Sample records for initial performance characterization

  1. OrbView-3 Initial On-Orbit Characterization

    NASA Technical Reports Server (NTRS)

    Ross, Kent; Blonski, Slawomir; Holekamp, Kara; Pagnutti, Mary; Zanoni, Vicki; Carver, David; Fendley, Debbie; Smith, Charles

    2004-01-01

    NASA at Stennis Space Center (SSC) established a Space Act Agreement with Orbital Sciences Corporation (OSC) and ORBIMAGE Inc. to collaborate on the characterization of the OrbView-3 system and its imagery products and to develop characterization techniques further. In accordance with the agreement, NASA performed an independent radiometric, spatial, and geopositional accuracy assessment of OrbView-3 imagery acquired before completion of the system's initial on-orbit checkout. OSC acquired OrbView-3 imagery over SSC from July 2003 through January 2004, and NASA collected ground reference information coincident with many of these acquisitions. After evaluating all acquisitions, NASA deemed two multispectral images and five panchromatic images useful for characterization. NASA then performed radiometric, spatial, and geopositional characterizations.

  2. Used Nuclear Fuel Loading and Structural Performance Under Normal Conditions of Transport- Demonstration of Approach and Results on Used Fuel Performance Characterization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adkins, Harold; Geelhood, Ken; Koeppel, Brian

    2013-09-30

    This document addresses Oak Ridge National Laboratory milestone M2FT-13OR0822015 Demonstration of Approach and Results on Used Nuclear Fuel Performance Characterization. This report provides results of the initial demonstration of the modeling capability developed to perform preliminary deterministic evaluations of moderate-to-high burnup used nuclear fuel (UNF) mechanical performance under normal conditions of storage (NCS) and normal conditions of transport (NCT) conditions. This report also provides results from the sensitivity studies that have been performed. Finally, discussion on the long-term goals and objectives of this initiative are provided.

  3. Initial data sets for the Schwarzschild spacetime

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gomez-Lobo, Alfonso Garcia-Parrado; Kroon, Juan A. Valiente; School of Mathematical Sciences, Queen Mary, University of London, Mile End Road, London E1 4NS

    2007-01-15

    A characterization of initial data sets for the Schwarzschild spacetime is provided. This characterization is obtained by performing a 3+1 decomposition of a certain invariant characterization of the Schwarzschild spacetime given in terms of concomitants of the Weyl tensor. This procedure renders a set of necessary conditions--which can be written in terms of the electric and magnetic parts of the Weyl tensor and their concomitants--for an initial data set to be a Schwarzschild initial data set. Our approach also provides a formula for a static Killing initial data set candidate--a KID candidate. Sufficient conditions for an initial data set tomore » be a Schwarzschild initial data set are obtained by supplementing the necessary conditions with the requirement that the initial data set possesses a stationary Killing initial data set of the form given by our KID candidate. Thus, we obtain an algorithmic procedure of checking whether a given initial data set is Schwarzschildean or not.« less

  4. Characterization of Initial Parameter Information for Lifetime Prediction of Electronic Devices.

    PubMed

    Li, Zhigang; Liu, Boying; Yuan, Mengxiong; Zhang, Feifei; Guo, Jiaqiang

    2016-01-01

    Newly manufactured electronic devices are subject to different levels of potential defects existing among the initial parameter information of the devices. In this study, a characterization of electromagnetic relays that were operated at their optimal performance with appropriate and steady parameter values was performed to estimate the levels of their potential defects and to develop a lifetime prediction model. First, the initial parameter information value and stability were quantified to measure the performance of the electronics. In particular, the values of the initial parameter information were estimated using the probability-weighted average method, whereas the stability of the parameter information was determined by using the difference between the extrema and end points of the fitting curves for the initial parameter information. Second, a lifetime prediction model for small-sized samples was proposed on the basis of both measures. Finally, a model for the relationship of the initial contact resistance and stability over the lifetime of the sampled electromagnetic relays was proposed and verified. A comparison of the actual and predicted lifetimes of the relays revealed a 15.4% relative error, indicating that the lifetime of electronic devices can be predicted based on their initial parameter information.

  5. Characterization of Initial Parameter Information for Lifetime Prediction of Electronic Devices

    PubMed Central

    Li, Zhigang; Liu, Boying; Yuan, Mengxiong; Zhang, Feifei; Guo, Jiaqiang

    2016-01-01

    Newly manufactured electronic devices are subject to different levels of potential defects existing among the initial parameter information of the devices. In this study, a characterization of electromagnetic relays that were operated at their optimal performance with appropriate and steady parameter values was performed to estimate the levels of their potential defects and to develop a lifetime prediction model. First, the initial parameter information value and stability were quantified to measure the performance of the electronics. In particular, the values of the initial parameter information were estimated using the probability-weighted average method, whereas the stability of the parameter information was determined by using the difference between the extrema and end points of the fitting curves for the initial parameter information. Second, a lifetime prediction model for small-sized samples was proposed on the basis of both measures. Finally, a model for the relationship of the initial contact resistance and stability over the lifetime of the sampled electromagnetic relays was proposed and verified. A comparison of the actual and predicted lifetimes of the relays revealed a 15.4% relative error, indicating that the lifetime of electronic devices can be predicted based on their initial parameter information. PMID:27907188

  6. LONG-TERM PERFORMANCE OF SOLID OXIDE STACKS WITH ELECTRODE-SUPPORTED CELLS OPERATING IN THE STEAM ELECTROLYSIS MODE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    J. E. O'Brien; R. C. O'Brien; X. Zhang

    2011-11-01

    Performance characterization and durability testing have been completed on two five-cell high-temperature electrolysis stacks constructed with advanced cell and stack technologies. The solid oxide cells incorporate a negative-electrode-supported multi-layer design with nickel-zirconia cermet negative electrodes, thin-film yttria-stabilized zirconia electrolytes, and multi-layer lanthanum ferrite-based positive electrodes. The per-cell active area is 100 cm2. The stack is internally manifolded with compliant mica-glass seals. Treated metallic interconnects with integral flow channels separate the cells. Stack compression is accomplished by means of a custom spring-loaded test fixture. Initial stack performance characterization was determined through a series of DC potential sweeps in both fuel cellmore » and electrolysis modes of operation. Results of these sweeps indicated very good initial performance, with area-specific resistance values less than 0.5 ?.cm2. Long-term durability testing was performed with A test duration of 1000 hours. Overall performance degradation was less than 10% over the 1000-hour period. Final stack performance characterization was again determined by a series of DC potential sweeps at the same flow conditions as the initial sweeps in both electrolysis and fuel cell modes of operation. A final sweep in the fuel cell mode indicated a power density of 0.356 W/cm2, with average per-cell voltage of 0.71 V at a current of 50 A.« less

  7. Acoustic Test Characterization of Melamine Foam for Usage in NASA's Payload Fairing Acoustic Attenuation Systems

    NASA Technical Reports Server (NTRS)

    Hughes, William O.; McNelis, Anne M.; McNelis, Mark E.

    2014-01-01

    The external acoustic liftoff levels predicted for NASA's future heavy lift launch vehicles are expected to be significantly higher than the environment created by today's commercial launch vehicles. This creates a need to develop an improved acoustic attenuation system for future NASA payload fairings. NASA Glenn Research Center initiated an acoustic test series to characterize the acoustic performance of melamine foam, with and without various acoustic enhancements. This testing was denoted as NEMFAT, which stands for NESC Enhanced Melamine Foam Acoustic Test, and is the subject of this paper. Both absorption and transmission loss testing of numerous foam configurations were performed at the Riverbank Acoustical Laboratory in July 2013. The NEMFAT test data provides an initial acoustic characterization and database of melamine foam for NASA. Because of its acoustic performance and lighter mass relative to fiberglass blankets, melamine foam is being strongly considered for use in the acoustic attenuation systems of NASA's future launch vehicles.

  8. X-ray characterization of short-pulse laser illuminated hydrogen storage alloys having very high performance

    NASA Astrophysics Data System (ADS)

    Daido, Hiroyuki; Abe, Hiroshi; Shobu, Takahisa; Shimomura, Takuya; Tokuhira, Shinnosuke; Takenaka, Yusuke; Furuyama, Takehiro; Nishimura, Akihiko; Uchida, Hirohisa; Ohshima, Takeshi

    2015-09-01

    Hydrogen storage alloys become more and more important in the fields of electric energy production and stage and automobiles such as Ni-MH batteries. The vacancies introduced in hydrogen absorption alloy by charged particle beams were found to be positive effect on the increase in the initial hydrogen absorption reaction rate in the previous study. The initial reaction rates of hydrogen absorption and desorption of the alloy are one of the important performances to be improved. Here, we report on the characterization of the hydrogen absorption reaction rate directly illuminated by a femtosecond and nanosecond lasers instead of particle beam machines. A laser illuminates the whole surface sequentially on a tip of a few cm square LaNi4.6Al0.4 alloy resulting in significant improvement in the hydrogen absorption reaction rate. For characterization of the surface layer, we perform an x-ray diffraction experiment using a monochromatized intense x-ray beam from SPring-8 synchrotoron machine.

  9. Clostridium perfringens bacteriophages FCP39O and FCP26F: genomic organization and proteomic analysis of the virions

    USDA-ARS?s Scientific Manuscript database

    Initial screening for bacteriophages lytic for Clostridium perfringens was performed utilizing filtered samples obtained from poultry (intestinal material), soil, sewage and poultry processing drainage water. Lytic phage preparations were initially characterized by transmission electron microscopy ...

  10. Comparative assessment of techniques for initial pose estimation using monocular vision

    NASA Astrophysics Data System (ADS)

    Sharma, Sumant; D`Amico, Simone

    2016-06-01

    This work addresses the comparative assessment of initial pose estimation techniques for monocular navigation to enable formation-flying and on-orbit servicing missions. Monocular navigation relies on finding an initial pose, i.e., a coarse estimate of the attitude and position of the space resident object with respect to the camera, based on a minimum number of features from a three dimensional computer model and a single two dimensional image. The initial pose is estimated without the use of fiducial markers, without any range measurements or any apriori relative motion information. Prior work has been done to compare different pose estimators for terrestrial applications, but there is a lack of functional and performance characterization of such algorithms in the context of missions involving rendezvous operations in the space environment. Use of state-of-the-art pose estimation algorithms designed for terrestrial applications is challenging in space due to factors such as limited on-board processing power, low carrier to noise ratio, and high image contrasts. This paper focuses on performance characterization of three initial pose estimation algorithms in the context of such missions and suggests improvements.

  11. Global Characterization of Protein Altering Mutations in Prostate Cancer

    DTIC Science & Technology

    2011-08-01

    prevalence of candidate cancer genes observed here in prostate cancer. (3) Perform integrative analyses of somatic mutation with gene expression and copy...analyses of somatic mutation with gene expression and copy number change data collected on the same samples. Body This is a “synergy” project between...However, to perform initial verification/validation studies, we have evaluated the mutation calls for several genes discovered initially by the

  12. Investigation of Sustained Detonation Devices: the Pulse Detonation Engine-Crossover System and the Rotating Detonation Engine System

    NASA Astrophysics Data System (ADS)

    Driscoll, Robert B.

    An experimental study is conducted on a Pulse Detonation Engine-Crossover System to investigate the feasibility of repeated, shock-initiated combustion and characterize the initiation performance. A PDE-crossover system can decrease deflagration-to-detonation transition length while employing a single spark source to initiate a multi-PDE system. Visualization of a transferred shock wave propagating through a clear channel reveals a complex shock train behind the leading shock. Shock wave Mach number and decay rate remains constant for varying crossover tube geometries and operational frequencies. A temperature gradient forms within the crossover tube due to forward flow of high temperature ionized gas into the crossover tube from the driver PDE and backward flow of ionized gas into the crossover tube from the driven PDE, which can cause intermittent auto-ignition of the driver PDE. Initiation performance in the driven PDE is strongly dependent on initial driven PDE skin temperature in the shock wave reflection region. An array of detonation tubes connected with crossover tubes is developed using optimized parameters and successful operation utilizing shock-initiated combustion through shock wave reflection is achieved and sustained. Finally, an air-breathing, PDE-Crossover System is developed to characterize the feasibility of shock-initiated combustion within an air-breathing pulse detonation engine. The initiation effectiveness of shock-initiated combustion is compared to spark discharge and detonation injection through a pre-detonator. In all cases, shock-initiated combustion produces improved initiation performance over spark discharge and comparable detonation transition run-up lengths relative to pre-detonator initiation. A computational study characterizes the mixing processes and injection flow field within a rotating detonation engine. Injection parameters including reactant flow rate, reactant injection area, placement of the fuel injection, and fuel injection distribution are varied to assess the impact on mixing. Decreasing reactant injection areas improves fuel penetration into the cross-flowing air stream, enhances turbulent diffusion of the fuel within the annulus, and increases local equivalence ratio and fluid mixedness. Staggering fuel injection holes produces a decrease in mixing when compared to collinear fuel injection. Finally, emulating nozzle integration by increasing annulus back-pressure increases local equivalence ratio in the injection region due to increased convection residence time.

  13. Spatial Discrimination Reversal and Incremental Repeated Acquisition in Adolescent and Adult BALB/c Mice

    PubMed Central

    Shen, Andrew Nathanael; Pope, Derek A.; Hutsell, Blake A.; Newland, M. Christopher

    2015-01-01

    Adolescence is characterized by neural and behavior development that includes increases in novel experiences and impulsive choice. Experimental rodent models can characterize behavior phenotypes that typify adolescence. The present experiment was designed to characterize differences between adolescent (post-natal day (PND) 34 - 60) and adult (PND 70 - 96) BALB/c mice using a response-initiated spatial discrimination reversal (SDR) and incremental repeated acquisition of response chains (IRA) procedures. During SDR, adolescents omitted more trials and were slower to initiate trials than adults, but the age groups did not differ on accuracy and perseveration measures. During IRA, adolescents displayed poorer overall performance (measured by progress quotient), lower accuracy at individual chain links, and completed fewer long response chains (>3 links) than adults. In both procedures (SDR and IRA), the poorer performance of adolescents appeared to be related to the use of a response device that was spatially removed from reinforcer delivery. These results indicate that SDR and IRA performance can be established during the brief rodent adolescent period but that these two age groups’ performances differ. We hypothesize that adolescent behavior is more sensitive than adult behavior to the spatiotemporal distance between response device and location of reinforcer delivery. PMID:26051193

  14. Statistics of work performed on a forced quantum oscillator.

    PubMed

    Talkner, Peter; Burada, P Sekhar; Hänggi, Peter

    2008-07-01

    Various aspects of the statistics of work performed by an external classical force on a quantum mechanical system are elucidated for a driven harmonic oscillator. In this special case two parameters are introduced that are sufficient to completely characterize the force protocol. Explicit results for the characteristic function of work and the corresponding probability distribution are provided and discussed for three different types of initial states of the oscillator: microcanonical, canonical, and coherent states. Depending on the choice of the initial state the probability distributions of the performed work may greatly differ. This result in particular also holds true for identical force protocols. General fluctuation and work theorems holding for microcanonical and canonical initial states are confirmed.

  15. Characterizing Fracturing of Clay-Rich Lower Watrous Rock: From Laboratory Experiments to Nonlocal Damage-Based Simulations

    NASA Astrophysics Data System (ADS)

    Guy, N.; Seyedi, D. M.; Hild, F.

    2018-06-01

    The work presented herein aims at characterizing and modeling fracturing (i.e., initiation and propagation of cracks) in a clay-rich rock. The analysis is based on two experimental campaigns. The first one relies on a probabilistic analysis of crack initiation considering Brazilian and three-point flexural tests. The second one involves digital image correlation to characterize crack propagation. A nonlocal damage model based on stress regularization is used for the simulations. Two thresholds both based on regularized stress fields are considered. They are determined from the experimental campaigns performed on Lower Watrous rock. The results obtained with the proposed approach are favorably compared with the experimental results.

  16. Initial Fire Suppression Reactions of Halons Phase 1. Development of Experimental Approach

    DTIC Science & Technology

    1990-09-01

    Engineering News, pp. 22-46, August 31, 1987. Mitani, T., " Flame Retardant Effects of CF 3Br and NaHCO 3 Combustion and Flame , Vol. 50, pp. 177-188, 1983...occurring when halons enter flame fronts are unclear. It is these initial reactions, however, that determine differences in halon performance, the effect of...LABORATORY FLAMES Over the past four decades, numerous tests have been performed in an effort to characterize the relative effectiveness of candidate

  17. Analyses of ACPL thermal/fluid conditioning system

    NASA Technical Reports Server (NTRS)

    Stephen, L. A.; Usher, L. H.

    1976-01-01

    Results of engineering analyses are reported. Initial computations were made using a modified control transfer function where the systems performance was characterized parametrically using an analytical model. The analytical model was revised to represent the latest expansion chamber fluid manifold design, and systems performance predictions were made. Parameters which were independently varied in these computations are listed. Systems predictions which were used to characterize performance are primarily transient computer plots comparing the deviation between average chamber temperature and the chamber temperature requirement. Additional computer plots were prepared. Results of parametric computations with the latest fluid manifold design are included.

  18. Multilayer Pressure Vessel Materials Testing and Analysis Phase 2

    NASA Technical Reports Server (NTRS)

    Popelar, Carl F.; Cardinal, Joseph W.

    2014-01-01

    To provide NASA with a suite of materials strength, fracture toughness and crack growth rate test results for use in remaining life calculations for the vessels described above, Southwest Research Institute® (SwRI®) was contracted in two phases to obtain relevant material property data from a representative vessel. An initial characterization of the strength, fracture and fatigue crack growth properties was performed in Phase 1. Based on the results and recommendations of Phase 1, a more extensive material property characterization effort was developed in this Phase 2 effort. This Phase 2 characterization included additional strength, fracture and fatigue crack growth of the multilayer vessel and head materials. In addition, some more limited characterization of the welds and heat affected zones (HAZs) were performed. This report

  19. Microbial Monitoring of Common Opportunistic Pathogens by Comparing Multiple Real-Time PCR Platforms for Potential Space Applications

    NASA Technical Reports Server (NTRS)

    Oubre, Cherie M.; Birmele, Michele N.; Castro, Victoria A.; Venkateswaran, Kasthuri J.; Vaishampayan, Parag A.; Jones, Kathy U.; Singhal, Adesh; Johnston, Angela S.; Roman, Monserrate C.; Ozbolt, Tamra A.; hide

    2013-01-01

    Because the International Space Station is a closed environment with rotations of astronauts and equipment that each introduce their own microbial flora, it is necessary to monitor the air, surfaces, and water for microbial contamination. Current microbial monitoring includes labor- and time-intensive methods to enumerate total bacterial and fungal cells, with limited characterization, during in-flight testing. Although this culture-based method is sufficient for monitoring the International Space Station, on future long-duration missions more detailed characterization will need to be performed during flight, as sample return and ground characterization may not be available. At a workshop held in 2011 at NASA's Johnson Space Center to discuss alternative methodologies and technologies suitable for microbial monitoring for these long-term exploration missions, molecular-based methodologies such as polymerase chain reaction (PCR) were recommended. In response, a multi-center (Marshall Space Flight Center, Johnson Space Center, Jet Propulsion Laboratory, and Kennedy Space Center) collaborative research effort was initiated to explore novel commercial-off-the-shelf hardware options for space flight environmental monitoring. The goal was to evaluate quantitative or semi-quantitative PCR approaches for low-cost in-flight rapid identification of microorganisms that could affect crew safety. The initial phase of this project identified commercially available platforms that could be minimally modified to perform nominally in microgravity. This phase was followed by proof-of-concept testing of the highest qualifying candidates with a universally available challenge organism, Salmonella enterica. The analysis identified two technologies that were able to perform sample-to-answer testing with initial cell sample concentrations between 50 and 400 cells. In addition, the commercial systems were evaluated for initial flight safety and readiness.

  20. Comprehensive characterization of C-glycosyl flavones in wheat (Triticum aestivum L.) germ using UPLC-PDA-ESI/HRMSn and mass defect filtering

    USDA-ARS?s Scientific Manuscript database

    A comprehensive characterization of C-glycosyl flavones in wheat germ has been conducted using multi-stage high resolution mass spectrometry (HRMS) combined with mass defect filter (MDF). MDF performed the initial search of raw data with defined mass ranges and mass defect windows to generate the n...

  1. Detection Performance of Upgraded "Polished Panel" Optical Receiver Concept on the Deep-Space Network's 34 Meter Research Antenna

    NASA Technical Reports Server (NTRS)

    Vilnrotter, Victor A.

    2012-01-01

    Initial optical communications experiments with a Vertex polished aluminum panel have been described. The polished panel was mounted on the main reflector of the DSN's research antenna at DSS-13. The PSF was recorded via remotely controlled digital camera mounted on the subreflector structure. Initial PSF generated by Jupiter showed significant tilt error and some mechanical deformation. After upgrades, the PSF improved significantly, leading to much better concentration of light. Communications performance of the initial and upgraded panel structure were compared. After the upgrades, simulated PPM symbol error probability decreased by six orders of magnitude. Work is continuing to demonstrate closed-loop tracking of sources from zenith to horizon, and better characterize communications performance in realistic daytime background environments.

  2. Degradation Characterization of Thermal Interface Greases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    DeVoto, Douglas J; Major, Joshua; Paret, Paul P

    Thermal interface materials (TIMs) are used in power electronics packaging to minimize thermal resistance between the heat generating component and the heat sink. Thermal greases are one such class. The conformability and thin bond line thickness (BLT) of these TIMs can potentially provide low thermal resistance throughout the operation lifetime of a component. However, their performance degrades over time due to pump-out and dry-out during thermal and power cycling. The reliability performance of greases through operational cycling needs to be quantified to develop new materials with superior properties. NREL, in collaboration with DuPont, has performed thermal and reliability characterization ofmore » several commercially available thermal greases. Initial bulk and contact thermal resistance of grease samples were measured, and then the thermal degradation that occurred due to pump-out and dry-out during temperature cycling was monitored. The thermal resistances of five different grease materials were evaluated using NREL's steady-state thermal resistance tester based on the ASTM test method D5470. Greases were then applied, utilizing a 2.5 cm x 2.5 cm stencil, between invar and aluminum plates to compare the thermomechanical performance of the materials in a representative test fixture. Scanning Acoustic microscopy, thermal, and compositional analyses were performed periodically during thermal cycling from -40 degrees Celcius to 125 degrees Celcius. Completion of this characterization has allowed for a comprehensive evaluation of thermal greases both for their initial bulk and contact thermal performance, as well as their degradation mechanisms under accelerated thermal cycling conditions.« less

  3. Degradation Characterization of Thermal Interface Greases: Preprint

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    DeVoto, Douglas J; Major, Joshua; Paret, Paul P

    Thermal interface materials (TIMs) are used in power electronics packaging to minimize thermal resistance between the heat generating component and the heat sink. Thermal greases are one such class. The conformability and thin bond line thickness (BLT) of these TIMs can potentially provide low thermal resistance throughout the operation lifetime of a component. However, their performance degrades over time due to pump-out and dry-out during thermal and power cycling. The reliability performance of greases through operational cycling needs to be quantified to develop new materials with superior properties. NREL, in collaboration with DuPont, has performed thermal and reliability characterization ofmore » several commercially available thermal greases. Initial bulk and contact thermal resistance of grease samples were measured, and then the thermal degradation that occurred due to pump-out and dry-out during temperature cycling was monitored. The thermal resistances of five different grease materials were evaluated using NREL's steady-state thermal resistance tester based on the ASTM test method D5470. Greases were then applied, utilizing a 2.5 cm x 2.5 cm stencil, between invar and aluminum plates to compare the thermomechanical performance of the materials in a representative test fixture. Scanning Acoustic microscopy, thermal, and compositional analyses were performed periodically during thermal cycling from -40 degrees Celcius to 125 degrees Celcius. Completion of this characterization has allowed for a comprehensive evaluation of thermal greases both for their initial bulk and contact thermal performance, as well as their degradation mechanisms under accelerated thermal cycling conditions.« less

  4. Degradation Characterization of Thermal Interface Greases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Major, Joshua; Narumanchi, Sreekant V; Paret, Paul P

    Thermal interface materials (TIMs) are used in power electronics packaging to minimize thermal resistance between the heat generating component and the heat sink. Thermal greases are one such class. The conformability and thin bond line thickness (BLT) of these TIMs can potentially provide low thermal resistance throughout the operation lifetime of a component. However, their performance degrades over time due to pump-out and dry-out during thermal and power cycling. The reliability performance of greases through operational cycling needs to be quantified to develop new materials with superior properties. NREL, in collaboration with DuPont, has performed thermal and reliability characterization ofmore » several commercially available thermal greases. Initial bulk and contact thermal resistance of grease samples were measured, and then the thermal degradation that occurred due to pump-out and dry-out during temperature cycling was monitored. The thermal resistances of five different grease materials were evaluated using NREL's steady-state thermal resistance tester based on the ASTM test method D5470. Greases were then applied, utilizing a 2.5 cm x 2.5 cm stencil, between invar and aluminum plates to compare the thermomechanical performance of the materials in a representative test fixture. Scanning Acoustic microscopy, thermal, and compositional analyses were performed periodically during thermal cycling from -40 degrees C to 125 degrees C. Completion of this characterization has allowed for a comprehensive evaluation of thermal greases both for their initial bulk and contact thermal performance, as well as their degradation mechanisms under accelerated thermal cycling conditions.« less

  5. Instrumentation for electrochemical performance characterization of neural electrodes

    NASA Astrophysics Data System (ADS)

    Marsh, Michael P.; Kruchowski, James N.; Hara, Seth A.; McIntosh, Malcom B.; Forsman, Renae M.; Reed, Terry L.; Kimble, Christopher; Lee, Kendall H.; Bennet, Kevin E.; Tomshine, Jonathan R.

    2017-08-01

    In an effort to determine the chronic stability, sensitivity, and thus the potential viability of various neurochemical recording electrode designs and compositions, we have developed a custom device called the Voltammetry Instrument for Neurochemical Applications (VINA). Here, we describe the design of the VINA and initial testing of its functionality for prototype neurochemical sensing electrodes. The VINA consists of multiple electrode fixtures, a flowing electrolyte bath, associated reservoirs, peristaltic pump, voltage waveform generator, data acquisition hardware, and system software written in National Instrument's LabVIEW. The operation of VINA was demonstrated on a set of boron-doped diamond neurochemical recording electrodes, which were subjected to an applied waveform for a period of eighteen days. Each electrode's cyclic voltammograms (CVs) were recorded, and sensitivity calibration to dopamine (DA) was performed. Results showed an initial decline with subsequent stabilization in the CV current measured during the voltammetric sweep, corresponding closely with changes in electrode sensitivity to DA. The VINA has demonstrated itself as a useful tool for the characterization of electrode stability and chronic electrochemical performance.

  6. A Common Initiation Criterion for CL-20 EBW Detonators

    NASA Astrophysics Data System (ADS)

    Valancius, Cole; Garasi, Christopher; O'Malley, Patrick

    2014-11-01

    In an effort to better understand the initiation mechanisms of hexanitrohexaazaisowurtzitane (CL-20) based Exploding Bridgewire (EBW) detonators, a series of studies were performed comparing electrical input parameters and detonator performance. Traditional methods of analysis, such as burst current and action, do not allow performance to be compared across multiple firesets. A new metric, electrical burst energy density (Eρ) , allows an explosive train to be characterized across all possible electrical configurations (different firesets, different sized gold bridges, different cables and cable lengths); by testing one electrical configuration, performance across all others is understood. This discovery has implications for design and surveillance, and for the first time, presents a link between modeling of electrical circuits (such as in ALEGRA) and explosive performance.

  7. Deposition and Characterization of Improved Hydrogen Getter Materials - Report on FY 14-15 Activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hubbard, Kevin Mark; Sandoval, Cynthia Wathen

    2015-10-15

    The goals of this work have been two-fold. First, to perform an initial, quantitative, optimization of getter performance, with the primary variables being DEB/Pd ratio and UV power. Second, to simplify the deposition process to make it more compatible with the DOE production environment.

  8. Perceptual learning in Williams syndrome: looking beyond averages.

    PubMed

    Gervan, Patricia; Gombos, Ferenc; Kovacs, Ilona

    2012-01-01

    Williams Syndrome is a genetically determined neurodevelopmental disorder characterized by an uneven cognitive profile and surprisingly large neurobehavioral differences among individuals. Previous studies have already shown different forms of memory deficiencies and learning difficulties in WS. Here we studied the capacity of WS subjects to improve their performance in a basic visual task. We employed a contour integration paradigm that addresses occipital visual function, and analyzed the initial (i.e. baseline) and after-learning performance of WS individuals. Instead of pooling the very inhomogeneous results of WS subjects together, we evaluated individual performance by expressing it in terms of the deviation from the average performance of the group of typically developing subjects of similar age. This approach helped us to reveal information about the possible origins of poor performance of WS subjects in contour integration. Although the majority of WS individuals showed both reduced baseline and reduced learning performance, individual analysis also revealed a dissociation between baseline and learning capacity in several WS subjects. In spite of impaired initial contour integration performance, some WS individuals presented learning capacity comparable to learning in the typically developing population, and vice versa, poor learning was also observed in subjects with high initial performance levels. These data indicate a dissociation between factors determining initial performance and perceptual learning.

  9. Detonation failure characterization of non-ideal explosives

    NASA Astrophysics Data System (ADS)

    Janesheski, Robert S.; Groven, Lori J.; Son, Steven

    2012-03-01

    Non-ideal explosives are currently poorly characterized, hence limiting the modeling of them. Current characterization requires large-scale testing to obtain steady detonation wave characterization for analysis due to the relatively thick reaction zones. Use of a microwave interferometer applied to small-scale confined transient experiments is being implemented to allow for time resolved characterization of a failing detonation. The microwave interferometer measures the position of a failing detonation wave in a tube that is initiated with a booster charge. Experiments have been performed with ammonium nitrate and various fuel compositions (diesel fuel and mineral oil). It was observed that the failure dynamics are influenced by factors such as chemical composition and confiner thickness. Future work is planned to calibrate models to these small-scale experiments and eventually validate the models with available large scale experiments. This experiment is shown to be repeatable, shows dependence on reactive properties, and can be performed with little required material.

  10. Georgia Long-Term Pavement Performance (GALTPP) Program – Maintaining Georgia’s Calibration Sites and Identifying the Potential for Using MEPDG for Characterization of Non-Standard Materials and Methods (Phase 1)

    DOT National Transportation Integrated Search

    2016-10-01

    The Georgia Department of Transportation (GDOT) has initiated a Georgia Long-Term Pavement Performance (GALTPP) monitoring program 1) to provide data for calibrating the prediction models in the AASHTO Mechanistic-Empirical Pavement Design Guide (MEP...

  11. Detonator Performance Characterization Using Multi-Frame Laser Schlieren Imaging

    NASA Astrophysics Data System (ADS)

    Clarke, S. A.; Landon, C. D.; Murphy, M. J.; Martinez, M. E.; Mason, T. A.; Thomas, K. A.

    2009-12-01

    Several experiments that are part of a phased plan to understand the evolution of detonation in a detonator from initiation shock through run to detonation to full detonation to transition to booster and booster detonation will be presented. High speed laser schlieren movies have been used to study several explosive initiation events, such as exploding bridgewires (EBW), exploding foil initiators (EFI) (or slappers), direct optical initiation (DOI), and electrostatic discharge (ESD). Additionally, a series of tests have been performed on "cut-back" detonators with varying initial pressing (IP) heights. We have also used this diagnostic to visualize a range of EBW, EFI, and DOI full-up detonators. Future applications to other explosive events such as boosters and IHE booster evaluation will be discussed. The EPIC hydrodynamic code has been used to analyze the shock fronts from the schlieren images to reverse calculate likely boundary or initial conditions to determine the temporal-spatial pressure profile across the output face of the detonator. LA-UR-05099

  12. Telerobotic system performance measurement - Motivation and methods

    NASA Technical Reports Server (NTRS)

    Kondraske, George V.; Khoury, George J.

    1992-01-01

    A systems performance-based strategy for modeling and conducting experiments relevant to the design and performance characterization of telerobotic systems is described. A developmental testbed consisting of a distributed telerobotics network and initial efforts to implement the strategy described is presented. Consideration is given to the general systems performance theory (GSPT) to tackle human performance problems as a basis for: measurement of overall telerobotic system (TRS) performance; task decomposition; development of a generic TRS model; and the characterization of performance of subsystems comprising the generic model. GSPT employs a resource construct to model performance and resource economic principles to govern the interface of systems to tasks. It provides a comprehensive modeling/measurement strategy applicable to complex systems including both human and artificial components. Application is presented within the framework of a distributed telerobotics network as a testbed. Insight into the design of test protocols which elicit application-independent data is described.

  13. Pretest characterization of WIPP experimental waste

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, J.; Davis, H.; Drez, P.E.

    The Waste Isolation Pilot Plant (WIPP) near Carlsbad, New Mexico, is an underground repository designed for the storage and disposal of transuranic (TRU) wastes from US Department of Energy (DOE) facilities across the country. The Performance Assessment (PA) studies for WIPP address compliance of the repository with applicable regulations, and include full-scale experiments to be performed at the WIPP site. These experiments are the bin-scale and alcove tests to be conducted by Sandia National Laboratories (SNL). Prior to conducting these experiments, the waste to be used in these tests needs to be characterized to provide data on the initial conditionsmore » for these experiments. This characterization is referred to as the Pretest Characterization of WIPP Experimental Waste, and is also expected to provide input to other programmatic efforts related to waste characterization. The purpose of this paper is to describe the pretest waste characterization activities currently in progress for the WIPP bin-scale waste, and to discuss the program plan and specific analytical protocols being developed for this characterization. The relationship between different programs and documents related to waste characterization efforts is also highlighted in this paper.« less

  14. Intraindividual variability in basic reaction time predicts middle-aged and older pilots' flight simulator performance.

    PubMed

    Kennedy, Quinn; Taylor, Joy; Heraldez, Daniel; Noda, Art; Lazzeroni, Laura C; Yesavage, Jerome

    2013-07-01

    Intraindividual variability (IIV) is negatively associated with cognitive test performance and is positively associated with age and some neurological disorders. We aimed to extend these findings to a real-world task, flight simulator performance. We hypothesized that IIV predicts poorer initial flight performance and increased rate of decline in performance among middle-aged and older pilots. Two-hundred and thirty-six pilots (40-69 years) completed annual assessments comprising a cognitive battery and two 75-min simulated flights in a flight simulator. Basic and complex IIV composite variables were created from measures of basic reaction time and shifting and divided attention tasks. Flight simulator performance was characterized by an overall summary score and scores on communication, emergencies, approach, and traffic avoidance components. Although basic IIV did not predict rate of decline in flight performance, it had a negative association with initial performance for most flight measures. After taking into account processing speed, basic IIV explained an additional 8%-12% of the negative age effect on initial flight performance. IIV plays an important role in real-world tasks and is another aspect of cognition that underlies age-related differences in cognitive performance.

  15. Intraindividual Variability in Basic Reaction Time Predicts Middle-Aged and Older Pilots’ Flight Simulator Performance

    PubMed Central

    2013-01-01

    Objectives. Intraindividual variability (IIV) is negatively associated with cognitive test performance and is positively associated with age and some neurological disorders. We aimed to extend these findings to a real-world task, flight simulator performance. We hypothesized that IIV predicts poorer initial flight performance and increased rate of decline in performance among middle-aged and older pilots. Method. Two-hundred and thirty-six pilots (40–69 years) completed annual assessments comprising a cognitive battery and two 75-min simulated flights in a flight simulator. Basic and complex IIV composite variables were created from measures of basic reaction time and shifting and divided attention tasks. Flight simulator performance was characterized by an overall summary score and scores on communication, emergencies, approach, and traffic avoidance components. Results. Although basic IIV did not predict rate of decline in flight performance, it had a negative association with initial performance for most flight measures. After taking into account processing speed, basic IIV explained an additional 8%–12% of the negative age effect on initial flight performance. Discussion. IIV plays an important role in real-world tasks and is another aspect of cognition that underlies age-related differences in cognitive performance. PMID:23052365

  16. Interlaboratory studies and initiatives developing standards for proteomics

    PubMed Central

    Ivanov, Alexander R.; Colangelo, Christopher M.; Dufresne, Craig P.; Friedman, David B.; Lilley, Kathryn S.; Mechtler, Karl; Phinney, Brett S.; Rose, Kristie L.; Rudnick, Paul A.; Searle, Brian C.; Shaffer, Scott A.; Weintraub, Susan T.

    2013-01-01

    Proteomics is a rapidly transforming interdisciplinary field of research that embraces a diverse set of analytical approaches to tackle problems in fundamental and applied biology. This view-point article highlights the benefits of interlaboratory studies and standardization initiatives to enable investigators to address many of the challenges found in proteomics research. Among these initiatives, we discuss our efforts on a comprehensive performance standard for characterizing PTMs by MS that was recently developed by the Association of Biomolecular Resource Facilities (ABRF) Proteomics Standards Research Group (sPRG). PMID:23319436

  17. The Effects of a Goal Setting Intervention on Productivity and Persistence in an Analogue Work Task

    ERIC Educational Resources Information Center

    Tammemagi, Triona; O'Hora, Denis; Maglieri, Kristen A.

    2013-01-01

    The authors of this study sought to quantify the beneficial effect of goal setting on work performance, and to characterize the persistence or deterioration of goal-directed behavior over time. Twenty-six participants completed a computer-based data entry task. Performance was measured during an initial baseline, a goal setting intervention that…

  18. Independence: proposing an initial framework for occupational therapy.

    PubMed

    Collins, Bethan

    2017-11-01

    The concept of independence is common in occupational therapy theory and practice but has rarely been clearly defined or conceptualized within in occupational therapy literature and there seems to be no standard definition. This can result in ambiguity, which potentially jeopardizes client-centred practice. This paper proposes an occupational therapy independence framework (OTIF) that synthesizes the range of characterizations of independence in a practically useful and occupation-centred manner. A review of literature, clinical experience, doctoral research and conversations with occupational therapists and disabled people, in particular those involved in a disability activism group and people with physical disabilities, has led to the development of the OTIF. Independence and interdependence, as characterized in the OTIF, occur when an individual exerts choice over occupational performance and can engage in occupations in a manner acceptable to the individual. Interdependence results when occupations are performed with another person whereas independence involves solitary occupational performance. Dependence typically results from inability to choose occupations or a mismatch between performance capacity and environmental factors. The OTIF has the potential to clarify the conceptualization of independence within occupational therapy theory and practice. This initial proposal is presented to stimulate debate and discussion.

  19. Annual Report, Fall 2016: Identifying Cost Effective Tank Waste Characterization Approaches

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reboul, S. H.; DiPrete, D. P.

    2016-12-12

    This report documents the activities that were performed during the second year of a project undertaken to improve the cost effectiveness and timeliness of SRNL’s tank closure characterization practices. The activities performed during the first year of the project were previously reported in SRNL-STI-2015-00144. The scope of the second year activities was divided into the following three primary tasks: 1) develop a technical basis and strategy for improving the cost effectiveness and schedule of SRNL’s tank closure characterization program; 2) initiate the design and assembly of a new waste removal system for improving the throughput and reducing the personnel dosemore » associated with extraction chromatography radiochemical separations; and 3) develop and perform feasibility testing of three alternative radiochemical separation protocols holding promise for improving high resource demand/time consuming tank closure sample analysis methods.« less

  20. Microbial Monitoring of Pathogens by Comparing Multiple Real-Time PCR Platforms for Potential Space Applications

    NASA Technical Reports Server (NTRS)

    Birmele, Michele

    2012-01-01

    The International Space Station (ISS) is a closed environment wih rotations of crew and equipment each introducing their own microbial flora making it necessary to monitor the air, surfaces, and water for microbial contamination. Current microbial monitoring includes labor and time intensive methods to enumerate total bacterial and fungal cells with limited characterization during in-flight testing. Although this culture-based method has been sufficient for monitoring the ISS, future long duration missions will need to perform more comprehensive characterization in-flight, since sample return and ground characterization may not be available. A workshop was held in 2011 at the Johnson Space Center to discuss alternative methodologies and technologies suitable for microbial monitoring for these longterm exploration missions where molecular-based methodologies, such as polymerase chain reaction (PCR), were recommended. In response, a multi-center (Marshall Space Flight Center, Johnson Space Center, Jet Propulsion Laboratory, and Kennedy Space Center) collaborative research effort was initiated to explore novel commercial-off-the-shelf hardware options for spaceflight environmental monitoring. The goal was to evaluate quantitative/semi-quantitative PCR approaches to space applications for low cost in-flight rapid identification of microorganisms affecting crew safety. The initial phase of this project identified commercially available platforms that could be minimally modified to perform nominally in microgravity followed by proof-of-concept testing on the highest qualifying candidates with a universally available test organism, Salmonella enterica. The platforms evaluated during proof-of-concept testing included the iCubate 2.0(TradeMark) (iCubate, Huntsville, AL), RAZOR EX (BioFire Diagnostics; Salt Lake City, Utah) and SmartCycler(TradeMark) (Cepheid; Sunnyvale, CA). The analysis identified two potential technologies (iCubate 2.0 and RAZOR EX) that were able to perform sample-to-answer testing with cell sample concentrations between SO to 400 cells. In addition, the commercial systems were evaluated for initial flight safety and readiness, sample concentration needs were reviewed, and a competitive procurement of commercially available platforms was initiated.

  1. Characterization of IKBKE as a Breast Cancer Oncogene

    DTIC Science & Technology

    2011-10-01

    HMLE -MEKDD cells stably expressing either pWZL or MF-IKKε. Immunoblot analysis by IKKε antibody. (D) IP with an IKK antibody from MCF-7 breast cancer ...summary is presented of research performed during three years of a project to further characterize the breast cancer oncogene IKKε. Two specific aims...constitutive IKKε transgenic mouse model to study the role of IKKε in breast cancer initiation and maintenance. The long term goals of this research

  2. Parameter identification of thermophilic anaerobic degradation of valerate.

    PubMed

    Flotats, Xavier; Ahring, Birgitte K; Angelidaki, Irini

    2003-01-01

    The considered mathematical model of the decomposition of valerate presents three unknown kinetic parameters, two unknown stoichiometric coefficients, and three unknown initial concentrations for biomass. Applying a structural identifiability study, we concluded that it is necessary to perform simultaneous batch experiments with different initial conditions for estimating these parameters. Four simultaneous batch experiments were conducted at 55 degrees C, characterized by four different initial acetate concentrations. Product inhibition of valerate degradation by acetate was considered. Practical identification was done optimizing the sum of the multiple determination coefficients for all measured state variables and for all experiments simultaneously. The estimated values of kinetic parameters and stoichiometric coefficients were characterized by the parameter correlation matrix, the confidence interval, and the student's t-test at 5% significance level with positive results except for the saturation constant, for which more experiments for improving its identifiability should be conducted. In this article, we discuss kinetic parameter estimation methods.

  3. Experimental study of strained and destrained turbulence

    NASA Astrophysics Data System (ADS)

    Chen, Jun; Meneveau, Charles; Katz, Joseph

    2003-11-01

    Planar Particle Image Velocimetry measurements are performed in a water tank facility in which high Reynolds number turbulence is generated by an array of spinning grids. Straining fields are applied using a piston with rectangular cross-section which is pushed towards the bottom of the tank, setting up a planar straining field there. The facility can also be used to reverse the distortion ("destraining'') by pulling the piston upwards. We present calibration tests characterizing the flow in the facility. The initial turbulent state is characterized by means of ditributions of rms values and energy spectra, and corresponds closely to isotropic, homogeneous turbulence. The applied straining is characterized using high-speed camera and PIV measurements of the mean flow without turbulence. Initial results of turbulence subjected to a sequence of straining and destraining motions are presented, with particular emphasis on the flux of kinetic energy from large to small scales and possible backscatter during destraining.

  4. Data-Based Performance Assessments for the DOE Hydropower Advancement Project

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    March, Patrick; Wolff, Dr. Paul; Smith, Brennan T

    2012-01-01

    The U. S. Department of Energy s Hydropower Advancement Project (HAP) was initiated to characterize and trend hydropower asset conditions across the U.S.A. s existing hydropower fleet and to identify and evaluate the upgrading opportunities. Although HAP includes both detailed performance assessments and condition assessments of existing hydropower plants, this paper focuses on the performance assessments. Plant performance assessments provide a set of statistics and indices that characterize the historical extent to which each plant has converted the potential energy at a site into electrical energy for the power system. The performance metrics enable benchmarking and trending of performance acrossmore » many projects in a variety contexts (e.g., river systems, power systems, and water availability). During FY2011 and FY2012, assessments will be performed on ten plants, with an additional fifty plants scheduled for FY2013. This paper focuses on the performance assessments completed to date, details the performance assessment process, and describes results from the performance assessments.« less

  5. Investigations into Performance and Lifetime Enhancements of OPV Devices: Cooperative Research and Development Final Report, CRADA Number CRD-08-263

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ginley, D.

    2014-06-01

    To evaluate Plextronics new additives and derivatives in lithium-ion Battery Applications, Plextronics will provide to NREL, a starting point, including materials and initial data for proof of concept. The central focus of this project is to acertain the nature of the efficacy of the Plextronics additives through physical and electrical characterization, including evaluations of new derivatives, system evaluations on batteries made with Plexcore and to study long term cycling performance differences. The initial focus is to establish Plexcore mode of action to support the commercialization of the first commercial evaluations of Plexcore in Sept. 2013.

  6. Lunar Dust Characterization for Exploration Life Support Systems

    NASA Technical Reports Server (NTRS)

    Agui, Juan H.

    2007-01-01

    Lunar dust effects can have a significant impact on the performance and maintenance of future exploration life support systems. Filtration systems will be challenged by the additional loading from lunar dust, and mitigation technology and strategies have to be adapted to protect sensitive equipment. An initial characterization of lunar dust and simulants was undertaken. The data emphasize the irregular morphology of the dust particles and the frequency dependence of lunar dust layer detachment from shaken surfaces.

  7. [Synthesis and Characterization of a Sugar Based Electrolyte for Thin-film Polymer Batteries

    NASA Technical Reports Server (NTRS)

    1998-01-01

    The work performed during the current renewal period, March 1,1998 focused primarily on the synthesis and characterization of a sugar based electrolyte for thin-film polymer batteries. The initial phase of the project involved developing a suitable sugar to use as the monomer in the polymeric electrolyte synthesis. The monomer has been synthesized and characterized completely. Overall the yield of this material is high and it can be produced in relatively large quantity easily and in high purity. The scheme used for the preparation of the monomer is outlined along with pertinent yields.

  8. Prospective Molecular Characterization of Burn Wound Colonization: Novel Tools and Analysis

    DTIC Science & Technology

    2014-02-01

    from patients with endocarditis and wound/soft tissue infections, have been sequenced and an initial analysis performed. Finally, enrollment in the...Price LB. Analysis of S. aureus isolates from endocarditis and skin/soft tissue infections A strict blast search was performed on the S. aureus...targets differentiating the cellulitis and endocarditis isolates. This was followed with a basic Pearson’s Chi-squared test with Yates’ continuity

  9. NASA GRC Technology Development Project for a Stirling Radioisotope Power System

    NASA Technical Reports Server (NTRS)

    Thieme, Lanny G.; Schreiber, Jeffrey G.

    2000-01-01

    NASA Glenn Research Center (GRC), the Department of Energy (DOE), and Stirling Technology Company (STC) are developing a Stirling convertor for an advanced radioisotope power system to provide spacecraft on-board electric power for NASA deep space missions. NASA GRC is conducting an in-house project to provide convertor, component, and materials testing and evaluation in support of the overall power system development. A first characterization of the DOE/STC 55-We Stirling Technology Demonstration Convertor (TDC) under the expected launch random vibration environment was recently completed in the NASA GRC Structural Dynamics Laboratory. Two TDCs also completed an initial electromagnetic interference (EMI) characterization at NASA GRC while being tested in a synchronized, opposed configuration. Materials testing is underway to support a life assessment of the heater head, and magnet characterization and aging tests have been initiated. Test facilities are now being established for an independent convertor performance verification and technology development. A preliminary Failure Mode Effect Analysis (FMEA), initial finite element analysis (FEA) for the linear alternator, ionizing radiation survivability assessment, and radiator parametric study have also been completed. This paper will discuss the status, plans, and results to date for these efforts.

  10. BHC80 ss Critical in Suppression of Snail-LSD1 Interaction and Breast Cancer Metastasis

    DTIC Science & Technology

    2012-01-01

    as well as Snail/LSD1 binding to the target gene promoter. The identification and functional characterization of PAPR1 will potentially help us...demonstrated that LSD1 enhances the protein stability of Snail and cooperates with Snail to induce EMT, the function of BHC80, as well as potential...identified a new protein component of the Snail/LSD1 complex, and have performed initial experiments to characterize the function of this protein, which

  11. (CALIFORNIA) META-ANALYSIS OF THE LIFE STYLE FACTORS RELEVANT TO ENVIRONMENTAL HAZARDS FOR THE AGING POPULATION

    EPA Science Inventory

    The goal of this U.S. Environmental Protection Agency (EPA) Aging Initiative study is to characterize activity patterns, physiological changes, and environmental exposures for the aging population. Meta-analysis was performed on more than 2000 reviewed articles to evaluate the l...

  12. The Isolation of Motivational, Motoric, and Schedule Effects on Operant Performance: A Modeling Approach

    PubMed Central

    Brackney, Ryan J; Cheung, Timothy H. C; Neisewander, Janet L; Sanabria, Federico

    2011-01-01

    Dissociating motoric and motivational effects of pharmacological manipulations on operant behavior is a substantial challenge. To address this problem, we applied a response-bout analysis to data from rats trained to lever press for sucrose on variable-interval (VI) schedules of reinforcement. Motoric, motivational, and schedule factors (effort requirement, deprivation level, and schedule requirements, respectively) were manipulated. Bout analysis found that interresponse times (IRTs) were described by a mixture of two exponential distributions, one characterizing IRTs within response bouts, another characterizing intervals between bouts. Increasing effort requirement lengthened the shortest IRT (the refractory period between responses). Adding a ratio requirement increased the length and density of response bouts. Both manipulations also decreased the bout-initiation rate. In contrast, food deprivation only increased the bout-initiation rate. Changes in the distribution of IRTs over time showed that responses during extinction were also emitted in bouts, and that the decrease in response rate was primarily due to progressively longer intervals between bouts. Taken together, these results suggest that changes in the refractory period indicate motoric effects, whereas selective alterations in bout initiation rate indicate incentive-motivational effects. These findings support the use of response-bout analyses to identify the influence of pharmacological manipulations on processes underlying operant performance. PMID:21765544

  13. Evaluation of suitable porosity for sintered porous {beta}-tricalcium phosphate as a bone substitute

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Jin-Hong; Bae, Ji-Yong; Shim, Jaebum

    2012-09-15

    Structural and mechanical characterization is performed for sintered porous beta tricalcium phosphate ({beta}-TCP) to determine the appropriate porosity for use as a bone substitute. Four different types of porous {beta}-TCP specimen with different porosities are fabricated through a sintering process. For structural characterization, scanning electron microscopy and a Microfocus X-ray computed tomography system are used to investigate the pore openings on the specimen's surface, pore size, pore distribution, and pore interconnections. Compression tests of the specimens are performed, and mechanical properties such as the elastic modulus and compressive strength are obtained. Also, the geometric shape and volume of the {beta}-TCPmore » around the contact region of two pores, which need to be initially resolved after implantation in order to increase the size of the pore openings, are evaluated through simple calculations. The results show that porous {beta}-TCP with 42.1% porosity may be a suitable bone substitute candidate in terms of sustaining external loads, and inducing and cultivating bone cells. - Highlights: Black-Right-Pointing-Pointer Structural and mechanical characterization was performed for sintered porous {beta}-TCP specimens. Black-Right-Pointing-Pointer For structural characterization, SEM and Microfocus X-ray CT system were used. Black-Right-Pointing-Pointer For mechanical characterization, compression tests were performed. Black-Right-Pointing-Pointer Porous {beta}-TCP with 42.1% porosity may be a suitable bone substitute.« less

  14. Performance of the Lester battery charger in electric vehicles

    NASA Technical Reports Server (NTRS)

    Vivian, H. C.; Bryant, J. A.

    1984-01-01

    Tests are performed on an improved battery charger. The primary purpose of the testing is to develop test methodologies for battery charger evaluation. Tests are developed to characterize the charger in terms of its charge algorithm and to assess the effects of battery initial state of charge and temperature on charger and battery efficiency. Tests show this charger to be a considerable improvement in the state of the art for electric vehicle chargers.

  15. Environment assisted degradation mechanisms in advanced light metals

    NASA Technical Reports Server (NTRS)

    Gangloff, R. P.; Stoner, G. E.; Swanson, R. E.

    1989-01-01

    A multifaceted research program on the performance of advanced light metallic alloys in aggressive aerospace environments, and associated environmental failure mechanisms was initiated. The general goal is to characterize alloy behavior quantitatively and to develop predictive mechanisms for environmental failure modes. Successes in this regard will provide the basis for metallurgical optimization of alloy performance, for chemical control of aggressive environments, and for engineering life prediction with damage tolerance and long term reliability.

  16. Observation of non-classical correlations in sequential measurements of photon polarization

    NASA Astrophysics Data System (ADS)

    Suzuki, Yutaro; Iinuma, Masataka; Hofmann, Holger F.

    2016-10-01

    A sequential measurement of two non-commuting quantum observables results in a joint probability distribution for all output combinations that can be explained in terms of an initial joint quasi-probability of the non-commuting observables, modified by the resolution errors and back-action of the initial measurement. Here, we show that the error statistics of a sequential measurement of photon polarization performed at different measurement strengths can be described consistently by an imaginary correlation between the statistics of resolution and back-action. The experimental setup was designed to realize variable strength measurements with well-controlled imaginary correlation between the statistical errors caused by the initial measurement of diagonal polarizations, followed by a precise measurement of the horizontal/vertical polarization. We perform the experimental characterization of an elliptically polarized input state and show that the same complex joint probability distribution is obtained at any measurement strength.

  17. Solid State Characterizations of Long-Term Leached Cast Stone Monoliths

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Asmussen, Robert M.; Pearce, Carolyn I.; Parker, Kent E.

    This report describes the results from the solid phase characterization of six Cast Stone monoliths from the extended leach tests recently reported on (Serne et al. 2016),that were selected for characterization using multiple state-of-the-art approaches. The Cast Stone samples investigated were leached for > 590 d in the EPA Method 1315 test then archived for > 390 d in their final leachate. After reporting the long term leach behavior of the monoliths (containing radioactive 99Tc and stable 127I spikes and for original Westsik et al. 2013 fabricated monoliths, 238U), it was suggested that physical changes to the waste forms andmore » a depleting inventory of contaminants of potential concern may mean that effective diffusivity calculations past 63 d should not be used to accurately represent long-term waste form behavior. These novel investigations, in both length of leaching time and application of solid state techniques, provide an initial arsenal of techniques which can be utilized to perform such Cast Stone solid phase characterization work, which in turn can support upcoming performance assessment maintenance. The work was performed at Pacific Northwest National Laboratory (PNNL) for Washington River Protection Solutions (WRPS) to characterize several properties of the long- term leached Cast Stone monolith samples.« less

  18. Timing considerations of Helmet Mounted Display performance

    NASA Technical Reports Server (NTRS)

    Tharp, Gregory; Liu, Andrew; French, Lloyd; Lai, Steve; Stark, Lawrence

    1992-01-01

    The Helmet Mounted Display (HMD) system developed in our lab should be a useful teleoperator systems display if it increases operator performance of the desired task; it can, however, introduce degradation in performance due to display update rate constraints and communication delays. Display update rates are slowed by communication bandwidth and/or computational power limitations. We used simulated 3D tracking and pick-and-place tasks to characterize performance levels for a range of update rates. Initial experiments with 3D tracking indicate that performance levels plateau at an update rate between 10 and 20 Hz. We have found that using the HMD with delay decreases performance as delay increases.

  19. Positive Affect and the Complex Dynamics of Human Flourishing

    ERIC Educational Resources Information Center

    Fredrickson, Barbara L.; Losada, Marcial F.

    2005-01-01

    Extending B. L. Fredrickson's (1998) broaden-and-build theory of positive emotions and M. Losada's (1999) nonlinear dynamics model of team performance, the authors predict that a ratio of positive to negative affect at or above 2.9 will characterize individuals in flourishing mental health. Participants (N=188) completed an initial survey to…

  20. Comparing Three Models of Achievement Goals: Goal Orientations, Goal Standards, and Goal Complexes

    ERIC Educational Resources Information Center

    Senko, Corwin; Tropiano, Katie L.

    2016-01-01

    Achievement goal theory (Dweck, 1986) initially characterized mastery goals and performance goals as opposites in a good-bad dualism of student motivation. A later revision (Harackiewicz, Barron, & Elliot, 1998) contended that both goals can provide benefits and be pursued together. Perhaps both frameworks are correct: Their contrasting views…

  1. Characterization of a piezoelectric MEMS actuator surface toward motion-enabled reconfigurable RF circuits

    NASA Astrophysics Data System (ADS)

    Tellers, M. C.; Pulskamp, J. S.; Bedair, S. S.; Rudy, R. Q.; Kierzewski, I. M.; Polcawich, R. G.; Bergbreiter, S. E.

    2018-03-01

    As an alternative to highly constrained hard-wired reconfigurable RF circuits, a motion-enabled reconfigurable circuit (MERC) offers freedom from transmission line losses and homogeneous materials selection. The creation of a successful MERC requires a precise mechanical mechanism for relocating components. In this work, a piezoelectric MEMS actuator array is modeled and experimentally characterized to assess its viability as a solution to the MERC concept. Actuation and design parameters are evaluated, and the repeatability of high quality on-axis motion at greater than 1 mm s-1 is demonstrated with little positional error. Finally, an initial proof-of-concept circuit reconfiguration has been demonstrated using off-the-shelf RF filter components. Although initial feasibility tests show filter performance degradation with an additional insertion loss of 0.3 dB per contact, out-of-band rejection degradation as high as 10 dB, and ripple performance reduction from 0.25 dB to 1.5 dB, MERC is proven here as an alternative to traditional approaches used in reconfigurable RF circuit applications.

  2. Graft Polymerization of Acrylic Acid on a Polytetrafluoroethylene Panel by an Inductively Coupled Plasma

    NASA Astrophysics Data System (ADS)

    Lan, Yan; You, Qingliang; Cheng, Cheng; Zhang, Suzhen; Ni, Guohua; Nagatsu, M.; Meng, Yuedong

    2011-02-01

    Surface modification on a polytetrafluoroethylene (PTFE) panel was performed with sequential nitrogen plasma treatments and surface-initiated polymerization. By introducing COO- groups to the surface of the PTFE panel through grafting polymerization of acrylic acid (AA), a transparent poly (acrylic acid) (PAA) membrane was achieved from acrylic acid solution. Grafting polymerization initiating from the active groups was achieved on the PTFE panel surface after the nitrogen plasma treatment. Utilizing the acrylic acid as monomers, with COO- groups as cross link sites to form reticulation structure, a transparent poly (acrylic acid) membrane with arborescent macromolecular structure was formed on the PTFE panel surface. Analysis methods, such as fourier transform infrared spectroscopy (FTIR), microscopy and X-ray photoelectron spectroscopy (XPS), were utilized to characterize the structures of the macromolecule membrane on the PTFE panel surface. A contact angle measurement was performed to characterize the modified PTFE panels. The surface hydrophilicities of modified PTFE panels were significantly enhanced after the plasma treatment. It was shown that the grafting rate is related to the treating time and the power of plasma.

  3. Solar Total Energy Project (STEP) Performance Analysis of High Temperature Energy Storage Subsystem

    NASA Technical Reports Server (NTRS)

    Moore, D. M.

    1984-01-01

    The 1982 milestones and lessons learned; performance in 1983; a typical day's operation; collector field performance and thermal losses; and formal testing are highlighted. An initial test that involves characterizing the high temperature storage (hts) subsystem is emphasized. The primary element is on 11,000 gallon storage tank that provides energy to the steam generator during transient solar conditions or extends operating time. Overnight, thermal losses were analyzed. The length of time the system is operated at various levels of cogeneration using stored energy is reviewed.

  4. An asymptotically exact reduced PDE model for the magnetorotational instability: derivation and numerical simulations

    NASA Astrophysics Data System (ADS)

    Jamroz, Ben; Julien, Keith; Knobloch, Edgar

    2008-12-01

    Taking advantage of disparate spatio-temporal scales relevant to astrophysics and laboratory experiments, we derive asymptotically exact reduced partial differential equation models for the magnetorotational instability. These models extend recent single-mode formulations leading to saturation in the presence of weak dissipation, and are characterized by a back-reaction on the imposed shear. Numerical simulations performed for a broad class of initial conditions indicate an initial phase of growth dominated by the optimal (fastest growing) magnetorotational instability fingering mode, followed by a vertical coarsening to a box-filling mode.

  5. Trellis phase codes for power-bandwith efficient satellite communications

    NASA Technical Reports Server (NTRS)

    Wilson, S. G.; Highfill, J. H.; Hsu, C. D.; Harkness, R.

    1981-01-01

    Support work on improved power and spectrum utilization on digital satellite channels was performed. Specific attention is given to the class of signalling schemes known as continuous phase modulation (CPM). The specific work described in this report addresses: analytical bounds on error probability for multi-h phase codes, power and bandwidth characterization of 4-ary multi-h codes, and initial results of channel simulation to assess the impact of band limiting filters and nonlinear amplifiers on CPM performance.

  6. Optical Characterization of Pulse Laser Deposition of Thin Films of Hard Materials Using RHEED and AFM Techniques

    DTIC Science & Technology

    2011-12-20

    diamond thin-film generation. PLD is initiated by laser ablation, which is essentially evaporation of a material by a high - powered laser. Subsequently...COVERED (From - To) 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) 5d...PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION

  7. Qualification of Laser Diode Arrays for Mercury Laser Altimeter

    NASA Technical Reports Server (NTRS)

    Stephen, Mark; Vasilyev, Aleksey; Schafer, John; Allan, Graham R.

    2004-01-01

    NASA's requirements for high reliability, high performance satellite laser instruments have driven the investigation of many critical components; specifically, 808 nm laser diode array (LDA) pump devices. Performance of Quasi-CW, High-power, laser diode arrays under extended use is presented. We report the optical power over several hundred million pulse operation and the effect of power cycling and temperature cycling of the laser diode arrays. Data on the initial characterization of the devices is also presented.

  8. Discrete analysis of spatial-sensitivity models

    NASA Technical Reports Server (NTRS)

    Nielsen, Kenneth R. K.; Wandell, Brian A.

    1988-01-01

    Procedures for reducing the computational burden of current models of spatial vision are described, the simplifications being consistent with the prediction of the complete model. A method for using pattern-sensitivity measurements to estimate the initial linear transformation is also proposed which is based on the assumption that detection performance is monotonic with the vector length of the sensor responses. It is shown how contrast-threshold data can be used to estimate the linear transformation needed to characterize threshold performance.

  9. Detonator Performance Characterization using Multi-Frame Laser Schlieren Imaging

    NASA Astrophysics Data System (ADS)

    Clarke, Steven; Landon, Colin; Murphy, Michael; Martinez, Michael; Mason, Thomas; Thomas, Keith

    2009-06-01

    Multi-frame Laser Schlieren Imaging of shock waves produced by detonators in transparent witness materials can be used to evaluate detonator performance. We use inverse calculations of the 2D propagation of shock waves in the EPIC finite element model computer code to calculate a temporal-spatial-pressure profile on the surface of the detonator that is consistent with the experimental shock waves from the schlieren imaging. Examples of calculated 2D temporal-spatial-pressure profiles from a range of detonator types (EFI --exploding foil initiators, DOI -- direct optical initiation, EBW -- exploding bridge wire, hotwire), detonator HE materials (PETN, HMX, etc), and HE densities. Also pressure interaction profiles from the interaction of multiple shock waves will be shown. LA-UR-09-00909.

  10. Initial characterization of an Experimental Referee Broadened-Specification (ERBS) aviation turbine fuel

    NASA Technical Reports Server (NTRS)

    Prok, G. M.; Seng, G. T.

    1980-01-01

    Characterization data and a hydrocarbon compositional analysis are presented for a research test fuel designated as an experimental referee broadened-specification aviation turbine fuel. This research fuel, which is a special blend of kerosene and hydrotreated catalytic gas oil, is a hypothetical representation of a future fuel should it become necessary to broaden current kerojet specifications. It is used as a reference fuel in research investigations into the effects of fuel property variations on the performance and durability of jet aircraft components, including combustors and fuel systems.

  11. mre11S—a yeast mutation that blocks double-strand-break processing and permits nonhomologous synapsis in meiosis

    PubMed Central

    Nairz, Knud; Klein, Franz

    1997-01-01

    During meiotic prophase the repair of self-inflicted DNA double-strand break (DSB) damage leads to meiotic recombination in yeast. We employed a genetic screen to specifically characterize cellular functions that become essential after this DSB formation. As a result a new allele of MRE11, termed mre11S (for Separation of functions) was isolated that allows initiation but not processing and repair of meiotic DSBs similar to the well-characterized rad50S allele. In contrast, the mre11-1 allele blocks initiation of meiotic DSBs as reported previously by others. The mre11S allele, which is mutated in the 5′ part of the gene, can partially complement mre11 alleles disrupted close to the 3′ end that cannot initiate DSBs when homozygous. This suggests homodimerization of the Mre11 protein and the presence of separate domains for DSB initiation and 5′ resection. The fact that two genes, RAD50 and MRE11, required for DSB processing are also essential for DSB initiation dictates a model in which a bifunctional initiation/repair complex is required to initiate meiotic recombination. A subset of mre11S nuclei was shown to perform extensive but partially nonhomologous synapsis. We propose that the unprocessed DSBs present in mre11S allow for synapsis, but that homologous synapsis is only ensured at a later stage of recombination. PMID:9303542

  12. 40 CFR 280.63 - Initial site characterization.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Initial site characterization. 280.63... Hazardous Substances § 280.63 Initial site characterization. (a) Unless directed to do otherwise by the implementing agency, owners and operators must assemble information about the site and the nature of the...

  13. Next generation control system for reflexive aerostructures

    NASA Astrophysics Data System (ADS)

    Maddux, Michael R.; Meents, Elizabeth P.; Barnell, Thomas J.; Cable, Kristin M.; Hemmelgarn, Christopher; Margraf, Thomas W.; Havens, Ernie

    2010-04-01

    Cornerstone Research Group Inc. (CRG) has developed and demonstrated a composite structural solution called reflexive composites for aerospace applications featuring CRG's healable shape memory polymer (SMP) matrix. In reflexive composites, an integrated structural health monitoring (SHM) system autonomously monitors the structural health of composite aerospace structures, while integrated intelligent controls monitor data from the SHM system to characterize damage and initiate healing when damage is detected. Development of next generation intelligent controls for reflexive composites were initiated for the purpose of integrating prognostic health monitoring capabilities into the reflexive composite structural solution. Initial efforts involved data generation through physical inspections and mechanical testing. Compression after impact (CAI) testing was conducted on composite-reinforced shape memory polymer samples to induce damage and investigate the effectiveness of matrix healing on mechanical performance. Non-destructive evaluation (NDE) techniques were employed to observe and characterize material damage. Restoration of mechanical performance was demonstrated through healing, while NDE data showed location and size of damage and verified mitigation of damage post-healing. Data generated was used in the development of next generation reflexive controls software. Data output from the intelligent controls could serve as input to Integrated Vehicle Health Management (IVHM) systems and Integrated Resilient Aircraft Controls (IRAC). Reflexive composite technology has the ability to reduce maintenance required on composite structures through healing, offering potential to significantly extend service life of aerospace vehicles and reduce operating and lifecycle costs.

  14. CALiPER Report 23: Photometric Testing of White Tunable LED Luminaires

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None, None

    2016-01-01

    This report documents an initial investigation of photometric testing procedures for white-tunable LED luminaires and summarizes the key features of those products. Goals of the study include understanding the amount of testing required to characterize a white-tunable product, and documenting the performance of available color-tunable luminaires that are intended for architectural lighting.

  15. Tailoring Anisotropic Li-Ion Transport Tunnels on Orthogonally Arranged Li-Rich Layered Oxide Nanoplates Toward High-Performance Li-Ion Batteries.

    PubMed

    Xu, Ming; Fei, Linfeng; Zhang, Weibing; Li, Tao; Lu, Wei; Zhang, Nian; Lai, Yanqing; Zhang, Zhian; Fang, Jing; Zhang, Kai; Li, Jie; Huang, Haitao

    2017-03-08

    High-performance Li-rich layered oxide (LRLO) cathode material is appealing for next-generation Li-ion batteries owing to its high specific capacity (>300 mAh g -1 ). Despite intense studies in the past decade, the low initial Coulombic efficiency and unsatisfactory cycling stability of LRLO still remain as great challenges for its practical applications. Here, we report a rational design of the orthogonally arranged {010}-oriented LRLO nanoplates with built-in anisotropic Li + ion transport tunnels. Such a novel structure enables fast Li + ion intercalation and deintercalation kinetics and enhances structural stability of LRLO. Theoretical calculations and experimental characterizations demonstrate the successful synthesis of target cathode material that delivers an initial discharge capacity as high as 303 mAh g -1 with an initial Coulombic efficiency of 93%. After 200 cycles at 1.0 C rate, an excellent capacity retention of 92% can be attained. Our method reported here opens a door to the development of high-performance Ni-Co-Mn-based cathode materials for high-energy density Li-ion batteries.

  16. A Thermal Precipitator for Fire Characterization Research

    NASA Technical Reports Server (NTRS)

    Meyer, Marit; Bryg, Vicky

    2008-01-01

    Characterization of the smoke from pyrolysis of common spacecraft materials provides insight for the design of future smoke detectors and post-fire clean-up equipment on the International Space Station. A thermal precipitator was designed to collect smoke aerosol particles for microscopic analysis in fire characterization research. Information on particle morphology, size and agglomerate structure obtained from these tests supplements additional aerosol data collected. Initial modeling for the thermal precipitator design was performed with the finite element software COMSOL Multiphysics, and includes the flow field and heat transfer in the device. The COMSOL Particle Tracing Module was used to determine particle deposition on SEM stubs which include TEM grids. Modeling provided optimized design parameters such as geometry, flow rate and temperatures. Microscopy results from fire characterization research using the thermal precipitator are presented.

  17. Performance improvement of planar dielectric elastomer actuators by magnetic modulating mechanism

    NASA Astrophysics Data System (ADS)

    Zhao, Yun-Hua; Li, Wen-Bo; Zhang, Wen-Ming; Yan, Han; Peng, Zhi-Ke; Meng, Guang

    2018-06-01

    In this paper, a novel planar dielectric elastomer actuator (DEA) with magnetic modulating mechanism is proposed. This design can provide the availability of wider actuation range and larger output force, which are significant indicators to evaluate the performance of DEAs. The DEA tends to be a compact and simple design, and an analytical model is developed to characterize the mechanical behavior. The result shows that the output force induced by the DEA can be improved by 76.90% under a certain applied voltage and initial magnet distance. Moreover, experiments are carried out to reveal the performance of the proposed DEA and validate the theoretical model. It demonstrates that the DEA using magnetic modulating mechanism can enlarge the actuation range and has more remarkable effect with decreasing initial magnet distance within the stable range. It can be useful to promote the applications of DEAs to soft robots and haptic feedback.

  18. Performance Evaluation of Phasor Measurement Systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Zhenyu; Kasztenny, Bogdan; Madani, Vahid

    2008-07-20

    After two decades of phasor network deployment, phasor measurements are now available at many major substations and power plants. The North American SynchroPhasor Initiative (NASPI), supported by both the US Department of Energy and the North American Electricity Reliability Council (NERC), provides a forum to facilitate the efforts in phasor technology in North America. Phasor applications have been explored and some are in today’s utility practice. IEEE C37.118 Standard is a milestone in standardizing phasor measurements and defining performance requirements. To comply with IEEE C37.118 and to better understand the impact of phasor quality on applications, the NASPI Performance andmore » Standards Task Team (PSTT) initiated and accomplished the development of two important documents to address characterization of PMUs and instrumentation channels, which leverage prior work (esp. in WECC) and international experience. This paper summarizes the accomplished PSTT work and presents the methods for phasor measurement evaluation.« less

  19. Avalanche diodes for the generation of coherent radiation

    NASA Technical Reports Server (NTRS)

    Penfield, P., Jr.

    1973-01-01

    Solid state devices and characterization, and optimum imbedding networks for realizing best performance were investigated along with a barrier injection transit time diode. These diodes were investigated for possible application as microwave amplifiers and oscillators. Measurements were made of diode noise figures in the frequency ranges of 4 - 6 GHz. Initial results indicate that a noise figure of 6 - 8 db may be possible. Optimum device structure and fabrication techniques necessary for low noise performance were investigated. Previously published documents on electrodynamics are included.

  20. New Redox Polymers that Exhibit Reversible Cleavage of Sulfur Bonds as Cathode Materials.

    PubMed

    Baloch, Marya; Ben Youcef, Hicham; Li, Chunmei; Garcia-Calvo, Oihane; Rodriguez, Lide M; Shanmukaraj, Devaraj; Rojo, Teofilo; Armand, Michel

    2016-11-23

    Two new cathode materials based on redox organosulfur polymers were synthesized and investigated for rechargeable lithium batteries as a proof-of-concept study. These cathodes offered good cycling performance owing to the absence of polysulfide solubility, which plagues Li/S systems. Herein, an aliphatic polyamine or a conjugated polyazomethine was used as the base to tether the redox-active species. The activity comes from the cleavage and formation of S-S or N-S bonds, which is made possible by the rigid conjugated backbone. The synthesized polymers were characterized through FTIR spectroscopy and thermogravimetric analysis (TGA). Galvanostatic measurements were performed to evaluate the discharge/charge cycles and characterize the performance of the lithium-based cells, which displayed initial discharge capacities of approximately 300 mA h g -1 at C/5 over 100 cycles with approximately 98 % Coulombic efficiency. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Shock Initiation Experiments with Ignition and Growth Modeling on the HMX-Based Explosive LX-14

    NASA Astrophysics Data System (ADS)

    Vandersall, Kevin S.; Dehaven, Martin R.; Strickland, Shawn L.; Tarver, Craig M.; Springer, H. Keo; Cowan, Matt R.

    2017-06-01

    Shock initiation experiments on the HMX-based explosive LX-14 were performed to obtain in-situ pressure gauge data, characterize the run-distance-to-detonation behavior, and provide a basis for Ignition and Growth reactive flow modeling. A 101 mm diameter gas gun was utilized to initiate the explosive charges with manganin piezoresistive pressure gauge packages placed between sample disks pressed to different densities ( 1.57 or 1.83 g/cm3 that corresponds to 85 or 99% of theoretical maximum density (TMD), respectively). The shock sensitivity was found to increase with decreasing density as expected. Ignition and Growth model parameters were derived that yielded reasonable agreement with the experimental data at both initial densities. The shock sensitivity at the tested densities will be compared to prior work published on other HMX-based formulations. This work performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344. This work was funded in part by the Joint DoD-DOE Munitions Program.

  2. Interpreting the Need for Initial Support to Perform Tandem Stance Tests of Balance

    PubMed Central

    Brach, Jennifer S.; Perera, Subashan; Wert, David M.; VanSwearingen, Jessie M.; Studenski, Stephanie A.

    2012-01-01

    Background Geriatric rehabilitation reimbursement increasingly requires documented deficits on standardized measures. Tandem stance performance can characterize balance, but protocols are not standardized. Objective The purpose of this study was to explore the impact of: (1) initial support to stabilize in position and (2) maximum hold time on tandem stance tests of balance in older adults. Design A cross-sectional secondary analysis of observational cohort data was conducted. Methods One hundred seventeen community-dwelling older adults (71% female, 12% black) were assigned to 1 of 3 groups based on the need for initial support to perform tandem stance: (1) unable even with support, (2) able only with support, and (3) able without support. The able without support group was further stratified on hold time in seconds: (1) <10 (low), (2) 10 to 29, (medium), and (3) 30 (high). Groups were compared on primary outcomes (gait speed, Timed “Up & Go” Test performance, and balance confidence) using analysis of variance. Results Twelve participants were unable to perform tandem stance, 14 performed tandem stance only with support, and 91 performed tandem stance without support. Compared with the able without support group, the able with support group had statistically or clinically worse performance and balance confidence. No significant differences were found between the able with support group and the unable even with support group on these same measures. Extending the hold time to 30 seconds in a protocol without initial support eliminated ceiling effects for 16% of the study sample. Limitations Small comparison groups, use of a secondary analysis, and lack of generalizability of results were limitations of the study. Conclusions Requiring initial support to stabilize in tandem stance appears to reflect meaningful deficits in balance-related mobility measures, so failing to consider support may inflate balance estimates and confound hold time comparisons. Additionally, 10-second maximum hold times limit discrimination of balance in adults with a higher level of function. For community-dwelling older adults, we recommend timing for at least 30 seconds and documenting initial support for consideration when interpreting performance. PMID:22745198

  3. Pre-conceptual Development and characterization of an extruded graphite composite fuel for the TREAT Reactor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luther, Erik; Rooyen, Isabella van; Leckie, Rafael

    2015-03-01

    In an effort to explore fuel systems that are more robust under accident scenarios, the DOE-NE has identified the need to resume transient testing. The Transient Reactor Test (TREAT) facility has been identified as the preferred option for the resumption of transient testing of nuclear fuel in the United States. In parallel, NNSA’s Global Threat Reduction Initiative (GTRI) Convert program is exploring the needs to replace the existing highly enriched uranium (HEU) core with low enriched uranium (LEU) core. In order to construct a new LEU core, materials and fabrication processes similar to those used in the initial core fabricationmore » must be identified, developed and characterized. In this research, graphite matrix fuel blocks were extruded and materials properties of were measured. Initially the extrusion process followed the historic route; however, the project was expanded to explore methods to increase the graphite content of the fuel blocks and explore modern resins. Materials properties relevant to fuel performance including density, heat capacity and thermal diffusivity were measured. The relationship between process defects and materials properties will be discussed.« less

  4. Improved silicon carbide for advanced heat engines

    NASA Technical Reports Server (NTRS)

    Whalen, Thomas J.; Mangels, J. A.

    1986-01-01

    The development of silicon carbide materials of high strength was initiated and components of complex shape and high reliability were formed. The approach was to adapt a beta-SiC powder and binder system to the injection molding process and to develop procedures and process parameters capable of providing a sintered silicon carbide material with improved properties. The initial effort was to characterize the baseline precursor materials, develop mixing and injection molding procedures for fabricating test bars, and characterize the properties of the sintered materials. Parallel studies of various mixing, dewaxing, and sintering procedures were performed in order to distinguish process routes for improving material properties. A total of 276 modulus-of-rupture (MOR) bars of the baseline material was molded, and 122 bars were fully processed to a sinter density of approximately 95 percent. Fluid mixing techniques were developed which significantly reduced flaw size and improved the strength of the material. Initial MOR tests indicated that strength of the fluid-mixed material exceeds the baseline property by more than 33 percent. the baseline property by more than 33 percent.

  5. Experimental Evaluation of Fatigue Crack Initiation from Corroded Hemispherical Notches in Aerospace Structural Materials

    NASA Technical Reports Server (NTRS)

    Garcia, Daniel B.; Forman, Royce; Shindo, David

    2010-01-01

    A test program was developed and executed to evaluate the influence of corroded hemispherical notches on the fatigue crack initiation and propagation in aluminum 7075-T7351, 4340 steel, and D6AC steel. Surface enhancements such as shot peening and laser shock peening were also incorporated as part of the test effort with the intent of improving fatigue performance. In addition to the testing, fracture mechanics and endurance limit based analysis methods were evaluated to characterize the results with the objective of challenging typical assumptions used in modeling fatigue cracks from corrosion pits. The results specifically demonstrate that the aluminum and steel alloys behave differently with respect to fatigue crack initiation from hemispherical corrosion pits. The aluminum test results were bounded by the fracture mechanics and endurance limit models while exhibiting a general insensitivity to the residual stress field generated by shot peening. The steel specimens were better characterized by the endurance limit fatigue properties and did exhibit sensitivities to residual stresses from the shot peening and laser shock peening

  6. Initial Characterization of Optical Communications with Disruption-Tolerant Network Protocols

    NASA Technical Reports Server (NTRS)

    Schoolcraft, Joshua; Wilson, Keith

    2011-01-01

    Disruption-tolerant networks (DTNs) are groups of network assets connected with a suite of communication protocol technologies designed to mitigate the effects of link delay and disruption. Application of DTN protocols to diverse groups of network resources in multiple sub-networks results in an overlay network-of-networks with autonomous data routing capability. In space environments where delay or disruption is expected, performance of this type of architecture (such as an interplanetary internet) can increase with the inclusion of new communications mediums and techniques. Space-based optical communication links are therefore an excellent building block of space DTN architectures. When compared to traditional radio frequency (RF) communications, optical systems can provide extremely power-efficient and high bandwidth links bridging sub-networks. Because optical links are more susceptible to link disruption and experience the same light-speed delays as RF, optical-enabled DTN architectures can lessen potential drawbacks and maintain the benefits of autonomous optical communications over deep space distances. These environment-driven expectations - link delay and interruption, along with asymmetric data rates - are the purpose of the proof-of-concept experiment outlined herein. In recognizing the potential of these two technologies, we report an initial experiment and characterization of the performance of a DTN-enabled space optical link. The experiment design employs a point-to-point free-space optical link configured to have asymmetric bandwidth. This link connects two networked systems running a DTN protocol implementation designed and written at JPL for use on spacecraft, and further configured for higher bandwidth performance. Comparing baseline data transmission metrics with and without periodic optical link interruptions, the experiment confirmed the DTN protocols' ability to handle real-world unexpected link outages while maintaining capability of reliably delivering data at relatively high rates. Finally, performance characterizations from this data suggest performance optimizations to configuration and protocols for future optical-specific DTN space link scenarios.

  7. Preparation and Characterization of Fine-Particle NTO and Its Formulation with Al Nanopowders

    NASA Astrophysics Data System (ADS)

    Lee, K.-Y.; Kennedy, J. E.; Asay, B. W.; Son, S. F.; Martin, E. S.

    2004-07-01

    We have initiated study of the effect of nano-aluminum on the detonation performance of NTO. A novel method for the preparation of both fine-particle NTO (UF-NTO) and its formulation with Al nanopowder has been developed. Results from small-scale sensitivity tests on both the UF-NTO and aluminized NTO composite indicated that they are insensitive to impact, friction and HESD. The performance of both UF-NTO and NTO/Al mix was evaluated by detonation-spreading floret tests. At the same pressed density, it was found that, when initiated by a 3-mm-diameter flyer plate, the aluminized NTO composite produced a shallower dent on a copper witness plate than neat UF-NTO and thus was inferior to UF-NTO in detonation spreading.

  8. Characterizing caged molecules through flash photolysis and transient absorption spectroscopy.

    PubMed

    Kao, Joseph P Y; Muralidharan, Sukumaran

    2013-01-01

    Caged molecules are photosensitive molecules with latent biological activity. Upon exposure to light, they are rapidly transformed into bioactive molecules such as neurotransmitters or second messengers. They are thus valuable tools for using light to manipulate biology with exceptional spatial and temporal resolution. Since the temporal performance of the caged molecule depends critically on the rate at which bioactive molecules are generated by light, it is important to characterize the kinetics of the photorelease process. This is accomplished by initiating the photoreaction with a very brief but intense pulse of light (i.e., flash photolysis) and monitoring the course of the ensuing reactions through various means, the most common of which is absorption spectroscopy. Practical guidelines for performing flash photolysis and transient absorption spectroscopy are described in this chapter.

  9. Characterization of Qatar's surface carbonates for CO2 capture and thermochemical energy storage

    NASA Astrophysics Data System (ADS)

    Kakosimos, Konstantinos E.; Al-Haddad, Ghadeer; Sakellariou, Kyriaki G.; Pagkoura, Chrysa; Konstandopoulos, Athanasios G.

    2017-06-01

    Samples of surface carbonates were collected from three different areas of the Qatar peninsula. We employed material characterization techniques to examine the morphology and composition of the samples, while their CO2 capture capacity was assessed via multiple successive calcination-carbonation cycles. Our samples were mainly calcite and dolomite based. Calcite samples showed higher initial capacity of around 11 mmol CO2 g-1 which decayed rapidly to less than 2 mmol CO2 g-1. On the other hand, dolomite samples showed an excellent stability (˜15 cycles) with a capacity of 6 mmol CO2 g-1. The performance of the dolomite samples is better compared to other similar natural samples, from literature. A promising result for future studies towards improving their performance by physical and chemical modification.

  10. Design, fabrication and testing of an optical temperature sensor

    NASA Technical Reports Server (NTRS)

    Morey, W. W.; Glenn, W. H.; Decker, R. O.; Mcclurg, W. C.

    1980-01-01

    The laboratory breadboard optical temperature sensor based on the temperature dependent absorptive characteristics of a rare earth (europium) doped optical fiber. The principles of operation, materials characterization, fiber and optical component design, design and fabrication of an electrooptic interface unit, signal processing, and initial test results are discussed. Initial tests indicated that, after a brief warmup period, the output of the sensor was stable to approximately 1 C at room temperature or approximately + or - 0.3 percent of point (K). This exceeds the goal of 1 percent of point. Recommendations are presented for further performance improvement.

  11. Chemical characterization of some aerobic liquids in CELSS

    NASA Technical Reports Server (NTRS)

    Madsen, Brooks C.

    1993-01-01

    Untreated aqueous soybean and wheat leachate and aerobically treated wheat leachate prepared from crop residues that are produced as a component of the Controlled Ecological Life Support System program designed to support long duration space missions were compared, and a general chemical characterization was accomplished. Solid phase extraction and high performance liquid chromatography were used to accomplish comparisons based on chromatographic and ultraviolet absorption properties of the components that are present. Specific compounds were not identified; however, general composition related to the initial presence of phenol-like compounds and their disappearance during aerobic treatment was explored.

  12. EOS Aura MLS, first year post-launch engineering assessment

    NASA Technical Reports Server (NTRS)

    Lee, Karen A.; Lay, Richard R.; Jarnot, Robert F.; Cofield, Richard E.; Flower, Dennis A.; Pickett, Herbert M.

    2005-01-01

    This paper discusses the current status of the MLS instrument which now continuously provides data to produce global maps of targeted chemical species as well as temperature, cloud ice, and gravity wave activity. Performance trends are assessed with respect to characterization during initial on-orbit activiation of the instrument, and with data from ground test verification prior to launch.

  13. Improved electrochemical properties of a coin cell using LiMn 1.5Ni 0.5O 4 as cathode in the 5 V range

    NASA Astrophysics Data System (ADS)

    Singhal, Rahul; Das, Suprem R.; Oviedo, Osbert; Tomar, Maharaj S.; Katiyar, Ram S.

    Phase pure LiMn 1.5Ni 0.5O 4 powders were synthesized by a chemical synthesis route and were subsequently characterized as cathode materials in a Li-ion coin cell comprising a Li anode and lithium hexafluorophosphate (LiPF 6), dissolved in dimethyl carbonate (DMC) + ethylene carbonate (EC) [1:1, v/v ratio] as electrolyte. The spinel structure and phase purity of the powders were characterized using X-ray diffraction and micro-Raman spectroscopy. The presence of both oxidation and reduction peaks in the cyclic voltammogram revealed Li + extraction and insertion from the spinel structure. The charge-discharge characteristics of the coin cell were performed in the 3.0-4.8 V range. An initial discharge capacity of ∼140 mAh g -1 was obtained with 94% initial discharge capacity retention after 50 repeated cycles. The microstructures and compositions of the cathode before and after electrochemistry were investigated using scanning electron microscopy and energy-dispersive analysis by X-ray analysis, respectively. Using X-ray diffraction, Raman spectroscopy and electrochemical analysis, we correlated the structural stability and the electrochemical performance of this cathode.

  14. Characterization of Fatigue Damage for Bonded Composite Skin/Stringer Configurations

    NASA Technical Reports Server (NTRS)

    Paris, Isabelle; Cvitkovich, Michael; Krueger, Ronald

    2008-01-01

    The fatigue damage was characterized in specimens which consisted of a tapered composite flange bonded onto a composite skin. Quasi-static tension tests were performed first to determine the failure load. Subsequently, tension fatigue tests were performed at 40%, 50%, 60% and 70% of the failure load to evaluate the debonding mechanisms. For four specimens, the cycling loading was stopped at intervals. Photographs of the polished specimen edges were taken under a light microscope to document the damage. At two diagonally opposite corners of the flange, a delamination appeared to initiate at the flange tip from a matrix crack in the top 45deg skin ply and propagated at the top 45deg/-45deg skin ply interface. At the other two diagonally opposite corners, a delamination running in the bondline initiated from a matrix crack in the adhesive pocket. In addition, two specimens were cut longitudinally into several sections. Micrographs revealed a more complex pattern inside the specimen where the two delamination patterns observed at the edges are present simultaneously across most of the width of the specimen. The observations suggest that a more sophisticated nondestructive evaluation technique is required to capture the complex damage pattern of matrix cracking and multi-level delaminations.

  15. Transiting Exoplanet Studies and Community Targets for JWST's Early Release Science Program

    NASA Technical Reports Server (NTRS)

    Stevenson, Kevin B.; Lewis, Nikole K.; Bean, Jacob L.; Beichman, Charles A.; Fraine, Jonathan; Kilpatrick, Brian M.; Krick, J. E.; Lothringer, Joshua D.; Mandell, Avi M.; Valenti, Jeff A.; hide

    2016-01-01

    The James Webb Space Telescope (JWST) will likely revolutionize transiting exoplanet atmospheric science, due to a combination of its capability for continuous, long duration observations and its larger collecting area, spectral coverage, and spectral resolution compared to existing space-based facilities. However, it is unclear precisely how well JWST will perform and which of its myriad instruments and observing modes will be best suited for transiting exoplanet studies. In this article, we describe a prefatory JWST Early Release Science (ERS) Cycle 1 program that focuses on testing specific observing modes to quickly give the community the data and experience it needs to plan more efficient and successful transiting exoplanet characterization programs in later cycles. We propose a multi-pronged approach wherein one aspect of the program focuses on observing transits of a single target with all of the recommended observing modes to identify and understand potential systematics, compare transmission spectra at overlapping and neighboring wavelength regions, confirm throughputs, and determine overall performances. In our search for transiting exoplanets that are well suited to achieving these goals, we identify 12 objects (dubbed community targets'') that meet our defined criteria. Currently, the most favorable target is WASP-62b because of its large predicted signal size, relatively bright host star, and location in JWST's continuous viewing zone. Since most of the community targets do not have well-characterized atmospheres, we recommend initiating preparatory observing programs to determine the presence of obscuring clouds/hazes within their atmospheres. Measurable spectroscopic features are needed to establish the optimal resolution and wavelength regions for exoplanet characterization. Other initiatives from our proposed ERS program include testing the instrument brightness limits and performing phase-curve observations. The latter are a unique challenge compared to transit observations because of their significantly longer durations. Using only a single mode, we propose to observe a full-orbit phase curve of one of the previously characterized, short-orbital-period planets to evaluate the facility-level aspects of long, uninterrupted time-series observations.

  16. Transiting Exoplanet Studies and Community Targets for JWST's Early Release Science Program

    NASA Technical Reports Server (NTRS)

    Stevenson, Kevin B.; Lewis, Nikole K.; Bean, Jacob L.; Beichman, Charles; Fraine, Jonathan; Kilpatrick, Brian M.; Krick, J. E.; Lothringer, Joshua D.; Mandell, Avi M.; Valenti, Jeff A.; hide

    2016-01-01

    The James Webb Space Telescope (JWST) will likely revolutionize transiting exoplanet atmospheric science, due to a combination of its capability for continuous, long duration observations and its larger collecting area, spectral coverage, and spectral resolution compared to existing space-based facilities. However, it is unclear precisely how well JWST will perform and which of its myriad instruments and observing modes will be best suited for transiting exoplanet studies. In this article, we describe a prefatory JWST Early Release Science (ERS) Cycle1 program that focuses on testing specific observing modes to quickly give the community the data and experience it needs to plan more efficient and successful transiting exoplanet characterization programs in later cycles. We propose a multi-pronged approach wherein one aspect of the program focuses on observing transits of a single target with all of the recommended observing modes to identify and understand potential systematics, compare transmission spectra at overlapping and neighboring wavelength regions, confirm throughputs, and determine overall performances. In our search for transiting exoplanets that are well suited to achieving these goals, we identify 12 objects (dubbed community targets) that meet our defined criteria. Currently, the most favorable target is WASP-62b because of its large predicted signal size, relatively bright host star, and location in JWSTs continuous viewing zone. Since most of the community targets do not have well-characterized atmospheres, we recommend initiating preparatory observing programs to determine the presence of obscuring cloudshazes within their atmospheres. Measurable spectroscopic features are needed to establish the optimal resolution and wavelength regions for exoplanet characterization. Other initiatives from our proposed ERS program include testing the instrument brightness limits and performing phase-curve observations. The latter are a unique challenge compared to transit observations because of their significantly longer durations. Using only a single mode, we propose to observe a full-orbit phase curve of one of the previously characterized, short-orbital-period planets to evaluate the facility-level aspects of long, uninterrupted time-series observations.

  17. Transiting Exoplanet Studies and Community Targets for JWST's Early Release Science Program

    NASA Astrophysics Data System (ADS)

    Stevenson, Kevin B.; Lewis, Nikole K.; Bean, Jacob L.; Beichman, Charles; Fraine, Jonathan; Kilpatrick, Brian M.; Krick, J. E.; Lothringer, Joshua D.; Mandell, Avi M.; Valenti, Jeff A.; Agol, Eric; Angerhausen, Daniel; Barstow, Joanna K.; Birkmann, Stephan M.; Burrows, Adam; Charbonneau, David; Cowan, Nicolas B.; Crouzet, Nicolas; Cubillos, Patricio E.; Curry, S. M.; Dalba, Paul A.; de Wit, Julien; Deming, Drake; Désert, Jean-Michel; Doyon, René; Dragomir, Diana; Ehrenreich, David; Fortney, Jonathan J.; García Muñoz, Antonio; Gibson, Neale P.; Gizis, John E.; Greene, Thomas P.; Harrington, Joseph; Heng, Kevin; Kataria, Tiffany; Kempton, Eliza M.-R.; Knutson, Heather; Kreidberg, Laura; Lafrenière, David; Lagage, Pierre-Olivier; Line, Michael R.; Lopez-Morales, Mercedes; Madhusudhan, Nikku; Morley, Caroline V.; Rocchetto, Marco; Schlawin, Everett; Shkolnik, Evgenya L.; Shporer, Avi; Sing, David K.; Todorov, Kamen O.; Tucker, Gregory S.; Wakeford, Hannah R.

    2016-09-01

    The James Webb Space Telescope (JWST) will likely revolutionize transiting exoplanet atmospheric science, due to a combination of its capability for continuous, long duration observations and its larger collecting area, spectral coverage, and spectral resolution compared to existing space-based facilities. However, it is unclear precisely how well JWST will perform and which of its myriad instruments and observing modes will be best suited for transiting exoplanet studies. In this article, we describe a prefatory JWST Early Release Science (ERS) Cycle 1 program that focuses on testing specific observing modes to quickly give the community the data and experience it needs to plan more efficient and successful transiting exoplanet characterization programs in later cycles. We propose a multi-pronged approach wherein one aspect of the program focuses on observing transits of a single target with all of the recommended observing modes to identify and understand potential systematics, compare transmission spectra at overlapping and neighboring wavelength regions, confirm throughputs, and determine overall performances. In our search for transiting exoplanets that are well suited to achieving these goals, we identify 12 objects (dubbed “community targets”) that meet our defined criteria. Currently, the most favorable target is WASP-62b because of its large predicted signal size, relatively bright host star, and location in JWST's continuous viewing zone. Since most of the community targets do not have well-characterized atmospheres, we recommend initiating preparatory observing programs to determine the presence of obscuring clouds/hazes within their atmospheres. Measurable spectroscopic features are needed to establish the optimal resolution and wavelength regions for exoplanet characterization. Other initiatives from our proposed ERS program include testing the instrument brightness limits and performing phase-curve observations. The latter are a unique challenge compared to transit observations because of their significantly longer durations. Using only a single mode, we propose to observe a full-orbit phase curve of one of the previously characterized, short-orbital-period planets to evaluate the facility-level aspects of long, uninterrupted time-series observations.

  18. ISDP salt batch #2 supernate qualification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peters, T. B.; Nash, C. A.; Fink, S. D.

    2009-01-05

    This report covers the laboratory testing and analyses of the second Integrated Salt Disposition Project (ISDP) salt supernate samples, performed in support of initial radioactive operations of Actinide Removal Process (ARP) and Modular Caustic-Side Solvent Extraction Unit (MCU). Major goals of this work include characterizing Tank 22H supernate, characterizing Tank 41H supernate, verifying actinide and strontium adsorption with a standard laboratory-scale test using monosodium titanate (MST) and filtration, and checking cesium mass transfer behavior for the MCU solvent performance when contacted with the liquid produced from MST contact. This study also includes characterization of a post-blend Tank 49H sample asmore » part of the Nuclear Criticality Safety Evaluation (NCSE). This work was specified by Task Technical Request and by Task Technical and Quality Assurance Plan (TTQAP). In addition, a sampling plan will be written to guide analytical future work. Safety and environmental aspects of the work were documented in a Hazard Assessment Package.« less

  19. CCS Activities Being Performed by the U.S. DOE

    PubMed Central

    Dressel, Brian; Deel, Dawn; Rodosta, Traci; Plasynski, Sean; Litynski, John; Myer, Larry

    2011-01-01

    The United States Department of Energy (DOE) is the lead federal agency for the development and deployment of carbon sequestration technologies. Its mission includes promoting scientific and technological innovations and transfer of knowledge for safe and permanent storage of CO2 in the subsurface. To accomplish its mission, DOE is characterizing and classifying potential geologic storage reservoirs in basins throughout the U.S. and Canada, and developing best practices for project developers, to help ensure the safety of future geologic storage projects. DOE’s Carbon Sequestration Program, Regional Carbon Sequestration Partnership (RCSP) Initiative, administered by the National Energy Technology Laboratory (NETL), is identifying, characterizing, and testing potential injection formations. The RCSP Initiative consists of collaborations among government, industry, universities, and international organizations. Through this collaborative effort, a series of integrated knowledge-based tools have been developed to help potential sequestration project developers. They are the Carbon Sequestration Atlas of the United States and Canada, National Carbon Sequestration Database and Geographic System (NATCARB), and best practice manuals for CCS including Depositional Reservoir Classification for CO2; Public Outreach and Education for Carbon Storage Projects; Monitoring, Verification, and Accounting of CO2 Stored in Deep Geologic Formation; Site Screening, Site Selection, and Initial Characterization of CO2 Storage in Deep Geologic Formations. DOE’s future research will help with refinement of these tools and additional best practice manuals (BPM) which focus on other technical aspects of project development. PMID:21556188

  20. End-of-Test Performance and Wear Characterization of NASA's Evolutionary Xenon Thruster (NEXT) Long-Duration Test

    NASA Technical Reports Server (NTRS)

    Shastry, Rohit; Herman, Daniel A.; Soulas, George C.; Patterson, Michael J.

    2014-01-01

    The NASA's Evolutionary Xenon Thruster (NEXT) program is developing the next-generation solar electric ion propulsion system with significant enhancements beyond the state-of-the-art NASA Solar Electric Propulsion Technology Application Readiness (NSTAR) ion propulsion system to provide future NASA science missions with enhanced capabilities. A Long-Duration Test (LDT) was initiated in June 2005 to validate the thruster service life modeling and to quantify the thruster propellant throughput capability. Testing was recently completed in February 2014, with the thruster accumulating 51,184 hours of operation, processing 918 kg of xenon propellant, and delivering 35.5 MN-s of total impulse.As part of the test termination procedure, a comprehensive performance characterization was performed across the entire NEXT throttle table. This was performed prior to planned repairs of numerous diagnostics that had become inoperable over the course of the test. After completion of these diagnostic repairs in November 2013, a comprehensive end-of-test performance and wear characterization was performed on the test article prior to exposure to atmosphere. These data have confirmed steady thruster performance with minimal degradation as well as mitigation of numerous life limiting mechanisms encountered in the NSTAR design. Component erosion rates compare favorably to pretest predictions based on semi-empirical models used for the thruster service life assessment. Additional data relating to ion beam density profiles, facility backsputter rates, facility backpressure effects on thruster telemetry, and modulation of the neutralizer keeper current are presented as part of the end-of-test characterization. Presently the test article for the NEXT LDT has been exposed to atmosphere and placed within a clean room environment, with post-test disassembly and inspection underway.

  1. Production and characterization of novel starch and poly(butylene adipate-co-terephthalate)-based materials and their applications

    NASA Astrophysics Data System (ADS)

    Stagner, Jacqueline Ann

    This work focuses on the production and characterization of blends of maleated thermoplastic starch (MTPS) and poly(butylenes adipate-co-terephthalate) and their application for use as thermoformed objects, films, and foams. First, by the production and characterization of maleated thermoplastic starch (MTPS) synthesized by reactive extrusion in a twin-screw extruder, a better understanding of MTPS was gained. This reactive thermoplastic starch was prepared with glycerol as the plasticizer, maleic anhydride (MA), and free-radical initiator, 2,5-bis(tert-butylperoxy)-2,5-dimethylhexane (Luperox 101). Dynamic light scattering (DLS), differential scanning calorimetry (DSC), Fourier transform infrared spectroscopy (FTIR), soxhlet extraction in acetone, and environmental scanning electron microscopy (ESEM) were performed to determine the effect of maleation, extrusion temperature, initiator concentration, and maleic anhydride concentration on the resulting MTPS. Next, maleated thermoplastic starch (MTPS) and thermoplastic starch (TPS) were reactively blended in a twin-screw extruder with a biodegradable polyester, poly(butylene adipate-co-terephthalate) (PBAT). The blends were extruded to produce thermoformable sheets. The mechanical properties of the sheets were characterized by tensile and puncture tests. Proof of grafting was determined by soxhlet extraction in dichloromethane and FTIR analysis. Observations of the thermal properties were made using DSC, while the surface of the sheets was imaged using ESEM. Blends of MTPS and PBAT were also extruded to produce films. Mechanical testing (tensile and puncture tests) and barrier performance testing (carbon dioxide, oxygen, and water vapor permeability) were performed on the films. Transmission electron microscopy (TEM) was used to image the blends and to view the dispersion of the various phases. Finally, blends of MTPS and PBAT were extruded with an endothermic chemical blowing agent to produce foams. The foams were characterized by measuring density, expansion ratio, specific length, compressive strength, resiliency, and moisture sorption. Also, digital light microscopy was used to image the cell structure of the foams. This work demonstrates that blends of starch and PBAT can be produced and formed into thermoformed objects, films, and foams. These objects can replace current objects made from non-biodegradable, petroleum-based plastics. By blending the starch and PBAT together, one receives advantages over using either component separately.

  2. Performance characterization and transient investigation of multipropellant resistojets

    NASA Technical Reports Server (NTRS)

    Braunscheidel, Edward P.

    1989-01-01

    The multipropellant resistojet thruster design initially was characterized for performance in a vacuum tank using argon, carbon dioxide, nitrogen, and hydrogen, with gas inlet pressures ranging from 13.7 to 310 kPa (2 to 45 psia) over a heat exchanger temperature range of ambient to 1200 C (2200 F). Specific impulse, the measure of performance, had values ranging from 120 to 600 seconds for argon and hydrogen respectively, with a constant heat exchanger temperature of 1200 C (2200 F). When operated under ambient conditions typical specific impulse values obtained for argon and hydrogen ranged from 55 to 290 seconds, respectively. Performance measured with several mixtures of argon and nitrogen showed no significant deviation from predictions obtained by directly weighting the argon and nitrogen individual performance results. Another aspect of the program investigating transient behavior, showed responses depended heavily on the start-up scenario used. Steady state heater temperatures were achieved in 20 to 75 minutes for argon, and in 10 to 90 minutes for hydrogen. Steady state specific impulses were achieved in 25 to 60, and 20 to 60 minutes respectively.

  3. Impact of egg disinfection of hatching eggs on the eggshell microbiome and bacterial load.

    PubMed

    Olsen, R; Kudirkiene, E; Thøfner, I; Pors, S; Karlskov-Mortensen, P; Li, L; Papasolomontos, S; Angastiniotou, C; Christensen, J

    2017-09-01

    Disinfection of hatching eggs is essential to ensure high quality production of broilers. Different protocols are followed in different hatcheries; however, only limited scientific evidence on how the disinfection procedures impact the microbiome is available. The aim of the present study was to characterize the microbiome and aerobic bacterial load of hatching eggs before disinfection and during the subsequent disinfection steps. The study included a group of visibly clean and a group of visibly dirty eggs. For dirty eggs, an initial wash in chlorine was performed, hereafter all eggs were submitted to two times fumigation and finally spray disinfection. The eggshell microbiome was characterized by sequencing of the total amount of 16S rRNA extracted from each sample, consisting of shell surface swabs of five eggs from the same group. In addition, the number of colony forming units (cfu) under aerobic conditions was established for each disinfection step. The disinfection procedure reduced the bacterial load from more than 104 cfu (initially visibly clean eggs) and 105 cfu (initially visibly dirty eggs) to less than 10 cfu per sample after disinfection for both groups of eggs. The microbiome of both initially visibly clean and initially visibly dirty eggs had the highest abundances of the phyla Firmicutes, Proteobacteria and Bacteroidetes. Within the phyla Firmicutes the relative abundances of Clostridiales decreased while Lactobacillus increased from before to after final disinfection. In conclusion, the investigated disinfection procedure is effective in reducing the bacterial load, and by adding a chlorine wash for initially visibly dirty eggs, the microbiome of initially visibly clean and initially visibly dirty eggs had a highly similar microflora after the final disinfection step. © 2017 Poultry Science Association Inc.

  4. Fabrication, characterization, and heuristic trade space exploration of magnetically actuated Miura-Ori origami structures

    NASA Astrophysics Data System (ADS)

    Cowan, Brett; von Lockette, Paris R.

    2017-04-01

    The authors develop magnetically actuated Miura-Ori structures through observation, experiment, and computation using an initially heuristic strategy followed by trade space visualization and optimization. The work is novel, especially within origami engineering, in that beyond final target shape approximation, Miura-Ori structures in this work are additionally evaluated for the shape approximation while folding and for their efficient use of their embedded actuators. The structures consisted of neodymium magnets placed on the panels of silicone elastomer substrates cast in the Miura-Ori folding pattern. Initially four configurations, arrangements of magnets on the panels, were selected based on heuristic arguments that (1) maximized the amount of magnetic torque applied to the creases and (2) reduced the number of magnets needed to affect all creases in the pattern. The results of experimental and computational performance metrics were used in a weighted sum model to predict the optimum configuration, which was then fabricated and experimentally characterized for comparison to the initial prototypes. As expected, optimization of magnet placement and orientation was effective at increasing the degree of theoretical useful work. Somewhat unexpectedly, however, trade space results showed that even after optimization, the configuration with the most number of magnets was least effective, per magnet, at directing its actuation to the structure’s creases. Overall, though the winning configuration experimentally outperformed its initial, non-optimal counterparts, results showed that the choice of optimum configuration was heavily dependent on the weighting factors. These results highlight both the ability of the Miura-Ori to be actuated with external magnetic stimuli, the effectiveness of a heuristic design approach that focuses on the actuation mechanism, and the need to address path-dependent metrics in assessing performance in origami folding structures.

  5. Flexure fatigue testing of 90 deg graphite/epoxy composites

    NASA Technical Reports Server (NTRS)

    Peck, Ann Nancy W.

    1995-01-01

    A great deal of research has been performed characterizing the in-plane fiber-dominated properties, under both static and fatigue loading, of advanced composite materials. To the author's knowledge, no study has been performed to date investigating fatigue characteristics in the transverse direction. This information is important in the design of bonded composite airframe structure where repeated, cyclic out-of-plane bending may occur. Recent tests characterizing skin/stringer debond failures in reinforced composite panels where the dominant loading in the skin is flexure along the edge of the frame indicate failure initiated either in the skin or else the flange, near the flange tip. When failure initiated in the skin, transverse matrix cracks formed in the surface skin ply closest to the flange and either initiated delaminations or created matrix cracks in the next lower ply, which in turn initiated delaminations. When failure initiated in the flanges, transverse cracks formed in the flange angle ply closest to the skin and initiated delamination. In no configuration did failure propagate through the adhesive bond layer. For the examined skin/flange configurations, the maximum transverse tension stress at failure correlates very well with the transverse tension strength of the composites. Transverse tension strength (static) data of graphite epoxy composites have been shown to vary with the volume of material stressed. As the volume of material stressed increased, the strength decreased. A volumetric scaling law based on Weibull statistics can be used to predict the transverse strength measurements. The volume dependence reflects the presence of inherent flaws in the microstructure of the lamina. A similar approach may be taken to determine a volume scale effect on the transverse tension fatigue behavior of graphite/epoxy composites. The objective of this work is to generate transverse tension strength and fatigue S-N characteristics for composite materials using 3-point flexure tests of 90 deg graphite/epoxy specimens. Investigations will include the volume scale effect as well as frequency and span-to-thickness ratio effects. Prior to the start of the experimental study, an analytical study using finite element modeling will be performed to investigate the span-to-thickness effect. The ratio of transverse flexure stress to shear stress will be monitored and its values predicted by the FEM analysis compared with the value obtained using a 'strength of materials' based approach.

  6. Performance and Reliability of Bonded Interfaces for High-temperature Packaging: Annual Progress Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    DeVoto, Douglas J.

    2017-10-19

    As maximum device temperatures approach 200 °Celsius, continuous operation, sintered silver materials promise to maintain bonds at these high temperatures without excessive degradation rates. A detailed characterization of the thermal performance and reliability of sintered silver materials and processes has been initiated for the next year. Future steps in crack modeling include efforts to simulate crack propagation directly using the extended finite element method (X-FEM), a numerical technique that uses the partition of unity method for modeling discontinuities such as cracks in a system.

  7. TPS In-Flight Health Monitoring Project Progress Report

    NASA Technical Reports Server (NTRS)

    Kostyk, Chris; Richards, Lance; Hudston, Larry; Prosser, William

    2007-01-01

    Progress in the development of new thermal protection systems (TPS) is reported. New approaches use embedded lightweight, sensitive, fiber optic strain and temperature sensors within the TPS. Goals of the program are to develop and demonstrate a prototype TPS health monitoring system, develop a thermal-based damage detection algorithm, characterize limits of sensor/system performance, and develop ea methodology transferable to new designs of TPS health monitoring systems. Tasks completed during the project helped establish confidence in understanding of both test setup and the model and validated system/sensor performance in a simple TPS structure. Other progress included complete initial system testing, commencement of the algorithm development effort, generation of a damaged thermal response characteristics database, initial development of a test plan for integration testing of proven FBG sensors in simple TPS structure, and development of partnerships to apply the technology.

  8. Development summary of a sympathetic discharge CO2 laser for lidar use

    NASA Technical Reports Server (NTRS)

    Jaenisch, Holger M.; Johnson, R. Barry

    1991-01-01

    A commercial pulsed sympathetic discharge laser has been characterized and modified for use as a potential lidar. This report summarizes the initial findings and modifications made to the baseline system. The new laser performance is then checked with theory and operational results are presented. The laser has inherent mode instability and high chirp. Several solutions were tried and their results are presented.

  9. Performance Characterization of Polyimide-Carbon Fiber Composites for Future Hypersonic Vehicles

    DTIC Science & Technology

    2010-08-01

    already being processed for leading edge primary structures and engine components for present and future stealth aircraft. In addition to describing our...The form of entry is the last name, first name, middle initial, and additional qualifiers separated by commas, e.g. Smith, Richard, Jr. 7...availability or distribution limitations of the report. If additional limitations/restrictions or special markings are indicated, follow agency

  10. Diagnosis and management of solitary pulmonary nodules.

    PubMed

    Jeong, Yeon Joo; Lee, Kyung Soo; Kwon, O Jung

    2008-12-01

    The advent of computed tomography (CT) screening with or without the help of computer-aided detection systems has increased the detection rate of solitary pulmonary nodules (SPNs), including that of early peripheral lung cancer. Helical dynamic (HD)CT, providing the information on morphologic and hemodynamic characteristics with high specificity and reasonably high accuracy, can be used for the initial assessment of SPNs. (18)F-fluorodeoxyglucose PET/CT is more sensitive at detecting malignancy than HDCT. Therefore, PET/CT may be selectively performed to characterize SPNs when HDCT gives an inconclusive diagnosis. Serial volume measurements are currently the most reliable methods for the tissue characterization of subcentimeter nodules. When malignant nodule is highly suspected for subcentimeter nodules, video-assisted thoracoscopic surgery nodule removal after nodule localization using the pulmonary nodule-marker system may be performed for diagnosis and treatment.

  11. Full scale phosphoric acid fuel cell stack technology development

    NASA Technical Reports Server (NTRS)

    Christner, L.; Faroque, M.

    1984-01-01

    The technology development for phosphoric acid fuel cells is summarized. The preparation, heat treatment, and characterization of carbon composites used as bipolar separator plates are described. Characterization included resistivity, porosity, and electrochemical corrosion. High density glassy carbon/graphite composites performed well in long-term fuel cell endurance tests. Platinum alloy cathode catalysts and low-loaded platinum electrodes were evaluated in 25 sq cm cells. Although the alloys displayed an initial improvement, some of this improvement diminished after a few thousand hours of testing. Low platinum loading (0.12 mg/sq cm anodes and 0.3 mg/sq cm cathodes) performed nearly as well as twice this loading. A selectively wetproofed anode backing paper was tested in a 5 by 15 inch three-cell stack. This material may provide for acid volume expansion, acid storage, and acid lateral distribution.

  12. Creating NDA working standards through high-fidelity spent fuel modeling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Skutnik, Steven E; Gauld, Ian C; Romano, Catherine E

    2012-01-01

    The Next Generation Safeguards Initiative (NGSI) is developing advanced non-destructive assay (NDA) techniques for spent nuclear fuel assemblies to advance the state-of-the-art in safeguards measurements. These measurements aim beyond the capabilities of existing methods to include the evaluation of plutonium and fissile material inventory, independent of operator declarations. Testing and evaluation of advanced NDA performance will require reference assemblies with well-characterized compositions to serve as working standards against which the NDA methods can be benchmarked and for uncertainty quantification. To support the development of standards for the NGSI spent fuel NDA project, high-fidelity modeling of irradiated fuel assemblies is beingmore » performed to characterize fuel compositions and radiation emission data. The assembly depletion simulations apply detailed operating history information and core simulation data as it is available to perform high fidelity axial and pin-by-pin fuel characterization for more than 1600 nuclides. The resulting pin-by-pin isotopic inventories are used to optimize the NDA measurements and provide information necessary to unfold and interpret the measurement data, e.g., passive gamma emitters, neutron emitters, neutron absorbers, and fissile content. A key requirement of this study is the analysis of uncertainties associated with the calculated compositions and signatures for the standard assemblies; uncertainties introduced by the calculation methods, nuclear data, and operating information. An integral part of this assessment involves the application of experimental data from destructive radiochemical assay to assess the uncertainty and bias in computed inventories, the impact of parameters such as assembly burnup gradients and burnable poisons, and the influence of neighboring assemblies on periphery rods. This paper will present the results of high fidelity assembly depletion modeling and uncertainty analysis from independent calculations performed using SCALE and MCNP. This work is supported by the Next Generation Safeguards Initiative, Office of Nuclear Safeguards and Security, National Nuclear Security Administration.« less

  13. Survival of pq -superstrings in field theory simulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lizarraga, Joanes; Urrestilla, Jon, E-mail: joanes.lizarraga@ehu.eus, E-mail: jon.urrestilla@ehu.eus

    2016-04-01

    We perform large-scale field theoretical simulations in expanding universe to characterize a network of strings that can form composed bound states. The network consists of two copies of Abelian Higgs strings (which we label p and q , respectively) coupled via a potential term to give pq bound states. The simulations are performed using two different kinds of initial conditions: the first one with a network of p - and q -strings, and the second one with a network of q - and pq -strings. This way, we start from two opposite situations: one with no initial pq -strings, andmore » one with a large initial number of pq -strings. We find that in both cases the system scales, and in both cases the system prefers to have a low fraction of pq -strings. This is somewhat surprising in the case for the second type of conditions, showing that the unzipping mechanism is very efficient. We also find hints that both initial conditions tend to asymptote to a common configuration, though we would need a larger dynamical range to confirm it. The average velocities of the different types of strings in the network have also been explored for the first time.« less

  14. Overview of a stirling engine test project

    NASA Technical Reports Server (NTRS)

    Slaby, J. G.

    1980-01-01

    Tests were conducted on three Stirling engines ranging in size from 1.33 to 53 horsepower (1 to 40 kW). The tests were directed toward developing alternative, backup component concepts to improve engine efficiency and performance or to reduce costs. Some of the activities included investigating attractive concepts and materials for cooler-regenerator units, installing a jet impingement device on a Stirling engine to determine its potential for improved engine performance, and presenting performance maps for initial characterization of Stirling engines. The experiment results of the tests are presented along with predictions of results of future tests to be conducted on the Stirling engines.

  15. Thermal Properties Measurement Report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carmack, Jon; Braase, Lori; Papesch, Cynthia

    2015-08-01

    The Thermal Properties Measurement Report summarizes the research, development, installation, and initial use of significant experimental thermal property characterization capabilities at the INL in FY 2015. These new capabilities were used to characterize a U 3Si 2 (candidate Accident Tolerant) fuel sample fabricated at the INL. The ability to perform measurements at various length scales is important and provides additional data that is not currently in the literature. However, the real value of the data will be in accomplishing a phenomenological understanding of the thermal conductivity in fuels and the ties to predictive modeling. Thus, the MARMOT advanced modeling andmore » simulation capability was utilized to illustrate how the microstructural data can be modeled and compared with bulk characterization data. A scientific method was established for thermal property measurement capability on irradiated nuclear fuel samples, which will be installed in the Irradiated Material Characterization Laboratory (IMCL).« less

  16. Concept Definition Study for In-Space Structural Characterization of a Lightweight Solar Array

    NASA Technical Reports Server (NTRS)

    Woods-Vedeler, Jessica A.; Pappa, Richard S.; Jones, Thomas W.; Spellman, Regina; Scott, Willis; Mockensturm, Eric M.; Liddle, Donn; Oshel, Ed; Snyder, Michael

    2002-01-01

    A Concept Definition Study (CDS) was conducted to develop a proposed "Lightweight High-Voltage Stretched-Lens Concentrator Solar Array Experiment" under NASA's New Millennium Program Space Technology-6 (NMP ST-6) activity. As part of a multi-organizational team, NASA Langley Research Center's role in this proposed experiment was to lead Structural Characterization of the solar array during the flight experiment. In support of this role, NASA LaRC participated in the CDS to de.ne an experiment for static, dynamic, and deployment characterization of the array. In this study, NASA LaRC traded state-of-the-art measurement approaches appropriate for an in-space, STS-based flight experiment, provided initial analysis and testing of the lightweight solar array and lens elements, performed a lighting and photogrammetric simulation in conjunction with JSC, and produced an experiment concept definition to meet structural characterization requirements.

  17. Characterization of cracking behavior using posttest fractographic analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kobayashi, T.; Shockey, D.A.

    A determination of time to initiation of stress corrosion cracking in structures and test specimens is important for performing structural failure analysis and for setting inspection intervals. Yet it is seldom possible to establish how much of a component's lifetime represents the time to initiation of fracture and how much represents postinitiation crack growth. This exploratory research project was undertaken to examine the feasibility of determining crack initiation times and crack growth rates from posttest examination of fracture surfaces of constant-extension-rate-test (CERT) specimens by using the fracture reconstruction applying surface topography analysis (FRASTA) technique. The specimens used in this studymore » were Type 304 stainless steel fractured in several boiling water reactor (BWR) aqueous environments. 2 refs., 25 figs., 2 tabs.« less

  18. Revealing the spatial region of a future fracture nucleation in heterogeneous materials at the initial deformation stage

    NASA Astrophysics Data System (ADS)

    Damaskinskaya, Ekaterina; Hilarov, Vladimir; Frolov, Dmitriy

    2016-11-01

    The energy distributions of acoustic emission (AE) signals have been analyzed on two scaling levels corresponding to deformation of granite samples and processes on a commercial mining enterprise. It is established that, in cases of localized fracture, the energy distribution of AE signals has shape described by a power law, while a dispersed fracture is characterized by an exponential energy distribution of the AE signals. Analysis of the functional form of the energy distribution performed at the initial stage of loading allows one to recognize a spatial region in the sample where localization of the defect formation will subsequently take place.

  19. Meso-scale investigation of anaerobic chemical reactivity of Ti-Al-B powder mixtures under impact loading

    NASA Astrophysics Data System (ADS)

    Gonzales, Manny; Gurumurthy, Ashok; Gokhale, Arun; Thadhani, Naresh N.

    2011-06-01

    Impact-initiated anaerobic chemical reactions in Ti-Al-B reactive powder mixtures under uniaxial stress conditions are investigated using a coupled experimental/computational approach. In particular, we characterize the effects of bulk composition on the threshold impact energy to initiate reaction using rod-on-anvil type tests performed on Ti-Al-B powder compacts. Statistical volume elements (SVEs) of different bulk compositions of the powder mixtures are analyzed using the continuum hydrocode CTH to quantify the effects of strain confinement and load configuration on the overall energy of the structure. These SVEs are also validated using one-point correlation functions to characterize the volume fraction and surface area of the constituents. Based on the deformation profiles from the continuum simulations, we investigate the effect of particle size distribution and clustering of Ti and B on the threshold energy required for observed reactivity. The deformation and threshold kinetic energy of the simulated system is compared with published values of the activation energy for Ti+B reactions and Al combustion in air to assess the extent of their impact-initiated reactivity. Funded by DTRA grant No. HDTRA1-10-1-0038

  20. Scouts behave as streakers in honeybee swarms

    NASA Astrophysics Data System (ADS)

    Greggers, Uwe; Schöning, Caspar; Degen, Jacqueline; Menzel, Randolf

    2013-08-01

    Harmonic radar tracking was used to record the flights of scout bees during takeoff and initial flight path of two honeybee swarms. One swarm remained intact and performed a full flight to a destination beyond the range of the harmonic radar, while a second swarm disintegrated within the range of the radar and most of the bees returned to the queen. The initial stretch of the full flight is characterized by accelerating speed, whereas the disintegrating swarm flew steadily at low speed. The two scouts in the swarm displaying full flight performed characteristic flight maneuvers. They flew at high speed when traveling in the direction of their destination and slowed down or returned over short stretches at low speed. Scouts in the disintegrating swarm did not exhibit the same kind of characteristic flight performance. Our data support the streaker bee hypothesis proposing that scout bees guide the swarm by traveling at high speed in the direction of the new nest site for short stretches of flight and slowing down when reversing flight direction.

  1. Biaxial deformation in high purity aluminum

    DOE PAGES

    Livescu, V.; Bingert, J. F.; Liu, C.; ...

    2015-09-25

    The convergence of multiple characterization tools has been applied to investigate the relationship of microstructure on damage evolution in high purity aluminum. The extremely coarse grain size of the disc-shaped sample provided a quasi-two dimensional structure from which the location of surface-measured features could be inferred. In particular, the role of pre-existing defects on damage growth was accessible due to the presence of casting porosity in the aluminum. Micro tomography, electron backscatter diffraction, and digital image correlation were applied to interrogate the sample in three dimensions. Recently micro-bulge testing apparatus was used to deform the pre-characterized disc of aluminum inmore » biaxial tension, and related analysis techniques were applied to map local strain fields. Subsequent post-mortem characterization of the failed sample was performed to correlate structure to damaged regions. We determined that strain localization and associated damage was most strongly correlated with grain boundary intersections and plastic anisotropy gradients between grains. Pre-existing voids played less of an apparent role than was perhaps initially expected. Finally, these combined techniques provide insight to the mechanism of damage initiation, propagation, and failure, along with a test bed for predictive damage models incorporating anisotropic microstructural effects.« less

  2. Preparation and characterization of (St-DVB-MAA) ion exchange resins

    NASA Astrophysics Data System (ADS)

    Jiang, Shanquan; Sun, Xiangwei; Ling, Lixing; Wang, Shumin; Wu, Wufeng; Cheng, Shihong; Hu, Yue; Zhong, Chunyan

    2017-08-01

    In this paper, used polyvinyl alcohol as dispersing agent, Benzoyl peroxide as initiator of polymerization, Divinyl benzene as cross-linking agent, Styrene and 2-Methylpropenoic acid as monomer, ion exchange resin (copolymer of St-DVB-MAA)were prepared by suspension polymerization on 80°C. The structures, components and properties of the prepared composite micro gels were characterized by Fourier transform infrared spectroscopy (FT-IR), thermogravimetric analysis (TGA). The experiment of ion exchange was conducted by resin to deal with copper ions in the solution. The result showed that performance of the ion exchange capacity was excellent, which impacted by pH.

  3. Characterization of failure processes in tungsten copper composites under fatigue loading conditions

    NASA Technical Reports Server (NTRS)

    Kim, Yong-Suk; Verrilli, Michael J.; Gabb, Timothy P.

    1989-01-01

    A fractographic and metallographic investigation was performed on specimens of a tungsten fiber reinforced copper matrix composite (9 vol percent), which had experienced fatigue failures at elevated temperatures. Major failure modes and possible failure mechanisms, with an emphasis placed on characterizing fatigue damage accumulation, were determined. Metallography of specimens fatigued under isothermal cyclic loading suggested that fatigue damage initiates in the matrix. Cracks nucleated within the copper matrix at grain boundaries, and they propagated through cavity coalescence. The growing cracks subsequently interacted with the reinforcing tungsten fibers, producing a localized ductile fiber failure. Examinations of interrupted tests before final failure confirmed the suggested fatigue damage processes.

  4. Experimental Evaluation and Workload Characterization for High-Performance Computer Architectures

    NASA Technical Reports Server (NTRS)

    El-Ghazawi, Tarek A.

    1995-01-01

    This research is conducted in the context of the Joint NSF/NASA Initiative on Evaluation (JNNIE). JNNIE is an inter-agency research program that goes beyond typical.bencbking to provide and in-depth evaluations and understanding of the factors that limit the scalability of high-performance computing systems. Many NSF and NASA centers have participated in the effort. Our research effort was an integral part of implementing JNNIE in the NASA ESS grand challenge applications context. Our research work under this program was composed of three distinct, but related activities. They include the evaluation of NASA ESS high- performance computing testbeds using the wavelet decomposition application; evaluation of NASA ESS testbeds using astrophysical simulation applications; and developing an experimental model for workload characterization for understanding workload requirements. In this report, we provide a summary of findings that covers all three parts, a list of the publications that resulted from this effort, and three appendices with the details of each of the studies using a key publication developed under the respective work.

  5. Performance characterization of a Bosch CO sub 2 reduction subsystem

    NASA Technical Reports Server (NTRS)

    Heppner, D. B.; Hallick, T. M.; Schubert, F. H.

    1980-01-01

    The performance of Bosch hardware at the subsystem level (up to five-person capacity) in terms of five operating parameters was investigated. The five parameters were: (1) reactor temperature, (2) recycle loop mass flow rate, (3) recycle loop gas composition (percent hydrogen), (4) recycle loop dew point and (5) catalyst density. Experiments were designed and conducted in which the five operating parameters were varied and Bosch performance recorded. A total of 12 carbon collection cartridges provided over approximately 250 hours of operating time. Generally, one cartridge was used for each parameter that was varied. The Bosch hardware was found to perform reliably and reproducibly. No startup, reaction initiation or carbon containment problems were observed. Optimum performance points/ranges were identified for the five parameters investigated. The performance curves agreed with theoretical projections.

  6. Effect of Solution pH and Chloride Concentration on Akaganeite Precipitation: Implications for Akaganeite Formation on Mars

    NASA Technical Reports Server (NTRS)

    Peretyazhko, T. A.; Rampe, E. B.; Clark, J. V.; Archer, P. D., Jr.; Morris, R. V.; Ming, D. V.

    2017-01-01

    Akaganeite (Beta-FeOOH, chloride-containing Fe(III) (hydr)oxide) has been recently discovered on the surface of Mars by the Mars Science Laboratory Curiosity rover in Yellowknife Bay, Gale Crater, Mars [1] and from orbit by the Mars Reconnaissance Orbiter in Robert Sharp crater and Antoniadi basin [2]. However, the mechanism and aqueous environmental conditions of akaganeite formation (e.g., pH and chloride concentration) remain unknown. We have investigated formation of akaganeite through Fe(III) hydrolysis at variable initial pH and chloride concentrations. The formed Fe(III) precipitates were characterized by instruments similar to instruments on Mars robotic spacecraft. Syntheses were performed through hydrolysis of Fe(III) perchlorate with addition of Na cloride (Fe/Cl ratio between 0.5 and 5) and at initial pH of 1.5, 2, 4, 6 and 8 at 90degC. X-ray diffraction analysis revealed formation of akaganeite alone or in mixture with goethite, hematite and ferrihydrite at all initial pHs and Fe/Cl ratio between 0.5 and 2 while akaganeite precipitated only at pH 1.5 and Fe/Cl greater than2. Chloride content of akaganeite was affected by initial pH and decreased from 20-60 mg/g at pH 1.5 to less than 0.1 mg/g at pH 8. The synthesized akaganeite samples were also characterized by Mössbauer and infrared spectroscopy and volatiles were analysed by thermal and evolved gas analysis. The obtained characterization data will be compared to published data from rover and orbital missions [1-3] to determine martian akaganeite composition, crystallinity and formation conditions.

  7. Characterization, Monitoring, and Risk Assessment at the IEA GHG Weyburn-Midale CO2 Monitoring and Storage Project, Saskatchewan, Canada.

    NASA Astrophysics Data System (ADS)

    Ben, R.; Chalaturnyk, R.; Gardner, C.; Hawkes, C.; Johnson, J.; White, D.; Whittaker, S.

    2008-12-01

    In July 2000, a major research project was initiated to study the geological storage of CO2 as part of a 5000 tonnes/day EOR project planned for the Weyburn Field in Saskatchewan, Canada. Major objectives of the IEA GHG Weyburn CO2 monitoring and storage project included: assessing the integrity of the geosphere encompassing the Weyburn oil pool for effective long-term storage of CO2; monitoring the movement of the injected CO2, and assessing the risk of migration of CO2 from the injection zone (approximately 1500 metres depth) to the surface. Over the period 2000-2004, a diverse group of 80+ researchers worked on: geological, geophysical, and hydrogeological characterizations at both the regional (100 km beyond the field) and detailed scale (10 km around the field); conducted time-lapse geophysical surveys; carried out surface and subsurface geochemical surveys; and undertook numerical reservoir simulations. Results of the characterization were used for a performance assessment that concluded the risk of CO2 movement to the biosphere was very small. By September 2007, more than 14 Mtonnes of CO2 had been injected into the Weyburn reservoir, including approximately 3 Mtonnes recycled from oil production. A "Final Phase" research project was initiated (2007- 2011) to contribute to a "Best Practices" guide for long-term CO2 storage in EOR settings. Research objectives include: improving the geoscience characterization; further detailed analysis and data collection on the role of wellbores; additional geochemical and geophysical monitoring activities; and an emphasis on quantitative risk assessments using multiple analysis techniques. In this talk a review of results from Phase I will be presented followed by plans and initial results for the Final Phase.

  8. Qualification and initial characterization of a high-purity 233U spike for use in uranium analyses

    DOE PAGES

    Mathew, K. J.; Canaan, R. D.; Hexel, C.; ...

    2015-08-20

    Several high-purity 233U items potentially useful as isotope dilution mass spectrometry standards for safeguards, non-proliferation, and nuclear forensics measurements are identified and rescued from downblending. By preserving the supply of 233U materials of different pedigree for use as source materials for certified reference materials (CRMs), it is ensured that the safeguards community has high quality uranium isotopic standards required for calibration of the analytical instruments. One of the items identified as a source material for a high-purity CRM is characterized for the uranium isotope-amount ratios using thermal ionization mass spectrometry (TIMS). Additional verification measurements on this material using quadrupole inductivelymore » coupled plasma mass spectrometry (ICPMS) are also performed. As a result, the comparison of the ICPMS uranium isotope-amount ratios with the TIMS data, with much smaller uncertainties, validated the ICPMS measurement practices. ICPMS is proposed for the initial screening of the purity of items in the rescue campaign.« less

  9. Study program to develop and evaluate die and container materials for the growth of silicon ribbons

    NASA Technical Reports Server (NTRS)

    1978-01-01

    Initial sessile drop experiments on SiC, Si3N4 and A1N were conducted. Very promising results were achieved on both SiC and Si3N4 where minimal penetration of these CNTD coatings by molten silicon was observed. More detailed characterization of the CNTD microstructures was accomplished as well as X-ray characterization of the third and fourth candidate materials system sets (i.e. A1N and altered Si3N4). Polished sections of post sessile drop specimens were also prepared and evaluated. The techniques of full scale crucible hot pressing were developed and die grinding development was initiated. The apparatus for measurement of oxygen partial pressure was reconstructed and calibrated. The sessile drop temperature measurement procedure was calibrated for absorption by the pyrex view-port and additional Auger electron analysis was performed at the interface of molten silicon with CNTD Si3N4 and A1N.

  10. Initial design and performance of the near surface unmanned aircraft system sensor suite in support of the GOES-R field campaign

    NASA Astrophysics Data System (ADS)

    Pearlman, Aaron J.; Padula, Francis; Shao, Xi; Cao, Changyong; Goodman, Steven J.

    2016-09-01

    One of the main objectives of the Geostationary Operational Environmental Satellite R-Series (GOES-R) field campaign is to validate the SI traceability of the Advanced Baseline Imager. The campaign plans include a feasibility demonstration study for new near surface unmanned aircraft system (UAS) measurement capability that is being developed to meet the challenges of validating geostationary sensors. We report our progress in developing our initial systems by presenting the design and preliminary characterization results of the sensor suite. The design takes advantage of off-the-shelf technologies and fiber-based optical components to make hemispheric directional measurements from a UAS. The characterization results - including laboratory measurements of temperature effects and polarization sensitivity - are used to refine the radiometric uncertainty budget towards meeting the validation objectives for the campaign. These systems will foster improved validation capabilities for the GOES-R field campaign and other next generation satellite systems.

  11. Global Characterization of Protein-Altering Mutations in Prostate Cancer

    DTIC Science & Technology

    2012-08-01

    observed, and assess prevalence; (3) Perform integrative analyses of somatic mutation with gene expression and copy number change data collected on the...v) completed CGH assays on 200 prostate cancers; (vi) initiated the integrated analyses of gene expression, copy number and mutation in prostate...histories of individual mutations within the progression of the cancer in which it was observed, and to assess the prevalence of candidate cancer genes

  12. Study and Characterization of Subharmonic Emissions by Using Shaped Ultrasonic Driving Pulse

    NASA Astrophysics Data System (ADS)

    Masotti, L.; Biagi, E.; Breschi, L.; Vannacci, E.

    Subharmonic emissions from Ultrasound Contrast Agents (UCAs) were studied by a Pulse Inversion method in order to assess the feasibility of implementation of this technique to subharmonic imaging. Interesting results concerning the dependence of the subharmonic emission with respect to initial pulse shape are presented. The experimentation was performed also by varying the acoustic pressure and concentration of the contrast agent (SonoVue®)

  13. Initial Identification and Characterization of an Emerging Zoonotic Influenza Prior to Pandemic Spread

    DTIC Science & Technology

    2010-11-01

    equally closely strains of both H1N2 influenza A virus of swine origin and H3N2 influenza A virus of avian origin. The expected matches for each of...Naval Health Research Center Initial Identification and Characterization of an Emerging Zoonotic Influenza Virus Prior to Pandemic Spread...10.1128/JCM.01336-10 PMCID: PMC3020883 Initial Identification and Characterization of an Emerging Zoonotic Influenza Virus Prior to Pandemic

  14. A Comprehensive Tutorial on In Vitro Characterization of New Photosensitizers for Photodynamic Antitumor Therapy and Photodynamic Inactivation of Microorganisms

    PubMed Central

    Maisch, Tim; Berneburg, Mark; Plaetzer, Kristjan

    2013-01-01

    In vitro research performed on eukaryotic or prokaryotic cell cultures usually represents the initial step for characterization of a novel photosensitizer (PS) intended for application in photodynamic therapy (PDT) of cancer or photodynamic inactivation (PDI) of microorganisms. Although many experimental steps of PS testing make use of the wide spectrum of methods readily employed in cell biology, special aspects of working with photoactive substances, such as the autofluorescence of the PS molecule or the requirement of light protection, need to be considered when performing in vitro experiments in PDT/PDI. This tutorial represents a comprehensive collection of operative instructions, by which, based on photochemical and photophysical properties of a PS, its uptake into cells, the intracellular localization and photodynamic action in both tumor cells and microorganisms novel photoactive molecules may be characterized for their suitability for PDT/PDI. Furthermore, it shall stimulate the efforts to expand the convincing benefits of photodynamic therapy and photodynamic inactivation within both established and new fields of applications and motivate scientists of all disciplines to get involved in photodynamic research. PMID:23762860

  15. Characterization of UOP IONSIV IE-911

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NYMAN, MAY D.; NENOFF, TINA M.; HEADLEY, THOMAS J.

    2001-06-01

    As a participating national lab in the inter-institutional effort to resolve performance issues of the non-elutable ion exchange technology for Cs extraction, they have carried out a series of characterization studies of UOP IONSIV{reg_sign} IE-911 and its component parts. IE-911 is a bound form (zirconium hydroxide-binder) of crystalline silicotitanate (CST) ion exchanger. The crystalline silicotitanate removes Cs from solutions by selective ion exchange. The performance issues of primary concern are: (1) excessive Nb leaching and subsequent precipitation of column-plugging Nb-oxide material, and (2) precipitation of aluminosilicate on IE-911 pellet surfaces, which may be initiated by dissolution of Si from themore » IE-911, thus creating a supersaturated solution with respect to silica. In this work, they have identified and characterized Si- and Nb-oxide based impurity phases in IE-911, which are the most likely sources of leachable Si and Nb, respectively. Furthermore, they have determined the criteria and mechanism for removal from IE-911 of the Nb-based impurity phase that is responsible for the Nb-oxide column plugging incidents.« less

  16. Error Characterization of Altimetry Measurements at Climate Scales

    NASA Astrophysics Data System (ADS)

    Ablain, Michael; Larnicol, Gilles; Faugere, Yannice; Cazenave, Anny; Meyssignac, Benoit; Picot, Nicolas; Benveniste, Jerome

    2013-09-01

    Thanks to studies performed in the framework of the SALP project (supported by CNES) since the TOPEX era and more recently in the framework of the Sea- Level Climate Change Initiative project (supported by ESA), strong improvements have been provided on the estimation of the global and regional mean sea level over the whole altimeter period for all the altimetric missions. Thanks to these efforts, a better characterization of altimeter measurements errors at climate scales has been performed and presented in this paper. These errors have been compared to user requirements in order to know if scientific goals are reached by altimeter missions. The main issue of this paper is the importance to enhance the link between altimeter and climate communities to improve or refine user requirements, to better specify future altimeter system for climate applications but also to reprocess older missions beyond their original specifications.

  17. Initial test of MITA/DIMM with an operational CBP system

    NASA Astrophysics Data System (ADS)

    Baldwin, Kevin; Hanna, Randall; Brown, Andrea; Brown, David; Moyer, Steven; Hixson, Jonathan G.

    2018-05-01

    The MITA (Motion Imagery Task Analyzer) project was conceived by CBP OA (Customs and Border Protection - Office of Acquisition) and executed by JHU/APL (Johns Hopkins University/Applied Physics Laboratory) and CERDEC NVESD MSD (Communications and Electronics Research Development Engineering Command Night Vision and Electronic Sensors Directorate Modeling and Simulation Division). The intent was to develop an efficient methodology whereby imaging system performance could be quickly and objectively characterized in a field setting. The initial design, development, and testing spanned a period of approximately 18 months with the initial project coming to a conclusion after testing of the MITA system in June 2017 with a fielded CBP system. The NVESD contribution to MITA was thermally heated target resolution boards deployed to support a range close to the sensor and, when possible, at range with the targets of interest. JHU/APL developed a laser DIMM (Differential Image Motion Monitor) system designed to measure the optical turbulence present along the line of sight of the imaging system during the time of image collection. The imagery collected of the target board was processed to calculate the in situ system resolution. This in situ imaging system resolution and the time-correlated turbulence measured by the DIMM system were used in NV-IPM (Night Vision Integrated Performance Model) to calculate the theoretical imaging system performance. Overall, this proves the MITA concept feasible. However, MITA is still in the initial phases of development and requires further verification and validation to ensure accuracy and reliability of both the instrument and the imaging system performance predictions.

  18. Neuropsychological and brain volume differences in patients with left- and right-beginning corticobasal syndrome.

    PubMed

    Jütten, Kerstin; Pieperhoff, Peter; Südmeyer, Martin; Schleicher, Axel; Ferrea, Stefano; Caspers, Svenja; Zilles, Karl; Schnitzler, Alfons; Amunts, Katrin; Lux, Silke

    2014-01-01

    Corticobasal Syndrome (CBS) is a rare neurodegenerative syndrome characterized by unilaterally beginning frontoparietal and basal ganglia atrophy. The study aimed to prove the hypothesis that there are differences in hemispheric susceptibility to disease-related changes. Two groups of CBS patients with symptoms starting either on the left or right body side were investigated. Groups consisted of four patients each and were matched for sex, age and disease duration. Patient groups and a group of eight healthy age-matched controls were analyzed using deformation field morphometry and neuropsychological testing. To further characterize individual disease progression regarding brain atrophy and neuropsychological performance, two female, disease duration-matched patients differing in initially impaired body side were followed over six months. A distinct pattern of neural atrophy and neuropsychological performance was revealed for both CBS: Patients with initial right-sided impairment (r-CBS) revealed atrophy predominantly in frontoparietal areas and showed, except from apraxia, no other cognitive deficits. In contrast, patients with impairment of the left body side (l-CBS) revealed more widespread atrophy, extending from frontoparietal to orbitofrontal and temporal regions; and apraxia, perceptional and memory deficits could be found. A similar pattern of morphological and neuropsychological differences was found for the individual disease progression in l-CBS and r-CBS single cases. For similar durations of disease, volumetric grey matter loss related to CBS pathology appeared earlier and progressed faster in l-CBS than in r-CBS. Cognitive impairment in r-CBS was characterized by apraxia, and additional memory and perceptional deficits for l-CBS.

  19. Cognitive function in early HIV infection.

    PubMed

    Prakash, Aanchal; Hou, Jue; Liu, Lei; Gao, Yi; Kettering, Casey; Ragin, Ann B

    2017-04-01

    This study aimed to examine cognitive function in acute/early HIV infection over the subsequent 2 years. Fifty-six HIV+ subjects and 21 seronegative participants of the Chicago Early HIV Infection Study were evaluated using a comprehensive neuropsychological assessment at study enrollment and at 2-year follow-up. Cognitive performance measures were compared in the groups using t tests and mixed-effect models. Patterns of relationship with clinical measures were determined between cognitive function and clinical status markers using Spearman's correlations. At the initial timepoint, the HIV group demonstrated significantly weaker performance on measures of verbal memory, visual memory, psychomotor speed, motor speed, and executive function. A similar pattern was found when cognitive function was examined at follow-up and across both timepoints. The HIV subjects had generally weaker performance on psychomotor speed, executive function, motor speed, visual memory, and verbal memory. The rate of decline in cognitive function across the 2-year follow-up period did not differ between groups. Correlations between clinical status markers and cognitive function at both timepoints showed weaker performance associated with increased disease burden. Neurocognitive difficulty in chronic HIV infection may have very early onset and reflect consequences of initial brain viral invasion and neuroinflammation during the intense, uncontrolled viremia of acute HIV infection. Further characterization of the changes occurring in initial stages of infection and the risk and protective factors for cognitive function could inform new strategies for neuroprotection.

  20. Evaluation of the Technical Feasibility and Effective Cost of Various Wafer Thicknesses for the Manufacture of Solar Cells

    NASA Technical Reports Server (NTRS)

    1979-01-01

    Fourteen wafering characterization runs were completed on a wire saw. Wafer thickness/taper uniformity was excellent. Several alternations and design adjustments were made, facilitating saw operation. A wafering characterization cycle was initiated, and is close to completion. A cell characterization cycle was initiated.

  1. Initial Multidisciplinary Design and Analysis Framework

    NASA Technical Reports Server (NTRS)

    Ozoroski, L. P.; Geiselhart, K. A.; Padula, S. L.; Li, W.; Olson, E. D.; Campbell, R. L.; Shields, E. W.; Berton, J. J.; Gray, J. S.; Jones, S. M.; hide

    2010-01-01

    Within the Supersonics (SUP) Project of the Fundamental Aeronautics Program (FAP), an initial multidisciplinary design & analysis framework has been developed. A set of low- and intermediate-fidelity discipline design and analysis codes were integrated within a multidisciplinary design and analysis framework and demonstrated on two challenging test cases. The first test case demonstrates an initial capability to design for low boom and performance. The second test case demonstrates rapid assessment of a well-characterized design. The current system has been shown to greatly increase the design and analysis speed and capability, and many future areas for development were identified. This work has established a state-of-the-art capability for immediate use by supersonic concept designers and systems analysts at NASA, while also providing a strong base to build upon for future releases as more multifidelity capabilities are developed and integrated.

  2. Diamond X-ray Photodiode for White and Monochromatic SR beams

    PubMed Central

    Keister, Jeffrey W.; Smedley, John; Muller, Erik M.; Bohon, Jen; Héroux, Annie

    2011-01-01

    High purity, single crystal CVD diamond plates are screened for quality and instrumented into a sensor assembly for quantitative characterization of flux and position sensitivity. Initial investigations have yielded encouraging results and have led to further development. Several limiting complications are observed and discussed, as well as mitigations thereof. For example, diamond quality requirements for x-ray diodes include low nitrogen impurity and crystallographic defectivity. Thin electrode windows and electronic readout performance are ultimately also critical to device performance. Promising features observed so far from prototype devices include calculable responsivity, flux linearity, position sensitivity and timing performance. Recent results from testing in high flux and high speed applications are described. PMID:21822344

  3. Performance of (CoPC)n catalyst in active lithium-thionyl chloride cells

    NASA Technical Reports Server (NTRS)

    Shah, Pinakin M.

    1990-01-01

    An experimental study was conducted with anode limited D size cells to characterize the performance of an active lithium-thionyl chloride (Li/SOCl2) system using the polymeric cobalt phthalocyanine, (CoPC)n, catalyst in carbon cathodes. The author describes the results of this experiment with respect to initial voltage delays, operating voltages, and capacities. The effectiveness of the preconditioning methods evolved to alleviate passivation effects on storage are also discussed. The results clearly demonstrated the superior high rate capability of cells with the catalyst. The catalyst did not adversely impact the performance of cells after active storage for up to 6 months, while retaining its beneficial influences.

  4. Characterization of turbulence stability through the identification of multifractional Brownian motions

    NASA Astrophysics Data System (ADS)

    Lee, K. C.

    2013-02-01

    Multifractional Brownian motions have become popular as flexible models in describing real-life signals of high-frequency features in geoscience, microeconomics, and turbulence, to name a few. The time-changing Hurst exponent, which describes regularity levels depending on time measurements, and variance, which relates to an energy level, are two parameters that characterize multifractional Brownian motions. This research suggests a combined method of estimating the time-changing Hurst exponent and variance using the local variation of sampled paths of signals. The method consists of two phases: initially estimating global variance and then accurately estimating the time-changing Hurst exponent. A simulation study shows its performance in estimation of the parameters. The proposed method is applied to characterization of atmospheric stability in which descriptive statistics from the estimated time-changing Hurst exponent and variance classify stable atmosphere flows from unstable ones.

  5. Overview of ion source characterization diagnostics in INTF

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bandyopadhyay, M., E-mail: mainak@iter-india.org; Sudhir, Dass; Bhuyan, M.

    2016-02-15

    INdian Test Facility (INTF) is envisaged to characterize ITER diagnostic neutral beam system and to establish the functionality of its eight inductively coupled RF plasma driver based negative hydrogen ion source and its beamline components. The beam quality mainly depends on the ion source performance and therefore, its diagnostics plays an important role for its safe and optimized operation. A number of diagnostics are planned in INTF to characterize the ion source performance. Negative ions and its cesium contents in the source will be monitored by optical emission spectroscopy (OES) and cavity ring down spectroscopy. Plasma near the extraction regionmore » will be studied using standard electrostatic probes. The beam divergence and negative ion stripping losses are planned to be measured using Doppler shift spectroscopy. During initial phase of ion beam characterization, carbon fiber composite based infrared imaging diagnostics will be used. Safe operation of the beam will be ensured by using standard thermocouples and electrical voltage-current measurement sensors. A novel concept, based on plasma density dependent plasma impedance measurement using RF electrical impedance matching parameters to characterize the RF driver plasma, will be tested in INTF and will be validated with OES data. The paper will discuss about the overview of the complete INTF diagnostics including its present status of procurement, experimentation, interface with mechanical systems in INTF, and integration with INTF data acquisition and control systems.« less

  6. Overview of ion source characterization diagnostics in INTF

    NASA Astrophysics Data System (ADS)

    Bandyopadhyay, M.; Sudhir, Dass; Bhuyan, M.; Soni, J.; Tyagi, H.; Joshi, J.; Yadav, A.; Rotti, C.; Parmar, Deepak; Patel, H.; Pillai, S.; Chakraborty, A.

    2016-02-01

    INdian Test Facility (INTF) is envisaged to characterize ITER diagnostic neutral beam system and to establish the functionality of its eight inductively coupled RF plasma driver based negative hydrogen ion source and its beamline components. The beam quality mainly depends on the ion source performance and therefore, its diagnostics plays an important role for its safe and optimized operation. A number of diagnostics are planned in INTF to characterize the ion source performance. Negative ions and its cesium contents in the source will be monitored by optical emission spectroscopy (OES) and cavity ring down spectroscopy. Plasma near the extraction region will be studied using standard electrostatic probes. The beam divergence and negative ion stripping losses are planned to be measured using Doppler shift spectroscopy. During initial phase of ion beam characterization, carbon fiber composite based infrared imaging diagnostics will be used. Safe operation of the beam will be ensured by using standard thermocouples and electrical voltage-current measurement sensors. A novel concept, based on plasma density dependent plasma impedance measurement using RF electrical impedance matching parameters to characterize the RF driver plasma, will be tested in INTF and will be validated with OES data. The paper will discuss about the overview of the complete INTF diagnostics including its present status of procurement, experimentation, interface with mechanical systems in INTF, and integration with INTF data acquisition and control systems.

  7. Methods for Initial Characterization of Campylobacter jejuni Bacteriophages.

    PubMed

    Sørensen, Martine Camilla Holst; Gencay, Yilmaz Emre; Brøndsted, Lone

    2017-01-01

    Here we describe an initial characterization of Campylobacter jejuni bacteriophages by host range analysis, genome size determination by pulsed-field gel electrophoresis, and receptor-type identification by screening mutants for phage sensitivity.

  8. Acute diarrhoea due to a Shiga toxin 2e-producing Escherichia coli O8 : H19.

    PubMed

    Saupe, Angela; Edel, Birgit; Pfister, Wolfgang; Löffler, Bettina; Ehricht, Ralf; Rödel, Jürgen

    2017-06-01

    Introduction. Identification of non-O157 Shiga-toxin-producing Escherichia coli (STEC) infections may be underestimated in microbiological diagnosis. Case presentation. A 58-year-old woman developed diarrhoea with watery and subsequently mucous stool. Initial multiplex PCR testing revealed a positive result for stx 2 . Culture isolation of a STEC was successful only after repeated inoculation of chromogenic E. coli media. Molecular characterization was performed and identified the isolate as stx 2e -positive STEC of serotype O8 : H19. The strain harboured lpfA , but not eae . Conclusion. This case highlights the usefulness of initial multiplex PCR for diagnosis of non-O157 STEC infection.

  9. Rocket Propulsion 21 Steering Committee Meeting (RP21) NASA In-Space Propulsion Update

    NASA Technical Reports Server (NTRS)

    Klem, Mark

    2015-01-01

    In-house Support of NEXT-C Contract Status Thruster NEXT Long Duration Test post-test destructive evaluation in progress Findings will be used to verify service life models identify potential design improvements Cathode heater fabrication initiated for cyclic life testing Thruster operating algorithm definition verification initiated to provide operating procedures for mission users High voltage propellant isolator life test voluntarily terminated after successfully operating 51,200 h Power processor unit (PPU) Replaced all problematic stacked multilayer ceramic dual inline pin capacitors within PPU Test bed Rebuilt installed discharge power supply primary power board Completed full functional performance characterization Final test report in progress Transferred PPU Testbed to contractor to support prototype design effort.

  10. Synthesis and characterization of poly-L-leucine initialized and immobilized by rehydrated hydrotalcite: understanding stability and the nature of interaction.

    PubMed

    Miranda, Ronald-Alexander; Finocchio, Elisabetta; Llorca, Jordi; Medina, Francisco; Ramis, Gianguido; Sueiras, Jesús E; Segarra, Anna M

    2013-10-07

    PLLs were synthesized by the ring-opening polycondensation (ROP) method using α-L-leucine N-carboxyanhydride (NCA) and initialized by triethylamine (Et3N), water or rehydrated hydrotalcite (HTrus). The role of temperature, different initiators and water in ROP was further investigated. In general, the initiators used in the polymerization reaction lead to PLL alpha-helical chains containing 5-40 monomers with NCA endgroups via a monomer-activated mechanism. However, the water has a twofold effect on ROP, as both a nucleophile and a base, which involves competition between two different types of initiating mechanisms (nucleophilic attack or deprotonation of the NCA monomer) in the polymerization reaction. This competition provides as a main product NCA endgroups with an alpha-helical structure and leads to the formation of the PLL cyclic-chains and beta-sheet structures which reduce the polymer Mw and the PD of the polypeptide. Furthermore, the water can hydrolyze the NCA endgroups resulting in PLL alpha-helical chains that contain living groups as the main product. On the other hand, the HTrus presents a double role: as both an initiator and a support. The polymers synthesized in the presence of HTrus presented a HT-carboxylate endgroup. The PLLs immobilized in HTrus through an anion-exchange method performed for just 30 minutes presented the PLL immobilized in the interlayer space of the HTrus. The PLL chains of the immobilized counterpart are stabilized by H-bonding with the M-OH of the HT structure. All the polypeptides and biohybrid materials synthesized have been characterized using different techniques (EA, ICP, XRD, Raman, MALDI-TOF, ESI-TOF, FT-IR at increasing temperatures, TG/DT analyses and TEM).

  11. United States Air Force Research Initiation Program for 1988. Volume 3

    DTIC Science & Technology

    1990-04-01

    Assignment for Dr. Kenneth M. Sobel Flight Control Design 210-9MG-035 90 Comparative Burning Rates and Duplex Dr. Forrest Thomas (1987) Loads of Solid...Patterson Air Force Base. The test configuration has been designed for injecting fuel droplets in a well controlled laminar on well-characterized turbulent...its counter response may be significant, our system has thus achieved some measure of control over when non -critical processing is actually performed

  12. Development of a Novel Alginate-Based Pleural Sealant

    DTIC Science & Technology

    2017-09-01

    and will be the subject of ongoing studies . Figure 20: Experimental set-up for endobronchial administration of sealants in the ex vivo pig lung...toxicity. In the studies to date, we have done extensive materials characterization not just of modified alginates but now a number of other biologic...pig) ex vivo lung models and have performed initial in vivo evaluations of several compounds in a non-survival surgery rat lung injury model. The

  13. Detection of Maillard reaction products by a coupled HPLC-Fraction collector technique and FTIR characterization of Cu(II)-complexation with the isolated species

    NASA Astrophysics Data System (ADS)

    Ioannou, Aristos; Daskalakis, Vangelis; Varotsis, Constantinos

    2017-08-01

    The isolation of reaction products of asparagine with reducing sugars at alkaline pH and high temperature has been probed by a combination of high performance liquid chromatography (HPLC) coupled with a Fraction Collector. The UV-vis and FTIR spectra of the isolated Maillard reaction products showed structure-sensitive changes as depicted by deamination events and formation of asparagine-saccharide conjugates. The initial reaction species of the Asn-Gluc reaction were also characterized by Density Functional Theory (DFT) methods. Evidence for Cu (II) metal ion complexation with the Maillard reaction products is supported by UV-vis and FTIR spectroscopy.

  14. Characterization of X-ray fields at the center for devices and radiological health

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cerra, F.

    This talk summarizes the process undertaken by the Center for Devices and Radiological Health (CDRH) for establishing reference x-ray fields in its accredited calibration laboratory. The main considerations and their effects on the calibration parameters are discussed. The characterization of fields may be broken down into two parts: (1) the initial setup of the calibration beam spectra and (2) the ongoing measurements and controls which ensure consistency of the reference fields. The methods employed by CDRH for both these stages and underlying considerations are presented. Uncertainties associated with the various parameters are discussed. Finally, the laboratory`s performance, as evidenced bymore » ongoing measurement quality assurance results, is reported.« less

  15. The Initial Development of Transient Volcanic Plumes as a Function of Source Conditions

    NASA Astrophysics Data System (ADS)

    Tournigand, Pierre-Yves; Taddeucci, Jacopo; Gaudin, Damien; Peña Fernández, Juan José; Del Bello, Elisabetta; Scarlato, Piergiorgio; Kueppers, Ulrich; Sesterhenn, Jörn; Yokoo, Akihiko

    2017-12-01

    Transient volcanic plumes, having similar eruption duration and rise timescales, characterize many unsteady Strombolian to Vulcanian eruptions. Despite being more common, such plumes are less studied than their steady state counterpart from stronger eruptions. Here we investigate the initial dynamics of transient volcanic plumes using high-speed (visible light and thermal) and high-resolution (visible light) videos from Strombolian to Vulcanian eruptions of Stromboli (Italy), Fuego (Guatemala), and Sakurajima (Japan) volcanoes. Physical parameterization of the plumes has been performed by defining their front velocity, velocity field, volume, and apparent surface temperature. We also characterized the ejection of the gas-pyroclast mixture at the vent, in terms of number, location, duration, and frequency of individual ejection pulses and of time-resolved mass eruption rate of the ejecta's ash fraction. Front velocity evolves along two distinct trends related to the initial gas-thrust phase and later buoyant phase. Plumes' velocity field, obtained via optical flow analysis, highlights different features, including initial jets and the formation and/or merging of ring vortexes at different scales. Plume volume increases over time following a power law trend common to all volcanoes and affected by discharge history at the vent. Time-resolved ash eruption rates range between 102 and 107 kg/s and may vary up to 2 orders of magnitude within the first seconds of eruption. Our results help detailing how the number, location, angle, duration, velocity, and time interval between ejection pulses at the vents crucially control the initial (first tens of second), and possibly later, evolution of transient volcanic plumes.

  16. Chemical characterization of organosulfates from the hydroxyl radical-initiated oxidation and ozonolysis of cis-3-hexen-1-ol

    NASA Astrophysics Data System (ADS)

    Barbosa, Thais S.; Riva, Matthieu; Chen, Yuzhi; da Silva, Cleyton M.; Ameida, Jose Claudino S.; Zhang, Zhenfa; Gold, Avram; Arbilla, Graciela; Bauerfeldt, Glauco F.; Surratt, Jason D.

    2017-08-01

    Cis-3-hexen-1-ol (cis-HXO) is a green leaf volatile emitted from plants under stress and belongs to an important class of biogenic volatile organic compounds. In this study, we have investigated the potential formation of organosulfates (OSs) from the hydroxyl radical (OH)-initiated oxidation and ozonolysis of cis-HXO using either non-acidified or acidified sulfate seed aerosols under different relative humidity (RH) conditions. For selected ozonolysis experiments, an OH scavenger was utilized. Ultra performance liquid chromatography interfaced to high-resolution quadrupole time-of-flight mass spectrometry with electrospray ionization (UPLC/ESI-HR-Q-TOFMS) was used to characterize cis-HXO-derived secondary organic aerosol (SOA) formation. Chemical characterization of cis-HXO-derived SOA products reveals that OSs were generated in significant quantity from multiphase chemistry of gas-phase oxidation products of cis-HXO. Ambient fine aerosol (PM2.5) samples collected from Rio de Janeiro, Brazil, were also analyzed. Seven cis-HXO-derived OSs identified in the lab study with molecular weights 154, 186, 170, 210, 212, 226 and 270 were also found in the PM2.5 samples collected in Brazil. This study provides direct evidence that the oxidation of cis-HXO by OH and O3 yields biogenic SOA through the formation of polar OSs.

  17. Change in surface properties of zirconia and initial attachment of osteoblastlike cells with hydrophilic treatment.

    PubMed

    Watanabe, Hiroaki; Saito, Kensuke; Kokubun, Katsutoshi; Sasaki, Hodaka; Yoshinari, Masao

    2012-01-01

    The objectives of this study were to characterize change in surface properties of tetragonal zirconia polycrystals (TZP) after hydrophilic treatment, and to determine the effect of such changes on initial attachment of osteoblast-like cells. Roughened surfaces were produced by alumina-blasting and acid-etching. Hydrophilic treatment comprised application of immediately after blasting and acid-etching (Blast/Etch), oxygen plasma (O2-Plasma), ultraviolet light (UV). Specimens stored in air were used as a control. The water contact angle was determined and surface analysis was performed using an X-ray photoelectron spectroscopy. Blast/Etch, O2-Plasma and UV specimens showed superhydrophilicity, and these hydrophilic treatments to TZP elicited a marked decrease in carbon content and an increase in hydroxyl groups. Hydrophilic treatments enhanced initial attachment of osteoblast-like cells and a change in cell morphologies. These results indicate that Blast/Etch, O2-Plasma, or UV treatment has potential in the creation and maintenance of superhydrophilic surfaces and enhancing initial attachment of osteoblast-like cells.

  18. A method of recovering the initial vectors of globally coupled map lattices based on symbolic dynamics

    NASA Astrophysics Data System (ADS)

    Sun, Li-Sha; Kang, Xiao-Yun; Zhang, Qiong; Lin, Lan-Xin

    2011-12-01

    Based on symbolic dynamics, a novel computationally efficient algorithm is proposed to estimate the unknown initial vectors of globally coupled map lattices (CMLs). It is proved that not all inverse chaotic mapping functions are satisfied for contraction mapping. It is found that the values in phase space do not always converge on their initial values with respect to sufficient backward iteration of the symbolic vectors in terms of global convergence or divergence (CD). Both CD property and the coupling strength are directly related to the mapping function of the existing CML. Furthermore, the CD properties of Logistic, Bernoulli, and Tent chaotic mapping functions are investigated and compared. Various simulation results and the performances of the initial vector estimation with different signal-to-noise ratios (SNRs) are also provided to confirm the proposed algorithm. Finally, based on the spatiotemporal chaotic characteristics of the CML, the conditions of estimating the initial vectors using symbolic dynamics are discussed. The presented method provides both theoretical and experimental results for better understanding and characterizing the behaviours of spatiotemporal chaotic systems.

  19. Making sense of "consumer engagement" initiatives to improve health and health care: a conceptual framework to guide policy and practice.

    PubMed

    Mittler, Jessica N; Martsolf, Grant R; Telenko, Shannon J; Scanlon, Dennis P

    2013-03-01

    Policymakers and practitioners continue to pursue initiatives designed to engage individuals in their health and health care despite discordant views and mixed evidence regarding the ability to cultivate greater individual engagement that improves Americans' health and well-being and helps manage health care costs. There is limited and mixed evidence regarding the value of different interventions. Based on our involvement in evaluating various community-based consumer engagement initiatives and a targeted literature review of models of behavior change, we identified the need for a framework to classify the universe of consumer engagement initiatives toward advancing policymakers' and practitioners' knowledge of their value and fit in various contexts. We developed a framework that expanded our conceptualization of consumer engagement, building on elements of two common models, the individually focused transtheoretical model of behavior and the broader, multilevel social ecological model. Finally, we applied this framework to one community's existing consumer engagement program. Consumer engagement in health and health care refers to the performance of specific behaviors ("engaged behaviors") and/or an individual's capacity and motivation to perform these behaviors ("activation"). These two dimensions are related but distinct and thus should be differentiated. The framework creates four classification schemas, by (1) targeted behavior types (self-management, health care encounter, shopping, and health behaviors) and by (2) individual, (3) group, and (4) community dimensions. Our example illustrates that the framework can systematically classify a variety of consumer engagement programs, and that this exercise and resulting characterization can provide a structured way to consider the program and how its components fit program goals both individually and collectively. Applying the framework could help advance the field by making policymakers and practitioners aware of the wide range of approaches, providing a structured way to organize and characterize interventions retrospectively, and helping them consider how they can meet the program's goals both individually and collectively. © 2013 Milbank Memorial Fund.

  20. Making Sense of “Consumer Engagement” Initiatives to Improve Health and Health Care: A Conceptual Framework to Guide Policy and Practice

    PubMed Central

    Mittler, Jessica N; Martsolf, Grant R; Telenko, Shannon J; Scanlon, Dennis P

    2013-01-01

    Context Policymakers and practitioners continue to pursue initiatives designed to engage individuals in their health and health care despite discordant views and mixed evidence regarding the ability to cultivate greater individual engagement that improves Americans’ health and well-being and helps manage health care costs. There is limited and mixed evidence regarding the value of different interventions. Methods Based on our involvement in evaluating various community-based consumer engagement initiatives and a targeted literature review of models of behavior change, we identified the need for a framework to classify the universe of consumer engagement initiatives toward advancing policymakers' and practitioners' knowledge of their value and fit in various contexts. We developed a framework that expanded our conceptualization of consumer engagement, building on elements of two common models, the individually focused transtheoretical model of behavior and the broader, multilevel social ecological model. Finally, we applied this framework to one community's existing consumer engagement program. Findings Consumer engagement in health and health care refers to the performance of specific behaviors (“engaged behaviors”) and/or an individual's capacity and motivation to perform these behaviors (“activation”). These two dimensions are related but distinct and thus should be differentiated. The framework creates four classification schemas, by (1) targeted behavior types (self-management, health care encounter, shopping, and health behaviors) and by (2) individual, (3) group, and (4) community dimensions. Our example illustrates that the framework can systematically classify a variety of consumer engagement programs, and that this exercise and resulting characterization can provide a structured way to consider the program and how its components fit program goals both individually and collectively. Conclusions Applying the framework could help advance the field by making policymakers and practitioners aware of the wide range of approaches, providing a structured way to organize and characterize interventions retrospectively, and helping them consider how they can meet the program's goals both individually and collectively. PMID:23488711

  1. The effect of various parameters of large scale radio propagation models on improving performance mobile communications

    NASA Astrophysics Data System (ADS)

    Pinem, M.; Fauzi, R.

    2018-02-01

    One technique for ensuring continuity of wireless communication services and keeping a smooth transition on mobile communication networks is the soft handover technique. In the Soft Handover (SHO) technique the inclusion and reduction of Base Station from the set of active sets is determined by initiation triggers. One of the initiation triggers is based on the strong reception signal. In this paper we observed the influence of parameters of large-scale radio propagation models to improve the performance of mobile communications. The observation parameters for characterizing the performance of the specified mobile system are Drop Call, Radio Link Degradation Rate and Average Size of Active Set (AS). The simulated results show that the increase in altitude of Base Station (BS) Antenna and Mobile Station (MS) Antenna contributes to the improvement of signal power reception level so as to improve Radio Link quality and increase the average size of Active Set and reduce the average Drop Call rate. It was also found that Hata’s propagation model contributed significantly to improvements in system performance parameters compared to Okumura’s propagation model and Lee’s propagation model.

  2. Characterization of Impact Initiation of Aluminum-Based Intermetallic-Forming Reactive Materials

    DTIC Science & Technology

    2011-12-01

    compressed intermetallic-forming aluminum-based reactive materials upon impact initiation, consisting of equi-volumetric tantalum-aluminum, tungsten-aluminum...18 2.3.4 Dynamic Energy Release Characterization using Pig Test . . . . . . 21 2.3.5 Shock Compression of Reactive Powder Mixtures...is to evaluate the reaction initiation characteristics of quasi-statically compressed intermetallic-forming aluminum-based reactive materials upon

  3. Silent initial conditions for cosmological perturbations with a change of spacetime signature

    NASA Astrophysics Data System (ADS)

    Mielczarek, Jakub; Linsefors, Linda; Barrau, Aurelien

    Recent calculations in loop quantum cosmology suggest that a transition from a Lorentzian to a Euclidean spacetime might take place in the very early universe. The transition point leads to a state of silence, characterized by a vanishing speed of light. This behavior can be interpreted as a decoupling of different space points, similar to the one characterizing the BKL phase. In this study, we address the issue of imposing initial conditions for the cosmological perturbations at the transition point between the Lorentzian and Euclidean phases. Motivated by the decoupling of space points, initial conditions characterized by a lack of correlations are investigated. We show that the “white noise” gains some support from analysis of the vacuum state in the deep Euclidean regime. Furthermore, the possibility of imposing the silent initial conditions at the trans-Planckian surface, characterized by a vanishing speed for the propagation of modes with wavelengths of the order of the Planck length, is studied. Such initial conditions might result from the loop deformations of the Poincaré algebra. The conversion of the silent initial power spectrum to a scale-invariant one is also examined.

  4. PDC bits break ground with advanced vibration mitigation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    NONE

    1995-10-01

    Advancements in PDC bit technology have resulted in the identification and characterization of different types of vibrational modes that historically have limited PDC bit performance. As a result, concepts have been developed that prevent the initiation of vibration and also mitigate its damaging effects once it occurs. This vibration-reducing concept ensures more efficient use of the energy available to a PDC bit performance. As a result, concepts have been developed that prevent the imitation of vibration and also mitigate its damaging effects once it occurs. This vibration-reducing concept ensures more efficient use of the energy available to a PDC bit,more » thereby improving its performance. This improved understanding of the complex forces affecting bit performance is driving bit customization for specific drilling programs.« less

  5. NPSAT1 MEMS 3-AXIS Rate Sensor Suite Performance, Characterization, and Flight Unit Acceptance Testing

    DTIC Science & Technology

    2011-09-01

    magnetometer as the sensor, and the ACS controller. The magnetic control approach of NPSAT1 relies on favorable moments of inertia by optimum equipment...parallel with the HAAS rotational axis. To cancel the earth’s rotational effects, the turntable was tilted at -36.4° (accounts for the geocentric ...this initialization. 108 a. Gyro Bias Calibration from Three-Axis Magnetometer Measurements Reference [35] presents a real-time approach for gyro

  6. Power management and distribution technology

    NASA Astrophysics Data System (ADS)

    Dickman, John Ellis

    Power management and distribution (PMAD) technology is discussed in the context of developing working systems for a piloted Mars nuclear electric propulsion (NEP) vehicle. The discussion is presented in vugraph form. The following topics are covered: applications and systems definitions; high performance components; the Civilian Space Technology Initiative (CSTI) high capacity power program; fiber optic sensors for power diagnostics; high temperature power electronics; 200 C baseplate electronics; high temperature component characterization; a high temperature coaxial transformer; and a silicon carbide mosfet.

  7. Power management and distribution technology

    NASA Technical Reports Server (NTRS)

    Dickman, John Ellis

    1993-01-01

    Power management and distribution (PMAD) technology is discussed in the context of developing working systems for a piloted Mars nuclear electric propulsion (NEP) vehicle. The discussion is presented in vugraph form. The following topics are covered: applications and systems definitions; high performance components; the Civilian Space Technology Initiative (CSTI) high capacity power program; fiber optic sensors for power diagnostics; high temperature power electronics; 200 C baseplate electronics; high temperature component characterization; a high temperature coaxial transformer; and a silicon carbide mosfet.

  8. Determination of a Definition of Solar Grade Silicon

    NASA Technical Reports Server (NTRS)

    Hill, D. E.; Gutsche, H. W.

    1975-01-01

    A definition of solar grade silicon was determined by investigating the singular and the combined effect of the impurities usually found in metallurgical grade silicon on solar cell device performance. The impurity matrix was defined by Jet Propulsion Laboratory Technical Direction Memorandum. The initial work was focussed on standardizing the solar cell process and test procedure, growing baseline crystals, growing crystals contaminated with carbon, iron, nickel, zirconium, aluminum and vanadium, solar blank preparation, and material characterization.

  9. Contributions to the initial development of a microelectromechanical loop heat pipe, which is based on coherent porous silicon

    NASA Astrophysics Data System (ADS)

    Cytrynowicz, Debra G.

    The research project itself was the initiation of the development of a planar miniature loop heat pipe based on a capillary wick structure made of coherent porous silicon. Work on this project fell into four main categories, which were component fabrication, test system construction, characterization testing and test data collection, performance analysis and thermal modeling. Component fabrication involved the production of various components for the evaporator. When applicable, these components were to be produced by microelectronic and MEMS or microelectromechanical fabrication techniques. Required work involved analyses and, where necessary, modifications to the wafer processing sequence, the photo-electrochemical etching process, system and controlling computer program to make it more reliable, flexible and efficient. The development of more than one wick production process was also extremely necessary in the event of equipment failure. Work on developing this alternative also involved investigations into various details of the photo-electrochemical etching process itself. Test system construction involved the actual assembly of open and closed loop test systems. Characterization involved developing and administering a series of tests to evaluate the performance of the wicks and test systems. Although there were some indications that the devices were operating according to loop heat pipe theory, they were transient and unstable. Performance analysis involved the construction of a transparent evaporator, which enabled the visual observation of the phenomena, which occurred in the evaporator during operation. It also involved investigating the effect of the quartz wool secondary wick on the operation of the device. Observations made during the visualization study indicated that the capillary and boiling limits were being reached at extremely low values of input power. The work was performed in a collaborative effort between the Biomedical Nanotechnology Research Laboratory at the University of Toledo, the Center for Microelectronics and Sensors and MEMS at the University of Cincinnati and the Thermo-Mechanical Systems Branch of the Power and On-Board Propulsion Division at the John H. Glenn Research Center of the National Aeronautics and Space Administration in Cleveland, Ohio. Work on the project produced six publications, which presented various details on component fabrication, tests system construction and characterization and thermal modeling.

  10. Tics as an initial manifestation of juvenile Huntington's disease: case report and literature review.

    PubMed

    Cui, Shi-Shuang; Ren, Ru-Jing; Wang, Ying; Wang, Gang; Chen, Sheng-Di

    2017-08-08

    Huntington's disease (HD) is an autosomal dominant disorder, typically characterized by chorea due to a trinucleotide repeat expansion in the HTT gene, although the clinical manifestations of patients with juvenile HD (JHD) are atypical. A 17-year-old boy with initial presentation of tics attended our clinic and his DNA analysis demonstrated mutation in the HTT gene (49 CAG repeats). After treatment, his symptoms improved. Furthermore, we performed literature review through searching the databases and summarized clinical features in 33 JHD patients. The most prevalent symptoms are ataxia, and two cases reported that tics as initial and prominent manifestation in JHD. Among them, 88% patients carried CAG repeats beyond 60 and most of them have family history. This case here illustrates the variable range of clinical symptoms of JHD and the necessity of testing for the HD mutation in young patients with tics with symptoms unable to be explained by Tourette's syndrome (TS).

  11. Anthocyanin production in callus cultures of Cleome rosea: modulation by culture conditions and characterization of pigments by means of HPLC-DAD/ESIMS.

    PubMed

    Simões, Claudia; Brasil Bizarri, Carlos Henrique; da Silva Cordeiro, Lívia; Carvalho de Castro, Tatiana; Machado Coutada, Leonardo César; Ribeiro da Silva, Antônio Jorge; Albarello, Norma; Mansur, Elisabeth

    2009-10-01

    Leaf and stem explants of Cleome rosea formed calluses when cultured on MS medium supplemented with different concentrations of 2,4-dichlorophenoxyacetic acid (2,4-D) or 4-amino-3,5,6-trichloropicolinic acid (PIC). The highest biomass accumulation was obtained in the callus cultures initiated from stem explants on medium supplemented with 0.90 microM 2,4-D. Reddish-pink regions were observed on callus surface after 6-7 months in culture and these pigments were identified as anthocyanins. Anthocyanins production was enhanced by reducing temperature and increasing light irradiation. Pigmented calluses transferred to MS1/2 with a 1:4 ratio NH(4)(+)/NO(3)(-), 70 g L(-1) sucrose and supplementation with 0.90 microM 2,4-D maintained a high biomass accumulation and showed an increase of 150% on anthocyanin production as compared with the initial culture conditions. Qualitative analysis of calluses was performed by high performance liquid chromatography coupled to diode array detector and electrospray ionization mass spectrometry (HPLC-DAD/ESIMS). Eleven anthocyanins were characterized and the majority of them were identified as acylated cyanidins, although two peonidins were also detected. The major peak was composed by two anthocyanins, whose proposed identity were cyanidin 3-(p-coumaroyl) diglucoside-5-glucoside and cyanidin 3-(feruloyl) diglucoside-5-glucoside.

  12. Suomi NPP VIIRS spectral characterization: understanding multiple RSR releases

    NASA Astrophysics Data System (ADS)

    Moeller, Chris; McIntire, Jeff; Schwarting, Tom; Moyer, Dave; Costa, Juliette

    2012-09-01

    The Suomi National Polar-orbiting Partnership (S-NPP) satellite was successfully launched on October 28, 2011, beginning the on-orbit era of the Visible Infrared Imager Radiometer Suite (VIIRS). In support of atlaunch readiness, VIIRS underwent a rigorous pre-launch test program to characterize its spatial, radiometric, and spectral performance. Spectral measurements, the subject of this paper, were collected during instrument level testing at Raytheon Corp. (summer 2009), and then again in a special spectral test for VisNIR bands during spacecraft level testing at Ball Aerospace and Technologies Corp. (spring 2010). These spectral performance measurements were analyzed by industry (Northrop Grumman, NG) and by the Relative Spectral Response (RSR) subgroup of the Government team, (NASA, Aerospace Corp., MIT/Lincoln Lab, Univ. Wisconsin) leading to releases of the S-NPP VIIRS RSR characterization by both NG and the Government team. The NG RSR analysis was planned to populate the Look-Up-Tables (LUTs) that support the various VIIRS operational products, while the Government team analysis was initially intended as a verification of the NG RSR product as well as an early release RSR characterization for the science community's pre-launch application. While the Government team deemed the NG December 2010 RSR release as acceptable for the "at-launch" RSR characterization during the pre-launch phase, the Government team has now (post-launch checkout phase) recommended for using the NG October 2011 RSR release as an update for the LUTs used in VIIRS SDR and EDR operational processing. Meanwhile the Government team RSR releases remain available to the community for their investigative interests, and may evolve if new understanding of VIIRS spectral performance is revealed in the S-NPP post-launch era.

  13. Neural Correlates of Lyrical Improvisation: An fMRI Study of Freestyle Rap

    PubMed Central

    Liu, Siyuan; Chow, Ho Ming; Xu, Yisheng; Erkkinen, Michael G.; Swett, Katherine E.; Eagle, Michael W.; Rizik-Baer, Daniel A.; Braun, Allen R.

    2012-01-01

    The neural correlates of creativity are poorly understood. Freestyle rap provides a unique opportunity to study spontaneous lyrical improvisation, a multidimensional form of creativity at the interface of music and language. Here we use functional magnetic resonance imaging to characterize this process. Task contrast analyses indicate that improvised performance is characterized by dissociated activity in medial and dorsolateral prefrontal cortices, providing a context in which stimulus-independent behaviors may unfold in the absence of conscious monitoring and volitional control. Connectivity analyses reveal widespread improvisation-related correlations between medial prefrontal, cingulate motor, perisylvian cortices and amygdala, suggesting the emergence of a network linking motivation, language, affect and movement. Lyrical improvisation appears to be characterized by altered relationships between regions coupling intention and action, in which conventional executive control may be bypassed and motor control directed by cingulate motor mechanisms. These functional reorganizations may facilitate the initial improvisatory phase of creative behavior. PMID:23155479

  14. Neural correlates of lyrical improvisation: an FMRI study of freestyle rap.

    PubMed

    Liu, Siyuan; Chow, Ho Ming; Xu, Yisheng; Erkkinen, Michael G; Swett, Katherine E; Eagle, Michael W; Rizik-Baer, Daniel A; Braun, Allen R

    2012-01-01

    The neural correlates of creativity are poorly understood. Freestyle rap provides a unique opportunity to study spontaneous lyrical improvisation, a multidimensional form of creativity at the interface of music and language. Here we use functional magnetic resonance imaging to characterize this process. Task contrast analyses indicate that improvised performance is characterized by dissociated activity in medial and dorsolateral prefrontal cortices, providing a context in which stimulus-independent behaviors may unfold in the absence of conscious monitoring and volitional control. Connectivity analyses reveal widespread improvisation-related correlations between medial prefrontal, cingulate motor, perisylvian cortices and amygdala, suggesting the emergence of a network linking motivation, language, affect and movement. Lyrical improvisation appears to be characterized by altered relationships between regions coupling intention and action, in which conventional executive control may be bypassed and motor control directed by cingulate motor mechanisms. These functional reorganizations may facilitate the initial improvisatory phase of creative behavior.

  15. Characterization of Damage Progression in SCS-6/timetal 21S (0)4 Under Thermomechanical Fatigue Loadings

    NASA Technical Reports Server (NTRS)

    Castelli, Michael G.

    1994-01-01

    A detailed experimental investigation was performed at a single maximum cyclic stress (sigma max) level to physically characterize the progression of thermomechanical fatigue (lW) damage in continuously reinforced (0 deg) SCS-6/Timetal 21S, a titanium matrix composite. In-phase (IP) and out of-phase (OP) loadings were investigated at sigma max = 1000 MPa with a temperature cycle from 150 to 6500 C. Damage progression, in terms of macroscopic property degradation, was experimentally quantified through an advanced TMF test methodology which incorporates explicit measurements of the isothermal static moduli at the TMF temperature extremes and the coefficient of thermal expansion (CTE) as functions of the TMF cycles. Detailed characterization of the physical damage progression at the microstructural level was performed by interrupting multiple TMF tests at various stages of mechanical property degradation and analyzing the microstructure through extensive destructive metallography. Further, the extent of damage was also quantified through residual static strength measurements. Results indicated that damage initiation occurred very early in cyclic life (N less than 0.1Nf) for both the IP and OP TMF loadings. IP TMF damage was found to be dominated by fiber breakage with a physical damage progression in the microstructure which was difficult to quantify. OP TMF loadings produced matrix cracking exclusively associated with surface initiations. Here, damage progression was easily distinguished in terms of both the number of cracks and their relative inward progressions toward the outer fiber rows with increased cycling. The point at which the leading cracks reached the outer fiber rows (when localized fiber/matrix de-bonding and matrix crack bridging occurred) appeared to be reflected in the macroscopic property degradation curves.

  16. High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis.

    PubMed

    Meeske, Alexander J; Rodrigues, Christopher D A; Brady, Jacqueline; Lim, Hoong Chuin; Bernhardt, Thomas G; Rudner, David Z

    2016-01-01

    The differentiation of the bacterium Bacillus subtilis into a dormant spore is among the most well-characterized developmental pathways in biology. Classical genetic screens performed over the past half century identified scores of factors involved in every step of this morphological process. More recently, transcriptional profiling uncovered additional sporulation-induced genes required for successful spore development. Here, we used transposon-sequencing (Tn-seq) to assess whether there were any sporulation genes left to be discovered. Our screen identified 133 out of the 148 genes with known sporulation defects. Surprisingly, we discovered 24 additional genes that had not been previously implicated in spore formation. To investigate their functions, we used fluorescence microscopy to survey early, middle, and late stages of differentiation of null mutants from the B. subtilis ordered knockout collection. This analysis identified mutants that are delayed in the initiation of sporulation, defective in membrane remodeling, and impaired in spore maturation. Several mutants had novel sporulation phenotypes. We performed in-depth characterization of two new factors that participate in cell-cell signaling pathways during sporulation. One (SpoIIT) functions in the activation of σE in the mother cell; the other (SpoIIIL) is required for σG activity in the forespore. Our analysis also revealed that as many as 36 sporulation-induced genes with no previously reported mutant phenotypes are required for timely spore maturation. Finally, we discovered a large set of transposon insertions that trigger premature initiation of sporulation. Our results highlight the power of Tn-seq for the discovery of new genes and novel pathways in sporulation and, combined with the recently completed null mutant collection, open the door for similar screens in other, less well-characterized processes.

  17. High-Throughput Genetic Screens Identify a Large and Diverse Collection of New Sporulation Genes in Bacillus subtilis

    PubMed Central

    Brady, Jacqueline; Lim, Hoong Chuin; Bernhardt, Thomas G.; Rudner, David Z.

    2016-01-01

    The differentiation of the bacterium Bacillus subtilis into a dormant spore is among the most well-characterized developmental pathways in biology. Classical genetic screens performed over the past half century identified scores of factors involved in every step of this morphological process. More recently, transcriptional profiling uncovered additional sporulation-induced genes required for successful spore development. Here, we used transposon-sequencing (Tn-seq) to assess whether there were any sporulation genes left to be discovered. Our screen identified 133 out of the 148 genes with known sporulation defects. Surprisingly, we discovered 24 additional genes that had not been previously implicated in spore formation. To investigate their functions, we used fluorescence microscopy to survey early, middle, and late stages of differentiation of null mutants from the B. subtilis ordered knockout collection. This analysis identified mutants that are delayed in the initiation of sporulation, defective in membrane remodeling, and impaired in spore maturation. Several mutants had novel sporulation phenotypes. We performed in-depth characterization of two new factors that participate in cell–cell signaling pathways during sporulation. One (SpoIIT) functions in the activation of σE in the mother cell; the other (SpoIIIL) is required for σG activity in the forespore. Our analysis also revealed that as many as 36 sporulation-induced genes with no previously reported mutant phenotypes are required for timely spore maturation. Finally, we discovered a large set of transposon insertions that trigger premature initiation of sporulation. Our results highlight the power of Tn-seq for the discovery of new genes and novel pathways in sporulation and, combined with the recently completed null mutant collection, open the door for similar screens in other, less well-characterized processes. PMID:26735940

  18. Performance Evaluation of Titanium Ion Optics for the NASA 30 cm Ion Thruster

    NASA Technical Reports Server (NTRS)

    Soulas, George C.

    2001-01-01

    The results of performance tests with titanium ion optics were presented and compared to those of molybdenum ion optics. Both titanium and molybdenum ion optics were initially operated until ion optics performance parameters achieved steady state values. Afterwards, performance characterizations were conducted. This permitted proper performance comparisons of titanium and molybdenum ion optics. Ion optics' performance A,as characterized over a broad thruster input power range of 0.5 to 3.0 kW. All performance parameters for titanium ion optics of achieved steady state values after processing 1200 gm of propellant. Molybdenum ion optics exhibited no burn-in. Impingement-limited total voltages for titanium ion optics where up to 55 V greater than those for molybdenum ion optics. Comparisons of electron backstreaming limits as a function of peak beam current density for molybdenum and titanium ion optics demonstrated that titanium ion optics operated with a higher electron backstreaming limit than molybdenum ion optics for a given peak beam current density. Screen grid ion transparencies for titanium ion optics were as much as 3.8 percent lower than those for molybdenum ion optics. Beam divergence half-angles that enclosed 95 percent of the total beam current for titanium ion optics were within 1 to 3 deg. of those for molybdenum ion optics. All beam divergence thrust correction factors for titanium ion optics were within 1 percent of those with molybdenum ion optics.

  19. Performance capabilities of the 8-cm mercury ion thruster

    NASA Technical Reports Server (NTRS)

    Mantenieks, M. A.

    1981-01-01

    A preliminary characterization of the performance capabilities of the 8-cm thruster in order to initiate an evaluation of its application to LSS propulsion requirements is presented. With minor thruster modifications, the thrust was increased by about a factor of four while the discharge voltage was reduced from 39 to 22 volts. The thruster was operated over a range of specific impulse of 1950 to 3040 seconds and a maximum total efficiency of about 54 percent was attained. Preliminary analysis of component lifetimes, as determined by temperature and spectroscopic line intensity measurements, indicated acceptable thruster lifetimes are anticipated at the high power level operation.

  20. Lightweight nickel electrode for nickel hydrogen cells and batteries

    NASA Technical Reports Server (NTRS)

    Britton, D. L.

    1986-01-01

    The nickel electrode was identified as the heaviest component of the nickel hydrogen (NiH2) battery. The NASA Lewis Research Center is developing nickel electrodes for NiH2 battery devices which will be lighter in weight and have higher energy densities when cycled under a low Earth orbit regime at deep depths of discharge. Lightweight plaques are first exposed to 31 percent potassium hydroxide for 3 months to determine their suitability for use as electrode substrates from a chemical corrosion standpoint. Pore size distribution and porosity of the plaques are then measured. The lightweight plaques examined are nickel foam, nickel felt, nickel plastic and nickel plated graphite. Plaques are then electrochemically impregnated in an aqueous solution. Initial characterization tests of the impregnated plaques are performed at five discharge levels, C/2, 1.0 C, 1.37 C, 2.0C, and 2.74 C rates. Electrodes that passed the initial characterization screening test will be life cycle tested. Lightweight electrodes are approximately 30 to 50 percent lighter in weight than the sintered nickel electrode.

  1. Comparison of detonation spreading in pressed ultra-fine and nano-TATB

    NASA Astrophysics Data System (ADS)

    Olles, Joseph; Wixom, Ryan; Knepper, Robert; Yarrington, Cole; Patel, Rajen; Stepanov, Victor

    2017-06-01

    Detonation spreading behavior in insensitive high explosives is an important performance characteristic for initiation-train design. In the past, several variations of the floret test have been used to study this phenomenon. Commonly, dent blocks or multi-fiber optical probes were employed for reduced cost and complexity. We devised a floret-like test, using minimal explosive material, to study the detonation spreading in nano-TATB as compared to ultra-fine TATB. Our test uses a streak camera, combined with photonic Doppler velocimetry, to image the breakout timing and quantify the output particle velocity. The TATB acceptor pellets are initiated using an explosively-driven aluminum flyer with a well characterized velocity. We characterized the two types of TATB by assessing purity, particle morphology, and the microstructure of the consolidated pellets. Our results align with published data for ultra-fine TATB, however the nano-TATB shows a distinct difference where output has a strong dependence on density. The results indicate that control over pellet pore size and pressing density may be used to optimize detonation spreading behavior.

  2. A novel approach on accelerated ageing towards reliability optimization of high concentration photovoltaic cells

    NASA Astrophysics Data System (ADS)

    Tsanakas, John A.; Jaffre, Damien; Sicre, Mathieu; Elouamari, Rachid; Vossier, Alexis; de Salins, Jean-Edouard; Bechou, Laurent; Levrier, Bruno; Perona, Arnaud; Dollet, Alain

    2014-09-01

    This paper presents a preliminary study upon a novel approach proposed for highly accelerated ageing and reliability optimization of high concentrating photovoltaic (HCPV) cells and assemblies. The intended approach aims to overcome several limitations of some current accelerated ageing tests (AAT) adopted up today, proposing the use of an alternative experimental set-up for performing faster and more realistic thermal cycles, under real sun, without the involvement of environmental chamber. The study also includes specific characterization techniques, before and after each AAT sequence, which respectively provide the initial and final diagnosis on the condition of the tested sample. The acquired data from these diagnostic/characterization methods are then used as indices to determine both quantitatively and qualitatively the severity of degradation and, thus, the ageing level for each tested HCPV assembly or cell sample. Ultimate goal of such "initial diagnosis - AAT - final diagnosis" sequences is to provide the basis for a future work on the reliability analysis of the main degradation mechanisms and confident prediction of failure propagation in HCPV cells, by means of acceleration factor (AF) and mean-time-to-failure (MTTF) estimations.

  3. Development of a custom-designed echo particle image velocimetry system for multi-component hemodynamic measurements: system characterization and initial experimental results

    NASA Astrophysics Data System (ADS)

    Liu, Lingli; Zheng, Hairong; Williams, Logan; Zhang, Fuxing; Wang, Rui; Hertzberg, Jean; Shandas, Robin

    2008-03-01

    We have recently developed an ultrasound-based velocimetry technique, termed echo particle image velocimetry (Echo PIV), to measure multi-component velocity vectors and local shear rates in arteries and opaque fluid flows by identifying and tracking flow tracers (ultrasound contrast microbubbles) within these flow fields. The original system was implemented on images obtained from a commercial echocardiography scanner. Although promising, this system was limited in spatial resolution and measurable velocity range. In this work, we propose standard rules for characterizing Echo PIV performance and report on a custom-designed Echo PIV system with increased spatial resolution and measurable velocity range. Then we employed this system for initial measurements on tube flows, rotating flows and in vitro carotid artery and abdominal aortic aneurysm (AAA) models to acquire the local velocity and shear rate distributions in these flow fields. The experimental results verified the accuracy of this technique and indicated the promise of the custom Echo PIV system in capturing complex flow fields non-invasively.

  4. Per-oral endoscopic myotomy for achalasia: An American perspective

    PubMed Central

    Friedel, David; Modayil, Rani; Iqbal, Shahzad; Grendell, James H; Stavropoulos, Stavros N

    2013-01-01

    Achalasia is an uncommon esophageal motility disorder characterized by the selective loss of enteric neurons leading to absence of peristalsis and impaired relaxation of the lower esophageal sphincter. Per-oral endoscopic myotomy (POEM) is a novel modality for the treatment of achalasia performed by gastroenterologists and surgeons. It represents a natural orifice transluminal endoscopic surgery (NOTES) approach to Heller myotomy. POEM has the minimal invasiveness of an endoscopic procedure that can duplicate results of the surgical Heller myotomy. POEM is conceptually similar to a surgical myotomy without the inherent external incisions and post-operative care associated with surgery. Initial high success and low complications rates promise a great future for this technique. In fact, POEM has been successfully performed on patients with end-stage achalasia as an initial treatment reserving esophagectomy for those without good response. The volume of POEMs performed worldwide has grown exponentially. In fact, surgeons who have performed Heller myotomy have embraced POEM as the preferred intervention for achalasia. However, the niche of POEM remains to be defined and long term results are awaited. We describe our experience with POEM having performed the first POEM outside of Japan in 2009, the evolution of our technique, and give our perspective on its future. PMID:24044040

  5. Performance of a commercial industrial-scale UF-based process for treatment of oily wastewaters.

    PubMed

    Karhu, M; Kuokkanen, T; Rämö, J; Mikola, M; Tanskanen, J

    2013-10-15

    An evaluation was made of the performance of a commercial industrial-scale ultrafiltration (UF)-based process for treatment of highly concentrated oily wastewaters. Wastewater samples were gathered from two plants treating industrial wastewaters in 2008, and in 2011 (only from one of the plants), from three points of a UF-based treatment train. The wastewater samples were analyzed by measuring the BOD7, COD, TOC and total surface charge (TSC). The inorganic content and zeta potentials of the samples were analyzed and GC-FID/MS analyses were performed. The removal performances of BOD7, COD, TOC and TSC in 2008 and 2011 for both plants were very high. Initial concentrations of contaminants in 2011 were lower than in 2008, therefore the COD and TSC reductions were also lower in 2011 than three years before. Regardless of the high performance of UF-based processes in both plants, at times the residual concentrations were considerable. This could be explained by the high initial concentrations and also by the presence of the dissolved compounds that were characterized. Linear correlation was observed between COD and TOC, and between COD and TSC. The correlation between COD and TSC could be utilized for process control purposes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Characterization and development of materials for advanced textile composites

    NASA Technical Reports Server (NTRS)

    Hartness, J. Timothy; Greene, Timothy L.; Taske, Leo E.

    1993-01-01

    Work ongoing under the NASA Langley - Advanced Composite Technology (ACT) program is discussed. The primary emphasis of the work centers around the development and characterization of graphite fiber that has been impregnated with an epoxy powder. Four epoxies have been characterized in towpreg form as to their weaveability and braidability. Initial mechanical properties have been generated on each resin system. These include unidirectional as well as 8-harness satin cloth. Initial 2D and 3D weaving and braiding trials will be reported on as well as initial efforts to develop towpreg suitable for advanced tow placement.

  7. Assessment of Various Low Temperature Electrolytes in Prototype Li-Ion Cells Developed for ESMD Applications

    NASA Technical Reports Server (NTRS)

    Smart, M. C.; Ratnakumar, B. V.; Whitcanack, L. D.

    2008-01-01

    Due to their attractive properties and proven success, Li-ion batteries have become identified as the battery chemistry of choice for a number of future NASA missions. A number of these applications would be greatly benefited by improved performance of Li-ion technology over a wider operating temperature range, especially at low temperatures, such as future ESMD missions. In many cases, these technology improvements may be mission enabling, and at the very least mission enhancing. In addition to aerospace applications, the DoE has interest in developing advanced Li-ion batteries that can operate over a wide temperature range to enable terrestrial HEV applications. Thus, our focus at JPL in recent years has been to extend the operating temperature range of Li-ion batteries, especially at low temperatures. To accomplish this, the main focus of the research has been devoted to developing improved lithium-ion conducting electrolytes. In the present paper, we would like to present some of the results we have obtained with six different ethylene carbonate-based electrolytes optimized for low temperature. In addition to investigating the behavior in experimental cells initially, the performance of these promising low temperature electrolytes was demonstrated in large capacity, aerospace quality Li-ion prototype cells, manufactured by Yardney Technical Products and Saft America, Inc. These cells were subjected to a number of performance tests, including discharge rate characterization, charge rate characterization, cycle life performance at various temperatures, and power characterization tests.

  8. Demonstration of innovative monitoring technologies at the Savannah River Integrated Demonstration Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rossabi, J.; Jenkins, R.A.; Wise, M.B.

    1993-12-31

    The Department of Energy`s Office of Technology Development initiated an Integrated Demonstration Program at the Savannah River Site in 1989. The objective of this program is to develop, demonstrate, and evaluate innovative technologies that can improve present-day environmental restoration methods. The Integrated Demonstration Program at SRS is entitled ``Cleanup of Organics in Soils and Groundwater at Non-Arid Sites.`` New technologies in the areas of drilling, characterization, monitoring, and remediation are being demonstrated and evaluated for their technical performance and cost effectiveness in comparison with baseline technologies. Present site characterization and monitoring methods are costly, time-consuming, overly invasive, and often imprecise.more » Better technologies are required to accurately describe the subsurface geophysical and geochemical features of a site and the nature and extent of contamination. More efficient, nonintrusive characterization and monitoring techniques are necessary for understanding and predicting subsurface transport. More reliable procedures are also needed for interpreting monitoring and characterization data. Site characterization and monitoring are key elements in preventing, identifying, and restoring contaminated sites. The remediation of a site cannot be determined without characterization data, and monitoring may be required for 30 years after site closure.« less

  9. Single Molecule Analysis of Replicated DNA Reveals the Usage of Multiple KSHV Genome Regions for Latent Replication

    PubMed Central

    Verma, Subhash C.; Lu, Jie; Cai, Qiliang; Kosiyatrakul, Settapong; McDowell, Maria E.; Schildkraut, Carl L.; Robertson, Erle S.

    2011-01-01

    Kaposi's sarcoma associated herpesvirus (KSHV), an etiologic agent of Kaposi's sarcoma, Body Cavity Based Lymphoma and Multicentric Castleman's Disease, establishes lifelong latency in infected cells. The KSHV genome tethers to the host chromosome with the help of a latency associated nuclear antigen (LANA). Additionally, LANA supports replication of the latent origins within the terminal repeats by recruiting cellular factors. Our previous studies identified and characterized another latent origin, which supported the replication of plasmids ex-vivo without LANA expression in trans. Therefore identification of an additional origin site prompted us to analyze the entire KSHV genome for replication initiation sites using single molecule analysis of replicated DNA (SMARD). Our results showed that replication of DNA can initiate throughout the KSHV genome and the usage of these regions is not conserved in two different KSHV strains investigated. SMARD also showed that the utilization of multiple replication initiation sites occurs across large regions of the genome rather than a specified sequence. The replication origin of the terminal repeats showed only a slight preference for their usage indicating that LANA dependent origin at the terminal repeats (TR) plays only a limited role in genome duplication. Furthermore, we performed chromatin immunoprecipitation for ORC2 and MCM3, which are part of the pre-replication initiation complex to determine the genomic sites where these proteins accumulate, to provide further characterization of potential replication initiation sites on the KSHV genome. The ChIP data confirmed accumulation of these pre-RC proteins at multiple genomic sites in a cell cycle dependent manner. Our data also show that both the frequency and the sites of replication initiation vary within the two KSHV genomes studied here, suggesting that initiation of replication is likely to be affected by the genomic context rather than the DNA sequences. PMID:22072974

  10. Acute diarrhoea due to a Shiga toxin 2e-producing Escherichia coli O8 : H19

    PubMed Central

    Saupe, Angela; Edel, Birgit; Pfister, Wolfgang; Löffler, Bettina; Ehricht, Ralf

    2017-01-01

    Introduction. Identification of non-O157 Shiga-toxin-producing Escherichia coli (STEC) infections may be underestimated in microbiological diagnosis. Case presentation. A 58-year-old woman developed diarrhoea with watery and subsequently mucous stool. Initial multiplex PCR testing revealed a positive result for stx2. Culture isolation of a STEC was successful only after repeated inoculation of chromogenic E. coli media. Molecular characterization was performed and identified the isolate as stx 2e-positive STEC of serotype O8 : H19. The strain harboured lpfA, but not eae. Conclusion. This case highlights the usefulness of initial multiplex PCR for diagnosis of non-O157 STEC infection. PMID:29026626

  11. Application of ground-penetrating radar at McMurdo Station, Antarctica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stefano, J.E.

    1992-05-01

    Argonne National Laboratory initiated a site investigation program at McMurdo Station, Antarctica, to characterize environmental contamination. The performance and usefulness of ground-penetrating radar (GPR) was evaluated under antarctic conditions during the initial site investigation in January 1991. Preliminary surveys were successful in defining the contact between reworked pyroclastic material and in the prefill, undisturbed pyroclastics and basalts at some sites. Interference from radio traffic at McMurdo Station was not observed, but interference was a problem in work with unshielded antennas near buildings. In general, the results of this field test suggest that high-quality, high-resolution, continuous subsurface profiles can be producedmore » with GPR over most of McMurdo Station.« less

  12. Application of ground-penetrating radar at McMurdo Station, Antarctica

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stefano, J.E.

    1992-01-01

    Argonne National Laboratory initiated a site investigation program at McMurdo Station, Antarctica, to characterize environmental contamination. The performance and usefulness of ground-penetrating radar (GPR) was evaluated under antarctic conditions during the initial site investigation in January 1991. Preliminary surveys were successful in defining the contact between reworked pyroclastic material and in the prefill, undisturbed pyroclastics and basalts at some sites. Interference from radio traffic at McMurdo Station was not observed, but interference was a problem in work with unshielded antennas near buildings. In general, the results of this field test suggest that high-quality, high-resolution, continuous subsurface profiles can be producedmore » with GPR over most of McMurdo Station.« less

  13. Effects of ultrasonic treatment on zeolite NaA synthesized from by-product silica.

    PubMed

    Vaičiukynienė, Danutė; Kantautas, Aras; Vaitkevičius, Vitoldas; Jakevičius, Leonas; Rudžionis, Žymantas; Paškevičius, Mantas

    2015-11-01

    The synthesis of zeolite NaA from silica by-product was carried out in the presence of 20 kHz ultrasound at room temperature. Zeolites obtained in this type of synthesis were compared to zeolites obtained by performing conventional static syntheses under similar conditions. The sonication effects on zeolite NaA synthesis were characterized by phase identification, crystallinity etc. The effects of different parameters such as crystallization time and initial materials preparation methods on the crystallinity and morphology of the synthesized zeolites were investigated. The final products were characterized by XRD and FT-IR. It was possible to obtain crystalline zeolite NaA from by-product silica in the presence of ultrasound. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Evaluating surveillance indicators supporting the Global Polio Eradication Initiative, 2011-2012.

    PubMed

    2013-04-12

    The Global Polio Eradication Initiative (GPEI) was established in 1988 by the World Health Assembly to interrupt transmission of wild poliovirus (WPV); completion of this initiative was declared a programmatic emergency of public health in January 2012. Polio cases are detected through surveillance for acute flaccid paralysis (AFP) with linked stool specimens tested for polioviruses (PVs) at accredited laboratories within the Global Polio Laboratory Network (GPLN). AFP surveillance findings are supplemented by testing sewage samples (environmental surveillance) collected at selected sites. Virologic data guide where targeted immunization activities should be conducted or improved. Key performance indicators are used to 1) monitor AFP surveillance quality at national and subnational levels to identify gaps where PV transmission could occur undetected; 2) provide evidence of where PV circulation has been interrupted; and 3) allow timely detection of an outbreak. Standardized surveillance indicators allow progress to be monitored over time and compared among countries. This report presents AFP surveillance performance indicators at national and subnational levels for countries affected by polio during 2011-2012, and trends in environmental surveillance, updating previous reports. In the 19 countries with transmission of PV (WPV and/or circulating vaccine-derived poliovirus [cVDPV]) during 2011-2012, national performance indicator targets were met in 12 (63%) countries in 2011 and 13 (68%) countries in 2012. Seven countries (37%) in 2011 had ≥80% of the population living in areas meeting performance indicators, increasing to nine countries (47%) in 2012. Performance indicators for timely reporting of PV isolation and characterization were met in four of six World Health Organization (WHO) regions in 2011 and five regions in 2012. To achieve global polio eradication, efforts are needed to improve and maintain AFP surveillance and laboratory performance.

  15. Performance Characterization of High Energy Commercial Lithium-ion Cells

    NASA Technical Reports Server (NTRS)

    Schneidegger, Brianne T.

    2010-01-01

    The NASA Glenn Research Center Electrochemistry Branch performed characterization of commercial lithium-ion cells to determine the cells' performance against Exploration Technology Development Program (ETDP) Key Performance Parameters (KPP). The goals of the ETDP Energy Storage Project require significant improvements in the specific energy of lithium-ion technology over the state-of-the-art. This work supports the high energy cell development for the Constellation customer Lunar Surface Systems (LSS). In support of these goals, testing was initiated in September 2009 with high energy cylindrical cells obtained from Panasonic and E-One Moli. Both manufacturers indicated the capability of their cells to deliver specific energy of at least 180 Wh/kg or higher. Testing is being performed at the NASA Glenn Research Center to evaluate the performance of these cells under temperature, rate, and cycling conditions relevant to the ETDP goals for high energy cells. The cell-level specific energy goal for high energy technology is 180 Wh/kg at a C/10 rate and 0 C. The threshold value is 165 Wh/kg. The goal is to operate for at least 2000 cycles at 100 percent DOD with greater than 80 percent capacity retention. The Panasonic NCR18650 cells were able to deliver nearly 200 Wh/kg at the aforementioned conditions. The E-One Moli ICR18650J cells also met the specific energy goal by delivering 183 Wh/kg. Though both cells met the goal for specific energy, this testing was only one portion of the testing required to determine the suitability of commercial cells for the ETDP. The cells must also meet goals for cycle life and safety. The results of this characterization are summarized in this report.

  16. Relationship between Weather, Traffic and Delay Based on Empirical Methods

    NASA Technical Reports Server (NTRS)

    Sridhar, Banavar; Swei, Sean S. M.

    2006-01-01

    The steady rise in demand for air transportation over the years has put much emphasis on the need for sophisticated air traffic flow management (TFM) within the National Airspace System (NAS). The NAS refers to hardware, software and people, including runways, radars, networks, FAA, airlines, etc., involved in air traffic management (ATM) in the US. One of the metrics that has been used to assess the performance of NAS is the actual delays provided through FAA's Air Traffic Operations Network (OPSNET). The OPSNET delay data includes those reportable delays, i.e. delays of 15 minutes or more experienced by Instrument Flight Rule (IFR) flights, submitted by the FAA facilities. These OPSNET delays are caused by the application of TFM initiatives in response to, for instance, weather conditions, increased traffic volume, equipment outages, airline operations, and runway conditions. TFM initiatives such as, ground stops, ground delay programs, rerouting, airborne holding, and miles-in-trail restrictions, are actions which are needed to control the air traffic demand to mitigate the demand-capacity imbalance due to the reduction in capacity. Consequently, TFM initiatives result in NAS delays. Of all the causes, weather has been identified as the most important causal factor for NAS delays. Therefore, in order to accurately assess the NAS performance, it has become necessary to create a baseline for NAS performance and establish a model which characterizes the relation between weather and NAS delays.

  17. Vapor Compression Distillation Subsystem (VCDS) component enhancement, testing and expert fault diagnostics development, volume 1

    NASA Technical Reports Server (NTRS)

    Kovach, L. S.; Zdankiewicz, E. M.

    1987-01-01

    Vapor compression distillation technology for phase change recovery of potable water from wastewater has evolved as a technically mature approach for use aboard the Space Station. A program to parametrically test an advanced preprototype Vapor Compression Distillation Subsystem (VCDS) was completed during 1985 and 1986. In parallel with parametric testing, a hardware improvement program was initiated to test the feasibility of incorporating several key improvements into the advanced preprototype VCDS following initial parametric tests. Specific areas of improvement included long-life, self-lubricated bearings, a lightweight, highly-efficient compressor, and a long-life magnetic drive. With the exception of the self-lubricated bearings, these improvements are incorporated. The advanced preprototype VCDS was designed to reclaim 95 percent of the available wastewater at a nominal water recovery rate of 1.36 kg/h achieved at a solids concentration of 2.3 percent and 308 K condenser temperature. While this performance was maintained for the initial testing, a 300 percent improvement in water production rate with a corresponding lower specific energy was achieved following incorporation of the improvements. Testing involved the characterization of key VCDS performance factors as a function of recycle loop solids concentration, distillation unit temperature and fluids pump speed. The objective of this effort was to expand the VCDS data base to enable defining optimum performance characteristics for flight hardware development.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu, Weikuan; Vetter, Jeffrey S

    Parallel NFS (pNFS) is touted as an emergent standard protocol for parallel I/O access in various storage environments. Several pNFS prototypes have been implemented for initial validation and protocol examination. Previous efforts have focused on realizing the pNFS protocol to expose the best bandwidth potential from underlying file and storage systems. In this presentation, we provide an initial characterization of two pNFS prototype implementations, lpNFS (a Lustre-based parallel NFS implementation) and spNFS (another reference implementation from Network Appliance, Inc.). We show that both lpNFS and spNFS can faithfully achieve the primary goal of pNFS, i.e., aggregating I/O bandwidth from manymore » storage servers. However, they both face the challenge of scalable metadata management. Particularly, the throughput of sp-NFS metadata operations degrades significanlty with an increasing number of data servers. Even for the better-performing lpNFS, we discuss its architecture and propose a direct I/O request flow protocol to improve its performance.« less

  19. Multijunction Solar Cell Technology for Mars Surface Applications

    NASA Technical Reports Server (NTRS)

    Stella, Paul M.; Mardesich, Nick; Ewell, Richard C.; Mueller, Robert L.; Endicter, Scott; Aiken, Daniel; Edmondson, Kenneth; Fetze, Chris

    2006-01-01

    Solar cells used for Mars surface applications have been commercial space qualified AM0 optimized devices. Due to the Martian atmosphere, these cells are not optimized for the Mars surface and as a result operate at a reduced efficiency. A multi-year program, MOST (Mars Optimized Solar Cell Technology), managed by JPL and funded by NASA Code S, was initiated in 2004, to develop tools to modify commercial AM0 cells for the Mars surface solar spectrum and to fabricate Mars optimized devices for verification. This effort required defining the surface incident spectrum, developing an appropriate laboratory solar simulator measurement capability, and to develop and test commercial cells modified for the Mars surface spectrum. This paper discusses the program, including results for the initial modified cells. Simulated Mars surface measurements of MER cells and Phoenix Lander cells (2007 launch) are provided to characterize the performance loss for those missions. In addition, the performance of the MER rover solar arrays is updated to reflect their more than two (2) year operation.

  20. High Fidelity Thermal Simulators for Non-Nuclear Testing: Analysis and Initial Results

    NASA Technical Reports Server (NTRS)

    Bragg-Sitton, Shannon M.; Dickens, Ricky; Dixon, David

    2007-01-01

    Non-nuclear testing can be a valuable tool in the development of a space nuclear power system, providing system characterization data and allowing one to work through various fabrication, assembly and integration issues without the cost and time associated with a full ground nuclear test. In a non-nuclear test bed, electric heaters are used to simulate the heat from nuclear fuel. Testing with non-optimized heater elements allows one to assess thermal, heat transfer, and stress related attributes of a given system, but fails to demonstrate the dynamic response that would be present in an integrated, fueled reactor system. High fidelity thermal simulators that match both the static and the dynamic fuel pin performance that would be observed in an operating, fueled nuclear reactor can vastly increase the value of non-nuclear test results. With optimized simulators, the integration of thermal hydraulic hardware tests with simulated neutronie response provides a bridge between electrically heated testing and fueled nuclear testing, providing a better assessment of system integration issues, characterization of integrated system response times and response characteristics, and assessment of potential design improvements' at a relatively small fiscal investment. Initial conceptual thermal simulator designs are determined by simple one-dimensional analysis at a single axial location and at steady state conditions; feasible concepts are then input into a detailed three-dimensional model for comparison to expected fuel pin performance. Static and dynamic fuel pin performance for a proposed reactor design is determined using SINDA/FLUINT thermal analysis software, and comparison is made between the expected nuclear performance and the performance of conceptual thermal simulator designs. Through a series of iterative analyses, a conceptual high fidelity design can developed. Test results presented in this paper correspond to a "first cut" simulator design for a potential liquid metal (NaK) cooled reactor design that could be applied for Lunar surface power. Proposed refinements to this simulator design are also presented.

  1. Characterization of Sweetmeat Waste and Its Suitability for Sorption of As(III) in Aqueous Media.

    PubMed

    Islam, Md Mirajul; Adak, Asok; Paul, Prabir K

    2017-04-01

      Presence of arsenic in effluents from mining, mineral processing, and metal plating industries pose a serious health hazard to human beings. In this research, suitability of cheap sweetmeat waste (SMW), which is sweet industry byproduct, was investigated for the treatment of As(III). The physicochemical properties of the sorbent were characterized. The SEM images revealed highly heterogeneous sorbent surface. XRD analysis showed the presence of different polysaccharides mainly containing hydroxyl functional group. FTIR analysis was also performed to confirm the functional groups present in the sorbent. Batch experiments were conducted for kinetic analysis, effect of initial As(III) concentration, sorbent dose, electrolytes, pH, and temperature in order to understand sorption behavior. Presence of electrolyte, solution pH, and temperature were found to affect the performance of the sorbent. The sorption followed pseudo-second order reaction and Langmuir isotherm model best. The studies revealed SMW to be an efficient media for removal of As(III) from aqueous environment.

  2. Ignition characterization of LOX/hydrocarbon propellants

    NASA Technical Reports Server (NTRS)

    Lawver, B. R.; Rousar, D. C.; Wong, K. Y.

    1985-01-01

    The results of an evaluation of the ignition characteristics of the gaseous oxygen (Gox)/Ethanol propellant combination are presented. Ignition characterization was accomplished through the analysis, design, fabrication and testing of a spark initiated torch igniter and prototype 620 lbF thruster/igniter assembly. The igniter was tested over a chamber pressure range of 74 to 197 psia and mixture ratio range of 0.778 to 3.29. Cold (-92 to -165 F) and ambient (44 to 80 F) propellant temperatures were used. Spark igniter ignition limits and thruster steady state and pulse mode, performance, cooling and stability data are presented. Spark igniter ignition limits are presented in terms of cold flow pressure, ignition chamber diameter and mixture ratio. Thruster performance is presented in terms of vacuum specific impulse versus engine mixture ratio. Gox/Ethanol propellants were shown to be ignitable over a wide range of mixture ratios. Cold propellants were shown to have a minor effect on igniter ignition limits. Thruster pulse mode capability was demonstrated with multiple pulses of 0.08 sec duration and less.

  3. SiC Fibers and SiCf/SiC Ceramic Matrix Minicomposites Damage Behavior

    NASA Technical Reports Server (NTRS)

    Almansour, Amjad S.

    2017-01-01

    Silicon Carbide based Ceramic Matrix Composites (CMCs) are attractive materials for use in high-temperature applications in the aerospace industry. Performance and durability of CMCs depend on the properties of its constituents such as fibers and matrix. Therefore, CMCs constituents limitations and damage mechanisms are discussed and characterized in representative simulated application conditions and dominant damage mechanisms are identified at elevated temperatures. In this work, the initiation and evolution of damage in Hi-Nicalon type S fiber-reinforced minicomposites with different interphases thicknesses from different manufacturers were investigated employing several nondestructive evaluation techniques such as acoustic emission, electrical resistance and microscopy. Moreover, the tensile creep behavior of single Hi-Nicalon Type S SiC fibers were tested and characterized and creep parameters were extracted. Fibers creep tests were performed in air or vacuum at 1200-1482 C under high stresses. Creep parameters was then used in understanding load sharing and lifing of ceramic matrix minicomposites. Future work plans will be reviewed.

  4. Sintered Cathodes for All-Solid-State Structural Lithium-Ion Batteries

    NASA Technical Reports Server (NTRS)

    Huddleston, William; Dynys, Frederick; Sehirlioglu, Alp

    2017-01-01

    All-solid-state structural lithium ion batteries serve as both structural load-bearing components and as electrical energy storage devices to achieve system level weight savings in aerospace and other transportation applications. This multifunctional design goal is critical for the realization of next generation hybrid or all-electric propulsion systems. Additionally, transitioning to solid state technology improves upon battery safety from previous volatile architectures. This research established baseline solid state processing conditions and performance benchmarks for intercalation-type layered oxide materials for multifunctional application. Under consideration were lithium cobalt oxide and lithium nickel manganese cobalt oxide. Pertinent characteristics such as electrical conductivity, strength, chemical stability, and microstructure were characterized for future application in all-solid-state structural battery cathodes. The study includes characterization by XRD, ICP, SEM, ring-on-ring mechanical testing, and electrical impedance spectroscopy to elucidate optimal processing parameters, material characteristics, and multifunctional performance benchmarks. These findings provide initial conditions for implementing existing cathode materials in load bearing applications.

  5. Comparison of RF BPM Receivers for NSLS-II Project

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pinayev,I.; Singh, O.

    2009-05-04

    The NSLS-II Light Source being built at Brookhaven National Laboratory requires submicron stability of the electron orbit in the storage ring in order to utilize fully very small emittances and electron beam sizes. This sets high stability requirements for beam position monitors and a program has been initiated for the purpose of characterizing RF beam position monitor (BPM) receivers in use at other light sources. Present state-of-the-art performance will be contrasted with more recently available technologies.

  6. Microwave Interferometry (90 GHz) for Hall Thruster Plume Density Characterization

    DTIC Science & Technology

    2005-06-01

    Hall thruster . The interferometer has been modified to overcome initial difficulties encountered during the preliminary testing. The modifications include the ability to perform remote and automated calibrations as well as an aluminum enclosure to shield the interferometer from the Hall thruster plume. With these modifications, it will be possible to make unambiguous electron density measurements of the thruster plume as well as to rapidly and automatically calibrate the interferometer to eliminate the effects of signal drift. Due to the versatility

  7. A Literature Review of Musculoskeletal Injuries to the Human Neck and the Effects of Head-Supported Mass Worn by Soldier

    DTIC Science & Technology

    2005-10-01

    in whiplash -type injury studies (Table 1). At the time it was the most sophisticated head - neck model available. This model uses a series of rigid...phase of rear-end whiplash loading (i.e. the extension phase). In this initial phase, the head translates backward, putting the upper spine in local...work to characterize neck response in impact scenarios has been performed, the effect of musculature on head -neck whiplash -type response is still

  8. The Isolation and Characterization of Human Prostate Cancer Stem Cells

    DTIC Science & Technology

    2015-05-01

    GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance

  9. Initial Closed Operation of the CELSS Test Facility Engineering Development Unit

    NASA Technical Reports Server (NTRS)

    Kliss, Mark

    1995-01-01

    As part of the NASA Controlled Ecological Life Support System (CELSS) Program, a CELSS Test Facility (CTF) is being planned for installation on the Space Station. The CTF will be used to provide data on the productivity and efficiency of a variety of CELSS higher plant crops grown sequentially from seed to harvest in the microgravity environment of the Space Station. Stringent environmental control will be maintained while fundamental crop productivity issues, such as carbon dioxide uptake and oxygen production rates, water transpiration rates, and biomass accumulation rates are obtained for comparison with ground-based data. In order to obtain an early realistic determination of the subsystem and system requirements necessary to provide the appropriate environmental conditions specified for CTF crop productivity experiments, an Engineering Development Unit (EDU) has been constructed and is undergoing initial operational testing at NASA Ames Research Center. The EDU is a ground-based testbed which will be used to characterize the integrated performance of major subsystem technologies, to evaluate hardware candidates and control strategies required for the CTF, and to further define the ability to meet CTF requirements within present Space Station constraints. This paper describes the initial closed operational testing of the EDU. Measured performance data are compared with the specified functional requirements and results from initial closed testing are presented. Plans for future science and technology testing are discussed.

  10. Evaluation of the Operational Multi-scale Environment model with Grid Adaptivity (OMEGA) for use in Wind Energy Applications in the Great Basin of Nevada

    NASA Astrophysics Data System (ADS)

    King, Kristien C.

    In order to further assess the wind energy potential for Nevada, the accuracy of a computational meteorological model, the Operational Multi-scale Environment model with Grid Adaptivity (OMEGA), was evaluated by comparing simulation results with data collected from a wind monitoring tower near Tonopah, NV. The state of Nevada is characterized by high mountains and low-lying valleys, therefore, in order to determine the wind potential for the state, meteorological models that predict the wind must be able to accurately represent and account for terrain features and simulate topographic forcing with accuracy. Topographic forcing has a dominant role in the development and modification of mesoscale flows in regions of complex terrain, like Tonopah, especially at the level of wind turbine blade heights (~80 m). Additionally, model factors such as horizontal resolution, terrain database resolution, model physics, time of model initialization, stability regime, and source of initial conditions may each affect the ability of a mesoscale model to forecast winds correctly. The observational tower used for comparison was located at Stone Cabin, Nevada. The tower had both sonic anemometers and cup anemometers installed at heights of 40 m, 60 m, and 80 m above the surface. During a previous experiment, tower data were collected for the period February 9 through March 10, 2007 and compared to model simulations using the MM5 and WRF models at a number of varying horizontal resolutions. In this previous research, neither the MM5 nor the WRF showed a significant improvement in ability to forecast wind speed with increasing horizontal grid resolution. The present research evaluated the ability of OMEGA to reproduce point winds as compared to the observational data from the Stone Cabin Tower at heights of 40 m, 60 m, and 80 m. Unlike other mesoscale atmospheric models, OMEGA incorporates an unstructured triangular adaptive grid which allows for increased flexibility and accuracy in characterizing areas of complex terrain. Model sensitivity to horizontal grid resolution, initial conditions, and time of initialization were tested. OMEGA was run over three different horizontal grid resolutions with minimum horizontal edge lengths of: 18 km, 6 km, and 2 km. For each resolution, the model was initialized using both the Global Forecasting System (GFS) and North American Regional Reanalysis (NARR) to determine model sensitivity to initial conditions. For both the NARR and GFS initializations, the model was started at both 0000 UTC and 1200 UTC to determine the effect of start time and stability regime on the performance of the model. An additional intensive study into the model's performance was also conducted by a detailed evaluation of model results during two separate 24-hour periods, the first a period where the model performed well and the second a period where the model performed poorly, to determine which atmospheric factors most affect the predictive ability of the OMEGA model. The statistical results were then compared with the results from the MM5 and WRF simulations to determine the most appropriate model for wind energy potential studies in complex terrain.

  11. Morphology and kinetics of crystals growth in amorphous films of Cr2O3, deposited by laser ablation

    NASA Astrophysics Data System (ADS)

    Bagmut, Aleksandr

    2018-06-01

    An electron microscopic investigation was performed on the structure and kinetics of the crystallization of amorphous Cr2O3 films, deposited by pulsed laser sputtering of chromium target in an oxygen atmosphere. The crystallization was initiated by the action of an electron beam on an amorphous film in the column of a transmission electron microscope. The kinetic curves were plotted on the basis of a frame-by-frame analysis of the video recorded during the crystallization of the film. It was found that the amorphous phase - crystal phase transition in Cr2O3 films occurs as a layer polymorphic crystallization and is characterized by the values of the dimensionless relative length unit δ0 ≈ 2000-3100. The action of the electron beam initiates the formation of crystals of two basic morphological forms: disk-shaped and sickle-shaped. Growth of a disk-shaped crystals is characterized by a constant rate v and the quadratic dependence of the fraction of the crystalline phase x on the time t. Sickle-shaped crystal at an initial stage, as it grows, becomes as ring-shaped and disk-shaped crystal. The growth of a sickle-shaped crystal is characterized by normal and tangential velocity components, which depend on the time as ∼√t and as ∼1/√t respectively The end point of the arc at the interface between the amorphous and crystalline phases as the crystal grows describes a curve, which is similar to the Fermat helix. For sickle-shaped, as well as for disk-shaped crystals, the degree of crystallinity x ∼ t2.

  12. Characterization of Porous, Dexamethasone-Releasing Polyurethane Coatings for Glucose Sensors

    PubMed Central

    Vallejo-Heligon, Suzana G.; Klitzman, Bruce; Reichert, William M.

    2014-01-01

    Commercially available implantable needle-type glucose sensors for diabetes management are robust analytically but can be unreliable clinically primarily due to tissue-sensor interactions. Here, we present the physical, drug release, and bioactivity characterization of tubular, porous dexamethasone (Dex) releasing polyurethane coatings designed to attenuate local inflammation in the tissue-sensor interface. Porous polyurethane coatings were produced by the salt-leaching/gas-foaming method. Scanning electron microscopy (SEM) and Micro-computed tomography (Micro-CT) showed a controlled porosity and coating thickness. In vitro drug release from coatings monitored over two weeks presented an initial fast release followed by a slower release. Total release from coatings was highly dependent on initial drug loading amount. Functional in vitro testing of glucose sensors deployed with porous coatings against glucose standards demonstrated that highly porous coatings minimally affected signal strength and response rate. Bioactivity of the released drug was determined by monitoring Dex-mediated, dose-dependent apoptosis of human peripheral blood derived monocytes in culture. Acute animal studies were used to determine the appropriate Dex payload for the implanted porous coatings. Pilot short-term animal studies showed that Dex released from porous coatings implanted in rat subcutis attenuated the initial inflammatory response to sensor implantation. These results suggest that deploying sensors with the porous, Dex-releasing coatings is a promising strategy to improve glucose sensor performance. PMID:25065548

  13. Preparation, characterization, and application of ZnO@SiO2 core-shell structured catalyst for photocatalytic degradation of phenol.

    PubMed

    Galedari, Naghmeh Abuali; Rahmani, Mohammad; Tasbihi, Minoo

    2017-05-01

    In the current study, ZnO@SiO 2 core-shell structured catalyst was synthesized for photocatalytic degradation of phenol from aqueous samples. The synthesized catalyst was characterized by Fourier transform infrared spectra, X-ray diffraction, energy-dispersive X-ray spectroscopy, UV-Vis-NIR diffuse reflectance spectroscopy, transmission electron microscopy, BET surface area, zeta potential, and field emission scanning electron microscopy. The effect of catalyst loading, initial phenol concentration, pH, UV light intensity and weight ratio of ZnO/(SiO 2  + ZnO) were studied towards photocatalytic degradation of phenol. Moreover, photocatalytic activities of bare ZnO and ZnO@SiO 2 were compared. The results advocated that ZnO@SiO 2 catalyst showed high photocatalytic performance for degradation of phenol (96 % after 120 min) at an initial pH of 5.9, catalyst loading of 0.5 g/L and initial phenol concentration of 25 mg/L. Increase in the weight ratio of ZnO/(SiO 2  + ZnO) from 0.2 to 0.33 significantly enhanced the photodegradation of phenol from 84 to 94 %. It was also found that photocatalytic activity of ZnO@SiO 2 was higher than bare ZnO nanoparticles. Graphical abstract ᅟ.

  14. Mass-energy and momentum extraction by gravitational wave emission in the merger of two colliding black holes: The non-head-on case

    NASA Astrophysics Data System (ADS)

    Aranha, R. F.; Soares, I. Damião; Tonini, E. V.

    2012-01-01

    We examine numerically the post-merger regime of two nonspining holes in non-head-on collisions in the realm of nonaxisymmetric Robinson-Trautman spacetimes. Characteristic initial data for the system are constructed and evolved via the Robinson-Trautman equation. The numerical integration is performed using a Galerkin spectral method which is sufficiently stable to reach the final configuration of the remnant black hole, when the gravitational wave emission ceases. The initial data contains three independent parameters, the ratio mass α of the individual colliding black holes, their initial premerger infalling velocity and the incidence angle of collision ρ0. The remnant black hole is characterized by its final boost parameter, rest mass and scattering angle. The motion of the remnant black hole is restricted to the plane determined by the directions of the two initial colliding black holes, characterizing a planar collision. The net momentum fluxes carried out by gravitational waves are confined to this plane. We evaluate the efficiency of mass-energy extraction, the total energy and momentum carried out by gravitational waves and the momentum distribution of the remnant black hole for a large domain of initial data parameters. Our analysis is based on the Bondi-Sachs four-momentum conservation laws. The process of mass-energy extraction is shown to be less efficient as the initial data departs from the head-on configuration. Head-on collisions (ρ0=0o) and orthogonal collisions (ρ0=90°) constitute, respectively, upper and lower bounds to the power emission and to the efficiency of mass-energy extraction. On the contrary, head-on collisions and orthogonal collisions constitute, respectively, lower and upper bounds for the momentum of the remnant. Distinct regimes of gravitational wave emission (bursts or quiescent emission) are characterized by the analysis of the time behavior of the gravitational wave power as a function of α. In particular, the net gravitational wave flux is nonzero for equal-mass colliding black holes in non-head-on collisions. The momentum extraction and the patterns of the momentum fluxes, as a function of the incidence angle, are examined. The relation between the incidence angle and the scattering angle closely approximates a relation for the inelastic collision of classical particles in Newtonian dynamics.

  15. Impact of atmosphere and land surface initial conditions on seasonal forecast of global surface temperature

    NASA Astrophysics Data System (ADS)

    Materia, Stefano; Borrelli, Andrea; Bellucci, Alessio; Alessandri, Andrea; Di Pietro, Pierluigi; Athanasiadis, Panagiotis; Navarra, Antonio; Gualdi, Silvio

    2014-05-01

    The impact of land surface and atmosphere initialization on the forecast skill of a seasonal prediction system is investigated, and an effort to disentangle the role played by the individual components to the global predictability is done, via a hierarchy of seasonal forecast experiments performed under different initialization strategies. A realistic atmospheric initial state allows an improved equilibrium between the ocean and overlying atmosphere, mitigating the coupling shock and possibly increasing the model predictive skill in the ocean. In fact, in a few regions characterized by strong air-sea coupling, the atmosphere initial condition affects the forecast skill for several months. In particular, the ENSO region, the eastern tropical Atlantic and the North Pacific benefit significantly from the atmosphere initialization. On mainland, the impact of atmospheric initial conditions is detected in the early phase of the forecast, while the quality of land surface initialization affects the forecast skill in the following lead seasons. The winter forecast in the high latitude plains of Siberia and Canada benefit from the snow initialization, while the impact of soil moisture initial state is particularly effective in the Mediterranean region, in central Asia and Australia. However, initialization through land surface reanalysis does not systematically guarantee an enhancement of the predictive skill: the quality of the forecast is sometimes higher for the non-constrained model. Overall, the introduction of a realistic initialization of land surface and atmosphere substantially increases skill and accuracy. However, further developments in the operating procedure for land surface initialization are required for more accurate seasonal forecasts.

  16. INITIAL CHARACTERIZATION OF MONOCLONAL ANTIBODIES AGAINST THE FUNGAL HEMOLYSIN STACHYLYSIN FROM STACHYBOTRYS CHARTARUM

    EPA Science Inventory

    Stachybotrys chartarum is known to produce the hemolysin stachylysin and its detection in human serum has been proposed as a biomarker for exposure to the fungus. In this study we report the initial characterization of monoclonal antibodies (mAbs) against stachylysin and the dev...

  17. Improved electrochemical performance of Li1.2Mn0.54Ni0.13Co0.13O2 cathode material synthesized by citric acid assisted sol-gel method for lithium ion batteries

    NASA Astrophysics Data System (ADS)

    Li, Shiyou; Liang, Youwei; Lei, Dan; Xie, Yingchun; Ai, Ling; Xie, Jing

    2018-03-01

    A citric acid assisted sol-gel method is employed for synthesizing Li1.2Mn0.54Ni0.13Co0.13O2 used as a cathode material in lithium-ion batteries. Powder X-ray diffraction (XRD) and scanning electron microscopy (SEM) characterizations prove that materials have a typical a-NaFeO2 structure with primary nano-sized particles. Electrochemical performances have been investigated by charge-discharge test and results show that the synthesized product exhibits excellent electrochemical performance with a high initial discharge capacity of 253.5 mAh g-1 at 0.1 C and a preferable capacity retention of 84.8% after 50 cycles.

  18. Progress of Ongoing NASA Lithium-Ion Cell Verification Testing for Aerospace Applications

    NASA Technical Reports Server (NTRS)

    McKissock, Barbara I.; Manzo, Michelle A.; Miller, Thomas B.; Reid, Concha M.; Bennett, William R.; Gemeiner, Russel

    2008-01-01

    A Lithium-ion Verification and Validation Program with the purpose to assess the capabilities of current aerospace lithium-ion (Li-ion) battery cells to perform in a low-earth-orbit (LEO) regime was initiated in 2002. This program involves extensive characterization and LEO life testing at ten different combinations of depth-of-discharge, temperature, and end-of-charge voltage. The test conditions selected for the life tests are defined as part of a statistically designed test matrix developed to determine the effects of operating conditions on performance and life of Li-ion cells. Results will be used to model and predict cell performance and degradation as a function of test operating conditions. Testing is being performed at the Naval Surface Warfare Center/Crane Division in Crane, Indiana. Testing was initiated in September 2004 with 40 Ah cells from Saft and 30 Ah cells from Lithion. The test program has been expanded with the addition of modules composed of 18650 cells from ABSL Power Solutions in April 2006 and the addition of 50 Ah cells from Mine Safety Appliances Co. (MSA) in June 2006. Preliminary results showing the average voltage and average available discharge capacity for the Saft and Lithion packs at the test conditions versus cycles are presented.

  19. High-power microwave generation using optically activated semiconductor switches

    NASA Astrophysics Data System (ADS)

    Nunnally, William C.

    1990-12-01

    The two prominent types of optically controlled switches, the optically controlled linear (OCL) switch and the optically initiated avalanche (OIA) switch, are described, and their operating parameters are characterized. Two transmission line approaches, one using a frozen-wave generator and the other using an injected-wave generator, for generation of multiple cycles of high-power microwave energy using optically controlled switches are discussed. The point design performances of the series-switch, frozen-wave generator and the parallel-switch, injected-wave generator are compared. The operating and performance limitations of the optically controlled switch types are discussed, and additional research needed to advance the development of the optically controlled, bulk, semiconductor switches is indicated.

  20. Super NiCd Open-Circuit Storage and Low Earth Orbit (LEO) Life Test Evaluation

    NASA Technical Reports Server (NTRS)

    Baer, Jean Marie; Hwang, Warren C.; Ang, Valerie J.; Hayden, Jeff; Rao, Gopalakrishna; Day, John H. (Technical Monitor)

    2002-01-01

    This presentation discusses Air Force tests performed on super NiCd cells to measure their performance under conditions simulating Low Earth Orbit (LEO) conditions. Super NiCd cells offer potential advantages over existing NiCd cell designs including advanced cell design with improved separator material and electrode making processes, but handling and storage requires active charging. These tests conclude that the super NiCd cells support generic Air Force qualifications for conventional LEO missions (up to five years duration) and that handling and storage may not actually require active charging as previously assumed. Topics covered include: Test Plan, Initial Characterization Tests, Open-Circuit Storage Tests, and post storage capacities.

  1. Magnetic graphene oxide-polystyrene and magnetic activated carbon-polystyrene nanocomposites as sorbents for bisphenol A.

    NASA Astrophysics Data System (ADS)

    Rekos, Kyriazis; Kampouraki, Zoi Christina; Samanidou, Victoria; Deliyanni, Eleni

    2016-04-01

    Magnetic graphene oxide-polystyrene and magnetic activated carbon-polystyrene nanocomposites as sorbents for bisphenol A. Kyriazis Rekos1, Zoi Christina Kampouraki1, Victoria Samanidou2, Eleni Deliyanni1 1 Laboratory of General and Inorganic Chemical Technology, Department of Chemistry, Aristotle University of Thessaloniki, GR-541 24 Thessaloniki, Greece 2 Laboratory of Analytical Chemistry, Department of Chemistry, Aristotle University of Thessaloniki, GR-541 24 Thessaloniki, Greece The aim of this work was to prepare and characterize novel composites of magnetic activated carbon or magnetic graphene oxide with polystyrene (GO/PSm), through one step simple and effective route. Μagnetite nanoparticles, prepared in the laboratory, were dispersed in the presence of activated carbon (C) or graphene oxide (GO) in a polystyrene (PS) solution in dimethylformamide, at elevated temperature, for the fabrication of the magnetite-Carbon-PS (C-PSm) and magnetite- Graphene Oxide-PS (GO-PSm) hybrid-nanoparticles. For comparison, C-PS and GO-PS composites were also prepared in the same route. The nanocomposites were tested for their sorption ability for an endocrine disruptor, bisphenol A. The effect of solution pH, initial concentration, contact time and temperature were examined. The magnetic graphite oxide-polystyrene presented higher adsorption capacity (100 mg/g) than the non magnetic composites (70 mg/g), as well as than initial graphite oxide (20 mg/g). FTIR, XRD, BET, TGA, VSM and SEM were performed in order to investigate the role of the PS on the better adsorption performance of the mGO-PS nanocomposites. The characterization with these techniques revealed the possible interactions of the surface functional groups of activated carbon and/or graphite oxide with polystyrene that resulted in the better performance of the magnetic nanocomposites for bisphenol A adsorption.

  2. PM2.5 Technology Assessment and Characterization Study in New York - PMTACS-NY: The 2001 Summer Field Intensive in Queens, NY

    NASA Astrophysics Data System (ADS)

    Demerjian, K. L.

    2002-12-01

    In the summer of 2001, an intensive field measurement campaign was carried out in Queens, NY as part of the PM2.5 Technology Assessment and Characterization Study in New York (PMTACS-NY) to characterize the physical and chemical composition of particulate matter and related precursors utilizing conventional and advanced instrumentation technologies. The measurement program, involving a team of scientists from federal, state, university and private sector organizations, was designed to provide detailed time resolved chemical and physical characterization of the urban PM2.5/co-pollutant complex in relation to the regional environment. A summary of the chemical and meteorological data defining specific events during the field intensive is presented as are results addressing specific hypothesis designed around PMTACS-NY program objectives. These include initial findings and conclusions related to 1) performance testing and evaluation of emerging measurement technologies and comparison with EPA mandated PM federal reference methods currently operational as part of the New York State and national PM2.5 monitoring network; 2) emissions characterization of CNG, standard diesel and CRT (Continuously Regenerating Technology) diesel retrofit powered vehicles; and 3) compositional comparisons of urban and regional PM2.5.

  3. Performance Improvement Through Indexing of Turbine Airfoils. Part 2; Numerical Simulation

    NASA Technical Reports Server (NTRS)

    Griffin, Lisa W.; Huber, Frank W.; Sharma, Om P.

    1996-01-01

    An experimental/analytical study has been conducted to determine the performance improvements achievable by circumferentially indexing succeeding rows of turbine stator airfoils. A series of tests was conducted to experimentally investigate stator wake clocking effects on the performance of the space shuttle main engine (SSME) alternate turbopump development (ATD) fuel turbine test article (TTA). The results from this study indicate that significant increases in stage efficiency can be attained through application of this airfoil clocking concept. Details of the experiment and its results are documented in part 1 of this paper. In order to gain insight into the mechanisms of the performance improvement, extensive computational fluid dynamics (CFD) simulations were executed. The subject of the present paper is the initial results from the CFD investigation of the configurations and conditions detailed in part 1 of the paper. To characterize the aerodynamic environments in the experimental test series, two-dimensional (2D), time accurate, multistage, viscous analyses were performed at the TTA midspan. Computational analyses for five different circumferential positions of the first stage stator have been completed. Details of the computational procedure and the results are presented. The analytical results verify the experimentally demonstrated performance improvement and are compared with data whenever possible. Predictions of time-averaged turbine efficiencies as well as gas conditions throughout the flow field are presented. An initial understanding of the turbine performance improvement mechanism based on the results from this investigation is described.

  4. Site characterization at the Rabbit Valley Geophysical Performance Evaluation Range

    NASA Astrophysics Data System (ADS)

    Koppenjan, S.,; Martinez, M.

    The United States Department of Energy (US DOE) is developing a Geophysical Performance Evaluation Range (GPER) at Rabbit Valley located 30 miles west of Grand Junction, Colorado. The purpose of the range is to provide a test area for geophysical instruments and survey procedures. Assessment of equipment accuracy and resolution is accomplished through the use of static and dynamic physical models. These models include targets with fixed configurations and targets that can be re-configured to simulate specific specifications. Initial testing (1991) combined with the current tests at the Rabbit Valley GPER will establish baseline data and will provide performance criteria for the development of geophysical technologies and techniques. The US DOE's Special Technologies Laboratory (STL) staff has conducted a Ground Penetrating Radar (GPR) survey of the site with its stepped FM-CW GPR. Additionally, STL contracted several other geophysical tests. These include an airborne GPR survey incorporating a 'chirped' FM-CW GPR system and a magnetic survey with a surfaced-towed magnetometer array unit Ground-based and aerial video and still frame pictures were also acquired. STL compiled and analyzed all of the geophysical maps and created a site characterization database. This paper discusses the results of the multi-sensor geophysical studies performed at Rabbit Valley and the future plans for the site.

  5. Site characterization at the Rabbit Valley Geophysical Performance Evaluation Range

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koppenjan, S,; Martinez, M.

    1994-06-01

    The United States Department of Energy (US DOE) is developing a Geophysical Performance Evaluation Range (GPER) at Rabbit Valley located 30 miles west of Grand Junction, Colorado. The purpose of the range is to provide a test area for geophysical instruments and survey procedures. Assessment of equipment accuracy and resolution is accomplished through the use of static and dynamic physical models. These models include targets with fixed configurations and targets that can be re-configured to simulate specific specifications. Initial testing (1991) combined with the current tests at the Rabbit Valley GPER will establish baseline data and will provide performance criteriamore » for the development of geophysical technologies and techniques. The US DOE`s Special Technologies Laboratory (STL) staff has conducted a Ground Penetrating Radar (GPR) survey of the site with its stepped FM-CW GPR. Additionally, STL contracted several other geophysical tests. These include an airborne GPR survey incorporating a ``chirped`` FM-CW GPR system and a magnetic survey with a surfaced-towed magnetometer array unit Ground-based and aerial video and still frame pictures were also acquired. STL compiled and analyzed all of the geophysical maps and created a site characterization database. This paper discusses the results of the multi-sensor geophysical studies performed at Rabbit Valley and the future plans for the site.« less

  6. Predictive classification of self-paced upper-limb analytical movements with EEG.

    PubMed

    Ibáñez, Jaime; Serrano, J I; del Castillo, M D; Minguez, J; Pons, J L

    2015-11-01

    The extent to which the electroencephalographic activity allows the characterization of movements with the upper limb is an open question. This paper describes the design and validation of a classifier of upper-limb analytical movements based on electroencephalographic activity extracted from intervals preceding self-initiated movement tasks. Features selected for the classification are subject specific and associated with the movement tasks. Further tests are performed to reject the hypothesis that other information different from the task-related cortical activity is being used by the classifiers. Six healthy subjects were measured performing self-initiated upper-limb analytical movements. A Bayesian classifier was used to classify among seven different kinds of movements. Features considered covered the alpha and beta bands. A genetic algorithm was used to optimally select a subset of features for the classification. An average accuracy of 62.9 ± 7.5% was reached, which was above the baseline level observed with the proposed methodology (30.2 ± 4.3%). The study shows how the electroencephalography carries information about the type of analytical movement performed with the upper limb and how it can be decoded before the movement begins. In neurorehabilitation environments, this information could be used for monitoring and assisting purposes.

  7. Characterization of solution-phase and gas-phase reactions in on-line electrochemistry-thermospray tandem mass spectrometry.

    PubMed

    Volk, K J; Yost, R A; Brajter-Toth, A

    1989-07-14

    Electrochemistry was used on-line with high-performance liquid chromatography-thermospray tandem mass spectrometry to provide insight into the solution-phase decomposition reactions of electrochemically generated oxidation products. Products formed during electrooxidation were monitored as the electrode potential was varied. The solution reactions which follow the initial electron transfer at the electrode are affected by the vaporizer tip temperature of the thermospray probe and the composition of the thermospray buffer. Either hydrolysis or ammonolysis reactions of the initial electrochemical oxidation products can occur with pH 7 ammonium acetate buffer. Both the electrochemically generated and the synthesized disulfide of 6-thiopurine decompose under thermospray conditions to produce 6-thiopurine and purine-6-sulfinate. Solution-phase studies indicate that nucleophilic and electrophilic substitution reactions with purine-6-sulfinate result in the formation of purine, adenine, and hypoxanthine. Products were identified and characterized by tandem mass spectrometry. This work shows the first example of high-performance liquid chromatography used on-line with electrochemistry to separate stable oxidation products prior to analysis by thermospray tandem mass spectrometry. In addition, solution-phase and gas-phase studies with methylamine show that the site of the nucleophilic and electrophilic reactions is probably inside the thermospray probe. Most importantly, these results also show that the on-line combination of electrochemistry with thermospray tandem mass spectrometry provides valuable information about redox and associated chemical reactions of biological molecules such as the structures of intermediates or products as well as providing insight into reaction pathways.

  8. A Factor Linking Floral Organ Identity and Growth Revealed by Characterization of the Tomato Mutant unfinished flower development (ufd).

    PubMed

    Poyatos-Pertíñez, Sandra; Quinet, Muriel; Ortíz-Atienza, Ana; Yuste-Lisbona, Fernando J; Pons, Clara; Giménez, Estela; Angosto, Trinidad; Granell, Antonio; Capel, Juan; Lozano, Rafael

    2016-01-01

    Floral organogenesis requires coordinated interactions between genes specifying floral organ identity and those regulating growth and size of developing floral organs. With the aim to isolate regulatory genes linking both developmental processes (i.e., floral organ identity and growth) in the tomato model species, a novel mutant altered in the formation of floral organs was further characterized. Under normal growth conditions, floral organ primordia of mutant plants were correctly initiated, however, they were unable to complete their development impeding the formation of mature and fertile flowers. Thus, the growth of floral buds was blocked at an early stage of development; therefore, we named this mutant as unfinished flower development ( ufd ). Genetic analysis performed in a segregating population of 543 plants showed that the abnormal phenotype was controlled by a single recessive mutation. Global gene expression analysis confirmed that several MADS-box genes regulating floral identity as well as other genes participating in cell division and different hormonal pathways were affected in their expression patterns in ufd mutant plants. Moreover, ufd mutant inflorescences showed higher hormone contents, particularly ethylene precursor 1-aminocyclopropane-1-carboxylic acid (ACC) and strigol compared to wild type. Such results indicate that UFD may have a key function as positive regulator of the development of floral primordia once they have been initiated in the four floral whorls. This function should be performed by affecting the expression of floral organ identity and growth genes, together with hormonal signaling pathways.

  9. In Vivo Analytical Performance of Nitric Oxide-Releasing Glucose Biosensors

    PubMed Central

    2015-01-01

    The in vivo analytical performance of percutaneously implanted nitric oxide (NO)-releasing amperometric glucose biosensors was evaluated in swine for 10 d. Needle-type glucose biosensors were functionalized with NO-releasing polyurethane coatings designed to release similar total amounts of NO (3.1 μmol cm–2) for rapid (16.0 ± 4.4 h) or slower (>74.6 ± 16.6 h) durations and remain functional as outer glucose sensor membranes. Relative to controls, NO-releasing sensors were characterized with improved numerical accuracy on days 1 and 3. Furthermore, the clinical accuracy and sensitivity of rapid NO-releasing sensors were superior to control and slower NO-releasing sensors at both 1 and 3 d implantation. In contrast, the slower, extended, NO-releasing sensors were characterized by shorter sensor lag times (<4.2 min) in response to intravenous glucose tolerance tests versus burst NO-releasing and control sensors (>5.8 min) at 3, 7, and 10 d. Collectively, these results highlight the potential for NO release to enhance the analytical utility of in vivo glucose biosensors. Initial results also suggest that this analytical performance benefit is dependent on the NO-release duration. PMID:24984031

  10. In vivo analytical performance of nitric oxide-releasing glucose biosensors.

    PubMed

    Soto, Robert J; Privett, Benjamin J; Schoenfisch, Mark H

    2014-07-15

    The in vivo analytical performance of percutaneously implanted nitric oxide (NO)-releasing amperometric glucose biosensors was evaluated in swine for 10 d. Needle-type glucose biosensors were functionalized with NO-releasing polyurethane coatings designed to release similar total amounts of NO (3.1 μmol cm(-2)) for rapid (16.0 ± 4.4 h) or slower (>74.6 ± 16.6 h) durations and remain functional as outer glucose sensor membranes. Relative to controls, NO-releasing sensors were characterized with improved numerical accuracy on days 1 and 3. Furthermore, the clinical accuracy and sensitivity of rapid NO-releasing sensors were superior to control and slower NO-releasing sensors at both 1 and 3 d implantation. In contrast, the slower, extended, NO-releasing sensors were characterized by shorter sensor lag times (<4.2 min) in response to intravenous glucose tolerance tests versus burst NO-releasing and control sensors (>5.8 min) at 3, 7, and 10 d. Collectively, these results highlight the potential for NO release to enhance the analytical utility of in vivo glucose biosensors. Initial results also suggest that this analytical performance benefit is dependent on the NO-release duration.

  11. Application of tolerance limits to the characterization of image registration performance.

    PubMed

    Fedorov, Andriy; Wells, William M; Kikinis, Ron; Tempany, Clare M; Vangel, Mark G

    2014-07-01

    Deformable image registration is used increasingly in image-guided interventions and other applications. However, validation and characterization of registration performance remain areas that require further study. We propose an analysis methodology for deriving tolerance limits on the initial conditions for deformable registration that reliably lead to a successful registration. This approach results in a concise summary of the probability of registration failure, while accounting for the variability in the test data. The (β, γ) tolerance limit can be interpreted as a value of the input parameter that leads to successful registration outcome in at least 100β% of cases with the 100γ% confidence. The utility of the methodology is illustrated by summarizing the performance of a deformable registration algorithm evaluated in three different experimental setups of increasing complexity. Our examples are based on clinical data collected during MRI-guided prostate biopsy registered using publicly available deformable registration tool. The results indicate that the proposed methodology can be used to generate concise graphical summaries of the experiments, as well as a probabilistic estimate of the registration outcome for a future sample. Its use may facilitate improved objective assessment, comparison and retrospective stress-testing of deformable.

  12. Health-risk based approach to setting drinking water standards for long-term space missions

    NASA Technical Reports Server (NTRS)

    Macler, Bruce A.; Dunsky, Elizabeth C.

    1992-01-01

    In order to develop plausible and appropriate drinking water contaminant standards for longer-term NASA space missions, such as those planned for the Space Exploration Initiative, a human health risk characterization was performed using toxicological and exposure values typical of space operations and crew. This risk characterization showed that the greatest acute waterborne health concern was from microbial infection leading to incapacitating gastrointestinal illness. Ingestion exposure pathways for toxic materials yielded de minimus acute health risks unlikely to affect SEI space missions. Risks of chronic health problems were within acceptable public health limits. Our analysis indicates that current Space Station Freedom maximum contamination levels may be unnecessarily strict. We propose alternative environmental contaminant values consistent with both acceptable short and long-term crew health safety.

  13. Development of a MEMS device for acoustic emission testing

    NASA Astrophysics Data System (ADS)

    Ozevin, Didem; Pessiki, Stephen P.; Jain, Akash; Greve, David W.; Oppenheim, Irving J.

    2003-08-01

    Acoustic emission testing is an important technology for evaluating structural materials, and especially for detecting damage in structural members. Significant new capabilities may be gained by developing MEMS transducers for acoustic emission testing, including permanent bonding or embedment for superior coupling, greater density of transducer placement, and a bundle of transducers on each device tuned to different frequencies. Additional advantages include capabilities for maintenance of signal histories and coordination between multiple transducers. We designed a MEMS device for acoustic emission testing that features two different mechanical types, a hexagonal plate design and a spring-mass design, with multiple detectors of each type at ten different frequencies in the range of 100 kHz to 1 MHz. The devices were fabricated in the multi-user polysilicon surface micromachining (MUMPs) process and we have conducted electrical characterization experiments and initial experiments on acoustic emission detection. We first report on C(V) measurements and perform a comparison between predicted (design) and measured response. We next report on admittance measurements conducted at pressures varying from vacuum to atmospheric, identifying the resonant frequencies and again providing a comparison with predicted performance. We then describe initial calibration experiments that compare the performance of the detectors to other acoustic emission transducers, and we discuss the overall performance of the device as a sensor suite, as contrasted to the single-channel performance of most commercial transducers.

  14. Conservative Treatment of Subacute Proximal Hamstring Tendinopathy Using Eccentric Exercises Performed With a Treadmill: A Case Report.

    PubMed

    Cushman, Daniel; Rho, Monica E

    2015-07-01

    Case report. Proximal hamstring tendinopathy in runners is characterized by pain with passive hip flexion with the knee extended, active hip extension, and pain with sitting. Relatively little literature exists on the condition, and publications on nonsurgical treatment protocols are even more scarce. Surgical intervention, which comprises the majority of literature for treatment of this condition, is an option for cases that fail to respond to nonsurgical treatment. The patient was a 34-year-old, otherwise healthy male triathlete with unilateral proximal hamstring tendinopathy diagnosed by ultrasound, who had pain only with running and prolonged sitting. After he failed to respond to 4 weeks of eccentric knee flexion and lumbopelvic musculature strengthening exercises, an eccentric hip extensor strengthening program using a treadmill was initiated. This treadmill exercise was performed on a daily basis, in addition to a lumbopelvic musculature strengthening program. The patient noted a decrease in pain within 2 weeks of initiating the new exercise, and was able to return to gradual running after 4 weeks and to speed training after 12 weeks. He returned to competition shortly thereafter and had no recurrence for 12 months after the initiation of therapy. His score on the Victorian Institute of Sport Assessment-proximal hamstring tendons improved from 23 on initial presentation to 83 at 12 weeks after the initiation of therapy. We described the management of a triathlete with subacute proximal hamstring tendinopathy, who responded well to nonsurgical treatment using eccentric hip extension strengthening using a treadmill. Therapy, level 4.

  15. Conservative Treatment of Subacute Proximal Hamstring Tendinopathy Using Eccentric Exercises Performed With a Treadmill: A Case Report

    PubMed Central

    CUSHMAN, DANIEL; RHO, MONICA E.

    2015-01-01

    STUDY DESIGN Case report. BACKGROUND Proximal hamstring tendinopathy in runners is characterized by pain with passive hip flexion with the knee extended, active hip extension, and pain with sitting. Relatively little literature exists on the condition, and publications on nonsurgical treatment protocols are even more scarce. Surgical intervention, which comprises the majority of literature for treatment of this condition, is an option for cases that fail to respond to nonsurgical treatment. CASE DESCRIPTION The patient was a 34-year-old, otherwise healthy male triathlete with unilateral proximal hamstring tendinopathy diagnosed by ultrasound, who had pain only with running and prolonged sitting. After he failed to respond to 4 weeks of eccentric knee flexion and lumbopelvic musculature strengthening exercises, an eccentric hip extensor strengthening program using a treadmill was initiated. This treadmill exercise was performed on a daily basis, in addition to a lumbopelvic musculature strengthening program. OUTCOMES The patient noted a decrease in pain within 2 weeks of initiating the new exercise, and was able to return to gradual running after 4 weeks and to speed training after 12 weeks. He returned to competition shortly thereafter and had no recurrence for 12 months after the initiation of therapy. His score on the Victorian Institute of Sport Assessment-proximal hamstring tendons improved from 23 on initial presentation to 83 at 12 weeks after the initiation of therapy. DISCUSSION We described the management of a triathlete with subacute proximal hamstring tendinopathy, who responded well to nonsurgical treatment using eccentric hip extension strengthening using a treadmill. LEVEL OF EVIDENCE Therapy, level 4. PMID:25996362

  16. Re-evaluation of the PBAN receptor molecule: characterization of PBANR variants expressed in the pheromone glands of moths

    USDA-ARS?s Scientific Manuscript database

    Sex pheromone production in most moths is initiated following pheromone biosynthesis activating neuropeptide receptor (PBANR) activation. PBANR was initially cloned from pheromone glands (PGs) of Helicoverpa zea and Bombyx mori. The B. mori PBANR is characterized by a relatively long C-terminus that...

  17. Characterization of feeding-delaying factors from the silkworm Bombyx mori.

    PubMed

    Nagata, Shinji; Morooka, Nobukatsu; Matsumoto, Sumihiro; Nagasawa, Hiromichi

    2009-04-01

    In several phytophagous insects, feeding behavior occurs regularly. Recently, we demonstrated that feeding behavior in larvae of the silkworm Bombyx mori had a regular frequency. To address the control of the feeding cycle in B. mori, we aimed to characterize factors influencing feeding initiation and termination. Injection of extracts of the midgut, foregut, and fat body into starved Bombyx larvae delayed the initiation of feeding. This result indicates the presence in these tissues of factors capable of decreasing the likelihood of feeding initiation.

  18. Performance and breakdown characteristics of irradiated vertical power GaN P-i-N diodes

    DOE PAGES

    King, M. P.; Armstrong, A. M.; Dickerson, J. R.; ...

    2015-10-29

    Electrical performance and defect characterization of vertical GaN P-i-N diodes before and after irradiation with 2.5 MeV protons and neutrons is investigated. Devices exhibit increase in specific on-resistance following irradiation with protons and neutrons, indicating displacement damage introduces defects into the p-GaN and n- drift regions of the device that impact on-state device performance. The breakdown voltage of these devices, initially above 1700 V, is observed to decrease only slightly for particle fluence <; 10 13 cm -2. Furthermore, the unipolar figure of merit for power devices indicates that while the on-resistance and breakdown voltage degrade with irradiation, vertical GaNmore » P-i-Ns remain superior to the performance of the best available, unirradiated silicon devices and on-par with unirradiated modern SiC-based power devices.« less

  19. Preparation of new nano magnetic material Fe3O4@g-C3N4 and good adsorption performance on uranium ion

    NASA Astrophysics Data System (ADS)

    Long, Wei; Liu, Huijun; Yan, Xueming; Fu, Li

    2018-03-01

    A new nano magnetic material Fe3O4@g-C3N4 was prepared by deposition reduction method, which performed good adsorption performance to uranium ion. Characterization results showed that the g-C3N4 particles were wrapped around the nano magnetic Fe3O4 particles, and the textural properties of this material was improved, so the adsorption performance to uranium ion was good. Adsorption experiments of this material demonstrated that the optimum pH value was 10, the optimum mass of adsorbent was 6.5 mg and the optimum adsorption time was 150 min in the initial concentration of 140 mg/L uranium ion solution system, and the maximum adsorption capacity was up to 352.1 mg/g and the maximum adsorption rate was more than 90%.

  20. Performance evaluation of a modular detector unit for X-ray computed tomography.

    PubMed

    Guo, Zhe; Tang, Zhiwei; Wang, Xinzeng; Deng, Mingliang; Hu, Guangshu; Zhang, Hui

    2013-04-18

    A research prototype CT scanner is currently under development in our lab. One of the key components in this project is the CT detector. This paper describes the design and performance evaluation of the modular CT detector unit for our proposed scanner. It consists of a Photodiode Array Assembly which captures irradiating X-ray photons and converts the energy into electrical current, and a mini Data Acquisition System which performs current integration and converts the analog signal into digital samples. The detector unit can be easily tiled together to form a CT detector. Experiments were conducted to characterize the detector performance both at the single unit level and system level. The noise level, linearity and uniformity of the proposed detector unit were reported and initial imaging studies were also presented which demonstrated the potential application of the proposed detector unit in actual CT scanners.

  1. Grain boundary damage evolution and SCC initiation of cold-worked alloy 690 in simulated PWR primary water

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhai, Ziqing; Toloczko, Mychailo B.; Kruska, Karen

    Long-term grain boundary (GB) damage evolution and stress corrosion crack initiation in alloy 690 are being investigated by constant load tensile testing in high-temperature, simulated PWR primary water. Six commercial alloy 690 heats are being tested in various cold work conditions loaded at their yield stress. This paper reviews the basic test approach and detailed characterizations performed on selected specimens after an exposure time of ~1 year. Intergranular crack nucleation was observed under constant stress in certain highly cold-worked (CW) alloy 690 heats and was found to be associated with the formation of GB cavities. Somewhat surprisingly, the heats mostmore » susceptible to cavity formation and crack nucleation were thermally treated materials with most uniform coverage of small GB carbides. Microstructure, % cold work and applied stress comparisons are made among the alloy 690 heats to better understand the factors influencing GB cavity formation and crack initiation.« less

  2. Pencil beam characteristics of the next-generation proton scanning gantry of PSI: design issues and initial commissioning results

    NASA Astrophysics Data System (ADS)

    Pedroni, E.; Meer, D.; Bula, C.; Safai, S.; Zenklusen, S.

    2011-07-01

    In this paper we report on the main design features, on the realization process and on selected first results of the initial commissioning of the new Gantry 2 of PSI for the delivery of proton therapy with new advanced pencil beam scanning techniques. We present briefly the characteristics of the new gantry system with main emphasis on the beam optics, on the characterization of the pencil beam used for scanning and on the performance of the scanning system. The idea is to give an overview of the major components of the whole system. The main long-term technical goal of the new equipment of Gantry 2 is to expand the use of pencil beam scanning to the whole spectrum of clinical indications including moving targets. We report here on the initial experience and problems encountered in the development of the system with selected preliminary results of the ongoing commissioning of Gantry 2.

  3. Self-Initiated Health Behaviors Following a Diagnosis of Mild Cognitive Impairment

    PubMed Central

    Morgan, Gillian H.; Garand, Linda I.; Lingler, Jennifer H.

    2012-01-01

    The purpose of this study was to characterize the health related activities that patients self-initiate after being diagnosed with Mild Cognitive Impairment (MCI). Fifty-three persons with MCI were queried regarding health related activity changes made as a direct result of the MCI diagnosis, excluding activities which a) they were performing prior to their diagnosis, or b) were formally recommended by a clinician. Qualitative description was used to analyze responses. Most participants (62%) reported initiating one or more health related activities. The activities fell into three distinct categories: behaviors that were symptom driven (e.g., cognitive exercises), health promoting (e.g., dietary changes), or general increases in activity level. Activities reported by this sample encompassed many practices for which there is limited evidence for a potential impact on the clinical course of MCI. However, findings provide insight into the types of interventions that may be most attractive to those living with an MCI diagnosis. PMID:21928756

  4. Ram-pressure scaling and non-uniformity characterization of a spherically imploding liner formed by hypervelocity plasma jets

    NASA Astrophysics Data System (ADS)

    Cassibry, Jason; Dougherty, Jesse; Thompson, Seth; Hsu, Scott; Witherspoon, F. D.; University of AL in Huntsville Team; Los Alamos National Laboratory Team; HyperV Technologies Corp. Team

    2014-10-01

    Three-dimensional modeling of plasma liner formation and implosion is performed using the Smoothed Particle Hydrodynamics Code (SPHC) with radiation, thermal transport, and tabular equations of state (EOS), accounting for ionization, in support of a proposed 60-gun plasma liner formation experiment for plasma-jet driven magneto-inertial fusion (PJMIF). Previous SPHC modeling showed that ideal gas law scaling of peak stagnation pressure increased linearly with density and number of jets, quadratically with jet radius and velocity, and inversely with the initial jet length, while results with tabular EOS, thermal transport, and radiation have greater sensitivity to the initial jet distribution. A series of simulations are conducted to study the effects of initial jet conditions on peak ram pressure and liner non-uniformity during plasma liner implosion. The growth rate of large-amplitude density perturbations introduced by the discrete jets are computed and compared with predictions by the Bell-Plesset equation.

  5. Synergism and Physicochemical Properties of Anionic/Amphoteric Surfactant Mixtures with Nonionic Surfactant of Amine Oxide Type

    NASA Astrophysics Data System (ADS)

    Blagojević, S. M.; Pejić, N. D.; Blagojević, S. N.

    2017-12-01

    The physicochemical properties of initial formulation, that is anionic/amphoteric surfactants mixture SLES/AOS/CAB (sodium lauryl ether sulfate (SLES), α-olefin sulfonates (AOS) and cocamidopropyl betaine (CAB) at ratio 80 : 15 : 5) with nonionic surfactant of amine oxide type (lauramine oxide (AO)) in various concentration (1-5%) were studied. To characterize the surfactants mixture, the critical micelle concentration (CMC), surface tension (γ), foam volume, biodegradability and irritability were determined. This study showed that adding of AO in those mixtures lowered both γ and CMC as well as enhanced SLES/AOS/CAB foaming properties, but did not significantly affect biodegradability and irritability of initial formulation. Moreover, an increase in AO concentration has a meaningful synergistic effect on the initial formulation properties. All those results indicates that a nonionic surfactant of amine oxide type significantly improves the performance of anionic/amphoteric mixed micelle systems, and because of that anionic/amphoteric/nonionic mixture can be used in considerably lower concentrations as a cleaning formulation.

  6. Dual-fission chamber and neutron beam characterization for fission product yield measurements using monoenergetic neutrons

    NASA Astrophysics Data System (ADS)

    Bhatia, C.; Fallin, B.; Gooden, M. E.; Howell, C. R.; Kelley, J. H.; Tornow, W.; Arnold, C. W.; Bond, E. M.; Bredeweg, T. A.; Fowler, M. M.; Moody, W. A.; Rundberg, R. S.; Rusev, G.; Vieira, D. J.; Wilhelmy, J. B.; Becker, J. A.; Macri, R.; Ryan, C.; Sheets, S. A.; Stoyer, M. A.; Tonchev, A. P.

    2014-09-01

    A program has been initiated to measure the energy dependence of selected high-yield fission products used in the analysis of nuclear test data. We present out initial work of neutron activation using a dual-fission chamber with quasi-monoenergetic neutrons and gamma-counting method. Quasi-monoenergetic neutrons of energies from 0.5 to 15 MeV using the TUNL 10 MV FM tandem to provide high-precision and self-consistent measurements of fission product yields (FPY). The final FPY results will be coupled with theoretical analysis to provide a more fundamental understanding of the fission process. To accomplish this goal, we have developed and tested a set of dual-fission ionization chambers to provide an accurate determination of the number of fissions occurring in a thick target located in the middle plane of the chamber assembly. Details of the fission chamber and its performance are presented along with neutron beam production and characterization. Also presented are studies on the background issues associated with room-return and off-energy neutron production. We show that the off-energy neutron contribution can be significant, but correctable, while room-return neutron background levels contribute less than <1% to the fission signal.

  7. MEMS ultrasonic transducer for monitoring of steel structures

    NASA Astrophysics Data System (ADS)

    Jain, Akash; Greve, David W.; Oppenheim, Irving J.

    2002-06-01

    Ultrasonic methods can be used to monitor crack propagation, weld failure, or section loss at critical locations in steel structures. However, ultrasonic inspection requires a skilled technician, and most commonly the signal obtained at any inspection is not preserved for later use. A preferred technology would use a MEMS device permanently installed at a critical location, polled remotely, and capable of on-chip signal processing using a signal history. We review questions related to wave geometry, signal levels, flaw localization, and electromechanical design issues for microscale transducers, and then describe the design, characterization, and initial testing of a MEMS transducer to function as a detector array. The device is approximately 1-cm square and was fabricated by the MUMPS process. The chip has 23 sensor elements to function in a phased array geometry, each element containing 180 hexagonal polysilicon diaphragms with a typical leg length of 49 microns and an unloaded natural frequency near 3.5 MHz. We first report characterization studies including capacitance-voltage measurements and admittance measurements, and then report initial experiments using a conventional piezoelectric transducer for excitation, with successful detection of signals in an on-axis transmission experiment and successful source localization from phased array performance in an off-axis transmission experiment.

  8. Photoinitiated Polymerization of Cationic Acrylamide in Aqueous Solution: Synthesis, Characterization, and Sludge Dewatering Performance

    PubMed Central

    Zheng, Huaili; Liao, Yi; Zheng, Meizhen; Zhu, Chuanjun; Ji, Fangying; Ma, Jiangya; Fan, Wei

    2014-01-01

    A copolymer of acrylamide (AM) with acryloyloxyethyl trimethyl ammonium chloride (DAC) as the cationic monomer was synthesized under the irradiation of high-pressure mercury lamp with 2,2-azobis(2-amidinopropane) dihydrochloride (V-50) as the photoinitiator. The compositions of the photoinduced copolymer were characterized by Fourier transform infrared spectra (FTIR), ultraviolet spectra (UV), and scanning electron microscope (SEM). The effects of 6 important factors, that is, photo-initiators concentration, monomers concentration, CO(NH2)2 (urea) concentrations, pH value, mass ratio of AM to DAC, and irradiation time on the molecular weight and dissolving time, were investigated. The optimal reaction conditions were that the photo-initiators concentration was 0.3%, monomers concentration was 30 wt.%, irradiation time was 60 min, urea concentration was 0.4%, pH value was 5.0, and mass ratio of AM to DAC was 6 : 4. Its flocculation properties were evaluated with activated sludge using jar test. The zeta potential of supernatant at different cationic monomer contents was simultaneously measured. The results demonstrated the superiority of the copolymer over the commercial polyacrylamide as a flocculant. PMID:24683343

  9. Novel High Temperature Capacitive Pressure Sensor Utilizing SiC Integrated Circuit Twin Ring Oscillators

    NASA Technical Reports Server (NTRS)

    Scardelletti, M.; Neudeck, P.; Spry, D.; Meredith, R.; Jordan, J.; Prokop, N.; Krasowski, M.; Beheim, G.; Hunter, G.

    2017-01-01

    This paper describes initial development and testing of a novel high temperature capacitive pressure sensor system. The pressure sensor system consists of two 4H-SiC 11-stage ring oscillators and a SiCN capacitive pressure sensor. One oscillator has the capacitive pressure sensor fixed at one node in its feedback loop and varies as a function of pressure and temperature while the other provides a pressure-independent reference frequency which can be used to temperature compensate the output of the first oscillator. A two-day repeatability test was performed up to 500C on the oscillators and the oscillator fundamental frequency changed by only 1. The SiCN capacitive pressure sensor was characterized at room temperature from 0 to 300 psi. The sensor had an initial capacitance of 3.76 pF at 0 psi and 1.75 pF at 300 psi corresponding to a 54 change in capacitance. The integrated pressure sensor system was characterized from 0 to 300 psi in steps of 50 psi over a temperature range of 25 to 500C. The pressure sensor system sensitivity was 0.113 kHzpsi at 25C and 0.026 kHzpsi at 500C.

  10. Measurement of aerosol optical properties by cw cavity enhanced spectroscopy

    NASA Astrophysics Data System (ADS)

    Jie, Guo; Ye, Shan-Shan; Yang, Xiao; Han, Ye-Xing; Tang, Huai-Wu; Yu, Zhi-Wei

    2016-10-01

    The CAPS (Cavity Attenuated Phase shift Spectroscopy) system, which detects the extinction coefficients within a 10 nm bandpass centered at 532 nm, comprises a green LED with center wavelength in 532nm, a resonant optical cavity (36 cm length), a Photo Multiplier Tube detector, and a lock in amplifier. The square wave modulated light from the LED passes through the optical cavity and is detected as a distorted waveform which is characterized by a phase shift with respect to the initial modulation. Extinction coefficients are determined from changes in the phase shift of the distorted waveform of the square wave modulated LED light that is transmitted through the optical cavity. The performance of the CAPS system was evaluated by using measurements of the stability and response of the system. The minima ( 0.1 Mm-1) in the Allan plots show the optimum average time ( 100s) for optimum detection performance of the CAPS system. In the paper, it illustrates that extinction coefficient was correlated with PM2.5 mass (0.91). These figures indicate that this method has the potential to become one of the most sensitive on-line analytical techniques for extinction coefficient detection. This work aims to provide an initial validation of the CAPS extinction monitor in laboratory and field environments. Our initial results presented in this paper show that the CAPS extinction monitor is capable of providing state-of-the-art performance while dramatically reducing the complexity of optical instrumentation for directly measuring the extinction coefficients.

  11. Investigation on adaptive wing structure based on shape memory polymer composite hinge

    NASA Astrophysics Data System (ADS)

    Yu, Yuemin; Li, Xinbo; Zhang, Wei; Leng, Jinsong

    2007-07-01

    This paper describes the design and investigation of the SMP composite hinge and the morphing wing structure. The SMP composite hinge was based on SMP and carbon fiber fabric. The twisting recoverability of it was investigated by heating and then cooling repeatedly above and below the Tg. The twisting recoverability characterized by the twisting angle. Results show that the SMP composite hinge have good shape recoverability, Recovery time has a great influence on the twisting recoverability. The twisting recovery ratio became large with the increment of recovery time. The morphing wing can changes shape for different tasks. For the advantages of great recovery force and stable performances, we adopt SMP composite hinge as actuator to apply into the structure of the wing which can realize draw back wings to change sweep angle according to the speed and other requirements of military airplanes. Finally, a series of simulations and experiments are performed to investigate the deformations of morphing wings have been performed successfully. It can be seen that the sweep angle change became large with the increment of initial angle. The area reduction became large with the increment of initial angle, but after 75° the area reduction became smaller and smaller. The deformations of the triangle wing became large with the increment of temperature. The area and the sweep angle of wings can be controlled by adjusting the stimulate temperature and the initial twisting angle of shape memory polymer composite hinge.

  12. Restoration of soils affected by oil exploitation activities based in functional diversity studies

    NASA Astrophysics Data System (ADS)

    Villacis, Jaime; Casanoves, Fernando; Hang, Susana; Armas, Cristina

    2017-04-01

    The functional characteristics of 25 forest species used in the restoration of areas affected by oil extraction activities were determined and species functional groups were constructed. Subsequently, the functional characteristics of the groups were related with performance variables of the species obtained in complementary studies, to make use recommendations. Three functional groups of species with similar responses and / or performance were characterized that showed significant differences between them for quantitative and qualitative traits. The first group formed by all shrubs and the rest of trees, most do not fix nitrogen, have single leaves and all species are evergreen and characterized by having lower values of specific foliar area, foliar nitrogen, dry matter leaf content and wood density, was denominated as intermediate acquisitions. The second group composed only for trees that do not fix nitrogen and with deciduous leaves and characterized by having the highest values of dry matter leaf content and foliar tensile force and intermediate values of specific foliar area and foliar nitrogen, was denominated as low conservative. Finally the third group formed only by trees that fix nitrogen, composed of leaves and mostly evergreen and characterized by having higher values of specific foliar area, foliar nitrogen, foliar phosphorus and lower foliar tensile force, was denominated as acquisitive. The intermediary acquisitions species Apeiba membranacea, Myrcia aff. fallax and Zygia longifolia, and the acquisitive species Cedrelinga cateniformis, Inga densiflora, Myroxylon balsamum, Piptadenia pteroclada and Platymiscium pinnatum, which showed excellent performance in nursery and / or field, represent the most suitable species to be used in reforestation programs of the sites affected by oil extraction activities in the Amazon region of Ecuador, because they have greater potential to protect soil and recycle nutrients in the initial stages of planting.

  13. A physical organogel electrolyte: characterized by in situ thermo-irreversible gelation and single-ion-predominent conduction

    PubMed Central

    Kim, Young-Soo; Cho, Yoon-Gyo; Odkhuu, Dorj; Park, Noejung; Song, Hyun-Kon

    2013-01-01

    Electrolytes are characterized by their ionic conductivity (σi). It is desirable that overall σi results from the dominant contribution of the ions of interest (e.g. Li+ in lithium ion batteries or LIB). However, high values of cationic transference number (t+) achieved by solid or gel electrolytes have resulted in low σi leading to inferior cell performances. Here we present an organogel polymer electrolyte characterized by a high liquid-electrolyte-level σi (~101 mS cm−1) with high t+ of Li+ (>0.8) for LIB. A conventional liquid electrolyte in presence of a cyano resin was physically and irreversibly gelated at 60°C without any initiators and crosslinkers, showing the behavior of lower critical solution temperature. During gelation, σi of the electrolyte followed a typical Arrhenius-type temperature dependency, even if its viscosity increased dramatically with temperature. Based on the Li+-driven ion conduction, LIB using the organogel electrolyte delivered significantly enhanced cyclability and thermal stability. PMID:23715177

  14. Tracking progress toward global polio eradication--worldwide, 2009-2010.

    PubMed

    2011-04-15

    Since the Global Polio Eradication Initiative (GPEI) began in 1988, progress has been tracked by 1) surveillance comprised of detection and investigation of cases of acute flaccid paralysis (AFP), coupled with environmental surveillance (sewage testing) in selected areas, and 2) timely testing of fecal specimens in accredited laboratories to identify polioviruses. The sensitivity of AFP case detection and the timeliness of AFP investigations are monitored with performance indicators. Polioviruses are isolated and characterized by the Global Polio Laboratory Network (GPLN). This report assesses the quality of polio surveillance and the timeliness of poliovirus isolation reporting and characterization worldwide during 2009--2010. During that period, 77% of countries affected by wild poliovirus (WPV) met national performance standards for AFP surveillance; underperforming subnational areas were identified in two of four countries with reestablished WPV transmission and in 13 of 22 countries with WPV outbreaks. Targets for timely GPLN reporting of poliovirus isolation results were met in five World Health Organization (WHO) regions in 2009 and in four of six regions in 2010; targets for timely poliovirus characterization were met in four WHO regions in 2009 and in five regions in 2010. Monitoring of surveillance performance indicators at subnational levels continues to be critical to identifying surveillance gaps that might allow WPV circulation to be missed in certain areas or subpopulations. To achieve polio eradication, efforts are needed to further strengthen AFP surveillance, implement targeted environmental surveillance, and ensure that GPLN quality is maintained.

  15. Next generation of global land cover characterization, mapping, and monitoring

    USGS Publications Warehouse

    Giri, Chandra; Pengra, Bruce; Long, J.; Loveland, Thomas R.

    2013-01-01

    Land cover change is increasingly affecting the biophysics, biogeochemistry, and biogeography of the Earth's surface and the atmosphere, with far-reaching consequences to human well-being. However, our scientific understanding of the distribution and dynamics of land cover and land cover change (LCLCC) is limited. Previous global land cover assessments performed using coarse spatial resolution (300 m–1 km) satellite data did not provide enough thematic detail or change information for global change studies and for resource management. High resolution (∼30 m) land cover characterization and monitoring is needed that permits detection of land change at the scale of most human activity and offers the increased flexibility of environmental model parameterization needed for global change studies. However, there are a number of challenges to overcome before producing such data sets including unavailability of consistent global coverage of satellite data, sheer volume of data, unavailability of timely and accurate training and validation data, difficulties in preparing image mosaics, and high performance computing requirements. Integration of remote sensing and information technology is needed for process automation and high-performance computing needs. Recent developments in these areas have created an opportunity for operational high resolution land cover mapping, and monitoring of the world. Here, we report and discuss these advancements and opportunities in producing the next generations of global land cover characterization, mapping, and monitoring at 30-m spatial resolution primarily in the context of United States, Group on Earth Observations Global 30 m land cover initiative (UGLC).

  16. R&D Plan for RISMC Industry Application #1: ECCS/LOCA Cladding Acceptance Criteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Szilard, Ronaldo Henriques; Zhang, Hongbin; Epiney, Aaron Simon

    The Nuclear Regulatory Commission (NRC) is finalizing a rulemaking change that would revise the requirements in 10 CFR 50.46. In the proposed new rulemaking, designated as 10 CFR 50.46c, the NRC proposes a fuel performance-based equivalent cladding reacted (ECR) criterion as a function of cladding hydrogen content before the accident (pre-transient) in order to include the effects of higher burnup on cladding performance as well as to address other technical issues. A loss of operational margin may result due to the more restrictive cladding embrittlement criteria. Initial and future compliance with the rule may significantly increase vendor workload and licenseemore » costs as a spectrum of fuel rod initial burnup states may need to be analyzed to demonstrate compliance. The Idaho National Laboratory (INL) has initiated a project, as part of the DOE Light Water Reactor Sustainability Program (LWRS), to develop analytical capabilities to support the industry in the transition to the new rule. This project is called the Industry Application 1 (IA1) within the Risk-Informed Safety Margin Characterization (RISMC) Pathway of LWRS. The general idea behind the initiative is the development of an Integrated Evaluation Model (IEM). The motivation is to develop a multiphysics framework to analyze how uncertainties are propagated across the stream of physical disciplines and data involved, as well as how risks are evaluated in a LOCA safety analysis as regulated under 10 CFR 50.46c. This IEM is called LOTUS which stands for LOCA Toolkit for US, and it represents the LWRS Program’s response to the proposed new rule making. The focus of this report is to complete an R&D plan to describe the demonstration of the LOCA/ECCS RISMC Industry Application # 1 using the advanced RISMC Toolkit and methodologies. This report includes the description and development plan for a RISMC LOCA tool that fully couples advanced MOOSE tools already in development in order to characterize and optimize plant safety and operational margins. Advanced MOOSE tools that are needed to complete this integrated evaluation model are: RAVEN, RELAP-7, BISON, and MAMMOTH.« less

  17. A preterm infant with intestinal lymphangiectasia: a diagnostic dilemma.

    PubMed

    McDonald, Karen Q; Bears, Christina M

    2009-01-01

    Intestinal lymphangiectasia (IL) is a potentially fatal disorder of the lymphatic system if it is not recognized and proper treatment initiated. The disease is characterized by lymphocytopenia, peripheral edema, and hypoalbuminemia. Because IL is a rare disease, the symptoms, diagnostic workup, and treatment are unfamiliar to many clinicians. Current literature documents only a few reported cases of IL in a preterm infant. This case report of a preterm infant reviews history, symptomatology, and the diagnostic workup performed. The steps in making the diagnosis, the treatment, and the prognosis of this condition are also presented.

  18. Mechanical design of a precision linear flexural stage for 3D x-ray diffraction microscope at the Advanced Photon Source

    NASA Astrophysics Data System (ADS)

    Shu, D.; Liu, W.; Kearney, S.; Anton, J.; Tischler, J. Z.

    2015-09-01

    The 3-D X-ray diffraction microscope is a new nondestructive tool for the three-dimensional characterization of mesoscopic materials structure. A flexural-pivot-based precision linear stage has been designed to perform a wire scan as a differential aperture for the 3-D diffraction microscope at the Advanced Photon Source, Argonne National Laboratory. The mechanical design and finite element analyses of the flexural stage, as well as its initial mechanical test results with laser interferometer are described in this paper.

  19. Adipose-derived mesenchymal stem cells from liposuction and resected fat are feasible sources for regenerative medicine.

    PubMed

    Schneider, Sandra; Unger, Marina; van Griensven, Martijn; Balmayor, Elizabeth R

    2017-05-19

    The use of mesenchymal stem cells (MSCs) in research and in regenerative medicine has progressed. Bone marrow as a source has drawbacks because of subsequent morbidities. An easily accessible and valuable source is adipose tissue. This type of tissue contains a high number of MSCs, and obtaining higher quantities of tissue is more feasible. Fat tissue can be harvested using different methods such as liposuction and resection. First, a detailed isolation protocol with complete characterization is described. This also includes highlighting problems and pitfalls. Furthermore, some comparisons of these different harvesting methods exist. However, the later characterization of the cells is conducted poorly in most cases. We performed an in-depth characterization over five passages including an investigation of the effect of freezing and thawing. Characterization was performed using flow cytometry with CD markers, metabolic activity with Alamar Blue, growth potential in between passages, and cytoskeleton staining. Our results show that the cells isolated with distinct isolation methods (solid versus liposuction "liquid") have the same MSC potential. However, the percentage of cells positive for the markers CD73, CD90, and CD105 is initially quite low. The cells isolated from the liquid fat tissue grow faster at higher passages, and significantly more cells display MSC markers. In summary, we show a simple and efficient method to isolate adipose-derived mesenchymal stem cells from different preparations. Liposuctions and resection can be used, whereas liposuction has more growth potential at higher passages.

  20. Beyond age at first sex: Patterns of emerging sexual behavior in adolescence and young adulthood

    PubMed Central

    Haydon, Abigail A.; Herring, Amy H.; Prinstein, Mitchell J.; Halpern, Carolyn Tucker

    2011-01-01

    Purpose Although the emergence of sexual expression during adolescence and early adulthood is nearly universal, little is known about patterns of initiation. Methods We used latent class analysis to group 12,194 respondents from Waves I and IV of the National Longitudinal Study of Adolescent Health (Add Health) into one of five classes based on variety, timing, spacing, and sequencing of oral-genital, anal, and vaginal sex. Multinomial logistic regression models, stratified by biological sex, examined associations between sociodemographic characteristics and class membership. Results Approximately half of respondents followed a pattern characterized predominately by initiation of vaginal sex first, average age of initiation of approximately 16 years, and spacing of one year or more between initiation of the first and second behaviors; almost one third initiated sexual activity slightly later but reported first experiences of oral-genital and vaginal sex within the same year. Classes characterized by postponement of sexual activity, initiation of only one type of behavior, or adolescent initiation of anal sex were substantially less common. Compared to White respondents, Black respondents were more likely to appear in classes characterized by initiation of vaginal sex first. Respondents from lower socioeconomic backgrounds were more likely to be in classes distinguished by early/atypical patterns of initiation. Conclusions A small number of typical and atypical patterns capture the emergence of sexual behavior during adolescence, but these patterns reveal complex associations among different elements of emerging sexuality that should be considered in future research. PMID:22525108

  1. Comparative Aging Study of Organic Solar Cells Utilizing Polyaniline and PEDOT:PSS as Hole Transport Layers.

    PubMed

    Abdulrazzaq, Omar; Bourdo, Shawn E; Woo, Myungwu; Saini, Viney; Berry, Brian C; Ghosh, Anindya; Biris, Alexandru S

    2015-12-23

    The aging effect on P3HT:PCBM organic solar cells was investigated with camphorsulfonic doped polyaniline (PANI:CSA) or poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) ( PSS) used as the hole transport layer (HTL). The cells were encapsulated and exposed to a continuous normal atmosphere on a dark shelf and then characterized intermittently for more than two years. The photovoltaic results revealed that the cells with PSS HTL showed better initial results than the cells with PANI:CSA HTL. Over time, PSS-based cells exhibited faster degradation than PANI:CSA-based cells, where the average efficiency of six cells dropped to zero in less than one and a half years. On the other hand, PANI:CSA-based cells exhibited a much more stable performance with an average efficiency drop of only 15% of their initial values after one and a half years and 63% after two years. A single-diode model was utilized to fit the experimental data with the theoretical curve to extract the diode parameters, such as the ideality factor, to explain the effect of aging on the diode's performance.

  2. Photoresist thin-film effects on alignment process capability

    NASA Astrophysics Data System (ADS)

    Flores, Gary E.; Flack, Warren W.

    1993-08-01

    Two photoresists were selected for alignment characterization based on their dissimilar coating properties and observed differences on alignment capability. The materials are Dynachem OFPR-800 and Shipley System 8. Both photoresists were examined on two challenging alignment levels in a submicron CMOS process, a nitride level and a planarized second level metal. An Ultratech Stepper model 1500 which features a darkfield alignment system with a broadband green light for alignment signal detection was used for this project. Initially, statistically designed linear screening experiments were performed to examine six process factors for each photoresist: viscosity, spin acceleration, spin speed, spin time, softbake time, and softbake temperature. Using the results derived from the screening experiments, a more thorough examination of the statistically significant process factors was performed. A full quadratic experimental design was conducted to examine viscosity, spin speed, and spin time coating properties on alignment. This included a characterization of both intra and inter wafer alignment control and alignment process capability. Insight to the different alignment behavior is analyzed in terms of photoresist material properties and the physical nature of the alignment detection system.

  3. Characterization and durability testing of plasma-sprayed zirconia-yttria and hafnia-yttria thermal barrier coatings. Part 2: Effect of spray parameters on the performance of several hafnia-yttria and zirconia-yttria coatings

    NASA Technical Reports Server (NTRS)

    Miller, Robert A.; Leissler, George W.

    1993-01-01

    This is the second of two reports which discuss initial experiments on thermal barrier coatings prepared and tested in newly upgraded plasma spray and burner rig test facilities at LeRC. The first report, part 1, describes experiments designed to establish the spray parameters for the baseline zirconia-yttria coating. Coating quality was judged primarily by the response to burner rig exposure, together with a variety of other characterization approaches including thermal diffusivity measurements. That portion of the study showed that the performance of the baseline NASA coating was not strongly sensitive to processing parameters. In this second part of the study, new hafnia-yttria coatings were evaluated with respect to both baseline and alternate zirconia-yttria coatings. The hafnia-yttria and the alternate zirconia-yttria coatings were very sensitive to plasma-spray parameters in that high-quality coatings were obtained only when specific parameters were used. The reasons for this important observation are not understood.

  4. Automatic Cataract Hardness Classification Ex Vivo by Ultrasound Techniques.

    PubMed

    Caixinha, Miguel; Santos, Mário; Santos, Jaime

    2016-04-01

    To demonstrate the feasibility of a new methodology for cataract hardness characterization and automatic classification using ultrasound techniques, different cataract degrees were induced in 210 porcine lenses. A 25-MHz ultrasound transducer was used to obtain acoustical parameters (velocity and attenuation) and backscattering signals. B-Scan and parametric Nakagami images were constructed. Ninety-seven parameters were extracted and subjected to a Principal Component Analysis. Bayes, K-Nearest-Neighbours, Fisher Linear Discriminant and Support Vector Machine (SVM) classifiers were used to automatically classify the different cataract severities. Statistically significant increases with cataract formation were found for velocity, attenuation, mean brightness intensity of the B-Scan images and mean Nakagami m parameter (p < 0.01). The four classifiers showed a good performance for healthy versus cataractous lenses (F-measure ≥ 92.68%), while for initial versus severe cataracts the SVM classifier showed the higher performance (90.62%). The results showed that ultrasound techniques can be used for non-invasive cataract hardness characterization and automatic classification. Copyright © 2016 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

  5. Characterization of three-way automotive catalysts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kenik, E.A.; More, K.L.; LaBarge, W.

    1997-04-01

    The CRADA between Delphi Automotive Systems (Delphi; formerly General Motors - AC Delco, Systems) and Lockheed Martin Energy Research (LMER) on automotive catalysts was completed at the end of FY96, after a ten month, no-cost extension. The CRADA was aimed at improved performance and lifetime of noble metal based three-way-catalysts (TWC), which are the primary catalytic system for automotive emission control systems. While these TWC can meet the currently required emission standards, higher than optimum noble metal loadings are often required to meet lifetime requirements. In addition, more stringent emission standards will be imposed in the near future, demanding improvedmore » performance and service life from these catalysts. Understanding the changes of TWC conversion efficiency with ageing is a critical need in improving these catalysts. Initially in a fresh catalyst, the active material is often distributed on a very fine scale, approaching single atoms or small atomic clusters. As such, a wide range of analytical techniques have been employed to provide high spatial resolution characterization of the evolving state of the catalytic material.« less

  6. Practice Pattern Variation in Pediatric Eosinophilic Esophagitis in the Carolinas EoE Collaborative: A Research Model in Community and Academic Practices.

    PubMed

    Huang, Kevin Z; Jensen, Elizabeth T; Chen, Hannah X; Landes, Lisa E; McConnell, Kristen A; Almond, M Angie; Johnston, Douglas T; Durban, Raquel; Jobe, Laura; Frost, Carrie; Donnelly, Sarah; Antonio, Brady; Safta, Anca M; Quiros, J Antonio; Markowitz, Jonathan E; Dellon, Evan S

    2018-06-01

    Differences in the initial management of pediatric eosinophilic esophagitis (EoE) by practice setting have not been well characterized. We aimed to characterize these differences for sites in the Carolinas EoE Collaborative (CEoEC), a multicenter network of academic and community practices. We performed a retrospective cohort study of pediatric EoE patients at five CEoEC sites: University of North Carolina (UNC) Hospital, Charlotte Asthma and Allergy Specialists, Greenville Health Systems, Wake Forest Baptist Medical Center, and the Medical University of South Carolina Hospital. Cases of EoE were defined by consensus guidelines. Data were extracted from electronic medical records. We tested for differences among sites and used a multinomial model (polytomous regression) to assess associations between treatment and site, adjusting on patient factors. We identified 464 children with EoE across the CEoEC sites. The median age was highest at Wake Forest (11.4 years), the median eosinophil count was highest at UNC (69 eos/hpf), and UNC had the most male patients (82%). UNC used topical steroids for initial treatment in 86% of cases, compared with <1% in Greenville ( P < 0.01). Greenville used dietary elimination more frequently than UNC (81% vs 2%, P < 0.01). Differences in treatment approach held after adjusting for potential baseline confounders. There was no significant association between patient factors and initial treatment approach. Significant differences in EoE patient factors and treatment approaches were identified across CEoEC sites and were not explained by patient or practice factors. This suggests that institutional or provider preferences drive initial treatment approaches, and that more data are needed to drive best practice decisions.

  7. Sci-Thur PM – Brachytherapy 01: Fast brachytherapy dose calculations: Characterization of egs-brachy features to enhance simulation efficiency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chamberland, Marc; Taylor, Randle E.P.; Rogers, Da

    2016-08-15

    Purpose: egs-brachy is a fast, new EGSnrc user-code for brachytherapy applications. This study characterizes egs-brachy features that enhance simulation efficiency. Methods: Calculations are performed to characterize efficiency gains from various features. Simulations include radionuclide and miniature x-ray tube sources in water phantoms and idealized prostate, breast, and eye plaque treatments. Features characterized include voxel indexing of sources to reduce boundary checks during radiation transport, scoring collision kerma via tracklength estimator, recycling photons emitted from sources, and using phase space data to initiate simulations. Bremsstrahlung cross section enhancement (BCSE), uniform bremsstrahlung splitting (UBS), and Russian Roulette (RR) are considered for electronicmore » brachytherapy. Results: Efficiency is enhanced by a factor of up to 300 using tracklength versus interaction scoring of collision kerma and by up to 2.7 and 2.6 using phase space sources and particle recycling respectively compared to simulations in which particles are initiated within sources. On a single 2.5 GHz Intel Xeon E5-2680 processor cor, simulations approximating prostate and breast permanent implant ((2 mm){sup 3} voxels) and eye plaque ((1 mm){sup 3}) treatments take as little as 9 s (prostate, eye) and up to 31 s (breast) to achieve 2% statistical uncertainty on doses within the PTV. For electronic brachytherapy, BCSE, UBS, and RR enhance efficiency by a factor >2000 compared to a factor of >10{sup 4} using a phase space source. Conclusion: egs-brachy features provide substantial efficiency gains, resulting in calculation times sufficiently fast for full Monte Carlo simulations for routine brachytherapy treatment planning.« less

  8. Antibiotic discovery throughout the Small World Initiative: A molecular strategy to identify biosynthetic gene clusters involved in antagonistic activity.

    PubMed

    Davis, Elizabeth; Sloan, Tyler; Aurelius, Krista; Barbour, Angela; Bodey, Elijah; Clark, Brigette; Dennis, Celeste; Drown, Rachel; Fleming, Megan; Humbert, Allison; Glasgo, Elizabeth; Kerns, Trent; Lingro, Kelly; McMillin, MacKenzie; Meyer, Aaron; Pope, Breanna; Stalevicz, April; Steffen, Brittney; Steindl, Austin; Williams, Carolyn; Wimberley, Carmen; Zenas, Robert; Butela, Kristen; Wildschutte, Hans

    2017-06-01

    The emergence of bacterial pathogens resistant to all known antibiotics is a global health crisis. Adding to this problem is that major pharmaceutical companies have shifted away from antibiotic discovery due to low profitability. As a result, the pipeline of new antibiotics is essentially dry and many bacteria now resist the effects of most commonly used drugs. To address this global health concern, citizen science through the Small World Initiative (SWI) was formed in 2012. As part of SWI, students isolate bacteria from their local environments, characterize the strains, and assay for antibiotic production. During the 2015 fall semester at Bowling Green State University, students isolated 77 soil-derived bacteria and genetically characterized strains using the 16S rRNA gene, identified strains exhibiting antagonistic activity, and performed an expanded SWI workflow using transposon mutagenesis to identify a biosynthetic gene cluster involved in toxigenic compound production. We identified one mutant with loss of antagonistic activity and through subsequent whole-genome sequencing and linker-mediated PCR identified a 24.9 kb biosynthetic gene locus likely involved in inhibitory activity in that mutant. Further assessment against human pathogens demonstrated the inhibition of Bacillus cereus, Listeria monocytogenes, and methicillin-resistant Staphylococcus aureus in the presence of this compound, thus supporting our molecular strategy as an effective research pipeline for SWI antibiotic discovery and genetic characterization. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  9. Intercomparison of model response and internal variability across climate model ensembles

    NASA Astrophysics Data System (ADS)

    Kumar, Devashish; Ganguly, Auroop R.

    2017-10-01

    Characterization of climate uncertainty at regional scales over near-term planning horizons (0-30 years) is crucial for climate adaptation. Climate internal variability (CIV) dominates climate uncertainty over decadal prediction horizons at stakeholders' scales (regional to local). In the literature, CIV has been characterized indirectly using projections of climate change from multi-model ensembles (MME) instead of directly using projections from multiple initial condition ensembles (MICE), primarily because adequate number of initial condition (IC) runs were not available for any climate model. Nevertheless, the recent availability of significant number of IC runs from one climate model allows for the first time to characterize CIV directly from climate model projections and perform a sensitivity analysis to study the dominance of CIV compared to model response variability (MRV). Here, we measure relative agreement (a dimensionless number with values ranging between 0 and 1, inclusive; a high value indicates less variability and vice versa) among MME and MICE and find that CIV is lower than MRV for all projection time horizons and spatial resolutions for precipitation and temperature. However, CIV exhibits greater dominance over MRV for seasonal and annual mean precipitation at higher latitudes where signals of climate change are expected to emerge sooner. Furthermore, precipitation exhibits large uncertainties and a rapid decline in relative agreement from global to continental, regional, or local scales for MICE compared to MME. The fractional contribution of uncertainty due to CIV is invariant for precipitation and decreases for temperature as lead time progresses towards the end of the century.

  10. Electron Beam Production and Characterization for the PLEIADES Thomson X-ray Source

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brown, W J; Hartemann, F V; Tremaine, A M

    2002-10-14

    We report on the performance of an S-band RF photocathode electron gun and accelerator for operation with the PLEIADES Thomson x-ray source at LLNL. Simulations of beam production, transport, and focus are presented. It is shown that a 1 ps, 500 pC electron bunch with a normalized emittance of less than 5 {pi}mm-mrad can be delivered to the interaction point. Initial electron measurements are presented. Calculations of expected x-ray flux are also performed, demonstrating an expected peak spectral brightness of 10{sup 20} photons/s/mm{sup 2}/mrad{sup 2}/0.1% bandwidth. Effects of RF phase jitter are also presented, and planned phase measurements and controlmore » methods are discussed.« less

  11. Development of lightweight ceramic ablators and arc-jet test results

    NASA Technical Reports Server (NTRS)

    Tran, Huy K.

    1994-01-01

    Lightweight ceramic ablators (LCA's) were recently developed at Ames to investigate the use of low density fibrous substrates and organic resins as high temperature, high strength ablative heat shields. Unlike the traditional ablators, LCA's use porous ceramic/carbon fiber matrices as substrates for structural support, and polymeric resins as fillers. Several substrates and resins were selected for the initial studies, and the best performing candidates were further characterized. Three arcjet tests were conducted to determine the LCA's thermal performance and ablation characteristics in a high enthalpy, hypersonic flow environment. Mass loss and recession measurements were obtained for each sample at post test, and the recession rates were determined from high speed motion films. Surface temperatures were also obtained from optical pyrometers.

  12. Characterization of the influence of polarization orientation on bulk damage in KDP crystals at different wavelengths

    NASA Astrophysics Data System (ADS)

    Zheng, YinBo; Ding, Lei; Zhou, XinDa; Ba, RongSheng; Yuan, Jing; Xu, HongLei; Na, Jin; Li, YaJun; Yang, XiaoYu; Chai, Liqun; Chen, Bo; Zheng, WanGuo

    2016-08-01

    The investigation of polarization orientation on damage performance of type I doubler KDP crystals under different wavelengths pulses irradiation is presented in this work. Pinpoints densities (PPD) and the size distribution of pinpoints are extracted through light scattering pictures captured by microscope. The obtained results indicate that the measured PPD as a function of the fluence is both wavelength and polarization dependent, although neither fluence nor polarization have impact on the size distribution of pinpoints. We also find that the damage performances can separate into three groups depending on the wavelength, which suggests the existence of different categories of precursors and different mechanisms responsible for bulk damage initiation in SHG KDP crystals.

  13. [Metabolic disorders as paraneoplastic syndromes].

    PubMed

    Krug, S; Michl, P

    2018-02-01

    Paraneoplastic syndromes are characterized by the tumor-induced release of peptide hormones and/or the initiation of immune phenomena, which elicit clinical changes and alterations in laboratory parameters independent of the tumor size and spread. In addition to neurological, endocrinal and rheumatological phenotypes, metabolic alterations play a special role in the clinical routine as they commonly present with acute symptoms in an emergency situation and necessitate immediate diagnosis and prompt initiation of treatment. Metabolic alterations within the framework of malignant diseases should be treated in a multidisciplinary team and it is often necessary to perform monitoring and treatment in an intensive care unit. This article focuses on the diagnostic and therapeutic options for metabolic disorders due to paraneoplastic syndromes, such as hypercalcemia, hypocalcemia, hyperglycemia, hypoglycemia and a special variant of tumor-induced metabolic disorders due to tumor lysis syndrome.

  14. Localized nasopharyngeal amyloidosis mimicking malignancy: A case report.

    PubMed

    Kim, Jong Seung; Kwon, Sam Hyun

    2017-07-01

    Nasopharyngeal amyloidosis is a benign, slowly progressive disease that is characterized by extracellular eosinophilic deposition. We report a rare case of localized nasopharyngeal amyloidosis. The initial chief complaint of this patient was frequent epistaxis and right aural fullness. The initial diagnosis was nasopharyngeal tumor. There is no universally effective medical treatment for nasopharyngeal amyloidosis but surgery can be an option. We performed careful observation with regular follow-up by nasopharyngoscopy and radiologic study. The patient reported no further complaints at 1-year follow-up and the lesion from nasopharyngeal amyloidosis was still present. Although it is rare, nasopharyngeal amyloidosis should be considered in the differential diagnosis of epistaxis, nasal obstruction, and otitis media with effusion, which are the main symptoms of nasopharyngeal carcinoma. In the absence of systemic disease, localized nasopharyngeal amyloidosis may be treated conservatively.

  15. Carbon-Carbon Nozzle Extension Development in Support of In-Space and Upper-Stage Liquid Rocket Engines

    NASA Technical Reports Server (NTRS)

    Gradl, Paul R.; Valentine, Peter G.

    2017-01-01

    Upper stage and in-space liquid rocket engines are optimized for performance through the use of high area ratio nozzles to fully expand combustion gases to low exit pressures, increasing exhaust velocities. Due to the large size of such nozzles, and the related engine performance requirements, carbon-carbon (C-C) composite nozzle extensions are being considered to reduce weight impacts. Currently, the state-of-the-art is represented by the metallic and foreign composite nozzle extensions limited to approximately 2000 degrees F. used on the Atlas V, Delta IV, Falcon 9, and Ariane 5 launch vehicles. NASA and industry partners are working towards advancing the domestic supply chain for C-C composite nozzle extensions. These development efforts are primarily being conducted through the NASA Small Business Innovation Research (SBIR) program in addition to other low level internal research efforts. This has allowed for the initial material development and characterization, subscale hardware fabrication, and completion of hot-fire testing in relevant environments. NASA and industry partners have designed, fabricated and hot-fire tested several subscale domestically produced C-C extensions to advance the material and coatings fabrication technology for use with a variety of liquid rocket and scramjet engines. Testing at NASA's Marshall Space Flight Center (MSFC) evaluated heritage and state-of-the-art C-C materials and coatings, demonstrating the initial capabilities of the high temperature materials and their fabrication methods. This paper discusses the initial material development, design and fabrication of the subscale carbon-carbon nozzle extensions, provides an overview of the test campaign, presents results of the hot fire testing, and discusses potential follow-on development work. The follow on work includes the fabrication of ultra-high temperature materials, larger C-C nozzle extensions, material characterization, sub-element testing and hot-fire testing at larger scale.

  16. Characterization of plastic deformation and chemical reaction in titanium-polytetrafluoroethylene mixture

    NASA Astrophysics Data System (ADS)

    Davis, Jeffery Jon

    1998-09-01

    The subject of this dissertation is the deformation process of a single metal - polymer system (titanium - polytetrafluoroethylene) and how this process leads to initiation of chemical reaction. Several different kinds of experiments were performed to characterize the behavior of this material to shock and impact. These mechanical conditions induce a rapid plastic deformation of the sample. All of the samples tested had an initial porosity which increased the plastic flow condition. It is currently believed that during the deformation process two important conditions occur: removal of the oxide layer from the metal and decomposition of the polymer. These conditions allow for rapid chemical reaction. The research from this dissertation has provided insight into the complex behavior of plastic deformation and chemical reactions in titanium - polytetrafluoroethylene (PTFE, Teflon). A hydrodynamic computational code was used to model the plastic flow for correlation with the results from the experiments. The results from this work are being used to develop an ignition and growth model for metal/polymer systems. Three sets of experiments were used to examine deformation of the 80% Ti and 20% Teflon materials: drop- weight, gas gun, and split-Hopkinson pressure bar. Recovery studies included post shot analysis of the samples using x-ray diffraction. Lagrangian hydrocode DYNA2D modeling of the drop-weight tests was performed for comparison with experiments. One of the reactions know to occur is Ti + C → TiC (s) which results in an exothermic release. However, the believed initial reactions occur between Ti and fluorine which produces TixFy gases. The thermochemical code CHEETAH was used to investigate the detonation products and concentrations possible during Ti - Teflon reaction. CHEETAH shows that the Ti - fluorine reactions are thermodynamically favorable. This research represents the most comprehensive to date study of deformation induced chemical reaction in metal/polymers.

  17. New inhalation-optimized itraconazole nanoparticle-based dry powders for the treatment of invasive pulmonary aspergillosis

    PubMed Central

    Duret, Christophe; Wauthoz, Nathalie; Sebti, Thami; Vanderbist, Francis; Amighi, Karim

    2012-01-01

    Purpose Itraconazole (ITZ) dry powders for inhalation (DPI) composed of nanoparticles (NP) embedded in carrier microparticles were prepared and characterized. Methods DPIs were initially produced by reducing the ITZ particle size to the nanometer range using high-pressure homogenization with tocopherol polyethylene 1000 succinate (TPGS, 10% w/w ITZ) as a stabilizer. The optimized nanosuspension and the initial microsuspension were then spray-dried with different proportions of or in the absence of mannitol and/or sodium taurocholate. DPI characterization was performed using scanning electron microscopy for morphology, laser diffraction to evaluate the size-reduction process, and the size of the dried NP when reconstituted in aqueous media, impaction studies using a multistage liquid impactor to determine the aerodynamic performance and fine-particle fraction that is theoretically able to reach the lung, and dissolution studies to determine the solubility of ITZ. Results Scanning electron microscopy micrographs showed that the DPI particles were composed of mannitol microparticles with embedded nano- or micro-ITZ crystals. The formulations prepared from the nanosuspension exhibited good flow properties and better fine-particle fractions, ranging from 46.2% ± 0.5% to 63.2% ± 1.7% compared to the 23.1% ± 0.3% that was observed with the formulation produced from the initial microsuspension. Spray-drying affected the NP size by inducing irreversible aggregation, which was able to be minimized by the addition of mannitol and sodium taurocholate before the drying procedure. The ITZ NP-based DPI considerably increased the ITZ solubility (58 ± 2 increased to 96 ± 1 ng/mL) compared with that of raw ITZ or an ITZ microparticle-based DPI (<10 ng/mL). Conclusion Embedding ITZ NP in inhalable microparticles is a very effective method to produce DPI formulations with optimal aerodynamic properties and enhanced ITZ solubility. These formulations could be applied to other poorly water-soluble drugs and could be a very effective alternative for treating invasive pulmonary aspergillosis. PMID:23093903

  18. Performance and characterization of a new tannin-based coagulant

    NASA Astrophysics Data System (ADS)

    Beltrán-Heredia, J.; Sánchez-Martín, J.; Gómez-Muñoz, C.

    2012-09-01

    Diethanolamine and formaldehyde were employed to cationize tannins from black wattle. This novel coagulant called CDF was functionally characterized in removing sodium dodecylbenzene sulfonate (anionic surfactant) and Palatine Fast Black WAN (azoic dye). Refined tannin-derived commercial coagulants exhibited similar efficiency, while CDF presented higher coagulant ability than alum, a usual coagulant agent. Low doses of CDF (ca. 100 mg L-1) were able to remove more than 70 % of surfactant and more than 85 % of dye (initial pollutant concentration of ca. 100 mg L-1) and it presented no temperature affection and worked at a relatively wide pH range. Surfactant and dye removal responded to the classical coagulant-and-adsorption models, such as Frumkin-Fowler-Guggenheim or Gu and Zhu in the case of surfactant, and Langmuir and Freundlich in the case of dye.

  19. Preparation and characterization of SnO2 and Carbon Co-coated LiFePO4 cathode materials.

    PubMed

    Wang, Haibin; Liu, Shuxin; Huang, Yongmao

    2014-04-01

    The SnO2 and carbon co-coated LiFePO4 cathode materials were successfully synthesized by solid state method. The microstructure and morphology of LiFePO4 composites were characterized by X-ray diffraction, Raman spectroscopy, scanning electron microscopy and transmission electron microscope. The results showed that the SnO2 and carbon co-coated LiFePO4 cathode materials exhibited more uniform particle size distribution. Compared with the uncoated LiFePO4/C, the structure of LiFePO4 with SnO2 and carbon coating had no change. The existence of SnO2 and carbon coating layer effectively enhanced the initial discharge capacity. Among the investigated samples, the one with DBTDL:LiFePO4 molar ratios of 7:100 exhibited the best electrochemical performance.

  20. X-ray source characterization of aluminum X-pinch plasmas driven by the 0. 5 TW LION accelerator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qi, N.; Hammer, D.A.; Kalantar, D.H.

    1989-12-01

    Recent experiments at Cornell have been performed to investigate X-pinch plasmas as intense x-ray sources which might be used to pump resonant photoexcitation lasers. Crossed Al wires have been driven by up to 600 kA current for 40 ns. High density bright spots are observed at the crossing point(s). Various diagnostics were used to characterize the X-pinch plasmas as a function of initial mass loading for several specific wire configurations. The optimum mass loading for different ionization stages of Al, and the total x-ray energy yields, which are on the order of hundreds of Joules, were examined. Estimates of plasmamore » density, {similar to}10{sup 20} cm{sup {minus}3}, and temperature, about 400 eV, were obtained.« less

  1. Characterizing Design Cognition of High School Students: Initial Analyses Comparing Those with and without Pre-Engineering Experiences

    ERIC Educational Resources Information Center

    Wells, John; Lammi, Matthew; Gero, John; Grubbs, Michael E.; Paretti, Marie; Williams, Christopher

    2016-01-01

    Reported in this article are initial results from of a longitudinal study to characterize the design cognition and cognitive design styles of high school students with and without pre-engineering course experience over a 2-year period, and to compare them with undergraduate engineering students. The research followed a verbal protocol analysis…

  2. Initial Characterization of Colombian High School Physics Teachers' Pedagogical Content Knowledge on Electric Fields

    ERIC Educational Resources Information Center

    Melo-Niño, Lina Viviana; Cañada, Florentina; Mellado, Vicente

    2017-01-01

    We explore the initial characterization of the pedagogical content knowledge of four, in-service, Colombian pre-university secondary education physics teachers on the concept of electric field. Two of them teach the content in English as a second language. The aim of the study was to obtain an image of the participants' teaching of electric field…

  3. Triple Plate Mold Final Report: Optimization of the Mold Design and Casting Parameters for a Thin U-10mo Fuel Casting

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aikin, Jr., Robert M.

    This work describes the experiments and modeling that have been performed to improve and try to optimize the simultaneous casting of three plates of U-10wt%Mo in a single coil vacuum induction melting (VIM) furnace. The plates of interest are 280 mm wide by 203 mm tall by 5 mm thick (11" x 8" x 0.2"). The initial mold design and processing parameters were supplied by Y-12. The mold and casting cavity were instrumented with a number of thermocouples, and the casting performed to determine the thermal history of the mold and casting. The resulting cast plates were radiographed and numerousmore » defects identified. Metallography was performed to help identify the nature of the radiographically observed defects. This information was then used to validate a mold filling and solidification model of that casting. Based on the initial casting, good casting design practice, and process simulation of several design alternatives, a revised design was developed with the goal of minimizing casting defects such as porosity. The redesigned mold had a larger hot-top and had its long axis along the horizontal direction. These changes were to try to develop a strong thermal gradient conducive to good feeding and minimization of micro- and macroporosity in the cast plates. An instrumented casting was then performed with the revised mold design and a linear distributor. This design yielded cast plates with significantly less radiographically identified defects. Unfortunately, there was significant variation in plate weight and metal content in their hot-tops. Fluid flow simulations were then performed on this mold/distributor design. This helped identify the issue with this linear distributor design. Additional simulations were then performed on candidate distributor redesigns and a preferred distributor annular design was identified. This improved annular design was used to produce a third instrumented casting with favorable results. These refined designs and their radiographic characterization are compared to the initial design.« less

  4. Implementation of a WRF-CMAQ Air Quality Modeling System in Bogotá, Colombia

    NASA Astrophysics Data System (ADS)

    Nedbor-Gross, R.; Henderson, B. H.; Pachon, J. E.; Davis, J. R.; Baublitz, C. B.; Rincón, A.

    2014-12-01

    Due to a continuous economic growth Bogotá, Colombia has experienced air pollution issues in recent years. The local environmental authority has implemented several strategies to curb air pollution that have resulted in the decrease of PM10 concentrations since 2010. However, more activities are necessary in order to meet international air quality standards in the city. The University of Florida Air Quality and Climate group is collaborating with the Universidad de La Salle to prioritize regulatory strategies for Bogotá using air pollution simulations. To simulate pollution, we developed a modeling platform that combines the Weather Research and Forecasting Model (WRF), local emissions, and the Community Multi-scale Air Quality model (CMAQ). This platform is the first of its kind to be implemented in the megacity of Bogota, Colombia. The presentation will discuss development and evaluation of the air quality modeling system, highlight initial results characterizing photochemical conditions in Bogotá, and characterize air pollution under proposed regulatory strategies. The WRF model has been configured and applied to Bogotá, which resides in a tropical climate with complex mountainous topography. Developing the configuration included incorporation of local topography and land-use data, a physics sensitivity analysis, review, and systematic evaluation. The threshold, however, was set based on synthesis of model performance under less mountainous conditions. We will evaluate the impact that differences in autocorrelation contribute to the non-ideal performance. Air pollution predictions are currently under way. CMAQ has been configured with WRF meteorology, global boundary conditions from GEOS-Chem, and a locally produced emission inventory. Preliminary results from simulations show promising performance of CMAQ in Bogota. Anticipated results include a systematic performance evaluation of ozone and PM10, characterization of photochemical sensitivity, and air quality predictions under proposed regulatory scenarios.

  5. Optimization of Biomathematical Model Predictions for Cognitive Performance Impairment in Individuals: Accounting for Unknown Traits and Uncertain States in Homeostatic and Circadian Processes

    PubMed Central

    Van Dongen, Hans P. A.; Mott, Christopher G.; Huang, Jen-Kuang; Mollicone, Daniel J.; McKenzie, Frederic D.; Dinges, David F.

    2007-01-01

    Current biomathematical models of fatigue and performance do not accurately predict cognitive performance for individuals with a priori unknown degrees of trait vulnerability to sleep loss, do not predict performance reliably when initial conditions are uncertain, and do not yield statistically valid estimates of prediction accuracy. These limitations diminish their usefulness for predicting the performance of individuals in operational environments. To overcome these 3 limitations, a novel modeling approach was developed, based on the expansion of a statistical technique called Bayesian forecasting. The expanded Bayesian forecasting procedure was implemented in the two-process model of sleep regulation, which has been used to predict performance on the basis of the combination of a sleep homeostatic process and a circadian process. Employing the two-process model with the Bayesian forecasting procedure to predict performance for individual subjects in the face of unknown traits and uncertain states entailed subject-specific optimization of 3 trait parameters (homeostatic build-up rate, circadian amplitude, and basal performance level) and 2 initial state parameters (initial homeostatic state and circadian phase angle). Prior information about the distribution of the trait parameters in the population at large was extracted from psychomotor vigilance test (PVT) performance measurements in 10 subjects who had participated in a laboratory experiment with 88 h of total sleep deprivation. The PVT performance data of 3 additional subjects in this experiment were set aside beforehand for use in prospective computer simulations. The simulations involved updating the subject-specific model parameters every time the next performance measurement became available, and then predicting performance 24 h ahead. Comparison of the predictions to the subjects' actual data revealed that as more data became available for the individuals at hand, the performance predictions became increasingly more accurate and had progressively smaller 95% confidence intervals, as the model parameters converged efficiently to those that best characterized each individual. Even when more challenging simulations were run (mimicking a change in the initial homeostatic state; simulating the data to be sparse), the predictions were still considerably more accurate than would have been achieved by the two-process model alone. Although the work described here is still limited to periods of consolidated wakefulness with stable circadian rhythms, the results obtained thus far indicate that the Bayesian forecasting procedure can successfully overcome some of the major outstanding challenges for biomathematical prediction of cognitive performance in operational settings. Citation: Van Dongen HPA; Mott CG; Huang JK; Mollicone DJ; McKenzie FD; Dinges DF. Optimization of biomathematical model predictions for cognitive performance impairment in individuals: accounting for unknown traits and uncertain states in homeostatic and circadian processes. SLEEP 2007;30(9):1129-1143. PMID:17910385

  6. Intensity noise reduction of a high-power nonlinear femtosecond fiber amplifier based on spectral-breathing self-similar parabolic pulse evolution

    NASA Astrophysics Data System (ADS)

    Wang, Sijia; Liu, Bowen; Song, Youjian; Hu, Minglie

    2016-04-01

    We report on a simple passive scheme to reduce the intensity noise of high-power nonlinear fiber amplifiers by use of the spectral-breathing parabolic evolution of the pulse amplification with an optimized negative initial chirp. In this way, the influences of amplified spontaneous emission (ASE) on the amplifier intensity noise can be efficiently suppressed, owing to the lower overall pulse chirp, shorter spectral broadening distance, as well as the asymptotic attractive nature of self-similar pulse amplification. Systematic characterizations of the relative intensity noise (RIN) of a free-running nonlinear Yb-doped fiber amplifier are performed over a series of initial pulse parameters. Experiments show that the measured amplifier RIN increases respect to the decreased input pulse energy, due to the increased amount of ASE noise. For pulse amplification with a proper negative initial chirp, the increase of RIN is found to be smaller than with a positive initial chirp, confirming the ASE noise tolerance of the proposed spectral-breathing parabolic amplification scheme. At the maximum output average power of 27W (25-dB amplification gain), the incorporation of an optimum negative initial chirp (-0.84 chirp parameter) leads to a considerable amplifier root-mean-square (rms) RIN reduction of ~20.5% (integrated from 10 Hz to 10 MHz Fourier frequency). The minimum amplifier rms RIN of 0.025% (integrated from 1 kHz to 5 MHz Fourier frequency) is obtained along with the transform-limited compressed pulse duration of 55fs. To our knowledge, the demonstrated intensity noise performance is the lowest RIN level measured from highpower free-running femtosecond fiber amplifiers.

  7. High Fidelity, Fuel-Like Thermal Simulators for Non-Nuclear Testing: Analysis and Initial Test Results

    NASA Technical Reports Server (NTRS)

    Bragg-Sitton, Shannon M.; Dickens, Ricky; Dixon, David; Kapernick, Richard

    2007-01-01

    Non-nuclear testing can be a valuable tool in the development of a space nuclear power system, providing system characterization data and allowing one to work through various fabrication, assembly and integration issues without the cost and time associated with a full ground nuclear test. In a non-nuclear test bed, electric heaters are used to simulate the heat from nuclear fuel. Testing with non-optimized heater elements allows one to assess thermal, heat transfer. and stress related attributes of a given system, but fails to demonstrate the dynamic response that would be present in an integrated, fueled reactor system. High fidelity thermal simulators that match both the static and the dynamic fuel pin performance that would be observed in an operating, fueled nuclear reactor can vastly increase the value of non-nuclear test results. With optimized simulators, the integration of thermal hydraulic hardware tests with simulated neutronic response provides a bridge between electrically heated testing and fueled nuclear testing. By implementing a neutronic response model to simulate the dynamic response that would be expected in a fueled reactor system, one can better understand system integration issues, characterize integrated system response times and response characteristics and assess potential design improvements at relatively small fiscal investment. Initial conceptual thermal simulator designs are determined by simple one-dimensional analysis at a single axial location and at steady state conditions; feasible concepts are then input into a detailed three-dimensional model for comparison to expected fuel pin performance. Static and dynamic fuel pin performance for a proposed reactor design is determined using SINDA/FLUINT thermal analysis software, and comparison is made between the expected nuclear performance and the performance of conceptual thermal simulator designs. Through a series of iterative analyses, a conceptual high fidelity design is developed: this is followed by engineering design, fabrication, and testing to validate the overall design process. Test results presented in this paper correspond to a "first cut" simulator design for a potential liquid metal (NaK) cooled reactor design that could be applied for Lunar surface power. Proposed refinements to this simulator design are also presented.

  8. Using an emotional saccade task to characterize executive functioning and emotion processing in attention-deficit hyperactivity disorder and bipolar disorder.

    PubMed

    Yep, Rachel; Soncin, Stephen; Brien, Donald C; Coe, Brian C; Marin, Alina; Munoz, Douglas P

    2018-04-23

    Despite distinct diagnostic criteria, attention-deficit hyperactivity disorder (ADHD) and bipolar disorder (BD) share cognitive and emotion processing deficits that complicate diagnoses. The goal of this study was to use an emotional saccade task to characterize executive functioning and emotion processing in adult ADHD and BD. Participants (21 control, 20 ADHD, 20 BD) performed an interleaved pro/antisaccade task (look toward vs. look away from a visual target, respectively) in which the sex of emotional face stimuli acted as the cue to perform either the pro- or antisaccade. Both patient groups made more direction (erroneous prosaccades on antisaccade trials) and anticipatory (saccades made before cue processing) errors than controls. Controls exhibited lower microsaccade rates preceding correct anti- vs. prosaccade initiation, but this task-related modulation was absent in both patient groups. Regarding emotion processing, the ADHD group performed worse than controls on neutral face trials, while the BD group performed worse than controls on trials presenting faces of all valence. These findings support the role of fronto-striatal circuitry in mediating response inhibition deficits in both ADHD and BD, and suggest that such deficits are exacerbated in BD during emotion processing, presumably via dysregulated limbic system circuitry involving the anterior cingulate and orbitofrontal cortex. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. Synthesis and characterization of electrospun molybdenum dioxide-carbon nanofibers as sulfur matrix additives for rechargeable lithium-sulfur battery applications.

    PubMed

    Zhuang, Ruiyuan; Yao, Shanshan; Jing, Maoxiang; Shen, Xiangqian; Xiang, Jun; Li, Tianbao; Xiao, Kesong; Qin, Shibiao

    2018-01-01

    One-dimensional molybdenum dioxide-carbon nanofibers (MoO 2 -CNFs) were prepared using an electrospinning technique followed by calcination, using sol-gel precursors and polyacrylonitrile (PAN) as a processing aid. The resulting samples were characterized by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), Raman spectroscopy, Brunauer-Emmet-Teller (BET) surface area measurements, scanning electron microscopy (SEM) and transmission electron microscopy (TEM). MoO 2 -CNFs with an average diameter of 425-575 nm obtained after heat treatment were used as a matrix to prepare sulfur/MoO 2 -CNF cathodes for lithium-sulfur (Li-S) batteries. The polysulfide adsorption and electrochemical performance tests demonstrated that MoO 2 -CNFs did not only act as polysulfide reservoirs to alleviate the shuttle effect, but also improve the electrochemical reaction kinetics during the charge-discharge processes. The effect of MoO 2 -CNF heat treatment on the cycle performance of sulfur/MoO 2 -CNFs electrodes was examined, and the data showed that MoO 2 -CNFs calcined at 850 °C delivered optimal performance with an initial capacity of 1095 mAh g -1 and 860 mAh g -1 after 50 cycles. The results demonstrated that sulfur/MoO 2 -CNF composites display a remarkably high lithium-ion diffusion coefficient, low interfacial resistance and much better electrochemical performance than pristine sulfur cathodes.

  10. Strategic groups, performance, and strategic response in the nursing home industry.

    PubMed

    Zinn, J S; Aaronson, W E; Rosko, M D

    1994-06-01

    This study examines the effect of strategic group membership on nursing home performance and strategic behavior. Data from the 1987 Medicare and Medicaid Automated Certification Survey were combined with data from the 1987 and 1989 Pennsylvania Long Term Care Facility Questionnaire. The sample consisted of 383 Pennsylvania nursing homes. Cluster analysis was used to place the 383 nursing homes into strategic groups on the basis of variables measuring scope and resource deployment. Performance was measured by indicators of the quality of nursing home care (rates of pressure ulcers, catheterization, and restraint usage) and efficiency in services provision. Changes in Medicare participation after passage of the 1988 Medicare Catastrophic Coverage Act (MCCA) measured strategic behavior. MANOVA and Turkey HSD post hoc means tests determined if significant differences were associated with strategic group membership. Cluster analysis produced an optimal seven-group solution. Differences in group means were significant for the clustering, performance, and conduct variables (p < .0001). Strategic groups characterized by facilities providing a continuum of care services had the best patient care outcomes. The most efficient groups were characterized by facilities with high Medicare census. While all strategic groups increased Medicare census following passage of the MCCA, those dominated by for-profits had the greatest increases. Our analysis demonstrates that strategic orientation influences nursing home response to regulatory initiatives, a factor that should be recognized in policy formation directed at nursing home reform.

  11. Energy and momentum analysis of the deployment dynamics of nets in space

    NASA Astrophysics Data System (ADS)

    Botta, Eleonora M.; Sharf, Inna; Misra, Arun K.

    2017-11-01

    In this paper, the deployment dynamics of nets in space is investigated through a combination of analysis and numerical simulations. The considered net is deployed by ejecting several corner masses and thanks to momentum and energy transfer from those to the innermost threads of the net. In this study, the net is modeled with a lumped-parameter approach, and assumed to be symmetrical, subject to symmetrical initial conditions, and initially slack. The work-energy and momentum conservation principles are employed to carry out centroidal analysis of the net, by conceptually partitioning the net into a system of corner masses and the net proper and applying the aforementioned principles to the corresponding centers of mass. The analysis provides bounds on the values that the velocity of the center of mass of the corner masses and the velocity of the center of mass of the net proper can individually attain, as well as relationships between these and different energy contributions. The analytical results allow to identify key parameters characterizing the deployment dynamics of nets in space, which include the ratio between the mass of the corner masses and the total mass, the initial linear momentum, and the direction of the initial velocity vectors. Numerical tools are employed to validate and interpret further the analytical observations. Comparison of deployment results with and without initial velocity of the net proper suggests that more complete and lasting deployment can be achieved if the corner masses alone are ejected. A sensitivity study is performed for the key parameters identified from the energy/momentum analysis, and the outcome establishes that more lasting deployment and safer capture (i.e., characterized by higher traveled distance) can be achieved by employing reasonably lightweight corner masses, moderate shooting angles, and low shooting velocities. A comparison with current literature on tether-nets for space debris capture confirms overall agreement on the importance and effect of the relevant inertial and ejection parameters on the deployment dynamics.

  12. Methylation profiling identifies 2 groups of gliomas according to their tumorigenesis.

    PubMed

    Laffaire, Julien; Everhard, Sibille; Idbaih, Ahmed; Crinière, Emmanuelle; Marie, Yannick; de Reyniès, Aurelien; Schiappa, Renaud; Mokhtari, Karima; Hoang-Xuan, Khê; Sanson, Marc; Delattre, Jean-Yves; Thillet, Joëlle; Ducray, François

    2011-01-01

    Extensive genomic and gene expression studies have been performed in gliomas, but the epigenetic alterations that characterize different subtypes of gliomas remain largely unknown. Here, we analyzed the methylation patterns of 807 genes (1536 CpGs) in a series of 33 low-grade gliomas (LGGs), 36 glioblastomas (GBMs), 8 paired initial and recurrent gliomas, and 9 controls. This analysis was performed with Illumina's Golden Gate Bead methylation arrays and was correlated with clinical, histological, genomic, gene expression, and genotyping data, including IDH1 mutations. Unsupervised hierarchical clustering resulted in 2 groups of gliomas: a group corresponding to de novo GBMs and a group consisting of LGGs, recurrent anaplastic gliomas, and secondary GBMs. When compared with de novo GBMs and controls, this latter group was characterized by a very high frequency of IDH1 mutations and by a hypermethylated profile similar to the recently described glioma CpG island methylator phenotype. MGMT methylation was more frequent in this group. Among the LGG cluster, 1p19q codeleted LGG displayed a distinct methylation profile. A study of paired initial and recurrent gliomas demonstrated that methylation profiles were remarkably stable across glioma evolution, even during anaplastic transformation, suggesting that epigenetic alterations occur early during gliomagenesis. Using the Cancer Genome Atlas data set, we demonstrated that GBM samples that had an LGG-like hypermethylated profile had a high rate of IDH1 mutations and a better outcome. Finally, we identified several hypermethylated and downregulated genes that may be associated with LGG and GBM oncogenesis, LGG oncogenesis, 1p19q codeleted LGG oncogenesis, and GBM oncogenesis.

  13. Methylation profiling identifies 2 groups of gliomas according to their tumorigenesis

    PubMed Central

    Laffaire, Julien; Everhard, Sibille; Idbaih, Ahmed; Crinière, Emmanuelle; Marie, Yannick; de Reyniès, Aurelien; Schiappa, Renaud; Mokhtari, Karima; Hoang-Xuan, Khê; Sanson, Marc; Delattre, Jean-Yves; Thillet, Joëlle; Ducray, François

    2011-01-01

    Extensive genomic and gene expression studies have been performed in gliomas, but the epigenetic alterations that characterize different subtypes of gliomas remain largely unknown. Here, we analyzed the methylation patterns of 807 genes (1536 CpGs) in a series of 33 low-grade gliomas (LGGs), 36 glioblastomas (GBMs), 8 paired initial and recurrent gliomas, and 9 controls. This analysis was performed with Illumina's Golden Gate Bead methylation arrays and was correlated with clinical, histological, genomic, gene expression, and genotyping data, including IDH1 mutations. Unsupervised hierarchical clustering resulted in 2 groups of gliomas: a group corresponding to de novo GBMs and a group consisting of LGGs, recurrent anaplastic gliomas, and secondary GBMs. When compared with de novo GBMs and controls, this latter group was characterized by a very high frequency of IDH1 mutations and by a hypermethylated profile similar to the recently described glioma CpG island methylator phenotype. MGMT methylation was more frequent in this group. Among the LGG cluster, 1p19q codeleted LGG displayed a distinct methylation profile. A study of paired initial and recurrent gliomas demonstrated that methylation profiles were remarkably stable across glioma evolution, even during anaplastic transformation, suggesting that epigenetic alterations occur early during gliomagenesis. Using the Cancer Genome Atlas data set, we demonstrated that GBM samples that had an LGG-like hypermethylated profile had a high rate of IDH1 mutations and a better outcome. Finally, we identified several hypermethylated and downregulated genes that may be associated with LGG and GBM oncogenesis, LGG oncogenesis, 1p19q codeleted LGG oncogenesis, and GBM oncogenesis. PMID:20926426

  14. Characterization of the Edge Crack Torsion (ECT) Test for Mode III Fracture Toughness Measurement of Laminated Composites

    NASA Technical Reports Server (NTRS)

    Ratcliffe, James G.

    2004-01-01

    The edge crack torsion (ECT) test is designed to initiate mode III delamination growth in composite laminates. The test has undergone several design changes during its development. The objective of this paper was to determine the suitability of the current ECT test design a mode III fracture test. To this end, ECT tests were conducted on specimens manufactured from IM7/8552 and S2/8552 tape laminates. Three-dimensional finite element analyses were performed. The analysis results were used to calculate the distribution of mode I, mode II, and mode III strain energy release rate along the delamination front. The results indicated that mode IIIdominated delamination growth would be initiated from the specimen center. However, in specimens of both material types, the measured values of GIIIc exhibited significant dependence on delamination length. Load-displacement response of the specimens exhibited significant deviation from linearity before specimen failure. X-radiographs of a sample of specimens revealed that damage was initiated in the specimens prior to failure. Further inspection of the failure surfaces is required to identify the damage and determine that mode III delamination is initiated in the specimens.

  15. Kaiser Permanente's performance improvement system, Part 4: Creating a learning organization.

    PubMed

    Schilling, Lisa; Dearing, James W; Staley, Paul; Harvey, Patti; Fahey, Linda; Kuruppu, Francesca

    2011-12-01

    In 2006, recognizing variations in performance in quality, safety, service, and efficiency, Kaiser Permanente leaders initiated the development of a performance improvement (PI) system. Kaiser Permanente has implemented a strategy for creating the systemic capacity for continuous improvement that characterizes a learning organization. Six "building blocks" were identified to enable Kaiser Permanente to make the transition to becoming a learning organization: real-time sharing of meaningful performance data; formal training in problem-solving methodology; workforce engagement and informal knowledge sharing; leadership structures, beliefs, and behaviors; internal and external benchmarking; and technical knowledge sharing. Putting each building block into place required multiple complex strategies combining top-down and bottom-up approaches. Although the strategies have largely been successful, challenges remain. The demand for real-time meaningful performance data can conflict with prioritized changes to health information systems. It is an ongoing challenge to teach PI, change management, innovation, and project management to all managers and staff without consuming too much training time. Challenges with workforce engagement include low initial use of tools intended to disseminate information through virtual social networking. Uptake of knowledge-sharing technologies is still primarily by innovators and early adopters. Leaders adopt new behaviors at varying speeds and have a range of abilities to foster an environment that is psychologically safe and stimulates inquiry. A learning organization has the capability to improve, and it develops structures and processes that facilitate the acquisition and sharing of knowledge.

  16. Fast and effective characterization of 3D region of interest in medical image data

    NASA Astrophysics Data System (ADS)

    Kontos, Despina; Megalooikonomou, Vasileios

    2004-05-01

    We propose a framework for detecting, characterizing and classifying spatial Regions of Interest (ROIs) in medical images, such as tumors and lesions in MRI or activation regions in fMRI. A necessary step prior to classification is efficient extraction of discriminative features. For this purpose, we apply a characterization technique especially designed for spatial ROIs. The main idea of this technique is to extract a k-dimensional feature vector using concentric spheres in 3D (or circles in 2D) radiating out of the ROI's center of mass. These vectors form characterization signatures that can be used to represent the initial ROIs. We focus on classifying fMRI ROIs obtained from a study that explores neuroanatomical correlates of semantic processing in Alzheimer's disease (AD). We detect a ROI highly associated with AD and apply the feature extraction technique with different experimental settings. We seek to distinguish control from patient samples. We study how classification can be performed using the extracted signatures as well as how different experimental parameters affect classification accuracy. The obtained classification accuracy ranged from 82% to 87% (based on the selected ROI) suggesting that the proposed classification framework can be potentially useful in supporting medical decision-making.

  17. Characterizing a Wake-Free Safe Zone for the Simplified Aircraft-Based Paired Approach Concept

    NASA Technical Reports Server (NTRS)

    Guerreiro, Nelson M.; Neitzke, Kurt W.; Johnson, Sally C.; Stough, H. Paul, III; McKissick, Burnell T.; Syed, Hazari I.

    2010-01-01

    The Federal Aviation Administration (FAA) has proposed a concept of operations geared towards achieving increased arrival throughput at U.S. Airports, known as the Simplified Aircraft-based Paired Approach (SAPA) concept. In this study, a preliminary characterization of a wake-free safe zone (WFSZ) for the SAPA concept has been performed. The experiment employed Monte-Carlo simulations of varying approach profiles by aircraft pairs to closely-spaced parallel runways. Three different runway lateral spacings were investigated (750 ft, 1000 ft and 1400 ft), along with no stagger and 1500 ft stagger between runway thresholds. The paired aircraft were flown in a leader/trailer configuration with potential wake encounters detected using a wake detection surface translating with the trailing aircraft. The WFSZ is characterized in terms of the smallest observed initial in-trail distance leading to a wake encounter anywhere along the approach path of the aircraft. The results suggest that the WFSZ can be characterized in terms of two primary altitude regions, in ground-effect (IGE) and out of ground-effect (OGE), with the IGE region being the limiting case with a significantly smaller WFSZ. Runway stagger was observed to only modestly reduce the WFSZ size, predominantly in the OGE region.

  18. An optical method for characterizing carbon content in ceramic pot filters.

    PubMed

    Goodwin, J Y; Elmore, A C; Salvinelli, C; Reidmeyer, Mary R

    2017-08-01

    Ceramic pot filter (CPF) technology is a relatively common means of household water treatment in developing areas, and performance characteristics of CPFs have been characterized using production CPFs, experimental CPFs fabricated in research laboratories, and ceramic disks intended to be CPF surrogates. There is evidence that CPF manufacturers do not always fire their products according to best practices and the result is incomplete combustion of the pore forming material and the creation of a carbon core in the final CPFs. Researchers seldom acknowledge the existence of potential existence of carbon cores, and at least one CPF producer has postulated that the carbon may be beneficial in terms of final water quality because of the presence of activated carbon in consumer filters marketed in the Western world. An initial step in characterizing the presence and impact of carbon cores is the characterization of those cores. An optical method which may be more viable to producers relative to off-site laboratory analysis of carbon content has been developed and verified. The use of the optical method is demonstrated via preliminary disinfection and flowrate studies, and the results of these studies indicate that the method may be of use in studying production kiln operation.

  19. Theory-Driven Longitudinal Study Exploring Indoor Tanning Initiation in Teens Using a Person-Centered Approach

    PubMed Central

    Hillhouse, Joel; Turrisi, Rob; Cleveland, Michael J.; Scaglione, Nichole M.; Baker, Katie; Florence, L. Carter

    2015-01-01

    Background Younger indoor tanning initiation leads to greater melanoma risk due to more frequent and persistent behavior. Despite this, there are no published studies exploring the predictors of indoor tanning initiation in teen populations. Purpose This longitudinal study uses latent profile analysis to examine indoor tanning initiation in indoor tanning risk subgroups from a national sample of female adolescents. Methods Latent profile analysis used indoor tanning beliefs and perceptions to identify indoor tanning initiation risk subgroups. The teens in each subgroup were reassessed on indoor tanning initiation after a year. Results Three subgroups were identified: a low-risk, Anti-Tanning subgroup (18.6%) characterized by low scores on positive indoor tanning belief scales and high scores on beliefs about indoor tanning dangers; a moderate-risk Aware Social Tanner subgroup (47.2%) characterized by high scores on positive indoor tanning belief scales but also high scores on beliefs about indoor tanning dangers; and a high-risk Risky Relaxation Tanner subgroup (34.2%) characterized by high scores on positive indoor tanning belief scales and low scores on beliefs about indoor tanning dangers. Teens in the Aware Social Tanner and Risky Relaxation Tanner subgroups were significantly more likely to initiate indoor tanning in the following year. Conclusions These findings highlight the need to identify teens at risk for indoor tanning initiation and develop tailored interventions that will move them to the lowest risk subgroup. Subgroup correlates suggest parent and peer-based interventions may be successful. PMID:26370893

  20. Theory-Driven Longitudinal Study Exploring Indoor Tanning Initiation in Teens Using a Person-Centered Approach.

    PubMed

    Hillhouse, Joel; Turrisi, Rob; Cleveland, Michael J; Scaglione, Nichole M; Baker, Katie; Florence, L Carter

    2016-02-01

    Younger indoor tanning initiation leads to greater melanoma risk due to more frequent and persistent behavior. Despite this, there are no published studies exploring the predictors of indoor tanning initiation in teen populations. This longitudinal study uses latent profile analysis to examine indoor tanning initiation in indoor tanning risk subgroups from a national sample of female adolescents. Latent profile analysis used indoor tanning beliefs and perceptions to identify indoor tanning initiation risk subgroups. The teens in each subgroup were reassessed on indoor tanning initiation after a year. Three subgroups were identified: a low risk, anti-tanning subgroup (18.6 %) characterized by low scores on positive indoor tanning belief scales and high scores on beliefs about indoor tanning dangers; a moderate risk aware social tanner subgroup (47.2 %) characterized by high scores on positive indoor tanning belief scales but also high scores on beliefs about indoor tanning dangers; and a high risk risky relaxation tanner subgroup (34.2 %) characterized by high scores on positive indoor tanning belief scales and low scores on beliefs about indoor tanning dangers. Teens in the aware social tanner and risky relaxation tanner subgroups were significantly more likely to initiate indoor tanning in the following year. These findings highlight the need to identify teens at risk for indoor tanning initiation and develop tailored interventions that will move them to the lowest risk subgroup. Subgroup correlates suggest parent and peer-based interventions may be successful.

  1. Immediate newborn care practices delay thermoregulation and breastfeeding initiation

    PubMed Central

    Sobel, Howard L; Silvestre, Maria Asuncion A; Mantaring, Jacinto Blas V; Oliveros, Yolanda E; Nyunt-U, Soe

    2011-01-01

    Aim A deadly nosocomial outbreak in a Philippine hospital drew nationwide attention to neonatal sepsis. Together with specific infection control measures, interventions that protect newborns against infection-related mortality include drying, skin-to-skin contact, delayed cord clamping, breastfeeding initiation and delayed bathing. This evaluation characterized hospital care in the first hours of life with the intent to drive policy change, strategic planning and hospital reform. Methods Trained physicians observed 481 consecutive deliveries in 51 hospitals using a standardized tool to record practices and timing of immediate newborn care procedures. Results Drying, weighing, eye care and vitamin K injections were performed in more than 90% of newborns. Only 9.6% were allowed skin-to-skin contact. Interventions were inappropriately sequenced, e.g. immediate cord clamping (median 12 sec), delayed drying (96.5%) and early bathing (90.0%). While 68.2% were put to the breast, they were separated two minutes later. Unnecessary suctioning was performed in 94.9%. Doctors trained in neonatal resuscitation were 2.5 (1.1–5.7) times more likely to unnecessarily suction vigorous newborns. Two per cent died and 5.7% developed sepsis/pneumonia. Conclusions This minute-by-minute observational assessment revealed that performance and timing of immediate newborn care interventions are below WHO standards and deprive newborns of basic protections against infection and death. PMID:21375583

  2. Methods development for total organic carbon accountability

    NASA Technical Reports Server (NTRS)

    Benson, Brian L.; Kilgore, Melvin V., Jr.

    1991-01-01

    This report describes the efforts completed during the contract period beginning November 1, 1990 and ending April 30, 1991. Samples of product hygiene and potable water from WRT 3A were supplied by NASA/MSFC prior to contract award on July 24, 1990. Humidity condensate samples were supplied on August 3, 1990. During the course of this contract chemical analyses were performed on these samples to qualitatively determine specific components comprising, the measured organic carbon concentration. In addition, these samples and known standard solutions were used to identify and develop methodology useful to future comprehensive characterization of similar samples. Standard analyses including pH, conductivity, and total organic carbon (TOC) were conducted. Colorimetric and enzyme linked assays for total protein, bile acid, B-hydroxybutyric acid, methylene blue active substances (MBAS), urea nitrogen, ammonia, and glucose were also performed. Gas chromatographic procedures for non-volatile fatty acids and EPA priority pollutants were also performed. Liquid chromatography was used to screen for non-volatile, water soluble compounds not amenable to GC techniques. Methods development efforts were initiated to separate and quantitate certain chemical classes not classically analyzed in water and wastewater samples. These included carbohydrates, organic acids, and amino acids. Finally, efforts were initiated to identify useful concentration techniques to enhance detection limits and recovery of non-volatile, water soluble compounds.

  3. [Basic principles, planning and implementation of non-commercial clinical trials].

    PubMed

    Finger, R P; Coch, C; Coenen, M; Mengel, M; Hartmann, G; Holz, F G

    2011-01-01

    The proof of a drug's efficacy in randomized controlled trials is fundamental to therapeutic concepts determined by evidence-based medicine. Clinical trials according to the German Medicinal Products Act are performed by the pharmaceutical industry as company-sponsored trials (CST) driven by commercial interests or by non-commercial facilities as investigator-initiated trials (IIT), typically implemented by University Hospitals. In areas with no commercial interest, IITs are the driving force that generate scientific progress leading to treatment optimization. Therefore, non-commercial or investigator-initiated clinical trials are indispensable for improving medical care. To ensure the safety of trial participants and the quality of the data obtained, clinical trials are controlled by many legal regulations and internationally accepted quality standards. Therefore implementation of a clinical trial requires profound knowledge, qualified personnel, appropriate infrastructure, and substantial financial resources. In IITs unlike CSTs this has to be accomplished by the University without the assistance of the pharmaceutical industry. Since teaching of skills needed to perform clinical trials is still largely neglected in medical school and during residency this review addresses the (in clinical trials) inexperienced physician and outlines the characterization of a clinical trial, the range and division of responsibilities and the performance of clinical trials according to the German Medicinal Products Act.

  4. Measurement of cortical functional activation in awake mice using two-photon microscopy and a novel pO2-sensitive probe(Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Sencan, Ikbal; Esipova, Tatiana V.; Kilic, Kivilcim; Li, Baoqiang; Desjardins, Michèle; Yaseen, Mohammad A.; Wang, Hui; Jaswal, Rajeshwer S.; Kura, Sreekanth; Fu, Buyin; Boas, David A.; Devor, Anna; Sakadžić, Sava; Vinogradov, Sergei A.

    2017-02-01

    We characterized cortical microvascular PO2 and blood flow changes in response to whisker stimulation in awake mice. The measurements were performed by combining two-photon microscopy imaging of the cortical oxygenation and optical coherence tomography imaging of the cerebral blood flow. In order to perform fast spatio-temporally resolved measurements of PO2, we used a newly-developed oxygen-sensitive probe PtG-2P, which has significantly higher brightness than the established two-photon-enhanced oxygen sensor PtP-C343. We characterized the performance of the new probe in vivo and mapped the amplitudes and shapes (e.g. initial dip, overshoot, and post stimulus undershoot) of the PO2 changes as a function of the vessel type (e.g., arterioles, capillaries, and venules) and a distance from the activation center. The measurements in the awake mice are not affected by the confounding factors of anesthesia on the animal physiology, including the level of cerebral metabolism and the amplitude and speed of neuronal and vascular responses. Our results will help to understand changes in oxygenation and blood flow on the cortical microvascular scale, will lead to improved understanding of the cerebral physiology, pathophysiology and will improve quantitative interpretation of fMRI signals.

  5. APNEA/WIT system nondestructive assay capability evaluation plan for select accessibly stored INEL RWMC waste forms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Becker, G.K.

    1997-01-01

    Bio-Imaging Research Inc. (BIR) and Lockheed Martin Speciality Components (LMSC) are engaged in a Program Research and Development Agreement and a Rapid Commercialization Initiative with the Department of Energy, EM-50. The agreement required BIR and LMSC to develop a data interpretation method that merges nondestructive assay and nondestructive examination (NDA/NDE) data and information sufficient to establish compliance with applicable National TRU Program (Program) waste characterization requirements and associated quality assurance performance criteria. This effort required an objective demonstration of the BIR and LMSC waste characterization systems in their standalone and integrated configurations. The goal of the test plan is tomore » provide a mechanism from which evidence can be derived to substantiate nondestructive assay capability and utility statement for the BIT and LMSC systems. The plan must provide for the acquisition, compilation, and reporting of performance data thereby allowing external independent agencies a basis for an objective evaluation of the standalone BIR and LMSC measurement systems, WIT and APNEA respectively, as well as an expected performance resulting from appropriate integration of the two systems. The evaluation is to be structured such that a statement regarding select INEL RWMC waste forms can be made in terms of compliance with applicable Program requirements and criteria.« less

  6. Ultrasonic immersion probes characterization for use in nondestructive testing according to EN 12668-2:2001

    NASA Astrophysics Data System (ADS)

    Silva, C. E. R.; Alvarenga, A. V.; Costa-Felix, R. P. B.

    2011-02-01

    Ultrasound is often used as a Non-Destructive Testing (NDT) technique to analyze components and structures to detect internal and surface flaws. To guarantee reliable measurements, it is necessary to calibrate instruments and properly assess related uncertainties. An important device of an ultrasonic instrument system is its probe, which characterization should be performed according to EN 12668-2. Concerning immersion probes beam profile, the parameters to be assessed are beam divergence, focal distance, width, and zone length. Such parameters are determined by scanning a reflector or a hydrophone throughout the transducer beam. Within the present work, a methodology developed at Inmetro's Laboratory of Ultrasound to evaluate relevant beam parameters is presented, based on hydrophone scan. Water bath and positioning system to move the hydrophone were used to perform the scan. Studied probes were excited by a signal generator, and the waterborne signals were detected by the hydrophone and acquired using an oscilloscope. A user-friendly virtual instrument was developed in LabVIEW to automate the system. The initial tests were performed using 1 and 2.25 MHz-ultrasonic unfocused probes (Ø 1.27 cm), and results were consistent with the manufacturer's specifications. Moreover, expanded uncertainties were lower than 6% for all parameters under consideration.

  7. U.S. Department of Energy's site screening, site selection, and initial characterization for storage of CO2 in deep geological formations

    USGS Publications Warehouse

    Rodosta, T.D.; Litynski, J.T.; Plasynski, S.I.; Hickman, S.; Frailey, S.; Myer, L.

    2011-01-01

    The U.S. Department of Energy (DOE) is the lead Federal agency for the development and deployment of carbon sequestration technologies. As part of its mission to facilitate technology transfer and develop guidelines from lessons learned, DOE is developing a series of best practice manuals (BPMs) for carbon capture and storage (CCS). The "Site Screening, Site Selection, and Initial Characterization for Storage of CO2 in Deep Geological Formations" BPM is a compilation of best practices and includes flowchart diagrams illustrating the general decision making process for Site Screening, Site Selection, and Initial Characterization. The BPM integrates the knowledge gained from various programmatic efforts, with particular emphasis on the Characterization Phase through pilot-scale CO2 injection testing of the Validation Phase of the Regional Carbon Sequestration Partnership (RCSP) Initiative. Key geologic and surface elements that suitable candidate storage sites should possess are identified, along with example Site Screening, Site Selection, and Initial Characterization protocols for large-scale geologic storage projects located across diverse geologic and regional settings. This manual has been written as a working document, establishing a framework and methodology for proper site selection for CO2 geologic storage. This will be useful for future CO2 emitters, transporters, and storage providers. It will also be of use in informing local, regional, state, and national governmental agencies of best practices in proper sequestration site selection. Furthermore, it will educate the inquisitive general public on options and processes for geologic CO2 storage. In addition to providing best practices, the manual presents a geologic storage resource and capacity classification system. The system provides a "standard" to communicate storage and capacity estimates, uncertainty and project development risk, data guidelines and analyses for adequate site characterization, and guidelines for reporting estimates within the classification based on each project's status. 

  8. Performance of the NASA Beacon Receiver for the Alphasat Aldo Paraboni TDP5 Propagation Experiment

    NASA Technical Reports Server (NTRS)

    Nessel, James; Morse, Jacquelynne; Zemba, Michael; Riva, Carlo; Luini, Lorenzo

    2015-01-01

    NASA Glenn Research Center (GRC) and the Politecnico di Milano (POLIMI) have initiated a joint propagation campaign within the framework of the Alphasat propagation experiment to characterize rain attenuation, scintillation, and gaseous absorption effects of the atmosphere in the 40 gigahertz band. NASA GRC has developed and installed a K/Q-band (20/40 gigahertz) beacon receiver at the POLIMI campus in Milan, Italy, which receives the 20/40 gigahertz signals broadcast from the Alphasat Aldo Paraboni Technology Demonstration Payload (TDP) no. 5 beacon payload. The primary goal of these measurements is to develop a physical model to improve predictions of communications systems performance within the Q-band. Herein, we describe the design and preliminary performance of the NASA propagation terminal, which has been installed and operating in Milan since June 2014. The receiver is based upon a validated Fast Fourier Transform (FFT) I/Q digital design approach utilized in other operational NASA propagation terminals, but has been modified to employ power measurement via a frequency estimation technique and to coherently track and measure the amplitude of the 20/40 gigahertz beacon signals. The system consists of a 1.2-meter K-band and a 0.6-meter Q-band Cassegrain reflector employing synchronous open-loop tracking to track the inclined orbit of the Alphasat satellite. An 8 hertz sampling rate is implemented to characterize scintillation effects, with a 1-hertz measurement bandwidth dynamic range of 45 decibels. A weather station with an optical disdrometer is also installed to characterize rain drop size distribution for correlation with physical based models.

  9. Extracting atmospheric turbulence and aerosol characteristics from passive imagery

    NASA Astrophysics Data System (ADS)

    Reinhardt, Colin N.; Wayne, D.; McBryde, K.; Cauble, G.

    2013-09-01

    Obtaining accurate, precise and timely information about the local atmospheric turbulence and extinction conditions and aerosol/particulate content remains a difficult problem with incomplete solutions. It has important applications in areas such as optical and IR free-space communications, imaging systems performance, and the propagation of directed energy. The capability to utilize passive imaging data to extract parameters characterizing atmospheric turbulence and aerosol/particulate conditions would represent a valuable addition to the current piecemeal toolset for atmospheric sensing. Our research investigates an application of fundamental results from optical turbulence theory and aerosol extinction theory combined with recent advances in image-quality-metrics (IQM) and image-quality-assessment (IQA) methods. We have developed an algorithm which extracts important parameters used for characterizing atmospheric turbulence and extinction along the propagation channel, such as the refractive-index structure parameter C2n , the Fried atmospheric coherence width r0 , and the atmospheric extinction coefficient βext , from passive image data. We will analyze the algorithm performance using simulations based on modeling with turbulence modulation transfer functions. An experimental field campaign was organized and data were collected from passive imaging through turbulence of Siemens star resolution targets over several short littoral paths in Point Loma, San Diego, under conditions various turbulence intensities. We present initial results of the algorithm's effectiveness using this field data and compare against measurements taken concurrently with other standard atmospheric characterization equipment. We also discuss some of the challenges encountered with the algorithm, tasks currently in progress, and approaches planned for improving the performance in the near future.

  10. Acoustic Noise Test Report for the U.S. Department of Energy 1.5-Megawatt Wind Turbine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roadman, Jason; Huskey, Arlinda

    2015-07-01

    A series of tests were conducted to characterize the baseline properties and performance of the U.S. Department of Energy (DOE) 1.5-megawatt wind turbine (DOE 1.5) to enable research model development and quantify the effects of future turbine research modifications. The DOE 1.5 is built on the platform of GE's 1.5-MW SLE commercial wind turbine model. It was installed in a nonstandard configuration at the NWTC with the objective of supporting DOE Wind Program research initiatives such as A2e. Therefore, the test results may not represent the performance capabilities of other GE 1.5-MW SLE turbines. The acoustic noise test documented inmore » this report is one of a series of tests carried out to establish a performance baseline for the DOE 1.5 in the NWTC inflow environment.« less

  11. Preparation and catalytic performance of copper-containing magnetic catalysts for degradation of azo dye (direct violet).

    PubMed

    Duan, Qiannan; Lee, Jianchao; Chen, Han; Zheng, Yunyun

    2017-12-01

    A novel magnetically separable magnetic activated carbon supporting-copper (MCAC) catalyst for catalytic wet peroxide oxidation (CWPO) was prepared by chemical impregnation. The prepared samples were characterized by X-ray diffraction (XRD), Brunauer-Emmett-Teller (BET) method, and scanning electron microscopy (SEM) equipped with energy dispersive spectrometry (EDS). The catalytic performance of the catalysts was evaluated by direct violet (D-BL) degradation in CWPO experiments. The influence of preparative and operational parameters (dipping conditions, calcination temperature, catalyst loading H 2 O 2 dosage, pH, reaction temperature, additive salt ions and initial D-BL concentration) on degradation performance of CWPO process was investigated. The resulting MCAC catalyst showed higher reusability in direct violet oxidation than the magnetic activated carbon (MAC). Besides, dynamic tests also showed the maximal degradation rate reached 90.16% and its general decoloring ability of MCAC was 34 mg g -1 for aqueous D-BL.

  12. Development efforts to improve curved-channel microchannel plates

    NASA Technical Reports Server (NTRS)

    Corbett, M. B.; Feller, W. B.; Laprade, B. N.; Cochran, R.; Bybee, R.; Danks, A.; Joseph, C.

    1993-01-01

    Curved-channel microchannel plate (C-plate) improvements resulting from an ongoing NASA STIS microchannel plate (MCP) development program are described. Performance limitations of previous C-plates led to a development program in support of the STIS MAMA UV photon counter, a second generation instrument on the Hubble Space Telescope. C-plate gain, quantum detection efficiency, dark noise, and imaging distortion, which are influenced by channel curvature non-uniformities, have all been improved through use of a new centrifuge fabrication technique. This technique will be described, along with efforts to improve older, more conventional shearing methods. Process optimization methods used to attain targeted C-plate performance goals will be briefly characterized. Newly developed diagnostic measurement techniques to study image distortion, gain uniformity, input bias angle, channel curvature, and ion feedback, will be described. Performance characteristics and initial test results of the improved C-plates will be reported. Future work and applications will also be discussed.

  13. Preparation of an amide group-connected graphene-polyaniline nanofiber hybrid and its application in supercapacitors.

    PubMed

    Jianhua, Liu; Junwei, An; Yecheng, Zhou; Yuxiao, Ma; Mengliu, Li; Mei, Yu; Songmei, Li

    2012-06-27

    Polyaniline (PANI) nanofiber is grafted onto graphene to obtain a novel graphene-polyaniline (GP) hybrid. Graphene is activated using SOCl2 and reacts with PANI to form an amide group that intimately connects graphene and PANI. The existence of the amide group and its anchoring effect in the GP hybrid are confirmed and characterized by SEM, TEM, FT-IR, Raman, XPS and quantum chemistry analyses. Electrochemical tests reveal that the GP hybrid has high capacitance performances of 579.8 and 361.9 F g(-1) at current densities of 0.3 and 1 A g(-1). These values indicate superiority to materials interacted by van der Waals force. Long-term charge/discharge tests at high current densities show that the GP hybrid preserves 96% of its initial capacitance, demonstrating good electrochemical stability. The improved electrochemical performance suggests promising application of the GP hybrid in high-performance supercapacitors.

  14. Real-time method for establishing a detection map for a network of sensors

    DOEpatents

    Nguyen, Hung D; Koch, Mark W; Giron, Casey; Rondeau, Daniel M; Russell, John L

    2012-09-11

    A method for establishing a detection map of a dynamically configurable sensor network. This method determines an appropriate set of locations for a plurality of sensor units of a sensor network and establishes a detection map for the network of sensors while the network is being set up; the detection map includes the effects of the local terrain and individual sensor performance. Sensor performance is characterized during the placement of the sensor units, which enables dynamic adjustment or reconfiguration of the placement of individual elements of the sensor network during network set-up to accommodate variations in local terrain and individual sensor performance. The reconfiguration of the network during initial set-up to accommodate deviations from idealized individual sensor detection zones improves the effectiveness of the sensor network in detecting activities at a detection perimeter and can provide the desired sensor coverage of an area while minimizing unintentional gaps in coverage.

  15. Micro-Spherical Sulfur/Graphene Oxide Composite via Spray Drying for High Performance Lithium Sulfur Batteries.

    PubMed

    Tian, Yuan; Sun, Zhenghao; Zhang, Yongguang; Wang, Xin; Bakenov, Zhumabay; Yin, Fuxing

    2018-01-18

    An efficient, industry-accepted spray drying method was used to synthesize micro-spherical sulfur/graphene oxide (S/GO) composites as cathode materials within lithium sulfur batteries. The as-designed wrapping of the sulfur-nanoparticles, with wrinkled GO composites, was characterized by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The unique morphological design of this material enabled superior discharge capacity and cycling performance, demonstrating a high initial discharge capacity of 1400 mAh g -1 at 0.1 C. The discharge capacity remained at 828 mAh g -1 after 150 cycles. The superior electrochemical performance indicates that the S/GO composite improves electrical conductivity and alleviates the shuttle effect. This study represents the first time such a facile spray drying method has been adopted for lithium sulfur batteries and used in the fabrication of S/GO composites.

  16. Polydopamine and MnO2 core-shell composites for high-performance supercapacitors

    NASA Astrophysics Data System (ADS)

    Hou, Ding; Tao, Haisheng; Zhu, Xuezhen; Li, Maoguo

    2017-10-01

    Polydopamine and MnO2 core-shell composites (PDA@MnO2) for high-performance supercapacitors had been successfully synthesized by a facile and fast method. The morphology, crystalline phase and chemical composition of PDA@MnO2 composites are characterized using SEM, TEM, XRD, EDS and XPS. The performance of PDA@MnO2 composites are further investigated by cyclic voltammetry, galvanostatic charge-discharge and electrochemical impedance spectroscopy in 1 M Na2SO4 electrolyte. The PDA@MnO2 core-shell nanostructure composites exhibit a high capacitance of 193 F g-1 at the current density of 1A g-1 and retained over 81.2% of its initial capacitance after 2500 cycles of charge-discharge at 2 A g-1. The results manifest that the PDA@MnO2 composites can be potentially applied in supercapacitors.

  17. Framing of task performance strategies: effects on performance in a multiattribute dynamic decision making environment.

    PubMed

    Nygren, T E

    1997-09-01

    It is well documented that the way a static choice task is "framed" can dramatically alter choice behavior, often leading to observable preference reversals. This framing effect appears to result from perceived changes in the nature or location of a person's initial reference point, but it is not clear how framing effects might generalize to performance on dynamic decision making tasks that are characterized by high workload, time constraints, risk, or stress. A study was conducted to examine the hypothesis that framing can introduce affective components to the decision making process and can influence, either favorably (positive frame) or adversely (negative frame), the implementation and use of decision making strategies in dynamic high-workload environments. Results indicated that negative frame participants were significantly impaired in developing and employing a simple optimal decision strategy relative to a positive frame group. Discussion focuses on implications of these results for models of dynamic decision making.

  18. Micro-Spherical Sulfur/Graphene Oxide Composite via Spray Drying for High Performance Lithium Sulfur Batteries

    PubMed Central

    Tian, Yuan; Sun, Zhenghao; Zhang, Yongguang; Yin, Fuxing

    2018-01-01

    An efficient, industry-accepted spray drying method was used to synthesize micro-spherical sulfur/graphene oxide (S/GO) composites as cathode materials within lithium sulfur batteries. The as-designed wrapping of the sulfur-nanoparticles, with wrinkled GO composites, was characterized by scanning electron microscopy (SEM) and transmission electron microscopy (TEM). The unique morphological design of this material enabled superior discharge capacity and cycling performance, demonstrating a high initial discharge capacity of 1400 mAh g−1 at 0.1 C. The discharge capacity remained at 828 mAh g−1 after 150 cycles. The superior electrochemical performance indicates that the S/GO composite improves electrical conductivity and alleviates the shuttle effect. This study represents the first time such a facile spray drying method has been adopted for lithium sulfur batteries and used in the fabrication of S/GO composites. PMID:29346303

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jason Maung, K.; Hahn, H. Thomas; Ju, Y.S.

    Multifunction integration of solar cells in load-bearing structures can enhance overall system performance by reducing parasitic components and material redundancy. The article describes a manufacturing strategy, named the co-curing scheme, to integrate thin-film silicon solar cells on carbon-fiber-reinforced epoxy composites and eliminate parasitic packaging layers. In this scheme, an assembly of a solar cell and a prepreg is cured to form a multifunctional composite in one processing step. The photovoltaic performance of the manufactured structures is then characterized under controlled cyclic mechanical loading. The study finds that the solar cell performance does not degrade under 0.3%-strain cyclic tension loading upmore » to 100 cycles. Significant degradation, however, is observed when the magnitude of cyclic loading is increased to 1% strain. The present study provides an initial set of data to guide and motivate further studies of multifunctional energy harvesting structures. (author)« less

  20. High-performance mesoporous LiFePO₄ from Baker's yeast.

    PubMed

    Zhang, Xudong; Zhang, Xueguang; He, Wen; Sun, Caiyun; Ma, Jingyun; Yuan, Junling; Du, Xiaoyong

    2013-03-01

    Based on the biomineralization assembly concept, a simple and inexpensive biomimetic sol-gel method is found to synthesize high-performance mesoporous LiFePO(4) (HPM-LFP). The key step of this approach is to apply Baker's yeast cells as both a structural template and a biocarbon source. The formation mechanism of ordered hierarchical mesoporous network structure is revealed by characterizing its morphology and microstructure. The HPM-LFP exhibits outstanding electrochemical performances. The HPM-LFP has a high discharge capacity (about 153 mAh g(-1) at a 0.1 C rate), only 2% capacity loss from the initial value after 100 cycles at a current density of 0.1 C. This simple and potentially universal design strategy is currently being pursued in the synthesis of an ideal cathode-active material for high power applications. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Comparison of Refractory Performance in Black Liquor Gasifiers and a Smelt Test System

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peascoe, RA

    2001-09-25

    Prior laboratory corrosion studies along with experience at the black liquor gasifier in New Bern, North Carolina, clearly demonstrate that serious material problems exist with the gasifier's refractory lining. Mullite-based and alumina-based refractories used at the New Bern facility suffered significant degradation even though they reportedly performed adequately in smaller scale systems. Oak Ridge National Laboratory's involvement in the failure analysis, and the initial exploration of suitable replacement materials, led to the realization that a simple and reliable, complementary method for refractory screening was needed. The development of a laboratory test system and its suitability for simulating the environment ofmore » black liquor gasifiers was undertaken. Identification and characterization of corrosion products were used to evaluate the test system as a rapid screening tool for refractory performance and as a predictor of refractory lifetime. Results from the test systems and pl ants were qualitatively similar.« less

  2. Critical Parameters of the Initiation Zone for Spontaneous Dynamic Rupture Propagation

    NASA Astrophysics Data System (ADS)

    Galis, M.; Pelties, C.; Kristek, J.; Moczo, P.; Ampuero, J. P.; Mai, P. M.

    2014-12-01

    Numerical simulations of rupture propagation are used to study both earthquake source physics and earthquake ground motion. Under linear slip-weakening friction, artificial procedures are needed to initiate a self-sustained rupture. The concept of an overstressed asperity is often applied, in which the asperity is characterized by its size, shape and overstress. The physical properties of the initiation zone may have significant impact on the resulting dynamic rupture propagation. A trial-and-error approach is often necessary for successful initiation because 2D and 3D theoretical criteria for estimating the critical size of the initiation zone do not provide general rules for designing 3D numerical simulations. Therefore, it is desirable to define guidelines for efficient initiation with minimal artificial effects on rupture propagation. We perform an extensive parameter study using numerical simulations of 3D dynamic rupture propagation assuming a planar fault to examine the critical size of square, circular and elliptical initiation zones as a function of asperity overstress and background stress. For a fixed overstress, we discover that the area of the initiation zone is more important for the nucleation process than its shape. Comparing our numerical results with published theoretical estimates, we find that the estimates by Uenishi & Rice (2004) are applicable to configurations with low background stress and small overstress. None of the published estimates are consistent with numerical results for configurations with high background stress. We therefore derive new equations to estimate the initiation zone size in environments with high background stress. Our results provide guidelines for defining the size of the initiation zone and overstress with minimal effects on the subsequent spontaneous rupture propagation.

  3. Microstructural characterization of pressed HMX material sets at differing densities

    NASA Astrophysics Data System (ADS)

    Molek, C. D.; Welle, E. J.; Wixom, R. R.; Ritchey, M. B.; Samuels, P.; Horie, Y.

    2017-01-01

    The detonation physics community has embraced the idea that initiation of high explosives (HE) proceeds from an ignition event through subsequent growth to steady detonation. A weakness of all the commonly used ignition and growth models is the microstructural characteristics of the HE are not explicitly incorporated in their ignition and growth terms. This is the case in spite of a demonstrated, but not well-understood, empirical link between particle morphology and initiation of HE. Morphological effects have been parametrically studied in many ways, the majority of efforts focus on establishing a tie between bulk powder metrics and initiation of the pressed beds. More recently, there has been a shift toward characterizing the microstructure of pressed beds in order to understand the underlying mechanisms governing initiation behavior. In this work, we have characterized the microstructures of two HMX classes pressed at three densities using ion bombardment techniques. We find more significant compaction associated with the larger crystalline material - Class 3 - than the smaller fluid energy milled material. The Class 3 material exhibits evidence of crystal cracking. Finally, we discuss this evidence and our attempt to correlate microstructural features to observed changes in continuum level initiation behavior.

  4. In-situ NC-AFM measurements of high quality AlN(0001) layers grown at low growth rate on 4H-SiC(0001) and Si(111) substrates using ammonia molecular beam epitaxy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chaumeton, Florian, E-mail: florian.chaumeton@cemes.fr; Gauthier, Sébastien, E-mail: gauthier@cemes.fr; Martrou, David, E-mail: david.martrou@cemes.fr

    Nitride wide-band-gap semiconductors are used to make high power electronic devices or efficient light sources. The performance of GaN-based devices is directly linked to the initial AlN buffer layer. During the last twenty years of research on nitride growth, only few information on the AlN surface quality have been obtained, mainly by ex-situ characterization techniques. Thanks to a Non Contact Atomic Force Microscope (NC-AFM) connected under ultra high vacuum (UHV) to a dedicated molecular beam epitaxy (MBE) chamber, the surface of AlN(0001) thin films grown on Si(111) and 4H-SiC(0001) substrates has been characterized. These experiments give access to a quantitativemore » determination of the density of screw and edge dislocations at the surface. The layers were also characterized by ex-situ SEM to observe the largest defects such as relaxation dislocations and hillocks. The influence of the growth parameters (substrate temperature, growth speed, III/V ratio) and of the initial substrate preparation on the dislocation density was also investigated. On Si(111), the large in-plane lattice mismatch with AlN(0001) (19%) induces a high dislocation density ranging from 6 to 12×10{sup 10}/cm{sup 2} depending on the growth conditions. On 4H-SiC(0001) (1% mismatch with AlN(0001)), the dislocation density decreases to less than 10{sup 10}/cm{sup 2}, but hillocks appear, depending on the initial SiC(0001) reconstruction. The use of a very low growth rate of 10 nm/h at the beginning of the growth process allows to decrease the dislocation density below 2 × 10{sup 9}/cm{sup 2}.« less

  5. A study on ground truth data for impact damaged polymer matrix composites

    NASA Astrophysics Data System (ADS)

    Wallentine, Sarah M.; Uchic, Michael D.

    2018-04-01

    This study presents initial results toward correlative characterization of barely-visible impact damage (BVID) in unidirectional carbon fiber reinforced polymer matrix composite laminate plates using nondestructive ultrasonic testing (UT) and destructive serial sectioning microscopy. To produce damage consistent with BVID, plates were impacted using an instrumented drop-weight tower with pneumatic anti-rebound brake. High-resolution, normal-incidence, single-sided, pulse-echo, immersion UT scans were performed to verify and map internal damage after impact testing. UT C-scans were registered to optical images of the specimen via landmark registration and the use of an affine transformation, allowing location of internal damage in reference to the overall plate and enabling specimen preparation for subsequent serial sectioning. The impact-damaged region was extracted from each plate, prepared and mounted for materialographic sectioning. A modified RoboMet.3D version 2 was employed for serial sectioning and optical microscopy characterization of the impact damaged regions. Automated montage capture of sub-micron resolution, bright-field reflection, 12-bit monochrome optical images was performed over the entire specimen cross-section. These optical images were post- processed to produce 3D data sets, including segmentation to improve visualization of damage features. Impact-induced delaminations were analyzed and characterized using both serial sectioning and ultrasonic methods. Those results and conclusions are presented, as well as future direction of the current study.

  6. Effect of amorphous Mg{sub 50}Ni{sub 50} on hydriding and dehydriding behavior of Mg{sub 2}Ni alloy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guzman, D., E-mail: danny.guzman@uda.cl; Ordonez, S.; Fernandez, J.F.

    Composite Mg{sub 2}Ni (25 wt.%) amorphous Mg{sub 50}Ni{sub 50} was prepared by mechanical milling starting with nanocrystalline Mg{sub 2}Ni and amorphous Mg{sub 50}Ni{sub 50} powders, by using a SPEX 8000 D mill. The morphological and microstructural characterization of the powders was performed via scanning electron microscopy and X-ray diffraction. The hydriding characterization of the composite was performed via a solid gas reaction method in a Sievert's-type apparatus at 363 K under an initial hydrogen pressure of 2 MPa. The dehydriding behavior was studied by differential thermogravimetry. On the basis of the results, it is possible to conclude that amorphous Mg{submore » 50}Ni{sub 50} improved the hydriding and dehydriding kinetics of Mg{sub 2}Ni alloy upon cycling. A tentative rationalization of experimental observations is proposed. - Research Highlights: {yields} First study of the hydriding behavior of composite Mg{sub 2}Ni (25 wt.%) amorphous Mg{sub 50}Ni{sub 50}. {yields} Microstructural characterization of composite material using XRD and SEM was obtained. {yields} An improved effect of Mg{sub 50}Ni{sub 50} on the Mg{sub 2}Ni hydriding behavior was verified. {yields} The apparent activation energy for the hydrogen desorption of composite was obtained.« less

  7. Characterization of Traveling Wave Ion Mobility Separations in Structures for Lossless Ion Manipulations

    DOE PAGES

    Hamid, Ahmed M.; Ibrahim, Yehia M.; Garimella, Venkata BS; ...

    2015-10-28

    We report on the development and characterization of a new traveling wave-based Structure for Lossless Ion Manipulations (TW-SLIM) for ion mobility separations (IMS). The TW-SLIM module uses parallel arrays of rf electrodes on two closely spaced surfaces for ion confinement, where the rf electrodes are separated by arrays of short electrodes, and using these TWs can be created to drive ion motion. In this initial work, TWs are created by the dynamic application of dc potentials. The capabilities of the TW-SLIM module for efficient ion confinement, lossless ion transport, and ion mobility separations at different rf and TW parameters aremore » reported. The TW-SLIM module is shown to transmit a wide mass range of ions (m/z 200–2500) utilizing a confining rf waveform (~1 MHz and ~300 V p-p) and low TW amplitudes (<20 V). Additionally, the short TW-SLIM module achieved resolutions comparable to existing commercially available low pressure IMS platforms and an ion mobility peak capacity of ~32 for TW speeds of <210 m/s. TW-SLIM performance was characterized over a wide range of rf and TW parameters and demonstrated robust performance. In conclusion, the combined attributes of the flexible design and low voltage requirements for the TW-SLIM module provide a basis for devices capable of much higher resolution and more complex ion manipulations.« less

  8. Surface characterization through shape oscillations of drops in microgravity and 1-g

    NASA Technical Reports Server (NTRS)

    Apfel, Robert E.; Holt, R. Glynn; Tian, Yuren; Shi, Tao; Zheng, Xiao-Yu

    1994-01-01

    The goal of these experiments is to determine the rheological properties of liquid drops of single or multiple components in the presence or absence of surface active materials by exciting drops into their quadrupole resonance and observing their free decay. The resulting data coupled with appropriate theory should give a better description of the physics of the underlying phenomena, providing a better foundation than earlier empirical results could. The space environment makes an idealized geometry available (spherical drops) so that theory and experiment can be properly compared, and allows a 'clean' environment, by which is meant an environment in which no solid surfaces come in contact with the drops during the test period. Moreover, by considering the oscillations of intentionally deformed drops in microgravity, a baseline is established for interpreting surface characterization experiments done on the ground by other groups and ours. Experiments performed on the United States Microgravity Laboratory Laboratory (USML-1) demonstrated that shape oscillation experiments could be performed over a wide parameter range, and with a variety of surfactant materials. Results, however, were compromised by an unexpected, slow drop tumbling, some problems with droplet injection, and the presence of bubbles in the drop samples. Nevertheless, initial data suggests that the space environment will be useful in providing baseline data that can serve to validate theory and permit quantitative materials characterization at 1-g.

  9. Characterization of Traveling Wave Ion Mobility Separations in Structures for Lossless Ion Manipulations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hamid, Ahmed M.; Ibrahim, Yehia M.; Garimella, Venkata BS

    We report on the development and characterization of a new traveling wave-based Structure for Lossless Ion Manipulations (TW-SLIM) for ion mobility separations (IMS). The TW-SLIM module uses parallel arrays of rf electrodes on two closely spaced surfaces for ion confinement, where the rf electrodes are separated by arrays of short electrodes, and using these TWs can be created to drive ion motion. In this initial work, TWs are created by the dynamic application of dc potentials. The capabilities of the TW-SLIM module for efficient ion confinement, lossless ion transport, and ion mobility separations at different rf and TW parameters aremore » reported. The TW-SLIM module is shown to transmit a wide mass range of ions (m/z 200–2500) utilizing a confining rf waveform (~1 MHz and ~300 V p-p) and low TW amplitudes (<20 V). Additionally, the short TW-SLIM module achieved resolutions comparable to existing commercially available low pressure IMS platforms and an ion mobility peak capacity of ~32 for TW speeds of <210 m/s. TW-SLIM performance was characterized over a wide range of rf and TW parameters and demonstrated robust performance. In conclusion, the combined attributes of the flexible design and low voltage requirements for the TW-SLIM module provide a basis for devices capable of much higher resolution and more complex ion manipulations.« less

  10. Recurrent Miller Fisher syndrome.

    PubMed

    Madhavan, S; Geetha; Bhargavan, P V

    2004-07-01

    Miller Fisher syndrome (MFS) is a variant of Guillan Barre syndrome characterized by the triad of ophthalmoplegia, ataxia and areflexia. Recurrences are exceptional with Miller Fisher syndrome. We are reporting a case with two episodes of MFS within two years. Initially he presented with partial ophthalmoplegia, ataxia. Second episode was characterized by full-blown presentation characterized by ataxia, areflexia and ophthalmoplegia. CSF analysis was typical during both episodes. Nerve conduction velocity study was fairly within normal limits. MRI of brain was within normal limits. He responded to symptomatic measures initially, then to steroids in the second episode. We are reporting the case due to its rarity.

  11. Towards adjoint-based inversion of time-dependent mantle convection with nonlinear viscosity

    NASA Astrophysics Data System (ADS)

    Li, Dunzhu; Gurnis, Michael; Stadler, Georg

    2017-04-01

    We develop and study an adjoint-based inversion method for the simultaneous recovery of initial temperature conditions and viscosity parameters in time-dependent mantle convection from the current mantle temperature and historic plate motion. Based on a realistic rheological model with temperature-dependent and strain-rate-dependent viscosity, we formulate the inversion as a PDE-constrained optimization problem. The objective functional includes the misfit of surface velocity (plate motion) history, the misfit of the current mantle temperature, and a regularization for the uncertain initial condition. The gradient of this functional with respect to the initial temperature and the uncertain viscosity parameters is computed by solving the adjoint of the mantle convection equations. This gradient is used in a pre-conditioned quasi-Newton minimization algorithm. We study the prospects and limitations of the inversion, as well as the computational performance of the method using two synthetic problems, a sinking cylinder and a realistic subduction model. The subduction model is characterized by the migration of a ridge toward a trench whereby both plate motions and subduction evolve. The results demonstrate: (1) for known viscosity parameters, the initial temperature can be well recovered, as in previous initial condition-only inversions where the effective viscosity was given; (2) for known initial temperature, viscosity parameters can be recovered accurately, despite the existence of trade-offs due to ill-conditioning; (3) for the joint inversion of initial condition and viscosity parameters, initial condition and effective viscosity can be reasonably recovered, but the high dimension of the parameter space and the resulting ill-posedness may limit recovery of viscosity parameters.

  12. Surface functionalized SiO2 nanoparticles with cationic polymers via the combination of mussel inspired chemistry and surface initiated atom transfer radical polymerization: Characterization and enhanced removal of organic dye.

    PubMed

    Huang, Qiang; Liu, Meiying; Mao, Liucheng; Xu, Dazhuang; Zeng, Guangjian; Huang, Hongye; Jiang, Ruming; Deng, Fengjie; Zhang, Xiaoyong; Wei, Yen

    2017-08-01

    Monodispersed SiO 2 particles functionalized with cationic polymers poly-((3-acrylamidopropyl)trimethylammonium chloride) (PAPTCl) were prepared using mussel inspired surface modification strategy and surface initiated atom transfer radical polymerization (SI-ATRP). Fourier transform infrared spectroscopy, transmission electron microscope, thermogravimetric analysis, X-ray photoelectron spectroscopy, and zeta potential were employed to characterize these SiO 2 samples. The adsorption performance of the functionalized SiO 2 (donated as SiO 2 -PDA-PAPTCl) towards anionic organic dye Congo red (CR) was investigated to evaluate their potential environmental applications. We demonstrated that the surface of SiO 2 particles can be successfully functionalized with cationic PAPTCl. The adsorption capability of as-prepared SiO 2 was found to increases from 28.70 and 106.65mg/g after surface grafted with cationic polymers. The significant enhancement in the adsorption capability of SiO 2 -PDA-PAPTCl is mainly attributed to the introduction of cationic polymers. More importantly, this strategy is expected to be promising for fabrication of many other functional polymer nanocomposites for environmental applications due to the universality of mussel inspired chemistry and well designability and good monomer adaptability of SI-ATRP. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Sorption of DNA by diatomite-Zn(II) embedded supermacroporous monolithic p(HEMA) cryogels.

    PubMed

    Tozak, Kabil Özcan; Erzengin, Mahmut; Sargin, Idris; Ünlü, Nuri

    2013-01-01

    In this study, the DNA sorption performance of diatomite-Zn(II) embedded supermacroporous monolithic p(HEMA) cryogels were investigated for the purpose of designing a novel adsorbent that can be utilized for DNA purification, separation and immunoadsorption studies such as removal of anti-dsDNA antibodies from systemic lupus erythematosus (SLE) patient plasma. Poly(2-hydroxyethyl methacrylate) [p(HEMA)]-based monolithic cryogel column embedded with Zn(2+)-diatomite particles was prepared by free radical cryo-copolymerization of 2-hydroxyethyl methacrylate (HEMA) with N,N'-methylene-bis-acrylamide (MBAAm). The polymerization reaction was initiated by N,N,N',N'-tetramethylene diamine (TEMED) and ammonium persulfate (APS) pair in an ice bath. After thawing, the monolithic composite cryogels were used for affinity sorption and then subsequent desorption of DNA molecules from aqueous solutions. Diatomite (DA) particles were characterized by XRF and BET method. The characterization of composite cryogel was done through SEM imaging. The effects of pH of the solution, initial DNA concentration, ionic strength, temperature and flow rates on adsorption were investigated to determine the optimum conditions for adsorption/desorption experiments. The particle embedding procedure was shown to yield significantly enhanced adsorption of DNA on the adsorbent. Furthermore, considering its excellent bio-compatibility, p(HEMA) cryogels are promising a candidate for further DNA sorption studies.

  14. Sorption of DNA by diatomite-Zn(II) embedded supermacroporous monolithic p(HEMA) cryogels

    PubMed Central

    Tozak, Kabil Özcan; Erzengin, Mahmut; Sargin, Idris; Ünlü, Nuri

    2013-01-01

    In this study, the DNA sorption performance of diatomite-Zn(II) embedded supermacroporous monolithic p(HEMA) cryogels were investigated for the purpose of designing a novel adsorbent that can be utilized for DNA purification, separation and immunoadsorption studies such as removal of anti-dsDNA antibodies from systemic lupus erythematosus (SLE) patient plasma. Poly(2-hydroxyethyl methacrylate) [p(HEMA)]-based monolithic cryogel column embedded with Zn2+-diatomite particles was prepared by free radical cryo-copolymerization of 2-hydroxyethyl methacrylate (HEMA) with N,N'-methylene-bis-acrylamide (MBAAm). The polymerization reaction was initiated by N,N,N',N'-tetramethylene diamine (TEMED) and ammonium persulfate (APS) pair in an ice bath. After thawing, the monolithic composite cryogels were used for affinity sorption and then subsequent desorption of DNA molecules from aqueous solutions. Diatomite (DA) particles were characterized by XRF and BET method. The characterization of composite cryogel was done through SEM imaging. The effects of pH of the solution, initial DNA concentration, ionic strength, temperature and flow rates on adsorption were investigated to determine the optimum conditions for adsorption/desorption experiments. The particle embedding procedure was shown to yield significantly enhanced adsorption of DNA on the adsorbent. Furthermore, considering its excellent bio-compatibility, p(HEMA) cryogels are promising a candidate for further DNA sorption studies. PMID:26600734

  15. Characterization of the 20-Ah nickel-cadmium cell used for energy storage on the Orbiting Astronomical Observatory

    NASA Technical Reports Server (NTRS)

    Ford, F. E.

    1972-01-01

    Tests were conducted on 20-Ah sealed nickel cadmium cells to evaluate initial and long-term performance at various charge rates, temperatures and voltage-control levels. An average ampere-hour recharge of 103 percent per orbit at 13 C was able to maintain cell capacity; required watt-hour recharge on an orbital basis was 8 to 10 percent greater than required ampere-hour recharge. Cells exhibited an early life burn-in characteristic. A discharge after periods of repetitive cycling yielded two voltage plateaus which were temporarily eliminated by the discharge.

  16. A CASE STUDY OF CHLORINE TRANSPORT AND FATE FOLLOWING A LARGE ACCIDENTAL RELEASE

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buckley, R.; Hunter, C.; Werth, D.

    2012-08-01

    A train derailment that occurred in Graniteville, South Carolina during the early morning hours of 06 January, 2005 resulted in the prompt release of approximately 60 tons of chlorine to the environment. Comprehensive modeling of the transport and fate of this release was performed including the characterization of the initial three-phased chlorine release, a detailed determination of the local atmospheric conditions acting to generate, disperse, and deplete the chlorine vapor cloud, the establishment of physical exchange mechanisms between the airborne vapor and local surface waters, and local aquatic dilution and mixing.

  17. A low-power, high-efficiency Ka-band TWTA

    NASA Astrophysics Data System (ADS)

    Curren, Arthur N.; Dayton, James A., Jr.; Palmer, Raymond W.; Force, Dale A.; Tamashiro, Rodney N.; Wilson, John F.; Dombro, Louis; Harvey, Wayne L.

    1992-03-01

    NASA has developed a new class of Ka-band TWT amplifiers (TWTAs) which achieve their high efficiency/low power performance goals by means of an advanced dynamic velocity taper (DVT). The DVT is characterized by a continuous, nonlinear reduction in helix pitch from its initial synchronous value in the output section of the TWT to near the end of the helix. Another efficiency-maximizing feature is the inclusion of a multistage depressed collector employing oxygen-free, high-conductivity Cu electrodes treated for secondary electron emission suppression by means of ion bombardment. An efficiency of 43 percent is expected to be reached.

  18. Initial Technology Assessment for the Large-Aperture UV-Optical-Infrared (LUVOIR) Mission Concept Study

    NASA Technical Reports Server (NTRS)

    Bolcar, Matthew R.; Feinberg, Lee; France, Kevin; Rauscher, Bernard J.; Redding, David; Schiminovich, David

    2016-01-01

    The NASA Astrophysics Division's 30-Year Roadmap prioritized a future large-aperture space telescope operating in the ultra-violet/optical/infrared wavelength regime. The Association of Universities for Research in Astronomy envisioned a similar observatory, the High Definition Space Telescope. And a multi-institution group also studied the Advanced Technology Large Aperture Space Telescope. In all three cases, a broad science case is outlined, combining general astrophysics with the search for biosignatures via direct-imaging and spectroscopic characterization of habitable exoplanets. We present an initial technology assessment that enables such an observatory that is currently being studied for the 2020 Decadal Survey by the Large UV/Optical/Infrared (LUVOIR) surveyor Science and Technology Definition Team. We present here the technology prioritization for the 2016 technology cycle and define the required technology capabilities and current state-of-the-art performance. Current, planned, and recommended technology development efforts are also reported.

  19. Performance Evaluation of CMUT-Based Ultrasonic Transformers for Galvanic Isolation.

    PubMed

    Heller, Jacques; Boulme, Audren; Alquier, Daniel; Ngo, Sophie; Certon, Dominique

    2018-04-01

    This paper presents the development of a novel acoustic transformer with high galvanic isolation dedicated to power switch triggering. The transformer is based on two capacitive micromachined ultrasonic transducers layered on each side of a silicon substrate; one is the primary circuit, and the other is the secondary circuit. The thickness mode resonance of the substrate is leveraged to transmit the triggering signal. The fabrication and characterization of an initial prototype is presented in this paper. All experimental results are discussed, from the electrical impedance measurements to the power efficiency measurements, for different electrical load conditions. A comparison with a specifically developed finite-element method model is done. Simulations are finally used to identify the optimization rules of this initial prototype. It is shown that the power efficiency can be increased from 35% to 60%, and the transmitted power can be increased from 1.6 to 45 mW/Volt.

  20. Factors associated with comprehensive dental care following an initial emergency dental visit.

    PubMed

    Johnson, Jeffrey T; Turner, Erwin G; Novak, Karen F; Kaplan, Alan L

    2005-01-01

    The purpose of this study was to characterize the patient population utilization of a dental home as grouped by: (1) age; (2) sex; and (3) payment method. A retrospective chart review of 1,020 patients, who initially presented for an emergency visit, was performed. From the original data pool, 2 groups were delineated: (1) those patients who returned for comprehensive dental care; and (2) those who did not return for comprehensive dental care. Patients with private dental insurance or Medicaid dental benefits were statistically more likely to return for comprehensive oral health care than those with no form of dental insurance. Younger patients (< or =3 years of age) were least likely to return for comprehensive dental care. Socioeconomic factors play a crucial role in care-seeking behaviors. These obstacles are often a barrier to preventive and comprehensive oral health care.

  1. Microelectrode-assisted low-voltage atmospheric pressure glow discharge in air

    NASA Astrophysics Data System (ADS)

    Liu, Wenzheng; Zhao, Shuai; Niu, Jiangqi; Chai, Maolin

    2017-09-01

    During the process of discharge, appropriately changing the paths corresponding to electric field lines and the field strength distribution along these paths, as well as increasing the number of initial electrons, can effectively enhance the uniformity of discharge and inhibit the formation of filamentary discharge. A method is proposed that uses a microelectrode to initiate the macroscopic discharge phenomenon. An asymmetric structure was designed comprising a single electrode of carbon fiber; this electrode structure is of helical-contact type. Benefitting from the special electric field distribution and the microdischarge process, a three-dimensional atmospheric pressure glow discharge was achieved in air, characterized by low discharge voltage, low energy consumption, good diffusion performance, and less ozone generation. The plasma studied is uniform and stable with good diffusion characteristics and low levels of contaminants and hence has potential applications in the field of air purification.

  2. Dirt feedlot residue experiments. Quarterly progress report, December 1977--March 1978

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Turk, M.

    1978-04-01

    Performance of the mobile fermentation system is reported. It made use of aged pen residue at the nominal loading rate of 0.25 lbs. volatile solids/ft./sup 3//day with a 10-day retention time and a fermentation temperature of 57/sup 0/C. Results of an experimental cattle feeding trial utilizing the protein in the fermentor liquid effluent as a replacement for standard protein supplements were encouraging. The evaluation of the capture efficiency of the system centrifuge both with and without a chemical flocculant was completed. An experimental cattle feeding trial utilizing the protein fermentation product (PFP) harvested by the centrifuge as replacement for themore » standard protein supplementwas initiated. The characterization of the cattle residues found in various cattle pens, feedlots, and locations was continued. An investigation was initiated into methods of separating the organic content of the feedlot residue from the sand and grit content. (JGB)« less

  3. Initial Technology Assessment for the Large UV-Optical-Infrared (LUVOIR) Mission Concept Study

    NASA Technical Reports Server (NTRS)

    Bolcar, Matthew R.; Feinberg, Lee D.; France, Kevin; Rauscher, Bernard J.; Redding, David; Schiminovich, David

    2016-01-01

    The NASA Astrophysics Divisions 30-Year Roadmap prioritized a future large-aperture space telescope operating in the ultra-violet-optical-infrared wavelength regime. The Association of Universities for Research in Astronomy envisioned a similar observatory, the High Definition Space Telescope. And a multi-institution group also studied the Advanced Technology Large Aperture Space Telescope. In all three cases, a broad science case is outlined, combining general astrophysics with the search for bio-signatures via direct-imaging and spectroscopic characterization of habitable exo-planets. We present an initial technology assessment that enables such an observatory that is currently being studied for the 2020 Decadal Survey by the Large UV-Optical Infrared (LUVOIR) surveyor Science and Technology Definition Team. We present here the technology prioritization for the 2016 technology cycle and define the required technology capabilities and current state-of-the-art performance. Current, planned, and recommended technology development efforts are also reported.

  4. Unconvincing diagnosis of a rare subtype of primary gastric lymphoma with incongruent endoscopic presentation: a case of gastric schwannoma.

    PubMed

    Lee, Seung Soo; Kim, In Ho

    2013-12-01

    Primary gastric lymphoma is a rare gastric malignancy. Its diagnostic process is complex. Clinician may find initial diagnosis of primary gastric lymphoma unreliable, especially when it indicates the rarest subtype of gastric lymphoma, while its initial endoscopic presentation fails to raise the slightest suspicion of primary gastric lymphoma. A 53-year-old Korean man was diagnosed, by endoscopic examination, with a round submucosal tumor of the stomach. Deep endoscopic biopsy, however, confirmed CD5 positive gastric lymphoma. Surgical treatment was performed for diagnosis and treatment. Postoperative histo-logical examination confirmed gastric schwannoma. Gastric schwannoma is a spindle cell tumor, characterized by a peripheral cuff-like lymphocytic infiltration. Deep endoscopic biopsy may have been misdirected to the peripheral lymphoid cuff, failing to acquire spindle cells. The literature has been reviewed, and options for diagnostic accuracy have been suggested.

  5. Modeling Initial Stage of Ablation Material Pyrolysis: Graphitic Precursor Formation and Interfacial Effects

    NASA Technical Reports Server (NTRS)

    Desai, Tapan G.; Lawson, John W.; Keblinski, Pawel

    2010-01-01

    Reactive molecular dynamics simulations are used to study initial stage of pyrolysis of ablation materials and their composites with carbon nanotubes and carbon fibers. The products formed during pyrolysis are characterized and water is found as the primary product in all cases. The water formation mechanisms are analyzed and the value of the activation energy for water formation is estimated. A detailed study on graphitic precursor formation reveals the presence of two temperature zones. In the lower temperature zone (less than 2000 K) polymerization occurs resulting in formation of large, stable graphitic precursors, and in the high temperature zone (greater than 2000 K) polymer scission results in formation of short polymer chains/molecules. Simulations performed in the high temperature zone on the phenolic resin composites (with carbon nanotubes and carbon fibers) shows that the presence of interfaces had no substantial effect on the chain scission rate or the activation energy value for water formation.

  6. Extrapyramidal signs in normal pressure hydrocephalus: an objective assessment

    PubMed Central

    Mandir, Allen S; Hilfiker, Jennifer; Thomas, George; Minahan, Robert E; Crawford, Thomas O; Williams, Michael A; Rigamonti, Daniele

    2007-01-01

    Background Beyond the classic Normal Pressure Hydrocephalus (NPH) triad of gait disturbance, incontinence, and dementia are characteristic signs of motor dysfunction in NPH patients. We used highly sensitive and objective methods to characterize upper limb extrapyramidal signs in a series of NPH subjects compared with controls. Concentrated evaluation of these profound, yet underappreciated movement disorders of NPH before and after techniques of therapeutic intervention may lead to improved diagnosis, insight into pathophysiology, and targeted treatment. Methods Twenty-two (22) consecutive NPH patients and 17 controls performed an upper limb motor task battery where highly sensitive and objective measures of akinesia/bradykinesia, tone, and tremor were conducted. NPH subjects performed this test battery before and more than 36 h after continuous CSF drainage via a spinal catheter over 72 h and, in those subjects undergoing permanent ventriculo-peritoneal shunt placement, at least 12 weeks later. Control subjects performed the task battery at the same dates as the NPH subjects. Statistical analyses were applied to group populations of NPH and control subjects and repeated measures for within subject performance. Results Twenty (20) NPH subjects remained in the study following CSF drainage as did 14 controls. NPH subjects demonstrated akinesia/bradykinesia (prolonged reaction and movement times) and increased resting tone compared with controls. Furthermore, the NPH group demonstrated increased difficulty with self-initiated tasks compared with stimulus-initiated tasks. Following CSF drainage, some NPH subjects demonstrated reduced movement times with greater improvement in self- versus stimulus-initiated tasks. Group reaction time was unchanged. Resting tremor present in one NPH subject resolved following shunt placement. Tone measures were consistent for all subjects throughout the study. Conclusion Clinical motor signs of NPH subjects extend beyond gait deficits and include extrapyramidal manifestations of bradykinesia, akinesia, rigidity, and propensity to perform more poorly when external cues to move are absent. Objective improvement of some but not all of these features was seen following temporary or permanent CSF diversion. PMID:17697324

  7. Compact energy dispersive X-ray microdiffractometer for diagnosis of neoplastic tissues

    NASA Astrophysics Data System (ADS)

    Sosa, C.; Malezan, A.; Poletti, M. E.; Perez, R. D.

    2017-08-01

    An energy dispersive X-ray microdiffractometer with capillary optics has been developed for characterizing breast cancer. The employment of low divergence capillary optics helps to reduce the setup size to a few centimeters, while providing a lateral spatial resolution of 100 μm. The system angular calibration and momentum transfer resolution were assessed by a detailed study of a polycrystalline reference material. The performance of the system was tested by means of the analysis of tissue-equivalent samples previously characterized by conventional X-ray diffraction. In addition, a simplified correction model for an appropriate comparison of the diffraction spectra was developed and validated. Finally, the system was employed to evaluate normal and neoplastic human breast samples, in order to determine their X-ray scatter signatures. The initial results indicate that the use of this compact energy dispersive X-ray microdiffractometer combined with a simplified correction procedure is able to provide additional information to breast cancer diagnosis.

  8. Fully achromatic nulling interferometer (FANI) for high SNR exoplanet characterization

    NASA Astrophysics Data System (ADS)

    Hénault, François

    2015-09-01

    Space-borne nulling interferometers have long been considered as the best option for searching and characterizing extrasolar planets located in the habitable zone of their parent stars. Solutions for achieving deep starlight extinction are now numerous and well demonstrated. However they essentially aim at realizing an achromatic central null in order to extinguish the star. In this communication is described a major improvement of the technique, where the achromatization process is extended to the entire fringe pattern. Therefore higher Signal-to-noise ratios (SNR) and appreciable simplification of the detection system should result. The basic principle of this Fully achromatic nulling interferometer (FANI) consists in inserting dispersive elements along the arms of the interferometer. Herein this principle is explained and illustrated by a preliminary optical system design. The typical achievable performance and limitations are discussed and some initial tolerance requirements are also provided.

  9. A sulfate-reducing bacterium with unusual growing capacity in moderately acidic conditions.

    PubMed

    Rampinelli, L R; Azevedo, R D; Teixeira, M C; Guerra-Sá, R; Leão, V A

    2008-09-01

    The use of sulfate-reducing bacteria (SRB) is a cost-effective route to treat sulfate- contaminated waters and precipitate metals. The isolation and characterization of a SRB strain from an AMD in a Brazilian tropical region site was carried out. With a moderately acidic pH (5.5), the C.1 strain began its growth and with continued growth, modified the pH accordingly. The strain under these conditions reduced sulfate at the same rate as an experiment performed using an initial pH of 7.0. The dsrB gene-based molecular approach was used for the characterization of this strain and its phylogenetic affiliation was similar to genus Desulfovibrio sp. The results show an SRB isolate with unexpected sulfate reducing capacity in moderately acidic conditions, bringing new possibilities for the treatment of AMD, as acid water would be neutralized to a mildly acidic condition.

  10. The Sun-Earth saddle point: characterization and opportunities to test general relativity

    NASA Astrophysics Data System (ADS)

    Topputo, Francesco; Dei Tos, Diogene A.; Rasotto, Mirco; Nakamiya, Masaki

    2018-04-01

    The saddle points are locations where the net gravitational accelerations balance. These regions are gathering more attention within the astrophysics community. Regions about the saddle points present clean, close-to-zero background acceleration environments where possible deviations from General Relativity can be tested and quantified. Their location suggests that flying through a saddle point can be accomplished by leveraging highly nonlinear orbits. In this paper, the geometrical and dynamical properties of the Sun-Earth saddle point are characterized. A systematic approach is devised to find ballistic orbits that experience one or multiple passages through this point. A parametric analysis is performed to consider spacecraft initially on L_{1,2} Lagrange point orbits. Sun-Earth saddle point ballistic fly-through trajectories are evaluated and classified for potential use. Results indicate an abundance of short-duration, regular solutions with a variety of characteristics.

  11. Colloid-based multiplexed method for screening plant biomass-degrading glycoside hydrolase activities in microbial communities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Reindl, W.; Deng, K.; Gladden, J.M.

    2011-05-01

    The enzymatic hydrolysis of long-chain polysaccharides is a crucial step in the conversion of biomass to lignocellulosic biofuels. The identification and characterization of optimal glycoside hydrolases is dependent on enzyme activity assays, however existing methods are limited in terms of compatibility with a broad range of reaction conditions, sample complexity, and especially multiplexity. The method we present is a multiplexed approach based on Nanostructure-Initiator Mass Spectrometry (NIMS) that allowed studying several glycolytic activities in parallel under diverse assay conditions. Although the substrate analogs carried a highly hydrophobic perfluorinated tag, assays could be performed in aqueous solutions due colloid formation ofmore » the substrate molecules. We first validated our method by analyzing known {beta}-glucosidase and {beta}-xylosidase activities in single and parallel assay setups, followed by the identification and characterization of yet unknown glycoside hydrolase activities in microbial communities.« less

  12. A Low-Cost, Hands-on Module to Characterize Antimicrobial Compounds Using an Interdisciplinary, Biophysical Approach

    PubMed Central

    Kaushik, Karishma S.; Kessel, Ashley; Ratnayeke, Nalin; Gordon, Vernita D.

    2015-01-01

    We have developed a hands-on experimental module that combines biology experiments with a physics-based analytical model in order to characterize antimicrobial compounds. To understand antibiotic resistance, participants perform a disc diffusion assay to test the antimicrobial activity of different compounds and then apply a diffusion-based analytical model to gain insights into the behavior of the active antimicrobial component. In our experience, this module was robust, reproducible, and cost-effective, suggesting that it could be implemented in diverse settings such as undergraduate research, STEM (science, technology, engineering, and math) camps, school programs, and laboratory training workshops. By providing valuable interdisciplinary research experience in science outreach and education initiatives, this module addresses the paucity of structured training or education programs that integrate diverse scientific fields. Its low-cost requirements make it especially suitable for use in resource-limited settings. PMID:25602254

  13. Experimental and Numerical Investigations on Strength and Deformation Behavior of Cataclastic Sandstone

    NASA Astrophysics Data System (ADS)

    Zhang, Y.; Shao, J. F.; Xu, W. Y.; Zhao, H. B.; Wang, W.

    2015-05-01

    This work is devoted to characterization of the deformation and strength properties of cataclastic sandstones. Before conducting mechanical tests, the physical properties were first examined. These sandstones are characterized by a loose damaged microstructure and poorly cemented contacts. Then, a series of mechanical tests including hydrostatic, uniaxial, and triaxial compression tests were performed to study the mechanical strength and deformation of the sandstones. The results obtained show nonlinear stress-strain responses. The initial microcracks are closed at hydrostatic stress of 2.6 MPa, and the uniaxial compressive strength is about 0.98 MPa. Under triaxial compression, there is a clear transition from volumetric compressibility to dilatancy and a strong dependency on confining pressure. Based on the experimental evidence, an elastoplastic model is proposed using a linear yield function and a nonassociated plastic potential. There is good agreement between numerical results and experimental data.

  14. LX-04 VIOLENCE MEASUREMENTS- STEVEN TESTS IMPACTED BY PROJECTILES SHOT FROM A HOWITZER GUN

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chidester, S K; Vandersall, K S; Switzer, L L

    Characterization of the reaction violence of LX-04 explosive (85% HMX and 15% Viton A by weight) was obtained from Steven Impact Tests performed above the reaction initiation threshold. A 155 mm Howitzer propellant driven gas gun was used to accelerate the Steven Test projectiles in the range of approximately 170-300 m/s to react (ignite) the LX-04 explosive. Blast overpressure gauges, acoustic microphones, and high-speed photography characterized the level of high explosive reaction violence. A detonation in this velocity range was not observed and when comparing these results (and the Susan test results) with that of other HMX based explosives, LX-04more » has a more gradual reaction violence slope as the impact velocity increases. The high binder content (15%) of the LX-04 explosive is believed to be the key factor to the lower level of violence.« less

  15. Virological Sampling of Inaccessible Wildlife with Drones.

    PubMed

    Geoghegan, Jemma L; Pirotta, Vanessa; Harvey, Erin; Smith, Alastair; Buchmann, Jan P; Ostrowski, Martin; Eden, John-Sebastian; Harcourt, Robert; Holmes, Edward C

    2018-06-02

    There is growing interest in characterizing the viromes of diverse mammalian species, particularly in the context of disease emergence. However, little is known about virome diversity in aquatic mammals, in part due to difficulties in sampling. We characterized the virome of the exhaled breath (or blow) of the Eastern Australian humpback whale ( Megaptera novaeangliae ). To achieve an unbiased survey of virome diversity, a meta-transcriptomic analysis was performed on 19 pooled whale blow samples collected via a purpose-built Unmanned Aerial Vehicle (UAV, or drone) approximately 3 km off the coast of Sydney, Australia during the 2017 winter annual northward migration from Antarctica to northern Australia. To our knowledge, this is the first time that UAVs have been used to sample viruses. Despite the relatively small number of animals surveyed in this initial study, we identified six novel virus species from five viral families. This work demonstrates the potential of UAVs in studies of virus disease, diversity, and evolution.

  16. Interrogation of bimetallic particle oxidation in three dimensions at the nanoscale

    PubMed Central

    Han, Lili; Meng, Qingping; Wang, Deli; Zhu, Yimei; Wang, Jie; Du, Xiwen; Stach, Eric A.; Xin, Huolin L.

    2016-01-01

    An understanding of bimetallic alloy oxidation is key to the design of hollow-structured binary oxides and the optimization of their catalytic performance. However, one roadblock encountered in studying these binary oxide systems is the difficulty in describing the heterogeneities that occur in both structure and chemistry as a function of reaction coordinate. This is due to the complexity of the three-dimensional mosaic patterns that occur in these heterogeneous binary systems. By combining real-time imaging and chemical-sensitive electron tomography, we show that it is possible to characterize these systems with simultaneous nanoscale and chemical detail. We find that there is oxidation-induced chemical segregation occurring on both external and internal surfaces. Additionally, there is another layer of complexity that occurs during the oxidation, namely that the morphology of the initial oxide surface can change the oxidation modality. This work characterizes the pathways that can control the morphology in binary oxide materials. PMID:27928998

  17. Aluminum Lithium Alloy 2195 Fusion Welding Improvements with New Filler Wire

    NASA Technical Reports Server (NTRS)

    Russell, Carolyn; Bjorkman, Gerry; McCool, Carolyn (Technical Monitor)

    2000-01-01

    A viewgraph presentation outlines NASA Marshall Space Flight Center, Lockheed Martin Michoud Space Systems, and McCook Metals' development an aluminum-copper weld filler wire for fusion welding 2195 aluminum lithium. The aluminum-copper based weld filler wire has been identified as B218, which is the result of six years of weld filler wire development funded by NASA, Lockheed Martin, and McCook Metals. The Super Lightweight External Tank for the NASA Space Shuttle Program consists of 2195 welded with 4043 aluminum-silicon weld filler wire. The B218 filler wire chemistry was developed to produce enhanced 2195 weld and repair weld mechanical properties. An initial characterization of the B218 weld filler wire was performed consisting of initial weld and repair weld evaluation comparing B218 and 4043. The testing involved room temperature and cryogenic tensile testing along with fracture toughness testing. B218 weld filler wire proved to produce enhanced initial and repair weld tensile and fracture properties over 4043. B218 weld filler wire has proved to be a superior weld filler wire for welding 2195 and other aluminum lithium alloys over 4043.

  18. Radionuclide Incorporation and Long Term Performance of Apatite Waste Forms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Jianwei; Lian, Jie; Gao, Fei

    2016-01-04

    This project aims to combines state-of-the-art experimental and characterization techniques with atomistic simulations based on density functional theory (DFT) and molecular dynamics (MD) simulations. With an initial focus on long-lived I-129 and other radionuclides such as Cs, Sr in apatite structure, specific research objectives include the atomic scale understanding of: (1) incorporation behavior of the radionuclides and their effects on the crystal chemistry and phase stability; (2) stability and microstructure evolution of designed waste forms under coupled temperature and radiation environments; (3) incorporation and migration energetics of radionuclides and release behaviors as probed by DFT and molecular dynamics (MD) simulations;more » and (4) chemical durability as measured in dissolution experiments for long term performance evaluation and model validation.« less

  19. Morphological effect of BiVO4 catalysts on degradation of aqueous paracetamol under visible light irradiation.

    PubMed

    Hu, Changying; Xu, Jie; Zhu, Yaqi; Chen, Acong; Bian, Zhaoyong; Wang, Hui

    2016-09-01

    Morphological effect of bismuth vanadate (BiVO4) on visible light-driven catalytic degradation of aqueous paracetamol was carefully investigated using four monoclinic BiVO4 catalysts. The catalysts with different morphologies were controllably prepared by a hydrothermal method without any additions. The prepared catalysts were fully characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), and UV-Vis diffuse reflectance spectroscopy (DRS). Under the visible light irradiation, these catalysts with different morphology were investigated to degrade aqueous paracetamol contaminant. The degradation effects were evaluated based on the catalyst morphology, solution pH, initial paracetamol concentration, and catalyst dosage. Cube-like BiVO4 powders exhibited excellent photocatalytic performance. The optimal photocatalytic performance of the cube-like BiVO4 in degrading paracetamol was achieved.

  20. Electrodeposition of actinide compounds from an aqueous ammonium acetate matrix. Experimental development and optimization

    DOE PAGES

    Boll, Rose Ann; Matos, Milan; Torrico, Matthew N.

    2015-03-27

    Electrodeposition is a technique that is routinely employed in nuclear research for the preparation of thin solid films of actinide materials which can be used in accelerator beam bombardments, irradiation studies, or as radioactive sources. The present study investigates the deposition of both lanthanides and actinides from an aqueous ammonium acetate electrolyte matrix. Electrodepositions were performed primarily on stainless steel disks; with yield analysis evaluated using -spectroscopy. Experimental parameters were studied and modified in order to optimize the uniformity and adherence of the deposition while maximizing the yield. The initial development utilized samarium as the plating material, with and withoutmore » a radioactive tracer. As a result, surface characterization studies were performed by scanning electron microscopy, electron microprobe analysis, radiographic imaging, and x-ray diffraction.« less

  1. Early Assessment of VIIRS On-Orbit Calibration and Support Activities

    NASA Technical Reports Server (NTRS)

    Xiong, Xiaoxiong; Chiang, Kwofu; McIntire, Jeffrey; Oudrari, Hassan; Wu, Aisheng; Schwaller, Mathew; Butler, James

    2012-01-01

    The Suomi National Polar-orbiting Partnership (S-NPP) satellite, formally the National Polar-orbiting Operational Environmental Satellite System (NPOESS) Preparatory Project (NPP), provides a bridge between current and future low-Earth orbiting weather and environmental observation satellite systems. The NASA s NPP VIIRS Characterization Support Team (VCST) is designed to assess the long term geometric and radiometric performance of the Visible Infrared Imaging Radiometer Suite (VIIRS) instrument onboard the S-NPP spacecraft and to support NPP Science Team Principal Investigators (PI) for their independent evaluation of VIIRS Environmental Data Records (EDRs). This paper provides an overview of Suomi NPP VIIRS on-orbit calibration activities and examples of sensor initial on-orbit performance. It focuses on the radiometric calibration support activities and capabilities provided by the NASA VCST.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Madden, Jeremy T.; Toth, Scott J.; Dettmar, Christopher M.

    Nonlinear optical (NLO) instrumentation has been integrated with synchrotron X-ray diffraction (XRD) for combined single-platform analysis, initially targeting applications for automated crystal centering. Second-harmonic-generation microscopy and two-photon-excited ultraviolet fluorescence microscopy were evaluated for crystal detection and assessed by X-ray raster scanning. Two optical designs were constructed and characterized; one positioned downstream of the sample and one integrated into the upstream optical path of the diffractometer. Both instruments enabled protein crystal identification with integration times between 80 and 150 µs per pixel, representing a ~10 3–10 4-fold reduction in the per-pixel exposure time relative to X-ray raster scanning. Quantitative centering andmore » analysis of phenylalanine hydroxylase fromChromobacterium violaceumcPAH,Trichinella spiralisdeubiquitinating enzyme TsUCH37, human κ-opioid receptor complex kOR-T4L produced in lipidic cubic phase (LCP), intimin prepared in LCP, and α-cellulose samples were performed by collecting multiple NLO images. The crystalline samples were characterized by single-crystal diffraction patterns, while α-cellulose was characterized by fiber diffraction. Good agreement was observed between the sample positions identified by NLO and XRD raster measurements for all samples studied.« less

  3. Functional diversification of the dehydrin gene family in apple and its contribution to cold acclimation during dormancy.

    PubMed

    Falavigna, Vítor da Silveira; Miotto, Yohanna Evelyn; Porto, Diogo Denardi; Anzanello, Rafael; Santos, Henrique Pessoa dos; Fialho, Flávio Bello; Margis-Pinheiro, Márcia; Pasquali, Giancarlo; Revers, Luís Fernando

    2015-11-01

    Dehydrins (DHN) are proteins involved in plant adaptive responses to abiotic stresses, mainly dehydration. Several studies in perennial crops have linked bud dormancy progression, a process characterized by the inability to initiate growth from meristems under favorable conditions, with DHN gene expression. However, an in-depth characterization of DHNs during bud dormancy progression is still missing. An extensive in silico characterization of the apple DHN gene family was performed. Additionally, we used five different experiments that generated samples with different dormancy status, including genotypes with contrasting dormancy traits, to analyze how DHN genes are being regulated during bud dormancy progression in apple by real-time quantitative polymerase chain reaction (RT-qPCR). Duplication events took place in the diversification of apple DHN family. Additionally, MdDHN genes presented tissue- and bud dormant-specific expression patterns. Our results indicate that MdDHN genes are highly divergent in function, with overlapping levels, and that their expressions are fine-tuned by the environment during the dormancy process in apple. © 2015 Scandinavian Plant Physiology Society.

  4. Characterization of 4H <000-1> Silicon Carbide Films Grown by Solvent-Laser Heated Floating Zone

    NASA Technical Reports Server (NTRS)

    Woodworth, Andrew, A; Sayir, Ali; Neudeck, Philip, G; Raghothamachar, Balaji; Dudley, Michael

    2012-01-01

    Commercially available bulk silicon carbide (SiC) has a high number (>2000/sq cm) of screw dislocations (SD) that have been linked to degradation of high-field power device electrical performance properties. Researchers at the NASA Glenn Research Center have proposed a method to mass-produce significantly higher quality bulk SiC. In order for this bulk growth method to become reality, growth of long single crystal SiC fibers must first be achieved. Therefore, a new growth method, Solvent-Laser Heated Floating Zone (Solvent-LHFZ), has been implemented. While some of the initial Solvent-LHFZ results have recently been reported, this paper focuses on further characterization of grown crystals and their growth fronts. To this end, secondary ion mass spectroscopy (SIMS) depth profiles, cross section analysis by focused ion beam (FIB) milling and mechanical polishing, and orientation and structural characterization by x-ray transmission Laue diffraction patterns and x-ray topography were used. Results paint a picture of a chaotic growth front, with Fe incorporation dependant on C concentration.

  5. Additive Manufacturing in Production: A Study Case Applying Technical Requirements

    NASA Astrophysics Data System (ADS)

    Ituarte, Iñigo Flores; Coatanea, Eric; Salmi, Mika; Tuomi, Jukka; Partanen, Jouni

    Additive manufacturing (AM) is expanding the manufacturing capabilities. However, quality of AM produced parts is dependent on a number of machine, geometry and process parameters. The variability of these parameters affects the manufacturing drastically and therefore standardized processes and harmonized methodologies need to be developed to characterize the technology for end use applications and enable the technology for manufacturing. This research proposes a composite methodology integrating Taguchi Design of Experiments, multi-objective optimization and statistical process control, to optimize the manufacturing process and fulfil multiple requirements imposed to an arbitrary geometry. The proposed methodology aims to characterize AM technology depending upon manufacturing process variables as well as to perform a comparative assessment of three AM technologies (Selective Laser Sintering, Laser Stereolithography and Polyjet). Results indicate that only one machine, laser-based Stereolithography, was feasible to fulfil simultaneously macro and micro level geometrical requirements but mechanical properties were not at required level. Future research will study a single AM system at the time to characterize AM machine technical capabilities and stimulate pre-normative initiatives of the technology for end use applications.

  6. Overview of the 2015 Algodones Sand Dunes field campaign to support sensor intercalibration

    NASA Astrophysics Data System (ADS)

    McCorkel, Joel; Bachmann, Charles M.; Coburn, Craig; Gerace, Aaron; Leigh, Larry; Czapla-Myers, Jeff; Helder, Dennis; Cook, Bruce

    2018-01-01

    Several sites from around the world are being used operationally and are suitable for vicarious calibration of space-borne imaging platforms. However, due to the proximity of these sites (e.g., Libya 4), a rigorous characterization of the landscape is not feasible, limiting their utility for sensor intercalibration efforts. Due to its accessibility and similarities to Libya 4, the Algodones Sand Dunes System in California, USA, was identified as a potentially attractive intercalibration site for space-borne, reflective instruments such as Landsat. In March 2015, a 4-day field campaign was conducted to develop an initial characterization of Algodones with a primary goal of assessing its intercalibration potential. Five organizations from the US and Canada collaborated to collect both active and passive airborne image data, spatial and temporal measurements of spectral bidirectional reflectance distribution function, and in-situ sand samples from several locations across the Algodones system. The collection activities conducted to support the campaign goal is summarized, including a summary of all instrumentation used, the data collected, and the experiments performed in an effort to characterize the Algodones site.

  7. Materials Characterization of Electron Beam Melted Ti-6Al-4V

    NASA Technical Reports Server (NTRS)

    Draper, Susan L.; Lerch, Bradley A.; Telesman, Jack; Martin, Richard E.; Locci, Ivan E.; Garg, Anita; Ring, Andrew J.

    2016-01-01

    An in-depth material characterization of Electron Beam Melted (EBM) Ti-6Al-4V material has been completed on samples fabricated on an ARCAM A2X EBM machine. The specimens were fabricated under eight separate builds with the material divided into two lots for material testing purposes. Hot Isostatic Pressing (HIP) was utilized to close porosity from fabrication and also served as a material heat treatment to obtain the desired microstructure. The changes in the microstructure and chemistry from the powder to pre-HIP and post-HIP material have been analyzed. Several nondestructive evaluation (NDE) techniques were utilized to characterize the samples both before and after HIP. The test matrix included tensile, high cycle fatigue, low cycle fatigue, fracture toughness, and fatigue crack growth at cryogenic, room, and elevated temperatures. The mechanical properties of the EBM Ti-6Al-4V are compared to conventional Ti-6Al-4V in the annealed condition. Fractography was performed to determine failure initiation site. The EBM Ti-6Al-4V had similar or superior mechanical properties compared to conventionally manufactured Ti-6Al-4V.

  8. ROBOTIC CRAWLER PROVIDES RADIOLOGICAL PROTECTION IN HAZARDOUS ENVIRONMENT

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    HAM, J.E.

    2002-01-31

    A robotic crawler was deployed into the process cells at the 224-T Building to perform cell characterization. The most significant hazard was the potential for criticality upon introduction of a moderating material. Due to the unknown fissile inventory in the cells and the potential moderation affects of a person, manned entry was considered too high of a risk, and a robotic crawler was determined to be the best option for the initial characterization. The robotic crawler provided maneuverability, allowing access to areas in the cells where debris was found. It provided visual inspection in areas with little light, using amore » low lux pan and tilt camera system. Also, it provided fissile inventory measurements using a non-destructive assay (NDA) detector. The NDA detector supplied real-time data to maintain criticality control. Other technologies used during the cell characterization were water-cooled suits and a thin water resistant synthetic anti-contamination coverall, used for heat stress reduction. Also, an aluminum framed shelter provided a weather barrier, allowing work to continue under conditions which would have stopped work without it.« less

  9. Harvesting microalgal biomass using crossflow membrane filtration: critical flux, filtration performance, and fouling characterization.

    PubMed

    Elcik, Harun; Cakmakci, Mehmet

    2017-06-01

    The purpose of this study was to investigate the efficient harvesting of microalgal biomass through crossflow membrane filtration. The microalgal biomass harvesting experiments were performed using one microfiltration membrane (pore size: 0.2 µm, made from polyvinylidene fluoride) and three ultrafiltration membranes (molecular weight cut-off: 150, 50, and 30 kDa, made from polyethersulfone, hydrophilic polyethersulfone, and regenerated cellulose, respectively). Initially, to minimize membrane fouling caused by microalgal cells, experiments with the objective of determining the critical flux were performed. Based on the critical flux calculations, the best performing membrane was confirmed to be the UH050 membrane, produced from hydrophilic polyethersulfone material. Furthermore, we also evaluated the effect of transmembrane pressure (TMP) and crossflow velocity (CFV) on filtration flux. It was observed that membrane fouling was affected not only by the membrane characteristics, but also by the TMP and CFV. In all the membranes, it was observed that increasing CFV was associated with increasing filtration flux, independent of the TMP.

  10. National Cancer Institute's Precision Medicine Initiatives for the new National Clinical Trials Network.

    PubMed

    Abrams, Jeffrey; Conley, Barbara; Mooney, Margaret; Zwiebel, James; Chen, Alice; Welch, John J; Takebe, Naoko; Malik, Shakun; McShane, Lisa; Korn, Edward; Williams, Mickey; Staudt, Louis; Doroshow, James

    2014-01-01

    The promise of precision medicine will only be fully realized if the research community can adapt its clinical trials methodology to study molecularly characterized tumors instead of the traditional histologic classification. Such trials will depend on adequate tissue collection, availability of quality controlled, high throughput molecular assays, and the ability to screen large numbers of tumors to find those with the desired molecular alterations. The National Cancer Institute's (NCI) new National Clinical Trials Network (NCTN) is well positioned to conduct such trials. The NCTN has the ability to seamlessly perform ethics review, register patients, manage data, and deliver investigational drugs across its many sites including both in cities and rural communities, academic centers, and private practices. The initial set of trials will focus on different questions: (1) Exceptional Responders Initiative-why do a minority of patients with solid tumors or lymphoma respond very well to some drugs even if the majority do not?; (2) NCI MATCH trial-can molecular markers predict response to targeted therapies in patients with advanced cancer resistant to standard treatment?; (3) ALCHEMIST trial-will targeted epidermal growth factor receptor (EGFR) and anaplastic lymphoma kinase (ALK) inhibitors improve survival for adenocarcinoma of the lung in the adjuvant setting?; and (4) Lung Cancer Master Protocol trial for advanced squamous cell lung cancer-is there an advantage to developing drugs for small subsets of molecularly characterized tumors in a single, multiarm trial design? These studies will hopefully spawn a new era of treatment trials that will carefully select the tumors that may respond best to investigational therapy.

  11. Temperature requirements for initiation of RNA-dependent RNA polymerization.

    PubMed

    Yang, Hongyan; Gottlieb, Paul; Wei, Hui; Bamford, Dennis H; Makeyev, Eugene V

    2003-09-30

    To continue the molecular characterization of RNA-dependent RNA polymerases of dsRNA bacteriophages (Cystoviridae), we purified and biochemically characterized the wild-type (wt) and a temperature-sensitive (ts) point mutant of the polymerase subunit (Pol) from bacteriophage phi12. Interestingly, initiation by both wt and the ts phi12 Pol was notably more sensitive to increased temperatures than the elongation step, the absolute value of the nonpermissive temperature being lower for the ts enzyme. Experiments with the Pol subunit of related cystovirus phi6 revealed a similar differential sensitivity of the initiation and elongation steps. This is consistent with the previous result showing that de novo initiation by RdRp from dengue virus is inhibited at elevated temperatures, whereas the elongation phase is relatively thermostable. Overall, these data suggest that de novo RNA-dependent RNA synthesis in many viral systems includes a specialized thermolabile state of the RdRp initiation complex.

  12. A science-based, watershed strategy to support effective remediation of abandoned mine lands

    USGS Publications Warehouse

    Buxton, Herbert T.; Nimick, David A.; Von Guerard, Paul; Church, Stan E.; Frazier, Ann G.; Gray, John R.; Lipin, Bruce R.; Marsh, Sherman P.; Woodward, Daniel F.; Kimball, Briant A.; Finger, Susan E.; Ischinger, Lee S.; Fordham, John C.; Power, Martha S.; Bunch, Christine M.; Jones, John W.

    1997-01-01

    A U.S. Geological Survey Abandoned Mine Lands Initiative will develop a strategy for gathering and communicating the scientific information needed to formulate effective and cost-efficient remediation of abandoned mine lands. A watershed approach will identify, characterize, and remediate contaminated sites that have the most profound effect on water and ecosystem quality within a watershed. The Initiative will be conducted during 1997 through 2001 in two pilot watersheds, the Upper Animas River watershed in Colorado and the Boulder River watershed in Montana. Initiative efforts are being coordinated with the U.S. Forest Service, Bureau of Land Management, National Park Service, and other stakeholders which are using the resulting scientific information to design and implement remediation activities. The Initiative has the following eight objective-oriented components: estimate background (pre-mining) conditions; define baseline (current) conditions; identify target sites (major contaminant sources); characterize target sites and processes affecting contaminant dispersal; characterize ecosystem health and controlling processes at target sites; develop remediation goals and monitoring network; provide an integrated, quality-assured and accessible data network; and document lessons learned for future applications of the watershed approach.

  13. Non-Destructive Current Sensing for Energy Efficiency Monitoring in Buildings with Environmental Certification

    PubMed Central

    Mota, Lia Toledo Moreira; Mota, Alexandre de Assis; Coiado, Lorenzo Campos

    2015-01-01

    Nowadays, buildings environmental certifications encourage the implementation of initiatives aiming to increase energy efficiency in buildings. In these certification systems, increased energy efficiency arising from such initiatives must be demonstrated. Thus, a challenge to be faced is how to check the increase in energy efficiency related to each of the employed initiatives without a considerable building retrofit. In this context, this work presents a non-destructive method for electric current sensing to assess implemented initiatives to increase energy efficiency in buildings with environmental certification. This method proposes the use of a sensor that can be installed directly in the low voltage electrical circuit conductors that are powering the initiative under evaluation, without the need for reforms that result in significant costs, repair, and maintenance. The proposed sensor consists of three elements: an air-core transformer current sensor, an amplifying/filtering stage, and a microprocessor. A prototype of the proposed sensor was developed and tests were performed to validate this sensor. Based on laboratory tests, it was possible to characterize the proposed current sensor with respect to the number of turns and cross-sectional area of the primary and secondary coils. Furthermore, using the Least Squares Method, it was possible to determine the efficiency of the air core transformer current sensor (the best efficiency found, considering different test conditions, was 2%), which leads to a linear output response. PMID:26184208

  14. Non-Destructive Current Sensing for Energy Efficiency Monitoring in Buildings with Environmental Certification.

    PubMed

    Mota, Lia Toledo Moreira; Mota, Alexandre de Assis; Coiado, Lorenzo Campos

    2015-07-10

    Nowadays, buildings environmental certifications encourage the implementation of initiatives aiming to increase energy efficiency in buildings. In these certification systems, increased energy efficiency arising from such initiatives must be demonstrated. Thus, a challenge to be faced is how to check the increase in energy efficiency related to each of the employed initiatives without a considerable building retrofit. In this context, this work presents a non-destructive method for electric current sensing to assess implemented initiatives to increase energy efficiency in buildings with environmental certification. This method proposes the use of a sensor that can be installed directly in the low voltage electrical circuit conductors that are powering the initiative under evaluation, without the need for reforms that result in significant costs, repair, and maintenance. The proposed sensor consists of three elements: an air-core transformer current sensor, an amplifying/filtering stage, and a microprocessor. A prototype of the proposed sensor was developed and tests were performed to validate this sensor. Based on laboratory tests, it was possible to characterize the proposed current sensor with respect to the number of turns and cross-sectional area of the primary and secondary coils. Furthermore, using the Least Squares Method, it was possible to determine the efficiency of the air core transformer current sensor (the best efficiency found, considering different test conditions, was 2%), which leads to a linear output response.

  15. Photonic devices based on patterning by two photon induced polymerization techniques

    NASA Astrophysics Data System (ADS)

    Fortunati, I.; Dainese, T.; Signorini, R.; Bozio, R.; Tagliazucca, V.; Dirè, S.; Lemercier, G.; Mulatier, J.-C.; Andraud, C.; Schiavuta, P.; Rinaldi, A.; Licoccia, S.; Bottazzo, J.; Franco Perez, A.; Guglielmi, M.; Brusatin, G.

    2008-04-01

    Two and three dimensional structures with micron and submicron resolution have been achieved in commercial resists, polymeric materials and sol-gel materials by several lithographic techniques. In this context, silicon-based sol-gel materials are particularly interesting because of their versatility, chemical and thermal stability, amount of embeddable active compounds. Compared with other micro- and nano-fabrication schemes, the Two Photon Induced Polymerization is unique in its 3D processing capability. The photopolymerization is performed with laser beam in the near-IR region, where samples show less absorption and less scattering, giving rise to a deeper penetration of the light. The use of ultrashort laser pulses allows the starting of nonlinear processes like multiphoton absorption at relatively low average power without thermally damaging the samples. In this work we report results on the photopolymerization process in hybrid organic-inorganic films based photopolymerizable methacrylate-containing Si-nanobuilding blocks. Films, obtained through sol-gel synthesis, are doped with a photo-initiator allowing a radical polymerization of methacrylic groups. The photo-initiator is activated by femtosecond laser source, at different input energies. The development of the unexposed regions is performed with a suitable solvent and the photopolymerized structures are characterized by microscopy techniques.

  16. Aerogel Insulation Systems for Space Launch Applications

    NASA Technical Reports Server (NTRS)

    Fesmire, James E.

    2005-01-01

    New developments in materials science in the areas of solution gelation processes and nanotechnology have led to the recent commercial production of aerogels. Concurrent with these advancements has been the development of new approaches to cryogenic thermal insulation systems. For example, thermal and physical characterizations of aerogel beads under cryogenic-vacuum conditions have been performed at the Cryogenics Test Laboratory of the NASA Kennedy Space Center. Aerogel-based insulation system demonstrations have also been conducted to improve performance for space launch applications. Subscale cryopumping experiments show the thermal insulating ability of these fully breathable nanoporous materials. For a properly executed thermal insulation system, these breathable aerogel systems are shown to not cryopump beyond the initial cooldown and thermal stabilization phase. New applications are being developed to augment the thermal protection systems of space launch vehicles, including the Space Shuttle External Tank. These applications include a cold-boundary temperature of 90 K with an ambient air environment in which both weather and flight aerodynamics are important considerations. Another application is a nitrogen-purged environment with a cold-boundary temperature of 20 K where both initial cooldown and launch ascent profiles must be considered. Experimental results and considerations for these flight system applications are discussed.

  17. Characterizing executive functioning in older special populations: from cognitively elite to cognitively impaired.

    PubMed

    de Frias, Cindy M; Dixon, Roger A; Strauss, Esther

    2009-11-01

    The authors examined the structure and invariance of executive functions (EF) across (a) a continuum of cognitive status in 3 groups of older adults (cognitively elite [CE], cognitively normal [CN], and cognitively impaired [CI]) and (b) a 3-year longitudinal interval. Using latent variable analyses (LISREL 8.80), the authors tested 3-factor models ("Inhibition": Hayling [Burgess & Shallice, 1997], Stroop [Regard, 1981]; "Shifting": Brixton [Burgess & Shallice, 1997], Color Trails [D'Elia et al., 1996]; and "Updating": Reading and Computational Span [Salthouse & Babcock, 1991]) and 1-factor models within each group. Participants (initial N = 570; 53-90 years) were from the Victoria Longitudinal Study (Sample 3, Waves 1 and 2). Cross-sectionally, the authors observed a 3-factor EF structure especially for the CE group and 1-factor solutions for all 3 groups. Longitudinally, temporal invariance was supported for the 3-factor model (CE and CN groups) and the 1-factor model (CI and CN groups). Subgroups with higher cognitive status and greater 3-year stability performed better on EF factors than corresponding groups with lower cognitive status and less stability. Studies of EF structure, performance, dedifferentiation, and dysfunction will benefit from considering initial cognitive status and longitudinal stability.

  18. Sono-assisted adsorption of a textile dye on milk vetch-derived charcoal supported by silica nanopowder.

    PubMed

    Jorfi, Sahand; Darvishi Cheshmeh Soltani, Reza; Ahmadi, Mehdi; Khataee, Alireza; Safari, Mahdi

    2017-02-01

    This study was performed to assess the efficiency of silica nanopowder (SNP)/milk vetch-derived charcoal (MVDC) nanocomposite coupled with the ultrasonic irradiation named sono-adsorption process for treating water-contained Basic Red 46 (BR46) dye. Field emission scanning electron microscopy (FE-SEM), X-ray diffraction (XRD), Brunauer-Emmett-Teller (BET) and Fourier transform infrared spectroscopy (FT-IR) were performed for the characterization of as-prepared adsorbent. The sono-assisted adsorption process was optimized using response surface optimization on the basis of central composite design by the application of quadratic model. Accordingly, the color removal can be retained more than 93% by an initial BR46 concentration of 8 mg/L, sonication time of 31 min, adsorbent dosage of 1.2 g/L and initial pH of 9. The pseudo-second order kinetic model described the sono-assisted adsorption of BR46 reasonably well (R 2  > 0.99). The intra-particular diffusion kinetic model pointed out that the sono-assisted adsorption of BR46 onto SNP/MVDC nanocomposite was diffusion controlled as well as that ultrasonication enhanced the diffusion rate. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Automated Tow Placement Processing and Characterization of Composites

    NASA Technical Reports Server (NTRS)

    Prabhakaran, R.

    2004-01-01

    The project had one of the initial objectives as automated tow placement (ATP), in which a robot was used to place a collimated band of pre-impregnated ribbons or a wide preconsolidated tape onto a tool surface. It was proposed to utilize the Automated Tow Placement machine that was already available and to fabricate carbon fiber reinforced PEEK (polyether-ether-ketone) matrix composites. After initial experiments with the fabrication of flat plates, composite cylinders were to be fabricated. Specimens from the fabricated parts were to be tested for mechanical characterization. A second objective was to conduct various types of tests for characterizing composite specimens cured by different fabrication processes.

  20. Development And Characterization Of A Liner-On-Target Injector For Staged Z-Pinch Experiments

    NASA Astrophysics Data System (ADS)

    Valenzuela, J. C.; Conti, F.; Krasheninnikov, I.; Narkis, J.; Beg, F.; Wessel, F. J.; Rahman, H. U.

    2016-10-01

    We present the design and optimization of a liner-on-target injector for Staged Z-pinch experiments. The injector is composed of an annular high atomic number (e.g. Ar, Kr) gas-puff and an on-axis plasma gun that delivers the ionized deuterium target. The liner nozzle injector has been carefully studied using Computational Fluid Dynamics (CFD) simulations to produce a highly collimated 1 cm radius gas profile that satisfies the theoretical requirement for best performance on the 1 MA Zebra current driver. The CFD simulations produce density profiles as a function of the nozzle shape and gas. These profiles are initialized in the MHD MACH2 code to find the optimal liner density for a stable, uniform implosion. We use a simple Snowplow model to study the plasma sheath acceleration in a coaxial plasma gun to help us properly design the target injector. We have performed line-integrated density measurements using a CW He-Ne laser to characterize the liner gas and the plasma gun density as a function of time. The measurements are compared with models and calculations and benchmarked accordingly. Advanced Research Projects Agency - Energy, DE-AR0000569.

  1. Characterization and Performance of a Kilo-TES Sub-Array for ACTPol

    NASA Technical Reports Server (NTRS)

    Grace, E. A.; Beall, J.; Cho, H. M.; Devlin, M. J.; Fox, A.; Hilton, G.; Hubmayr, J.; Irwin, K.; Klein, J.; Li, D.; hide

    2014-01-01

    ACTPol is a polarization-sensitive receiver upgrade to the Atacama CosmologyTelescope (ACT) which will make millimeterwavelength measurements of the small-scale polarization anisotropies of the cosmic microwave background to investigate the properties of inflation, dark energy, dark matter, and neutrinos in the early Universe. ACTPol will employ three arrays of transition edge sensor (TES) bolometer detectors. The detectors, with a target transition temperature of 150 mK, will be operated at a bath temperature of 100 mK provided by a dilution refrigerator. One array operating at a central frequency of 150 GHz and consisting of 1024 TESes achieved first light at the ACT site in July 2013. We anticipate fielding the remainder of the focal plane, consisting of a second 150 GHz array and a multi-chroic array sensitive to 90 and 150 GHz, at the end of the 2013 observing season. In these proceedings, we present characterization of key detector parameters from measurements performed on the first array both in the lab and during initial field testing. We comment on the design goals, measurements, and uniformity of the detector transition temperatures, saturation powers, and thermal conductivities while detailing measurement methods and results for the detector optical efficiencies and time constants.

  2. Investigating the Evolution of Progressive Die Wear on Uncoated Dp1180 Steel in Production Environment

    NASA Astrophysics Data System (ADS)

    Wu, W.; Zhou, D. J.; Adamski, D. J.; Young, D.; Wang, Y. W.

    2017-09-01

    A study of die wear was performed using an uncoated dual phase, 1,180 MPa ultimate tensile strength steel (DP1180) in a progressive die. The objectives of the current study are to evaluate the die durability of various tooling materials and coatings for forming operations on uncoated DP1180 steel and update OEM’s die standards based on the experimental results in the real production environment. In total, 100,800 hits were performed in manufacturing production conditions, where 33 die inserts with the combination of 10 die materials and 9 coatings were investigated. The die inserts were evaluated for surface wear using scanning electron microscopy and characterized in terms of die material and/or coating defects, failure mode, failure initiation and propagation. Surface roughness of the formed parts was characterized using a WYKO NT110 machine. The analytical analysis of the die inserts and formed parts, combined with the failure mode and service life, provide a basis for die material and coating selection for forming AHSS components. The conclusions of this study will guide the selection of die material and coatings for high-volume production of AHSS components.

  3. Initial Results of Accelerated Stress Testing on Single-Channel and Multichannel Drivers: Solid-State Lighting Technology Area

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    None

    This report is the first in a series of studies on accelerated stress testing (AST) of drivers used for SSL luminaires, such as downlights, troffers, and streetlights. A representative group of two-stage commercial driver products was exposed to an AST environment consisting of 75°C and 75% relative humidity (7575). These drivers were a mix of single-channel drivers (i.e., a single output current for one LED primary) and multichannel drivers (i.e., separate output currents for multiple LED primaries). This AST environment was chosen because previous testing on downlights with integrated drivers demonstrated that 38% of the sample population failed in lessmore » than 2,500 hours of testing using this method. In addition to AST test results, the performance of an SSL downlight product incorporating an integrated, multichannel driver during extended room temperature operational life (RTOL) testing is also reported. A battery of measurements was used to evaluate these products during accelerated testing, including full electrical characterization (i.e., power consumption, PF, total harmonic distortion [THD], and inrush current) and photometric characterization of external LED loads attached to the drivers (i.e., flicker performance and lumen maintenance).« less

  4. Demonstration of the Cascadia G‐FAST geodetic earthquake early warning system for the Nisqually, Washington, earthquake

    USGS Publications Warehouse

    Crowell, Brendan; Schmidt, David; Bodin, Paul; Vidale, John; Gomberg, Joan S.; Hartog, Renate; Kress, Victor; Melbourne, Tim; Santillian, Marcelo; Minson, Sarah E.; Jamison, Dylan

    2016-01-01

    A prototype earthquake early warning (EEW) system is currently in development in the Pacific Northwest. We have taken a two‐stage approach to EEW: (1) detection and initial characterization using strong‐motion data with the Earthquake Alarm Systems (ElarmS) seismic early warning package and (2) the triggering of geodetic modeling modules using Global Navigation Satellite Systems data that help provide robust estimates of large‐magnitude earthquakes. In this article we demonstrate the performance of the latter, the Geodetic First Approximation of Size and Time (G‐FAST) geodetic early warning system, using simulated displacements for the 2001Mw 6.8 Nisqually earthquake. We test the timing and performance of the two G‐FAST source characterization modules, peak ground displacement scaling, and Centroid Moment Tensor‐driven finite‐fault‐slip modeling under ideal, latent, noisy, and incomplete data conditions. We show good agreement between source parameters computed by G‐FAST with previously published and postprocessed seismic and geodetic results for all test cases and modeling modules, and we discuss the challenges with integration into the U.S. Geological Survey’s ShakeAlert EEW system.

  5. Subjective study of preferred listening conditions in Italian Catholic churches

    NASA Astrophysics Data System (ADS)

    Martellotta, Francesco

    2008-10-01

    The paper describes the results of research aimed at investigating the preferred subjective listening conditions inside churches. The effect of different musical motifs (spanning Gregorian chants to symphonic music) was investigated and regression analysis was performed in order to point out the relationship between subjective ratings and acoustical parameters. In order to present realistic listening conditions to the subjects a small subset of nine churches was selected among a larger set of acoustic data collected in several Italian churches during a widespread on-site survey. The subset represented different architectural styles and shapes, and was characterized by average listening conditions. For each church a single source-receiver combination with fixed relative positions was chosen. Measured binaural impulse responses were cross-talk cancelled and then convolved with five anechoic motifs. Paired comparisons were finally performed, asking a trained panel of subjects their preference. Factor analysis pointed out a substantially common underlying pattern characterizing subjective responses. The results show that preferred listening conditions vary as a function of the musical motif, depending on early decay time for choral music and on a combination of initial time delay and lateral energy for instrumental music.

  6. Liquid Oxygen Propellant Densification Production and Performance Test Results With a Large-Scale Flight-Weight Propellant Tank for the X33 RLV

    NASA Technical Reports Server (NTRS)

    Tomsik, Thomas M.; Meyer, Michael L.

    2010-01-01

    This paper describes in-detail a test program that was initiated at the Glenn Research Center (GRC) involving the cryogenic densification of liquid oxygen (LO2). A large scale LO2 propellant densification system rated for 200 gpm and sized for the X-33 LO2 propellant tank, was designed, fabricated and tested at the GRC. Multiple objectives of the test program included validation of LO2 production unit hardware and characterization of densifier performance at design and transient conditions. First, performance data is presented for an initial series of LO2 densifier screening and check-out tests using densified liquid nitrogen. The second series of tests show performance data collected during LO2 densifier test operations with liquid oxygen as the densified product fluid. An overview of LO2 X-33 tanking operations and load tests with the 20,000 gallon Structural Test Article (STA) are described. Tank loading testing and the thermal stratification that occurs inside of a flight-weight launch vehicle propellant tank were investigated. These operations involved a closed-loop recirculation process of LO2 flow through the densifier and then back into the STA. Finally, in excess of 200,000 gallons of densified LO2 at 120 oR was produced with the propellant densification unit during the demonstration program, an achievement that s never been done before in the realm of large-scale cryogenic tests.

  7. Adjustable Focus Optical Correction Lens (AFOCL)

    NASA Technical Reports Server (NTRS)

    Peters, Bruce R.

    2001-01-01

    This report describes the activities and accomplishments along with the status of the characterization of a PLZT-based Adjustable Focus Optical Correction Lens (AFOCL) test device. The activities described in this report were undertaken by members of the Center for Applied Optics (CAO) at the University of Alabama in Huntsville (UAH) under NASA Contract NAS8-00188. The effort was led by Dr. Bruce Peters as the Principal Investigator and supported by Dr. Patrick Reardon, Ms. Deborah Bailey, and graduate student Mr. Jeremy Wong. The activities outlined for the first year of the contract were to identify vendors and procure a test device along with performing the initial optical characterization of the test device. This activity has been successfully executed and test results are available and preliminary information was published at the SPIE Photonics West Conference in San Jose, January 2001. The paper, "Preliminary investigation of an active PLZT lens," was well received and generated response with several questions from the audience. A PLZT test device has been commercially procured from an outside vendor: The University of California in San Diego (UCSD) in partnership with New Interconnect Packaging Technologies (NIPT) Inc. The device has been subjected to several tests to characterize the optical performance of the device at wavelengths of interest. The goal was to evaluate the AFOCL similar to a conventional lens and measure any optical aberrations present due to the PLZT material as a deviation in the size of the diffraction limited spot (blur), the presence of diffracted energy into higher orders surrounding the focused spot (a variation in Strehl), and/or a variation or spread in the location of the focused energy away from the optical axis (a bias towards optical wedge, spherical, comma, or other higher order aberrations). While data has been collected indicative of the imaging quality of the AFOCL test device, it was not possible to fully characterize the optical performance of the AFOCL alone because there were significant optical distortions due to fabrication related issues.

  8. A Computer-Aided Diagnosis System Using Artificial Intelligence for the Diagnosis and Characterization of Thyroid Nodules on Ultrasound: Initial Clinical Assessment.

    PubMed

    Choi, Young Jun; Baek, Jung Hwan; Park, Hye Sun; Shim, Woo Hyun; Kim, Tae Yong; Shong, Young Kee; Lee, Jeong Hyun

    2017-04-01

    An initial clinical assessment is described of a new, commercially available, computer-aided diagnosis (CAD) system using artificial intelligence (AI) for thyroid ultrasound, and its performance is evaluated in the diagnosis of malignant thyroid nodules and categorization of nodule characteristics. Patients with thyroid nodules with decisive diagnosis, whether benign or malignant, were consecutively enrolled from November 2015 to February 2016. An experienced radiologist reviewed the ultrasound image characteristics of the thyroid nodules, while another radiologist assessed the same thyroid nodules using the CAD system, providing ultrasound characteristics and a diagnosis of whether nodules were benign or malignant. The diagnostic performance and agreement of US characteristics between the experienced radiologist and the CAD system were compared. In total, 102 thyroid nodules from 89 patients were included; 59 (57.8%) were benign and 43 (42.2%) were malignant. The CAD system showed a similar sensitivity as the experienced radiologist (90.7% vs. 88.4%, p > 0.99), but a lower specificity and a lower area under the receiver operating characteristic (AUROC) curve (specificity: 74.6% vs. 94.9%, p = 0.002; AUROC: 0.83 vs. 0.92, p = 0.021). Classifications of the ultrasound characteristics (composition, orientation, echogenicity, and spongiform) between radiologist and CAD system were in substantial agreement (κ = 0.659, 0.740, 0.733, and 0.658, respectively), while the margin showed a fair agreement (κ = 0.239). The sensitivity of the CAD system using AI for malignant thyroid nodules was as good as that of the experienced radiologist, while specificity and accuracy were lower than those of the experienced radiologist. The CAD system showed an acceptable agreement with the experienced radiologist for characterization of thyroid nodules.

  9. Spiral ganglion cells and macrophages initiate neuro-inflammation and scarring following cochlear implantation

    PubMed Central

    Bas, Esperanza; Goncalves, Stefania; Adams, Michelle; Dinh, Christine T.; Bas, Jose M.; Van De Water, Thomas R.; Eshraghi, Adrien A.

    2015-01-01

    Conservation of a patient's residual hearing and prevention of fibrous tissue/new bone formation around an electrode array are some of the major challenges in cochlear implant (CI) surgery. Although it is well-known that fibrotic tissue formation around the electrode array can interfere with hearing performance in implanted patients, and that associated intracochlear inflammation can initiate loss of residual hearing, little is known about the molecular and cellular mechanisms that promote this response in the cochlea. In vitro studies in neonatal rats and in vivo studies in adult mice were performed to gain insight into the pro-inflammatory, proliferative, and remodeling phases of pathological wound healing that occur in the cochlea following an electrode analog insertion. Resident Schwann cells (SC), macrophages, and fibroblasts had a prominent role in the inflammatory process in the cochlea. Leukocytes were recruited to the cochlea following insertion of a nylon filament in adult mice, where contributed to the inflammatory response. The reparative stages in wound healing are characterized by persistent neuro-inflammation of spiral ganglion neurons (SGN) and expression of regenerative monocytes/macrophages in the cochlea. Accordingly, genes involved in extracellular matrix (ECM) deposition and remodeling were up-regulated in implanted cochleae. Maturation of scar tissue occurs in the remodeling phase of wound healing in the cochlea. Similar to other damaged peripheral nerves, M2 macrophages and de-differentiated SC were observed in damaged cochleae and may play a role in cell survival and axonal regeneration. In conclusion, the insertion of an electrode analog into the cochlea is associated with robust early and chronic inflammatory responses characterized by recruitment of leukocytes and expression of pro-inflammatory cytokines that promote intracochlear fibrosis and loss of the auditory hair cells (HC) and SGN important for hearing after CI surgery. PMID:26321909

  10. Strategic groups, performance, and strategic response in the nursing home industry.

    PubMed Central

    Zinn, J S; Aaronson, W E; Rosko, M D

    1994-01-01

    OBJECTIVE. This study examines the effect of strategic group membership on nursing home performance and strategic behavior. DATA SOURCES AND STUDY SETTING. Data from the 1987 Medicare and Medicaid Automated Certification Survey were combined with data from the 1987 and 1989 Pennsylvania Long Term Care Facility Questionnaire. The sample consisted of 383 Pennsylvania nursing homes. STUDY DESIGN. Cluster analysis was used to place the 383 nursing homes into strategic groups on the basis of variables measuring scope and resource deployment. Performance was measured by indicators of the quality of nursing home care (rates of pressure ulcers, catheterization, and restraint usage) and efficiency in services provision. Changes in Medicare participation after passage of the 1988 Medicare Catastrophic Coverage Act (MCCA) measured strategic behavior. MANOVA and Turkey HSD post hoc means tests determined if significant differences were associated with strategic group membership. FINDINGS. Cluster analysis produced an optimal seven-group solution. Differences in group means were significant for the clustering, performance, and conduct variables (p < .0001). Strategic groups characterized by facilities providing a continuum of care services had the best patient care outcomes. The most efficient groups were characterized by facilities with high Medicare census. While all strategic groups increased Medicare census following passage of the MCCA, those dominated by for-profits had the greatest increases. CONCLUSIONS. Our analysis demonstrates that strategic orientation influences nursing home response to regulatory initiatives, a factor that should be recognized in policy formation directed at nursing home reform. PMID:8005789

  11. RECENT ADVANCES IN HIGH TEMPERATURE ELECTROLYSIS AT IDAHO NATIONAL LABORATORY: SINGLE CELL TESTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    X. Zhang; J. E. O'Brien; R. C. O'Brien

    2012-07-01

    An experimental investigation on the performance and durability of single solid oxide electrolysis cells (SOECs) is under way at the Idaho National Laboratory. In order to understand and mitigate the degradation issues in high temperature electrolysis, single SOECs with different configurations from several manufacturers have been evaluated for initial performance and long-term durability. A new test apparatus has been developed for single cell and small stack tests from different vendors. Single cells from Ceramatec Inc. show improved durability compared to our previous stack tests. Single cells from Materials and Systems Research Inc. (MSRI) demonstrate low degradation both in fuel cellmore » and electrolysis modes. Single cells from Saint Gobain Advanced Materials (St. Gobain) show stable performance in fuel cell mode, but rapid degradation in the electrolysis mode. Electrolyte-electrode delamination is found to have significant impact on degradation in some cases. Enhanced bonding between electrolyte and electrode and modification of the microstructure help to mitigate degradation. Polarization scans and AC impedance measurements are performed during the tests to characterize the cell performance and degradation.« less

  12. Dynamics of an Overdriven Nitromethane Initiation System

    NASA Astrophysics Data System (ADS)

    Hároz, E. H.; Rae, P. J.; Armstrong, C. L.; Baca, E. V.; Campbell, C.; Gunderson, J. A.; Holmes, M.; Lopez-Pulliam, I.; Vaughan, L. D.; Dickson, P. M.

    2017-06-01

    For upcoming large-scale HE experiments, an initiation system is needed to ensure uniform and simultaneous burn. To that end, we developed an initiation system based on nitromethane. Initial, small-scale tests characterized the response of the nitromethane in the proposed cylindrical initiator geometry, indicating robust detonation under a variety of conditions such as a plane wave lenses & cylinders of PBX 9501 into a flyer plate or direct-drive. Detonation velocity, as measured by piezoelectric pin time-of-arrival measurements along the length and at bottom of vessel, shows an overdriven response. All cases show a detonation velocity faster than the literature value of 7.3 km s-1 for nitromethane, with the fastest velocity occurring for the 8-detonator, 8'' cylinder case with a velocity = 7.7 km s-1. Streak camera imaging characterized the curvature of the shock front as it arrived at the bottom of the vessel via spark gap. A final test of the initiator system looked at the expansion of the initiator vessel walls via PDV, showing velocities up to 3.5 km s-1. Finally, our initiator was placed inside a secondary vessel containing 1000 lbs of nitromethane. High-speed photography & pin data indicate complete symmetrical burn of the secondary nitromethane.

  13. In-situ electrical, mechanical and electrochemical characterizations of one-dimensional nanostructures

    NASA Astrophysics Data System (ADS)

    Mir Shah Ghassemi, Seyyed Hessam

    One-dimensional nanostructures initiated new aspects to the materials applications due to their superior properties compared to the bulk materials. Properties of nanostructures have been characterized by many techniques and used for various device applications. However, simultaneous correlation between the physical and structural properties of these nanomaterials has not been widely investigated. Therefore, it is necessary to perform in-situ study on the physical and structural properties of nanomaterials to understand their relation. In this work, we will use a unique instrument to perform real time atomic force microscopy (AFM) and scanning tunneling microscopy (STM) of nanomaterials inside a transmission electron microscopy (TEM) system. This AFM/STM-TEM system is used to investigate the mechanical, electrical, and electrochemical properties of boron nitride nanotubes (BNNTs) and Silicon nanorods (SiNRs). BNNTs are one of the subjects of this PhD research due to their comparable, and in some cases superior, properties compared to carbon nanotubes. Therefore, to further develop their applications, it is required to investigate these characteristics in atomic level. In this research, the mechanical properties of multi-walled BNNTs were first studied. Several tests were designed to study and characterize their real-time deformation behavior to the applied force. Observations revealed that BNNTs possess highly flexible structures under applied force. Detailed studies were then conducted to understand the bending mechanism of the BNNTs. Formations of reversible ripples were observed and described in terms of thermodynamic energy of the system. Fracture failure of BNNTs were initiated at the outermost walls and characterized to be brittle. Second, the electrical properties of individual BNNTs were studied. Results showed that the bandgap and electronic properties of BNNTs can be engineered by means of applied strain. It was found that the conductivity, electron concentration and carrier mobility of BNNTs can be tuned as a function of applied stress. Although, BNNTs are considered to be candidate for field emission applications, observations revealed that their properties degrade upon cycles of emissions. Results showed that due to the high emission current density, the temperature of the sample was increased and reached to the decomposition temperature at which the B-N bonds start to break. In addition to BNNTs, we have also performed in-situ study on the electrochemical properties of silicon nanorods (SiNRs). Specifically, lithiation and delithiation of SiNRs were studied by our STM-TEM system. Our observations showed the direct formation of Li22Si 5 phases as a result of lithium intercalation. Radial expansion of the anode materials were observed and characterized in terms of size-scale. Later, the formation and growth of the lithium fibers on the surface of the anode materials were observed and studied. Results revealed the formation of lithium islands inside the ionic liquid electrolyte which then grew as Li dendrite toward the cathode material.

  14. Habitable exoplanet imaging mission (HabEx): initial flight system design

    NASA Astrophysics Data System (ADS)

    Alibay, Farah; Kuan, Gary M.; Warfield, Keith R.

    2017-09-01

    The Habitable Exoplanet Imaging Mission (HabEx) is a concept for a mission to directly image planetary systems around Sun-like stars and to perform general astrophysics investigations being studied as part of a number of mission concepts for the upcoming 2020 Astrophysics Decadal Survey. HabEx would help assess the prevalence of habitable planets in our galaxy, searching in particular for potential biosignatures in the atmospheres of planets in habitable zones. More generally, HabEx would image our neighboring solar systems and characterize the variety of planets that inhabits them. Its direct imaging capability would also enable the mission to study the structure and evolution of debris disks around nearby stars, and their dynamical interaction with planets. Additionally, it will explore a number of more general astrophysics phenomena in our solar system, galaxy, and beyond, in the UV through NIR range. The exoplanet science goals lead to a mission concept with requirements for high contrast imaging and the continuous spectral coverage. The baseline for HabEx is a 4-meter diameter off-axis telescope designed to both search for habitable planets and perform general astrophysics observations, possibly combined with a starshade. In this paper, the initial flight system design for both the telescope and the starshade are presented, focusing on the key and driving requirements and subsystems, as well as the trajectory and station keeping and formation flying technique. Furthermore, some of the initial design trades undergone are described, as well as the key challenges and enablers. Finally, some of the future design and architecture trades to be performed within the flight systems as part of the continuing effort in the HabEx study are discussed.

  15. Airborne and Ground-Based Optical Characterization of Legacy Underground Nuclear Test Sites

    NASA Astrophysics Data System (ADS)

    Vigil, S.; Craven, J.; Anderson, D.; Dzur, R.; Schultz-Fellenz, E. S.; Sussman, A. J.

    2015-12-01

    Detecting, locating, and characterizing suspected underground nuclear test sites is a U.S. security priority. Currently, global underground nuclear explosion monitoring relies on seismic and infrasound sensor networks to provide rapid initial detection of potential underground nuclear tests. While seismic and infrasound might be able to generally locate potential underground nuclear tests, additional sensing methods might be required to further pinpoint test site locations. Optical remote sensing is a robust approach for site location and characterization due to the ability it provides to search large areas relatively quickly, resolve surface features in fine detail, and perform these tasks non-intrusively. Optical remote sensing provides both cultural and surface geological information about a site, for example, operational infrastructure, surface fractures. Surface geological information, when combined with known or estimated subsurface geologic information, could provide clues concerning test parameters. We have characterized two legacy nuclear test sites on the Nevada National Security Site (NNSS), U20ak and U20az using helicopter-, ground- and unmanned aerial system-based RGB imagery and light detection and ranging (lidar) systems. The multi-faceted information garnered from these different sensing modalities has allowed us to build a knowledge base of how a nuclear test site might look when sensed remotely, and the standoff distances required to resolve important site characteristics.

  16. Nano ZSM-5 type ferrisilicates as novel catalysts for ethylbenzene dehydrogenation in the presence of N 2O

    NASA Astrophysics Data System (ADS)

    Khatamian, M.; Khandar, A. A.; Haghighi, M.; Ghadiri, M.

    2011-11-01

    Nanosized ZSM-5 type ferrisilicates were successfully prepared using hydrothermal process. Several parameters including gel initiative compositions (Na+ or K+ alkali system), SiO2/Fe2O3 molar ratios and hydrothermal temperature were systematically investigated. The samples were characterized by XRD, TEM, SEM-EDS, BET surface area and ICP techniques. It was found that surface areas and the total pore volume increase with increasing in the SiO2/Fe2O3 molar ratio at Na-FZ ferrisilicates. The catalytic performance of the synthesized catalysts was evaluated in ethylbenzene dehydrogenation to styrene in the presence of N2O or steam at temperatures ranging from 400 °C to 660 °C under atmospheric pressure. The effects of gel initiative compositions, SiO2/Fe2O3 molar ratio as well as the hydrothermal synthesis temperature on the catalytic performance of these catalysts have been addressed. It was shown that styrene yield significantly influenced by altering in the SiO2/Fe2O3 ratio but was not greatly influenced by changes in hydrothermal synthesis temperatures. The comparison between performance of potassium and sodium containing catalysts was shown that the one with potassium has higher yield and selectivity toward styrene production at an optimum temperature of 610 °C.

  17. Brief periods of NREM sleep do not promote early offline gains but subsequent on-task performance in motor skill learning.

    PubMed

    Maier, Jonathan G; Piosczyk, Hannah; Holz, Johannes; Landmann, Nina; Deschler, Christoph; Frase, Lukas; Kuhn, Marion; Klöppel, Stefan; Spiegelhalder, Kai; Sterr, Annette; Riemann, Dieter; Feige, Bernd; Voderholzer, Ulrich; Nissen, Christoph

    2017-11-01

    Sleep modulates motor learning, but its detailed impact on performance curves remains to be fully characterized. This study aimed to further determine the impact of brief daytime periods of NREM sleep on 'offline' (task discontinuation after initial training) and 'on-task' (performance within the test session) changes in motor skill performance (finger tapping task). In a mixed design (combined parallel group and repeated measures) sleep laboratory study (n=17 'active' wake vs. sleep, n=19 'passive' wake vs. sleep), performance curves were assessed prior to and after a 90min period containing either sleep, active or passive wakefulness. We observed a highly significant, but state- (that is, sleep/wake)-independent early offline gain and improved on-task performance after sleep in comparison to wakefulness. Exploratory curve fitting suggested that the observed sleep effect most likely emerged from an interaction of training-induced improvement and detrimental 'time-on-task' processes, such as fatigue. Our results indicate that brief periods of NREM sleep do not promote early offline gains but subsequent on-task performance in motor skill learning. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Femtosecond laser microstructured Alumina toughened Zirconia: A new strategy to improve osteogenic differentiation of hMSCs

    NASA Astrophysics Data System (ADS)

    Carvalho, Angela; Cangueiro, Liliana; Oliveira, Vítor; Vilar, Rui; Fernandes, Maria H.; Monteiro, Fernando J.

    2018-03-01

    The use of topographic patterns has been a continuously growing area of research for tissue engineering and it is widely accepted that the surface topography of biomaterials can influence and modulate the initial biological response. Ultrafast lasers are extremely powerful tools to machine and pattern the surface of a wide range of biomaterials, however, only few work has been performed on ceramics with the intent of biomedical applications, and the biological characterization of these structured materials is scarce. In this work, relevance is given to the biological performance of such materials. A femtosecond laser ablation technique was used to modify Alumina toughened Zirconia (ATZ) surface topography, developing surfaces structured at the micro and nanoscale levels (μATZ), in a controlled and reproducible manner. Materials characterization was performed before and after laser treatment, and both materials were compared in terms of osteogenic response of human bone marrow derived mesenchymal stem cells cultured under basal conditions, expecting that the micro/nanofeatures will improve the biological response of cells. Cells metabolic activity and proliferation increased with the culture time and surface microtopography modulated cells alignment and guided proliferation. The modified surface, displayed significantly higher expression of osteogenic transcription factors and genes and, additionally, the formation of a mineralized extracellular matrix, when compared to the control surface, i.e. unmodified ATZ.

  19. Differential Effects of Paced and Unpaced Responding on delayed Serial Order Recall in Schizophrenia

    PubMed Central

    Hill, S. Kristian; Griffin, Ginny B.; Houk, James C.; Sweeney, John A.

    2011-01-01

    Working memory for temporal order is a component of working memory that is especially dependent on striatal systems, but has not been extensively studied in schizophrenia. This study was designed to characterize serial order reproduction by adapting a spatial serial order task developed for nonhuman primate studies, while controlling for working memory load and whether responses were initiated freely (unpaced) or in an externally paced format. Clinically stable schizophrenia patients (n=27) and psychiatrically healthy individuals (n=25) were comparable on demographic variables and performance on standardized tests of immediate serial order recall (Digit Span, Spatial Span). No group differences were observed for serial order recall when read sequence reproduction was unpaced. However, schizophrenia patients exhibited significant impairments when responding was paced, regardless of sequence length or retention delay. Intact performance by schizophrenia patients during the unpaced condition indicates that prefrontal storage and striatal output systems are sufficiently intact to learn novel response sequences and hold them in working memory to perform serial order tasks. However, retention for newly learned response sequences was disrupted in schizophrenia patients by paced responding, when read-out of each element in the response sequence was externally controlled. The disruption of memory for serial order in paced read-out condition indicates a deficit in frontostriatal interaction characterized by an inability to update working memory stores and deconstruct ‘chunked’ information. PMID:21705197

  20. Prostate Angiogenesis in Development and Inflammation

    PubMed Central

    Wong, Letitia; Gipp, Jerry; Carr, Jason; Loftus, Christopher; Benck, Molly; Lee, Sanghee; Mehta, Vatsal; Vezina, Chad; Bushman, Wade

    2014-01-01

    BACKGROUND Prostatic inflammation is an important factor in development and progression of BPH/LUTS. This study was performed to characterize the normal development and vascular anatomy of the mouse prostate and then examine, for the first time, the effects of prostatic inflammation on the prostate vasculature. METHODS Adult mice were perfused with India ink to visualize the prostatic vascular anatomy. Immunostaining was performed on the E16.5 UGS and the P5, P20 and adult prostate to characterize vascular development. Uropathogenic E. coli 1677 was instilled transurethrally into adult male mice to induce prostate inflammation. RT-PCR and BrdU labeling was performed to assay anigogenic factor expression and endothelial proliferation, respectively. RESULTS An artery on the ventral surface of the bladder trifurcates near the bladder neck to supply the prostate lobes and seminal vesicle. Development of the prostatic vascular system is associated with endothelial proliferation and robust expression of pro-angiogenic factors Pecam1, Tie1, Tek, Angpt1, Angpt2, Fgf2, Vegfa, Vegfc, Figf. Bacterial-induced prostatic inflammation induced endothelial cell proliferation and increased vascular density but surprisingly decreased pro-angiogenic factor expression. CONCLUSIONS The striking decrease in pro-angiogenic factor mRNA expression associated with endothelial proliferation and increased vascular density during inflammation suggests that endothelial response to injury is not a recapitulation of normal development and may be initiated and regulated by different regulatory mechanisms. PMID:24293357

  1. Laboratory findings in neurosyphilis patients with epileptic seizures alone as the initial presenting symptom.

    PubMed

    Tong, Man-Li; Liu, Li-Li; Zeng, Yan-Li; Zhang, Hui-Lin; Liu, Gui-Li; Zheng, Wei-Hong; Dong, Jie; Wu, Jing-Yi; Su, Yuan-Hui; Lin, Li-Rong; Yang, Tian-Ci

    2013-04-01

    A retrospective chart review was performed to characterize the clinical presentation, the characteristic combination of serologic and cerebrospinal fluid (CSF) abnormalities, and the neuroimaging findings of neurosyphilis (NS) patients who had epileptic seizures alone as an initial presenting symptom. In a 6.75-year period, 169 inpatients with NS were identified at Zhongshan Hospital (from June 2005 to February 2012). We demonstrated that 13 (7.7%) of the 169 NS patients had epileptic seizures alone as an initial presenting feature. Epileptic seizures occurred in NS patients with syphilitic meningitis (2 cases), meningovascular NS (5 cases), and general paresis (6 cases). The types of epileptic seizures included simple partial, complex partial with secondary generalization (including status epilepticus), and generalized seizures (no focal onset reported). Nine of NS patients with only epileptic seizures as primary symptom were misdiagnosed, and the original misdiagnosis was 69.23% (9/13). Ten (10/13, 76.9%) patients had an abnormal magnetic resonance imaging, and 7 (7/13 53.8%) patients had abnormal electroencephalogram recordings. In addition, the sera rapid plasma reagin (RPR) and Treponema pallidum particle agglutination (TPPA) from all 13 patients were positive. The overall positive rates of the CSF-RPR and CSF-TPPA were 61.5% and 69.2%, respectively. Three patients demonstrated CSF pleocytosis, and 9 patients exhibited elevated CSF protein levels. Therefore, NS with only epileptic seizures at the initial presentation exhibits a lack of specificity. It is recommended that every patient with clinically evident symptoms of epileptic seizures should have a blood test performed for syphilis. When the serology results are positive, all of the patients should undergo a CSF examination to diagnose NS. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Noninvasive cardiac activation imaging of ventricular arrhythmias during drug-induced QT prolongation in the rabbit heart.

    PubMed

    Han, Chengzong; Pogwizd, Steven M; Killingsworth, Cheryl R; Zhou, Zhaoye; He, Bin

    2013-10-01

    Imaging myocardial activation from noninvasive body surface potentials promises to aid in both cardiovascular research and clinical medicine. To investigate the ability of a noninvasive 3-dimensional cardiac electrical imaging technique for characterizing the activation patterns of dynamically changing ventricular arrhythmias during drug-induced QT prolongation in rabbits. Simultaneous body surface potential mapping and 3-dimensional intracardiac mapping were performed in a closed-chest condition in 8 rabbits. Data analysis was performed on premature ventricular complexes, couplets, and torsades de pointes (TdP) induced during intravenous administration of clofilium and phenylephrine with combinations of various infusion rates. The drug infusion led to a significant increase in the QT interval (from 175 ± 7 to 274 ± 31 ms) and rate-corrected QT interval (from 183 ± 5 to 262 ± 21 ms) during the first dose cycle. All the ectopic beats initiated by a focal activation pattern. The initial beat of TdPs arose at the focal site, whereas the subsequent beats were due to focal activity from different sites or 2 competing focal sites. The imaged results captured the dynamic shift of activation patterns and were in good correlation with the simultaneous measurements, with a correlation coefficient of 0.65 ± 0.02 averaged over 111 ectopic beats. Sites of initial activation were localized to be ~5 mm from the directly measured initiation sites. The 3-dimensional cardiac electrical imaging technique could localize the origin of activation and image activation sequence of TdP during QT prolongation induced by clofilium and phenylephrine in rabbits. It offers the potential to noninvasively investigate the proarrhythmic effects of drug infusion and assess the mechanisms of arrhythmias on a beat-to-beat basis. © 2013 Heart Rhythm Society. All rights reserved.

  3. Public purchasers contracting external primary care providers in Central America for better responsiveness, efficiency of health care and public governance: issues and challenges.

    PubMed

    Macq, Jean; Martiny, Patrick; Villalobos, Luis Bernardo; Solis, Alejandro; Miranda, Jose; Mendez, Hilda Cecilia; Collins, Charles

    2008-09-01

    Several national health systems in Latin America initiated health reforms to counter widespread criticisms of low equity and efficiency. For public purchasing agencies, these reforms often consisted in contracting external providers for primary care provision. This paper intends to clarify both the complex and intertwined issues characterizing such contracting as well as health system performances within the context of four Central American countries. It results from a European Commission financed project lead between 2002 and 2005, involving participants from Costa Rica, Guatemala, Nicaragua, Salvador, United Kingdom, Netherlands and Belgium, whose aim was to promote exchanges between these participants. The findings presented in this paper are the results of a two stage process: (a) the design of an initial analytical framework, built upon findings from the literature, interlinking characteristics of contractual relation with health systems performances criteria and (b) the use of that framework in four case studies to identify cross-cutting issues. This paper reinforces two pivotal findings: (a) contracting requires not only technical, but also political choices and (b) it cannot be considered as a mechanical process. The unpredictability of its evolution requires a flexible and reactive approach. This should be better assimilated by national and international organizations involved in health services provision, so as to progressively come out of dogmatic approaches in deciding to initiate contractual relation with external providers for primary care provision.

  4. Facile synthesis of graphene-wrapped honeycomb MnO2 nanospheres and their application in supercapacitors.

    PubMed

    Zhu, Jiayi; He, Junhui

    2012-03-01

    Graphene-wrapped MnO(2) nanocomposites were first fabricated by coassembly between honeycomb MnO(2) nanospheres and graphene sheets via electrostatic interaction. The materials were characterized by means of X-ray diffraction, scanning electron microscopy, transmission electron microscopy, atomic force microscopy, and thermogravimetric analysis. The novel MnO(2)/graphene hybrid materials were used for investigation of electrochemical capacitive behaviors. The hybrid materials displayed enhanced capacitive performance (210 F/g at 0.5 A/g). Additionally, over 82.4% of the initial capacitance was retained after repeating the cyclic voltammetry test for 1000 cycles. The improved electrochemical performance might be attributed to the combination of the pesudocapacitance of MnO(2) nanospheres with the honeycomb-like "opened" structure and good electrical conductivity of graphene sheets. © 2012 American Chemical Society

  5. Mod II engine performance

    NASA Technical Reports Server (NTRS)

    Richey, Albert E.; Huang, Shyan-Cherng

    1987-01-01

    The testing of a prototype of an automotive Stirling engine, the Mod II, is discussed. The Mod II is a one-piece cast block with a V-4 single-crankshaft configuration and an annular regenerator/cooler design. The initial testing of Mod II concentrated on the basic engine, with auxiliaries driven by power sources external to the engine. The performance of the engine was tested at 720 C set temperature and 820 C tube temperature. At 720 C, it is observed that the power deficiency is speed dependent and linear, with a weak pressure dependency, and at 820 C, the power deficiency is speed and pressure dependent. The effects of buoyancy and nozzle spray pattern on the heater temperature spread are investigated. The characterization of the oil pump and the operating cycle and temperature spread tests are proposed for further evaluation of the engine.

  6. Initial evaluation of discrete orthogonal basis reconstruction of ECT images

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moody, E.B.; Donohue, K.D.

    1996-12-31

    Discrete orthogonal basis restoration (DOBR) is a linear, non-iterative, and robust method for solving inverse problems for systems characterized by shift-variant transfer functions. This simulation study evaluates the feasibility of using DOBR for reconstructing emission computed tomographic (ECT) images. The imaging system model uses typical SPECT parameters and incorporates the effects of attenuation, spatially-variant PSF, and Poisson noise in the projection process. Sample reconstructions and statistical error analyses for a class of digital phantoms compare the DOBR performance for Hartley and Walsh basis functions. Test results confirm that DOBR with either basis set produces images with good statistical properties. Nomore » problems were encountered with reconstruction instability. The flexibility of the DOBR method and its consistent performance warrants further investigation of DOBR as a means of ECT image reconstruction.« less

  7. The Optical Depth Sensor (ODS) in the DREAMS package onboard the Exomars Entry Descent and Landing Demonstrator Module

    NASA Astrophysics Data System (ADS)

    Rannou, P.; Pommereau, J.-P.; Sarkissian, A.; Foujols, T.

    2012-09-01

    The optical depth sensor (ODS) is designed to retrieve the optical depth of the dust layer and to characterize the high altitude clouds on Mars. It was developped initially for the mission MARS 96, and also was included in the payload of several other missions. The sensor was finally built and used for a field experiment in Africa in order to validate the concept and test the performance. In this work we present main principle of the retrieval, the instrumental concept and the result of the tests performed during the 2004-2005 winter field experiment. It is now included in the package DREAM, which is part of the payload of the EDM on Mars 2016 and associated to two terrestrial campaigns, in tropical environment (Brasil) and in the arctic environment.

  8. Evaluation of performance of the MACAO systems at the VLTI

    NASA Astrophysics Data System (ADS)

    Rengaswamy, Sridharan; Haguenauer, Pierre; Brillant, Stephane; Cortes, Angela; Girard, Julien H.; Guisard, Stephane; Paufique, Jérôme; Pino, Andres

    2010-07-01

    Multiple Application Curvature Adaptive Optics (MACAO) systems are used at the coudé focus of the unit telescopes (UTs) at the La-Silla Paranal Observatory, Paranal, to correct for the wave-front aberrations induced by the atmosphere. These systems are in operation since 2005 and are designed to provide beams with 10 mas residual rms tip-tilt error to the VLTI laboratory. We have initiated several technical studies such as measuring the Strehl ratio of the images recorded at the guiding camera of the VLTI, establishing the optimum setup of the MACAO to get collimated and focused beam down to the VLTI laboratory and to the instruments, and ascertaining the data generated by the real time computer, all aimed at characterizing and improving the overall performance of these systems. In this paper we report the current status of these studies.

  9. (WISCONSIN) OVERVIEW OF US EPA RESEARCH ACTIVITIES AIMED AT CHARACTERIZING CHILDRENS EXPOSURES

    EPA Science Inventory

    Overview of significant research activities that have been initiated by the USEPA to increase understanding of children’s vulnerabilities and to better characterize children’s exposures to chemical stressors.

  10. Super-stable Poissonian structures

    NASA Astrophysics Data System (ADS)

    Eliazar, Iddo

    2012-10-01

    In this paper we characterize classes of Poisson processes whose statistical structures are super-stable. We consider a flow generated by a one-dimensional ordinary differential equation, and an ensemble of particles ‘surfing’ the flow. The particles start from random initial positions, and are propagated along the flow by stochastic ‘wave processes’ with general statistics and general cross correlations. Setting the initial positions to be Poisson processes, we characterize the classes of Poisson processes that render the particles’ positions—at all times, and invariantly with respect to the wave processes—statistically identical to their initial positions. These Poisson processes are termed ‘super-stable’ and facilitate the generalization of the notion of stationary distributions far beyond the realm of Markov dynamics.

  11. The Role of Frontal Cortical and Medial-Temporal Lobe Brain Areas in Learning a Bayesian Prior Belief on Reversals

    PubMed Central

    Jang, Anthony I.; Costa, Vincent D.; Rudebeck, Peter H.; Chudasama, Yogita; Murray, Elisabeth A.

    2015-01-01

    Reversal learning has been extensively studied across species as a task that indexes the ability to flexibly make and reverse deterministic stimulus–reward associations. Although various brain lesions have been found to affect performance on this task, the behavioral processes affected by these lesions have not yet been determined. This task includes at least two kinds of learning. First, subjects have to learn and reverse stimulus–reward associations in each block of trials. Second, subjects become more proficient at reversing choice preferences as they experience more reversals. We have developed a Bayesian approach to separately characterize these two learning processes. Reversal of choice behavior within each block is driven by a combination of evidence that a reversal has occurred, and a prior belief in reversals that evolves with experience across blocks. We applied the approach to behavior obtained from 89 macaques, comprising 12 lesion groups and a control group. We found that animals from all of the groups reversed more quickly as they experienced more reversals, and correspondingly they updated their prior beliefs about reversals at the same rate. However, the initial values of the priors that the various groups of animals brought to the task differed significantly, and it was these initial priors that led to the differences in behavior. Thus, by taking a Bayesian approach we find that variability in reversal-learning performance attributable to different neural systems is primarily driven by different prior beliefs about reversals that each group brings to the task. SIGNIFICANCE STATEMENT The ability to use prior knowledge to adapt choice behavior is critical for flexible decision making. Reversal learning is often studied as a form of flexible decision making. However, prior studies have not identified which brain regions are important for the formation and use of prior beliefs to guide choice behavior. Here we develop a Bayesian approach that formally characterizes learning set as a concept, and we show that, in macaque monkeys, the amygdala and medial prefrontal cortex have a role in establishing an initial belief about the stability of the reward environment. PMID:26290251

  12. Stem Cell-Like Gene Expression in Ovarian Cancer Predicts Type II Subtype and Prognosis

    PubMed Central

    Schwede, Matthew; Spentzos, Dimitrios; Bentink, Stefan; Hofmann, Oliver; Haibe-Kains, Benjamin; Harrington, David; Quackenbush, John; Culhane, Aedín C.

    2013-01-01

    Although ovarian cancer is often initially chemotherapy-sensitive, the vast majority of tumors eventually relapse and patients die of increasingly aggressive disease. Cancer stem cells are believed to have properties that allow them to survive therapy and may drive recurrent tumor growth. Cancer stem cells or cancer-initiating cells are a rare cell population and difficult to isolate experimentally. Genes that are expressed by stem cells may characterize a subset of less differentiated tumors and aid in prognostic classification of ovarian cancer. The purpose of this study was the genomic identification and characterization of a subtype of ovarian cancer that has stem cell-like gene expression. Using human and mouse gene signatures of embryonic, adult, or cancer stem cells, we performed an unsupervised bipartition class discovery on expression profiles from 145 serous ovarian tumors to identify a stem-like and more differentiated subgroup. Subtypes were reproducible and were further characterized in four independent, heterogeneous ovarian cancer datasets. We identified a stem-like subtype characterized by a 51-gene signature, which is significantly enriched in tumors with properties of Type II ovarian cancer; high grade, serous tumors, and poor survival. Conversely, the differentiated tumors share properties with Type I, including lower grade and mixed histological subtypes. The stem cell-like signature was prognostic within high-stage serous ovarian cancer, classifying a small subset of high-stage tumors with better prognosis, in the differentiated subtype. In multivariate models that adjusted for common clinical factors (including grade, stage, age), the subtype classification was still a significant predictor of relapse. The prognostic stem-like gene signature yields new insights into prognostic differences in ovarian cancer, provides a genomic context for defining Type I/II subtypes, and potential gene targets which following further validation may be valuable in the clinical management or treatment of ovarian cancer. PMID:23536770

  13. Characterizing the energy output generated by a standard electric detonator using shadowgraph imaging

    NASA Astrophysics Data System (ADS)

    Petr, V.; Lozano, E.

    2017-09-01

    This paper overviews a complete method for the characterization of the explosive energy output from a standard detonator. Measurements of the output of explosives are commonly based upon the detonation parameters of the chemical energy content of the explosive. These quantities provide a correct understanding of the energy stored in an explosive, but they do not provide a direct measure of the different modes in which the energy is released. This optically based technique combines high-speed and ultra-high-speed imaging to characterize the casing fragmentation and the detonator-driven shock load. The procedure presented here could be used as an alternative to current indirect methods—such as the Trauzl lead block test—because of its simplicity, high data accuracy, and minimum demand for test repetition. This technique was applied to experimentally measure air shock expansion versus time and calculating the blast wave energy from the detonation of the high explosive charge inside the detonator. Direct measurements of the shock front geometry provide insight into the physics of the initiation buildup. Because of their geometry, standard detonators show an initial ellipsoidal shock expansion that degenerates into a final spherical wave. This non-uniform shape creates variable blast parameters along the primary blast wave. Additionally, optical measurements are validated using piezoelectric pressure transducers. The energy fraction spent in the acceleration of the metal shell is experimentally measured and correlated with the Gurney model, as well as to several empirical formulations for blasts from fragmenting munitions. The fragment area distribution is also studied using digital particle imaging analysis and correlated with the Mott distribution. Understanding the fragmentation distribution plays a critical role when performing hazard evaluation from these types of devices. In general, this technique allows for characterization of the detonator within 6-8% error with no knowledge of the amount or type of explosive contained within the shell, making it also suitable for the study of unknown improvised explosive devices.

  14. Characterization of a backbone cleavage product of BMS-196854 (Oncostatin M), a recombinant anti-inflammatory cytokine.

    PubMed

    Zhao, F; Stein, D J; Paborji, M; Cash, P W; Root, B J; Wei, Z; Knupp, C J

    2001-01-01

    BMS-196843 (Oncostatin M) is a therapeutic recombinant protein in development. Scale-up process changes led to unexpected instability of the bulk drug substance solution during storage. A product with an apparent higher MW than the parent protein was observed by the size-exclusion chromatography (SEC). This study was aimed to fully characterize the product and to identify a solution to stabilize the protein. SEC, SDS-PAGE, tryptic mapping, and N-terminal sequencing were performed to characterize the unknown product. The effect of pH, temperature, bulk concentration, and immobilized trypsin inhibitor on the degradation rate was studied to elucidate the mechanism and to identify stabilization strategies. Despite the apparent high MW indicated initially by SEC, the unknown was characterized to be a degradation product resulted from a backbone cleavage between residues Arg145-Gly146. The resulting fragments from the backbone cleavage were, however, still linked through an intramolecular disulfide bond. Thus, the final product had a more open structure with an increased hydrodynamic radius compared to the parent protein, which explains the initial SEC results. The site-specific backbone cleavage was suspected to be catalyzed by trypsin-like protease impurities in the bulk solution. The bulk drug substance solution was subsequently treated with immobilized soybean trypsin inhibitor, and the degradation rate was significantly reduced. Furthermore, increasing the solution pH from 5 to 8 led to an increase in the degradation rate, which was consistent with the expected pH dependency of trypsin activity. In addition, the effect of bulk concentration also supported the involvement of protease impurities rather than a spontaneous peptide bond hydrolysis reaction. Trace trypsin-like protease impurities led to an unusual site-specific backbone cleavage of BMS-196854. The proteolytic degradation can be minimized by treating the bulk solution with immobilized soybean trypsin inhibitor and/or controlling the solution pH and storage temperature.

  15. Universal entanglement timescale for Rényi entropies

    NASA Astrophysics Data System (ADS)

    Cresswell, Jesse C.

    2018-02-01

    Recently it was shown that the growth of entanglement in an initially separable state, as measured by the purity of subsystems, can be characterized by a timescale that takes a universal form for any Hamiltonian. We show that the same timescale governs the growth of entanglement for all Rényi entropies. Since the family of Rényi entropies completely characterizes the entanglement of a pure bipartite state, our timescale is a universal feature of bipartite entanglement. The timescale depends only on the interaction Hamiltonian and the initial state.

  16. Realistic Testing of the Safe Affordable Fission Engine (SAFE-100) Thermal Simulator Using Fiber Bragg Gratings

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stinson-Bagby, Kelly L.; Fielder, Robert S.; Van Dyke, Melissa K.

    2004-02-04

    The motivation for the reported research was to support NASA space nuclear power initiatives through the development of advanced fiber optic sensors for space-based nuclear power applications. Distributed high temperature measurements were made with 20 FBG temperature sensors installed in the SAFE-100 thermal simulator at the NASA Marshal Space Flight Center. Experiments were performed at temperatures approaching 800 deg. C and 1150 deg. C for characterization studies of the SAFE-100 core. Temperature profiles were successfully generated for the core during temperature increases and decreases. Related tests in the SAFE-100 successfully provided strain measurement data.

  17. Tensile and fatigue behavior of tungsten/copper composites

    NASA Technical Reports Server (NTRS)

    Verrilli, Michael J.; Gabb, Timothy P.; Kim, Y. S.

    1989-01-01

    Work on W/Cu unidirectional composites was initiated to study the behavior of this ductile-ductile composite system under thermomechanical fatigue and to examine the applicability of fatigue-life prediction methods for thermomechanical fatigue of this metal matrix composite. The first step was to characterize the tensile behavior of four ply, 10 vol. percent W/Cu plates at room and elevated temperatures. Fatigue tests were conducted in load control on 0 degree specimens at 260 C. The maximum cyclic stress was varied but the minimum cyclic stress was kept constant. All tests were performed in vacuum. The strain at failure increased with increasing maximum cyclic stress.

  18. Ceramic Matrix Composite (CMC) Materials Characterization

    NASA Technical Reports Server (NTRS)

    Calomino, Anthony

    2001-01-01

    Under the former NASA EPM Program, much initial progress was made in identifying constituent materials and processes for SiC/SiC ceramic composite hot-section components. This presentation discusses the performance benefits of these approaches and elaborates on further constituent and property improvements made under NASA UEET. These include specific treatments at NASA that significantly improve the creep and environmental resistance of the Sylramic(TM) SiC fiber as well as the thermal conductivity and creep resistance of the CVI Sic matrix. Also discussed are recent findings concerning the beneficial effects of certain 2D-fabric architectures and carbon between the BN interphase coating and Sic matrix.

  19. Preparation, thermal property and morphology analysis of waterborne polyurethane-acrylate

    NASA Astrophysics Data System (ADS)

    Zhao, Zhenyu; Jing, Zefeng; Qiu, Fengxian; Dai, Yuting; Xu, Jicheng; Yu, Zongping; Yang, Pengfei

    2017-01-01

    A series of waterborne polyurethane-acrylate (WPUA) dispersions were prepared with isophorone diisocyanate (IPDI), polyether polyol (NJ-210), dimethylol propionic acid (DMPA), hydroxyethyl methyl acrylate (HEMA), different proportions of methyl methacrylate (MMA) and ethyl acrylate (MMA and EA) and initiating agent by the emulsion co-polymerization. The structures, thermal properties and morphology of WPUA films were characterized with FT-IR, DSC, SEM and AFM. Performances of the dispersions and films were studied by means of apparent viscidity, particle size and polydispersity, surface tension and mechanical properties. The obtained WPUA have great potential application such as coatings, leather finishing, adhesives, sealants, plastic coatings and wood finishes.

  20. New Soft Tissue Implants Using Organic Elastomers

    NASA Astrophysics Data System (ADS)

    Ku, David N.

    Typical biomaterials are stiff, difficult to manufacture, and not initially developed for medical implants. A new biomaterial is proposed that is similar to human soft tissue. The biomaterial provides mechanical properties similar to soft tissue in its mechanical and physical properties. Characterization is performed for modulus of elasticity, ultimate strength and wear resistance. The material further exhibits excellent biocompatibility with little toxicity and low inflammation. The material can be molded into a variety of anatomic shapes for use as a cartilage replacement, heart valve, and reconstructive implant for trauma victims. The biomaterial may be suitable for several biodevices of the future aimed at soft-tissue replacements.

  1. Probing the structure of RecA-DNA filaments. Advantages of a fluorescent guanine analog.

    PubMed

    Singleton, Scott F; Roca, Alberto I; Lee, Andrew M; Xiao, Jie

    2007-04-23

    The RecA protein of Escherichia coli plays a crucial roles in DNA recombination and repair, as well as various aspects of bacterial pathogenicity. The formation of a RecA-ATP-ssDNA complex initiates all RecA activities and yet a complete structural and mechanistic description of this filament has remained elusive. An analysis of RecA-DNA interactions was performed using fluorescently labeled oligonucleotides. A direct comparison was made between fluorescein and several fluorescent nucleosides. The fluorescent guanine analog 6-methylisoxanthopterin (6MI) demonstrated significant advantages over the other fluorophores and represents an important new tool for characterizing RecA-DNA interactions.

  2. Using ultrasonic (US)-initiated template copolymerization for preparation of an enhanced cationic polyacrylamide (CPAM) and its application in sludge dewatering.

    PubMed

    Feng, Li; Liu, Shuang; Zheng, Huaili; Liang, Jianjun; Sun, Yongjun; Zhang, Shixin; Chen, Xin

    2018-06-01

    In this study, the ultrasonic (US)-initiated template copolymerization was employed to synthesize a novel cationic polyacrylamide (CPAM) characterized by a microblock structure using dimethyldiallylammonium chloride (DMDAAC) and acrylamide (AM) as monomers, and sodium polyacrylate (NaPAA) as template. The polymers structure property was analyzed by Fourier transform infrared spectroscopy (FT-IR), 1 H nuclear magnetic resonance spectroscopy ( 1 H NMR) and thermogravimetric analysis (TGA). The results showed that a novel cationic microblock structure was successfully synthesized in the template copolymer of DMDAAC and AM (TPADM). Meanwhile, the analysis result of association constant (M K ) provided powerful support for a I Zip-up (ZIP) template polymerization mechanism and the formation of the microblock structure. The factors affecting the polymerization were investigated, including ultrasonic power, ultrasonic time, monomer concentration, initiator concentration, m AM :m DMDAAC and n NaPAA :n DMDAAC . The sludge dewatering performance of the polymers was evaluated in terms of specific resistance to filtration (SRF), filter cake moisture content (FCMC), floc size (d 50 ) and fractal dimension (D f ). Flocculation mechanism was also analyzed and discussed. The sludge dewatering results revealed that the polymer with the novel microblock structure showed a more excellent flocculation performance than those with randomly distributed cationic units. A desirable flocculation performance with a SRF of 4.5 × 10 12  m kg -1 , FCMC of 73.1%, d 50 of 439.156 µm and D f of 1.490 were obtained at pH of 7.0, dosage of 40 mg L -1 and the molecular weight of 5.0 × 10 6  Da. The cationic microblock extremely enhanced the polymer charge neutralization and bridging ability, thus obtaining the excellent sludge dewatering performance. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. Characterization of On-Orbit U.S. Lab Condensate Vacuum Venting

    NASA Astrophysics Data System (ADS)

    Schmidl, W. D.; Alred, J. A.; Mikatarian, R.; Soares, C.; Miles, E.

    2002-01-01

    The venting of liquid streams into a vacuum has been studied extensively for many years. An experiment was performed aboard the International Space Station (ISS) to video tape the U.S. Lab's condensate venting event with cameras located on the Space Station Remote Manipulator System (SSRMS). Images of the vent plume were acquired close to both the port and starboard vent nozzles. The imaging started with a wider view and then zoomed in closer before the shutdown phase of the vent event occurred. The objective of this experiment was to extend our understanding of the properties of venting liquids into space. Data from the video images were analyzed to obtain the approximate cone angle encompassing the core of the vent plume. The condensate vent plume was characterized as having three phases, a startup phase, a nominal phase, and a shutdown phase. The startup phase consisted of the initial period when the vent first started and the liquid first entered the heated line. The nominal phase was the period when the majority of the liquid was vented. The shutdown phase occurs close to the end of the vent event. The shutdown phase was further divided into two parts, the shutdown initial phase, and a later shutdown sputtering phase. The shutdown initial phase occurs when gas becomes entrained in the condensate liquid being vented. The sputtering phase occurred after the vent valve was closed, and the liquid/ice in the line was removed by continuing to heat the line to bake it out. It was determined that the ice particles were ejected at higher angles, but lower velocities, during the startup and shutdown phases. The number and velocities of ice particles ejected outside of the core region, during the startup, initial shutdown and shutdown sputtering phases were determined. The core of liquid ejected during the startup and shutdown phases was contained within a half cone angle of less than 60 degrees. The startup phase took approximately 36 seconds, the shutdown initial phase took approximately 22 seconds, and the shutdown sputtering phase took approximately 32 seconds. Results from the experiment were correlated with the Boeing ISS vent plume model.

  4. 40 CFR 60.4400 - How do I conduct the initial and subsequent performance tests, regarding NOX?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... subsequent performance tests, regarding NOX? 60.4400 Section 60.4400 Protection of Environment ENVIRONMENTAL... Standards of Performance for Stationary Combustion Turbines Performance Tests § 60.4400 How do I conduct the initial and subsequent performance tests, regarding NOX? (a) You must conduct an initial performance test...

  5. 40 CFR 60.4400 - How do I conduct the initial and subsequent performance tests, regarding NOX?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... subsequent performance tests, regarding NOX? 60.4400 Section 60.4400 Protection of Environment ENVIRONMENTAL... Standards of Performance for Stationary Combustion Turbines Performance Tests § 60.4400 How do I conduct the initial and subsequent performance tests, regarding NOX? (a) You must conduct an initial performance test...

  6. 40 CFR 60.4400 - How do I conduct the initial and subsequent performance tests, regarding NOX?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... subsequent performance tests, regarding NOX? 60.4400 Section 60.4400 Protection of Environment ENVIRONMENTAL... Standards of Performance for Stationary Combustion Turbines Performance Tests § 60.4400 How do I conduct the initial and subsequent performance tests, regarding NOX? (a) You must conduct an initial performance test...

  7. 40 CFR 60.4400 - How do I conduct the initial and subsequent performance tests, regarding NOX?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... subsequent performance tests, regarding NOX? 60.4400 Section 60.4400 Protection of Environment ENVIRONMENTAL... Standards of Performance for Stationary Combustion Turbines Performance Tests § 60.4400 How do I conduct the initial and subsequent performance tests, regarding NOX? (a) You must conduct an initial performance test...

  8. 40 CFR 60.4400 - How do I conduct the initial and subsequent performance tests, regarding NOX?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... subsequent performance tests, regarding NOX? 60.4400 Section 60.4400 Protection of Environment ENVIRONMENTAL... Standards of Performance for Stationary Combustion Turbines Performance Tests § 60.4400 How do I conduct the initial and subsequent performance tests, regarding NOX? (a) You must conduct an initial performance test...

  9. Assessment of MARMOT Grain Growth Model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fromm, B.; Zhang, Y.; Schwen, D.

    2015-12-01

    This report assesses the MARMOT grain growth model by comparing modeling predictions with experimental results from thermal annealing. The purpose here is threefold: (1) to demonstrate the validation approach of using thermal annealing experiments with non-destructive characterization, (2) to test the reconstruction capability and computation efficiency in MOOSE, and (3) to validate the grain growth model and the associated parameters that are implemented in MARMOT for UO 2. To assure a rigorous comparison, the 2D and 3D initial experimental microstructures of UO 2 samples were characterized using non-destructive Synchrotron x-ray. The same samples were then annealed at 2273K for grainmore » growth, and their initial microstructures were used as initial conditions for simulated annealing at the same temperature using MARMOT. After annealing, the final experimental microstructures were characterized again to compare with the results from simulations. So far, comparison between modeling and experiments has been done for 2D microstructures, and 3D comparison is underway. The preliminary results demonstrated the usefulness of the non-destructive characterization method for MARMOT grain growth model validation. A detailed analysis of the 3D microstructures is in progress to fully validate the current model in MARMOT.« less

  10. Study of structure-function relationships in proteins: Techniques and applications ot cytochrome c: Final report January 15, 1988--January 14, 1989

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldstein, D.A.; Rackovsky, S.R.

    1989-08-01

    During the initial period of this work we explored the differential geometry results which had been used to explain the structure-function relationships in the set of yeast iso-1-cytochrome c mutants studied under the initial contract. In addition we continued the development of techniques which would permit the structural characterization and comparison of proteins in a very efficient manner. We have expanded the studies based on the characterization of the structural preferences of various residues in a sample of twenty six globular proteins. It has been demonstrated that the overall structural preferences and the amino acid specific preferences seen in themore » analysis carried out at the five alpha carbon level can not be explained by the results of the analysis carried out at the four alpha carbon level. Thus the structural preferences seen must be described by considering groups of five or more residues. We do no yet have enough data to extend the analysis to the six alpha carbon unit level. We have also verified that the yeast/tuna structural analogy which we used before was justified, and have performed a conformational energy minimization of the reduced yeast cytochrome c crystal data in order to have a baseline for the study of mutant proteins. 6 refs.« less

  11. Multiple Fatigue Failure Behaviors and Long-Life Prediction Approach of Carburized Cr-Ni Steel with Variable Stress Ratio

    PubMed Central

    Deng, Hailong; Li, Wei; Zhao, Hongqiao; Sakai, Tatsuo

    2017-01-01

    Axial loading tests with stress ratios R of −1, 0 and 0.3 were performed to examine the fatigue failure behavior of a carburized Cr-Ni steel in the long-life regime from 104 to 108 cycles. Results show that this steel represents continuously descending S-N characteristics with interior inclusion-induced failure under R = −1, whereas it shows duplex S-N characteristics with surface defect-induced failure and interior inclusion-induced failure under R = 0 and 0.3. The increasing tension eliminates the effect of compressive residual stress and promotes crack initiation from the surface or interior defects in the carburized layer. The FGA (fine granular area) formation greatly depends on the number of loading cycles, but can be inhibited by decreasing the compressive stress. Based on the evaluation of the stress intensity factor at the crack tip, the surface and interior failures in the short life regime can be characterized by the crack growth process, while the interior failure with the FGA in the long life regime can be characterized by the crack initiation process. In view of the good agreement between predicted and experimental results, the proposed approach can be well utilized to predict fatigue lives associated with interior inclusion-FGA-fisheye induced failure, interior inclusion-fisheye induced failure, and surface defect induced failure. PMID:28906454

  12. Surface PEGylation of mesoporous silica materials via surface-initiated chain transfer free radical polymerization: Characterization and controlled drug release.

    PubMed

    Huang, Long; Liu, Meiying; Mao, Liucheng; Huang, Qiang; Huang, Hongye; Wan, Qing; Tian, Jianwen; Wen, Yuanqing; Zhang, Xiaoyong; Wei, Yen

    2017-12-01

    As a new type of mesoporous silica materials with large pore diameter (pore size between 2 and 50nm) and high specific surface areas, SBA-15 has been widely explored for different applications especially in the biomedical fields. The surface modification of SBA-15 with functional polymers has demonstrated to be an effective way for improving its properties and performance. In this work, we reported the preparation of PEGylated SBA-15 polymer composites through surface-initiated chain transfer free radical polymerization for the first time. The thiol group was first introduced on SBA-15 via co-condensation with γ-mercaptopropyltrimethoxysilane (MPTS), that were utilized to initiate the chain transfer free radical polymerization using poly(ethylene glycol) methyl ether methacrylate (PEGMA) and itaconic acid (IA) as the monomers. The successful modification of SBA-15 with poly(PEGMA-co-IA) copolymers was evidenced by a series of characterization techniques, including 1 H NMR, FT-IR, TGA and XPS. The final SBA-15-SH- poly(PEGMA-co-IA) composites display well water dispersity and high loading capability towards cisplatin (CDDP) owing to the introduction of hydrophilic PEGMA and carboxyl groups. Furthermore, the CDDP could be released from SBA-15-SH-poly(PEGMA-co-IA)-CDDP complexes in a pH dependent behavior, suggesting the potential controlled drug delivery of SBA-15-SH-poly(PEGMA-co-IA). More importantly, the strategy should be also useful for fabrication of many other functional materials for biomedical applications owing to the advantages of SBA-15 and well monomer adoptability of chain transfer free radical polymerization. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. A Workflow for Subsurface Pressure Control in Geological CO2 Storage: Optimization of Brine Extraction

    NASA Astrophysics Data System (ADS)

    Birkholzer, J. T.; Gonzalez-Nicolas, A.; Cihan, A.

    2017-12-01

    Industrial-scale injection of CO2 into the subsurface increases the fluid pressure in the reservoir, sometimes to the point that the resulting stress increases must be properly controlled to prevent potential damaging impacts such as fault activation, leakage through abandoned wells, or caprock fracturing. Brine extraction is one approach for managing formation pressure, effective stress, and plume movement in response to CO2 injection. However, the management of the extracted brine adds cost to the carbon capture and sequestration operations; therefore optimizing (minimizing) the extraction volume of brine is of great importance. In this study, we apply an adaptive management approach that optimizes extraction rates of brine for pressure control in an integrated optimization framework involving site monitoring, model calibration, and optimization. We investigate the optimization performance as affected by initial site characterization data and introduction of newly acquired data during the injection phase. More accurate initial reservoir characterization data reduce the risk of pressure buildup damage with better estimations of initial extraction rates, which results in better control of pressure during the overall injection time periods. Results also show that low frequencies of model calibration and optimization with the new data, especially at early injection periods, may lead to optimization problems, either that pressure buildup constraints are violated or excessively high extraction rates are proposed. These optimization problems can be eliminated if more frequent data collection and model calibration are conducted, especially at early injection time periods. Approaches such as adaptive pressure management may constitute an effective tool to manage pressure buildup under uncertain and unknown reservoir conditions by minimizing the brine extraction volumes while not exceeding critical pressure buildups of the reservoir.

  14. Improved silicon carbide for advanced heat engines

    NASA Technical Reports Server (NTRS)

    Whalen, T. J.; Winterbottom, W. L.

    1986-01-01

    Work performed to develop silicon carbide materials of high strength and to form components of complex shape and high reliability is described. A beta-SiC powder and binder system was adapted to the injection molding process and procedures and process parameters developed capable of providing a sintered silicon carbide material with improved properties. The initial effort has been to characterize the baseline precursor materials (beta silicon carbide powder and boron and carbon sintering aids), develop mixing and injection molding procedures for fabricating test bars, and characterize the properties of the sintered materials. Parallel studies of various mixing, dewaxing, and sintering procedures have been carried out in order to distinguish process routes for improving material properties. A total of 276 MOR bars of the baseline material have been molded, and 122 bars have been fully processed to a sinter density of approximately 95 percent. The material has a mean MOR room temperature strength of 43.31 ksi (299 MPa), a Weibull characteristic strength of 45.8 ksi (315 MPa), and a Weibull modulus of 8.0. Mean values of the MOR strengths at 1000, 1200, and 14000 C are 41.4, 43.2, and 47.2 ksi, respectively. Strength controlling flaws in this material were found to consist of regions of high porosity and were attributed to agglomerates originating in the initial mixing procedures. The mean stress rupture lift at 1400 C of five samples tested at 172 MPa (25 ksi) stress was 62 hours and at 207 MPa (30 ksi) stress was 14 hours. New fluid mixing techniques have been developed which significantly reduce flaw size and improve the strength of the material. Initial MOR tests indicate the strength of the fluid-mixed material exceeds the baseline property by more than 33 percent.

  15. Experimental Study on Surrogate Nuclear Fuel Rods under Reversed Cyclic Bending

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Hong; Wang, Jy-An John

    The mechanical behavior of spent nuclear fuel (SNF) rods under reversed cyclic bending or bending fatigue must be understood to evaluate their vibration integrity in a transportation environment. This is especially important for high-burnup fuels (>45 GWd/MTU), which have the potential for increased structural damage. It has been demonstrated that the bending fatigue of SNF rods can be effectively studied using surrogate rods. In this investigation, surrogate rods made of stainless steel (SS) 304 cladding and aluminum oxide pellets were tested under load or moment control at a variety of amplitude levels at 5 Hz using the Cyclic Integrated Reversible-Bendingmore » Fatigue Tester developed at Oak Ridge National Laboratory. The behavior of the rods was further characterized using flexural rigidity and hysteresis data, and fractography was performed on the failed rods. The proposed surrogate rods captured many of the characteristics of deformation and failure mode observed in SNF, including the linear-to-nonlinear deformation transition and large residual curvature in static tests, PPI and PCMI failure mechanisms, and large variation in the initial structural condition. Rod degradation was measured and characterized by measuring the flexural rigidity; the degradation of the rigidity depended on both the moment amplitude applied and the initial structural condition of the rods. It was also shown that a cracking initiation site can be located on the internal surface or the external surface of cladding. Finally, fatigue damage to the bending rods can be described in terms of flexural rigidity, and the fatigue life of rods can be predicted once damage model parameters are properly evaluated. The developed experimental approach, test protocol, and analysis method can be used to study the vibration integrity of SNF rods in the future.« less

  16. Bilirubin glucuronidation revisited: proper assay conditions to estimate enzyme kinetics with recombinant UGT1A1.

    PubMed

    Zhou, Jin; Tracy, Timothy S; Remmel, Rory P

    2010-11-01

    Bilirubin, an end product of heme catabolism, is primarily eliminated via glucuronic acid conjugation by UGT1A1. Impaired bilirubin conjugation, caused by inhibition of UGT1A1, can result in clinical consequences, including jaundice and kernicterus. Thus, evaluation of the ability of new drug candidates to inhibit UGT1A1-catalyzed bilirubin glucuronidation in vitro has become common practice. However, the instability of bilirubin and its glucuronides presents substantial technical challenges to conduct in vitro bilirubin glucuronidation assays. Furthermore, because bilirubin can be diglucuronidated through a sequential reaction, establishment of initial rate conditions can be problematic. To address these issues, a robust high-performance liquid chromatography assay to measure both bilirubin mono- and diglucuronide conjugates was developed, and the incubation conditions for bilirubin glucuronidation by human embryonic kidney 293-expressed UGT1A1 were carefully characterized. Our results indicated that bilirubin glucuronidation should be assessed at very low protein concentrations (0.05 mg/ml protein) and over a short incubation time (5 min) to assure initial rate conditions. Under these conditions, bilirubin total glucuronide formation exhibited a hyperbolic (Michaelis-Menten) kinetic profile with a K(m) of ∼0.2 μM. In addition, under these initial rate conditions, the relative proportions between the total monoglucuronide and the diglucuronide product were constant across the range of bilirubin concentration evaluated (0.05-2 μM), with the monoglucuronide being the predominant species (∼70%). In conclusion, establishment of appropriate incubation conditions (i.e., very low protein concentrations and short incubation times) is necessary to properly characterize the kinetics of bilirubin glucuronidation in a recombinant UGT1A1 system.

  17. Systemic characterization and evaluation of particle packings as initial sets for discrete element simulations

    NASA Astrophysics Data System (ADS)

    Morfa, Carlos Recarey; Cortés, Lucía Argüelles; Farias, Márcio Muniz de; Morales, Irvin Pablo Pérez; Valera, Roberto Roselló; Oñate, Eugenio

    2018-07-01

    A methodology that comprises several characterization properties for particle packings is proposed in this paper. The methodology takes into account factors such as dimension and shape of particles, space occupation, homogeneity, connectivity and isotropy, among others. This classification and integration of several properties allows to carry out a characterization process to systemically evaluate the particle packings in order to guarantee the quality of the initial meshes in discrete element simulations, in both the micro- and the macroscales. Several new properties were created, and improvements in existing ones are presented. Properties from other disciplines were adapted to be used in the evaluation of particle systems. The methodology allows to easily characterize media at the level of the microscale (continuous geometries—steels, rocks microstructures, etc., and discrete geometries) and the macroscale. A global, systemic and integral system for characterizing and evaluating particle sets, based on fuzzy logic, is presented. Such system allows researchers to have a unique evaluation criterion based on the aim of their research. Examples of applications are shown.

  18. Systemic characterization and evaluation of particle packings as initial sets for discrete element simulations

    NASA Astrophysics Data System (ADS)

    Morfa, Carlos Recarey; Cortés, Lucía Argüelles; Farias, Márcio Muniz de; Morales, Irvin Pablo Pérez; Valera, Roberto Roselló; Oñate, Eugenio

    2017-10-01

    A methodology that comprises several characterization properties for particle packings is proposed in this paper. The methodology takes into account factors such as dimension and shape of particles, space occupation, homogeneity, connectivity and isotropy, among others. This classification and integration of several properties allows to carry out a characterization process to systemically evaluate the particle packings in order to guarantee the quality of the initial meshes in discrete element simulations, in both the micro- and the macroscales. Several new properties were created, and improvements in existing ones are presented. Properties from other disciplines were adapted to be used in the evaluation of particle systems. The methodology allows to easily characterize media at the level of the microscale (continuous geometries—steels, rocks microstructures, etc., and discrete geometries) and the macroscale. A global, systemic and integral system for characterizing and evaluating particle sets, based on fuzzy logic, is presented. Such system allows researchers to have a unique evaluation criterion based on the aim of their research. Examples of applications are shown.

  19. First Year PIDDP Report on gamma-ray and x-ray spectroscopy: X-ray remote sensing and in situ spectroscopy for planetary exploration missions and gamma-ray remote sensing and in situ spectroscopy for planetary exploration missions

    NASA Technical Reports Server (NTRS)

    Mahdavi, M.; Giboni, K. L.; Vajda, S.; Schweitzer, J. S.; Truax, J. A.

    1994-01-01

    Detectors that will be used for planetary missions must have their responses calibrated in a reproducible manner. In addition, it is important to characterize a detector system at uneven portions of its life cycle, for example after exposure to different amounts of radiation. A calibration and response characterization facility has been constructed at Schlumberger-Doll Research for all types of gamma- and x-ray detectors that may be used for planetary measurement. This facility is currently being tested. Initial use is expected for the MARS 94 detectors. The facility will then also be available for calibrating other detectors as well as arrays of detectors such as the NEAR detector with its central Nal(TI) crystal surrounded with a large BGO crystal. Cadmium telluride detectors are investigated for applications in space explorations. These detectors show an energy resolution of 5 keV for the 122 keV 57Co line. Earlier reported polarization effects are not observed. The detectors can be used at temperatures up to 100 C, although with reduced energy resolution. The thickness of standard detectors is limited to 2 mm. These detectors become fully efficient at bias voltages above 200 V. Initial results for a 1 cm thick detector show that the quality of the material is inferior to the thinner standard detectors and hole trapping affects the pulse height. A detailed characterization of the detector is in progress. Prototypes of photomultipliers based on a Channel Electron Multiplier (CEM) are being built to study their performance. Such photomultipliers promise better timing characteristics and a higher dynamic range while being more compact and of lower in weight.

  20. Characterizing rare-event property distributions via replicate molecular dynamics simulations of proteins.

    PubMed

    Krishnan, Ranjani; Walton, Emily B; Van Vliet, Krystyn J

    2009-11-01

    As computational resources increase, molecular dynamics simulations of biomolecules are becoming an increasingly informative complement to experimental studies. In particular, it has now become feasible to use multiple initial molecular configurations to generate an ensemble of replicate production-run simulations that allows for more complete characterization of rare events such as ligand-receptor unbinding. However, there are currently no explicit guidelines for selecting an ensemble of initial configurations for replicate simulations. Here, we use clustering analysis and steered molecular dynamics simulations to demonstrate that the configurational changes accessible in molecular dynamics simulations of biomolecules do not necessarily correlate with observed rare-event properties. This informs selection of a representative set of initial configurations. We also employ statistical analysis to identify the minimum number of replicate simulations required to sufficiently sample a given biomolecular property distribution. Together, these results suggest a general procedure for generating an ensemble of replicate simulations that will maximize accurate characterization of rare-event property distributions in biomolecules.

  1. Feasibility study of palm-based fuels for hybrid rocket motor applications

    NASA Astrophysics Data System (ADS)

    Tarmizi Ahmad, M.; Abidin, Razali; Taha, A. Latif; Anudip, Amzaryi

    2018-02-01

    This paper describes the combined analysis done in pure palm-based wax that can be used as solid fuel in a hybrid rocket engine. The measurement of pure palm wax calorific value was performed using a bomb calorimeter. An experimental rocket engine and static test stand facility were established. After initial measurement and calibration, repeated procedures were performed. Instrumentation supplies carried out allow fuel regression rate measurements, oxidizer mass flow rates and stearic acid rocket motors measurements. Similar tests are also carried out with stearate acid (from palm oil by-products) dissolved with nitrocellulose and bee solution. Calculated data and experiments show that rates and regression thrust can be achieved even in pure-tested palm-based wax. Additionally, palm-based wax is mixed with beeswax characterized by higher nominal melting temperatures to increase moisturizing points to higher temperatures without affecting regression rate values. Calorie measurements and ballistic experiments were performed on this new fuel formulation. This new formulation promises driving applications in a wide range of temperatures.

  2. A study of the relationship between the performance and dependability of a fault-tolerant computer

    NASA Technical Reports Server (NTRS)

    Goswami, Kumar K.

    1994-01-01

    This thesis studies the relationship by creating a tool (FTAPE) that integrates a high stress workload generator with fault injection and by using the tool to evaluate system performance under error conditions. The workloads are comprised of processes which are formed from atomic components that represent CPU, memory, and I/O activity. The fault injector is software-implemented and is capable of injecting any memory addressable location, including special registers and caches. This tool has been used to study a Tandem Integrity S2 Computer. Workloads with varying numbers of processes and varying compositions of CPU, memory, and I/O activity are first characterized in terms of performance. Then faults are injected into these workloads. The results show that as the number of concurrent processes increases, the mean fault latency initially increases due to increased contention for the CPU. However, for even higher numbers of processes (less than 3 processes), the mean latency decreases because long latency faults are paged out before they can be activated.

  3. Characterization of spatially resolved high resolution x-ray spectrometers for HEDP and light-source experiments

    NASA Astrophysics Data System (ADS)

    Hill, K. W.; Bitter, M.; Delgado-Aparicio, L.; Efthimion, P.; Pablant, N.; Lu, J.; Beiersdorfer, P.; Chen, H.; Magee, E.

    2014-10-01

    A high resolution 1D imaging x-ray spectrometer concept comprising a spherically bent crystal and a 2D pixelated detector is being optimized for diagnostics of small sources such as high energy density physics (HEDP) and synchrotron radiation or x-ray free electron laser experiments. This instrument is used on tokamak experiments for measurement of spatial profiles of Doppler ion temperature and plasma flow velocity, as well as electron temperature. Laboratory measurements demonstrate a resolving power, E/ ΔE of 10,000 and spatial resolution better than 10 μm. Good performance is obtained for Bragg angles ranging from 23 to 63 degrees. Initial tests of the instrument on HEDP plasmas are being performed with a goal of developing spatially resolved ion and electron temperature diagnostics. This work was performed under the auspices of the US DOE by PPPL under Contract DE-AC02-09CH11466 and by LLNL under Contract DE-AC52-07NA27344.

  4. Early regimes of water capillary flow in slit silica nanochannels.

    PubMed

    Oyarzua, Elton; Walther, Jens H; Mejía, Andrés; Zambrano, Harvey A

    2015-06-14

    Molecular dynamics simulations are conducted to investigate the initial stages of spontaneous imbibition of water in slit silica nanochannels surrounded by air. An analysis is performed for the effects of nanoscopic confinement, initial conditions of liquid uptake and air pressurization on the dynamics of capillary filling. The results indicate that the nanoscale imbibition process is divided into three main flow regimes: an initial regime where the capillary force is balanced only by the inertial drag and characterized by a constant velocity and a plug flow profile. In this regime, the meniscus formation process plays a central role in the imbibition rate. Thereafter, a transitional regime takes place, in which, the force balance has significant contributions from both inertia and viscous friction. Subsequently, a regime wherein viscous forces dominate the capillary force balance is attained. Flow velocity profiles identify the passage from an inviscid flow to a developing Poiseuille flow. Gas density profiles ahead of the capillary front indicate a transient accumulation of air on the advancing meniscus. Furthermore, slower capillary filling rates computed for higher air pressures reveal a significant retarding effect of the gas displaced by the advancing meniscus.

  5. Micromechanical Characterization and Texture Analysis of Direct Cast Titanium Alloys Strips

    NASA Technical Reports Server (NTRS)

    2000-01-01

    This research was conducted to determine a post-processing technique to optimize mechanical and material properties of a number of Titanium based alloys and aluminides processed via Melt Overflow Solidification Technique (MORST). This technique was developed by NASA for the development of thin sheet titanium and titanium aluminides used in high temperature applications. The materials investigated in this study included conventional titanium alloy strips and foils, Ti-1100, Ti-24Al-11Nb (Alpha-2), and Ti-48Al-2Ta (Gamma). The methodology used included micro-characterization, heat-treatment, mechanical processing and mechanical testing. Characterization techniques included optical, electron microscopy, and x-ray texture analysis. The processing included heat-treatment and mechanical deformation through cold rolling. The initial as-cast materials were evaluated for their microstructure and mechanical properties. Different heat-treatment and rolling steps were chosen to process these materials. The properties were evaluated further and a processing relationship was established in order to obtain an optimum processing condition. The results showed that the as-cast material exhibited a Widmanstatten (fine grain) microstructure that developed into a microstructure with larger grains through processing steps. The texture intensity showed little change for all processing performed in this investigation.

  6. Characterization and inactivation of an agmatine deiminase from Helicobacter pylori

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jones, Justin E.; Causey, Corey P.; Lovelace, Leslie

    2010-11-12

    Helicobacter pylori encodes a potential virulence factor, agmatine deiminase (HpAgD), which catalyzes the conversion of agmatine to N-carbamoyl putrescine (NCP) and ammonia - agmatine is decarboxylated arginine. Agmatine is an endogenous human cell signaling molecule that triggers the innate immune response in humans. Unlike H. pylori, humans do not encode an AgD; it is hypothesized that inhibition of this enzyme would increase the levels of agmatine, and thereby enhance the innate immune response. Taken together, these facts suggest that HpAgD is a potential drug target. Herein we describe the optimized expression, isolation, and purification of HpAgD (10-30 mg/L media). Themore » initial kinetic characterization of this enzyme has also been performed. Additionally, the crystal structure of wild-type HpAgD has been determined at 2.1 {angstrom} resolution. This structure provides a molecular basis for the preferential deimination of agmatine, and identifies Asp198 as a key residue responsible for agmatine recognition, which has been confirmed experimentally. Information gathered from these studies led to the development and characterization of a novel class of haloacetamidine-based HpAgD inactivators. These compounds are the most potent AgD inhibitors ever described.« less

  7. Practical guidelines for characterization of O-diglycosyl flavonoid isomers by triple quadrupole MS and their applications for identification of some fruit juices flavonoids.

    PubMed

    Abad-García, B; Garmón-Lobato, S; Berrueta, L A; Gallo, B; Vicente, F

    2009-07-01

    Fifteen flavonoid O-diglycosides with different interglycosidic linkage isomery and glycosylation position have been studied in order to analyze their fragmentation patterns. Initial separation was carried out using high performance liquid chromatography with diode array detection (HPLC/DAD) coupled to an electrospray ionization (ESI) interface and a triple quadrupole mass spectrometer. Some useful differences in their MS spectra have been found and discussed. As it has already been reported, [Y*]+/[Y0]+ ratio for flavanones and [Y1]+/[Y0]+ ratio for other flavonoids is specific for each isomeric interglycosidic linkage. In this work it has also been observed that the abundance of these ions is dependent on the position of glycosylation. On the basis of these differences, systematic guidelines for our experimental conditions have been proposed for the differentiation of not only isomeric interglycosidic linkage but also glycosylation position using collision-induced dissociation MS/MS (CID-MS/MS) spectra in positive mode. These results have been successfully applied for the characterization of three diglycosyl flavonoids found in Citrus fruit juices and these conclusions have also been extrapolated for characterizing two triglycosides in the same fruits. Copyright 2009 John Wiley & Sons, Ltd.

  8. A comparative study of Full Navier-Stokes and Reduced Navier-Stokes analyses for separating flows within a diffusing inlet S-duct

    NASA Technical Reports Server (NTRS)

    Anderson, B. H.; Reddy, D. R.; Kapoor, K.

    1993-01-01

    A three-dimensional implicit Full Navier-Stokes (FNS) analysis and a 3D Reduced Navier Stokes (RNS) initial value space marching solution technique has been applied to a class of separated flow problems within a diffusing S-duct configuration characterized by vortex-liftoff. Both the FNS and the RNS solution technique were able to capture the overall flow physics of vortex lift-off, and gave remarkably similar results which agreed reasonably well with the experimental measured averaged performance parameters of engine face total pressure recovery and distortion. However, the Full Navier-Stokes and Reduced Navier-Stokes also consistently predicted separation further downstream in the M2129 inlet S-duct than was indicated by experimental data, thus compensating errors were present in the two Navier-Stokes analyses. The difficulties encountered in the Navier-Stokes separations analyses of the M2129 inlet S-duct center primarily on turbulence model issues, and these focused on two distinct but different phenomena, namely, (1) characterization of low skin friction adverse pressure gradient flows, and (2) description of the near wall behavior of flows characterized by vortex lift-off.

  9. Variable-free exploration of stochastic models: a gene regulatory network example.

    PubMed

    Erban, Radek; Frewen, Thomas A; Wang, Xiao; Elston, Timothy C; Coifman, Ronald; Nadler, Boaz; Kevrekidis, Ioannis G

    2007-04-21

    Finding coarse-grained, low-dimensional descriptions is an important task in the analysis of complex, stochastic models of gene regulatory networks. This task involves (a) identifying observables that best describe the state of these complex systems and (b) characterizing the dynamics of the observables. In a previous paper [R. Erban et al., J. Chem. Phys. 124, 084106 (2006)] the authors assumed that good observables were known a priori, and presented an equation-free approach to approximate coarse-grained quantities (i.e., effective drift and diffusion coefficients) that characterize the long-time behavior of the observables. Here we use diffusion maps [R. Coifman et al., Proc. Natl. Acad. Sci. U.S.A. 102, 7426 (2005)] to extract appropriate observables ("reduction coordinates") in an automated fashion; these involve the leading eigenvectors of a weighted Laplacian on a graph constructed from network simulation data. We present lifting and restriction procedures for translating between physical variables and these data-based observables. These procedures allow us to perform equation-free, coarse-grained computations characterizing the long-term dynamics through the design and processing of short bursts of stochastic simulation initialized at appropriate values of the data-based observables.

  10. Integrated nonlinear optical imaging microscope for on-axis crystal detection and centering at a synchrotron beamline

    PubMed Central

    Madden, Jeremy T.; Toth, Scott J.; Dettmar, Christopher M.; Newman, Justin A.; Oglesbee, Robert A.; Hedderich, Hartmut G.; Everly, R. Michael; Becker, Michael; Ronau, Judith A.; Buchanan, Susan K.; Cherezov, Vadim; Morrow, Marie E.; Xu, Shenglan; Ferguson, Dale; Makarov, Oleg; Das, Chittaranjan; Fischetti, Robert; Simpson, Garth J.

    2013-01-01

    Nonlinear optical (NLO) instrumentation has been integrated with synchrotron X-ray diffraction (XRD) for combined single-platform analysis, initially targeting applications for automated crystal centering. Second-harmonic-generation microscopy and two-photon-excited ultraviolet fluorescence microscopy were evaluated for crystal detection and assessed by X-ray raster scanning. Two optical designs were constructed and characterized; one positioned downstream of the sample and one integrated into the upstream optical path of the diffractometer. Both instruments enabled protein crystal identification with integration times between 80 and 150 µs per pixel, representing a ∼103–104-fold reduction in the per-pixel exposure time relative to X-ray raster scanning. Quantitative centering and analysis of phenylalanine hydroxylase from Chromobacterium violaceum cPAH, Trichinella spiralis deubiquitinating enzyme TsUCH37, human κ-opioid receptor complex kOR-T4L produced in lipidic cubic phase (LCP), intimin prepared in LCP, and α-cellulose samples were performed by collecting multiple NLO images. The crystalline samples were characterized by single-crystal diffraction patterns, while α-cellulose was characterized by fiber diffraction. Good agreement was observed between the sample positions identified by NLO and XRD raster measurements for all samples studied. PMID:23765294

  11. Autonomous path-planning navigation system for site characterization

    NASA Astrophysics Data System (ADS)

    Rankin, Arturo L.; Crane, Carl D., III; Armstrong, David G., II; Nease, Allen D.; Brown, H. Edward

    1996-05-01

    The location and removal of buried munitions is an important yet hazardous task. Current development is aimed at performing both the ordnance location and removal tasks autonomously. An autonomous survey vehicle (ASV) named the Gator has been developed at the Center for Intelligent Machines and Robotics, under the direction of Wright Laboratory, Tyndall Air Force Base, Florida, and the Navy Explosive Ordnance Disposal Technology Division, Indian Head, Maryland. The primary task of the survey vehicle is to autonomously traverse an off-road site, towing behind it a trailer containing a sensor package capable of characterizing the sub-surface contents. Achieving 00 percent coverage of the site is critical to fully characterizing the site. This paper presents a strategy for planning efficient paths for the survey vehicle that guarantees near-complete coverage of a site. A small library of three in-house developed path planners are reviewed. A strategy is also presented to keep the trailer on-path and to calculate the percent of coverage of a site with a resolution of 0.01 m2. All of the algorithms discussed in this paper were initially developed in simulation on a Silicon Graphics computer and subsequently implemented on the survey vehicle.

  12. Characterization and recovery of Deep Sub Micron (DSM) technologies behavior under radiation

    NASA Technical Reports Server (NTRS)

    Stoica, Adrian; Wang, Xiao

    2005-01-01

    This paper serves a twofold purpose: characterize the behavior of a reconfigurable chip exposed to radiation; and demonstrate a method for functionality recovery due to Total Ionizing Dose (TID) effects. The experiments are performed using a PL developed reconfigurable device, a Field Programmable Transistor Array (FPTA). The paper initially describes experiments on the characterization of the NMOS transistor behavior for TID values up to 300krad. The behavior of analog and digital circuits downloaded onto the FPTA chip is also assessed for TID effects. This paper also presents a novel approach for circuit functionality recovery due to radiation effects based on Evolvable Hardware. The key idea is to reconfigure a programmable device, in-situ, to compensate, or bypass its degraded or damaged components. Experiments with total radiation dose up to 300kRad show that while the functionality of a variety of circuits, including digital gates, a rectifier and a Digital to Analog Converter implemented on a FPTA-2 chip is degraded/lost at levels before 200kRad, the correct functionality can be recovered through the proposed evolutionary approach and the chips are able to survive higher radiation, for several functions in excess of total radiation dose of 250kRad.

  13. Construction and characterization of a single stage dual diaphragm gas gun

    NASA Astrophysics Data System (ADS)

    Helminiak, Nathaniel Steven

    In the interest of studying the propagation of shock waves, this work sets out to design, construct, and characterize a pneumatic accelerator that performs high-velocity flyer plate impact tests. A single stage gas gun with a dual diaphragm breach allows for a non-volatile, reliable experimental testing platform for shock phenomena. This remotely operated gas gun utilizes compressed nitrogen to launch projectiles down a 14 foot long, 2 inch diameter bore barrel, which subsequently impacts a target material of interest. A dual diaphragm firing mechanism allows the 4.5 liter breech to reach a total pressure differential of 10ksi before accelerating projectiles to velocities as high as 1,000 m/s (1570-2240 mph). The projectile's velocity is measured using a series of break pin circuits. The target response can be measured with Photon Doppler Velocimetry (PDV) and/or stress gauge system. A vacuum system eliminates the need for pressure relief in front of the projectile, while additionally allowing the system to remain closed over the entire firing cycle. Characterization of the system will allow for projectile speed to be estimated prior to launching based on initial breach pressure.

  14. Atomistic simulations of shock-induced alloying reactions in Ni /Al nanolaminates

    NASA Astrophysics Data System (ADS)

    Zhao, Shijin; Germann, Timothy C.; Strachan, Alejandro

    2006-10-01

    We employ molecular dynamics simulations with a first principles-based many body potential to characterize the exothermic alloying reactions of nanostructured Ni /Al multilayers induced by shock loading. We introduce a novel technique that captures both the initial shock transit as well as the subsequent longer-time-scale Ni3Al alloy formation. Initially, the softer Al layers are shock heated to a higher temperature than the harder Ni layers as a result of a series of shock reflections from the impedance-mismatched interfaces. Once initiated, the highly exothermic alloying reactions can propagate in a self-sustained manner by mass and thermal diffusion. We also characterize the role of voids on the initiation of alloying. The interaction of the shock wave with the voids leads not only to significant local heating (hot spots) but also directly aids the intermixing between Al and Ni; both of these phenomena contribute to a significant acceleration of the alloying reactions.

  15. Blocking Modification of Eukaryotic Initiation 5A2 Antagonizes Cervical Carcinoma via Inhibition of RhoA/ROCK Signal Transduction Pathway.

    PubMed

    Liu, Xiaojun; Chen, Dong; Liu, Jiamei; Chu, Zhangtao; Liu, Dongli

    2017-10-01

    Cervical carcinoma is one of the leading causes of cancer-related death for female worldwide. Eukaryotic initiation factor 5A2 belongs to the eukaryotic initiation factor 5A family and is proposed to be a key factor involved in the development of diverse cancers. In the current study, a series of in vivo and in vitro investigations were performed to characterize the role of eukaryotic initiation factor 5A2 in oncogenesis and metastasis of cervical carcinoma. The expression status of eukaryotic initiation factor 5A2 in 15 cervical carcinoma patients was quantified. Then, the effect of eukaryotic initiation factor 5A2 knockdown on in vivo tumorigenicity ability, cell proliferation, cell cycle distribution, and cell mobility of HeLa cells was measured. To uncover the mechanism driving the function of eukaryotic initiation factor 5A2 in cervical carcinoma, expression of members within RhoA/ROCK pathway was detected, and the results were further verified with an RhoA overexpression modification. The level of eukaryotic initiation factor 5A2 in cervical carcinoma samples was significantly higher than that in paired paratumor tissues ( P < .05). And the in vivo tumorigenic ability of HeLa cells was reduced by inhibition of eukaryotic initiation factor 5A2. Knockdown of eukaryotic initiation factor 5A2 in HeLa cells decreased the cell viability compared with normal cells and induced G1 phase cell cycle arrest ( P < .05). Moreover, the cell migration ability of eukaryotic initiation factor 5A2 knockdown cells was dramatically inhibited. Associated with alterations in phenotypes, RhoA, ROCK I, and ROCK II were downregulated. The above-mentioned changes in eukaryotic initiation factor 5A2 knockdown cells were alleviated by the overexpression of RhoA. The major findings outlined in the current study confirmed the potential of eukaryotic initiation factor 5A2 as a promising prognosis predictor and therapeutic target for cervical carcinoma treatment. Also, our data inferred that eukaryotic initiation factor 5A2 might function in carcinogenesis of cervical carcinoma through an RhoA/ROCK-dependent manner.

  16. USEPA RESEARCH ACTIVITIES TO CHARACTERIZE CHILDREN'S ENVIRONMENTAL EXPOSURES

    EPA Science Inventory

    Given the vulnerability of children to effects from environmental exposures, understanding links between children's health and environmental exposures is critical. In recent years, significant research has been initiated at USEPA to characterize children's exposures.

  17. Control of hyper-extended passive margin architecture on subduction initiation with application to the Alps and present-day North Atlantic ocean

    NASA Astrophysics Data System (ADS)

    Candioti, Lorenzo; Bauville, Arthur; Picazo, Suzanne; Mohn, Geoffroy; Kaus, Boris

    2016-04-01

    Hyper-extended magma-poor margins are characterized by extremely thinned crust and partially serpentinized mantle exhumation. As this can act as a zone of weakness during a subsequent compression event, a hyper-extended margin can thus potentially facilitate subduction initiation. Hyper-extended margins are also found today as passive margins fringing the Atlantic and North Atlantic ocean, e.g. Iberia and New Foundland margins [1] and Porcupine, Rockwall and Hatton basins. It has been proposed in the literature that hyper-extension in the Alpine Tethys does not exceed ~600 km in width [2]. The geodynamical evolution of the Alpine and Atlantic passive margins are distinct: no subduction is yet initiated in the North Atlantic, whereas the Alpine Tethys basin has undergone subduction. Here, we investigate the control of the presence of a hyper-extended margin on subduction initiation. We perform high resolution 2D simulations considering realistic rheologies and temperature profiles for these locations. We systematically vary the length and thickness of the hyper-extended crust and serpentinized mantle, to better understand the conditions for subduction initiation. References: [1] G. Manatschal. New models for evolution of magma-poor rifted margins based on a review of data and concepts from West Iberia and the Alps. Int J Earth Sci (Geol Rundsch) (2004); 432-466. [2] G. Mohn, G. Manatschal, M. Beltrando, I. Haupert. The role of rift-inherited hyper-extension in alpine-type orogens. Terra Nova (2014); 347-353.

  18. Magnetohydrodynamic Modeling of Solar Coronal Dynamics with an Initial Non-force-free Magnetic Field

    NASA Astrophysics Data System (ADS)

    Prasad, A.; Bhattacharyya, R.; Kumar, Sanjay

    2017-05-01

    The magnetic fields in the solar corona are generally neither force-free nor axisymmetric and have complex dynamics that are difficult to characterize. Here we simulate the topological evolution of solar coronal magnetic field lines (MFLs) using a magnetohydrodynamic model. The simulation is initialized with a non-axisymmetric non-force-free magnetic field that best correlates with the observed vector magnetograms of solar active regions (ARs). To focus on these ideas, simulations are performed for the flaring AR 11283 noted for its complexity and well-documented dynamics. The simulated dynamics develops as the initial Lorentz force pushes the plasma and facilitates successive magnetic reconnections at the two X-type null lines present in the initial field. Importantly, the simulation allows for the spontaneous development of mass flow, unique among contemporary works, that preferentially reconnects field lines at one of the X-type null lines. Consequently, a flux rope consisting of low-lying twisted MFLs, which approximately traces the major polarity inversion line, undergoes an asymmetric monotonic rise. The rise is attributed to a reduction in the magnetic tension force at the region overlying the rope, resulting from the reconnection. A monotonic rise of the rope is in conformity with the standard scenario of flares. Importantly, the simulated dynamics leads to bifurcations of the flux rope, which, being akin to the observed filament bifurcation in AR 11283, establishes the appropriateness of the initial field in describing ARs.

  19. Magnetohydrodynamic Modeling of Solar Coronal Dynamics with an Initial Non-force-free Magnetic Field

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prasad, A.; Bhattacharyya, R.; Kumar, Sanjay

    The magnetic fields in the solar corona are generally neither force-free nor axisymmetric and have complex dynamics that are difficult to characterize. Here we simulate the topological evolution of solar coronal magnetic field lines (MFLs) using a magnetohydrodynamic model. The simulation is initialized with a non-axisymmetric non-force-free magnetic field that best correlates with the observed vector magnetograms of solar active regions (ARs). To focus on these ideas, simulations are performed for the flaring AR 11283 noted for its complexity and well-documented dynamics. The simulated dynamics develops as the initial Lorentz force pushes the plasma and facilitates successive magnetic reconnections atmore » the two X-type null lines present in the initial field. Importantly, the simulation allows for the spontaneous development of mass flow, unique among contemporary works, that preferentially reconnects field lines at one of the X-type null lines. Consequently, a flux rope consisting of low-lying twisted MFLs, which approximately traces the major polarity inversion line, undergoes an asymmetric monotonic rise. The rise is attributed to a reduction in the magnetic tension force at the region overlying the rope, resulting from the reconnection. A monotonic rise of the rope is in conformity with the standard scenario of flares. Importantly, the simulated dynamics leads to bifurcations of the flux rope, which, being akin to the observed filament bifurcation in AR 11283, establishes the appropriateness of the initial field in describing ARs.« less

  20. Initial Navigation Alignment of Optical Instruments on GOES-R

    NASA Astrophysics Data System (ADS)

    Isaacson, P.; DeLuccia, F.; Reth, A. D.; Igli, D. A.; Carter, D.

    2016-12-01

    The GOES-R satellite is the first in NOAA's next-generation series of geostationary weather satellites. In addition to a number of space weather sensors, it will carry two principal optical earth-observing instruments, the Advanced Baseline Imager (ABI) and the Geostationary Lightning Mapper (GLM). During launch, currently scheduled for November of 2016, the alignment of these optical instruments is anticipated to shift from that measured during pre-launch characterization. While both instruments have image navigation and registration (INR) processing algorithms to enable automated geolocation of the collected data, the launch-derived misalignment may be too large for these approaches to function without an initial adjustment to calibration parameters. The parameters that may require adjustment are for Line of Sight Motion Compensation (LMC), and the adjustments will be estimated on orbit during the post-launch test (PLT) phase. We have developed approaches to estimate the initial alignment errors for both ABI and GLM image products. Our approaches involve comparison of ABI and GLM images collected during PLT to a set of reference ("truth") images using custom image processing tools and other software (the INR Performance Assessment Tool Set, or "IPATS") being developed for other INR assessments of ABI and GLM data. IPATS is based on image correlation approaches to determine offsets between input and reference images, and these offsets are the fundamental input to our estimate of the initial alignment errors. Initial testing of our alignment algorithms on proxy datasets lends high confidence that their application will determine the initial alignment errors to within sufficient accuracy to enable the operational INR processing approaches to proceed in a nominal fashion. We will report on the algorithms, implementation approach, and status of these initial alignment tools being developed for the GOES-R ABI and GLM instruments.

  1. 40 CFR 63.6610 - By what date must I conduct the initial performance tests or other initial compliance...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... initial performance tests or other initial compliance demonstrations if I own or operate a stationary RICE... performance tests or other initial compliance demonstrations if I own or operate a stationary RICE with a site... stationary RICE with a site rating of more than 500 brake HP located at a major source of HAP emissions you...

  2. 40 CFR 63.6610 - By what date must I conduct the initial performance tests or other initial compliance...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... initial performance tests or other initial compliance demonstrations if I own or operate a stationary RICE... performance tests or other initial compliance demonstrations if I own or operate a stationary RICE with a site... stationary RICE with a site rating of more than 500 brake HP located at a major source of HAP emissions you...

  3. Enabling aqueous processing for crack-free thick electrodes

    DOE PAGES

    Du, Zhijia; Rollag, K. M.; Li, J.; ...

    2017-04-14

    Aqueous processing of thick electrodes for Li-ion cells promises to increase energy density due to increased volume fraction of active materials, and to reduce cost due to the elimination of the toxic solvents. Here in this paper this work reports the processing and characterization of aqueous processed electrodes with high areal loading and associated full pouch cell performance. Cracking of the electrode coatings becomes a critical issue for aqueous processing of the positive electrode as areal loading increases above 20–25 mg/cm 2 (~4 mAh/cm 2). Crack initiation and propagation, which was observed during drying via optical microscopy, is related tomore » the build-up of capillary pressure during the drying process. The surface tension of water was reduced by the addition of isopropyl alcohol (IPA), which led to improved wettability and decreased capillary pressure during drying. The critical thickness (areal loading) without cracking increased gradually with increasing IPA content. The electrochemical performance was evaluated in pouch cells. Electrodes processed with water/IPA (80/20 wt%) mixture exhibited good structural integrity with good rate performance and cycling performance.« less

  4. Noise modeling and analysis of an IMU-based attitude sensor: improvement of performance by filtering and sensor fusion

    NASA Astrophysics Data System (ADS)

    K., Nirmal; A. G., Sreejith; Mathew, Joice; Sarpotdar, Mayuresh; Suresh, Ambily; Prakash, Ajin; Safonova, Margarita; Murthy, Jayant

    2016-07-01

    We describe the characterization and removal of noises present in the Inertial Measurement Unit (IMU) MPU- 6050, which was initially used in an attitude sensor, and later used in the development of a pointing system for small balloon-borne astronomical payloads. We found that the performance of the IMU degraded with time because of the accumulation of different errors. Using Allan variance analysis method, we identified the different components of noise present in the IMU, and verified the results by the power spectral density analysis (PSD). We tried to remove the high-frequency noise using smooth filters such as moving average filter and then Savitzky Golay (SG) filter. Even though we managed to filter some high-frequency noise, these filters performance wasn't satisfactory for our application. We found the distribution of the random noise present in IMU using probability density analysis and identified that the noise in our IMU was white Gaussian in nature. Hence, we used a Kalman filter to remove the noise and which gave us good performance real time.

  5. Ultrasonic Transducer Irradiation Test Results

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Daw, Joshua; Palmer, Joe; Ramuhalli, Pradeep

    2015-02-01

    Ultrasonic technologies offer the potential for high-accuracy and -resolution in-pile measurement of a range of parameters, including geometry changes, temperature, crack initiation and growth, gas pressure and composition, and microstructural changes. Many Department of Energy-Office of Nuclear Energy (DOE-NE) programs are exploring the use of ultrasonic technologies to provide enhanced sensors for in-pile instrumentation during irradiation testing. For example, the ability of small diameter ultrasonic thermometers (UTs) to provide a temperature profile in candidate metallic and oxide fuel would provide much needed data for validating new fuel performance models. Other ongoing efforts include an ultrasonic technique to detect morphology changesmore » (such as crack initiation and growth) and acoustic techniques to evaluate fission gas composition and pressure. These efforts are limited by the lack of identified ultrasonic transducer materials capable of long term performance under irradiation test conditions. For this reason, the Pennsylvania State University (PSU) was awarded an ATR NSUF project to evaluate the performance of promising magnetostrictive and piezoelectric transducers in the Massachusetts Institute of Technology Research Reactor (MITR) up to a fast fluence of at least 10 21 n/cm 2. The goal of this research is to characterize and demonstrate magnetostrictive and piezoelectric transducer operation during irradiation, enabling the development of novel radiation-tolerant ultrasonic sensors for use in Material Testing Reactors (MTRs). As such, this test is an instrumented lead test and real-time transducer performance data is collected along with temperature and neutron and gamma flux data. The current work bridges the gap between proven out-of-pile ultrasonic techniques and in-pile deployment of ultrasonic sensors by acquiring the data necessary to demonstrate the performance of ultrasonic transducers. To date, one piezoelectric transducer and two magnetostrictive transducers have demonstrated reliable operation under irradiation. The irradiation is ongoing.« less

  6. Autopsy of forestry ballot initiative: characterizing voter support for Oregon's measure 64.

    Treesearch

    Jeffrey D. Kline; Catriona Armstrong

    2001-01-01

    On November 3,1998, Oregon voters soundly rejected a ballot initiative intended to promote sustainable forestry practices and protect forest ecosystems by restricting clearcut logging and herbicide and pesticide use. We found that initiative support was greater in more urban counties composed of more educated residents earning higher incomes and with higher proportions...

  7. Getting Ready for School: Palm Beach County's Early Childhood Cluster Initiative

    ERIC Educational Resources Information Center

    Spielberger, Julie; Baker, Stephen; Winje, Carolyn

    2008-01-01

    This publication reports findings from the second year of an implementation study of the Early Childhood Cluster Initiative (ECCI). ECCI is a prekindergarten program in ten elementary schools and a community child care center in Palm Beach County, based on the design of the High/Scope Perry Preschool model. The initiative is characterized by low…

  8. A Bayesian method for characterizing distributed micro-releases: II. inference under model uncertainty with short time-series data.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marzouk, Youssef; Fast P.; Kraus, M.

    2006-01-01

    Terrorist attacks using an aerosolized pathogen preparation have gained credibility as a national security concern after the anthrax attacks of 2001. The ability to characterize such attacks, i.e., to estimate the number of people infected, the time of infection, and the average dose received, is important when planning a medical response. We address this question of characterization by formulating a Bayesian inverse problem predicated on a short time-series of diagnosed patients exhibiting symptoms. To be of relevance to response planning, we limit ourselves to 3-5 days of data. In tests performed with anthrax as the pathogen, we find that thesemore » data are usually sufficient, especially if the model of the outbreak used in the inverse problem is an accurate one. In some cases the scarcity of data may initially support outbreak characterizations at odds with the true one, but with sufficient data the correct inferences are recovered; in other words, the inverse problem posed and its solution methodology are consistent. We also explore the effect of model error-situations for which the model used in the inverse problem is only a partially accurate representation of the outbreak; here, the model predictions and the observations differ by more than a random noise. We find that while there is a consistent discrepancy between the inferred and the true characterizations, they are also close enough to be of relevance when planning a response.« less

  9. Waterhammer Transient Simulation and Model Anchoring for the Robotic Lunar Lander Propulsion System

    NASA Technical Reports Server (NTRS)

    Stein, William B.; Trinh, Huu P.; Reynolds, Michael E.; Sharp, David J.

    2011-01-01

    Waterhammer transients have the potential to adversely impact propulsion system design if not properly addressed. Waterhammer can potentially lead to system plumbing, and component damage. Multi-thruster propulsion systems also develop constructive/destructive wave interference which becomes difficult to predict without detailed models. Therefore, it is important to sufficiently characterize propulsion system waterhammer in order to develop a robust design with minimal impact to other systems. A risk reduction activity was performed at Marshall Space Flight Center to develop a tool for estimating waterhammer through the use of anchored simulation for the Robotic Lunar Lander (RLL) propulsion system design. Testing was performed to simulate waterhammer surges due to rapid valve closure and consisted of twenty-two series of waterhammer tests, resulting in more than 300 valve actuations. These tests were performed using different valve actuation schemes and three system pressures. Data from the valve characterization tests were used to anchor the models that employed MSCSoftware.EASY5 v.2010 to model transient fluid phenomena by using transient forms of mass and energy conservation. The anchoring process was performed by comparing initial model results to experimental data and then iterating the model input to match the simulation results with the experimental data. The models provide good correlation with experimental results, supporting the use of EASY5 as a tool to model fluid transients and provide a baseline for future RLL system modeling. This paper addresses tasks performed during the waterhammer risk reduction activity for the RLL propulsion system. The problem of waterhammer simulation anchoring as applied to the RLL system is discussed with results from the corresponding experimental valve tests. Important factors for waterhammer mitigation are discussed along with potential design impacts to the RLL propulsion system.

  10. Root Cause Investigation of Lead-Free Solder Joint Interfacial Failures After Multiple Reflows

    NASA Astrophysics Data System (ADS)

    Li, Yan; Hatch, Olen; Liu, Pilin; Goyal, Deepak

    2017-03-01

    Solder joint interconnects in three-dimensional (3D) packages with package stacking configurations typically must undergo multiple reflow cycles during the assembly process. In this work, interfacial open joint failures between the bulk solder and the intermetallic compound (IMC) layer were found in Sn-Ag-Cu (SAC) solder joints connecting a small package to a large package after multiple reflow reliability tests. Systematic progressive 3D x-ray computed tomography experiments were performed on both incoming and assembled parts to reveal the initiation and evolution of the open failures in the same solder joints before and after the reliability tests. Characterization studies, including focused ion beam cross-sections, scanning electron microscopy, and energy-dispersive x-ray spectroscopy, were conducted to determine the correlation between IMC phase transformation and failure initiation in the solder joints. A comprehensive failure mechanism, along with solution paths for the solder joint interfacial failures after multiple reflow cycles, is discussed in detail.

  11. Monitoring Interfacial Lipid Oxidation in Oil-in-Water Emulsions Using Spatially Resolved Optical Techniques.

    PubMed

    Banerjee, Chiranjib; Westberg, Michael; Breitenbach, Thomas; Bregnhøj, Mikkel; Ogilby, Peter R

    2017-06-06

    The oxidation of lipids is an important phenomenon with ramifications for disciplines that range from food science to cell biology. The development and characterization of tools and techniques to monitor lipid oxidation are thus relevant. Of particular significance in this regard are tools that facilitate the study of oxidations at interfaces in heterogeneous samples (e.g., oil-in-water emulsions, cell membranes). In this article, we establish a proof-of-principle for methods to initiate and then monitor such oxidations with high spatial resolution. The experiments were performed using oil-in-water emulsions of polyunsaturated fatty acids (PUFAs) prepared from cod liver oil. We produced singlet oxygen at a point near the oil-water interface of a given PUFA droplet in a spatially localized two-photon photosensitized process. We then followed the oxidation reactions initiated by this process with the fluorescence-based imaging technique of structured illumination microscopy (SIM). We conclude that the approach reported herein has attributes well-suited to the study of lipid oxidation in heterogeneous samples.

  12. Pain in hereditary neuropathy with liability to pressure palsy: an association with fibromyalgia syndrome?

    PubMed

    Yilmaz, Ugur; Bird, Thomas T; Carter, Gregory T; Wang, Leo H; Weiss, Michael D

    2015-03-01

    This study characterizes the nature of pain in hereditary neuropathy with liability to pressure palsy (HNPP). This retrospective study was performed to assess duration, nature, location, and intensity of pain on initial presentation of subjects with HNPP, including the degree and type of analgesic medication use and electrodiagnostic characteristics. Subjects who met the American College of Rheumatology criteria for fibromyalgia syndrome (FMS) were also identified. Of 32 HNPP subjects, 24 (75%) had symptoms of pain, and 4 (12%) had pain as an initial symptom. Of subjects who described pain, 9 (28%) reported only musculoskeletal pain, 10 (31%) only neuropathic pain, and 5 (16%) both musculoskeletal and neuropathic pain. All 9 subjects with only musculoskeletal pain met criteria for FMS. Neuropathic and musculoskeletal pain occur commonly in HNPP and may be a presenting symptom. Additionally, HNPP with predominantly musculoskeletal pain may meet criteria for FMS and potentially delay the diagnosis. © 2014 Wiley Periodicals, Inc.

  13. Copolymerization modification of poly (butylene itaconate)

    NASA Astrophysics Data System (ADS)

    Gao, Chuanhui; Wang, Jing; Han, Shijian; Hu, Zunfu; Liu, Yuetao

    2017-08-01

    A series of copolyesters-poly (butylene itaconate) (PBI) was synthesized by melt polycondensation from itaconic acid (IA) and 1,4-butanediol (BDO). On this basis, dimethyl terephthalate (DMT), adipic acid (AP) and sebacic acid (SA), respectively, was selected as the third comonomer component to modify PBI to poly (butylene itaconate-co-butylene terephthalate) (PBIT), poly (butylene itaconate-co-butylene adipate) (PBIA) and (butylene itaconate-co-butylene sebacate) (PBIS), of which structure and physical properties were characterized by FT-IR, 1H-NMR, GPC, DSC and TG. The results showed that PBI was amorphous material, and the molecular weight and the initial thermal decomposition temperature of PBI were 1108, 244°C, respectively. Compared to PBI, the molecular weight and the thermal stability of copolyesters (PBIA, PBIT and PBIS) could be increased by this treatment. Particularly, the molecular weight of PBIS was increased to 12,321, 12 times more than PBI, the initial thermal decomposition temperature was improved to 336°C, and PBIS had good crystallization performance.

  14. Fabrication and Evaluation of Titanium and Zirconium based Wires for use during Extended, Deep Space, Missions

    NASA Technical Reports Server (NTRS)

    Grugel, Richard N.

    2006-01-01

    Novel materials and designs are necessary for transport vessels and propulsion systems to fulfill NASA's vision of easier access to space and the expansion of human exploration beyond low-earth orbit. Spacecraft components must necessarily be lighter and stronger than their predecessors and will likely be required to serve new purposes. Furthermore, they must be resilient to the thermal, vacuum, and radiation environment of space for extended periods of time and may need to perform in the near proximity of a nuclear fuel source. To this end research has been initiated to fabricate novel, composite, wires based on titanium and zirconium pearlitic alloys. It is expected that the fabricated wire will well endure in the space environment with application as tethers, sail components, fasteners, and a myriad of other (including earth-based) uses. A background on pearlitic wire, novel alloy development, microstructural characterization, and initial mechanical testing results will be presented and discussed.

  15. Numerical study of the ignition behavior of a post-discharge kernel injected into a turbulent stratified cross-flow

    NASA Astrophysics Data System (ADS)

    Jaravel, Thomas; Labahn, Jeffrey; Ihme, Matthias

    2017-11-01

    The reliable initiation of flame ignition by high-energy spark kernels is critical for the operability of aviation gas turbines. The evolution of a spark kernel ejected by an igniter into a turbulent stratified environment is investigated using detailed numerical simulations with complex chemistry. At early times post ejection, comparisons of simulation results with high-speed Schlieren data show that the initial trajectory of the kernel is well reproduced, with a significant amount of air entrainment from the surrounding flow that is induced by the kernel ejection. After transiting in a non-flammable mixture, the kernel reaches a second stream of flammable methane-air mixture, where the successful of the kernel ignition was found to depend on the local flow state and operating conditions. By performing parametric studies, the probability of kernel ignition was identified, and compared with experimental observations. The ignition behavior is characterized by analyzing the local chemical structure, and its stochastic variability is also investigated.

  16. Evolutionary models of rotating dense stellar systems: challenges in software and hardware

    NASA Astrophysics Data System (ADS)

    Fiestas, Jose

    2016-02-01

    We present evolutionary models of rotating self-gravitating systems (e.g. globular clusters, galaxy cores). These models are characterized by the presence of initial axisymmetry due to rotation. Central black hole seeds are alternatively included in our models, and black hole growth due to consumption of stellar matter is simulated until the central potential dominates the kinematics in the core. Goal is to study the long-term evolution (~ Gyr) of relaxed dense stellar systems, which deviate from spherical symmetry, their morphology and final kinematics. With this purpose, we developed a 2D Fokker-Planck analytical code, which results we confirm by detailed N-Body techniques, applying a high performance code, developed for GPU machines. We compare our models to available observations of galactic rotating globular clusters, and conclude that initial rotation modifies significantly the shape and lifetime of these systems, and can not be neglected in studying the evolution of globular clusters, and the galaxy itself.

  17. The characterization of widespread fatigue damage in fuselage structure

    NASA Technical Reports Server (NTRS)

    Piascik, Robert S.; Willard, Scott A.; Miller, Matthew

    1994-01-01

    The characteristics of widespread fatigue damage (WSFD) in fuselage riveted structure were established by detailed nondestructive and destructive examinations of fatigue damage contained in a full size fuselage test article. The objectives of this were to establish an experimental data base for validating emerging WSFD analytical prediction methodology and to identify first order effects that contribute to fatigue crack initiation and growth. Detailed examinations were performed on a test panel containing four bays of a riveted lap splice joint. The panel was removed from a full scale fuselage test article after receiving 60,000 full pressurization cycles. The results of in situ examinations document the progression of fuselage skin fatigue crack growth through crack linkup. Detailed tear down examinations and fractography of the lap splice joint region revealed fatigue crack initiation sites, crack morphology, and crack linkup geometry. From this large data base, distributions of crack size and locations are presented and discussions of operative damage mechanisms are offered.

  18. The characterization of widespread fatigue damage in fuselage structure

    NASA Technical Reports Server (NTRS)

    Piascik, Robert S.; Willard, Scott A.; Miller, Matthew

    1994-01-01

    The characteristics of widespread fatigue damage (WSFD) in fuselage riveted structure were established by detailed nondestructive and destructive examinations of fatigue damage contained in a full size fuselage test article. The objectives of this work were to establish an experimental data base for validating emerging WSFD analytical prediction methodology and to identify first order effects that contribute to fatigue crack initiation and growth. Detailed examinations were performed on a test panel containing four bays of a riveted lap splice joint. The panel was removed from a full scale fuselage test article after receiving 60,000 full pressurization cycles. The results of in situ examinations document the progression of fuselage skin fatigue crack growth through crack linkup. Detailed tear down examinations and fractography of the lap splice joint region revealed fatigue crack initiation sites, crack morphology and crack linkup geometry. From this large data base, distributions of crack size and locations are presented and discussions of operative damage mechanisms are offered.

  19. Digital Access to a Sky Century at Harvard: Initial Photometry and Astrometry

    NASA Astrophysics Data System (ADS)

    Laycock, S.; Tang, S.; Grindlay, J.; Los, E.; Simcoe, R.; Mink, D.

    2010-10-01

    Digital Access to a Sky Century at Harvard (DASCH) is a project to digitize the collection of ~500,000 glass photographic plates held at Harvard College Observatory. The collection spans the time period from 1880 to 1985, during which time every point on the sky was been observed from 500 to 1000 times. In this paper, we describe the DASCH commissioning run, during which we developed the data-reduction pipeline, characterized the plates and fine-tuned the digitizer's performance and operation. This initial run consisted of 500 plates taken from a variety of different plate series, all containing the open cluster Praeseppe (M44). We report that accurate photometry at the 0.1 mag level is possible on the majority of plates, and demonstrate century-long light curves of various types of variable stars in and around M44. DASCH will generate a public online archive of the entire plate collection, including images, source catalogs, and light curves for nearly all astronomical objects brighter than about 17th magnitude.

  20. A simplified method of evaluating the stress wave environment of internal equipment

    NASA Technical Reports Server (NTRS)

    Colton, J. D.; Desmond, T. P.

    1979-01-01

    A simplified method called the transfer function technique (TFT) was devised for evaluating the stress wave environment in a structure containing internal equipment. The TFT consists of following the initial in-plane stress wave that propagates through a structure subjected to a dynamic load and characterizing how the wave is altered as it is transmitted through intersections of structural members. As a basis for evaluating the TFT, impact experiments and detailed stress wave analyses were performed for structures with two or three, or more members. Transfer functions that relate the wave transmitted through an intersection to the incident wave were deduced from the predicted wave response. By sequentially applying these transfer functions to a structure with several intersections, it was found that the environment produced by the initial stress wave propagating through the structure can be approximated well. The TFT can be used as a design tool or as an analytical tool to determine whether a more detailed wave analysis is warranted.

  1. Synthesis and electrochemical performance of LiV3O8/polythiophene composite as cathode materials for lithium ion batteries

    NASA Astrophysics Data System (ADS)

    Guo, Haipeng; Liu, Li; Shu, Hongbo; Yang, Xiukang; Yang, Zhenhua; Zhou, Meng; Tan, Jinli; Yan, Zichao; Hu, Hai; Wang, Xianyou

    2014-02-01

    LiV3O8/polythiophene (LiV3O8/PTh) composite has been chemically synthesized via an in-situ oxidative polymerization method. The structure and morphology of the samples have been characterized by X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM) and high-resolution transmission electron microscopy (HRTEM). LiV3O8/PTh composite shows a single phase in the XRD pattern, but the existence of PTh has been confirmed by FTIR spectra. HRTEM images show that an uniform PTh layer with a thickness of 3-5 nm covered on the surface of LiV3O8. Electrochemical performance of samples has been characterized by the charge/discharge test, cyclic voltammetry (CV), electrochemical impedance spectroscopic studies (EIS) and galvanostatic intermittent titration technique (GITT). The LiV3O8/PTh composite exhibits much better electrochemical performance than bare LiV3O8. The initial discharge capacities of 15 wt.% LiV3O8/PTh composite are 213.3 and 200.3 mAh g-1 with almost no capacity retention after 50 cycles at current densities of 300 and 900 mA g-1, respectively. PTh could enhance electronic conductivity, decrease the charge transfer resistance, increase the lithium diffusion coefficient, and thus improve cycling performance of LiV3O8. All these results demonstrate that the LiV3O8/PTh composite has a promising application as cathode material for lithium ion batteries.

  2. Space Shuttle Thermal Protection System Repair Flight Experiment Induced Contamination Impacts

    NASA Technical Reports Server (NTRS)

    Smith, Kendall A.; Soares, Carlos E.; Mikatarian, Ron; Schmidl, Danny; Campbell, Colin; Koontz, Steven; Engle, Michael; McCroskey, Doug; Garrett, Jeff

    2006-01-01

    NASA s activities to prepare for Flight LF1 (STS-114) included development of a method to repair the Thermal Protection System (TPS) of the Orbiter s leading edge should it be damaged during ascent by impacts from foam, ice, etc . Reinforced Carbon-Carbon (RCC) is used for the leading edge TPS. The repair material that was developed is named Non- Oxide Adhesive eXperimental (NOAX). NOAX is an uncured adhesive material that acts as an ablative repair material. NOAX completes curing during the Orbiter s descent. The Thermal Protection System (TPS) Detailed Test Objective 848 (DTO 848) performed on Flight LF1 (STS-114) characterized the working life, porosity void size in a micro-gravity environment, and the on-orbit performance of the repairs to pre-damaged samples. DTO 848 is also scheduled for Flight ULF1.1 (STS-121) for further characterization of NOAX on-orbit performance. Due to the high material outgassing rates of the NOAX material and concerns with contamination impacts to optically sensitive surfaces, ASTM E 1559 outgassing tests were performed to determine NOAX condensable outgassing rates as a function of time and temperature. Sensitive surfaces of concern include the Extravehicular Mobility Unit (EMU) visor, cameras, and other sensors in proximity to the experiment during the initial time after application. This paper discusses NOAX outgassing characteristics, how the amount of deposition on optically sensitive surfaces while the NOAX is being manipulated on the pre-damaged RCC samples was determined by analysis, and how flight rules were developed to protect those optically sensitive surfaces from excessive contamination where necessary.

  3. Application of Ruze Equation for Inflatable Aperture Antennas

    NASA Technical Reports Server (NTRS)

    Welch, Bryan W.

    2008-01-01

    Inflatable aperture reflector antennas are an emerging technology that NASA is investigating for potential uses in science and exploration missions. As inflatable aperture antennas have not been proven fully qualified for space missions, they must be characterized properly so that the behavior of the antennas can be known in advance. To properly characterize the inflatable aperture antenna, testing must be performed in a relevant environment, such as a vacuum chamber. Since the capability of having a radiofrequency (RF) test facility inside a vacuum chamber did not exist at NASA Glenn Research Center, a different methodology had to be utilized. The proposal to test an inflatable aperture antenna in a vacuum chamber entailed performing a photogrammetry study of the antenna surface by using laser ranging measurements. A root-mean-square (rms) error term was derived from the photogrammetry study to calculate the antenna surface loss as described by the Ruze equation. However, initial testing showed that problems existed in using the Ruze equation to calculate the loss due to errors on the antenna surface. This study utilized RF measurements obtained in a near-field antenna range and photogrammetry data taken from a laser range scanner to compare the expected performance of the test antenna (via the Ruze equation) with the actual RF patterns and directivity measurements. Results showed that the Ruze equation overstated the degradation in the directivity calculation. Therefore, when the photogrammetry study is performed on the test antennas in the vacuum chamber, a more complex equation must be used in light of the fact that the Ruze theory overstates the loss in directivity for inflatable aperture reflector antennas.

  4. Physical and Chemical Microstructural Damage in Pressed CL-20 explosives

    NASA Astrophysics Data System (ADS)

    Demol, Gauthier; Sandusky, Harold W.

    1999-06-01

    Based upon its molecular composition, its structure, and its heat of formation, it was expected that CL-20 (hexanitrohexaazaisowurtzitane) would be more energetic and more sensitive than RDX and HMX. Reports of batch-to-batch variations in the sensitivity of neat CL-20 have led to its sensitivity being ranked in the range between the sensitivity of RDX and that of PETN. The ultimate utility of CL-20 as an ingredient in explosive and propellant formulations will depend upon the ability to understand the factors that are responsible for this batch-to-batch variability, and to control the sensitivity in formulations within acceptable limits. This work is a characterization of CL-20 at various stages in its life cycle. The evolution of damage from the initial neat crystals of CL-20 to the ready-to-use pressed pellets will be described. This characterization includes physical documentation using light microscopy and Scanning Electron Microscopy. Spatially resolved chemical analysis is also performed using Fourier-Transform Infrared Spectroscopy.

  5. Antimicrobial cellulosic hydrogel from olive oil industrial residue.

    PubMed

    Dacrory, Sawsan; Abou-Yousef, Hussein; Abouzeid, Ragab E; Kamel, Samir; Abdel-Aziz, Mohamed S; El-Badry, Mohamed

    2018-05-25

    The cellulose-based antimicrobial hydrogel was prepared from seed and husk cellulosic fibers of olive industry residues by load silver nanoparticles (AgNPs) onto grafted acrylamide monomer (Am) cellulosic fibers. The grafting approach was the free radical mechanism by utilizing ceric ammonium nitrate (CAN) as initiator in aqueous medium and N,N methylene bisacrylamide (MBAm) as a cross linker. The effect of different grafting conditions on the properties of produced hydrogels has been studied by determining the grafting parameters, i.e. concentration of Am, MBAm, grafting time and temperature to optimize grafting yield (G %), grafting efficiency (GE %), and swelling %. Characterizations of the obtained hydrogels were performed through monitoring swelling behavior, FTIR spectroscopy, SEM, and EDX. AgNPs were grown into the prepared hydrogel. Hydrogel/AgNPs were characterized by FT-IR spectroscopy, X-ray diffraction (XRD) and scanning electron microscopy (SEM). The hydrogel loaded AgNPs exhibit high efficient antimicrobial activity against Staphylococcus aureus, Pseudomonas aeruginosa, and Candida albicans. Copyright © 2018. Published by Elsevier B.V.

  6. Characterization of new regulatory elements within the Drosophila bithorax complex.

    PubMed

    Pérez-Lluch, Sílvia; Cuartero, Sergi; Azorín, Fernando; Espinàs, M Lluïsa

    2008-12-01

    The homeotic Abdominal-B (Abd-B) gene expression depends on a modular cis-regulatory region divided into discrete functional domains (iab) that control the expression of the gene in a particular segment of the fly. These domains contain regulatory elements implicated in both initiation and maintenance of homeotic gene expression and elements that separate the different domains. In this paper we have performed an extensive analysis of the iab-6 regulatory region, which regulates Abd-B expression at abdominal segment A6 (PS11), and we have characterized two new polycomb response elements (PREs) within this domain. We report that PREs at Abd-B cis-regulatory domains present a particular chromatin structure which is nuclease accessible all along Drosophila development and both in active and repressed states. We also show that one of these regions contains a dCTCF and CP190 dependent activity in transgenic enhancer-blocking assays, suggesting that it corresponds to the Fab-6 boundary element of the Drosophila bithorax complex.

  7. Dome Degradation Characterization of Wide-Field-of-View Nonscanner Aboard ERBE and Its Reprocessing

    NASA Technical Reports Server (NTRS)

    Shrestha, Alok K.; Kato, Seiji; Wong, Takmeng; Su, Wenying; Stackhouse, Paul W., Jr.; Rose, Fred; Miller, Walter F.; Bush, Kathryn; Rutan, David A.; Minnis, Patrick; hide

    2015-01-01

    Earth Radiation Budget Experiment (ERBE) wide-field-of-view (WFOV) nonscanners aboard ERBS and NOAA- 9/NOAA-10 provided broadband shortwave and longwave irradiances from 1985 to 1999. The previous analysis showed dome degradation in the shortwave nonscanner instruments. The correction was performed with a constant spectral (gray assumption) degradation. We suspect that the gray assumption affected daytime longwave irradiance and led to a day-minus-night longwave flux differences (little change in night time longwave) increase over time. Based on knowledge from the CERES process, we will reprocess entire ERBE nonscanner radiation dataset by characterizing shortwave dome transmissivity with spectral dependent degradation using the solar data observed by these instruments. Once spectral dependent degradation is derived, imager derived cloud fraction and the cloud phase as well as surface type over the FOV of nonscanner instruments will be used to model unfiltering coefficients. This poster primarily explains the reprocessing techniques and includes initial comparison of several months of data processed with existing and our recent methods.

  8. Spatially resolved spectroscopy analysis of the XMM-Newton large program on SN1006

    NASA Astrophysics Data System (ADS)

    Li, Jiang-Tao; Decourchelle, Anne; Miceli, Marco; Vink, Jacco; Bocchino, Fabrizio

    2016-04-01

    We perform analysis of the XMM-Newton large program on SN1006 based on our newly developed methods of spatially resolved spectroscopy analysis. We extract spectra from low and high resolution meshes. The former (3596 meshes) is used to roughly decompose the thermal and non-thermal components and characterize the spatial distributions of different parameters, such as temperature, abundances of different elements, ionization age, and electron density of the thermal component, as well as photon index and cutoff frequency of the non-thermal component. On the other hand, the low resolution meshes (583 meshes) focus on the interior region dominated by the thermal emission and have enough counts to well characterize the Si lines. We fit the spectra from the low resolution meshes with different models, in order to decompose the multiple plasma components at different thermal and ionization states and compare their spatial distributions. In this poster, we will present the initial results of this project.

  9. Performance evaluation of a permanent ring magnet based helicon plasma source for negative ion source research

    NASA Astrophysics Data System (ADS)

    Pandey, Arun; Bandyopadhyay, M.; Sudhir, Dass; Chakraborty, A.

    2017-10-01

    Helicon wave heated plasmas are much more efficient in terms of ionization per unit power consumed. A permanent magnet based compact helicon wave heated plasma source is developed in the Institute for Plasma Research, after carefully optimizing the geometry, the frequency of the RF power, and the magnetic field conditions. The HELicon Experiment for Negative ion-I source is the single driver helicon plasma source that is being studied for the development of a large sized, multi-driver negative hydrogen ion source. In this paper, the details about the single driver machine and the results from the characterization of the device are presented. A parametric study at different pressures and magnetic field values using a 13.56 MHz RF source has been carried out in argon plasma, as an initial step towards source characterization. A theoretical model is also presented for the particle and power balance in the plasma. The ambipolar diffusion process taking place in a magnetized helicon plasma is also discussed.

  10. Microstructural Characterization of Alloy 617 Crept into the Tertiary Regime

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lillo, Thomas Martin; Wright, Richard Neil

    2015-07-01

    The microstructure of Alloy 617 was characterized following creep tests interrupted at total creep strains ranging from 2-20%. A range of creep temperatures (750-1000oC) and initial creep stresses (10-145 MPa) produced creep test durations ranging from 1 to 5800 hours. Image analysis of optical photomicrographs on longitudinal sections of the gage length was used to document the fraction of creep porosity as a function of creep parameters. Creep porosity was negligible below tertiary creep strains of 10% and increased with tertiary creep strain, thereafter. For a given temperature and total creep strain, creep porosity increased with decreasing creep stress. Creepmore » porosity increased linearly with duration of the creep experiment. TEM performed on the gage sections did not reveal significant creep cavity formation on grain boundaries at the sub-micron level. It was concluded that the onset of tertiary creep did not result from creep cavitation and more likely arose due to the formation of low energy dislocation substructures with increasing tertiary strain.« less

  11. In vivo characterization of a smart MRI agent that displays an inverse response to calcium concentration.

    PubMed

    Mamedov, Ilgar; Canals, Santiago; Henig, Jörg; Beyerlein, Michael; Murayama, Yusuke; Mayer, Hermann A; Logothetis, Nikos K; Angelovski, Goran

    2010-12-15

    Contrast agents for magnetic resonance imaging (MRI) that exhibit sensitivity toward specific ions or molecules represent a challenging but attractive direction of research. Here a Gd(3+) complex linked to an aminobis(methylenephosphonate) group for chelating Ca(2+) was synthesized and investigated. The longitudinal relaxivity (r(1)) of this complex decreases during the relaxometric titration with Ca(2+) from 5.76 to 3.57 mM(-1) s(-1) upon saturation. The r(1) is modulated by changes in the hydration number, which was confirmed by determination of the luminescence emission lifetimes of the analogous Eu(3+) complex. The initial in vivo characterization of this responsive contrast agent was performed by means of electrophysiology and MRI experiments. The investigated complex is fully biocompatible, having no observable effect on neuronal function after administration into the brain ventricles or parenchyma. Distribution studies demonstrated that the diffusivity of this agent is significantly lower compared with that of gadolinium-diethylenetriaminepentaacetic acid (Gd-DTPA).

  12. Modeling Alzheimer's disease cognitive scores using multi-task sparse group lasso.

    PubMed

    Liu, Xiaoli; Goncalves, André R; Cao, Peng; Zhao, Dazhe; Banerjee, Arindam

    2018-06-01

    Alzheimer's disease (AD) is a severe neurodegenerative disorder characterized by loss of memory and reduction in cognitive functions due to progressive degeneration of neurons and their connections, eventually leading to death. In this paper, we consider the problem of simultaneously predicting several different cognitive scores associated with categorizing subjects as normal, mild cognitive impairment (MCI), or Alzheimer's disease (AD) in a multi-task learning framework using features extracted from brain images obtained from ADNI (Alzheimer's Disease Neuroimaging Initiative). To solve the problem, we present a multi-task sparse group lasso (MT-SGL) framework, which estimates sparse features coupled across tasks, and can work with loss functions associated with any Generalized Linear Models. Through comparisons with a variety of baseline models using multiple evaluation metrics, we illustrate the promising predictive performance of MT-SGL on ADNI along with its ability to identify brain regions more likely to help the characterization Alzheimer's disease progression. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Characterization on White Etching Layer Formed During Ceramic Milling of Inconel 718

    NASA Astrophysics Data System (ADS)

    Kruk, A.; Wusatowska-Sarnek, A. M.; Ziętara, M.; Jemielniak, K.; Siemiątkowski, Z.; Czyrska-Filemonowicz, A.

    2018-03-01

    A comprehensive characterization of the near surface formed during the interrupted high-speed dry ceramic milling of IN718 was performed using light imaging, SEM/EDX, TEM and nano-hardness methods. It was found out that even an initial cut by a fresh tool creates a sub-surface alteration roughly 20 µm deep. The depth of altered sub-surface progressively changed to a roughly 40 µm when the tool reached an approximately half of its life, and almost 60 µm at the tool's end of the life. In the last two cases, the visible WEL (utilizing a light microscope) of the thickness roughly 6 and 15 µm was created, respectively. The outermost layer of the deformed subsurface was found to be for all three cases approximately 1.5 µm thick and composed of dynamically recrystallized γ phase grains with the average diameter of approximately 150 nm. This layer was free of δ phase and γ' or γ″ precipitates. It was followed by a plastically deformed zone.

  14. Performance evaluation of a permanent ring magnet based helicon plasma source for negative ion source research.

    PubMed

    Pandey, Arun; Bandyopadhyay, M; Sudhir, Dass; Chakraborty, A

    2017-10-01

    Helicon wave heated plasmas are much more efficient in terms of ionization per unit power consumed. A permanent magnet based compact helicon wave heated plasma source is developed in the Institute for Plasma Research, after carefully optimizing the geometry, the frequency of the RF power, and the magnetic field conditions. The HELicon Experiment for Negative ion-I source is the single driver helicon plasma source that is being studied for the development of a large sized, multi-driver negative hydrogen ion source. In this paper, the details about the single driver machine and the results from the characterization of the device are presented. A parametric study at different pressures and magnetic field values using a 13.56 MHz RF source has been carried out in argon plasma, as an initial step towards source characterization. A theoretical model is also presented for the particle and power balance in the plasma. The ambipolar diffusion process taking place in a magnetized helicon plasma is also discussed.

  15. Isolation and initial structural characterization of a 27 kDa protein from Zingiber officinale

    NASA Astrophysics Data System (ADS)

    Rasheed, Saima; Malik, Shoaib Ahmad; Falke, Sven; Arslan, Ali; Fazel, Ramin; Schlüter, Hartmut; Betzel, Christian; Choudhary, M. Iqbal

    2018-03-01

    Zingiber officinale Roscoe (Ginger) is a widely used traditional medicinal plant (for different ailments such as arthritis, constipation, and hypertension). This article describes the isolation and characterization of a so far unknown protein from ginger rhizomes applying ion exchange, affinity, size-exclusion chromatography, small angle X-ray scattering (SAXS), and mass spectrometry techniques. One-dimensional Coomassie-stained SDS-PAGE was performed under non-reducing conditions, showing one band corresponding to approx. 27 kDa. Dynamic light scattering (DLS) analysis of the protein solution revealed monodispersity and a monomeric state of the purified protein. Circular dichroism (CD) spectroscopy strongly indicated a β-sheet-rich protein, and disordered regions. MALDI-TOF-MS, and LC-MS/MS analysis resulted in the identification of 27.29 kDa protein, having 32.13% and 25.34% sequence coverage with Zingipain-1 and 2, respectively. The monomeric state and molecular weight were verified by small angle X-ray scattering (SAXS) studies. An elongated ab-initio model was calculated based on the scattering intensity distribution.

  16. Characterization of Glutaredoxin Fe-S Cluster-Binding Interactions Using Circular Dichroism Spectroscopy.

    PubMed

    Albetel, Angela-Nadia; Outten, Caryn E

    2018-01-01

    Monothiol glutaredoxins (Grxs) with a conserved Cys-Gly-Phe-Ser (CGFS) active site are iron-sulfur (Fe-S) cluster-binding proteins that interact with a variety of partner proteins and perform crucial roles in iron metabolism including Fe-S cluster transfer, Fe-S cluster repair, and iron signaling. Various analytical and spectroscopic methods are currently being used to monitor and characterize glutaredoxin Fe-S cluster-dependent interactions at the molecular level. The electronic, magnetic, and vibrational properties of the protein-bound Fe-S cluster provide a convenient handle to probe the structure, function, and coordination chemistry of Grx complexes. However, some limitations arise from sample preparation requirements, complexity of individual techniques, or the necessity for combining multiple methods in order to achieve a complete investigation. In this chapter, we focus on the use of UV-visible circular dichroism spectroscopy as a fast and simple initial approach for investigating glutaredoxin Fe-S cluster-dependent interactions. © 2018 Elsevier Inc. All rights reserved.

  17. Synthesis, growth and characterization of a nonlinear optical crystal: Bis l-proline hydrogen nitrate.

    PubMed

    Selvaraju, K; Kirubavathi, K

    2013-11-01

    The single crystals of bis l-proline hydrogen nitrate (BLPHN) belonging to non-centrosymmetric space group were successfully grown by the slow evaporation solution growth technique. The BLPHN crystals of size 10×7×3mm(3) were obtained in 35days. Initially, the solubility tests were carried out for two solvents such as deionized water and mixed of deionized water-acetone. Among the two solvents, the solubility of BLPHN was found to be the highest in deionized water, so crystallization of BLPHN was done from its aqueous solution. As grown, crystals were characterized by single crystal X-ray diffraction studies and optical transmission spectral studies. Infrared spectroscopy, thermo gravimetric analysis and differential thermal analysis measurements were performed to study the molecular vibration and thermal behavior of the grown BLPHN crystals. Nonlinear optical (NLO) behavior of BLPHN crystal was studied by Kurtz and Perry powder method. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. An Overview of the Characterization of the Space Launch Vehicle Aerodynamic Environments

    NASA Technical Reports Server (NTRS)

    Blevins, John A.; Campbell, John R., Jr.; Bennett, David W.; Rausch, Russ D.; Gomez, Reynaldo J.; Kiris, Cetin C.

    2014-01-01

    Aerodynamic environments are some of the rst engineering data products that are needed to design a space launch vehicle. These products are used in performance predic- tions, vehicle control algorithm design, as well as determing loads on primary and secondary structures in multiple discipline areas. When the National Aeronautics and Space Admin- istration (NASA) Space Launch System (SLS) Program was established with the goal of designing a new, heavy-lift launch vehicle rst capable of lifting the Orion Program Multi- Purpose Crew Vehicle (MPCV) to low-earth orbit and preserving the potential to evolve the design to a 200 metric ton cargo launcher, the data needs were no di erent. Upon commencement of the new program, a characterization of aerodynamic environments were immediately initiated. In the time since, the SLS Aerodynamics Team has produced data describing the majority of the aerodynamic environment de nitions needed for structural design and vehicle control under nominal ight conditions. This paper provides an overview of select SLS aerodynamic environments completed to date.

  19. Molecular Imprinting of Silica Nanoparticle Surfaces via Reversible Addition-Fragmentation Polymerization for Optical Biosensing Applications

    NASA Astrophysics Data System (ADS)

    Oluz, Zehra; Nayab, Sana; Kursun, Talya Tugana; Caykara, Tuncer; Yameen, Basit; Duran, Hatice

    Azo initiator modified surface of silica nanoparticles were coated via reversible addition-fragmentation polymerization (RAFT) of methacrylic acid and ethylene glycol dimethacrylate using 2-phenylprop 2-yl dithobenzoate as chain transfer agent. Using L-phenylalanine anilide as template during polymerization led molecularly imprinted nanoparticles. RAFT polymerization offers an efficient control of grafting process, while molecularly imprinted polymers shows enhanced capacity as sensor. L-phenylalanine anilide imprinted silica particles were characterized by X-Ray photoelectron spectroscopy (XPS), atomic force microscopy (AFM). Performances of the particles were followed by surface plasmon resonance spectroscopy (SPR) after coating the final product on gold deposited glass substrate against four different analogous of analyte molecules: D-henylalanine anilide, L-tyrosine, L-tryptophan and L-phenylalanine. Characterizations indicated that silica particles coated with polymer layer do contain binding sites for L-phenylalanine anilide, and are highly selective for the molecule of interest. This project was supported by TUBITAK (Project No:112M804).

  20. Eye Tracking Dysfunction in Schizophrenia: Characterization and Pathophysiology

    PubMed Central

    Sereno, Anne B.; Gooding, Diane C.; O’Driscoll, Gilllian A.

    2011-01-01

    Eye tracking dysfunction (ETD) is one of the most widely replicated behavioral deficits in schizophrenia and is over-represented in clinically unaffected first-degree relatives of schizophrenia patients. Here, we provide an overview of research relevant to the characterization and pathophysiology of this impairment. Deficits are most robust in the maintenance phase of pursuit, particularly during the tracking of predictable target movement. Impairments are also found in pursuit initiation and correlate with performance on tests of motion processing, implicating early sensory processing of motion signals. Taken together, the evidence suggests that ETD involves higher-order structures, including the frontal eye fields, which adjust the gain of the pursuit response to visual and anticipated target movement, as well as early parts of the pursuit pathway, including motion areas (the middle temporal area and the adjacent medial superior temporal area). Broader application of localizing behavioral paradigms in patient and family studies would be advantageous for refining the eye tracking phenotype for genetic studies. PMID:21312405

Top