Science.gov

Sample records for inheritance cpg site

  1. Collaboration between CpG sites is needed for stable somatic inheritance of DNA methylation states

    PubMed Central

    Haerter, Jan O.; Lövkvist, Cecilia; Dodd, Ian B.; Sneppen, Kim

    2014-01-01

    Inheritance of 5-methyl cytosine modification of CpG (CG/CG) DNA sequences is needed to maintain early developmental decisions in vertebrates. The standard inheritance model treats CpGs as independent, with methylated CpGs maintained by efficient methylation of hemimethylated CpGs produced after DNA replication, and unmethylated CpGs maintained by an absence of de novo methylation. By stochastic simulations of CpG islands over multiple cell cycles and systematic sampling of reaction parameters, we show that the standard model is inconsistent with many experimental observations. In contrast, dynamic collaboration between CpGs can provide strong error-tolerant somatic inheritance of both hypermethylated and hypomethylated states of a cluster of CpGs, reproducing observed stable bimodal methylation patterns. Known recruitment of methylating enzymes by methylated CpGs could provide the necessary collaboration, but we predict that recruitment of demethylating enzymes by unmethylated CpGs strengthens inheritance and allows CpG islands to remain hypomethylated within a sea of hypermethylation. PMID:24288373

  2. Collaboration between CpG sites is needed for stable somatic inheritance of DNA methylation states.

    PubMed

    Haerter, Jan O; Lövkvist, Cecilia; Dodd, Ian B; Sneppen, Kim

    2014-02-01

    Inheritance of 5-methyl cytosine modification of CpG (CG/CG) DNA sequences is needed to maintain early developmental decisions in vertebrates. The standard inheritance model treats CpGs as independent, with methylated CpGs maintained by efficient methylation of hemimethylated CpGs produced after DNA replication, and unmethylated CpGs maintained by an absence of de novo methylation. By stochastic simulations of CpG islands over multiple cell cycles and systematic sampling of reaction parameters, we show that the standard model is inconsistent with many experimental observations. In contrast, dynamic collaboration between CpGs can provide strong error-tolerant somatic inheritance of both hypermethylated and hypomethylated states of a cluster of CpGs, reproducing observed stable bimodal methylation patterns. Known recruitment of methylating enzymes by methylated CpGs could provide the necessary collaboration, but we predict that recruitment of demethylating enzymes by unmethylated CpGs strengthens inheritance and allows CpG islands to remain hypomethylated within a sea of hypermethylation.

  3. Collaborations between CpG sites in DNA methylation

    NASA Astrophysics Data System (ADS)

    Song, You; Ren, Honglei; Lei, Jinzhi

    2017-08-01

    DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

  4. DNA methylation in human epigenomes depends on local topology of CpG sites

    PubMed Central

    Lövkvist, Cecilia; Dodd, Ian B.; Sneppen, Kim; Haerter, Jan O.

    2016-01-01

    In vertebrates, methylation of cytosine at CpG sequences is implicated in stable and heritable patterns of gene expression. The classical model for inheritance, in which individual CpG sites are independent, provides no explanation for the observed non-random patterns of methylation. We first investigate the exact topology of CpG clustering in the human genome associated to CpG islands. Then, by pooling genomic CpG clusters on the basis of short distances between CpGs within and long distances outside clusters, we show a strong dependence of methylation on the number and density of CpG organization. CpG clusters with fewer, or less densely spaced, CpGs are predominantly hyper-methylated, while larger clusters are predominantly hypo-methylated. Intermediate clusters, however, are either hyper- or hypo-methylated but are rarely found in intermediate methylation states. We develop a model for spatially-dependent collaboration between CpGs, where methylated CpGs recruit methylation enzymes that can act on CpGs over an extended local region, while unmethylated CpGs recruit demethylation enzymes that act more strongly on nearby CpGs. This model can reproduce the effects of CpG clustering on methylation and produces stable and heritable alternative methylation states of CpG clusters, thus providing a coherent model for methylation inheritance and methylation patterning. PMID:26932361

  5. DNA methylation in human epigenomes depends on local topology of CpG sites.

    PubMed

    Lövkvist, Cecilia; Dodd, Ian B; Sneppen, Kim; Haerter, Jan O

    2016-06-20

    In vertebrates, methylation of cytosine at CpG sequences is implicated in stable and heritable patterns of gene expression. The classical model for inheritance, in which individual CpG sites are independent, provides no explanation for the observed non-random patterns of methylation. We first investigate the exact topology of CpG clustering in the human genome associated to CpG islands. Then, by pooling genomic CpG clusters on the basis of short distances between CpGs within and long distances outside clusters, we show a strong dependence of methylation on the number and density of CpG organization. CpG clusters with fewer, or less densely spaced, CpGs are predominantly hyper-methylated, while larger clusters are predominantly hypo-methylated. Intermediate clusters, however, are either hyper- or hypo-methylated but are rarely found in intermediate methylation states. We develop a model for spatially-dependent collaboration between CpGs, where methylated CpGs recruit methylation enzymes that can act on CpGs over an extended local region, while unmethylated CpGs recruit demethylation enzymes that act more strongly on nearby CpGs. This model can reproduce the effects of CpG clustering on methylation and produces stable and heritable alternative methylation states of CpG clusters, thus providing a coherent model for methylation inheritance and methylation patterning.

  6. Prognostic Value of PLAGL1-Specific CpG Site Methylation in Soft-Tissue Sarcomas

    PubMed Central

    Peille, Anne-Lise; Brouste, Veronique; Kauffmann, Audrey; Lagarde, Pauline; Le Morvan, Valerie; Coindre, Jean-Michel; Chibon, Frederic; Bresson-Bepoldin, Laurence

    2013-01-01

    Soft tissue sarcomas (STS) are rare, complex tumors with a poor prognosis. The identification of new prognostic biomarkers is needed to improve patient management. Our aim was to determine the methylation status of the 118 CpG sites in the PLAGL1 tumor-suppressor gene P1 CpG island promoter and study the potential prognostic impact of PLAGL1 promoter methylation CpG sites in STS. Training cohorts constituted of 28 undifferentiated sarcomas (US) and 35 leiomyosarcomas (LMS) were studied. PLAGL1 mRNA expression was investigated by microarray analysis and validated by RT-qPCR. Pyrosequencing was used to analyze quantitative methylation of the PLAGL1 promoter. Associations between global promoter or specific CpG site methylation and mRNA expression were evaluated using Pearson’s product moment correlation coefficient. Cox univariate and multivariate proportional hazard models were used to assess the predictive power of CpG site methylation status. Sixteen CpG sites associated with PLAGL1 mRNA expression were identified in US and 6 in LMS. Statistical analyses revealed an association between CpG107 methylation status and both overall and metastasis-free survival in US, which was confirmed in a validation cohort of 37 US. The exhaustive study of P1 PLAGL1 promoter methylation identified a specific CpG site methylation correlated with mRNA expression, which was predictive for both metastasis-free and overall survival and may constitute the first US-specific biomarker. Such a biomarker may be relevant for identifying patients likely to derive greater benefit from treatment. PMID:24260468

  7. Analysis of CpG methylation sites and CGI among human papillomavirus DNA genomes

    PubMed Central

    2011-01-01

    Background The Human Papillomavirus (HPV) genome is divided into early and late coding sequences, including 8 open reading frames (ORFs) and a regulatory region (LCR). Viral gene expression may be regulated through epigenetic mechanisms, including cytosine methylation at CpG dinucleotides. We have analyzed the distribution of CpG sites and CpG islands/clusters (CGI) among 92 different HPV genomes grouped in function of their preferential tropism: cutaneous or mucosal. We calculated the proportion of CpG sites (PCS) for each ORF and calculated the expected CpG values for each viral type. Results CpGs are underrepresented in viral genomes. We found a positive correlation between CpG observed and expected values, with mucosal high-risk (HR) virus types showing the smallest O/E ratios. The ranges of the PCS were similar for most genomic regions except E4, where the majority of CpGs are found within islands/clusters. At least one CGI belongs to each E2/E4 region. We found positive correlations between PCS for each viral ORF when compared with the others, except for the LCR against four ORFs and E6 against three other ORFs. The distribution of CpG islands/clusters among HPV groups is heterogeneous and mucosal HR-HPV types exhibit both lower number and shorter island sizes compared to cutaneous and mucosal Low-risk (LR) HPVs (all of them significantly different). Conclusions There is a difference between viral and cellular CpG underrepresentation. There are significant correlations between complete genome PCS and a lack of correlations between several genomic region pairs, especially those involving LCR and E6. L2 and L1 ORF behavior is opposite to that of oncogenes E6 and E7. The first pair possesses relatively low numbers of CpG sites clustered in CGIs while the oncogenes possess a relatively high number of CpG sites not associated to CGIs. In all HPVs, E2/E4 is the only region with at least one CGI and shows a higher content of CpG sites in every HPV type with an

  8. Retrotransposition creates sloping shores: a graded influence of hypomethylated CpG islands on flanking CpG sites.

    PubMed

    Grandi, Fiorella C; Rosser, James M; Newkirk, Simon J; Yin, Jun; Jiang, Xiaoling; Xing, Zhuo; Whitmore, Leanne; Bashir, Sanum; Ivics, Zoltán; Izsvák, Zsuzsanna; Ye, Ping; Yu, Y Eugene; An, Wenfeng

    2015-08-01

    Long interspersed elements (LINEs), through both self-mobilization and trans-mobilization of short interspersed elements and processed pseudogenes, have made an indelible impact on the structure and function of the human genome. One consequence is the creation of new CpG islands (CGIs). In fact, more than half of all CGIs in the genome are associated with repetitive DNA, three-quarters of which are derived from retrotransposons. However, little is known about the epigenetic impact of newly inserted CGIs. We utilized a transgenic LINE-1 mouse model and tracked DNA methylation dynamics of individual germline insertions during mouse development. The retrotransposed GFP marker sequence, a strong CGI, is hypomethylated in male germ cells but hypermethylated in somatic tissues, regardless of genomic location. The GFP marker is similarly methylated when delivered into the genome via the Sleeping Beauty DNA transposon, suggesting that the observed methylation pattern may be independent of the mode of insertion. Comparative analyses between insertion- and non-insertion-containing alleles further reveal a graded influence of the retrotransposed CGI on flanking CpG sites, a phenomenon that we described as "sloping shores." Computational analyses of human and mouse methylomic data at single-base resolution confirm that sloping shores are universal for hypomethylated CGIs in sperm and somatic tissues. Additionally, the slope of a hypomethylated CGI can be affected by closely positioned CGI neighbors. Finally, by tracing sloping shore dynamics through embryonic and germ cell reprogramming, we found evidence of bookmarking, a mechanism that likely determines which CGIs will be eventually hyper- or hypomethylated.

  9. Genome wide classification and characterisation of CpG sites in cancer and normal cells.

    PubMed

    Ghorbani, Mohammadmersad; Themis, Michael; Payne, Annette

    2016-01-01

    This study identifies common methylation patterns across different cancer types in an effort to identify common molecular events in diverse types of cancer cells and provides evidence for the sequence surrounding a CpG to influence its susceptibility to aberrant methylation. CpG sites throughout the genome were divided into four classes: sites that either become hypo or hyper-methylated in a variety cancers using all the freely available microarray data (HypoCancer and HyperCancer classes) and those found in a constant hypo (Never methylated class) or hyper-methylated (Always methylated class) state in both normal and cancer cells. Our data shows that most CpG sites included in the HumanMethylation450K microarray remain unmethylated in normal and cancerous cells; however, certain sites in all the cancers investigated become specifically modified. More detailed analysis of the sites revealed that majority of those in the never methylated class were in CpG islands whereas those in the HyperCancer class were mostly associated with miRNA coding regions. The sites in the Hypermethylated class are associated with genes involved in initiating or maintaining the cancerous state, being enriched for processes involved in apoptosis, and with transcription factors predicted to bind to these genes linked to apoptosis and tumourgenesis (notably including E2F). Further we show that more LINE elements are associated with the HypoCancer class and more Alu repeats are associated with the HyperCancer class. Motifs that classify the classes were identified to distinguish them based on the surrounding DNA sequence alone, and for the identification of DNA sequences that could render sites more prone to aberrant methylation in cancer cells. This provides evidence that the sequence surrounding a CpG site has an influence on whether a site is hypo or hyper methylated.

  10. Aberrant Methylation of Gene Associated CpG Sites Occurs in Borderline Personality Disorder

    PubMed Central

    Künzel, Natascha; Schmidt, Christian; Kiehl, Steffen; Dammann, Gerhard; Dammann, Reinhard

    2013-01-01

    Borderline personality disorder (BPD) is a complex psychiatric disease with an increased impact in the last years. While the diagnosis and therapy are well established, little is known on the pathogenesis of borderline personality disorder. Previously, a significant increase in DNA methylation of relevant neuropsychiatric genes in BPD patients has been reported. In our study we performed genome wide methylation analysis and revealed specific CpG sites that exhibited increased methylation in 24 female BPD patients compared to 11 female healthy controls. Bead chip technology and quantitative bisulfite pyrosequencing showed a significantly increased methylation at CpG sites of APBA2 (1.1 fold) and APBA3 (1.1 fold), KCNQ1 (1.5 fold), MCF2 (1.1 fold) and NINJ2 (1.2 fold) in BPD patients. For the CpG sites of GATA4 and HLCS an increase in DNA methylation was observed, but was only significant in the bead chip assay. Moreover genome wide methylation levels of blood samples of BPD patients and control samples are similar. In summary, our results show a significant 1.26 fold average increase in methylation at the analyzed gene associated CpG sites in the blood of BPD patients compared to controls samples (p<0.001). This data may provide new insights into epigenetic mechanisms underlying the pathogenesis of BPD. PMID:24367640

  11. CpG island hypermethylation at multiple gene sites in diagnosis and prognosis of prostate cancer.

    PubMed

    Ellinger, Jörg; Bastian, Patrick J; Jurgan, Thomas; Biermann, Katharina; Kahl, Philip; Heukamp, Lukas C; Wernert, Nicolas; Müller, Stefan C; von Ruecker, Alexander

    2008-01-01

    CpG island hypermethylation causes gene silencing and could be decisive in prostate carcinogenesis and progression. We investigated its role at multiple gene sites during prostate carcinogenesis. A quantitative, methylation-specific polymerase chain reaction was used to analyze the hypermethylation patterns at nine gene loci (Annexin2, APC, EDNRB, GSTP1, PTGS2, MDR1, RARbeta, Reprimo, and TIG1) in 80 patients with prostate cancer (PCa) and 26 patients with benign prostatic hyperplasia (BPH). Hypermethylation was more frequent in PCa than in BPH tissues (EDNRB, 100% versus 88%; TIG1, 96% versus 12%; RARbeta, 95% versus 35%; GSTP1, 93% versus 15%; APC, 80% versus 50%; MDR1, 80% versus 31%; PTGS2, 68% versus 15%; Reprimo, 59% versus 19%; and Annexin2, 4% versus 0%). TIG1 and GSTP1 hypermethylation distinguished between PCa and BPH with a specificity of greater than 85% and sensitivity of greater than 93%. Hypermethylation at a single gene locus did not correlate with any clinicopathologic variables. In contrast, hypermethylation at two genes (eg, APC and TIG1, APC and GSTP1, APC and PTGS2, APC or MDR, GSTP1 or PTGS2) correlated significantly with the pathologic stage and/or Gleason score (P = 0.033 to 0.045). Hypermethylation at APC and Reprimo, as well as DNA hypermethylation at more than five genes, correlated significantly with the rate of prostate-specific antigen recurrence after radical prostatectomy (P = 0.0078 and P = 0.0074, respectively). Our results have confirmed that the hypermethylation patterns are helpful in the diagnosis and prognosis of PCa. Increases in CpG island hypermethylation at multiple gene sites occur during PCa progression and indicate early biochemical recurrence after radical prostatectomy.

  12. CpG site DNA methylation patterns reveal a novel regulatory element in the mouse prion protein gene

    PubMed Central

    DALAI, Wuyun; MATSUO, Eiko; TAKEYAMA, Natsumi; KAWANO, Junichi; SAEKI, Keiichi

    2016-01-01

    The cellular isoform of the prion protein (PrPC) plays critical roles in the development of prion disorders. Although PrP mRNA is ubiquitously present in a tissue-specific manner, the DNA methylation of PrP gene (Prnp) is still unknown. In this study, we demonstrated that the CpG island (CGI, positioned at −218 to +152 bp from the transcriptional start site) including the Prnp core promoter region was completely unmethylated in all tested tissues. On the other hand, CpG methylation in the CGI shore region (positioned at −599 to −238 bp) occurred in various tissue- and site-specific proportions. Interestingly, the correlation analysis between CpG methylation status and PrP mRNA levels showed that one CpG site methylation at −576 was negatively correlated with the PrP mRNA level (Pearson’s r = −0.374, P=0.035). Taken together, our results suggest that Prnp is a typical housekeeping gene and various methylation frequencies of the CGI shore region are likely to affect Prnp expression in a tissue-specific manner. PMID:27666463

  13. CpG Sites Associated with Cigarette Smoking: Analysis of Epigenome-Wide Data from the Sister Study

    PubMed Central

    Harlid, Sophia; Xu, Zongli; Panduri, Vijayalakshmi; Sandler, Dale P.

    2014-01-01

    Background: Smoking increases the risk of many diseases, and it is also linked to blood DNA methylation changes that may be important in disease etiology. Objectives: We sought to identify novel CpG sites associated with cigarette smoking. Methods: We used two epigenome-wide data sets from the Sister Study to identify and confirm CpG sites associated with smoking. One included 908 women with methylation measurements at 27,578 CpG sites using the HumanMethylation27 BeadChip; the other included 200 women with methylation measurements for 473,844 CpG sites using the HumanMethylation450 BeadChip. Significant CpGs from the second data set that were not included in the 27K assay were validated by pyrosequencing in a subset of 476 samples from the first data set. Results: Our study successfully confirmed smoking associations for 9 previously established CpGs and identified 2 potentially novel CpGs: cg26764244 in GNG12 (p = 9.0 × 10–10) and cg22335340 in PTPN6 (p = 2.9 × 10–05). We also found strong evidence of an association between smoking status and cg02657160 in CPOX (p = 7.3 × 10–7), which has not been previously reported. All 12 CpGs were undermethylated in current smokers and showed an increasing percentage of methylation in former and never-smokers. Conclusions: We identified 2 potentially novel smoking related CpG sites, and provided independent replication of 10 previously reported CpGs sites related to smoking, one of which is situated in the gene CPOX. The corresponding enzyme is involved in heme biosynthesis, and smoking is known to increase heme production. Our study extends the evidence base for smoking-related changes in DNA methylation. Citation: Harlid S, Xu Z, Panduri V, Sandler DP, Taylor JA. 2014. CpG sites associated with cigarette smoking: analysis of epigenome-wide data from the Sister Study. Environ Health Perspect 122:673–678; http://dx.doi.org/10.1289/ehp.1307480 PMID:24704585

  14. Epigenetic regulation of OAS2 shows disease-specific DNA methylation profiles at individual CpG sites

    PubMed Central

    Gu, Xiaolian; Boldrup, Linda; Coates, Philip J.; Fahraeus, Robin; Nylander, Elisabet; Loizou, Christos; Olofsson, Katarina; Norberg-Spaak, Lena; Gärskog, Ola; Nylander, Karin

    2016-01-01

    Epigenetic modifications are essential regulators of biological processes. Decreased DNA methylation of OAS2 (2′-5′-Oligoadenylate Synthetase 2), encoding an antiviral protein, has been seen in psoriasis. To provide further insight into the epigenetic regulation of OAS2, we performed pyrosequencing to detect OAS2 DNA methylation status at 11 promoter and first exon located CpG sites in psoriasis (n = 12) and two common subtypes of squamous cell carcinoma (SCC) of the head and neck: tongue (n = 12) and tonsillar (n = 11). Compared to corresponding controls, a general hypomethylation was seen in psoriasis. In tongue and tonsillar SCC, hypomethylation was found at only two CpG sites, the same two sites that were least demethylated in psoriasis. Despite differences in the specific residues targeted for methylation/demethylation, OAS2 expression was upregulated in all conditions and correlations between methylation and expression were seen in psoriasis and tongue SCC. Distinctive methylation status at four successively located CpG sites within a genomic area of 63 bp reveals a delicately integrated epigenetic program and indicates that detailed analysis of individual CpGs provides additional information into the mechanisms of epigenetic regulation in specific disease states. Methylation analyses as clinical biomarkers need to be tailored according to disease-specific sites. PMID:27572959

  15. DNA methylation levels at individual age-associated CpG sites can be indicative for life expectancy.

    PubMed

    Lin, Qiong; Weidner, Carola I; Costa, Ivan G; Marioni, Riccardo E; Ferreira, Marcelo R P; Deary, Ian J; Wagner, Wolfgang

    2016-02-01

    DNA-methylation (DNAm) levels at age-associated CpG sites can be combined into epigenetic aging signatures to estimate donor age. It has been demonstrated that the difference between such epigenetic age-predictions and chronological age is indicative for of all-cause mortality in later life. In this study, we tested alternative epigenetic signatures and followed the hypothesis that even individual age-associated CpG sites might be indicative for life-expectancy. Using a 99-CpG aging model, a five-year higher age-prediction was associated with 11% greater mortality risk in DNAm profiles of the Lothian Birth Cohort 1921 study. However, models based on three CpGs, or even individual CpGs, generally revealed very high offsets in age-predictions if applied to independent microarray datasets. On the other hand, we demonstrate that DNAm levels at several individual age-associated CpGs seem to be associated with life expectancy - e.g., at CpGs associated with the genesPDE4C and CLCN6. Our results support the notion that small aging signatures should rather be analysed by more quantitative methods, such as site-specific pyrosequencing, as the precision of age-predictions is rather low on independent microarray datasets. Nevertheless, the results hold the perspective that simple epigenetic biomarkers, based on few or individual age-associated CpGs, could assist the estimation of biological age.

  16. Methylation of CpG sites in BCL2 major breakpoint region and the increase of BCL2/JH translocation with aging.

    PubMed

    Martin-Guerrero, Idoia; de Prado, Elena; Ardanaz, Maite; Martin-Arruti, Maialen; Garcia-Orad, Cristina; Guerra, Isabel; Ruiz, Irune; Zabalza, Iñaki; Garcia-Orad, Africa

    2015-10-01

    The BCL2 breakage mechanism has been shown to be highly dependent on DNA methylation at the major breakpoint region (MBR) CpG sites. We recently described an increased frequency of BCL2/ JH translocation with aging. It is known that methylation levels change with aging. The present study aimed to determine whether methylation alterations at CpG sites of BCL2 MBR were the cause of increased breakages with aging. We analyzed the methylation levels of three CpG sites on the region by pyrosequencing and studied if methylation levels and/or polymorphisms affecting CpG sites were associated with an increase of translocations. We observed that although the methylation levels of MBR CpG sites were higher in individuals with BCL2/JH translocation, in contrast to our expectations, these levels decreased with the age. Moreover, we show that polymorphisms at those CpG sites leading to absence of methylation seem to be a protective factor for the apparition of translocations.

  17. Activation induced deaminase mutational signature overlaps with CpG methylation sites in follicular lymphoma and other cancers

    PubMed Central

    Rogozin, Igor B.; Lada, Artem G.; Goncearenco, Alexander; Green, Michael R.; De, Subhajyoti; Nudelman, German; Panchenko, Anna R.; Koonin, Eugene V.; Pavlov, Youri I.

    2016-01-01

    Follicular lymphoma (FL) is an uncurable cancer characterized by progressive severity of relapses. We analyzed sequence context specificity of mutations in the B cells from a large cohort of FL patients. We revealed substantial excess of mutations within a novel hybrid nucleotide motif: the signature of somatic hypermutation (SHM) enzyme, Activation Induced Deaminase (AID), which overlaps the CpG methylation site. This finding implies that in FL the SHM machinery acts at genomic sites containing methylated cytosine. We identified the prevalence of this hybrid mutational signature in many other types of human cancer, suggesting that AID-mediated, CpG-methylation dependent mutagenesis is a common feature of tumorigenesis. PMID:27924834

  18. Activation induced deaminase mutational signature overlaps with CpG methylation sites in follicular lymphoma and other cancers.

    PubMed

    Rogozin, Igor B; Lada, Artem G; Goncearenco, Alexander; Green, Michael R; De, Subhajyoti; Nudelman, German; Panchenko, Anna R; Koonin, Eugene V; Pavlov, Youri I

    2016-12-07

    Follicular lymphoma (FL) is an uncurable cancer characterized by progressive severity of relapses. We analyzed sequence context specificity of mutations in the B cells from a large cohort of FL patients. We revealed substantial excess of mutations within a novel hybrid nucleotide motif: the signature of somatic hypermutation (SHM) enzyme, Activation Induced Deaminase (AID), which overlaps the CpG methylation site. This finding implies that in FL the SHM machinery acts at genomic sites containing methylated cytosine. We identified the prevalence of this hybrid mutational signature in many other types of human cancer, suggesting that AID-mediated, CpG-methylation dependent mutagenesis is a common feature of tumorigenesis.

  19. A simple algorithm for quantifying DNA methylation levels on multiple independent CpG sites in bisulfite genomic sequencing electropherograms

    PubMed Central

    Leakey, Tatiana I.; Zielinski, Jerzy; Siegfried, Rachel N.; Siegel, Eric R.; Fan, Chun-Yang; Cooney, Craig A.

    2008-01-01

    DNA methylation at cytosines is a widely studied epigenetic modification. Methylation is commonly detected using bisulfite modification of DNA followed by PCR and additional techniques such as restriction digestion or sequencing. These additional techniques are either laborious, require specialized equipment, or are not quantitative. Here we describe a simple algorithm that yields quantitative results from analysis of conventional four-dye-trace sequencing. We call this method Mquant and we compare it with the established laboratory method of combined bisulfite restriction assay (COBRA). This analysis of sequencing electropherograms provides a simple, easily applied method to quantify DNA methylation at specific CpG sites. PMID:18480118

  20. A simple algorithm for quantifying DNA methylation levels on multiple independent CpG sites in bisulfite genomic sequencing electropherograms.

    PubMed

    Leakey, Tatiana I; Zielinski, Jerzy; Siegfried, Rachel N; Siegel, Eric R; Fan, Chun-Yang; Cooney, Craig A

    2008-06-01

    DNA methylation at cytosines is a widely studied epigenetic modification. Methylation is commonly detected using bisulfite modification of DNA followed by PCR and additional techniques such as restriction digestion or sequencing. These additional techniques are either laborious, require specialized equipment, or are not quantitative. Here we describe a simple algorithm that yields quantitative results from analysis of conventional four-dye-trace sequencing. We call this method Mquant and we compare it with the established laboratory method of combined bisulfite restriction assay (COBRA). This analysis of sequencing electropherograms provides a simple, easily applied method to quantify DNA methylation at specific CpG sites.

  1. CpG sites with continuously increasing or decreasing methylation from early to late human fetal brain development.

    PubMed

    Schneider, Eberhard; Dittrich, Marcus; Böck, Julia; Nanda, Indrajit; Müller, Tobias; Seidmann, Larissa; Tralau, Tim; Galetzka, Danuta; El Hajj, Nady; Haaf, Thomas

    2016-10-30

    Normal human brain development is dependent on highly dynamic epigenetic processes for spatial and temporal gene regulation. Recent work identified wide-spread changes in DNA methylation during fetal brain development. We profiled CpG methylation in frontal cortex of 27 fetuses from gestational weeks 12-42, using Illumina 450K methylation arrays. Sites showing genome-wide significant correlation with gestational age were compared to a publicly available data set from gestational weeks 3-26. Altogether, we identified 2016 matching developmentally regulated differentially methylated positions (m-dDMPs): 1767m-dDMPs were hypermethylated and 1149 hypomethylated during fetal development. M-dDMPs are underrepresented in CpG islands and gene promoters, and enriched in gene bodies. They appear to cluster in certain chromosome regions. M-dDMPs are significantly enriched in autism-associated genes and CpGs. Our results promote the idea that reduced methylation dynamics during fetal brain development may predispose to autism. In addition, m-dDMPs are enriched in genes with human-specific brain expression patterns and/or histone modifications. Collectively, we defined a subset of dDMPs exhibiting constant methylation changes from early to late pregnancy. The same epigenetic mechanisms involving methylation changes in cis-regulatory regions may have been adopted for human brain evolution and ontogeny. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Methylation and sequence analysis around EagI sites: identification of 28 new CpG islands in XQ24-XQ28.

    PubMed Central

    Tribioli, C; Tamanini, F; Patrosso, C; Milanesi, L; Villa, A; Pergolizzi, R; Maestrini, E; Rivella, S; Bione, S; Mancini, M

    1992-01-01

    Thirty-two probes for CpG islands of the distal long arm of the human X chromosome have been identified. From a genomic library of DNA of the hamster-human cell hybrid X3000.1 digested with the rare cutter restriction enzyme EagI, 53 different human clones have been isolated and characterized by methylation and sequence analysis. The characteristic pattern of DNA methylation of CpG islands at the 5' end of genes of the X chromosome has been used to distinguish between EagI sites in CpG islands versus isolated EagI sites. The sequence analysis has confirmed and completed the characterization showing that sequences at the 5' end of known genes were among the clones defined CpG islands and that the non-CpG islands clones were mostly repetitive sequences with a non-methylated or variably methylated EagI site. Thus, since clones corresponding to repetitive sequences can be easily identified by sequencing, such libraries are a very good source of CpG islands. The methylation analysis of 28 different new probes allows to state that demethylation of CpG islands of the active X and methylation of those on the inactive X chromosome are the general rule. Moreover, the finding, in all instances, of methylation differences between male and female DNA is in very strong support of the notion that most genes of the distal long arm of the X chromosome are subject to X inactivation. Images PMID:1542569

  3. Methylation status of individual CpG sites within Alu elements in the human genome and Alu hypomethylation in gastric carcinomas

    PubMed Central

    2010-01-01

    Background Alu methylation is correlated with the overall level of DNA methylation and recombination activity of the genome. However, the maintenance and methylation status of each CpG site within Alu elements (Alu) and its methylation status have not well characterized. This information is useful for understanding natural status of Alu in the genome and helpful for developing an optimal assay to quantify Alu hypomethylation. Methods Bisulfite clone sequencing was carried out in 14 human gastric samples initially. A Cac8I COBRA-DHPLC assay was developed to detect methylated-Alu proportion in cell lines and 48 paired gastric carcinomas and 55 gastritis samples. DHPLC data were statistically interpreted using SPSS version 16.0. Results From the results of 427 Alu bisulfite clone sequences, we found that only 27.2% of CpG sites within Alu elements were preserved (4.6 of 17 analyzed CpGs, A ~ Q) and that 86.6% of remaining-CpGs were methylated. Deamination was the main reason for low preservation of methylation targets. A high correlation coefficient of methylation was observed between Alu clones and CpG site J (0.963), A (0.950), H (0.946), D (0.945). Comethylation of the sites H and J were used as an indicator of the proportion of methylated-Alu in a Cac8I COBRA-DHPLC assay. Validation studies showed that hypermethylation or hypomethylation of Alu elements in human cell lines could be detected sensitively by the assay after treatment with 5-aza-dC and M.SssI, respectively. The proportion of methylated-Alu copies in gastric carcinomas (3.01%) was significantly lower than that in the corresponding normal samples (3.19%) and gastritis biopsies (3.23%). Conclusions Most Alu CpG sites are deaminated in the genome. 27% of Alu CpG sites represented in our amplification products. 87% of the remaining CpG sites are methylated. Alu hypomethylation in primary gastric carcinomas could be detected with the Cac8I COBRA-DHPLC assay quantitatively. PMID:20163738

  4. Detection of Turner syndrome using X-chromosome inactivation specific differentially methylated CpG sites: A pilot study.

    PubMed

    Zhang, Qiang; Guo, Xiaohong; Tian, Tian; Wang, Teng; Li, Qiaoli; Wang, Lei; Liu, Yun; Xing, Qinghe; He, Lin; Zhao, Xinzhi

    2017-05-01

    Early diagnosis of Turner syndrome (TS) may improve preventive measures and treatment. X-chromosome inactivation specific differentially methylated CpG sites (XIDMSs) that are high methylated in inactive X chromosomes (Xi) and unmethylated in active X chromosomes (Xa) may be potential makers for TS detection. The candidate XIDMSs were screened from 9 male and 12 female DNA samples with normal karyotypes using the Illumina 450k array and validated by bisulfite sequencing PCR and pyrosequencing assay. X chromosome dosage was calculated according to the methylation level of multiple XIDMSs. Overall, 108 candidate XIDMSs were screened by the 450k array. Validations indicated that XIDMSs gathered and formed the X-chromosome inactivation specific differentially methylated regions (XIDMRs). Using 3 XIDMRs at SAT1, UXT and UTP14A loci, 36 TS, 22 normal female and 6 male samples were analyzed. Methylation levels of the 20 XIDMSs in the XIDMRs could distinguish between TS and normal female DNA samples, the X chromosome dosage was consistent with karyotyping data. Analyzing samples of 2 triple X syndrome and 3 Klinefelter syndrome patients suggested that this method could be used to detect X chromosome aneuploids other than TS. XIDMSs are widely spread along the X chromosome and might be effective markers for detection of TS and other X chromosome aneuploids. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Characterization of CpG sites that escape methylation on the inactive human X-chromosome.

    PubMed

    Moen, Erika L; Litwin, Edward; Arnovitz, Stephen; Zhang, Xu; Zhang, Wei; Dolan, M Eileen; Godley, Lucy A

    2015-01-01

    In many whole genome studies of gene expression or modified cytosines, data from probes localized to the X-chromosome are removed from analyses due to gender bias. Previously, we observed population differences in cytosine modifications between Caucasian and African lymphoblastoid cell lines (LCLs) on the autosomes using whole genome arrays to measure modified cytosines. DNA methylation plays a critical role in establishment and maintenance of X-chromosome inactivation in females. Therefore, we reasoned that by investigating cytosine modification patterns specifically on the X-chromosome, we could obtain valuable information about a chromosome that is often disregarded in genome-wide analyses. We investigated population differences in cytosine modification patterns along the X-chromosome between Caucasian and African LCLs and identified novel sites that escape methylation on the inactive X-chromosome (Xi) in females. We characterized the chromatin state of these loci by incorporating the extensive histone modification ChIP-seq data generated by ENCODE. To explore the relationship between DNA and histone modifications further, we hypothesized that BRD4, a protein that binds acetylated histones, could be preventing some sites from becoming de novo methylated. To test this, we treated 4 female LCLs with JQ1, a small molecule inhibitor of BRD4, but found that JQ1 treatment induced minor changes in cytosine modification levels, and the majority of sites escaping methylation on the Xi remained unmethylated. This suggests that other epigenetic mechanisms or transcription factors are likely playing a larger role in protecting these sites from de novo methylation on the Xi.

  6. The CpG Dinucleotide Adjacent to a κB Site Affects NF-κB Function through Its Methylation

    PubMed Central

    Wang, Tao; Li, Jinge; Ding, Ke; Zhang, Li; Che, Qiuru; Sun, Xiuming; Dai, Yumeng; Sun, Wei; Bao, Meiying; Wang, Xiaochun; Yang, Liquan; Li, Zhiwei

    2017-01-01

    NF-κB is an important transcription factor that plays critical roles in cell survival, proliferation, inflammation, and cancers. Although the majority of experimentally identified functional NF-κB binding sites (κB sites) match the consensus sequence, there are plenty of non-functional NF-κB consensus sequences in the genome. We analyzed the surrounding sequences of the known κB sites that perfectly match the GGGRNNYYCC consensus sequence and identified the nucleotide at the -1 position of κB sites as a key contributor to the binding of the κB sites by NF-κB. We demonstrated that a cytosine at the -1 position of a κB site (-1C) could be methylated, which thereafter impaired NF-κB binding and/or function. In addition, all -1C κB sites are located in CpG islands and are conserved during evolution only when they are within CpG islands. Interestingly, when there are multiple NF-κB binding possibilities, methylation of -1C might increase NF-κB binding. Our finding suggests that a single nucleotide at the -1 position of a κB site could be a critical factor in NF-κB functioning and could be exploited as an additional manner to regulate the expression of NF-κB target genes. PMID:28257066

  7. GaussianCpG: a Gaussian model for detection of CpG island in human genome sequences.

    PubMed

    Yu, Ning; Guo, Xuan; Zelikovsky, Alexander; Pan, Yi

    2017-05-24

    As crucial markers in identifying biological elements and processes in mammalian genomes, CpG islands (CGI) play important roles in DNA methylation, gene regulation, epigenetic inheritance, gene mutation, chromosome inactivation and nuclesome retention. The generally accepted criteria of CGI rely on: (a) %G+C content is ≥ 50%, (b) the ratio of the observed CpG content and the expected CpG content is ≥ 0.6, and (c) the general length of CGI is greater than 200 nucleotides. Most existing computational methods for the prediction of CpG island are programmed on these rules. However, many experimentally verified CpG islands deviate from these artificial criteria. Experiments indicate that in many cases %G+C is < 50%, CpG obs /CpG exp varies, and the length of CGI ranges from eight nucleotides to a few thousand of nucleotides. It implies that CGI detection is not just a straightly statistical task and some unrevealed rules probably are hidden. A novel Gaussian model, GaussianCpG, is developed for detection of CpG islands on human genome. We analyze the energy distribution over genomic primary structure for each CpG site and adopt the parameters from statistics of Human genome. The evaluation results show that the new model can predict CpG islands efficiently by balancing both sensitivity and specificity over known human CGI data sets. Compared with other models, GaussianCpG can achieve better performance in CGI detection. Our Gaussian model aims to simplify the complex interaction between nucleotides. The model is computed not by the linear statistical method but by the Gaussian energy distribution and accumulation. The parameters of Gaussian function are not arbitrarily designated but deliberately chosen by optimizing the biological statistics. By using the pseudopotential analysis on CpG islands, the novel model is validated on both the real and artificial data sets.

  8. Levels of DNA Methylation Vary at CpG Sites across the BRCA1 Promoter, and Differ According to Triple Negative and "BRCA-Like" Status, in Both Blood and Tumour DNA.

    PubMed

    Daniels, Sarah L; Burghel, George J; Chambers, Philip; Al-Baba, Shadi; Connley, Daniel D; Brock, Ian W; Cramp, Helen E; Dotsenko, Olena; Wilks, Octavia; Wyld, Lynda; Cross, Simon S; Cox, Angela

    2016-01-01

    Triple negative breast cancer is typically an aggressive and difficult to treat subtype. It is often associated with loss of function of the BRCA1 gene, either through mutation, loss of heterozygosity or methylation. This study aimed to measure methylation of the BRCA1 gene promoter at individual CpG sites in blood, tumour and normal breast tissue, to assess whether levels were correlated between different tissues, and with triple negative receptor status, histopathological scoring for BRCA-like features and BRCA1 protein expression. Blood DNA methylation levels were significantly correlated with tumour methylation at 9 of 11 CpG sites examined (p<0.0007). The levels of tumour DNA methylation were significantly higher in triple negative tumours, and in tumours with high BRCA-like histopathological scores (10 of 11 CpG sites; p<0.01 and p<0.007 respectively). Similar results were observed in blood DNA (6 of 11 CpG sites; p<0.03 and 7 of 11 CpG sites; p<0.02 respectively). This study provides insight into the pattern of CpG methylation across the BRCA1 promoter, and supports previous studies suggesting that tumours with BRCA1 promoter methylation have similar features to those with BRCA1 mutations, and therefore may be suitable for the same targeted therapies.

  9. Regulated transcription of human matrix metalloproteinase 13 (MMP13) and interleukin-1β (IL1B) genes in chondrocytes depends on methylation of specific proximal promoter CpG sites.

    PubMed

    Hashimoto, Ko; Otero, Miguel; Imagawa, Kei; de Andrés, María C; Coico, Jonathan M; Roach, Helmtrud I; Oreffo, Richard O C; Marcu, Kenneth B; Goldring, Mary B

    2013-04-05

    The role of DNA methylation in the regulation of catabolic genes such as MMP13 and IL1B, which have sparse CpG islands, is poorly understood in the context of musculoskeletal diseases. We report that demethylation of specific CpG sites at -110 bp and -299 bp of the proximal MMP13 and IL1B promoters, respectively, detected by in situ methylation analysis of chondrocytes obtained directly from human cartilage, strongly correlated with higher levels of gene expression. The methylation status of these sites had a significant impact on promoter activities in chondrocytes, as revealed in transfection experiments with site-directed CpG mutants in a CpG-free luciferase reporter. Methylation of the -110 and -299 CpG sites, which reside within a hypoxia-inducible factor (HIF) consensus motif in the respective MMP13 and IL1B promoters, produced the most marked suppression of their transcriptional activities. Methylation of the -110 bp CpG site in the MMP13 promoter inhibited its HIF-2α-driven transactivation and decreased HIF-2α binding to the MMP13 proximal promoter in chromatin immunoprecipitation assays. In contrast to HIF-2α, MMP13 transcriptional regulation by other positive (RUNX2, AP-1, ELF3) and negative (Sp1, GATA1, and USF1) factors was not affected by methylation status. However, unlike the MMP13 promoter, IL1B was not susceptible to HIF-2α transactivation, indicating that the -299 CpG site in the IL1B promoter must interact with other transcription factors to modulate IL1B transcriptional activity. Taken together, our data reveal that the methylation of different CpG sites in the proximal promoters of the human MMP13 and IL1B genes modulates their transcription by distinct mechanisms.

  10. Validation of a DNA methylation microarray for 850,000 CpG sites of the human genome enriched in enhancer sequences

    PubMed Central

    Moran, Sebastian; Arribas, Carles; Esteller, Manel

    2016-01-01

    Aim: DNA methylation is the best known epigenetic mark. Cancer and other pathologies show an altered DNA methylome. However, delivering complete DNA methylation maps is compromised by the price and labor-intensive interpretation of single nucleotide methods. Material & methods: Following the success of the HumanMethylation450 BeadChip (Infinium) methylation microarray (450K), we report the technical and biological validation of the newly developed MethylationEPIC BeadChip (Infinium) microarray that covers over 850,000 CpG methylation sites (850K). The 850K microarray contains >90% of the 450K sites, but adds 333,265 CpGs located in enhancer regions identified by the ENCODE and FANTOM5 projects. Results & conclusion: The 850K array demonstrates high reproducibility at the 450K CpG sites, is consistent among technical replicates, is reliable in the matched study of fresh frozen versus formalin-fixed paraffin-embeded samples and is also useful for 5-hydroxymethylcytosine. These results highlight the value of the MethylationEPIC BeadChip as a useful tool for the analysis of the DNA methylation profile of the human genome. PMID:26673039

  11. Validation of a DNA methylation microarray for 850,000 CpG sites of the human genome enriched in enhancer sequences.

    PubMed

    Moran, Sebastian; Arribas, Carles; Esteller, Manel

    2016-03-01

    DNA methylation is the best known epigenetic mark. Cancer and other pathologies show an altered DNA methylome. However, delivering complete DNA methylation maps is compromised by the price and labor-intensive interpretation of single nucleotide methods. Following the success of the HumanMethylation450 BeadChip (Infinium) methylation microarray (450K), we report the technical and biological validation of the newly developed MethylationEPIC BeadChip (Infinium) microarray that covers over 850,000 CpG methylation sites (850K). The 850K microarray contains >90% of the 450K sites, but adds 333,265 CpGs located in enhancer regions identified by the ENCODE and FANTOM5 projects. The 850K array demonstrates high reproducibility at the 450K CpG sites, is consistent among technical replicates, is reliable in the matched study of fresh frozen versus formalin-fixed paraffin-embeded samples and is also useful for 5-hydroxymethylcytosine. These results highlight the value of the MethylationEPIC BeadChip as a useful tool for the analysis of the DNA methylation profile of the human genome.

  12. Regulatory domain or CpG site variation in SLC12A5, encoding the chloride transporter KCC2, in human autism and schizophrenia

    PubMed Central

    Merner, Nancy D.; Chandler, Madison R.; Bourassa, Cynthia; Liang, Bo; Khanna, Arjun R.; Dion, Patrick; Rouleau, Guy A.; Kahle, Kristopher T.

    2015-01-01

    Many encoded gene products responsible for neurodevelopmental disorders (NDs) like autism spectrum disorders (ASD), schizophrenia (SCZ), intellectual disability (ID), and idiopathic generalized epilepsy (IGE) converge on networks controlling synaptic function. An increase in KCC2 (SLC12A5) Cl− transporter activity drives the developmental GABA excitatory-inhibitory sequence, but the role of KCC2 in human NDs is essentially unknown. Here, we report two rare, non-synonymous (NS), functionally-impairing variants in the KCC2 C-terminal regulatory domain (CTRD) in human ASD (R952H and R1049C) and SCZ (R952H) previously linked with IGE and familial febrile seizures, and another novel NS KCC2 variant in ASD (R1048W) with highly-predicted pathogenicity. Exome data from 2517 simplex families in the ASD Simon Simplex Collection (SSC) revealed significantly more KCC2 CTRD variants in ASD cases than controls, and interestingly, these were more often synonymous and predicted to disrupt or introduce a CpG site. Furthermore, full gene analysis showed ASD cases are more likely to contain rare KCC2 variants affecting CpG sites than controls. These data suggest genetically-encoded dysregulation of KCC2-dependent GABA signaling may contribute to multiple human NDs. PMID:26528127

  13. 43 CFR 3835.20 - Transferring, selling, inheriting, or otherwise conveying mining claims or sites already subject...

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... otherwise conveying mining claims or sites already subject to a waiver. 3835.20 Section 3835.20 Public Lands... already subject to a waiver. (a) If you purchase, inherit, or otherwise obtain mining claims or sites that... otherwise obtain mining claims or sites that are subject to a waiver and you do not qualify for the...

  14. Genome-Wide Estimates of Mutation Rates and Spectrum in Schizosaccharomyces pombe Indicate CpG Sites are Highly Mutagenic Despite the Absence of DNA Methylation

    PubMed Central

    Behringer, Megan G.; Hall, David W.

    2015-01-01

    We accumulated mutations for 1952 generations in 79 initially identical, haploid lines of the fission yeast Schizosaccharomyces pombe, and then performed whole-genome sequencing to determine the mutation rates and spectrum. We captured 696 spontaneous mutations across the 79 mutation accumulation (MA) lines. We compared the mutation spectrum and rate to a recently published equivalent experiment on the same species, and to another model ascomycetous yeast, the budding yeast Saccharomyces cerevisiae. While the two species are approximately 600 million years diverged from each other, they share similar life histories, genome size and genomic G/C content. We found that Sc. pombe and S. cerevisiae have similar mutation rates, but Sc. pombe exhibits a stronger insertion bias. Intriguingly, we observed an increased mutation rate at cytosine nucleotides, specifically CpG nucleotides, which is also seen in S. cerevisiae. However, the absence of methylation in Sc. pombe and the pattern of mutation at these sites, primarily C → A as opposed to C → T, strongly suggest that the increased mutation rate is not caused by deamination of methylated cytosines. This result implies that the high mutability of CpG dinucleotides in other species may be caused in part by a methylation-independent mechanism. Many of our findings mirror those seen in the recent study, despite the use of different passaging conditions, indicating that MA is a reliable method for estimating mutation rates and spectra. PMID:26564949

  15. Genome-Wide Estimates of Mutation Rates and Spectrum in Schizosaccharomyces pombe Indicate CpG Sites are Highly Mutagenic Despite the Absence of DNA Methylation.

    PubMed

    Behringer, Megan G; Hall, David W

    2015-11-12

    We accumulated mutations for 1952 generations in 79 initially identical, haploid lines of the fission yeast Schizosaccharomyces pombe, and then performed whole-genome sequencing to determine the mutation rates and spectrum. We captured 696 spontaneous mutations across the 79 mutation accumulation (MA) lines. We compared the mutation spectrum and rate to a recently published equivalent experiment on the same species, and to another model ascomycetous yeast, the budding yeast Saccharomyces cerevisiae. While the two species are approximately 600 million years diverged from each other, they share similar life histories, genome size and genomic G/C content. We found that Sc. pombe and S. cerevisiae have similar mutation rates, but Sc. pombe exhibits a stronger insertion bias. Intriguingly, we observed an increased mutation rate at cytosine nucleotides, specifically CpG nucleotides, which is also seen in S. cerevisiae. However, the absence of methylation in Sc. pombe and the pattern of mutation at these sites, primarily C → A as opposed to C → T, strongly suggest that the increased mutation rate is not caused by deamination of methylated cytosines. This result implies that the high mutability of CpG dinucleotides in other species may be caused in part by a methylation-independent mechanism. Many of our findings mirror those seen in the recent study, despite the use of different passaging conditions, indicating that MA is a reliable method for estimating mutation rates and spectra.

  16. Genome-wide CpG island methylation and intergenic demethylation propensities vary among different tumor sites

    PubMed Central

    Lee, Seung-Tae; Wiemels, Joseph L.

    2016-01-01

    The epigenetic landscape of cancer includes both focal hypermethylation and broader hypomethylation in a genome-wide manner. By means of a comprehensive genomic analysis on 6637 tissues of 21 tumor types, we here show that the degrees of overall methylation in CpG island (CGI) and demethylation in intergenic regions, defined as ‘backbone’, largely vary among different tumors. Depending on tumor type, both CGI methylation and backbone demethylation are often associated with clinical, epidemiological and biological features such as age, sex, smoking history, anatomic location, histological type and grade, stage, molecular subtype and biological pathways. We found connections between CGI methylation and hypermutability, microsatellite instability, IDH1 mutation, 19p gain and polycomb features, and backbone demethylation with chromosomal instability, NSD1 and TP53 mutations, 5q and 19p loss and long repressive domains. These broad epigenetic patterns add a new dimension to our understanding of tumor biology and its clinical implications. PMID:26464434

  17. Hypomethylated CpG around the transcription start site enables TERT expression and HPV16 E6 regulates TERT methylation in cervical cancer cells.

    PubMed

    Jiang, Jing; Zhao, Li-Jun; Zhao, Chao; Zhang, Guo; Zhao, Yun; Li, Jing-Ran; Li, Xiao-Ping; Wei, Li-Hui

    2012-03-01

    The human papillomavirus (HPV) oncoprotein, E6, activates telomerase reverse transcriptase (TERT) expression and causes cellular immortalization. It remains unclear whether E6 affects TERT transcription by altering DNA methylation profiles. In this study, we explored the methylation status of the TERT promoter in cervical cancer cell lines and its variations after E6 was silenced by RNAi. Three kinds of cervical cell lines (HPV16 positive: CaSki and SiHa; HPV18 positive: HeLa), were taken to analyze the methylation status of the TERT promoter by methylation-specific polymerase chain reaction (MSP) and bisulfite sequencing (BS). Stealth RNAi was transiently transfected to these cell lines to silence the expression of HPV16/18 E6, and the subsequent changes of TERT mRNA levels and TERT promoter DNA methylation were examined. Hypomethylation of the DNA around the TERT transcription start site (-156 to +162 bp) was functionally related to its transcription. After transfection with Stealth RNAi, the levels of HPV16/18 E6 and TERT mRNA were greatly decreased. The methylated CpG around the transcription start sites in CaSki and SiHa cells were statistically increased (respectively P=0.016, P=0.000). However, there was no significant difference in HeLa cells (P=0.128). Hypomethylated CpG around the transcription start site enables the expression of TERT in cervical cancer cells. Our results show for the first time that HPV16 E6 can promote TERT transcription through demethylating the DNA sequence around the TERT transcription start site in cervical squamous cancer cells. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Increased expression of prion protein gene is accompanied by demethylation of CpG sites in a mouse embryonal carcinoma cell line, P19C6

    PubMed Central

    DALAI, Wuyun; MATSUO, Eiko; TAKEYAMA, Natsumi; KAWANO, Junichi; SAEKI, Keiichi

    2017-01-01

    Elucidation of the processes regulating the prion protein gene (Prnp) is an important key to understanding the development of prion disorders. In this study, we explored the involvement of DNA methylation in Prnp transcriptional regulation during neuronal differentiation of embryonic carcinoma P19C6 cells. When P19C6 cells were differentiated into neuronal cells, the expression of Prnp was markedly increased, while CpG methylation was significantly demethylated at the nucleotide region between −599 and −238 from the transcription start site. In addition, when P19C6 cells were applied in a DNA methyltransferase inhibitor, RG108, Prnp transcripts were also significantly increased in relation to the decreased methylation statuses. These findings helped to elucidate the DNA methylation-mediated regulation of Prnp expression during neuronal differentiation. PMID:28132962

  19. IGF2/H19 hypomethylation is tissue, cell, and CpG site dependent and not correlated with body asymmetry in adolescents with Silver-Russell syndrome.

    PubMed

    Kannenberg, Kai; Weber, Karin; Binder, Cathrin; Urban, Christina; Kirschner, Hans-Joachim; Binder, Gerhard

    2012-09-18

    Silver-Russell syndrome (SRS) is characterized by severe intrauterine and postnatal growth failure and frequent body asymmetry. Half of the patients with SRS carry a DNA hypomethylation of the imprinting center region 1 (ICR1) of the insulin-like growth factor 2 (IGF2)/H19 locus, and the clinical phenotype is most severe in these patients. We aimed to elucidate the epigenetic basis of asymmetry in SRS and the cellular consequences of the ICR1 hypomethylation. The ICR1 methylation status was analyzed in blood and in addition in buccal smear probes and cultured fibroblasts obtained from punch biopsies taken from the two body halves of 5 SRS patients and 3 controls. We found that the ICR1 hypomethylation in SRS patients was stronger in blood leukocytes and oral mucosa cells than in fibroblasts. ICR1 CpG sites were affected differently. The severity of hypomethylation was not correlated to body asymmetry. IGF2 expression and IGF-II secretion of fibroblasts were not correlated to the degree of ICR1 hypomethylation. SRS fibroblasts responded well to stimulation by recombinant human IGF-I or IGF-II, with proliferation rates comparable with controls. Clonal expansion of primary fibroblasts confirmed the complexity of the cellular mosaicism. We conclude that the ICR1 hypomethylation SRS is tissue, cell, and CpG site specific. The correlation of the ICR1 hypomethylation to IGF2 and H19 expression is not strict, may depend on the investigated tissue, and may become evident only in case of more severe methylation defects. The body asymmetry in juvenile SRS patients is not related to a corresponding ICR1 hypomethylation gradient, rendering more likely an intrauterine origin of asymmetry. Overall, it may be instrumental to consider not only the ICR1 methylation status as decisive for IGF2/H19 expression regulation.

  20. Cultural inheritance drives site fidelity and migratory connectivity in a long-distance migrant.

    PubMed

    Harrison, Xavier A; Tregenza, Tom; Inger, Richard; Colhoun, Kendrew; Dawson, Deborah A; Gudmundsson, Gudmundur A; Hodgson, David J; Horsburgh, Gavin J; McElwaine, Graham; Bearhop, Stuart

    2010-12-01

    Cultural transmission is thought to be a mechanism by which migratory animals settle into habitats, but little evidence exists in wild populations because of the difficulty of following individuals over successive generations and wide geographical distances. Cultural inheritance of migration routes represents a mechanism whereby geographical isolation can arise between separate groups and could constrain individuals to potentially suboptimal sites within their range. Conversely, adopting the parental migratory route in adult life, rather than dispersing randomly, may increase an individual's reproductive success because that strategy has already been proven to allow successful breeding. We combined a pedigree of related light-bellied Brent geese (Branta bernicla hrota) with 6 years of observations of marked birds to calculate the dispersal distances of adult offspring from their parents in both Ireland and Iceland. In both countries, the majority of offspring were found to recruit into or near their parental sites, indicating migratory connectivity in the flyway. Despite this kin structure, we found no evidence of genetic differentiation using genotype data from 1127 individuals across 15 microsatellite loci. We suggest that the existence of migratory connectivity of subpopulations is far more common than previous research indicates and that cultural information may play an important role in structuring reproductive isolation among them.

  1. DNA methylation at a bovine alpha satellite I repeat CpG site during development following fertilization and somatic cell nuclear transfer.

    PubMed

    Couldrey, Christine; Wells, David N

    2013-01-01

    Incomplete epigenetic reprogramming is postulated to contribute to the low developmental success following somatic cell nuclear transfer (SCNT). Here, we describe the epigenetic reprogramming of DNA methylation at an alpha satellite I CpG site (αsatI-5) during development of cattle generated either by artificial insemination (AI) or in vitro fertilization (IVF) and SCNT. Quantitative methylation analysis identified that SCNT donor cells were highly methylated at αsatI-5 and resulting SCNT blastocysts showed significantly more methylation than IVF blastocysts. At implantation, no difference in methylation was observed between SCNT and AI in trophoblast tissue at αsatI-5, however, SCNT embryos were significantly hyper-methylated compared to AI controls at this time point. Following implantation, DNA methylation at αsatI-5 decreased in AI but not SCNT placental tissues. In contrast to placenta, the proportion of methylation at αsatI-5 remained high in adrenal, kidney and muscle tissues during development. Differences in the average proportion of methylation were smaller in somatic tissues than placental tissues but, on average, SCNT somatic tissues were hyper-methylated at αsatI-5. Although sperm from all bulls was less methylated than somatic tissues at αsatI-5, on average this site remained hyper-methylated in sperm from cloned bulls compared with control bulls. This developmental time course confirms that epigenetic reprogramming does occur, at least to some extent, following SCNT. However, the elevated methylation levels observed in SCNT blastocysts and cellular derivatives implies that there is either insufficient time or abundance of appropriate reprogramming factors in oocytes to ensure complete reprogramming. Incomplete reprogramming at this CpG site may be a contributing factor to low SCNT success rates, but more likely represents the tip of the iceberg in terms of incompletely reprogramming. Until protocols ensure the epigenetic signature of a

  2. Allele-specific gene expression patterns in primary leukemic cells reveal regulation of gene expression by CpG site methylation

    PubMed Central

    Milani, Lili; Lundmark, Anders; Nordlund, Jessica; Kiialainen, Anna; Flaegstad, Trond; Jonmundsson, Gudmundur; Kanerva, Jukka; Schmiegelow, Kjeld; Gunderson, Kevin L.; Lönnerholm, Gudmar; Syvänen, Ann-Christine

    2009-01-01

    To identify genes that are regulated by cis-acting functional elements in acute lymphoblastic leukemia (ALL) we determined the allele-specific expression (ASE) levels of 2529 genes by genotyping a genome-wide panel of single nucleotide polymorphisms in RNA and DNA from bone marrow and blood samples of 197 children with ALL. Using a reproducible, quantitative genotyping method and stringent criteria for scoring ASE, we found that 16% of the analyzed genes display ASE in multiple ALL cell samples. For most of the genes, the level of ASE varied largely between the samples, from 1.4-fold overexpression of one allele to apparent monoallelic expression. For genes exhibiting ASE, 55% displayed bidirectional ASE in which overexpression of either of the two SNP alleles occurred. For bidirectional ASE we also observed overall higher levels of ASE and correlation with the methylation level of these sites. Our results demonstrate that CpG site methylation is one of the factors that regulates gene expression in ALL cells. PMID:18997001

  3. CpG site degeneration triggered by the loss of functional constraint created a highly polymorphic macaque drug-metabolizing gene, CYP1A2

    PubMed Central

    2011-01-01

    Background Elucidating the pattern of evolutionary changes in drug-metabolizing genes is an important subject not only for evolutionary but for biomedical research. We investigated the pattern of divergence and polymorphisms of macaque CYP1A1 and CYP1A2 genes, which are major drug-metabolizing genes in humans. In humans, CYP1A2 is specifically expressed in livers while CYP1A1 has a wider gene expression pattern in extrahepatic tissues. In contrast, macaque CYP1A2 is expressed at a much lower level than CYP1A1 in livers. Interestingly, a previous study has shown that Macaca fascicularis CYP1A2 harbored unusually high genetic diversity within species. Genomic regions showing high genetic diversity within species is occasionally interpreted as a result of balancing selection, where natural selection maintains highly diverged alleles with different functions. Nevertheless many other forces could create such signatures. Results We found that the CYP1A1/2 gene copy number and orientation has been highly conserved among mammalian genomes. The signature of gene conversion between CYP1A1 and CYP1A2 was detected, but the last gene conversion event in the simian primate lineage occurred before the Catarrhini-Platyrrhini divergence. The high genetic diversity of macaque CYP1A2 therefore cannot be explained by gene conversion between CYP1A1 and CYP1A2. By surveying CYP1A2 polymorphisms in total 91 M. fascicularis and M. mulatta, we found several null alleles segregating in these species, indicating functional constraint on CYP1A2 in macaques may have weakened after the divergence between humans and macaques. We propose that the high genetic diversity in macaque CYP1A2 is partly due to the degeneration of CpG sites, which had been maintained at a high level by purifying selection, and the rapid degeneration process was initiated by the loss of functional constraint on macaque CYP1A2. Conclusions Our findings show that the highly polymorphic CYP1A2 gene in macaques has not been

  4. Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing

    PubMed Central

    Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

    2017-01-01

    Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG’s contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates. PMID:28327639

  5. Site-specific methylation of CpG nucleotides in the hTERT promoter region can control the expression of hTERT during malignant progression of colorectal carcinoma.

    PubMed

    Choi, Jee-Hye; Park, Soo Hyun; Park, Jina; Park, Borae G; Cha, Seong-Jae; Kong, Kwang-Hoon; Lee, Kwang-Ho; Park, Ae Ja

    2007-09-28

    Expression of hTERT has been recognized an important factor in cellular aging and immortalization. Therefore, to analyze regulatory mechanism of hTERT expression, we investigated the CpG methylation pattern of the hTERT promoter as an epigenetic mechanism and its implication in transcriptional regulation of hTERT using tissues of colorectal carcinoma. As a result, we were able to observe an increased pattern of hTERT expression according to the malignant progression of colorectal carcinoma. Additionally, we could find that hTERT expression was induced when the P1 and P2 region of hTERT were sufficiently hypermethylated and, oppositely, the G1 region of hTERT was hypomethylated. Importantly, we could find three specific CpG sites (7th CpG of P2 and 11th and 2nd-10th CpGs of P1) closely related with the increasing of hTERT expression. These findings may provide important clues to deducing the expression mechanisms of hTERT.

  6. Isotopic and genetic evidence for culturally inherited site fidelity to feeding grounds in southern right whales (Eubalaena australis).

    PubMed

    Valenzuela, Luciano O; Sironi, Mariano; Rowntree, Victoria J; Seger, Jon

    2009-03-01

    Ocean warming will undoubtedly affect the migratory patterns of many marine species, but specific changes can be predicted only where behavioural mechanisms guiding migration are understood. Southern right whales show maternally inherited site fidelity to near-shore winter nursery grounds, but exactly where they feed in summer (collectively and individually) remains mysterious. They consume huge quantities of copepods and krill, and their reproductive rates respond to fluctuations in krill abundance linked to El Niño Southern Oscillation (ENSO). Here we show that genetic and isotopic signatures, analysed together, indicate maternally directed site fidelity to diverse summer feeding grounds for female right whales calving at Península Valdés, Argentina. Isotopic values from 131 skin samples span a broad range (-23.1 to -17.2‰ δ¹³C, 6.0 to 13.8‰ δ¹⁵N) and are more similar than expected among individuals sharing the same mitochondrial haplotype. This pattern indicates that calves learn summer feeding locations from their mothers, and that the timescale of culturally inherited site fidelity to feeding grounds is at least several generations. Such conservatism would be expected to limit the exploration of new feeding opportunities, and may explain why this population shows increased rates of reproductive failure in years following elevated sea-surface temperature anomalies off South Georgia, the richest known feeding ground for baleen whales in the South Atlantic.

  7. Liposomal SLA co-incorporated with PO CpG ODNs or PS CpG ODNs induce the same protection against the murine model of leishmaniasis.

    PubMed

    Shargh, Vahid Heravi; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jaafari, Iman; Jalali, Seyed Amir; Abbasi, Azam; Badiee, Ali

    2012-06-06

    First generation Leishmania vaccines consisting of whole killed parasites with or without adjuvants have reached phase 3 trial and failed to show enough efficacy mainly due to the lack of an appropriate adjuvant. In this study, the nuclease-resistant phosphorothioate CpG oligodeoxynucleotides (PS CpG) or nuclease-sensitive phosphodiester CpG ODNs (PO CpG) were used as adjuvants to enhance immunogenicity and rate of protection against leishmaniasis. Due to the susceptibility of PO CpG to nuclease degradation, an efficient liposomal delivery system was developed to protect them from degradation. 1, 2-dioleoyl-3-trimethylammonium-propane (DOTAP) as a cationic lipid was used because of its unique adjuvanticity and electrostatic interaction with negatively charged CpG ODNs. To evaluate the role of liposomal formulation in protection rate and enhanced immune response, BALB/c mice were immunized subcutaneously with liposomal soluble Leishmania antigens (SLA) co-incorporated with PO CpG (Lip-SLA-PO CpG), Lip-SLA-PS CpG, SLA+PO CpG, SLA+PS CpG, SLA or buffer. As criteria for protection, footpad swelling at the site of challenge, parasite loads, the levels of IFN-γ and IL-4, and the IgG subtypes were evaluated. The groups of mice receiving Lip-SLA-PO CpG or Lip-SLA-PS CpG showed a high protection rate compared with the control groups. In addition, there was no significant difference in immune response generation between mice immunized with PS CpG and the group receiving PO CpG when incorporated into the liposomes. The results suggested that liposomal form of PO CpG might be used instead of PS CpG in future vaccine formulations as an efficient adjuvant.

  8. Ubiquitous and tenacious methylation of the CpG site in codon 248 of the p53 gene may explain its frequent appearance as a mutational hot spot in human cancer.

    PubMed Central

    Magewu, A N; Jones, P A

    1994-01-01

    Cytosine methylation at CpG dinucleotides is thought to cause more than one-third of all transition mutations responsible for human genetic diseases and cancer. We investigated the methylation status of the CpG dinucleotide at codon 248 in exon 7 of the p53 gene because this codon is a hot spot for inactivating mutations in the germ line and in most human somatic tissues examined. Codon 248 is contained within an HpaII site (CCGG), and the methylation status of this and flanking CpG sites was analyzed by using the methylation-sensitive enzymes CfoI (GCGC) and HpaII. Codon 248 and the CfoI and HpaII sites in the flanking introns were methylated in every tissue and cell line examined, indicating extensive methylation of this region in the p53 gene. Exhaustive treatment of an osteogenic sarcoma cell line, TE85, with the hypomethylating drug 5-aza-2'-deoxycytidine did not demethylate codon 248 or the CfoI sites in intron 6, although considerable global demethylation of the p53 gene was induced. Constructs containing either exon 7 alone or exon 7 and the flanking introns were transfected into TE85 cells to determine whether de novo methylation would occur. The presence of exon 7 alone caused some de novo methylation to occur at codon 248. More extensive de novo methylation of the CfoI sites in intron 6, which contains an Alu sequence, occurred in cells transfected with a vector containing exon 7 and flanking introns. With longer time in culture, there was increased methylation at the CfoI sites, and de novo methylation of codon 248 and its flanking HpaII sites was observed. These de novo-methylated sites were also resistant to 5-aza-2'-deoxycytidine-induced demethylation. The frequent methylation of codon 248 and adjacent Alu sequence may explain the enhanced mutability of this site as a result of the deamination of the 5-methylcytosine. Images PMID:8196660

  9. The polymorphism (-600 C>A) of CpG methylation site at the promoter region of CYP17A1 and its association of male infertility and testosterone levels.

    PubMed

    Park, Jung-Hoon; Lee, Jinu; Kim, Cheol-Hee; Lee, Suman

    2014-01-15

    Cytochrome P450, family 17, subfamily A, polypeptide 1 (CYP17A1) is a key regulatory enzyme in the steroidogenic pathway. The functional and clinical relevance of novel CYP17A1 promoter single nucleotide polymorphism (-600 C>A, rs17115149) was investigated with male infertility. Case-control association study of CYP17A1 from 456 infertile men performed with 465 normal fertile men. The rs17115149 at the promoter region of CYP17A1 was significantly associated with Oligoasthenoteratozoospermia (OAT, P=0.0015, n=265). 5-aza-dC treatment to B lymphocyte cells increased the CYP17A1 expression. Direct bisulfite sequencing of five human tissues showed that the rs17115149 is located at -600bp (-600C>A) before transcription start site within the CpG islands of CYP17A1 promoter. This -600 Cytosine of CpG site was highly methylated in colon and stomach tissues, but low methylated in adrenal gland, kidney and testis with higher CYP17A1 RNA expression. Especially, this polymorphism is statistically significant associated with testosterone levels from infertile males (n=197, P<0.05). CYP17A1 promoter polymorphism (rs17115149, -600C>A) is a functional regulatory SNP which associated with its expression possibly by epigenetic pathway, which may signify a genetic risk factor for male infertility. © 2013 Elsevier B.V. All rights reserved.

  10. Enhanced antibody production in mice to the malaria antigen AMA1 by CPG 7909 requires physical association of CpG and antigen.

    PubMed

    Mullen, Gregory E D; Aebig, Joan A; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Long, Carole A; Miles, Aaron P; Saul, Allan

    2007-07-20

    CpG oligodeoxynucleotides are potent immunostimulants. In this study, CPG 7909 was formulated with the recombinant Plasmodium falciparum protein AMA1-C1 adsorbed to Alhydrogel (aluminum hydroxide) and used to immunize mice. Mice receiving free CPG 7909 in a separate same site injection to the AMA1-C1/Alhydrogel had the same antibody responses as mice receiving AMA1-C1/Alhydrogel alone. For mice immunized with CPG 7909 bound to the AMA1-C1/Alhydrogel formulation, there was a bell shaped CPG 7909 dose-response curve with the highest antibody response co-incident with the concentration of CPG 7909 that saturated binding to the Alhydrogel. At a higher CPG 7909 dose where 74% was unbound, there was no enhancement of response over AMA1-C1/Alhydrogel alone. Our results suggest that the adjuvant effects of CpGs are optimal when adsorbed to Alhydrogel and highlight the need for careful characterization of the vaccine formulation.

  11. A Web Site to Improve Management of Patients with Inherited Bleeding Disorders in the Emergency Department: Results at 2 Years.

    PubMed

    Tagliaferri, Annarita; Di Perna, Caterina; Biasoli, Chiara; Rivolta, Gianna Franca; Quintavalle, Gabriele; Cervellin, Gianfranco; Barozzi, Marco; Benedettini, Laura; Pattacini, Corrado

    2016-07-01

    Treatment of patients with inherited bleeding disorders (PWIBD) in the emergency department (ED) is challenging. In 2010, a project was started involving all eight hemophilia centers (HC) and all 44 EDs of the Region of Emilia-Romagna (Italy) to improve emergency care for PWIBD. The project incorporates guidelines for emergency treatment, education for ED staff, and a dedicated Web site providing extensive information, proposing treatments, and sharing data with patients' electronic clinical records. A Web algorithm, accessible to PWIBD as well as ED and HC staff, suggests the first dose of concentrate for each type and severity of bleed or trauma. Following training courses in each ED, the network was activated. During 2012 and 2013, the site was visited 14,000 times, the EDs accessed the Web site 1,739 times, and used the algorithms 206 times. In two reference EDs, triage-assessment and triage-treatment times were reduced in 2013 and 2012 (27/20 and 110/71.5 minutes, respectively) and medical advice from the HC increased (54 vs. 24% cases). The main advantages of this system are better management of patients in ED (shorter triage-to-treatment times) and improved collaboration between HCs and EDs. The most critical point remaining is staff turnover in EDs, necessitating continual training.

  12. CpG oligodeoxynucleotides as mucosal adjuvants

    PubMed Central

    Iho, Sumiko; Maeyama, Jun-ichi; Suzuki, Fumiko

    2015-01-01

    Bacterial DNA comprising palindromic sequences and containing unmethylated CpG is recognized by toll-like receptor 9 of plasmacytoid dendritic cells (pDCs) and induces the production of interferon-α and chemokines, leading to the activation of a Th1 immune response. Therefore, synthetic equivalents of bacterial DNA (CpG oligodeoxynucleotides) have been developed for clinical applications. They are usually phosphorothioated for in vivo use; this approach also leads to adverse effects as reported in mouse models.Mucosal vaccines that induce both mucosal and systemic immunity received substantial attention in recent years. For their development, phosphodiester-linked oligodeoxynucleotides, including the sequence of a palindromic CpG DNA may be advantageous as adjuvants because their target pDCs are present right there, in the mucosa of the vaccination site. In addition, the probability of adverse effects is believed to be low. Here, we review the discovery of such CpG oligodeoxynucleotides and their possible use as mucosal adjuvants. PMID:25751765

  13. Stabilization of epigenetic states of CpG islands by local cooperation.

    PubMed

    Sormani, Giulia; Haerter, Jan O; Lövkvist, Cecilia; Sneppen, Kim

    2016-06-21

    DNA methylation of CpG sites is an important epigenetic mark in mammals. Active promoters are often associated with unmethylated CpG sites, whereas methylated CpG sites correlate with silenced promoters. Methylation of CpG sites must be generally described as a dynamical process that is mediated by methylation enzymes, such as DNMT1 and DNMT3a/b. However, there are several models of how CpG sites can be protected from methylation and thereby remain unmethylated. In this paper we examine the combination of both: the positive feedbacks of DNA methylation and a short range counterpart which in turn protects-and thereby maintains-the unmethylated state. The emergent dynamics is provided by collaborative, re-enforcing feedbacks in favor of methylated CpG islands and cooperative protection of one CpG site by another in favor of unmethylated CpG sites. Our results suggest that this synthesis of mechanisms provides equally robust maintenance of both the unmethylated and methylated states of CpG islands.

  14. Relatively high rates of G:C → A:T transitions at CpG sites were observed in certain epithelial tissues including pancreas and submaxillary gland of adult big blue® mice.

    PubMed

    Prtenjaca, Anita; Tarnowski, Heather E; Marr, Alison M; Heney, Melanie A; Creamer, Laura; Sathiamoorthy, Sarmitha; Hill, Kathleen A

    2014-01-01

    With few exceptions, spontaneous mutation frequency and pattern are similar across tissue types and relatively constant in young to middle adulthood in wild type mice. Underrepresented in surveys of spontaneous mutations across murine tissues is the diversity of epithelial tissues. For the first time, spontaneous mutations were detected in pancreas and submaxillary gland and compared with kidney, lung, and male germ cells from five adult male Big Blue® mice. Mutation load was assessed quantitatively through measurement of mutant and mutation frequency and qualitatively through identification of mutations and characterization of recurrent mutations, multiple mutations, mutation pattern, and mutation spectrum. A total of 9.6 million plaque forming units were screened, 226 mutants were collected, and 196 independent mutations were identified. Four novel mutations were discovered. Spontaneous mutation frequency was low in pancreas and high in the submaxillary gland. The submaxillary gland had multiple recurrent mutations in each of the mice and one mutant had two independent mutations. Mutation patterns for epithelial tissues differed from that observed in male germ cells with a striking bias for G:C to A:T transitions at CpG sites. A comprehensive review of lacI spontaneous mutation patterns in young adult mice and rats identified additional examples of this mutational bias. An overarching observation about spontaneous mutation frequency in adult tissues of the mouse remains one of stability. A repeated observation in certain epithelial tissues is a higher rate of G:C to A:T transitions at CpG sites and the underlying mechanisms for this bias are not known.

  15. Chromatin remodeling by WSTF-ISWI at the replication site: opening a window of opportunity for epigenetic inheritance?

    PubMed

    Poot, Raymond A; Bozhenok, Ludmila; van den Berg, Debbie L C; Hawkes, Nicola; Varga-Weisz, Patrick D

    2005-04-01

    During DNA replication, chromatin states have to be accurately transmitted from the parental to the daughter strands for faithful epigenetic inheritance. Chromatin remodelling factors at the replication site are thought to be involved in this process. Recent work adds ATP-dependent nucleosome remodelling factors to this category of enzymes. The WICH complex, consisting of the ISWI-type ATPase SNF2H and the Williams Syndrome Transcription Factor (WSTF), binds to replication foci using PCNA, a key factor in DNA- and chromatin replication and DNA repair, as an interaction platform. Depletion of WSTF results in decreased chromatin accessibility, which is evident already in newly replicated DNA. This leads to heterochromatin formation on a global scale and a decrease in overall transcriptional activity. Here, we propose that WICH, by keeping nucleosomes mobile, provides access to the newly replicated DNA and may thereby create a window of opportunity after DNA replication for rebinding of factors that maintain the epigenetic state, and thus prevents aberrant heterochromatin formation. Our model may provide an explanation for the long-standing observation of a delay in chromatin "maturation" on newly replicated DNA, by connecting this delay with the action of PCNA-bound WSTF-ISWI, and highlights chromatin remodeling shortly after DNA replication as a critical point for regulation.

  16. Cytosine hypomethylation at CHG and CHH sites in the pleiotropic mutants of Mendelian inheritance in Catharanthus roseus.

    PubMed

    Kumari, Renu; Yadav, Gitanjali; Sharma, Vishakha; Sharma, Vinay; Kumar, Sushil

    2013-12-01

    The 5S and 18S rDNA sequences of Catharanthus roseus cv 'Nirmal' (wild type) and its leafless inflorescence (lli), evergreen dwarf (egd) and irregular leaf lamina (ill) single mutants and lli egd, lli ill and egd ill double mutants were characterized. The lli, egd and ill mutants of Mendelian inheritance bore the names after their most conspicuous morphological feature(s). They had been chemically induced and isolated for their salt tolerance. The double mutants were isolated as morphological segregants from crosses between single mutants. The morphological features of the two parents accompanied salt tolerance in the double mutants. All the six mutants were hypomethylated at repeat sequences, upregulated and downregulated for many genes and carried pleiotropic alterations for several traits. Here the 5S and 18S rDNAs of C. roseus were found to be relatively low in cytosine content. Cytosines were preponderantly in CG context (53%) and almost all of them were methylated (97%). The cytosines in CHH and CHG (where H = A, T or C) contexts were largely demethylated (92%) in mutants. The demethylation was attributable to reduced expression of RDR2 and DRM2 led RNA dependant DNA methylation and CMT3 led maintenance methylation pathways. Mutants had gained some cytosines by substitution of C at T sites. These perhaps arose on account of errors in DNA replication, mediated by widespread cytosine demethylation at CHG and CHH sites. It was concluded that the regulation of cytosine ethylation mechanisms was disturbed in the mutants. ILL, EGD and LLI genes were identified as the positive regulators of other genes mediating the RdDM and CMT3 pathways, for establishment and maintenance of cytosine methylation in C. roseus.

  17. Methylation of the CpG Sites Only on the Sense Strand of the APC Gene Is Specific for Hepatocellular Carcinoma

    PubMed Central

    Jain, Surbhi; Lin, Selena Y.; Lin, Yih-Jyh; Evans, Alison A.; Selaru, Florin M.; Lin, Pin- Wen; Chen, Shun-Hua; Block, Timothy M.; Hu, Chi-Tan; Song, Wei; Meltzer, Stephen J.; Su, Ying-Hsiu

    2011-01-01

    Hypermethylation of the promoter of the tumor suppressor gene, adenomatous polyposis coli (APC), occurs in various malignancies, including hepatocellular carcinoma (HCC). However, reports on the specificity of the methylation of the APC gene for HCC have varied. To gain insight into how these variations occur, bisulfite PCR sequencing was performed to analyze the methylation status of both sense and antisense strands of the APC gene in samples of HCC tissue, matched adjacent non-HCC liver tissue, hepatitis, cirrhosis, and normal liver tissues. DNA derived from fetal liver and 12 nonhepatic normal tissue was also examined. These experiments revealed liver-specific, antisense strand-biased CpG methylation of the APC gene and suggested that, although methylation of the antisense strand of the APC gene exists in normal liver and other non-HCC disease liver tissue, methylation of the sense strand of the APC gene occurs predominantly in HCC. To determine the effect of the DNA strand on the specificity of the methylated APC gene as a biomarker for HCC detection, quantitative methylation-specific PCR assays for sense and antisense strand DNA were developed and performed on DNA isolated from HCC (n = 58), matched adjacent non-HCC (n = 58), cirrhosis (n = 41), and hepatitis (n = 39). Receiver operating characteristic curves were constructed. With the cutoff value set at the limit of detection, the specificity of sense and antisense strand methylation was 84% and 43%, respectively, and sensitivity was 67.2% and 72.4%, respectively. This result demonstrated that the identity of the methylated DNA strand impacted the specificity of APC for HCC detection. Interestingly, methylation of the sense strand of APC occurred in 40% of HCCs from patients with serum AFP levels less than 20 ng/mL, suggesting a potential role for APC as a biomarker to complement AFP in HCC screening. PMID:22073196

  18. Revised genomic consensus for the hypermethylated CpG island region of the human L1 transposon and integration sites of full length L1 elements from recombinant clones made using methylation-tolerant host strains.

    PubMed Central

    Crowther, P J; Doherty, J P; Linsenmeyer, M E; Williamson, M R; Woodcock, D M

    1991-01-01

    Efficient recovery of clones from the 5' end of the human L1 dispersed repetitive elements necessitates the use of deletion mcr- host strains since this region contains a CpG island which is hypermethylated in vivo. Clones recovered with conventional mcr+ hosts seem to have been derived preferentially from L1 members which have accumulated mutations that have removed sites of methylation. We present a revised consensus from the 5' presumptive control region of these elements. This revised consensus contains a consensus RNA polymerase III promoter which would permit the synthesis of transcripts from the 5' end of full length L1 elements. Such potential transcripts are likely to exhibit a high degree of secondary structure. In addition, we have determined the flanking sequences for 6 full length L1 elements. The majority of full length L1 clones show no convincing evidence for target site duplication in the insertion site as commonly observed with truncated L1 elements. These data would be consistent with two mechanisms of integration of transposing L1 elements with different mechanisms predominating for full length and truncated elements. PMID:1710354

  19. Single-CpG-resolution methylome analysis identifies clinicopathologically aggressive CpG island methylator phenotype clear cell renal cell carcinomas

    PubMed Central

    Kanai, Yae

    2012-01-01

    To clarify the significance of DNA methylation alterations during renal carcinogenesis, methylome analysis using single-CpG-resolution Infinium array was performed on 29 normal renal cortex tissue (C) samples, 107 non-cancerous renal cortex tissue (N) samples obtained from patients with clear cell renal cell carcinomas (RCCs) and 109 tumorous tissue (T) samples. DNA methylation levels at 4830 CpG sites were already altered in N samples compared with C samples. Unsupervised hierarchical clustering analysis based on DNA methylation levels at the 801 CpG sites, where DNA methylation alterations had occurred in N samples and were inherited by and strengthened in T samples, clustered clear cell RCCs into Cluster A (n = 90) and Cluster B (n = 14). Clinicopathologically aggressive tumors were accumulated in Cluster B, and the cancer-free and overall survival rates of patients in this cluster were significantly lower than those of patients in Cluster A. Clear cell RCCs in Cluster B were characterized by accumulation of DNA hypermethylation on CpG islands and considered to be CpG island methylator phenotype (CIMP)-positive cancers. DNA hypermethylation of the CpG sites on the FAM150A, GRM6, ZNF540, ZFP42, ZNF154, RIMS4, PCDHAC1, KHDRBS2, ASCL2, KCNQ1, PRAC, WNT3A, TRH, FAM78A, ZNF671, SLC13A5 and NKX6-2 genes became hallmarks of CIMP in RCCs. On the other hand, Cluster A was characterized by genome-wide DNA hypomethylation. These data indicated that DNA methylation alterations at precancerous stages may determine tumor aggressiveness and patient outcome. Accumulation of DNA hypermethylation on CpG islands and genome-wide DNA hypomethylation may each underlie distinct pathways of renal carcinogenesis. Abbreviations:BAMCAbacterial artificial chromosome array-based methylated CpG island amplificationCnormal renal cortex tissue obtained from patients without any primary renal tumorCIMPCpG island methylator phenotypeHCChepatocellular carcinomaNnon-cancerous renal cortex tissue

  20. Diet-induced hypermethylation at agouti viable yellow is not inherited transgenerationally through the female

    USDA-ARS?s Scientific Manuscript database

    The effects of nonmutagenic environmental exposures can sometimes be transmitted for several generations, suggesting transgenerational inheritance of induced epigenetic variation. Methyl donor supplementation of female mice during pregnancy induces CpG hypermethylation at the agouti viable yellow (A...

  1. CpG Demethylation Enhances Alpha-Synuclein Expression and Affects the Pathogenesis of Parkinson's Disease

    PubMed Central

    Matsumoto, Lumine; Takuma, Hiroshi; Tamaoka, Akira; Kurisaki, Hiroshi; Date, Hidetoshi; Tsuji, Shoji; Iwata, Atsushi

    2010-01-01

    Background Alpha-synuclein (SNCA) gene expression is an important factor in the pathogenesis of Parkinson's disease (PD). Gene multiplication can cause inherited PD, and promoter polymorphisms that increase SNCA expression are associated with sporadic PD. CpG methylation in the promoter region may also influence SNCA expression. Methodology/Principal Findings By using cultured cells, we identified a region of the SNCA CpG island in which the methylation status altered along with increased SNCA expression. Postmortem brain analysis revealed regional non-specific methylation differences in this CpG region in the anterior cingulate and putamen among controls and PD; however, in the substantia nigra of PD, methylation was significantly decreased. Conclusions/Significance This CpG region may function as an intronic regulatory element for SNCA gene. Our findings suggest that a novel epigenetic regulatory mechanism controlling SNCA expression influences PD pathogenesis. PMID:21124796

  2. Nanodelivery systems for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Gao, Xiao-Dong

    2017-01-01

    Synthetic oligodeoxynucleotides containing immunostimulatory CpG motif mimic bacterial DNA and are potent activator of innate and adaptive immune responses. Therefore, CpG ODNs have significant potentials as immunotherapeutic agent for treatment of infectious diseases, allergy and cancer. Many clinical trials involving CpG ODNs either used alone or as adjuvant have been initiated. However, delivery of CpG ODNs to target sites still remains a great challenge due to their extreme susceptibility to nuclease degradation in serum and poor cellular uptake. Chemical modification of CpG ODNs backbone can protect them against degradation by nucleases, but have raised concern regarding several severe side effects. Development of efficient CpG ODNs delivery systems to address these issues and enhance their immunostimulatory effect are highly desirable. In recent years, the emergence of nanotechnology has provided unprecedented opportunities to encapsulate CpG ODN into various nanocarriers or synthesize CpG ODNs nanostructures. This review provides an overview of the delivery systems based on nanomaterials and nanostructures newly developed for enhancing the immunostimulatory effect of CpG ODNs, together with a brief discussion on perspectives for future studies in this field.

  3. CpG islands and the regulation of transcription

    PubMed Central

    Deaton, Aimée M.; Bird, Adrian

    2011-01-01

    Vertebrate CpG islands (CGIs) are short interspersed DNA sequences that deviate significantly from the average genomic pattern by being GC-rich, CpG-rich, and predominantly nonmethylated. Most, perhaps all, CGIs are sites of transcription initiation, including thousands that are remote from currently annotated promoters. Shared DNA sequence features adapt CGIs for promoter function by destabilizing nucleosomes and attracting proteins that create a transcriptionally permissive chromatin state. Silencing of CGI promoters is achieved through dense CpG methylation or polycomb recruitment, again using their distinctive DNA sequence composition. CGIs are therefore generically equipped to influence local chromatin structure and simplify regulation of gene activity. PMID:21576262

  4. Inherited Neuropathies

    PubMed Central

    Li, Jun

    2013-01-01

    With a prevalence of 1 in 2500 people, inherited peripheral nerve diseases, collectively called Charcot-Marie-Tooth disease (CMT), are among the most common inherited neurologic disorders. Patients with CMT typically present with chronic muscle weakness and atrophy in limbs, sensory loss in the feet and hands, and foot deformities. Clinical similarities between patients often require genetic testing to achieve a precise diagnosis. In this article, the author reviews the clinical and pathologic features of CMT, and demonstrates how electrodiagnostic and genetic tools are used to assist in the diagnosis and symptomatic management of the diseases. Several cases are presented to illustrate the diagnostic processes. PMID:23117945

  5. Technology evaluation: CpG-7909, Coley.

    PubMed

    Paul, Stéphane

    2003-10-01

    Coley Pharmaceutical (formerly CpG ImmunoPharmaceuticals) is developing CpG-7909 (ProMune) for use in the potential treatment of cancer and as a vaccine adjuvant. By April 2000, CpG-7909 had entered phase I/II trials for cancer and in March 2002, Coley initiated a phase I trial in non-Hodgkin's lymphoma in combination with rituximab (Rituxan). By October 2002, CpG-7909 was in phase II trials as a vaccine adjuvant. Cpg-7909 is currently also undergoing phase II trials for melanoma.

  6. Initiation of DNA replication at CpG islands in mammalian chromosomes.

    PubMed Central

    Delgado, S; Gómez, M; Bird, A; Antequera, F

    1998-01-01

    CpG islands are G+C-rich regions approximately 1 kb long that are free of methylation and contain the promoters of many mammalian genes. Analysis of in vivo replication intermediates at three hamster genes and one human gene showed that the CpG island regions, but not their flanks, were present in very short nascent strands, suggesting that they are replication origins (ORIs). CpG island-like fragments were enriched in a population of short nascent strands from human erythroleukaemic cells, suggesting that islands constitute a significant fraction of endogenous ORIs. Correspondingly, bulk CpG islands were found to replicate coordinately early in S phase. Our results imply that CpG islands are initiation sites for both transcription and DNA replication, and may represent genomic footprints of replication initiation. PMID:9545253

  7. Effect of CpG dinucleotides within IgH switch region repeats on immunoglobulin class switch recombination.

    PubMed

    Zhang, Zheng Z; Hsieh, Chih-Lin; Okitsu, Cindy Yen; Han, Li; Yu, Kefei; Lieber, Michael R

    2015-08-01

    Immunoglobulin (Ig) heavy chains undergo class switch recombination (CSR) to change the heavy chain isotype from IgM to IgG, A or E. The switch regions are several kilobases long, repetitive, and G-rich on the nontemplate strand. They are also relatively depleted of CpG (also called CG) sites for unknown reasons. Here we use synthetic switch regions at the IgH switch alpha (Sα) locus to test the effect of CpG sites and to try to understand why the IgH switch sequences evolved to be relatively depleted of CpG. We find that even just two CpG sites within an 80 bp synthetic switch repeat iterated 15 times (total switch region length of 1200 bp containing 30 CpG sites) are sufficient to dramatically reduce both Ig CSR and transcription through the switch region from the upstream Iα sterile transcript promoter, which is the promoter that directs transcripts through the Sα region. De novo DNA methylation occurs at the four CpG sites in and around the Iα promoter when each 80 bp Iα switch repeat contains the two CpG sites. Thus, a relatively low density of CpG sites within the switch repeats can induce upstream CpG methylation at the IgH alpha locus, and cause a substantial decrease in transcription from the sterile transcript promoter. This effect is likely the reason that switch regions evolved to contain very few CpG sites. We discuss these findings as they relate to DNA methylation and to Ig CSR.

  8. 43 CFR 3835.20 - Transferring, selling, inheriting, or otherwise conveying mining claims or sites already subject...

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ...: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) WAIVERS FROM ANNUAL MAINTENANCE FEES Conveying Mining Claims or Sites..., you must pay the annual maintenance fee by the September 1 following the date the transfer...

  9. 43 CFR 3835.20 - Transferring, selling, inheriting, or otherwise conveying mining claims or sites already subject...

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ...: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) WAIVERS FROM ANNUAL MAINTENANCE FEES Conveying Mining Claims or Sites..., you must pay the annual maintenance fee by the September 1 following the date the transfer...

  10. 43 CFR 3835.20 - Transferring, selling, inheriting, or otherwise conveying mining claims or sites already subject...

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ...: Interior Regulations Relating to Public Lands (Continued) BUREAU OF LAND MANAGEMENT, DEPARTMENT OF THE INTERIOR MINERALS MANAGEMENT (3000) WAIVERS FROM ANNUAL MAINTENANCE FEES Conveying Mining Claims or Sites..., you must pay the annual maintenance fee by the September 1 following the date the transfer became...

  11. CpG oligodeoxynucleotide CpG-685 upregulates functional interleukin-21 receptor on chronic lymphocytic leukemia B cells through an NF-κB mediated pathway.

    PubMed

    Browning, Rebekah L; Mo, Xiaokui; Muthusamy, Natarajan; Byrd, John C

    2015-06-30

    CpG oligodeoxynucleotides (ODNs) upregulate the interleukin-21 receptor (IL21R) and enhance IL-21-mediated cytotoxicity in chronic lymphocytic leukemia (CLL) B cells. We demonstrate that treatment of CLL B cells with the ODN CpG-685 leads to increased IL21R expression, and that this increased expression enhances the effects of IL-21 treatment as evidenced by increased phosphorylation of JAK1, STAT1, and STAT3, as compared to IL-21 treatment without prior CpG stimulation. Induction of IL21R by CpG-685 also enhanced IL-21-mediated cytotoxicity. The mechanism by which CpG ODNs upregulate IL21R has not been elucidated, although IL21R regulation in T cells has been shown to be linked to T cell receptor-induced Sp1 binding to the IL21R promoter. Here, we demonstrate that luciferase reporter constructs containing the Sp1 binding site have increased basal luciferase activity compared to constructs lacking the Sp1 binding site, but fail to increase luciferase activity with CpG-685 stimulation in CLL B cells. By treating CLL cells with an NF-κB inhibitor, we inhibit the CpG ODN-mediated induction of IL21R, thus demonstrating that CpG-685 upregulates IL21R through an NF-κB mediated pathway. These findings suggest an alternative mechanism for induction of IL-21 receptor in CLL B cells and provide a basis for creation of future combination therapies.

  12. CpG oligodeoxynucleotide CpG-685 upregulates functional interleukin-21 receptor on chronic lymphocytic leukemia B cells through an NF-κB mediated pathway

    PubMed Central

    Browning, Rebekah L.; Mo, Xiaokui

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) upregulate the interleukin-21 receptor (IL21R) and enhance IL-21-mediated cytotoxicity in chronic lymphocytic leukemia (CLL) B cells. We demonstrate that treatment of CLL B cells with the ODN CpG-685 leads to increased IL21R expression, and that this increased expression enhances the effects of IL-21 treatment as evidenced by increased phosphorylation of JAK1, STAT1, and STAT3, as compared to IL-21 treatment without prior CpG stimulation. Induction of IL21R by CpG-685 also enhanced IL-21-mediated cytotoxicity. The mechanism by which CpG ODNs upregulate IL21R has not been elucidated, although IL21R regulation in T cells has been shown to be linked to T cell receptor-induced Sp1 binding to the IL21R promoter. Here, we demonstrate that luciferase reporter constructs containing the Sp1 binding site have increased basal luciferase activity compared to constructs lacking the Sp1 binding site, but fail to increase luciferase activity with CpG-685 stimulation in CLL B cells. By treating CLL cells with an NF-κB inhibitor, we inhibit the CpG ODN-mediated induction of IL21R, thus demonstrating that CpG-685 upregulates IL21R through an NF-κB mediated pathway. These findings suggest an alternative mechanism for induction of IL-21 receptor in CLL B cells and provide a basis for creation of future combination therapies. PMID:26158860

  13. Regulation of DNA transposition by CpG methylation and chromatin structure in human cells

    PubMed Central

    2013-01-01

    Background The activity of transposable elements can be regulated by different means. DNA CpG methylation is known to decrease or inhibit transpositional activity of diverse transposons. However, very surprisingly, it was previously shown that CpG methylation of the Sleeping Beauty (SB) transposon significantly enhanced transposition in mouse embryonic stem cells. Results In order to investigate the unexpected response of SB transposition to CpG methylation, related transposons from the Tc1/mariner superfamily, that is, Tc1, Himar1, Hsmar1, Frog Prince (FP) and Minos were tested to see how transposition was affected by CpG methylation. A significant increase of >20-fold in transposition of SB, FP and Minos was seen, whereas Tc1, Himar1 and Hsmar1 showed no difference in transposition upon CpG-methylation. The terminal inverted repeats (TIRs) of the SB, FP and Minos elements share a common structure, in which each TIR contains two functionally important binding sites for the transposase (termed the IR/DR structure). The group of IR/DR elements showed increased excision after CpG methylation compared to untreated transposon donor plasmids. We found that de novo CpG methylation is not required for transposition. A mutated FP donor plasmid with depleted CpG sites in both TIRs was as efficient in transposition as the wild-type transposon, indicating that CpG sites inside the TIRs are not responsible for altered binding of factors potentially modulating transposition. By using an in vivo one-hybrid DNA-binding assay in cultured human cells we found that CpG methylation had no appreciable effect on the affinity of SB transposase to its binding sites. However, chromatin immunoprecipitation indicated that CpG-methylated transposon donor plasmids are associated with a condensed chromatin structure characterized by trimethylated histone H3K9. Finally, DNA compaction by protamine was found to enhance SB transposition. Conclusions We have shown that DNA CpG methylation

  14. Regulation of DNA transposition by CpG methylation and chromatin structure in human cells.

    PubMed

    Jursch, Tobias; Miskey, Csaba; Izsvák, Zsuzsanna; Ivics, Zoltán

    2013-05-15

    The activity of transposable elements can be regulated by different means. DNA CpG methylation is known to decrease or inhibit transpositional activity of diverse transposons. However, very surprisingly, it was previously shown that CpG methylation of the Sleeping Beauty (SB) transposon significantly enhanced transposition in mouse embryonic stem cells. In order to investigate the unexpected response of SB transposition to CpG methylation, related transposons from the Tc1/mariner superfamily, that is, Tc1, Himar1, Hsmar1, Frog Prince (FP) and Minos were tested to see how transposition was affected by CpG methylation. A significant increase of >20-fold in transposition of SB, FP and Minos was seen, whereas Tc1, Himar1 and Hsmar1 showed no difference in transposition upon CpG-methylation. The terminal inverted repeats (TIRs) of the SB, FP and Minos elements share a common structure, in which each TIR contains two functionally important binding sites for the transposase (termed the IR/DR structure). The group of IR/DR elements showed increased excision after CpG methylation compared to untreated transposon donor plasmids. We found that de novo CpG methylation is not required for transposition. A mutated FP donor plasmid with depleted CpG sites in both TIRs was as efficient in transposition as the wild-type transposon, indicating that CpG sites inside the TIRs are not responsible for altered binding of factors potentially modulating transposition. By using an in vivo one-hybrid DNA-binding assay in cultured human cells we found that CpG methylation had no appreciable effect on the affinity of SB transposase to its binding sites. However, chromatin immunoprecipitation indicated that CpG-methylated transposon donor plasmids are associated with a condensed chromatin structure characterized by trimethylated histone H3K9. Finally, DNA compaction by protamine was found to enhance SB transposition. We have shown that DNA CpG methylation upregulates transposition of IR

  15. Inherited Pain

    PubMed Central

    Eberhardt, Mirjam; Nakajima, Julika; Klinger, Alexandra B.; Neacsu, Cristian; Hühne, Kathrin; O'Reilly, Andrias O.; Kist, Andreas M.; Lampe, Anne K.; Fischer, Kerstin; Gibson, Jane; Nau, Carla; Winterpacht, Andreas; Lampert, Angelika

    2014-01-01

    Inherited erythromelalgia (IEM) causes debilitating episodic neuropathic pain characterized by burning in the extremities. Inherited “paroxysmal extreme pain disorder” (PEPD) differs in its clinical picture and affects proximal body areas like the rectal, ocular, or jaw regions. Both pain syndromes have been linked to mutations in the voltage-gated sodium channel Nav1.7. Electrophysiological characterization shows that IEM-causing mutations generally enhance activation, whereas mutations leading to PEPD alter fast inactivation. Previously, an A1632E mutation of a patient with overlapping symptoms of IEM and PEPD was reported (Estacion, M., Dib-Hajj, S. D., Benke, P. J., Te Morsche, R. H., Eastman, E. M., Macala, L. J., Drenth, J. P., and Waxman, S. G. (2008) NaV1.7 Gain-of-function mutations as a continuum. A1632E displays physiological changes associated with erythromelalgia and paroxysmal extreme pain disorder mutations and produces symptoms of both disorders. J. Neurosci. 28, 11079–11088), displaying a shift of both activation and fast inactivation. Here, we characterize a new mutation of Nav1.7, A1632T, found in a patient suffering from IEM. Although transfection of A1632T in sensory neurons resulted in hyperexcitability and spontaneous firing of dorsal root ganglia (DRG) neurons, whole-cell patch clamp of transfected HEK cells revealed that Nav1.7 activation was unaltered by the A1632T mutation but that steady-state fast inactivation was shifted to more depolarized potentials. This is a characteristic normally attributed to PEPD-causing mutations. In contrast to the IEM/PEPD crossover mutation A1632E, A1632T failed to slow current decay (i.e. open-state inactivation) and did not increase resurgent currents, which have been suggested to contribute to high-frequency firing in physiological and pathological conditions. Reduced fast inactivation without increased resurgent currents induces symptoms of IEM, not PEPD, in the new Nav1.7 mutation, A1632T

  16. INHERITED CARDIOMYOPATHIES

    PubMed Central

    Towbin, Jeffrey A.

    2015-01-01

    Cardiomyopathies, diseases of the heart muscle, are major causes of morbidity and mortality. A significant percentage of patients with cardiomyopathies have genetic-based, inheritable disease and, over the past two decades the genetic causes of these disorders have been increasingly discovered. The genes causing these disorders when they are mutated appear to encode proteins that frame a “final common pathway” for that specific disorder but the specifics of the phenotype, including age of onset, severity, and outcome is variable for reasons not yet understood. The “final common pathways” for the classified forms of cardiomyopathy include the sarcomere in the primarily diastolic dysfunction disorders hypertrophic cardiomyopathy (HCM) and restrictive cardiomyopathy (RCM), the linkage of the sarcomere and sarcolemma in the systolic dysfunction disorder dilated cardiomyopathy (DCM), and the desmosome in arrhythmogenic cardiomyopathy (AVC). Left ventricular noncompaction cardiomyopathy (LVNC) is an overlap disorder and appears that any of these “final common pathways” can be involved depending on the specific form of LVNC. The genetics and mechanisms responsible for these clinical phenotypes will be described. PMID:25186923

  17. Inherited variation in circadian rhythm genes and risks of prostate cancer and three other cancer sites in combined cancer consortia.

    PubMed

    Gu, Fangyi; Zhang, Han; Hyland, Paula L; Berndt, Sonja; Gapstur, Susan M; Wheeler, William; Ellipse Consortium, The; Amos, Christopher I; Bezieau, Stephane; Bickeböller, Heike; Brenner, Hermann; Brennan, Paul; Chang-Claude, Jenny; Conti, David V; Doherty, Jennifer Anne; Gruber, Stephen B; Harrison, Tabitha A; Hayes, Richard B; Hoffmeister, Michael; Houlston, Richard S; Hung, Rayjean J; Jenkins, Mark A; Kraft, Peter; Lawrenson, Kate; McKay, James; Markt, Sarah; Mucci, Lorelei; Phelan, Catherine M; Qu, Conghui; Risch, Angela; Rossing, Mary Anne; Wichmann, H-Erich; Shi, Jianxin; Schernhammer, Eva; Yu, Kai; Landi, Maria Teresa; Caporaso, Neil E

    2017-11-01

    Circadian disruption has been linked to carcinogenesis in animal models, but the evidence in humans is inconclusive. Genetic variation in circadian rhythm genes provides a tool to investigate such associations. We examined associations of genetic variation in nine core circadian rhythm genes and six melatonin pathway genes with risk of colorectal, lung, ovarian and prostate cancers using data from the Genetic Associations and Mechanisms in Oncology (GAME-ON) network. The major results for prostate cancer were replicated in the Prostate, Lung, Colorectal and Ovarian (PLCO) cancer screening trial, and for colorectal cancer in the Genetics and Epidemiology of Colorectal Cancer Consortium (GECCO). The total number of cancer cases and controls was 15,838/18,159 for colorectal, 14,818/14,227 for prostate, 12,537/17,285 for lung and 4,369/9,123 for ovary. For each cancer site, we conducted gene-based and pathway-based analyses by applying the summary-based Adaptive Rank Truncated Product method (sARTP) on the summary association statistics for each SNP within the candidate gene regions. Aggregate genetic variation in circadian rhythm and melatonin pathways were significantly associated with the risk of prostate cancer in data combining GAME-ON and PLCO, after Bonferroni correction (ppathway  < 0.00625). The two most significant genes were NPAS2 (pgene  = 0.0062) and AANAT (pgene  = 0.00078); the latter being significant after Bonferroni correction. For colorectal cancer, we observed a suggestive association with the circadian rhythm pathway in GAME-ON (ppathway  = 0.021); this association was not confirmed in GECCO (ppathway  = 0.76) or the combined data (ppathway  = 0.17). No significant association was observed for ovarian and lung cancer. These findings support a potential role for circadian rhythm and melatonin pathways in prostate carcinogenesis. Further functional studies are needed to better understand the underlying biologic mechanisms.

  18. Inherit Space

    NASA Technical Reports Server (NTRS)

    Giarratano, Joseph C.; Jenks, K. C.

    1997-01-01

    The objective of the proposed research was to begin development of a unique educational tool targeted at educating and inspiring young people 12-16 years old about NASA and the Space Program. Since these young people are the future engineers, scientists and space pioneers, the nurturing of their enthusiasm and interest is of critical importance to the Nation. This summer the basic infrastructure of the tool was developed in the context of an educational game paradigm. The game paradigm has achieved remarkable success in maintaining the interest of young people in a self-paced, student-directed learning environment. This type of environment encourages student exploration and curiosity which are exactly the traits that future space pioneers need to develop to prepare for the unexpected. The Inherit Space Educational Tool is an open-ended learning environment consisting of a finite-state machine classic adventure game paradigm. As the young person explores this world, different obstacles must be overcome. Rewards will be offered such as using the flight simulator to fly around and explore Titan. This simulator was modeled on conventional Earth flight simulators but has been considerably enhanced to add texture mapping of Titan's atmosphere utilizing the latest information from the NASA Galileo Space Probe. Additional scenery was added to provide color VGA graphics of a futuristic research station on Titan as well as an interesting story to keep the youngster's attention. This summer the game infrastructure has been developed as well as the Titan Flight Simulator. A number of other enhancements are planned.

  19. Nucleosome dynamics and maintenance of epigenetic states of CpG islands

    NASA Astrophysics Data System (ADS)

    Sneppen, Kim; Dodd, Ian B.

    2016-06-01

    Methylation of mammalian DNA occurs primarily at CG dinucleotides. These CpG sites are located nonrandomly in the genome, tending to occur within high density clusters of CpGs (islands) or within large regions of low CpG density. Cluster methylation tends to be bimodal, being dominantly unmethylated or mostly methylated. For CpG clusters near promoters, low methylation is associated with transcriptional activity, while high methylation is associated with gene silencing. Alternative CpG methylation states are thought to be stable and heritable, conferring localized epigenetic memory that allows transient signals to create long-lived gene expression states. Positive feedback where methylated CpG sites recruit enzymes that methylate nearby CpGs, can produce heritable bistability but does not easily explain that as clusters increase in size or density they change from being primarily methylated to primarily unmethylated. Here, we show that an interaction between the methylation state of a cluster and its occupancy by nucleosomes provides a mechanism to generate these features and explain genome wide systematics of CpG islands.

  20. Formulation of vaccines containing CpG oligonucleotides and alum

    PubMed Central

    Aebig, Joan A.; Mullen, Gregory E. D.; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A.; Saul, Allan; Miles, Aaron P.

    2007-01-01

    CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum based vaccines containing CPG 7909. PMID:17512533

  1. Formulation of vaccines containing CpG oligonucleotides and alum.

    PubMed

    Aebig, Joan A; Mullen, Gregory E D; Dobrescu, Gelu; Rausch, Kelly; Lambert, Lynn; Ajose-Popoola, Olubunmi; Long, Carole A; Saul, Allan; Miles, Aaron P

    2007-06-30

    CpG oligodeoxynucleotides are potent immunostimulants. For parenterally delivered alum-based vaccines, the immunostimulatory effect of CpG depends on the association of the CpG and antigen to the alum. We describe effects of buffer components on the binding of CPG 7909 to aluminum hydroxide (Alhydrogel), assays for measuring binding of CPG 7909 to alum and CPG 7909 induced dissociation of antigen from the alum. Free CPG 7909 is a potent inducer of IP-10 in mice. However the lack of IP-10 production from formulations containing bound CPG 7909 suggested that CPG 7909 does not rapidly dissociate from the alum after injection. It also suggests that IP-10 assays are not a good basis for potency assays for alum-based vaccines containing CPG 7909.

  2. Hypermethylation of CpG islands in primary and metastatic human prostate cancer.

    PubMed

    Yegnasubramanian, Srinivasan; Kowalski, Jeanne; Gonzalgo, Mark L; Zahurak, Marianna; Piantadosi, Steven; Walsh, Patrick C; Bova, G Steven; De Marzo, Angelo M; Isaacs, William B; Nelson, William G

    2004-03-15

    Aberrant DNA methylation patterns may be the earliest somatic genome changes in prostate cancer. Using real-time methylation-specific PCR, we assessed the extent of hypermethylation at 16 CpG islands in DNA from seven prostate cancer cell lines (LNCaP, PC-3, DU-145, LAPC-4, CWR22Rv1, VCaP, and C42B), normal prostate epithelial cells, normal prostate stromal cells, 73 primary prostate cancers, 91 metastatic prostate cancers, and 25 noncancerous prostate tissues. We found that CpG islands at GSTP1, APC, RASSF1a, PTGS2, and MDR1 were hypermethylated in >85% of prostate cancers and cancer cell lines but not in normal prostate cells and tissues; CpG islands at EDNRB, ESR1, CDKN2a, and hMLH1 exhibited low to moderate rates of hypermethylation in prostate cancer tissues and cancer cell lines but were entirely unmethylated in normal tissues; and CpG islands at DAPK1, TIMP3, MGMT, CDKN2b, p14/ARF, and CDH1 were not abnormally hypermethylated in prostate cancers. Receiver operator characteristic curve analyses suggested that CpG island hypermethylation changes at GSTP1, APC, RASSF1a, PTGS2, and MDR1 in various combinations can distinguish primary prostate cancer from benign prostate tissues with sensitivities of 97.3-100% and specificities of 92-100%. Hypermethylation of the CpG island at EDNRB was correlated with the grade and stage of the primary prostate cancers. PTGS2 CpG island hypermethylation portended an increased risk of recurrence. Furthermore, CpG island hypermethylation patterns in prostate cancer metastases were very similar to the primary prostate cancers and tended to show greater differences between cases than between anatomical sites of metastasis.

  3. Prediction of CpG-island function: CpG clustering vs. sliding-window methods

    PubMed Central

    2010-01-01

    Background Unmethylated stretches of CpG dinucleotides (CpG islands) are an outstanding property of mammal genomes. Conventionally, these regions are detected by sliding window approaches using %G + C, CpG observed/expected ratio and length thresholds as main parameters. Recently, clustering methods directly detect clusters of CpG dinucleotides as a statistical property of the genome sequence. Results We compare sliding-window to clustering (i.e. CpGcluster) predictions by applying new ways to detect putative functionality of CpG islands. Analyzing the co-localization with several genomic regions as a function of window size vs. statistical significance (p-value), CpGcluster shows a higher overlap with promoter regions and highly conserved elements, at the same time showing less overlap with Alu retrotransposons. The major difference in the prediction was found for short islands (CpG islets), often exclusively predicted by CpGcluster. Many of these islets seem to be functional, as they are unmethylated, highly conserved and/or located within the promoter region. Finally, we show that window-based islands can spuriously overlap several, differentially regulated promoters as well as different methylation domains, which might indicate a wrong merge of several CpG islands into a single, very long island. The shorter CpGcluster islands seem to be much more specific when concerning the overlap with alternative transcription start sites or the detection of homogenous methylation domains. Conclusions The main difference between sliding-window approaches and clustering methods is the length of the predicted islands. Short islands, often differentially methylated, are almost exclusively predicted by CpGcluster. This suggests that CpGcluster may be the algorithm of choice to explore the function of these short, but putatively functional CpG islands. PMID:20500903

  4. Comparative analysis using K-mer and K-flank patterns provides evidence for CpG island sequence evolution in mammalian genomes.

    PubMed

    Chae, Heejoon; Park, Jinwoo; Lee, Seong-Whan; Nephew, Kenneth P; Kim, Sun

    2013-05-01

    CpG islands are GC-rich regions often located in the 5' end of genes and normally protected from cytosine methylation in mammals. The important role of CpG islands in gene transcription strongly suggests evolutionary conservation in the mammalian genome. However, as CpG dinucleotides are over-represented in CpG islands, comparative CpG island analysis using conventional sequence analysis techniques remains a major challenge in the epigenetics field. In this study, we conducted a comparative analysis of all CpG island sequences in 10 mammalian genomes. As sequence similarity methods and character composition techniques such as information theory are particularly difficult to conduct, we used exact patterns in CpG island sequences and single character discrepancies to identify differences in CpG island sequences. First, by calculating genome distance based on rank correlation tests, we show that k-mer and k-flank patterns around CpG sites can be used to correctly reconstruct the phylogeny of 10 mammalian genomes. Further, we used various machine learning algorithms to demonstrate that CpG islands sequences can be characterized using k-mers. In addition, by testing a human model on the nine different mammalian genomes, we provide the first evidence that k-mer signatures are consistent with evolutionary history.

  5. GC Content Increased at CpG Flanking Positions of Fish Genes Compared with Sea Squirt Orthologs as a Mechanism for Reducing Impact of DNA Methylation

    PubMed Central

    Wang, Yong; Leung, Frederick C. C.

    2008-01-01

    Background Fractional DNA methylation in sea squirts evolved to global DNA methylation in fish. The impact of global DNA methylation is reflected by more CpG depletions and/or more A/T to G/C changes at CpG flanking positions due to context-dependent mutations of methylated CpG sites. Methods and Findings In this report, we demonstrate that the sea squirt genes have undergone more CpG to TpG/CpA substitutions than the fish orthologs using homologous fragments from orthologous genes among Ciona intestinalis, Ciona savignyi, fugufish and zebrafish. To avoid premature transcription, the TGA sites derived from CGA were largely converted to TGG in sea squirt genes. By contrast, a significant increment of GC content at CpG flanking positions was shown in fish genes. The positively selected A/T to G/C substitutions, in combination with the CpG to TpG/CpA substitutions, are the sources of the extremely low CpG observed/expected ratios in vertebrates. The nonsynonymous substitutions caused by the GC content increase have resulted in frequent amino acid replacements in the directions that were not noticed previously. Conclusion The increased GC content at CpG flanking positions can reduce CpG loss in fish genes and attenuate the impact of DNA methylation on CpG-containing codons, probably accounting for evolution towards vertebrates. PMID:19005573

  6. GC content increased at CpG flanking positions of fish genes compared with sea squirt orthologs as a mechanism for reducing impact of DNA methylation.

    PubMed

    Wang, Yong; Leung, Frederick C C

    2008-01-01

    Fractional DNA methylation in sea squirts evolved to global DNA methylation in fish. The impact of global DNA methylation is reflected by more CpG depletions and/or more A/T to G/C changes at CpG flanking positions due to context-dependent mutations of methylated CpG sites. In this report, we demonstrate that the sea squirt genes have undergone more CpG to TpG/CpA substitutions than the fish orthologs using homologous fragments from orthologous genes among Ciona intestinalis, Ciona savignyi, fugufish and zebrafish. To avoid premature transcription, the TGA sites derived from CGA were largely converted to TGG in sea squirt genes. By contrast, a significant increment of GC content at CpG flanking positions was shown in fish genes. The positively selected A/T to G/C substitutions, in combination with the CpG to TpG/CpA substitutions, are the sources of the extremely low CpG observed/expected ratios in vertebrates. The nonsynonymous substitutions caused by the GC content increase have resulted in frequent amino acid replacements in the directions that were not noticed previously. The increased GC content at CpG flanking positions can reduce CpG loss in fish genes and attenuate the impact of DNA methylation on CpG-containing codons, probably accounting for evolution towards vertebrates.

  7. Mitochondrial inheritance in yeast.

    PubMed

    Westermann, Benedikt

    2014-07-01

    Mitochondria are the site of oxidative phosphorylation, play a key role in cellular energy metabolism, and are critical for cell survival and proliferation. The propagation of mitochondria during cell division depends on replication and partitioning of mitochondrial DNA, cytoskeleton-dependent mitochondrial transport, intracellular positioning of the organelle, and activities coordinating these processes. Budding yeast Saccharomyces cerevisiae has proven to be a valuable model organism to study the mechanisms that drive segregation of the mitochondrial genome and determine mitochondrial partitioning and behavior in an asymmetrically dividing cell. Here, I review past and recent advances that identified key components and cellular pathways contributing to mitochondrial inheritance in yeast. This article is part of a Special Issue entitled: 18th European Bioenergetic Conference. Guest Editors: Manuela Pereira and Miguel Teixeira.

  8. Inherited disorders of desmosomes.

    PubMed

    McGrath, John A

    2005-11-01

    Desmosomes are highly organized intercellular junctions that provide mechanical integrity to tissues by anchoring intermediate filaments to sites of strong adhesion. These cell-cell adhesion junctions are found in skin, heart, lymph nodes and meninges. Over the last 8 years, several naturally occurring human gene mutations in structural components of desmosomes have been reported. These comprise autosomal dominant or recessive mutations in plakophilin 1, plakophilin 2, desmoplakin, plakoglobin, desmoglein 1, desmoglein 4 and corneodesmosin. These discoveries have often highlighted novel or unusual phenotypes, including abnormal skin fragility and differentiation, and developmental anomalies of various ectodermal appendages, especially hair. Some desmosomal gene mutations may also result in cardiac disease, notably cardiomyopathy. This article describes the spectrum of clinical features that may be found in the inherited disorders of desmosomes and highlights the key functions of several of the desmosomal proteins in tissue adhesion and cell biology.

  9. Mitochondrial inheritance in fungi.

    PubMed

    Basse, Christoph W

    2010-12-01

    Faithful inheritance of mitochondria is essential for growth and development. Uniparental inheritance of mitochondria is a common phenomenon in sexual eukaryotes and has been reported for numerous fungal species. Uniparental inheritance is a genetically regulated process, aimed to gain a homoplasmic state within cells, and this is often associated with selective elimination of one parental mitochondria population. This review will focus on recent developments in our understanding of common and specified regulatory circuits of selective mitochondrial inheritance during sexual development. It further refers to the influence of mitochondrial fusion on generation of recombinant mitochondrial DNA molecules. The latter aspect appears rather exciting in the context of intron homing and could bring a new twist to the debate on the significance of uniparental inheritance. The emergence of genome-wide studies offers new perspectives to address potential relationships between uniparental inheritance, vegetative inheritance and last but not least cellular scavenging systems to dispose of disintegrated organelles.

  10. Deoxyribonucleic acid (DNA) methyltransferase contributes to p16 promoter CpG island methylation in lung adenocarcinoma with smoking.

    PubMed

    Sun, Rongju; Liu, Jiahong; Wang, Bo; Ma, Lingyun; Quan, Xiaojiao; Chu, Zhixiang; Li, Tanshi

    2015-01-01

    In this study, the relationship between CpG island methylation and smoking and DNA methyltransferase in the occurrence and development of lung adenocarcinoma was explored by detecting p16 promoter methylation status. Protein and mRNA levels of p16 were detected by immunohistochemistry and in situ hybridization assays. p16 gene promoter and exon 1 CpG island locus Hap II sites methylation status was analyzed with the methylation-specific PCR. Only 4 of 40 p16-positive cases were detected to methylate on CpG islands with 10% methylating rate whereas 18 of p16-negative cases were methylated up to 36.73% of methylating rate. The methylating rates of both p16-positive and p16-negative groups were significantly different. 17 of 50 cases with smoking from total 89 lung adenocarcinoma cases were detected to methylate on CpG islands while only 5 of the remaining 39 non-smokers to methylate. The difference of the methylating rates in both smokers and non-smokers was significant to suggest the closely association of CpG island methylation of p16 with smoking. Furthermore, p16 promoter CpG islands were detected to methylate in 15 of 35 cases with higher DNA methyltransferase activity whereas only 7 detected to methylate in the remaining 54 cases with lower DNA methyltransferase activity. p16 promoter CpG island methylation likely made p16 expressing silence thus contributed to the tumorigenesis of lung adenocarcinoma. Smoking is likely to promote p16 CpG island methylation or by its effect of the activity and metabolism of DNA methyltransferase 1 (DNMT) on CpG island methylation status.

  11. CpG oligodeoxynucleotide induction of antiviral effector molecules in sheep.

    PubMed

    Nichani, Anil K; Kaushik, Radhey S; Mena, Angelo; Popowych, Yurij; Dent, Donna; Townsend, Hugh G G; Mutwiri, George; Hecker, Rolf; Babiuk, Lorne A; Griebel, Philip J

    2004-01-01

    Immunostimulatory CpG oligodeoxynucleotide (ODN) can protect mice against infection by many pathogens but the mechanisms mediating disease protection are not well defined. Furthermore, the mechanisms of CpG ODN induced disease protection in vivo have not been investigated in other species. We investigated the induction of antiviral effector molecules in sheep treated with a class B CpG ODN (2007). Subcutaneous injection of ODN 2007 induced a dose-dependent increase in serum levels of the antiviral effector molecule, 2'5'-A synthetase. Peak levels of enzyme were observed 4 days following ODN injection and enzyme levels remained elevated for the following 3-5 days. Repeated ODN injections induced a more sustained elevation of serum 2'5'-A synthetase activity. Finally, formulation of ODN 2007 in emulsigen increased the level of serum 2'5'-A synthetase activity and this response was CpG-specific. Elevated serum 2'5'-A synthetase activity suggested that CpG ODN acted through the induction of either interferon (IFN)-alpha or IFN-gamma. ODN 2007 did not induce detectable levels of IFN-alpha or IFN-gamma when incubated with peripheral blood mononuclear cells, but both IFN-alpha and IFN-gamma were detected following stimulation of lymph node cells with ODN 2007. CpG ODN induction of 2'5'-A synthetase in vitro correlated with the secretion of both IFN-alpha and IFN-gamma. Furthermore, immunohistochemical staining of skin revealed a marked cellular infiltration at the site of ODN 2007 injection. This cellular infiltration was CpG-specific and consisted of primarily CD172(+) myeloid cells. Many of the cells recruited to the site of ODN 2007 injection expressed IFN-alpha and some IFN-gamma. These observations support the conclusion that localized cell recruitment and activation contribute to CpG ODN induction of antiviral effector molecules, such as interferon and 2'5'-A synthetase.

  12. Biodistribution and metabolism of immunostimulatory oligodeoxynucleotide CPG 7909 in mouse and rat tissues following subcutaneous administration.

    PubMed

    Noll, Bernhard O; McCluskie, Michael J; Sniatala, Tanja; Lohner, Angela; Yuill, Stephanie; Krieg, Arthur M; Schetter, Christian; Davis, Heather L; Uhlmann, Eugen

    2005-03-15

    To evaluate pharmacokinetics (PK) and biodistribution, CPG 7909, a 24-mer immunostimulatory fully phosphorothioated oligodeoxynucleotide (PS-ODN), was administered by subcutaneous injection at 2, 5 and 12.5mg/kg to mice and at 9mg/kg to rats. Parent compound and metabolites were isolated from plasma and tissues and quantified by capillary gel electrophoresis with UV detection (CGE-UV) and molecular masses were determined by matrix-assisted-laser-desorption-ionization time of flight detection (MALDI-TOF). An established method for PS-ODN isolation from plasma and tissue was modified to prevent oxidation of the phosphorothioate bonds during the extraction process, significantly increasing sensitivity in the subsequent MALDI-TOF analysis. Concentrations of CPG 7909 and metabolites were highest at the injection site (>600mg/kg at 4h). Maximal concentrations in local (draining) lymph nodes (LLN), kidney and liver were 10-15% of that at the injection site. The highest total amount of PS-ODN (percentage of administered dose) was found in the liver (32% at 4h), followed closely by the injection site (23% at 4h). Only very low levels of CPG 7909 and metabolites were found in plasma and only during the first hours. Metabolites identified by MALDI-TOF were similar for both species and all analyzed tissues, although the relative amounts of the different metabolites varied with tissue and over time. Degradation of CPG 7909 in vivo occurred predominantly by 3'exonucleases with additional cleavage by endonucleases.

  13. Epigenetic inheritance: Uncontested?

    PubMed Central

    Zhu, Bing; Reinberg, Danny

    2011-01-01

    “Epigenetics” is currently defined as “the inheritance of variation (-genetics) above and beyond (epi-) changes in the DNA sequence”. Despite the fact that histones are believed to carry important epigenetic information, little is known about the molecular mechanisms of the inheritance of histone-based epigenetic information, including histone modifications and histone variants. Here we review recent progress and discuss potential models for the mitotic inheritance of histone modifications-based epigenetic information. PMID:21321606

  14. Attachment of class B CpG ODN onto DOTAP/DC-chol liposome in nasal vaccine formulations augments antigen-specific immune responses in mice.

    PubMed

    Tada, Rui; Muto, Shoko; Iwata, Tomoko; Hidaka, Akira; Kiyono, Hiroshi; Kunisawa, Jun; Aramaki, Yukihiko

    2017-01-26

    To overcome infectious diseases, the development of mucosal vaccines would be an effective strategy, since mucosal surfaces are the entry site for most pathogens. In general, protein antigens show inherently poor immunogenicity when administered by the mucosal route. Therefore, co-administration of an appropriate mucosal adjuvant is required to exert immune responses toward pathogen-derived antigens effectively. However, the development of a safe and effective mucosal adjuvant system is still challenging. Although, recent studies reported that oligodeoxynucleotides (ODNs) containing immunostimulatory CpG motifs (CpG ODNs) act as potent mucosal adjuvants and are useful in the formulation of nasal vaccines, there are some disadvantages. For instance, the administration of phosphorothioate (PS)-modified CpG ODNs can induce adverse systemic effects, such as splenomegaly, in a dose-dependent manner. Therefore, a reduced dose of CpG ODN might be crucial when used as vaccine adjuvant for clinical purposes. Therefore, we prepared a CpG ODN-loaded cationic liposome, and evaluated its mucosal adjuvant activity. We prepared a CpG ODN-loaded DOTAP/DC-chol liposome that was stable during our experiments, by mixing CpG ODNs and liposomes at an N/P ratio of 4. Further, we demonstrated that the attachment of class B CpG ODN to the DOTAP/DC-chol liposomes synergistically enhanced antigen-specific IgA production in the nasal area than that induced by CpG ODN and DOTAP/DC-chol liposomes alone. The endpoint titers were more than tenfolds higher than that induced by either single CpG ODN or single DOTAP/DC-chol liposomes. Additionally, although serum IgG1 responses (indicated as a Th2 response) remained unchanged for DOTAP/DC-chol liposomes and CpG ODN-loaded DOTAP/DC-chol liposomes, the CpG ODN-loaded DOTAP/DC-chol liposomes synergistically induced the production of serum IgG2a (indicated as a Th1 response) than that by the individual liposomes. We conclude that the advantage of using

  15. Recognition of CpG oligodeoxynucleotides by human Toll-like receptor 9 and subsequent cytokine induction.

    PubMed

    Suwarti, Suwarti; Yamazaki, Tomohiko; Svetlana, Chechetka; Hanagata, Nobutaka

    2013-01-25

    Toll-like receptor 9 (TLR9) recognizes a synthetic ligand, oligodeoxynucleotide (ODN) containing cytosine-phosphate-guanine (CpG). Activation of TLR9 by CpG ODN induces a signal transduction cascade that plays a pivotal role in first-line immune defense in the human body. The three-dimensional structure of TLR9 has not yet been reported, and the ligand-binding mechanism of TLR9 is still poorly understood; therefore, the mechanism of human TLR9 (hTLR9) ligand binding needs to be elucidated. In this study, we constructed several hTLR9 mutants, including truncated mutants and single mutants in the predicted CpG ODN-binding site. We used these mutants to analyze the role of potential important regions of hTLR9 in receptor signaling induced by phosphorothioate (PTO)-modified CpG ODN and CpG ODNs only consist entirely of a phosphodiester (PD) backbone, CpG ODN2006x3-PD that we developed. We found truncated mutants of hTLR9 lost the signaling activity, indicating that both the C- and N-termini of the extracellular domain (ECD) are necessary for the function of hTLR9. We identified residues, His505, Gln510, His530, and Tyr554, in the C-terminal of hTLR9-ECD that are essential for hTLR9 activation. These residues might form positive charged clusters with which negatively charged CpG ODN could interact. Furthermore, we observed ODN-PD induced interleukin-6 (IL-6) through TLR9 in a CpG-sequence-dependent manner in human peripheral blood mononuclear cells and B cells, whereas ODN-PTO induced IL-6 in a CpG-sequence-independent manner. These finding are relevant for the mechanism of hTLR9 activation by CpG ODNs.

  16. CpG methylation at GATA elements in the regulatory region of CCR3 positively correlates with CCR3 transcription.

    PubMed

    Uhm, Tae Gi; Lee, Seol Kyung; Kim, Byung Soo; Kang, Jin Hyun; Park, Choon Sik; Rhim, Tai Youn; Chang, Hun Soo; Kim, Do Jin; Chung, Il Yup

    2012-04-30

    DNA methylation may regulate gene expression by restricting the access of transcription factors. We have previously demonstrated that GATA-1 regulates the transcription of the CCR3 gene by dynamically interacting with both positively and negatively acting GATA elements of high affinity binding in the proximal promoter region including exon 1. Exon 1 has three CpG sites, two of which are positioned at the negatively acting GATA elements. We hypothesized that the methylation of these two CpGs sites might preclude GATA-1 binding to the negatively acting GATA elements and, as a result, increase the availability of GATA-1 to the positively acting GATA element, thereby contributing to an increase in GATA-1-mediated transcription of the gene. To this end, we determined the methylation of the three CpG sites by bisulfate pyrosequencing in peripheral blood eosinophils, cord blood (CB)-derived eosinophils, PBMCs, and cell lines that vary in CCR3 mRNA expression. Our results demonstrated that methylation of CpG sites at the negatively acting GATA elements severely reduced GATA-1 binding and augmented transcription activity in vitro. In agreement, methylation of these CpG sites positively correlated with CCR3 mRNA expression in the primary cells and cell lines examined. Interestingly, methylation patterns of these three CpG sites in CB-derived eosinophils mostly resembled those in peripheral blood eosinophils. These results suggest that methylation of CpG sites at the GATA elements in the regulatory regions fine-tunes CCR3 transcription.

  17. Effect of target gene CpG content on spontaneous mutation in299 transgenic mice.

    PubMed

    Skopek, T; Marino, D; Kort, K; Miller, J; Trumbauer, M; Gopal, S; Chen, H

    1998-05-25

    Transgenic mutation assays utilizing bacterial target genes display a high frequency of spontaneous mutation at CpG sequences. This is believed to result from the fact that: (1) the prokaryotic genes currently being used as transgenic mutation targets have a high CpG content and (2) these sequences are methylated by mammalian cells to produce 5-methylcytosine (5MC), a known promutagenic base. To study the effect of CpG content on the frequency and type of spontaneous mutation, we have synthesized an analogue of the bacterial lacI target gene (mrkII) that contains a reduced number of CpG sequences. This gene was inserted into a lambda vector and used to construct transgenic mice that undergo vector rescue from genomic DNA upon in vitro packaging. Results on spontaneous mutation frequency and spectrum have been collected and compared to those observed at the lacI gene in Big Blue transgenic mice. Spontaneous mutations at the mrkII gene occurred at a frequency in the mid-10-5 range and were predominantly base pair substitutions, similar to results seen in Big Blue. However, mrkII mutations were distributed toward the carboxyl end of the gene instead of the bias toward the amino terminus seen in lacI. Unexpectedly, 23% of the spontaneous mrkII mutations were GC-->AT transitions at CpG sequences (compared to 32% in lacI), despite the reduction in CpG number from 95 in lacI to only 13 in mrkII. Nine of the CpG bases undergoing transition mutations in mrkII have not been recorded previously as spontaneous sites in Big Blue. Therefore, substantial reduction of the number of CpG sequences in the lacI transgene did not significantly reduce the rate of spontaneous mutation or alter the contribution of CpG-related events. This suggests that other factors are also operating to establish frequency and composition of spontaneous mutations in transgenic targets. Copyright 1998 Elsevier Science B.V. All rights reserved.

  18. Inheritable stimulatory effects of caffeine on steroidogenic acute regulatory protein expression and cortisol production in human adrenocortical cells.

    PubMed

    Ping, Jie; Lei, You-Ying; Liu, Lian; Wang, Ting-ting; Feng, Ying-hong; Wang, Hui

    2012-01-05

    Caffeine is the most widely consumed psychoactive substance in the world. It can elevate the level of glucocorticoid which is involved in metabolism regulation, stress response, and immune function. However, the specific mechanism has yet to be elucidated. Glucocorticoid is steroid hormone synthesized in adrenal cortex and the key rate-limiting step in its biosynthesis is mediated by steroidogenic acute regulatory protein (StAR). This study was designed to investigate the direct effects and inheritable epigenetic mechanisms of caffeine on cortisol production and StAR expression in human adrenocortical cells. The human adrenocortical cell line NCI-H295A was cultured with 0.4-40μM caffeine. There was a significant increase of the cortisol production in cells. In both acutely and chronically caffeine-treated cell groups, mRNA and protein expressions of StAR were stimulated in a dose-dependent manner. DNA methylation detection via bisulfite-sequencing PCR (BSP) uncovered a single site CpG demethylation at nt -682 within the StAR promoter region. Then we investigated how long the increased StAR expression and the single CpG demethylation could last. The caffeine was withdrawn after 48h of treatment and then the cells were continually subcultured for up to 5 and 10 passages, respectively. The results showed that the StAR expression at post-caffeine passage 10 still increased, as compared with that in the control. The caffeine-induced demethylation at nt -682 in StAR promoter underwent a similar time course as StAR expression does. The present study reveals the direct effect and possible inheritable epigenetic mechanism of caffeine on steroidogenesis in human adrenocortical cells and has implications for our understanding of the consumption of caffeine. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  19. General implications for CpG hot spot mutations: methylation patterns of the human iduronate-2-sulfatase gene locus.

    PubMed

    Tomatsu, Shunji; Orii, Koji O; Bi, Y; Gutierrez, Monica A; Nishioka, Tatsuo; Yamaguchi, Seiji; Kondo, Naomi; Orii, Tadao; Noguchi, Akihiko; Sly, William S

    2004-06-01

    The methylation pattern at CpG sites of a housekeeping gene correlates with the likelihood of mutation. Mucopolysaccharidosis (MPS) type II, an X-linked disorder, results from the deficiency of iduronate-2-sulfatase (IDS). In these patients, over 35% of independent point mutations at the IDS gene locus were found at CpG sites as transitional events. To gain insight into the relationship between methylation status and CpG hot spot mutations, we investigated patterns of cytosine methylation in the entire IDS gene, except for introns 4-8. Bisulfite genomic sequencing was performed on the normal leukocyte DNA. Our data show that: 1) cytosine methylation at the CpG sites was extensive, except for those present from the promoter region to a portion of intron 3; 2) a sharp boundary of methylated-nonmethylated regions was observed at the 5'-flanking region, whereas a gradual change in methylation was observed in the 2.0-kb segment in the 3'-flanking region; 3) the boundary of the 5'-flanking region contained multiple Sp1 sites and the TATA box; 4) the CpG sites in exons 1 and 2 were hypomethylated and were associated only with rare transitional mutations, while the CpG sites in exon 3 were also hypomethylated, yet were associated with a high rate of transitional mutations; 5) there was no striking sex difference in the methylation patterns in active alleles; and, 6) the methylation in both strands was symmetrical, except at the boundary of methylated-unmethylated regions.

  20. CpG Oligodeoxynucleotides Enhance Host Defense during Murine Tuberculosis

    PubMed Central

    Juffermans, Nicole P.; Leemans, Jaklien C.; Florquin, Sandrine; Verbon, Annelies; Kolk, Arend H.; Speelman, Peter; van Deventer, Sander J. H.; van der Poll, Tom

    2002-01-01

    Oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs activate immune cells to produce cytokines. CpG ODNs protect mice against infections with intracellular bacteria by the induction of a T helper 1 (Th1) response. To determine the effect of CpG ODNs in pulmonary tuberculosis, mice were treated with CpG ODNs or control ODNs at the time of intranasal infection. CpG ODNs reduced mycobacterial outgrowth for up to 5 weeks after Mycobacterium tuberculosis infection and were associated with a decrease in inflammation in lung tissue. CpG treatment was also associated with elevated levels of gamma interferon (IFN-γ) and decreased levels of interleukin 4 in the lungs and an increased capacity of splenocytes to secrete Th1-type cytokines. CpG ODNs given 2 weeks after infection were still able to reduce mycobacterial outgrowth and to enhance a Th1 response 5 weeks postinfection. Administration of CpG ODNs to IFN-γ-gene-deficient mice failed to reduce mycobacterial outgrowth. These data suggest that CpG ODNs improve host defense during pulmonary tuberculosis by an IFN-γ-dependent mechanism. PMID:11748176

  1. Unique DNA methylome profiles in CpG island methylator phenotype colon cancers

    PubMed Central

    Xu, Yaomin; Hu, Bo; Choi, Ae-Jin; Gopalan, Banu; Lee, Byron H.; Kalady, Matthew F.; Church, James M.; Ting, Angela H.

    2012-01-01

    A subset of colorectal cancers was postulated to have the CpG island methylator phenotype (CIMP), a higher propensity for CpG island DNA methylation. The validity of CIMP, its molecular basis, and its prognostic value remain highly controversial. Using MBD-isolated genome sequencing, we mapped and compared genome-wide DNA methylation profiles of normal, non-CIMP, and CIMP colon specimens. Multidimensional scaling analysis revealed that each specimen could be clearly classified as normal, non-CIMP, and CIMP, thus signifying that these three groups have distinctly different global methylation patterns. We discovered 3780 sites in various genomic contexts that were hypermethylated in both non-CIMP and CIMP colon cancers when compared with normal colon. An additional 2026 sites were found to be hypermethylated in CIMP tumors only; and importantly, 80% of these sites were located in CpG islands. These data demonstrate on a genome-wide level that the additional hypermethylation seen in CIMP tumors occurs almost exclusively at CpG islands and support definitively that these tumors were appropriately named. When these sites were examined more closely, we found that 25% were adjacent to sites that were also hypermethylated in non-CIMP tumors. Thus, CIMP is also characterized by more extensive methylation of sites that are already prone to be hypermethylated in colon cancer. These observations indicate that CIMP tumors have specific defects in controlling both DNA methylation seeding and spreading and serve as an important first step in delineating molecular mechanisms that control these processes. PMID:21990380

  2. CPG 7909, an immunostimulatory TLR9 agonist oligodeoxynucleotide, as adjuvant to Engerix-B HBV vaccine in healthy adults: a double-blind phase I/II study.

    PubMed

    Cooper, C L; Davis, H L; Morris, M L; Efler, S M; Adhami, M Al; Krieg, A M; Cameron, D W; Heathcote, J

    2004-11-01

    Oligodeoxynucleotides containing immunostimulatory CpG motifs (CpG ODN) act as potent Th1-like immune enhancers with many antigens in animal models. We have extended these observations to the first clinical evaluation of the safety, tolerability and immunogenicity of CPG 7909 when added to a commercial HBV vaccine. In a randomized, double-blind phase I dose escalation study, healthy volunteers aged 18-35 years were vaccinated at 0, 4 and 24 weeks by intramuscular injection with Engerix-B (GlaxoSmithKline). The regular adult dose of 20 microg recombinant hepatitis B surface antigen (HBsAg) adsorbed to alum was administered mixed with saline (control) or with CPG 7909 at one of three doses (0.125, 0.5 or 1.0 mg). HBsAg-specific antibody responses (anti-HBs) appeared significantly sooner and were significantly higher at all timepoints up to and including 24 weeks in CPG 7909 recipients compared to control subjects (p< or = 0.001). Strikingly, most CpG 7909-vaccinated subjects developed protective levels of anti-HBs IgG within just two weeks of the priming vaccine dose. A trend towards higher rates of positive cytotoxic T cell lymphocyte responses was noted in the two higher dose groups of CPG 7909 compared to controls. The most frequently reported adverse events were injection site reactions, flu-like symptoms and headache. While these were more frequent in CPG 7909 groups than in the control group (p<0.0001), most were reported to be of mild to moderate intensity regardless of group. In summary, CPG 7909 as an adjuvant to Engerix-B was well-tolerated and enhanced vaccine immunogenicity. CPG 7909 may allow the development of a two-dose prophylactic HBV vaccine.

  3. Genomic landscape of CpG rich elements in human.

    PubMed

    Babenko, Vladimir N; Chadaeva, Irina V; Orlov, Yuriy L

    2017-02-07

    The studies on CpG islands (CGI) and Alu elements functions, evolution, and distribution in the genome started since the discovery in nineteen eighties (1981, 1986, correspondingly). Their highly skewed genome wide distribution implies the non-random retrotransposition pattern. Besides CGIs in gene promoters, CGIs clusters were observed in the homeobox gene regions and in the macrosatellites, but the whole picture of their distribution specifics was not grasped. Attempts to identify any causative features upon their (genome wide) distribution, such as the DNA context mediated preferred insertion sites of Alu repeats, have been made to ascribe their clusters location. Recent emergence of high resolution 3D map of human genome allowed segregating the genome into the large scale chromatin domains of naturally observable nuclear subcompartments, or Topologically Associated Domains (TADs), designated by spatial chromatin distribution. We utilized the chromatin map to elucidate relations between large scale chromatin state and CpG rich elements landscape. In the course of analysis it was confirmed that genes, Alu and CGI clusters maintain obvious, albeit different in strength, preference for open chromatin. For the first time it was clearly shown that the clusters density of the Alu and CGIs monotonically depend on the chromatin accessibility rate. In particular, the highest density of these elements is found in A1 euchromatin regions characterized by a high density of small length genes replicating in the early S-phase. It implies that these elements mediate (CGIs) or are a side element (Alus) of chromatin accessibility. We elucidated that both methylated and non-methylated CGIs display the affinity to chromatin accessibility. As a part of comparative genomics section, we elucidated that the dog's genome non-canonical structure, outstanding in mammals for its high CGIs abundance compared to gene number, is explained by the presence of dense tandem CGI extended hotspots

  4. Children's Understanding of Inheritance.

    ERIC Educational Resources Information Center

    Clough, Elizabeth Engel; Wood-Robinson, Colin

    1985-01-01

    Investigated common belief patterns secondary school students (N=84) have about inheritance, noting the most prevalent misconceptions about genetics which occur at different age levels. Implications based on findings and suggestions for teaching lower secondary courses are included. (ML)

  5. [Inherited aplastic anemias].

    PubMed

    Esteves, A C; Freitas, O; Almeida, T; Rosado, L

    2010-08-01

    The inherited aplastic anaemias are a heterogeneous group of disorders characterized by bone marrow failure, frequent association with one or more somatic anomalies and increased risk of cancer. They are rare disorders, usually diagnosed at paediatric age, and have significant premature mortality. The authors report 11 cases of inherited aplastic anaemias, 8 of Fanconi's anaemia and 3 of Dyskeratosis congenita. These cases were diagnosed in the last 14 years in the Dona Estefânia Hospital.

  6. Using a minigene approach to characterize a novel splice site mutation in human F7 gene causing inherited factor VII deficiency in a Chinese pedigree.

    PubMed

    Yu, T; Wang, X; Ding, Q; Fu, Q; Dai, J; Lu, Y; Xi, X; Wang, H

    2009-11-01

    Factor VII deficiency which transmitted as an autosomal recessive disorder is a rare haemorrhagic condition. The aim of this study was to identify the molecular genetic defect and determine its functional consequences in a Chinese pedigree with FVII deficiency. The proband was diagnosed as inherited coagulation FVII deficiency by reduced plasma levels of FVII activity (4.4%) and antigen (38.5%). All nine exons and their flanking sequence of F7 gene were amplified by polymerase chain reaction (PCR) for the proband and the PCR products were directly sequenced. The compound heterozygous mutations of F7 (NM_000131.3) c.572-1G>A and F7 (NM_000131.3) c.1165T>G; p.Cys389Gly were identified in the proband's F7 gene. To investigate the splicing patterns associated with F7 c.572-1G>A, ectopic transcripts in leucocytes of the proband were analyzed. F7 minigenes, spanning from intron 4 to intron 7 and carrying either an A or a G at position -1 of intron 5, were constructed and transiently transfected into human embryonic kidney (HEK) 293T cells, followed by RT-PCR analysis. The aberrant transcripts from the F7 c.572-1G>A mutant allele were not detected by ectopic transcription study. Sequencing of the RT-PCR products from the mutant transfectant demonstrated the production of an erroneously spliced mRNA with exon 6 skipping, whereas a normal splicing occurred in the wide type transfectant. The aberrant mRNA produced from the F7 c.572-1G>A mutant allele is responsible for the factor VII deficiency in this pedigree.

  7. Restoration of CpG Methylation in The Egf Promoter Region during Rat Liver Regeneration

    PubMed Central

    Deming, Li; Ziwei, Li; Xueqiang, Guo; Cunshuan, Xu

    2015-01-01

    Epidermal growth factor (EGF) is an important factor for healing after tissue damage in diverse experimental models. It plays an important role in liver regeneration (LR). The objective of this experiment is to investigate the methylation variation of 10 CpG sites in the Egf promoter region and their relevance to Egf expression during rat liver regenera- tion. As a follow up of our previous study, rat liver tissue was collected after rat 2/3 partial hepatectomy (PH) during the re-organization phase (from days 14 to days 28). Liver DNA was extracted and modified by sodium bisulfate. The methylation status of 10 CpG sites in Egf promoter region was determined using bisulfite sequencing polymerase chain reaction (PCR), as BSP method. The results showed that 3 (sites 3, 4 and 9) out of 10 CpG sites have strikingly methylation changes during the re-organization phase compared to the regeneration phase (from 2 hours to 168 hours, P=0.002, 0.048 and 0.018, respectively). Our results showed that methylation modification of CpGs in the Egf promoter region could be restored to the status before PH operation and changes of methylation didn’t affect Egf mRNA expression during the re-organization phase. PMID:26464832

  8. De novo methylation of the MyoD1 CpG island during the establishment of immortal cell lines.

    PubMed Central

    Jones, P A; Wolkowicz, M J; Rideout, W M; Gonzales, F A; Marziasz, C M; Coetzee, G A; Tapscott, S J

    1990-01-01

    CpG dinucleotides are unevenly distributed in the vertebrate genome. Bulk DNA is depleted of CpGs and most of the cytosines in the dinucleotide in this fraction are methylated. On the other hand, CpG islands, which are often associated with genes, are unmethylated at testable sites in all normal tissues with the exception of genes on the inactive X chromosome. We used Hpa II/Msp I analysis and ligation-mediated polymerase chain reaction to examine the methylation of the MyoD1 CpG island in adult mouse tissues, early cultures of mouse embryo cells, and immortal fibroblastic cell lines. The island was almost devoid of methylation at CCGG sites in adult mouse tissues and in low-passage mouse embryo fibroblasts. In marked contrast, the island was methylated in 10T 1/2 cells and in six other immortal cell lines showing that methylation of this CpG island had occurred during escape from senescence. The island became even more methylated in chemically transformed derivatives of 10T 1/2 cells. Thus, CpG islands not methylated in normal tissues may become modified to an abnormally high degree during immortalization and transformation. Images PMID:2385586

  9. Contrasting chromatin organization of CpG islands and exons in the human genome

    PubMed Central

    2010-01-01

    Background CpG islands and nucleosome-free regions are both found in promoters. However, their association has never been studied. On the other hand, DNA methylation is absent in promoters but is enriched in gene bodies. Intragenic nucleosomes and their modifications have been recently associated with RNA splicing. Because the function of intragenic DNA methylation remains unclear, I explored the possibility of its involvement in splicing regulation. Results Here I show that CpG islands were associated not only with methylation-free promoters but also with nucleosome-free promoters. Nucleosome-free regions were observed only in promoters containing a CpG island. However, the DNA sequences of CpG islands predicted the opposite pattern, implying a limitation of sequence programs for the determination of nucleosome occupancy. In contrast to the methylation-and nucleosome-free states of CpG-island promoters, exons were densely methylated at CpGs and packaged into nucleosomes. Exon-enrichment of DNA methylation was specifically found in spliced exons and in exons with weak splice sites. The enrichment patterns were less pronounced in initial exons and in non-coding exons, potentially reflecting a lower need for their splicing. I also found that nucleosomes, DNA methylation, and H3K36me3 marked the exons of transcripts with low, medium, and high gene expression levels, respectively. Conclusions Human promoters containing a CpG island tend to remain nucleosome-free as well as methylation-free. In contrast, exons demonstrate a high degree of methylation and nucleosome occupancy. Exonic DNA methylation seems to function together with exonic nucleosomes and H3K36me3 for the proper splicing of transcripts with different expression levels. PMID:20602769

  10. Polycomb-like proteins link the PRC2 complex to CpG islands.

    PubMed

    Li, Haojie; Liefke, Robert; Jiang, Junyi; Kurland, Jesse Vigoda; Tian, Wei; Deng, Pujuan; Zhang, Weidi; He, Qian; Patel, Dinshaw J; Bulyk, Martha L; Shi, Yang; Wang, Zhanxin

    2017-09-06

    The Polycomb repressive complex 2 (PRC2) mainly mediates transcriptional repression and has essential roles in various biological processes including the maintenance of cell identity and proper differentiation. Polycomb-like (PCL) proteins, such as PHF1, MTF2 and PHF19, are PRC2-associated factors that form sub-complexes with PRC2 core components, and have been proposed to modulate the enzymatic activity of PRC2 or the recruitment of PRC2 to specific genomic loci. Mammalian PRC2-binding sites are enriched in CG content, which correlates with CpG islands that display a low level of DNA methylation. However, the mechanism of PRC2 recruitment to CpG islands is not fully understood. Here we solve the crystal structures of the N-terminal domains of PHF1 and MTF2 with bound CpG-containing DNAs in the presence of H3K36me3-containing histone peptides. We show that the extended homologous regions of both proteins fold into a winged-helix structure, which specifically binds to the unmethylated CpG motif but in a completely different manner from the canonical winged-helix DNA recognition motif. We also show that the PCL extended homologous domains are required for efficient recruitment of PRC2 to CpG island-containing promoters in mouse embryonic stem cells. Our research provides the first, to our knowledge, direct evidence to demonstrate that PCL proteins are crucial for PRC2 recruitment to CpG islands, and further clarifies the roles of these proteins in transcriptional regulation in vivo.

  11. CpG DNA as a vaccine adjuvant

    PubMed Central

    Bode, Christian; Zhao, Gan; Steinhagen, Folkert; Kinjo, Takeshi; Klinman, Dennis M

    2011-01-01

    Synthetic oligodeoxynucleotides (ODNs) containing unmethylated CpG motifs trigger cells that express Toll-like receptor 9 (including human plasmacytoid dendritic cells and B cells) to mount an innate immune response characterized by the production of Th1 and proinflammatory cytokines. When used as vaccine adjuvants, CpG ODNs improve the function of professional antigen-presenting cells and boost the generation of humoral and cellular vaccine-specific immune responses. These effects are optimized by maintaining ODNs and vaccine in close proximity. The adjuvant properties of CpG ODNs are observed when administered either systemically or mucosally, and persist in immunocompromised hosts. Preclinical studies indicate that CpG ODNs improve the activity of vaccines targeting infectious diseases and cancer. Clinical trials demonstrate that CpG ODNs have a good safety profile and increase the immunogenicity of coadministered vaccines. PMID:21506647

  12. Genome-Wide Locations of Potential Epimutations Associated with Environmentally Induced Epigenetic Transgenerational Inheritance of Disease Using a Sequential Machine Learning Prediction Approach

    PubMed Central

    Haque, M. Muksitul; Holder, Lawrence B.; Skinner, Michael K.

    2015-01-01

    Environmentally induced epigenetic transgenerational inheritance of disease and phenotypic variation involves germline transmitted epimutations. The primary epimutations identified involve altered differential DNA methylation regions (DMRs). Different environmental toxicants have been shown to promote exposure (i.e., toxicant) specific signatures of germline epimutations. Analysis of genomic features associated with these epimutations identified low-density CpG regions (<3 CpG / 100bp) termed CpG deserts and a number of unique DNA sequence motifs. The rat genome was annotated for these and additional relevant features. The objective of the current study was to use a machine learning computational approach to predict all potential epimutations in the genome. A number of previously identified sperm epimutations were used as training sets. A novel machine learning approach using a sequential combination of Active Learning and Imbalance Class Learner analysis was developed. The transgenerational sperm epimutation analysis identified approximately 50K individual sites with a 1 kb mean size and 3,233 regions that had a minimum of three adjacent sites with a mean size of 3.5 kb. A select number of the most relevant genomic features were identified with the low density CpG deserts being a critical genomic feature of the features selected. A similar independent analysis with transgenerational somatic cell epimutation training sets identified a smaller number of 1,503 regions of genome-wide predicted sites and differences in genomic feature contributions. The predicted genome-wide germline (sperm) epimutations were found to be distinct from the predicted somatic cell epimutations. Validation of the genome-wide germline predicted sites used two recently identified transgenerational sperm epimutation signature sets from the pesticides dichlorodiphenyltrichloroethane (DDT) and methoxychlor (MXC) exposure lineage F3 generation. Analysis of this positive validation data set

  13. Genome-Wide Locations of Potential Epimutations Associated with Environmentally Induced Epigenetic Transgenerational Inheritance of Disease Using a Sequential Machine Learning Prediction Approach.

    PubMed

    Haque, M Muksitul; Holder, Lawrence B; Skinner, Michael K

    2015-01-01

    Environmentally induced epigenetic transgenerational inheritance of disease and phenotypic variation involves germline transmitted epimutations. The primary epimutations identified involve altered differential DNA methylation regions (DMRs). Different environmental toxicants have been shown to promote exposure (i.e., toxicant) specific signatures of germline epimutations. Analysis of genomic features associated with these epimutations identified low-density CpG regions (<3 CpG / 100bp) termed CpG deserts and a number of unique DNA sequence motifs. The rat genome was annotated for these and additional relevant features. The objective of the current study was to use a machine learning computational approach to predict all potential epimutations in the genome. A number of previously identified sperm epimutations were used as training sets. A novel machine learning approach using a sequential combination of Active Learning and Imbalance Class Learner analysis was developed. The transgenerational sperm epimutation analysis identified approximately 50K individual sites with a 1 kb mean size and 3,233 regions that had a minimum of three adjacent sites with a mean size of 3.5 kb. A select number of the most relevant genomic features were identified with the low density CpG deserts being a critical genomic feature of the features selected. A similar independent analysis with transgenerational somatic cell epimutation training sets identified a smaller number of 1,503 regions of genome-wide predicted sites and differences in genomic feature contributions. The predicted genome-wide germline (sperm) epimutations were found to be distinct from the predicted somatic cell epimutations. Validation of the genome-wide germline predicted sites used two recently identified transgenerational sperm epimutation signature sets from the pesticides dichlorodiphenyltrichloroethane (DDT) and methoxychlor (MXC) exposure lineage F3 generation. Analysis of this positive validation data set

  14. Discovery of MLL1 binding units, their localization to CpG Islands, and their potential function in mitotic chromatin.

    PubMed

    Bina, Minou; Wyss, Phillip; Novorolsky, Elise; Zulkelfi, Noorfatin; Xue, Jing; Price, Randi; Fay, Matthew; Gutmann, Zach; Fogler, Brian; Wang, Daidong

    2013-12-28

    Mixed Lineage Leukemia 1 (MLL1) is a mammalian ortholog of the Drosophila Trithorax. In Drosophila, Trithorax complexes transmit the memory of active genes to daughter cells through interactions with Trithorax Response Elements (TREs). However, despite their functional importance, nothing is known about sequence features that may act as TREs in mammalian genomic DNA. By analyzing results of reported DNA binding assays, we identified several CpG rich motifs as potential MLL1 binding units (defined as morphemes). We find that these morphemes are dispersed within a relatively large collection of human promoter sequences and appear densely packed near transcription start sites of protein-coding genes. Genome wide analyses localized frequent morpheme occurrences to CpG islands. In the human HOX loci, the morphemes are spread across CpG islands and in some cases tail into the surrounding shores and shelves of the islands. By analyzing results of chromatin immunoprecipitation assays, we found a connection between morpheme occurrences, CpG islands, and chromatin segments reported to be associated with MLL1. Furthermore, we found a correspondence of reported MLL1-driven "bookmarked" regions in chromatin to frequent occurrences of MLL1 morphemes in CpG islands. Our results implicate the MLL1 morphemes in sequence-features that define the mammalian TREs and provide a novel function for CpG islands. Apparently, our findings offer the first evidence for existence of potential TREs in mammalian genomic DNA and the first evidence for a connection between CpG islands and gene-bookmarking by MLL1 to transmit the memory of highly active genes during mitosis. Our results further suggest a role for overlapping morphemes in producing closely packed and multiple MLL1 binding events in genomic DNA so that MLL1 molecules could interact and reside simultaneously on extended potential transcriptional maintenance elements in human chromosomes to transmit the memory of highly active genes

  15. Discovery of MLL1 binding units, their localization to CpG Islands, and their potential function in mitotic chromatin

    PubMed Central

    2013-01-01

    Background Mixed Lineage Leukemia 1 (MLL1) is a mammalian ortholog of the Drosophila Trithorax. In Drosophila, Trithorax complexes transmit the memory of active genes to daughter cells through interactions with Trithorax Response Elements (TREs). However, despite their functional importance, nothing is known about sequence features that may act as TREs in mammalian genomic DNA. Results By analyzing results of reported DNA binding assays, we identified several CpG rich motifs as potential MLL1 binding units (defined as morphemes). We find that these morphemes are dispersed within a relatively large collection of human promoter sequences and appear densely packed near transcription start sites of protein-coding genes. Genome wide analyses localized frequent morpheme occurrences to CpG islands. In the human HOX loci, the morphemes are spread across CpG islands and in some cases tail into the surrounding shores and shelves of the islands. By analyzing results of chromatin immunoprecipitation assays, we found a connection between morpheme occurrences, CpG islands, and chromatin segments reported to be associated with MLL1. Furthermore, we found a correspondence of reported MLL1-driven “bookmarked” regions in chromatin to frequent occurrences of MLL1 morphemes in CpG islands. Conclusion Our results implicate the MLL1 morphemes in sequence-features that define the mammalian TREs and provide a novel function for CpG islands. Apparently, our findings offer the first evidence for existence of potential TREs in mammalian genomic DNA and the first evidence for a connection between CpG islands and gene-bookmarking by MLL1 to transmit the memory of highly active genes during mitosis. Our results further suggest a role for overlapping morphemes in producing closely packed and multiple MLL1 binding events in genomic DNA so that MLL1 molecules could interact and reside simultaneously on extended potential transcriptional maintenance elements in human chromosomes to transmit the

  16. Intravaginal immunization with viral subunit protein plus CpG oligodeoxynucleotides induces protective immunity against HSV-2.

    PubMed

    Kwant, Amanda; Rosenthal, Kenneth L

    2004-08-13

    Although the genital tract has been considered a poor inductive site for immunization with non-replicating antigens, genital immunization may be important for protection against sexually transmitted infections. Recently, we and others showed that CpG oligodeoxynucleotides (ODNs) serve as potent adjuvants for mucosal immunization. The purpose of this study was to determine whether intravaginal (IVAG) immunization with recombinant glycoprotein B (rgB) of herpes simplex virus type 2 (HSV-2) plus CpG ODN can induce specific immunity and protect against genital HSV-2 challenge. C57BL/6 mice were immunized IVAG with rgB plus CpG ODN, rgB plus non-CpG ODN, or rgB alone and challenged IVAG with HSV-2. Mice immunized with rgB + CpG had higher levels of anti-gB IgA and IgG in the vaginal washes and serum compared to mice immunized with rgB alone. Mice immunized with rgB + CpG also had the highest levels of gB-specific IgG in the nasal washes, however no specific IgA was detected in the nasal washes of any group. Mice immunized IVAG with rgB + CpG showed higher survival and lower pathology scores following genital HSV-2 challenge than mice immunized with rgB + non-CpG ODN or rgB alone. Additionally, vaginal viral titers were lower in the rgB + CpG group after infection. These results clearly show that the genital tract is capable of generating a protective immune response after local intravaginal immunization and that a non-replicating antigen is able to induce such a response when administered with an appropriate adjuvant.

  17. CpG Methylation in the Hexamerin 110 Gene in the European Honeybee, Apis mellifera

    PubMed Central

    Ikeda, Takashi; Furukawa, Seiichi; Nakamura, Jun; Sasaki, Masami; Sasaki, Tetsuhiko

    2011-01-01

    The European honeybee, Apis mellifera L. (Hymenoptera: Apidae), has a full set of machinery for functional CpG methylation of its genome. A recent study demonstrated that DNA methylation in the honeybee is involved in caste differentiation. In this study, the expression and methylation of the hexamerin 110 gene (Hex110), which encodes a storage protein, was analyzed. High levels of the Hex110 transcript were expressed in both worker and queen larvae. Low levels of this transcript were also detected in adult fat bodies, and the expression level was higher in the queen than in the worker. Bisulfite sequencing revealed that the Hex110 gene is overall methylated at a low level, with a limited number of CpG sites methylated at relatively high levels. These highly methylated sites were exclusively located in the exon regions. The average methylation rate of the Hex110 gene was higher in the adult stage than in the larval stage. Furthermore, several CpG sites were differentially methylated between the worker and queen larvae. These observations suggest that the methylation of the Hex110 gene is regulated at the developmental stage and in a caste-dependent manner. PMID:21870982

  18. A distinct group of CpG islands shows differential DNA methylation between replicas of the same cell line in vitro.

    PubMed

    Cocozza, Sergio; Scala, Giovanni; Miele, Gennaro; Castaldo, Imma; Monticelli, Antonella

    2013-10-10

    CpG dinucleotide-rich genomic DNA regions, known as CpG islands (CGIs), can be methylated at their cytosine residues as an epigenetic mark that is stably inherited during cell mitosis. Differentially methylated regions (DMRs) are genomic regions showing different degrees of DNA methylation in multiple samples. In this study, we focused our attention on CGIs showing different DNA methylation between two culture replicas of the same cell line. We used methylation data of 35 cell lines from the Encyclopedia of DNA Elements (ENCODE) consortium to identify CpG islands that were differentially methylated between replicas of the same cell line and denoted them Inter Replicas Differentially Methylated CpG islands (IRDM-CGIs). We identified a group of IRDM-CGIs that was consistently shared by different cell lines, and denoted it common IRDM-CGIs. X chromosome CGIs were overrepresented among common IRDM-CGIs. Autosomal IRDM-CGIs were preferentially located in gene bodies and intergenic regions had a lower G + C content, a smaller mean length, and a reduced CpG percentage. Functional analysis of the genes associated with autosomal IRDM-CGIs showed that many of them are involved in DNA binding and development. Our results show that several specific functional and structural features characterize common IRDM-CGIs. They may represent a specific subset of CGIs that are more prone to being differentially methylated for their intrinsic characteristics.

  19. Inherited Retinal Degenerative Disease Clinical Trial Network

    DTIC Science & Technology

    2012-10-01

    the total number of individuals affected by retinitis pigmentosa (RP) and other forms of rare inherited retinal degenerative diseases is estimated at...for autosomal dominant retinitis pigmentosa ). As new interventions become available for clinical evaluation, the creation of such a network will...dominant retinitis pigmentosa at six sites- the CTEC site at University of Utah and five recruitment sites- the Retina Foundation of the Southwest

  20. Safety and immunogenicity of CPG 7909 injection as an adjuvant to Fluarix influenza vaccine.

    PubMed

    Cooper, C L; Davis, H L; Morris, M L; Efler, S M; Krieg, A M; Li, Y; Laframboise, C; Al Adhami, M J; Khaliq, Y; Seguin, I; Cameron, D W

    2004-08-13

    CPG 7909, a 24-mer B-Class CpG oligodeoxynucleotide (ODN), was tested for safety, tolerability and its ability to augment the immunogenicity of a commercial trivalent killed split influenza vaccine (Fluarix containing A/Beijing/262/95, A/Sydney/5/97 and B/Harbin/7/94; SmithKline Beecham) in a phase Ib blinded, randomized, controlled clinical trial. Sixty healthy volunteers were recruited in two consecutive cohorts of 30 subjects, who were randomly assigned to receive Fluarix plus 1mg CPG 7909 or Fluarix plus saline control (15 subjects each). Vaccines were administered by intramuscular injection on a single occasion with subjects in the first cohort receiving a 1/10th dose of Fluarix and those in the second cohort receiving the full-dose. All safety measures including physical evaluation, laboratory blood assays, and assays for DNA autoimmunity were within normal values except for transient and clinically inconsequential decreases in total white blood cell counts in groups receiving CPG 7909. All vaccines were found to be generally well tolerated with similar frequency and intensity for most adverse reactions for groups receiving CPG 7909 as controls. Exceptions were injection site pain and headache, which were reduced in frequency in subjects receiving the 1/10th Fluarix dose without CpG, compared to the frequency in all other groups. There was a lack of pre-existing immunity, defined as hemagglutinin inhibition (HI) activity < or =20, for all subjects to the influenza strains A/Beijing/262/95 and B/Harbin/7/94 and for some subjects to A/Sydney/5/97. Post-vaccination humoral immune responses, as determined 2 and 4 weeks later by assay of HI activity and ELISA to detect antibodies against hemagglutinin (anti-HA) were similar for both full and reduced Fluarix doses but the cellular immune responses (measured as PBMC antigen-specific IFN-gamma secretion) were reduced in the 1/10th Fluarix dose group. Humoral responses were not significantly enhanced by the addition

  1. Inherited peripheral neuropathies.

    PubMed

    Shy, Michael E

    2011-04-01

    Mutations in genes expressed in Schwann cells and the axons they ensheathe cause the hereditary motor and sensory neuropathies, also known as Charcot-Marie-Tooth disease (CMT). More than 40 different genes have been shown to cause inherited neuropathies; chromosomal localizations of many other distinct inherited neuropathies have been mapped, and new genetic causes for inherited neuropathies continue to be discovered. How to keep track of all of these disorders, when to pursue genetic testing, and what tests to order for specific patients are difficult challenges for any neurologist. This review addresses these issues and provides illustrative cases to help in dealing with them. CMT serves as a living system to identify molecules necessary for normal peripheral nervous system (PNS) function. Understanding how these various molecules interact will provide a better understanding of the pathogenesis of peripheral neuropathies in general as well as other neurodegenerative disorders involving the PNS.

  2. Organs as inheritable property?

    PubMed

    Voo, Teck Chuan; Holm, Soren

    2014-01-01

    It has been argued that organs should be treated as individual tradable property like other material possessions and assets, on the basis that this would promote individual freedom and increase efficiency in addressing the shortage of organs for transplantation. If organs are to be treated as property, should they be inheritable? This paper seeks to contribute to the idea of organs as inheritable property by providing a defence of a default of the family of a dead person as inheritors of transplantable organs. In the course of discussion, various succession rules for organs and their justifications will be suggested. We then consider two objections to organs as inheritable property. Our intention here is to provoke further thought on whether ownership of one's body parts should be assimilated to property ownership.

  3. CpG islands influence chromatin structure via the CpG-binding protein Cfp1.

    PubMed

    Thomson, John P; Skene, Peter J; Selfridge, Jim; Clouaire, Thomas; Guy, Jacky; Webb, Shaun; Kerr, Alastair R W; Deaton, Aimée; Andrews, Rob; James, Keith D; Turner, Daniel J; Illingworth, Robert; Bird, Adrian

    2010-04-15

    CpG islands (CGIs) are prominent in the mammalian genome owing to their GC-rich base composition and high density of CpG dinucleotides. Most human gene promoters are embedded within CGIs that lack DNA methylation and coincide with sites of histone H3 lysine 4 trimethylation (H3K4me3), irrespective of transcriptional activity. In spite of these intriguing correlations, the functional significance of non-methylated CGI sequences with respect to chromatin structure and transcription is unknown. By performing a search for proteins that are common to all CGIs, here we show high enrichment for Cfp1, which selectively binds to non-methylated CpGs in vitro. Chromatin immunoprecipitation of a mono-allelically methylated CGI confirmed that Cfp1 specifically associates with non-methylated CpG sites in vivo. High throughput sequencing of Cfp1-bound chromatin identified a notable concordance with non-methylated CGIs and sites of H3K4me3 in the mouse brain. Levels of H3K4me3 at CGIs were markedly reduced in Cfp1-depleted cells, consistent with the finding that Cfp1 associates with the H3K4 methyltransferase Setd1 (refs 7, 8). To test whether non-methylated CpG-dense sequences are sufficient to establish domains of H3K4me3, we analysed artificial CpG clusters that were integrated into the mouse genome. Despite the absence of promoters, the insertions recruited Cfp1 and created new peaks of H3K4me3. The data indicate that a primary function of non-methylated CGIs is to genetically influence the local chromatin modification state by interaction with Cfp1 and perhaps other CpG-binding proteins.

  4. CpG islands influence chromatin structure via the CpG-binding protein Cfp1

    PubMed Central

    Thomson, John P.; Skene, Peter J.; Selfridge, Jim; Clouaire, Thomas; Guy, Jacky; Webb, Shaun; Kerr, Alastair R. W.; Deaton, Aimée; Andrews, Rob; James, Keith D.; Turner, Daniel J.; Illingworth, Robert; Bird, Adrian

    2013-01-01

    CpG islands (CGIs) are prominent in the mammalian genome owing to their GC-rich base composition and high density of CpG dinucleotides1,2. Most human gene promoters are embedded within CGIs that lack DNA methylation and coincide with sites of histone H3 lysine 4 trimethylation (H3K4me3), irrespective of transcriptional activity3,4. In spite of these intriguing correlations, the functional significance of non-methylated CGI sequences with respect to chromatin structure and transcription is unknown. By performing a search for proteins that are common to all CGIs, here we show high enrichment for Cfp1, which selectively binds to non-methylated CpGs in vitro5,6. Chromatin immunoprecipitation of a mono-allelically methylated CGI confirmed that Cfp1 specifically associates with non-methylated CpG sites in vivo. High throughput sequencing of Cfp1-bound chromatin identified a notable concordance with non-methylated CGIs and sites of H3K4me3 in the mouse brain. Levels of H3K4me3 at CGIs were markedly reduced in Cfp1-depleted cells, consistent with the finding that Cfp1 associates with the H3K4 methyltransferase Setd1 (refs 7, 8). To test whether non-methylated CpG-dense sequences are sufficient to establish domains of H3K4me3, we analysed artificial CpG clusters that were integrated into the mouse genome. Despite the absence of promoters, the insertions recruited Cfp1 and created new peaks of H3K4me3. The data indicate that a primary function of non-methylated CGIs is to genetically influence the local chromatin modification state by interaction with Cfp1 and perhaps other CpG-binding proteins. PMID:20393567

  5. Inherited peripheral neuropathies.

    PubMed

    Saporta, Mario A; Shy, Michael E

    2013-05-01

    Charcot-Marie-Tooth (CMT) disease is a heterogeneous group of inherited peripheral neuropathies in which the neuropathy is the sole or primary component of the disorder, as opposed to diseases in which the neuropathy is part of a more generalized neurologic or multisystem syndrome. Because of the great genetic heterogeneity of this condition, it can be challenging for the general neurologist to diagnose patients with specific types of CMT. This article reviews the biology of the inherited peripheral neuropathies, delineates major phenotypic features of the CMT subtypes, and suggest strategies for focusing genetic testing. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Inherited Peripheral Neuropathies

    PubMed Central

    Saporta, Mario A.; Shy, Michael E.

    2013-01-01

    SYNOPSIS Charcot Marie Tooth disease (CMT) is a heterogeneous group of inherited peripheral neuropathies in which the neuropathy is the sole or primary component of the disorder, as opposed to diseases in which the neuropathy is part of a more generalized neurological or multisystem syndrome. Due to the great genetic heterogeneity of this condition, it can be challenging for the general neurologist to diagnose patients with specific types of CMT. Here, we review the biology of the inherited peripheral neuropathies, delineate major phenotypic features of the CMT subtypes and suggest strategies for focusing genetic testing. PMID:23642725

  7. Comparison of in vivo Adjuvanticity of Liposomal PO CpG ODN with Liposomal PS CpG ODN: Soluble Leishmania Antigens as a Model

    PubMed Central

    Golali, Ensieh; Jaafari, Mahmoud Reza; Khamesipour, Ali; Abbasi, Azam; Saberi, Zahra; Badiee, Ali

    2012-01-01

    Objective(s) CpG oligodeoxynucleotides (CpG ODNs) have been shown to have potent immunostimulatory adjuvant activity for a wide range of antigens. Due to susceptibility of phosphodiester CpG ODNs (PO CpG) to nuclease degradation, nuclease-resistant phosphorothioate CpG ODNs (PS CpG) were currently utilized in an in vivo model. In this study, according to some recently reported drawbacks with PS CpG, the adjuvant potential of liposomal PO CpG as a substitute for PS CpG was evaluated. Materials and Methods Soluble Leishmania antigens (SLA) as a model antigen and distearoylphosphatidylcoline (DSPC) as a neutral lipid were employed to prepare liposomes. Susceptible BALB/c mice received buffer, SLA, Lip-SLA, Lip-SLA-PS CpG, Lip-SLA-PO CpG, SLA+PS CpG, or SLA+PO CpG subcutaneously 3 times with 3 weeks intervals and then were challenged with Leishmania major’s live promastigotes. Blood and spleen samples were analyzed to determine the level and type of antibodies and cytokines. The number of live parasites in the spleen of immunized mice was determined. Moreover, the lesion size progress was assessed weekly by footpad swelling measurement. Results The results showed that mice immunized with Lip-SLA-PS CpG or Lip-SLA-PO CpG developed a significantly smaller footpad swelling, higher level of anti SLA IgG antibodies before and after challenge, and lower spleen parasite burden compared with the control groups. However, there was no significant difference between mice received Lip-SLA-PS CpG and those received Lip-SLA-PO CpG. Conclusion The results demonstrated that liposomal PO CpG ODN could be used instead of PS CpG ODN to overcome the possible drawbacks. PMID:23493437

  8. Dualism of gene GC content and CpG pattern in regard to expression in the human genome: magnitude versus breadth.

    PubMed

    Vinogradov, Alexander E

    2005-12-01

    In this article, I show that, in the human genome, the GC content in genes (but not the CpG island in the promoter) is related to the maximum level of gene expression among tissues, whereas the promoter CpG island and gene CpG level are more strongly related to the breadth of expression among tissues. The relevance of gene GC content to expression cannot be a consequence (i.e. a byproduct) of transcription because it does not correlate with expression in the germline. The variation of GC content and CpG level can determine the characteristics of gene expression in a synergistic interplay with transcription-factor-binding sites (mediated by chromatin condensation).

  9. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning.

    PubMed

    Martin, Elizabeth M; Fry, Rebecca C

    2016-01-01

    A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing -1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched (P < 0.001-0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation.

  10. A cross-study analysis of prenatal exposures to environmental contaminants and the epigenome: support for stress-responsive transcription factor occupancy as a mediator of gene-specific CpG methylation patterning

    PubMed Central

    Martin, Elizabeth M.; Fry, Rebecca C.

    2016-01-01

    A biological mechanism by which exposure to environmental contaminants results in gene-specific CpG methylation patterning is currently unknown. We hypothesize that gene-specific CpG methylation is related to environmentally perturbed transcription factor occupancy. To test this hypothesis, a database of 396 genes with altered CpG methylation either in cord blood leukocytes or placental tissue was compiled from 14 studies representing assessments of six environmental contaminants. Subsequently, an in silico approach was used to identify transcription factor binding sites enriched among the genes with altered CpG methylation in relationship to the suite of environmental contaminants. For each study, the sequences of the promoter regions (representing −1000 to +500 bp from the transcription start site) of all genes with altered CpG methylation were analyzed for enrichment of transcription factor binding sites. Binding sites for a total of 56 unique transcription factors were identified to be enriched within the promoter regions of the genes. Binding sites for the Kidney-Enriched Krupple-like Factor 15, a known responder to endogenous stress, were enriched (P < 0.001–0.041) among the genes with altered CpG methylation associated for five of the six environmental contaminants. These data support the transcription factor occupancy theory as a potential mechanism underlying environmentally-induced gene-specific CpG methylation. PMID:27066266

  11. Microdevices for detecting locus-specific DNA methylation at CpG resolution.

    PubMed

    Koo, Kevin M; Wee, Eugene J H; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

    2014-06-15

    Simple, rapid, and inexpensive strategies for detecting DNA methylation could facilitate routine patient diagnostics. Herein, we describe a microdevice based electrochemical assay for the detection of locus-specific DNA methylation at single CpG dinucleotide resolution after bisulfite conversion of a target DNA sequence. This is achieved by using the ligase chain reaction (LCR) to recognize and amplify a C to T base change at a CpG site and measuring the change electrochemically (eLCR). Unlike other electrochemical detection methods for DNA methylation, methylation specific (MS)-eLCR can potentially interrogate any CpG of interest in the genome. MS-eLCR also distinguishes itself from other electrochemical LCR detection schemes by integrating a peroxidase-mimicking DNAzyme sequence into the LCR amplification probes design which in turn, serves as a redox moiety when bound with a hemin cofactor. Following hybridization to surface-bound capture probes, the DNAzyme-linked LCR products induce electrocatalytic responses that are proportional to the methylation levels of the gene locus in the presence of hydrogen peroxide. The performance of the assay was evaluated by simultaneously detecting C to T changes at a locus associated with cancer metastasis in breast cancer cell lines and serum-derived samples. MS-eLCR required as little as 0.04 pM of starting material and was sensitive to 10-15% methylation change with good reproducibility (RSD=7.9%, n=3). Most importantly, the accuracy of the method in quantifying locus-specific methylation was comparable to both fluorescence-based and Next Generation Sequencing approaches. We thus believe that the proposed assay could potentially be a low cost alternative to current technologies for DNA methylation detection of specific CpG sites. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Identification of genomic features in environmentally induced epigenetic transgenerational inherited sperm epimutations.

    PubMed

    Guerrero-Bosagna, Carlos; Weeks, Shelby; Skinner, Michael K

    2014-01-01

    A variety of environmental toxicants have been shown to induce the epigenetic transgenerational inheritance of disease and phenotypic variation. The process involves exposure of a gestating female and the developing fetus to environmental factors that promote permanent alterations in the epigenetic programming of the germline. The molecular aspects of the phenomenon involve epigenetic modifications (epimutations) in the germline (e.g. sperm) that are transmitted to subsequent generations. The current study integrates previously described experimental epigenomic transgenerational data and web-based bioinformatic analyses to identify genomic features associated with these transgenerationally transmitted epimutations. A previously identified genomic feature associated with these epimutations is a low CpG density (<12/100bp). The current observations suggest the transgenerational differential DNA methylation regions (DMR) in sperm contain unique consensus DNA sequence motifs, zinc finger motifs and G-quadruplex sequences. Interaction of molecular factors with these sequences could alter chromatin structure and accessibility of proteins with DNA methyltransferases to alter de novo DNA methylation patterns. G-quadruplex regions can promote the opening of the chromatin that may influence the action of DNA methyltransferases, or factors interacting with them, for the establishment of epigenetic marks. Zinc finger binding factors can also promote this chromatin remodeling and influence the expression of non-coding RNA. The current study identified genomic features associated with sperm epimutations that may explain in part how these sites become susceptible for transgenerational programming.

  13. Induction of systemic TH1-like innate immunity in normal volunteers following subcutaneous but not intravenous administration of CPG 7909, a synthetic B-class CpG oligodeoxynucleotide TLR9 agonist.

    PubMed

    Krieg, Arthur M; Efler, Susan M; Wittpoth, Michael; Al Adhami, Mohammed J; Davis, Heather L

    2004-01-01

    Subcutaneous injection of normal human volunteers with a B-class CpG oligodeoxynucleotide (ODN) TLR9 agonist, CPG 7909, induced a TH1-like pattern of systemic innate immune activation manifested by expression of IL-6, IL-12p40, IFN-alpha, and IFN-inducible chemokines. Serum IP-10 was found to be the most sensitive assay for subcutaneous CPG 7909 stimulation; its level was significantly increased in all subjects at all dose levels, including the lowest tested dose of just 0.0025 mg/kg. This pattern of chemokine and cytokine induction was markedly different from that previously reported to be induced by TLR9 stimulation in rodents, most likely reflecting species-specific differences in the cell types expressing TLR9. Subcutaneous CPG 7909 injection induced transient shifts in blood neutrophils, lymphocytes, and monocytes, consistent with the increased chemokine expression. Levels of acute phase reactants such as C-reactive protein were also increased. A second subcutaneous CPG 7909 injection administered 2 weeks after the first elicited similar immune responses, showing little or no tolerance to the effects of repeated in vivo TLR9 stimulation. Subjects developed dose-dependent transient injection site reactions and flu-like symptoms but otherwise tolerated injection well, with no evidence of organ toxicity or systemic autoimmunity. The activation of innate immunity was dependent on the route of ODN administration, since intravenous injection caused no such effects. These studies indicate that in vivo activation of TLR9 by subcutaneous administration of CPG 7909 could be a well-tolerated immunotherapeutic approach for induction of TH1 innate immune activation.

  14. CpG promoter methylation status is not a prognostic indicator of gene expression in beryllium challenge.

    PubMed

    Tooker, Brian C; Ozawa, Katherine; Newman, Lee S

    2016-05-01

    Individuals exposed to beryllium (Be) may develop Be sensitization (BeS) and progress to chronic beryllium disease (CBD). Recent studies with other metal antigens suggest epigenetic mechanisms may be involved in inflammatory disease processes, including granulomatous lung disorders and that a number of metal cations alter gene methylation. The objective of this study was to determine if Be can exert an epigenetic effect on gene expression by altering methylation in the promoter region of specific genes known to be involved in Be antigen-mediated gene expression. To investigate this objective, three macrophage tumor mouse cell lines known to differentially produce tumor necrosis factor (TNF)-α, but not interferon (IFN)-γ, in response to Be antigen were cultured with Be or controls. Following challenges, ELISA were performed to quantify induced TNFα and IFNγ expression. Bisulfate-converted DNA was evaluated by pyrosequencing to quantify CpG methylation within the promoters of TNFα and IFNγ. Be-challenged H36.12J cells expressed higher levels of TNFα compared to either H36.12E cells or P388D.1 cells. However, there were no variations in TNFα promoter CpG methylation levels between cell lines at the six CpG sites tested. H36.12J cell TNFα expression was shown to be metal-specific by the induction of significantly more TNFα when exposed to Be than when exposed to aluminum sulfate, or nickel (II) chloride, but not when exposed to cobalt (II) chloride. However, H36.12J cell methylation levels at the six CpG sites examined in the TNFα promoter did not correlate with cytokine expression differences. Nonetheless, all three cell lines had significantly more promoter methylation at the six CpG sites investigated within the IFNγ promoter (a gene that is not expressed) when compared to the six CpG sites investigated in the TNFα promoter, regardless of treatment condition (p < 1.17 × 10(-9)). These findings suggest that, in this cell system, promoter hypo

  15. Lipedema: an inherited condition.

    PubMed

    Child, Anne H; Gordon, Kristiana D; Sharpe, Pip; Brice, Glen; Ostergaard, Pia; Jeffery, Steve; Mortimer, Peter S

    2010-04-01

    Lipedema is a condition characterized by swelling and enlargement of the lower limbs due to abnormal deposition of subcutaneous fat. Lipedema is an under-recognized condition, often misdiagnosed as lymphedema or dismissed as simple obesity. We present a series of pedigrees and propose that lipedema is a genetic condition with either X-linked dominant inheritance or more likely, autosomal dominant inheritance with sex limitation. Lipedema appears to be a condition almost exclusively affecting females, presumably estrogen-requiring as it usually manifests at puberty. Lipedema is an entity distinct from obesity, but may be wrongly diagnosed as primary obesity, due to clinical overlap. The phenotype suggests a condition distinct from obesity and associated with pain, tenderness, and easy bruising in affected areas. (c) 2010 Wiley-Liss, Inc.

  16. Pathology of inherited rickets in Corriedale sheep.

    PubMed

    Dittmer, K E; Thompson, K G; Blair, H T

    2009-01-01

    A skeletal disease with features of rickets and simple autosomal recessive inheritance has been discovered in Corriedale sheep in New Zealand. The clinical signs resemble rickets in other species and include decreased growth rate, thoracic lordosis and angular limb deformities. Gross lesions include segmental thickening of physes, growth arrest lines, collapse of subchondral bone of the humeral head, thickened cortices and enthesophytes around distal limb joints. Microscopically, there is persistence of hypertrophic chondrocytes at sites of endochondral ossification, inappropriate and excessive osteoclastic resorption, microfractures and wide, unmineralized osteoid seams lining trabeculae and filling secondary osteons. This study confirms that this skeletal disease of Corriedale sheep is a newly discovered form of inherited rickets and suggests that the genetic defect may be different from inherited forms of rickets described to date in man and animals.

  17. Mitochondrial inheritance and disease.

    PubMed

    Fine, P E

    1978-09-23

    Spontaneously occurring variants of the D.N.A. content of mitochondria may be responsible for human disease. Among the prime candidates for such a mitochondrial aetiology are certain drug-induced blood dyscrasias, particularly that due to chloramphenicol. Because mitochondria are generally inherited from the female parent, such disorders should be clustered among matroclinally related individuals. The clinical manifestations of such diseases are a function of the manner in which mitochondria are allocated to somatic cells and tissues during development.

  18. Epigenetic transgenerational inheritance

    PubMed Central

    Skinner, Michael K.

    2017-01-01

    Endocrine disruptors are critical environmental exposures that influence health and can promote epigenetic transgenerational inheritance of disease and abnormal physiology. Advances in 2015 included analyses of the effects of endocrine disruptors on human disease, further examples of endocrine disruptors promoting transgenerational behavioural effects, insights into effects of endocrine disruptors on epigenetic programming of primordial germ cells and the finding that endocrine disruptors can transgenerationally promote genetic mutations. PMID:26585656

  19. DNA containing CpG motifs induces angiogenesis

    NASA Astrophysics Data System (ADS)

    Zheng, Mei; Klinman, Dennis M.; Gierynska, Malgorzata; Rouse, Barry T.

    2002-06-01

    New blood vessel formation in the cornea is an essential step in the pathogenesis of a blinding immunoinflammatory reaction caused by ocular infection with herpes simplex virus (HSV). By using a murine corneal micropocket assay, we found that HSV DNA (which contains a significant excess of potentially bioactive "CpG" motifs when compared with mammalian DNA) induces angiogenesis. Moreover, synthetic oligodeoxynucleotides containing CpG motifs attract inflammatory cells and stimulate the release of vascular endothelial growth factor (VEGF), which in turn triggers new blood vessel formation. In vitro, CpG DNA induces the J774A.1 murine macrophage cell line to produce VEGF. In vivo CpG-induced angiogenesis was blocked by the administration of anti-mVEGF Ab or the inclusion of "neutralizing" oligodeoxynucleotides that specifically oppose the stimulatory activity of CpG DNA. These findings establish that DNA containing bioactive CpG motifs induces angiogenesis, and suggest that CpG motifs in HSV DNA may contribute to the blinding lesions of stromal keratitis.

  20. Inherited hepatocellular carcinoma.

    PubMed

    Villanueva, Augusto; Newell, Pippa; Hoshida, Yujin

    2010-10-01

    Inherited liver disorders that cause chronic inflammation, fibrosis, and cirrhosis can lead to the development of liver cancer. Because of the rarity and diversity of some of these syndromes, the relative risk of developing HCC in these patients and the age at which tumours typically arise cannot be accurately estimated. Among patients with hereditary hemachromatosis (HH), the annual incidence of HCC is 4% once cirrhosis has been established. Fibrosis and portal hypertension associated with HH can be partially reversed with therapeutic phlebotomy, but it is unclear whether this treatment alters the incidence of HCC in these patients. Importantly, it seems likely that coincidence of these genetic disorders with known HCC risk factors such as alcoholism and viral hepatitis would amplify their oncogenic potential. For this reason, patients with known genetic disorders of the liver should be repeatedly counselled to avoid environmental and toxic injury to the liver. Treatment of HCC in patients with inherited liver disease mirrors that of HCC associated with other etiologies. Unfortunately, there are case series which suggest these patients with inherited liver disease and HCC tend to present at more advanced stages and are therefore not eligible for curative therapies, causing overall decreased survival relative to patients with HCC of viral or other etiologies. Copyright © 2010 Elsevier Ltd. All rights reserved.

  1. Synthetic CpG islands reveal DNA sequence determinants of chromatin structure

    PubMed Central

    Wachter, Elisabeth; Quante, Timo; Merusi, Cara; Arczewska, Aleksandra; Stewart, Francis; Webb, Shaun; Bird, Adrian

    2014-01-01

    The mammalian genome is punctuated by CpG islands (CGIs), which differ sharply from the bulk genome by being rich in G + C and the dinucleotide CpG. CGIs often include transcription initiation sites and display ‘active’ histone marks, notably histone H3 lysine 4 methylation. In embryonic stem cells (ESCs) some CGIs adopt a ‘bivalent’ chromatin state bearing simultaneous ‘active’ and ‘inactive’ chromatin marks. To determine whether CGI chromatin is developmentally programmed at specific genes or is imposed by shared features of CGI DNA, we integrated artificial CGI-like DNA sequences into the ESC genome. We found that bivalency is the default chromatin structure for CpG-rich, G + C-rich DNA. A high CpG density alone is not sufficient for this effect, as A + T-rich sequence settings invariably provoke de novo DNA methylation leading to loss of CGI signature chromatin. We conclude that both CpG-richness and G + C-richness are required for induction of signature chromatin structures at CGIs. DOI: http://dx.doi.org/10.7554/eLife.03397.001 PMID:25259796

  2. Crystal structure of human nucleosome core particle containing enzymatically introduced CpG methylation.

    PubMed

    Fujii, Yoshifumi; Wakamori, Masatoshi; Umehara, Takashi; Yokoyama, Shigeyuki

    2016-06-01

    Cytosine methylation, predominantly of the CpG sequence in vertebrates, is one of the major epigenetic modifications crucially involved in the control of gene expression. Due to the difficulty of reconstituting site-specifically methylated nucleosomal DNA at crystallization quality, most structural analyses of CpG methylation have been performed using chemically synthesized oligonucleotides, There has been just one recent study of nucleosome core particles (NCPs) reconstituted with nonpalindromic human satellite 2-derived DNAs. Through the preparation of a 146-bp palindromic α-satellite-based nucleosomal DNA containing four CpG dinucleotide sequences and its enzymatic methylation and restriction, we reconstituted a 'symmetric' human CpG-methylated nucleosome core particle (NCP). We solved the crystal structures of the CpG-methylated and unmodified NCPs at 2.6 and 3.0 Å resolution, respectively. We observed the electron densities of two methyl groups, among the eight 5-methylcytosines introduced in the CpG-fully methylated NCP. There were no obvious structural differences between the CpG-methylated 'symmetric NCP' and the unmodified NCP. The preparation of a crystallization-grade CpG-methylated NCP provides a platform for the analysis of CpG-methyl reader and eraser proteins.

  3. A Novel CpG Island Set Identifies Tissue-Specific Methylation at Developmental Gene Loci

    PubMed Central

    Illingworth, Robert; Kerr, Alastair; DeSousa, Dina; Jørgensen, Helle; Ellis, Peter; Stalker, Jim; Jackson, David; Clee, Chris; Plumb, Robert; Rogers, Jane; Humphray, Sean; Cox, Tony; Langford, Cordelia; Bird, Adrian

    2008-01-01

    CpG islands (CGIs) are dense clusters of CpG sequences that punctuate the CpG-deficient human genome and associate with many gene promoters. As CGIs also differ from bulk chromosomal DNA by their frequent lack of cytosine methylation, we devised a CGI enrichment method based on nonmethylated CpG affinity chromatography. The resulting library was sequenced to define a novel human blood CGI set that includes many that are not detected by current algorithms. Approximately half of CGIs were associated with annotated gene transcription start sites, the remainder being intra- or intergenic. Using an array representing over 17,000 CGIs, we established that 6%–8% of CGIs are methylated in genomic DNA of human blood, brain, muscle, and spleen. Inter- and intragenic CGIs are preferentially susceptible to methylation. CGIs showing tissue-specific methylation were overrepresented at numerous genetic loci that are essential for development, including HOX and PAX family members. The findings enable a comprehensive analysis of the roles played by CGI methylation in normal and diseased human tissues. PMID:18232738

  4. A novel CpG island set identifies tissue-specific methylation at developmental gene loci.

    PubMed

    Illingworth, Robert; Kerr, Alastair; Desousa, Dina; Jørgensen, Helle; Ellis, Peter; Stalker, Jim; Jackson, David; Clee, Chris; Plumb, Robert; Rogers, Jane; Humphray, Sean; Cox, Tony; Langford, Cordelia; Bird, Adrian

    2008-01-01

    CpG islands (CGIs) are dense clusters of CpG sequences that punctuate the CpG-deficient human genome and associate with many gene promoters. As CGIs also differ from bulk chromosomal DNA by their frequent lack of cytosine methylation, we devised a CGI enrichment method based on nonmethylated CpG affinity chromatography. The resulting library was sequenced to define a novel human blood CGI set that includes many that are not detected by current algorithms. Approximately half of CGIs were associated with annotated gene transcription start sites, the remainder being intra- or intergenic. Using an array representing over 17,000 CGIs, we established that 6%-8% of CGIs are methylated in genomic DNA of human blood, brain, muscle, and spleen. Inter- and intragenic CGIs are preferentially susceptible to methylation. CGIs showing tissue-specific methylation were overrepresented at numerous genetic loci that are essential for development, including HOX and PAX family members. The findings enable a comprehensive analysis of the roles played by CGI methylation in normal and diseased human tissues.

  5. Base excision repair of tandem modifications in a methylated CpG dinucleotide.

    PubMed

    Sassa, Akira; Çağlayan, Melike; Dyrkheeva, Nadezhda S; Beard, William A; Wilson, Samuel H

    2014-05-16

    Cytosine methylation and demethylation in tracks of CpG dinucleotides is an epigenetic mechanism for control of gene expression. The initial step in the demethylation process can be deamination of 5-methylcytosine producing the TpG alteration and T:G mispair, and this step is followed by thymine DNA glycosylase (TDG) initiated base excision repair (BER). A further consideration is that guanine in the CpG dinucleotide may become oxidized to 7,8-dihydro-8-oxoguanine (8-oxoG), and this could affect the demethylation process involving TDG-initiated BER. However, little is known about the enzymology of BER of altered in-tandem CpG dinucleotides; e.g. Tp8-oxoG. Here, we investigated interactions between this altered dinucleotide and purified BER enzymes, the DNA glycosylases TDG and 8-oxoG DNA glycosylase 1 (OGG1), apurinic/apyrimidinic (AP) endonuclease 1, DNA polymerase β, and DNA ligases. The overall TDG-initiated BER of the Tp8-oxoG dinucleotide is significantly reduced. Specifically, TDG and DNA ligase activities are reduced by a 3'-flanking 8-oxoG. In contrast, the OGG1-initiated BER pathway is blocked due to the 5'-flanking T:G mispair; this reduces OGG1, AP endonuclease 1, and DNA polymerase β activities. Furthermore, in TDG-initiated BER, TDG remains bound to its product AP site blocking OGG1 access to the adjacent 8-oxoG. These results reveal BER enzyme specificities enabling suppression of OGG1-initiated BER and coordination of TDG-initiated BER at this tandem alteration in the CpG dinucleotide.

  6. Direct observation of preferential processing of clustered abasic DNA damages with APE1 in TATA box and CpG island by reaction kinetics and fluorescence dynamics.

    PubMed

    Singh, Vandana; Kumari, Bhavini; Maity, Banibrata; Seth, Debabrata; Das, Prolay

    2014-01-01

    Sequences like the core element of TATA box and CpG island are frequently encountered in the genome and related to transcription. The fate of repair of clustered abasic sites in such sequences of genomic importance is largely unknown. This prompted us to investigate the sequence dependence of cleavage efficiency of APE1 enzyme at abasic sites within the core sequences of TATA box and CpG island using fluorescence dynamics and reaction kinetics. Simultaneous molecular dynamics study through steady state and time resolved fluorescence spectroscopy using unique ethidium bromide dye release assay confirmed an elevated amount of abasic site cleavage of the TATA box sequence as compared to the core CpG island. Reaction kinetics showed that catalytic efficiency of APE1 for abasic site cleavage of core CpG island sequence was ∼4 times lower as compared to that of the TATA box. Higher value of Km was obtained from the core CpG island sequence than the TATA box sequence. This suggests a greater binding effect of APE1 enzyme on TATA sequence that signifies a prominent role of the sequence context of the DNA substrate. Evidently, a faster response from APE1 was obtained for clustered abasic damage repair of TATA box core sequences than CpG island consensus sequences. The neighboring bases of the abasic sites in the complementary DNA strand were found to have significant contribution in addition to the flanking bases in modulating APE1 activity. The repair refractivity of the bistranded clustered abasic sites arise from the slow processing of the second abasic site, consequently resulting in decreased overall production of potentially lethal double strand breaks.

  7. Inherited platelet disorders and oral health.

    PubMed

    Valera, Marie-Cécile; Kemoun, Philippe; Cousty, Sarah; Sie, Pierre; Payrastre, Bernard

    2013-02-01

    Platelets play a key role in thrombosis and hemostasis. Accumulation of platelets at the site of vascular injury is the first step in the formation of hemostatic plugs, which play a pivotal role in preventing blood loss after injury. Platelet adhesion at sites of injury results in spreading, secretion, recruitment of additional platelets, and formation of platelet aggregates. Inherited platelet disorders are rare causes of bleeding syndromes, ranging from mild bruising to severe hemorrhage. The defects can reflect deficiency or dysfunction of platelet surface glycoproteins, granule contents, cytoskeletal proteins, platelet pro-coagulant function, and signaling pathways. For instance, Bernard-Soulier syndrome and Glanzmann thrombasthenia are attributed to deficiencies of glycoprotein Ib/IX/V and GPIIb/IIIa, respectively, and are rare but severe platelet disorders. Inherited defects that impair platelet secretion and/or signal transduction are among the most common forms of mild platelet disorders and include gray platelet syndrome, Hermansky-Pudlak syndrome, and Chediak-Higashi syndrome. When necessary, desmopressin, antifibrinolytic agents, and transfusion of platelets remain the most common treatment of inherited platelet disorders. Alternative therapies such as recombinant activated factor VII are also available for a limited number of situations. In this review, we will discuss the management of patients with inherited platelet disorders in various clinical situations related to dental cares, including surgical intervention. © 2012 John Wiley & Sons A/S.

  8. Exercise and Inherited Arrhythmias.

    PubMed

    Cheung, Christopher C; Laksman, Zachary W M; Mellor, Gregory; Sanatani, Shubhayan; Krahn, Andrew D

    2016-04-01

    Sudden cardiac death (SCD) in an apparently healthy individual is a tragedy that prompts a series of investigations to identify the cause of death and to prevent SCD in potentially at-risk family members. Several inherited channelopathies and cardiomyopathies, including long QT syndrome (LQTS), catecholaminergic polymorphic ventricular cardiomyopathy (CPVT), hypertrophic cardiomyopathy (HCM), and arrhythmogenic right ventricular cardiomyopathy (ARVC) are associated with exercise-related SCD. Exercise restriction has been a historical mainstay of therapy for these conditions. Syncope and cardiac arrest occur during exercise in LQTS and CPVT because of ventricular arrhythmias, which are managed with β-blockade and exercise restriction. Exercise may provoke hemodynamic or ischemic changes in HCM, leading to ventricular arrhythmias. ARVC is a disease of the desmosome, whose underlying disease process is accelerated by exercise. On this basis, expert consensus has erred on the side of caution, recommending rigorous exercise restriction for all inherited arrhythmias. With time, as familiarity with inherited arrhythmia conditions has increased and patients with milder forms of disease are diagnosed, practitioners have questioned the historical rigorous restrictions advocated for all. This change has been driven by the fact that these are often children and young adults who wish to lead active lives. Recent evidence suggests a lower risk of exercise-related arrhythmias in treated patients than was previously assumed, including those with previous symptoms managed with an implantable cardioverter-defibrillator. In this review, we emphasize shared decision making, monitored medical therapy, individual and team awareness of precautions and emergency response measures, and a more permissive approach to recreational and competitive exercise.

  9. Inheritance and testicular cancer.

    PubMed Central

    Nicholson, P. W.; Harland, S. J.

    1995-01-01

    Statistical analysis of published data on the age of onset of germ cell tumours of the testis and of the prevalence of bilateral disease in familial and general cases suggest the following: 1. Patients with bilateral disease carry the same genetic predisposition as familial cases. 2. Males with the hereditary predisposition develop none, unilateral or bilateral tumours in the proportions 55%, 38% and 7% respectively. 3. One-third of all testis cancer patients are genetically predisposed to the disease. 4. The 2.2% risk to brothers of cases as reported elsewhere can be accounted for by the homozygous (recessive) inheritance of a single predisposing gene. PMID:7841065

  10. Asymmetric DNA methylation of CpG dyads is a feature of secondary DMRs associated with the Dlk1/Gtl2 imprinting cluster in mouse.

    PubMed

    Guntrum, Megan; Vlasova, Ekaterina; Davis, Tamara L

    2017-01-01

    Differential DNA methylation plays a critical role in the regulation of imprinted genes. The differentially methylated state of the imprinting control region is inherited via the gametes at fertilization, and is stably maintained in somatic cells throughout development, influencing the expression of genes across the imprinting cluster. In contrast, DNA methylation patterns are more labile at secondary differentially methylated regions which are established at imprinted loci during post-implantation development. To investigate the nature of these more variably methylated secondary differentially methylated regions, we adopted a hairpin linker bisulfite mutagenesis approach to examine CpG dyad methylation at differentially methylated regions associated with the murine Dlk1/Gtl2 imprinting cluster on both complementary strands. We observed homomethylation at greater than 90% of the methylated CpG dyads at the IG-DMR, which serves as the imprinting control element. In contrast, homomethylation was only observed at 67-78% of the methylated CpG dyads at the secondary differentially methylated regions; the remaining 22-33% of methylated CpG dyads exhibited hemimethylation. We propose that this high degree of hemimethylation could explain the variability in DNA methylation patterns at secondary differentially methylated regions associated with imprinted loci. We further suggest that the presence of 5-hydroxymethylation at secondary differentially methylated regions may result in hemimethylation and methylation variability as a result of passive and/or active demethylation mechanisms.

  11. Hepatitic inherited metabolic disorders.

    PubMed

    Arroyo, May; Crawford, James M

    2006-01-01

    Primary metabolic disorders are a disparate group of diseases that may or may not be accompanied by hepatic manifestations. Those with liver involvement may show a range of histopathologic changes. Proper histologic diagnosis requires correlation with clinical and laboratory data, including evaluation for mutations either via serum protein electrophoresis or through formal genetic analysis. This article is a review of the three most common inherited metabolic disorders which may present with a hepatitic pattern. In alpha1-antitrypsin disorder, there is a broad range of clinical presentations, age at presentation, and histological features ranging from "neonatal hepatitis" to a chronic progressive hepatitis in later childhood and adulthood. Hence, this disorder must be in the differential diagnosis of liver disease of the very young, and in older children and adults, with or without coexistent overt pulmonary symptoms. In Wilson disease, presentation tends to be in older childhood or the adult, with a progressive chronic hepatitis. Cystic fibrosis may feature a characteristic obstructive biliary syndrome, coexisting with the many extrahepatic manifestations of this debilitating disease. Lastly, the progressive familial intrahepatic cholestasis (PFIC) syndromes are given as examples of inherited metabolic conditions in which relentlessly progressive cholestatic liver disease eventuates over years in end-stage cholestatic liver disease with cirrhosis. Distinguishing features include absence of elevated serum gamma-glutamyl transpeptidase (GGT) in PFIC-1 and PFIC-2, and elevated GGT in PFIC-3. However, molecular studies are required for a confident diagnosis of the rare PFIC syndromes.

  12. Inherited mitochondrial disorders.

    PubMed

    Finsterer, Josef

    2012-01-01

    Though inherited mitochondrial disorders (MIDs) are most well known for their syndromic forms, for which widely known acronyms (MELAS, MERRF, NARP, LHON etc.) have been coined, the vast majority of inherited MIDs presents in a non-syndromic form. Since MIDs are most frequently multisystem disorders already at onset or during the disease course, a MID should be suspected if there is a combination of neurological and non-neurological abnormalities. Neurological abnormalities occurring as a part of a MID include stroke-like episodes, epilepsy, migraine-like headache, movement disorders, cerebellar ataxia, visual impairment, encephalopathy, cognitive impairment, dementia, psychosis, hypopituitarism, aneurysms, or peripheral nervous system disease, such as myopathy, neuropathy, or neuronopathy. Non-neurological manifestations concern the ears, the endocrine organs, the heart, the gastrointestinal tract, the kidneys, the bone marrow, and the skin. Whenever there is an unexplained combination of neurological and non-neurological disease in a patient or kindred, a MID should be suspected and appropriate diagnostic measures initiated. Genetic testing should be guided by the phenotype, the biopsy findings, and the biochemical results.

  13. CpG island methylator phenotype in colorectal cancer

    PubMed Central

    Toyota, Minoru; Ahuja, Nita; Ohe-Toyota, Mutsumi; Herman, James G.; Baylin, Stephen B.; Issa, Jean-Pierre J.

    1999-01-01

    Aberrant methylation of promoter region CpG islands is associated with transcriptional inactivation of tumor-suppressor genes in neoplasia. To understand global patterns of CpG island methylation in colorectal cancer, we have used a recently developed technique called methylated CpG island amplification to examine 30 newly cloned differentially methylated DNA sequences. Of these 30 clones, 19 (63%) were progressively methylated in an age-dependent manner in normal colon, 7 (23%) were methylated in a cancer-specific manner, and 4 (13%) were methylated only in cell lines. Thus, a majority of CpG islands methylated in colon cancer are also methylated in a subset of normal colonic cells during the process of aging. In contrast, methylation of the cancer-specific clones was found exclusively in a subset of colorectal cancers, which appear to display a CpG island methylator phenotype (CIMP). CIMP+ tumors also have a high incidence of p16 and THBS1 methylation, and they include the majority of sporadic colorectal cancers with microsatellite instability related to hMLH1 methylation. We thus define a pathway in colorectal cancer that appears to be responsible for the majority of sporadic tumors with mismatch repair deficiency. PMID:10411935

  14. CpG 7909: PF 3512676, PF-3512676.

    PubMed

    2006-01-01

    CpG 7909 [PF-3512676] is an immunomodulating synthetic oligonucleotide designed to specifically agonise the Toll-like receptor 9 (TLR9). It is being developed for the treatment of cancer [ProMune] as a monotherapy and in combination with chemotherapeutic agents, and it is also under development as an adjuvant [VaxImmune] for vaccines against cancer and infectious diseases. CpG 7909, acting through the TLR9 receptor present in B cells and plasmacytoid dendritic cells, stimulates human B-cell proliferation, enhances antigen-specific antibody production and induces interferon-alpha production, interleukin-10 secretion and natural killer cell activity. Coley Pharmaceutical Group originally developed CpG 7909 using its CpG DNA technology. In March 2005, Coley granted Pfizer an exclusive global license to develop and commercialise CPG 7909 [ProMune] for the treatment, control and prevention of multiple cancer indications. Coley licensed CpG 7909 [VaxImmune] to Chiron Corporation for adjuvant use with Chiron's prophylactic vaccine candidates against infectious diseases in December 2003. Chiron was acquired by and merged into Novartis in April 2006. In 2002, GlaxoSmithKline (GSK) was granted a worldwide, non-exclusive licence to Coley's CpG immunostimulatory oligonucleotides, including CpG 7909 [VaxImmune], for their use as adjuvants for cancer vaccines. In 2000, Coley entered into a co-exclusive licensing agreement with GSK for the development of therapeutic and prophylactic vaccines against infectious diseases. This licensing agreement included CpG 7909 [VaxImmune] and other CpG-based immunostimulatory oligonucleotides. In September 2004, Coley Pharmaceuticals was awarded a 16.9 million US dollars, 5-year contract from the National Institute of Allergy and Infectious Diseases (NIAID), one of the National Institutes of Health (NIH), to support the development of novel immune-activating drugs for defense against bioterror agents. This contract will be used to expand Coley

  15. Dominantly-inherited lop ears.

    PubMed

    Leung, Alexander K C; Kong, Albert Y F; Robson, W Lane M; McLeod, D Ross

    2007-10-01

    We describe a four-generation Chinese family that included five members who had an isolated bilateral lop ear anomaly. The presentation suggested a dominant mode of inheritance. The absence of male-to-male transmission does not exclude an X-linked dominant mode of inheritance. Since the phenotypic anomaly of the male proband was no more severe than the affected female members, an autosomal dominant mode of inheritance is most likely. 2007 Wiley-Liss, Inc

  16. Long Oskar Controls Mitochondrial Inheritance in Drosophila melanogaster.

    PubMed

    Hurd, Thomas Ryan; Herrmann, Beate; Sauerwald, Julia; Sanny, Justina; Grosch, Markus; Lehmann, Ruth

    2016-12-05

    Inherited mtDNA mutations cause severe human disease. In most species, mitochondria are inherited maternally through mechanisms that are poorly understood. Genes that specifically control the inheritance of mitochondria in the germline are unknown. Here, we show that the long isoform of the protein Oskar regulates the maternal inheritance of mitochondria in Drosophila melanogaster. We show that, during oogenesis, mitochondria accumulate at the oocyte posterior, concurrent with the bulk streaming and churning of the oocyte cytoplasm. Long Oskar traps and maintains mitochondria at the posterior at the site of primordial germ cell (PGC) formation through an actin-dependent mechanism. Mutating long oskar strongly reduces the number of mtDNA molecules inherited by PGCs. Therefore, Long Oskar ensures germline transmission of mitochondria to the next generation. These results provide molecular insight into how mitochondria are passed from mother to offspring, as well as how they are positioned and asymmetrically partitioned within polarized cells.

  17. CPG Network Optimization for a Biomimetic Robotic Fish via PSO.

    PubMed

    Yu, Junzhi; Wu, Zhengxing; Wang, Ming; Tan, Min

    2016-09-01

    In this brief, we investigate the parameter optimization issue of a central pattern generator (CPG) network governed forward and backward swimming for a fully untethered, multijoint biomimetic robotic fish. Considering that the CPG parameters are tightly linked to the propulsive performance of the robotic fish, we propose a method for determination of relatively optimized control parameters. Within the framework of evolutionary computation, we use a combination of dynamic model and particle swarm optimization (PSO) algorithm to seek the CPG characteristic parameters for an enhanced performance. The PSO-based optimization scheme is validated with extensive experiments conducted on the actual robotic fish. Noticeably, the optimized results are shown to be superior to previously reported forward and backward swimming speeds.

  18. Eat dirt: CpG DNA and immunomodulation of asthma.

    PubMed

    Kline, Joel N

    2007-07-01

    Asthma is a disorder of increasing prevalence and severity that has been linked with reduced early-life exposure to microbes and microbial products. Populations with increased environmental exposures to pathogen-associated molecular patterns (e.g., children who have large numbers of older siblings, who were raised on farms, and who have earlier out-of-home day-care attendance) have fewer and less severe atopic disorders. The mechanism(s) responsible for these observations remain uncertain, but modulation by pathogen-associated molecular patterns of the inflammatory milieu (and thus the setting in which allergens may be encountered) has received strong support. One microbial product with marked immunostimulatory properties is bacterial DNA, which differs from mammalian DNA in the frequency of cytosine-guanine (CpG) dinucleotides; many of the effects of bacterial DNA can be recapitulated by oligodeoxynucleotides (ODNs) containing CpG in specific base sequence motifs (CpG ODNs). Because CpG ODNs induce Th1-type cytokines (which can suppress the Th2-type responses that cause many of the manifestations of allergic disease), we speculated that they may be useful in preventing or reversing the eosinophilic inflammation of atopic asthma. We found this to be the case, using murine models of incipient and established allergic asthma, but learned that the Th1-type cytokines were not critical for efficacy. Subsequent work has suggested that induction of regulatory-type responses (from T cells and antigen-presenting cells) is involved in the protection provided by CpG ODNs. Ongoing clinical trials are examining the utility of CpG ODNs alone and as an adjuvant for immunotherapy in human populations with atopic disease.

  19. Inherited mitochondrial optic neuropathies

    PubMed Central

    Yu-Wai-Man, P; Griffiths, P G; Hudson, G; Chinnery, P F

    2009-01-01

    Leber hereditary optic neuropathy (LHON) and autosomal dominant optic atrophy (DOA) are the two most common inherited optic neuropathies and they result in significant visual morbidity among young adults. Both disorders are the result of mitochondrial dysfunction: LHON from primary mitochondrial DNA (mtDNA) mutations affecting the respiratory chain complexes; and the majority of DOA families have mutations in the OPA1 gene, which codes for an inner mitochondrial membrane protein critical for mtDNA maintenance and oxidative phosphorylation. Additional genetic and environmental factors modulate the penetrance of LHON, and the same is likely to be the case for DOA which has a markedly variable clinical phenotype. The selective vulnerability of retinal ganglion cells (RGCs) is a key pathological feature and understanding the fundamental mechanisms that underlie RGC loss in these disorders is a prerequisite for the development of effective therapeutic strategies which are currently limited. PMID:19001017

  20. Transcriptional silencing of Cyclooxygenase-2 by hyper-methylation of the 5' CpG island in human gastric carcinoma cells.

    PubMed

    Song, S H; Jong, H S; Choi, H H; Inoue, H; Tanabe, T; Kim, N K; Bang, Y J

    2001-06-01

    It has been well established that overexpression of Cyclooxygenase-2 (Cox-2) in epithelial cells inhibits apoptosis and increases the invasiveness of malignant cells, favoring tumorigenesis and metastasis. However, the molecular mechanism that regulates Cox-2 expression has not been well defined in gastric carcinoma. In this study, we examined whether the Cox-2 expression could be regulated by hyper-methylation of the Cox-2 CpG island (spanning from -590 to +186 with respect to the transcription initiation site) in human gastric carcinoma cell lines. By Southern analysis, we found that three gastric cells (SNU-601, -620, and -719) without Cox-2 expression demonstrated hyper-methylation at the Cox-2 CpG island. A detailed methylation pattern using bisulfite sequencing analysis revealed that all of the CpG sites were completely methylated in SNU-601. Treatment with demethylating agents effectively reactivated the expression of Cox-2 and restored IL-1beta sensitivity in the previously resistant SNU-601. By transient transfection experiments, we demonstrate that constitutively active Cox-2 promoter activities were exhibited even without an exogenous stimulation in SNU-601. Furthermore, when the motif of the nuclear factor for interleukin-6 expression site, the cyclic AMP response element, or both was subjected to point mutation, the constitutive luciferase activity was markedly reduced. In addition, Cox-2 promoter activity was completely blocked by in vitro methylation of all of the CpG sites in the Cox-2 promoter region with SssI (CpG) methylase in SNU-601. Taken together, these results indicate that transcriptional repression of Cox-2 is caused by hyper-methylation of the Cox-2 CpG island in gastric carcinoma cell lines.

  1. Investigation of the gravitational interaction between the components of the galaxy pairs Arp 242, CPG 165, and CPG 410

    NASA Astrophysics Data System (ADS)

    Ali, Gamal B.; Tawfeek, Amira A.; Amin, Magdy Y.

    2015-12-01

    In this paper the effect of interaction between the components of the galaxy pairs Arp 242, CPG 165, and CPG 410 on the symmetry of their morphologies and structures is studied by applying the technique of surface photometry. For each component of each pair we present the isophotal contours, profiles of surface brightness (SB), major-axis position angle (PA), and isophotal center-shift. The present analysis is done using the r- and i-band images from the Sloan Digital Sky Survey (SDSS) observation. It is found that the position angle and the isophotal center shift are strongly affected by the state of interaction between the components of the pairs.

  2. Hypermethylation of the death-associated protein kinase CpG island in canine B-cell lymphoid tumors.

    PubMed

    Sato, Masahiko; Mochizuki, Hiroyuki; Goto-Koshino, Yuko; Fujiwara-Igarashi, Aki; Takahashi, Masashi; Fujino, Yasuhito; Ohno, Koichi; Tsujimoto, Hajime

    2014-10-15

    Death-associated protein kinase (DAPK) is a 160-kD serine/threonine kinase known as a key molecule in interferon-γ (IFN-γ)-induced apoptosis and tumor suppression. Hypermethylation of the CpG island in DAPK inactivates the gene in a variety of human malignancies. This study aimed to detect the inactivation of DAPK in canine lymphoid tumor cells. The sequence of canine DAPK cDNA was obtained from normal dog peripheral blood mononuclear cells after reverse transcription polymerase chain reaction (RT-PCR). By rapid amplification of 5'-cDNA ends, the transcription initiation site of the DAPK gene was identified. The CpG island located upstream of the translation initiation site was identified by using a search algorithm. The methylation status of the CpG island was examined using bisulfite sequence analysis and methylation-specific PCR (MSP). The inactivation of DAPK gene was examined in 3 canine lymphoid tumor cell lines, GL-1 (B-cell leukemia), CLBL-1 (B-cell lymphoma), and CL-1 (T-cell lymphoma). DAPK mRNA expression was measured by real-time RT-PCR. IFN-γ-induced apoptosis was detected by terminal deoxynucleotidyl transferase dUTP nick end labelling (TUNEL) assay. The influence of demethylation was examined with 5-aza-2'-deoxycytidine (5-aza-dC). The methylation status in 14 dogs with various lymphoid tumors was screened by MSP. A 1926-bp CpG island containing 280 CpG repeats was identified upstream of the translation start site of canine DAPK. Bisulfate sequence analysis and MSP revealed hypermethylation of the CpG island in GL-1 cells, but not in CLBL-1 or CL-1 cells. The amount of DAPK mRNA was significantly smaller in GL-1 cells than CLBL-1 and CL-1 cells. IFN-γ-induced apoptosis was detected in CLBL-1 and CL-1 cells but not in GL-1 cells. Treatment with 5-aza-dC significantly increased the amount of DAPK mRNA and IFN-γ-induced apoptosis in GL-1 cells. These results revealed the inactivation of DAPK through methylation of its CpG island in GL-1 cells. MSP

  3. Inherited epidermolysis bullosa

    PubMed Central

    2010-01-01

    Inherited epidermolysis bullosa (EB) encompasses a number of disorders characterized by recurrent blister formation as the result of structural fragility within the skin and selected other tissues. All types and subtypes of EB are rare; the overall incidence and prevalence of the disease within the United States is approximately 19 per one million live births and 8 per one million population, respectively. Clinical manifestations range widely, from localized blistering of the hands and feet to generalized blistering of the skin and oral cavity, and injury to many internal organs. Each EB subtype is known to arise from mutations within the genes encoding for several different proteins, each of which is intimately involved in the maintenance of keratinocyte structural stability or adhesion of the keratinocyte to the underlying dermis. EB is best diagnosed and subclassified by the collective findings obtained via detailed personal and family history, in concert with the results of immunofluorescence antigenic mapping, transmission electron microscopy, and in some cases, by DNA analysis. Optimal patient management requires a multidisciplinary approach, and revolves around the protection of susceptible tissues against trauma, use of sophisticated wound care dressings, aggressive nutritional support, and early medical or surgical interventions to correct whenever possible the extracutaneous complications. Prognosis varies considerably and is based on both EB subtype and the overall health of the patient. PMID:20507631

  4. Inherited mitochondrial neuropathies.

    PubMed

    Finsterer, Josef

    2011-05-15

    Mitochondrial disorders (MIDs) occasionally manifest as polyneuropathy either as the dominant feature or as one of many other manifestations (inherited mitochondrial neuropathy). MIDs in which polyneuropathy is the dominant feature, include NARP syndrome due to the transition m.8993T>, CMT2A due to MFN2 mutations, CMT2K and CMT4A due to GDAP1 mutations, and axonal/demyelinating neuropathy with external ophthalmoplegia due to POLG1 mutations. MIDs in which polyneuropathy is an inconstant feature among others is the MELAS syndrome, MERRF syndrome, LHON, Mendelian PEO, KSS, Leigh syndrome, MNGIE, SANDO; MIRAS, MEMSA, AHS, MDS (hepato-cerebral form), IOSCA, and ADOA syndrome. In the majority of the cases polyneuropathy presents in a multiplex neuropathy distribution. Nerve conduction studies may reveal either axonal or demyelinated or mixed types of neuropathies. If a hereditary neuropathy is due to mitochondrial dysfunction, the management of these patients is at variance from non-mitochondrial hereditary neuropathies. Patients with mitochondrial hereditary neuropathy need to be carefully investigated for clinical or subclinical involvement of other organs or systems. Supportive treatment with co-factors, antioxidants, alternative energy sources, or lactate lowering agents can be tried. Involvement of other organs may require specific treatment. Mitochondrial neuropathies should be included in the differential diagnosis of hereditary neuropathies. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Progressive increases in the methylation status and heterochromatinization of the myoD CpG island during oncogenic transformation.

    PubMed Central

    Rideout, W M; Eversole-Cire, P; Spruck, C H; Hustad, C M; Coetzee, G A; Gonzales, F A; Jones, P A

    1994-01-01

    Alterations in DNA methylation patterns are one of the earliest and most common events in tumorigenesis. Overall levels of genomic methylation often decrease during transformation, but localized regions of increased methylation have been observed in the same tumors. We have examined changes in the methylation status of the muscle determination gene myoD, which contains a CpG island, as a function of oncogenic transformation. This CpG island underwent de novo methylation during immortalization of 10T1/2 cells, and progressively more sites became methylated during the subsequent transformation of the cells to oncogenicity. The greatest increase in methylation occurred in the middle of the CpG island in exon 1 during transformation. Interestingly, no methylation was apparent in the putative promoter of myoD in either the 10T1/2 cell line or its transformed derivative. The large number of sites in the CpG island that became methylated during transformation was correlated with heterochromatinization of myoD as evidenced by a decreased sensitivity to cleavage of DNA in nuclei by MspI. A site in the putative promoter also became insensitive to MspI digestion in nuclei, suggesting that the chromatin structural changes extended beyond the areas of de novo methylation. Unlike Lyonized genes on the inactive X chromosome, whose timing of replication is shifted to late S phase, myoD replicated early in S phase in the transformed cell line. Methylation analysis of myoD in DNAs from several human tumors, which presumably do not express the gene, showed that hypermethylation also frequently occurs during carcinogenesis in vivo. Thus, the progressive increase in methylation of myoD during immortalization and transformation coinciding with a change in chromatin structure, as illustrated by the in vitro tumorigenic model, may represent a common mechanism in carcinogenesis for permanently silencing the expression of genes which can influence cell growth and differentiation. Images

  6. Topical CpG Oligodeoxynucleotide Adjuvant Enhances the Adaptive Immune Response against Influenza A Infections

    PubMed Central

    Cheng, Wing Ki; Plumb, Adam William; Lai, Jacqueline Cheuk-Yan; Abraham, Ninan; Dutz, Jan Peter

    2016-01-01

    Current influenza vaccines generate humoral immunity, targeting highly variable epitopes and thus fail to achieve long-term protection. T cells recognize and respond to several highly conserved epitopes across influenza serotypes. A strategy of raising strong cytotoxic T cell memory responses to epitopes conserved across serotypes would provide cross serotype protection, eliminating the need for annual vaccination. We explored the adjuvant potential of epicutaneous (ec) and subcutaneous (sc) delivery of CpG oligodeoxynucleotide in conjunction with sc protein immunization to improve protection against influenza A virus (IAV) infections using a mouse model. We found enhanced long-term protection with epicutaneous CpG ODN (ecCpG) compared to subcutaneous CpG ODN (scCpG) as demonstrated by reduced viral titers in the lungs. This correlated with increased antigen-specific CD8 T cells in the airways and the lungs. The memory T cell response after immunization with ecCpG adjuvant was comparable to memory response by priming with IAV infection in the lungs. In addition, ecCpG was more efficient than scCpG in inducing the generation of IFN-γ producing CD4 T cells. The adjuvant effect of ecCpG was accompanied with its ability to modulate tissue-homing molecules on T cells that may direct them to the site of infection. Together, this work provides evidence for using ecCpG to induce strong antibody and memory T cell responses to confer protection against IAV infection. PMID:27524984

  7. Mitochondrial inheritance in Aspergillus nidulans.

    PubMed

    Coenen, A; Croft, J H; Slakhorst, M; Debets, F; Hoekstra, R

    1996-04-01

    Mitochondrial chloramphenicol and oligomycin resistance mutations were used to investigate mitochondrial inheritance in A. nidulans. Mitochondrial RFLPs could not be used to distinguish between paternal and maternal mitochondria because none were detected in the 54 isolates investigated. Several thousand ascospores from each of 111 hybrid cleistothecia from 21 different crosses between 7 heterokaryon incompatible isolates were tested for biparental inheritance. All mitochondrial inheritance was strictly uniparental. Not one instance of paternal inheritance of mitochondria was observed. The implications of our results for the theory that uniparental inheritance evolved to avoid cytoplasmic conflict are discussed. Possible explanations for the maintenance of strict uniparental inheritance of mitochondria in an inbreeding homothallic organism are suggested. The chloramphenicol resistance marker was inherited preferentially to the oligomycin resistance marker probably due to the inhibited energy production of mitochondria with the oligomycin resistance mutation. The maternal parent was determined for 93 hybrid cleistothecia from 17 crosses between 7 different strains. Contrary to previous reports A. nidulans strains functioned as both maternal and paternal parent in most crosses.

  8. Source of CpG Depletion in the HIV-1 Genome.

    PubMed

    Alinejad-Rokny, Hamid; Anwar, Firoz; Waters, Shafagh A; Davenport, Miles P; Ebrahimi, Diako

    2016-12-01

    The dinucleotide CpG is highly underrepresented in the genome of human immunodeficiency virus type 1 (HIV-1). To identify the source of CpG depletion in the HIV-1 genome, we investigated two biological mechanisms: (1) CpG methylation-induced transcriptional silencing and (2) CpG recognition by Toll-like receptors (TLRs). We hypothesized that HIV-1 has been under selective evolutionary pressure by these mechanisms leading to the reduction of CpG in its genome. A CpG depleted genome would enable HIV-1 to avoid methylation-induced transcriptional silencing and/or to avoid recognition by TLRs that identify foreign CpG sequences. We investigated these two hypotheses by determining the sequence context dependency of CpG depletion and comparing it with that of CpG methylation and TLR recognition. We found that in both human and HIV-1 genomes the CpG motifs flanked by T/A were depleted most and those flanked by C/G were depleted least. Similarly, our analyses of human methylome data revealed that the CpG motifs flanked by T/A were methylated most and those flanked by C/G were methylated least. Given that a similar CpG depletion pattern was observed for the human genome within which CpGs are not likely to be recognized by TLRs, we argue that the main source of CpG depletion in HIV-1 is likely host-induced methylation. Analyses of CpG motifs in over 100 viruses revealed that this unique CpG representation pattern is specific to the human and simian immunodeficiency viruses.

  9. Internet resources cataloguing inherited disorders in dogs.

    PubMed

    Nicholas, Frank W; Crook, Alice; Sargan, David R

    2011-08-01

    Up-to-date annotated catalogues of known inherited disorders in dogs are freely available on the Internet, providing vital information to existing and prospective dog owners, dog breeders, veterinarians, geneticists and others interested in the occurrence and control of inherited disorders. These resources are the Canine Inherited Disorders Database (CIDD), Inherited Diseases in Dogs (IDID) and Online Mendelian Inheritance in Animals (OMIA) the latter associated with Listing of Inherited Disorders in Animals (LIDA). The history and features of these resources are summarised.

  10. Interleukin-1 Receptor-Associated Kinase 2- and Protein Kinase D1-Dependent Regulation of IRAK-Monocyte Expression by CpG DNA

    PubMed Central

    Kim, Young-In; Park, Jeoung-Eun; Kwon, Ki Han; Hong, Cheol Yi; Yi, Ae-Kyung

    2012-01-01

    As a part of the negative feedback mechanism, CpG DNA induces IRAK-M expression in monocytic cells. In the present study we investigated a biochemical signaling pathway and the transcription factors responsible for CpG DNA-mediated Irak-m gene expression. CpG DNA-induced Irak-m expression did not require new protein synthesis and was regulated at the transcriptional level through an endosomal pH-sensitive TLR9/MyD88 signaling pathway. Over-expression of the dominant negative (DN) form of or gene-specific knockdown of signaling modulators in the TLR9 pathway demonstrated that IRAK4, IRAK1, IRAK2, and PKD1 are required for Irak-m transcription induced by CpG DNA. Over-expression of DN-IRAK1 only partially, but significantly, inhibited CpG DNA-induced Irak-m promoter activity. While IRAK1 was critical for the initial phase, IRAK2 was required for the late phase of TLR9 signaling by sustaining activation of PKD1 that leads to activation of NF-κB and MAPKs. Irak-m promoter-luciferase reporters with alterations in the predicted cis-acting transcriptional regulatory elements revealed that the NF-κB consensus site in the Irak-m promoter region is absolutely required for Irak-m gene expression. AP-1 and CREB binding sites also contributed to the optimal Irak-m expression by CpG DNA. Collectively, our results demonstrate that IRAK2 plays a key role in the TLR9-mediated transcriptional regulation of Irak-m expression by sustaining activation of PKD1 and NF-κB. PMID:22928050

  11. Phase 1 Trial of the Plasmodium falciparum Blood Stage Vaccine MSP142-C1/Alhydrogel with and without CPG 7909 in Malaria Naïve Adults

    PubMed Central

    Ellis, Ruth D.; Martin, Laura B.; Shaffer, Donna; Long, Carole A.; Miura, Kazutoyo; Fay, Michael P.; Narum, David L.; Zhu, Daming; Mullen, Gregory E. D.; Mahanty, Siddhartha; Miller, Louis H.; Durbin, Anna P.

    2010-01-01

    Background Merozoite surface protein 142 (MSP142) is a leading blood stage malaria vaccine candidate. In order to induce immune responses that cover the major antigenic polymorphisms, FVO and 3D7 recombinant proteins of MSP142 were mixed (MSP142-C1). To improve the level of antibody response, MSP142-C1 was formulated with Alhydrogel plus the novel adjuvant CPG 7909. Methods A Phase 1 clinical trial was conducted in healthy malaria-naïve adults at the Center for Immunization Research in Washington, D.C., to evaluate the safety and immunogenicity of MSP142-C1/Alhydrogel +/− CPG 7909. Sixty volunteers were enrolled in dose escalating cohorts and randomized to receive three vaccinations of either 40 or 160 µg protein adsorbed to Alhydrogel +/− 560 µg CPG 7909 at 0, 1 and 2 months. Results Vaccinations were well tolerated, with only one related adverse event graded as severe (Grade 3 injection site erythema) and all other vaccine related adverse events graded as either mild or moderate. Local adverse events were more frequent and severe in the groups receiving CPG. The addition of CPG enhanced anti-MSP142 antibody responses following vaccination by up to 49-fold two weeks after second immunization and 8-fold two weeks after the third immunization when compared to MSP142-C1/Alhydrogel alone (p<0.0001). After the third immunization, functionality of the antibody was tested by an in vitro growth inhibition assay. Inhibition was a function of antibody titer, with an average of 3% (range −2 to 10%) in the non CPG groups versus 14% (3 to 32%) in the CPG groups. Conclusion/Significance The favorable safety profile and high antibody responses induced with MSP142-C1/Alhydrogel + CPG 7909 are encouraging. MSP142-C1/Alhydrogel is being combined with other blood stage antigens and will be taken forward in a formulation adjuvanted with CPG 7909. Trial Registration ClinicalTrials.gov Identifier: NCT00320658 PMID:20107498

  12. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

    PubMed Central

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-01-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion. PMID:27877826

  13. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery.

    PubMed

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-08-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

  14. Effect of amino groups of mesoporous silica nanoparticles on CpG oligodexynucleotide delivery

    NASA Astrophysics Data System (ADS)

    Xu, Yi; Claiden, Peter; Zhu, Yufang; Morita, Hiromi; Hanagata, Nobutaka

    2015-08-01

    In this study, we proposed to modify mesoporous silica nanoparticles (MSNs) with 3-aminopropyltriethoxysilane (NH2-TES), aminoethylaminopropyltriethoxysilane (2NH2-TES) and 3-[2-(2-aminoethylamino)ethylamino] propyl-trimethoxysilane (3NH2-TES) for binding of cytosine-phosphate-guanosine oligodexynucleotides (CpG ODN), and investigated the effect of different amino groups of MSNs on the CpG ODN delivery. Serum stability, in vitro cytotoxicity, and cytokine interleukin-6 (IL-6) induction by MSN-NH2/CpG, MSN-2NH2/CpG and MSN-3NH2/CpG complexes were investigated in detail. The results showed that three kinds of aminated-MSN-based CpG ODN delivery systems had no cytotoxicity to RAW264.7 cells, and binding of CpG ODN to MSN-NH2, MSN-2NH2 and MSN-3NH2 nanoparticles enhanced the serum stability of CpG ODN due to protection by the nanoparticles. However, three aminated MSN-based CpG ODN delivery systems exhibited different CpG ODN delivery efficiency, and MSN-NH2/CpG complexes had the highest ability to induce IL-6 secretion.

  15. Inherited drainage - paleochannels and preferential groundwater flow

    NASA Astrophysics Data System (ADS)

    Owen, Richard; Dahlin, T.

    2010-06-01

    It is suggested that in a localized remnant of Kalahari sand at Dufuya, central Zimbabwe, groundwater flows in an integrated pattern inherited from the paleochannel network of the underlying gneiss. Contact springs occur at discrete localities along the Kalahari sand/gneiss boundary and are associated with spring sapping and land surface subsidence. Subsidence is presumed to be due to preferential solute removal by leaching and dissolution as a result of concentration of groundwater flow within the buried paleochannel network and the location of the springs is presumed to occur where the paleochannel network intersects the Kalahari sand/gneiss boundary. Over time the surficial Kalahari sand is preferentially removed along these buried drainage lines by spring sapping and headwards erosion, exposing the gneiss. Multi-electrode direct current resistivity profiling and radar have been used to map the sub-surface, revealing the topography of the basement and nature of the Kalahari cover. Coincidence of gneiss basement depressions with the spring sites, leached sands and subsidence zones suggests inheritance of the gneiss fluvial paleochannel network pattern by the present day groundwater flow. Washed sand and gravel intersected in shallow boreholes in these areas provides further evidentiary support for the concept of inherited drainage.

  16. TET1 Depletion Induces Aberrant CpG Methylation in Colorectal Cancer Cells

    PubMed Central

    Yamamoto, Eiichiro; Harada, Taku; Aoki, Hironori; Maruyama, Reo; Toyota, Mutsumi; Sasaki, Yasushi; Sugai, Tamotsu; Tokino, Takashi; Nakase, Hiroshi

    2016-01-01

    Aberrant DNA methylation is commonly observed in colorectal cancer (CRC), but the underlying mechanism is not fully understood. 5-hydroxymethylcytosine levels and TET1 expression are both reduced in CRC, while epigenetic silencing of TET1 is reportedly associated with the CpG island methylator phenotype. In the present study, we aimed to clarify the relationship between loss of TET1 and aberrant DNA methylation in CRC. Stable TET1 knockdown clones were established using Colo320DM cells, which express high levels of TET1, and HCT116 cells, which express TET1 at a level similar to that in normal colonic tissue. Infinium HumanMethylation450 BeadChip assays revealed increased levels of 5-methylcytosine at more than 10,000 CpG sites in TET1-depleted Colo320DM cells. Changes in DNA methylation were observed at various positions within the genome, including promoters, gene bodies and intergenic regions, and the altered methylation affected expression of a subset of genes. By contrast, TET1 knockdown did not significantly affect DNA methylation in HCT116 cells. However, TET1 depletion was associated with attenuated effects of 5-aza-2’-deoxycytidine on gene expression profiles in both cell lines. These results suggest that loss of TET1 may induce aberrant DNA methylation and may attenuate the effect of 5-aza-2’-deoxycytidine in CRC cells. PMID:27977763

  17. R-loop formation is a distinctive characteristic of unmethylated human CpG island promoters

    PubMed Central

    Ginno, Paul A.; Lott, Paul L.; Christensen, Holly C.; Korf, Ian; Chédin, Frédéric

    2012-01-01

    Summary CpG islands (CGIs) function as promoters for approximately 60% of human genes. Most of these elements remain protected from CpG methylation, a prevalent epigenetic modification associated with transcriptional silencing. Here, we report that methylation-resistant CGI promoters are characterized by significant strand asymmetry in the distribution of guanines and cytosines (GC skew) immediately downstream from their transcription start sites. Using innovative genomics methodologies, we show that transcription through regions of GC skew leads to the formation of long R-loop structures. Furthermore, we show that GC skew and R-loop formation potential is correlated with and predictive of the unmethylated state of CGIs. Finally, we provide evidence that R-loop formation protects from DNMT3B1, the primary de novo DNA methyltransferase in early development. Altogether, these results suggest that protection from DNA methylation is a built-in characteristic of the DNA sequence of CGI promoters that is revealed by the co-transcriptional formation of R-loop structures. PMID:22387027

  18. R-loop formation is a distinctive characteristic of unmethylated human CpG island promoters.

    PubMed

    Ginno, Paul A; Lott, Paul L; Christensen, Holly C; Korf, Ian; Chédin, Frédéric

    2012-03-30

    CpG islands (CGIs) function as promoters for approximately 60% of human genes. Most of these elements remain protected from CpG methylation, a prevalent epigenetic modification associated with transcriptional silencing. Here, we report that methylation-resistant CGI promoters are characterized by significant strand asymmetry in the distribution of guanines and cytosines (GC skew) immediately downstream from their transcription start sites. Using innovative genomics methodologies, we show that transcription through regions of GC skew leads to the formation of long R loop structures. Furthermore, we show that GC skew and R loop formation potential is correlated with and predictive of the unmethylated state of CGIs. Finally, we provide evidence that R loop formation protects from DNMT3B1, the primary de novo DNA methyltransferase in early development. Altogether, these results suggest that protection from DNA methylation is a built-in characteristic of the DNA sequence of CGI promoters that is revealed by the cotranscriptional formation of R loop structures. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Prediction of CpG island methylation status by integrating DNA physicochemical properties.

    PubMed

    Feng, Pengmian; Chen, Wei; Lin, Hao

    2014-10-01

    As an inheritable epigenetic modification, DNA methylation plays important roles in many biological processes. The non-uniform distribution of DNA methylation across the genome implies that characterizing genome-wide DNA methylation patterns is necessary to better understand the regulatory mechanisms of DNA methylation. Although a series of experimental technologies have been proposed, they are cost-ineffective for DNA methylation status detection. As complements to experimental techniques, computational methods will facilitate the identification of DNA methylation status. In the present study, we proposed a Naïve Bayes model to predict CpG island methylation status. In this model, DNA sequences are formulated by "pseudo trinucleotide composition" into which three DNA physicochemical properties were incorporated. It was observed by the jack-knife test that the overall success rate achieved by the proposed model in predicting the DNA methylation status was 88.22%. This result indicates that the proposed model is a useful tool for DNA methylation status prediction. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Electrophysiological Representation of Scratching CPG Activity in the Cerebellum

    PubMed Central

    Martínez-Silva, Lourdes; Manjarrez, Elias; Gutiérrez-Ospina, Gabriel; Quevedo, Jorge N.

    2014-01-01

    We analyzed the electrical activity of neuronal populations in the cerebellum and the lumbar spinal cord during fictive scratching in adult decerebrate cats before and after selective sections of the Spino-Reticulo Cerebellar Pathway (SRCP) and the Ventral-Spino Cerebellar Tract (VSCT). During fictive scratching, we found a conspicuous sinusoidal electrical activity, called Sinusoidal Cerebellar Potentials (SCPs), in the cerebellar vermis, which exhibited smaller amplitude in the paravermal and hemisphere cortices. There was also a significant spino-cerebellar coherence between these SCPs and the lumbar sinusoidal cord dorsum potentials (SCDPs). However, during spontaneous activity such spino-cerebellar coherence between spontaneous potentials recorded in the same regions decreased. We found that the section of the SRCP and the VSCT did not abolish the amplitude of the SCPs, suggesting that there are additional pathways conveying information from the spinal CPG to the cerebellum. This is the first evidence that the sinusoidal activity associated to the spinal CPG circuitry for scratching has a broad representation in the cerebellum beyond the sensory representation from hindlimbs previously described. Furthermore, the SCPs represent the global electrical activity of the spinal CPG for scratching in the cerebellar cortex. PMID:25350378

  1. The Impact of CpG Island on Defining Transcriptional Activation of the Mouse L1 Retrotransposable Elements

    PubMed Central

    Lee, Sung-Hun; Cho, Soo-Young; Shannon, M. Frances; Fan, Jun; Rangasamy, Danny

    2010-01-01

    Background L1 retrotransposable elements are potent insertional mutagens responsible for the generation of genomic variation and diversification of mammalian genomes, but reliable estimates of the numbers of actively transposing L1 elements are mostly nonexistent. While the human and mouse genomes contain comparable numbers of L1 elements, several phylogenetic and L1Xplore analyses in the mouse genome suggest that 1,500–3,000 active L1 elements currently exist and that they are still expanding in the genome. Conversely, the human genome contains only 150 active L1 elements. In addition, there is a discrepancy among the nature and number of mouse L1 elements in L1Xplore and the mouse genome browser at the UCSC and in the literature. To date, the reason why a high copy number of active L1 elements exist in the mouse genome but not in the human genome is unknown, as are the potential mechanisms that are responsible for transcriptional activation of mouse L1 elements. Methodology/Principal Findings We analyzed the promoter sequences of the 1,501 potentially active mouse L1 elements retrieved from the GenBank and L1Xplore databases and evaluated their transcription factors binding sites and CpG content. To this end, we found that a substantial number of mouse L1 elements contain altered transcription factor YY1 binding sites on their promoter sequences that are required for transcriptional initiation, suggesting that only a half of L1 elements are capable of being transcriptionally active. Furthermore, we present experimental evidence that previously unreported CpG islands exist in the promoters of the most active TF family of mouse L1 elements. The presence of sequence variations and polymorphisms in CpG islands of L1 promoters that arise from transition mutations indicates that CpG methylation could play a significant role in determining the activity of L1 elements in the mouse genome. Conclusions A comprehensive analysis of mouse L1 promoters suggests that the

  2. Routes of delivery for CpG and anti-CD137 for the treatment of orthotopic kidney tumors in mice.

    PubMed

    Westwood, Jennifer A; Potdevin Hunnam, Titaina C U; Pegram, Hollie J; Hicks, Rodney J; Darcy, Phillip K; Kershaw, Michael H

    2014-01-01

    We have found previously that the tumor cell lines, Renca (a renal cancer) and MC38 (a colon tumor) which had been injected subcutaneously in mice, could be successfully treated with a combination therapy of an oligodeoxynucleotide (CpG1826) (injected intratumorally) and anti-CD137 antibody (injected intraperitoneally). Thus the combination treatment was expected to initiate a "danger" signal via TLR9 on immune cells, and the anti-CD137 was expected to further activate T cells. In the present study, we found that several other tumor types injected subcutaneously could also be successfully treated with this combination therapy. In addition, we wished to determine if the treatment could work as effectively in an orthotopic metastatic model, which is more physiologically relevant to cancer in humans. Renca was selected as we were familiar with injecting this orthotopically into the outer cortex of the kidney in mice, and it spontaneously metastasizes to lung and abdominal sites. We tested various routes of delivery of CpG combined with intraperitoneal delivery of anti-CD137. Orthotopic tumors were injected with CpG intratumorally, using ultrasound-guided delivery on multiple occasions, combined with anti-CD137 intraperitoneally. A reduction in primary tumor size was observed following intratumoral injection of CpG compared to other treatments. We found that there was a statistically significant increase in survival of mice with orthotopic Renca tumor following intratumoral injection of CpG. However, we determined that the most effective route of delivery of CpG was intravenous, which led to further significantly enhanced survival of mice when combined with anti-CD137 intraperitoneally, likely due to inhibition of metastatic disease. Our data supports future development of this combination therapy for cancer.

  3. Methylated CpG dinucleotides are the preferential targets for G-to-T transversion mutations induced by benzo[a]pyrene diol epoxide in mammalian cells: similarities with the p53 mutation spectrum in smoking-associated lung cancers.

    PubMed

    Yoon, J H; Smith, L E; Feng, Z; Tang, M; Lee, C S; Pfeifer, G P

    2001-10-01

    A large fraction of the p53 mutations in lung cancers from smokers are G-to-T transversions, a type of mutation that is infrequent in lung cancers from nonsmokers and in most other tumors. Previous studies have indicated that there is an association between G-to-T transversion hotspots in lung cancers and sites of preferential formation of polycyclic aromatic hydrocarbon adducts along the p53 gene. p53 codons containing methylated CpG sequences are preferential targets for formation of adducts by (+/-) anti-7beta,8alpha-dihydroxy-9alpha,10alpha-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE). To assess the role of CpG methylation in induction of mutations by BPDE, we analyzed BPDE mutagenesis in three CpG methylated target genes: a supF shuttle vector and the cII and lacI transgenes in embryonic mouse fibroblasts. After methylation of the shuttle vector at all CpG sequences, 42% of all G-to-T transversions were at CpG sites compared with 23% in unmethylated DNA. In the cII transgene, which is methylated at CpG sequences in vivo, 83 of 147 (56%) of the BPDE-induced mutations were G-to-T transversions, and 58% (48 of 83) of all G-to-T transversions occurred at methylated CpG sequences. In the lacI gene, 68% (75 of 111) of the BPDE-induced mutations were G-to-T events, and 58 of 75 (77%) of these occurred at methylated CpG sequences. The occurrence of transversion hotspots at methylated CpGs correlated with high levels of BPDE adducts formed at such sites. This situation mirrors the one in the p53 gene in lung cancers from smokers where 236 of 465 (51%) of the G-to-T transversions occurred at methylated CpG sites. These findings further strengthen a link between polycyclic aromatic hydrocarbons present in cigarette smoke and lung cancer mutations and provide evidence that mutational processes other than C-to-T transition mutations can occur selectively at methylated CpG sequences.

  4. Cationic liposomes containing soluble Leishmania antigens (SLA) plus CpG ODNs induce protection against murine model of leishmaniasis.

    PubMed

    Heravi Shargh, Vahid; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jalali, Seyed Amir; Firouzmand, Hengameh; Abbasi, Azam; Badiee, Ali

    2012-07-01

    Development of an effective vaccine against leishmaniasis is possible due to the fact that individuals cured from cutaneous leishmaniasis (CL) are protected from further infection. First generation Leishmania vaccines consisting of whole killed parasites reached to phase 3 clinical trials but failed to show enough efficacies mainly due to the lack of an appropriate adjuvant. In this study, an efficient liposomal protein-based vaccine against Leishmania major infection was developed using soluble Leishmania antigens (SLA) as a first generation vaccine and cytidine phosphate guanosine oligodeoxynucleotides (CpG ODNs) as an immunostimulatory adjuvant. 1, 2-Dioleoyl-3-trimethylammonium-propane was used as a cationic lipid to prepare the liposomes due to its intrinsic adjuvanticity. BALB/c mice were immunized subcutaneously (SC), three times in 2-week intervals, with Lip-SLA-CpG, Lip-SLA, SLA + CpG, SLA, or HEPES buffer. As criteria for protection, footpad swelling at the site of challenge and spleen parasite loads were assessed, and the immune responses were evaluated by determination of IFN-γ and IL-4 levels of cultured splenocytes, and IgG subtypes. The group of mice that received Lip-SLA-CpG showed a significantly smaller footpad swelling, lower spleen parasite burden, higher IgG2a antibody, and lower IL-4 level compared to the control groups. It is concluded that cationic liposomes containing SLA and CpG ODNs are appropriate to induce Th1 type of immune response and protection against leishmaniasis.

  5. Methylation of avpr1a in the cortex of wild prairie voles: effects of CpG position and polymorphism

    PubMed Central

    Maguire, S. M.; Phelps, S. M.

    2017-01-01

    DNA methylation can cause stable changes in neuronal gene expression, but we know little about its role in individual differences in the wild. In this study, we focus on the vasopressin 1a receptor (avpr1a), a gene extensively implicated in vertebrate social behaviour, and explore natural variation in DNA methylation, genetic polymorphism and neuronal gene expression among 30 wild prairie voles (Microtus ochrogaster). Examination of CpG density across 8 kb of the locus revealed two distinct CpG islands overlapping promoter and first exon, characterized by few CpG polymorphisms. We used a targeted bisulfite sequencing approach to measure DNA methylation across approximately 3 kb of avpr1a in the retrosplenial cortex, a brain region implicated in male space use and sexual fidelity. We find dramatic variation in methylation across the avrp1a locus, with pronounced diversity near the exon–intron boundary and in a genetically variable putative enhancer within the intron. Among our wild voles, differences in cortical avpr1a expression correlate with DNA methylation in this putative enhancer, but not with the methylation status of the promoter. We also find an unusually high number of polymorphic CpG sites (polyCpGs) in this focal enhancer. One polyCpG within this enhancer (polyCpG 2170) may drive variation in expression either by disrupting transcription factor binding motifs or by changing local DNA methylation and chromatin silencing. Our results contradict some assumptions made within behavioural epigenetics, but are remarkably concordant with genome-wide studies of gene regulation. PMID:28280564

  6. Cultural inheritance as a mechanism for population sex-ratio bias in reptiles.

    PubMed

    Freedberg, S; Wade, M J

    2001-05-01

    Although natural populations of most species exhibit a 1:1 sex ratio, biased sex ratios are known to be associated with non-Mendelian inheritance, as in sex-linked meiotic drive and cytoplasmic inheritance (Charnov 1982; Hurst 1993). We show how cultural inheritance, another type of non-Mendelian inheritance, can favor skewed primary sex ratios and propose that it may explain the female-biased sex ratios commonly observed in reptiles with environmental sex determination (ESD). Like cytoplasmic elements, cultural traits can be inherited through one sex. This, in turn, favors skewing the primary sex allocation in favor of the transmitting sex. Female nest-site philopatry is a sex-specific, culturally inherited trait in many reptiles with ESD and highly female-biased sex ratios. We propose that the association of nest-site selection with ESD facilitates the maternal manipulation of offspring sex ratios toward females.

  7. Kin selection under blending inheritance.

    PubMed

    Gardner, Andy

    2011-09-07

    Why did Darwin fail to develop his insights on kin selection into a proper theory of social adaptation? One suggestion has been that his inadequate understanding of heredity kept the problem out of focus. Here, I determine whether it is possible to develop a quantitative theory of kin selection upon the assumption of blending inheritance. I find that, whilst Hamilton's rule of kin selection can be readily derived under the assumption of blending inheritance, this mechanism complicates the computation of relatedness coefficients, and can even cause them to fluctuate over generations. Nevertheless, I show that the ultimate criterion for selection to favour any social trait - i.e. a time-average of Hamilton's rule - remains the same as under particulate inheritance. By eliminating the gene from the theory of kin selection, I clarify the role that it plays in the theory of social adaptation.

  8. Imitation as an inheritance system

    PubMed Central

    Shea, Nicholas

    2009-01-01

    What is the evolutionary significance of the various mechanisms of imitation, emulation and social learning found in humans and other animals? This paper presents an advance in the theoretical resources for addressing that question, in the light of which standard approaches from the cultural evolution literature should be refocused. The central question is whether humans have an imitation-based inheritance system—a mechanism that has the evolutionary function of transmitting behavioural phenotypes reliably down the generations. To have the evolutionary power of an inheritance system, an imitiation-based mechanism must meet a range of demanding requirements. The paper goes on to review the evidence for and against the hypothesis that there is indeed an imitation-based inheritance system in humans. PMID:19620113

  9. HPV16 CpG methyl-haplotypes are associated with cervix precancer and cancer in the Guanacaste natural history study

    PubMed Central

    Frimer, Marina; Sun, Chang; McAndrew, Thomas; Smith, Benjamin; Harari, Ariana; Chen, Zigui; Mirabello, Lisa; Wentzensen, Nicolas; Goldberg, Gary L.; Rodriguez, Ana C.; Schiffman, Mark; Burk, Robert D.

    2016-01-01

    Objective To evaluate HPV16 CpG methylation and methyl-haplotypes and their association with cervix precancer and cancer utilizing massively parallel single molecule next-generation sequencing (NGS). Methods A nested case-control study of HPV16 positive women was performed in a prospective cohort from Guanacaste, Costa Rica designed to study the natural history of HPV and cervical neoplasia. Controls encompassed 31 women with transient infections; there were 44 cases, including 31 women with CIN3 and 13 with cervical cancer. DNA samples from exfoliated cervical cells were treated with bisulfite and four regions (E6, E2, L2 and L1) were amplified with barcoded primers and tested by NGS. CpG methylation was quantified using a bioinformatics pipeline. Results Median methylation levels were significantly different between the CIN3+ cases versus controls in the E2, L2, and L1 regions. Methyl-haplotypes, specifically in 5 CpG sites included in the targeted L2 region, with the pattern “−−+−+” had the highest Area Under the Curve value (AUC = 88.40%) observed for CIN3 vs. controls. The most significant CpG site, L2 4277, determined by bisulfite NGS had an AUC = 78.62%. Conclusions This study demonstrates that NGS of bisulfite treated HPV DNA is a useful and efficient technique to survey methylation patterns in HPV16. This procedure provides quantitative information on both individual CpG sites and methyl-haplotypes that identify women with elevated present or subsequent risk for HPV16 CIN3 and cancer. PMID:26001326

  10. NonO binds to the CpG island of oct4 promoter and functions as a transcriptional activator of oct4 gene expression.

    PubMed

    Park, Yoojin; Lee, Ja-Myong; Hwang, Min-Young; Son, Gi-hoon; Geum, Dongho

    2013-01-01

    We investigated the relationship between oct4 gene expression patterns and CpG sites methylation profiles during ES cell differentiation into neurons, and identified relevant binding factor. The oct4 gene expression level gradually declined as ES cell differentiation progressed, and the CpG sites in the oct4 proximal enhancer (PE) and promoter regions were methylated in concert with ES cell differentiation. An electro-mobility shift assay (EMSA) showed that putative proteins bind to CpG sites in the oct4 PE/promoter. We purified CpG binding proteins with DNAbinding purification method, and NonO was identified by liquid chromatography-mass spectrometry. EMSA with specific competitors revealed that NonO specifically binds to the conserved CCGGTGAC sequence in the oct4 promoter. Methylation at a specific cytosine residue (CC* GGTGAC) reduced the binding affinity of NonO for the recognition sequence. Chromatin immunoprecipitation analysis confirmed that NonO binds to the unmethylated oct4 promoter. There were no changes in the NonO mRNA and protein levels between ES cells and differentiated cells. The transcriptional role of NonO in oct4 gene expression was evaluated by luciferase assays and knockdown experiments. The luciferase activity significantly increased threefold when the NonO expression vector was cotransfected with the NonO recognition sequence, indicating that NonO has a transcription activator effect on oct4 gene expression. In accordance with this effect, when NonO expression was inhibited by siRNA treatment, oct4 expression was also significantly reduced. In summary, we purified NonO, a novel protein that binds to the CpG island of oct4 promoter, and positively regulates oct4 gene expression in ES cells.

  11. PGD for inherited cardiac diseases.

    PubMed

    Kuliev, Anver; Pomerantseva, Ekaterina; Polling, Dana; Verlinsky, Oleg; Rechitsky, Svetlana

    2012-04-01

    Preimplantation genetic diagnosis (PGD) has been applied for more than 200 different inherited conditions, with expanding application to common disorders with genetic predisposition. One of the recent indications for PGD has been inherited cardiac disease, for which no preclinical diagnosis and preventive management may exist and which may lead to premature or sudden death. This paper presents the first, as far as is known, cumulative experience of PGD for inherited cardiac diseases, including familial hypertrophic and dilated cardiomyopathy, cardioencephalomyopathy and Emery-Dreifuss muscular dystrophy. A total of 18 PGD cycles were performed, resulting in transfer in 15 of them, which yielded nine unaffected pregnancies and the births of seven disease- or disease predisposition-free children. The data open the prospect of PGD for inherited cardiac diseases, allowing couples carrying cardiac disease predisposing genes to reproduce without much fear of having offspring with these genes, which are at risk for premature or sudden death. Preimplantation genetic diagnosis (PGD) is currently an established clinical procedure in assisted reproduction and genetic practices. Its application has been expanding beyond traditional indications of prenatal diagnosis and currently includes common disorders with genetic predisposition, such as inherited forms of cancer. This applies also to the diseases with no current prospect of treatment, which may manifest despite presymptomatic diagnosis and follow up, when PGD may provide the only relief for the at-risk couples to reproduce. One of the recent indications for PGD has been inherited cardiac disease, for which no preclinical diagnosis and preventive management may exist and which may lead to premature or sudden death. We present here our first cumulative experience of PGD for inherited cardiac diseases, including familial hypertrophic and dilated cardiomyopathy, cardioencephalomyopathy and Emery-Dreifuss muscular dystrophy. A

  12. Isochores and CpG islands in YAC contigs in human Xq26. 1-qter

    SciTech Connect

    Pilia, G.; Little, R.D.; Schlessinger, D. ); Aiessani, B.; Bernardi, G. )

    1993-08-01

    GC levels were assessed at 37 loci across 30 Mb of Xq26.1-qter, a region physically mapped in overlapping yeast artificial chromosome clones. In 8 Mb of R band Xq26, GC is relatively high (up to 44T%) in the distal 4 Mb. Consistently low GC values (38-41%) are observed in G band Xq27. In contrast, further toward the telomere in Xq28, the GC level rises progressively to reach 52% at 2 to 4 Mb from the end of the chromosome; this region is delimited by low GC loci. Across these regions of Xq, the content of rare-cutter restriction enzyme sites containing CpG, including [open quotes]CpG islands[close quotes] in the most completely mapped Xq26-27.1 region, is correlated with GC level. Isochore mapping can thus provide one index of putative gene content across mapped regions. 43 refs., 5 figs.

  13. CD14 is not involved in the uptake of synthetic CpG oligonucleotides.

    PubMed

    Li, Jessica; Ahmet, Fatma; O'Keeffe, Meredith; Lahoud, Mireille H; Heath, William R; Caminschi, Irina

    2017-01-01

    We have previously shown that DEC205, a surface receptor expressed at high levels on CD8(+)DC, is able to capture synthetic CpG oligonucleotides (ODN) and is required for optimal responsiveness. However, even in the absence of DEC205, CD8(+)DC are able to respond to CpG ODN, albeit suboptimally. This suggested that additional receptors might contribute to the uptake of CpG ODN. CD14 represented an ideal candidate as it is expressed by DC and has been shown to bind and facilitate the uptake of CpG ODN. However, when CD14-deficient (CD14(-/-)) mice and normal B6 mice were injected with CpG ODN, CD8(+)DC were equivalently activated as assessed by the upregulation of the co-stimulatory molecules CD40 and CD80. Furthermore, the level of serum IL-6 and IL-12 produced in response to CpG ODN was comparable in CD14(-/-) and B6 mice. Importantly, mice deficient in both DEC205 and CD14 had comparable responses to mice lacking DEC205 alone, both in terms of cytokine production and DC activation, arguing that CD14 did not contribute to responses to CpG ODN. For CD14 to act as an uptake receptor for CpG ODN, it must first capture CpG ODN. To this end we assessed the capacity of cell surface CD14 to bind CpG ODN. Although we unequivocally confirmed that CD14 is required for the binding of its known ligand LPS, CD14 was not required for binding or responses to A-, B-, and C- Class CpG ODN. Our studies dispute the claim that CD14 is involved in CpG ODN capture.

  14. Enhancement of the Anthrax AVA Vaccine with CpG ODN’s

    DTIC Science & Technology

    2005-08-28

    NUMBER OF PAGES 20. LIMITATION OF ABSTRACT UL - 28-Aug-2005 Final Report on ACCELERATE ANTHRAX: CpG 7909 Vaccine Adjuvant Program Report Title...Vaccine Adsorbed (BioThrax?) Combined with CPG 7909 in Normal Volunteers” was completed and presented at the 2005 Interscience Conference on Antimicrobial...Agents and Chemotherapy in a poster entitled “Marked Enhancement Of Antibody Response To Anthrax Vaccine Adsorbed With CPG 7909 In Healthy

  15. Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures.

    PubMed

    Upadhyay, Mohita; Vivekanandan, Perumal

    2015-01-01

    Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the evolutionary lineage of the infected host. Our

  16. Depletion of CpG Dinucleotides in Papillomaviruses and Polyomaviruses: A Role for Divergent Evolutionary Pressures

    PubMed Central

    Upadhyay, Mohita; Vivekanandan, Perumal

    2015-01-01

    Background Papillomaviruses and polyomaviruses are small ds-DNA viruses infecting a wide-range of vertebrate hosts. Evidence supporting co-evolution of the virus with the host does not fully explain the evolutionary path of papillomaviruses and polyomaviruses. Studies analyzing CpG dinucleotide frequencies in virus genomes have provided interesting insights on virus evolution. CpG dinucleotide depletion has not been extensively studied among papillomaviruses and polyomaviruses. We sought to analyze the relative abundance of dinucleotides and the relative roles of evolutionary pressures in papillomaviruses and polyomaviruses. Methods We studied 127 full-length sequences from papillomaviruses and 56 full-length sequences from polyomaviruses. We analyzed the relative abundance of dinucleotides, effective codon number (ENC), differences in synonymous codon usage. We examined the association, if any, between the extent of CpG dinucleotide depletion and the evolutionary lineage of the infected host. We also investigated the contribution of mutational pressure and translational selection to the evolution of papillomaviruses and polyomaviruses. Results All papillomaviruses and polyomaviruses are CpG depleted. Interestingly, the evolutionary lineage of the infected host determines the extent of CpG depletion among papillomaviruses and polyomaviruses. CpG dinucleotide depletion was more pronounced among papillomaviruses and polyomaviruses infecting human and other mammals as compared to those infecting birds. Our findings demonstrate that CpG depletion among papillomaviruses is linked to mutational pressure; while CpG depletion among polyomaviruses is linked to translational selection. We also present evidence that suggests methylation of CpG dinucleotides may explain, at least in part, the depletion of CpG dinucleotides among papillomaviruses but not polyomaviruses. Conclusions The extent of CpG depletion among papillomaviruses and polyomaviruses is linked to the

  17. Nicotine induced CpG methylation of Pax6 binding motif in StAR promoter reduces the gene expression and cortisol production

    SciTech Connect

    Wang, Tingting; Chen, Man; Liu, Lian; Cheng, Huaiyan; Yan, You-E; Feng, Ying-Hong; Wang, Hui

    2011-12-15

    Steroidogenic acute regulatory protein (StAR) mediates the rate-limiting step in the synthesis of steroid hormones, essential to fetal development. We have reported that the StAR expression in fetal adrenal is inhibited in a rat model of nicotine-induced intrauterine growth retardation (IUGR). Here using primary human fetal adrenal cortex (pHFAC) cells and a human fetal adrenal cell line NCI-H295A, we show that nicotine inhibits StAR expression and cortisol production in a dose- and time-dependent manner, and prolongs the inhibitory effect on cells proliferating over 5 passages after termination of nicotine treatment. Methylation detection within the StAR promoter region uncovers a single site CpG methylation at nt -377 that is sensitive to nicotine treatment. Nicotine-induced alterations in frequency of this point methylation correlates well with the levels of StAR expression, suggesting an important role of the single site in regulating StAR expression. Further studies using bioinformatics analysis and siRNA approach reveal that the single CpG site is part of the Pax6 binding motif (CGCCTGA) in the StAR promoter. The luciferase activity assays validate that Pax6 increases StAR gene expression by binding to the glucagon G3-like motif (CGCCTGA) and methylation of this site blocks Pax6 binding and thus suppresses StAR expression. These data identify a nicotine-sensitive CpG site at the Pax6 binding motif in the StAR promoter that may play a central role in regulating StAR expression. The results suggest an epigenetic mechanism that may explain how nicotine contributes to onset of adult diseases or disorders such as metabolic syndrome via fetal programming. -- Highlights: Black-Right-Pointing-Pointer Nicotine-induced StAR inhibition in two human adrenal cell models. Black-Right-Pointing-Pointer Nicotine-induced single CpG site methylation in StAR promoter. Black-Right-Pointing-Pointer Persistent StAR inhibition and single CpG methylation after nicotine termination

  18. Transgenerational inheritance of metabolic disease.

    PubMed

    Stegemann, Rachel; Buchner, David A

    2015-07-01

    Metabolic disease encompasses several disorders including obesity, type 2 diabetes, and dyslipidemia. Recently, the incidence of metabolic disease has drastically increased, driven primarily by a worldwide obesity epidemic. Transgenerational inheritance remains controversial, but has been proposed to contribute to human metabolic disease risk based on a growing number of proof-of-principle studies in model organisms ranging from Caenorhabditis elegans to Mus musculus to Sus scrofa. Collectively, these studies demonstrate that heritable risk is epigenetically transmitted from parent to offspring over multiple generations in the absence of a continued exposure to the triggering stimuli. A diverse assortment of initial triggers can induce transgenerational inheritance including high-fat or high-sugar diets, low-protein diets, various toxins, and ancestral genetic variants. Although the mechanistic basis underlying the transgenerational inheritance of disease risk remains largely unknown, putative molecules mediating transmission include small RNAs, histone modifications, and DNA methylation. Due to the considerable impact of metabolic disease on human health, it is critical to better understand the role of transgenerational inheritance of metabolic disease risk to open new avenues for therapeutic intervention and improve upon the current methods for clinical diagnoses and treatment.

  19. Transgenerational epigenetic inheritance in plants.

    PubMed

    Hauser, Marie-Theres; Aufsatz, Werner; Jonak, Claudia; Luschnig, Christian

    2011-08-01

    Interest in transgenerational epigenetic inheritance has intensified with the boosting of knowledge on epigenetic mechanisms regulating gene expression during development and in response to internal and external signals such as biotic and abiotic stresses. Starting with an historical background of scantily documented anecdotes and their consequences, we recapitulate the information gathered during the last 60 years on naturally occurring and induced epialleles and paramutations in plants. We present the major players of epigenetic regulation and their importance in controlling stress responses. The effect of diverse stressors on the epigenetic status and its transgenerational inheritance is summarized from a mechanistic viewpoint. The consequences of transgenerational epigenetic inheritance are presented, focusing on the knowledge about its stability, and in relation to genetically fixed mutations, recombination, and genomic rearrangement. We conclude with an outlook on the importance of transgenerational inheritance for adaptation to changing environments and for practical applications. This article is part of a Special Issue entitled "Epigenetic control of cellular and developmental processes in plants".

  20. Transgenerational Inheritance of Metabolic Disease

    PubMed Central

    Stegemann, Rachel; Buchner, David A.

    2015-01-01

    Metabolic disease encompasses several disorders including obesity, type 2 diabetes, and dyslipidemia. Recently, the incidence of metabolic disease has drastically increased, driven primarily by a worldwide obesity epidemic. Transgenerational inheritance remains controversial, but has been proposed to contribute to human metabolic disease risk based on a growing number of proof-of-principle studies in model organisms ranging from C. elegans to M. musculus to S. scrofa. Collectively, these studies demonstrate that heritable risk is epigenetically transmitted from parent to offspring over multiple generations in the absence of a continued exposure to the triggering stimuli. A diverse assortment of initial triggers can induce transgenerational inheritance including high-fat or high-sugar diets, low-protein diets, various toxins, and ancestral genetic variants. Although the mechanistic basis underlying the transgenerational inheritance of disease risk remains largely unknown, putative molecules mediating transmission include small RNAs, histone modifications, and DNA methylation. Due to the considerable impact of metabolic disease on human health, it is critical to better understand the role of transgenerational inheritance of metabolic disease risk to open new avenues for therapeutic intervention and improve upon the current methods for clinical diagnoses and treatment. PMID:25937492

  1. Transgenerational epigenetic inheritance in plants☆

    PubMed Central

    Hauser, Marie-Theres; Aufsatz, Werner; Jonak, Claudia; Luschnig, Christian

    2015-01-01

    Interest in transgenerational epigenetic inheritance has intensified with the boosting of knowledge on epigenetic mechanisms regulating gene expression during development and in response to internal and external signals such as biotic and abiotic stresses. Starting with an historical background of scantily documented anecdotes and their consequences, we recapitulate the information gathered during the last 60 years on naturally occurring and induced epialleles and paramutations in plants. We present the major players of epigenetic regulation and their importance in controlling stress responses. The effect of diverse stressors on the epigenetic status and its transgenerational inheritance is summarized from a mechanistic viewpoint. The consequences of transgenerational epigenetic inheritance are presented, focusing on the knowledge about its stability, and in relation to genetically fixed mutations, recombination, and genomic rearrangement. We conclude with an outlook on the importance of transgenerational inheritance for adaptation to changing environments and for practical applications. This article is part of a Special Issue entitled “Epigenetic control of cellular and developmental processes in plants”. PMID:21515434

  2. Inherited or acquired metabolic disorders.

    PubMed

    Eichler, Florian; Ratai, Eva; Carroll, Jason J; Masdeu, Joseph C

    2016-01-01

    This chapter starts with a description of imaging of inherited metabolic disorders, followed by a discussion on imaging of acquired toxic-metabolic disorders of the adult brain. Neuroimaging is crucial for the diagnosis and management of a number of inherited metabolic disorders. Among these, inherited white-matter disorders commonly affect both the nervous system and endocrine organs. Magnetic resonance imaging (MRI) has enabled new classifications of these disorders that have greatly enhanced both our diagnostic ability and our understanding of these complex disorders. Beyond the classic leukodystrophies, we are increasingly recognizing new hereditary leukoencephalopathies such as the hypomyelinating disorders. Conventional imaging can be unrevealing in some metabolic disorders, but proton magnetic resonance spectroscopy (MRS) may be able to directly visualize the metabolic abnormality in certain disorders. Hence, neuroimaging can enhance our understanding of pathogenesis, even in the absence of a pathologic specimen. This review aims to present pathognomonic brain MRI lesion patterns, the diagnostic capacity of proton MRS, and information from clinical and laboratory testing that can aid diagnosis. We demonstrate that applying an advanced neuroimaging approach enhances current diagnostics and management. Additional information on inherited and metabolic disorders of the brain can be found in Chapter 63 in the second volume of this series.

  3. Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer.

    PubMed

    Scheiermann, Julia; Klinman, Dennis M

    2014-11-12

    Synthetic oligonucleotides (ODN) that express unmethylated "CpG motifs" trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer.

  4. CpG and TpA frequencies in the plant system.

    PubMed Central

    Boudraa, M; Perrin, P

    1987-01-01

    Higher plant nuclear sequences reveal avoidance of CpG and TpA doublets. Chloroplast sequences avoid the TpA doublet in all codon positions. The chloroplast genome is not methylated but codon positions II-III and untranslated regions avoid CpG. The mitochondrial genome, also unmethylated, avoids CpG in all codon positions. We therefore deduce that methylation is not sufficient to explain CpG avoidance in the higher plant systems. Other factors must be taken into account such as amino acid composition, codon choices and perhaps stability of the DNA helix. PMID:3497385

  5. Tissue-specific methylation of individual CpG dinucleotides in the 5{prime} upstream region of the mouse catalase gene (Cas-1)

    SciTech Connect

    Pillay, I.L.; Singh, S.M.

    1994-09-01

    The intracellular antioxidant enzyme, catalase, is encoded by a gene whose level of expression in different organisms, including humans, varies with tissue-type. The {open_quotes}TATA-less{close_quotes} 5{prime} upstream region of the catalase gene, in mice and humans, contains a CpG island. Such CG-rich regions are target sites for cytosine methylation and have been implicated in tissue-specific gene expression. However, the methylation status of individual CpG dinucleotides and their significance in gene expression has not been established. A 275 bp fragment within the 5{prime} region of Cas-1 was evaluated for CpG methylation. HpaII digestion of genomic DNA, followed by polymerase chain reaction amplification (HpaII-PCR), suggests that at least one of three CCGG is not methylated in nine different somatic tissues that express this enzyme at various levels. In contrast, all three CCGG sites are methylated in DNA from sperm and spleen. Further examination of the methylation specificity of individual CCGG sites was conducted using sodium bisulfite modification of genomic DNA followed by HPaII-PCR. Sodium bisulfite modifies non-methylated cytosines to uracils, changing a CG to a TG dinucleotide. This nucleotide substitution eliminates HpaII sites and allows the methylation status of each of the CCGG sites to be assessed. The ability to discern the number and combination of methylated sites within the 5{prime} region of a gene permits the determination of a possible correlation between differential methylation patterns and temporal/spatial gene regulation. Analysis of differential methylation, using the mouse catalase gene as a model, provides further insight into CpG methylation as one mechanism of mammalian gene regulation.

  6. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians.

    PubMed

    Marsh, Adam G; Hoadley, Kenneth D; Warner, Mark E

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in

  7. Distribution of CpG Motifs in Upstream Gene Domains in a Reef Coral and Sea Anemone: Implications for Epigenetics in Cnidarians

    PubMed Central

    Marsh, Adam G.; Hoadley, Kenneth D.; Warner, Mark E.

    2016-01-01

    Coral reefs are under assault from stressors including global warming, ocean acidification, and urbanization. Knowing how these factors impact the future fate of reefs requires delineating stress responses across ecological, organismal and cellular scales. Recent advances in coral reef biology have integrated molecular processes with ecological fitness and have identified putative suites of temperature acclimation genes in a Scleractinian coral Acropora hyacinthus. We wondered what unique characteristics of these genes determined their coordinate expression in response to temperature acclimation, and whether or not other corals and cnidarians would likewise possess these features. Here, we focus on cytosine methylation as an epigenetic DNA modification that is responsive to environmental stressors. We identify common conserved patterns of cytosine-guanosine dinucleotide (CpG) motif frequencies in upstream promoter domains of different functional gene groups in two cnidarian genomes: a coral (Acropora digitifera) and an anemone (Nematostella vectensis). Our analyses show that CpG motif frequencies are prominent in the promoter domains of functional genes associated with environmental adaptation, particularly those identified in A. hyacinthus. Densities of CpG sites in upstream promoter domains near the transcriptional start site (TSS) are 1.38x higher than genomic background levels upstream of -2000 bp from the TSS. The increase in CpG usage suggests selection to allow for DNA methylation events to occur more frequently within 1 kb of the TSS. In addition, observed shifts in CpG densities among functional groups of genes suggests a potential role for epigenetic DNA methylation within promoter domains to impact functional gene expression responses in A. digitifera and N. vectensis. Identifying promoter epigenetic sequence motifs among genes within specific functional groups establishes an approach to describe integrated cellular responses to environmental stress in

  8. Prognostication of patients with clear cell renal cell carcinomas based on quantification of DNA methylation levels of CpG island methylator phenotype marker genes.

    PubMed

    Tian, Ying; Arai, Eri; Gotoh, Masahiro; Komiyama, Motokiyo; Fujimoto, Hiroyuki; Kanai, Yae

    2014-10-20

    The CpG island methylator phenotype (CIMP) of clear cell renal cell carcinomas (ccRCCs) is characterized by accumulation of DNA methylation at CpG islands and poorer patient outcome. The aim of this study was to establish criteria for prognostication of patients with ccRCCs using the ccRCC-specific CIMP marker genes. DNA methylation levels at 299 CpG sites in the 14 CIMP marker genes were evaluated quantitatively in tissue specimens of 88 CIMP-negative and 14 CIMP-positive ccRCCs in a learning cohort using the MassARRAY system. An additional 100 ccRCCs were also analyzed as a validation cohort. Receiver operating characteristic curve analysis showed that area under the curve values for the 23 CpG units including the 32 CpG sites in the 7 CIMP-marker genes, i.e. FAM150A, ZNF540, ZNF671, ZNF154, PRAC, TRH and SLC13A5, for discrimination of CIMP-positive from CIMP-negative ccRCCs were larger than 0.95. Criteria combining the 23 CpG units discriminated CIMP-positive from CIMP-negative ccRCCs with 100% sensitivity and specificity in the learning cohort. Cancer-free and overall survival rates of patients with CIMP-positive ccRCCs diagnosed using the criteria combining the 23 CpG units in a validation cohort were significantly lower than those of patients with CIMP-negative ccRCCs (P = 1.41 × 10-5 and 2.43 × 10-13, respectively). Patients with CIMP-positive ccRCCs in the validation cohort had a higher likelihood of disease-related death (hazard ratio, 75.8; 95% confidence interval, 7.81 to 735; P = 1.89 × 10-4) than those with CIMP-negative ccRCCs. The established criteria are able to reproducibly diagnose CIMP-positive ccRCCs and may be useful for personalized medicine for patients with ccRCCs.

  9. Epigenetic inheritance in rice plants.

    PubMed

    Akimoto, Keiko; Katakami, Hatsue; Kim, Hyun-Jung; Ogawa, Emiko; Sano, Cecile M; Wada, Yuko; Sano, Hiroshi

    2007-08-01

    Epigenetics is defined as mechanisms that regulate gene expression without base sequence alteration. One molecular basis is considered to be DNA cytosine methylation, which reversibly modifies DNA or chromatin structures. Although its correlation with epigenetic inheritance over generations has been circumstantially shown, evidence at the gene level has been limited. The present study aims to find genes whose methylation status directly correlates with inheritance of phenotypic changes. DNA methylation in vivo was artificially reduced by treating rice (Oryza sativa ssp. japonica) seeds with 5-azadeoxycytidine, and the progeny were cultivated in the field for > 10 years. Genomic regions with changed methylation status were screened by the methylation-sensitive amplified polymorphysm (MSAP) method, and cytosine methylation was directly scanned by the bisulfite mapping method. Pathogen infection with Xanthomonas oryzae pv. oryzae, race PR2 was performed by the scissors-dip method on mature leaf blades. The majority of seedlings were lethal, but some survived to maturity. One line designated as Line-2 showed a clear marker phenotype of dwarfism, which was stably inherited by the progeny over nine generations. MSAP screening identified six fragments, among which two were further characterized by DNA blot hybridization and direct methylation mapping. One clone encoding a retrotransposon gag-pol polyprotein showed a complete erasure of 5-methylcytosines in Line-2, but neither translocation nor expression of this region was detectable. The other clone encoded an Xa21-like protein, Xa21G. In wild-type plants, all cytosines were methylated within the promoter region, whereas in Line-2, corresponding methylation was completely erased throughout generations. Expression of Xa21G was not detectable in wild type but was constitutive in Line-2. When infected with X. oryzae pv. oryzae, against which Xa21 confers resistance in a gene-for-gene manner, the progeny of Line-2 were

  10. CpG islands of hepatitis B virus genome isolated from Chinese patients.

    PubMed

    Hou, Zhiwei; Huang, Jihua; Zhong, Chengyao; Li, Lianbing; Xie, Qingdong; Ma, Mingfu; Han, Tingting; Wang, Degang; Maldonado, Martin; Xu, Lan; Huang, Tianhua; Zhong, Ying

    2015-05-01

    There are differences in the distribution and length of HBV CpG islands and the viral mutations contribute greatly to the development of HBV-related diseases. However, little is known regarding the effects of such difference and mutations in HBV genotypes B and C sequences on the regulation of HBV gene expression and their clinical outcomes. To study the distribution, length and genetic trait of CpG islands in normal and mutant sequences of HBV genotypes B and C, 320 HBV isolates from Chinese patients were retrieved from GenBank. Programs CLUSTALX 1.83 and MethPrimer were employed to perform multiple sequence alignments and to predict CpG islands, respectively. 72.0% genotype B isolates contained three conventional CpG islands, and 76.1% genotype C only contained CpG islands II and III. 14.6% genotype B and 7.5% genotype C contained three novel CpG islands. In genotype B, lengths of conventional CpG islands between normal and mutant isolates exhibited substantial variations, but in genotype C, those were relatively stable. CpG island II could be "truncated" or "split". "Truncated" region mutations were associated with structural and functional abnormalities of HBV genes. Rate of "split" CpG island II in genotype B was much higher than that in genotype C. In the majority of isolates from HCC and HBV-ACLF, genotype C lacked CpG island I and novel islands. Distribution, length and genetic trait of CpG islands in HBV genotypes B and C might affect their methylation status, and further affect regulation of HBV gene expression, leading to different clinical outcomes.

  11. Divergent therapeutic and immunologic effects of oligodeoxynucleotides with distinct CpG motifs.

    PubMed

    Ballas, Z K; Krieg, A M; Warren, T; Rasmussen, W; Davis, H L; Waldschmidt, M; Weiner, G J

    2001-11-01

    Immune stimulatory oligodeoxynucleotides (ODN) with unmethylated CpG motifs are potent inducers of both innate and adaptive immunity. It initially appeared that a single type of optimal CpG motif would work in all applications. We now report that specific motifs of CpG ODN can vary dramatically in their ability to induce individual immune effects and that these differences impact on their antitumor activity in different tumor models. In particular, a distinct type of CpG motif, which has a chimeric backbone in combination with poly(G) tails, is a potent inducer of NK lytic activity but has little effect on cytokine secretion or B cell proliferation. One such NK-optimized CpG ODN (1585) can induce regression of established melanomas in mice. Surprisingly, no such therapeutic effects were seen with CpG ODN optimized for activation of B cells and Th1-like cytokine expression (ODN 1826). The therapeutic effects of CpG 1585 in melanoma required the presence of NK but not T or B cells and were not associated with the induction of a tumor-specific memory response. In contrast, CpG 1826, but not CpG 1585, was effective at inducing regression of the EL4 murine lymphoma; this rejection was associated with the induction of a memory response and although NK cells were necessary, they were not sufficient. These results demonstrate that selection of optimal CpG ODN for cancer immunotherapy depends upon a careful analysis of the cellular specificities of various CpG motifs and an understanding of the cellular mechanisms responsible for the antitumor activity in a particular tumor.

  12. DNA methylation analysis using CpG microarrays is impaired in benzopyrene exposed cells

    SciTech Connect

    Sadikovic, Bekim; Andrews, Joseph; Rodenhiser, David I.

    2007-12-15

    Epigenetic alterations have emerged as a key mechanism involved in tumorigenesis. These disruptions are partly due to environmental factors that change normal DNA methylation patterns necessary for transcriptional regulation and chromatin compaction. Microarray technologies are allowing environmentally susceptible epigenetic patterns to be mapped and the precise targets of environmentally induced alterations to be identified. Previously, we observed BaP-induced epigenetic events and cell cycle disruptions in breast cancer cell lines that included time- and concentration-dependent loss of proliferation as well as sequence-specific hypo- and hypermethylation events. In this present report, we further characterized epigenetic changes in BaP-exposed MCF-7 cells. We analyzed DNA methylation on a CpG island microarray platform with over 5400 unique genomic regions. Depleted and enriched microarray targets, representative of putative DNA methylation changes, were identified across the genome; however, subsequent sodium bisulfite analyses revealed no changes in DNA methylation at a number of these loci. Instead, we found that the identification of DNA methylation changes using this restriction enzyme-based microarray approach corresponded with the regions of DNA bound by the BaP derived DNA adducts. This DNA adduct formation occurs at both methylated and unmethylated CpG dinucleotides and affects PCR amplification during sample preparation. Our data suggest that caution should be exercised when interpreting data from comparative microarray experiments that rely on enzymatic reactions. These results are relevant to genome screening approaches involving environmental exposures in which DNA adduct formation at specific nucleotide sites may bias target acquisition and compromise the correct identification of epigenetically responsive genes.

  13. Detection and discrimination of maintenance and de novo CpG methylation events using MethylBreak.

    PubMed

    Hsu, William; Mercado, Augustus T; Hsiao, George; Yeh, Jui-Ming; Chen, Chung-Yung

    2017-05-15

    Understanding the principles governing the establishment and maintenance activities of DNA methyltransferases (DNMTs) can help in the development of predictive biomarkers associated with genetic disorders and diseases. A detection system was developed that distinguishes and quantifies methylation events using methylation-sensitive endonucleases and molecular beacon technology. MethylBreak (MB) is a 22-mer oligonucleotide with one hemimethylated and two unmethylated CpG sites, which are also recognition sites for Sau96I and SacII, and is attached to a fluorophore and a quencher. Maintenance methylation was quantified by fluorescence emission due to the digestion of SacII when the hemimethylated CpG site is methylated, which inhibits Sau96I cleavage. The signal difference between SacII digestion of both MB substrate and maintenance methylated MB corresponds to de novo methylation event. Our technology successfully discriminated and measured both methylation activities at different concentrations of MB and achieved a high correlation coefficient of R(2)=0.997. Additionally, MB was effectively applied to normal and cancer cell lines and in the analysis of enzymatic kinetics and RNA inhibition of recombinant human DNMT1. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. CpG dinucleotide positioning patterns determine the binding affinity of methyl-binding domain to nucleosomes.

    PubMed

    Mendonca, Agnes; Sanchez, Oscar F; Liu, Wenjie; Li, Zhe; Yuan, Chongli

    2017-06-01

    The methyl-binding domain of MBD1 is a common methyl CpG binding motif and has been linked to transcriptional repression. Understanding the dynamics of MBD1 binding to nucleosomal DNA is crucial, but the molecular interactions between MBD1 and chromatin remain elusive. In this study, we found the binding of MBD1 to nucleosomes demonstrates sequence preferences depending on the position of the methyl groups on the nucleosome. Specifically, binding was favored at (me)CpG sites in the dyad proximal region and facing towards the histone octamers. At locations where the (me)CpG sites face away from the histone octamer, the binding affinity was significantly lower. Interestingly, the binding of ΔMBD1 at methylated CpG sites facing away from histone octamers induces conformational changes of nucleosomes, resulting in a more "open" conformation. The biological implication of DNA methylation is thus likely to be synergistically regulated via DNA sequences contents and their nucleosome-positioning patterns based on our in vitro findings. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. In silico prediction of two classes of honeybee genes with CpG deficiency or CpG enrichment and sorting according to gene ontology classes.

    PubMed

    Wang, Yong; Leung, Frederick C C

    2009-06-01

    Two honeybee DNA methyltransferase genes have recently been identified and confirmed to be functional. The honeybee genes under regulation by DNA methylation may therefore be CpG deficient, due to natural deamination of methylated DNA. In this report, we show that <39% of the known honeybee genes are likely to be methylated on the basis of their low CpG obs/exp ratios. In contrast, orthologues of these genes in the fruitfly do not show CpG deficiency. Classes of function as determined by Gene Ontology were obtained for the honeybee genes with significantly low and high CpG obs/exp ratios. Overrepresented classes in the low CpG[obs/exp] genes are involved in transcription, translation, protein folding, protein localization, protein transportation, cell cycle, and DNA and RNA metabolism.

  16. Systemic delivery of chTNT-3/CpG immunoconjugates for immunotherapy in murine solid tumor models.

    PubMed

    Jang, Julie K; Khawli, Leslie A; Canter, David C; Hu, Peisheng; Zhu, Tian H; Wu, Brian W; Angell, Trevor E; Li, Zhongjun; Epstein, Alan L

    2016-05-01

    CpG oligodeoxynucleotides (CpG) potently activate the immune system by mimicking microbial DNA. Conjugation of CpG to chTNT-3, an antibody targeting the necrotic centers of tumors, enabled CpG to accumulate in tumors after systemic delivery, where it can activate the immune system in the presence of tumor antigens. CpG chemically conjugated to chTNT-3 (chTNT-3/CpG) were compared to free CpG in their ability to stimulate the immune system in vitro and reduce tumor burden in vivo. In subcutaneous Colon 26 adenocarcinoma and B16-F10 melanoma models in BALB/c and C57BL/6 mice, respectively, chTNT-3/CpG, free CpG, or several different control constructs were administered systemically. Intraperitoneal injections of chTNT-3/CpG delayed tumor growth and improved survival and were comparable to intratumorally administered CpG. Compared to saline-treated mice, chTNT-3/CpG-treated mice had smaller average tumor volumes by as much as 72% in Colon 26-bearing mice and 79% in B16-bearing mice. Systemically delivered free CpG and CpG conjugated to an isotype control antibody did not reduce tumor burden or improve survival. In this study, chTNT-3/CpG retained immunostimulatory activity of the CpG moiety and enabled delivery to tumors. Because systemically administered CpG rapidly clear the body and do not accumulate into tumors, chTNT-3/CpG provide a solution to the limitations observed in preclinical and clinical trials.

  17. Epigenetic Inheritance across the Landscape

    PubMed Central

    Whipple, Amy V.; Holeski, Liza M.

    2016-01-01

    The study of epigenomic variation at the landscape-level in plants may add important insight to studies of adaptive variation. A major goal of landscape genomic studies is to identify genomic regions contributing to adaptive variation across the landscape. Heritable variation in epigenetic marks, resulting in transgenerational plasticity, can influence fitness-related traits. Epigenetic marks are influenced by the genome, the environment, and their interaction, and can be inherited independently of the genome. Thus, epigenomic variation likely influences the heritability of many adaptive traits, but the extent of this influence remains largely unknown. Here, we summarize the relevance of epigenetic inheritance to ecological and evolutionary processes, and review the literature on landscape-level patterns of epigenetic variation. Landscape-level patterns of epigenomic variation in plants generally show greater levels of isolation by distance and isolation by environment then is found for the genome, but the causes of these patterns are not yet clear. Linkage between the environment and epigenomic variation has been clearly shown within a single generation, but demonstrating transgenerational inheritance requires more complex breeding and/or experimental designs. Transgenerational epigenetic variation may alter the interpretation of landscape genomic studies that rely upon phenotypic analyses, but should have less influence on landscape genomic approaches that rely upon outlier analyses or genome–environment associations. We suggest that multi-generation common garden experiments conducted across multiple environments will allow researchers to understand which parts of the epigenome are inherited, as well as to parse out the relative contribution of heritable epigenetic variation to the phenotype. PMID:27826318

  18. CpG ODN mimicking CpG rich region of myxosporean Myxobolus supamattayai stimulates innate immunity in Asian sea bass (Lates calcarifer) and defense against Streptococcus iniae.

    PubMed

    U-Taynapun, Kittichon; Chirapongsatonkul, Nion; Itami, Toshiaki; Tantikitti, Chutima

    2016-11-01

    Oligodeoxynucleotides (ODNs) containing unmethylated cytosine-phosphate-guanine CpG dinucleotides within specific sequence contexts (CpG motifs) have been reported as pathogen-associated molecular patterns (PAMPs). Its immunostimulatory effects have been demonstrated in diverse vertebrate models. CpG ODN is typically found in bacterial or viral genome and recognized by a non-self recognition receptor Toll-like receptor9 (TLR9). Here, a new CpG ODN 1013 which mimics sequence of SSU rDNA of early eukaryotic organism myxosporidia, Myxobolus supamattayai, was employed to stimulate the immune responses of Asian sea bass Lates calcarifer. Its immunostimulant potentiality was comparatively compared with that of CpG ODN 1668, a widely used as functional immunostimulant. Both unmethylated CpG ODNs with some modified phosphorothioated positions were intraperitoneally injection (5 μg/fish). Hematological examination, immunological assays and immune-related genes expression were evaluated 12 h, 1, 3 and 5 d after post CpG ODN challenge. The immunosimulatory effect of these CpG ODNs on fish immunity to protect the bacterial pathogen Streptococcus iniae was also determined. The results demonstrated that these two CpG ODNs could induce immune responses in Asian sea bass including the significant (P < 0.05) increase level of WBC, peroxidase activity and oxidative radicals in head kidney (HK) leukocyte, serum innate immune parameters and up-regulation of four immune responsive genes compared with the control group. Most of immune responses induced by ODN 1668 were strong within 1 d but lesser extended while ODN 1013 prolonged the stimulatory effects during the whole experimental period. After challenge with S. iniae, the survival proportion in ODN 1013-treated fish was apparently higher than that treated with ODN 1668 and PBS, respectively. The results together suggested that CpG ODN 1013 enhanced innate immune responses, including humoral and cellular responses, through

  19. 5'-Hydroxymethylcytosine Precedes Loss of CpG Methylation in Enhancers and Genes Undergoing Activation in Cardiomyocyte Maturation.

    PubMed

    Kranzhöfer, David K; Gilsbach, Ralf; Grüning, Björn A; Backofen, Rolf; Nührenberg, Thomas G; Hein, Lutz

    2016-01-01

    Cardiomyocytes undergo major changes in DNA methylation during maturation and transition to a non-proliferative state after birth. 5'-hydroxylation of methylated cytosines (5hmC) is not only involved in DNA loss of CpG methylation but is also thought to be an epigenetic mark with unique distribution and functions. Here, we sought to get insight into the dynamics of 5'-hydroxymethylcytosine in newborn and adult cardiomyocytes. Cardiomyocyte nuclei from newborn and adult C57BL/6 mice were purified by flow cytometric sorting. 5hmC-containing DNA was captured by selective chemical labeling, followed by deep sequencing. Sequencing reads of library replicates were mapped independently (n = 3 for newborn, n = 2 for adult mice) and merged for further analysis steps. 5hmC coverage was normalized to read length and the total number of mapped reads (RPKM). MethylC-Seq, ChIP-Seq and RNA-Seq data sets of newborn and adult cardiomyocytes served to elucidate specific features of 5hmC at gene bodies and around low methylated regions (LMRs) representing regulatory genomic regions with enhancer function. 163,544 and 315,220 5hmC peaks were identified in P1 and adult cardiomyocytes, respectively. Of these peaks, 66,641 were common between P1 and adult cardiomyocytes with more than 50% reciprocal overlap. P1 and adult 5hmC peaks were overrepresented in genic features such as exons, introns, 3'- and 5'-untranslated regions (UTRs), promotors and transcription end sites (TES). During cardiomyocyte maturation, 5hmC was found to be enriched at sites of subsequent DNA loss of CpG methylation such as gene bodies of upregulated genes (i.e. Atp2a2, Tnni3, Mb, Pdk4). Additionally, centers of postnatally established enhancers were premarked by 5hmC before DNA loss of CpG methylation. Simultaneous analysis of 5hmC-Seq, MethylC-Seq, RNA-Seq and ChIP-Seq data at two defined time points of cardiomyocyte maturation demonstrates that 5hmC is positively associated with gene expression and decorates

  20. 5'-Hydroxymethylcytosine Precedes Loss of CpG Methylation in Enhancers and Genes Undergoing Activation in Cardiomyocyte Maturation

    PubMed Central

    Kranzhöfer, David K.; Gilsbach, Ralf; Grüning, Björn A.; Backofen, Rolf; Nührenberg, Thomas G.; Hein, Lutz

    2016-01-01

    Background Cardiomyocytes undergo major changes in DNA methylation during maturation and transition to a non-proliferative state after birth. 5’-hydroxylation of methylated cytosines (5hmC) is not only involved in DNA loss of CpG methylation but is also thought to be an epigenetic mark with unique distribution and functions. Here, we sought to get insight into the dynamics of 5’-hydroxymethylcytosine in newborn and adult cardiomyocytes. Methods Cardiomyocyte nuclei from newborn and adult C57BL/6 mice were purified by flow cytometric sorting. 5hmC-containing DNA was captured by selective chemical labeling, followed by deep sequencing. Sequencing reads of library replicates were mapped independently (n = 3 for newborn, n = 2 for adult mice) and merged for further analysis steps. 5hmC coverage was normalized to read length and the total number of mapped reads (RPKM). MethylC-Seq, ChIP-Seq and RNA-Seq data sets of newborn and adult cardiomyocytes served to elucidate specific features of 5hmC at gene bodies and around low methylated regions (LMRs) representing regulatory genomic regions with enhancer function. Results 163,544 and 315,220 5hmC peaks were identified in P1 and adult cardiomyocytes, respectively. Of these peaks, 66,641 were common between P1 and adult cardiomyocytes with more than 50% reciprocal overlap. P1 and adult 5hmC peaks were overrepresented in genic features such as exons, introns, 3’- and 5’-untranslated regions (UTRs), promotors and transcription end sites (TES). During cardiomyocyte maturation, 5hmC was found to be enriched at sites of subsequent DNA loss of CpG methylation such as gene bodies of upregulated genes (i.e. Atp2a2, Tnni3, Mb, Pdk4). Additionally, centers of postnatally established enhancers were premarked by 5hmC before DNA loss of CpG methylation. Conclusions Simultaneous analysis of 5hmC-Seq, MethylC-Seq, RNA-Seq and ChIP-Seq data at two defined time points of cardiomyocyte maturation demonstrates that 5hmC is positively

  1. Utilizing inheritance in requirements engineering

    NASA Technical Reports Server (NTRS)

    Kaindl, Hermann

    1994-01-01

    The scope of this paper is the utilization of inheritance for requirements specification, i.e., the tasks of analyzing and modeling the domain, as well as forming and defining requirements. Our approach and the tool supporting it are named RETH (Requirements Engineering Through Hypertext). Actually, RETH uses a combination of various technologies, including object-oriented approaches and artificial intelligence (in particular frames). We do not attempt to exclude or replace formal representations, but try to complement and provide means for gradually developing them. Among others, RETH has been applied in the CERN (Conseil Europeen pour la Rechereche Nucleaire) Cortex project. While it would be impossible to explain this project in detail here, it should be sufficient to know that it deals with a generic distributed control system. Since this project is not finished yet, it is difficult to state its size precisely. In order to give an idea, its final goal is to substitute the many existing similar control systems at CERN by this generic approach. Currently, RETH is also tested using real-world requirements for the Pastel Mission Planning System at ESOC in Darmstadt. First, we outline how hypertext is integrated into a frame system in our approach. Moreover, the usefulness of inheritance is demonstrated as performed by the tool RETH. We then summarize our experiences of utilizing inheritance in the Cortex project. Lastly, RETH will be related to existing work.

  2. Inherited predisposition to multiple myeloma

    PubMed Central

    Koura, Divya T.

    2013-01-01

    Multiple myeloma (MM) is the second most common hematologic malignancy in the United States, after non-Hodgkin lymphoma. Family pedigree analyses of high-risk families, case-control studies and racial disparities in disease incidence all point to a potential inherited predisposition to MM. Genome-wide association studies (GWASs) have identified susceptibility loci in a number of cancers and such studies are currently underway in MM. To date, GWASs in MM have identified several potential regions of interest for further study on chromosomes 3p22, 7p15.3, 8q24 and 2p23.3. In addition, several targets of paraproteins (so called ‘paratargs’) in MM have been identified. Hyperphosphorylation of the paratarg protein, which is inherited in an autosomal dominant manner, appears a common mechanism underlying the antigenicity of these proteins. One particular protein, hyperphosphorylated paratarg-7 (pP-7) is a common target in persons with myeloma and has also been identified in affected members of several high-risk MM families. It appears that the frequency of pP-7 as an antigenic target may be particularly high in African American patients with MM, which could be part of the explanation for observed racial disparities in the incidence of MM. In this review we focus on available data in the area of inherited predisposition to MM, and highlight future research directions. PMID:23926460

  3. Inherited Retinal Degenerative Clinical Trial Network

    DTIC Science & Technology

    2009-10-01

    ending in blindness. In the United States, the total number of individuals affected by retinitis pigmentosa (RP) and other forms of rare inherited...AD_________________ AWARD NUMBER: W81XWH-07-1-0720 TITLE: Inherited Retinal Degenerative...Final 3. DATES COVERED 27 Sep 2007 – 29 Sep 2009 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Inherited Retinal Degenerative Clinical Trial Network

  4. Suppression of HIV replication in vitro by CpG and CpG conjugated to the non toxic B subunit of cholera toxin.

    PubMed

    Nowroozalizadeh, Salma; Jansson, Marianne; Adamsson, Jenni; Lindblad, Marianne; Fenyö, Eva-Maria; Holmgren, Jan; Harandi, Ali M

    2008-05-01

    Administration of oligodeoxynucleotides (ODNs) containing CpG motifs generates a rapid and potent response of CC-chemokines, known as ligands of the HIV-1 co-receptor CCR5, in the murine female genital tract. The present study explored the potential HIV inhibitory activities of different human CpG prototypes either alone or conjugated to the non-toxic subunit of cholera toxin (CTB). Results showed that in vitro replication of both HIV-1 and HIV-2 can be suppressed by different human CpG prototypes. Importantly, the conjugation of CpG ODN to CTB (CTB-CpG) enhanced the antiviral activity of CpG against primary HIV-1 isolates of both R5 and X4 phenotypes in peripheral blood mononuclear cells (PBMC) as well as U87.CD4 co-receptor indicator cells. CTB-CpGs triggered higher amounts of MIP-1alpha, and MIP-1beta in PBMC than the corresponding CpG ODNs, which may explain the superior antiviral effect of CTB-CpG against R5 virus in PBMC. Incubation of PBMC with CpG ODN and CTB-CpG did not alter surface expression of HIV-1 receptors indicating that the observed anti-HIV-1 effect is not mediated through down regulation of HIV-1 receptors on target cells. Further, the enhanced antiviral effect of CTB-CpG was dependent on the presence of phosphorothioate backbone in the ODN, whereas the presence of CpG motif in ODNs was dispensable. These results have implications for the development of novel intervention strategies to prevent HIV infection.

  5. CpG Dinucleotide Frequencies Reveal the Role of Host Methylation Capabilities in Parvovirus Evolution

    PubMed Central

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James

    2013-01-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to “fractional” methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses. PMID:24109231

  6. Consolidated Recovered Materials Advisory Notice (RMAN) for the Comprehensive Procurement Guideline (CPG)

    EPA Pesticide Factsheets

    EPA's Comprehensive Procurement Guideline (CPG) designates recycled content products that government agencies should buy. EPA publishes purchasing guidance and recommendations for recycled content levels in Recovered Material Advisory Notices (RMANs) that accompany each CPG, and updates its guidance annually. For the convenience of procurement officials, this document represents a compilation of the five RMANs published by EPA to date.

  7. Innovative strategies for co-delivering antigens and CpG oligonucleotides

    PubMed Central

    Krishnamachari, Yogita; Salem, Aliasger K.

    2009-01-01

    Cytosine-phosphorothioate-guanine oligodeoxynucleotides (CpG ODN) is a recent class of immunostimulatory adjuvants that includes unmethylated CpG dinucleotide sequences similar to those commonly found in bacterial DNA. CpG ODN specifically triggers toll like receptor 9 (TLR9), which is found within phagoendosomes of antigen presenting cells (APCs) such as dendritic cells (DCs). CpG ODN triggers activation and maturation of DCs and helps to increase expression of antigens. CpG ODN can be used to induce polarized Th1 type immune responses. Several studies have shown that antigens and CpG ODN must be co-localized in the same APC to generate the most potent therapeutic antigen-specific immune responses. Delivery vehicles can be utilized to ensure co-delivery of antigens and CpG ODN to the same APCs and to significantly increase uptake by APCs. These strategies can result in antigen-specific immune responses that are 5 to 500-fold greater than administration of antigen alone. In this review, we discuss several recent and innovative strategies to co-delivering antigens and CpG ODN adjuvants to APCs. These approaches include the utilization of conjugate molecules, multi-component nanorods, liposomes, biodegradable microparticles, pulsatile release chips and cell-microparticle hybrids. PMID:19272328

  8. CpG dinucleotide frequencies reveal the role of host methylation capabilities in parvovirus evolution.

    PubMed

    Upadhyay, Mohita; Samal, Jasmine; Kandpal, Manish; Vasaikar, Suhas; Biswas, Banhi; Gomes, James; Vivekanandan, Perumal

    2013-12-01

    Parvoviruses are rapidly evolving viruses that infect a wide range of hosts, including vertebrates and invertebrates. Extensive methylation of the parvovirus genome has been recently demonstrated. A global pattern of methylation of CpG dinucleotides is seen in vertebrate genomes, compared to "fractional" methylation patterns in invertebrate genomes. It remains unknown if the loss of CpG dinucleotides occurs in all viruses of a given DNA virus family that infect host species spanning across vertebrates and invertebrates. We investigated the link between the extent of CpG dinucleotide depletion among autonomous parvoviruses and the evolutionary lineage of the infected host. We demonstrate major differences in the relative abundance of CpG dinucleotides among autonomous parvoviruses which share similar genome organization and common ancestry, depending on the infected host species. Parvoviruses infecting vertebrate hosts had significantly lower relative abundance of CpG dinucleotides than parvoviruses infecting invertebrate hosts. The strong correlation of CpG dinucleotide depletion with the gain in TpG/CpA dinucleotides and the loss of TpA dinucleotides among parvoviruses suggests a major role for CpG methylation in the evolution of parvoviruses. Our data present evidence that links the relative abundance of CpG dinucleotides in parvoviruses to the methylation capabilities of the infected host. In sum, our findings support a novel perspective of host-driven evolution among autonomous parvoviruses.

  9. Synchronization and stochastic resonance of the small-world neural network based on the CPG.

    PubMed

    Lu, Qiang; Tian, Juan

    2014-06-01

    According to biological knowledge, the central nervous system controls the central pattern generator (CPG) to drive the locomotion. The brain is a complex system consisting of different functions and different interconnections. The topological properties of the brain display features of small-world network. The synchronization and stochastic resonance have important roles in neural information transmission and processing. In order to study the synchronization and stochastic resonance of the brain based on the CPG, we establish the model which shows the relationship between the small-world neural network (SWNN) and the CPG. We analyze the synchronization of the SWNN when the amplitude and frequency of the CPG are changed and the effects on the CPG when the SWNN's parameters are changed. And we also study the stochastic resonance on the SWNN. The main findings include: (1) When the CPG is added into the SWNN, there exists parameters space of the CPG and the SWNN, which can make the synchronization of the SWNN optimum. (2) There exists an optimal noise level at which the resonance factor Q gets its peak value. And the correlation between the pacemaker frequency and the dynamical response of the network is resonantly dependent on the noise intensity. The results could have important implications for biological processes which are about interaction between the neural network and the CPG.

  10. Self-Assembled DNA Immunonanoflowers as Multivalent CpG Nanoagents.

    PubMed

    Zhang, Liqin; Zhu, Guizhi; Mei, Lei; Wu, Cuichen; Qiu, Liping; Cui, Cheng; Liu, Yuan; Teng, I-Ting; Tan, Weihong

    2015-11-04

    Synthetic unmethylated cytosine-guanine (CpG) oligodeoxynucleotides are immunostimulatory motifs that have shown promise as vaccines or adjuvants for diseases such as cancers and infectious diseases. In the present work, novel immuno-nanoflowers (NFs), self-assembled from long DNA integrated with tandem CpG through rolling circle replication, were developed for efficient CpG delivery and protection from nuclease degradation. In a model of macrophage-like cells, the CpG NFs proved to be potent immunostimulators by triggering the proliferation of these immune cells, which, in turn, secreted immunostimulatory cytokines, including tumor necrosis factor α, interleukin-6, and interleukin-10. These results demonstrate the ability of CpG NFs to induce cancer cell apoptosis and necrosis.

  11. CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases.

    PubMed

    Klinman, Dennis M; Klaschik, Sven; Sato, Takashi; Tross, Debbie

    2009-03-28

    Synthetic oligodeoxynucleotides (ODN) containing unmethylated CpG motifs act as immune adjuvants, accelerating and boosting antigen-specific immune responses. CpG motifs promote the induction of Th1 and pro-inflammatory cytokines and support the maturation/activation of professional antigen presenting cells (particularly plasmacytoid dendritic cells). These effects are optimized by maintaining close physical contact between the CpG ODN and the immunogen. Co-administering CpG ODN with a variety of vaccines has improved the resultant humoral and/or cellular immune responses, culminating in enhanced protective immunity in rodent and primate challenge models. Ongoing clinical studies indicate that CpG ODN are safe and well-tolerated when administered as adjuvants to humans, and that they can support increased vaccine-specific immune responses.

  12. An AscI boundary library for the studies of genetic and epigenetic alterations in CpG islands.

    PubMed

    Dai, Zunyan; Weichenhan, Dieter; Wu, Yue-Zhong; Hall, Julia L; Rush, Laura J; Smith, Laura T; Raval, Aparna; Yu, Li; Kroll, Daniela; Muehlisch, Joerg; Frühwald, Michael C; de Jong, Pieter; Catanese, Joe; Davuluri, Ramana V; Smiraglia, Dominic J; Plass, Christoph

    2002-10-01

    Knudson's two-hit hypothesis postulates that genetic alterations in both alleles are required for the inactivation of tumor-suppressor genes. Genetic alterations include small or large deletions and mutations. Over the past years, it has become clear that epigenetic alterations such as DNA methylation are additional mechanisms for gene silencing. Restriction Landmark Genomic Scanning (RLGS) is a two-dimensional gel electrophoresis that assesses the methylation status of thousands of CpG islands. RLGS has been applied successfully to scan cancer genomes for aberrant DNA methylation patterns. So far, the majority of this work was done using NotI as the restriction landmark site. Here, we describe the development of RLGS using AscI as the restriction landmark site for genome-wide scans of cancer genomes. The availability of AscI as a restriction landmark for RLGS allows for scanning almost twice as many CpG islands in the human genome compared with using NotI only. We describe the development of an AscI-EcoRV boundary library that supports the cloning of novel methylated genes. Feasibility of this system is shown in three tumor types, medulloblastomas, lung cancers, and head and neck cancers. We report the cloning of 178 AscI RLGS fragments via two methods by use of this library.

  13. A CpG Oligonucleotide Can Protect Mice From a Low Aerosol Challenge Dose of Burkholderia mallei

    DTIC Science & Technology

    2006-03-01

    per group) ( Charles River Labora- tories, Wilmington, MA) were given 100 g (5 mg/kg) of CPG 7909 (B class) or CpG 2216 (A class) i.p. 48 h before...glycerol. The CpG ODNs were provided by the Coley Pharmaceutical Group (Wellesley, MA), contained undetectable levels of endotoxin , and were

  14. Immune stimulatory CpG oligodeoxynucleotides reduces Salmonella enterica subsp. Arizonae organ colonization and mortality in young turkeys

    USDA-ARS?s Scientific Manuscript database

    Synthetic oligodeoxynucleotides (ODN) containing CpG dinucleotides (CpG ODN) mimic bacterial DNA and are stimulatory to the innate immune system of most vertebrate species. The immunostimulatory activities of CpG ODN have been studied extensively and are well characterized in human and murine immun...

  15. Soluble cpg15 from Astrocytes Ameliorates Neurite Outgrowth Recovery of Hippocampal Neurons after Mouse Cerebral Ischemia.

    PubMed

    Zhao, Jing-Jing; Hu, Jie-Xian; Lu, De-Xin; Ji, Chun-Xia; Qi, Yao; Liu, Xiao-Yan; Sun, Feng-Yan; Huang, Fang; Xu, Ping; Chen, Xian-Hua

    2017-02-08

    The present study focuses on the function of cpg15, a neurotrophic factor, in ischemic neuronal recovery using transient global cerebral ischemic (TGI) mouse model and oxygen-glucose deprivation (OGD)-treated primary cultured cells. The results showed that expression of cpg15 proteins in astrocytes, predominantly the soluble form, was significantly increased in mouse hippocampus after TGI and in the cultured astrocytes after OGD. Addition of the medium from the cpg15-overexpressed astrocytic culture into the OGD-treated hippocampal neuronal cultures reduces the neuronal injury, whereas the recovery of neurite outgrowths of OGD-injured neurons was prevented when cpg15 in the OGD-treated astrocytes was knocked down, or the OGD-treated-astrocytic medium was immunoadsorbed by cpg15 antibody. Furthermore, lentivirus-delivered knockdown of cpg15 expression in mouse hippocampal astrocytes diminishes the dendritic branches and exacerbates injury of neurons in CA1 region after TGI. In addition, treatment with inhibitors of MEK1/2, PI3K, and TrkA decreases, whereas overexpression of p-CREB, but not dp-CREB, increases the expression of cpg15 in U118 or primary cultured astrocytes. Also, it is observed that the Flag-tagged soluble cpg15 from the astrocytes transfected with Flag-tagged cpg15-expressing plasmids adheres to the surface of neuronal bodies and the neurites. In conclusion, our results suggest that the soluble cpg15 from astrocytes induced by ischemia could ameliorate the recovery of the ischemic-injured hippocampal neurons via adhering to the surface of neurons. The upregulated expression of cpg15 in astrocytes may be activated via MAPK and PI3K signal pathways, and regulation of CREB phosphorylation.SIGNIFICANCE STATEMENT Neuronal plasticity plays a crucial role in the amelioration of neurological recovery of ischemic injured brain, which remains a challenge for clinic treatment of cerebral ischemia. cpg15 as a synaptic plasticity-related factor may participate in

  16. Plate tectonics, damage and inheritance.

    PubMed

    Bercovici, David; Ricard, Yanick

    2014-04-24

    The initiation of plate tectonics on Earth is a critical event in our planet's history. The time lag between the first proto-subduction (about 4 billion years ago) and global tectonics (approximately 3 billion years ago) suggests that plates and plate boundaries became widespread over a period of 1 billion years. The reason for this time lag is unknown but fundamental to understanding the origin of plate tectonics. Here we suggest that when sufficient lithospheric damage (which promotes shear localization and long-lived weak zones) combines with transient mantle flow and migrating proto-subduction, it leads to the accumulation of weak plate boundaries and eventually to fully formed tectonic plates driven by subduction alone. We simulate this process using a grain evolution and damage mechanism with a composite rheology (which is compatible with field and laboratory observations of polycrystalline rocks), coupled to an idealized model of pressure-driven lithospheric flow in which a low-pressure zone is equivalent to the suction of convective downwellings. In the simplest case, for Earth-like conditions, a few successive rotations of the driving pressure field yield relic damaged weak zones that are inherited by the lithospheric flow to form a nearly perfect plate, with passive spreading and strike-slip margins that persist and localize further, even though flow is driven only by subduction. But for hotter surface conditions, such as those on Venus, accumulation and inheritance of damage is negligible; hence only subduction zones survive and plate tectonics does not spread, which corresponds to observations. After plates have developed, continued changes in driving forces, combined with inherited damage and weak zones, promote increased tectonic complexity, such as oblique subduction, strike-slip boundaries that are subparallel to plate motion, and spalling of minor plates.

  17. Mitochondrial inheritance in budding yeast.

    PubMed

    Boldogh, I R; Yang, H C; Pon, L A

    2001-06-01

    During the past decade significant advances were made toward understanding the mechanism of mitochondrial inheritance in the yeast Saccharomyces cerevisiae. A combination of genetics, cell-free assays and microscopy has led to the discovery of a great number of components. These fall into three major categories: cytoskeletal elements, mitochondrial membrane components and regulatory proteins. These proteins mediate activities, including movement of mitochondria from mother cells to buds, segregation of mitochondria and mitochondrial DNA, and equal distribution of the organelle between mother cells and buds during yeast cell division.

  18. Paternal inheritance of mitochondria in Chlamydomonas.

    PubMed

    Nakamura, Soichi

    2010-03-01

    To analyze mitochondrial DNA (mtDNA)inheritance, differences in mtDNA between Chlamydomonas reinhardtii and Chlamydomonas smithii, respiration deficiency and antibiotic resistance were used to distinguish mtDNA origins. The analyses indicated paternal inheritance. However, these experiments raised questions regarding whether paternal inheritance occurred normally.Mitochondrial nucleoids were observed in living zygotes from mating until 3 days after mating and then until progeny formation. However, selective disappearance of nucleoids was not observed. Subsequently, experimental serial backcrosses between the two strains demonstrated strict paternal inheritance. The fate of mt+ and mt- mtDNA was followed using the differences in mtDNA between the two strains. The slow elimination of mt+ mtDNA through zygote maturation in darkness was observed, and later the disappearance of mt+ mtDNA was observed at the beginning of meiosis. To explain the different fates of mtDNA, methylation status was investigated; however, no methylation was detected. Variously constructed diploid cells showed biparental inheritance. Thus, when the mating process occurs normally, paternal inheritance occurs. Mutations disrupting mtDNA inheritance have not yet been isolated. Mutations that disrupt maternal inheritance of chloroplast DNA (cpDNA) do not disrupt inheritance of mtDNA. The genes responsible for mtDNA inheritance are different from those of chloroplasts.

  19. Atypical mitochondrial inheritance patterns in eukaryotes.

    PubMed

    Breton, Sophie; Stewart, Donald T

    2015-10-01

    Mitochondrial DNA (mtDNA) is predominantly maternally inherited in eukaryotes. Diverse molecular mechanisms underlying the phenomenon of strict maternal inheritance (SMI) of mtDNA have been described, but the evolutionary forces responsible for its predominance in eukaryotes remain to be elucidated. Exceptions to SMI have been reported in diverse eukaryotic taxa, leading to the prediction that several distinct molecular mechanisms controlling mtDNA transmission are present among the eukaryotes. We propose that these mechanisms will be better understood by studying the deviations from the predominating pattern of SMI. This minireview summarizes studies on eukaryote species with unusual or rare mitochondrial inheritance patterns, i.e., other than the predominant SMI pattern, such as maternal inheritance of stable heteroplasmy, paternal leakage of mtDNA, biparental and strictly paternal inheritance, and doubly uniparental inheritance of mtDNA. The potential genes and mechanisms involved in controlling mitochondrial inheritance in these organisms are discussed. The linkage between mitochondrial inheritance and sex determination is also discussed, given that the atypical systems of mtDNA inheritance examined in this minireview are frequently found in organisms with uncommon sexual systems such as gynodioecy, monoecy, or andromonoecy. The potential of deviations from SMI for facilitating a better understanding of a number of fundamental questions in biology, such as the evolution of mtDNA inheritance, the coevolution of nuclear and mitochondrial genomes, and, perhaps, the role of mitochondria in sex determination, is considerable.

  20. Promoter CpG methylation in cancer cells contributes to the regulation of MUC4

    PubMed Central

    Yamada, N; Nishida, Y; Tsutsumida, H; Goto, M; Higashi, M; Nomoto, M; Yonezawa, S

    2009-01-01

    Mucin 4 (MUC4) is a high molecular weight transmembrane mucin that is overexpressed in many carcinomas and is a risk factor associated with a poor prognosis. In this study, we show that the DNA methylation pattern is intimately correlated with MUC4 expression in breast, lung, pancreas and colon cancer cell lines. We mapped the DNA methylation status of 94 CpG sites from −3622 to +29 using MassARRAY analysis that utilises base-specific cleavage of nucleic acids. MUC4-negative cancer cell lines and those with low MUC4 expression (eg, A427) were highly methylated near the transcriptional start site, whereas MUC4-positive cell lines (eg, NCI-H292) had low methylation levels. Moreover, 5-aza-2′-deoxycytidine and trichostatin A treatment of MUC4-negative cells or those with low MUC4 expression caused elevation of MUC4 mRNA. Our results suggest that DNA methylation in the 5′ flanking region play an important role in MUC4 gene expression in carcinomas of various organs. An understanding of epigenetic changes in MUC4 may contribute to the diagnosis of carcinogenic risk and prediction of outcome in patients with cancer. PMID:19127263

  1. Long-Range Bidirectional Strand Asymmetries Originate at CpG Islands in the Human Genome

    PubMed Central

    Arndt, Peter F.

    2009-01-01

    In the human genome, CpG islands (CGIs), which are GC- and CpG-rich sequences, are associated with transcription starting sites (TSSs); in addition, there is evidence that CGIs harbor origins of bidirectional replication (OBRs) and are preferred sites for heteroduplex formation during recombination. Transcription, replication, and recombination processes are known to induce specific mutational patterns in various genomes, and therefore, these patterns are expected to be found around CGIs. We use triple alignments of human, chimp, and macaque to compute the rates of nucleotide substitutions in up to 1 Mbps long intergenic regions on both sides of CGIs. Our analysis revealed that around a CGI there is an asymmetry between complementary substitution rates that is similar to the one that found around the OBR in bacteria. We hypothesize that these asymmetries are induced by differences in the replication of the leading and lagging strand and that a significant number of CGIs overlap OBRs. Within CGIs, we observed a mutational signature of GC-biased gene conversion that is associated with recombination. We suggest that recombination has played a major role in the creation of CGIs. PMID:20333189

  2. All three classes of CpG ODNs up-regulate IP-10 gene in pigs.

    PubMed

    Dar, Arshud; Nichani, Anil; Lai, Ken; Potter, Andy; Gerdts, Volker; Babiuk, Lorne A; Mutwiri, George

    2010-04-01

    The analysis of CpG ODN induced innate immune responses in different animal species has shown substantial similarities and differences in levels and types of induced cytokines profile. The objectives of these studies were to identify innate immune biomarkers activated by three classes of CpG ODNs in pigs. For this purpose, we investigated the kinetics of innate immune responses in immune cells from pigs following in vitro and in vivo stimulation with CpG ODNs. The mRNA expression of cytokine and chemokine genes were assayed by SYBR green based quantitative real time PCR. A-class CpG ODN induced significant but transient levels of IFN-gamma, IL-12 (P40), IL-6, IL-4 and TNF-alpha mRNA, C-class CpG ODN induced significant level of IFN-gamma, IFN-alpha and IL-12 mRNA and the lowest level of IL-4 (Th-2 type) mRNA. A very low level of some cytokines stimulation was observed by GC ODNs. It is noteworthy, that IL-12 (P35) mRNA was significantly stimulated by B-class GpC ODN 7909. Interestingly, all classes of CpG ODNs induced significant level of IP-10 at 12h post stimulation. These in vitro and in vivo observations suggest that interferon-gamma inducible protein 10 (IP-10) may be a reliable biomarker for immune activity induced by CpG ODNs in pigs.

  3. Epigenetic analysis of HIV-1 proviral genomes from infected individuals: predominance of unmethylated CpG's.

    PubMed

    Weber, Stefanie; Weiser, Barbara; Kemal, Kimdar S; Burger, Harold; Ramirez, Christina M; Korn, Klaus; Anastos, Kathryn; Kaul, Rupert; Kovacs, Colin; Doerfler, Walter

    2014-01-20

    Efforts to cure HIV-1 infections aim at eliminating proviral DNA. Integrated DNA from various viruses often becomes methylated de novo and transcriptionally inactivated. We therefore investigated CpG methylation profiles of 55 of 94 CpG's (58.5%) in HIV-1 proviral genomes including ten CpG's in each LTR and additional CpG's in portions of gag, env, nef, rev, and tat genes. We analyzed 33 DNA samples from PBMC's of 23 subjects representing a broad spectrum of HIV-1 disease. In 22 of 23 HIV-1-infected individuals, there were only unmethylated CpG's regardless of infection status. In one long term nonprogressor, however, methylation of proviral DNA varied between 0 and 75% over an 11-year period although the CD4+ counts remained stable. Hence levels of proviral DNA methylation can fluctuate. The preponderance of unmethylated CpG's suggests that proviral methylation is not a major factor in regulating HIV-1 proviral activity in PBMC's. Unmethylated CpG's may play a role in HIV-1 immunopathogenesis. © 2013 Elsevier Inc. All rights reserved.

  4. CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies.

    PubMed

    Hanagata, Nobutaka

    2017-01-01

    Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide-CpG ODN conjugates and nanomaterial-CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide-CpG ODN conjugates, and nanomaterial-CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies.

  5. CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies

    PubMed Central

    Hanagata, Nobutaka

    2017-01-01

    Unmethylated cytosine-guanine dinucleotide-containing oligodeoxynucleotides (CpG ODNs), which are synthetic agonists of Toll-like receptor 9 (TLR9), activate humoral and cellular immunity and are being developed as vaccine adjuvants to prevent or treat cancers, infectious diseases, and allergies. Free CpG ODNs have been used in many clinical trials implemented to verify their effects. However, recent research has reported that self-assembled CpG ODNs, protein/peptide–CpG ODN conjugates, and nanomaterial–CpG ODN complexes demonstrate higher adjuvant effects than free CpG ODNs, owing to their improved uptake efficiency into cells expressing TLR9. Moreover, protein/peptide–CpG ODN conjugates and nanomaterial–CpG ODN complexes are able to deliver CpG ODNs and antigens (or allergens) to the same types of cells, which enables a higher degree of prophylaxis or therapeutic effect. In this review, the author describes recent trends in the research and development of CpG ODN nanomedicines containing self-assembled CpG ODNs, protein/peptide–CpG ODN conjugates, and nanomaterial–CpG ODN complexes, focusing mainly on the results of preclinical and clinical studies. PMID:28144136

  6. Mapping structural landmarks, ligand binding sites, and missense mutations to the collagen IV heterotrimers predicts major functional domains, novel interactions, and variation in phenotypes in inherited diseases affecting basement membranes.

    PubMed

    Parkin, J Des; San Antonio, James D; Pedchenko, Vadim; Hudson, Billy; Jensen, Shane T; Savige, Judy

    2011-02-01

    Collagen IV is the major protein found in basement membranes. It comprises three heterotrimers (α1α1α2, α3α4α5, and α5α5α6) that form distinct networks, and are responsible for membrane strength and integrity.We constructed linear maps of the collagen IV heterotrimers ("interactomes") that indicated major structural landmarks, known and predicted ligand-binding sites, and missense mutations, in order to identify functional and disease-associated domains, potential interactions between ligands, and genotype–phenotype relationships. The maps documented more than 30 known ligand-binding sites as well as motifs for integrins, heparin, von Willebrand factor (VWF), decorin, and bone morphogenetic protein (BMP). They predicted functional domains for angiogenesis and haemostasis, and disease domains for autoimmunity, tumor growth and inhibition, infection, and glycation. Cooperative ligand interactions were indicated by binding site proximity, for example, between integrins, matrix metalloproteinases, and heparin. The maps indicated that mutations affecting major ligand-binding sites, for example, for Von Hippel Lindau (VHL) protein in the α1 chain or integrins in the α5 chain, resulted in distinctive phenotypes (Hereditary Angiopathy, Nephropathy, Aneurysms, and muscle Cramps [HANAC] syndrome, and early-onset Alport syndrome, respectively). These maps further our understanding of basement membrane biology and disease, and suggest novel membrane interactions, functions, and therapeutic targets.

  7. Digenic inheritance in medical genetics.

    PubMed

    Schäffer, Alejandro A

    2013-10-01

    Digenic inheritance (DI) is the simplest form of inheritance for genetically complex diseases. By contrast with the thousands of reports that mutations in single genes cause human diseases, there are only dozens of human disease phenotypes with evidence for DI in some pedigrees. The advent of high-throughput sequencing (HTS) has made it simpler to identify monogenic disease causes and could similarly simplify proving DI because one can simultaneously find mutations in two genes in the same sample. However, through 2012, I could find only one example of human DI in which HTS was used; in that example, HTS found only the second of the two genes. To explore the gap between expectation and reality, I tried to collect all examples of human DI with a narrow definition and characterise them according to the types of evidence collected, and whether there has been replication. Two strong trends are that knowledge of candidate genes and knowledge of protein-protein interactions (PPIs) have been helpful in most published examples of human DI. By contrast, the positional method of genetic linkage analysis, has been mostly unsuccessful in identifying genes underlying human DI. Based on the empirical data, I suggest that combining HTS with growing networks of established PPIs may expedite future discoveries of human DI and strengthen the evidence for them.

  8. Comprehensive analysis of CpG islands in human chromosomes 21 and 22

    NASA Astrophysics Data System (ADS)

    Takai, Daiya; Jones, Peter A.

    2002-03-01

    CpG islands are useful markers for genes in organisms containing 5-methylcytosine in their genomes. In addition, CpG islands located in the promoter regions of genes can play important roles in gene silencing during processes such as X-chromosome inactivation, imprinting, and silencing of intragenomic parasites. The generally accepted definition of what constitutes a CpG island was proposed in 1987 by Gardiner-Garden and Frommer [Gardiner-Garden, M. & Frommer, M. (1987) J. Mol. Biol. 196, 261-282] as being a 200-bp stretch of DNA with a C+G content of 50% and an observed CpG/expected CpG in excess of 0.6. Any definition of a CpG island is somewhat arbitrary, and this one, which was derived before the sequencing of mammalian genomes, will include many sequences that are not necessarily associated with controlling regions of genes but rather are associated with intragenomic parasites. We have therefore used the complete genomic sequences of human chromosomes 21 and 22 to examine the properties of CpG islands in different sequence classes by using a search algorithm that we have developed. Regions of DNA of greater than 500 bp with a G+C equal to or greater than 55% and observed CpG/expected CpG of 0.65 were more likely to be associated with the 5' regions of genes and this definition excluded most Alu-repetitive elements. We also used genome sequences to show strong CpG suppression in the human genome and slight suppression in Drosophila melanogaster and Saccharomyces cerevisiae. This finding is compatible with the recent detection of 5-methylcytosine in Drosophila, and might suggest that S. cerevisiae has, or once had, CpG methylation.

  9. Roles of Cell Division and Gene Transcription in the Methylation of CpG Islands

    PubMed Central

    Bender, Christina M.; Gonzalgo, Mark L.; Gonzales, Felicidad A.; Nguyen, Carvell T.; Robertson, Keith D.; Jones, Peter A.

    1999-01-01

    De novo methylation of CpG islands within the promoters of eukaryotic genes is often associated with their transcriptional repression, yet the methylation of CpG islands located downstream of promoters does not block transcription. We investigated the kinetics of mRNA induction, demethylation, and remethylation of the p16 promoter and second-exon CpG islands in T24 cells after 5-aza-2′-deoxycytidine (5-Aza-CdR) treatment to explore the relationship between CpG island methylation and gene transcription. The rates of remethylation of both CpG islands were associated with time but not with the rate of cell division, and remethylation of the p16 exon 2 CpG island occurred at a higher rate than that of the p16 promoter. We also examined the relationship between the remethylation of coding sequence CpG islands and gene transcription. The kinetics of remethylation of the p16 exon 2, PAX-6 exon 5, c-ABL exon 11, and MYF-3 exon 3 loci were examined following 5-Aza-CdR treatment because these genes contain exonic CpG islands which are hypermethylated in T24 cells. Remethylation occurred most rapidly in the p16, PAX-6, and c-ABL genes, shown to be transcribed prior to drug treatment. These regions also exhibited higher levels of remethylation in single-cell clones and subclones derived from 5-Aza-CdR-treated T24 cells. Our data suggest that de novo methylation is not restricted to the S phase of the cell cycle and that transcription through CpG islands does not inhibit their remethylation. PMID:10490608

  10. An origin of bidirectional DNA replication is located within a CpG island at the 3" end of the chicken lysozyme gene.

    PubMed Central

    Phi-van, L; Strätling, W H

    1999-01-01

    We previously identified a broad initiation zone of DNA replication at the chicken lysozyme gene locus. However, the existence of a highly preferred origin of bidirectional replication (OBR), often found in initiation zones, remained elusive. In order to re-examine this issue we used a competitive PCR assay to determine the abundance of closely spaced genomic segments in a 1 kb size fraction of nascent DNA. A sharp peak of nascent strand abundance occurred at the 3" end of the gene, where initiation events were 17 times more frequent than upstream of the gene. This primary initiation site, active in lysozyme expressing myelomonocytic HD11 cells and non-expressing hepatic DU249 cells, was found to reside within an unusually located CpG island. While most CpG islands are found at the 5" end of genes, the lysozyme gene island extends from the 3" end of the second intron and includes approximately 1.2 kb of 3" flanking DNA. As diagnosed by methylation-sensitive restriction enzymes, the island is largely non-methylated in HD11 cells, DU249 cells and inactive chicken erythrocytes. Furthermore, a DNase I hypersensitive site (HS) that is composed of two subsites separated by approximately 100 bp, was localised very close to the segment with the highest initiation activity. Our results suggest that the non-methylated CpG island and the HS provide an accessible chromatin structure for the lysozyme gene origin of replication. PMID:10454594

  11. Detection of cytosine and CpG density in proto-oncogenes and tumor suppressor genes in promoter sequences of acute myeloid leukemia.

    PubMed

    Dogan, Senol; Cilic, Anis; Marjanovic, Damir; Kurtovic-Kozaric, Amina

    2017-03-21

    Aberrant methylation is one of the driving forces of cancer genome development. Although the rate of methylation appears massively variable across the genome, it is mainly observed in histone modification, chromatin organization, DNA accessibility, or promoter sequence. Methylation of promoter sequence occurs mostly to cytosine nucleotides, which can affect transcription factors' binding affinities. In this study, we demonstrated that cytosine repeats (C types density), consisting of CC, CCC, CCCC, CCCCC, CCCCCC, CCCCCCC motifs and CpG islands density in 25 proto-oncogenes, tumor suppressor genes and control genes may play a role in the pathogenesis of acute myeloid leukemia. The promoter sequences were divided into a 100 nucleotide window from -500 to +100 nucleotides and 20 nucleotide window from -100 to +100. Each window is analyzed to find the higher C type and CpG islands density, which may cause the increased methylation in the promoter sequence. Our novel findings show that promoter sequence cytosine repeats and CpG density increase closer to transcription sites, especially just before and after the transcription start site (TSS). The results demonstrate that cytosine density increases while proto-oncogenes and TSG promoter sequences are closer to TSS 50.8% and 41.0% respectively, if (-500 to -200) and (-100 to +100) windows of the nucleotide sequences are compared. This proves that around TSS location has special nucleotide motifs and could be an important implication for our understanding of potential methylating locations in promoters.

  12. Clinical evaluation of CpG oligonucleotides as adjuvants for vaccines targeting infectious diseases and cancer

    PubMed Central

    Scheiermann, Julia; Klinman, Dennis M.

    2014-01-01

    Synthetic oligonucleotides (ODN) that express unmethylated “CpG motifs” trigger cells that express Toll-like receptor 9. In humans this includes plasmacytoid dendritic cells and B cells. CpG ODN induce an innate immune response characterized by the production of Th1 and pro-inflammatory cytokines. Their utility as vaccine adjuvants was evaluated in a number of clinical trials. Results indicate that CpG ODN improve antigen presentation and the generation of vaccine-specific cellular and humoral responses. This work provides an up-to-date overview of the utility of CpG ODN as adjuvants for vaccines targeting infectious agents and cancer. PMID:24975812

  13. INHERITED NEUROPATHIES: CLINICAL OVERVIEW AND UPDATE

    PubMed Central

    KLEIN, CHRISTOPHER J.; DUAN, XIAOHUI; SHY, MICHAEL E.

    2014-01-01

    Inherited neuropathy is a group of common neurologic disorders with heterogeneous clinical presentations and genetic causes. Detailed neuromuscular evaluations, including nerve conduction studies, laboratory testing, and histopathologic examination, can assist in identification of the inherited component beyond family history. Genetic testing increasingly enables definitive diagnosis of specific inherited neuropathies. Diagnosis, however, is often complex, and neurologic disability may have both genetic and acquired components in individual patients. The decision of which genetic test to order or whether to order genetic tests is often complicated, and the strategies to maximize the value of testing are evolving. Apart from rare inherited metabolic neuropathies, treatment approaches remain largely supportive. We provide a clinical update of the various types of inherited neuropathies, their differential diagnoses, and distinguishing clinical features (where available). A framework is provided for clinical evaluations, including the inheritance assessment, electrophysiologic examinations, and specific genetic tests. PMID:23801417

  14. Inherited neuropathies: clinical overview and update.

    PubMed

    Klein, Christopher J; Duan, Xiaohui; Shy, Michael E

    2013-10-01

    Inherited neuropathy is a group of common neurologic disorders with heterogeneous clinical presentations and genetic causes. Detailed neuromuscular evaluations, including nerve conduction studies, laboratory testing, and histopathologic examination, can assist in identification of the inherited component beyond family history. Genetic testing increasingly enables definitive diagnosis of specific inherited neuropathies. Diagnosis, however, is often complex, and neurologic disability may have both genetic and acquired components in individual patients. The decision of which genetic test to order or whether to order genetic tests is often complicated, and the strategies to maximize the value of testing are evolving. Apart from rare inherited metabolic neuropathies, treatment approaches remain largely supportive. We provide a clinical update of the various types of inherited neuropathies, their differential diagnoses, and distinguishing clinical features (where available). A framework is provided for clinical evaluations, including the inheritance assessment, electrophysiologic examinations, and specific genetic tests. Copyright © 2013 Wiley Periodicals, Inc.

  15. Calcium Ions in Inherited Cardiomyopathies.

    PubMed

    Deftereos, Spyridon; Papoutsidakis, Nikolaos; Giannopoulos, Georgios; Angelidis, Christos; Raisakis, Konstantinos; Bouras, Georgios; Davlouros, Periklis; Panagopoulou, Vasiliki; Goudevenos, John; Cleman, Michael W; Lekakis, John

    2016-01-01

    Inherited cardiomyopathies are a known cause of heart failure, although the pathways and mechanisms leading from mutation to the heart failure phenotype have not been elucidated. There is strong evidence that this transition is mediated, at least in part, by abnormal intracellular Ca(2+) handling, a key ion in ventricular excitation, contraction and relaxation. Studies in human myocytes, animal models and in vitro reconstituted contractile protein complexes have shown consistent correlations between Ca(2+) sensitivity and cardiomyopathy phenotype, irrespective of the causal mutation. In this review we present the available data about the connection between mutations linked to familial hypertrophic (HCM), dilated (DCM) and restrictive (RCM) cardiomyopathy, right ventricular arrhythmogenic cardiomyopathy/dysplasia (ARVC/D) as well as left ventricular non-compaction and the increase or decrease in Ca(2+) sensitivity, together with the results of attempts to reverse the manifestation of heart failure by manipulating Ca(2+) homeostasis.

  16. Inherited predisposition to myeloproliferative neoplasms

    PubMed Central

    Jones, Amy V.

    2013-01-01

    Myeloproliferative neoplasms (MPNs) are haematological disorders characterized by an overproduction of mature myeloid cells with a tendency to transform to acute myeloid leukaemia. Clonal proliferation of myeloid progenitor cells is driven by somatically acquired mutations, most notably JAK2 V617F, but there are important features relating to pathogenesis and phenotypic diversity that cannot be explained by acquired mutations alone. In this review we consider what is currently known about the role that inherited factors play in the development and biology of both sporadic and familial forms of MPN. Although most MPN cases appear to be sporadic, familial predisposition has been recognized for many years in a subset of cases and epidemiological studies have indicated the presence of common susceptibility alleles. Currently the JAK2 46/1 haplotype (also referred to as ‘GGCC’) is the strongest known predisposition factor for sporadic MPNs carrying a JAK2 V617F mutation, explaining a large proportion of the heritability of this disorder. Less is known about what genetic variants predispose to MPNs that lack JAK2 V617F, but there have been recent reports of interesting associations in biologically plausible candidates, and more loci are set to emerge with the application of systematic genome-wide association methodologies. Several highly penetrant predisposition variants that affect erythropoietin signalling, thrombopoietin signalling or oxygen sensing have been characterized in families with nonclonal hereditary erythrocytosis or thrombocytosis, but much less is known about familial predisposition to true clonal MPN. The heterogeneous pattern of inheritance and presumed genetic heterogeneity in these families makes analysis difficult, but whole exome or genome sequencing should provide novel insights into these elusive disorders. PMID:23926457

  17. Methylation level of CpG islands in GGH gene promoter in pediatric acute leukemia

    PubMed Central

    Wang, Huihui; Mai, Huirong; Yuan, Xiuli; Li, Changgang; Wen, Feiqiu

    2017-01-01

    Background γ-Glutamyl hydrolase (GGH) regulates intracellular folates and antifolates such as methotrexate (MTX) for proper nucleotide biosynthesis and antifolate-induced cytotoxicity, respectively. In addition to genetic polymorphism and karyotypic abnormalities, methylation of CpG island 1 (CpG1) in the promoter region is found to modulate GGH activity by reducing GGH mRNA expression in acute lymphoblastic leukemia (ALL) cells. We aim to investigate methylation status of two CpG islands (CpG1 and CpG2) in the GGH promoter region in pediatric patients with ALL and acute myelogenous leukemia (AML). Methods 70B-ALL, 29 AML, 10 ITP (idiopathic thrombocytopenic purpura) and 40 healthy children are recruited in the present study. MS-HRM (methylation-sensitive high-resolution melting) and bisulfite sequencing PCR (BSP) are used to detect methylation change and its level in CpG1 and CpG2 in the GGH promoter region. GGH mRNA expression is quantified by real-time PCR. Correlation between CpG island methylation and GGH mRNA expression is assessed by statistical software. Results Methylations of CpG1 are detected in leukemia cells samples obtained from 30.9% (21/68) of patients with ALL and 20.7% (6/29) of patients with AML. These methylations are not detected in the controls. Methylations of CpG2 are detected in leukemia cell samples obtained from 44.1% (30/68) of the ALL patients and 37.9% (11/29) of the AML patients. These percentages are significantly higher than that observed in the control cell samples: 6.0% (3/50) (Fisher's exact test, P = 0.000). The abundance of CpG1 methylation in all leukemia cell samples is classified as Grade I (methylation level is less than 10%) and the abundance of CpG2 methylation in leukemia cell samples is classified in separate grades. Our results indicate that methylation of CpG1 or hypermethylation (the methylation level is greater than 10%) of CpG2 could significantly reduce GGH mRNA expression in leukemia cells from the ALL and AML

  18. A Pulse-Type Hardware CPG Model for Generation and Transition of Quadruped Locomotion Pattern

    NASA Astrophysics Data System (ADS)

    Hata, Keiko; Sekine, Yoshifumi; Nakabora, Yoshifumi; Saeki, Katsutoshi

    The purpose of our research is to clarify information processing functions of living organisms by neural networks using pulse-type hardware neuron models and applying pulse-type hardware neural networks to engineered models. It is known that locomotion such as walking by a living organism is generated and transited by CPG (Central Pattern Generator) in the central nervous system. We investigate a pulse-type hardware CPG model using coupled oscillator composed of pulse-type hardware neuron models. A CPG model is need to generate and control quadruped locomotion. In this paper, we describe generation and transition of oscillation patterns, corresponding to quadruped locomotion patterns. As a result, it is shown that generation and transition of oscillation patterns are possible by giving external inputs of one pulse to the CPG model.

  19. The Use of Chlorhexidine/n-Propyl Gallate (CPG) as an Ambient-Temperature Urine Preservative

    NASA Technical Reports Server (NTRS)

    Nillen, Jeannie L.; Smith, Scott M.

    2003-01-01

    A safe, effective ambient temperature urine preservative, chlorhexidine/n-propyl gallate (CPG), has been formulated for use during spacefli ght that reduces the effects of oxidation and bacterial contamination on sample integrity while maintaining urine pH. The ability of this preservative to maintain stability of nine key analytes was evaluated for a period of one year. CPG effectively maintained stability of a mmonia, total nitrogen, 3-methylhistidine, chloride, sodium, potassiu m, and urea; however, creatinine and osmolality were not preserved by CPG. These data indicate that CPG offers prolonged room-temperature storage for multiple urine analytes, reducing the requirements for f rozen urine storage on future spaceflights. Iii medical applications on Earth, this technology can allow urine samples to be collected in remote settings and eliminate the need to ship frozen samples.

  20. CpG oligonucleotides for immunotherapeutic treatment of neuroblastoma.

    PubMed

    Miles, Suzanne A; Sandler, Anthony D

    2009-03-28

    Neuroblastoma is the most common extracranial solid tumor malignancy of childhood. Although it is generally responsive to treatment, high risk cases of neuroblastoma frequently recur. The prognosis for relapsed cases is extremely poor despite aggressive therapy. The frequency of relapse and subsequent failure of further treatment has spurred the need to develop non toxic and more effective treatments for targeting residual tumor cells during the phase of minimal residual disease. Traditional cancer therapies are non-specific, leading to the destruction of normal, healthy tissues. Failure to induce specific tumor immunity may be due to several immunosuppressive factors. Primary amongst these factors are: lack of co-stimulatory molecules on the surface of tumor cells, the ability of the tumor to modulate immunity in a suppressive manner and the presence of an immunosuppressive microenvironment at the location of the tumor. Unfortunately, tumor tolerance impedes the ability to establish immunity to tumor antigens and overcoming this tolerance is essential to developing effective tumor immunity. Vaccine strategies that target host immune effector cells with synthetic oligodeoxynucleotides (ODNs) that contain unmethylated CpG motifs (CpG-ODNs) represent a novel approach to overcoming tolerance in cancer therapy. This approach enables biasing of host immunity toward a proinflammatory Th1 and thus anti-tumor response. The addition of immunogenic tumor specific antigen to the CpG-ODN vaccine may allow for specific targeting and killing of established tumors.

  1. Primer in Genetics and Genomics, Article 4-Inheritance Patterns.

    PubMed

    Aiello, Lisa B; Chiatti, Beth Desaretz

    2017-07-01

    Since the completion of the Human Genome Project, much has been uncovered about inheritance of various illnesses and disorders. There are two main types of inheritance: Mendelian and non-Mendelian. Mendelian inheritance includes autosomal dominant, autosomal recessive, X-linked, and Y-linked inheritance. Non-Mendelian inheritance includes mitochondrial and multifactorial inheritance. Nurses must understand the types of inheritance in order to identify red flags that may indicate the possibility of a hereditary disorder in a patient or family.

  2. CpG oligodeoxynucleotides potentiate the antitumor activity of anti-BST2 antibody.

    PubMed

    Hiramatsu, Kosuke; Serada, Satoshi; Kobiyama, Kouji; Nakagawa, Satoshi; Morimoto, Akiko; Matsuzaki, Shinya; Ueda, Yutaka; Fujimoto, Minoru; Yoshino, Kiyoshi; Ishii, Ken J; Enomoto, Takayuki; Kimura, Tadashi; Naka, Tetsuji

    2015-10-01

    Numerous monoclonal antibodies (mAb) targeting tumor antigens have recently been developed. Antibody-dependent cellular cytotoxicity (ADCC) and antibody-dependent cellular phagocytosis (ADCP) via effector cells such as tumor-infiltrating natural killer (NK) cells and macrophages are often involved in mediating the antitumor activity of mAb. CpG oligodeoxynucleotides (ODN) have a potent antitumor activity and are considered to increase tumor infiltration of NK cells and macrophages. Our group previously reported significant antitumor activity of anti-bone marrow stromal antigen 2 (BST2) mAb against BST2-positive endometrial cancer cells through ADCC. In this study, we evaluated the synergistic antitumor activity of combination therapy with anti-BST-2 mAb and CpG ODN using SCID mice and elucidated the mechanisms underlying this activity. Anti-BST2 mAb and CpG ODN monotherapy had a significant dose-dependent antitumor activity (P = 0.0135 and P = 0.0196, respectively). Combination therapy with anti-BST2 mAb and CpG ODN had a significant antitumor activity in SCID mice (P < 0.01), but not in NOG mice. FACS analysis revealed significantly increased numbers of NK cells and macrophages in tumors treated with a combination of anti-BST2 mAb and CpG ODN and with CpG ODN alone in SCID mice (P < 0.05 and P < 0.01, respectively). These results suggested that the combination therapy with anti-BST2 mAb and CpG ODN has a significant antitumor activity and induces tumor infiltration of NK cells and macrophages. Combination therapy with CpG ODN and anti-BST2 mAb or other antitumor mAb depending on ADCC may represent a new treatment option for cancer.

  3. A Hybrid Approach for CpG Island Detection in the Human Genome

    PubMed Central

    Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

    2016-01-01

    Background CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. Methodology/Principal Findings A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. Conclusion/Significance The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time. PMID:26727213

  4. A Hybrid Approach for CpG Island Detection in the Human Genome.

    PubMed

    Yang, Cheng-Hong; Lin, Yu-Da; Chiang, Yi-Cheng; Chuang, Li-Yeh

    2016-01-01

    CpG islands have been demonstrated to influence local chromatin structures and simplify the regulation of gene activity. However, the accurate and rapid determination of CpG islands for whole DNA sequences remains experimentally and computationally challenging. A novel procedure is proposed to detect CpG islands by combining clustering technology with the sliding-window method (PSO-based). Clustering technology is used to detect the locations of all possible CpG islands and process the data, thus effectively obviating the need for the extensive and unnecessary processing of DNA fragments, and thus improving the efficiency of sliding-window based particle swarm optimization (PSO) search. This proposed approach, named ClusterPSO, provides versatile and highly-sensitive detection of CpG islands in the human genome. In addition, the detection efficiency of ClusterPSO is compared with eight CpG island detection methods in the human genome. Comparison of the detection efficiency for the CpG islands in human genome, including sensitivity, specificity, accuracy, performance coefficient (PC), and correlation coefficient (CC), ClusterPSO revealed superior detection ability among all of the test methods. Moreover, the combination of clustering technology and PSO method can successfully overcome their respective drawbacks while maintaining their advantages. Thus, clustering technology could be hybridized with the optimization algorithm method to optimize CpG island detection. The prediction accuracy of ClusterPSO was quite high, indicating the combination of CpGcluster and PSO has several advantages over CpGcluster and PSO alone. In addition, ClusterPSO significantly reduced implementation time.

  5. CpG oligodeoxyribonucleotides protect mice from Burholderia pseudomallei but not Francisella tularensis Schu 54 aersols

    DTIC Science & Technology

    2010-01-01

    live vaccine strain (LVS), when administered before parenteral challenge. Given the potential to develop CpG ODN as a pre-treatment for multiple...1] have been successfully developed as adjuvants for a broad array of bacterial subunit vaccines and are currently undergoing multiple clinical...tularensis live vaccine strain (LVS) [3] suggest that CpG ODN may also protect against human-virulent F. tularensis Schu S4 infection. Significantly

  6. Spectroscopic Study of CpG Alternating DNA-Methylene Blue Interaction for Methylation Detection.

    PubMed

    Hosseini, Morteza; Khaki, Fereshteh; Dadmehr, Mehdi; Ganjali, Mohammad Reza

    2016-05-01

    Recognition of methylated DNA sites would be useful strategy due to the important roles of methylation in disease occurrence and developmental processes. The interaction of CpG rich methylated and unmethylated DNA hybrid with methylene blue (MB) as an optical probe has been investigated by absorption, emission, circular dichorism and fluorescence anisotropy analysis. Titration of MB with both sequences caused a hypsochromism and decreased the absorption of MB that indicating an intercalative mode of interaction. The experimental results revealed that MB as the optical indicator could distinguish between the methylated and unmethylated DNA sequences. Under optimum conditions, upon the addition of methylated dsDNA, the fluorescence intensity increased in linear range from 1.0 × 10(-9) to 1.0 × 10(-6) M with detection limit of 7.2 × 10(-10) M and on the other hand, the intensity of MB showed no change with addition of unmethylated dsDNA.

  7. THE PROTEASOME REGULATES BACTERIAL CpG DNA-INDUCED SIGNALING PATHWAYS IN MURINE MACROPHAGES

    PubMed Central

    Gao, Jian Jun; Shen, Jing; Kolbert, Christopher; Raghavakaimal, Sreekumar; Papasian, Christopher J.; Qureshi, Asaf A.; Vogel, Stefanie N.; Morrison, David C.; Qureshi, Nilofer

    2010-01-01

    Our previous work has provided strong evidence that the proteasome is central to the vast majority of genes induced in mouse macrophages in response to lipopolysaccharide (LPS) stimulation. In the studies presented here, we evaluated the role of the macrophage proteasome in response to a second microbial product CpG DNA (unmethylated bacterial DNA). For these studies, we applied Affymetrix microarray analysis of RNA derived from murine macrophages stimulated with CpG DNA in the presence or absence of proteasome inhibitor, lactacystin. The results of these studies revealed that similar to LPS, a vast majority of those macrophage genes regulated by CpG DNA are also under the control of the proteasome at 4 h. In contrast to LPS stimulation, however, many of these genes were induced much later than 4 h, at 18 h, in response to CpG DNA. Lactacystin treatment of macrophages completely blocked the CpG DNA-induced gene expression of TNF-α and other genes involved in production of inflammatory mediators. These data strongly support the conclusion that, similar to LPS, the macrophage proteasome is a key regulator of CpG DNA-induced signaling pathways. PMID:20160661

  8. Graphene oxide-chitosan nanocomposites for intracellular delivery of immunostimulatory CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Yan, Ting; Xu, Sha; Feng, Shini; Huang, Dandi; Fujita, Morihisa; Gao, Xiao-Dong

    2017-04-01

    CpG oligodeoxynucleotides (ODNs) activate innate and adaptive immune responses, and show strong potential as immunotherapeutic agents against various diseases. Benefiting from their unique physicochemical properties, graphene oxide (GO) has recently attracted great attention in nanomedicine. In this study, we developed a novel CpG ODNs delivery system based on GO-chitosan (GO-CS) nanocomposites. GO-CS nanocomposites were prepared by self-assembly of both components via electrostatic interactions. Compared with GO, GO-CS nanocomposites possessed smaller size, positive surface charge and lower cytotoxicity. CpG ODNs were loaded onto GO-CS nanocomposites via electrostatic interactions. GO-CS nanocomposites greatly improved the loading capacity and cellular uptake of CpG ODNs. GO-CS/CpG ODNs complexes further resulted in an enhanced interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) production compared with that of free CpG ODNs and GO/CpG ODNs complexes. Therefore, GO-CS nanocomposites can serve as efficient nanocarriers for enhancing the delivery efficiency of CpG ODNs.

  9. Topical CpG enhances the response of murine malignant melanoma to dacarbazine.

    PubMed

    Najar, Hossain M; Dutz, Jan P

    2008-09-01

    Malignant melanoma is a potentially fatal skin cancer that is increasing in incidence. Standard chemoimmunotherapy consisting of dacarbazine (DTIC) given with IFN-alpha has had disappointing results. We describe a chemoimmunotherapy protocol for cutaneous melanoma that combines the administration of DTIC with the topical application of CpG oligodinucleotide (ODN). Subcutaneous B16 melanoma tumors in C57BL/6 mice were treated with intraperitoneal injections of DTIC followed by the topical application of CpG-ODN over the tumors. This therapeutic approach abrogated the growth of established tumors and significantly enhanced survival. Topical CpG application was more effective than intratumoral CpG. Cell depletion studies indicated that the antitumor effect was dependent on both CD4(+) and CD8(+) cells but not on natural killer (NK) cells. Tumor-specific cytotoxic T-lymphocyte activity was generated in treated animals and was highest in topically treated animals. Immunohistochemical analysis revealed that DTIC, but not CpG, enhanced tumor cell apoptosis. Further, topical CpG induced an expansion of a B220(+)CD8(+) subset of dendritic cells and a subset of NK1.1(+) CD11c(+) cells within the tumors. By enhancing both tumor cell death and local immune activation, DTIC/topical CpG chemoimmunotherapy induced an effective T-cell-dependent host-immune response against melanoma.

  10. CpG oligodeoxynucleotides with crude parasite antigens reduce worm recovery in Opisthorchis viverrini infected hamsters.

    PubMed

    Kaewraemruaen, Chamraj; Sermswan, Rasana W; Wongratanacheewin, Surasakdi

    2016-12-01

    Opisthorchis viverrini, a human liver fluke, is still an endemic parasitic infection in Thailand and nearly all countries in Southeast Asia. O. viverrini induces a chronic stage of infection in hamsters. During the first 2 weeks of infection, Th1 inducing cytokine, IL-12, increased but was down regulated in chronic infection. In this study it was found that unmethylated-CpG ODN (oligodeoxynucleotides) 1826 increased hamster mononuclear cell proliferation and stimulated IFN-γ production in vitro. The IFN-γ levels in hamster sera were significantly increased in hamsters injected with CpG ODN 1826 alone or plus crude somatic antigens (CSAg). Further investigation using the flow cytometer found that CD4(+)T cells and IFN-γ(+) CD4(+)T cells (Th1-like cells) in the hamster blood were significantly increased. The role of these cells in the protective responses in hamsters was evaluated by challenging with 25 metacercaria and observation for 3 months. The number of worms recovered was significantly reduced in the hamsters injected with CpG ODN 1826 with CSAg, but not in CpG ODN 1826 alone groups when compared to PBS control. The percent of reduction in hamsters against this parasite were 32.95% and 21.49% in the CpG ODN 1826 with CSAg and CpG ODN 1826 alone. This study indicates that CpG ODN 1826 plus parasite antigens elicit a Th1-like response that leads to the enhancement of worm reduction.

  11. Legal Portion in Russian Inheritance Law

    ERIC Educational Resources Information Center

    Inshina, Roza; Murzalimova, Lyudmila

    2013-01-01

    In this paper the authors describe the right to inherit as one of the basic human rights guaranteed by the Constitution of the Russian Federation. The state has set rules according to which after a person's death, his or her property is inherited by other persons. The Russian civil legislation establishes the institution of legal portions that is…

  12. Inherited Bone Marrow Failure Syndromes (IBMFS)

    Cancer.gov

    The NCI IBMFS Cohort Study consists of affected individuals and their immediate families in North America who have an inherited bone marrow failure syndrome (IBMFS)-either one that has been specifically identified and defined, or bone marrow failure that appears to be inherited but has not yet been clearly identified as having a genetic basis.

  13. 25 CFR 213.13 - Inherited lands.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 25 Indians 1 2012-04-01 2011-04-01 true Inherited lands. 213.13 Section 213.13 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF RESTRICTED LANDS OF MEMBERS OF FIVE CIVILIZED TRIBES, OKLAHOMA, FOR MINING How to Acquire Leases § 213.13 Inherited lands. Except to...

  14. 25 CFR 213.13 - Inherited lands.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 25 Indians 1 2013-04-01 2013-04-01 false Inherited lands. 213.13 Section 213.13 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF RESTRICTED LANDS OF MEMBERS OF FIVE CIVILIZED TRIBES, OKLAHOMA, FOR MINING How to Acquire Leases § 213.13 Inherited lands. Except to...

  15. 25 CFR 213.13 - Inherited lands.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Inherited lands. 213.13 Section 213.13 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF RESTRICTED LANDS OF MEMBERS OF FIVE CIVILIZED TRIBES, OKLAHOMA, FOR MINING How to Acquire Leases § 213.13 Inherited lands. Except to...

  16. 25 CFR 213.13 - Inherited lands.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 25 Indians 1 2011-04-01 2011-04-01 false Inherited lands. 213.13 Section 213.13 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF RESTRICTED LANDS OF MEMBERS OF FIVE CIVILIZED TRIBES, OKLAHOMA, FOR MINING How to Acquire Leases § 213.13 Inherited lands. Except to...

  17. 25 CFR 213.13 - Inherited lands.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 25 Indians 1 2014-04-01 2014-04-01 false Inherited lands. 213.13 Section 213.13 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR ENERGY AND MINERALS LEASING OF RESTRICTED LANDS OF MEMBERS OF FIVE CIVILIZED TRIBES, OKLAHOMA, FOR MINING How to Acquire Leases § 213.13 Inherited lands. Except to...

  18. Mitochondrial movement and inheritance in budding yeast.

    PubMed

    Boldogh, Istvan R; Fehrenbacher, Kammy L; Yang, Hyeong-Cheol; Pon, Liza A

    2005-07-18

    Mitochondria are essential organelles that perform fundamental cellular functions including aerobic energy mobilization, fatty acid oxidation, amino acid metabolism, heme biosynthesis and apoptosis. Mitochondria cannot be synthesized de novo. Therefore, the inheritance of this organelle is an essential part of the cell cycle; that is, daughter cells that do not inherit mitochondria will not survive. The budding yeast, Saccharomyces cerevisiae, is a facultative aerobe that can tolerate mitochondrial mutations that would be lethal in other organisms. Therefore, yeast has been used extensively to study inheritance and segregation of mitochondria. As a result, much of what we know regarding mitochondrial inheritance has been uncovered using yeast as a model system. Here, we describe the latest developments in mitochondrial motility and inheritance.

  19. Curcumin inhibits the AKT/NF-κB signaling via CpG demethylation of the promoter and restoration of NEP in the N2a cell line.

    PubMed

    Deng, Yushuang; Lu, Xi; Wang, Li; Li, Tao; Ding, Yubin; Cao, Huimin; Zhang, Yuping; Guo, Xiuming; Yu, Gang

    2014-07-01

    Curcumin (CUR), a non-toxic polyphenol from Curcuma longa, has been investigated as a potential therapy with anti-inflammatory and anti-oxidative effects for Alzheimer's disease (AD), which depicts features of chronic inflammatory environment resulting in cellular death. However, it remains largely unknown whether the anti-inflammatory effect of CUR in AD is associated with its property of CpG demethylation, which is another function of CUR with the most research interest during recent years. Neprilysin (NEP, EP24.11), a zinc-dependent metallopeptidase expressed relatively low in the brain, is emerging as a potent inhibitor of AKT/Protein Kinase B. In addition, hypermethylated promoter of NEP has been reported to be associated with decreases in NEP expression. In the present study, using bisulfite-sequencing PCR (BSP) assay, we showed that the CpG sites in NEP gene were hypermethylated both in wild-type mouse neuroblastoma N2a cells (N2a/wt) and N2a cells stably expressing human Swedish mutant amyloid precursor protein (APP) (N2a/APPswe) associated with familial early onset AD. CUR treatment induced restoration of NEP gene via CpG demethylation. This CUR-mediated upregulation of NEP expression was also concomitant with the inhibition of AKT, subsequent suppression of nuclear transcription factor-κB (NF-κB) and its downstream pro-inflammatory targets including COX-2, iNOS in N2a/APPswe cells. This study represents the first evidence on a link between CpG demethylation effect on NEP and anti-inflammation ability of CUR that may provide a novel mechanistic insight into the anti-inflammatory actions of CUR as well as new basis for using CUR as a therapeutic intervention for AD.

  20. Identification of a boron nitride nanosphere-binding peptide for the intracellular delivery of CpG oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Zhang, Huijie; Yamazaki, Tomohiko; Zhi, Chunyi; Hanagata, Nobutaka

    2012-09-01

    CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7 (BNNS-BP7) were taken up by cells and showed no cytotoxicity, and CpG ODNs were successfully crosslinked with BP7 to create BP7-CpG ODN conjugates. Using BP7 as a linker, the loading efficiency of CpG ODNs on BNNS increased 5-fold compared to the direct binding of CpG ODNs to BNNS. Furthermore, the BP7-CpG ODN conjugate-loaded BNNS had a greater capacity to induce interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) production from peripheral blood mononuclear cells (PBMCs) than that of CpG ODNs directly loaded on BNNS. The higher amount of cytokine induction by BP7-CpG ODN conjugate-loaded BNNS may be attributed to a higher loading capacity and stronger binding to BNNS of the linker BP7. The greater functionality of BP7-conjugated CpG ODNs on BNNS expands the potential of BNNS for drug delivery applications.CpG oligonucleotides (CpG ODNs) interact with Toll-like receptor 9 (TLR9), which results in the induction of immunostimulatory cytokines. We delivered CpG ODNs intracellularly using boron nitride nanospheres (BNNS). To enhance the loading capacity of CpG ODNs on BNNS, we used a phage display technique to identify a 12-amino acid peptide designated as BP7, with specific affinity for BNNS, and used it as a linker to load CpG ODNs on BNNS. The tyrosine residue (Y) at the eighth position from the N-terminus played a crucial role in the affinity of BP7 to BNNS. BNNS that bound BP7

  1. Paternity and inheritance of wealth

    NASA Astrophysics Data System (ADS)

    Hartung, John

    1981-06-01

    One of the oldest conjectures in anthropology is that men transfer wealth to their sister's son when the biological paternity of their `own' children is in doubt1-12. Because maternity is certain, a man is necessarily related to his sister's son and his brother (see Fig. 1). It is argued here that relatedness to male heirs can be assured by passing wealth to sister's sons or down a line of brothers, whether the prevailing kinship system reckons those brothers matrilineally or patrilineally. It is also argued that when several transfers of wealth are considered, a man's likelihood of being cuckolded need not be unrealistically high13 for his successive matrilineal heirs to be more related to him than his successive patrilineal heirs (see Fig. 2). Cross-cultural data on sister's son/brother inheritance14 and frequency of extramarital sex for females15 support the hypothesis that men tend to transmit wealth to their sister's son and/or brother when the probability that their putative children are their genetic children is relatively low.

  2. Coalgebraic structure of genetic inheritance.

    PubMed

    Tian, Jianjun; Li, Bai-Lian

    2004-09-01

    Although in the broadly defined genetic algebra, multiplication suggests a forward direction of from parents to progeny, when looking from the reverse direction, it also suggests to us a new algebraic structure-coalge- braic structure, which we call genetic coalgebras. It is not the dual coalgebraic structure and can be used in the construction of phylogenetic trees. Math- ematically, to construct phylogenetic trees means we need to solve equations x([n]) = a, or x([n]) = b. It is generally impossible to solve these equations inalgebras. However, we can solve them in coalgebras in the sense of tracing back for their ancestors. A thorough exploration of coalgebraic structure in genetics is apparently necessary. Here, we develop a theoretical framework of the coalgebraic structure of genetics. From biological viewpoint, we defined various fundamental concepts and examined their elementary properties that contain genetic significance. Mathematically, by genetic coalgebra, we mean any coalgebra that occurs in genetics. They are generally noncoassociative and without counit; and in the case of non-sex-linked inheritance, they are cocommutative. Each coalgebra with genetic realization has a baric property. We have also discussed the methods to construct new genetic coalgebras, including cocommutative duplication, the tensor product, linear combinations and the skew linear map, which allow us to describe complex genetic traits. We also put forward certain theorems that state the relationship between gametic coalgebra and gametic algebra. By Brower's theorem in topology, we prove the existence of equilibrium state for the in-evolution operator.

  3. Inherited disorders of blood coagulation.

    PubMed

    Lippi, Giuseppe; Franchini, Massimo; Montagnana, Martina; Favaloro, Emmanuel J

    2012-08-01

    Hemostasis is traditionally defined as a physiological response to blood vessel injury and bleeding, which entails a co-ordinated process involving the blood vessel, platelets, and blood clotting proteins (i.e. coagulation factors). Hemostasis can be divided into primary and secondary components. The former rapidly initiates after endothelial damage and is characterized by vascular contraction, platelet adhesion, and formation of a soft aggregate plug. The latter is initiated following the release of tissue factor and involves a complex sequence of events known as the blood coagulation cascade, encompassing serial steps where each coagulation factor activates another in a chain reaction that culminates in the conversion of fibrinogen to fibrin. Patients carrying abnormalities of the coagulation cascade (i.e. deficiencies of coagulation factors) have an increased bleeding tendency, where the clinical severity is mostly dependent upon the type and the plasma level of the factor affected. These disorders also impose a heavy medical and economic burden on individual patients and society in general. The aim of this article is to provide a general overview on the pathophysiology, clinics, diagnostics, and therapy of inherited disorders of coagulation factors.

  4. Treatable inherited rare movement disorders.

    PubMed

    Jinnah, H A; Albanese, Alberto; Bhatia, Kailash P; Cardoso, Francisco; Da Prat, Gustavo; de Koning, Tom J; Espay, Alberto J; Fung, Victor; Garcia-Ruiz, Pedro J; Gershanik, Oscar; Jankovic, Joseph; Kaji, Ryuji; Kotschet, Katya; Marras, Connie; Miyasaki, Janis M; Morgante, Francesca; Munchau, Alexander; Pal, Pramod Kumar; Rodriguez Oroz, Maria C; Rodríguez-Violante, Mayela; Schöls, Ludger; Stamelou, Maria; Tijssen, Marina; Uribe Roca, Claudia; de la Cerda, Andres; Gatto, Emilia M

    2017-09-01

    There are many rare movement disorders, and new ones are described every year. Because they are not well recognized, they often go undiagnosed for long periods of time. However, early diagnosis is becoming increasingly important. Rapid advances in our understanding of the biological mechanisms responsible for many rare disorders have enabled the development of specific treatments for some of them. Well-known historical examples include Wilson disease and dopa-responsive dystonia, for which specific and highly effective treatments have life-altering effects. In recent years, similarly specific and effective treatments have been developed for more than 30 rare inherited movement disorders. These treatments include specific medications, dietary changes, avoidance or management of certain triggers, enzyme replacement therapy, and others. This list of treatable rare movement disorders is likely to grow during the next few years because a number of additional promising treatments are actively being developed or evaluated in clinical trials. © 2017 International Parkinson and Movement Disorder Society. © 2017 International Parkinson and Movement Disorder Society.

  5. Thrombosis in Inherited Fibrinogen Disorders

    PubMed Central

    Korte, Wolfgang; Poon, Man-Chiu; Iorio, Alfonso; Makris, Michael

    2017-01-01

    Although inherited fibrinogen disorders (IFD) are primarily considered to be bleeding disorders, they are associated with a higher thrombotic complication risk than defects in other clotting factors. Managing IFD patients with thrombosis is challenging as anticoagulant treatment may exacerbate the underlying bleeding risk which can be life-threatening. Due to the low prevalence of IFD, there is little information on pathophysiology or optimal treatment of thrombosis in these patients. We searched the literature for cases of thrombosis among IFD patients and identified a total of 128 patient reports. In approximately half of the cases, thromboses were spontaneous, while in the others trauma, surgery, and parturition contributed to the risk. The true mechanism(s) of thrombosis in IFD patients remain to be elucidated. A variety of anticoagulant treatments have been used in the treatment or prevention of thrombosis, sometimes with concurrent fibrinogen replacement therapy. There is no definite evidence that fibrinogen supplementation increases the risk of thrombosis, and it may potentially be effective in the treatment and prevention of both thrombosis and hemorrhage in IFD patients. PMID:28503122

  6. Leading the Team You Inherit.

    PubMed

    Watkins, Michael D

    2016-06-01

    Most leaders don't have the luxury of building their teams from scratch. Instead they're put in charge of an existing group, and they need guidance on the best way to take over and improve performance. Watkins, an expert on transitions, suggests a three-step approach: Assess. Act quickly to size up the personnel you've inherited, systematically gathering data from one-on-one chats, team meetings, and other sources. Reflect, too, on the business challenges you face, the kinds of people you want in various roles, and the degree to which they need to collaborate. Reshape. Adjust the makeup of the team by moving people to new positions, shifting their responsibilities, or replacing them. Make sure that everyone is aligned on goals and how to achieve them--you may need to change the team's stated direction. Consider also making changes in the way the team operates (reducing the frequency of meetings, for example, or creating new subteams). Then establish ground rules and processes to sustain desired behaviors, and revisit those periodically. Accelerate team development. Set your people up for some early wins. Initial successes will boost everyone's confidence and reinforce the value of your new operating model, thus paving the way for ongoing growth.

  7. Impact of prophylactic CpG Oligodeoxynucleotide application on implant-associated Staphylococcus aureus bone infection.

    PubMed

    Sethi, Shneh; Thormann, Ulrich; Sommer, Ursula; Stötzel, Sabine; Mohamed, Walid; Schnettler, Reinhard; Domann, Eugen; Chakraborty, Trinad; Alt, Volker

    2015-09-01

    TLR-9 ligand CpG oligodeoxynucleotide type B (CpG ODN) induces a proinflammatory environment. We evaluated the effects of a preoperative CpG ODN application in an implant-associated Staphylococcus aureus bone infection model by monitoring bacterial loads and cytokine and chemokine levels. A total of 95 rats were used in four different groups: CpG ODN group (group 1; n=25), non-CpG-ODN group (group 2; n=25); saline pretreatment (group 3; n=25), and one uninfected group (group 4; n=20). A single dose of CpG-ODN was administered to the left tibialis anterior muscle 3days prior to surgery and the tibia midshaft was osteotomized, stabilized by an intramedullary implant and subsequently contaminated with 10(3) colony forming units (CFUs) of S. aureus in groups 1-3. The osteotomy gap in animals of group 4 was not contaminated with S. aureus and those animals did not receive any pretreatment. CpG ODN administration resulted in significant reduction of the bacterial load in tibia tissue homogenate and on the implant surface on day 1 post-infection compared to non-CpG-ODN pretreatment (p<0.05; p<0.05). Reductions in bacterial CFUs, compared to non-treated (saline) controls, were approximately 67% and 77% for bone tissue homogenates and implants. No bacteria were detected in uninfected rats. Early reduction of bacterial CFUs in the tibia was accompanied by increased levels of proinflammatory mediators MIP-2, IL-1β and RANTES in bone tissue milieu of the CpG ODN treated group compared to controls. At day 42 post-infection, bone marrow tissue of rats pretreated with CpG ODN had comparable high bacterial CFU numbers as the non-CpG ODN or saline treated groups. Microbiological analysis of implants removed from CpG ODN treated rats showed high bacterial growth densities on their surfaces which were not different from those observed in controls. In histology, all animals of groups 1-3 showed established infected non-unions. Additionally, inflammatory mediator profiles in bone

  8. Effect of pain in pediatric inherited neuropathies.

    PubMed

    Ramchandren, Sindhu; Jaiswal, Mamta; Feldman, Eva; Shy, Michael

    2014-03-04

    Assess the prevalence and impact of pain in children with Charcot-Marie-Tooth (CMT) disease. In this prospective cross-sectional study on children with CMT disease seen at study sites of the Inherited Neuropathy Consortium, we collected standardized assessments of pain (Wong-Baker FACES Pain Rating Scale) from 176 patients (140 children aged 8-18 years, and 36 children aged 2-7 years through parent proxies), along with standardized clinical assessments and quality-of-life (QOL) outcomes. We then developed a series of multivariate regression models to determine whether standardized measures of neuropathy severity, functional impact, or structural changes to the feet explained the observed pain scores. The mean score on the Wong-Baker FACES Pain Rating Scale was 2 (range 0-5). Increased pain strongly correlated with worse QOL scores but not with more severe neuropathy. Independent determinants of increased pain in children with CMT disease included measures of ankle inflexibility. Pain is present in children with CMT disease and negatively affects QOL. Pain scores do not positively correlate with neuropathy severity but do correlate in limited univariate analyses with measures of ankle inflexibility. Further studies to elucidate the mechanisms of pain may help identify treatments that can reduce pain and improve QOL in patients with CMT disease.

  9. Nucleosomes Correlate with In Vivo Progression Pattern of De Novo Methylation of p16 CpG Islands in Human Gastric Carcinogenesis

    PubMed Central

    Lu, Zhe-Ming; Zhou, Jing; Wang, Xiuhong; Guan, Zhenpo; Bai, Hua; Liu, Zhao-Jun; Su, Na; Pan, Kaifeng; Ji, Jiafu; Deng, Dajun

    2012-01-01

    Background The exact relationship between nucleosome positioning and methylation of CpG islands in human pathogenesis is unknown. Methodology/Principal Findings In the present study, we characterized the nucleosome position within the p16 CpG island and established a seeding methylation-specific PCR (sMSP) assay based on bisulfite modification to enrich the p16 alleles containing methylated-CpG at the methylation “seeding" sites within its intron-1 in gastric carcinogenesis. The sMSP-positive rate in primary gastric carcinoma (GC) samples (36/40) was significantly higher than that observed in gastritis (19/45) or normal samples (7/13) (P<0.01). Extensive clone sequencing of these sMSP products showed that the density of methylated-CpGs in p16 CpG islands increased gradually along with the severity of pathological changes in gastric tissues. In gastritis lesions the methylation was frequently observed in the region corresponding to the exon-1 coding-nucleosome and the 5′UTR-nucleosome; the methylation was further extended to the region corresponding to the promoter-nucleosome in GC samples. Only few methylated-CpG sites were randomly detected within p16 CpG islands in normal tissues. The significantly inversed relationship between the p16 exon-1 methylation and its transcription was observed in GC samples. An exact p16 promoter-specific 83 bp-MSP assay confirms the result of sMSP (33/55 vs. 1/6, P<0.01). In addition, p16 methylation in chronic gastritis lesions significantly correlated with H. pylori infection; however, such correlation was not observed in GC specimens. Conclusions/Significance It was determined that de novo methylation was initiated in the coding region of p16 exon-1 in gastritis, then progressed to its 5′UTR, and ultimately to the proximal promoter in GCs. Nucleosomes may function as the basic extension/progression unit of de novo methylation of p16 CpG islands in vivo. PMID:22558275

  10. Randomized, double-blind, placebo-controlled, safety and immunogenicity study of 4 formulations of Anthrax Vaccine Adsorbed plus CPG 7909 (AV7909) in healthy adult volunteers.

    PubMed

    Hopkins, Robert J; Daczkowski, Nancy F; Kaptur, Paulina E; Muse, Derek; Sheldon, Eric; LaForce, Craig; Sari, Suha; Rudge, Thomas L; Bernton, Edward

    2013-06-26

    A new anthrax vaccine that could accelerate the immune response and possibly reduce the number of injections needed for protection would be desirable in a post-exposure setting. This Phase 1 study compared the safety and immunogenicity of 2 IM doses (Days 0 and 14) of 4 formulations of AV7909 (AVA plus CPG 7909) with 2 IM doses of BioThrax(®) (Anthrax Vaccine Adsorbed) and 2 IM doses of saline placebo administered on Days 0 and 14. A total of 105 healthy adults 18-50 years of age were randomized to 1 of 6 study groups: BioThrax (0.5 mL), AV7909 Formulation 1 (0.5 mL AVA+0.5mg CPG 7909), AV7909 Formulation 2 (0.5 mL AVA+0.25mg CPG 7909), AV7909 Formulation 3 (0.25 mL AVA+0.5mg CPG 7909), AV7909 Formulation 4 (0.25 mL AVA+0.25mg CPG 7909), or saline placebo (0.5 mL). All randomized subjects received at least 1 vaccination, and 100 subjects completed the trial. After 2 doses, mean peak normalized toxin neutralizing antibody responses (TNA NF50) in the AV7909 groups were higher than in the BioThrax group. Differences among the 4 AV7909 groups were not statistically significant. Subjects who received AV7909 reached peak titers on Day 28 vs. Day 35 in the BioThrax group. The most common adverse events (AEs) in the BioThrax and AV7909 groups assessed as related to vaccination were injection site reactions. Transient lymphopenia was observed after the first dose in each AV7909 group. Frequencies of injection site and systemic reactions recorded by subjects in diaries for 7 days after each injection were highest with AV7909 Formulation 1. No AEs of special interest (autoimmune events) were observed in the study. Further studies of doses and dosing regimens are planned to assess the immunogenicity and reactogenicity of AV7909.

  11. Randomized, Double-Blind, Placebo-Controlled, Safety and Immunogenicity Study of 4 Formulations of Anthrax Vaccine Adsorbed Plus CPG 7909 (AV7909) in Healthy Adult Volunteers

    PubMed Central

    Hopkins, Robert J.; Daczkowski, Nancy F.; Kaptur, Paulina E.; Muse, Derek; Sheldon, Eric; LaForce, Craig; Sari, Suha; Rudge, Thomas L.; Bernton, Edward

    2013-01-01

    A new anthrax vaccine that could accelerate the immune response and possibly reduce the number of injections needed for protection would be desirable in a post-exposure setting. This Phase 1 study compared the safety and immunogenicity of 2 IM doses (Days 0 and 14) of 4 formulations of AV7909 (AVA plus CPG 7909) with 2 IM doses of BioThrax® (Anthrax Vaccine Adsorbed) and 2 IM doses of saline placebo administered on Days 0 and 14. A total of 105 healthy adults 18 to 50 years of age were randomized to 1 of 6 study groups: BioThrax (0.5 mL), AV7909 Formulation 1 (0.5 mL AVA + 0.5 mg CPG 7909), AV7909 Formulation 2 (0.5 mL AVA + 0.25 mg CPG 7909), AV7909 Formulation 3 (0.25 mL AVA + 0.5 mg CPG 7909), AV7909 Formulation 4 (0.25 mL AVA + 0.25 mg CPG 7909), or saline placebo (0.5 mL). All randomized subjects received at least 1 vaccination, and 100 subjects completed the trial. After 2 doses, mean peak normalized toxin neutralizing antibody responses (TNA NF50) in the AV7909 groups were higher than in the BioThrax group. Differences among the 4 AV7909 groups were not statistically significant. Subjects who received AV7909 reached peak titers on Day 28 vs. Day 35 in the BioThrax group. The most common adverse events (AEs) in the BioThrax and AV7909 groups assessed as related to vaccination were injection site reactions. Transient lymphopenia was observed after the first dose in each AV7909 group. Frequencies of injection site and systemic reactions recorded by subjects in diaries for 7 days after each injection were highest with AV7909 Formulation 1. No AEs of special interest (autoimmune events) were observed in the study. Further studies of doses and dosing regimens are planned to assess the immunogenicity and reactogenicity of AV7909. PMID:23701746

  12. An interspecies analysis reveals a key role for unmethylated CpG dinucleotides in vertebrate Polycomb complex recruitment

    PubMed Central

    Lynch, Magnus D; Smith, Andrew J H; De Gobbi, Marco; Flenley, Maria; Hughes, Jim R; Vernimmen, Douglas; Ayyub, Helena; Sharpe, Jacqueline A; Sloane-Stanley, Jacqueline A; Sutherland, Linda; Meek, Stephen; Burdon, Tom; Gibbons, Richard J; Garrick, David; Higgs, Douglas R

    2012-01-01

    The role of DNA sequence in determining chromatin state is incompletely understood. We have previously demonstrated that large chromosomal segments from human cells recapitulate their native chromatin state in mouse cells, but the relative contribution of local sequences versus their genomic context remains unknown. In this study, we compare orthologous chromosomal regions for which the human locus establishes prominent sites of Polycomb complex recruitment in pluripotent stem cells, whereas the corresponding mouse locus does not. Using recombination-mediated cassette exchange at the mouse locus, we establish the primacy of local sequences in the encoding of chromatin state. We show that the signal for chromatin bivalency is redundantly encoded across a bivalent domain and that this reflects competition between Polycomb complex recruitment and transcriptional activation. Furthermore, our results suggest that a high density of unmethylated CpG dinucleotides is sufficient for vertebrate Polycomb recruitment. This model is supported by analysis of DNA methyltransferase-deficient embryonic stem cells. PMID:22056776

  13. The Genomic Impact of DNA CpG Methylation on Gene Expression; Relationships in Prostate Cancer.

    PubMed

    Long, Mark D; Smiraglia, Dominic J; Campbell, Moray J

    2017-02-14

    The process of DNA CpG methylation has been extensively investigated for over 50 years and revealed associations between changing methylation status of CpG islands and gene expression. As a result, DNA CpG methylation is implicated in the control of gene expression in developmental and homeostasis processes, as well as being a cancer-driver mechanism. The development of genome-wide technologies and sophisticated statistical analytical approaches has ushered in an era of widespread analyses, for example in the cancer arena, of the relationships between altered DNA CpG methylation, gene expression, and tumor status. The remarkable increase in the volume of such genomic data, for example, through investigators from the Cancer Genome Atlas (TCGA), has allowed dissection of the relationships between DNA CpG methylation density and distribution, gene expression, and tumor outcome. In this manner, it is now possible to test that the genome-wide correlations are measurable between changes in DNA CpG methylation and gene expression. Perhaps surprisingly is that these associations can only be detected for hundreds, but not thousands, of genes, and the direction of the correlations are both positive and negative. This, perhaps, suggests that CpG methylation events in cancer systems can act as disease drivers but the effects are possibly more restricted than suspected. Additionally, the positive and negative correlations suggest direct and indirect events and an incomplete understanding. Within the prostate cancer TCGA cohort, we examined the relationships between expression of genes that control DNA methylation, known targets of DNA methylation and tumor status. This revealed that genes that control the synthesis of S-adenosyl-l-methionine (SAM) associate with altered expression of DNA methylation targets in a subset of aggressive tumors.

  14. Interplay of Promoter Usage and Intragenic CpG Content: Impact on GFP Reporter Gene Expression.

    PubMed

    Krinner, Simone; Heitzer, Asli; Asbach, Benedikt; Wagner, Ralf

    2015-12-01

    Successful therapeutic protein production in vitro and in vivo requires efficient and long-term transgene expression supported by optimized vector and transgene cis-regulatory sequence elements. This study provides a comparative analysis of CpG-rich, highly expressed, versus CpG-depleted, poorly expressed green fluorescent protein (GFP) reporter transgenes, transcribed by various promoters in two different cell systems. Long-term GFP expression from a defined locus in stable Chinese hamster ovary cells was clearly influenced by the combination of transgene CpG content and promoter usage, as shown by differential silencing effects on selection pressure removal among the cytomegalovirus (CMV) promoter and elongation factor (EF)-1α promoter. Whereas a high intragenic CpG content promoted local DNA methylation, CpG depletion rather accelerated transgene loss and increased the local chromatin density. On lentiviral transfer of various expression modules into epigenetically sensitive P19 embryonic pluripotent carcinoma cells, CMV promoter usage led to rapid gene silencing irrespective of the intragenic CpG content. In contrast, EF-1α promoter-controlled constructs showed delayed silencing activity and high-level transgene expression, in particular when the CpG-rich GFP reporter was used. Notably, GFP silencing in P19 cells could be prevented completely by the bidirectional, dual divergently transcribed A2UCOE (ubiquitously acting chromatin-opening element derived from the human HNRPA2B1-CBX3 locus) promoter. Because the level of GFP expression by the A2UCOE promoter was entirely unaffected by the intragenic CpG level, we suggest that A2UCOE can overcome chromatin compaction resulting from intragenic CpG depletion due to its ascribed chromatin-opening abilities. Our analyses provide insights into the interplay of the intragenic CpG content with promoter sequences and regulatory sequence elements, thus contributing toward the design of therapeutic transgene expression

  15. Inherited abnormalities of skeletal development in sheep.

    PubMed

    Thompson, K G; Piripi, S A; Dittmer, K E

    2008-09-01

    Inherited diseases of the skeleton are reported less often in sheep than in most other domestic animal species but are likely to occur more frequently than the veterinary literature would suggest. Although most are lethal or semi-lethal, the gene frequency for some of these diseases has reached surprisingly high levels in defined populations, presumably due either to the founder effect or the presence of a selective advantage of heterozygous individuals. This article reviews the clinical characteristics, pathology, mode of inheritance and molecular basis of skeletal diseases known to have a genetic aetiology in sheep. Inherited skeletal diseases of sheep are potential models for studying the treatment of similar diseases in humans.

  16. [INHERITANCE OF EPIDERMIS PIGMENTATION IN SUNFLOWER ACHENES].

    PubMed

    Gorohivets, N A; Vedmedeva, E V

    2016-01-01

    Inheritance of epidermis pigmentation in the pericarp of sunflower seeds was studied. Inheritance of pigmentation was confirmed by three alleles Ew (epidermis devoid of pigmentation), Estr (epidermal pigmentation in strips), Edg (solid pigmentation). Dominance of the lack of epidermis pigmentation over striped epidermis and striped epidermis over solid pigmentation was established. It was shown that the striped epidermis pigmentation and the presence of testa layer are controlled by two genes, expression of which is independent from each other. Yellowish hypodermis was discovered in the sample I2K2218, which is inherited monogenically dominantly.

  17. Law & psychiatry: Murder, inheritance, and mental illness.

    PubMed

    Gold, Azgad; Appelbaum, Paul S

    2011-07-01

    Should a murderer be allowed to inherit the victim's estate? The question dates from biblical times, but most jurisdictions today have statutes in place that bar inheritance by convicted murderers. However, a special problem arises when the killer has a severe mental illness and has been found not guilty by reason of insanity. Should such people, who have not been convicted of a crime, be permitted to collect their inheritance? Jurisdictions vary in their responses, with the rules reflecting a mix of practical and moral considerations influenced by different perspectives about what determines the behavior of persons with mental illness.

  18. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei.

    PubMed

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M

    2006-03-01

    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  19. CpG oligodeoxynucleotide stimulates protective innate immunity against human renal cell carcinoma xenografted in nude mice.

    PubMed

    Zhou, Pei-jun; Ma, Bin-bin; He, Wei; Xu, Da; Wang, Xiang-hui

    2011-09-01

    Renal cell carcinoma easily develops metastasis, which is highly resistant to a variety of therapies. Oligodeoxynucleotides containing unmethylated CpG motifs (CpG ODN) are potent activators of innate and adaptive immunity. CpG ODN is inclined to be used as vaccine adjuvant or in combination with other therapies to exert antitumor effect mediated by the adaptive immunity. Herein, we examined the antitumor effect of CpG ODN monotherapy and the role of innate immunity on human RCC Caki-1 cells xenografted in nude mice. Our results indicated that the peritumoral subcutaneous injections of CpG ODN1826 once a week resulted in significant inhibition of the growth of Caki-1 xenografts compared with the control groups, and the survival of tumor-bearing mice were also prolonged significantly. When cytotoxicity of splenic cells from host mice was assessed, it was found that CpG ODN1826 significantly promoted the cytotoxicities of splenocytes targeting primary Caki-1 cells or YAC-1 cells, indicating that the activity of natural killer cells in tumor-bearing nude mice was enhanced by CpG ODN1826 monotherapy. The serum concentrations of interleukin-12 were increased in mice treated with CpG ODN1826. Thus, CpG ODN1826 monotherapy induces significant inhibitory effects on the growth of human RCC xenografted in athymic immunodeficient mice, and the tumor-bearing mice achieves long-term survival, which might be attributed to enhanced innate immunity.

  20. Nonagonistic Dectin-1 ligand transforms CpG into a multitask nanoparticulate TLR9 agonist

    PubMed Central

    Kobiyama, Kouji; Aoshi, Taiki; Narita, Hirotaka; Kuroda, Etsushi; Hayashi, Masayuki; Tetsutani, Kohhei; Koyama, Shohei; Mochizuki, Shinichi; Sakurai, Kazuo; Katakai, Yuko; Yasutomi, Yasuhiro; Saijo, Shinobu; Iwakura, Yoichiro; Akira, Shizuo; Coban, Cevayir; Ishii, Ken J.

    2014-01-01

    CpG DNA, a ligand for Toll-like receptor 9 (TLR9), has been one of the most promising immunotherapeutic agents. Although there are several types of potent humanized CpG oligodeoxynucleotide (ODN), developing “all-in-one” CpG ODNs activating both B cells and plasmacytoid dendritic cells forming a stable nanoparticle without aggregation has not been successful. In this study, we generated a novel nanoparticulate K CpG ODN (K3) wrapped by the nonagonistic Dectin-1 ligand schizophyllan (SPG), K3-SPG. In sharp contrast to K3 alone, K3-SPG stimulates human peripheral blood mononuclear cells to produce a large amount of both type I and type II IFN, targeting the same endosome where IFN-inducing D CpG ODN resides without losing its K-type activity. K3-SPG thus became a potent adjuvant for induction of both humoral and cellular immune responses, particularly CTL induction, to coadministered protein antigens without conjugation. Such potent adjuvant activity of K3-SPG is attributed to its nature of being a nanoparticle rather than targeting Dectin-1 by SPG, accumulating and activating antigen-bearing macrophages and dendritic cells in the draining lymph node. K3-SPG acting as an influenza vaccine adjuvant was demonstrated in vivo in both murine and nonhuman primate models. Taken together, K3-SPG may be useful for immunotherapeutic applications that require type I and type II IFN as well as CTL induction. PMID:24516163

  1. CPG15 regulates synapse stability in the developing and adult brain

    PubMed Central

    Fujino, Tadahiro; Leslie, Jennifer H.; Eavri, Ronen; Chen, Jerry L.; Lin, Walter C.; Flanders, Genevieve H.; Borok, Erzsebet; Horvath, Tamas L.; Nedivi, Elly

    2011-01-01

    Use-dependent selection of optimal connections is a key feature of neural circuit development and, in the mature brain, underlies functional adaptation, such as is required for learning and memory. Activity patterns guide circuit refinement through selective stabilization or elimination of specific neuronal branches and synapses. The molecular signals that mediate activity-dependent synapse and arbor stabilization and maintenance remain elusive. We report that knockout of the activity-regulated gene cpg15 in mice delays developmental maturation of axonal and dendritic arbors visualized by anterograde tracing and diolistic labeling, respectively. Electrophysiology shows that synaptic maturation is also delayed, and electron microscopy confirms that many dendritic spines initially lack functional synaptic contacts. While circuits eventually develop, in vivo imaging reveals that spine maintenance is compromised in the adult, leading to a gradual attrition in spine numbers. Loss of cpg15 also results in poor learning. cpg15 knockout mice require more trails to learn, but once they learn, memories are retained. Our findings suggest that CPG15 acts to stabilize active synapses on dendritic spines, resulting in selective spine and arbor stabilization and synaptic maturation, and that synapse stabilization mediated by CPG15 is critical for efficient learning. PMID:22190461

  2. CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

    PubMed

    Kava, Hieronimus W; Murray, Vincent

    2016-10-01

    This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Gene silencing by DNA methylation and dual inheritance in Chinese hamster ovary cells.

    PubMed

    Paulin, R P; Ho, T; Balzer, H J; Holliday, R

    1998-06-01

    Chinese hamster ovary (CHO) cells strain D422, which has one copy of the adenine phosphoribosyl transferase (APRT) gene, were permeabilized by electroporation and treated with 5-methyl deoxycytidine triphosphate. Cells with a silenced APRT gene were selected on 2, 6-diaminopurine. Colonies were isolated and shown to be reactivated to APRT+ by 5-aza-cytidine and by selection in medium containing adenine, aminopterin and thymidine. Genomic DNA was prepared from eight isolates of independent origin and subjected to bisulphite treatment. This deaminates cytosine to uracil in single-stranded DNA but does not deaminate 5-methyl cytosine. PCR, cloning and sequencing revealed the methylation pattern of CpG doublets in the promoter region of the APRT- gene, whereas the active APRT gene had nonmethylated DNA. CHO strain K1, which has two copies of the APRT+ gene, could also be silenced by the same procedure but at a lower frequency. The availability of the 5-methyl dCTP-induced silencing, 5-aza-CR and a standard mutagen, ethyl methane sulphonate, makes it possible to follow concomitantly the inheritance of active, mutant or silenced gene copies. This analysis demonstrates "dual inheritance" at the APRT locus in CHO cells.

  4. Differential DNA Methylation Regions in Adult Human Sperm following Adolescent Chemotherapy: Potential for Epigenetic Inheritance

    PubMed Central

    Shnorhavorian, Margarett; Schwartz, Stephen M.; Stansfeld, Barbara; Sadler-Riggleman, Ingrid; Beck, Daniel

    2017-01-01

    Background The potential that adolescent chemotherapy can impact the epigenetic programming of the germ line to influence later life adult fertility and promote epigenetic inheritance was investigated. Previous studies have demonstrated a number of environmental exposures such as abnormal nutrition and toxicants can promote sperm epigenetic changes that impact offspring. Methods Adult males approximately ten years after pubertal exposure to chemotherapy were compared to adult males with no previous exposure. Sperm were collected to examine differential DNA methylation regions (DMRs) between the exposed and control populations. Gene associations and correlations to genetic mutations (copy number variation) were also investigated. Methods and Findings A signature of statistically significant DMRs was identified in the chemotherapy exposed male sperm. The DMRs, termed epimutations, were found in CpG desert regions of primarily 1 kilobase size. Observations indicate adolescent chemotherapy exposure can promote epigenetic alterations that persist in later life. Conclusions This is the first observation in humans that an early life chemical exposure can permanently reprogram the spermatogenic stem cell epigenome. The germline (i.e., sperm) epimutations identified suggest chemotherapy has the potential to promote epigenetic inheritance to the next generation. PMID:28146567

  5. The regulation of TIM-3 transcription in T cells involves c-Jun binding but not CpG methylation at the TIM-3 promoter.

    PubMed

    Yun, Su Jin; Jun, Ka-Jung; Komori, Kuniharu; Lee, Mi Jin; Kwon, Myung-Hee; Chwae, Yong-Joon; Kim, Kyongmin; Shin, Ho-Joon; Park, Sun

    2016-07-01

    Tim-3 is an immunomodulatory protein that is expressed constitutively on monocytes but is induced in activated T cells. The mechanisms involved in the regulation of TIM-3 transcription are poorly understood. In the present study, we investigated whether methylation of the TIM-3 promoter is involved in regulatingTIM-3 transcription in T cells, and identified a transcription factor that regulates TIM-3 transcription by associating with the TIM-3 minimal promoter region. Pyrosequencing of the TIM-3 promoter up to -1440bp revealed 11 hypermethylated CpG sites and 4 hypomethylated CpG sites in human CD4(+) T cells as well as in CD11b(+) cells. Dimethylation of histone H3 lysine 4 (H3K4), a mark of transcriptional activation, was predominantly found in the proximal TIM-3 promoter -954 to -34bp region, whereas trimethylation of H3K9 and H3K27, which are markers of transcriptional suppression, were mostly observed in the distal promoter -1549 to -1048bp region in human CD4(+) T cells and CD11b(+) cells. However, no change in the methylation status of CpG sites and the histone H3 in the TIM-3 promoter was found during induction of TIM-3 transcription in T cells. Finally, AP-1 involvement in TIM-3 transcription was shown in relation with the TIM-3 minimal promoter -146 to +144bp region. The present study defines the minimal TIM-3 promoter region and demonstrates its interaction with c-Jun during TIM-3 transcription in CD4(+) T cells.

  6. Hypermutable non-synonymous sites are under stronger negative selection.

    PubMed

    Schmidt, Steffen; Gerasimova, Anna; Kondrashov, Fyodor A; Adzhubei, Ivan A; Adzuhbei, Ivan A; Kondrashov, Alexey S; Sunyaev, Shamil

    2008-11-01

    Mutation rate varies greatly between nucleotide sites of the human genome and depends both on the global genomic location and the local sequence context of a site. In particular, CpG context elevates the mutation rate by an order of magnitude. Mutations also vary widely in their effect on the molecular function, phenotype, and fitness. Independence of the probability of occurrence of a new mutation's effect has been a fundamental premise in genetics. However, highly mutable contexts may be preserved by negative selection at important sites but destroyed by mutation at sites under no selection. Thus, there may be a positive correlation between the rate of mutations at a nucleotide site and the magnitude of their effect on fitness. We studied the impact of CpG context on the rate of human-chimpanzee divergence and on intrahuman nucleotide diversity at non-synonymous coding sites. We compared nucleotides that occupy identical positions within codons of identical amino acids and only differ by being within versus outside CpG context. Nucleotides within CpG context are under a stronger negative selection, as revealed by their lower, proportionally to the mutation rate, rate of evolution and nucleotide diversity. In particular, the probability of fixation of a non-synonymous transition at a CpG site is two times lower than at a CpG site. Thus, sites with different mutation rates are not necessarily selectively equivalent. This suggests that the mutation rate may complement sequence conservation as a characteristic predictive of functional importance of nucleotide sites.

  7. Hypermutable Non-Synonymous Sites Are under Stronger Negative Selection

    PubMed Central

    Kondrashov, Fyodor A.; Adzuhbei, Ivan A.; Kondrashov, Alexey S.; Sunyaev, Shamil

    2008-01-01

    Mutation rate varies greatly between nucleotide sites of the human genome and depends both on the global genomic location and the local sequence context of a site. In particular, CpG context elevates the mutation rate by an order of magnitude. Mutations also vary widely in their effect on the molecular function, phenotype, and fitness. Independence of the probability of occurrence of a new mutation's effect has been a fundamental premise in genetics. However, highly mutable contexts may be preserved by negative selection at important sites but destroyed by mutation at sites under no selection. Thus, there may be a positive correlation between the rate of mutations at a nucleotide site and the magnitude of their effect on fitness. We studied the impact of CpG context on the rate of human–chimpanzee divergence and on intrahuman nucleotide diversity at non-synonymous coding sites. We compared nucleotides that occupy identical positions within codons of identical amino acids and only differ by being within versus outside CpG context. Nucleotides within CpG context are under a stronger negative selection, as revealed by their lower, proportionally to the mutation rate, rate of evolution and nucleotide diversity. In particular, the probability of fixation of a non-synonymous transition at a CpG site is two times lower than at a CpG site. Thus, sites with different mutation rates are not necessarily selectively equivalent. This suggests that the mutation rate may complement sequence conservation as a characteristic predictive of functional importance of nucleotide sites. PMID:19043566

  8. Inherited Disorders of Calcium and Phosphate Metabolism

    PubMed Central

    Gattineni, Jyothsna

    2014-01-01

    Purpose of Review Inherited disorders of calcium and phosphate homeostasis have variable presentation and can cause significant morbidity. Understanding the mode of inheritance and pathophysiology of these conditions will help in the diagnosis and early institution of therapy. Recent Findings Identification of genetic mutations in human subjects and animal models has advanced our understanding of many inherited disorders of calcium and phosphate regulation. Identification of mutations of CaSR also has improved our understanding of hypocalcemic and hypercalcemic conditions. Mutations of Fgf23, Klotho and phosphate transporter genes have been identified as causes for disorders of phosphate metabolism. Summary Calcium and phosphate homeostasis is tightly regulated in a narrow range due to their vital role in many biological processes. Inherited disorders of calcium and phosphate metabolism though uncommon can have severe morbidity. Genetic counseling of the affected families is an important part of the follow up of these patients. PMID:24553630

  9. Inherited disorders of calcium and phosphate metabolism.

    PubMed

    Gattineni, Jyothsna

    2014-04-01

    Inherited disorders of calcium and phosphate homeostasis have variable presentation and can cause significant morbidity. An understanding of the mode of inheritance and pathophysiology of these conditions will help in the diagnosis and early institution of therapy. Identification of genetic mutations in humans and animal models has advanced our understanding of many inherited disorders of calcium and phosphate regulation. Identification of mutations of calcium-sensing receptor has improved our understanding of hypocalcemic and hypercalcemic conditions. Mutations of Fgf23, Klotho and phosphate transporter genes have been identified to cause disorders of phosphate metabolism. Calcium and phosphate homeostasis is tightly regulated in a narrow range due to their vital role in many biological processes. Inherited disorders of calcium and phosphate metabolism though uncommon can have severe morbidity. Genetic counseling of the affected families is an important part of the follow-up of these patients.

  10. Center for Inherited Disease Research (CIDR)

    Cancer.gov

    The Center for Inherited Disease Research (CIDR) Program at The Johns Hopkins University provides high-quality next generation sequencing and genotyping services to investigators working to discover genes that contribute to common diseases.

  11. Developmental origins of epigenetic transgenerational inheritance

    PubMed Central

    Hanson, Mark A.; Skinner, Michael K.

    2016-01-01

    Environmental factors can induce epigenetic alterations in the germ cells that can potentially be transmitted transgenerationally. This non-genetic form of inheritance is termed epigenetic transgenerational inheritance and has been shown in a variety of species including plants, flies, worms, fish, rodents, pigs, and humans. This phenomenon operates during specific critical windows of exposure, linked to the developmental biology of the germ cells (sperm and eggs). Therefore, concepts of the developmental origins of transgenerational inheritance of phenotypic variation and subsequent disease risk need to include epigenetic processes affecting the developmental biology of the germ cell. These developmental impacts on epigenetic transgenerational inheritance, in contrast to multigenerational exposures, are the focus of this Perspective. PMID:27390622

  12. Developmental origins of epigenetic transgenerational inheritance.

    PubMed

    Hanson, Mark A; Skinner, Michael K

    Environmental factors can induce epigenetic alterations in the germ cells that can potentially be transmitted transgenerationally. This non-genetic form of inheritance is termed epigenetic transgenerational inheritance and has been shown in a variety of species including plants, flies, worms, fish, rodents, pigs, and humans. This phenomenon operates during specific critical windows of exposure, linked to the developmental biology of the germ cells (sperm and eggs). Therefore, concepts of the developmental origins of transgenerational inheritance of phenotypic variation and subsequent disease risk need to include epigenetic processes affecting the developmental biology of the germ cell. These developmental impacts on epigenetic transgenerational inheritance, in contrast to multigenerational exposures, are the focus of this Perspective.

  13. Patterns of inheritance in familial ALS.

    PubMed

    Bradley, Marcus; Bradley, Lloyd; de Belleroche, Jackie; Orrell, Richard W

    2005-05-10

    We investigated 185 families with ALS for evidence of anticipation and mitochondrial inheritance. Although initial analysis demonstrated significant anticipation of age at death between generations in patients with familial ALS, further analysis demonstrated features of regression to the mean, suggesting that the perceived differences are the result of bias. In addition, there was no evidence of an effect of preferential maternal inheritance, which would have supported transmission of mitochondrial DNA mutations.

  14. Inheritance and Synchronization in Concurrent OOP

    NASA Astrophysics Data System (ADS)

    Briot, Jean-Pierre; Yonezawa, Akinori

    This paper discusses knowledge sharing (inheritance) mechanisms for Object-Oriented Programming (OOP) in the context of concurrent (distributed) languages. We review three different schemes: inheritance, delegation and copy. A fourth model, called recipe-query, is presented and all are compared and criticized. Techniques relying on the shared memory assumption are rejected. We point out the conflict between distributing knowledge among objects and the synchronization of concurrent objects.

  15. Stability with Inheritance in the Conditional Strategy.

    PubMed

    Gross; Repka

    1998-06-21

    The conditional strategy is a theoretical framework that explains the existence within populations of individuals that express alternative behavioral, physical or life history tactics (phenotypes). An example is fighters and sneakers in many animal mating systems. In the conditional strategy the alternative tactics are chosen by individuals based on their state, for example large or small bodied. Since state is often heritable, due for example to additive genetic variance, the alternative tactics may also have inheritance. As the tactics do not have equal fitnesses, it is generally believed that any such inheritance would prevent the evolutionary stability of the conditional strategy. However, in previous work we introduced an Inheritance Theorem and were able to prove that a conditional strategy with tactic inheritances can have a unique equilibrium proportion of the tactics. We now prove a second property of our Inheritance Theorem, namely the stability of the equilibrium. This means that if the tactics are perturbed from their equilibrium proportions, they will return across generations to their equilibrium proportions. An example is provided in mites. We have therefore established an Inheritance Theorem which includes both the existence of an equilibrium and its stability for alternative tactics in a conditional strategy.Copyright 1998 Academic Press Limited

  16. A role for ubiquitination in mitochondrial inheritance in Saccharomyces cerevisiae.

    PubMed

    Fisk, H A; Yaffe, M P

    1999-06-14

    The smm1 mutation suppresses defects in mitochondrial distribution and morphology caused by the mdm1-252 mutation in the yeast Saccharomyces cerevisiae. Cells harboring only the smm1 mutation themselves display temperature-sensitive growth and aberrant mitochondrial inheritance and morphology at the nonpermissive temperature. smm1 maps to RSP5, a gene encoding an essential ubiquitin-protein ligase. The smm1 defects are suppressed by overexpression of wild-type ubiquitin but not by overexpression of mutant ubiquitin in which lysine-63 is replaced by arginine. Furthermore, overexpression of this mutant ubiquitin perturbs mitochondrial distribution and morphology in wild-type cells. Site-directed mutagenesis revealed that the ubiquitin ligase activity of Rsp5p is essential for its function in mitochondrial inheritance. A second mutation, smm2, which also suppressed mdm1-252 defects, but did not cause aberrant mitochondrial distribution and morphology, mapped to BUL1, encoding a protein interacting with Rsp5p. These results indicate that protein ubiquitination mediated by Rsp5p plays an essential role in mitochondrial inheritance, and reveal a novel function for protein ubiquitination.

  17. The role of individual inheritance in tumor progression and metastasis.

    PubMed

    Hunter, Kent

    2015-07-01

    Metastasis, the dissemination and growth of tumor cells at secondary sites, is the primary cause of patient mortality from solid tumors. Metastasis is an extremely complex, inefficient process requiring contributions of not only the tumor cell but also local and distant environmental factors, at both the cellular and molecular level. Variation in the function of any of the steps in the metastatic cascade may therefore have profound implications for the ultimate course of the disease. In addition to the somatic and cellular heterogeneity that can affect cancer outcome, an individual's specific ancestry or genetic background can also significantly influence metastatic progression. These inherited variants not only encoded for metastatic susceptibility but also provided a window to study critical factors that are not easily accessible with current technologies. Furthermore, investigations into inherited metastatic susceptibility enable identification of important molecular and cellular processes that are not subject to mutation and are consequently not detectable by standard cancer genome sequencing strategies. Incorporation of inherited variation into metastasis research therefore provides methods to more comprehensively investigate the etiology of the lethal consequences of tumor progression.

  18. A specific CpG oligodeoxynucleotide induces protective antiviral responses against grass carp reovirus in grass carp Ctenopharyngodon idella.

    PubMed

    Su, Hang; Yuan, Gailing; Su, Jianguo

    2016-07-01

    CpG oligodeoxynucleotides (ODNs) show strong immune stimulatory activity in vertebrate, however, they possess specific sequence feature among species. In this study, we screened out an optimal CpG ODN sequence for grass carp (Ctenopharyngodon idella), 1670A 5'-TCGAACGTTTTAACGTTTTAACGTT-3', from six published sequences and three sequences designed by authors based on grass carp head kidney mononuclear cells and CIK (C. idella kidney) cells proliferation. VP4 mRNA expression was strongly inhibited by CpG ODN 1670A in CIK cells with GCRV infection, showing its strong antiviral activity. The mechanism via toll-like receptor 9 (TLR9)-mediated signaling pathway was measured by real-time quantitative RT-PCR, and TLR21 did not play a role in the immune response to CpG ODN. The late up-regulation of CiRIG-I mRNA expression indicated that RIG-I-like receptors (RLRs) signaling pathway participated in the immune response to CpG ODN which is the first report on the interaction between CpG and RLRs. We also found that the efficient CpG ODN can activates interferon system. Infected with GCRV, type I interferon expression was reduced and type II interferon was induced by the efficient CpG ODN in CIK cells, especially IFNγ2, suggesting that IFNγ2 played an important role in response to the efficient CpG ODN. These results provide a theoretical basis and new development trend for further research on CpG and the application of CpG vaccine adjuvant in grass carp disease control.

  19. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  20. Identification and validation of highly frequent CpG island hypermethylation in colorectal adenomas and carcinomas.

    PubMed

    Oster, Bodil; Thorsen, Kasper; Lamy, Philippe; Wojdacz, Tomasz K; Hansen, Lise Lotte; Birkenkamp-Demtröder, Karin; Sørensen, Karina D; Laurberg, Søren; Orntoft, Torben F; Andersen, Claus L

    2011-12-15

    In our study, whole-genome methylation arrays were applied to identify novel genes with tumor specific DNA methylation of promoter CpG islands in pre-malignant and malignant colorectal lesions. Using a combination of Illumina HumanMethylation27 beadchips, Methylation-Sensitive High Resolution Melting (MS-HRM) analysis, and Exon arrays (Affymetrix) the DNA methylation pattern of ∼14,000 genes and their transcript levels were investigated in six normal mucosas, six adenomas and 30 MSI and MSS carcinomas. Sixty eight genes with tumor-specific hypermethylation were identified (p < 0.005). Identified hypermethylated sites were validated in an independent sample set of eight normal mucosas, 12 adenomas, 40 MSS and nine MSI cancer samples. The methylation patterns of 15 selected genes, hypermethylated in adenomas and carcinomas (FLI1, ST6GALNAC5, TWIST1, ADHFE1, JAM2, IRF4, CNRIP1, NRG1 and EYA4), in carcinomas only (ABHD9, AOX1 and RERG), or in MSI but not MSS carcinomas (RAMP2, DSC3 and MLH1) were validated using MS-HRM. Four of these genes (MLH1, AOX1, EYA4 and TWIST1) had previously been reported to be hypermethylated in CRC. Eleven genes, not previously known to be affected by CRC specific hypermethylation, were identified and validated. Inverse correlation to gene expression was observed for six of the 15 genes with Spearman correlation coefficients ranging from -0.39 to -0.60. For six of these genes the altered methylation patterns had a profound transcriptional association, indicating that methylation of these genes may play a direct regulatory role. The hypermethylation changes often occurred already in adenomas, indicating that they may be used as biomarkers for early detection of CRC.

  1. Synergy of anti-CD40, CpG and MPL in activation of mouse macrophages.

    PubMed

    Shi, Yongyu; Felder, Mildred A R; Sondel, Paul M; Rakhmilevich, Alexander L

    2015-08-01

    Activation of macrophages is a prerequisite for their antitumor effects. Several reagents, including agonistic anti-CD40 monoclonal antibody (anti-CD40), CpG oligodeoxynucleotides (CpG) and monophosphoryl lipid A (MPL), can stimulate activation of macrophages. Our previous studies showed synergy between anti-CD40 and CpG and between anti-CD40 and MPL in macrophage activation and antitumor efficacy in mice. In the present study, we asked whether there was synergy among these three reagents. The activation of adherent peritoneal exudate cells (PEC) obtained from mice injected with anti-CD40 and then treated with CpG and/or MPL in vitro was determined by their ability to suppress proliferation of tumor cells and to produce various cytokines and chemokines in vitro. Cell sorting and histology followed by functional testing showed that macrophages were the main cell population in PEC activated by CD40 ligation in vivo. A combination of anti-CD40, CpG or MPL activated PEC to suppress proliferation of B16 cells and produce nitric oxide far greater than the single reagents or any of the double combinations of these reagents. In addition, the combination of all three reagents activated PEC to secrete IL-12, IFN-γ and MCP-1 to a greater degree than any single reagent or any two combined reagents. These results demonstrate that macrophages can be synergistically activated by anti-CD40, CpG and MPL, suggesting that this novel combined approach might be further investigated as potential cancer therapy.

  2. CpG Oligodeoxynucleotide1826 combined with radioresistant cancer cell vaccine confers significant antitumor effects.

    PubMed

    Zhuang, X B; Xing, N; Zhang, Q; Yuan, S J; Chen, W; Qiao, T K

    2015-01-01

    Immunotherapy is a hot issue in cancer research over the years and tumor cell vaccine is one of the increasing number of studies. Although the whole tumor cell vaccine can provide the best source of immunizing antigens, there is still a limitation that most tumors are not naturally immunogenic. CpG Oligodeoxynucleotides (CpG ODNs), synthetic oligonucleotides containing a cytosine-phosphate-guanine(CpG) motif, was shown to enhance immune responses to a wide variety of antigens. In this study, we generated the radioresistant Lewis lung cancer cell by repeated X-ray radiation and inactivated it as a whole tumor cell vaccine to enhance the immunogenicity of tumor cell vaccine. Mice were subcutaneously immunized with this inactivated vaccine combined with CpG ODN1826 and then inoculated with autologous Lewis lung cancer (LLC) to estimate the antitumor efficacy. The results showed that the radioresistant tumor cell vaccine combined with CpG ODN1826 could significantly inhibit tumor growth, increased survival of the mice and with 20% of the mice surviving tumor free in vivo compared with the unimmunized mice bearing LLC tumor. A significant increase of apoptosis was also observed in the tumor prophylactically immunized with vaccine of inactivated radioresistant tumor cell plus CpG ODN1826. The potent antitumor effect correlated with higher secretion levels of tumor necrosis factor-alpha(TNF-α) and lower levels of interleukin-10(IL-10) concentration in serum. Furthermore, the results suggested that the antitumor mechanism was probably depended on the decreased level of programmed death ligand-1(PD-L1) which plays an important role in the negative regulation of immune response by the inhibition of tumor antigen-specific T cell activation. These findings clearly demonstrated that the radioresistant tumor cell vaccine combined with CpG ODN1826 as an appropriate adjuvant could induce effective antitumor immunity in vivo.

  3. Hemocytic immune responses triggered by CpG ODNs in shrimp Litopenaeus vannamei.

    PubMed

    Sun, Rui; Qiu, Limei; Yue, Feng; Wang, Lingling; Liu, Rui; Zhou, Zhi; Zhang, Huan; Song, Linsheng

    2013-01-01

    CpG oligodeoxynucleotides (CpG ODNs), also called bacterial DNA or synthetic oligodeoxynucleotides, can induce apparent immunity protection against various pathogens, and they are widely used as functional immunostimulant or vaccine adjuvant in mammals. In the present study, CpG-rich plasmid pUC57-CpG was constructed and employed to stimulate the shrimp Litopenaeus vannamei, and the total hemocyte count, percentage of apoptotic hemocytes, regeneration of circulating hemocytes, the ability of phagocytosis and generation of reactive oxygen species (ROS) were measured to reveal the possible protection mechanism of CpG ODNs. After the injection of pUC57-CpG, the total hemocyte count significantly decreased (p < 0.01) to 2.56 × 10(7) cell/mL at the first day post stimulation, while the apoptosis increased (p < 0.01), which was 1.72-fold of that in control group. At the same time, the regeneration of circulating hemocytes fluctuated in a similar trend, and a significant increase was observed at the first day post stimulation. The phagocytotic activity including the percentage of phagocytosis and phagocytotic index, experienced an upward tend during the whole experimental period and the ROS level increased by 22% (p < 0.05) compared to that in the control group at first day post stimulation. These results together suggested that pUC57-CpG could promote the apoptosis and regeneration of circulating hemocytes, and enhance the phagocytosis and ROS production, which might contribute to the boosted immunity against the infection of pathogens.

  4. Epigenetic changes of serotonin transporter in the patients with alcohol dependence: methylation of an serotonin transporter promoter CpG island.

    PubMed

    Park, Byung-Yang; Lee, Boung-Chul; Jung, Kyoung Hwa; Jung, Myung Hun; Park, Byung Lae; Chai, Young Gyu; Choi, Ihn-Geun

    2011-06-01

    Psychiatric disorders such as depression, anxiety and alcohol dependence are associated with serotonin metabolism. We assessed the methylation level of the serotonin transporter (5-HTT) promoter region in control and alcohol dependent patients. Twenty seven male patients who met the Diagnostic and Statistical Manual of Mental Disorder IV (DSM-IV) criteria for alcohol dependence were compared with fifteen controls. Polymerase chain reaction (PCR) assays of bisulfate-modified DNA were designed to amplify a part of the CpG island in the 5HTT gene. Pyrosequencing was performed and the methylation level at seven CpG island sites was measured. We found no differences in the methylation patterns of the serotonin transporter linked promoter region (5-HTTLPR) between alcohol-dependent and control subjects. Our negative finding may be because 5-HTT epigenetic variation may not affect the expression for 5-HTT or there may be other methylation site critical for its expression. To find out more conclusive result, repeating the study in more methylation sites with a larger number of samples in a well-controlled setting is needed.

  5. SNPs located at CpG sites modulate genome-epigenome interaction

    USDA-ARS?s Scientific Manuscript database

    DNA methylation is an important molecular-level phenotype that links genotypes and complex disease traits. Previous studies have found local correlation between genetic variants and DNA methylation levels (cis-meQTLs). However, general mechanisms underlying cis-meQTLs are unclear. We conducted a cis...

  6. Investigation of the Gravitational Interaction between the Components of the Galaxy Pairs CPG 165

    NASA Astrophysics Data System (ADS)

    Tawfeek, Amira A.; Ali, Gamal B.; Amin, Magdy Y.

    2014-04-01

    In this paper the effect of interaction between the components of the galaxy pair CPG 165 on the symmetry of their morphologies and structures is studied by applying the technique of surface photometry. For each component of the pair we present the isophotal contours, profiles of surface brightness (SB), major-axis position angle (PA), and isophotal center-shift. The present analysis is done using the r- and i-band images from the Sloan Digital Sky Survey (SDSS) observation. It is found that the position angle and the isophotal center shift are strongly affected by the state of interaction between the components of the pair CPG 165.

  7. Protective immunity against Megalocytivirus infection in rock bream (Oplegnathus fasciatus) following CpG ODN administration.

    PubMed

    Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju

    2017-06-27

    Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10(7)) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10(6)) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10(4) and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10(7)) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10(4)). Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Mutations and CpG islands among hepatitis B virus genotypes in Europe.

    PubMed

    Zhong, Chengyao; Hou, Zhiwei; Huang, Jihua; Xie, Qingdong; Zhong, Ying

    2015-02-05

    Hepatitis B virus (HBV) genotypes have a distinct geographical distribution and influence disease progression and treatment outcomes. The purpose of this study was to investigate the distribution of HBV genotypes in Europe, the impact of mutation of different genotypes on HBV gene abnormalities, the features of CpG islands in each genotype and their potential role in epigenetic regulation. Of 383 HBV isolates from European patients, HBV genotypes A-G were identified, with the most frequent being genotype D (51.96%) in 12 countries, followed by A (39.16%) in 7 countries, and then E (3.66%), G (2.87%), B (1.57%), F (0.52%) and C (0.26%). A higher rate of mutant isolates were identified in those with genotype D (46.7%) followed by G (45.5%), and mutations were associated with structural and functional abnormalities of HBV genes. Conventional CpG island I was observed in genotypes A, B, C, D and E. Conventional islands II and III were detected in all A-G genotypes. A novel CpG island IV was found in genotypes A, D and E, and island V was only observed in genotype F. The A-G genotypes lacked the novel CpG island VI. "Split" CpG island I in genotypes D and E and "split" island II in genotypes A, D, E, F and G were observed. Two mutant isolates from genotype D and one from E were found to lack both CpG islands I and III. HBV genotypes A-G were identified in European patients. Structural and functional abnormalities of HBV genes were caused by mutations leading to the association of genotypes D and G with increased severity of liver disease. The distribution, length and genetic traits of CpG islands were different between genotypes and their biological and clinical significances warrant further study, which will help us better understand the potential role of CpG islands in epigenetic regulation of the HBV genome.

  9. CpG Methylation, a Parent-of-Origin Effect for Maternal-Biased Transmission of Congenital Myotonic Dystrophy.

    PubMed

    Barbé, Lise; Lanni, Stella; López-Castel, Arturo; Franck, Silvie; Spits, Claudia; Keymolen, Kathelijn; Seneca, Sara; Tomé, Stephanie; Miron, Ioana; Letourneau, Julie; Liang, Minggao; Choufani, Sanaa; Weksberg, Rosanna; Wilson, Michael D; Sedlacek, Zdenek; Gagnon, Cynthia; Musova, Zuzana; Chitayat, David; Shannon, Patrick; Mathieu, Jean; Sermon, Karen; Pearson, Christopher E

    2017-03-02

    CTG repeat expansions in DMPK cause myotonic dystrophy (DM1) with a continuum of severity and ages of onset. Congenital DM1 (CDM1), the most severe form, presents distinct clinical features, large expansions, and almost exclusive maternal transmission. The correlation between CDM1 and expansion size is not absolute, suggesting contributions of other factors. We determined CpG methylation flanking the CTG repeat in 79 blood samples from 20 CDM1-affected individuals; 21, 27, and 11 individuals with DM1 but not CDM1 (henceforth non-CDM1) with maternal, paternal, and unknown inheritance; and collections of maternally and paternally derived chorionic villus samples (7 CVSs) and human embryonic stem cells (4 hESCs). All but two CDM1-affected individuals showed high levels of methylation upstream and downstream of the repeat, greater than non-CDM1 individuals (p = 7.04958 × 10(-12)). Most non-CDM1 individuals were devoid of methylation, where one in six showed downstream methylation. Only two non-CDM1 individuals showed upstream methylation, and these were maternally derived childhood onset, suggesting a continuum of methylation with age of onset. Only maternally derived hESCs and CVSs showed upstream methylation. In contrast, paternally derived samples (27 blood samples, 3 CVSs, and 2 hESCs) never showed upstream methylation. CTG tract length did not strictly correlate with CDM1 or methylation. Thus, methylation patterns flanking the CTG repeat are stronger indicators of CDM1 than repeat size. Spermatogonia with upstream methylation may not survive due to methylation-induced reduced expression of the adjacent SIX5, thereby protecting DM1-affected fathers from having CDM1-affected children. Thus, DMPK methylation may account for the maternal bias for CDM1 transmission, larger maternal CTG expansions, age of onset, and clinical continuum, and may serve as a diagnostic indicator.

  10. Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

    SciTech Connect

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; Nembrini, Chiara; Marsland, Benjamin J.; Hubbell, Jeffrey A.; Swartz, Melody A.

    2015-09-21

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatory therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.

  11. Protection induced by a CpG oligonucelotide in Nile tilapia against Streptococcus iniae infection and identification of upregulated genes

    USDA-ARS?s Scientific Manuscript database

    At two days post treatment, a CpG oligodeoxynucleotide (CpG 120818-9A) offered Nile tilapia (Oreochromis niloticus L.) significant (P<0.05) protection against Streptococcus iniae infection, with relative percent survival up to 63%. To understand the molecular mechanisms involved in the protective im...

  12. Nanoparticle conjugation enhances the immunomodulatory effects of intranasally delivered CpG in house dust mite-allergic mice

    DOE PAGES

    Ballester, Marie; Jeanbart, Laura; de Titta, Alexandre; ...

    2015-09-21

    An emerging strategy in preventing and treating airway allergy consists of modulating the immune response induced against allergens in the lungs. CpG oligodeoxynucleotides have been investigated in airway allergy studies, but even if promising, efficacy requires further substantiation. We investigated the effect of pulmonary delivery of nanoparticle (NP)-conjugated CpG on lung immunity and found that NP-CpG led to enhanced recruitment of activated dendritic cells and to Th1 immunity compared to free CpG. We then evaluated if pulmonary delivery of NP-CpG could prevent and treat house dust mite-induced allergy by modulating immunity directly in lungs. When CpG was administered as immunomodulatorymore » therapy prior to allergen sensitization, we found that NP-CpG significantly reduced eosinophilia, IgE levels, mucus production and Th2 cytokines, while free CpG had only a moderate effect on these parameters. In a therapeutic setting where CpG was administered after allergen sensitization, we found that although both free CpG and NP-CpG reduced eosinophilia and IgE levels to the same extent, NP conjugation of CpG significantly enhanced reduction of Th2 cytokines in lungs of allergic mice. Taken together, these data highlight benefits of NP conjugation and the relevance of NP-CpG as allergen-free therapy to modulate lung immunity and treat airway allergy.« less

  13. Binding Mode of CpG Oligodeoxynucleotides to Nanoparticles Regulates Bifurcated Cytokine induction via Toll-like Receptor 9

    NASA Astrophysics Data System (ADS)

    Chinnathambi, Shanmugavel; Chen, Song; Ganesan, Singaravelu; Hanagata, Nobutaka

    2012-07-01

    The interaction of cytosine-phosphate-guanine oligodeoxynucleotides (CpG ODNs) with Toll-like receptor 9 (TLR9) activates the immune system. Multimeric class A CpG ODNs induce interferon-α (IFN-α) and, to a lesser extent, interleukin-6. By contrast, monomeric class B CpG ODNs induce interleukin-6 but not IFN-α. This difference suggests that the multimerization of CpG ODN molecules is a key factor in IFN-α induction. We multimerized class B CpG ODN2006x3-PD molecules that consist entirely of a phosphodiester backbone onto quantum dot silicon nanoparticles with various binding modes. Herein, we present the binding mode-dependent bifurcation of cytokine induction and discuss its possible mechanism of CpG ODN and TLR9 interaction. Our discoveries also suggest that nanoparticles play roles in not only delivery of CpG ODNs but also control of CpG ODN activity.

  14. The immune responses triggered by CpG ODNs in shrimp Litopenaeus vannamei are associated with LvTolls.

    PubMed

    Sun, Rui; Wang, Mengqiang; Wang, Lingling; Yue, Feng; Yi, Qilin; Huang, Mengmeng; Liu, Rui; Qiu, Limei; Song, Linsheng

    2014-03-01

    CpG oligodeoxynucleotides (ODNs) represent a kind of pathogen-associated molecular patterns (PAMPs) as well as a novel adjuvant that activate the innate immune system through interaction with Toll-like receptor 9 (TLR9) in mammals. In the present study, the synthetic oligodeoxynucleotides, CpG ODN 2395, was employed to investigate the interactive mode of CpG ODNs with three known Tolls (LvToll1-3) from shrimp Litopenaeus vannamei. The mature peptides of extracellular domains of LvTolls (LvToll-ECDs) were recombinant expressed and their binding activities to CpG ODN 2395 were further examined by ELISA. rLvToll1-ECD and rLvToll3-ECD exhibited affinity to CpG ODN 2395 in a dose-dependent manner when their concentrations ranged from 0.25 to 2.00 μmol/L, while rLvToll2-ECD did not show any binding activities to CpG ODN 2395 in tested concentrations. Additionally, after the stimulation of CpG ODN 2395, the luciferase activities of HEK293T cells transfected with LvToll1-mosaic or LvToll3-mosaic were significantly increased to 2.38-fold (p<0.01) and 1.56-fold (p<0.01), while that in the HEK293T cells transfected with LvToll2-mosaic declined to 0.41-fold. The TNF-α activities were significantly enhanced (p<0.01), and a significant increase (p<0.05) of the NO production was observed at 12h post CpG ODN 2395 stimulation. Moreover, the induced TNF-α activities and increased NO production triggered by CpG ODN 2395 were abolished after the treatment of chloroquine (CQ). The uptake of CpG ODN 2395 by shrimp haemocytes was investigated using the laser scanning confocal microscope, and CpG ODN 2395 was observed to be internalized by the haemocytes and distributed in the cytoplasm with aggregated signals around the nucleuses. It suggested that the interactions of CpG ODNs with LvToll1 and LvToll3 as well as the mature of endosomes in the haemocytes of shrimp L. vannamei were indispensable for the triggering of immune responses by CpG ODNs, and the results provided a foundation

  15. Molecular autopsy in victims of inherited arrhythmias.

    PubMed

    Semsarian, Christopher; Ingles, Jodie

    2016-10-01

    Sudden cardiac death (SCD) is a rare but devastating complication of a number of underlying cardiovascular diseases. While coronary artery disease and acute myocardial infarction are the most common causes of SCD in older populations, inherited cardiac disorders comprise a substantial proportion of SCD cases aged less than 40 years. Inherited cardiac disorders include primary inherited arrhythmogenic disorders such as familial long QT syndrome (LQTS), Brugada syndrome (BrS), catecholaminergic polymorphic ventricular tachycardia (CPVT), and inherited cardiomyopathies, most commonly hypertrophic cardiomyopathy (HCM). In up to 40% of young SCD victims (defined as 1-40 years old, excluding sudden unexplained death in infancy from 0 to 1 years, referred to as SIDS), no cause of death is identified at postmortem [so-called "autopsy negative" or "sudden arrhythmic death syndrome" (SADS)]. Management of families following a SCD includes the identification of the cause of death, based either on premorbid clinical details or the pathological findings at the postmortem. When no cause of death is identified, genetic testing of DNA extracted from postmortem tissue (the molecular autopsy) may identify a cause of death in up to 30% of SADS cases. Targeted clinical testing in a specialized multidisciplinary clinic in surviving family members combined with the results from genetic testing, provide the optimal setting for the identification of relatives who may be at risk of having the same inherited heart disease and are therefore also predisposed to an increased risk of SCD.

  16. [Genetic diagnostic testing in inherited retinal dystrophies].

    PubMed

    Kohl, S; Biskup, S

    2013-03-01

    Inherited retinal dystrophies are clinically and genetically highly heterogeneous. They can be divided according to the clinical phenotype and course of the disease, as well as the underlying mode of inheritance. Isolated retinal dystrophies (i.e., retinitis pigmentosa, Leber's congenital amaurosis, cone and cone-rod dystrophy, macular dystrophy, achromatopsia, congenital stationary nightblindness) and syndromal forms (i.e., Usher syndrome, Bardet-Biedl syndrome) can be differentiated. To date almost 180 genes and thousands of distinct mutations have been identified that are responsible for the different forms of these blinding illnesses. Until recently, there was no adequate diagnostic genetic testing available. With the development of the next generation sequencing technologies, a comprehensive genetic screening analysis for all known genes for inherited retinal dystrophies has been established at reasonable costs and in appropriate turn-around times. Depending on the primary clinical diagnosis and the presumed mode of inheritance, different diagnostic panels can be chosen for genetic testing. Statistics show that in 55-80 % of the cases the genetic defect of the inherited retinal dystrophy can be identified with this approach, depending on the initial clinical diagnosis. The aim of any genetic diagnostics is to define the genetic cause of a given illness within the affected patient and family and thereby i) confirm the clinical diagnosis, ii) provide targeted genetic testing in family members, iii) enable therapeutic intervention, iv) give a prognosis on disease course and progression and v) in the long run provide the basis for novel therapeutic approaches and personalised medicine.

  17. Inheritance of idiopathic torsion dystonia among Jews.

    PubMed Central

    Zilber, N; Korczyn, A D; Kahana, E; Fried, K; Alter, M

    1984-01-01

    Idiopathic torsion dystonia (ITD) has long been considered to be genetically determined, but the pattern of inheritance has been unclear. It has been suggested that inheritance may differ in Jews and non-Jews. In the present study, data gathered in a nationwide survey of ITD in Israel were analysed. Between 1969 and 1980, 47 patients were collected, of whom 40 were of European origin. In these European Jews, the ITD frequency was about 1:23 000 live births, which was five-fold greater than in Jews of Afro-Asian origin. Assuming that all cases fit the same genetic model, an X linked or a simple autosomal recessive model of inheritance did not agree well with our data. An autosomal dominant model with low penetrance could have accounted for our observations and would yield an ITD gene frequency in European Jews of 3 to 4:100 000. In view of the increased ages of their fathers, the isolated cases may have included some new mutations. Multifactorial inheritance was also possible. However, it may be inappropriate to assume that all cases have the same genetic basis, or even that all are inherited. PMID:6694180

  18. [Gene therapy for inherited retinal dystrophies].

    PubMed

    Côco, Monique; Han, Sang Won; Sallum, Juliana Maria Ferraz

    2009-01-01

    The inherited retinal dystrophies comprise a large number of disorders characterized by a slow and progressive retinal degeneration. They are the result of mutations in genes that express in either the photoreceptor cells or the retinal pigment epithelium. The mode of inheritance can be autosomal dominant, autosomal recessive, X linked recessive, digenic or mitochondrial DNA inherited. At the moment, there is no treatment for these conditions and the patients can expect a progressive loss of vision. Accurate genetic counseling and support for rehabilitation are indicated. Research into the molecular and genetic basis of disease is continually expanding and improving the prospects for rational treatments. In this way, gene therapy, defined as the introduction of exogenous genetic material into human cells for therapeutic purposes, may ultimately offer the greatest treatment for the inherited retinal dystrophies. The eye is an attractive target for gene therapy because of its accessibility, immune privilege and translucent media. A number of retinal diseases affecting the eye have known gene defects. Besides, there is a well characterized animal model for many of these conditions. Proposals for clinical trials of gene therapy for inherited retinal degenerations owing to defects in the gene RPE65, have recently received ethical approval and the obtained preliminary results brought large prospects in the improvement on patient's quality of life.

  19. Inheritance of Telomere Length in a Bird

    PubMed Central

    Horn, Thorsten; Robertson, Bruce C.; Will, Margaret; Eason, Daryl K.; Elliott, Graeme P.; Gemmell, Neil J.

    2011-01-01

    Telomere dynamics are intensively studied in human ageing research and epidemiology, with many correlations reported between telomere length and age-related diseases, cancer and death. While telomere length is influenced by environmental factors there is also good evidence for a strong heritable component. In human, the mode of telomere length inheritance appears to be paternal and telomere length differs between sexes, with females having longer telomeres than males. Genetic factors, e.g. sex chromosomal inactivation, and non-genetic factors, e.g. antioxidant properties of oestrogen, have been suggested as possible explanations for these sex-specific telomere inheritance and telomere length differences. To test the influence of sex chromosomes on telomere length, we investigated inheritance and sex-specificity of telomere length in a bird species, the kakapo (Strigops habroptilus), in which females are the heterogametic sex (ZW) and males are the homogametic (ZZ) sex. We found that, contrary to findings in humans, telomere length was maternally inherited and also longer in males. These results argue against an effect of sex hormones on telomere length and suggest that factors associated with heterogamy may play a role in telomere inheritance and sex-specific differences in telomere length. PMID:21364951

  20. Inheritance of telomere length in a bird.

    PubMed

    Horn, Thorsten; Robertson, Bruce C; Will, Margaret; Eason, Daryl K; Elliott, Graeme P; Gemmell, Neil J

    2011-02-22

    Telomere dynamics are intensively studied in human ageing research and epidemiology, with many correlations reported between telomere length and age-related diseases, cancer and death. While telomere length is influenced by environmental factors there is also good evidence for a strong heritable component. In human, the mode of telomere length inheritance appears to be paternal and telomere length differs between sexes, with females having longer telomeres than males. Genetic factors, e.g. sex chromosomal inactivation, and non-genetic factors, e.g. antioxidant properties of oestrogen, have been suggested as possible explanations for these sex-specific telomere inheritance and telomere length differences. To test the influence of sex chromosomes on telomere length, we investigated inheritance and sex-specificity of telomere length in a bird species, the kakapo (Strigops habroptilus), in which females are the heterogametic sex (ZW) and males are the homogametic (ZZ) sex. We found that, contrary to findings in humans, telomere length was maternally inherited and also longer in males. These results argue against an effect of sex hormones on telomere length and suggest that factors associated with heterogamy may play a role in telomere inheritance and sex-specific differences in telomere length.

  1. Inheritance in tetraploid yeast revisited: segregation patterns and statistical power under different inheritance models.

    PubMed

    Stift, M; Reeve, R; van Tienderen, P H

    2010-07-01

    In their recent article, Albertin et al. (2009) suggest an autotetraploid origin of 10 tetraploid strains of baker's yeast (Saccharomyces cerevisiae), supported by the frequent observation of double reduction meiospores. However, the presented inheritance results were puzzling and seemed to contradict the authors' interpretation that segregation ratios support a tetrasomic model of inheritance. Here, we provide an overview of the expected segregation ratios at the tetrad and meiospore level given scenarios of strict disomic and tetrasomic inheritance, for cases with and without recombination between locus and centromere. We also use a power analysis to derive adequate sample sizes to distinguish alternative models. Closer inspection of the Albertin et al. data reveals that strict disomy can be rejected in most cases. However, disomic inheritance with strong but imperfect preferential pairing could not be excluded with the sample sizes used. The possibility of tetrad analysis in tetraploid yeast offers a valuable opportunity to improve our understanding of meiosis and inheritance of tetraploids.

  2. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides

    PubMed Central

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS–PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS–PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS–PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS–PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS–PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS–PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α. PMID:26346655

  3. Polyethyleneimine-functionalized boron nitride nanospheres as efficient carriers for enhancing the immunostimulatory effect of CpG oligodeoxynucleotides.

    PubMed

    Zhang, Huijie; Feng, Shini; Yan, Ting; Zhi, Chunyi; Gao, Xiao-Dong; Hanagata, Nobutaka

    2015-01-01

    CpG oligodeoxynucleotides (ODNs) stimulate innate and adaptive immune responses. Thus, these molecules are promising therapeutic agents and vaccine adjuvants against various diseases. In this study, we developed a novel CpG ODNs delivery system based on polyethyleneimine (PEI)-functionalized boron nitride nanospheres (BNNS). PEI was coated on the surface of BNNS via electrostatic interactions. The prepared BNNS-PEI complexes had positive zeta potential and exhibited enhanced dispersity and stability in aqueous solution. In vitro cytotoxicity assays revealed that the BNNS-PEI complexes with concentrations up to 100 μg/mL exhibited no obvious cytotoxicity. Furthermore, the positively charged surface of the BNNS-PEI complexes greatly improved the loading capacity and cellular uptake efficiency of CpG ODNs. Class B CpG ODNs loaded on the BNNS-PEI complexes enhanced the production of interleukin-6 and tumor necrosis factor-α from peripheral blood mononuclear cells compared with CpG ODNs directly loaded on BNNS. Contrary to the free CpG ODNs or CpG ODNs directly loaded on BNNS, class B CpG ODNs loaded on the BNNS-PEI complexes induced interferon-α simultaneously. PEI coating may have changed the physical form of class B CpG ODNs on BNNS, which further affected their interaction with Toll-like receptor 9 and induced interferon-α. Therefore, BNNS-PEI complexes can be used to enhance the immunostimulatory effect and therapeutic activity of CpG ODNs and the treatment of diseases requiring interleukin-6, tumor necrosis factor-α, and interferon-α.

  4. Exposure to stimulatory CpG oligonucleotides during gestation induces maternal hypertension and excess vasoconstriction in pregnant rats.

    PubMed

    Goulopoulou, Styliani; Wenceslau, Camilla F; McCarthy, Cameron G; Matsumoto, Takayuki; Webb, R Clinton

    2016-04-15

    Bacterial infections increase risk for pregnancy complications, such as preeclampsia and preterm birth. Unmethylated CpG DNA sequences are present in bacterial DNA and have immunostimulatory effects. Maternal exposure to CpG DNA induces fetal demise and craniofacial malformations; however, the effects of CpG DNA on maternal cardiovascular health have not been examined. We tested the hypothesis that exposure to synthetic CpG oligonucleotides (ODNs) during gestation would increase blood pressure and cause vascular dysfunction in pregnant rats. Pregnant and nonpregnant female rats were treated with CpG ODN (ODN 2395) or saline (Veh) starting on gestational day 14or corresponding day for the nonpregnant groups. Exposure to CpG ODN increased systolic blood pressure in pregnant (Veh: 121 ± 2 mmHg vs. ODN 2395: 134 ± 2 mmHg,P< 0.05) but not in nonpregnant rats (Veh: 111 ± 2 mmHg vs. ODN 2395: 108 ± 5 mmHg,P> 0.05). Mesenteric resistance arteries from pregnant CpG ODN-treated rats had increased contractile responses to U46619 [thromboxane A2(TxA2) mimetic] compared with arteries from vehicle-treated rats [Emax(%KCl), Veh: 87 ± 4 vs. ODN 2395: 104 ± 4,P< 0.05]. Nitric oxide synthase (NOS) inhibition increased contractile responses to U46619, and CpG ODN treatment abolished this effect in arteries from pregnant ODN 2395-treated rats. CpG ODN potentiated the involvement of cyclooxygenase (COX) to U46619-induced contractions. In conclusion, exposure to CpG ODN during gestation induces maternal hypertension, augments resistance artery contraction, increases the involvement of COX-dependent mechanisms and reduces the contribution of NOS-dependent mechanisms to TxA2-induced contractions in mesenteric resistance arteries.

  5. Intranasal CpG Therapy Attenuated Experimental Fungal Asthma in a TLR9-Dependent and -Independent Manner

    PubMed Central

    Ramaprakash, Hemanth; Hogaboam, Cory M.

    2010-01-01

    Background CpG administration abolishes airway inflammation and remodeling in acute models of allergic airway disease. Methods Herein, we investigated the therapeutic effect of CpG in a chronic fungal model of asthma. TLR9+/+ and TLR9–/– mice were sensitized to soluble Aspergillus fumigatus antigens and challenged with live A. fumigatus conidia. Mice were treated with intraperitoneal (IP) or intranasal (IN) CpG, or left untreated 14–28 days after conidium challenge. All features of allergic airway disease were attenuated in TLR9+/+ mice treated with IN CpG, including airway hyperresponsiveness (AHR), mucus production, and peribronchial fibrosis. Results TLR9–/– mice treated with IN CpG exhibited attenuated airway remodeling but not AHR. Whole-lung IL-12 levels were significantly elevated in both TLR9+/+ and TLR9–/– mice receiving IN CpG but not in either group receiving IP CpG. Whole-lung IL-10 levels were significantly elevated in IN CpG-treated TLR9+/+ mice but not in TLR9–/– mice receiving IN CpG. Increased whole-lung transcript and protein levels of the scavenger receptors SR-A and MARCO were observed in TLR9–/– mice compared with TLR9+/+ mice, possibly accounting for the CpG responsiveness in the knockout group. Conclusions Together, these data show that IN CpG has a therapeutic effect during established fungal asthma, which is TLR9 dependent and independent. PMID:20016192

  6. Transgenerational epigenetic inheritance: an open discussion.

    PubMed

    Nagy, Corina; Turecki, Gustavo

    2015-08-01

    Much controversy surrounds the idea of transgenerational epigenetics. Recent papers argue that epigenetic marks acquired through experience are passed to offspring, but as in much of the field of epigenetics, there is lack of precision in the definitions and perhaps too much eagerness to translate animal research to humans. Here, we review operational definitions of transgenerational inheritance and the processes of epigenetic programing during early development. Subsequently, based on this background, we critically examine some recent findings of studies investigating transgenerational inheritance. Finally, we discuss possible mechanisms that may explain transgenerational inheritance, including transmission of an epigenetic blueprint, which may predispose offspring to specific epigenetic patterning. Taken together, we conclude that presently, the evidence suggesting that acquired epigenetic marks are passed to the subsequent generation remains limited.

  7. Inherited cardiomyopathies mimicking arrhythmogenic right ventricular cardiomyopathy.

    PubMed

    Roberts, Jason D; Veinot, John P; Rutberg, Julie; Gollob, Michael H

    2010-01-01

    Arrhythmogenic right ventricular cardiomyopathy (ARVC) represents an inherited cardiomyopathy that manifests clinically with malignant ventricular arrhythmias, sudden cardiac death, and less commonly heart failure. The condition is characterized by replacement of the myocardium, primarily of the right ventricle, with fibrofatty tissue. Extensive fibrofatty replacement of the myocardium has been previously thought to be pathognomonic of ARVC; however, this report details two other forms of inherited cardiomyopathy, namely hypertrophic cardiomyopathy (HCM) and the PRKAG2 cardiac syndrome, that were found to have significant fibrofatty myocardial replacement at pathologic examination. This report represents the first documentation of inherited cardiomyopathies mimicking ARVC and highlights the concept that other cardiac conditions can be associated with fibrofatty replacement of the myocardium. Copyright 2010 Elsevier Inc. All rights reserved.

  8. Environmental stress and epigenetic transgenerational inheritance.

    PubMed

    Skinner, Michael K

    2014-09-05

    Previous studies have shown a wide variety of environmental toxicants and abnormal nutrition can promote the epigenetic transgenerational inheritance of disease. More recently a number of studies have indicated environmental stress can also promote epigenetic alterations that are transmitted to subsequent generations to induce pathologies. A recent study by Yao and colleagues demonstrated gestational exposure to restraint stress and forced swimming promoted preterm birth risk and adverse newborn outcomes generationally. This ancestral stress promoted the epigenetic transgenerational inheritance of abnormalities in the great-grand offspring of the exposed gestating female. Several studies now support the role of environmental stress in promoting the epigenetic transgenerational inheritance of disease. Observations suggest ancestral environmental stress may be a component of disease etiology in the current population.

  9. DNA methylation and the frequency of CpG in animal DNA.

    PubMed Central

    Bird, A P

    1980-01-01

    An analysis of nearest neighbour dinucleotide frequencies and the level of DNA methylation in animals strongly supports the suggestion that 5-methylcytosine (5mC) tends to mutate abnormally frequently to T. This tendency is the likely cause of the CpG deficiency in heavily methylated genomes. PMID:6253938

  10. 75 FR 13555 - Compliance Policy Guide Sec. 540.375 Canned Salmon - Adulteration Involving Decomposition (CPG...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-03-22

    .... 540.375 Canned Salmon -- Adulteration Involving Decomposition (CPG 7108.10); Withdrawal of Guidance... Administration (FDA) is announcing the withdrawal of Compliance Policy Guide Sec. 540.375 Canned Salmon... FDA staff relating to decomposition in fish and fishery products, including canned salmon, is...

  11. CpG methylation suppresses transcriptional activity of human syncytin-1 in non-placental tissues

    SciTech Connect

    Matouskova, Magda; Blazkova, Jana; Pajer, Petr; Pavlicek, Adam; Hejnar, Jiri . E-mail: hejnar@img.cas.cz

    2006-04-15

    Syncytin-1 is a captive envelope glycoprotein encoded by one of human endogenous retroviruses W. It is expressed exclusively in the placental trophoblast where it participates in cell-to-cell fusion during differentiation of syncytiotrophobast. In other tissues, however, syncytin-1 expression must be kept in check because inadvertent cell fusion might be dangerous for tissue organization and integrity. We describe here an inverse correlation between CpG methylation of syncytin-1 5' long terminal repeat and its expression. Hypomethylation of the syncytin-1 5' long terminal repeat in the placenta and in the choriocarcinoma-derived cell line BeWo was detected. However, other analyzed primary cells and cell lines non-expressing syncytin-1 contain proviruses heavily methylated in this sequence. CpG methylation of syncytin-1 is resistant to the effect of the demethylating agent 5-azacytidine. The inhibitory role of CpG methylation is further confirmed by transient transfection of in-vitro-methylated syncytin-1 promoter-driven reporter construct. Altogether, we conclude that CpG methylation plays a principal role in the transcriptional suppression of syncytin-1 in non-placental tissues, and, in contrast, demethylation of the syncytin-1 promoter in trophoblast is a prerequisite for its expression and differentiation of multinucleated syncytiotrophoblast.

  12. Enhanced immune response of BMDCs pulsed with H9N2 AIV and CpG.

    PubMed

    Lin, Jian; Yin, Yin Y; Qin, Tao; Zhu, Li Q; Yu, Qing H; Yang, Qian

    2014-11-28

    Dendritic cells (DCs), professional antigen presenting cells, have demonstrated effective in controlling the initial of innate immune, while CpG could improve the performance of immune system. To explore the mechanism of CpG enhancing the immune response, we compared different stimulated mouse DCs with systemic approach microarrays. Analysis revealed 1840 differentially expressed genes in H9N2 stimulated group, more than 1728 altered genes in inactive H9N2 group. Investigation also proved that CpG/inactive H9N2 co-stimulation changed 2140 genes, more than that in H9N2 group, strongly demonstrated that CpG improved the performance of inactive H9N2 vaccination. Pathways analysis founded that DCs response rapid to shift in their maturation state, which involved Toll-like receptor (TLR) pathway significantly. Microarrays results were also verified by qRT-PCR with 14 elected representative genes. Further analysis proved that co-stimulatory molecules (CD40, CD80, CD86 and MHC-II), regulatory protein (IRF-7 and TRAF-6) and pro-inflammatory cytokines (IL-1, IL-6 and IL-12) were all changed and involved in DCs maturation. At last we demonstrated TLR signalling pathway in chicken bone marrow-derived dendritic cells (chBM-DCs) stimulated with CpG. The distinct transcriptional profiles of DCs pulsed with various stimuli expanded our understanding of how DCs respond and recognize influenza. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. DNA methylation determines nucleosome occupancy in the 5'-CpG islands of tumor suppressor genes.

    PubMed

    Portela, A; Liz, J; Nogales, V; Setién, F; Villanueva, A; Esteller, M

    2013-11-21

    Promoter CpG island hypermethylation of tumor suppressor genes is an epigenetic hallmark of human cancer commonly associated with nucleosome occupancy and the transcriptional silencing of the neighboring gene. Nucleosomes can determine the underlying DNA methylation status. Herein, we show that the opposite is also true: DNA methylation can determine nucleosome positioning. Using a cancer model and digital nucleosome positioning techniques, we demonstrate that the induction of DNA hypomethylation events by genetic (DNMT1/DNMT3B deficient cells) or drug (a DNA demethylating agent) approaches is associated with the eviction of nucleosomes from previously hypermethylated CpG islands of tumor suppressor genes. Most importantly, the establishment of a stable cell line that restores DNMT1/DNMT3B deficiency shows that nucleosomes reoccupy their positions in de novo methylated CpG islands. Finally, we extend these results to the genomic level, combining a DNA methylation microarray and the nucleosome positioning technique. Using this global approach, we observe the dependency of nucleosome occupancy upon the DNA methylation status. Thus, our results suggest that there is a close association between hypermethylated CpG islands and the presence of nucleosomes, such that each of these epigenetic mechanisms can determine the recruitment of the other.

  14. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation

    PubMed Central

    Kirov, Julia V.; Adkisson, Michael; Nava, A. J.; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K.; Lloyd, K. C. Kent; de Jong, Pieter; West, David B.

    2015-01-01

    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown. PMID:26275310

  15. CpG oligodeoxynucleotides with double stem-loops show strong immunostimulatory activity.

    PubMed

    Yang, Liang; Wu, Xiuli; Wan, Min; Yu, Yue; Yu, Yongli; Wang, Liying

    2013-01-01

    Based on the current understanding of TLR9 recognition of CpG ODN, we have tried to design a series of CpG ODNs that display double stem-loops when being analyzed for their secondary structures using 'mfold web server'. Proliferation of human PBMC and bioassay for IFN production were used as technical platforms in primary screening. Interestingly, two of them, designated as DSL01 and D-SL03, belonging to B class CpG ODN and C class CpG ODN respectively, showed vigorous immunostimulatory activity and were chosen for further tests. Flow cytometry analysis showed that both of them could activate human B cells, NK cells, mononuclear cells and T cells and up-regulate expression of CD80, CD86 and HLA-DR on the surface of subsets in human PBMCs. Furthermore, we demonstrated that those two ODNs potently stimulated proliferation of PBMC/splenocytes obtained from diverse vertebrate species. Noticeably, both of them displayed anti-breast cancer effect in mice when administered by peritumoral injection.

  16. Reporter Gene Silencing in Targeted Mouse Mutants Is Associated with Promoter CpG Island Methylation.

    PubMed

    Kirov, Julia V; Adkisson, Michael; Nava, A J; Cipollone, Andreana; Willis, Brandon; Engelhard, Eric K; Lloyd, K C Kent; de Jong, Pieter; West, David B

    2015-01-01

    Targeted mutations in mouse disrupt local chromatin structure and may lead to unanticipated local effects. We evaluated targeted gene promoter silencing in a group of six mutants carrying the tm1a Knockout Mouse Project allele containing both a LacZ reporter gene driven by the native promoter and a neo selection cassette. Messenger RNA levels of the reporter gene and targeted gene were assessed by qRT-PCR, and methylation of the promoter CpG islands and LacZ coding sequence were evaluated by sequencing of bisulfite-treated DNA. Mutants were stratified by LacZ staining into presumed Silenced and Expressed reporter genes. Silenced mutants had reduced relative quantities LacZ mRNA and greater CpG Island methylation compared with the Expressed mutant group. Within the silenced group, LacZ coding sequence methylation was significantly and positively correlated with CpG Island methylation, while promoter CpG methylation was only weakly correlated with LacZ gene mRNA. The results support the conclusion that there is promoter silencing in a subset of mutants carrying the tm1a allele. The features of targeted genes which promote local silencing when targeted remain unknown.

  17. Preexposure to CpG Protects against the Delayed Effects of Neonatal Respiratory Syncytial Virus Infection

    PubMed Central

    Yamaguchi, Yuko; Harker, James A.; Wang, Belinda; Openshaw, Peter J.

    2012-01-01

    Severe respiratory viral infection in early life is associated with recurrent wheeze and asthma in later childhood. Neonatal immune responses tend to be skewed toward T helper 2 (Th2) responses, which may contribute to the development of a pathogenic recall response to respiratory infection. Since neonatal Th2 skewing can be modified by stimulation with Toll-like receptor (TLR) ligands, we investigated the effect of exposure to CpG oligodeoxynucleotides (TLR9 ligands) prior to neonatal respiratory syncytial virus (RSV) infection in mice. CpG preexposure was protective against enhanced disease during secondary adult RSV challenge, with a reduction in viral load and an increase in Th1 responses. A similar Th1 switch and reduction in disease were observed if CpG was administered in the interval between neonatal infection and challenge. In neonates, CpG pretreatment led to a transient increase in expression of major histocompatibility complex class II (MHCII) and CD80 on CD11c-positive cells and gamma interferon (IFN-γ) production by NK cells after RSV infection, suggesting that the protective effects may be mediated by antigen-presenting cells (APC) and NK cells. We conclude that the adverse effects of early-life respiratory viral infection on later lung health might be mitigated by conditions that promote TLR activation in the infant lung. PMID:22811525

  18. Aberrant development and plasticity of excitatory visual cortical networks in the absence of cpg15.

    PubMed

    Picard, Nathalie; Leslie, Jennifer H; Trowbridge, Sara K; Subramanian, Jaichandar; Nedivi, Elly; Fagiolini, Michela

    2014-03-05

    During development, experience plays a crucial role in sculpting neuronal connections. Patterned neural activity guides formation of functional neural circuits through the selective stabilization of some synapses and the pruning of others. Activity-regulated factors are fundamental to this process, but their roles in synapse stabilization and maturation is still poorly understood. CPG15, encoded by the activity-regulated gene candidate plasticity gene 15, is a small, glycosylphosphatidylinositol (GPI)-linked, extracellular protein that promotes synapse stabilization. Here we show that global knock-out of cpg15 results in abnormal postnatal development of the excitatory network in visual cortex and an associated disruption in development of visual receptive field properties. In addition, whereas repeated stimulation induced potentiation and depression in wild-type mice, the depression was slower in cpg15 knock-out mice, suggesting impairment in short-term depression-like mechanisms. These findings establish the requirement for cpg15 in activity-dependent development of the visual system and demonstrate the importance of timely excitatory network development for normal visual function.

  19. Inheritance of apospory in bahiagrass, Paspalum notatum.

    PubMed

    Martínez, E J; Urbani, M H; Quarin, C L; Ortiz, J P

    2001-01-01

    Previous studies on the inheritance of aposporous apomixis in bahiagrass showed a wide range of segregation ratios in crosses involving sexual and aposporous apomictic plants. The F1 progenies were classified through a visual progeny test carried out on few F2 plants. The number of sexual F1s highly exceeded the apomictics leading to the conclusion that apomixis was controlled by a few recessive genes. The present study examines the inheritance of apospory in bahiagrass. A sexual plant was self-pollinated and crossed with an aposporous apomictic plant as pollen donor. Backcross and F2 progenies were obtained in several combinations. All self-pollinated sexual plants or sexual x sexual crosses produced progenies free of apospory. All crosses involving a sexual and an apomictic plant produced approximately three times more apospory-free plants than plants with apospory. Bahiagrass is of autotetraploid origin and hence is expected to display tetrasomic inheritance. The most widely accepted genetic model for inheritance of apospory in tropical grasses is a single dominant gene with tetrasomic inheritance. In the present experiments none of the apospory-free F1s segregated for the apospory trait indicating that it is most likely a dominant character. However, the observed results fit better a modified model: tetrasomic inheritance of a single dominant gene with pleiotropic effect and incomplete penetrance. The excess of apospory-free plants in the F1 progeny could be ascribed to some distortion in the segregation pattern due to a pleiotropic lethal effect of the dominant A allele with incomplete penetrance. Alternatively, partial lethality of factors linked to aposporous gene may account for segregation distortion against apospory.

  20. Proposed multigenic Composite Inheritance in major depression.

    PubMed

    Raymer, Katherine A; Waters, Robert F; Price, Catherine R

    2005-01-01

    Various rationale have been considered in the familial inheritance pattern of major depression ranging from simple one-gene Mendelian inheritance to pseudo-additive gene action. We instead predict broad genetic expressivity patterns in the progeny of parents where at least one parent has recurrent major depression. In keeping with this idea, we feel that recurrent major depression could involve an expression imbalance of "normal" genes either exclusively or along with allelic variation(s). The patterns of pathology are theoretically conceptualized as qualitative and quantitative, meaning that expressivity of the genetic pattern in these children may range from minimal to complete even among siblings. Thus, prediction of the particular genetic pattern expressed by a particular child might prove difficult. The complex inheritance pattern that we propose is referred to as Composite Inheritance. Composite Inheritance considers that both the up- and down-regulation of luxury genes and housekeeping genes are involved in this dichotomous qualitative inheritance pattern and also the wide quantitative expressivity. The luxury genes include such genes as those coding for the neurotransmitter transporters and receptors. The housekeeping genes found to date include those that code for proteins involved in gene transcription, secondary signaling systems, fatty acid metabolism and transport, and intracellular calcium homeostasis. Other luxury and housekeeping genes no doubt remain to be discovered. Our current research utilizes an empirical approach involving advanced genomics and specialized pattern recognition mathematics in families having at least one parent with recurrent major depression. The goal of our research is to develop a pattern recognition system of genetic expressivity in major depression to which prevention and early intervention may be tailored.

  1. New patterns of inheritance in mitochondrial disease.

    PubMed

    Schwartz, Marianne; Vissing, John

    2003-10-17

    With the identification of a patient with mutated mitochondrial DNA (mtDNA) of paternal origin, it has been unequivocally proven that not only does paternal mtDNA survive in the zygote, but it can also contribute substantially to the mtDNA pool of adult, human skeletal muscle. The questions are: how often does paternal mtDNA inheritance occur and what mechanisms are involved? In this paper, we will review current knowledge on the fate of sperm mitochondria after fertilization and discuss the impact paternal inheritance may have on our understanding of mitochondrial biology.

  2. Genetics beyond Mendel. Understanding nontraditional inheritance patterns.

    PubMed

    Wagstaff, J

    2000-09-01

    Many medical conditions that clearly have a strong genetic component are not transmitted in a straightforward dominant, recessive, or X-linked pattern. Recent progress in understanding other modes of inheritance, such as imprinting, trinucleotide repeat expansion, mitochondrial inheritance, and mosaicism, has allowed us to solve many of these hereditary puzzles. Such advances have led to improvements in diagnosis and genetic counseling for patients affected with these disorders and should be valuable in development of effective therapies for some of these disorders in the future.

  3. Inherited epidermolysis bullosa: clinical and therapeutic aspects*

    PubMed Central

    Boeira, Vanessa Lys Simas Yamakawa; Souza, Erica Sales; Rocha, Bruno de Oliveira; Oliveira, Pedro Dantas; de Oliveira, Maria de Fátima Santos Paim; Rêgo, Vitória Regina Pedreira de Almeida; Follador, Ivonise

    2013-01-01

    Inherited epidermolysis bullosa (EB) is a heterogeneous group of genetic disorders that present with skin and, in some cases, mucosal fragility, predisposing patients to the development of blisters and/or erosions after minimal trauma or friction. Children with a recurrent history of these kinds of lesions or neonates that present them in the absence of another reasonable explanation should be investigated. Diagnosis must be based on clinical and histopathological findings. To date, management of inherited EB basically consists in avoiding traumas that trigger lesions, as well as preventing infection and facilitating healing of the wounds with the systematic use of bandages. PMID:23739692

  4. Transgenerational epigenetic inheritance: how important is it?

    PubMed

    Grossniklaus, Ueli; Kelly, William G; Kelly, Bill; Ferguson-Smith, Anne C; Pembrey, Marcus; Lindquist, Susan

    2013-03-01

    Much attention has been given to the idea of transgenerational epigenetic inheritance, but fundamental questions remain regarding how much takes place and the impact that this might have on organisms. We asked five leading researchers in this area--working on a range of model organisms and in human disease--for their views on these topics. Their responses highlight the mixture of excitement and caution that surrounds transgenerational epigenetic inheritance and the wide gulf between species in terms of our knowledge of the mechanisms that may be involved.

  5. DNMT3B Expression Might Contribute to CpG Island Methylator Phenotype in Colorectal Cancer

    PubMed Central

    Nosho, Katsuhiko; Shima, Kaori; Irahara, Natsumi; Kure, Shoko; Baba, Yoshifumi; Kirkner, Gregory J.; Chen, Li; Gokhale, Sumita; Hazra, Aditi; Spiegelman, Donna; Giovannucci, Edward L.; Jaenisch, Rudolf; Fuchs, Charles S.; Ogino, Shuji

    2010-01-01

    Purpose DNA methyltransferase-3B (DNMT3B) plays an important role in de novo CpG island methylation. Dnmt3b can induce colon tumor in mice with methylation in specific CpG islands. We hypothesized that cellular DNMT3B level might influence the occurrence of widespread CpG island methylation (i.e., the CpG island methylator phenotype, CIMP) in colon cancer. Experimental Design Utilizing 765 colorectal cancers in two cohort studies, we detected DNMT3B expression in 116 (15%) tumors by immunohistochemistry. We assessed microsatellite instability, quantified DNA methylation in repetitive long interspersed nucleotide element-1 (LINE-1) by Pyrosequencing, eight CIMP-specific promoters [CACNA1G, CDKN2A (p16), CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1], and eight other CpG islands (CHFR, HIC1, IGFBP3, MGMT, MINT1, MINT31, p14, and WRN) by real-time PCR (MethyLight). Results Tumoral DNMT3B overexpression was significantly associated with CIMP-high [≥6/8 methylated CIMP-specific promoters; odds ratio (OR), 3.34; 95% confidence interval, 2.11-5.29; P < 0.0001]. The relations between DNMT3B and methylation in 16 individual CpG islands varied substantially (OR, 0.80-2.96), suggesting variable locus-to-locus specificities of DNMT3B activity. DNMT3B expression was not significantly related with LINE-1 hypomethylation. In multivariate logistic regression, the significant relation between DNMT3B and CIMP-high persisted (OR, 2.39; 95% confidence interval, 1.11-5.14; P = 0.026) after adjusting for clinical and other molecular features, including p53, β-catenin, LINE-1, microsatellite instability, KRAS, PIK3CA,and BRAF. DNMT3B expression was unrelated with patient outcome, survival, or prognosis. Conclusions Tumoral DNMT3B overexpression is associated with CIMP-high in colorectal cancer. Our data support a possible role of DNMT3B in nonrandom de novo CpG island methylation leading to colorectal cancer. PMID:19470733

  6. Aberrant repair initiated by mismatch-specific thymine-DNA glycosylases provides a mechanism for the mutational bias observed in CpG islands

    PubMed Central

    Talhaoui, Ibtissam; Couve, Sophie; Gros, Laurent; Ishchenko, Alexander A.; Matkarimov, Bakhyt; Saparbaev, Murat K.

    2014-01-01

    The human thymine-DNA glycosylase (TDG) initiates the base excision repair (BER) pathway to remove spontaneous and induced DNA base damage. It was first biochemically characterized for its ability to remove T mispaired with G in CpG context. TDG is involved in the epigenetic regulation of gene expressions by protecting CpG-rich promoters from de novo DNA methylation. Here we demonstrate that TDG initiates aberrant repair by excising T when it is paired with a damaged adenine residue in DNA duplex. TDG targets the non-damaged DNA strand and efficiently excises T opposite of hypoxanthine (Hx), 1,N6-ethenoadenine, 7,8-dihydro-8-oxoadenine and abasic site in TpG/CpX context, where X is a modified residue. In vitro reconstitution of BER with duplex DNA containing Hx•T pair and TDG results in incorporation of cytosine across Hx. Furthermore, analysis of the mutation spectra inferred from single nucleotide polymorphisms in human population revealed a highly biased mutation pattern within CpG islands (CGIs), with enhanced mutation rate at CpA and TpG sites. These findings demonstrate that under experimental conditions used TDG catalyzes sequence context-dependent aberrant removal of thymine, which results in TpG, CpA→CpG mutations, thus providing a plausible mechanism for the putative evolutionary origin of the CGIs in mammalian genomes. PMID:24692658

  7. Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines.

    PubMed

    Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

    2013-01-01

    Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the BNNS affected the magnitude

  8. Chitosan-coated boron nitride nanospheres enhance delivery of CpG oligodeoxynucleotides and induction of cytokines

    PubMed Central

    Zhang, Huijie; Chen, Song; Zhi, Chunyi; Yamazaki, Tomohiko; Hanagata, Nobutaka

    2013-01-01

    Background Cytosine-phosphate-guanine (CpG) oligodeoxynucleotides activate Toll-like receptor 9, leading to induction of proinflammatory cytokines, which play an important role in induction and maintenance of innate and adaptive immune responses. Previously, we have used boron nitride nanospheres (BNNS) as a carrier for delivery of unmodified CpG oligodeoxynucleotides to activate Toll-like receptor 9. However, because CpG oligodeoxynucleotides and BNNS are both negatively charged, electrostatic repulsion between them is likely to reduce the loading of CpG oligodeoxynucleotides onto BNNS. Therefore, the efficiency of uptake of CpG oligodeoxynucleotides is also limited and does not result in induction of a robust cytokine response. To ameliorate these problems, we developed a CpG oligodeoxynucleotide delivery system using chitosan-coated BNNS as a carrier. Methods To facilitate attachment of CpG oligodeoxynucleotides onto the BNNS and improve their loading capacity, we prepared positively charged BNNS by coating them with chitosan preparations of three different molecular weights and used them as carriers for delivery of CpG oligodeoxynucleotides. Results The zeta potentials of the BNNS-CS complexes were positive, and chitosan coating improved their dispersity and stability in aqueous solution compared with BNNS. The positive charge of the BNNS-CS complexes greatly improved the loading capacity and cellular uptake efficiency of CpG oligodeoxynucleotides. The loading capacity of the CpG oligodeoxynucleotides depended on the molecular weight of chitosan, which affected the positive charge density on the surface of the BNNS. CpG oligodeoxynucleotides loaded onto BNNS-CS complexes significantly enhanced production of interleukin-6 and tumor necrosis factor-α by peripheral blood mononuclear cells compared with CpG oligodeoxynucleotides directly loaded onto BNNS, or when Lipofectamine™ 2000 was used as the carrier. The molecular weight of the chitosan used to coat the

  9. CpG methylation differences between neurons and glia are highly conserved from mouse to human.

    PubMed

    Kessler, Noah J; Van Baak, Timothy E; Baker, Maria S; Laritsky, Eleonora; Coarfa, Cristian; Waterland, Robert A

    2016-01-15

    Understanding epigenetic differences that distinguish neurons and glia is of fundamental importance to the nascent field of neuroepigenetics. A recent study used genome-wide bisulfite sequencing to survey differences in DNA methylation between these two cell types, in both humans and mice. That study minimized the importance of cell type-specific differences in CpG methylation, claiming these are restricted to localized genomic regions, and instead emphasized that widespread and highly conserved differences in non-CpG methylation distinguish neurons and glia. We reanalyzed the data from that study and came to markedly different conclusions. In particular, we found widespread cell type-specific differences in CpG methylation, with a genome-wide tendency for neuronal CpG-hypermethylation punctuated by regions of glia-specific hypermethylation. Alarmingly, our analysis indicated that the majority of genes identified by the primary study as exhibiting cell type-specific CpG methylation differences were misclassified. To verify the accuracy of our analysis, we isolated neuronal and glial DNA from mouse cortex and performed quantitative bisulfite pyrosequencing at nine loci. The pyrosequencing results corroborated our analysis, without exception. Most interestingly, we found that gene-associated neuron vs. glia CpG methylation differences are highly conserved across human and mouse, and are very likely to be functional. In addition to underscoring the importance of independent verification to confirm the conclusions of genome-wide epigenetic analyses, our data indicate that CpG methylation plays a major role in neuroepigenetics, and that the mouse is likely an excellent model in which to study the role of DNA methylation in human neurodevelopment and disease.

  10. Doubly uniparental inheritance: two mitochondrial genomes, one precious model for organelle DNA inheritance and evolution.

    PubMed

    Passamonti, Marco; Ghiselli, Fabrizio

    2009-02-01

    Eukaryotes have exploited several mechanisms for organelle uniparental inheritance, so this feature arose and evolved independently many times in their history. Metazoans' mitochondria commonly experience strict maternal inheritance; that is, they are only transmitted by females. However, the most noteworthy exception comes from some bivalve mollusks, in which two mitochondrial lineages (together with their genomes) are inherited: one through females (F) and the other through males (M). M and F genomes show up to 30% sequence divergence. This inheritance mechanism is known as doubly uniparental inheritance (DUI), because both sexes inherit uniparentally their mitochondria. Here, we review what we know about this unusual system, and we propose a model for evolution of DUI that might account for its origin as sex determination mechanism. Moreover, we propose DUI as a choice model to address many aspects that should be of interest to a wide range of biological subfields, such as mitochondrial inheritance, mtDNA evolution and recombination, genomic conflicts, evolution of sex, and developmental biology. Actually, as research proceeds, mitochondria appear to have acquired a central role in many fundamental processes of life, which are not only in their metabolic activity as cellular power plants, such as cell signaling, fertilization, development, differentiation, ageing, apoptosis, and sex determination. A function of mitochondria in the origin and maintenance of sex has been also proposed.

  11. Accurate CpG and non-CpG cytosine methylation analysis by high-throughput locus-specific pyrosequencing in plants.

    PubMed

    How-Kit, Alexandre; Daunay, Antoine; Mazaleyrat, Nicolas; Busato, Florence; Daviaud, Christian; Teyssier, Emeline; Deleuze, Jean-François; Gallusci, Philippe; Tost, Jörg

    2015-07-01

    Pyrosequencing permits accurate quantification of DNA methylation of specific regions where the proportions of the C/T polymorphism induced by sodium bisulfite treatment of DNA reflects the DNA methylation level. The commercially available high-throughput locus-specific pyrosequencing instruments allow for the simultaneous analysis of 96 samples, but restrict the DNA methylation analysis to CpG dinucleotide sites, which can be limiting in many biological systems. In contrast to mammals where DNA methylation occurs nearly exclusively on CpG dinucleotides, plants genomes harbor DNA methylation also in other sequence contexts including CHG and CHH motives, which cannot be evaluated by these pyrosequencing instruments due to software limitations. Here, we present a complete pipeline for accurate CpG and non-CpG cytosine methylation analysis at single base-resolution using high-throughput locus-specific pyrosequencing. The devised approach includes the design and validation of PCR amplification on bisulfite-treated DNA and pyrosequencing assays as well as the quantification of the methylation level at every cytosine from the raw peak intensities of the Pyrograms by two newly developed Visual Basic Applications. Our method presents accurate and reproducible results as exemplified by the cytosine methylation analysis of the promoter regions of two Tomato genes (NOR and CNR) encoding transcription regulators of fruit ripening during different stages of fruit development. Our results confirmed a significant and temporally coordinated loss of DNA methylation on specific cytosines during the early stages of fruit development in both promoters as previously shown by WGBS. The manuscript describes thus the first high-throughput locus-specific DNA methylation analysis in plants using pyrosequencing.

  12. Epigenetic regulation on the 5'-proximal CpG island of human porcine endogenous retrovirus subgroup A receptor 2/GPR172B.

    PubMed

    Nakaya, Yuki; Shojima, Takayuki; Yasuda, Jiro; Imakawa, Kazuhiko; Miyazawa, Takayuki

    2011-01-01

    Porcine endogenous retroviruses (PERVs) have been considered one of the major risks of xenotransplantation from pigs to humans. PERV-A efficiently utilizes human PERV-A receptor 2 (HuPAR-2)/GPR172B to infect human cells; however, there has been no study on the regulation mechanisms of HuPAR-2/GPR172B expression. In this study, we examined the expression of HuPAR-2/GPR172B from the standpoint of epigenetic regulation and discussed the risks of PERV-A infection in xenotransplantation. Quantitative real-time RT-PCR revealed that HuPAR-2 mRNA was preferentially expressed in placental tissue, whereas it was highly suppressed in BeWo cells (a human choriocarcinoma cell line) and HEK293 cells. A CpG island containing the HuPAR-2 transcription starting site was identified by in silico analysis. The DNA methylation ratio (the relative quantity of methylcytosine to total cytosine) and histone modification (H3K9me3) levels in the CpG island measured by bisulfite genomic sequencing and ChIP assay, respectively, were inversely correlated with the mRNA levels. Both HuPAR-2 mRNA and HuPAR-2 protein were up-regulated in HEK293 cells by inhibiting DNA methylation and histone deacetylation. Additionally, promoter/enhancer activities within the CpG island were suppressed by in vitro DNA methylation. Our results demonstrated that epigenetic modification regulates HuPAR-2 expression.

  13. Inherited Mutations in Women with Ovarian Carcinoma

    PubMed Central

    Norquist, Barbara M.; Harrell, Maria I.; Brady, Mark F.; Walsh, Tom; Lee, Ming K.; Gulsuner, Suleyman; Bernards, Sarah S.; Casadei, Silvia; Yi, Qian; Burger, Robert A.; Chan, John K.; Davidson, Susan A.; Mannel, Robert S.; DiSilvestro, Paul A.; Lankes, Heather A.; Ramirez, Nilsa C.; King, Mary Claire; Swisher, Elizabeth M.; Birrer, Michael J.

    2016-01-01

    Importance Germline mutations in BRCA1 and BRCA2 are relatively common in women with ovarian, fallopian tube, and peritoneal carcinoma (OC) causing a greatly increased lifetime risk of these cancers, but the frequency and relevance of inherited mutations in other genes is less well characterized. Objective To determine the frequency and importance of germline mutations in cancer-associated genes in OC. Design Subjects were ascertained from two phase III clinical trials in newly diagnosed advanced stage OC (GOG 218 and GOG 262), and a university-based gynecologic oncology tissue bank. Germline DNA was sequenced from women with OC using the targeted capture and multiplex sequencing assay BROCA. Setting Referral centers participating in NRG Oncology studies, and a University-based gynecologic oncology practice (UW). Participants The study population was 1915 women with OC with available germline DNA, unselected for age or family history, enrolled at the time of OC diagnosis (GOG 218, N=788; GOG 262, N=557; UW, N=570). Main Outcomes and Measures Mutation frequencies in OC were compared to the NHLBI GO Exome Sequencing Project (ESP) and the Exome Aggregation Consortium (ExAC). Clinical characteristics and survival were assessed by mutation status. Results Of 1915 subjects, 280 (15%) had mutations in BRCA1 (182), or BRCA2 (98) and 8 (0.4%) had mutations in DNA mismatch repair (MMR) genes. Mutations in BRIP1 (26), RAD51C (11), RAD51D (11), PALB2 (12) and BARD1 (4), were significantly more common in OC patients than in the ESP or ExAC, and in total were present in 3.3% of patients. Race, histologic subtype, and disease site were not predictive of mutation frequency. Mutation status affected survival, in particular for BRCA2 mutation carriers with HR 0.60 (95% CI 0.45 – 0.79, p<0.001) for progression-free survival, and HR 0.39 (95% CI 0.25 – 0.60, p<0.001) for overall survival in the GOG patients. Conclusions and Relevance In total, 347/1915 (18%) OC patients carried

  14. Understanding Genetics and Inheritance in Rural Schools

    ERIC Educational Resources Information Center

    Kibuka-Sebitosi, Esther

    2007-01-01

    Conducted in urban and rural schools in two provinces of South Africa, the present study reports biology learners' understanding of concepts about genetics and inheritance. Participants were Grade 11 and 12 learners, aged 15-16 years. The tools included a written questionnaire, interviews, pre- and post-paper and pencil tests and focus group…

  15. Inherited resistance to Corynebacterium kutscheri in mice.

    PubMed Central

    Hirst, R G; Wallace, M E

    1976-01-01

    An analysis of the factors responsible for inherited resistance to Corynebacterium kutscheri was undertaken. Various inbred mouse strains were examined; these included the Swiss Lynch and C57Bl/l mice, their F1 and F2 progeny, and the progeny of the F1 backcrossed to each parent strain. Two modes of inherited resistance are described. An examination suggested that resistance as measured by the mean lethal dose of C. kutscheri was under polygenic control and was inherited continuously. However, the efficiency with which C. kutscheri was eliminated by the mononuclear phagocyte cells of the liver over 3 days differed markedly among strains. A genetic analysis of this mononuclear phagocyte microbicidal efficiency (MPME) in Swiss Lynch and C57Bl/6 mice was undertaken. The trait, MPME, was present, but did not segregate, in the F1 progeny or in the progeny of the backcross to the resistant C57Bl/6 parent; this was clear evidence of dominance. Moreover, MPME segregated in a ratio of 1:1 in the progeny of the backcross to the sensitive Swiss Lynch parent and in a ratio of 3:1 in the F2 progeny. It was concluded that MPME was inherited discontinuously and was controlled by a single dominant autosomal gene (or closely linked group); the recessive allele was assigned the gene symbol ack. Linkage experiments showed there to be no association between the ack locus and any of the immune-response genes. PMID:971958

  16. The genetics of inherited macular dystrophies

    PubMed Central

    Michaelides, M; Hunt, D; Moore, A

    2003-01-01

    The aim of this paper is to review current knowledge relating to the monogenic macular dystrophies, with discussion of currently mapped genes, chromosomal loci and genotype-phenotype relationships. Inherited systemic disorders with a macular dystrophy component will not be discussed. PMID:12960208

  17. Epigenetic Inheritance of Disease and Disease Risk

    PubMed Central

    Bohacek, Johannes; Mansuy, Isabelle M

    2013-01-01

    Epigenetic marks in an organism can be altered by environmental factors throughout life. Although changes in the epigenetic code can be positive, some are associated with severe diseases, in particular, cancer and neuropsychiatric disorders. Recent evidence has indicated that certain epigenetic marks can be inherited, and reshape developmental and cellular features over generations. This review examines the challenging possibility that epigenetic changes induced by environmental factors can contribute to some of the inheritance of disease and disease risk. This concept has immense implications for the understanding of biological functions and disease etiology, and provides potential novel strategies for diagnosis and treatment. Examples of epigenetic inheritance relevant to human disease, such as the detrimental effects of traumatic stress or drug/toxic exposure on brain functions, are reviewed. Different possible routes of transmission of epigenetic information involving the germline or germline-independent transfer are discussed, and different mechanisms for the maintenance and transmission of epigenetic information like chromatin remodeling and small noncoding RNAs are considered. Future research directions and remaining major challenges in this field are also outlined. Finally, the adaptive value of epigenetic inheritance, and the cost and benefit of allowing acquired epigenetic marks to persist across generations is critically evaluated. PMID:22781843

  18. Genetic instability in inherited and sporadic leukemias.

    PubMed

    Popp, Henning D; Bohlander, Stefan K

    2010-12-01

    Genetic instability due to increased DNA damage and altered DNA repair is of central significance in the initiation and progression of inherited and sporadic human leukemias. Although very rare, some inherited DNA repair insufficiency syndromes (e.g., Fanconi anemia, Bloom's syndrome) have added substantially to our understanding of crucial mechanisms of leukemogenesis in recent years. Conversely, sporadic leukemias account for the main proportion of leukemias and here DNA damaging reactive oxygen species (ROS) play a central role. Although the exact mechanisms of increased ROS production remain largely unknown and no single pathway has been detected thus far, some oncogenic proteins (e.g., the activated tyrosine kinases BCR-ABL1 and FLT3-ITD) seem to play a key role in driving genetic instability by increased ROS generation which influences the disease course (e.g., blast crisis in chronic myeloid leukemia or relapse in FLT3-ITD positive acute myeloid leukemia). Of course other mechanisms, which promote genetic instability in leukemia also exist. A newly emerging mechanism is the genome-wide alteration of epigenetic marks (e.g., hypomethylation of histone H3K79), which promotes chromosomal instability. Taken together genetic instability plays a critical role both in inherited and sporadic leukemias and emerges as a common theme in both inherited and sporadic leukemias. Beyond its theoretical impact, the analysis of genetic instability may lead the way to the development of innovative therapy strategies. © 2010 Wiley-Liss, Inc.

  19. The inheritance of acquired epigenetic variations.

    PubMed

    Jablonka, Eva; Lamb, Marion J

    2015-08-01

    There is evidence that the functional history of a gene in one generation can influence its expression in the next. In somatic cells, changes in gene activity are frequently associated with changes in the pattern of methylation of the cytosines in DNA; these methylation patterns are stably inherited. Recent work suggests that information about patterns of methylation and other epigenetic states can also be transmitted from parents to offspring. This evidence is the basis of a model for the inheritance of acquired epigenetic variations. According to the model, an environmental stimulus can induce heritable chromatin modifications which are very specific and predictable, and might result in an adaptive response to the stimulus. This type of response probably has most significance for adaptive evolution in organisms such as fungi and plants, which lack distinct segregation of the soma and germ line. However, in all organisms, the accumulation of specific and random chromatin modifications in the germ line may be important in speciation, because these modifications could lead to reproductive isolation between populations. Heritable chromatin variations may also alter the frequency and distribution of classical mutations and meiotic recombination. Therefore, inherited epigenetic changes in the structure of chromatin can influence neo-Darwinian evolution as well as cause a type of "Lamarckian" inheritance.

  20. Difficulties in Learning Inheritance and Polymorphism

    ERIC Educational Resources Information Center

    Liberman, Neomi; Beeri, Catriel; Kolikant, Yifat Ben-David

    2011-01-01

    This article reports on difficulties related to the concepts of inheritance and polymorphism, expressed by a group of 22 in-service CS teachers with an experience with the procedural paradigm, as they coped with a course on OOP. Our findings are based on the analysis of tests, questionnaires that the teachers completed in the course, as well as on…

  1. Difficulties in Learning Inheritance and Polymorphism

    ERIC Educational Resources Information Center

    Liberman, Neomi; Beeri, Catriel; Kolikant, Yifat Ben-David

    2011-01-01

    This article reports on difficulties related to the concepts of inheritance and polymorphism, expressed by a group of 22 in-service CS teachers with an experience with the procedural paradigm, as they coped with a course on OOP. Our findings are based on the analysis of tests, questionnaires that the teachers completed in the course, as well as on…

  2. Fractional populations in sex-linked inheritance

    NASA Astrophysics Data System (ADS)

    Pyo Lee, Seung; Chung, Myung-Hoon; Koo Kim, Chul; Nahm, Kyun

    2001-03-01

    We study the fractional populations in chromosome inherited diseases. The governing equations for the fractional populations are found and solved in the presence of mutation and selection. The physical fixed points obtained are used to discuss the cases of color blindness and hemophilia.

  3. Inheritance of the accessory navicular bone.

    PubMed

    Kiter, E; Erduran, M; Günal, I

    2000-01-01

    The accessory navicular bone is one of the most symptomatic bones of the foot. Although it has been reported to be present in various members of the same family, there is a lack of knowledge about its inheritance in the literature. We examined three families and suggest that it has an autosomal dominant trait with incomplete penetrance.

  4. A Simple Analysis of an Inherited Trait

    ERIC Educational Resources Information Center

    Aagaard, Stanley; Keller, Elhannan

    1977-01-01

    Described is a classroom activity for analyzing an inherited human trait, the ability to tast phenylthiocarbamide (PTC). Formulas for analyzing gene frequency are given for classroom and neighborhood samples. Additional tables include statistics on the ability to taste PTC and other easily sampled human traits. (MA)

  5. Phylogenetics Exercise Using Inherited Human Traits

    ERIC Educational Resources Information Center

    Tuimala, Jarno

    2006-01-01

    A bioinformatics laboratory exercise based on inherited human morphological traits is presented. It teaches how morphological characters can be used to study the evolutionary history of humans using parsimony. The exercise can easily be used in a pen-and-paper laboratory, but if computers are available, a more versatile analysis can be carried…

  6. Phylogenetics Exercise Using Inherited Human Traits

    ERIC Educational Resources Information Center

    Tuimala, Jarno

    2006-01-01

    A bioinformatics laboratory exercise based on inherited human morphological traits is presented. It teaches how morphological characters can be used to study the evolutionary history of humans using parsimony. The exercise can easily be used in a pen-and-paper laboratory, but if computers are available, a more versatile analysis can be carried…

  7. Epigenetic inheritance of proteostasis and ageing

    PubMed Central

    Li, Cheryl; Casanueva, Olivia

    2016-01-01

    Abundant evidence shows that the genome is not as static as once thought and that gene expression can be reversibly modulated by the environment. In some cases, these changes can be transmitted to the next generation even if the environment has reverted. Such transgenerational epigenetic inheritance requires that information be stored in the germline in response to exogenous stressors. One of the most elusive questions in the field of epigenetic inheritance is the identity of such inherited factor(s). Answering this question would allow us to understand how the environment can shape human populations for multiple generations and may help to explain the rapid rise in obesity and neurodegenerative diseases in modern society. It will also provide clues on how we might be able to reprogramme the epigenome to prevent transmission of detrimental phenotypes and identify individuals who might be at increased risk of disease. In this article, we aim to review recent developments in this field, focusing on research conducted mostly in the nematode Caenorhabditis elegans and mice, that link environmental modulators with the transgenerational inheritance of phenotypes that affect protein-folding homoeostasis and ageing. PMID:27744335

  8. Unexplained infertility: association with inherited thrombophilia.

    PubMed

    Fatini, Cinzia; Conti, Lucia; Turillazzi, Valentina; Sticchi, Elena; Romagnuolo, Ilaria; Milanini, Maria Novella; Cozzi, Cinzia; Abbate, Rosanna; Noci, Ivo

    2012-05-01

    Unexplained infertility represents one of the most common diagnoses in fertility care. Attention is being paid to the association between inherited thrombophilia and infertility causes. In this study we investigated the prevalence of inherited thrombophilia according to infertility causes. We studied Prothrombin gene G20210A mutation, Factor V Leiden, deficiencies in protein S and C and antithrombin in 930 Caucasian infertile women referred to Fertility Center of the Department of Sciences for Woman and Child's Health, University of Florence, of whom 230 with unexplained, 195 female and 283 male infertility, and in 240 women who have conceived naturally without hormonal stimulation therapy. A significant relationship between inherited thrombophilia [OR 95%CI 1.97 (1.05-3.68), p = 0.03] and unexplained infertility was observed, whereas no association between thrombophilia and female and male infertility was found. Significantly higher prevalence of prothrombin gene mutation in unexplained infertile women in comparison to that observed in fertile women was observed (5.7% vs 2.1% p = 0.04); the prevalence of the other thrombophilia determinants was higher, even if not significantly, in the unexplained infertile group. This study demonstrates the relationship between inherited thrombophilia and unexplained infertility, thus suggesting the contribution of genetic components in modulating unexplained infertility, behind anovulation, male and tubal factor. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Epigenetic inheritance and the missing heritability.

    PubMed

    Trerotola, Marco; Relli, Valeria; Simeone, Pasquale; Alberti, Saverio

    2015-07-28

    Genome-wide association studies of complex physiological traits and diseases consistently found that associated genetic factors, such as allelic polymorphisms or DNA mutations, only explained a minority of the expected heritable fraction. This discrepancy is known as "missing heritability", and its underlying factors and molecular mechanisms are not established. Epigenetic programs may account for a significant fraction of the "missing heritability." Epigenetic modifications, such as DNA methylation and chromatin assembly states, reflect the high plasticity of the genome and contribute to stably alter gene expression without modifying genomic DNA sequences. Consistent components of complex traits, such as those linked to human stature/height, fertility, and food metabolism or to hereditary defects, have been shown to respond to environmental or nutritional condition and to be epigenetically inherited. The knowledge acquired from epigenetic genome reprogramming during development, stem cell differentiation/de-differentiation, and model organisms is today shedding light on the mechanisms of (a) mitotic inheritance of epigenetic traits from cell to cell, (b) meiotic epigenetic inheritance from generation to generation, and (c) true transgenerational inheritance. Such mechanisms have been shown to include incomplete erasure of DNA methylation, parental effects, transmission of distinct RNA types (mRNA, non-coding RNA, miRNA, siRNA, piRNA), and persistence of subsets of histone marks.

  10. The apparent enhancement of CpG transversions in primate lineage is a consequence of multiple replacements.

    PubMed

    Borštnik, Branko; Pumpernik, Danilo

    2014-06-01

    We claim that the apparently enhanced CpG transversions in the form CpG to CpC/GpG or to ApG/CpT are caused by the hypermutable CpG to CpA/TpG transition. The nucleotide replacement counts obtained from the human/chimpanzee/gorilla/orangutan sequence alignments representing the replacements due to the evolutionary species divergence and the results of 1000 genomes project that provide us with the differences due to the intraspecies diversification were analyzed to estimate the ratio of CpG versus non-CpG transversion probabilities. The trinucleotide replacement counts were extracted from the regions that are free of functional constraints. The CpG transversion probabilities based upon the genomic comparisons were found to exceed more than twice the non-CpG transversions. The diversity data emerging from 14 population groups were partitioned in five classes as a function of the parameter quantifying the spread of the polymorphic allele among the group of individuals. The results based upon the human polymorphism exhibit a trend where CpG over non-CpG transversion probability ratio is less and less exceeding unity as the values of the derived allele frequency (DAF) of snps are diminishing. A computer simulation of a simplified model indicates that the phenomenon of the apparent enhancement of CpG transversions can have its source in the interference of the entropic effects with the maximum likelihood methodologies.

  11. Immunostimulatory Oligodeoxynucleotides Containing the CpG Motif are Effective as Immune Adjuvants in Tumor Antigen Immunization

    NASA Astrophysics Data System (ADS)

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-09-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund's adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund's adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund's adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy.

  12. Development of safe and effective nonviral gene therapy by eliminating CpG motifs from plasmid DNA vector.

    PubMed

    Takahashi, Yuki; Nishikawa, Makiya; Takakura, Yoshinobu

    2012-01-01

    Nonviral gene therapy is expected to become a regular treatment for a variety of difficult-to-treat diseases, such as cancer and virus infection. Plasmid DNA, which is used in most nonviral gene delivery systems, usually contains, unmethylated cytosine-guanine dinucleotides, so called CpG motifs. CpG motifs are recognized by immune cells as a danger signal, leading to an inflammatory response. Such inflammatory responses could affect the safety and effectiveness of nonviral gene therapy. Therefore, reducing the number of CpG motifs in plasmid DNA has been used to increase the potency of plasmid DNA-based gene therapy. Previous studies have demonstrated that CpG reduction can extend the time period of transgene expression from plasmid DNA after in vivo gene transfer. In this review, the biological functions of the CpG motif are briefly summarized. Then, safety issues of nonviral gene therapy are discussed from the viewpoint of the inflammatory response to the CpG motif in plasmid DNA, and the effects of the CpG motif in plasmid DNA on the transgene expression profile of nonviral gene transfer are reviewed.

  13. Immunostimulatory oligodeoxynucleotides containing the CpG motif are effective as immune adjuvants in tumor antigen immunization

    PubMed Central

    Weiner, George J.; Liu, Hsin-Ming; Wooldridge, James E.; Dahle, Christopher E.; Krieg, Arthur M.

    1997-01-01

    Recent advances in our understanding of the immune response are allowing for the logical design of new approaches to cancer immunization. One area of interest is the development of new immune adjuvants. Immunostimulatory oligodeoxynucleotides containing the CpG motif (CpG ODN) can induce production of a wide variety of cytokines and activate B cells, monocytes, dendritic cells, and NK cells. Using the 38C13 B cell lymphoma model, we assessed whether CpG ODN can function as immune adjuvants in tumor antigen immunization. The idiotype served as the tumor antigen. Select CpG ODN were as effective as complete Freund’s adjuvant at inducing an antigen-specific antibody response but were associated with less toxicity. These CpG ODN induced a higher titer of antigen-specific IgG2a than did complete Freund’s adjuvant, suggesting an enhanced TH1 response. Mice immunized with CpG ODN as an adjuvant were protected from tumor challenge to a degree similar to that seen in mice immunized with complete Freund’s adjuvant. We conclude that CpG ODN are effective as immune adjuvants and are attractive as part of a tumor immunization strategy. PMID:9380720

  14. Phase I clinical trial of CpG oligonucleotide 7909 (PF-03512676) in patients with previously treated chronic lymphocytic leukemia.

    PubMed

    Zent, Clive S; Smith, Brian J; Ballas, Zuhair K; Wooldridge, James E; Link, Brian K; Call, Timothy G; Shanafelt, Tait D; Bowen, Deborah A; Kay, Neil E; Witzig, Thomas E; Weiner, George J

    2012-02-01

    CpG oligonucleotide 7909 (CpG 7909, PF-03512676), a synthetic 24mer single stranded agonist of TLR9 expressed by B cells and plasmacytoid dendritic cells, is immunomodulatory and can cause activation-induced death of chronic lymphocytic leukemia (CLL) cells. We report a phase I study of CpG 7909 in 41 patients with early relapsed CLL. A single intravenous dose of CpG 7909 was well tolerated with no clinical effects and no significant toxicity up to 1.05 mg/kg. Single dose subcutaneous CpG 7909 had a maximum tolerated dose (MTD) of 0.45 mg/kg with dose limiting toxicity of myalgia and constitutional effects. Multiple weekly subcutaneous doses at the MTD were well tolerated. CpG 7909 administration induced immunologic changes in CLL and non-malignant cells that were dose and route dependent. We conclude that multidose therapy with subcutaneous CpG 7909 (0.45 mg/kg) could be used in future phase II combination clinical trials for CLL.

  15. Human-specific CpG “beacons” identify loci associated with human-specific traits and disease

    PubMed Central

    Bell, Christopher G.; Wilson, Gareth A.; Butcher, Lee M.; Roos, Christian; Walter, Lutz; Beck, Stephan

    2012-01-01

    Regulatory change has long been hypothesized to drive the delineation of the human phenotype from other closely related primates. Here we provide evidence that CpG dinucleotides play a special role in this process. CpGs enable epigenome variability via DNA methylation, and this epigenetic mark functions as a regulatory mechanism. Therefore, species-specific CpGs may influence species-specific regulation. We report non-polymorphic species-specific CpG dinucleotides (termed “CpG beacons”) as a distinct genomic feature associated with CpG island (CGI) evolution, human traits and disease. Using an inter-primate comparison, we identified 21 extreme CpG beacon clusters (≥ 20/kb peaks, empirical p < 1.0 × 10−3) in humans, which include associations with four monogenic developmental and neurological disease related genes (Benjamini-Hochberg corrected p = 6.03 × 10−3). We also demonstrate that beacon-mediated CpG density gain in CGIs correlates with reduced methylation in these species in orthologous CGIs over time, via human, chimpanzee and macaque MeDIP-seq. Therefore mapping into both the genomic and epigenomic space the identified CpG beacon clusters define points of intersection where a substantial two-way interaction between genetic sequence and epigenetic state has occurred. Taken together, our data support a model for CpG beacons to contribute to CGI evolution from genesis to tissue-specific to constitutively active CGIs. PMID:22968434

  16. In ovo administration of CpG oligodeoxynucleotides and the recombinant microneme protein MIC2 protects against Eimeria infections.

    PubMed

    Dalloul, Rami A; Lillehoj, Hyun S; Klinman, Dennis M; Ding, Xicheng; Min, Wongi; Heckert, Robert A; Lillehoj, Erik P

    2005-05-02

    We have previously demonstrated that short oligodeoxynucleotides containing unmethylated CpG motifs (CpG ODNs) exert a positive effect on weight loss and oocyst shedding associated with Eimeria infection when injected in vivo. The present work investigated the effects of in ovo vaccination with CpG ODNs and an Eimeria recombinant microneme protein (MIC2), alone or in combination, on susceptibility to coccidiosis. In ovo injection of CpG ODNs alone enhanced resistance to experimental Eimeria acervulina infection as best exemplified by reduced oocyst shedding. Two CpG ODNs reduced the oocyst load, but did not affect weight gain. When co-administered with the recombinant microneme protein, both ODNs reduced oocyst shedding; however, only ODN D19 plus MIC2 consistently improved weight gain. Vaccinating with ODN 2006 or MIC2 protein curtailed oocyst shedding but did not enhance weight gain in Eimeria tenella-infected birds. Co-administration of CpG ODN and MIC2 did not have an additive effect in reducing the oocyst output; however, it resulted in the highest and lowest Ab response before and after Eimeria tenella infection, respectively. Collectively, CpG ODNs administered in ovo demonstrated immunoenhancing and adjuvant effects following Eimeria infections.

  17. In Ovo Delivery of CpG DNA Reduces Avian Infectious Laryngotracheitis Virus Induced Mortality and Morbidity

    PubMed Central

    Thapa, Simrika; Abdul Cader, Mohamed Sarjoon; Murugananthan, Kalamathy; Nagy, Eva; Sharif, Shayan; Czub, Markus; Abdul-Careem, Mohamed Faizal

    2015-01-01

    Endosomal toll-like receptor-21 and -9 sense CpG DNA activating production of pro-inflammatory mediators with antimicrobial effects. Here, we investigated the induction of antiviral response of in ovo delivered CpG DNA against infectious laryngotracheitis virus (ILTV) infection. We found that in ovo delivered CpG DNA significantly reduces ILTV infection pre-hatch correlating with the expression of IL-1β and increase of macrophages in lungs. As assessed in vitro, CpG DNA stimulated avian macrophages could be a potential source of IL-1β and other pro-inflammatory mediators. Since we also found that in ovo CpG DNA delivery maintains increased macrophages in the lungs post-hatch, we infected the chickens on the day of hatch with ILTV. We found that in ovo delivered CpG DNA significantly reduces mortality and morbidity resulting from ILTV infection encountered post-hatch. Thus, CpG DNA can be a candidate innate immune stimulant worthy of further investigation for the control of ILTV infection in chickens. PMID:25856635

  18. CpG oligonucleotide therapy cures subcutaneous and orthotopic tumors and evokes protective immunity in murine bladder cancer.

    PubMed

    Ninalga, Christina; Loskog, Angelica; Klevenfeldt, Magdalena; Essand, Magnus; Tötterman, Thomas H

    2005-01-01

    Bacillus Calmette-Guerin (BCG) instillation is standard immunotherapy for superficial bladder carcinoma. However, many patients become refractory to BCG, giving impetus to the development of alternative therapies. CpG oligodeoxynucleotide (ODN) therapy has been shown to promote T(H)1-oriented antitumor responses in various tumor models. To investigate its therapeutic effect in bladder cancer, we used different CpG ODNs to treat C57BL/6 mice bearing the subcutaneous murine bladder tumor MB49. CpG type B ODN 1668 was superior at inhibiting tumor growth, leading to complete regression of large tumors. More importantly, CpG ODN 1668 also regressed orthotopically growing MB49 tumors for the first time. Rechallenge of CpG ODN-cured mice with MB49 showed that a majority of the mice were protected long term, demonstrating that CpG ODN therapy evokes a memory response. Adenoviral vectors (Ad) encoding CD40L, tumor necrosis factor-related activation-induced cytokine, lymphotactin, interleukin (IL) 2, and IL-15 were also investigated. AdCD40L and AdIL-15 transduction could abolish MB49 tumorigenicity, and these vectors were combined with CpG ODN 1668 to investigate any enhanced effects. No such effects were seen. All groups of mice treated with CpG ODNs, alone or in combination with adenoviral vector, exhibited increased serum concentrations of IL-12, indicative of a T(H)1 response. Our results show that CpG ODN therapy cures established subcutaneous and orthotopic bladder cancer via a T(H)1-mediated response and provides long-lasting protective immunity.

  19. Recognition of CpG Island Chromatin by KDM2A Requires Direct and Specific Interaction with Linker DNA

    PubMed Central

    Zhou, Jin C.; Blackledge, Neil P.; Farcas, Anca M.

    2012-01-01

    Up to 70% of human genes are associated with regions of nonmethylated DNA called CpG islands (S. Saxonov, P. Berg, and D. L. Brutlag, Proc. Natl. Acad. Sci. U. S. A. 103:1412–1417, 2006). Usually associated with the 5′ end of genes, CpG islands are thought to impact gene expression. We previously demonstrated that the histone demethylase KDM2A is specifically recruited to CpG islands to define a unique chromatin architecture and highlight gene regulatory regions in large and complex mammalian genomes. This targeting relies on a zinc finger CXXC DNA binding domain (ZF-CXXC), but how this demethylase interfaces with CpG island chromatin in vivo remains unknown. Here we demonstrate, using defined chromatin templates in vitro and chromatin profiling in vivo, that nucleosomes are a major barrier to KDM2A binding and that CpG islands are directly interpreted by the ZF-CXXC domain through specific interaction with linker DNA. Furthermore, KDM2A appears to be constrained to CpG islands not only by their nonmethylated state but also by a combination of methylated DNA and nucleosome occlusion elsewhere in the genome. Our observations suggest that both DNA sequence and chromatin structure are defining factors in interpreting CpG island chromatin and translation of the CpG signal. More generally, these features of CpG island recognition suggest that chromatin structure and accessibility play a major role in defining how transcription factors recognize DNA and regulatory elements genome-wide. PMID:22083960

  20. Characteristics of fads2 gene expression and putative promoter in European sea bass (Dicentrarchus labrax): comparison with salmonid species and analysis of CpG methylation.

    PubMed

    Geay, Florian; Zambonino-Infante, José; Reinhardt, Richard; Kuhl, Heiner; Santigosa, Ester; Cahu, Chantal; Mazurais, David

    2012-03-01

    Marine fish species exhibit low capacity to biosynthesise highly unsaturated fatty acid (HUFA) in comparison to strict freshwater and anadromous species. It is admitted that the Delta(6) desaturase (FADS2) is a key enzyme in the HUFA biosynthetic pathway. We investigated by quantitative PCR the relative amounts of FADS2 mRNA in European sea bass (Dicentrarchus labrax) in comparison with a salmonid species, the rainbow trout (Oncorhynchus mykiss L.). The analysis of the expression data was performed regarding the difference of the characteristics of a critical fragment of the fads2 gene promoter between sea bass and Atlantic salmon. The lower level of fads2 gene expression observed in sea bass suggested that fads2 gene putative promoter, which exhibited an E-box like Sterol Regulatory Element (SRE) site but lacked a Sp1 site, is less active in this marine species. The cytosine methylation of CpG sites in the putative promoter region including E-box like SRE and NF-Y binding sites of sea bass fads2 gene was also investigated following a nutritional conditioning of larvae. However, no significant difference of CpG methylation could be found for any of the 28 CpGs analysed between larvae fed diet with high or low HUFA contents. In conclusion, the present data revealed lower constitutive expression of the fads2 gene possibly related to different characteristics of gene promoter in sea bass in comparison with salmonid species, and indicated that long-term conditioning of fads2 gene expression did not influence the methylation of the gene promoter at potential SRE binding site.

  1. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  2. Both CpG Methylation and Activation-Induced Deaminase Are Required for the Fragility of the Human bcl-2 Major Breakpoint Region: Implications for the Timing of the Breaks in the t(14;18) Translocation

    PubMed Central

    Cui, Xiaoping; Lu, Zhengfei; Kurosawa, Aya; Klemm, Lars; Bagshaw, Andrew T.; Tsai, Albert G.; Gemmell, Neil; Müschen, Markus; Adachi, Noritaka; Hsieh, Chih-Lin

    2013-01-01

    The t(14;18) chromosomal translocation typically involves breakage at the bcl-2 major breakpoint region (MBR) to cause human follicular lymphoma. A theory to explain the striking propensity of the MBR breaks at three CpG clusters within the 175-bp MBR region invoked activation-induced deaminase (AID). In a test of that theory, we used here minichromosomal substrates in human pre-B cell lines. Consistent with the essential elements of the theory, we found that the MBR breakage process is indeed highly dependent on DNA methylation at the CpG sites and highly dependent on the AID enzyme to create lesions at peak locations within the MBR. Interestingly, breakage of the phosphodiester bonds at the AID-initiated MBR lesions is RAG dependent, but, unexpectedly, most are also dependent on Artemis. We found that Artemis is capable of nicking small heteroduplex structures and is even able to nick single-base mismatches. This raises the possibility that activated Artemis, derived from the unjoined D to JH DNA ends at the IgH locus on chromosome 14, nicks AID-generated TG mismatches at methyl CpG sites, and this would explain why the breaks at the chromosome 18 MBR occur within the same time window as those on chromosome 14. PMID:23263985

  3. Inheritable copper tolerance in the chlorophyte macroalga Enteromorpha intestinalis

    SciTech Connect

    Lewis, S.; Williams, P.; Donkin, M.; Depledge, M.H.

    1995-12-31

    A study was carried out to determine if a population of Enteromorpha intestinalis, from a metal polluted site, exhibited copper tolerance. This work was in preparation for investigating stress protein patterns in copper tolerant and sensitive populations. The effects of copper on growth of E. intestinalis from three clean and one metal polluted site were compared. Growth was assessed by incubating thallus sections in a range of copper solutions and measuring increase in length. Offspring were cultured from clean and polluted sites and the effects of copper on their growth assessed, to determine if any tolerance was inheritable. Concentrations of the trace metals; copper, zinc and manganese in the populations were also determined. Over the range of copper concentrations tested (0--150 {micro}g/i), growth of the polluted site populations was not significantly affected (P > 0.05). However growth of the clean site populations was significantly depressed by exposure to 50 {micro}g/l. This pattern of response was also exhibited by the offspring. Trace metal concentrations in the clean site populations were very similar, however the polluted site population contained {sup {minus}}10 times the control site values of manganese and {approximately}35 times the values of zinc and copper. The results suggest that the polluted site population of E. intestinalis has developed a degree of copper tolerance which appears to have a genetic basis. This investigation is consistent with previous work into copper tolerance in ship-fouling populations of E. intestinalis var. compressa. A commercially available HSP70 antibody with a high degree of cross-reactivity to E. intestinalis has been identified and used to screen samples of the seaweed from the aforementioned populations.

  4. The inheritance of organelle genes and genomes: patterns and mechanisms.

    PubMed

    Xu, Jianping

    2005-12-01

    Unlike nuclear genes and genomes, the inheritance of organelle genes and genomes does not follow Mendel's laws. In this mini-review, I summarize recent research progress on the patterns and mechanisms of the inheritance of organelle genes and genomes. While most sexual eukaryotes show uniparental inheritance of organelle genes and genomes in some progeny at least part of the time, increasing evidence indicates that strictly uniparental inheritance is rare and that organelle inheritance patterns are very diverse and complex. In contrast with the predominance of uniparental inheritance in multicellular organisms, organelle genes in eukaryotic microorganisms, such as protists, algae, and fungi, typically show a greater diversity of inheritance patterns, with sex-determining loci playing significant roles. The diverse patterns of inheritance are matched by the rich variety of potential mechanisms. Indeed, many factors, both deterministic and stochastic, can influence observed patterns of organelle inheritance. Interestingly, in multicellular organisms, progeny from interspecific crosses seem to exhibit more frequent paternal leakage and biparental organelle genome inheritance than those from intraspecific crosses. The recent observation of a sex-determining gene in the basidiomycete yeast Cryptococcus neoformans, which controls mitochondrial DNA inheritance, has opened up potentially exciting research opportunities for identifying specific molecular genetic pathways that control organelle inheritance, as well as for testing evolutionary hypotheses regarding the prevalence of uniparental inheritance of organelle genes and genomes.

  5. Synthetic Human TLR9-LRR11 Peptide Attenuates TLR9 Signaling by Binding to and thus Decreasing Internalization of CpG Oligodeoxynucleotides.

    PubMed

    Pan, Xichun; Li, Bin; Kuang, Mei; Liu, Xin; Cen, Yanyan; Qin, Rongxin; Ding, Guofu; Zheng, Jiang; Zhou, Hong

    2016-02-22

    Toll-like receptor (TLR) 9 is an endosomal receptor recognizing bacterial DNA/CpG-containing oligodeoxynucleotides (CpG ODN). Blocking CpG ODN/TLR9 activity represents a strategy for therapeutic prevention of immune system overactivation. Herein, we report that a synthetic peptide (SP) representing the leucine-rich repeat 11 subdomain of the human TLR9 extracellular domain could attenuate CpG ODN/TLR9 activity in RAW264.7 cells by binding to CpG ODN and decreasing its internalization. Our results demonstrate that preincubation with SP specifically inhibited CpG ODN- but not lipopolysaccharide (LPS)- and lipopeptide (PAM3CSK4)-stimulated TNF-α and IL-6 release. Preincubation of SP with CpG ODN dose-dependently decreased TLR9-driven phosphorylation of IκBα and ERK and activation of NF-κB/p65. Moreover, SP dose-dependently decreased FAM-labeled CpG ODN internalization, whereas non-labeled CpG ODN reversed the inhibition. The KD value of SP-CpG ODN binding was within the micromolar range. Our results demonstrated that SP was a specific inhibitor of CpG ODN/TLR9 activity via binding to CpG ODN, leading to reduced ODN internalization and decreased activation of subsequent pathways within cells. Thus, SP could be used as a potential CpG ODN antagonist to block TLR9 signaling.

  6. Mediation of the malignant biological characteristics of gastric cancer cells by the methylated CpG islands in RNF180 DNA promoter.

    PubMed

    Deng, Jingyu; Guo, Jiangtao; Guo, Xiaofan; Hou, Yachao; Xie, Xingming; Sun, Changyu; Zhang, Rupeng; Yu, Xiaohua; Liang, Han

    2016-07-12

    We previously demonstrated that the methylation of ring finger protein 180 (RNF180) DNA promoter was specific to gastric cancer tissues. We reported that four hypermethylated CpG islands, namely, CpG-116, CpG-80, CpG+97, and CpG+102, in RNF180 promoter were significantly associated with the postoperative overall survival of gastric cancer patients. Correlation analysis revealed that the methylated status of CpG islands was significantly associated with the lymph node metastasis of gastric cancer. We formulated four types of MGC-803 cells with the specific demethylation of one of the four CpG islands through vector transfection method. Conventional detections for the biological characteristics of cancer cells showed that 1) the methylation of CpG+102 island in RNF180 DNA promoter could remarkably influence the comprehensively malignant biological characteristics of gastric cancer cells, including their proliferation, invasion, cell cycle, anti-apoptosis, and tumorigenicity. 2) The CpG+97 island, in addition to the CpG+102 island, should be considered as the other key methylated locus in RNF180 DNA promoter to mediate the malignant biological characteristics of gastric cancer cells. The methylated status of the key CpG islands of RNF180 DNA promoter may be used to predict the variations of the malignant biological characteristics of gastric cancer cells. The proposed method is a promising molecular therapy for gastric cancer.

  7. Mediation of the malignant biological characteristics of gastric cancer cells by the methylated CpG islands in RNF180 DNA promoter

    PubMed Central

    Deng, Jingyu; Guo, Jiangtao; Guo, Xiaofan; Hou, Yachao; Xie, Xingming; Sun, Changyu; Zhang, Rupeng; Yu, Xiaohua; Liang, Han

    2016-01-01

    We previously demonstrated that the methylation of ring finger protein 180 (RNF180) DNA promoter was specific to gastric cancer tissues. We reported that four hypermethylated CpG islands, namely, CpG-116, CpG-80, CpG+97, and CpG+102, in RNF180 promoter were significantly associated with the postoperative overall survival of gastric cancer patients. Correlation analysis revealed that the methylated status of CpG islands was significantly associated with the lymph node metastasis of gastric cancer. We formulated four types of MGC-803 cells with the specific demethylation of one of the four CpG islands through vector transfection method. Conventional detections for the biological characteristics of cancer cells showed that 1) the methylation of CpG+102 island in RNF180 DNA promoter could remarkably influence the comprehensively malignant biological characteristics of gastric cancer cells, including their proliferation, invasion, cell cycle, anti-apoptosis, and tumorigenicity. 2) The CpG+97 island, in addition to the CpG+102 island, should be considered as the other key methylated locus in RNF180 DNA promoter to mediate the malignant biological characteristics of gastric cancer cells. The methylated status of the key CpG islands of RNF180 DNA promoter may be used to predict the variations of the malignant biological characteristics of gastric cancer cells. The proposed method is a promising molecular therapy for gastric cancer. PMID:27223257

  8. Elusive inheritance: Transgenerational effects and epigenetic inheritance in human environmental disease.

    PubMed

    Martos, Suzanne N; Tang, Wan-Yee; Wang, Zhibin

    2015-07-01

    Epigenetic mechanisms involving DNA methylation, histone modification, histone variants and nucleosome positioning, and noncoding RNAs regulate cell-, tissue-, and developmental stage-specific gene expression by influencing chromatin structure and modulating interactions between proteins and DNA. Epigenetic marks are mitotically inherited in somatic cells and may be altered in response to internal and external stimuli. The idea that environment-induced epigenetic changes in mammals could be inherited through the germline, independent of genetic mechanisms, has stimulated much debate. Many experimental models have been designed to interrogate the possibility of transgenerational epigenetic inheritance and provide insight into how environmental exposures influence phenotypes over multiple generations in the absence of any apparent genetic mutation. Unexpected molecular evidence has forced us to reevaluate not only our understanding of the plasticity and heritability of epigenetic factors, but of the stability of the genome as well. Recent reviews have described the difference between transgenerational and intergenerational effects; the two major epigenetic reprogramming events in the mammalian lifecycle; these two events making transgenerational epigenetic inheritance of environment-induced perturbations rare, if at all possible, in mammals; and mechanisms of transgenerational epigenetic inheritance in non-mammalian eukaryotic organisms. This paper briefly introduces these topics and mainly focuses on (1) transgenerational phenotypes and epigenetic effects in mammals, (2) environment-induced intergenerational epigenetic effects, and (3) the inherent difficulties in establishing a role for epigenetic inheritance in human environmental disease.

  9. ampliMethProfiler: a pipeline for the analysis of CpG methylation profiles of targeted deep bisulfite sequenced amplicons.

    PubMed

    Scala, Giovanni; Affinito, Ornella; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Chiariotti, Lorenzo; Cocozza, Sergio

    2016-11-25

    CpG sites in an individual molecule may exist in a binary state (methylated or unmethylated) and each individual DNA molecule, containing a certain number of CpGs, is a combination of these states defining an epihaplotype. Classic quantification based approaches to study DNA methylation are intrinsically unable to fully represent the complexity of the underlying methylation substrate. Epihaplotype based approaches, on the other hand, allow methylation profiles of cell populations to be studied at the single molecule level. For such investigations, next-generation sequencing techniques can be used, both for quantitative and for epihaplotype analysis. Currently available tools for methylation analysis lack output formats that explicitly report CpG methylation profiles at the single molecule level and that have suited statistical tools for their interpretation. Here we present ampliMethProfiler, a python-based pipeline for the extraction and statistical epihaplotype analysis of amplicons from targeted deep bisulfite sequencing of multiple DNA regions. ampliMethProfiler tool provides an easy and user friendly way to extract and analyze the epihaplotype composition of reads from targeted bisulfite sequencing experiments. ampliMethProfiler is written in python language and requires a local installation of BLAST and (optionally) QIIME tools. It can be run on Linux and OS X platforms. The software is open source and freely available at http://amplimethprofiler.sourceforge.net .

  10. Using Mendelian inheritance to improve high-throughput SNP discovery.

    PubMed

    Chen, Nancy; Van Hout, Cristopher V; Gottipati, Srikanth; Clark, Andrew G

    2014-11-01

    Restriction site-associated DNA sequencing or genotyping-by-sequencing (GBS) approaches allow for rapid and cost-effective discovery and genotyping of thousands of single-nucleotide polymorphisms (SNPs) in multiple individuals. However, rigorous quality control practices are needed to avoid high levels of error and bias with these reduced representation methods. We developed a formal statistical framework for filtering spurious loci, using Mendelian inheritance patterns in nuclear families, that accommodates variable-quality genotype calls and missing data--both rampant issues with GBS data--and for identifying sex-linked SNPs. Simulations predict excellent performance of both the Mendelian filter and the sex-linkage assignment under a variety of conditions. We further evaluate our method by applying it to real GBS data and validating a subset of high-quality SNPs. These results demonstrate that our metric of Mendelian inheritance is a powerful quality filter for GBS loci that is complementary to standard coverage and Hardy-Weinberg filters. The described method, implemented in the software MendelChecker, will improve quality control during SNP discovery in nonmodel as well as model organisms.

  11. Impact of SNPs on CpG Islands in the MYC and HRAS oncogenes and in a wide variety of tumor suppressor genes: A multi-cancer approach

    PubMed Central

    Samy, Mohammad D.; Yavorski, John M.; Mauro, James A.; Blanck, George

    2016-01-01

    ABSTRACT Single nucleotide polymorphisms (SNPs) that occur within CpG Islands may lead to increased hypermethylation if a SNP allele has the potential to form a CpG dinucleotide, as well as potentially lead to hypomethylation if a SNP allele eliminates a CpG dinucleotide. We analyzed CpG-related SNP allele frequencies in whole genome sequences (WGS) across 5 TCGA cancer datasets, thereby exploiting a more recent appreciation for signaling pathway degeneracy in cancer. The cancer data sets were analyzed for SNPs in CpG islands associated with the oncogenes, HRAS and MYC, and in the CpG islands associated with the tumor suppressor genes, APC, DCC, and RB1. We determined that one SNP allele (rs3824120) in a CpG island associated with MYC which eliminated a CpG was more common in the cancer datasets than in the 100Genomes databases (p < 0.01). For HRAS, 2 SNP alleles (rs112690925, rs7939028) that created CpG's occurred significantly less frequently in the cancer data sets than in the general SNP databases (e.g., rs7939028, p < 0.0002, in comparison with AllSNPs(142)). Also, one SNP allele (rs4940177) that created a CpG in a CpG island associated with the DCC tumor suppressor gene, was more common in the cancer datasets (p < 0.0007). To understand a broader picture of the potential of SNP alleles to create CpG's in CpG islands of tumor suppressor genes, we developed a scripted algorithm to assess the SNP alleles associated with the CpG islands of 43 tumor suppressor genes. The following tumor suppressor genes have the possibility of significant, percent increases in their CpG counts, depending on which SNP allele(s) is present: VHL, BRCA1, BRCA2, CHEK2, PTEN and RB1. PMID:27074591

  12. Impact of SNPs on CpG Islands in the MYC and HRAS oncogenes and in a wide variety of tumor suppressor genes: A multi-cancer approach.

    PubMed

    Samy, Mohammad D; Yavorski, John M; Mauro, James A; Blanck, George

    2016-06-17

    Single nucleotide polymorphisms (SNPs) that occur within CpG Islands may lead to increased hypermethylation if a SNP allele has the potential to form a CpG dinucleotide, as well as potentially lead to hypomethylation if a SNP allele eliminates a CpG dinucleotide. We analyzed CpG-related SNP allele frequencies in whole genome sequences (WGS) across 5 TCGA cancer datasets, thereby exploiting a more recent appreciation for signaling pathway degeneracy in cancer. The cancer data sets were analyzed for SNPs in CpG islands associated with the oncogenes, HRAS and MYC, and in the CpG islands associated with the tumor suppressor genes, APC, DCC, and RB1. We determined that one SNP allele (rs3824120) in a CpG island associated with MYC which eliminated a CpG was more common in the cancer datasets than in the 100Genomes databases (p < 0.01). For HRAS, 2 SNP alleles (rs112690925, rs7939028) that created CpG's occurred significantly less frequently in the cancer data sets than in the general SNP databases (e.g., rs7939028, p < 0.0002, in comparison with AllSNPs(142)). Also, one SNP allele (rs4940177) that created a CpG in a CpG island associated with the DCC tumor suppressor gene, was more common in the cancer datasets (p < 0.0007). To understand a broader picture of the potential of SNP alleles to create CpG's in CpG islands of tumor suppressor genes, we developed a scripted algorithm to assess the SNP alleles associated with the CpG islands of 43 tumor suppressor genes. The following tumor suppressor genes have the possibility of significant, percent increases in their CpG counts, depending on which SNP allele(s) is present: VHL, BRCA1, BRCA2, CHEK2, PTEN and RB1.

  13. A New CPG Model for the Generation of Modular Trajectories for Hexapod Robots

    NASA Astrophysics Data System (ADS)

    Pinto, Carla M. A.; Rocha, Diana; Santos, Cristina P.; Matos, Vítor

    2011-09-01

    Legged robots are often used in a large variety of tasks, in different environments. Nevertheless, due to the large number of degrees-of-freedom to be controlled, online generation of trajectories in these robots is very complex. In this paper, we consider a modular approach to online generation of trajectories, based on biological concepts, namely Central Pattern Generators (CPGs). We introduce a new CPG model for hexapod robots' rhythms, based in the work of Golubitsky et al (1998). Each neuron/oscillator in the CPG consists of two modules/primitives: rhythmic and discrete. We study the effect on the robots' gaits of superimposing the two motor primitives, considering two distinct types of coupling. We conclude, from the simulation results, that the amplitude and frequency of periodic solutions, identified with hexapods' tripod and metachronal gaits, remain constant for the two couplings, after insertion of the discrete part.

  14. Generation of Adaptive Gait Patterns for Quadruped Robot with CPG Network including Motor Dynamic Model

    NASA Astrophysics Data System (ADS)

    Son, Yurak; Kamano, Takuya; Yasuno, Takashi; Suzuki, Takayuki; Harada, Hironobu

    This paper describes the generation of adaptive gait patterns using new Central Pattern Generators (CPGs) including motor dynamic models for a quadruped robot under various environment. The CPGs act as the flexible oscillators of the joints and make the desired angle of the joints. The CPGs are mutually connected each other, and the sets of their coupling parameters are adjusted by genetic algorithm so that the quadruped robot can realize the stable and adequate gait patterns. As a result of generation, the suitable CPG networks for not only a walking straight gait pattern but also rotation gait patterns are obtained. Experimental results demonstrate that the proposed CPG networks are effective to automatically adjust the adaptive gait patterns for the tested quadruped robot under various environment. Furthermore, the target tracking control based on image processing is achieved by combining the generated gait patterns.

  15. Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

    PubMed

    Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

    2004-09-01

    Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.

  16. Novel approaches for diagnosing inherited platelet disorders.

    PubMed

    Bastida Bermejo, José María; Hernández-Rivas, Jesús María; González-Porras, José Ramón

    2017-01-20

    Inherited platelet disorders diagnosis is based on the clinical history and bleeding assessment tools. The laboratory functional assays as well as the molecular test to identify the pathogenic genetic variant are essential to confirm the accurate diagnosis of these disorders. Nowadays, the main challenges to developing a new diagnostic system are involved in reducing the samples' volume, and faster and more helpful analysis. Moreover, there are no widely available and standardised global tests. High throughput genetic testing such as next-generation sequencing has revolutionised DNA sequencing technologies as it allows the simultaneous and faster investigation of multiple genes at a manageable cost. This technology has improved the molecular characterisation of inherited platelet disorders and has been implemented in the research studies and the clinical routine practice. Copyright © 2016 Elsevier España, S.L.U. All rights reserved.

  17. Inheritance of Hair Constrictions in Mice

    PubMed Central

    Mann, Stanley J.; Straile, William E.

    1972-01-01

    The frequencies of multi-constricted hairs in the pelage is the same (75%) in the caudal mid-dorsum of C57BL/10 and CBA inbred mice, but there are more single-constricted hairs in C57BL mice (9.41%) than in CBA mice (0.13%). This structural feature is used as a basis for genetic analysis of the hair coat.—The frequency of single-constricted hairs (4.41%) in F1 mice is intermediate between the frequencies observed in the CBA and C57BL parent strains. Data from the F2 crosses and backcrosses to the respective parent strains indicate that the presence of numerous single-constricted hairs in the pelage is an inherited characteristic. The mode of inheritance is controlled primarily by a semi-dominant autosomal gene (single-constriction; Hct), without the involvement of maternal factors. PMID:5034773

  18. Inheritance is where physiology meets evolution.

    PubMed

    Danchin, Etienne; Pocheville, Arnaud

    2014-06-01

    Physiology and evolutionary biology have developed as two separated disciplines, a separation that mirrored the hypothesis that the physiological and evolutionary processes could be decoupled. We argue that non-genetic inheritance shatters the frontier between physiology and evolution, and leads to the coupling of physiological and evolutionary processes to a point where there exists a continuum between accommodation by phenotypic plasticity and adaptation by natural selection. This approach is also profoundly affecting the definition of the concept of phenotypic plasticity, which should now be envisaged as a multi-scale concept. We further suggest that inclusive inheritance provides a quantitative way to help bridging infra-individual (i.e. physiology) with supra-individual (i.e. evolution) approaches, in a way that should help building the long sough inclusive evolutionary synthesis. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.

  19. Recessive inheritance of a relative fat pattern.

    PubMed Central

    Hasstedt, S J; Ramirez, M E; Kuida, H; Williams, R R

    1989-01-01

    We defined a relative-fat-pattern index (RFPI) as the ratio of subscapular skinfold thickness to the sum of subscapular and suprailiac skinfold thicknesses and computed RFPI for 774 adults (age greater than or equal to 25 years) in 59 pedigrees ascertained through cases of cardiovascular disease. Likelihood analysis of RFPI supported recessive inheritance of an allele with a frequency of 46%, which elevated mean RFPI from .412 to .533 when homozygous. The analysis apportioned the variance in RFPI as 42.3% due to the major locus, 9.5% due to polygenic inheritance, and 48.2% due to random environmental effects. Homozygotes for the recessive allele tended to have small suprailiac skinfold thicknesses rather than large subscapular skinfold thicknesses. Homozygotes were more frequent in younger than in older cases of obesity, coronary heart disease, essential hypertension, and diabetes mellitus; the increase was significant for all but diabetes. PMID:2589320

  20. Evolutionary inheritance of elemental stoichiometry in phytoplankton

    PubMed Central

    Quigg, Antonietta; Irwin, Andrew J.; Finkel, Zoe V.

    2011-01-01

    The elemental composition of phytoplankton is a fusion of the evolutionary history of the host and plastid, resulting in differences in genetic constraints and selection pressures associated with environmental conditions. The evolutionary inheritance hypothesis predicts similarities in elemental composition within related taxonomic lineages of phytoplankton. To test this hypothesis, we measured the elemental composition (C, N, P, S, K, Mg, Ca, Sr, Fe, Mn, Zn, Cu, Co, Cd and Mo) of 14 phytoplankton species and combined these with published data from 15 more species from both marine and freshwater environments grown under nutrient-replete conditions. The largest differences in the elemental profiles of the species distinguish between the prokaryotic Cyanophyta and primary endosymbiotic events that resulted in the green and red plastid lineages. Smaller differences in trace element stoichiometry within the red and green plastid lineages are consistent with changes in trace elemental stoichiometry owing to the processes associated with secondary endosymbioses and inheritance by descent with modification. PMID:20826483

  1. Evolutionary inheritance of elemental stoichiometry in phytoplankton.

    PubMed

    Quigg, Antonietta; Irwin, Andrew J; Finkel, Zoe V

    2011-02-22

    The elemental composition of phytoplankton is a fusion of the evolutionary history of the host and plastid, resulting in differences in genetic constraints and selection pressures associated with environmental conditions. The evolutionary inheritance hypothesis predicts similarities in elemental composition within related taxonomic lineages of phytoplankton. To test this hypothesis, we measured the elemental composition (C, N, P, S, K, Mg, Ca, Sr, Fe, Mn, Zn, Cu, Co, Cd and Mo) of 14 phytoplankton species and combined these with published data from 15 more species from both marine and freshwater environments grown under nutrient-replete conditions. The largest differences in the elemental profiles of the species distinguish between the prokaryotic Cyanophyta and primary endosymbiotic events that resulted in the green and red plastid lineages. Smaller differences in trace element stoichiometry within the red and green plastid lineages are consistent with changes in trace elemental stoichiometry owing to the processes associated with secondary endosymbioses and inheritance by descent with modification.

  2. Medical Problems in Obstetrics: Inherited Metabolic Disease.

    PubMed

    Murphy, Elaine

    2015-07-01

    An increasing number of women with rare inherited disorders of metabolism are becoming pregnant. Although, in general, outcomes for women and their children are good, there are a number of issues that need to be considered. Currently, limited specific guidance on the management of these conditions in pregnancy is available. Prepregnancy counselling with information on inheritance, options for reproduction, teratogenicity risk, potential impact on maternal health and long-term health of children should be offered. With appropriate specialist management, the teratogenic risk of conditions such as maternal phenylketonuria (PKU) can be eliminated, and the risk of metabolic decompensation in disorders of energy metabolism or intoxication significantly reduced. Multidisciplinary management, and close liaison between obstetricians and other specialists, is required for those women in whom there is cardiac, renal, respiratory, joint or other organ involvement.

  3. Management of inherited atherogenic dyslipidemias in children.

    PubMed

    Guardamagna, Ornella; Cagliero, Paola; Abello, Francesca

    2013-04-01

    In order to prevent cardiovascular disease, the treatment of inherited dyslipidemias in childhood represents an emerging topic capturing scientists' consideration. A body of findings emerged in the last decade for diagnosis and therapy, and results were recently summarized to introduce new guidelines by the American Academy of Pediatrics and National Institute for Health and Clinical Excellence. It is well known and generally shared the need to detect affected children precociously, when the family history address to genetic dyslipidemia and when familial premature cardiovascular disease occurs. A spectrum of disorders involving lipoproteins could be recognized by specific biochemical and genetic markers. A defined diagnosis represents the starting point to establish a correct treatment and follow-up program. This review represents a literature synthesis of the main cornerstones and criticisms concerning the screening program and management of atherogenic inherited dyslipidemias in children and adolescents.

  4. Pregnancy in women with inherited metabolic disease

    PubMed Central

    2015-01-01

    An increasing number of women with rare inherited disorders of metabolism are becoming pregnant. Whilst, in general, outcomes for women and their children are good, there are issues that need to be considered. Due to the rarity of many conditions, there is limited specific guidance available on best management. Prepregnancy counselling with information on inheritance, options for reproduction, teratogenicity risk, potential impact on maternal health and long-term health of children should be offered. With appropriate specialist management, the teratogenic risk of conditions such as maternal phenylketonuria (PKU) can be eliminated, and the risk of metabolic decompensation in other disorders of intoxication or energy metabolism significantly reduced. Newer therapies, such as enzyme replacement therapy, appear to be safe in pregnancy, but specific advice should be sought. Multidisciplinary management, and close liaison between obstetricians and other specialists is required for women in whom there is cardiac, renal, respiratory, joint or other organ involvement. PMID:27512458

  5. Inheritance is where physiology meets evolution

    PubMed Central

    Danchin, Étienne; Pocheville, Arnaud

    2014-01-01

    Physiology and evolutionary biology have developed as two separated disciplines, a separation that mirrored the hypothesis that the physiological and evolutionary processes could be decoupled. We argue that non-genetic inheritance shatters the frontier between physiology and evolution, and leads to the coupling of physiological and evolutionary processes to a point where there exists a continuum between accommodation by phenotypic plasticity and adaptation by natural selection. This approach is also profoundly affecting the definition of the concept of phenotypic plasticity, which should now be envisaged as a multi-scale concept. We further suggest that inclusive inheritance provides a quantitative way to help bridging infra-individual (i.e. physiology) with supra-individual (i.e. evolution) approaches, in a way that should help building the long sough inclusive evolutionary synthesis. PMID:24882815

  6. [Inheritance and innovation of traditional processing technology of Chinese medicine].

    PubMed

    Yang, Ming; Zhong, Ling-Yun; Xue, Xiao; Liu, Rong-Hua; Gong, Qian-Feng

    2016-02-01

    To discuss the inheritance and innovation study of Chinese medicine processing technology from three aspects: inheritance, standardization and industrial innovation development, propose "three lacks" in inheritance, "six lacks of standardization, and one lack of unity" in standardization, and "three emphasizing and three despising aspects" in industrial innovation, and propose feasible solutions for the above mentioned problems, providing a good foundation for inheritance and innovation of Chinese medicine processing. Copyright© by the Chinese Pharmaceutical Association.

  7. Guru - A tool for automatic restructuring of self inheritance hierarchies

    SciTech Connect

    Moore, I.

    1995-12-31

    This paper introduces Guru, a prototype tool for restructuring inheritance hierarchies in Self, while preserving the behavior of objects. Guru reverse engineers from existing inheritance hierarchies. Unlike previous work, Guru handles resends, redefined methods and the restructuring of only part of a system. Furthermore, Guru handles dynamic and cyclical inheritance, which are more specific to Self. Guru removes duplicated methods, and can create inheritance hierarchies with no overridden methods. The results of two non-trivial tests are presented and assessed.

  8. Environmentally Induced Epigenetic Transgenerational Inheritance of Altered SRY Genomic Binding During Gonadal Sex Determination.

    PubMed

    Skinner, Michael K; Bhandari, Ramji K; Haque, M Muksitul; Nilsson, Eric E

    2015-12-01

    A critical transcription factor required for mammalian male sex determination is SRY (sex determining region on the Y chromosome). The expression of SRY in precursor Sertoli cells is one of the initial events in testis development. The current study was designed to determine the impact of environmentally induced epigenetic transgenerational inheritance on SRY binding during gonadal sex determination in the male. The agricultural fungicide vinclozolin and vehicle control (DMSO) exposed gestating females (F0 generation) during gonadal sex determination promoted the transgenerational inheritance of differential DNA methylation in sperm of the F3 generation (great grand-offspring). The fetal gonads in F3 generation males were used to identify potential alterations in SRY binding sites in the developing Sertoli cells. Chromatin immunoprecipitation with an SRY antibody followed by genome-wide promoter tiling array (ChIP-Chip) was used to identify alterations in SRY binding. A total of 81 adjacent oligonucleotide sites and 173 single oligo SRY binding sites were identified to be altered transgenerationally in the Sertoli cell vinclozolin lineage F3 generation males. Observations demonstrate the majority of the previously identified normal SRY binding sites were not altered and the altered SRY binding sites were novel and new additional sites. The chromosomal locations, gene associations and potentially modified cellular pathways were investigated. In summary, environmentally induced epigenetic transgenerational inheritance of germline epimutations appears to alter the cellular differentiation and development of the precursor Sertoli cell SRY binding during gonadal sex determination that influence the developmental origins of adult onset testis disease.

  9. Confined water in controlled pore glass CPG-10-120 studied by positron annihilation lifetime spectroscopy and differential scanning calorimetry

    NASA Astrophysics Data System (ADS)

    Šauša, O.; Mat'ko, I.; Illeková, E.; Macová, E.; Berek, D.

    2015-06-01

    The solidification and melting of water confined in the controlled pore glass (CPG) with average pore size 12.6 nm has been studied by differential scanning calorimetry (DSC) and positron annihilation lifetime spectroscopy (PALS). The fully-filled sample of CPG by water as well as the samples of CPG with different content of water were used. The measurements show the presence of amorphous and crystalline phases of water in this type and size of pores, freezing point depression of a confined liquid and presence of certain transitions at lower temperatures, which could be detected only for cooling regime. The localization of confined water in the partially filled pores of CPG at room temperature was studied.

  10. Plasmid containing CpG motifs enhances the efficacy of porcine reproductive and respiratory syndrome live attenuated vaccine.

    PubMed

    Guo, Xiaoyu; Zhang, Quan; Hou, Shaohua; Zhai, Guoqin; Zhu, Hongfei; Sánchez-Vizcaíno, J M

    2011-12-15

    Porcine reproductive and respiratory syndrome (PRRS) is now among the most important swine diseases that affect the Chinese swine industry. Both killed and live attenuated vaccines are currently used against the disease, but neither of them could provide full protection after vaccination. In the present study, the adjuvanticity of a plasmid containing CpG motifs (pUC18-CpG) was introduced to enhance the efficacy of a commercial PRRS live attenuated vaccine. After vaccination, PRRSV-specific antibodies, PRRSV-specific cytokines, and clinical parameters were studied and compared between different vaccinated groups. During a following challenge study, co-administration of pUC18-CpG with the vaccine could confer higher protection rate. Our results have shown that co-administration of pUC18-CpG with the vaccine could elicit more potent adaptive immune response and provide better protection. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. CoCanCPG. Coordination of cancer clinical practice in Europe.

    PubMed

    Fervers, Bèatrice; Remy-Stockinger, Magali; Mazeau-Woynar, Valèrie; Otter, Renèe; Liberati, Alessandro; Littlejohns, Peter; Qureshi, Safia; Vlayen, Joan; Characiejus, Dainius; Corbacho, Belèn; Garner, Sarah; Hamza-Mohamed, Farida; Hermosilla, Teresa; Kersten, Sonja; Kulig, Michael; Leshem, Benny; Levine, Nava; Ballini, Luciana; Middelton, Clifford; Mlika-Cabane, Najoua; Paquet, Louise; Podmaniczki, Erzsèbet; Ramaekers, Dirk; Robinson, Eliezer; Sanchez, Emilia; Philip, Thierry

    2008-01-01

    All European countries are facing common challenges for delivering appropriate, evidence-based care to patients with cancer. Despite tangible improvements in diagnosis and treatment, marked differences in cancer survival exist throughout Europe. The reliable translation of new research evidence into consistent patient-oriented strategies is a key endeavour to overcome inequalities in healthcare. Clinical-practice guidelines are important tools for improving quality of care by informing professionals and patients about the most appropriate clinical practice. Guideline programmes in different countries use similar strategies to achieve similar goals. This results in unnecessary duplication of effort and inefficient use of resources. While different initiatives at the international level have attempted to improve the quality of guidelines, less investment has been made to overcome existing fragmentation and duplication of effort in cancer guideline development and research. To provide added value to existing initiatives and foster equitable access to evidence-based cancer care in Europe, CoCanCPG will establish cooperation between cancer guideline programmes. CoCanCPG is an ERA-Net coordinated by the French National Cancer Institute with 17 partners from 11 countries. The CoCanCPG partners will achieve their goal through an ambitious, stepwise approach with a long-term perspective, involving: 1. implementing a common framework for sharing knowledge and skills; 2. developing shared activities for guideline development; 3. assembling a critical mass for pertinent research into guideline methods; 4. implementing an appropriate framework for cooperation. Successful development of joint activities involves learning how to adopt common quality standards and how to share responsibilities, while taking into account the cultural and organisational diversity of the participating organisations. Languages barriers and different organisational settings add a level of complexity to

  12. Leukotriene B4 potentiates CpG signaling for enhanced cytokine secretion by human leukocytes.

    PubMed

    Gaudreault, Eric; Gosselin, Jean

    2009-08-15

    TLRs are known to be important in innate host defense against a variety of microbial infections. In particular, TLR9 has been associated with immune defense against different foreign organisms by recognition of unmethylated DNA sequences. In this report, we provide evidence that leukotriene B(4) (LTB(4)) has the capacity to modulate TLR9 expression on human neutrophils. The effect of LTB(4) was found to be specific, because related leukotrienes such as LTC(4) and LTD(4) or neutrophil agonists IL-8 and C5a failed to modulate TLR9 expression in neutrophils. Using fluorochrome-tagged CpG DNA, we observed that LTB(4) treatment also increased TLR9 ligand binding in neutrophils. Moreover, LTB(4) stimulation potentiates CpG-mediated signaling via an endosome-independent mechanism in human neutrophils, leading to enhanced secretion of proinflammatory cytokines. The increase in cytokine secretion by LTB(4) following CpG stimulation of neutrophils was associated with the activation of TGF-beta-activated kinase (TAK-1) as well as p38 and c-Jun (JNK) kinases. In contrast, in PBMC LTB(4) leads to an increase in cytokine secretion following CpG stimulation but via a MyD88- and endosome-dependent mechanism. As observed in neutrophils, PBMC stimulation with LTB(4) in the presence of CpG also results in enhanced TAK-1, p38, and JNK phosphorylation/activation. These data provide new evidence underlying the immunomodulatory properties of LTB(4) leading to antimicrobial defense.

  13. Aberrant methylation of the Cyclooxygenase 2 CpG island in colorectal tumors.

    PubMed

    Toyota, M; Shen, L; Ohe-Toyota, M; Hamilton, S R; Sinicrope, F A; Issa, J P

    2000-08-01

    Cyclooxygenases (COXs) are key enzymes that convert arachidonic acid to prostaglandins. Overexpression of one of the COX isozymes, COX2, has been shown to play an important role in colorectal cancer progression. Recently, however, low expression of COX2 has been reported in a subset of colorectal and gastric cancers. Aberrant CpG island methylation and associated transcriptional silencing are common in colorectal cancer, and we therefore investigated the potential role of methylation in the transcriptional silencing of COX2. We examined the methylation status of the COX2 5' CpG island in a series of tumor cell lines. Among the 33 cell lines examined, dense methylation (>70%) of COX2 was detected in 5 cell lines, and partial methylation was detected in 10 cell lines. Detailed methylation mapping using bisulfite genomic sequencing revealed that loss of expression of COX2 mRNA was closely correlated with methylation of a region upstream of exon 1, and expression could be restored by demethylation using the DNA methyltransferase inhibitor 5-aza-deoxycytidine. Aberrant methylation of COX2 was also detected in 12 of 92 (13%) unselected sporadic primary colorectal cancers and 7 of 50 (14%) colorectal adenomas. COX2 methylation was strongly associated with the presence of the CpG island methylator phenotype (P<0.01), inversely related to p53 gene mutation (P<0.01), and unrelated to microsatellite instability status. We propose that COX2 expression in colorectal tumors is modulated by functional factors that favor high expression and by the CpG island methylator phenotype that favors silencing in a subset of cases. These results raise the possibility that tumors with COX2 methylation may be less sensitive to treatment using specific COX2 inhibitors.

  14. Methylation Linear Discriminant Analysis (MLDA) for identifying differentially methylated CpG islands

    PubMed Central

    Dai, Wei; Teodoridis, Jens M; Graham, Janet; Zeller, Constanze; Huang, Tim HM; Yan, Pearlly; Vass, J Keith; Brown, Robert; Paul, Jim

    2008-01-01

    Background Hypermethylation of promoter CpG islands is strongly correlated to transcriptional gene silencing and epigenetic maintenance of the silenced state. As well as its role in tumor development, CpG island methylation contributes to the acquisition of resistance to chemotherapy. Differential Methylation Hybridisation (DMH) is one technique used for genome-wide DNA methylation analysis. The study of such microarray data sets should ideally account for the specific biological features of DNA methylation and the non-symmetrical distribution of the ratios of unmethylated and methylated sequences hybridised on the array. We have therefore developed a novel algorithm tailored to this type of data, Methylation Linear Discriminant Analysis (MLDA). Results MLDA was programmed in R (version 2.7.0) and the package is available at CRAN [1]. This approach utilizes linear regression models of non-normalised hybridisation data to define methylation status. Log-transformed signal intensities of unmethylated controls on the microarray are used as a reference. The signal intensities of DNA samples digested with methylation sensitive restriction enzymes and mock digested are then transformed to the likelihood of a locus being methylated using this reference. We tested the ability of MLDA to identify loci differentially methylated as analysed by DMH between cisplatin sensitive and resistant ovarian cancer cell lines. MLDA identified 115 differentially methylated loci and 23 out of 26 of these loci have been independently validated by Methylation Specific PCR and/or bisulphite pyrosequencing. Conclusion MLDA has advantages for analyzing methylation data from CpG island microarrays, since there is a clear rational for the definition of methylation status, it uses DMH data without between-group normalisation and is less influenced by cross-hybridisation of loci. The MLDA algorithm successfully identified differentially methylated loci between two classes of samples analysed by DMH

  15. Dog Models for Blinding Inherited Retinal Dystrophies

    PubMed Central

    Komáromy, András M.

    2015-01-01

    Abstract Spontaneous canine models exist for several inherited retinal dystrophies. This review will summarize the models and indicate where they have been used in translational gene therapy trials. The RPE65 gene therapy trials to treat childhood blindness are a good example of how studies in dogs have contributed to therapy development. Outcomes in human clinical trials are compared and contrasted with the result of the preclinical dog trials. PMID:25671556

  16. Dog models for blinding inherited retinal dystrophies.

    PubMed

    Petersen-Jones, Simon M; Komáromy, András M

    2015-03-01

    Spontaneous canine models exist for several inherited retinal dystrophies. This review will summarize the models and indicate where they have been used in translational gene therapy trials. The RPE65 gene therapy trials to treat childhood blindness are a good example of how studies in dogs have contributed to therapy development. Outcomes in human clinical trials are compared and contrasted with the result of the preclinical dog trials.

  17. CZ: Multimethods and Multiple Inheritance Without Diamonds

    DTIC Science & Technology

    2009-12-01

    renaming (e.g., Eiffel [31]) or by lin- earizing the class hierarchy [46, 45]. However, there is still no satisfactory solution to the dia- mond...the latter is the desirable semantics; it is supported in languages such as Scala, Eiffel , and C++ (the last through virtual inheritance) [38, 31, 21...certain. Previous Solutions. Languages that directly attempt to solve the object initialization problem include Eiffel [31], C++ [21], Scala [38] and

  18. Problem of technological inheritance in machine engineering

    NASA Astrophysics Data System (ADS)

    Blumenstein, Valery; Rakhimyanov, Kharis; Heifetz, Mikhail; Kleptzov, Alexander

    2016-01-01

    This article demonstrates the importance of the research study with regard to the technological inheritance of the properties, which characterize the surface layer, at different stages of a part's life cycle. It looks back at the major achievements and gives the findings relating to the technological inheritance of the parameters of the surface layer strength and quality as well as to how they affect the performance properties of machine parts. It demonstrates that high rates of machine engineering development, occurrence of new materials and more complicated machine operation environment require a shorter period for design-to-manufacture facility by reducing experiments and increasing design work. That, in its turn, generates the necessity in more complex but also more accurate models of metal behavior under stressing. It is especially critical for strengthening treatment. Among them are the models developed within the mechanics of technological inheritance. It is assumed that at the stages of a part's life cycle deformation accumulates on a continuous basis and the plasticity reserve of the metal, which the surface layer is made of, depletes. The research study of technological inheritance and the discovery of physical patterns of the evolution and degradation of the structures in a thin surface layer, which occur during machining and operational stressing of parts made from existing and unique including nanopatterned metals, is a crucial scientific challenge. This leads to the acquisition of new knowledge in the plasticity of state-of-the-art metals in the conditions of complex non monotonous stressing and to the development of efficient integrated and combined methods of technological impact.

  19. Inherited factor V deficient neonate with galactosaemia.

    PubMed

    Mansouritorghabeh, Hassan; Sharifi-Hoseini, Mohamad Reza; Shahroudian, Masoud

    2012-03-01

    Reporting a case of inherited factor V deficiency and galactosemia. A neonate was admitted with hematoma, jaundice, splenomegaly, diarrhea, anemia, abdominal ascites and bilateral cataracts that diagnosis of galactosaemia and factor V deficiency was established. Coinheritance of both coagulation disorder and metabolic disorder is very rare episode that was identified in a neonate. Our case indicates that in mild bleeding episodes of neonates that imitate of coagulation disorders should be considered promptly by pediatricians. Copyright © 2012. Published by Elsevier Inc.

  20. Mitochondrial inheritance in a mitochondrially mediated disease.

    PubMed

    Egger, J; Wilson, J

    1983-07-21

    Mendelian inheritance involves the transmission to successive generations of DNA contained in genes in the nucleus, but DNA is also contained in mitochondria, where it is believed to be responsible for the encoding of certain mitochondrial enzymes. Since nearly all mitochondrial DNA is maternally transmitted, one might expect a nonmendelian pattern of inheritance in mitochondrial cytopathy, a syndrome in which there are abnormalities in mitochondrial structure and deficiencies in a variety of mitochondrial enzymes. We studied the pedigrees of 6 affected families whose members we had examined personally and of 24 families described in the literature. In 27 families, exclusively maternal transmission occurred; in 3 there was also paternal transmission in one generation. Altogether, 51 mothers but only 3 fathers had transmitted the condition. These results are consistent with mitochondrial transmission of mitochondrial cytopathy; the inheritance and enzyme defects of mitochondrial cytopathy can be considered in the light of recent evidence that subunits of respiratory-enzyme complexes are encoded solely by mitochondrial DNA. The occasional paternal transmission may be explained if certain enzyme subunits that are encoded by nuclear DNA are affected.

  1. Arrhythmogenic inherited heart muscle diseases in children.

    PubMed

    Towbin, J A; Bowles, N E

    2001-01-01

    The left ventricle (LV) plays a central role in the maintenance of health of children and adults due to its role as the major pump of the heart. In cases of LV dysfunction, a significant percentage of affected individuals develop signs and symptoms of congestive heart failure, leading to the need for therapeutic intervention. Therapy for these patients include anticongestive medications and, in some, placement of devices such as aortic balloon pump or left ventricular assist device, or cardiac transplantation. In the majority of patients the origin is unknown, leading to the term idiopathic dilated cardiomyopathy. During the past decade, the basis of LV dysfunction has begun to unravel. In approximately 30% to 40% of cases, the disorder is inherited; autosomal dominant inheritance is most common (although X-linked, autosomal recessive and mitochondrial inheritance occurs). In the remaining patients, the disorder is presumed to be acquired, with inflammatory heart disease playing an important role. In the case of familial dilated cardiomyopathy, the genetic basis is beginning to unfold. To date, 2 genes for X-linked familial dilated cardiomyopathy (dystrophin, G4.5) have been identified and 4 genes for the autosomal dominant form (actin, desmin, lamin A/C, delta-sarcoglycan) have been described. In 1 form of inflammatory heart disease, coxsackievirus myocarditis, inflammatory mediators, and dystrophin cleavage play a role in the development of LV dysfunction. This review describes the molecular genetics of LV dysfunction and provide evidence for a "final common pathway" responsible for the phenotype.

  2. Paternal inheritance in mealybugs (Hemiptera: Coccoidea: Pseudococcidae)

    NASA Astrophysics Data System (ADS)

    Kol-Maimon, Hofit; Mendel, Zvi; Franco, José Carlos; Ghanim, Murad

    2014-10-01

    Mealybugs have a haplodiploid reproduction system, with paternal genome elimination (PGE); the males are diploid soon after fertilization, but during embryogenesis, the male paternal set of chromosomes becomes heterochromatic (HC) and therefore inactive. Previous studies have suggested that paternal genes can be passed on from mealybug males to their sons, but not necessarily by any son, to the next generation. We employed crosses between two mealybug species— Planococcus ficus (Signoret) and Planococcus citri (Risso)—and between two populations of P. ficus, which differ in their mode of pheromone attraction, in order to demonstrate paternal inheritance from males to F2 through F1 male hybrids. Two traits were monitored through three generations: mode of male pheromone attraction (pherotype) and sequences of the internal transcribed spacer 2 (ITS2) gene segment (genotype). Our results demonstrate that paternal inheritance in mealybugs can occur from males to their F2 offspring, through F1 males (paternal line). F2 backcrossed hybrid males expressed paternal pherotypes and ITS2 genotypes although their mother originated through a maternal population. Further results revealed other, hitherto unknown, aspects of inheritance in mealybugs, such as that hybridization between the two species caused absence of paternal traits in F2 hybrid females produced by F1 hybrid females. Furthermore, hybridization between the two species raised the question of whether unattracted males have any role in the interactions between P. ficus and P. citri.

  3. Inheritance law in an aging society.

    PubMed

    Hill, G J

    1995-01-01

    An exploratory analysis of states' inheritance law changes between 1961 and 1990 was conducted in order to discern major trends and their implications for older families. Results suggested that states were modifying their laws in ways similar to suggestions of the law community's Uniform Probate Code, with about one third of the states adopting the Code itself. Consequently, inheritance law has become less traditional and paternalistic and more like "facilitative law," that is, flexible, accommodating, and supportive of family autonomy and decisionmaking authority. These changes and new laws that simplify procedures, protect the dependent and vulnerable, treat marital property more like community property, recognize variant family forms, and enable extrafamilial bequests, may serve to minimize family disruption, conserve resources, and allow families to tailor property divisions and procedures to particular needs and wishes. An impact study is proposed for disclosing the actual effects on inheritance law reforms. Also, while trends observed in this study were fairly evident, states' adoption of new laws was uneven and selective, inviting continuing trend analyses and further research into the reasons for interstate variation.

  4. Phenotype as Agent for Epigenetic Inheritance

    PubMed Central

    Torday, John S.; Miller, William B.

    2016-01-01

    The conventional understanding of phenotype is as a derivative of descent with modification through Darwinian random mutation and natural selection. Recent research has revealed Lamarckian inheritance as a major transgenerational mechanism for environmental action on genomes whose extent is determined, in significant part, by germ line cells during meiosis and subsequent stages of embryological development. In consequence, the role of phenotype can productively be reconsidered. The possibility that phenotype is directed towards the effective acquisition of epigenetic marks in consistent reciprocation with the environment during the life cycle of an organism is explored. It is proposed that phenotype is an active agent in niche construction for the active acquisition of epigenetic marks as a dominant evolutionary mechanism rather than a consequence of Darwinian selection towards reproductive success. The reproductive phase of the life cycle can then be appraised as a robust framework in which epigenetic inheritance is entrained to affect growth and development in continued reciprocal responsiveness to environmental stresses. Furthermore, as first principles of physiology determine the limits of epigenetic inheritance, a coherent justification can thereby be provided for the obligate return of all multicellular eukaryotes to the unicellular state. PMID:27399791

  5. Genetic sequence analysis of inherited bleeding diseases

    PubMed Central

    Peyvandi, Flora; Kunicki, Tom

    2013-01-01

    The genes encoding the coagulation factor proteins were among the first human genes to be characterized over 25 years ago. Since then, significant progress has been made in the translational application of this information for the 2 commonest severe inherited bleeding disorders, hemophilia A and B. For these X-linked disorders, genetic characterization of the disease-causing mutations is now incorporated into the standard of care and genetic information is used for risk stratification of treatment complications. With electronic databases detailing >2100 unique mutations for hemophilia A and >1100 mutations for hemophilia B, these diseases are among the most extensively characterized inherited diseases in humans. Experience with the genetics of the rare bleeding disorders is, as expected, less well advanced. However, here again, electronic mutation databases have been developed and provide excellent guidance for the application of genetic analysis as a confirmatory approach to diagnosis. Most recently, progress has also been made in identifying the mutant loci in a variety of inherited platelet disorders, and these findings are beginning to be applied to the genetic diagnosis of these conditions. Investigation of patients with bleeding phenotypes without a diagnosis, using genome-wide strategies, may identify novel genes not previously recognized as playing a role in hemostasis. PMID:24124085

  6. Fractional populations in multiple gene inheritance.

    PubMed

    Chung, Myung-Hoon; Kim, Chul Koo; Nahm, Kyun

    2003-01-22

    With complete knowledge of the human genome sequence, one of the most interesting tasks remaining is to understand the functions of individual genes and how they communicate. Using the information about genes (locus, allele, mutation rate, fitness, etc.), we attempt to explain population demographic data. This population evolution study could complement and enhance biologists' understanding about genes. We present a general approach to study population genetics in complex situations. In the present approach, multiple allele inheritance, multiple loci inheritance, natural selection and mutations are allowed simultaneously in order to consider a more realistic situation. A simulation program is presented so that readers can readily carry out studies with their own parameters. It is shown that the multiplicity of the loci greatly affects the demographic results of fractional population ratios. Furthermore, the study indicates that some high infant mortality rates due to congenital anomalies can be attributed to multiple loci inheritance. The simulation program can be downloaded from http://won.hongik.ac.kr/~mhchung/index_files/yapop.htm. In order to run this program, one needs Visual Studio.NET platform, which can be downloaded from http://msdn.microsoft.com/netframework/downloads/default.asp.

  7. Cytoplasmic inheritance of organelles in brown algae.

    PubMed

    Motomura, Taizo; Nagasato, Chikako; Kimura, Kei

    2010-03-01

    Brown algae, together with diatoms and chrysophytes, are a member of the heterokonts. They have either a characteristic life cycle of diplohaplontic alternation of gametophytic and sporophytic generations that are isomorphic or heteromorphic, or a diplontic life cycle. Isogamy, anisogamy and oogamy have been recognized as the mode of sexual reproduction. Brown algae are the characteristic group having elaborated multicellular organization within the heterokonts. In this study, cytoplasmic inheritance of chloroplasts, mitochondria and centrioles was examined, with special focus on sexual reproduction and subsequent zygote development. In oogamy, chloroplasts and mitochondria are inherited maternally. In isogamy, chloroplasts in sporophyte cells are inherited biparentally (maternal or paternal); however, mitochondria (or mitochondrial DNA) derived from the female gamete only remained during zygote development after fertilization. Centrioles in zygotes are definitely derived from the male gamete, irrespective of the sexual reproduction pattern. Female centrioles in zygotes are selectively broken down within 1-2 h after fertilization. The remaining male centrioles play a crucial role as a part of the centrosome for microtubule organization, mitosis, determination of the cytokinetic plane and cytokinesis, as well as for maintaining multicellularity and regular morphogenesis in brown algae.

  8. Paternal inheritance in mealybugs (Hemiptera: Coccoidea: Pseudococcidae).

    PubMed

    Kol-Maimon, Hofit; Mendel, Zvi; Franco, José Carlos; Ghanim, Murad

    2014-10-01

    Mealybugs have a haplodiploid reproduction system, with paternal genome elimination (PGE); the males are diploid soon after fertilization, but during embryogenesis, the male paternal set of chromosomes becomes heterochromatic (HC) and therefore inactive. Previous studies have suggested that paternal genes can be passed on from mealybug males to their sons, but not necessarily by any son, to the next generation. We employed crosses between two mealybug species--Planococcus ficus (Signoret) and Planococcus citri (Risso)--and between two populations of P. ficus, which differ in their mode of pheromone attraction, in order to demonstrate paternal inheritance from males to F2 through F1 male hybrids. Two traits were monitored through three generations: mode of male pheromone attraction (pherotype) and sequences of the internal transcribed spacer 2 (ITS2) gene segment (genotype). Our results demonstrate that paternal inheritance in mealybugs can occur from males to their F2 offspring, through F1 males (paternal line). F2 backcrossed hybrid males expressed paternal pherotypes and ITS2 genotypes although their mother originated through a maternal population. Further results revealed other, hitherto unknown, aspects of inheritance in mealybugs, such as that hybridization between the two species caused absence of paternal traits in F2 hybrid females produced by F1 hybrid females. Furthermore, hybridization between the two species raised the question of whether unattracted males have any role in the interactions between P. ficus and P. citri.

  9. 25 CFR 91.9 - Inheritance of improvements.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 25 Indians 1 2012-04-01 2011-04-01 true Inheritance of improvements. 91.9 Section 91.9 Indians..., OSAGE RESERVATION, OKLAHOMA § 91.9 Inheritance of improvements. (a) Upon the death of the owner of... of the county courts, State of Oklahoma, and shall be subject to inheritance or bequest in accordance...

  10. 25 CFR 91.9 - Inheritance of improvements.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Inheritance of improvements. 91.9 Section 91.9 Indians..., OSAGE RESERVATION, OKLAHOMA § 91.9 Inheritance of improvements. (a) Upon the death of the owner of... of the county courts, State of Oklahoma, and shall be subject to inheritance or bequest in accordance...

  11. 25 CFR 91.9 - Inheritance of improvements.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 25 Indians 1 2014-04-01 2014-04-01 false Inheritance of improvements. 91.9 Section 91.9 Indians..., OSAGE RESERVATION, OKLAHOMA § 91.9 Inheritance of improvements. (a) Upon the death of the owner of... of the county courts, State of Oklahoma, and shall be subject to inheritance or bequest in accordance...

  12. 25 CFR 91.9 - Inheritance of improvements.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 25 Indians 1 2013-04-01 2013-04-01 false Inheritance of improvements. 91.9 Section 91.9 Indians..., OSAGE RESERVATION, OKLAHOMA § 91.9 Inheritance of improvements. (a) Upon the death of the owner of... of the county courts, State of Oklahoma, and shall be subject to inheritance or bequest in accordance...

  13. CpG DNA: A pathogenic factor in systemic lupus erythematosus?

    SciTech Connect

    Krieg, A.M.

    1995-11-01

    Systemic lupus erythematosus (SLE) is a multifactorial disease of unknown etiology. Characteristic features of SLE include (1) polyclonal B cell activation, (2) overexpression of the immune stimulatory cytokine interleukin-6 (IL-6), (3) defective tolerance to self antigens, and (4) production of anti-DNA antibodies (Ab). Bacterial infection has been suspected as a triggering factor for lupus. Bacterial DNA differs from vertebrate DNA in the frequency and methylation of CpG dinucleotides. These CpG motifs in bacterial DNA induce a variety of immune effects, including (1) polyclonal activation of murine and human B cells, (2) IL-6 secretion, and (3) resistance to apoptosis, thereby potentially allowing the survival of autoreactive cells. These results suggest that microbial DNA could therefore be a pathogenic factor in SLE. SLE patients have elevated levels of circulating plasma DNA which is reportedly enriched in hypomethylated CpGs. Genomic DNA is also hypomethylated in SLE. The purpose of this review is to summarize the immune effects of CpG motifs and to present the evidence for their possible involvement in the pathogenesis of SLE. 77 refs.

  14. Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats

    PubMed Central

    López-Álvarez, Guadalupe S.; Wojdacz, Tomasz K.; García-Cuellar, Claudia M.; Monroy-Ramírez, Hugo C.; Rodríguez-Segura, Miguel A.; Pacheco-Rivera, Ruth A.; Valencia-Antúnez, Carlos A.; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R.; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

    2017-01-01

    ABSTRACT The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats. PMID:27895046

  15. Orphan CpG islands define a novel class of highly active enhancers.

    PubMed

    Bell, Joshua S K; Vertino, Paula M

    2017-06-03

    CpG islands (CGI) are critical genomic regulatory elements that support transcriptional initiation and are associated with the promoters of most human genes. CGI are distinguished from the bulk genome by their high CpG density, lack of DNA methylation, and euchromatic features. While CGI are canonically known as strong promoters, thousands of 'orphan' CGI lie far from any known transcript, leaving their function an open question. We undertook a comprehensive analysis of the epigenetic state of orphan CGI across over 100 cell types. Here we show that most orphan CGI display the chromatin features of active enhancers (H3K4me1, H3K27Ac) in at least one cell type. Relative to classical enhancers, these enhancer CGI (ECGI) are stronger, as gauged by chromatin state and in functional assays, are more broadly expressed, and are more highly conserved. Likewise, ECGI engage in more genomic contacts and are enriched for transcription factor binding relative to classical enhancers. In human cancers, these epigenetic differences between ECGI vs. classical enhancers manifest in distinct alterations in DNA methylation. Thus, ECGI define a class of highly active enhancers, strengthened by the broad transcriptional activity, CpG density, hypomethylation, and chromatin features they share with promoter CGI. In addition to indicating a role for thousands of orphan CGI, these findings suggests that enhancer activity may be an intrinsic function of CGI in general and provides new insights into the evolution of enhancers and their epigenetic regulation during development and tumorigenesis.

  16. CpG methylation is targeted to transcription units in an invertebrate genome

    PubMed Central

    Suzuki, Miho M.; Kerr, Alastair R.W.; De Sousa, Dina; Bird, Adrian

    2007-01-01

    DNA is methylated at the dinucleotide CpG in genomes of a wide range of plants and animals. Among animals, variable patterns of genomic CpG methylation have been described, ranging from undetectable levels (e.g., in Caenorhabditis elegans) to high levels of global methylation in the vertebrates. The most frequent pattern in invertebrate animals, however, is mosaic methylation, comprising domains of methylated DNA interspersed with unmethylated domains. To understand the origin of mosaic DNA methylation patterns, we examined the distribution of DNA methylation in the Ciona intestinalis genome. Bisulfite sequencing and computational analysis revealed methylated domains with sharp boundaries that strongly colocalize with ∼60% of transcription units. By contrast, promoters, intergenic DNA, and transposons are not preferentially targeted by DNA methylation. Methylated transcription units include evolutionarily conserved genes, whereas the most highly expressed genes preferentially belong to the unmethylated fraction. The results lend support to the hypothesis that CpG methylation functions to suppress spurious transcriptional initiation within infrequently transcribed genes. PMID:17420183

  17. Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype

    PubMed Central

    Toyota, Minoru; Ohe-Toyota, Mutsumi; Ahuja, Nita; Issa, Jean-Pierre J.

    2000-01-01

    Colorectal cancers (CRCs) are characterized by multiple genetic (mutations) and epigenetic (CpG island methylation) alterations, but it is not known whether these evolve independently through stochastic processes. We have recently described a novel pathway termed CpG island methylator phenotype (CIMP) in CRC, which is characterized by the simultaneous methylation of multiple CpG islands, including several known genes, such as p16, hMLH1, and THBS1. We have now studied mutations in K-RAS, p53, DPC4, and TGFβRII in a panel of colorectal tumors with or without CIMP. We find that CIMP defines two groups of tumors with significantly different genetic lesions: frequent K-RAS mutations were found in CIMP+ CRCs (28/41, 68%) compared with CIMP− cases (14/47, 30%, P = 0.0005). By contrast, p53 mutations were found in 24% (10/41) of CIMP+ CRCs vs. 60% (30/46) of CIMP− cases (P = 0.002). Both of these differences were independent of microsatellite instability. These interactions between CIMP, K-RAS mutations, and p53 mutations were preserved in colorectal adenomas, suggesting that they occur early in carcinogenesis. The distinct combinations of epigenetic and genetic alterations in each group suggest that activation of oncogenes and inactivation of tumor suppressor genes is related to the underlying mechanism of generating molecular diversity in cancer, rather than simply accumulate stochastically during cancer development. PMID:10639144

  18. Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture

    PubMed Central

    Li, Cai; Lowe, Robert; Ziemke, Tom

    2013-01-01

    The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value. PMID:23675345

  19. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

    PubMed Central

    Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

    2016-01-01

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

  20. Gene silencing of Nox4 by CpG island methylation during hepatocarcinogenesis in rats.

    PubMed

    López-Álvarez, Guadalupe S; Wojdacz, Tomasz K; García-Cuellar, Claudia M; Monroy-Ramírez, Hugo C; Rodríguez-Segura, Miguel A; Pacheco-Rivera, Ruth A; Valencia-Antúnez, Carlos A; Cervantes-Anaya, Nancy; Soto-Reyes, Ernesto; Vásquez-Garzón, Verónica R; Sánchez-Pérez, Yesennia; Villa-Treviño, Saúl

    2017-01-15

    The association between the downregulation of genes and DNA methylation in their CpG islands has been extensively studied as a mechanism that favors carcinogenesis. The objective of this study was to analyze the methylation of a set of genes selected based on their microarray expression profiles during the process of hepatocarcinogenesis. Rats were euthanized at: 24 h, 7, 11, 16 and 30 days and 5, 9, 12 and 18 months post-treatment. We evaluated the methylation status in the CpG islands of four deregulated genes (Casp3, Cldn1, Pex11a and Nox4) using methylation-sensitive high-resolution melting technology for the samples obtained from different stages of hepatocarcinogenesis. We did not observe methylation in Casp3, Cldn1 or Pex11a. However, Nox4 exhibited altered methylation patterns, reaching a maximum of 10%, even during the early stages of hepatocarcinogenesis. We observed downregulation of mRNA and protein of Nox4 (97.5% and 40%, respectively) after the first carcinogenic stimulus relative to the untreated samples. Our results suggest that Nox4 downregulation is associated with DNA methylation of the CpG island in its promoter. We propose that methylation is a mechanism that can silence the expression of Nox4, which could contribute to the acquisition of neoplastic characteristics during hepatocarcinogenesis in rats.

  1. Humanoids Learning to Walk: A Natural CPG-Actor-Critic Architecture.

    PubMed

    Li, Cai; Lowe, Robert; Ziemke, Tom

    2013-01-01

    The identification of learning mechanisms for locomotion has been the subject of much research for some time but many challenges remain. Dynamic systems theory (DST) offers a novel approach to humanoid learning through environmental interaction. Reinforcement learning (RL) has offered a promising method to adaptively link the dynamic system to the environment it interacts with via a reward-based value system. In this paper, we propose a model that integrates the above perspectives and applies it to the case of a humanoid (NAO) robot learning to walk the ability of which emerges from its value-based interaction with the environment. In the model, a simplified central pattern generator (CPG) architecture inspired by neuroscientific research and DST is integrated with an actor-critic approach to RL (cpg-actor-critic). In the cpg-actor-critic architecture, least-square-temporal-difference based learning converges to the optimal solution quickly by using natural gradient learning and balancing exploration and exploitation. Futhermore, rather than using a traditional (designer-specified) reward it uses a dynamic value function as a stability indicator that adapts to the environment. The results obtained are analyzed using a novel DST-based embodied cognition approach. Learning to walk, from this perspective, is a process of integrating levels of sensorimotor activity and value.

  2. CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs

    PubMed Central

    Hu, Jiaqing; Yang, Dandan; Wang, Hui; Li, Chuanhao; Zeng, Yongqing; Chen, Wei

    2016-01-01

    Oligodeoxynucleotides containing unmethylated CpG motifs (CpG ODN) mimic the immunostimulatory activity of microbial DNA by interacting with Toll-like receptor 9 (TLR9) to activate both the innate and adaptive immune responses in different species. However, few studies have been published to compare the effects of CpG ODN on different pig breeds. Therefore, in this study, whole blood gene expression profiles of DPL and Landrace pigs treated with CpG ODN were studied using RNA-seq technology. Five Hundred differentially expressed genes (DEGs) were identified between the two breeds. DPL pigs had significantly higher number of immune-relevant DEGs than the Landrace pigs after CpG ODN treatment. Pathway analysis showed that cytokine-cytokine receptor interaction and chemokine signaling pathway were the major enriched pathways of the immune-relevant DEGs. Further in vitro experiments showed that PBMCs of the DPL pigs had significantly higher levels of TLR9 mRNA than those of the Landrace pigs, both before and after CpG ODN stimulation. Cytokine and chemokine induction in the PBMCs of both breeds were also measured after CpG ODN stimulation. Our data showed that mRNA levels of cytokines (IFNα, IL8, IL12 p40) and chemokines (CXCL9, CXCL13) were significantly higher in the PBMCs of the DPL pigs than those of the Landrace pigs. Taken together, our data provide new information regarding the pig breed difference in response to CpG ODN stimulation and that higher levels of TLR9 mRNA in DPL pigs may be a major contributor for disease resistance. PMID:28018321

  3. CpG Oligodeoxynucleotides Induce Differential Cytokine and Chemokine Gene Expression Profiles in Dapulian and Landrace Pigs.

    PubMed

    Hu, Jiaqing; Yang, Dandan; Wang, Hui; Li, Chuanhao; Zeng, Yongqing; Chen, Wei

    2016-01-01

    Oligodeoxynucleotides containing unmethylated CpG motifs (CpG ODN) mimic the immunostimulatory activity of microbial DNA by interacting with Toll-like receptor 9 (TLR9) to activate both the innate and adaptive immune responses in different species. However, few studies have been published to compare the effects of CpG ODN on different pig breeds. Therefore, in this study, whole blood gene expression profiles of DPL and Landrace pigs treated with CpG ODN were studied using RNA-seq technology. Five Hundred differentially expressed genes (DEGs) were identified between the two breeds. DPL pigs had significantly higher number of immune-relevant DEGs than the Landrace pigs after CpG ODN treatment. Pathway analysis showed that cytokine-cytokine receptor interaction and chemokine signaling pathway were the major enriched pathways of the immune-relevant DEGs. Further in vitro experiments showed that PBMCs of the DPL pigs had significantly higher levels of TLR9 mRNA than those of the Landrace pigs, both before and after CpG ODN stimulation. Cytokine and chemokine induction in the PBMCs of both breeds were also measured after CpG ODN stimulation. Our data showed that mRNA levels of cytokines (IFNα, IL8, IL12 p40) and chemokines (CXCL9, CXCL13) were significantly higher in the PBMCs of the DPL pigs than those of the Landrace pigs. Taken together, our data provide new information regarding the pig breed difference in response to CpG ODN stimulation and that higher levels of TLR9 mRNA in DPL pigs may be a major contributor for disease resistance.

  4. The Effect of TLR9 Agonist CpG Oligodeoxynucleotides on the Intestinal Immune Response of Cobia (Rachycentron canadum)

    PubMed Central

    Byadgi, Omkar; Puteri, Dinda; Lee, Jai-Wei; Chang, Tsung-Chou; Lee, Yan-Horn; Chu, Chun-Yen; Cheng, Ta-Chih

    2014-01-01

    Cytosine-guanine oligodeoxynucleotide (CpG ODN) motifs of bacterial DNA are recognized through toll-like receptor 9 (TLR9) and are potent activators of innate immunity. However, the interaction between TLR9 and CpG ODN in aquatic species has not been well characterized. Hence, cobia TLR9 isoform B (RCTLR9B) was cloned and its expression and induction in intestine were investigated. RCTLR9B cDNA consists of 3113bp encoding 1009 amino acids containing three regions, leucine rich repeats, transmembrane domain, and toll/interleukin-1 receptor (TIR) domain. Intraperitoneal injection of CpG ODN 2395 upregulated RCTLR9 A and B and MyD88 and also induced the expressions of Mx, chemokine CC, and interleukin IL-1β. Cobia intraperitoneally injected with CpG ODN 1668 and 2395 had increased survival rates after challenge with Photobacterium damselae subsp. piscicida. In addition, formulation of CpG ODN with formalin-killed bacteria (FKB) and aluminum hydroxide gel significantly increased expressions of RCTLR9 A (50 folds) and B (30 folds) isoforms at 10 dpi (CpG ODN 1668) and MyD88 (21 folds) at 6 dpv (CpG ODN 2395). Subsequently, IL-1β increased at 6 dpv in 1668 group. No histopathological damage and inflammatory responses were observed in the injected cobia. Altogether, these results facilitate CpG ODNs as an adjuvant to increase bacterial disease resistance and efficacy of vaccines in cobia. PMID:24991578

  5. Genome-wide profiling of DNA methylation reveals a class of normally methylated CpG island promoters.

    PubMed

    Shen, Lanlan; Kondo, Yutaka; Guo, Yi; Zhang, Jiexin; Zhang, Li; Ahmed, Saira; Shu, Jingmin; Chen, Xinli; Waterland, Robert A; Issa, Jean-Pierre J

    2007-10-01

    The role of CpG island methylation in normal development and cell differentiation is of keen interest, but remains poorly understood. We performed comprehensive DNA methylation profiling of promoter regions in normal peripheral blood by methylated CpG island amplification in combination with microarrays. This technique allowed us to simultaneously determine the methylation status of 6,177 genes, 92% of which include dense CpG islands. Among these 5,549 autosomal genes with dense CpG island promoters, we have identified 4.0% genes that are nearly completely methylated in normal blood, providing another exception to the general rule that CpG island methylation in normal tissue is limited to X inactivation and imprinted genes. We examined seven genes in detail, including ANKRD30A, FLJ40201, INSL6, SOHLH2, FTMT, C12orf12, and DPPA5. Dense promoter CpG island methylation and gene silencing were found in normal tissues studied except testis and sperm. In both tissues, bisulfite cloning and sequencing identified cells carrying unmethylated alleles. Interestingly, hypomethylation of several genes was associated with gene activation in cancer. Furthermore, reactivation of silenced genes could be induced after treatment with a DNA demethylating agent or in a cell line lacking DNMT1 and/or DNMT3b. Sequence analysis identified five motifs significantly enriched in this class of genes, suggesting that cis-regulatory elements may facilitate preferential methylation at these promoter CpG islands. We have identified a group of non-X-linked bona fide promoter CpG islands that are densely methylated in normal somatic tissues, escape methylation in germline cells, and for which DNA methylation is a primary mechanism of tissue-specific gene silencing.

  6. Association of the colorectal CpG island methylator phenotype with molecular features, risk factors, and family history.

    PubMed

    Weisenberger, Daniel J; Levine, A Joan; Long, Tiffany I; Buchanan, Daniel D; Walters, Rhiannon; Clendenning, Mark; Rosty, Christophe; Joshi, Amit D; Stern, Mariana C; LeMarchand, Loic; Lindor, Noralane M; Daftary, Darshana; Gallinger, Steven; Selander, Teresa; Bapat, Bharati; Newcomb, Polly A; Campbell, Peter T; Casey, Graham; Ahnen, Dennis J; Baron, John A; Haile, Robert W; Hopper, John L; Young, Joanne P; Laird, Peter W; Siegmund, Kimberly D

    2015-03-01

    The CpG island methylator phenotype (CIMP) represents a subset of colorectal cancers characterized by widespread aberrant DNA hypermethylation at select CpG islands. The risk factors and environmental exposures contributing to etiologic heterogeneity between CIMP and non-CIMP tumors are not known. We measured the CIMP status of 3,119 primary population-based colorectal cancer tumors from the multinational Colon Cancer Family Registry. Etiologic heterogeneity was assessed by a case-case study comparing risk factor frequency of colorectal cancer cases with CIMP and non-CIMP tumors using logistic regression to estimate the case-case odds ratio (ccOR). We found associations between tumor CIMP status and MSI-H (ccOR = 7.6), BRAF V600E mutation (ccOR = 59.8), proximal tumor site (ccOR = 9; all P < 0.0001), female sex [ccOR = 1.8; 95% confidence interval (CI), 1.5-2.1], older age (ccOR = 4.0 comparing over 70 years vs. under 50; 95% CI, 3.0-5.5), and family history of CRC (ccOR = 0.6; 95% CI, 0.5-0.7). While use of NSAIDs varied by tumor CIMP status for both males and females (P = 0.0001 and P = 0.02, respectively), use of multivitamin or calcium supplements did not. Only for female colorectal cancer was CIMP status associated with increased pack-years of smoking (Ptrend < 0.001) and body mass index (BMI; Ptrend = 0.03). The frequency of several colorectal cancer risk factors varied by CIMP status, and the associations of smoking and obesity with tumor subtype were evident only for females. Differences in the associations of a unique DNA methylation-based subgroup of colorectal cancer with important lifestyle and environmental exposures increase understanding of the molecular pathologic epidemiology of this heavily methylated subset of colorectal cancer. Cancer Epidemiol Biomarkers Prev; 24(3); 512-9. ©2015 AACR. ©2015 American Association for Cancer Research.

  7. Induction of a systemic antiviral state in vivo in the domestic cat with a class A CpG oligonucleotide.

    PubMed

    Robert-Tissot, Céline; Meli, Marina L; Riond, Barbara; Hofmann-Lehmann, Regina; Lutz, Hans

    2012-11-15

    The evolution of cats as a solitary species has pressured feline viruses to develop highly efficient transmission strategies, the ability to persist within the host for long periods of time and the aptitude to adapt to natural and vaccine-induced immunological pressures. These characteristics render feline viruses particularly dangerous in catteries, shelters and rescue homes, were cats from different backgrounds live in close proximity. The possibility to induce short-term resistance of newcomer cats to a broad variety of viruses could help prevent the dissemination of viruses both within and outside such facilities. Oligonucleotides (ODN) containing unmethylated cytosine phosphate guanosine (CpG) motifs stimulate innate immune responses in mammals. We have previously shown that ODN 2216, a class A CpG ODN, promotes the expression by feline immune cells of potent antiviral molecules that increase resistance of feline fibroblastic and epithelial cell lines to five common feline viruses. With the aim to test the safety and extent of the biological effects of ODN 2216 in the domestic cat, we performed an initial in vivo experiment in which two cats were injected the molecule once subcutaneously and two additional cats received control treatments. No side effects to administration of ODN 2216 were observed. Moreover, this molecule induced the expression of the myxovirus resistance (Mx) gene, a marker for the instigation of innate antiviral processes, in blood as well as in oral, conjunctival and rectal mucosa cells, indicating systemic biological activity of the molecule with protective potential at viral entry sites. Mx mRNA levels were already elevated in blood 6h post injection of ODN 2216, reached peak levels within 24h and returned to basal values by 96-192 h after administration of the molecule. Similar induction patterns were observed in all analyzed mucosal cells. Plasma collected from treated cats at regular intervals until 96-192 h could moreover induce Mx m

  8. Impact of CpG methylation on structure, dynamics and solvation of cAMP DNA responsive element

    PubMed Central

    Derreumaux, Sylvie; Chaoui, Mounia; Tevanian, Georges; Fermandjian, Serge

    2001-01-01

    Methylation of CpG motifs in DNA is involved in the control of gene expression and in several other epigenic effects. It suppresses also the immuno-stimulation properties of bacterial or viral DNAs that contain CpGs. However, effects of methylation on the DNA structure and dynamics are not clear. Here we carried out a 10 ns MD simulation, confronted to an NMR analysis, of a hexadecanucleotide with the cAMP responsive element (CRE) DNA methylated at its center: d(GAGATGAmCGTCATCTC)2 (CREmet). Methylation does not introduce significant structure modification but reduces the dynamics. Molecular mechanics and generalized Born solvation energy calculations showed that the stiffness of CREmet arises from both a restriction of the conformational space by the bulky methyl groups and a folding of DNA around the hydrophobic methyls. The latter effect is favored when the GpA steps belonging to the TGA binding half-sites adopt the BII conformation. The inability of the methylated DNAs to interact with their protein partners—either transcription factors for gene regulation or a Toll-like receptor for immunostimulation—could result from both the obstacle created by methyls, preventing crucial interactions, and the loss of DNA flexibility, reducing its adaptability. Results are discussed in the light of NMR and crystallographic data. PMID:11376150

  9. CpG methylation patterns and decitabine treatment response in acute myeloid leukemia cells and normal hematopoietic precursors

    PubMed Central

    Negrotto, Soledad; Ng, Kwok Peng; Jankowska, Ania M.; Bodo, Juraj; Gopalan, Banu; Guinta, Kathryn; Mulloy, James C.; Hsi, Eric; Maciejewski, Jaroslaw; Saunthararajah, Yogen

    2011-01-01

    The DNA hypomethylating drug decitabine maintains normal hematopoietic stem cell (HSC) self-renewal but induces terminal differentiation in acute myeloid leukemia (AML) cells. The basis for these contrasting cell-fates, and for selective CpG hypomethylation by decitabine, is poorly understood. Promoter CpGs, with methylation measured by microarray, were classified by the direction of methylation change with normal myeloid maturation. In AML cells, the methylation pattern at maturation-responsive CpG suggested at least partial maturation. Consistent with partial maturation, in gene expression analyses, AML cells expressed high levels of the key lineage-specifying factor CEBPA, but relatively low levels of the key late-differentiation driver CEBPE. In methylation analysis by mass-spectrometry, CEBPE promoter CpG that are usually hypomethylated during granulocyte maturation were significantly hypermethylated in AML cells. Decitabine treatment induced cellular differentiation of AML cells, and the largest methylation decreases were at CpG that are hypomethylated with myeloid maturation, including CEBPE promoter CpG. In contrast, decitabine-treated normal HSC retained immature morphology, and methylation significantly decreased at CpG that are less methylated in immature cells. High expression of lineage-specifying factor and aberrant epigenetic repression of some key late-differentiation genes distinguishes AML cells from normal HSC and could explain the contrasting differentiation and methylation responses to decitabine. PMID:21836612

  10. Therapeutic administration of a synthetic CpG oligodeoxynucleotide triggers formation of anti-CpG antibodies.

    PubMed

    Karbach, Julia; Neumann, Antje; Wahle, Claudia; Brand, Kathrin; Gnjatic, Sacha; Jäger, Elke

    2012-09-01

    The synthetic oligodeoxynucleotide CpG 7909, which contains unmethylated cytosine/guanine (CpG) motifs, has potent immunostimulatory effects when coadministered with NY-ESO-1 peptides or recombinant NY-ESO-1 protein, resulting in an enhanced cellular and humoral immune response against the vaccine antigen. In this study, w