained and observed for comparative purposes, before and after inoculation into pork. Control oncospheres were ellipsoidal, had nucleated basophile cells in their interior, and showed red aggregates on their surfaces when stained with 3% Sudan IV. While rounded microscopical structures similar to those previously reported were found, these differed morphologically from oncospheres, were of a lipid nature, and occurred in both infected and uninfected animals. No evidence supporting the presence of latent post-oncospheral stages of Taenia solium was generated in this series of experiments.

  11. Efficacy of extracts of immature mango on ovine gastrointestinal nematodes.

    PubMed

    Nery, Patrícia S; Nogueira, Flávia A; Oliveira, Neide J F; Martins, Ernane R; Duarte, Eduardo R

    2012-12-01

    The principal health problem in small ruminants is helminthiasis and the rapid development of nematode resistance to anthelminthics has limited the success of control in several countries, stimulating the search for alternatives. In this study, extracts of immature fruits of the mango Mangifera indica L. var Ubá were evaluated for inhibition of larval development and fecal egg count reduction in sheep naturally infected with gastrointestinal nematodes. In the phytochemical analyses, tannins and flavonoids were the metabolites identified. Aqueous extracts of immature fruits at 100 mg ml(-1) showed 100 % inhibition of larval development. The LC(90) of the extract was 35.9 mg ml(-1) and the in vivo anthelminthic efficacy at 0.740 g kg(-1) (BW, orally) was 53 %. The identification of larvae showed that 99.8 % were Haemonchus spp. In vitro and in vivo results indicate that this fruit could assist ovine nematode control.

  12. Stage-specific immunity to Taenia taeniaeformis infection in mice. A histological study of the course of infection in mice vaccinated with either oncosphere or metacestode antigens.

    PubMed

    Bøgh, H O; Lightowlers, M W; Sullivan, N D; Mitchell, G F; Rickard, M D

    1990-03-01

    The course of Taenia taeniaeformis infection in mice previously vaccinated with antigens prepared from either oncosphere (TtO) or metacestode (TtM) was followed by histological examination of livers from mice killed at various times post-infection (p.i.). Distinctly different immune responses occurred in the two groups. Very few cysts were seen at any stage of infection in TtO-vaccinated mice and most of those which were present appeared histologically similar to cysts in control mice. In TtM-vaccinated mice many cysts were present from early in infection but histologically it was apparent that most were dying from 15 days p.i. because the tegument had lost its integrity, and degranulated polymorphonuclear leucocytes were present inside the parasites. These findings support earlier suggestions that stage-specific antigens are expressed in oncospheres and metacestodes. Parasites developing normally were surrounded by a halo of alcian blue staining amorphous acellular material. This material appeared to act as a barrier to attack by host inflammatory cells, and disappearance of this layer signalled death of the parasite. The possibility that the gut acted as a barrier to delay migration of oncospheres to the liver in vaccinated mice was investigated, but no evidence for this could be found.

  13. Role of Suppressive Oral Antibiotics in Orthopedic Hardware Infections for Those Not Undergoing Two-Stage Replacement Surgery.

    PubMed

    Keller, Sara C; Cosgrove, Sara E; Higgins, Yvonne; Piggott, Damani A; Osgood, Greg; Auwaerter, Paul G

    2016-10-01

    Background.  The use of suppressive antibiotics in treatment of orthopedic hardware infections (OHIs), including spinal hardware infections, prosthetic joint infections, and infections of internal fixation devices, is controversial. Methods.  Over a 4-year period at 2 academic medical centers, patients with OHI who were treated with debridement and retention of hardware components, with single-stage exchange, or without surgery were studied to determine whether use of oral antibiotics for at least 6 months after diagnosis impacts successful treatment of the infection at 1 year after diagnosis. Results.  Of 89 patients in the study, 42 (47.2%) were free of clinical infection 1 year after initial diagnosis. Suppressive antibiotics used for at least 6 months after diagnosis was not associated with being free of clinical infection (adjusted odds ratio [aOR], 5.29; 95% confidence interval [CI], .74-37.80), but being on suppressive antibiotics at least 3 months after diagnosis was associated with being free of clinical infection (OR, 3.50; 95% CI, 1.30-9.43). Causative organisms impacted the likelihood of success; patients with methicillin-resistant Staphylococcus aureus as well as with Gram-negative rods were both less likely to have achieved clinical success at 1 year after surgery (aOR = 0.018, 95% CI = .0017-.19 and aOR = 0.20, 95% CI = .039-.99, respectively). Conclusions.  Oral suppressive antibiotic therapy in treatment of OHI with retention of hardware for 3 months, but not 6 months, postdiagnosis increases the likelihood of treatment success. The organisms implicated in the infection directly impact the likelihood of treatment success.

  14. Role of Suppressive Oral Antibiotics in Orthopedic Hardware Infections for Those Not Undergoing Two-Stage Replacement Surgery

    PubMed Central

    Keller, Sara C.; Cosgrove, Sara E.; Higgins, Yvonne; Piggott, Damani A.; Osgood, Greg; Auwaerter, Paul G.

    2016-01-01

    Background. The use of suppressive antibiotics in treatment of orthopedic hardware infections (OHIs), including spinal hardware infections, prosthetic joint infections, and infections of internal fixation devices, is controversial. Methods. Over a 4-year period at 2 academic medical centers, patients with OHI who were treated with debridement and retention of hardware components, with single-stage exchange, or without surgery were studied to determine whether use of oral antibiotics for at least 6 months after diagnosis impacts successful treatment of the infection at 1 year after diagnosis. Results. Of 89 patients in the study, 42 (47.2%) were free of clinical infection 1 year after initial diagnosis. Suppressive antibiotics used for at least 6 months after diagnosis was not associated with being free of clinical infection (adjusted odds ratio [aOR], 5.29; 95% confidence interval [CI], .74–37.80), but being on suppressive antibiotics at least 3 months after diagnosis was associated with being free of clinical infection (OR, 3.50; 95% CI, 1.30–9.43). Causative organisms impacted the likelihood of success; patients with methicillin-resistant Staphylococcus aureus as well as with Gram-negative rods were both less likely to have achieved clinical success at 1 year after surgery (aOR = 0.018, 95% CI = .0017–.19 and aOR = 0.20, 95% CI = .039–.99, respectively). Conclusions. Oral suppressive antibiotic therapy in treatment of OHI with retention of hardware for 3 months, but not 6 months, postdiagnosis increases the likelihood of treatment success. The organisms implicated in the infection directly impact the likelihood of treatment success. PMID:27747252

  15. MAPK phosphotase 5 deficiency contributes to protection against blood-stage Plasmodium yoelii 17XL infection in mice.

    PubMed

    Cheng, Qianqian; Zhang, Qingfeng; Xu, Xindong; Yin, Lan; Sun, Lin; Lin, Xin; Dong, Chen; Pan, Weiqing

    2014-04-15

    Cell-mediated immunity plays a crucial role in the development of host resistance to asexual blood-stage malaria infection. However, little is known of the regulatory factors involved in this process. In this study, we investigated the impact of MAPK phosphotase 5 (MKP5) on protective immunity against a lethal Plasmodium yoelii 17XL blood-stage infection using MKP5 knockout C57BL/6 mice. Compared with wild-type control mice, MKP5 knockout mice developed significantly lower parasite burdens with prolonged survival times. We found that this phenomenon correlated with a rapid and strong IFN-γ-dependent cellular immune response during the acute phase of infection. Inactivation of IFN-γ by the administration of a neutralizing Ab significantly reduced the protective effects in MKP5 knockout mice. By analyzing IFN-γ production in innate and adaptive lymphocyte subsets, we observed that MKP5 deficiency specifically enhanced the IFN-γ response mediated by CD4+ T cells, which was attributable to the increased stimulatory capacity of splenic CD11c+ dendritic cells. Furthermore, following vaccination with whole blood-stage soluble plasmodial Ag, MKP5 knockout mice acquired strongly enhanced Ag-specific immune responses and a higher level of protection against subsequent P. yoelii 17XL challenge. Finally, we found the enhanced response mediated by MKP5 deficiency resulted in a lethal consequence in mice when infected with nonlethal P. yoelii 17XNL. Thus, our data indicate that MKP5 is a potential regulator of immune resistance against Plasmodium infection in mice, and that an understanding of the role of MKP5 in manipulating anti-malaria immunity may provide valuable information on the development of better control strategies for human malaria.

  16. [Changes of reflectance spectra of pine needles in different stage after being infected by pine wood nematode].

    PubMed

    Xu, Hua-chao; Luo, You-qing; Zhang, Ting-ting; Shi, Yong-jun

    2011-05-01

    In the present study, seedlings of Pinus Thunbergii and Pinus Massoniana were planted and used for reflectance spectrum measurement. In different stage after being infected by pine wood nematode, reflectance spectra were measured by ASD spectrometer and the features of spectral parameters and the change of chlorophyll were analyzed. The results showed that (1) Disease could be estimated in the early stage according to the curve of mid-infrared reflectance; (2) Dynamic parameters such as the position of red edge, green peak height, reflectance of red band, slope of red edge and reflectance of water-stressed wave band were consistent with the disease features of two pine species after being infected by pine wood nematode; (3) To both of two pine species, content of chlorophyll tended to reduce with the development of disease and obvious linear relationship was observed between chlorophyll content and spectral parameters. There results might be able to provide some theoretical basis for the application of remote sensing technology in monitoring of pine wood disease. In addition, it might be also used as theoretical support for the controlling measures in different stage after being infected by pine wood nematode.

  17. Immunological memory to blood-stage malaria infection is controlled by the histamine releasing factor (HRF) of the parasite.

    PubMed

    Demarta-Gatsi, Claudia; Peronet, Roger; Smith, Leanna; Thiberge, Sabine; Ménard, Robert; Mécheri, Salaheddine

    2017-08-22

    While most subunit malaria vaccines provide only limited efficacy, pre-erythrocytic and erythrocytic genetically attenuated parasites (GAP) have been shown to confer complete sterilizing immunity. We recently generated a Plasmodium berghei (PbNK65) parasite that lacks a secreted factor, the histamine releasing factor (HRF) (PbNK65 hrfΔ), and induces in infected mice a self-resolving blood stage infection accompanied by a long lasting immunity. Here, we explore the immunological mechanisms underlying the anti-parasite protective properties of the mutant PbNK65 hrfΔ and demonstrate that in addition to an up-regulation of IL-6 production, CD4(+) but not CD8(+) T effector lymphocytes are indispensable for the clearance of malaria infection. Maintenance of T cell-associated protection is associated with the reduction in CD4(+)PD-1(+) and CD8(+)PD-1(+) T cell numbers. A higher number of central and effector memory B cells in mutant-infected mice also plays a pivotal role in protection. Importantly, we also demonstrate that prior infection with WT parasites followed by a drug cure does not prevent the induction of PbNK65 hrfΔ-induced protection, suggesting that such protection in humans may be efficient even in individuals that have been infected and who repeatedly received antimalarial drugs.

  18. Mortality Dynamics of Spodoptera frugiperda (Lepidoptera: Noctuidae) Immatures in Maize

    PubMed Central

    Varella, Andrea Corrêa; Menezes-Netto, Alexandre Carlos; Alonso, Juliana Duarte de Souza; Caixeta, Daniel Ferreira; Peterson, Robert K. D.; Fernandes, Odair Aparecido

    2015-01-01

    We characterized the dynamics of mortality factors affecting immature developmental stages of the fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae). Multiple decrement life tables for egg and early larval stages of S. frugiperda in maize (Zea mays L.) fields were developed with and without augmentative releases of Telenomus remus Nixon (Hymenoptera: Platygastridae) from 2009 to 2011. Total egg mortality ranged from 73 to 81% and the greatest egg mortality was due to inviability, dislodgement, and predation. Parasitoids did not cause significant mortality in egg or early larval stages and the releases of T. remus did not increase egg mortality. Greater than 95% of early larvae died from predation, drowning, and dislodgment by rainfall. Total mortality due to these factors was largely irreplaceable. Results indicate that a greater effect in reducing generational survival may be achieved by adding mortality to the early larval stage of S. frugiperda. PMID:26098422

  19. Tibial tubercle osteotomy or quadriceps snip in two-stage revision for prosthetic knee infection? A randomized prospective study.

    PubMed

    Bruni, Danilo; Iacono, Francesco; Sharma, Bharat; Zaffagnini, Stefano; Marcacci, Maurilio

    2013-04-01

    Although 7% to 38% of revision total knee arthroplasties (RTKAs) are attributable to prosthetic knee infections, controversy exists regarding the best surgical approach while reducing the risk of extensor mechanism complications and the reinfection rate. We compared The Knee Society Score(©) (KSS), incidences of complications, maximum knee flexion, residual extension lag, and reinfection rate in patients with prosthetic knee infections treated with two-stage RTKAs using either the tibial tubercle osteotomy (TTO) or the quadriceps snip (QS) for exposure at the time of reimplantation. We prospectively followed 81 patients with chronic prosthetic knee infections treated between 1997 and 2004. Patients were randomized to receive a TTO or QS for exposure at the time of reimplantation. All patients had the same rehabilitation protocol. The minimum followup was 8 years (mean, 12 years; range, 8-15 years). Patients in the TTO group had a higher mean KSS than the QS group (88 versus 70, respectively). Mean maximum knee flexion was greater in the TTO group (113° versus 94°); with a lower incidence of extension lag (45% versus 13%). We observed no differences in reinfection rate between groups. We found the TTO combined with an early rehabilitation protocol associated with superior KSS did not impair extensor mechanism function or increase the reinfection rate. We believe a two-stage RTKA with TTO is a reasonable approach for treating prosthetic knee infections. Level I, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence.

  20. Apoptosis in Macrophages and Alveolar Epithelial Cells during Early Stages of Infection by Legionella pneumophila and Its Role in Cytopathogenicity

    PubMed Central

    Gao, Lian-Yong; Abu Kwaik, Yousef

    1999-01-01

    The hallmark of Legionnaires’ disease is intracellular replication of Legionella pneumophila within cells in the alveolar spaces. Cytopathogenicity of this bacterium to the host cell has been well demonstrated, but the mechanisms of host cell death due to infection by L. pneumophila are not well understood. In this study, induction of apoptosis in macrophages and alveolar epithelial cells by L. pneumophila during early stages of infection was confirmed by using multiple criteria, including DNA fragmentation by agarose gel electrophoresis, terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling, surface exposure of phosphatidylserine, and cellular morphology by transmission electron microscopy. Induction of nuclear apoptosis in L. pneumophila-infected macrophages is mediated by activation of the caspase cascade death machinery. We provide genetic and biochemical evidence that L. pneumophila-induced apoptosis in macrophages and alveolar epithelial cells does not require intracellular bacterial replication or new protein synthesis. In addition, extracellular L. pneumophila is capable of inducing apoptosis. Furthermore, induction of apoptosis by L. pneumophila correlates with cytopathogenicity. We conclude that L. pneumophila-induced apoptosis in macrophages and alveolar epithelial cells plays an important role in cytopathogenicity to the host cell during early stages of infection. PMID:9916101

  1. Human iPSC-derived Immature Astroglia Promote Oligodendrogenesis by increased TIMP-1 Secretion

    PubMed Central

    Jiang, Peng; Chen, Chen; Liu, Xiao-Bo; Pleasure, David E.; Liu, Ying; Deng, Wenbin

    2016-01-01

    SUMMARY Astrocytes, once considered passive support cells, are increasingly appreciated as dynamic regulators of neuronal development and function, in part via secreted factors. The extent to which they similarly regulate oligodendrocytes, or proliferation and differentiation of oligodendrocyte progenitor cells (OPCs) is less well understood. Here, we generated astrocytes from human pluripotent stem cells (hiPSC-Astros) and demonstrate that immature astrocytes - as opposed to mature - promoted oligodendrogenesis in vitro. In the PVL mouse model of neonatal hypoxic/ischemic encephalopathy, associated with cerebral palsy in humans, transplanted immature hiPSC-Astros promote myelinogenesis and behavioral outcome. We further identified TIMP-1 as a selectively upregulated component secreted from immature hiPSC-Astros. Accordingly, in the rat PVL model, intranasal administration of conditioned medium from immature hiPSC-Astros promoted oligodendrocyte maturation in a TIMP-1 dependent manner. Our findings suggest stage-specific developmental interactions between astroglia and oligodendroglia, with important therapeutic implications for promoting myelinogenesis. PMID:27134175

  2. Hyperoxia and the Immature Brain.

    PubMed

    Reich, Bettina; Hoeber, Daniela; Bendix, Ivo; Felderhoff-Mueser, Ursula

    2017-02-03

    Despite major advances in obstetrics and neonatal intensive care, preterm infants frequently suffer from neurological impairments in later life. Preterm and also full-term neonates are generally susceptible to injury caused by reactive oxygen species due to the immaturity of endogenous radical scavenging systems. It is well known that high oxygen levels experienced during the critical phase of maturation can profoundly influence developmental processes. Supraphysiological oxygen concentrations used for resuscitation or in the care of critically ill infants are known to have deleterious effects on the developing lung and retina, contributing to the pathophysiology of neonatal diseases like bronchopulmonary dysplasia and retinopathy of prematurity. Moreover, experimental work from the last decade suggests that hyperoxia also leads to neuronal and glial cell death, contributing to the injury of white and grey matter observed in preterm infants. During the critical phase of brain maturation, hyperoxia can alter developmental processes, resulting in the disruption of neural plasticity and myelination. However, oxygen therapy can often not be avoided in neonatal intensive care. Therefore, in situations requiring oxygen supplementation, in addition to the development of appropriate monitoring systems, protective and/or regenerative strategies are highly warranted. Here, we summarise the clinical and experimental evidence as well as potential therapeutic strategies, providing an overview of the pathophysiology of oxygen exposure on the developing central nervous system and its impact on neonatal brain injury.

  3. Phaseolus immature embryo rescue technology.

    PubMed

    Geerts, Pascal; Toussaint, André; Mergeai, Guy; Baudoin, Jean-Pierre

    2011-01-01

    Predominant among the production constraints of the common bean Phaseolus vulgaris are infestation of Ascochyta blight, Bean Golden Mosaic virus (BGMV), and Bean Fly. Interbreeding with Phaseolus -coccineus L. and/or Phaseolus polyanthus Greenm has been shown to provide P. vulgaris with greater resistance to these diseases. For interspecific crosses to be successful, it is important to use P. coccineus and P. polyanthus as female parents; this prevents rapid reversal to the recurrent parent P. vulgaris. Although incompatibility barriers are post-zygotic, early hybrid embryo abortion limits the success of F1 crosses. While rescue techniques for globular and early heart-shaped embryos have improved in recent years, -success in hybridization remains very low. In this study, we describe six steps that allowed us to rescue 2-day-old P. vulgaris embryos using a pod culture technique. Our methods consisted of (i) pod culture, (ii) extraction and culture of immature embryos, (iii) dehydration of embryos, (iv) germination of embryos, (v) rooting of developed shoots, and (vi) hardening of plantlets.

  4. Frequent homozygosity in both mature and immature ovarian teratomas: a shared genetic basis of tumorigenesis.

    PubMed

    Snir, Olivia L; DeJoseph, Maura; Wong, Serena; Buza, Natalia; Hui, Pei

    2017-06-30

    Although homozygosity is well documented in mature teratomas, the genetic zygosity of ovarian immature teratomas and mixed germ cell tumors is less well studied. Ten cases of mature cystic teratomas, eleven cases of grade 2 or 3 immature teratomas, and seven cases of mixed germ cell tumors with an immature teratoma component were investigated by short tandem repeat genotyping to interrogate their genetic zygosity. DNA genotyping was informative in eight mature teratomas, seven immature teratomas and six cases of mixed germ cell tumors. Out of the eight mature teratomas, five cases showed partial or complete homozygosity (63%) with two cases demonstrating complete homozygosity (25%). Of the immature teratomas, six cases showed partial or complete homozygosity (86%) with two cases demonstrating complete homozygosity (29%). For the mixed germ cell tumors, two cases showed partial homozygosity (33%) and none displayed complete homozygosity. Long-term clinical follow-up was available for five immature teratomas (mean follow-up 110 months) and five mixed germ cell tumors (mean follow-up 66 months). None of the five patients with pure immature teratoma had a recurrence; in contrast, four out of five mixed ovarian germ cell tumors recurred between 4 months to 8 years (P=0.048). In conclusion, both immature and mature teratomas harbor frequent genetic homozygosity suggesting a common cellular origin involving germ cells at the same developmental stage. The difference in the rate of homozygosity and tumor recurrence between pure immature teratomas and mixed germ cell tumors suggests that the two entities may involve different pathogenetic pathways and likely pursue different biological behaviors.Modern Pathology advance online publication, 30 June 2017; doi:10.1038/modpathol.2017.66.

  5. Endometrial epithelial cell response to semen from HIV-infected men during different stages of infection is distinct and can drive HIV-1-long terminal repeat.

    PubMed

    Kafka, Jessica K; Sheth, Prameet M; Nazli, Aisha; Osborne, Brendan J; Kovacs, Colin; Kaul, Rupert; Kaushic, Charu

    2012-01-02

    Although more than 60% of HIV transmission occurs via semen, little is known about the immune impact of seminal plasma on HIV susceptibility. Here, we examined the level of selected immunomodulatory factors in seminal plasma from HIV-uninfected and therapy-naive, HIV-infected men in acute and chronic stages; the cytokine response elicited by seminal plasma in genital epithelial cells (GECs); and whether any GEC response to seminal plasma could drive HIV replication in infected T cells. A panel of nine cytokines and chemokines was measured in seminal plasma from HIV-uninfected and HIV-infected men and in primary GEC cultures following seminal plasma exposure. HIV-long terminal repeat (LTR) activation was measured in 1G5 T cells exposed to supernatants from seminal plasma-treated GECs. Pro-inflammatory cytokines and chemokines were present at significantly higher levels in seminal plasma from acute men, whereas transforming growth factor (TGF)-β1 was significantly higher in seminal plasma from chronic men. Pro-inflammatory cytokine production by GECs was significantly decreased following incubation with seminal plasma from chronic men. Blocking the TGF-β1 receptor in GECs prior to seminal plasma exposure enhanced pro-inflammatory cytokine production. Exposure to seminal plasma activated nuclear factor (NF)-κB in GECs and blocking it significantly reduced pro-inflammatory cytokine production. GEC responses to seminal plasma, especially from acute men, significantly activated HIV-LTR activation in 1G5 T cells. Immunomodulatory factors in seminal plasma vary, depending on presence and stage of HIV infection. Exposure to seminal plasma leads to NF-κB activation and pro-inflammatory cytokine production, whereas TGF-β in seminal plasma may suppress pro-inflammatory cytokine production by GECs. GEC responses to seminal plasma can activate HIV-LTR in infected CD4(+) T cells.

  6. Rationale for one stage exchange of infected hip replacement using uncemented implants and antibiotic impregnated bone graft.

    PubMed

    Winkler, Heinz

    2009-09-04

    Infection of a total hip replacement (THR) is considered a devastating complication, necessitating its complete removal and thorough debridement of the site. It is undoubted that one stage exchange, if successful, would provide the best benefit both for the patient and the society. Still the fear of re-infection dominates the surgeons decisions and in the majority of cases directs them to multiple stage protocols. However, there is no scientifically based argument for that practice. Successful eradication of infection with two stage procedures is reported to average 80% to 98%. On the other hand a literature review of Jackson and Schmalzried (CORR 2000) summarizing the results of 1,299 infected hip replacements treated with direct exchange (almost exclusively using antibiotic loaded cement), reports of 1,077 (83%) having been successful. The comparable results suggest, that the major factor for a successful outcome with traditional approaches may be found in the quality of surgical debridement and dead space management. Failures in all protocols seem to be caused by small fragments of bacterial colonies remaining after debridement, whereas neither systemic antibiotics nor antibiotic loaded bone cement (PMMA) have been able to improve the situation significantly. Reasons for failure may be found in the limited sensitivity of traditional bacterial culturing and reduced antibiotic susceptibility of involved pathogens, especially considering biofilm formation. Whenever a new prosthesis is implanted into a previously infected site the surgeon must be aware of increased risk of failure, both in single or two stage revisions. Eventual removal therefore should be easy with low risk of additional damage to the bony substance. On the other hand it should also have potential of a good long term result in case of success. Cemented revisions generally show inferior long term results compared to uncemented techniques; the addition of antibiotics to cement reduces its

  7. Infection-Related Hospitalizations in Older Patients With End-Stage Renal Disease

    PubMed Central

    Dalrymple, Lorien S.; Johansen, Kirsten L.; Chertow, Glenn M.; Cheng, Su-Chun; Grimes, Barbara; Gold, Ellen B.; Kaysen, George A.

    2010-01-01

    Background Infection is an important cause of hospitalization and death in patients receiving dialysis. Few studies have examined the full range of infections experienced by dialysis patients. The purpose of this study was to examine the types, rates and risk factors for infection among older persons starting dialysis. Study Design Retrospective observational cohort study. Setting and Participants The cohort was assembled from the United States Renal Data System and included patients aged 65 to 100 years who initiated dialysis between 1/1/00 and 12/31/02. Exclusions included prior kidney transplant, unknown dialysis modality, or death, loss to follow-up, or transplant during the first 90 days of dialysis. Patients were followed until death, transplant, or study end 12/31/04. Predictors Baseline demographics, co-morbidities, serum albumin and hemoglobin. Outcomes and Measurements Infection-related hospitalizations were ascertained using discharge ICD-9-CM codes. Hospitalization rates were calculated for each type of infection. The Wei-Lin-Weissfeld Model was used to examine risk factors for up to 4 infection-related events. Results 119,858 patients were included, 7,401 of whom were on peritoneal dialysis. During a median follow-up of 1.9 years, infection-related diagnoses were observed in approximately 35% of all hospitalizations. Approximately 50% of patients had at least one infection-related hospitalization. Rates (per 100 person-years) of pulmonary, soft tissue, and genitourinary infections ranged from 8.3 to 10.3 in patients on peritoneal dialysis and 10.2 to 15.3 in patients on hemodialysis. Risk factors for infection included older age, female sex, diabetes, heart failure, pulmonary disease, and low serum albumin. Limitations Use of ICD-9-CM codes, reliance on Medicare claims to capture hospitalizations, use of the Medical Evidence Form to ascertain co-morbidities, absence of data on dialysis access. Conclusion Infection-related hospitalization is frequent in

  8. CD8+ T cells from a novel T cell receptor transgenic mouse induce liver-stage immunity that can be boosted by blood-stage infection in rodent malaria.

    PubMed

    Lau, Lei Shong; Fernandez-Ruiz, Daniel; Mollard, Vanessa; Sturm, Angelika; Neller, Michelle A; Cozijnsen, Anton; Gregory, Julia L; Davey, Gayle M; Jones, Claerwen M; Lin, Yi-Hsuan; Haque, Ashraful; Engwerda, Christian R; Nie, Catherine Q; Hansen, Diana S; Murphy, Kenneth M; Papenfuss, Anthony T; Miles, John J; Burrows, Scott R; de Koning-Ward, Tania; McFadden, Geoffrey I; Carbone, Francis R; Crabb, Brendan S; Heath, William R

    2014-05-01

    To follow the fate of CD8+ T cells responsive to Plasmodium berghei ANKA (PbA) infection, we generated an MHC I-restricted TCR transgenic mouse line against this pathogen. T cells from this line, termed PbT-I T cells, were able to respond to blood-stage infection by PbA and two other rodent malaria species, P. yoelii XNL and P. chabaudi AS. These PbT-I T cells were also able to respond to sporozoites and to protect mice from liver-stage infection. Examination of the requirements for priming after intravenous administration of irradiated sporozoites, an effective vaccination approach, showed that the spleen rather than the liver was the main site of priming and that responses depended on CD8α+ dendritic cells. Importantly, sequential exposure to irradiated sporozoites followed two days later by blood-stage infection led to augmented PbT-I T cell expansion. These findings indicate that PbT-I T cells are a highly versatile tool for studying multiple stages and species of rodent malaria and suggest that cross-stage reactive CD8+ T cells may be utilized in liver-stage vaccine design to enable boosting by blood-stage infections.

  9. CD8+ T Cells from a Novel T Cell Receptor Transgenic Mouse Induce Liver-Stage Immunity That Can Be Boosted by Blood-Stage Infection in Rodent Malaria

    PubMed Central

    Mollard, Vanessa; Sturm, Angelika; Neller, Michelle A.; Cozijnsen, Anton; Gregory, Julia L.; Davey, Gayle M.; Jones, Claerwen M.; Lin, Yi-Hsuan; Haque, Ashraful; Engwerda, Christian R.; Nie, Catherine Q.; Hansen, Diana S.; Murphy, Kenneth M.; Papenfuss, Anthony T.; Miles, John J.; Burrows, Scott R.; de Koning-Ward, Tania; McFadden, Geoffrey I.; Carbone, Francis R.; Crabb, Brendan S.; Heath, William R.

    2014-01-01

    To follow the fate of CD8+ T cells responsive to Plasmodium berghei ANKA (PbA) infection, we generated an MHC I-restricted TCR transgenic mouse line against this pathogen. T cells from this line, termed PbT-I T cells, were able to respond to blood-stage infection by PbA and two other rodent malaria species, P. yoelii XNL and P. chabaudi AS. These PbT-I T cells were also able to respond to sporozoites and to protect mice from liver-stage infection. Examination of the requirements for priming after intravenous administration of irradiated sporozoites, an effective vaccination approach, showed that the spleen rather than the liver was the main site of priming and that responses depended on CD8α+ dendritic cells. Importantly, sequential exposure to irradiated sporozoites followed two days later by blood-stage infection led to augmented PbT-I T cell expansion. These findings indicate that PbT-I T cells are a highly versatile tool for studying multiple stages and species of rodent malaria and suggest that cross-stage reactive CD8+ T cells may be utilized in liver-stage vaccine design to enable boosting by blood-stage infections. PMID:24854165

  10. Contribution of mammary epithelial cells to the immune response during early stages of a bacterial infection to Staphylococcus aureus

    PubMed Central

    2014-01-01

    To differentiate between the contribution of mammary epithelial cells (MEC) and infiltrating immune cells to gene expression profiles of mammary tissue during early stage mastitis, we investigated in goats the in vivo transcriptional response of MEC to an experimental intra mammary infection (IMI) with Staphylococcus aureus, using a non-invasive RNA sampling method from milk fat globules (MFG). Microarrays were used to record gene expression patterns during the first 24 hours post-infection (hpi). This approach was combined with laser capture microdissection of MEC from frozen slides of mammary tissue to analyze some relevant genes at 30 hpi. During the early stages post-inoculation, MEC play an important role in the recruitment and activation of inflammatory cells through the IL-8 signalling pathway and initiate a sharp induction of innate immune genes predominantly associated with the pro-inflammatory response. At 30 hpi, MEC express genes encoding different acute phase proteins, including SAA3, SERPINA1 and PTX3 and factors, such as S100A12, that contribute directly to fighting the infection. No significant change in the expression of genes encoding caseins was observed until 24 hpi, thus validating our experimental model to study early stages of infection before the occurrence of tissue damage, since the milk synthesis function is still operative. This is to our knowledge the first report showing in vivo, in goats, how MEC orchestrate the innate immune response to an IMI challenge with S. aureus. Moreover, the non-invasive sampling method of mammary representative RNA from MFG provides a valuable tool to easily follow the dynamics of gene expression in MEC to search for sensitive biomarkers in milk for early detection of mastitis and therefore, to successfully improve the treatment and thus animal welfare. PMID:24521038

  11. Induction of immune response in macaque monkeys infected with simian-human immunodeficiency virus having the TNF-{alpha} gene at an early stage of infection

    SciTech Connect

    Shimizu, Yuya; Miyazaki, Yasuyuki; Ibuki, Kentaro; Suzuki, Hajime; Kaneyasu, Kentaro; Goto, Yoshitaka; Hayami, Masanori; Miura, Tomoyuki; Haga, Takeshi . E-mail: a0d518u@cc.miyazaki-u.ac.jp

    2005-12-20

    TNF-{alpha} has been implicated in the pathogenesis of, and the immune response against, HIV-1 infection. To clarify the roles of TNF-{alpha} against HIV-1-related virus infection in an SHIV-macaque model, we genetically engineered an SHIV to express the TNF-{alpha} gene (SHIV-TNF) and characterized the virus's properties in vivo. After the acute viremic stage, the plasma viral loads declined earlier in the SHIV-TNF-inoculated monkeys than in the parental SHIV (SHIV-NI)-inoculated monkeys. SHIV-TNF induced cell death in the lymph nodes without depletion of circulating CD4{sup +} T cells. SHIV-TNF provided some immunity in monkeys by increasing the production of the chemokine RANTES and by inducing an antigen-specific proliferation of lymphocytes. The monkeys immunized with SHIV-TNF were partly protected against a pathogenic SHIV (SHIV-C2/1) challenge. These findings suggest that TNF-{alpha} contributes to the induction of an effective immune response against HIV-1 rather than to the progression of disease at the early stage of infection.

  12. HIV Clade-C Infection and Cognitive Impairment, Fatigue, Depression, and Quality of Life in Early-Stage Infection in Northern Indians.

    PubMed

    Cook, R; Jones, D L; Nehra, R; Kumar, A M; Prabhakar, S; Waldrop-Valverde, D; Sharma, S; Kumar, M

    2016-07-01

    HIV disease progression is associated with declining quality of life and overall health status, although most research in this domain has been conducted among Western populations where B is the infecting clade. This study sought to determine the effects of early-stage clade-C HIV infection (CD4 count ≥400 cells/mm(3)) on neurocognitive functioning, cognitive depression, and fatigue by comparing a matched sample of HIV-positive and HIV-negative Northern Indians. This study also examined the impact of these factors on quality of life within the HIV-positive individuals. HIV-positive participants demonstrated reduced cognitive functioning, increased fatigue, and lower quality of life. Fatigue and cognitive impairment interacted to negatively impact quality of life. Results suggest that early-stage HIV clade-C-infected individuals may experience subclinical symptoms, and further research is needed to explore the benefit of therapeutic interventions to ensure optimal clinical outcomes and maintain quality of life in this vulnerable population. © The Author(s) 2013.

  13. Equine Cyathostominae can develop to infective third-stage larvae on straw bedding.

    PubMed

    Love, Sandy; Burden, Faith A; McGirr, Eoghan C; Gordon, Louise; Denwood, Matthew J

    2016-08-31

    Domesticated grazing animals including horses and donkeys are frequently housed using deep litter bedding systems, where it is commonly presumed that there is no risk of infection from the nematodes that are associated with grazing at pasture. We use two different approaches to test whether equids could become infected with cyathostomines from the ingestion of deep litter straw bedding. Two herbage plot studies were performed in horticultural incubators set up to simulate three straw bedding scenarios and one grass turf positive control. Faeces were placed on 16 plots, and larval recoveries performed on samples of straw/grass substrate over 2- to 3-week periods. Within each incubator, a thermostat was set to maintain an environmental temperature of approximately 10 °C to 20 °C. To provide further validation, 24 samples of straw bedding were collected over an 8-week period from six barns in which a large number of donkeys were housed in a deep litter straw bedding system. These samples were collected from the superficial bedding at 16 sites along a "W" route through each barn. No infective larvae were recovered from any of the plots containing dry straw. However, infective cyathostomine larvae were first detected on day 8 from plots containing moist straw. In the straw bedding study, cyathostomine larvae were detected in 18 of the 24 samples. Additionally, in the two barns which were sampled serially, the level of larval infectivity generally increased from week to week, except when the straw bedding was removed and replaced. We have demonstrated that equine cyathostomines can develop to infective larvae on moist straw bedding. It is therefore possible for a horse or donkey bedded in deep litter straw to become infected by ingesting the contaminated straw. This has implications for parasite control in stabled equids and potentially in housed ruminants, and further investigation is required in order to establish the relative infective pressure from pasture versus

  14. Placental immaturity, endocardial fibroelastosis and fetal hypoxia.

    PubMed

    Perez, Marie-Hélène; Boulos, Tatiana; Stucki, Pascal; Cotting, Jacques; Osterheld, Maria-Chiara; Di Bernardo, Stefano

    2009-01-01

    We describe a term newborn who, after a normal gestational course, presented at birth with absent cardiac activity and no spontaneous breathing. Death occurred within 30 h. Autopsy revealed placental villous immaturity, multiple acute hypoxic lesions, but also chronic hypoxic lesions like endocardial fibroelastosis. This striking association of endocardial fibroelastosis and placental villous immaturity is reviewed and correlated with 2 other cases of placental villous immaturity that led to in utero death at 39 and 41 weeks of gestation. Placental villous immaturity must be suspected and looked for by both pediatricians and obstetricians in every case of stillbirth or perinatal asphyxia of unclear origin. In order to minimize the risk of recurrence in further pregnancies, elective cesarean section may be considered.

  15. Enigmatic central canal contacting cells: immature neurons in "standby mode"?

    PubMed

    Marichal, Nicolás; García, Gabriela; Radmilovich, Milka; Trujillo-Cenóz, Omar; Russo, Raúl E

    2009-08-12

    The region that surrounds the central canal of the spinal cord derives from the neural tube and retains a substantial degree of plasticity. In turtles, this region is a neurogenic niche where newborn neurons coexist with precursors, a fact that may be related with the endogenous repair capabilities of low vertebrates. Immunohistochemical evidence suggests that the ependyma of the mammalian spinal cord may contain cells with similar properties, but their actual nature remains unsolved. Here, we combined immunohistochemistry for cell-specific markers with patch-clamp recordings to test the hypothesis that the ependyma of neonatal rats contains immature neurons similar to those in low vertebrates. We found that a subclass of cells expressed HuC/D neuronal proteins, doublecortin, and PSA-NCAM (polysialylated neural cell adhesion molecule) but did not express NeuN (anti-neuronal nuclei). These immature neurons displayed electrophysiological properties ranging from slow Ca(2+)-mediated responses to fast repetitive Na(+) spikes, suggesting different stages of maturation. These cells originated in the embryo, because we found colocalization of neuronal markers with 5-bromo-2'-deoxyuridine when injected during embryonic day 7-17 but not in postnatal day 0-5. Our findings represent the first evidence that the ependyma of the rat spinal cord contains cells with molecular and functional features similar to immature neurons in adult neurogenic niches. The fact that these cells retain the expression of molecules that participate in migration and neuronal differentiation raises the possibility that the ependyma of the rat spinal cord is a reservoir of immature neurons in "standby mode," which under some circumstances (e.g., injury) may complete their maturation to integrate spinal circuits.

  16. The Biting Midge Culicoides sonorensis (Diptera: Ceratopogonidae) Is Capable of Developing Late Stage Infections of Leishmania enriettii

    PubMed Central

    Seblova, Veronika; Sadlova, Jovana; Vojtkova, Barbora; Votypka, Jan; Carpenter, Simon; Bates, Paul Andrew; Volf, Petr

    2015-01-01

    Background Despite their importance in animal and human health, the epidemiology of species of the Leishmania enriettii complex remains poorly understood, including the identity of their biological vectors. Biting midges of the genus Forcipomyia (Lasiohelea) have been implicated in the transmission of a member of the L. enriettii complex in Australia, but the far larger and more widespread genus Culicoides has not been investigated for the potential to include vectors to date. Methodology/Principal Findings Females from colonies of the midges Culicoides nubeculosus Meigen and C. sonorensis Wirth & Jones and the sand fly Lutzomyia longipalpis Lutz & Nevia (Diptera: Psychodidae) were experimentally infected with two different species of Leishmania, originating from Australia (Leishmania sp. AM-2004) and Brazil (Leishmania enriettii). In addition, the infectivity of L. enriettii infections generated in guinea pigs and golden hamsters for Lu. longipalpis and C. sonorensis was tested by xenodiagnosis. Development of L. enriettii in Lu. longipalpis was relatively poor compared to other Leishmania species in this permissive vector. Culicoides nubeculosus was not susceptible to infection by parasites from the L. enriettii complex. In contrast, C. sonorensis developed late stage infections with colonization of the thoracic midgut and the stomodeal valve. In hamsters, experimental infection with L. enriettii led only to mild symptoms, while in guinea pigs L. enriettii grew aggressively, producing large, ulcerated, tumour-like lesions. A high proportion of C. sonorensis (up to 80%) feeding on the ears and nose of these guinea pigs became infected. Conclusions/Significance We demonstrate that L. enriettii can develop late stage infections in the biting midge Culicoides sonorensis. This midge was found to be susceptible to L. enriettii to a similar degree as Lutzomyia longipalpis, the vector of Leishmania infantum in South America. Our results support the hypothesis that some

  17. Morphology of immature stages of Dohrniphora cornuta (Bigot) (Diptera: Phoridae).

    PubMed

    Feng, Dian-Xing; Liu, Guang-Chun

    2012-11-01

    Morphology of all larval instars and puparium of Dohrniphora cornuta (Bigot), a most common phorid fly species indoors in China, is presented using scanning electron microscopy. The first instar larva was composed of 12 segments, each of segments 3-11 with six slender tubercles situated dorsally, dorsolaterally, and laterally in transverse row. These tubercles divided into two segments, of which the basal one was smooth, and the brush-shaped distal one was comprised of a cluster of fine spines. Antennae and maxillary palp complex were visible. Two slits could be seen at the posterior spiracle. Besides the presence of anterior spiracle, the tubercles of second instar became stouter than those of first instar and were covered by numerous long bristles from the base to top. The posterior spiracle contained four slits. Third larval instar was similar to second instar. The bubble membrane comprised of ≈120 globules with a pointed tip on their top presented at the segment 5 of third instar larvae. Puparia showed a retracted cephalic region and a pair of distinct pupal respiratory horns on the dorsum. The respiratory horns were long and bore numerous branches from base to apex. The apex of branch with two longitudinal slits was relatively broad and curled dorsally.

  18. The effects of benzimidazoles on the larval stage of Toxocara cati in experimentally infected chickens.

    PubMed

    Oryan, A; Sadjjani, S M; Azizi, S

    2009-04-01

    Toxocara cati (T. cati) and Toxocara canis (T. canis), roundworms of cats and dogs, are zoonotic parasites that cause visceral and ocular larval migrans in human beings. Humans and other paratenic hosts are infected by ingesting the infective Toxocara eggs from contaminated soil, unwashed hands, contaminated raw vegetables or ingestion of under-cooked organs and muscle tissues of infected paratenic hosts such as chickens, cattle and sheep. It has been shown that the seroprevalence of toxocariasis in the rural and urban children of southern Iran is high and more than 50% of cats of this area are also infected with T. cati. It is stated that consumption of raw chicken meat resulted in visceral toxocariasis. It is possible that poultry reared outdoors and feeding in open range system, gain Toxocara eggs from soil and or by eating infected earthworms as paratenic host. The aim of the present study was to investigate the effects of albendazole and febendazole in experimentally infected chickens with eggs of T. cati by histopathological and digestive methods. Pathologic lesions were observed only in the untreated group and larvae were detected in brain of 3 chickens of this group by squash method. No larva was observed at histopathological level in liver, lungs, brain, cardiac and skeletal muscles and other examined organs of either treated or untreated animals. No lesion was seen in other tissues of the infected untreated chickens. Treatment resulted in disappearance of the larvae and disappearance of the gross and histopathologic abnormalities from their organs. No detectable difference was observed in chemosusceptibility of the two drugs.

  19. Transcriptional changes of cytokines in rooster testis and epididymis during sexual maturation stages and Salmonella infection.

    PubMed

    Anastasiadou, M; Michailidis, G

    2016-08-01

    Infection of rooster testis and epididymis by pathogens can lead to impaired fertility, resulting in economic losses in the poultry industry. Antimicrobial protection of rooster reproductive organs is, therefore, an important aspect of reproductive physiology. Salmonellosis is one of the most important zoonotic diseases, caused by Salmonella bacteria including Salmonella Enteritidis (SE) and is usually the result of infection of the reproductive organs. Thus, knowledge of the endogenous innate immune mechanisms of the rooster testis and epididymis is an emerging aspect of reproductive physiology. Cytokines are key factors for stimulating the immune response and inflammation in chickens to Salmonella infection. In the present study the expression profile of 11 pro-inflammatory cytokine genes in the rooster testis and epididymis in vivo and transcriptional changes in these organs during sexual maturation and SE infection were investigated. Gene expression analysis data revealed that in both testis and epididymis nine cytokines namely the IL-1β, IL-6, IL-8, IL-10, IL-12, IL-15, IL-16, IL-17 and IL-18 genes were expressed, while no mRNA transcripts were detected in both organs for IL-2 and IL-4. Furthermore, the expression of various cytokine genes during sexual maturation appeared to be developmentally regulated, while SE infection resulted in a significant up-regulation of IL-1β, -6, -12 and -18 genes in the testis and an increase in the mRNA relative abundance of IL-1β, -6, -12, -16 and -18 in the epididymis of SE-infected sexually mature 28-week-old roosters. These results suggest a cytokine-mediated immune response mechanism against Salmonella infection in the rooster reproductive tract. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. An intraoperatively moulded PMMA prostheses like spacer for two-stage revision of infected total knee arthroplasty.

    PubMed

    Kohl, Sandro; Evangelopoulos, Dimitrios S; Kohlhof, Hendrik; Krueger, Andreas; Hartel, Maximilian; Roeder, Christoph; Eggli, Stefan

    2011-12-01

    We report a series of 16 consecutive total knee arthroplasty (TKA) revision procedures for deep infection, treated with a newly developed intraoperatively moulded PMMA cement-prostheses-like spacer (CPLS). The standard treatment consisted of a two-stage protocol with initial explantation of the infected components combined with radical debridement, followed by implantation of a temporary cement spacer and final reimplantation of a new TKA. A sterilizeable Teflon tapered aluminium mould was developed for production of a custom made CPLS during the intervention. Stable implantation of the CPLS was achieved with a second cementation, allowing for correct alignment and ligament balancing. The spacer remained 3.5 months on average until reimplantation of a TKA occurred. At time of reimplantation, patients had an average KSS score of 84.44 points with an average flexion capacity of 102°. There was no recurrent infection during the study period of minimum 2 years. With this new technique, a low friction articulation with good stability, high comfort and a better range of motion compared to handcrafted spacers was achieved. The use of this spacer is a time sparing, cheap and convenient option in 2-stage TKA revision.

  1. Efficacy of albendazole:β-cyclodextrin citrate in the parenteral stage of Trichinella spiralis infection.

    PubMed

    Codina, Ana V; García, Agustina; Leonardi, Darío; Vasconi, María D; Di Masso, Ricardo J; Lamas, María C; Hinrichsen, Lucila I

    2015-01-01

    Albendazole-β-cyclodextrin citrate (ABZ:C-β-CD) inclusion complex in vivo antiparasitic activity was evaluated in the parenteral phase of Trichinella spiralis infection in mice. An equimolar complex of ABZ:C-β-CD was prepared by spray-drying and tested in CBi-IGE male mice orally infected with L1 infective larvae. Infected animals were treated with 50 or 30mg/kg albendazole, (ABZ) equivalent amounts of the ABZ:C-β-CD complex and non treated (controls). Mice received a daily dose on days 28, 29 and 30 post-infection. A week later, larval burden and percentage of encysted dead larvae were assessed in the host by counting viable and non-viable larvae in the tongue. Complexation of ABZ with C-β-CD increased the drug dissolution efficiency nearly eightfold. At 37 days p-i, the reduction percentage in muscle larval load was 35% in mice treated with 50mg/kg/day ABZ and 68% in those given the complex. Treatment with the lower dose showed a similar decrease in parasite burden. Treated animals showed a high percentage of nonviable larvae, the proportion being significantly higher in mice receiving the complex than in control animals (72-88% vs. 11%, P=0.0032). These data indicate that ABZ:C-β-CD increases bioavailability and effectiveness of ABZ against encapsulated Trichinella larvae, thus allowing the use of small doses. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Serologic markers in early stages of African horse sickness virus infection.

    PubMed

    Martínez-Torrecuadrada, J L; Díaz-Laviada, M; Roy, P; Sánchez, C; Vela, C; Sánchez-Vizcaíno, J M; Casal, J I

    1997-02-01

    Fifteen horses were experimentally infected with African horse sickness virus (AHSV) serotype 4. To learn more about the time course of production and specificity of AHSV-specific antibodies, sera were analyzed by immunoblot analysis. Only animals that survived for more than 9 days were able to develop a humoral immune response detectable by immunoblotting. The earliest serological markers corresponded mainly to VP5, VP6, and NS2 and to a lesser extent to VP3, NS1, and NS3. Neutralizing antibodies to VP2 were not detected by immunoblotting, suggesting that they are mostly conformation dependent. VP7-specific antibodies were detected later in infection. These results make NS2 and VP6 the most attractive candidates for the rapid diagnosis of the infection.

  3. Serologic markers in early stages of African horse sickness virus infection.

    PubMed Central

    Martínez-Torrecuadrada, J L; Díaz-Laviada, M; Roy, P; Sánchez, C; Vela, C; Sánchez-Vizcaíno, J M; Casal, J I

    1997-01-01

    Fifteen horses were experimentally infected with African horse sickness virus (AHSV) serotype 4. To learn more about the time course of production and specificity of AHSV-specific antibodies, sera were analyzed by immunoblot analysis. Only animals that survived for more than 9 days were able to develop a humoral immune response detectable by immunoblotting. The earliest serological markers corresponded mainly to VP5, VP6, and NS2 and to a lesser extent to VP3, NS1, and NS3. Neutralizing antibodies to VP2 were not detected by immunoblotting, suggesting that they are mostly conformation dependent. VP7-specific antibodies were detected later in infection. These results make NS2 and VP6 the most attractive candidates for the rapid diagnosis of the infection. PMID:9003637

  4. Rate of detection of human herpesvirus-6 at different stages of HIV infection.

    PubMed

    Gautheret, A; Aubin, J T; Fauveau, V; Rozenbaum, W; Huraux, J M; Agut, H

    1995-09-01

    In a cross-sectional study, human herpesvirus-6 (HHV-6) infection was analysed by means of polymerase chain reaction in peripheral blood mononuclear cells (PBMCs) and saliva from 125 HIV-seropositive subjects and 29 HIV-seronegative controls. HHV-6 was detected in saliva significantly more frequently in HIV-seronegative subjects than in HIV-seropositive subjects (p = 0.023), with no significant difference between HIV-seropositive subgroups. The HIV proviral copy number in PBMCs differed significantly according to HIV subgroup, as expected, but did not differ according to either the presence of HHV-6 or the number of HHV-6 copies in PBMCs. All the HHV-6 identified were variant B except for one variant A strain detected in saliva from a healthy subject. These results do not support the hypothesis that there is synergistic activation of HHV-6 infection in the course of HIV infection.

  5. Multi-Agent Simulations of the Immune Response to Hiv during the Acute Stage of Infection

    NASA Astrophysics Data System (ADS)

    Walshe, R.; Ruskin, H. J.; Callaghan, A.

    Results of multi-agent based simulations of the immune response to HIV during the acute phase of infection are presented here. The model successfully recreates the viral dynamics associated with the acute phase of infection, i.e., a rapid rise in viral load followed by a sharp decline to what is often referred to as a "set point", a result of T-cell response and emergence of HIV neutralizing antibodies. The results indicate that sufficient T Killer cell response is the key factor in controlling viral growth during this phase with antibody levels of critical importance only in the absence of a sufficient T Killer response.

  6. Survival After HIV Infection Stage 3 (AIDS) Diagnosis, by Population Density Areas, United States, 2005-2010.

    PubMed

    Bosh, Karin A; Shi, Jing; Chen, Mi

    We examined the survival rates after diagnosis of HIV infection stage 3 (AIDS) in the United States by population density area of residence at diagnosis. We used data from the National HIV Surveillance System to calculate survival rates among people aged ≥13 with HIV infection stage 3 (AIDS) diagnosed from 2005 through 2010. We determined survival rates for more than 12, 24, and 36 months after diagnosis; overall and by demographic characteristics; and across 3 population density area categories (large metropolitan statistical areas [MSAs, ≥500 000 people], small-to-medium MSAs [50 000 to 499 999 people], and nonmetropolitan areas [<50 000 people]). The survival rates for more than 12, 24, and 36 months after diagnosis were highest among people residing in large MSAs (90.2%, 87.2%, and 84.9%, respectively) and lowest among people residing in nonmetropolitan areas (87.3%, 84.1%, and 81.4%, respectively). With a few exceptions, survival rates were lower in those residing in nonmetropolitan areas than those residing in large MSAs and small-to-medium MSAs across most subgroups by age at diagnosis, race/ethnicity, sex, transmission category, region of residence, and year of diagnosis. Between 2005 and 2010, significant year-to-year increases occurred in the proportion of people surviving more than 36 months after diagnosis across all 3 population density area categories (estimated annual percentage change: large MSAs [0.88; 95% confidence interval (CI), 0.56-1.20]; small-to-medium MSAs [0.94; 95% CI, 0.06-1.83]; and nonmetropolitan areas [1.26; 95% CI, 0.07-2.46]). Although survival rates for those with HIV infection stage 3 (AIDS) improved in all 3 population density area categories, efforts to remove barriers to care and promote treatment adherence in nonmetropolitan areas will be necessary to eliminate survival disparities.

  7. Humoral and Cellular Immunity to Plasmodium falciparum Merozoite Surface Protein 1 and Protection From Infection With Blood-Stage Parasites

    PubMed Central

    Moormann, Ann M.; Sumba, Peter Odada; Chelimo, Kiprotich; Fang, Hua; Tisch, Daniel J.; Dent, Arlene E.; John, Chandy C.; Long, Carole A.; Vulule, John; Kazura, James W.

    2013-01-01

    Background. Acquired immunity to malaria develops with increasing age and repeated infections. Understanding immune correlates of protection from malaria would facilitate vaccine development and identification of biomarkers that reflect changes in susceptibility resulting from ongoing malaria control efforts. Methods. The relationship between immunoglobulin G (IgG) antibody and both interferon γ (IFN-γ) and interleukin 10 (IL-10) responses to the 42-kD C-terminal fragment of Plasmodium falciparum merozoite surface protein 1 (MSP142) and the risk of (re)infection were examined following drug-mediated clearance of parasitemia in 94 adults and 95 children in an area of holoendemicity of western Kenya. Results. Positive IFN-γ enzyme-linked immunosorbent assay (ELISA) and enzyme-linked immunosorbent spot assay (ELISPOT) responses to MSP142 3D7 were associated with delayed time to (re)infection, whereas high-titer IgG antibodies to MSP142 3D7 or FVO alleles were not independently predictive of the risk of (re)infection. When IFN-γ and IL-10 responses were both present, the protective effect of IFN-γ was abrogated. A Cox proportional hazard model including IFN-γ, IL-10, MSP142 3D7 IgG antibody responses, hemoglobin S genotype, age, and infection status at baseline showed that the time to blood-stage infection correlated positively with IFN-γ responses and negatively with IL-10 responses, younger age, and asymptomatic parasitemia. Conclusions. Evaluating combined allele-specific cellular and humoral immunity elicited by malaria provides a more informative measure of protection relative to evaluation of either measure alone. PMID:23539744

  8. Humoral and cellular immunity to Plasmodium falciparum merozoite surface protein 1 and protection from infection with blood-stage parasites.

    PubMed

    Moormann, Ann M; Sumba, Peter Odada; Chelimo, Kiprotich; Fang, Hua; Tisch, Daniel J; Dent, Arlene E; John, Chandy C; Long, Carole A; Vulule, John; Kazura, James W

    2013-07-01

     Acquired immunity to malaria develops with increasing age and repeated infections. Understanding immune correlates of protection from malaria would facilitate vaccine development and identification of biomarkers that reflect changes in susceptibility resulting from ongoing malaria control efforts.  The relationship between immunoglobulin G (IgG) antibody and both interferon γ (IFN-γ) and interleukin 10 (IL-10) responses to the 42-kD C-terminal fragment of Plasmodium falciparum merozoite surface protein 1 (MSP142) and the risk of (re)infection were examined following drug-mediated clearance of parasitemia in 94 adults and 95 children in an area of holoendemicity of western Kenya.  Positive IFN-γ enzyme-linked immunosorbent assay (ELISA) and enzyme-linked immunosorbent spot assay (ELISPOT) responses to MSP142 3D7 were associated with delayed time to (re)infection, whereas high-titer IgG antibodies to MSP142 3D7 or FVO alleles were not independently predictive of the risk of (re)infection. When IFN-γ and IL-10 responses were both present, the protective effect of IFN-γ was abrogated. A Cox proportional hazard model including IFN-γ, IL-10, MSP142 3D7 IgG antibody responses, hemoglobin S genotype, age, and infection status at baseline showed that the time to blood-stage infection correlated positively with IFN-γ responses and negatively with IL-10 responses, younger age, and asymptomatic parasitemia.  Evaluating combined allele-specific cellular and humoral immunity elicited by malaria provides a more informative measure of protection relative to evaluation of either measure alone.

  9. Supplement of L-Arg improves protective immunity during early-stage Plasmodium yoelii 17XL infection.

    PubMed

    Zhu, X; Pan, Y; Li, Y; Cui, L; Cao, Y

    2012-01-01

    L-arginine (L-Arg), the precursor of nitric oxide (NO), plays multiple important roles in nutrient metabolism and immune regulation. L-Arg supplement serves as a potential adjunctive therapy for severe malaria, because it improves NO bioavailability and reverses endothelial dysfunction in severe malaria patients. In this study, we investigated the effect of dietary L-Arg supplement on host immune responses during subsequent malaria infection using the Plasmodium yoelii 17XL - BALB/c mouse model. We have shown that pretreatment of mice with L-Arg significantly decreased parasitemia and prolonged the survival time of mice after infection. L-Arg supplement led to significant increases in activated CD4(+)T-bet(+)IFN-γ(+) T cells and F4/80(+)CD36(+) macrophages during early-stage infection, which were accompanied by enhanced synthesis of IFN-γ, TNF-α and NO by spleen cells. Moreover, L-Arg-pretreated mice developed more splenic myeloid and plasmacytoid dendritic cells with up-regulated expression of MHC II, CD86 and TLR9. In comparison, L-Arg treatment did not change the number of regulatory T cells and the level of anti-inflammatory cytokine IL-10. Taken together, our results showed that L-Arg pretreatment could improve the protective immune response in experimental malaria infection in mice, which underlines potential importance of L-Arg supplement in malaria-endemic human populations.

  10. Detecting Presymptomatic Infection Is Necessary to Forecast Major Epidemics in the Earliest Stages of Infectious Disease Outbreaks

    PubMed Central

    Thompson, Robin N.; Gilligan, Christopher A.; Cunniffe, Nik J.

    2016-01-01

    We assess how presymptomatic infection affects predictability of infectious disease epidemics. We focus on whether or not a major outbreak (i.e. an epidemic that will go on to infect a large number of individuals) can be predicted reliably soon after initial cases of disease have appeared within a population. For emerging epidemics, significant time and effort is spent recording symptomatic cases. Scientific attention has often focused on improving statistical methodologies to estimate disease transmission parameters from these data. Here we show that, even if symptomatic cases are recorded perfectly, and disease spread parameters are estimated exactly, it is impossible to estimate the probability of a major outbreak without ambiguity. Our results therefore provide an upper bound on the accuracy of forecasts of major outbreaks that are constructed using data on symptomatic cases alone. Accurate prediction of whether or not an epidemic will occur requires records of symptomatic individuals to be supplemented with data concerning the true infection status of apparently uninfected individuals. To forecast likely future behavior in the earliest stages of an emerging outbreak, it is therefore vital to develop and deploy accurate diagnostic tests that can determine whether asymptomatic individuals are actually uninfected, or instead are infected but just do not yet show detectable symptoms. PMID:27046030

  11. Resolution of de novo HIV production and trafficking in immature dendritic cells.

    PubMed

    Turville, Stuart G; Aravantinou, Meropi; Stössel, Hella; Romani, Nikolaus; Robbiani, Melissa

    2008-01-01

    The challenge in observing de novo virus production in human immunodeficiency virus (HIV)-infected dendritic cells (DCs) is the lack of resolution between cytosolic immature and endocytic mature HIV gag protein. To track HIV production, we developed an infectious HIV construct bearing a diothiol-resistant tetracysteine motif (dTCM) at the C terminus of HIV p17 matrix within the HIV gag protein. Using this construct in combination with biarsenical dyes, we observed restricted staining of the dTCM to de novo-synthesized uncleaved gag in the DC cytosol. Co-staining with HIV gag antibodies, reactive to either p17 matrix or p24 capsid, preferentially stained mature virions and thus allowed us to track the virus at distinct stages of its life cycle within DCs and upon transfer to neighboring DCs or T cells. Thus, in staining HIV gag with biarsenical dye system in situ, we characterized a replication-competent virus capable of being tracked preferentially within infected leukocytes and observed in detail the dynamic nature of the HIV production and transfer in primary DCs.

  12. Metabolic profiles of soybean roots during early stages of Fusarium tucumaniae infection

    USDA-ARS?s Scientific Manuscript database

    Soybean germplasm exhibits various levels of resistance to Fusarium tucumaniae, the main causal agent of sudden death syndrome (SDS) of soybean in Argentina. In this study, two soybean genotypes, one susceptible (NA 4613) and one partially resistant (DM 4670) to SDS infection, were inoculated with F...

  13. Persistence of Zika Virus in Breast Milk after Infection in Late Stage of Pregnancy

    PubMed Central

    Sotelo, José R.; Sotelo, Andre B.; Sotelo, Fabio J.B.; Pinho, Joao R.R.; Oliveira, Rita de Cassia; Bezerra, Alanna M.P.S.; Deutsch, Alice D.; Villas-Boas, Lucy S.; Felix, Alvina C.; Romano, Camila M.; Machado, Clarisse M.; Mendes-Correa, Maria C.J.; Santana, Rubia A.F.; Menezes, Fernando G.; Mangueira, Cristovao L.P.

    2017-01-01

    We detected Zika virus in breast milk of a woman in Brazil infected with the virus during the 36th week of pregnancy. Virus was detected 33 days after onset of signs and symptoms and 9 days after delivery. No abnormalities were found during fetal assessment or after birth of the infant. PMID:28192072

  14. Persistence of Zika Virus in Breast Milk after Infection in Late Stage of Pregnancy.

    PubMed

    Sotelo, José R; Sotelo, Andre B; Sotelo, Fabio J B; Doi, André M; Pinho, Joao R R; Oliveira, Rita de Cassia; Bezerra, Alanna M P S; Deutsch, Alice D; Villas-Boas, Lucy S; Felix, Alvina C; Romano, Camila M; Machado, Clarisse M; Mendes-Correa, Maria C J; Santana, Rubia A F; Menezes, Fernando G; Mangueira, Cristovao L P

    2017-05-01

    We detected Zika virus in breast milk of a woman in Brazil infected with the virus during the 36th week of pregnancy. Virus was detected 33 days after onset of signs and symptoms and 9 days after delivery. No abnormalities were found during fetal assessment or after birth of the infant.

  15. Longevity of the immune response and memory to blood-stage malaria infection.

    PubMed

    Achtman, A H; Bull, P C; Stephens, R; Langhorne, J

    2005-01-01

    Immunity to malaria develops slowly with protection against the parasite lagging behind protection against disease symptoms. The data on the longevity of protective immune responses are sparse. However, studies of antibody responses associated with protection reveal that they consist of a short- and a long-lived component. Compared with the antibody levels observed in other infection and immunization systems, the levels of the short-lived antibody compartment drop below the detectable threshold with unusual rapidity. The prevalence of long-lived antibodies is comparable to that seen after bacterial and protozoan infections. There is even less available data concerning T cell longevity in malaria infection, but what there is seems to indicate that T cell memory is short in the absence of persistent antigen. In general, the degree and duration of parasite persistence represent a major factor determining how immune response longevity and protection correlate. The predilection for short-lived immune responses in malaria infection could be caused by a number of mechanisms resulting from the interplay of normal regulatory mechanisms of the immune system and immune evasion by the parasite. In conclusion, it appears that the parasite-host relationship has developed to favor some short-lived responses, which allow the host to survive while allowing the parasite to persist. Anti-malarial immune responses present a complex picture, and many aspects of regulation and longevity of the response require further research.

  16. Susceptibility of larvae of Galleria mellonella to infection by Aspergillus fumigatus is dependent upon stage of conidial germination.

    PubMed

    Renwick, Julie; Daly, Paul; Reeves, Emer P; Kavanagh, Kevin

    2006-06-01

    The ability of conidia of the human pathogenic fungus Aspergillus fumigatus to kill larvae of the insect Galleria mellonella was investigated. Conidia at different stages of the germination process displayed variations in their virulence as measured using the Galleria infection model. Non-germinating ('resting') conidia were avirulent except when an inoculation density of 1 x 10(7) conidia per insect was used. Conidia that had been induced to commence the germination process by pre-culturing in growth medium for 3 h were capable of killing larvae at densities of 1 x 10(6) and 1 x 10(7) per insect. An inoculation density of 1 x 10(5) conidia per insect remained avirulent. Conidia in the outgrowth phase of germination (characterised as the formation of a germ tube) were the most virulent and were capable of killing 100% of larvae after 5 or 24 h when 1 x 10(7) or 1 x 10(6) conidia, that had been allowed to germinate for 24 h, were used. Examination of the response of insect haemocytes to conidia at different stages of the germination process established that haemocytes could engulf non-germinating conidia and those in the early stages of the germination process but that conidia, which had reached the outgrowth stages of germination were not phagocytosed. The results presented here indicate that haemocytes of G. mellonella are capable of phagocytosing A. fumigatus conidia less than 3.0 microm in diameter but that conidia greater than this are too large to be engulfed. The virulence of A. fumigatus in G. mellonella larvae can be ascertained within 60-90 h if infection densities of 1 x 10(6) or 1 x 10(7) activated conidia (pre-incubated for 2-3 h) per insect are employed.

  17. Effect of ageing on neurocognitive function by stage of HIV infection: evidence from the Multicenter AIDS Cohort Study.

    PubMed

    Goodkin, Karl; Miller, Eric N; Cox, Christopher; Reynolds, Sandra; Becker, James T; Martin, Eileen; Selnes, Ola A; Ostrow, David G; Sacktor, Ned C

    2017-09-01

    The demographics of the HIV epidemic in the USA have shifted towards older age. We aimed to establish the relationship between the processes of ageing and HIV infection in neurocognitive impairment. With longitudinal data from the Multicenter AIDS Cohort Study, a long-term prospective cohort study of the natural and treated history of HIV infection among men who have sex with men in the USA, we examined the effect of ageing, HIV infection (by disease stage), and their interaction on five neurocognitive domains: information processing speed, executive function, episodic memory, working memory, and motor function. We controlled for duration of serostatus in a subanalysis, as well as comorbidities and other factors that affect cognition. Analyses were by linear mixed models for longitudinal data. 5086 participants (47 886 visits) were included in the analytic sample (2278 HIV-seropositive participants contributed 20 477 visits and 2808 HIV-seronegative control participants contributed 27 409 visits). In an a-priori multivariate analysis with control variables including comorbidities and time since seroconversion, significant, direct negative effects of ageing were noted on all neurocognitive domains (p<0·0001 for all). Similar effects were noted for late-stage HIV disease progression on information processing speed (p=0·002), executive function (p<0·0001), motor function (p<0·0001), and working memory (p=0·001). Deleterious interaction effects were also noted in the domains of episodic memory (p=0·03) and motor function (p=0·02). A greater than expected effect of ageing on episodic memory and motor function with advanced stages of HIV infection suggests that these two domains are most susceptible to the progression of neurocognitive impairment caused by ageing in individuals with HIV. This deficit pattern suggests differential damage to the hippocampus and basal ganglia (specifically nigrostriatal pathways). Older individuals with HIV infection should be

  18. The sensitivity of an immature vestibular system to altered gravity.

    PubMed

    Gabriel, Martin; Frippiat, Jean-Pol; Frey, Herbert; Horn, Eberhard R

    2012-07-01

    Stimulus deprivation or stimulus augmentation can induce long-lasting modifications to sensory and motor systems. If deprivation is effective only during a limited period of life this phase is called "critical period." A critical period was described for the development of the roll-induced vestibuloocular reflex (rVOR) of Xenopus laevis using spaceflights. Spaceflight durations and basic conditions of Xenopus' development did not make it possible to answer the question whether exposure of the immature vestibular organ to weightlessness affects rVOR development. The embryonic development of Pleurodeles waltl is slow enough to solve this problem because the rVOR cannot be induced before 15 dpf. Stage 20-21 embryos (4 dpf) were exposed to microgravity during a 10-day spaceflight, or to 3g hypergravity following the same time schedule. After termination of altered gravity, the rVOR was recorded twice in most animals. The main observations were as follows: (1) after the first rVOR appearance at stage 37 (16 dpf), both rVOR gain and amplitude increased steadily up to saturation levels of 0.22 and 20°, respectively. (2) Three days after termination of microgravity, flight and ground larvae showed no rVOR; 1 day later, the rVOR could be induced only in ground larvae. Differences disappeared after 3 weeks. (3) For 10 days after 3g exposure, rVOR development was similar to that of 1g-controls but 3 weeks later, 3g-larvae showed a larger rVOR than 1g-controls. These observations indicate that the immature vestibular system is transiently sensitive to microgravity exposure and that exposure of the immature vestibular system to hypergravity leads to a slowly growing vestibular sensitization.

  19. The Role of Nuclear Medicine in the Staging and Management of Human Immune Deficiency Virus Infection and Associated Diseases.

    PubMed

    Ankrah, Alfred O; Glaudemans, Andor W J M; Klein, Hans C; Dierckx, Rudi A J O; Sathekge, Mike

    2017-06-01

    Human immune deficiency virus (HIV) is a leading cause of death. It attacks the immune system, thereby rendering the infected host susceptible to many HIV-associated infections, malignancies and neurocognitive disorders. The altered immune system affects the way the human host responds to disease, resulting in atypical presentation of these disorders. This presents a diagnostic challenge and the clinician must use all diagnostic avenues available to diagnose and manage these conditions. The advent of highly active antiretroviral therapy (HAART) has markedly reduced the mortality associated with HIV infection but has also brought in its wake problems associated with adverse effects or drug interaction and may even modulate some of the HIV-associated disorders to the detriment of the infected human host. Nuclear medicine techniques allow non-invasive visualisation of tissues in the body. By using this principle, pathophysiology in the body can be targeted and the treatment of diseases can be monitored. Being a functional imaging modality, it is able to detect diseases at the molecular level, and thus it has increased our understanding of the immunological changes in the infected host at different stages of the HIV infection. It also detects pathological changes much earlier than conventional imaging based on anatomical changes. This is important in the immunocompromised host as in some of the associated disorders a delay in diagnosis may have dire consequences. Nuclear medicine has played a huge role in the management of many HIV-associated disorders in the past and continues to help in the diagnosis, prognosis, staging, monitoring and assessing the response to treatment of many HIV-associated disorders. As our understanding of the molecular basis of disease increases nuclear medicine is poised to play an even greater role. In this review we highlight the functional basis of the clinicopathological correlation of HIV from a metabolic view and discuss how the use of

  20. Galeazzi semitendinosus tenodesis for patellofemoral instability in skeletally immature patients.

    PubMed

    Grannatt, Kathryn; Heyworth, Benton E; Ogunwole, Olabode; Micheli, Lyle J; Kocher, Mininder S

    2012-09-01

    Numerous surgical treatments have been described to address subluxation or dislocation of the patella, but many are not suitable for the skeletally immature patient, as they risk injury to the proximal tibial physis or tibial tubercle apophysis. The Galeazzi semitendinosus tenodesis is a soft-tissue reconstruction technique designed to stabilize the patella without altering the femoral or the bony structures about the knee. We sought to determine if this semitendinosus tenodesis is a safe and effective treatment for patellofemoral instability in skeletally immature patients. We retrospectively analyzed the records of a population of skeletally immature patients who underwent semitendinosus tenodesis for patellofemoral instability at our institution from 1990 to 2006. Condition-specific outcome and function were prospectively collected, including the International Knee Documentation Committee (IKDC) score, Kujala Score, and Marx Activity Scale. Recurrent instability was defined as patient-reported postoperative subluxation, dislocation, or both. Twenty-eight patients (34 total knees) were included in the study. Average follow-up was 70 months (range, 27 to 217 mo). Patients reported recurrent instability in 28 of the 34 knees (82%). Overall, 41% of patients had IKDC scores <70. Twelve knees (35%) were symptomatic enough to undergo subsequent surgery, but had similar mean IKDC (63), Kujala (81), and Marx Activity Scores (7.5) at long-term follow-up to those (IKDC 64, Kujala 79, Marx 8.2) who did not undergo additional surgeries (P=0.73, 0.88, 0.76, respectively). Complications included 1 superficial wound infection and 1 mild wound dehiscence. Patellofemoral instability remains a challenging clinical problem, particularly in patients with open physes. The Galeazzi semitendinosus tenodesis is a safe procedure for patellofemoral instability in skeletally immature patients, but our long-term data suggest it may not be as successful as previously reported. Approximately

  1. Molecular basis of early stages of Clostridium difficile infection: germination and colonization.

    PubMed

    Sarker, Mahfuzur R; Paredes-Sabja, Daniel

    2012-08-01

    Clostridium difficile infections (CDIs) occur when antibiotic therapy disrupts the gastrointestinal flora, favoring infected C. difficile spores to germinate, outgrow, colonize and produce toxins. During CDI, C. difficile vegetative cells initiate the process of sporulation allowing a fraction of the spores to remain adhered to the intestinal surfaces. These spores, which are unaffected by antibiotic therapy commonly used for CDIs, then germinate, outgrow and recolonize the host's GI tract causing relapse of CDI. Consequently, the germination and colonization processes can be considered as the earliest and most essential steps for the development as well as relapse of CDI. The aim of this review is to provide an overview on the molecular basis involved in C. difficile spore germination and colonization.

  2. Iridovirus Bcl-2 protein inhibits apoptosis in the early stage of viral infection.

    PubMed

    Lin, Pei-Wen; Huang, Yi-Jen; John, Joseph Abraham Christopher; Chang, Ya-Nan; Yuan, Chung-Hsiang; Chen, Wen-Ya; Yeh, Chiao-Hwa; Shen, San-Tai; Lin, Fu-Pang; Tsui, Wen-Huei; Chang, Chi-Yao

    2008-01-01

    The grouper iridovirus (GIV) belongs to the family Iridoviridae, whose genome contains an antiapoptotic B-cell lymphoma (Bcl)-2-like gene. This study was carried-out to understand whether GIV blocks apoptosis in its host. UV-irradiated grouper kidney (GK) cells underwent apoptosis. However, a DNA fragmentation assay of UV-exposed GK cells after GIV infection revealed an inhibition of apoptosis. The UV- or heat-inactivated GIV failed to inhibit apoptosis, implying that a gene or protein of the viral particle might contribute to an apoptosis inhibitory function. The DNA ladder assay for GIV-infected GK cells after UV irradiation confirmed that apoptosis inhibition was an early process which occurred as early as 5 min post-infection. A GIV-Bcl sequence comparison showed distant sequence similarities to that of human and four viruses; however, all possessed the putative Bcl-2 homology (BH) domains of BH1, BH2, BH3, and BH4, as well as a transmembrane domain. Northern blot hybridization showed that GIV-Bcl transcription began at 2 h post-infection, and the mRNA level significantly increased in the presence of cycloheximide or aphidicolin, indicating that this GIV-Bcl is an immediate-early gene. This was consistent with the Western blot results, which also revealed that the virion carries the Bcl protein. We observed the localization of GIV-Bcl on the mitochondrial membrane and other defined intracellular areas. By immunostaining, it was proven that GIV-Bcl-expressing cells effectively inhibited apoptosis. Taken together, these results demonstrate that GIV inhibits the promotion of apoptosis by GK cells, which is mediated by the immediate early expressed viral Bcl gene.

  3. Electron Tomography of HIV-1 Infection in Gut-Associated Lymphoid Tissue

    PubMed Central

    Ladinsky, Mark S.; Kieffer, Collin; Olson, Gregory; Deruaz, Maud; Vrbanac, Vladimir; Tager, Andrew M.; Kwon, Douglas S.; Bjorkman, Pamela J.

    2014-01-01

    Critical aspects of HIV-1 infection occur in mucosal tissues, particularly in the gut, which contains large numbers of HIV-1 target cells that are depleted early in infection. We used electron tomography (ET) to image HIV-1 in gut-associated lymphoid tissue (GALT) of HIV-1–infected humanized mice, the first three-dimensional ultrastructural examination of HIV-1 infection in vivo. Human immune cells were successfully engrafted in the mice, and following infection with HIV-1, human T cells were reduced in GALT. Virions were found by ET at all stages of egress, including budding immature virions and free mature and immature viruses. Immuno-electron microscopy verified the virions were HIV-1 and showed CD4 sequestration in the endoplasmic reticulum of infected cells. Observation of HIV-1 in infected GALT tissue revealed that most HIV-1–infected cells, identified by immunolabeling and/or the presence of budding virions, were localized to intestinal crypts with pools of free virions concentrated in spaces between cells. Fewer infected cells were found in mucosal regions and the lamina propria. The preservation quality of reconstructed tissue volumes allowed details of budding virions, including structures interpreted as host-encoded scission machinery, to be resolved. Although HIV-1 virions released from infected cultured cells have been described as exclusively mature, we found pools of both immature and mature free virions within infected tissue. The pools could be classified as containing either mostly mature or mostly immature particles, and analyses of their proximities to the cell of origin supported a model of semi-synchronous waves of virion release. In addition to HIV-1 transmission by pools of free virus, we found evidence of transmission via virological synapses. Three-dimensional EM imaging of an active infection within tissue revealed important differences between cultured cell and tissue infection models and furthered the ultrastructural understanding

  4. Batrachochytrium dendrobatidis infection patterns among Panamanian amphibian species, habitats and elevations during epizootic and enzootic stages.

    PubMed

    Brem, Forrest M R; Lips, Karen R

    2008-09-24

    The pathogenic fungus Batrachochytrium dendrobatidis (Bd) has caused declines of many amphibian populations, yet the full course of the epizootic has rarely been observed in wild populations. We determined effects of elevation, habitat, and aquatic index (AI) on prevalence of infection among Panamanian amphibians sampled along 2 elevational transects. Amphibian populations on the Santa Fé transect (SFT) had declined in 2002, while those on the El Copé transect (ECT) were healthy until September 2004. In 2004 we sampled Bd along both transects, surveying the SFT 2 yr after decline, and surveying the ECT 4 mo prior to the arrival of Bd, during the epizootic, and 2 mo later. Overall prevalence of Bd along the ECT increased from 0.0 (95% CI 0.00-0.0003) to 0.51 (95% CI 0.48-0.55) over a 3 mo period, accompanied by significant decreases in amphibian abundance and species richness in all habitats. Prevalence of infection on the ECT was highest along riparian transects and at higher elevations, but not among levels of AI. Prevalence of infection on the SFT was highest in pool transects, and at higher elevations, but not among levels of AI. Riparian amphibian abundance and species richness also declined at SFT following detection of Bd in 2002. Variation among species, microenvironmental conditions, and the length of coexistence with Bd may contribute to observed differences in prevalence of Bd and in population response.

  5. Surface Proteome of “Mycobacterium avium subsp. hominissuis” during the Early Stages of Macrophage Infection

    PubMed Central

    McNamara, Michael; Tzeng, Shin-Cheng; Maier, Claudia; Zhang, Li

    2012-01-01

    “Mycobacterium avium subsp. hominissuis” is a robust and pervasive environmental bacterium that can cause opportunistic infections in humans. The bacterium overcomes the host immune response and is capable of surviving and replicating within host macrophages. Little is known about the bacterial mechanisms that facilitate these processes, but it can be expected that surface-exposed proteins play an important role. In this study, the selective biotinylation of surface-exposed proteins, streptavidin affinity purification, and shotgun mass spectrometry were used to characterize the surface-exposed proteome of M. avium subsp. hominissuis. This analysis detected more than 100 proteins exposed at the bacterial surface of M. avium subsp. hominissuis. Comparisons of surface-exposed proteins between conditions simulating early infection identified several groups of proteins whose presence on the bacterial surface was either constitutive or appeared to be unique to specific culture conditions. This proteomic profile facilitates an improved understanding of M. avium subsp. hominissuis and how it establishes infection. Additionally, surface-exposed proteins are excellent targets for the host adaptive immune system, and their identification can inform the development of novel treatments, diagnostic tools, and vaccines for mycobacterial disease. PMID:22392927

  6. Detoxification and function of immature tomato.

    PubMed

    Yamashoji, Shiro; Onoda, Eri

    2016-10-15

    α-Tomatine and chlorophyll (a and b) decreased, and β-carotene and lycopene increased with ripening of tomatoes. α-Tomatine was localised in peel of immature green tomatoes. The dose-response curve of α-tomatine determined by WST-1 (water soluble tetrazolium) assay was the same as that by LDH (lactate dehydrogenase) assay, suggesting that the cytotoxicity of α-tomatine depends on the destruction of plasma membrane. Immature green tomatoes had little cytotoxic effect after one month-incubation with 25% ethanol or 4.5% acetate at 7°C, and α-tomatine was decomposed by crude enzymes extracted from immature green tomatoes. Immature green tomatoes incubated with 4.5% acetic acid inhibited the accumulation of lipid in adipocytes. From the above facts the detoxification and the anti-obesity effect of immature green tomatoes are expected to be controlled by the removal of peel, the enzymatic decomposition or the incubation with 4.5% acetate or 25% ethanol. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Early stage of Epstein-Barr virus lytic infection leading to the "starry sky" pattern formation in endemic Burkitt lymphoma.

    PubMed

    Fujita, Shuichi; Buziba, Nathan; Kumatori, Atsushi; Senba, Masachika; Yamaguchi, Akira; Toriyama, Kan

    2004-05-01

    Burkitt lymphoma (BL) is histologically characterized by a "starry sky" appearance, representing scattered macrophages that have phagocytosed cell debris among proliferating lymphoma cells. As is well known, almost all the neoplastic cells of endemic BL are infected with Epstein-Barr virus (EBV). Previous studies have indicated that most of the EBV in B cells is latent, and few virus particles enter the lytic cycle. To examine the histologic relationship between EBV infection stages and the formation of the starry sky pattern in African endemic BL tissues. Tissue samples from 44 patients with African endemic BL were examined with immunohistochemistry and in situ hybridization. We used EBV-encoded small RNA (EBER) as a marker of latent infection, and BamHI H left frame 1 (BHLF1) and BamHI Z EBV replication activator (ZEBRA) as lytic cycle markers. In all cases, signals for EBER were found in most neoplastic lymphocytes, and in 73% of cases, signals for BHLF1 and/or ZEBRA were recognized in the lymphoma cells within and around the lacunae in starry sky figures. The mean number of lacunae per unit area in cases positive for lytic cycle markers was significantly higher than that in negative cases (P <.001). Our findings suggest that EBV-infected lymphoma cells in the lytic cycle, which eventually lapse into cell death, are phagocytosed prior to their rupture by macrophages that have migrated into the parenchyma. We emphasize that transition of EBV-infected lymphoma cells to the lytic cycle is one of the histomorphogenetic factors influencing the formation of starry sky pattern in endemic BL.

  8. Filaria-induced immune evasion: suppression by the infective stage of Brugia malayi at the earliest host-parasite interface.

    PubMed

    Semnani, Roshanak Tolouei; Law, Melissa; Kubofcik, Joseph; Nutman, Thomas B

    2004-05-15

    To assess the physiologic interactions between the infective stage of Brugia malayi--one of the extracellular parasites responsible for lymphatic filariasis in humans--and the APC with which they come in contact during their development and routes of travel, we have investigated the interaction between the infective stage (L3) of B. malayi and human Langerhans cells (LC) in the skin. Our data indicate that live L3 result in increased migration of LC from the epidermis without affecting the viability of these cells and up-regulation of the IL-18 cytokine involved in LC migration. Live L3 also result in down-regulation of MHC class I and II on the LC cell surface. Additionally, microarray data indicate that live L3 significantly down-regulated expression of IL-8 as well as of multiple genes involved in Ag presentation, reducing the capacity of LC to induce CD4(+) T cells in allogeneic MLR, and thus resulting in a decreased ability of LC to promote CD4(+) T cell proliferation and production of IFN-gamma and IL-10. These data suggest that L3 exert a down-regulatory response in epidermal LC that leads to a diminished capacity of these cells to activate CD4(+) T cells.

  9. Differential sensitivity of immature and mature ventral mesencephalic neurons to rotenone induced neurotoxicity in vitro.

    PubMed

    Satish Bollimpelli, V; Kondapi, Anand K

    2015-12-25

    Rotenone induced neuronal toxicity in ventral mesencephalic (VM) dopaminergic (DA) neurons in culture is widely accepted as an important model for the investigation of Parkinson's disease (PD). However, little is known about developmental stage dependent toxic effects of rotenone on VM neurons in vitro. The objective of present study is to investigate the effect of rotenone on developing VM neurons at immature versus mature stages. Primary VM neurons were cultured in the absence of glial cells. Exposure of VM neurons to rotenone for 2 days induced cell death in both immature and mature neurons in a concentration-dependent manner, but to a greater extent in mature neurons. While rotenone-treated mature VM neurons showed α-synuclein aggregation and sensitivity to DA neurons, immature VM neurons exhibited only DA neuronal sensitivity but not α-synuclein aggregation. In addition, on rotenone treatment, enhancement of caspase-3 activity and reactive oxygen species (ROS) production were higher in mature VM neurons than in immature neurons. These results suggest that even though both mature and immature VM neurons are sensitive to rotenone, their manifestations differ from each other, with only mature VM neurons exhibiting Parkinsonian conditions.

  10. Does Male Care, Provided to Immature Individuals, Influence Immature Fitness in Rhesus Macaques?

    PubMed Central

    Langos, Doreen; Kulik, Lars; Ruiz-Lambides, Angelina; Widdig, Anja

    2015-01-01

    Among many mammals, maternal care strongly impacts infant survival; however, less is known about whether adult males also affect infant fitness. Paternal care is expected when providing care enhances offspring survival and reproduction, which likewise increases fathers’ fitness. Males might also care for unrelated immature individuals to increase their mating probability with the immature individuals’ mothers. Studies in multimale primate groups showed that sires enhance food access for offspring and provide protection in conflicts. Furthermore, fathers’ presence during infancy has been suggested to accelerate offspring sexual maturation. However, no study has yet directly linked the degree of father-offspring bonds to offspring fitness in primates. We previously reported father-offspring affiliation in rhesus macaques, pronounced during early infancy and independent of mothers’ presence. The present study aims at investigating whether affiliation with fathers or other males affects proxies of immature fitness (body mass gain, body fat and testis size). First, we combined behavioral, genetic and morphometric data from 55 subjects of one group. Second, using demographic and genetic data, we investigated for 92 individuals of the population whether mother- and father-offspring co-residence during immaturity influenced offspring lifetime reproductive success (LRS). Our results show that focal rank and higher amounts of affiliation with high-ranking males during infancy tend to positively impact body mass gain of female, but not male focal animals. In contrast, body mass gain of male focal individuals, but not females’, appeared to be higher when affiliation of male immature individuals was evenly distributed across their adult male partners. Moreover, we found mothers’, but not fathers’, presence during immaturity to predict offspring LRS. Our results suggest that male-immature affiliation, but not father-offspring co-residence, potentially impacts

  11. Pollination triggers female gametophyte development in immature Nicotiana tabacum flowers

    PubMed Central

    Brito, Michael S.; Bertolino, Lígia T.; Cossalter, Viviane; Quiapim, Andréa C.; DePaoli, Henrique C.; Goldman, Gustavo H.; Teixeira, Simone P.; Goldman, Maria H. S.

    2015-01-01

    In Nicotiana tabacum, female gametophytes are not fully developed at anthesis, but flower buds pollinated 12 h before anthesis produce mature embryo sacs. We investigated several pollination-associated parameters in N. tabacum flower buds to determine the developmental timing of important events in preparation for successful fertilization. First, we performed hand pollinations in flowers from stages 4 to 11 to study at which developmental stage pollination would produce fruits. A Peroxtesmo test was performed to correlate peroxidase activity on the stigma surface, indicative of stigma receptivity, with fruit set. Pollen tube growth and female gametophyte development were microscopically analyzed in pistils of different developmental stages. Fruits were obtained only after pollinations of flower buds at late stage 7 and older; fruit weight and seed germination capacity increased as the developmental stage of the pollinated flower approached anthesis. Despite positive peroxidase activity and pollen tube growth, pistils at stages 5 and 6 were unable to produce fruits. At late stage 7, female gametophytes were undergoing first mitotic division. After 24 h, female gametophytes of unpollinated pistils were still in the end of the first division, whereas those of pollinated pistils showed egg cells. RT-qPCR assay showed that the expression of the NtEC1 gene, a marker of egg cell development, is considerably higher in pollinated late stage 7 ovaries compared with unpollinated ovaries. To test whether ethylene is the signal eliciting female gametophyte maturation, the expression of ACC synthase was examined in unpollinated and pollinated stage 6 and late stage 7 stigmas/styles. Pollination induced NtACS expression in stage 6 pistils, which are unable to produce fruits. Our results show that pollination is a stimulus capable of triggering female gametophyte development in immature tobacco flowers and suggests the existence of a yet undefined signal sensed by the pistil. PMID

  12. IFNAR1-Signalling Obstructs ICOS-mediated Humoral Immunity during Non-lethal Blood-Stage Plasmodium Infection

    PubMed Central

    Sebina, Ismail; James, Kylie R.; Soon, Megan S. F.; Best, Shannon E.; Montes de Oca, Marcela; Amante, Fiona H.; Thomas, Bryce S.; Beattie, Lynette; Souza-Fonseca-Guimaraes, Fernando; Smyth, Mark J.; Hertzog, Paul J.; Hill, Geoffrey R.; Engwerda, Christian R.

    2016-01-01

    Parasite-specific antibodies protect against blood-stage Plasmodium infection. However, in malaria-endemic regions, it takes many months for naturally-exposed individuals to develop robust humoral immunity. Explanations for this have focused on antigenic variation by Plasmodium, but have considered less whether host production of parasite-specific antibody is sub-optimal. In particular, it is unclear whether host immune factors might limit antibody responses. Here, we explored the effect of Type I Interferon signalling via IFNAR1 on CD4+ T-cell and B-cell responses in two non-lethal murine models of malaria, P. chabaudi chabaudi AS (PcAS) and P. yoelii 17XNL (Py17XNL) infection. Firstly, we demonstrated that CD4+ T-cells and ICOS-signalling were crucial for generating germinal centre (GC) B-cells, plasmablasts and parasite-specific antibodies, and likewise that T follicular helper (Tfh) cell responses relied on B cells. Next, we found that IFNAR1-signalling impeded the resolution of non-lethal blood-stage infection, which was associated with impaired production of parasite-specific IgM and several IgG sub-classes. Consistent with this, GC B-cell formation, Ig-class switching, plasmablast and Tfh differentiation were all impaired by IFNAR1-signalling. IFNAR1-signalling proceeded via conventional dendritic cells, and acted early by limiting activation, proliferation and ICOS expression by CD4+ T-cells, by restricting the localization of activated CD4+ T-cells adjacent to and within B-cell areas of the spleen, and by simultaneously suppressing Th1 and Tfh responses. Finally, IFNAR1-deficiency accelerated humoral immune responses and parasite control by boosting ICOS-signalling. Thus, we provide evidence of a host innate cytokine response that impedes the onset of humoral immunity during experimental malaria. PMID:27812214

  13. Resistance to antibody neutralization in HIV-2 infection occurs in late stage disease and is associated with X4 tropism.

    PubMed

    Marcelino, José M; Borrego, Pedro; Nilsson, Charlotta; Família, Carlos; Barroso, Helena; Maltez, Fernando; Doroana, Manuela; Antunes, Francisco; Quintas, Alexandre; Taveira, Nuno

    2012-11-28

    To characterize the nature and dynamics of the neutralizing antibody (NAb) response and escape in chronically HIV-2 infected patients. Twenty-eight chronically infected adults were studied over a period of 1-4 years. The neutralizing activity of plasma immunoglobulin G (IgG) antibodies against autologous and heterologous primary isolates was analyzed using a standard assay in TZM-bl cells. Coreceptor usage was determined in ghost cells. The sequence and predicted three-dimensional structure of the C2V3C3 Env region were determined for all isolates. Only 50% of the patients consistently produced IgG NAbs to autologous and contemporaneous virus isolates. In contrast, 96% of the patients produced IgG antibodies that neutralized at least two isolates of a panel of six heterologous R5 isolates. Breadth and potency of the neutralizing antibodies were positively associated with the number of CD4(+) T cells and with the titer and avidity of C2V3C3-specific binding IgG antibodies. X4 isolates were obtained only from late stage disease patients and were fully resistant to neutralization. The V3 loop of X4 viruses was longer, had a higher net charge, and differed markedly in secondary structure compared to R5 viruses. Most HIV-2 patients infected with R5 isolates produce C2V3C3-specific neutralizing antibodies whose potency and breadth decreases as the disease progresses. Resistance to antibody neutralization occurs in late stage disease and is usually associated with X4 viral tropism and major changes in V3 sequence and conformation. Our studies support a model of HIV-2 pathogenesis in which the neutralizing antibodies play a central role and have clear implications for the vaccine field.

  14. Molecular characterization of occult hepatitis B virus infection in patients with end-stage liver disease in Colombia.

    PubMed

    Rendon, Julio Cesar; Cortes-Mancera, Fabian; Restrepo-Gutierrez, Juan Carlos; Hoyos, Sergio; Navas, Maria-Cristina

    2017-01-01

    Hepatitis B virus (HBV) occult infection (OBI) is a risk factor to be taken into account in transfusion, hemodialysis and organ transplantation. The aim of this study was to identify and characterize at the molecular level OBI cases in patients with end-stage liver disease. Sixty-six liver samples were obtained from patients with diagnosis of end-stage liver disease submitted to liver transplantation in Medellin (North West, Colombia). Samples obtained from patients who were negative for the surface antigen of HBV (n = 50) were tested for viral DNA detection by nested PCR for ORFs S, C, and X and confirmed by Southern-Blot. OBI cases were analyzed by sequencing the viral genome to determine the genotype and mutations; additionally, viral genome integration events were examined by the Alu-PCR technique. In five cases out of 50 patients (10%) the criteria for OBI was confirmed. HBV genotype F (subgenotypes F1 and F3), genotype A and genotype D were characterized in liver samples. Three integration events in chromosomes 5q14.1, 16p13 and 20q12 affecting Receptor-type tyrosine-protein phosphatase T, Ras Protein Specific Guanine Nucleotide Releasing Factor 2, and the zinc finger 263 genes were identified in two OBI cases. Sequence analysis of the viral genome of the 5 OBI cases showed several punctual missense and nonsense mutations affecting ORFs S, P, Core and X. This is the first characterization of OBI in patients with end-stage liver disease in Colombia. The OBI cases were identified in patients with HCV infection or cryptogenic cirrhosis. The integration events (5q14.1, 16p13 and 20q12) described in this study have not been previously reported. Further studies are required to validate the role of mutations and integration events in OBI pathogenesis.

  15. Molecular characterization of occult hepatitis B virus infection in patients with end-stage liver disease in Colombia

    PubMed Central

    Rendon, Julio Cesar; Cortes-Mancera, Fabian; Restrepo-Gutierrez, Juan Carlos; Hoyos, Sergio

    2017-01-01

    Background Hepatitis B virus (HBV) occult infection (OBI) is a risk factor to be taken into account in transfusion, hemodialysis and organ transplantation. The aim of this study was to identify and characterize at the molecular level OBI cases in patients with end-stage liver disease. Methods Sixty-six liver samples were obtained from patients with diagnosis of end-stage liver disease submitted to liver transplantation in Medellin (North West, Colombia). Samples obtained from patients who were negative for the surface antigen of HBV (n = 50) were tested for viral DNA detection by nested PCR for ORFs S, C, and X and confirmed by Southern-Blot. OBI cases were analyzed by sequencing the viral genome to determine the genotype and mutations; additionally, viral genome integration events were examined by the Alu-PCR technique. Results In five cases out of 50 patients (10%) the criteria for OBI was confirmed. HBV genotype F (subgenotypes F1 and F3), genotype A and genotype D were characterized in liver samples. Three integration events in chromosomes 5q14.1, 16p13 and 20q12 affecting Receptor-type tyrosine-protein phosphatase T, Ras Protein Specific Guanine Nucleotide Releasing Factor 2, and the zinc finger 263 genes were identified in two OBI cases. Sequence analysis of the viral genome of the 5 OBI cases showed several punctual missense and nonsense mutations affecting ORFs S, P, Core and X. Conclusions This is the first characterization of OBI in patients with end-stage liver disease in Colombia. The OBI cases were identified in patients with HCV infection or cryptogenic cirrhosis. The integration events (5q14.1, 16p13 and 20q12) described in this study have not been previously reported. Further studies are required to validate the role of mutations and integration events in OBI pathogenesis. PMID:28686707

  16. Fighting while Parasitized: Can Nematode Infections Affect the Outcome of Staged Combat in Beetles?

    PubMed Central

    Vasquez, David; Willoughby, Anna; Davis, Andrew K.

    2015-01-01

    The effects of non-lethal parasites may be felt most strongly when hosts engage in intense, energy-demanding behaviors. One such behavior is fighting with conspecifics, which is common among territorial animals, including many beetle species. We examined the effects of parasites on the fighting ability of a saproxylic beetle, the horned passalus (Odontotaenius disjunctus, Family: Passalidae), which is host to a non-lethal nematode, Chondronema passali. We pitted pairs of randomly-chosen (but equally-weighted) beetles against each other in a small arena and determined the winner and aggression level of fights. Then we examined beetles for the presence, and severity of nematode infections. There was a non-significant tendency (p = 0.065) for the frequency of wins, losses and draws to differ between beetles with and without C. passali; non-parasitized individuals (n = 104) won 47% of their fights while those with the parasite (n = 88) won 34%, a 13% difference in wins. The number of nematodes in a beetle affected the outcome of fights between infected and uninfected individuals in an unexpected fashion: fighting ability was lowest in beetles with the lowest (p = 0.033), not highest (p = 0.266), nematode burdens. Within-fight aggression was highest when both beetles were uninfected and lowest when both were infected (p = 0.034). Collectively, these results suggest the nematode parasite, C. passali, is associated with a modest reduction in fighting ability in horned passalus beetles, consistent with the idea that parasitized beetles have lower energy available for fighting. This study adds to a small but growing body of evidence showing how parasites negatively influence fighting behavior in animals. PMID:25830367

  17. Ribavirin mitigates wart growth in rabbits at early stages of infection with cottontail rabbit papillomavirus.

    PubMed

    Ostrow, R S; Forslund, K M; McGlennen, R C; Shaw, D P; Schlievert, P M; Ussery, M A; Huggins, J W; Faras, A J

    1992-02-01

    The challenge to develop antiviral agents effective against DNA viruses such as human papillomavirus (HPV) has been dependent on finding an animal model which mimics the human forms of the disease. We have used an existing model system for the purpose of measuring the effect of antiviral drugs on the inhibition of growth of these lesions. This was based upon domestic rabbits which efficiently grow cutaneous papillomas (warts) when infected with cottontail rabbit papillomavirus (CRPV). One agent which had shown significant success in achieving these goals was ribavirin. Ribavirin was administered intradermally shortly prior to infection at multiple sites with CRPV. Following daily injections of this drug for eight weeks, we have shown a dose-dependent response which had markedly reduced the number of warts, the time of first appearance of warts and reduced the tumor mass as compared to placebo-treated control animals. At the highest dose of ribavirin tested, 30 mg/kg/day, compared to controls, the average reduction in the number of warts was 52%, the average time of first appearance of warts was 49% longer, and the average mass of the warts was reduced by 98%. No detectable antibodies to CRPV were observed in any of the animals. The only side effects which were observed was focal alopecia, and a decrease in body growth upon prolonged treatment, both of which were completely reversible. Pharmacokinetic studies established the metabolism of ribavirin over a 24-h period of time. Ribavirin administered beginning 12 or 30 days post-infection, while not reducing the number of warts, slightly retarded the growth of warts as determined by date of first appearance of warts and mass of warts.

  18. Experimental caprine neosporosis: the influence of gestational stage on the outcome of infection.

    PubMed

    Porto, Wagnner José Nascimento; Regidor-Cerrillo, Javier; Kim, Pomy de Cássia Peixoto; Benavides, Julio; Silva, Ana Clécia dos Santos; Horcajo, Pilar; Oliveira, Andrea Alice da Fonseca; Ferre, Ignacio; Mota, Rinaldo Aparecido; Ortega-Mora, Luis Miguel

    2016-02-11

    Here, we assessed outcome of experimental infection by Neospora caninum in goats intravenously inoculated with 10(6) tachyzoites of the Nc-Spain7 isolate at 40 (G1), 90 (G2) and 120 (G3) days of gestation. Infected goats had fever between 5 and 9 days post inoculation (dpi); all were seropositive at the time of abortion/birth. Foetal death occurred in G1 from 10 to 21 dpi (n = 7) and in G2 from 27 to 35 dpi (n = 4). Goats in G2 also had seropositive stillbirth (n = 1) and healthy kids (n = 2). G3 goats (n = 7) had 3 seropositive and 3 seronegative weak kids, and 2 seronegative healthy kids. Parasite DNA detection in placentomes was 100% in G2, 85.7% in G3 and in G1 was detected only in placentomes from the goats with foetal losses from 17 dpi (100%). Parasites were detected in foetal/kid brain (>85.7%) and liver (≥ 50%) of G2 and G3, and in G1 after 17 dpi (100%). The highest parasite loads were detected in the placentomes of G1 from 17 dpi and G2, and in foetal tissues of G1 from 17 dpi and G3. Multifocal necrotic lesions were observed in the placentas of the three groups, but they were larger and more frequent in G1 and G2. Similar lesions were observed in foetal tissues, but they were more frequent in G3. These findings suggest that, as observed in cattle and sheep, the clinical consequences of N. caninum in pregnant goats are dependent in part on the time of gestation when animals were infected.

  19. Immatures of the New World Treehopper Tribe Amastrini (Hemiptera: Membracidae: Smiliinae) with a key to genera

    USDA-ARS?s Scientific Manuscript database

    The immatures stages of 9 of the 11 genera (Amastris Stål, Bajulata Ball, Erosne Stål, Harmonides Kirkaldy, Idioderma Van Duzee, Lallemandia Funkhouser, Neotynelia Creão-Duarte & Sakakibara, Tynelia Stål, and Vanduzea Goding) of the tribe Amastrini are described for the first time long with brief di...

  20. Depressed Hypoxic and Hypercapnic Ventilatory Responses at Early Stage of Lethal Avian Influenza A Virus Infection in Mice

    PubMed Central

    Pollock, Zemmie; Harrod, Kevin S.; Xu, Fadi

    2016-01-01

    H5N1 virus infection results in ~60% mortality in patients primarily due to respiratory failure, but the underlying causes of mortality are unclear. The goal of this study is to reveal respiratory disorders occurring at the early stage of infection that may be responsible for subsequent respiratory failure and death. BALB/c mice were intranasally infected with one of two H5N1 virus strains: HK483 (lethal) or HK486 (non-lethal) virus. Pulmonary ventilation and the responses to hypoxia (HVR; 7% O2 for 3 min) and hypercapnia (HCVR; 7% CO2 for 5 min) were measured daily at 2 days prior and 1, 2, and 3 days postinfection (dpi) and compared to mortality typically by 8 dpi. At 1, 2, and 3 dpi, immunoreactivities (IR) of substance P (SP-IR) in the nodose ganglion or tyrosine hydroxylase (TH-IR) in the carotid body coupled with the nucleoprotein of influenza A (NP-IR) was examined in some mice, while arterial blood was collected in others. Our results showed that at 2 and 3 dpi: 1) both viral infections failed to alter body temperature and weight, V˙CO2, or induce viremia while producing similarly high lung viral titers; 2) HK483, but not HK486, virus induced tachypnea and depressed HVR and HCVR without changes in arterial blood pH and gases; and 3) only HK483 virus led to NP-IR in vagal SP-IR neurons, but not in the carotid body, and increased density of vagal SP-IR neurons. In addition, all HK483, rather than HK486, mice died at 6 to 8 dpi and the earlier death was correlated with more severe depression of HVR and HCVR. Our data suggest that tachypnea and depressed HVR/HCVR occur at the early stage of lethal H5N1 viral infection associated with viral replication and increased SP-IR density in vagal neurons, which may contribute to the respiratory failure and death. PMID:26808681

  1. In Vivo Analysis of the Viable Microbiota and Helicobacter pylori Transcriptome in Gastric Infection and Early Stages of Carcinogenesis.

    PubMed

    Thorell, Kaisa; Bengtsson-Palme, Johan; Liu, Oscar Hsin-Fu; Palacios Gonzales, Reyna Victoria; Nookaew, Intawat; Rabeneck, Linda; Paszat, Lawrence; Graham, David Y; Nielsen, Jens; Lundin, Samuel B; Sjöling, Åsa

    2017-10-01

    Emerging evidence shows that the human microbiota plays a larger role in disease progression and health than previously anticipated. Helicobacter pylori, the causative agent of gastric cancer and duodenal and gastric ulcers, was early associated with gastric disease, but it has also been proposed that the accompanying microbiota in Helicobacter pylori-infected individuals might affect disease progression and gastric cancer development. In this study, the composition of the transcriptionally active microbial community and H. pylori gene expression were determined using metatranscriptomic RNA sequencing of stomach biopsy specimens from individuals with different H. pylori infection statuses and premalignant tissue changes. The results show that H. pylori completely dominates the microbiota not only in infected individuals but also in most individuals classified as H. pylori uninfected using conventional methods. Furthermore, H. pylori abundance is positively correlated with the presence of Campylobacter, Deinococcus, and Sulfurospirillum Finally, we quantified the expression of a large number of Helicobacter pylori genes and found high expression of genes involved in pH regulation and nickel transport. Our study is the first to dissect the viable microbiota of the human stomach by metatranscriptomic analysis, and it shows that metatranscriptomic analysis of the gastric microbiota is feasible and can provide new insights into how bacteria respond in vivo to variations in the stomach microenvironment and at different stages of disease progression. Copyright © 2017 American Society for Microbiology.

  2. A lethal case of Plasmodium falciparum infection in a young patient with end-stage renal failure who underwent regular hemodialysis.

    PubMed

    Hartopo, Anggoro Budi; Wijisaksono, Doni Priambodo

    2010-01-01

    Acute renal failure associated with Plasmodium falciparum infection is already well recognized. Nevertheless, end-stage chronic renal failure and falciparum malaria comorbidity is a rare condition. We report a case of Plasmodium falciparum infection in a young male Javanese patient with end-stage chronic renal failure who underwent regular hemodialysis. This rare comorbidity led to rapid deterioration of consciousness and metabolic disturbances which had already existed in end-stage renal failure. Because of the immunosuppressive condition due to organ failure, the patient did not survive despite anti-malarial chemotherapy.

  3. Distribution and characteristics of bovine leukemia virus integration sites in the host genome at three different clinical stages of infection.

    PubMed

    Miyasaka, T; Oguma, K; Sentsui, H

    2015-01-01

    Bovine leukemia virus (BLV) is an oncogenic retrovirus closely related to human T-cell lymphotropic virus. BLV-infected cattle are categorized as asymptomatic carriers or as having persistent lymphocytosis or enzootic bovine leukemia, depending on the clinical stage. We investigated the BLV integration site distribution at three BLV clinical stages and examined genome sequence features around the integration sites. In all, 264 BLV integration sites, at various locations on each chromosome, were identified in 28 cattle by inverse PCR and BLAST searches. Approximately one-third of BLV proviruses were independently integrated within transcriptional units, and approximately 10 % were integrated near transcription start sites. Moreover, less than 7 % of BLV integration sites were located near CpG islands. BLV did not preferentially integrate into transcriptionally active regions during any of the clinical stages. At the nucleotide level, regions around BLV integration points were significantly A/T rich with weak sequence consensus. BLV preferentially integrated within long interspersed nuclear repeat elements. Although BLV integration sites may not be associated with disease progression, integration is selective at the nucleotide level.

  4. Pf155/RESA protein influences the dynamic microcirculatory behavior of ring-stage Plasmodium falciparum infected red blood cells

    NASA Astrophysics Data System (ADS)

    Diez-Silva, Monica; Park, Yongkeun; Huang, Sha; Bow, Hansen; Mercereau-Puijalon, Odile; Deplaine, Guillaume; Lavazec, Catherine; Perrot, Sylvie; Bonnefoy, Serge; Feld, Michael S.; Han, Jongyoon; Dao, Ming; Suresh, Subra

    2012-08-01

    Proteins exported by Plasmodium falciparum to the red blood cell (RBC) membrane modify the structural properties of the parasitized RBC (Pf-RBC). Although quasi-static single cell assays show reduced ring-stage Pf-RBCs deformability, the parameters influencing their microcirculatory behavior remain unexplored. Here, we study the dynamic properties of ring-stage Pf-RBCs and the role of the parasite protein Pf155/Ring-Infected Erythrocyte Surface Antigen (RESA). Diffraction phase microscopy revealed RESA-driven decreased Pf-RBCs membrane fluctuations. Microfluidic experiments showed a RESA-dependent reduction in the Pf-RBCs transit velocity, which was potentiated at febrile temperature. In a microspheres filtration system, incubation at febrile temperature impaired traversal of RESA-expressing Pf-RBCs. These results show that RESA influences ring-stage Pf-RBCs microcirculation, an effect that is fever-enhanced. This is the first identification of a parasite factor influencing the dynamic circulation of young asexual Pf-RBCs in physiologically relevant conditions, offering novel possibilities for interventions to reduce parasite survival and pathogenesis in its human host.

  5. Pf155/RESA protein influences the dynamic microcirculatory behavior of ring-stage Plasmodium falciparum infected red blood cells

    PubMed Central

    Diez-Silva, Monica; Park, YongKeun; Huang, Sha; Bow, Hansen; Mercereau-Puijalon, Odile; Deplaine, Guillaume; Lavazec, Catherine; Perrot, Sylvie; Bonnefoy, Serge; Feld, Michael S.; Han, Jongyoon; Dao, Ming; Suresh, Subra

    2012-01-01

    Proteins exported by Plasmodium falciparum to the red blood cell (RBC) membrane modify the structural properties of the parasitized RBC (Pf-RBC). Although quasi-static single cell assays show reduced ring-stage Pf-RBCs deformability, the parameters influencing their microcirculatory behavior remain unexplored. Here, we study the dynamic properties of ring-stage Pf-RBCs and the role of the parasite protein Pf155/Ring-Infected Erythrocyte Surface Antigen (RESA). Diffraction phase microscopy revealed RESA-driven decreased Pf-RBCs membrane fluctuations. Microfluidic experiments showed a RESA-dependent reduction in the Pf-RBCs transit velocity, which was potentiated at febrile temperature. In a microspheres filtration system, incubation at febrile temperature impaired traversal of RESA-expressing Pf-RBCs. These results show that RESA influences ring-stage Pf-RBCs microcirculation, an effect that is fever-enhanced. This is the first identification of a parasite factor influencing the dynamic circulation of young asexual Pf-RBCs in physiologically relevant conditions, offering novel possibilities for interventions to reduce parasite survival and pathogenesis in its human host. PMID:22937223

  6. Infections of Larval Stages of Dicrocoelium dendriticum and Brachylaima sp. in Brown Garden Snail, Helix aspersa, in Turkey.

    PubMed

    Köse, Mustafa; Eser, Mustafa; Kartal, Kürşat; Bozkurt, Mehmet Fatih

    2015-10-01

    The aim of this study was to determine the presence and prevalence of larval stages of Dicrocoelium dendriticum and Brachylaima sp. in the first intermediate host, a species of land snail, Helix aspersa, in Turkey. A total of 211 snails were collected in April-May 2014 from pastures in Mersin District. Larval stages of D. dendriticum were identified under a light microscope. Hepatopancreas from naturally infected H. aspersa snails were examined histologically. The prevalence of larval stages of D. dendriticum and Brachylaima sp. in H. aspersa snails was found to be 2.4% and 1.9%, respectively, in Mersin, Turkey. Cercariae were not matured in sporocysts at the beginning of April; however, it was observed that cercariae matured and started to leave sporocysts by early-May. Thus, it was concluded that H. aspersa acts as an intermediate host to D. dendriticumin and Brachylaima sp. in Mersin, Turkey. A digenean trematode Brachylaima sp. was seen for the first time in Turkey.

  7. Infections of Larval Stages of Dicrocoelium dendriticum and Brachylaima sp. in Brown Garden Snail, Helix aspersa, in Turkey

    PubMed Central

    Köse, Mustafa; Eser, Mustafa; Kartal, Kürşat; Bozkurt, Mehmet Fatih

    2015-01-01

    The aim of this study was to determine the presence and prevalence of larval stages of Dicrocoelium dendriticum and Brachylaima sp. in the first intermediate host, a species of land snail, Helix aspersa, in Turkey. A total of 211 snails were collected in April-May 2014 from pastures in Mersin District. Larval stages of D. dendriticum were identified under a light microscope. Hepatopancreas from naturally infected H. aspersa snails were examined histologically. The prevalence of larval stages of D. dendriticum and Brachylaima sp. in H. aspersa snails was found to be 2.4% and 1.9%, respectively, in Mersin, Turkey. Cercariae were not matured in sporocysts at the beginning of April; however, it was observed that cercariae matured and started to leave sporocysts by early-May. Thus, it was concluded that H. aspersa acts as an intermediate host to D. dendriticumin and Brachylaima sp. in Mersin, Turkey. A digenean trematode Brachylaima sp. was seen for the first time in Turkey. PMID:26537045

  8. Cryopreservation of immature embryos of Theobroma cacao.

    PubMed

    Pence, V C

    1991-06-01

    Immature, white zygotic embryos of Theobroma cacao L. (cacao) retained the ability to produce callus and to undergo somatic embryogenesis after slow hydrated freezing and desiccated fast freezing in liquid nitrogen. The highest rate of somatic embryogenesis occurred in embryos which were precultured on a medium containing 3% sucrose, frozen slowly with cryoprotectants before exposure to liquid nitrogen, and recovered on a medium containing 3 mg/liter NAA. Embryos precultured on media containing sucrose increasing to 21% had a higher rate of survival but were less embryogenic after freezing. These results suggest that immature embryos might be used for long-term germplasm storage of T. cacao germplasm.

  9. Experimental infections of rabbits with proliferative and latent stages of Besnoitia besnoiti.

    PubMed

    Liénard, Emmanuel; Pop, Loredana; Prevot, Françoise; Grisez, Christelle; Mallet, Virginie; Raymond-Letron, Isabelle; Bouhsira, Émilie; Franc, Michel; Jacquiet, Philippe

    2015-10-01

    Cattle besnoitiosis due to Besnoitia besnoiti is spreading across Europe and is responsible for severe economic losses in newly infected herds. Experimentally speaking, rabbits have been found to be susceptible to this parasite. The adaptation of B. besnoiti to rabbits may offer a new, easier and cheaper model of investigation for this disease. This study compared the virulence between tachyzoites and bradyzoites of B. besnoiti in rabbits. Eighteen New Zealand rabbits were allocated into three groups of six animals each. The rabbits from the control (group C), "tachyzoite" (group T) and "bradyzoite" (group B) groups were subcutaneously injected in the right flank with 66 μg of ovalbumin, 6.10(6) tachyzoites (125th passage on Vero cells) and 6.10(6) bradyzoites (collected from a natural infected cow) of B. besnoiti, respectively. Clinical follow-up and blood sampling for serological survey and qPCR were performed during 10 weeks until euthanasia. Molecular and immunohistochemistry examination was achieved on 25 samples of tissue per rabbit. Seroconversion occurred in group T without any clinical signs. Rabbits of group B exhibited a febrile condition (temperature above 40 °C from day 8 to day 11 following injection) with positive qPCR in blood. Cysts of B. besnoiti were found on skin samples and organs of rabbits from group B in tissue explored with threshold cycle (Ct) values below 30. These results suggest a higher virulence of bradyzoites in rabbits than Vero cell-cultivated tachyzoites. The proposed model could be used to assess the in vivo effectiveness of vaccine or drugs against cattle besnoitiosis.

  10. Signaling Strategies of Malaria Parasite for Its Survival, Proliferation, and Infection during Erythrocytic Stage

    PubMed Central

    Soni, Rani; Sharma, Drista; Rai, Praveen; Sharma, Bhaskar; Bhatt, Tarun K.

    2017-01-01

    Irrespective of various efforts, malaria persist the most debilitating effect in terms of morbidity and mortality. Moreover, the existing drugs are also vulnerable to the emergence of drug resistance. To explore the potential targets for designing the most effective antimalarial therapies, it is required to focus on the facts of biochemical mechanism underlying the process of parasite survival and disease pathogenesis. This review is intended to bring out the existing knowledge about the functions and components of the major signaling pathways such as kinase signaling, calcium signaling, and cyclic nucleotide-based signaling, serving the various aspects of the parasitic asexual stage and highlighted the Toll-like receptors, glycosylphosphatidylinositol-mediated signaling, and molecular events in cytoadhesion, which elicit the host immune response. This discussion will facilitate a look over essential components for parasite survival and disease progression to be implemented in discovery of novel antimalarial drugs and vaccines. PMID:28400771

  11. Signaling Strategies of Malaria Parasite for Its Survival, Proliferation, and Infection during Erythrocytic Stage.

    PubMed

    Soni, Rani; Sharma, Drista; Rai, Praveen; Sharma, Bhaskar; Bhatt, Tarun K

    2017-01-01

    Irrespective of various efforts, malaria persist the most debilitating effect in terms of morbidity and mortality. Moreover, the existing drugs are also vulnerable to the emergence of drug resistance. To explore the potential targets for designing the most effective antimalarial therapies, it is required to focus on the facts of biochemical mechanism underlying the process of parasite survival and disease pathogenesis. This review is intended to bring out the existing knowledge about the functions and components of the major signaling pathways such as kinase signaling, calcium signaling, and cyclic nucleotide-based signaling, serving the various aspects of the parasitic asexual stage and highlighted the Toll-like receptors, glycosylphosphatidylinositol-mediated signaling, and molecular events in cytoadhesion, which elicit the host immune response. This discussion will facilitate a look over essential components for parasite survival and disease progression to be implemented in discovery of novel antimalarial drugs and vaccines.

  12. Analysis of the Transcriptome of the Infective Stage of the Beet Cyst Nematode, H. schachtii

    PubMed Central

    Fosu-Nyarko, John; Nicol, Paul; Naz, Fareeha; Gill, Reetinder; Jones, Michael G. K.

    2016-01-01

    The beet cyst nematode, Heterodera schachtii, is a major root pest that significantly impacts the yield of sugar beet, brassicas and related species. There has been limited molecular characterisation of this important plant pathogen: to identify target genes for its control the transcriptome of the pre-parasitic J2 stage of H. schachtii was sequenced using Roche GS FLX. Ninety seven percent of reads (i.e., 387,668) with an average PHRED score > 22 were assembled with CAP3 and CLC Genomics Workbench into 37,345 and 47,263 contigs, respectively. The transcripts were annotated by comparing with gene and genomic sequences of other nematodes and annotated proteins on public databases. The annotated transcripts were much more similar to sequences of Heterodera glycines than to those of Globodera pallida and root knot nematodes (Meloidogyne spp.). Analysis of these transcripts showed that a subset of 2,918 transcripts was common to free-living and plant parasitic nematodes suggesting that this subset is involved in general nematode metabolism and development. A set of 148 contigs and 183 singletons encoding putative homologues of effectors previously characterised for plant parasitic nematodes were also identified: these are known to be important for parasitism of host plants during migration through tissues or feeding from cells or are thought to be involved in evasion or modulation of host defences. In addition, the presence of sequences from a nematode virus is suggested. The sequencing and annotation of this transcriptome significantly adds to the genetic data available for H. schachtii, and identifies genes primed to undertake required roles in the critical pre-parasitic and early post-parasitic J2 stages. These data provide new information for identifying potential gene targets for future protection of susceptible crops against H. schachtii. PMID:26824923

  13. Immature mosquitoes (Diptera: Culicidae) in a eutrophic landfill tank from State of Rio de Janeiro, Brazil.

    PubMed

    Alencar, Jeronimo; Morone, Fernanda; Mello, Cecília Ferreira de; Gil-Santana, Hélcio Reinaldo; Guimarães, Anthony Érico

    2013-01-01

    To determine the faunal composition of immature culicids inhabiting a percolation tank in the landfill of Sapucaia, State of Rio de Janeiro, Brazil, immature mosquitoes were collected over a two-day period during the third weeks of April, August and October 2011. The species found were Culex usquatus, Lutzia bigoti, Anopheles argyritarsis and Limatus durhamii. This study is the first to report the colonization of eutrophic breeding sites by these species. The oviposition behavior observed in this study suggests a secondary adaptation or change in habit to select eutrophic environments during the developmental stages of the observed species.

  14. Pregnancy and fertilization potential of immature oocytes retrieved in intracytoplasmic sperm injection cycles

    PubMed Central

    Ko, Duck Sung; Lee, Sun-Hee; Park, Dong-Wook; Yang, Kwang Moon

    2015-01-01

    Objective The goal of this study was to evaluate the pregnancy potential of immature (metaphase I or germinal vesicle stage) oocytes retrieved in intracytoplasmic sperm injection (ICSI) cycles. Methods A total of 1,871 couples with infertility underwent 2,984 ICSI cycles. Cycles in which three or fewer oocytes were retrieved were included in this study in order to evaluate the pregnancy potential of immature oocytes. Cycles were divided into five groups (group I-V), according to the maturation status of the oocytes at the time of cumulus cell removal and ICSI. The fertilization and pregnancy rates after ICSI were analyzed and compared among the study groups based on the maturation status of the retrieved oocytes. Results The retrieval of only immature oocytes was associated with a significant decrease in the fertilization rate (76.1%±37.3% vs. 49.0%±49.1%, 66.7%±48.7%; group I vs. group II, group III, respectively) and the average number of transferred embryos (1.5±0.7 vs. 1.1±0.4, 1.1±0.6). The cycle cancellation rate was significantly higher when only immature oocytes were retrieved. The clinical pregnancy rate decreased significantly when the transferred embryos had originated from immature oocytes (16.9% vs. 10.3%, 1.2%). Conclusion In ICSI cycles, the fertilization potential and pregnancy potential of the immature oocytes retrieved in ICSI cycles were inferior to those of mature oocytes. Therefore, increasing the number of injectable oocytes and transferrable embryos by using immature oocytes after their spontaneous in vitro maturation does not necessarily improve pregnancy outcomes. PMID:26473112

  15. Pregnancy and fertilization potential of immature oocytes retrieved in intracytoplasmic sperm injection cycles.

    PubMed

    Ko, Duck Sung; Lee, Sun-Hee; Park, Dong-Wook; Yang, Kwang Moon; Lim, Chun Kyu

    2015-09-01

    The goal of this study was to evaluate the pregnancy potential of immature (metaphase I or germinal vesicle stage) oocytes retrieved in intracytoplasmic sperm injection (ICSI) cycles. A total of 1,871 couples with infertility underwent 2,984 ICSI cycles. Cycles in which three or fewer oocytes were retrieved were included in this study in order to evaluate the pregnancy potential of immature oocytes. Cycles were divided into five groups (group I-V), according to the maturation status of the oocytes at the time of cumulus cell removal and ICSI. The fertilization and pregnancy rates after ICSI were analyzed and compared among the study groups based on the maturation status of the retrieved oocytes. The retrieval of only immature oocytes was associated with a significant decrease in the fertilization rate (76.1%±37.3% vs. 49.0%±49.1%, 66.7%±48.7%; group I vs. group II, group III, respectively) and the average number of transferred embryos (1.5±0.7 vs. 1.1±0.4, 1.1±0.6). The cycle cancellation rate was significantly higher when only immature oocytes were retrieved. The clinical pregnancy rate decreased significantly when the transferred embryos had originated from immature oocytes (16.9% vs. 10.3%, 1.2%). In ICSI cycles, the fertilization potential and pregnancy potential of the immature oocytes retrieved in ICSI cycles were inferior to those of mature oocytes. Therefore, increasing the number of injectable oocytes and transferrable embryos by using immature oocytes after their spontaneous in vitro maturation does not necessarily improve pregnancy outcomes.

  16. Sensitivity of two in vitro assays for evaluating plant activity against the infective stage of Haemonchus contortus strains.

    PubMed

    Al-Rofaai, A; Rahman, W A; Abdulghani, Mahfoudh

    2013-02-01

    The sensitivity of larval paralysis assay (LPA) and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide-formazan (MTT-formazan) assay was compared to evaluate the anthelmintic activity of plant extracts. In this study, the methanolic extract of Azadirachta indica (neem) was evaluated for its activity against the infective-stage larvae (L(3)) of susceptible and resistant Haemonchus contortus strains using the two aforementioned assays. In both in vitro assays, the same serial concentrations of the extract were used, and the median lethal concentrations were determined to compare the sensitivity of both assays. The results revealed a significant difference (P < 0.05) in the sensitivity of the LPA and the MTT-formazan assay. The MTT-formazan assay is more feasible for practical applications because it measured the L(3) mortality more accurately than LPA. This study may help find a suitable assay for investigating the anthelmintic activity of plant extracts against trichostrongylid nematodes.

  17. Simultaneous versus sequential one-stage combined anterior and posterior spinal surgery for spinal infections (outcomes and complications)

    PubMed Central

    Ozturk, Cagatay; Vural, Recep; Sehirlioglu, Ali; Mutlu, Muren

    2006-01-01

    To compare simultaneous with sequential one-stage (same anaesthesia) combined anterior and posterior spinal surgery in the treatment of spinal infections in terms of the operation time, blood loss and complication rate. Fifty-six patients who underwent one-stage (same anaesthesia) simultaneous or sequential anterior decompression and posterior stabilisation of the involved vertebrae for spinal infection from January 1994 to December 2002 were reviewed. In group I (n=29), sequential anterior and posterior surgery was performed. In group II (n=27), simultaneous anterior and posterior spinal surgery was performed. With regard to age and gender, there was no statistical difference between both groups (P=0.05). The analysed and compared data between the two groups included the age, gender, blood loss, operation time and postoperative complications. There was a statistically significant difference between the two groups in terms of the duration of surgery, amount of blood transfusion needed and occurrence of major postoperative complications (P<0.05). The mean correction of the kyphotic deformity was similar in both groups (P>0.05) without a subsequent loss of correction on follow-up radiographic films at a mean follow-up of 6.5 years (range, 3 to 11 years). Simultaneous anterior and posterior surgery is a good alternative procedure. It provides the ability to manipulate both anterior and posterior aspects of the spine at the same time and appears to result in less blood loss, a shorter operative time and fewer complications. However, gaining experience and the availability of two surgical teams are important factors in the success of the procedure. PMID:16736143

  18. A paradigm shift in endodontic management of immature teeth: conservation of stem cells for regeneration.

    PubMed

    Huang, George T-J

    2008-06-01

    This article will review the new concept of regenerative endodontics in the management of immature permanent teeth. The potential role of stem cells to regenerate immature permanent teeth after conservative treatment will be discussed. Two sets of data source are focused in this review: (i) the characterization of various dental stem cells discovered since 2000 and (ii) recent clinical case reports showing that after conservative treatment, severely infected immature teeth with periradicular periodontitis and abscess can undergo healing and apexogenesis or maturogenesis. A new protocol of treating endodontically involved immature permanent teeth based on published articles to date is summarized in the review. The key procedures of the protocol are (1) minimal or no instrumentation of the canal while relying on a gentle but thorough irrigation of the canal system, (2) the disinfection is augmented with intra-canal medication of a triple-antibiotic paste between appointments, and (3) the treated tooth is sealed with mineral trioxide aggregate (MTA) and glass ionomer/resin cement at the completion of the treatment. Periodical follow-ups will take place to observe any continued maturation of the root. While more clinical research is needed, regenerative endodontics promotes a paradigm shift in treating endodontically involved immature permanent teeth from performing apexification procedures to conserving any dental stem cells that might remain in the disinfected viable tissues to allow tissue regeneration and repair to achieve apexogenesis/maturogenesis.

  19. Association of caveolin with Chlamydia trachomatis inclusions at early and late stages of infection.

    PubMed

    Norkin, L C; Wolfrom, S A; Stuart, E S

    2001-06-10

    The mechanism by which the intracellular bacterial pathogen Chlamydia trachomatis enters eukaryotic cells is poorly understood. There are conflicting reports of entry occurring by clathrin-dependent and clathrin-independent processes. We report here that C. trachomatis serovar K enters HEp-2 and HeLa 229 epithelial cells and J-774A.1 mouse macrophage/monocyte cells via caveolin-containing sphingolipid and cholesterol-enriched raft microdomains in the host cell plasma membranes. First, filipin and nystatin, drugs that specifically disrupt raft function by cholesterol chelation, each impaired entry of C. trachomatis serovar K. In control experiments, filipin did not impair entry of the same organism by an antibody-mediated opsonic process, nor did it impair entry of BSA-coated microspheres. Second, the chlamydia-containing endocytic vesicles specifically reacted with antisera against the caveolae marker protein caveolin. These vesicles are known to become the inclusions in which parasite replication occurs. They avoid fusion with lysosomes and instead traffic to the Golgi region, where they intercept Golgi-derived vesicles that recycle sphingolipids and cholesterol to the plasma membrane. We also report that late-stage C. trachomatis inclusions continue to display high levels of caveolin, which they likely acquire from the exocytic Golgi vesicles. We suggest that the atypical raft-mediated entry process may have important consequences for the host-pathogen interaction well after entry has occurred. These consequences include enabling the chlamydial vesicle to avoid acidification and fusion with lysosomes, to traffic to the Golgi region, and to intercept sphingolipid-containing vesicles from the Golgi. Copyright 2001 Academic Press.

  20. Lack of flagella disadvantages Salmonella enterica serovar Enteritidis during the early stages of infection in the rat.

    PubMed

    Robertson, Jeanette M C; McKenzie, Norma H; Duncan, Michelle; Allen-Vercoe, Emma; Woodward, Martin J; Flint, Harry J; Grant, George

    2003-01-01

    The roles of flagella and five fimbriae (SEF14, SEF17, SEF21, pef, lpf) in the early stages (up to 3 days) of Salmonella enterica serovar Enteritidis (S. Enteritidis) infection have been investigated in the rat. Wild-type strains LA5 and S1400 (fim+/fla+) and insertionally inactivated mutants unable to express the five fimbriae (fim-/fla+), flagella (fim+/fla-) or fimbriae and flagella (fim-/fla-) were used. All wild-type and mutant strains were able to colonize the gut and spread to the mesenteric lymph nodes, liver and spleen. There appeared to be little or no difference between the fim-/fla+ and wild-type (fim+/fla+) strains. In contrast, the numbers of aflagellate (fim+/fla- or fim-/fla-) salmonella in the liver and spleen were transiently reduced. In addition, fim+/fla- or fim-/fla- strains were less able to persist in the upper gastrointestinal tract and the inflammatory responses they elicited in the gut were less severe. Thus, expression of SEF14, SEF17, SEF21, pef and lpf did not appear to be a prerequisite for induction of S. Enteritidis infection in the rat. Deletion of flagella did, however, disadvantage the bacterium. This may be due to the inability to produce or release the potent immunomodulating protein flagellin.

  1. Host PI(3,5)P2 activity is required for Plasmodium berghei growth during liver stage infection

    PubMed Central

    Thieleke-Matos, Carolina; da Silva, Mafalda Lopes; Cabrita-Santos, Laura; Pires, Cristiana F.; Ramalho, José S.; Ikonomov, Ognian; Seixas, Elsa; Shisheva, Assia; Seabra, Miguel C.; Barral, Duarte C.

    2014-01-01

    Malaria parasites go through an obligatory liver stage before they infect erythrocytes and cause disease symptoms. In the host hepatocytes, the parasite is enclosed by a parasitophorous vacuole membrane (PVM). Here, we dissected the interaction between the Plasmodium parasite and the host cell late endocytic pathway and show that parasite growth is dependent on the phosphoinositide 5-kinase (PIKfyve), which converts phosphatidylinositol 3-phosphate [PI(3)P] into phosphatidylinositol 3,5-bisphosphate [PI(3,5)P2] in the endosomal system. We found that inhibition of PIKfyve either by pharmacological or non-pharmacological means causes a delay in parasite growth. Moreover, we show that the PI(3,5)P2 effector protein TRPML1 that is involved in late endocytic membrane fusion, is present in vesicles closely contacting the PVM and is necessary for parasite growth. Thus, our studies suggest that the parasite PVM is able to fuse with host late endocytic vesicles in a PI(3,5)P2-dependent manner, allowing the exchange of material between the host and the parasite, which is essential for successful infection. PMID:24992508

  2. Calves born after direct transfer of vitrified bovine in vitro-produced blastocysts derived from vitrified immature oocytes.

    PubMed

    Vieira, A D; Forell, F; Feltrin, C; Rodrigues, J L

    2008-06-01

    Vitrification has been the method of choice for the cryopreservation of bovine oocytes, as rapid cooling decreases chilling sensitivity. The aim of this study was to determine the in vitro and in vivo survival and the viability of immature oocytes vitrified using super-cooled liquid nitrogen. Immature oocytes were randomly allocated to three groups: (i) non-vitrified control group, (ii) vitrified in normal (-196 degrees C) liquid nitrogen (LN(2)) and (iii) vitrified in super-cooled LN(2) (< or =-200 degrees C). Open-pulled glass micropipettes were used as vitrification containers. Immature oocytes were in vitro-matured, fertilized and cultured to the blastocyst stage. In vitro viability was assessed by cleavage and blastocyst rates on days 2 and 7 of culture respectively. Vitrified blastocysts derived from the immature vitrified oocytes were directly transferred to synchronous recipients. The in vitro embryo development of vitrified immature oocytes was not influenced by the LN(2) state. After direct transfer (one embryo per recipient) of 16 embryos obtained from immature vitrified oocytes (eight from each vitrified group), two healthy calves were born in each group. These results indicated that vitrification of immature bovine oocytes using glass micropipettes under normal or super-cooled LN(2), resulted in viable blastocysts and live calves following in vitro embryo production.

  3. Immature doublecortin-positive hippocampal neurons are important for learning but not for remembering.

    PubMed

    Vukovic, Jana; Borlikova, Gilyana G; Ruitenberg, Marc J; Robinson, Gregory J; Sullivan, Robert K P; Walker, Tara L; Bartlett, Perry F

    2013-04-10

    It is now widely accepted that hippocampal neurogenesis underpins critical cognitive functions, such as learning and memory. To assess the behavioral importance of adult-born neurons, we developed a novel knock-in mouse model that allowed us to specifically and reversibly ablate hippocampal neurons at an immature stage. In these mice, the diphtheria toxin receptor (DTR) is expressed under control of the doublecortin (DCX) promoter, which allows for specific ablation of immature DCX-expressing neurons after administration of diphtheria toxin while leaving the neural precursor pool intact. Using a spatially challenging behavioral test (a modified version of the active place avoidance test), we present direct evidence that immature DCX-expressing neurons are required for successful acquisition of spatial learning, as well as reversal learning, but are not necessary for the retrieval of stored long-term memories. Importantly, the observed learning deficits were rescued as newly generated immature neurons repopulated the granule cell layer upon termination of the toxin treatment. Repeat (or cyclic) depletion of immature neurons reinstated behavioral deficits if the mice were challenged with a novel task. Together, these findings highlight the potential of stimulating neurogenesis as a means to enhance learning.

  4. IFN-gamma treatment at early stages of influenza virus infection protects mice from death in a NK cell-dependent manner.

    PubMed

    Weiss, Ido D; Wald, Ori; Wald, Hanna; Beider, Katia; Abraham, Michal; Galun, Eithan; Nagler, Arnon; Peled, Amnon

    2010-06-01

    Influenza pandemics are imminent and represent a major world health concern. Since vaccinations are expected to be less efficient in the coming years due to newly emerging influenza virus strains, novel antiviral therapies are urgently needed. Here, we show that influenza-infected mice, capable of clearing the virus in the early stages of infection, failed to control inflammation and death. Sequential administration of Interferon-gamma (IFN-gamma) at early stage of the infection protected infected mice from death in a NK cell-dependent manner. IFN-gamma treatment stimulated NK cell proliferation and function and increased their number in the bone marrow, blood, spleen, and infected lungs, keeping viral clearance intact. In parallel, IFN-gamma treatment significantly reduced the number of T cells and NKT cells in the lungs at the inflammatory phase following infection. Thus, rapidly clearing the virus and reducing inflammation by shaping the cellular and cytokine profiles in the early stages of infection may favorably change the fate of influenza pathogenesis.

  5. Infection of Goose with Genotype VIId Newcastle Disease Virus of Goose Origin Elicits Strong Immune Responses at Early Stage

    PubMed Central

    Xu, Qianqian; Chen, Yuqiu; Zhao, Wenjun; Zhang, Tingting; Liu, Chenggang; Qi, Tianming; Han, Zongxi; Shao, Yuhao; Ma, Deying; Liu, Shengwang

    2016-01-01

    Newcastle disease (ND), caused by virulent strains of Newcastle disease virus (NDV), is a highly contagious disease of birds that is responsible for heavy economic losses for the poultry industry worldwide. However, little is known about host-virus interactions in waterfowl, goose. In this study, we aim to characterize the host immune response in goose, based on the previous reports on the host response to NDV in chickens. Here, we evaluated viral replication and mRNA expression of 27 immune-related genes in 10 tissues of geese challenged with a genotype VIId NDV strain of goose origin (go/CH/LHLJ/1/06). The virus showed early replication, especially in digestive and immune tissues. The expression profiles showed up-regulation of Toll-like receptor (TLR)1–3, 5, 7, and 15, avian β-defensin (AvBD) 5–7, 10, 12, and 16, cytokines [interleukin (IL)-8, IL-18, IL-1β, and interferon-γ], inducible NO synthase (iNOS), and MHC class I in some tissues of geese in response to NDV. In contrast, NDV infection suppressed expression of AvBD1 in cecal tonsil of geese. Moreover, we observed a highly positive correlation between viral replication and host mRNA expressions of TLR1-5 and 7, AvBD4-6, 10, and 12, all the cytokines measured, MHC class I, FAS ligand, and iNOS, mainly at 72 h post-infection. Taken together, these results demonstrated that NDV infection induces strong innate immune responses and intense inflammatory responses at early stage in goose which may associate with the viral pathogenesis. PMID:27757109

  6. Circulation of HIV antigen in blood according to stage of infection, risk group, age and geographic origin.

    PubMed

    Goudsmit, J; Paul, D A

    1987-12-01

    Human immunodeficiency virus antigen (HIV-ag) was determined by enzyme immunoassay (EIA) in HIV-antibody (anti-HIV) positive as well as pre-anti-HIV seroconversion sera and the results analysed according to stage of infection, risk group, age and geographic origin. Eleven (19%) of 58 homosexual men tested showed HIV-ag in a serum taken 3-4 months before or one at the time of anti-HIV seroconversion. In another eight (14%) HIV-ag persisted after seroconversion and half of them developed AIDS or AIDS-related complex (ARC) in contrast to none of the other 50 anti-HIV seroconversions. Two (13%) of 16 haemophiliacs tested had HIV-ag only in the first anti-HIV seropositive sample. HIV-ag was present in 86% (30/35) of Dutch homosexual men with AIDS, in 32% (7/22) of men with ARC and in 17% (24/145) of men with persistent generalized lymphadenopathy (PGL) or without symptoms. Three percent (2/60) of sera of asymptomatic i.v. drug users from Amsterdam were HIV-ag positive. Ten percent (1 of 10) of sera from Central Africans with 'Slim Disease' were HIV-ag positive. Among infected children from the USA or Europe 89-100% (8/9 and 2/2) of AIDS cases, 67-100% (6/9 and 3/3) of children with ARC and 75% (3/4) of asymptomatic children were HIV-ag positive. The HIV-ag EIA appears to be able to identify HIV infection earlier than the available anti-HIV assays in a significant number of cases. Since persistence of HIV-ag, except possibly in African cases, is strongly associated with clinical deterioration, HIV-ag appears to be a suitable marker for, independent of their clinical status, selecting individuals for antiviral therapy and also for monitoring the efficiency of such therapy.

  7. Platelets activate a pathogenic response to blood-stage Plasmodium infection but not a protective immune response.

    PubMed

    Gramaglia, Irene; Velez, Joyce; Combes, Valery; Grau, Georges E R; Wree, Melanie; van der Heyde, Henri C

    2017-03-23

    Clinical studies indicate that thrombocytopenia correlates with the development of severe falciparum malaria, suggesting that platelets either contribute to control of parasite replication, possibly as innate parasite killer cells or function in eliciting pathogenesis. Removal of platelets by anti-CD41 mAb treatment, platelet inhibition by aspirin, and adoptive transfer of wild-type (WT) platelets to CD40-KO mice, which do not control parasite replication, resulted in similar parasitemia compared with control mice. Human platelets at a physiologic ratio of 1 platelet to 9 red blood cells (RBCs) did not inhibit the in vitro development or replication of blood-stage Plasmodium falciparum The percentage of Plasmodium-infected (iRBCs) with bound platelets during the ascending parasitemia in Plasmodium chabaudi- and Plasmodium berghei-infected mice and the 48-hour in vitro cycle of P falciparum was <10%. P chabaudi and P berghei iRBCs with apoptotic parasites (TdT(+)) exhibited minimal platelet binding (<5%), which was similar to nonapoptotic iRBCs. These findings collectively indicate platelets do not kill bloodstage Plasmodium at physiologically relevant effector-to-target ratios. P chabaudi primary and secondary parasitemia was similar in mice depleted of platelets by mAb-injection just before infection, indicating that activation of the protective immune response does not require platelets. In contrast to the lack of an effect on parasite replication, adoptive transfer of WT platelets to CD40-KO mice, which are resistant to experimental cerebral malaria, partially restored experimental cerebral malaria mortality and symptoms in CD40-KO recipients, indicating platelets elicit pathogenesis and platelet CD40 is a key molecule. © 2017 by The American Society of Hematology.

  8. Infection of Goose with Genotype VIId Newcastle Disease Virus of Goose Origin Elicits Strong Immune Responses at Early Stage.

    PubMed

    Xu, Qianqian; Chen, Yuqiu; Zhao, Wenjun; Zhang, Tingting; Liu, Chenggang; Qi, Tianming; Han, Zongxi; Shao, Yuhao; Ma, Deying; Liu, Shengwang

    2016-01-01

    Newcastle disease (ND), caused by virulent strains of Newcastle disease virus (NDV), is a highly contagious disease of birds that is responsible for heavy economic losses for the poultry industry worldwide. However, little is known about host-virus interactions in waterfowl, goose. In this study, we aim to characterize the host immune response in goose, based on the previous reports on the host response to NDV in chickens. Here, we evaluated viral replication and mRNA expression of 27 immune-related genes in 10 tissues of geese challenged with a genotype VIId NDV strain of goose origin (go/CH/LHLJ/1/06). The virus showed early replication, especially in digestive and immune tissues. The expression profiles showed up-regulation of Toll-like receptor (TLR)1-3, 5, 7, and 15, avian β-defensin (AvBD) 5-7, 10, 12, and 16, cytokines [interleukin (IL)-8, IL-18, IL-1β, and interferon-γ], inducible NO synthase (iNOS), and MHC class I in some tissues of geese in response to NDV. In contrast, NDV infection suppressed expression of AvBD1 in cecal tonsil of geese. Moreover, we observed a highly positive correlation between viral replication and host mRNA expressions of TLR1-5 and 7, AvBD4-6, 10, and 12, all the cytokines measured, MHC class I, FAS ligand, and iNOS, mainly at 72 h post-infection. Taken together, these results demonstrated that NDV infection induces strong innate immune responses and intense inflammatory responses at early stage in goose which may associate with the viral pathogenesis.

  9. Linking adults and immatures of South African marine fishes.

    PubMed

    Steinke, Dirk; Connell, Allan D; Hebert, Paul D N

    2016-11-01

    The early life-history stages of fishes are poorly known, impeding acquisition of the identifications needed to monitor larval recruitment and year-class strength. A comprehensive database of COI sequences, linked to authoritatively identified voucher specimens, promises to change this situation, representing a significant advance for fisheries science. Barcode records were obtained from 2526 early larvae and pelagic eggs of fishes collected on the inshore shelf within 5 km of the KwaZulu-Natal coast, about 50 km south of Durban, South Africa. Barcodes were also obtained from 3215 adults, representing 946 South African fish species. Using the COI reference library on BOLD based on adults, 89% of the immature fishes could be identified to a species level; they represented 450 species. Most of the uncertain sequences could be assigned to a genus, family, or order; only 92 specimens (4%) were unassigned. Accumulation curves based on inference of phylogenetic diversity indicate near-completeness of the collecting effort. The entire set of adult and larval fishes included 1006 species, representing 43% of all fish species known from South African waters. However, this total included 189 species not previously recorded from this region. The fact that almost 90% of the immatures gained a species identification demonstrates the power and completeness of the DNA barcode reference library for fishes generated during the 10 years of FishBOL.

  10. Point prevalence of infection with Mycoplasma bovoculi and Moraxella spp. in cattle at different stages of infectious bovine keratoconjunctivitis.

    PubMed

    Schnee, Christiane; Heller, Martin; Schubert, Evelyn; Sachse, Konrad

    2015-01-01

    Infectious bovine keratoconjunctivitis (IBK) has significant economic consequences and a detrimental impact on animal welfare. Although Moraxella (Mor.) bovis is the primary causative agent, the role of other bacteria, such as Mor. ovis, Mor. bovoculi and Mycoplasma (Myc.) bovoculi, is not well understood. To assess the prevalence of infection with these organisms, and to correlate this with outbreaks of IBK, conjunctival samples from four herds of cattle in Germany of differing IBK status were examined. Herds were selected to represent a hypothetical course of IBK ranging from the pre-outbreak stage (herd 1), to the acute disease stage (herd 2), to a stage where treatment had ceased (herd 3). Unaffected animals were also included (herd 4). To facilitate effective, sensitive sample analysis, a new real-time PCR for Myc. bovoculi was developed and used in concert with established real-time PCR protocols for Myc. bovis and Moraxella spp. Herds 1 and 2 showed similarly high rates of detection for Myc. bovoculi (92.5% and 84.0%, respectively), whereas herds 3 and 4 had a lower prevalence (35.5% and 26.2%, respectively). Mor. bovis and Mor. ovis were more prevalent in herd 1 (32.5% and 87.5%, respectively) and herd 2 (38% and 58%, respectively) than herd 3 (10.4% and 1.3%, respectively) and herd 4 (9.8% and 31.1%, respectively). Mor. bovoculi was the only pathogen that correlated with clinical signs of IBK; at 20% prevalence, it was almost exclusively detected in herd 2. The results indicate that herds with high Myc. bovoculi prevalence are more predisposed to outbreaks of IBK, possibly due to a synergistic interaction with Moraxella spp.

  11. Comparative approach to understanding traumatic injury in the immature, postnatal brain of domestic animals.

    PubMed

    Finnie, J W

    2012-08-01

    Traumatic brain injury (TBI) is a frequent occurrence in veterinary medicine, but the mechanisms leading to brain damage after a head impact are incompletely understood, particularly in the postnatal immature and still developing nervous system. This paper reviews neurotrauma studies, largely in paediatric humans and experimental animal models, in order to outline the pathophysiological and biomechanical events likely to be operative in head trauma involving domestic animal species in the postnatal period, as there is almost no other information available in the veterinary literature. Predicting the outcome of TBI is particularly difficult at this developmental time, in large part because recovery is influenced by the stage of brain maturation and neuroplasticity. An important part of the clinical management of TBI is the differentiation of primary brain damage, which occurs at the moment of head impact and is largely refractory to treatment, from the cascade of secondary events, which evolve over time and are potentially preventable and amenable to therapeutic intervention. An understanding of the causes and consequences of secondary brain damage such as hypoxia-ischaemia, brain swelling, elevated intracranial pressure, and infection is critical to limiting the resulting brain injury.

  12. A stage structured predator-prey model with disease in the prey

    NASA Astrophysics Data System (ADS)

    Agarwal, M.; Pandey, P.

    2008-02-01

    A non-linear mathematical model for a prey-predator community is proposed and analyzed. In the model, prey gets infected and predator population is structured into two stages of life, immature and mature with a time lag between two stages. Boundedness and non-negativity of the solutions of the system have been proved. Criterion for the stability of the system in the absence of delay is derived and bifurcation is found. The critical value of delay parameter for which stability change may occur is obtained.

  13. Lipoprotein succession in Borrelia burgdorferi: similar but distinct roles for OspC and VlsE at different stages of mammalian infection.

    PubMed

    Tilly, Kit; Bestor, Aaron; Rosa, Patricia A

    2013-07-01

    Borrelia burgdorferi alternates between ticks and mammals, requiring variable gene expression and protein production to adapt to these diverse niches. These adaptations include shifting among the major outer surface lipoproteins OspA, OspC, and VlsE at different stages of the infectious cycle. We hypothesize that these proteins carry out a basic but essential function, and that OspC and VlsE fulfil this requirement during early and persistent stages of mammalian infection respectively. Previous work by other investigators suggested that several B. burgdorferi lipoproteins, including OspA and VlsE, could substitute for OspC at the initial stage of mouse infection, when OspC is transiently but absolutely required. In this study, we assessed whether vlsE and ospA could restore infectivity to an ospC mutant, and found that neither gene product effectively compensated for the absence of OspC during early infection. In contrast, we determined that OspC production was required by B. burgdorferi throughout SCID mouse infection if the vlsE gene were absent. Together, these results indicate that OspC can substitute for VlsE when antigenic variation is unnecessary, but that these two abundant lipoproteins are optimized for their related but specific roles during early and persistent mammalian infection by B. burgdorferi. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  14. PSEUDARTHROSIS OF THE SCAPHOID IN IMMATURE SKELETONS

    PubMed Central

    de Lemos, Marcelo Barreto; Bentes, Ádria Simone Ferreira; Neto, Miguel Flores do Amaral; Spinelli, Leandro de Freitas; Severo, Antônio Lourenço; Lech, Osvandré

    2015-01-01

    This paper presents a review of the literature on pseudarthrosis of the scaphoid in skeletally immature individuals, taking into consideration its epidemiology, diagnosis and treatment, as well as its controversies. Knowledge of this subject makes it possible for patients to be given appropriate treatment immediately. Pseudarthrosis of the scaphoid in skeletally immature patients is a rare condition that results from error or lack of diagnosis of a fracture. Thus, careful clinical and radiographic examination should be performed in order to confirm or rule out this diagnosis. Several treatment methods have been reported and have shown good results. These include conservative plaster cast treatment, bone graft without osteosynthesis, bone graft with Kirschner wires, percutaneous screws and bone graft with compression screws. The treatment performed depends on the characteristics of the pseudarthrosis and the surgeon's experience. PMID:27042636

  15. Morphological Description of the Immatures of the Ant, Monomorium floricola

    PubMed Central

    Russ Solis, Daniel; Gonçalves Paterson Fox, Eduardo; Mayumi Kato, Luciane; Massuretti de jesus, Carlos; Teruyoshi Yabuki, Antonio; Eugênia de Carvalho Campos, Ana; Correa Bueno, Odair

    2010-01-01

    Some ant species of the genus Monomorium Mayr occur worldwide and are considered important urban pests. The larvae of only a few species of this genus have been described, and these descriptions are either superficial or incomplete. This study aimed to determine the number of larval instars and describe the immature stages of the ant Monomorium floricola Jerdon (Formicidae: Myrmicinae). Specimens were analyzed and measured using light and scanning electron microscopy. Three larval instars were found, and all larvae had pheidoloid bodies with ectatommoid mandibles, consistent with other Monomorium species described previously. Five types of body hairs were described, and their distribution was instar-specific. Body and mandible dimensions of the larvae also were constant for each instar. Like other Myrmicinae, the larvae did not create a cocoon. Some of differences among the hair types and sensilla were observed by comparing the samples with larvae of other species in the genus, and these differences may have taxonomic utility. PMID:20575746

  16. Small mammals as hosts of immature ixodid ticks.

    PubMed

    Horak, I G; Fourie, L J; Braack, L E O

    2005-09-01

    Two hundred and twenty-five small mammals belonging to 16 species were examined for ticks in Free State, Mpumalanga and Limpopo Provinces, South Africa, and 18 ixodid tick species, of which two could only be identified to genus level, were recovered. Scrub hares, Lepus saxatilis, and Cape hares, Lepus capensis, harboured the largest number of tick species. In Free State Province Namaqua rock mice, Aethomys namaquensis, and four-striped grass mice, Rhabdomys pumilio, were good hosts of the immature stages of Haemaphysalis leachi and Rhipicephalus gertrudae, while in Mpumalanga and Limpopo Provinces red veld rats, Aethomys chrysophilus, Namaqua rock mice and Natal multimammate mice, Mastomys natalensis were good hosts of H. leachi and Rhipicephalus simus. Haemaphysalis leachi was the only tick recovered from animals in all three provinces.

  17. Structure and uncoating of immature adenovirus

    PubMed Central

    Pérez-Berná, Ana J.; Marabini, Roberto; Scheres, Sjors H. W.; Menéndez-Conejero, Rosa; Dmitriev, Igor P.; Curiel, David T.; Mangel, Walter F.; Flint, S. Jane; Martín, Carmen San

    2009-01-01

    Summary Maturation via proteolytical processing is a common trait in the viral world, and is often accompanied by large conformational changes and rearrangements in the capsid. The adenovirus protease has been shown to play a dual role in the viral infectious cycle: (a) in maturation, as viral assembly starts with precursors to several of the structural proteins, but ends with proteolytically processed versions in the mature virion; and (b) in entry, because protease-impaired viruses have difficulties in endosome escape and uncoating. Indeed, viruses that have not undergone proteolytical processing are not infectious. We present the 3D structure of immature adenovirus particles, as represented by the thermosensitive mutant Ad2 ts1 grown under non-permissive conditions, and compare it with the mature capsid. Our 3DEM maps at subnanometer resolution indicate that adenovirus maturation does not involve large scale conformational changes in the capsid. Difference maps reveal the location of unprocessed peptides pIIIa and pVI and help to define their role in capsid assembly and maturation. An intriguing difference appears in the core, indicating a more compact organization and increased stability of the immature cores. We have further investigated these properties by in vitro disassembly assays. Fluorescence and electron microscopy experiments reveal differences in the stability and uncoating of immature viruses, both at the capsid and core levels, as well as disassembly intermediates not previously imaged. PMID:19563809

  18. Structure and Uncoating of Immature Adenovirus

    SciTech Connect

    Perez-Berna, A.J.; Mangel, W.; Marabini, R.; Scheres, S. H. W., Menendez-Conejero, R.; Dmitriev, I. P.; Curiel, D. T.; Flint, S. J.; San Martin, C.

    2009-09-18

    Maturation via proteolytic processing is a common trait in the viral world and is often accompanied by large conformational changes and rearrangements in the capsid. The adenovirus protease has been shown to play a dual role in the viral infectious cycle: (a) in maturation, as viral assembly starts with precursors to several of the structural proteins but ends with proteolytically processed versions in the mature virion, and (b) in entry, because protease-impaired viruses have difficulties in endosome escape and uncoating. Indeed, viruses that have not undergone proteolytic processing are not infectious. We studied the three-dimensional structure of immature adenovirus particles as represented by the adenovirus type 2 thermosensitive mutant ts1 grown under non-permissive conditions and compared it with the mature capsid. Our three-dimensional electron microscopy maps at subnanometer resolution indicate that adenovirus maturation does not involve large-scale conformational changes in the capsid. Difference maps reveal the locations of unprocessed peptides pIIIa and pVI and help define their role in capsid assembly and maturation. An intriguing difference appears in the core, indicating a more compact organization and increased stability of the immature cores. We have further investigated these properties by in vitro disassembly assays. Fluorescence and electron microscopy experiments reveal differences in the stability and uncoating of immature viruses, both at the capsid and core levels, as well as disassembly intermediates not previously imaged.

  19. An Immediate Innate Immune Response Occurred In the Early Stage of E.granulosus Eggs Infection in Sheep: Evidence from Microarray Analysis

    PubMed Central

    Tang, Jishun; Hou, Hongyan; Chen, Sheng; Jia, Bin; Ban, Qian

    2015-01-01

    Background Cystic Echinococcosis(CE), caused by infection with the larval stage of the cestode Echinococcus granulosus (E. granulosus), is a chronic parasitic zoonosis, with highly susceptible infection in sheep. However, the comprehensive molecular mechanisms that underlie the process of E. granulosus infection in the early stage remain largely unknown. The objective of this present study was to gain a cluster of genes expression profiles in the intestine tissue of sheep infected with CE. Methods Nine healthy sheep were divided into infection group and healthy controls, with six infected perorally 5000 E. granulosus eggs suspended in 1000μl physiological saline and three controls perorally injected 1000μl physiological saline. All animals were sacrificed at 4 hours post-infection, respectively. The intestine tissue was removed and the RNA was extracted. In the infection group, the biology replicates were designed to make sure the accuracy of the data. The ovine microarrays were used to analyze changes of gene expression in the intestine tissue between CE infected sheep and healthy controls. Real-time PCR was used to assess reliability of the microarray data. Results By biology repeats, a total of 195 differentially expressed genes were identified between infected group and controls at 4 hours post-infection, with 105 genes related to immune responses, while 90 genes associated with functions including energy metabolism, fat soluble transport, etc. Among the 105 immunity genes, 72 genes showed up-regulated expression levels while 33 showed down-regulation levels. Function analysis showed that most of up-regulated genes were related to innate immune responses, such as mast cell, NK cell, cytokines, chemokines and complement. In addition, Real-time PCR analysis of a random selection of nine genes confirmed the reliability of the microarray data. Conclusion To our knowledge, this is the first report describing gene expression profiles in the intestine tissue of CE

  20. An Immediate Innate Immune Response Occurred In the Early Stage of E. granulosus Eggs Infection in Sheep: Evidence from Microarray Analysis.

    PubMed

    Hui, Wenqiao; Jiang, Song; Tang, Jishun; Hou, Hongyan; Chen, Sheng; Jia, Bin; Ban, Qian

    2015-01-01

    Cystic Echinococcosis(CE), caused by infection with the larval stage of the cestode Echinococcus granulosus (E. granulosus), is a chronic parasitic zoonosis, with highly susceptible infection in sheep. However, the comprehensive molecular mechanisms that underlie the process of E. granulosus infection in the early stage remain largely unknown. The objective of this present study was to gain a cluster of genes expression profiles in the intestine tissue of sheep infected with CE. Nine healthy sheep were divided into infection group and healthy controls, with six infected perorally 5000 E. granulosus eggs suspended in 1000 μl physiological saline and three controls perorally injected 1000 μl physiological saline. All animals were sacrificed at 4 hours post-infection, respectively. The intestine tissue was removed and the RNA was extracted. In the infection group, the biology replicates were designed to make sure the accuracy of the data. The ovine microarrays were used to analyze changes of gene expression in the intestine tissue between CE infected sheep and healthy controls. Real-time PCR was used to assess reliability of the microarray data. By biology repeats, a total of 195 differentially expressed genes were identified between infected group and controls at 4 hours post-infection, with 105 genes related to immune responses, while 90 genes associated with functions including energy metabolism, fat soluble transport, etc. Among the 105 immunity genes, 72 genes showed up-regulated expression levels while 33 showed down-regulation levels. Function analysis showed that most of up-regulated genes were related to innate immune responses, such as mast cell, NK cell, cytokines, chemokines and complement. In addition, Real-time PCR analysis of a random selection of nine genes confirmed the reliability of the microarray data. To our knowledge, this is the first report describing gene expression profiles in the intestine tissue of CE infection sheep. These results

  1. Infections

    MedlinePlus

    ... Eye Infections Pinkeye (Conjunctivitis) Styes Fungal Infections (Ringworm, Yeast, etc.) Diaper Rash Infections That Pets Carry Oral ... Pneumonia Tinea (Ringworm, Jock Itch, Athlete's Foot) Vaginal Yeast Infections Immunizations Do My Kids Need Vaccines Before ...

  2. Therapeutic efficacy of eprinomectin extended-release injection against induced infections of developing (fourth-stage larvae) and adult nematode parasites of cattle.

    PubMed

    Rehbein, S; Baggott, D G; Royer, G C; Yoon, S; Cramer, L G; Soll, M D

    2013-03-01

    The therapeutic efficacy of eprinomectin in an extended-release injection (ERI) formulation was evaluated against induced infections of developing fourth-stage larval or adult gastrointestinal and pulmonary nematodes of cattle in a series of six studies under two identical protocols (three each for developing fourth-stage larvae or adults) conducted in the USA, Germany or the UK (two studies at each location, one per stage). Each study initially included 16 nematode-free cattle. The cattle were of various breeds or crosses, weighed 109-186.5 kg prior to treatment, and were approximately 4-7 months old. The animals were blocked based on pre-treatment bodyweight and then randomly allocated to treatment: eprinomectin ERI vehicle (control) at 1 mL/50 kg body weight or eprinomectin 5% ERI at 1 mL/50 kg bodyweight (1.0 mg eprinomectin/kg) for a total of eight and eight animals in each group. Treatments were administered once on Day 0 by subcutaneous injection in front of the shoulder. In each study, cattle were infected with a combination of infective third-stage larvae or eggs of gastrointestinal and pulmonary nematodes. Inoculation was scheduled so that the nematodes were expected to be fourth-stage larvae or adults at the time of treatment. For parasite recovery, all study animals were humanely euthanized and necropsied 14-15 (adult infections) or 21-22 days after treatment (developing fourth-stage larval infections). When compared with the vehicle-treated control counts, efficacy of eprinomectin ERI against developing fourth-stage larvae and adults was ≥98% (p<0.05) for the following nematodes: Dictyocaulus viviparus, Bunostomum phlebotomum, Cooperia curticei, C. oncophora, C. surnabada, C. punctata, Haemonchus contortus, H. placei, Nematodirus helvetianus, Oesophagostomum radiatum, Oes. venulosum, Ostertagia leptospicularis, O. ostertagi, O. circumcincta, O. pinnata, O. trifurcata (developing fourth-stage larval infections only), Strongyloides papillosus

  3. EVALUATION OF THE THERAPEUTIC EFFICACY OF LEVAMISOLE HYDROCHLORIDE ON THIRD-STAGE LARVAE OF Lagochilascaris minor IN EXPERIMENTALLY INFECTED MICE

    PubMed Central

    CAMPOS, Dulcinéa Maria Barbosa; BARBOSA, Alverne Passos; OLIVEIRA, Jayrson Araújo; BARBOSA, Carlos Augusto Lopes; LOBO, Tamara Flavia Correa; SILVA, Luana Gabriella; THOMAZ, Douglas Vieira; PEIXOTO, Josana de Castro

    2016-01-01

    Lagochilascariosis, a disease caused by Lagochilascaris minor, affects the neck, sinuses, tonsils, lungs, the sacral region, dental alveoli, eyeballs and the central nervous system of humans. A cycle of autoinfection may occur in human host tissues characterized by the presence of eggs, larvae and adult worms. This peculiarity of the cycle hinders therapy, since there are no drugs that exhibit ovicidal, larvicidal and vermicidal activity. Given these facts, we studied the action of levamisole hydrochloride on third-stage larvae in the migration phase (G1) and on encysted larvae (G3) of L. minor. To this end, 87 inbred mice of the C57BL/6 strain were divided into test groups comprising 67 animals (G1-37; G3-30) and a control group (G2-10; G4-10) with 20 animals. Each animal was inoculated orally with 2,000 infective eggs of the parasite. The animals of the test groups were treated individually with a single oral dose of levamisole hydrochloride at a concentration of 0.075 mg. The drug was administered either 30 minutes prior to the parasite inoculation (G1 animals) or 120 days after the inoculation (G3 animals). The mice in the control groups were not treated with the drug. After the time required for the migration and the encysting of L. minor larvae, all the animals were euthanized and their tissues examined. The data were analyzed using the Student's unpaired t-test and the Levene test. The groups showed no statistically significant difference. Levamisole hydrochloride was ineffective on third-stage larvae of L. minor. These findings explain the massive expulsion of live adult worms, as well as the use of long treatment schemes, owing to the persistence of larvae and eggs in human parasitic lesions. PMID:27253745

  4. HIV Treatments Reduce Malaria Liver Stage Burden in a Non-Human Primate Model of Malaria Infection at Clinically Relevant Concentrations In Vivo

    PubMed Central

    Hobbs, Charlotte V.; Neal, Jillian; Conteh, Solomon; Donnelly, Liam; Chen, Jingyang; Marsh, Kennan; Lambert, Lynn; Orr-Gonzalez, Sachy; Hinderer, Jessica; Healy, Sara; Borkowsky, William; Penzak, Scott R.; Chakravarty, Sumana; Hoffman, Stephen L.; Duffy, Patrick E.

    2014-01-01

    We have previously shown that the HIV protease inhibitor lopinavir-ritonavir (LPV-RTV) and the antibiotic trimethoprim sulfamethoxazole (TMP-SMX) inhibit Plasmodium liver stages in rodent malarias and in vitro in P. falciparum. Since clinically relevant levels are better achieved in the non-human-primate model, and since Plasmodium knowlesi is an accepted animal model for the study of liver stages of malaria as a surrogate for P. falciparum infection, we investigated the antimalarial activity of these drugs on Plasmodium knowlesi liver stages in rhesus macaques. We demonstrate that TMP-SMX and TMP-SMX+LPV-RTV (in combination), but not LPV-RTV alone, inhibit liver stage parasite development. Because drugs that inhibit the clinically silent liver stages target parasites when they are present in lower numbers, these results may have implications for eradication efforts. PMID:24988386

  5. Determinants of late disease-stage presentation at diagnosis of HIV infection in Venezuela: A case-case comparison

    PubMed Central

    Bonjour, Maeva A; Montagne, Morelba; Zambrano, Martha; Molina, Gloria; Lippuner, Catherine; Wadskier, Francis G; Castrillo, Milvida; Incani, Renzo N; Tami, Adriana

    2008-01-01

    Background Although Venezuela has a National Human Immunodeficiency Virus (HIV) Program offering free diagnosis and treatment, 41% of patients present for diagnosis at a later disease-stage, indicating that access to care may still be limited. Our study aimed to identify factors influencing delay in presenting for HIV-diagnosis using a case-case comparison. A cross-sectional survey was performed at the Regional HIV Reference Centre (CAI), Carabobo Region, Venezuela. Between May 2005 and October 2006 225 patients diagnosed with HIV at CAI were included and demographic, behavioural and medical characteristics collected from medical files. Socio-economic and behavioural factors were obtained from 129 eligible subjects through interviews. "Late presentation" at diagnosis was defined as patients classified with disease-stage B or C according to the 1993 Centers for Disease Control and Prevention (Atlanta, USA) classification, and "early presentation" defined as diagnosis in disease-stage A. Results Of 225 subjects, 91 (40%) were defined as late presenters. A similar proportion (51/129) was obtained in the interviewed sub-sample. Older age (>30 years), male heterosexuality, lower socio-economic status, perceiving ones partner to be faithful and living ≥ 25 km from the CAI were positively associated with late diagnosis in a multivariate model. Females were less likely to present late than heterosexual males (odds ratio = 0.23, P = 0.06). The main barriers to HIV testing were low knowledge of HIV/AIDS, lack of awareness of the free HIV program, lack of perceived risk of HIV-infection, fear for HIV-related stigma, fear for lack of confidentiality at testing site and logistic barriers. Conclusion Despite the free Venezuelan HIV Program, poverty and barriers related to lack of knowledge and awareness of both HIV and the Program itself were important determinants in late presentation at HIV diagnosis. This study also indicates that women; heterosexual, bisexual and

  6. Determinants of late disease-stage presentation at diagnosis of HIV infection in Venezuela: a case-case comparison.

    PubMed

    Bonjour, Maeva A; Montagne, Morelba; Zambrano, Martha; Molina, Gloria; Lippuner, Catherine; Wadskier, Francis G; Castrillo, Milvida; Incani, Renzo N; Tami, Adriana

    2008-04-16

    Although Venezuela has a National Human Immunodeficiency Virus (HIV) Program offering free diagnosis and treatment, 41% of patients present for diagnosis at a later disease-stage, indicating that access to care may still be limited. Our study aimed to identify factors influencing delay in presenting for HIV-diagnosis using a case-case comparison. A cross-sectional survey was performed at the Regional HIV Reference Centre (CAI), Carabobo Region, Venezuela. Between May 2005 and October 2006 225 patients diagnosed with HIV at CAI were included and demographic, behavioural and medical characteristics collected from medical files. Socio-economic and behavioural factors were obtained from 129 eligible subjects through interviews. "Late presentation" at diagnosis was defined as patients classified with disease-stage B or C according to the 1993 Centers for Disease Control and Prevention (Atlanta, USA) classification, and "early presentation" defined as diagnosis in disease-stage A. Of 225 subjects, 91 (40%) were defined as late presenters. A similar proportion (51/129) was obtained in the interviewed sub-sample. Older age (>30 years), male heterosexuality, lower socio-economic status, perceiving ones partner to be faithful and living >/= 25 km from the CAI were positively associated with late diagnosis in a multivariate model. Females were less likely to present late than heterosexual males (odds ratio = 0.23, P = 0.06). The main barriers to HIV testing were low knowledge of HIV/AIDS, lack of awareness of the free HIV program, lack of perceived risk of HIV-infection, fear for HIV-related stigma, fear for lack of confidentiality at testing site and logistic barriers. Despite the free Venezuelan HIV Program, poverty and barriers related to lack of knowledge and awareness of both HIV and the Program itself were important determinants in late presentation at HIV diagnosis. This study also indicates that women; heterosexual, bisexual and homosexual men might have different

  7. Vitamin D status does not predict sustained virologic response or fibrosis stage in chronic hepatitis C genotype 1 infection.

    PubMed

    Kitson, Matthew T; Dore, Gregory J; George, Jacob; Button, Peter; McCaughan, Geoffrey W; Crawford, Darrell H G; Sievert, William; Weltman, Martin D; Cheng, Wendy S; Roberts, Stuart K

    2013-03-01

    The relationship between vitamin D status and response to antiviral therapy and liver histology in hepatitis C virus genotype 1 (HCV-1) infection remains unclear, with studies to date yielding inconsistent results and failing to use reference assay methodology. We therefore analyzed pre-treatment 25-hydroxyvitamin D [25(OH)D] level, using reference liquid chromatography-tandem mass spectrometry methodology, in a cohort of treatment-naïve patients with HCV-1 to evaluate the association between vitamin D status, virologic response, and liver histology. 274 patients, with pre-treatment liver biopsy and up to 48 weeks of pegylated interferon alfa-2a plus ribavirin therapy, were tested for serum 25(OH)D level. Predictors of sustained virologic response (SVR), and variables associated with fibrosis stage, activity grade and 25(OH)D status were identified using multivariate analysis. Mean 25(OH)D level was 79.6 nmol/L, with a prevalence of 25(OH)D <75 nmol/L and <50 nmol/L of 48% and 16%, respectively. Season, race and geographic latitude were independent predictors of 25(OH)D status, while vitamin D deficiency was more prevalent in those with high activity grade (21% vs. 11%; p=0.03). Mean 25(OH)D level was lower (76.6 vs. 84.7 nmol/L; p=0.03) and 25(OH)D <75 nmol/L more prevalent (53% vs. 40%; p=0.03) in patients with an SVR, but no association between 25(OH)D status and SVR was found in multivariate analysis. Mean 25(OH)D level did not vary between fibrosis stage or activity grade. Baseline 25(OH)D level is not independently associated with SVR or fibrosis stage in HCV-1, but vitamin D deficiency is associated with high activity grade. Copyright © 2012 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

  8. Experimental infections with Fasciola in snails, mice and rabbits.

    PubMed

    Hussein, Abdel-Nasser A; Khalifa, R M A

    2008-05-01

    Experimental infection trails of Lymnaea (cailliaudi) natalensis snails with miracidia of Fasciola hepatica revealed neither cercariae nor larval stages shed. Infection of white mice with metacercariae from field-collected snails proved to be negative for Fasciola eggs and immature juveniles or adults after 84 days post infection. The infection of eight rabbits (Oryctolagus cuniculus) has succeeded; two rabbits were infected, with a very low infection rate. Faeces of rabbits were negative for eggs. The worm burden was one and three worms from 40 fed metacercariae. The obtained fluke measures 23 mm in length by 4 mm in width. The tegument is covered with sharp-ending spines. The uterus contains few eggs. The intrauterine eggs measured 158 microm x 80 microm. According to the morphological characters of these flukes, they belong to F. gigantica.

  9. Morphological and morphometric differentiation of dorsal-spined first stage larvae of lungworms, (Nematoda: Protostrongylidae) infecting muskoxen (Ovibos moschatus) in the Central Canadian Arctic

    USDA-ARS?s Scientific Manuscript database

    Umingmakstrongylus pallikuukensis and Varestrongylus eleguneniensis are the two most common protostrongylid nematodes infecting muskoxen in the North American Arctic and Subarctic. First stage larvae (L1) of both these lungworms have a characteristic dorsal spine originating at the level of proxima...

  10. Development of life stages of Leptotrombidium imphalum and Leptotrombidium chiangraiensis (Acari: Trombiculidae) uninfected and infected with the scrub typhus rickettsia, Orientia tsustugamushi

    USDA-ARS?s Scientific Manuscript database

    Leptotrombidium chiangraiensis Tanskul and Linthicum and Leptotrombidium imphalum Vercammen-Grandjean are important vectors of scrub typhus in ricefield habitats in northern Thailand. The developmental biology of all stages of the life cycle of two generations of mites infected with Orientia tsutsug...

  11. Staging of recent HIV-1 infection using Geenius rapid confirmatory assay compared to INNO-LIA, New Lav and Blot 2.2 assays.

    PubMed

    Tuaillon, E; Sanosyan, A; Pisoni, A; Liscouët, J; Makinson, A; Perre, P Van de

    2017-10-01

    Besides confirmation of HIV seropositivity, Western Blot (WB) assays play an important role for identification of recent infection based on incomplete antibody reactivity and lack of p31 band. We evaluated the capacities of the Geenius™ HIV1/2 Confirmatory Assay (Bio-Rad), a new generation rapid confirmatory assay based on immune-chromatography and automated reading, for staging of HIV-1 infection. Sixteen samples collected during early HIV-1 infections (Fiebig stage III-VI) were tested using the Geenius assay, and compared to HIV Blot 2.2 WB assay (MP Diagnostics), New Lav Blot I WB assay (Bio-Rad) and INNO-LIA™ HIV I/II Score Dot Blot assay (Fujirebio). Results obtained with Geenius and INNO LIA in 47 newly diagnosed chronic HIV-1 infections were also compared. The p24 band was less frequently detected in early HIV-1 infections using the Geenius (3/16) compared to the New Lav (15/16, p<0.0001), INNO-LIA (13/16, p=0.0011), and Blot 2.2 (13/16, p=0.0011). Testing samples collected during chronic infection allowed to confirm that p31 band and complete Gag, Pol, Env profiles were less frequently observed using the Geenius assay compared to the INNO LIA assay (p=0.027 for p31, and p=0.0015 for complete profile). The Geenius assay is a simple and rapid test showing a high sensitivity to detect Env bands and to confirm HIV-1 seropositivity during the early phases of infection. However, this test is less suitable for distinguishing between later stages of acute and chronic infections because of a reduced sensitivity to detect the p31 and p24 bands compared to INNO LIA and New Lav assays. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Treatment of third-stage larvae of Toxocara cati with milbemycin oxime plus praziquantel tablets and emodepside plus praziquantel spot-on formulation in experimentally infected cats.

    PubMed

    Wolken, Sonja; Böhm, Claudia; Schaper, Roland; Schnieder, Thomas

    2012-11-01

    Toxocara cati is the most prevalent gastrointestinal helminth in cats worldwide, with cats of all ages at risk of infection. An anthelminthic treatment that not only affects the gut-dwelling stages of this parasite but is also effective against developmental stages in the tissue has the advantage that the pathology caused by migrating larvae is minimized and the need for repeated treatments is reduced. This study was conducted to evaluate the efficacy of milbemycin oxime/praziquantel tablets (Milbemax®, Novartis) against third-stage larvae of T. cati in comparison to a spot-on formulation of emodepside and praziquantel (Profender®, Bayer). Twenty-four kittens were experimentally infected with T. cati and randomly allocated to three study groups. Treatments were performed at the minimum therapeutic dosage 5 days after the experimental infection. The development of patent infections was monitored and all cats were dewormed 50 days post-infection. Efficacies were calculated based on counts of excreted worms in the treated groups compared to a negative control group. Seven of the eight cats in the negative control group developed a patent T. cati infection and all cats were excreting worms at the end of the study (geometric mean worm count 18.1). No efficacy could be observed for the milbemycin oxime-treated animals. All cats developed a patent infection and excreted worms (geometric mean worm count 27.7). The treatment with Profender® was 98.5 % effective against L3 of T. cati. One cat developed a patent infection and was excreting worms at the end of the study (geometric mean worm count 0.3). No adverse reactions were noted in either treatment group.

  13. Ultrastructure of endogenous stages of Eimeria ninakohlyakimovae Yakimoff & Rastegaieff, 1930 Emend. Levine, 1961 in experimentally infected goat.

    PubMed

    Vieira, L S; Lima, J D; Ribeiro, M F; Bozzi, I A; Camargos, E R

    1997-01-01

    The ultrastructure of endogenous stages of Eimeria ninakohlyakimovae was observed in epithelial cells of cecum and colon crypts from a goat experimentally infected with 2.0 x 10(5) oocysts/kg. The secondary meronts developed above the nucleus of the host cell. The nucleus first divides and merozoites then form on the surface of multinucleated meronts. Free merozoites in the parasitophorous vacuole present a conoid, double membrane, one pair of rhoptries, micronemes, micropore, anterior and posterior polar ring, a nucleus with a nucleolus and peripheral chromatin. The microgamonts are located below the nucleus of the host cell and contain several nuclei at the periphery of the parasite. The microgametes consist of a body, a nucleus, three flagella and mitochondria. The macrogamonts develop below the nucleus of the host cell and have a large nucleus with a prominent nucleolus. The macrogametes contain a nucleus, wall-forming bodies of type I and type II. The young oocysts present a wall containing two layers and a sporont.

  14. Liver-Resident Memory CD8(+) T Cells Form a Front-Line Defense against Malaria Liver-Stage Infection.

    PubMed

    Fernandez-Ruiz, Daniel; Ng, Wei Yi; Holz, Lauren E; Ma, Joel Z; Zaid, Ali; Wong, Yik Chun; Lau, Lei Shong; Mollard, Vanessa; Cozijnsen, Anton; Collins, Nicholas; Li, Jessica; Davey, Gayle M; Kato, Yu; Devi, Sapna; Skandari, Roghieh; Pauley, Michael; Manton, Jonathan H; Godfrey, Dale I; Braun, Asolina; Tay, Szun Szun; Tan, Peck Szee; Bowen, David G; Koch-Nolte, Friedrich; Rissiek, Björn; Carbone, Francis R; Crabb, Brendan S; Lahoud, Mireille; Cockburn, Ian A; Mueller, Scott N; Bertolino, Patrick; McFadden, Geoffrey I; Caminschi, Irina; Heath, William R

    2016-10-18

    In recent years, various intervention strategies have reduced malaria morbidity and mortality, but further improvements probably depend upon development of a broadly protective vaccine. To better understand immune requirement for protection, we examined liver-stage immunity after vaccination with irradiated sporozoites, an effective though logistically difficult vaccine. We identified a population of memory CD8(+) T cells that expressed the gene signature of tissue-resident memory T (Trm) cells and remained permanently within the liver, where they patrolled the sinusoids. Exploring the requirements for liver Trm cell induction, we showed that by combining dendritic cell-targeted priming with liver inflammation and antigen recognition on hepatocytes, high frequencies of Trm cells could be induced and these cells were essential for protection against malaria sporozoite challenge. Our study highlights the immune potential of liver Trm cells and provides approaches for their selective transfer, expansion, or depletion, which may be harnessed to control liver infections or autoimmunity. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Colletotrichum orbiculare WHI2, a Yeast Stress-Response Regulator Homolog, Controls the Biotrophic Stage of Hemibiotrophic Infection Through TOR Signaling.

    PubMed

    Harata, Ken; Nishiuchi, Takumi; Kubo, Yasuyuki

    2016-06-01

    The hemibiotrophic fungus Colletotrichum orbiculare first establishes a biotrophic infection stage in cucumber (Cucumber sativus) epidermal cells and subsequently transitions to a necrotrophic stage. Here, we found that C. orbiculare established hemibiotrophic infection via C. orbiculare WHI2, a yeast stress regulator homolog, and TOR (target of rapamycin) signaling. Plant defense responses such as callose deposition, H2O2, and antimicrobial proteins were strongly induced by the C. orbiculare whi2Δ mutant, resulting in defective pathogenesis. Expression analysis of biotrophy-specific genes evaluated by the promoter VENUS fusion gene indicated weaker VENUS signal intensity in the whi2Δ mutant, thereby suggesting that C. orbiculare WHI2 plays a key role in regulating biotrophic infection of C. orbiculare. The involvement of CoWHI2 in biotrophic infection was further explored with a DNA microarray. In the Cowhi2Δ mutant, TOR-dependent ribosomal protein-related genes were strikingly upregulated compared with the wild type. Moreover, callose deposition in the host plant after inoculation with the Cowhi2Δ mutant treated with rapamycin, which inhibits TOR activity, was reduced, and the mutant remained biotrophic in contrast to the untreated mutant. Thus, regulation of TOR by Whi2 is apparently crucial to the biotrophic stage of hemibiotrophic infection in C. orbiculare.

  16. Rapid and Slow Progressors Show Increased IL-6 and IL-10 Levels in the Pre-AIDS Stage of HIV Infection

    PubMed Central

    de Medeiros, Rúbia M.; Valverde-Villegas, Jacqueline M.; Junqueira, Dennis M.; Gräf, Tiago; Lindenau, Juliana D.; de Mello, Marineide G.; Vianna, Priscila; Almeida, Sabrina E. M.; Chies, Jose Artur B.

    2016-01-01

    Cytokines are intrinsically related to disease progression in HIV infection. We evaluated the plasma levels of Th1/Th2/Th17 cytokines in extreme progressors, including slow (SPs) and rapid (RPs) progressors, who were thus classified based on clinical and laboratory follow-up covering a period of time before the initiation of HAART, ranging from 93–136.5 months for SPs and 7.5–16.5 months for RPs. Analyses were also performed based on the different stages of HIV infection (chronic, pre-HAART individuals—subjects sampled before initiating HAART but who initiated therapy from 12 to 24 months—and those receiving HAART). The plasma cytokine levels of 16 HIV-infected rapid progressors and 25 slow progressors were measured using a Human Th1/Th2/Th17 CBA kit. The IL-6 and IL-10 plasma levels differed significantly between the stages of HIV infection. The IL-6 levels were higher in slow progressors pre-HAART than in chronically infected SPs and HIV-seronegative individuals. The IL-10 levels were higher in slow progressors pre-HAART than in slow progressors receiving HAART and HIV-seronegative controls, and in rapid progressors, the IL-10 levels were higher in pre-HAART subjects than in HIV-seronegative controls. The results reflect the changes in the cytokine profile occurring during different clinical stages in HIV+ subjects. Our results suggest an association between increased IL-6 and IL-10 levels and pre-HAART stages independent of the slow or rapid progression status of the subjects. Thus, increased IL-6 and IL-10 levels could indicate a global inflammatory status and could be used as markers of the disease course in HIV-infected individuals. PMID:27214135

  17. Results of single stage exchange arthroplasty with retention of well fixed cement-less femoral component in management of infected total hip arthroplasty

    PubMed Central

    Rahman, Wael A; Kazi, Hussain A; Gollish, Jeffery D

    2017-01-01

    AIM To investigate success of one stage exchange with retention of fixed acetabular cup. METHODS Fifteen patients treated by single stage acetabular component exchange with retention of well-fixed femoral component in infected total hip arthroplasty (THA) were retrospectively reviewed. Inclusion criteria were patients with painful chronic infected total hip. The patient had radiologically well fixed femoral components, absence of major soft tissue or bone defect compromising, and infecting organism was not poly or virulent micro-organism. The organisms were identified preoperatively in 14 patients (93.3%), coagulase negative Staphylococcus was the infecting organism in 8 patients (53.3%). RESULTS Mean age of the patients at surgery was 58.93 (± 10.67) years. Mean follow-up was 102.8 mo (36-217 mo, SD 56.4). Fourteen patients had no recurrence of the infection; one hip (6.7%) was revised for management of infection. Statistical analysis using Kaplan Meier curve showed 93.3% survival rate. One failure in our series; the infection recurred after 14 mo, the patient was treated successfully with surgical intervention by irrigation, and debridement and liner exchange. Two complications: The first patient had recurrent hip dislocation 12 years following the definitive procedure, which was managed by revision THA with abductor reconstruction and constrained acetabular liner; the second complication was aseptic loosening of the acetabular component 2 years following the definitive procedure. CONCLUSION Successful in management of infected THA when following criteria are met; well-fixed stem, no draining sinuses, non-immune compromised patients, and infection with sensitive organisms. PMID:28361019

  18. The shiitake mushroom-derived immuno-stimulant lentinan protects against murine malaria blood-stage infection by evoking adaptive immune-responses.

    PubMed

    Zhou, Lian-di; Zhang, Qi-hui; Zhang, Ying; Liu, Jun; Cao, Ya-ming

    2009-04-01

    Lentinan, a (1-3)-beta glucan from Lentinus edodes, is an effective immunostimulatory drug. We tested the effects of lentinan during blood-stage infection by Plasmodium yoelii 17XL (P.y17XL). Pre-treatment of mice with lentinan significantly decreased the parasitemia and increased their survival after infection. Enhanced IL-12, IFN-gamma and NO production induced by lentinan in spleen cells of infected mice revealed that the Th1 immune response was stimulated against malaria infection. In vitro and in vivo, lentinan can result in enhanced expression of MHC II, CD80/CD86, and Toll-like receptors (TLR2/TLR4), and increased production of IL-12 in spleen dendritic cells (DCs) co-cultured with parasitized red blood cells (pRBCs). Moreover, both the number of CD4(+)CD25(+) regulatory T cells (Tregs) and the levels of IL-10 secreted by Tregs were reduced by pre-treatment with lentinan in the spleen of malaria-infected mice. Meanwhile, apoptosis of CD4(+) T cell in spleens of mice pretreated with lentinan was significantly reduced. In summary, lentinan can induce protective Th1 immune responses to control the proliferation of malaria parasites during the blood-stage of P.y17XL infection by stimulating maturation of DCs to inhibit negative regulation of the Th1 immune response by Tregs. Taken together, our findings suggest that lentinan has prophylactic potential for the treatment of malaria.

  19. Estimating the distribution of probable age-at-death from dental remains of immature human fossils.

    PubMed

    Shackelford, Laura L; Stinespring Harris, Ashley E; Konigsberg, Lyle W

    2012-02-01

    In two historic longitudinal growth studies, Moorrees et al. (Am J Phys Anthropol 21 (1963) 99-108; J Dent Res 42 (1963) 1490-1502) presented the "mean attainment age" for stages of tooth development for 10 permanent tooth types and three deciduous tooth types. These findings were presented graphically to assess the rate of tooth formation in living children and to age immature skeletal remains. Despite being widely cited, these graphical data are difficult to implement because there are no accompanying numerical values for the parameters underlying the growth data. This analysis generates numerical parameters from the data reported by Moorrees et al. by digitizing 358 points from these tooth formation graphs using DataThief III, version 1.5. Following the original methods, the digitized points for each age transition were conception-corrected and converted to the logarithmic scale to determine a median attainment age for each dental formation stage. These values are subsequently used to estimate age-at-death distributions for immature individuals using a single tooth or multiple teeth, including estimates for 41 immature early modern humans and 25 immature Neandertals. Within-tooth variance is calculated for each age estimate based on a single tooth, and a between-tooth component of variance is calculated for age estimates based on two or more teeth to account for the increase in precision that comes from using additional teeth. Finally, we calculate the relative probability of observing a particular dental formation sequence given known-age reference information and demonstrate its value in estimating age for immature fossil specimens. Copyright © 2011 Wiley Periodicals, Inc.

  20. Expression of late viral proteins is restricted in nasal mucosal leucocytes but not in epithelial cells during early-stage equine herpes virus-1 infection.

    PubMed

    Gryspeerdt, Annick C; Vandekerckhove, Annelies P; Baghi, Hossein Bannazadeh; Van de Walle, Gerlinde R; Nauwynck, Hans J

    2012-08-01

    Equine herpes virus (EHV)-1 replicates in the epithelial cells of the upper respiratory tract and reaches the lamina propria and bloodstream in infected mononuclear cells. This study evaluated expression of the late viral proteins gB, gC, gD and gM in respiratory epithelial and mononuclear cells using: (1) epithelial-like rabbit kidney cells and peripheral blood mononuclear cells infected with EHV-1 in vitro; (2) an equine ex vivo nasal explant system; and (3) nasal mucosa tissue of ponies infected in vivo. The viral proteins were expressed in all late-infected epithelial cells, whereas expression was not observed in infected leucocytes where proteins gB and gM were expressed in 60-90%, and proteins gC and gD in only 20% of infected cells, respectively. The results indicate that expression of these viral proteins during early-stage EHV-1 infection is highly dependent on the cell type infected.

  1. Amelioration of Citrobacter rodentium proliferation in early stage of infection in mice by pre-treatment with Lactobacillus brevis KB290 and verification using in vivo bioluminescence imaging.

    PubMed

    Waki, Naoko; Kuwabara, Yuki; Yoshikawa, Yuko; Suganuma, Hiroyuki; Koide, Hiroyuki; Oku, Naoto; Ohashi, Norio

    2016-11-10

    Bioluminescent imaging (BLI) has become a useful tool for monitoring bacterial infections in real time. Citrobacter rodentium and its BLI are widely used as a murine model of enteropathogenic and enterohaemorrhagic Escherichia coli infection. In this study, we evaluated the protective effects of the probiotic Lactobacillus brevis KB290 against C. rodentium infection by the BLI approach. First, we examined several solutions for making the suspension of bioluminescent C. rodentium for an oral inoculation to establish a stable intestinal infection. Three percent NaHCO 3 solution was found to be the best. Subsequently, mice were orally administered KB290 once daily for 7 days before inoculation with bioluminescent C. rodentium and for 8 days after infection. The bioluminescence intensity of mice fed with KB290 was significantly lower than that of unfed mice on days 1-3 post-infection . The mRNA levels of tumour necrosis factor-α and interferon-γ in the distal colon from KB290-fed mice were shown to be significantly higher than those from unfed mice on day 3 post-infection. The results suggested that KB290 intake partially inhibited the proliferation of C. rodentium , especially in the early stages of infection, via the moderate enhancement of tumour necrosis factor-α and interferon-γ production in the colon.

  2. Interleukin-1β selectively expands and sustains interleukin-22+ immature human natural killer cells in secondary lymphoid tissue

    PubMed Central

    Hughes, Tiffany; Becknell, Brian; Freud, Aharon G.; McClory, Susan; Briercheck, Edward; Yu, Jianhua; Mao, Charlene; Giovenzana, Chiara; Nuovo, Gerard; Wei, Lai; Zhang, Xiaoli; Gavrilin, Mikhail A.; Wewers, Mark D.; Caligiuri, Michael A.

    2013-01-01

    SUMMARY Among human natural killer (NK) cell intermediates in secondary lymphoid tissue (SLT), stage 3 CD34− CD117+CD161+CD94− immature NK (iNK) cells uniquely express aryl hydrocarbon receptor (AHR) and interleukin-22 (IL-22), supporting a role in mucosal immunity. The mechanisms controlling proliferation and differentiation of these cells are unknown. Here we demonstrate that the IL-1 receptor IL-1R1 was selectively expressed by a subpopulation of iNK cells that localized proximal to IL-1β-producing conventional dendritic cells (cDCs) within SLT. IL-1R1hi iNK cells required continuous exposure to IL-1β to retain AHR and IL-22 expression, and proliferate in direct response to cDC-derived IL-15 and IL-1β. In the absence of IL-1β, a substantially greater fraction of IL-1R1hi iNK cells differentiated to stage 4 NK cells and acquired the ability to kill and secrete IFN-γ. Thus, cDC-derived IL-1β preserves and expands IL-1R1hiIL-22+AHR+ iNK cells, potentially influencing human mucosal innate immunity during infection. PMID:20620944

  3. Diagnosis and treatment of intracranial immature teratoma.

    PubMed

    Huang, Xiang; Zhang, Rong; Zhou, Liang-Fu

    2009-01-01

    The purpose of this paper is toexplore the clinical features, treatment and prognosis of intracranial immature teratomas. The clinical data, serum levels of tumor markers, treatment regimens and prognosis of 15 patients with intracranial immature teratomas were reviewed retrospectively. In patients whose plasma alpha-fetoprotein (AFP) and beta-human chorionic gonadotropin (beta-HCG) were determined, AFP and beta-HCG were elevated in 57.1 and 16.7% of the cases, respectively. All patients received surgical treatment. The tumor was totally removed in 12 cases, subtotally in 2, and partially in 1 case. After surgery, of the 15 patients, 9 received radiotherapy, 4 gamma knife surgery and 7 chemotherapy. Thirteen patients were followed up. Compared to the common 5-year survival rate of 40%, in patients who received gamma knife surgery, the 5-year survival rate after surgery was 100%, which is better than the 5-year survival rate of patients who did not receive gamma knife surgery (p = 0.0049). Postoperative radiotherapy and chemical therapy had no significant impact on the 5-year survival rate (p > 0.05). The prognosis of intracranial immature teratomas is poor. The detection of their clinical manifestation, the analysis of imaging features and the serum levels of tumor markers are helpful in diagnosing intracranial teratomas. The total removal of the tumor is important to cure the disease. We did not see a difference in outcome between patients who received postoperative chemotherapy or radiotherapy and those who did not. Regular follow-up MRI examinations are necessary so that the conditions of the patients can be closely monitored. If a patient has residual or recurrent tumor after surgery, gamma knife surgery can be effective. Copyright 2009 S. Karger AG, Basel.

  4. The Maturely, Immature Orientale Impact Basin

    NASA Astrophysics Data System (ADS)

    Cahill, J. T.; Lawrence, D. J.; Stickle, A. M.; Delen, O.; Patterson, G.; Greenhagen, B. T.

    2015-12-01

    Lunar surface maturity is consistently examined using the NIR optical maturity parameter (OMAT) [1]. However, the NIR only provides a perspective of the upper microns of the lunar surface. Recent studies of Lunar Prospector (LP) and Lunar Reconnaissance Orbiter data sets are now demonstrating additional measures of maturity with sensitivities to greater depths (~2 m) in the regolith. These include thermal infrared, S-band radar, and epithermal neutron data sets [2-4]. Interestingly, each of these parameters is directly comparable to OMAT despite each measuring slightly different aspects of the regolith. This is demonstrated by Lawrence et al. [3] where LP-measured non-polar highlands epithermal neutrons trend well with albedo, OMAT, and the Christensen Feature (CF). Lawrence et al. [3] used these data to derive and map highlands hydrogen (H) which is dominantly a function of H-implantation. With this in mind, areas of enriched-H are mature, while areas of depleted H are immature. Surface roughness as measured by S-band radar [4], also provides a measure of maturity. In this case, the circular polarization ratio (CPR) is high when rough and immature, and low when smooth and mature. Knowing this, one can recognize areas in the non-polar lunar highlands that show contradictory measures of maturity. For example, while many lunar localities show consistently immature albedo, OMAT, CF, CPR, and H concentrations (e.g., Tycho), others do not. Orientale basin is the most prominent example, shown to have immature CPR, CF, and H concentrations despite a relatively mature albedo and OMAT values as well as an old age determination (~3.8 Ga). To better understand how the lunar regolith is weathering in the upper 1-2 m of regolith with time we examine the Orientale basin relative to other highlands regions. [1] Lucey et al. (2000) JGR, 105, 20377; [2] Lucey et al. (2013) LPSC, 44, 2890; [3] Lawrence et al. (2015) Icarus, j.icarus.2015.01.005; [4] Neish et al. (2013) JGR, 118

  5. Retrospective analysis of hepatitis B virus chronic infection in 247 patients: clinical stages, response to treatment and poor prognostic factors.

    PubMed

    Cunha-Silva, Marlone; Marinho, Fábio R T; Oliveira, Paulo F; Lopes, Tirzah M; Sevá-Pereira, Tiago; Lorena, Sonia L S; Almeida, Jazon R S

    Chronic hepatitis B is a major cause of cirrhosis, and the natural history of the disease has several clinical stages that should be thoroughly understood for the implementation of proper treatment. Nonetheless, curing the disease with antiviral treatment remains a challenge. To describe the clinical course, response to treatment, and poor prognostic factors in 247 hepatitis B virus chronic infection patients treated in a tertiary hospital in Brazil. This was a retrospective and observational study, by analyzing the medical records of HBV infected patients between January 2000 and January 2015. Most patients were male (67.2%) and 74.1% were HBeAg negative. Approximately 41% had cirrhosis and 8.5% were hepatitis C virus coinfected. The viral load was negative after two years on lamivudine, entecavir and tenofovir in 86%, 90.6%, and 92.9% of the patients, respectively. The five-year resistance rates for lamivudine, adefovir, entecavir, and tenofovir were 57.5%, 51.8%, 1.9%, and 0%, respectively. The overall seroconversion rates were 31.2% for HBeAg and 9.4% for HBsAg. Hepatocellular carcinoma was diagnosed in 9.7% of patients, liver transplantation was performed in 9.7%, and overall mortality was 10.5%. Elevations of serum alanine aminotransferase (p=0.0059) and viral load (p<0.0001) were associated with progression to liver cirrhosis. High viral load was associated with progression to hepatocellular carcinoma (p<0.0001). Significant risk factors associated with death were elevated alanine aminotransferase (p=0.0039), liver cirrhosis (p<0.0001), high viral load (p=0.007), and hepatocellular carcinoma (p=0.0008). HBeAg positive status was not associated with worse outcomes, and treatment may have been largely responsible. Elevations of viral load and serum alanine aminotransferase may select patients with worse prognosis, especially progression to cirrhosis and hepatocellular carcinoma, which were strongly association with death. Copyright © 2017 Sociedade Brasileira

  6. Long-Term Relationships: the Complicated Interplay between the Host and the Developmental Stages of Toxoplasma gondii during Acute and Chronic Infections

    PubMed Central

    Pittman, Kelly J.

    2015-01-01

    SUMMARY Toxoplasma gondii represents one of the most common parasitic infections in the world. The asexual cycle can occur within any warm-blooded animal, but the sexual cycle is restricted to the feline intestinal epithelium. T. gondii is acquired through consumption of tissue cysts in undercooked meat as well as food and water contaminated with oocysts. Once ingested, it differentiates into a rapidly replicating asexual form and disseminates throughout the body during acute infection. After stimulation of the host immune response, T. gondii differentiates into a slow-growing, asexual cyst form that is the hallmark of chronic infection. One-third of the human population is chronically infected with T. gondii cysts, which can reactivate and are especially dangerous to individuals with reduced immune surveillance. Serious complications can also occur in healthy individuals if infected with certain T. gondii strains or if infection is acquired congenitally. No drugs are available to clear the cyst form during the chronic stages of infection. This therapeutic gap is due in part to an incomplete understanding of both host and pathogen responses during the progression of T. gondii infection. While many individual aspects of T. gondii infection are well understood, viewing the interconnections between host and parasite during