PTEN/MMAC1 Mutations in Hepatocellular Carcinomas: Somatic Inactivation of Both Alleles in Tumors

PubMed Central

Kawamura, Naoki; Nagai, Hisaki; Bando, Koichi; Koyama, Masaaki; Matsumoto, Satoshi; Tajiri, Takashi; Onda, Masahiko; Fujimoto, Jiro; Ueki, Takahiro; Konishi, Noboru; Shiba, Tadayoshi

1999-01-01

Allelic loss of loci on chromosome 10q occurs frequently in hepatocellular carcinomas. Somatic mutations of the PTEN/MMAC1 gene on this chromosome at 10q23 were recently identified in sporadic cancers of the uterus, brain, prostate and breast. To investigate the potential role of PTEN/MMAC1 gene in the genesis of hepatocellular carcinomas, we examined 96 tumors for allelic loss on 10q and also for subtle mutations anywhere within the coding region of PTEN/MMAC1 gene. Allelic loss was identified in 25 of the 89 (27%) tumors that were informative for polymorphic markers in the region. Somatic mutations were identified in five of those tumors: three frameshift mutations, a 1‐bp insertion at codon 83–84 in exon 4 and two 4‐bp deletions, both at codon 318–319 in exon 8; two C‐to‐G transversion mutation, both at ‐9 bp from the initiation codon in the 5’non‐coding region of exon 1. No missense mutation was observed in this panel of tumors. In most of the informative tumors carrying intragenic mutations of one allele, we were able to detect loss of heterozygosity as well. These findings suggest that two alleles of the PTEN/MMAC1 gene may be inactivated by a combination of intragenic point mutation on one allele and loss of chromosomal material on the other allele in some of these tumors. PMID:10363579

Alterations of the three short open reading frames in the Rous sarcoma virus leader RNA modulate viral replication and gene expression.

PubMed Central

Moustakas, A; Sonstegard, T S; Hackett, P B

1993-01-01

The Rous sarcoma virus (RSV) leader RNA has three short open reading frames (ORF1 to ORF3) which are conserved in all avian sarcoma-leukosis retroviruses. Effects on virus propagation were determined following three types of alterations in the ORFs: (i) replacement of AUG initiation codons in order to prohibit ORF translation, (ii) alterations of the codon context around the AUG initiation codon to enhance translation of the normally silent ORF3, and (iii) elongation of the ORF coding sequences. Mutagenesis of the AUG codons for ORF1 and ORF2 (AUG1 and AUG2) singly or together delayed the onset of viral replication and cell transformation. In contrast, mutagenesis of AUG3 almost completely suppressed these viral activities. Mutagenesis of ORF3 to enhance its translation inhibited viral propagation. When the mutant ORF3 included an additional frameshift mutation which extended the ORF beyond the initiation site for the gag, gag-pol, and env proteins, host cells were initially transformed but died soon thereafter. Elongation of ORF1 from 7 to 62 codons led to the accumulation of transformation-defective virus with a delayed onset of replication. In contrast, viruses with elongation of ORF1 from 7 to 30 codons, ORF2 from 16 to 48 codons, or ORF3 from 9 to 64 codons, without any alterations in the AUG context, exhibited wild-type phenotypes. These results are consistent with a model that translation of the ORFs is necessary to facilitate virus production. Images PMID:7685415

Somatic mutations in cancer: Stochastic versus predictable.

PubMed

Gold, Barry

2017-02-01

The origins of human cancers remain unclear except for a limited number of potent environmental mutagens, such as tobacco and UV light, and in rare cases, familial germ line mutations that affect tumor suppressor genes or oncogenes. A significant component of cancer etiology has been deemed stochastic and correlated with the number of stem cells in a tissue, the number of times the stem cells divide and a low incidence of random DNA polymerase errors that occur during each cell division. While somatic mutations occur during each round of DNA replication, mutations in cancer driver genes are not stochastic. Out of a total of 2843 codons, 1031 can be changed to stop codons by a single base substitution in the tumor suppressor APC gene, which is mutated in 76% of colorectal cancers (CRC). However, the nonsense mutations, which comprise 65% of all the APC driver mutations in CRC, are not random: 43% occur at Arg CGA codons, although they represent <3% of the codons. In TP53, CGA codons comprise <3% of the total 393 codons but they account for 72% and 39% of the mutations in CRC and ovarian cancer OVC, respectively. This mutation pattern is consistent with the kinetically slow, but not stochastic, hydrolytic deamination of 5-methylcytosine residues at specific methylated CpG sites to afford T·G mismatches that lead to C→T transitions and stop codons at CGA. Analysis of nonsense mutations in CRC, OVC and a number of other cancers indicates the need to expand the predictable risk factors for cancer to include, in addition to random polymerase errors, the methylation status of gene body CGA codons in tumor suppressor genes. Copyright © 2017. Published by Elsevier B.V.

rpoB gene mutations among Mycobacterium tuberculosis isolates from extrapulmonary sites.

PubMed

Khosravi, Azar Dokht; Meghdadi, Hossein; Ghadiri, Ata A; Alami, Ameneh; Sina, Amir Hossein; Mirsaeidi, Mehdi

2018-03-01

The aim of this study was to analyze mutations occurring in the rpoB gene of Mycobacterium tuberculosis (MTB) isolates from clinical samples of extrapulmonary tuberculosis (EPTB). Seventy formalin-fixed, paraffin-embedded samples and fresh tissue samples from confirmed EPTB cases were analyzed. Nested PCR based on the rpoB gene was performed on the extracted DNAs, combined with cloning and subsequent sequencing. Sixty-seven (95.7%) samples were positive for nester PCR. Sequence analysis of the 81 bp region of the rpoB gene demonstrated mutations in 41 (61.2%) of 67 sequenced samples. Several point mutations including deletion mutations at codons 510, 512, 513 and 515, with 45% and 51% of the mutations in codons 512 and 513 respectively were seen, along with 26% replacement mutations at codons 509, 513, 514, 518, 520, 524 and 531. The most common alteration was Gln → His, at codon 513, presented in 30 (75.6%) isolates. This study demonstrated sequence alterations in codon 513 of the 81 bp region of the rpoB gene as the most common mutation occurred in 75.6% of molecularly confirmed rifampin-resistant strains. In addition, simultaneous mutation at codons 512 and 513 was demonstrated in 34.3% of the isolates. © 2018 APMIS. Published by John Wiley & Sons Ltd.

Differential Reprogramming of Isogenic Colorectal Cancer Cells by Distinct Activating KRAS Mutations

PubMed Central

2015-01-01

Oncogenic mutations of Ras at codons 12, 13, or 61, that render the protein constitutively active, are found in ∼16% of all cancer cases. Among the three major Ras isoforms, KRAS is the most frequently mutated isoform in cancer. Each Ras isoform and tumor type displays a distinct pattern of codon-specific mutations. In colon cancer, KRAS is typically mutated at codon 12, but a significant fraction of patients have mutations at codon 13. Clinical data suggest different outcomes and responsiveness to treatment between these two groups. To investigate the differential effects upon cell status associated with KRAS mutations we performed a quantitative analysis of the proteome and phosphoproteome of isogenic SW48 colon cancer cell lines in which one allele of the endogenous gene has been edited to harbor specific KRAS mutations (G12V, G12D, or G13D). Each mutation generates a distinct signature, with the most variability seen between G13D and the codon 12 KRAS mutants. One notable example of specific up-regulation in KRAS codon 12 mutant SW48 cells is provided by the short form of the colon cancer stem cell marker doublecortin-like Kinase 1 (DCLK1) that can be reversed by suppression of KRAS. PMID:25599653

Negative and Translation Termination-Dependent Positive Control of FLI-1 Protein Synthesis by Conserved Overlapping 5′ Upstream Open Reading Frames in Fli-1 mRNA

PubMed Central

Sarrazin, Sandrine; Starck, Joëlle; Gonnet, Colette; Doubeikovski, Alexandre; Melet, Fabrice; Morle, François

2000-01-01

The proto-oncogene Fli-1 encodes a transcription factor of the ets family whose overexpression is associated with multiple virally induced leukemias in mouse, inhibits murine and avian erythroid cell differentiation, and induces drastic perturbations of early development in Xenopus. This study demonstrates the surprisingly sophisticated regulation of Fli-1 mRNA translation. We establish that two FLI-1 protein isoforms (of 51 and 48 kDa) detected by Western blotting in vivo are synthesized by alternative translation initiation through the use of two highly conserved in-frame initiation codons, AUG +1 and AUG +100. Furthermore, we show that the synthesis of these two FLI-1 isoforms is regulated by two short overlapping 5′ upstream open reading frames (uORF) beginning at two highly conserved upstream initiation codons, AUG −41 and GUG −37, and terminating at two highly conserved stop codons, UGA +35 and UAA +15. The mutational analysis of these two 5′ uORF revealed that each of them negatively regulates FLI-1 protein synthesis by precluding cap-dependent scanning to the 48- and 51-kDa AUG codons. Simultaneously, the translation termination of the two 5′ uORF appears to enhance 48-kDa protein synthesis, by allowing downstream reinitiation at the 48-kDa AUG codon, and 51-kDa protein synthesis, by allowing scanning ribosomes to pile up and consequently allowing upstream initiation at the 51-kDa AUG codon. To our knowledge, this is the first example of a cellular mRNA displaying overlapping 5′ uORF whose translation termination appears to be involved in the positive control of translation initiation at both downstream and upstream initiation codons. PMID:10757781

The proto-oncogene KRAS and BRAF profiles and some clinical characteristics in colorectal cancer in the Turkish population.

PubMed

Ozen, Filiz; Ozdemir, Semra; Zemheri, Ebru; Hacimuto, Gizem; Silan, Fatma; Ozdemir, Ozturk

2013-02-01

The aim of the current study was to investigate the prevalence and predictive significance of the KRAS and BRAF mutations in Turkish patients with colorectal cancer (CRC). Totally, 53 fresh tumoral tissue specimens were investigated in patients with CRC. All specimens were obtained during routine surgery of patients who were histopathologically diagnosed and genotyped for common KRAS and BRAF point mutations. After DNA extraction, the target mutations were analyzed using the AutoGenomics INFINITI(®) assay, and some samples were confirmed by quantitative real-time polymerase chain reaction fluorescence melting curve analyses. KRAS mutations were found in 26 (49.05%) CRC samples. Twenty-seven samples (50.95%) had wild-type profiles for KRAS codon 12, 13, and 61 in the current cohort. In 17 (65.38%) samples, codon 12; in 7 (26.93%) samples, codon 13; and in 2 (7.69%) samples, codon 61 were found to be mutated, particularly in grade 2 of tumoral tissues. No point mutation was detected in BRAF codon Val600Glu for the studied CRC patients. Our study, based on a representative collection of human CRC tumors, indicates that KRAS gene mutations were detected in 49.05% of the samples, and the most frequent mutation was in the G12D codon. Results also showed that codons 12 and 13 of KRAS are relatively frequently without BRAF mutation in a CRC cohort from the Turkish population.

The Effect of an Alternate Start Codon on Heterologous Expression of a PhoA Fusion Protein in Mycoplasma gallisepticum

PubMed Central

Panicker, Indu S.; Browning, Glenn F.; Markham, Philip F.

2015-01-01

While the genomes of many Mycoplasma species have been sequenced, there are no collated data on translational start codon usage, and the effects of alternate start codons on gene expression have not been studied. Analysis of the annotated genomes found that ATG was the most prevalent translational start codon among Mycoplasma spp. However in Mycoplasma gallisepticum a GTG start codon is commonly used in the vlhA multigene family, which encodes a highly abundant, phase variable lipoprotein adhesin. Therefore, the effect of this alternate start codon on expression of a reporter PhoA lipoprotein was examined in M. gallisepticum. Mutation of the start codon from ATG to GTG resulted in a 2.5 fold reduction in the level of transcription of the phoA reporter, but the level of PhoA activity in the transformants containing phoA with a GTG start codon was only 63% of that of the transformants with a phoA with an ATG start codon, suggesting that GTG was a more efficient translational initiation codon. The effect of swapping the translational start codon in phoA reporter gene expression was less in M. gallisepticum than has been seen previously in Escherichia coli or Bacillus subtilis, suggesting the process of translational initiation in mycoplasmas may have some significant differences from those used in other bacteria. This is the first study of translational start codon usage in mycoplasmas and the impact of the use of an alternate start codon on expression in these bacteria. PMID:26010086

A Novel Frameshift Mutation at Codons 138/139 (HBB: c.417_418insT) on the β-Globin Gene Leads to β-Thalassemia.

PubMed

Jiang, Fan; Huang, Lv-Yin; Chen, Gui-Lan; Zhou, Jian-Ying; Xie, Xing-Mei; Li, Dong-Zhi

2017-01-01

We describe a new β-thalassemic mutation in a Chinese subject. This allele develops by insertion of one nucleotide (+T) between codons 138 and 139 in the third exon of the β-globin gene. The mutation causes a frameshift that leads to a termination codon at codon 139. In the heterozygote, this allele has the phenotype of classical β-thalassemia (β-thal) minor.

Genotyping of beta thalassemia trait by high-resolution DNA melting analysis.

PubMed

Saetung, Rattika; Ongchai, Siriwan; Charoenkwan, Pimlak; Sanguansermsri, Torpong

2013-11-01

Beta thalassemia is a common hereditary hemalogogical disease in Thailand, with a prevalence of 5-8%. In this study, we evaluated the high resolution DNA melting (HRM) assay to identify beta thalassemia mutation in samples from 143 carriers of the beta thalassemia traits in at risk couples. The DNA was isolated from venous blood samples and tested for mutation under a series of 5 PCR-HRM (A, B, C, D and E primers) protocols. The A primers were for detection of beta thalassemia mutations in the HBB promoter region, the B primers for mutations in exon I, the C primers for exon II, the D primers for exon III and the E primers for the 3.4 kb deletion mutation. The mutations were diagnosed by comparing the complete melting curve profiles of a wild type control with those for each mutant sample. With the PCR-HRM technique, fourteen types of beta thalassemia mutations were detected. Each mutation had a unique and specific melting profile. The mutations included 36.4% (52 cases) codon 41/42-CTTT, 26.6% (38 cases) codon 17 A-T, 11.2% (16 cases) IVS1-1 G-T, 8.4% (12 cases) codon 71/72 +A, 8.4% (12 cases) of the 3.4 kb deletion and 3.5% (5 cases) -28 A-G. The remainder included one instance each of -87 C-A, -31 A-C, codon 27/28 +C, codon 30 G-A, IVS1-5 G-C, codon 35 C-A, codon 41-C and IVSII -654 C-T. Of the total cases, 85.8% of the mutations could be detected by primers B and C. The PCR-HRM method provides a rapid, simple and highly feasible strategy for mutation screening of beta thalassemia traits.

Mutations That Affect the Efficiency of Translation of mRNA for the cII Gene of Coliphage Lambda

PubMed Central

Dul, Ed; Mahoney, Michael E.; Wulff, Daniel L.

1987-01-01

Starting with the λ pRE- strain λctr1 cy3008, which forms clear plaques, we have isolated two mutant strains, λdya2 ctr1 cy3008 and λ dya3 ctr1 cy3008, that form plaques with very slightly turbid centers. The dya2 and dya3 mutations lie in the region of overlap between the PRE promoter and the ribosome recognition region of the cII gene, and have nucleotide alterations at positions -1 and +5 of pRE, and alterations of cII mRNA at -16 and -21 nucleotides before the initial AUG codon of the gene. Both mutations destabilize a stem structure that may be formed by cII mRNA, and dya2 also changes the sequence on cII mRNA that is complementary to the 3'-end of 16 S rRNA from 5'-UAAGGA-3' to 5'-UGAGGA-3'.—The dya2 and dya3 mutations, along with the ctr1 mutation, which destabilizes either of two alternate stem structures which may be formed by cII mRNA (these being more stable stem structures than the one affected by dya2 and dya3), were tested for their ability to reverse two cII- mutations that are characterized by inefficient translation of cII mRNA. These are cII3088, an A → G mutation four bases before the initial AUG codon, and cII3059 , a GUU → GAU (Val2 → Asp) second codon mutation. It was found that ctr1 completely reverses the translation defects of these two mutations, while dya2 partially reverses these translation defects. The dya3 mutation has no effect on translation efficiency under any condition tested. However neither the ctr1 mutation nor the dya2 mutation has much effect on translation efficiency in an otherwise cII+ background, indicating that other factors must limit the rate of translation of cII mRNA under these conditions. PMID:2953647

Genomic analysis of codon usage shows influence of mutation pressure, natural selection, and host features on Marburg virus evolution.

PubMed

Nasrullah, Izza; Butt, Azeem M; Tahir, Shifa; Idrees, Muhammad; Tong, Yigang

2015-08-26

The Marburg virus (MARV) has a negative-sense single-stranded RNA genome, belongs to the family Filoviridae, and is responsible for several outbreaks of highly fatal hemorrhagic fever. Codon usage patterns of viruses reflect a series of evolutionary changes that enable viruses to shape their survival rates and fitness toward the external environment and, most importantly, their hosts. To understand the evolution of MARV at the codon level, we report a comprehensive analysis of synonymous codon usage patterns in MARV genomes. Multiple codon analysis approaches and statistical methods were performed to determine overall codon usage patterns, biases in codon usage, and influence of various factors, including mutation pressure, natural selection, and its two hosts, Homo sapiens and Rousettus aegyptiacus. Nucleotide composition and relative synonymous codon usage (RSCU) analysis revealed that MARV shows mutation bias and prefers U- and A-ended codons to code amino acids. Effective number of codons analysis indicated that overall codon usage among MARV genomes is slightly biased. The Parity Rule 2 plot analysis showed that GC and AU nucleotides were not used proportionally which accounts for the presence of natural selection. Codon usage patterns of MARV were also found to be influenced by its hosts. This indicates that MARV have evolved codon usage patterns that are specific to both of its hosts. Moreover, selection pressure from R. aegyptiacus on the MARV RSCU patterns was found to be dominant compared with that from H. sapiens. Overall, mutation pressure was found to be the most important and dominant force that shapes codon usage patterns in MARV. To our knowledge, this is the first detailed codon usage analysis of MARV and extends our understanding of the mechanisms that contribute to codon usage and evolution of MARV.

Insights into factorless translational initiation by the tRNA-like pseudoknot domain of a viral IRES.

PubMed

Au, Hilda H T; Jan, Eric

2012-01-01

The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae family adopts an overlapping triple pseudoknot structure to directly recruit the 80S ribosome in the absence of initiation factors. The pseudoknot I (PKI) domain of the IRES mimics a tRNA-like codon:anticodon interaction in the ribosomal P site to direct translation initiation from a non-AUG initiation codon in the A site. In this study, we have performed a comprehensive mutational analysis of this region to delineate the molecular parameters that drive IRES translation. We demonstrate that IRES-mediated translation can initiate at an alternate adjacent and overlapping start site, provided that basepairing interactions within PKI remain intact. Consistent with this, IGR IRES translation tolerates increases in the variable loop region that connects the anticodon- and codon-like elements within the PKI domain, as IRES activity remains relatively robust up to a 4-nucleotide insertion in this region. Finally, elements from an authentic tRNA anticodon stem-loop can functionally supplant corresponding regions within PKI. These results verify the importance of the codon:anticodon interaction of the PKI domain and further define the specific elements within the tRNA-like domain that contribute to optimal initiator Met-tRNA(i)-independent IRES translation.

Insights into Factorless Translational Initiation by the tRNA-Like Pseudoknot Domain of a Viral IRES

PubMed Central

Au, Hilda H. T.; Jan, Eric

2012-01-01

The intergenic region internal ribosome entry site (IGR IRES) of the Dicistroviridae family adopts an overlapping triple pseudoknot structure to directly recruit the 80S ribosome in the absence of initiation factors. The pseudoknot I (PKI) domain of the IRES mimics a tRNA-like codon:anticodon interaction in the ribosomal P site to direct translation initiation from a non-AUG initiation codon in the A site. In this study, we have performed a comprehensive mutational analysis of this region to delineate the molecular parameters that drive IRES translation. We demonstrate that IRES-mediated translation can initiate at an alternate adjacent and overlapping start site, provided that basepairing interactions within PKI remain intact. Consistent with this, IGR IRES translation tolerates increases in the variable loop region that connects the anticodon- and codon-like elements within the PKI domain, as IRES activity remains relatively robust up to a 4-nucleotide insertion in this region. Finally, elements from an authentic tRNA anticodon stem-loop can functionally supplant corresponding regions within PKI. These results verify the importance of the codon:anticodon interaction of the PKI domain and further define the specific elements within the tRNA-like domain that contribute to optimal initiator Met-tRNAi-independent IRES translation. PMID:23236506

PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

ERIC Educational Resources Information Center

Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

2009-01-01

Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

The impact of KRAS mutations on VEGF-A production and tumour vascular network

PubMed Central

2013-01-01

Background The malignant potential of tumour cells may be influenced by the molecular nature of KRAS mutations being codon 13 mutations less aggressive than codon 12 ones. Their metabolic profile is also different, with an increased anaerobic glycolytic metabolism in cells harbouring codon 12 KRAS mutations compared with cells containing codon 13 mutations. We hypothesized that this distinct metabolic behaviour could be associated with different HIF-1α expression and a distinct angiogenic profile. Methods Codon13 KRAS mutation (ASP13) or codon12 KRAS mutation (CYS12) NIH3T3 transfectants were analyzed in vitro and in vivo. Expression of HIF-1α, and VEGF-A was studied at RNA and protein levels. Regulation of VEGF-A promoter activity was assessed by means of luciferase assays using different plasmid constructs. Vascular network was assessed in tumors growing after subcutaneous inoculation. Non parametric statistics were used for analysis of results. Results Our results show that in normoxic conditions ASP13 transfectants exhibited less HIF-1α protein levels and activity than CYS12. In contrast, codon 13 transfectants exhibited higher VEGF-A mRNA and protein levels and enhanced VEGF-A promoter activity. These differences were due to a differential activation of Sp1/AP2 transcription elements of the VEGF-A promoter associated with increased ERKs signalling in ASP13 transfectants. Subcutaneous CYS12 tumours expressed less VEGF-A and showed a higher microvessel density (MVD) than ASP13 tumours. In contrast, prominent vessels were only observed in the latter. Conclusion Subtle changes in the molecular nature of KRAS oncogene activating mutations occurring in tumour cells have a major impact on the vascular strategy devised providing with new insights on the role of KRAS mutations on angiogenesis. PMID:23506169

The helicase Ded1p controls use of near-cognate translation initiation codons in 5' UTRs.

PubMed

Guenther, Ulf-Peter; Weinberg, David E; Zubradt, Meghan M; Tedeschi, Frank A; Stawicki, Brittany N; Zagore, Leah L; Brar, Gloria A; Licatalosi, Donny D; Bartel, David P; Weissman, Jonathan S; Jankowsky, Eckhard

2018-06-27

The conserved and essential DEAD-box RNA helicase Ded1p from yeast and its mammalian orthologue DDX3 are critical for the initiation of translation 1 . Mutations in DDX3 are linked to tumorigenesis 2-4 and intellectual disability 5 , and the enzyme is targeted by a range of viruses 6 . How Ded1p and its orthologues engage RNAs during the initiation of translation is unknown. Here we show, by integrating transcriptome-wide analyses of translation, RNA structure and Ded1p-RNA binding, that the effects of Ded1p on the initiation of translation are connected to near-cognate initiation codons in 5' untranslated regions. Ded1p associates with the translation pre-initiation complex at the mRNA entry channel and repressing the activity of Ded1p leads to the accumulation of RNA structure in 5' untranslated regions, the initiation of translation from near-cognate start codons immediately upstream of these structures and decreased protein synthesis from the corresponding main open reading frames. The data reveal a program for the regulation of translation that links Ded1p, the activation of near-cognate start codons and mRNA structure. This program has a role in meiosis, in which a marked decrease in the levels of Ded1p is accompanied by the activation of the alternative translation initiation sites that are seen when the activity of Ded1p is repressed. Our observations indicate that Ded1p affects translation initiation by controlling the use of near-cognate initiation codons that are proximal to mRNA structure in 5' untranslated regions.

Effect of KRAS codon13 mutations in patients with advanced colorectal cancer (advanced CRC) under oxaliplatin containing chemotherapy. Results from a translational study of the AIO colorectal study group

PubMed Central

2012-01-01

Background To evaluate the value of KRAS codon 13 mutations in patients with advanced colorectal cancer (advanced CRC) treated with oxaliplatin and fluoropyrimidines. Methods Tumor specimens from 201 patients with advanced CRC from a randomized, phase III trial comparing oxaliplatin/5-FU vs. oxaliplatin/capecitabine were retrospectively analyzed for KRAS mutations. Mutation data were correlated to response data (Overall response rate, ORR), progression-free survival (PFS) and overall survival (OS). Results 201 patients were analysed for KRAS mutation (61.2% males; mean age 64.2 ± 8.6 years). KRAS mutations were identified in 36.3% of tumors (28.8% in codon 12, 7.4% in codon 13). The ORR in codon 13 patients compared to codon 12 and wild type patients was significantly lower (p = 0.008). There was a tendency for a better overall survival in KRAS wild type patients compared to mutants (p = 0.085). PFS in all patients was not different in the three KRAS genetic groups (p = 0.72). However, we found a marked difference in PFS between patients with codon 12 and 13 mutant tumors treated with infusional 5-FU versus capecitabine based regimens. Conclusions Our data suggest that the type of KRAS mutation may be of clinical relevance under oxaliplatin combination chemotherapies without the addition of monoclonal antibodies in particular when overall response rates are important. Trial registration number 2002-04-017 PMID:22876876

Detection of EGFR Gene Mutation by Mutation-oriented LAMP Method.

PubMed

Matsumoto, Naoyuki; Kumasaka, Akira; Ando, Tomohiro; Komiyama, Kazuo

2018-04-01

Epidermal growth factor receptor (EGFR) is a target of molecular therapeutics for non-small cell lung cancer. EGFR gene mutations at codons 746-753 promote constitutive EGFR activation and result in worst prognosis. However, these mutations augment the therapeutic effect of EGFR-tyrosine kinase inhibitor. Therefore, the detection of EGFR gene mutations is important for determining treatment planning. The aim of the study was to establish a method to detect EGFR gene mutations at codons 746-753. EGFR gene mutation at codons 746-753 in six cancer cell lines were investigated. A loop-mediated isothermal amplification (LAMP)-based procedure was developed, that employed peptide nucleic acid to suppress amplification of the wild-type allele. This mutation-oriented LAMP can amplify the DNA fragment of the EGFR gene with codons 746-753 mutations within 30 min. Moreover, boiled cells can work as template resources. Mutation oriented-LAMP assay for EGFR gene mutation is sensitive on extracted DNA. This procedure would be capable of detecting EGFR gene mutation in sputum, pleural effusion, broncho-alveolar lavage fluid or trans-bronchial lung biopsy by chair side. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Decoding Mechanisms by which Silent Codon Changes Influence Protein Biogenesis and Function

PubMed Central

Bali, Vedrana; Bebok, Zsuzsanna

2015-01-01

Scope Synonymous codon usage has been a focus of investigation since the discovery of the genetic code and its redundancy. The occurrences of synonymous codons vary between species and within genes of the same genome, known as codon usage bias. Today, bioinformatics and experimental data allow us to compose a global view of the mechanisms by which the redundancy of the genetic code contributes to the complexity of biological systems from affecting survival in prokaryotes, to fine tuning the structure and function of proteins in higher eukaryotes. Studies analyzing the consequences of synonymous codon changes in different organisms have revealed that they impact nucleic acid stability, protein levels, structure and function without altering amino acid sequence. As such, synonymous mutations inevitably contribute to the pathogenesis of complex human diseases. Yet, fundamental questions remain unresolved regarding the impact of silent mutations in human disorders. In the present review we describe developments in this area concentrating on mechanisms by which synonymous mutations may affect protein function and human health. Purpose This synopsis illustrates the significance of synonymous mutations in disease pathogenesis. We review the different steps of gene expression affected by silent mutations, and assess the benefits and possible harmful effects of codon optimization applied in the development of therapeutic biologics. Physiological and medical relevance Understanding mechanisms by which synonymous mutations contribute to complex diseases such as cancer, neurodegeneration and genetic disorders, including the limitations of codon-optimized biologics, provides insight concerning interpretation of silent variants and future molecular therapies. PMID:25817479

Tuning of Recombinant Protein Expression in Escherichia coli by Manipulating Transcription, Translation Initiation Rates, and Incorporation of Noncanonical Amino Acids.

PubMed

Schlesinger, Orr; Chemla, Yonatan; Heltberg, Mathias; Ozer, Eden; Marshall, Ryan; Noireaux, Vincent; Jensen, Mogens Høgh; Alfonta, Lital

2017-06-16

Protein synthesis in cells has been thoroughly investigated and characterized over the past 60 years. However, some fundamental issues remain unresolved, including the reasons for genetic code redundancy and codon bias. In this study, we changed the kinetics of the Eschrichia coli transcription and translation processes by mutating the promoter and ribosome binding domains and by using genetic code expansion. The results expose a counterintuitive phenomenon, whereby an increase in the initiation rates of transcription and translation lead to a decrease in protein expression. This effect can be rescued by introducing slow translating codons into the beginning of the gene, by shortening gene length or by reducing initiation rates. On the basis of the results, we developed a biophysical model, which suggests that the density of co-transcriptional-translation plays a role in bacterial protein synthesis. These findings indicate how cells use codon bias to tune translation speed and protein synthesis.

Fatal mitochondrial encephalopathy caused by fumarase deficiency: A molecular-genetic study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gellera, C.; Cavadini, P.; Baratta, S.

Fumarase deficiency is a rare autosomal recessive disorder of the citric acid cycle resulting in severe organic aciduria and encephalopathy. Mammalian cells contain two fumarase isoenzymes, one mitochondrial and one cytosolic. In rat, the two proteins are encoded by the same gene and are synthesized by alternative initiation of translation at two in-phase AUG codons. One single fumarase gene locus has been identified on human chromosome 1. In most of the patients so far described, the activities of both isozymes are severely affected, suggesting that mutations within a single gene may underlie the disease. Here, we report the molecular studymore » of fumarase deficiency in a patient exhibiting compound heterozygosity for two different allelic mutations affecting the amino acid composition of both isoforms. The proband, an Italian boy of nonconsanguineous parents, died at 7 months of age of a progressive encephalopathy. Immunoblot demonstrated absence of cross-reacting material in both cytosolic and mitochondrial fraction of all tissues examined. Molecular analysis of the patient`s fumarase cDNA amplified by RT-PCR showed the presence of two mutations affecting the amino acid composition of both isoforms, a missense mutation resulting in the nonconservative amino acid substitution at codon 190 (Arg190Cys) and an amino acid in-frame insertion at codon 434 (Lys434ins). SSCP analysis of genomic PCR fragments encompassing the mutations demonstrated that the patient was heterozygous for both mutations, having inherited the Arg-to-Cys substitution from the father and the in-frame insertion from the mother. Finally, the effects of the mutations on enzyme function were investigated by expressing both normal and mutated fumarase cDNAs in a fumarase-deficient ({delta}FUM1) S. cerevisiae strain.« less

Vertebrate codon bias indicates a highly GC-rich ancestral genome.

PubMed

Nabiyouni, Maryam; Prakash, Ashwin; Fedorov, Alexei

2013-04-25

Two factors are thought to have contributed to the origin of codon usage bias in eukaryotes: 1) genome-wide mutational forces that shape overall GC-content and create context-dependent nucleotide bias, and 2) positive selection for codons that maximize efficient and accurate translation. Particularly in vertebrates, these two explanations contradict each other and cloud the origin of codon bias in the taxon. On the one hand, mutational forces fail to explain GC-richness (~60%) of third codon positions, given the GC-poor overall genomic composition among vertebrates (~40%). On the other hand, positive selection cannot easily explain strict regularities in codon preferences. Large-scale bioinformatic assessment, of nucleotide composition of coding and non-coding sequences in vertebrates and other taxa, suggests a simple possible resolution for this contradiction. Specifically, we propose that the last common vertebrate ancestor had a GC-rich genome (~65% GC). The data suggest that whole-genome mutational bias is the major driving force for generating codon bias. As the bias becomes prominent, it begins to affect translation and can result in positive selection for optimal codons. The positive selection can, in turn, significantly modulate codon preferences. Copyright © 2013 Elsevier B.V. All rights reserved.

Molecular Characterization of β-Thalassemia Mutations in Central Vietnam.

PubMed

Doro, Maria G; Casu, Giuseppina; Frogheri, Laura; Persico, Ivana; Triet, Le Phan Minh; Hoa, Phan Thi Thuy; Hoang, Nguyen Huy; Pirastru, Monica; Mereu, Paolo; Cucca, Francesco; Masala, Bruno

2017-03-01

The molecular basis of β-thalassemia (β-thal) mutations in North and in South Vietnam have been described during the past 15 years, whereas limited data were available concerning the central area of the country. In this study, we describe the molecular characterization and frequency of β-globin gene mutations in the Thua Thien Hue Province of Central Vietnam as the result of a first survey conducted in 22 transfusion-dependent patients, and four unrelated heterozygotes. Nine different known mutations were identified (seven of the β 0 and two of the β + type) in a total of 48 chromosomes. The most common was codon 26 (G>A) or Hb E (HBB: c.79 G>A) accounting for 29.2% of the total studied chromosomes, followed by codon 17 (A>T) (HBB: c.52 A>T) (25.0%), and codons 41/42 (-TTCT) (HBB: c.126_129delCTTT) (18.8%). Other mutations with appreciable frequencies (6.3-8.3%) were IVS-I-1 (G>T) (HBB: c.92+1 G>T), codon 26 (G>T) (HBB: c.79 G>T) and codons 71/72 (+A) (HBB: c.216_217insA). Relatively rarer (2.0%) were the promoter -28 (A>G) (HBB: c.78 A>G) mutation, the codon 95 (+A) (HBB: c.287_288insA), which is reported only in the Vietnamese, and the codons 14/15 (+G) (HBB: c.45_46insG) mutation, thus far observed only in Thailand. Results are relevant for implementing appropriate measures for β-thal prevention and control in the region as well as in the whole country.

Simultaneous identification of 36 mutations in KRAS codons 61and 146, BRAF, NRAS, and PIK3CA in a single reaction by multiplex assay kit

PubMed Central

2013-01-01

Background Retrospective analyses in the West suggest that mutations in KRAS codons 61 and 146, BRAF, NRAS, and PIK3CA are negative predictive factors for cetuximab treatment in colorectal cancer patients. We developed a novel multiplex kit detecting 36 mutations in KRAS codons 61 and 146, BRAF, NRAS, and PIK3CA using Luminex (xMAP) assay in a single reaction. Methods Tumor samples and clinical data from Asian colorectal cancer patients treated with cetuximab were collected. We investigated KRAS, BRAF, NRAS, and PIK3CA mutations using both the multiplex kit and direct sequencing methods, and evaluated the concordance between the 2 methods. Objective response, progression-free survival (PFS), and overall survival (OS) were also evaluated according to mutational status. Results In total, 82 of 83 samples (78 surgically resected specimens and 5 biopsy specimens) were analyzed using both methods. All multiplex assays were performed using 50 ng of template DNA. The concordance rate between the methods was 100%. Overall, 49 (59.8%) patients had all wild-type tumors, 21 (25.6%) had tumors harboring KRAS codon 12 or 13 mutations, and 12 (14.6%) had tumors harboring KRAS codon 61, KRAS codon 146, BRAF, NRAS, or PIK3CA mutations. The response rates in these patient groups were 38.8%, 4.8%, and 0%, respectively. Median PFS in these groups was 6.1 months (95% confidence interval (CI): 3.1–9.2), 2.7 months (1.2–4.2), and 1.6 months (1.5–1.7); median OS was 13.8 months (9.2–18.4), 8.2 months (5.7–10.7), and 6.3 months (1.3–11.3), respectively. Statistically significant differences in both PFS and OS were found between patients with all wild-type tumors and those with KRAS codon 61, KRAS codon 146, BRAF, NRAS, or PIK3CA mutations (PFS: 95% CI, 0.11–0.44; P < 0.0001; OS: 95% CI, 0.15–0.61; P < 0.0001). Conclusions Our newly developed multiplex kit is practical and feasible for investigation of a range of sample types. Moreover, mutations in KRAS codon 61, KRAS codon 146, BRAF, NRAS, or PIK3CA detected in Asian patients were not predictive of clinical benefits from cetuximab treatment, similar to the result obtained in European studies. PMID:24006859

Ineffectiveness of the presence of H-ras/p53 combination of mutations in squamous cell carcinoma cells to induce a conversion of a nontumorigenic to a tumorigenic phenotype.

PubMed

Lee, H; Li, D; Prior, T; Casto, B C; Weghorst, C M; Shuler, C F; Milo, G E

1997-10-01

Human tumor cells have properties in vitro or in surrogate hosts that are distinct from those of normal cells, such as immortality, anchorage independence, and tumor formation in nude mice. However, different cells from individual tumors may exhibit some, but not all of these features. In previous years, human tumor cell lines derived from different tumor and tissue types have been studied to determine those molecular changes that are associated with the in vitro properties listed above and with tumorigenicity in nude mice. In the present study, seven cell lines derived from human tumors were characterized for p53 and ras mutations that may occur in SCC tumor phenotypes and for tumor formation in nude mice. This investigation was designed to examine whether co-occurrence of mutated ras and p53 lead to a malignant stage in the progression process. None of the seven cell lines contained mutations in the recognized "hot spots" of the p53 tumor suppressor gene, but four had a nonsense/splice mutation in codon 126 and a mutation in codon 12 of the H-ras gene. The remaining three cell lines had p53 mutations in intron 5, in codon 193, and a missense mutation in codon 126, respectively. Four of seven cell lines were nontumorigenic; two of these cell lines contained a nonsense p53-126 mutation and mutated ras; one had a missense mutation at codon 126 but no mutated ras; the the fourth had only a p53 mutation at codon 193. Two of the nontumorigenic cell lines were converted to tumorigenicity after treatment with methyl methanesulfonate or N-methyl-N'-nitro-N-nitrosoguanidine with no apparent additional mutations in either gene. Our analysis revealed that there was a high frequency of genetic diversity and mutations in both p53 and H-ras. There was also a lack of a causal relationship in the presence of mutations in p53 and the cells' ability to exhibit a malignant potential in nude mice.

Translation initiation at an upstream CUG codon regulates the expression of Hibiscus chlorotic ringspot virus coat protein.

PubMed

Koh, Dora Chin-Yen; Wang, Xiaoxing; Wong, Sek-Man; Liu, D X

2006-12-01

Viruses depend heavily on host cells for replication and exploit the host translation machinery for its gene expression using various unorthodox translation mechanisms. According to the conventional scanning model, only the 5'-proximal gene in the viral RNA is accessible to the ribosomes whereas other genes are silent. In this study, we use a model plant RNA virus, Hibiscus chlorotic ringspot virus (HCRSV), to investigate various translation mechanisms involved in regulation of the expression of internal genes. The 3'-end 1.2kb region of HCRSV genomic and subgenomic RNAs were shown to encode four polypeptides of 38, 27, 25 and 22.5kDa. Mutagenesis studies revealed that a CUG codon ((2570)CUG) is the initiation codon for p27, the longest of the three co-C-terminal products (p27, p25 and p22.5), and translation of p25 and p22.5 was initiated at (2603)AUG and (2666)AUG, respectively. Translation initiation of the p27 expression at the (2570)CUG codon regulates the expression of p38, the viral coat protein through a leaky scanning mechanism and mutational analysis of an upstream open reading frame (ORF) demonstrated that initiation of the p27 expression at this CUG codon (instead of an AUG) may play a role in maintaining the ratio of p27 and p38. In addition, a previously identified internal ribosome entry site was shown to control the expression of p27 and p38 in the subgenomic RNA 2.

The Frequency and Type of K-RAS Mutations in Mexican Patients With Colorectal Cancer: A National Study.

PubMed

Cárdenas-Ramos, Susana G; Alcázar-González, Gregorio; Reyes-Cortés, Luisa M; Torres-Grimaldo, Abdiel A; Calderón-Garcidueñas, Ana L; Morales-Casas, José; Flores-Sánchez, Patricia; De León-Escobedo, Raúl; Gómez-Díaz, Antonio; Moreno-Bringas, Carmen; Sánchez-Guillén, Jorge; Ramos-Salazar, Pedro; González-de León, César; Barrera-Saldaña, Hugo A

2017-06-01

Current metastatic colorectal cancer (mCRC) therapy uses monoclonal antibodies against the epidermal growth factor receptor. This treatment is only useful in the absence of K-RAS gene mutations; therefore the study of such mutations is part of a personalized treatment. The aim of this work is to determine the frequency and type of the most common K-RAS mutations in Mexican patients with metastatic disease by nucleotide sequencing. We studied 888 patients with mCRC from different regions of Mexico. The presence of mutations in exon 2, codons 12 and 13, of the K-RAS gene was determined by nucleotide sequencing. Patients exhibited K-RAS gene mutations in 35% (310/888) of cases. Mutation frequency of codons 12 and 13 was 71% (221/310) and 29% (89/310), respectively. The most common mutation (45.7%) in codon 12 was c.35G>A (p.G12D), whereas the one in codon 13 was c.38G>A (p.G13D) (78.7%). Given the frequency of K-RAS mutations in Mexicans, making a genetic study before deciding to treat mCRC patients with monoclonal antibodies is indispensable.

Loss of GATA-1 Full Length as a Cause of Diamond–Blackfan Anemia Phenotype

PubMed Central

Parrella, Sara; Aspesi, Anna; Quarello, Paola; Garelli, Emanuela; Pavesi, Elisa; Carando, Adriana; Nardi, Margherita; Ellis, Steven R.; Ramenghi, Ugo; Dianzani, Irma

2015-01-01

Mutations in the hematopoietic transcription factor GATA-1 alter the proliferation/differentiation of hemopoietic progenitors. Mutations in exon 2 interfere with the synthesis of the full-length isoform of GATA-1 and lead to the production of a shortened isoform, GATA-1s. These mutations have been found in patients with Diamond–Blackfan anemia (DBA), a congenital erythroid aplasia typically caused by mutations in genes encoding ribosomal proteins. We sequenced GATA-1 in 23 patients that were negative for mutations in the most frequently mutated DBA genes. One patient showed a c.2T > C mutation in the initiation codon leading to the loss of the full-length GATA-1 isoform. PMID:24453067

A detailed analysis of codon usage patterns and influencing factors in Zika virus.

PubMed

Singh, Niraj K; Tyagi, Anuj

2017-07-01

Recent outbreaks of Zika virus (ZIKV) in Africa, Latin America, Europe, and Southeast Asia have resulted in serious health concerns. To understand more about evolution and transmission of ZIKV, detailed codon usage analysis was performed for all available strains. A high effective number of codons (ENC) value indicated the presence of low codon usage bias in ZIKV. The effect of mutational pressure on codon usage bias was confirmed by significant correlations between nucleotide compositions at third codon positions and ENCs. Correlation analysis between Gravy values, Aroma values and nucleotide compositions at third codon positions also indicated some influence of natural selection. However, the low codon adaptation index (CAI) value of ZIKV with reference to human and mosquito indicated poor adaptation of ZIKV codon usage towards its hosts, signifying that natural selection has a weaker influence than mutational pressure. Additionally, relative dinucleotide frequencies, geographical distribution, and evolutionary processes also influenced the codon usage pattern to some extent.

[Analysis of prevalence of point mutations in codon 12 of oncogene K-ras from non-cancerous samples of cervical cytology positive for type 16 or 18 PVH].

PubMed

Golijow, C D; Mourón, S A; Gómez, M A; Dulout, F N

1999-12-01

Ninety-one non cancerous samples from genital specimens positives for VPH 16 or 18 and 27 non-infected samples as controls were studied. Mutations at codon 12 in K-ras gene was analyzed using enriched alelic PCR technique. Among the samples studied 17.58% showed mutations in this codon. Significant differences were observed between the control group (negative DNA-HPV) and positives DNA-HPV samples (p < 0.01). No differences were found between both viral types in relation to the mutation frequency. The presence of mutations in the K-ras gene in non cancerous cytological samples point out new questions about the role of mutations in proto-oncogenes and the development of cervical cancer.

Novel mutations responsible for α-thalassemia in Iranian families.

PubMed

Bayat, Nooshin; Farashi, Samaneh; Hafezi-Nejad, Nima; Faramarzi, Negin; Ashki, Mehri; Vakili, Shadi; Imanian, Hashem; Khosravi, Mohsen; Azar-Keivan, Azita; Najmabadi, Hossein

2013-01-01

α-Thalassemia (α-thal) is usually caused by deletions on the α-globin gene cluster and the role of point mutations is less well investigated. In the present study, a total of 1048 individuals with hypochromic microcytic anemia, who did not present the most common α-thal deletions, were referred for α-globin gene DNA sequencing. The nucleotide changes were studied and a total of five new mutations was identified, of which three were located on the α2 gene [codon7 (Lys→Stop), codon 34 (Leu→Pro) and codon 83 (Leu→Arg)] and two on the α1 gene [IVS-I-116 (A>G) and codon 44 (+C)]. These novel mutations not only explain new findings by molecular analysis of the α-globin gene but also have clinical importance due to their changes in α-globin production in means of decreased hemoglobin (Hb) related values. Moreover, considerations of its role in combination with other mutations, and the possibility of causing Hb H (β4) are yet to be studied.

A method for multi-codon scanning mutagenesis of proteins based on asymmetric transposons.

PubMed

Liu, Jia; Cropp, T Ashton

2012-02-01

Random mutagenesis followed by selection or screening is a commonly used strategy to improve protein function. Despite many available methods for random mutagenesis, nearly all generate mutations at the nucleotide level. An ideal mutagenesis method would allow for the generation of 'codon mutations' to change protein sequence with defined or mixed amino acids of choice. Herein we report a method that allows for mutations of one, two or three consecutive codons. Key to this method is the development of a Mu transposon variant with asymmetric terminal sequences. As a demonstration of the method, we performed multi-codon scanning on the gene encoding superfolder GFP (sfGFP). Characterization of 50 randomly chosen clones from each library showed that more than 40% of the mutants in these three libraries contained seamless, in-frame mutations with low site preference. By screening only 500 colonies from each library, we successfully identified several spectra-shift mutations, including a S205D variant that was found to bear a single excitation peak in the UV region.

Physical Model for the Evolution of the Genetic Code

NASA Astrophysics Data System (ADS)

Yamashita, Tatsuro; Narikiyo, Osamu

2011-12-01

Using the shape space of codons and tRNAs we give a physical description of the genetic code evolution on the basis of the codon capture and ambiguous intermediate scenarios in a consistent manner. In the lowest dimensional version of our description, a physical quantity, codon level is introduced. In terms of the codon levels two scenarios are typically classified into two different routes of the evolutional process. In the case of the ambiguous intermediate scenario we perform an evolutional simulation implemented cost selection of amino acids and confirm a rapid transition of the code change. Such rapidness reduces uncomfortableness of the non-unique translation of the code at intermediate state that is the weakness of the scenario. In the case of the codon capture scenario the survival against mutations under the mutational pressure minimizing GC content in genomes is simulated and it is demonstrated that cells which experience only neutral mutations survive.

Molecular basis of beta-thalassemia in the Maldives.

PubMed

Furuumi, H; Firdous, N; Inoue, T; Ohta, H; Winichagoon, P; Fucharoen, S; Fukumaki, Y

1998-03-01

We have systematically analyzed beta-thalassemia genes using polymerase chain reaction-related techniques, dot-blot hybridization with oligonucleotide probes, allele specific-polymerase chain reaction, and sequencing of amplified DNA fragments from 41 unrelated patients, including 37 beta-thalassemia homozygotes, three with beta-thalassemia/Hb E, and one with beta-thalassemia/Hb S. Four different beta-thalassemia mutations were detected in 78 alleles. These are the IVS-I-5 (G-->C), codon 30 (AGG-->ACG) [also indicated as IVS-I (-1)], IVS-I-1 (G-->A), and codons 41/42 (-TTCT) mutations. The distribution of the beta-thalassemia mutations in the Maldives is 58 alleles (74.3%) with the IVS-I-5 (G-->C) mutation, 12 (15.4%) with the codon 30 (AGG-->ACG) mutation, seven (9%) with the IVS-I-1 (G-->A) mutation, and one with the codons 41/42 (-TTCT) mutation. The first three mutations account for 98.7% of the total number of beta-thalassemia chromosomes studied. These mutations are clustered in the region spanning 6 bp around the junction of exon 1 and the first intervening sequence of the beta-globin gene. These observations have significant implications for setting up a thalassemia prevention and control program in the Maldives. Analysis of haplotypes and frameworks of chromosomes bearing each beta-thalassemia mutation suggested that the origin and spread of these mutations were reflected by the historical record.

Random codon re-encoding induces stable reduction of replicative fitness of Chikungunya virus in primate and mosquito cells.

PubMed

Nougairede, Antoine; De Fabritus, Lauriane; Aubry, Fabien; Gould, Ernest A; Holmes, Edward C; de Lamballerie, Xavier

2013-02-01

Large-scale codon re-encoding represents a powerful method of attenuating viruses to generate safe and cost-effective vaccines. In contrast to specific approaches of codon re-encoding which modify genome-scale properties, we evaluated the effects of random codon re-encoding on the re-emerging human pathogen Chikungunya virus (CHIKV), and assessed the stability of the resultant viruses during serial in cellulo passage. Using different combinations of three 1.4 kb randomly re-encoded regions located throughout the CHIKV genome six codon re-encoded viruses were obtained. Introducing a large number of slightly deleterious synonymous mutations reduced the replicative fitness of CHIKV in both primate and arthropod cells, demonstrating the impact of synonymous mutations on fitness. Decrease of replicative fitness correlated with the extent of re-encoding, an observation that may assist in the modulation of viral attenuation. The wild-type and two re-encoded viruses were passaged 50 times either in primate or insect cells, or in each cell line alternately. These viruses were analyzed using detailed fitness assays, complete genome sequences and the analysis of intra-population genetic diversity. The response to codon re-encoding and adaptation to culture conditions occurred simultaneously, resulting in significant replicative fitness increases for both re-encoded and wild type viruses. Importantly, however, the most re-encoded virus failed to recover its replicative fitness. Evolution of these viruses in response to codon re-encoding was largely characterized by the emergence of both synonymous and non-synonymous mutations, sometimes located in genomic regions other than those involving re-encoding, and multiple convergent and compensatory mutations. However, there was a striking absence of codon reversion (<0.4%). Finally, multiple mutations were rapidly fixed in primate cells, whereas mosquito cells acted as a brake on evolution. In conclusion, random codon re-encoding provides important information on the evolution and genetic stability of CHIKV viruses and could be exploited to develop a safe, live attenuated CHIKV vaccine.

Translation, modification and cellular distribution of two AC4 variants of African cassava mosaic virus in yeast and their pathogenic potential in plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hipp, Katharina, E-mail: katharina.hipp@bio.uni-st

Plant infecting geminiviruses encode a small (A)C4 protein within the open reading frame of the replication-initiator protein. In African cassava mosaic virus, two in-frame start codons may be used for the translation of a longer and a shorter AC4 variant. Both were fused to green fluorescent protein or glutathione-S-transferase genes and expressed in fission yeast. The longer variant accumulated in discrete spots in the cytoplasm, whereas the shorter variant localized to the plasma membrane. A similar expression pattern was found in plants. A myristoylation motif may promote a targeting of the shorter variant to the plasma membrane. Mass spectrometry analysismore » of the yeast-expressed shorter variant detected the corresponding myristoylation. The biological relevance of the second start codon was confirmed using mutated infectious clones. Whereas mutating the first start codon had no effect on the infectivity in Nicotiana benthamiana plants, the second start codon proved to be essential. -- Highlights: •The ACMV AC4 may be translated from one or the other in-frame start codon. •Both AC4 variants are translated in fission yeast. •The long AC4 protein localizes to the cytoplasm, the short to the plasma membrane. •The short variant is myristoylated in yeast and may promote membrane localization. •Only the shorter AC4 variant has an impact on viral infections in plants.« less

Characterization of codon usage pattern and influencing factors in Japanese encephalitis virus.

PubMed

Singh, Niraj K; Tyagi, Anuj; Kaur, Rajinder; Verma, Ramneek; Gupta, Praveen K

2016-08-02

Recently, several outbreaks of Japanese encephalitis (JE), caused by Japanese encephalitis virus (JEV), have been reported and it has become cause of concern across the world. In this study, detailed analysis of JEV codon usage pattern was performed. The relative synonymous codon usage (RSCU) values along with mean effective number of codons (ENC) value of 55.30 indicated the presence of low codon usages bias in JEV. The effect of mutational pressure on codon usage bias was confirmed by significant correlations of A3s, U3s, G3s, C3s, GC3s, ENC values, with overall nucleotide contents (A%, U%, G%, C%, and GC%). The correlation analysis of A3s, U3s, G3s, C3s, GC3s, with axis values of correspondence analysis (CoA) further confirmed the role of mutational pressure. However, the correlation analysis of Gravy values and Aroma values with A3s, U3s, G3s, C3s, and GC3s, indicated the presence of natural selection on codon usage bias in addition to mutational pressure. The natural selection was further confirmed by codon adaptation index (CAI) analysis. Additionally, relative dinucleotide frequencies, geographical distribution, and evolutionary processes also influenced the codon usage pattern to some extent. Copyright © 2016 Elsevier B.V. All rights reserved.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

PubMed

Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

2017-10-01

Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

Mutation at codon 442 in the rpoB gene of Mycobacterium leprae does not confer resistance to rifampicin.

PubMed

Lavania, Mallika; Hena, Abu; Reja, Hasanoor; Nigam, Astha; Biswas, Nibir Kumar; Singh, Itu; Turankar, Ravindra P; Gupta, Ud; Kumar, Senthil; Rewaria, Latika; Patra, Pradip K R; Sengupta, Utpal; Bhattacharya, Basudeb

2016-03-01

Rifampicin is the major drug in the treatment of leprosy. The rifampicin resistance of Mycobacterium leprae results from a mutation in the rpoB gene, encoding the β subunit of RNA polymerase. As M. leprae is a non-cultivable organism observation of its growth using mouse food-pad (MFP) is the only Gold Standard assay used for confirmation of "in-vivo" drug resistance. Any mutation at molecular level has to be verified by MFP assay for final confirmation of drug resistance in leprosy. In the present study, M. leprae strains showing a mutation only at codon 442 Gln-His and along with mutation either at codon 424 Val-Gly or at 438 Gln-Val within the Rifampicin Resistance Determining Region (RRDR) confirmed by DNA sequencing and by high resolution melting (HRM) analysis were subjected for its growth in MFP. The M. leprae strain having the new mutation at codon 442 Gln-His was found to be sensitive to all the three drugs and strains having additional mutations at 424 Val-Gly and 438 Gln-Val were conferring resistance with Multi drug therapy (MDT) in MFP. These results indicate that MFP is the gold standard method for confirming the mutations detected by molecular techniques.

Disruption of the Opal Stop Codon Attenuates Chikungunya Virus-Induced Arthritis and Pathology.

PubMed

Jones, Jennifer E; Long, Kristin M; Whitmore, Alan C; Sanders, Wes; Thurlow, Lance R; Brown, Julia A; Morrison, Clayton R; Vincent, Heather; Peck, Kayla M; Browning, Christian; Moorman, Nathaniel; Lim, Jean K; Heise, Mark T

2017-11-14

Chikungunya virus (CHIKV) is a mosquito-borne alphavirus responsible for several significant outbreaks of debilitating acute and chronic arthritis and arthralgia over the past decade. These include a recent outbreak in the Caribbean islands and the Americas that caused more than 1 million cases of viral arthralgia. Despite the major impact of CHIKV on global health, viral determinants that promote CHIKV-induced disease are incompletely understood. Most CHIKV strains contain a conserved opal stop codon at the end of the viral nsP3 gene. However, CHIKV strains that encode an arginine codon in place of the opal stop codon have been described, and deep-sequencing analysis of a CHIKV isolate from the Caribbean identified both arginine and opal variants within this strain. Therefore, we hypothesized that the introduction of the arginine mutation in place of the opal termination codon may influence CHIKV virulence. We tested this by introducing the arginine mutation into a well-characterized infectious clone of a CHIKV strain from Sri Lanka and designated this virus Opal524R. This mutation did not impair viral replication kinetics in vitro or in vivo Despite this, the Opal524R virus induced significantly less swelling, inflammation, and damage within the feet and ankles of infected mice. Further, we observed delayed induction of proinflammatory cytokines and chemokines, as well as reduced CD4 + T cell and NK cell recruitment compared to those in the parental strain. Therefore, the opal termination codon plays an important role in CHIKV pathogenesis, independently of effects on viral replication. IMPORTANCE Chikungunya virus (CHIKV) is a mosquito-borne alphavirus that causes significant outbreaks of viral arthralgia. Studies with CHIKV and other alphaviruses demonstrated that the opal termination codon within nsP3 is highly conserved. However, some strains of CHIKV and other alphaviruses contain mutations in the opal termination codon. These mutations alter the virulence of related alphaviruses in mammalian and mosquito hosts. Here, we report that a clinical isolate of a CHIKV strain from the recent outbreak in the Caribbean islands contains a mixture of viruses encoding either the opal termination codon or an arginine mutation. Mutating the opal stop codon to an arginine residue attenuates CHIKV-induced disease in a mouse model. Compared to infection with the opal-containing parental virus, infection with the arginine mutant causes limited swelling and inflammation, as well as dampened recruitment of immune mediators of pathology, including CD4 + T cells and NK cells. We propose that the opal termination codon plays an essential role in the induction of severe CHIKV disease. Copyright © 2017 Jones et al.

N-ras Mutation Detection by Pyrosequencing in Adult Patients with Acute Myeloid Leukemia at a Single Institution

PubMed Central

Jeong, Ji Hun; Park, Soon Ho; Park, Mi Jung; Kim, Moon Jin; Kim, Kyung Hee; Park, Pil Whan; Seo, Yiel Hea; Lee, Jae Hoon; Park, Jinny; Hong, Junshik

2013-01-01

Background N-ras mutations are one of the most commonly detected abnormalities of myeloid origin. N-ras mutations result in a constitutively active N-ras protein that induces uncontrolled cell proliferation and inhibits apoptosis. We analyzed N-ras mutations in adult patients with AML at a particular institution and compared pyrosequencing analysis with a direct sequencing method for the detection of N-ras mutations. Methods We analyzed 90 bone marrow samples from 83 AML patients. We detected N-ras mutations in codons 12, 13, and 61 using the pyrosequencing method and subsequently confirmed all data by direct sequencing. Using these methods, we screened the N-ras mutation quantitatively and determined the incidence and characteristic of N-ras mutation. Results The incidence of N-ras mutation was 7.2% in adult AML patients. The patients with N-ras mutations showed significant higher hemoglobin levels (P=0.022) and an increased incidence of FLT3 mutations (P=0.003). We observed 3 cases with N-ras mutations in codon 12 (3.6%), 2 cases in codon 13 (2.4%), and 1 case in codon 61 (1.2%). All the mutations disappeared during chemotherapy. Conclusions There is a low incidence (7.2%) of N-ras mutations in AML patients compared with other populations. Similar data is obtained by both pyrosequencing and direct sequencing. This study showed the correlation between the N-ras mutation and the therapeutic response. However, pyrosequencing provides quantitative data and is useful for monitoring therapeutic responses. PMID:23667841

Correlations of HBV Genotypes, Mutations Affecting HBeAg Expression and HBeAg/ anti-HBe Status in HBV Carriers

PubMed Central

Lim, Chee Kent; Tan, Joanne Tsui Ming; Khoo, Jason Boo Siang; Ravichandran, Aarthi; Low, Hsin Mei; Chan, Yin Chyi; Ton, So Har

2006-01-01

This study was carried out to determine the effects of hepatitis B virus genotypes, core promoter mutations (A1762G1764→T1762A1764) as well as precore stop codon mutations (TGG→TAG) on HBeAg expression and HBeAg/ anti-HBe status. Study was also performed on the effects of codon 15 variants (C1858/ T1858) on the predisposition of precore stop codon mutations (TGG→TAG). A total of 77 sera samples were analyzed. Fifty one samples were successfully genotyped of which the predominant genotype was genotype B (29/ 51, 56.9 %), followed by genotype C (16/ 51, 31.4 %). Co-infections by genotypes B and C were observed in four samples (7.8 %). To a lesser degree, genotypes D and E (2.0 % each) were also observed. For core promoter mutations, the prevalence was 68.8 % (53/ 77) for A1762G1764 wild-type and 14.3 % (11/ 77) for T1762A1764 mutant while 9.1 % (7/ 77) was co-infected by both strains. The prevalence of codon 15 variants was found to be 42.9 % (33/ 77) for T1858 variant and 16.9 % (13/ 77) for C1858 variant. No TAG mutation was found. In our study, no associations were found between genotypes (B and C) and core promoter mutations as well as codon 15 variants. Also no correlation was observed between HBeAg/ anti-HBe status with genotypes (B and C) and core promoter mutations. PMID:16421626

Mutations in eukaryotic release factors 1 and 3 act as general nonsense suppressors in Drosophila.

PubMed Central

Chao, Anna T; Dierick, Herman A; Addy, Tracie M; Bejsovec, Amy

2003-01-01

In a screen for suppressors of the Drosophila wingless(PE4) nonsense allele, we isolated mutations in the two components that form eukaryotic release factor. eRF1 and eRF3 comprise the translation termination complex that recognizes stop codons and catalyzes the release of nascent polypeptide chains from ribosomes. Mutations disrupting the Drosophila eRF1 and eRF3 show a strong maternal-effect nonsense suppression due to readthrough of stop codons and are zygotically lethal during larval stages. We tested nonsense mutations in wg and in other embryonically acting genes and found that different stop codons can be suppressed but only a subset of nonsense alleles are subject to suppression. We suspect that the context of the stop codon is significant: nonsense alleles sensitive to suppression by eRF1 and eRF3 encode stop codons that are immediately followed by a cytidine. Such suppressible alleles appear to be intrinsically weak, with a low level of readthrough that is enhanced when translation termination is disrupted. Thus the eRF1 and eRF3 mutations provide a tool for identifying nonsense alleles that are leaky. Our findings have important implications for assigning null mutant phenotypes and for selecting appropriate alleles to use in suppressor screens. PMID:14573473

Suppression of severe achondroplasia with developmental delay and acanthosis nigricans by the p.Thr651Pro mutation.

PubMed

Manickam, Kandamurugu; Donoghue, Daniel J; Meyer, April N; Snyder, Pamela J; Prior, Thomas W

2014-01-01

Severe achondroplasia with developmental delay and acanthosis nigricans (SADDAN) is an extremely rare severe skeletal dysplasia characterized by significant developmental delay, brain structural abnormalities, hearing loss, and acanthosis nigricans. The disorder is the result of a single missense mutation at codon 650 (p.Lys650Met) in the fibroblast growth factor receptor 3 gene (FGFR3). We describe a child who initially presented with a mild achondroplasia or hypochondroplasia like phenotype. Molecular analysis of the FGFR3 gene showed the common SADDAN mutation and a second novel mutation at codon 651 (p.Thr651Pro). Both mutations were shown to occur on the same allele (cis) and de novo. Transient transfection studies with FGFR3 double mutant constructs show that the p.Thr651Pro mutation causes a dramatic decrease in constitutive receptor kinase activity than that observed by the p.Lys650Met mutation. Our data suggest that the molecular effect by the p.Thr651Pro is to elicit a conformational change that decreases the FGFR3 tyrosine kinase activity, which is constitutively activated by the SADDAN mutation. Due to the inheritance of both a gain-of-function and a loss-of-function mutation, we conclude that a reduction of constitutive activation caused the milder skeletal phenotype. Although the occurrence of double mutations are expected to be rare, the presence of other FGFR3 modifiers may be responsible for some of the clinically discrepant skeletal dysplasia cases. © 2013 Wiley Periodicals, Inc.

High-resolution melting analysis of gyrA codon 84 and grlA codon 80 mutations conferring resistance to fluoroquinolones in Staphylococcus pseudintermedius isolates from canine clinical samples.

PubMed

Loiacono, Monica; Martino, Piera A; Albonico, Francesca; Dell'Orco, Francesca; Ferretti, Manuela; Zanzani, Sergio; Mortarino, Michele

2017-09-01

Staphylococcus pseudintermedius is an opportunistic pathogen of dogs and cats. A high-resolution melting analysis (HRMA) protocol was designed and tested on 42 clinical isolates with known fluoroquinolone (FQ) susceptibility and gyrA codon 84 and grlA codon 80 mutation status. The HRMA approach was able to discriminate between FQ-sensitive and FQ-resistant strains and confirmed previous reports that the main mutation site associated with FQ resistance in S. pseudintermedius is located at position 251 (Ser84Leu) of gyrA. Routine, HRMA-based FQ susceptibility profiles may be a valuable tool to guide therapy. The FQ resistance-predictive power of the assay should be tested in a significantly larger number of isolates.

Mutations in the glucose-6-phosphatase gene that cause glycogen storage disease type 1a

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chou, J.Y.; Lei, K.J.; Shelly, L.L.

1994-09-01

Glycogen storage disease (GSD) type la (von Gierke disease) is caused by the deficiency of glucose-6-phosphatase (G6Pase), the key enzyme in glucose homeostasis. The disease presents with clinical manifestations of severe hypoglycemia, hepatomegaly, growth retardation, lactic acidemia, hyperlipidemia, and hyperuricemia. We have succeeded in isolating a murine G6Pase cDNA from a normal mouse liver cDNA library by differentially screening method. We then isolated the human G6Pase cDNA and gene. To date, we have characterized the G6Pase genes of twelve GSD type la patients and uncovered a total of six different mutations. The mutations are comprised of R83C (an Arg atmore » codon 83 to a Cys), Q347X (a Gly at codon 347 to a stop codon), 459insTA (a two basepair insertion at nucleotide 459 yielding a truncated G6Pase of 129 residues), R295C (an Arg at codon 295 to a Cys), G222R (a Gly at codon 222 to an Arg) and {delta}F327 (a codon deletion for Phe-327 at nucleotides 1058 to 1060). The relative incidences of these mutations are 37.5% (R83C), 33.3% (Q347X), 16.6% (459insTA), 4.2% (G222R), 4.2% (R295C) and 4.2% ({delta}F327). Site-directed mutagenesis and transient expression assays demonstrated that the R83C, Q347X, R295C, and {delta}F327 mutations abolished whereas the G222R mutation greatly reduced G6Pase activity. We further characterized the structure-function requirements of amino acids 83, 222, and 295 in G6Pase catalysis. The identification of mutations in GSD type la patients has unequivocally established the molecular basis of the type la disorder. Knowledge of the mutations may be applied to prenatal diagnosis and opens the way for developing and evaluating new therapeutic approaches.« less

Prognostic impact of KRAS mutation subtypes in 677 patients with metastatic lung adenocarcinomas

PubMed Central

Yu, Helena A.; Sima, Camelia S.; Shen, Ronglai; Kass, Samantha; Gainor, Justin; Shaw, Alice; Hames, Megan; Iams, Wade; Aston, Jonathan; Lovly, Christine M.; Horn, Leora; Lydon, Christine; Oxnard, Geoffrey R.; Kris, Mark G.; Ladanyi, Marc; Riely, Gregory J.

2015-01-01

Background We previously demonstrated that patients with metastatic KRAS mutant lung cancers have a shorter survival compared to patients with KRAS wild type cancers. Recent reports have suggested different clinical outcomes and distinct activated signaling pathways depending on KRAS mutation subtype. To better understand the impact of KRAS mutation subtype, we analyzed data from 677 patients with KRAS mutant metastatic lung cancer. Methods We reviewed all patients with metastatic or recurrent lung cancers found to have KRAS mutations over a 6 year time period. We evaluated the associations between KRAS mutation type, clinical factors, and overall survival in univariate and multivariate analyses. Any significant findings were validated in an external multi-institution patient data set. Results Among 677 patients with KRAS mutant lung cancers (53 at codon 13, 624 at codon 12), there was no difference in overall survival for patients when comparing KRAS transition versus transversion mutations (p=0.99), smoking status (p=0.33) or when comparing specific amino acid substitutions (p=0.20). In our data set, patients with KRAS codon 13 mutant tumors (n=53) had shorter overall survival compared to patients with codon 12 mutant tumors (n=624)( 1.1 vs 1.3 years, respectively, p=0.009), and the findings were confirmed in a multivariate Cox model controlling for age, sex and smoking status (HR 1.52 95% CI 1.11-2.08, p=0.008). In an independent validation set of tumors from 682 patients with stage IV KRAS mutant lung cancers, there was no difference in survival between patients with KRAS codon 13 versus codon 12 mutations (1.0 vs 1.1 years respectively, p=0.41). Conclusions Among individuals with KRAS mutant metastatic lung cancers treated with conventional therapy, there are apparent differences in outcome based on KRAS mutation subtype PMID:25415430

Influence of certain forces on evolution of synonymous codon usage bias in certain species of three basal orders of aquatic insects.

PubMed

Selva Kumar, C; Nair, Rahul R; Sivaramakrishnan, K G; Ganesh, D; Janarthanan, S; Arunachalam, M; Sivaruban, T

2012-12-01

Forces that influence the evolution of synonymous codon usage bias are analyzed in six species of three basal orders of aquatic insects. The rationale behind choosing six species of aquatic insects (three from Ephemeroptera, one from Plecoptera, and two from Odonata) for the present analysis is based on phylogenetic position at the basal clades of the Order Insecta facilitating the understanding of the evolution of codon bias and of factors shaping codon usage patterns in primitive clades of insect lineages and their subtle differences in some of their ecological and environmental requirements in terms of habitat-microhabitat requirements, altitudinal preferences, temperature tolerance ranges, and consequent responses to climate change impacts. The present analysis focuses on open reading frames of the 13 protein-coding genes in the mitochondrial genome of six carefully chosen insect species to get a comprehensive picture of the evolutionary intricacies of codon bias. In all the six species, A and T contents are observed to be significantly higher than G and C, and are used roughly equally. Since transcription hypothesis on codon usage demands A richness and T poorness, it is quite likely that mutation pressure may be the key factor associated with synonymous codon usage (SCU) variations in these species because the mutation hypothesis predicts AT richness and GC poorness in the mitochondrial DNA. Thus, AT-biased mutation pressure seems to be an important factor in framing the SCU variation in all the selected species of aquatic insects, which in turn explains the predominance of A and T ending codons in these species. This study does not find any association between microhabitats and codon usage variations in the mitochondria of selected aquatic insects. However, this study has identified major forces, such as compositional constraints and mutation pressure, which shape patterns of codon usage in mitochondrial genes in the primitive clades of insect lineages.

Phenotypic and genotypic evaluation of fluoroquinolone resistance in clinical isolates of Staphylococcus aureus in Tehran

PubMed Central

Aligholi, Marzieh; Mirsalehian, Akbar; Halimi, Shahnaz; Imaneini, Hossein; Taherikalani, Morovat; Jabalameli, Fereshteh; Asadollahi, Parisa; Mohajer, Babak; Abdollahi, Alireza; Emaneini, Mohammad

2011-01-01

Summary Background Fluoroquinolones are broad-spectrum antibiotics widely used in the treatment of bacterial infections such as Staphylococcus aureus isolates. Resistance to these antibiotics is increasing. Material/Methods The occurrence of mutations in the grlA and gyrA loci were evaluated in 69 fluoroquinolone-resistant S. aureus isolates from 2 teaching hospitals of Tehran University of Medical Sciences. Results Out of the 165 S. aureus isolates, 87 (52.7%) were resistant to methicillin and 69 (41.8%) were resistant to fluoroquinolone. Fluoroquinolone-resistant S. aureus isolates had a mutation at codon 80 in the grlA gene and different mutational combinations in the gyrA gene. These mutational combinations included 45 isolates at codons 84 and 86, 23 isolates at codons 84, 86 and 106 and 1 isolate at codons 84, 86 and 90. Fluoroquinolone-resistant S. aureus isolates were clustered into 33 PFGE types. Conclusions The findings of this study show that the fluoroquinolone-resistant S. aureus strains isolated in the teaching hospitals in Tehran had multiple mutations in the QRDRs region of both grlA and gyrA genes. PMID:21873957

Phenotypic and genotypic evaluation of fluoroquinolone resistance in clinical isolates of Staphylococcus aureus in Tehran.

PubMed

Aligholi, Marzieh; Mirsalehian, Akbar; Halimi, Shahnaz; Imaneini, Hossein; Taherikalani, Morovat; Jabalameli, Fereshteh; Asadollahi, Parisa; Mohajer, Babak; Abdollahi, Alireza; Emaneini, Mohammad

2011-09-01

Fluoroquinolones are broad-spectrum antibiotics widely used in the treatment of bacterial infections such as Staphylococcus aureus isolates. Resistance to these antibiotics is increasing. The occurrence of mutations in the grlA and gyrA loci were evaluated in 69 fluoroquinolone-resistant S. aureus isolates from 2 teaching hospitals of Tehran University of Medical Sciences. Out of the 165 S. aureus isolates, 87 (52.7%) were resistant to methicillin and 69 (41.8%) were resistant to fluoroquinolone. Fluoroquinolone-resistant S. aureus isolates had a mutation at codon 80 in the grlA gene and different mutational combinations in the gyrA gene. These mutational combinations included 45 isolates at codons 84 and 86, 23 isolates at codons 84, 86 and 106 and 1 isolate at codons 84, 86 and 90. Fluoroquinolone-resistant S. aureus isolates were clustered into 33 PFGE types. The findings of this study show that the fluoroquinolone-resistant S. aureus strains isolated in the teaching hospitals in Tehran had multiple mutations in the QRDRs region of both grlA and gyrA genes.

Selective forces and mutational biases drive stop codon usage in the human genome: a comparison with sense codon usage.

PubMed

Trotta, Edoardo

2016-05-17

The three stop codons UAA, UAG, and UGA signal the termination of mRNA translation. As a result of a mechanism that is not adequately understood, they are normally used with unequal frequencies. In this work, we showed that selective forces and mutational biases drive stop codon usage in the human genome. We found that, in respect to sense codons, stop codon usage was affected by stronger selective forces but was less influenced by neutral mutational biases. UGA is the most frequent termination codon in human genome. However, UAA was the preferred stop codon in genes with high breadth of expression, high level of expression, AT-rich coding sequences, housekeeping functions, and in gene ontology categories with the largest deviation from expected stop codon usage. Selective forces associated with the breadth and the level of expression favoured AT-rich sequences in the mRNA region including the stop site and its proximal 3'-UTR, but acted with scarce effects on sense codons, generating two regions, upstream and downstream of the stop codon, with strongly different base composition. By favouring low levels of GC-content, selection promoted labile local secondary structures at the stop site and its proximal 3'-UTR. The compositional and structural context favoured by selection was surprisingly emphasized in the class of ribosomal proteins and was consistent with sequence elements that increase the efficiency of translational termination. Stop codons were also heterogeneously distributed among chromosomes by a mechanism that was strongly correlated with the GC-content of coding sequences. In human genome, the nucleotide composition and the thermodynamic stability of stop codon site and its proximal 3'-UTR are correlated with the GC-content of coding sequences and with the breadth and the level of gene expression. In highly expressed genes stop codon usage is compositionally and structurally consistent with highly efficient translation termination signals.

ACB-PCR measurement of spontaneous and furan-induced H-ras codon 61 CAA to CTA and CAA to AAA mutation in B6C3F1 mouse liver.

PubMed

Banda, Malathi; Recio, Leslie; Parsons, Barbara L

2013-10-01

Furan is a rodent liver carcinogen, but the mode of action for furan hepatocarcinogenicity is unclear. H-ras codon 61 mutations have been detected in spontaneous liver tumors of B6C3F1 mice, and the fraction of liver tumors carrying H-ras codon 61 CAA to AAA mutation increased in furan-treated mice. Allele-specific competitive blocker PCR (ACB-PCR) has been used previously to quantify early, carcinogen-induced increases in tumor-associated mutations. The present pilot study investigated whether furan drives clonal expansion of pre-existing H-ras mutant cells in B6C3F1 mouse liver. H-ras codon 61 CAA to CTA and CAA to AAA mutations were measured in DNA isolated from liver tissue of female mice treated with 0, 1, 2, 4, or 8 mg furan/kg body weight, five days per week for three weeks, using five mice per treatment group. Spontaneous levels of mutation were low, with two of five control mice having an H-ras codon 61 CTA or AAA mutant fraction (MF) greater than 10(-5) . Several furan-treated mice had H-ras codon 61 AAA or CTA MFs greater than those measured in control mice and lower bound estimates of induced MF were calculated. However, no statistically-significant differences were observed between treatment groups. Therefore, while sustained exposure to furan is carcinogenic, at the early stage of carcinogenesis examined in this study (three weeks), there was not a significant expansion of H-ras mutant cells. Copyright © 2013 Wiley Periodicals, Inc.

HMG CoA lyase deficiency: identification of five causal point mutations in codons 41 and 42, including a frequent Saudi Arabian mutation, R41Q.

PubMed Central

Mitchell, G A; Ozand, P T; Robert, M F; Ashmarina, L; Roberts, J; Gibson, K M; Wanders, R J; Wang, S; Chevalier, I; Plöchl, E; Miziorko, H

1998-01-01

The hereditary deficiency of 3-hydroxy-3-methylglutaryl (HMG) CoA lyase (HL; OMIM 246450 [http://www3.ncbi.nlm.nih. gov:80/htbin-post/Omim/dispmim?246450]) results in episodes of hypoketotic hypoglycemia and coma and is reported to be frequent and clinically severe in Saudi Arabia. We found genetic diversity among nine Saudi HL-deficient probands: six were homozygous for the missense mutation R41Q, and two were homozygous for the frameshift mutation F305fs(-2). In 32 non-Saudi HL-deficient probands, we found three R41Q alleles and also discovered four other deleterious point mutations in codons 41 and 42: R41X, D42E, D42G, and D42H. In purified mutant recombinant HL, all four missense mutations in codons 41 and 42 cause a marked decrease in HL activity. We developed a screening procedure for HL missense mutations that yields residual activity at levels comparable to those obtained using purified HL peptides. Codons 41 and 42 are important for normal HL catalysis and account for a disproportionate 21 (26%) of 82 of mutant alleles in our group of HL-deficient probands. PMID:9463337

[Novel CHST6 compound heterozygous mutations cause macular corneal dystrophy in a Chinese family].

PubMed

Qi, Yan-hua; Dang, Xiu-hong; Su, Hong; Zhou, Nan; Liang, Ting; Wang, Zheng; Huang, Shang-zhi

2010-02-01

The aim of this study was to identify mutations of CHST6 gene in a Chinese family with macular corneal dystrophy (MCD) and to investigate the histopathological changes of MCD. Corneal button of the proband was obtained from penetrating keratoplasty for the treatment of severe corneal dystrophy. The sections and ultrathin sections of this specimen were examined under light microscope and transmission electron microscope (TEM). Genomic DNA was extracted from leukocytes in peripheral blood from the family members. The coding region of CHST6 was amplified by polymerase chain reaction (PCR). The PCR products were analyzed by direct sequencing and restriction enzyme digestion. Histochemical study revealed positive results of colloidal iron stain. TEM revealed enlargement of smooth endoplasmic reticulum and the presence of intracytoplasmic vacuoles. Two mutations, Q298X Y358H, were identified in exon 3 of CHST6. Three patients were compound heterozygotes of these two mutations. The C892T transversion occurred at codon 298 turned the codon of glutamine to a stop codon; the T1072C transversion occurred at codon 358 caused a missense mutation, tyrosine to histidine. All six unaffected family members were heterozygotes. These two mutations were not detected in any of the 100 control subjects. The novel compound heterozygous mutation results in loss of CHST6 function and causes the occurrence of MCD. This is the first report of this gene mutation.

Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

PubMed

Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

2012-01-01

Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

SENCA: A Multilayered Codon Model to Study the Origins and Dynamics of Codon Usage

PubMed Central

Pouyet, Fanny; Bailly-Bechet, Marc; Mouchiroud, Dominique; Guéguen, Laurent

2016-01-01

Gene sequences are the target of evolution operating at different levels, including the nucleotide, codon, and amino acid levels. Disentangling the impact of those different levels on gene sequences requires developing a probabilistic model with three layers. Here we present SENCA (site evolution of nucleotides, codons, and amino acids), a codon substitution model that separately describes 1) nucleotide processes which apply on all sites of a sequence such as the mutational bias, 2) preferences between synonymous codons, and 3) preferences among amino acids. We argue that most synonymous substitutions are not neutral and that SENCA provides more accurate estimates of selection compared with more classical codon sequence models. We study the forces that drive the genomic content evolution, intraspecifically in the core genome of 21 prokaryotes and interspecifically for five Enterobacteria. We retrieve the existence of a universal mutational bias toward AT, and that taking into account selection on synonymous codon usage has consequences on the measurement of selection on nonsynonymous substitutions. We also confirm that codon usage bias is mostly driven by selection on preferred codons. We propose new summary statistics to measure the relative importance of the different evolutionary processes acting on sequences. PMID:27401173

Mutational landscape of a chemically-induced mouse model of liver cancer.

PubMed

Connor, Frances; Rayner, Tim F; Aitken, Sarah J; Feig, Christine; Lukk, Margus; Santoyo-Lopez, Javier; Odom, Duncan T

2018-06-26

Carcinogen-induced mouse models of liver cancer are used extensively to study pathogenesis of the disease and have a critical role in validating candidate therapeutics. These models can recapitulate molecular and histological features of human disease. However, it is not known if the genomic alterations driving these mouse tumour genomes are comparable to those found in human tumours. Here, we provide a detailed genomic characterisation of tumours from a commonly used mouse model of hepatocellular carcinoma (HCC). We analysed whole exome sequences of liver tumours arising in mice exposed to diethylnitrosamine (DEN). DEN-initiated tumours had a high, uniform number of somatic single nucleotide variants (SNVs), with few insertions, deletions or copy number alterations, consistent with the known genotoxic action of DEN. Exposure of hepatocytes to DEN left a reproducible mutational imprint in resulting tumour exomes which we could computationally reconstruct using six known COSMIC mutational signatures. The tumours carried a high diversity of low-incidence, non-synonymous point mutations in many oncogenes and tumour suppressors, reflecting the stochastic introduction of SNVs into the hepatocyte genome by the carcinogen. We identified four recurrently mutated genes that were putative oncogenic drivers of HCC in this model. Every neoplasm carried activating hotspot mutations either in codon 61 of Hras, in codon 584 of Braf or in codon 254 of Egfr. Truncating mutations of Apc occurred in 21% of neoplasms, which were exclusively carcinomas supporting a role for deregulation of Wnt/β-catenin signalling in cancer progression. Our study provides detailed insight into the mutational landscape of tumours arising in a commonly-used carcinogen model of HCC, facilitating the future use of this model to understand the human disease. Mouse models are widely used to study the biology of cancer and to test potential therapies. Here, we have described the mutational landscape of tumours arising in a carcinogen-induced mouse model of liver cancer. Since cancer is a disease caused by genomic alterations, information about the patterns and types of mutations in the tumours in this mouse model should facilitate its use to study human liver cancer. Copyright © 2018 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Pre-trial inter-laboratory analytical validation of the FOCUS4 personalised therapy trial.

PubMed

Richman, Susan D; Adams, Richard; Quirke, Phil; Butler, Rachel; Hemmings, Gemma; Chambers, Phil; Roberts, Helen; James, Michelle D; Wozniak, Sue; Bathia, Riya; Pugh, Cheryl; Maughan, Timothy; Jasani, Bharat

2016-01-01

Molecular characterisation of tumours is increasing personalisation of cancer therapy, tailored to an individual and their cancer. FOCUS4 is a molecularly stratified clinical trial for patients with advanced colorectal cancer. During an initial 16-week period of standard first-line chemotherapy, tumour tissue will undergo several molecular assays, with the results used for cohort allocation, then randomisation. Laboratories in Leeds and Cardiff will perform the molecular testing. The results of a rigorous pre-trial inter-laboratory analytical validation are presented and discussed. Wales Cancer Bank supplied FFPE tumour blocks from 97 mCRC patients with consent for use in further research. Both laboratories processed each sample according to an agreed definitive FOCUS4 laboratory protocol, reporting results directly to the MRC Trial Management Group for independent cross-referencing. Pyrosequencing analysis of mutation status at KRAS codons12/13/61/146, NRAS codons12/13/61, BRAF codon600 and PIK3CA codons542/545/546/1047, generated highly concordant results. Two samples gave discrepant results; in one a PIK3CA mutation was detected only in Leeds, and in the other, a PIK3CA mutation was only detected in Cardiff. pTEN and mismatch repair (MMR) protein expression was assessed by immunohistochemistry (IHC) resulting in 6/97 discordant results for pTEN and 5/388 for MMR, resolved upon joint review. Tumour heterogeneity was likely responsible for pyrosequencing discrepancies. The presence of signet-ring cells, necrosis, mucin, edge-effects and over-counterstaining influenced IHC discrepancies. Pre-trial assay analytical validation is essential to ensure appropriate selection of patients for targeted therapies. This is feasible for both mutation testing and immunohistochemical assays and must be built into the workup of such trials. ISRCTN90061564. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Codon usage bias in phylum Actinobacteria: relevance to environmental adaptation and host pathogenicity.

PubMed

Lal, Devi; Verma, Mansi; Behura, Susanta K; Lal, Rup

2016-10-01

Actinobacteria are Gram-positive bacteria commonly found in soil, freshwater and marine ecosystems. In this investigation, bias in codon usages of ninety actinobacterial genomes was analyzed by estimating different indices of codon bias such as Nc (effective number of codons), SCUO (synonymous codon usage order), RSCU (relative synonymous codon usage), as well as sequence patterns of codon contexts. The results revealed several characteristic features of codon usage in Actinobacteria, as follows: 1) C- or G-ending codons are used frequently in comparison with A- and U ending codons; 2) there is a direct relationship of GC content with use of specific amino acids such as alanine, proline and glycine; 3) there is an inverse relationship between GC content and Nc estimates, 4) there is low SCUO value (<0.5) for most genes; and 5) GCC-GCC, GCC-GGC, GCC-GAG and CUC-GAC are the frequent context sequences among codons. This study highlights the fact that: 1) in Actinobacteria, extreme GC content and codon bias are driven by mutation rather than natural selection; (2) traits like aerobicity are associated with effective natural selection and therefore low GC content and low codon bias, demonstrating the role of both mutational bias and translational selection in shaping the habitat and phenotype of actinobacterial species. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Mitochondrial genetic codes evolve to match amino acid requirements of proteins.

PubMed

Swire, Jonathan; Judson, Olivia P; Burt, Austin

2005-01-01

Mitochondria often use genetic codes different from the standard genetic code. Now that many mitochondrial genomes have been sequenced, these variant codes provide the first opportunity to examine empirically the processes that produce new genetic codes. The key question is: Are codon reassignments the sole result of mutation and genetic drift? Or are they the result of natural selection? Here we present an analysis of 24 phylogenetically independent codon reassignments in mitochondria. Although the mutation-drift hypothesis can explain reassignments from stop to an amino acid, we found that it cannot explain reassignments from one amino acid to another. In particular--and contrary to the predictions of the mutation-drift hypothesis--the codon involved in such a reassignment was not rare in the ancestral genome. Instead, such reassignments appear to take place while the codon is in use at an appreciable frequency. Moreover, the comparison of inferred amino acid usage in the ancestral genome with the neutral expectation shows that the amino acid gaining the codon was selectively favored over the amino acid losing the codon. These results are consistent with a simple model of weak selection on the amino acid composition of proteins in which codon reassignments are selected because they compensate for multiple slightly deleterious mutations throughout the mitochondrial genome. We propose that the selection pressure is for reduced protein synthesis cost: most reassignments give amino acids that are less expensive to synthesize. Taken together, our results strongly suggest that mitochondrial genetic codes evolve to match the amino acid requirements of proteins.

Mutations in the sigma subunit of E. coli RNA polymerase which affect positive control of transcription.

PubMed

Hu, J C; Gross, C A

1985-01-01

The sigma subunits of bacterial RNA polymerases are required for the selective initiation of transcription. We have isolated and characterized mutations in rpoD, the gene which encodes the major form of sigma in E. coli, which affect the selectivity of transcription. These mutations increase the expression of araBAD up to 12-fold in the absence of CAP-cAMP. Expression of lac is unaffected, while expression of malT-activated operons is decreased. We determined the DNA sequence of 17 independently isolated mutations, and found that they consist of three different changes in a single CGC arginine codon at position 596 in the sigma polypeptide.

HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove

PubMed Central

Filbin, Megan E.; Kieft, Jeffrey S.

2011-01-01

Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem–loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem–loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis. PMID:21606179

HCV IRES domain IIb affects the configuration of coding RNA in the 40S subunit's decoding groove.

PubMed

Filbin, Megan E; Kieft, Jeffrey S

2011-07-01

Hepatitis C virus (HCV) uses a structured internal ribosome entry site (IRES) RNA to recruit the translation machinery to the viral RNA and begin protein synthesis without the ribosomal scanning process required for canonical translation initiation. Different IRES structural domains are used in this process, which begins with direct binding of the 40S ribosomal subunit to the IRES RNA and involves specific manipulation of the translational machinery. We have found that upon initial 40S subunit binding, the stem-loop domain of the IRES that contains the start codon unwinds and adopts a stable configuration within the subunit's decoding groove. This configuration depends on the sequence and structure of a different stem-loop domain (domain IIb) located far from the start codon in sequence, but spatially proximal in the IRES•40S complex. Mutation of domain IIb results in misconfiguration of the HCV RNA in the decoding groove that includes changes in the placement of the AUG start codon, and a substantial decrease in the ability of the IRES to initiate translation. Our results show that two distal regions of the IRES are structurally communicating at the initial step of 40S subunit binding and suggest that this is an important step in driving protein synthesis.

Capturing the metabolomic diversity of KRAS mutants in non-small-cell lung cancer cells

PubMed Central

Marabese, Mirko; Broggini, Massimo; Pastorelli, Roberta

2014-01-01

In non-small-cell lung cancer (NSCLC), one-fifth of patients have KRAS mutations, which are considered a negative predictive factor to first-line therapy. Evidence is emerging that not all KRAS mutations have the same biological activities and possible remodeling of cell metabolism by KRAS activation might complicate the scenario. An open question is whether different KRAS mutations at codon-12 affect cellular metabolism differently with possible implications for different responses to cancer treatments. We applied an explorative mass spectrometry-based untargeted metabolomics strategy to characterize the largest possible number of metabolites that might distinguish isogenic NSCLC cells overexpressing mutated forms of KRAS at codon-12 (G12C, G12D, G12V) and the wild-type. The glutamine deprivation assay and real-time PCR were used to confirm the involvement of some of the metabolic pathways highlighted. Cell clones indicated distinct metabolomic profiles in KRAS wild-type and mutants. Clones harboring different KRAS mutations at codon-12 also had different metabolic remodeling, such as a different redox buffering system and different glutamine-dependency not driven by the transcriptional state of enzymes involved in glutaminolysis. These findings indicate that KRAS mutations at codon-12 are associated with different metabolomic profiles that might affect the responses to cancer treatments. PMID:24952473

Genotyping of K-ras codons 12 and 13 mutations in colorectal cancer by capillary electrophoresis.

PubMed

Chen, Yen-Ling; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei

2009-06-26

Point mutations of the K-ras gene located in codons 12 and 13 cause poor responses to the anti-epidermal growth factor receptor (anti-EGFR) therapy of colorectal cancer (CRC) patients. Besides, mutations of K-ras gene have also been proven to play an important role in human tumor progression. We established a simple and effective capillary electrophoresis (CE) method for simultaneous point mutation detection in codons 12 and 13 of K-ras gene. We combined one universal fluorescence-based nonhuman-sequence primer and two fragment-oriented primers in one tube, and performed this two-in-one polymerase chain reaction (PCR). PCR fragments included wild type and seven point mutations at codons 12 and 13 of K-ras gene. The amplicons were analyzed by single-strand conformation polymorphism (SSCP)-CE method. The CE analysis was performed by using a 1x Tris-borate-EDTA (TBE) buffer containing 1.5% (w/v) hydroxyethylcellulose (HEC) (MW 250,000) under reverse polarity with 15 degrees C and 30 degrees C. Ninety colorectal cancer patients were blindly genotyped using this developed method. The results showed good agreement with those of DNA sequencing method. The SSCP-CE was feasible for mutation screening of K-ras gene in populations.

Conserved nonsense-prone CpG sites in apoptosis-regulatory genes: conditional stop signs on the road to cell death.

PubMed

Zhao, Yongzhong; Epstein, Richard J

2013-01-01

Methylation-prone CpG dinucleotides are strongly conserved in the germline, yet are also predisposed to somatic mutation. Here we quantify the relationship between germline codon mutability and somatic carcinogenesis by comparing usage of the nonsense-prone CGA (→TGA) codons in gene groups that differ in apoptotic function; to this end, suppressor genes were subclassified as either apoptotic (gatekeepers) or repair (caretakers). Mutations affecting CGA codons in sporadic tumors proved to be highly asymmetric. Moreover, nonsense mutations were 3-fold more likely to affect gatekeepers than caretakers. In addition, intragenic CGA clustering nonrandomly affected functionally critical regions of gatekeepers. We conclude that human gatekeeper suppressor genes are enriched for nonsense-prone codons, and submit that this germline vulnerability to tumors could reflect in utero selection for a methylation-dependent capability to short-circuit environmental insults that otherwise trigger apoptosis and fetal loss.

Characterization of the porcine epidemic diarrhea virus codon usage bias.

PubMed

Chen, Ye; Shi, Yuzhen; Deng, Hongjuan; Gu, Ting; Xu, Jian; Ou, Jinxin; Jiang, Zhiguo; Jiao, Yiren; Zou, Tan; Wang, Chong

2014-12-01

Porcine epidemic diarrhea virus (PEDV) has been responsible for several recent outbreaks of porcine epidemic diarrhea (PED) and has caused great economic loss in the swine-raising industry. Considering the significance of PEDV, a systemic analysis was performed to study its codon usage patterns. The relative synonymous codon usage value of each codon revealed that codon usage bias exists and that PEDV tends to use codons that end in T. The mean ENC value of 47.91 indicates that the codon usage bias is low. However, we still wanted to identify the cause of this codon usage bias. A correlation analysis between the codon compositions (A3s, T3s, G3s, C3s, and GC3s), the ENC values, and the nucleotide contents (A%, T%, G%, C%, and GC%) indicated that mutational bias plays role in shaping the PEDV codon usage bias. This was further confirmed by a principal component analysis between the codon compositions and the axis values. Using the Gravy, Aroma, and CAI values, a role of natural selection in the PEDV codon usage pattern was also identified. Neutral analysis indicated that natural selection pressure plays a more important role than mutational bias in codon usage bias. Natural selection also plays an increasingly significant role during PEDV evolution. Additionally, gene function and geographic distribution also influence the codon usage bias to a degree. Copyright © 2014 Elsevier B.V. All rights reserved.

UPF1 silenced cellular model systems for screening of read-through agents active on β039 thalassemia point mutation.

PubMed

Salvatori, Francesca; Pappadà, Mariangela; Breveglieri, Giulia; D'Aversa, Elisabetta; Finotti, Alessia; Lampronti, Ilaria; Gambari, Roberto; Borgatti, Monica

2018-05-15

Nonsense mutations promote premature translational termination, introducing stop codons within the coding region of mRNAs and causing inherited diseases, including thalassemia. For instance, in β 0 39 thalassemia the CAG (glutamine) codon is mutated to the UAG stop codon, leading to premature translation termination and to mRNA destabilization through the well described NMD (nonsense-mediated mRNA decay). In order to develop an approach facilitating translation and, therefore, protection from NMD, ribosomal read-through molecules, such as aminoglycoside antibiotics, have been tested on mRNAs carrying premature stop codons. These findings have introduced new hopes for the development of a pharmacological approach to the β 0 39 thalassemia therapy. While several strategies, designed to enhance translational read-through, have been reported to inhibit NMD efficiency concomitantly, experimental tools for systematic analysis of mammalian NMD inhibition by translational read-through are lacking. We developed a human cellular model of the β 0 39 thalassemia mutation with UPF-1 suppressed and showing a partial NMD suppression. This novel cellular model could be used for the screening of molecules exhibiting preferential read-through activity allowing a great rescue of the mutated transcripts.

Coexistence of two different mutations in codon 12 of the Kras gene in colorectal cancer: Report of a case supporting the concept of tumoral heterogeneity.

PubMed

Improta, Giuseppina; Zupa, Angela; Possidente, Luciana; Tartarone, Alfredo; Pedicini, Piernicola; Nappi, Antonio; Molinari, Sergio; Fraggetta, Filippo; Vita, Giulia

2013-05-01

Evaluation of the mutational status of KRAS is a crucial step for the correct therapeutic approach in treating advanced colorectal cancer as the identification of wild-type KRAS tumors leads to more specific and less toxic treatments for patients. Although several studies have highlighted the differences between primary and metastatic tumors, the possibility of two or more mutations in the same codon has seldom been reported. The present study reports an additional case of an advanced adenocarcinoma of the colon showing two somatic mutations (p.G12D and p.G12V) in the same codon (codon 12) of exon 2 of the KRAS gene, thus supporting the possibility of two differing clonal origins of the tumor. Although the clinical significance of multiple mutations remains unknown at present, based on the limited data available in the literature, this rare event appears to be associated with a more aggressive disease, as in the present case. This case report demonstrates the existence of intratumoral heterogeneity and the coexistence of distinct clones within a tumor that may have profound clinical implications for disease progression and therapeutic responses.

Nuclear expression and gain-of-function β-catenin mutation in glomangiopericytoma (sinonasal-type hemangiopericytoma): insight into pathogenesis and a diagnostic marker.

PubMed

Lasota, Jerzy; Felisiak-Golabek, Anna; Aly, F Zahra; Wang, Zeng-Feng; Thompson, Lester D R; Miettinen, Markku

2015-05-01

Glomangiopericytoma (sinonasal-type hemangiopericytoma) is a rare mesenchymal neoplasm with myoid phenotype (smooth muscle actin-positive), which distinguishes this tumor from soft tissue hemangiopericytoma/solitary fibrous tumor. Molecular genetic changes underlying the pathogenesis of glomangiopericytoma are not known. In this study, 13 well-characterized glomangiopericytomas were immunohistochemically evaluated for β-catenin expression. All analyzed tumors showed strong expression and nuclear accumulation of β-catenin. Following this observation, β-catenin glycogen serine kinase-3 beta phosphorylation region, encoded by exon 3, was PCR amplified in all cases and evaluated for mutations using Sanger sequencing. Heterozygous mutations were identified in 12 of 13 tumors. All mutations consisted of single-nucleotide substitutions: three in codon 32 (c.94G>C (n=2) and c.95A>T), four in codon 33 (two each c.98C>G and c.98C>T), two in codon 37 (c.109T>G), one in codon 41 (c.121A>G), and two in codon 45 (c.133T>C). At the protein level, these substitutions would lead to p.D32H, p.D32V, p.S33C, p.S33F, p.S37A, p.T41A, and p.S45L mutations, respectively. Previously, similar mutations have been reported in different types of cancers and shown to trigger activation of β-catenin signaling. All analyzed glomangiopericytomas showed prominent nuclear expression of cyclin D1, as previously shown for tumors with nuclear expression of β-catenin as a sign of oncogenic activation. These results demonstrate that mutational activation of β-catenin and associated cyclin D1 overexpression may be central events in the pathogenesis of glomangiopericytoma. In additon, nuclear accumulation of β-catenin is a diagnostic marker for glomangiopericytoma.

Multiple Evolutionary Selections Involved in Synonymous Codon Usages in the Streptococcus agalactiae Genome.

PubMed

Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Liu, Zhen-Xing; Hao, Le; Ma, Jiang-Yao; Li, Yu-Gu

2016-02-24

Streptococcus agalactiae is an important human and animal pathogen. To better understand the genetic features and evolution of S. agalactiae, multiple factors influencing synonymous codon usage patterns in S. agalactiae were analyzed in this study. A- and U-ending rich codons were used in S. agalactiae function genes through the overall codon usage analysis, indicating that Adenine (A)/Thymine (T) compositional constraints might contribute an important role to the synonymous codon usage pattern. The GC3% against the effective number of codon (ENC) value suggested that translational selection was the important factor for codon bias in the microorganism. Principal component analysis (PCA) showed that (i) mutational pressure was the most important factor in shaping codon usage of all open reading frames (ORFs) in the S. agalactiae genome; (ii) strand specific mutational bias was not capable of influencing the codon usage bias in the leading and lagging strands; and (iii) gene length was not the important factor in synonymous codon usage pattern in this organism. Additionally, the high correlation between tRNA adaptation index (tAI) value and codon adaptation index (CAI), frequency of optimal codons (Fop) value, reinforced the role of natural selection for efficient translation in S. agalactiae. Comparison of synonymous codon usage pattern between S. agalactiae and susceptible hosts (human and tilapia) showed that synonymous codon usage of S. agalactiae was independent of the synonymous codon usage of susceptible hosts. The study of codon usage in S. agalactiae may provide evidence about the molecular evolution of the bacterium and a greater understanding of evolutionary relationships between S. agalactiae and its hosts.

Multiple Evolutionary Selections Involved in Synonymous Codon Usages in the Streptococcus agalactiae Genome

PubMed Central

Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Liu, Zhen-Xing; Hao, Le; Ma, Jiang-Yao; Li, Yu-Gu

2016-01-01

Streptococcus agalactiae is an important human and animal pathogen. To better understand the genetic features and evolution of S. agalactiae, multiple factors influencing synonymous codon usage patterns in S. agalactiae were analyzed in this study. A- and U-ending rich codons were used in S. agalactiae function genes through the overall codon usage analysis, indicating that Adenine (A)/Thymine (T) compositional constraints might contribute an important role to the synonymous codon usage pattern. The GC3% against the effective number of codon (ENC) value suggested that translational selection was the important factor for codon bias in the microorganism. Principal component analysis (PCA) showed that (i) mutational pressure was the most important factor in shaping codon usage of all open reading frames (ORFs) in the S. agalactiae genome; (ii) strand specific mutational bias was not capable of influencing the codon usage bias in the leading and lagging strands; and (iii) gene length was not the important factor in synonymous codon usage pattern in this organism. Additionally, the high correlation between tRNA adaptation index (tAI) value and codon adaptation index (CAI), frequency of optimal codons (Fop) value, reinforced the role of natural selection for efficient translation in S. agalactiae. Comparison of synonymous codon usage pattern between S. agalactiae and susceptible hosts (human and tilapia) showed that synonymous codon usage of S. agalactiae was independent of the synonymous codon usage of susceptible hosts. The study of codon usage in S. agalactiae may provide evidence about the molecular evolution of the bacterium and a greater understanding of evolutionary relationships between S. agalactiae and its hosts. PMID:26927064

Large-scale analyses of synonymous substitution rates can be sensitive to assumptions about the process of mutation.

PubMed

Aris-Brosou, Stéphane; Bielawski, Joseph P

2006-08-15

A popular approach to examine the roles of mutation and selection in the evolution of genomes has been to consider the relationship between codon bias and synonymous rates of molecular evolution. A significant relationship between these two quantities is taken to indicate the action of weak selection on substitutions among synonymous codons. The neutral theory predicts that the rate of evolution is inversely related to the level of functional constraint. Therefore, selection against the use of non-preferred codons among those coding for the same amino acid should result in lower rates of synonymous substitution as compared with sites not subject to such selection pressures. However, reliably measuring the extent of such a relationship is problematic, as estimates of synonymous rates are sensitive to our assumptions about the process of molecular evolution. Previous studies showed the importance of accounting for unequal codon frequencies, in particular when synonymous codon usage is highly biased. Yet, unequal codon frequencies can be modeled in different ways, making different assumptions about the mutation process. Here we conduct a simulation study to evaluate two different ways of modeling uneven codon frequencies and show that both model parameterizations can have a dramatic impact on rate estimates and affect biological conclusions about genome evolution. We reanalyze three large data sets to demonstrate the relevance of our results to empirical data analysis.

A mutated hygromycin resistance gene is functional in the n-alkane-assimilating yeast Candida tropicalis.

PubMed

Hara, A; Ueda, M; Misawa, S; Matsui, T; Furuhashi, K; Tanaka, A

2000-03-01

Development of a transformation system in the n-alkane-assimilating diploid yeast Candida tropicalis requires an antibiotic resistance gene in order to establish a selectable marker. The resistance gene for hygromycin B has often been used as a selectable marker in yeast transformation. However, C. tropicalis harboring the hygromycin resistance gene (HYG) was as sensitive to hygromycin B as the wild-type strain. Nine CTG codons were found in the ORF of the HYG gene. This codon has been reported to be translated as serine rather than leucine in Candida species. Analysis of the tRNA gene in C. tropicalis with the anticodon CAG [tRNA(CAG) gene], which is complementary to the codon CTG, showed that the sequence was highly similar to that of the C. maltosa tRNA(CAG) gene. In C. maltosa, the codon CTG is read as serine and not leucine. These results suggested that the HYG gene was not functional due to the nonuniversal usage of the CTG codon. Each of the nine CTG codons in the ORF of the HYG gene was changed to a CTC codon, which is read as leucine, by site-directed mutagenesis. When a plasmid containing the mutated HYG gene (HYG#) was constructed and introduced into C. tropicalis, hygromycin-resistant transformants were successfully obtained. This mutated hygromycin resistance gene may be useful for direct selection of C. tropicalis transformants.

Base damage, local sequence context and TP53 mutation hotspots: a molecular dynamics study of benzo[a]pyrene induced DNA distortion and mutability

PubMed Central

Menzies, Georgina E.; Reed, Simon H.; Brancale, Andrea; Lewis, Paul D.

2015-01-01

The mutational pattern for the TP53 tumour suppressor gene in lung tumours differs to other cancer types by having a higher frequency of G:C>T:A transversions. The aetiology of this differing mutation pattern is still unknown. Benzo[a]pyrene,diol epoxide (BPDE) is a potent cigarette smoke carcinogen that forms guanine adducts at TP53 CpG mutation hotspot sites including codons 157, 158, 245, 248 and 273. We performed molecular modelling of BPDE-adducted TP53 duplex sequences to determine the degree of local distortion caused by adducts which could influence the ability of nucleotide excision repair. We show that BPDE adducted codon 157 has greater structural distortion than other TP53 G:C>T:A hotspot sites and that sequence context more distal to adjacent bases must influence local distortion. Using TP53 trinucleotide mutation signatures for lung cancer in smokers and non-smokers we further show that codons 157 and 273 have the highest mutation probability in smokers. Combining this information with adduct structural data we predict that G:C>T:A mutations at codon 157 in lung tumours of smokers are predominantly caused by BPDE. Our results provide insight into how different DNA sequence contexts show variability in DNA distortion at mutagen adduct sites that could compromise DNA repair at well characterized cancer related mutation hotspots. PMID:26400171

Codon 62 (GTG>GCG, Val→Ala) (α1) (HBA1: c.188T>C) causing nondeletional α-thalassemia in a Chinese family.

PubMed

Liao, Can; Tang, Hai-Shen; Li, Ru; Li, Dong-Zhi

2013-01-01

We report a novel α-globin gene point mutation detected during newborn screening for hemoglobinopathies. Sequence analyses identified a GTG>GCG substitution at codon 62 of the α1-globin gene. This mutation causes a silent α-thalassemia (α-thal).

Molecular spectrum of c-KIT and PDGFRA gene mutations in gastro intestinal stromal tumor: determination of frequency, distribution pattern and identification of novel mutations in Indian patients.

PubMed

Ahmad, Firoz; Lad, Purnima; Bhatia, Simi; Das, Bibhu Ranjan

2015-01-01

KIT and PDGFRA gene mutations are the major genetic alterations seen in gastrointestinal stromal tumors (GISTs) and are being used clinically for predicting response to imatinib therapy. In the current study, we set out to explore the frequency and distribution pattern of c-KIT (exons 9, 11 and 13) and PDGFRA (exons 12 and 18) by direct sequencing in a series of 70 Indian GIST cases. Overall, 27 (38.5 %) and 4 (5.7 %) of the cases had c-KIT and PDGFRA mutations, respectively. Majority of KIT mutations involved exon 11 (85.7 %), followed by exon 9 (14.3 %), while none showed exon 13 mutation. Most exon 9 mutations showed Ala503-Tyr504 duplication, while one had novel point mutation at codon 476 (S476G). In contrast to exon 9 mutations, most exon 11 mutations were in-frame deletions (79 %, 19/24), predominantly at codons 550-560, while remaining exon 11 mutant cases were point mutations at codons 559, 560, 568, 573 and 575. Interestingly, P573T, Q556_V560delinsH, Q575H and Q575_P577 were novel variations observed in exon 11. The PDGFRA mutations were seen mostly in exon 18, which showed point mutation at codon 842 (D842V), while exon 12 showed a novel indel variation (V561_H570delinsT). No significant correlation between c-KIT/PDGFRA mutations and clinicopathological data was observed. In conclusion, this study highlights the frequency and distribution pattern of c-KIT/PDGFRA mutation in Indian cohort. The current study identified novel variations that added new insights into the genetic heterogeneity of GIST patients. Furthermore, this is the first study to report the presence of PDGFRA mutation from Indian subcontinent.

Molecular screening of the Hbs Constant Spring (codon 142, TAA>CAA, α2) and Paksé (codon 142, TAA>TAT, α2) mutations in Thailand.

PubMed

Pichanun, Dalad; Munkongdee, Thongperm; Klamchuen, Sumonmaln; Butthep, Punnee; Winichagoon, Pranee; Fucharoen, Suthat; Svasti, Saovaros

2010-01-01

Hb Constant Spring [Hb CS, α142(H19)Term] and Hb Paksé [α142(H19)Term] occur from the mutation in the termination codon of the α2-globin gene, TAA>CAA (→Gln) and TAA>TAT (→Tyr), respectively. They are the most common nondeletional α-thalassemia (α-thal) variants causing Hb H disease in Southeast Asia. In this study, 587 cord blood samples were screened for the Hb CS and Hb Paksé mutations by a dot-blot hybridization technique using oligonucleotide probes specific for each mutation. The results showed that the prevalence of Hb CS and Hb Paksé in Central Thailand are 5.80 and 0.51%, respectively, which is in concordance with the results from previous studies.

Mutation Analysis of KRAS and BRAF Genes in Metastatic Colorectal Cancer: a First Large Scale Study from Iran.

PubMed

Koochak, Aghigh; Rakhshani, Nasser; Karbalaie Niya, Mohammad Hadi; Tameshkel, Fahimeh Safarnezhad; Sohrabi, Masoud Reza; Babaee, Mohammad Reza; Rezvani, Hamid; Bahar, Babak; Imanzade, Farid; Zamani, Farhad; Khonsari, Mohammad Reza; Ajdarkosh, Hossein; Hemmasi, Gholamreza

2016-01-01

The investigation of mutation patterns in oncogenes potentially can make available a reliable mechanism for management and treatment decisions for patients with colorectal cancer (CRC). This study concerns the rate of KRAS and BRAF genes mutations in Iranian metastatic colorectal cancer (mCRC) patients, as well as associations of genotypes with clinicopathological features. A total of 1,000 mCRC specimens collected from 2008 to 2012 that referred to the Mehr Hospital and Partolab center, Tehran, Iran enrolled in this cross sectional study. Using HRM, Dxs Therascreen and Pyrosequencing methods, we analyzed the mutational status of KRAS and BRAF genes in these. KRAS mutations were present in 33.6% cases (n=336). Of KRAS mutation positive cases, 85.1% were in codon 12 and 14.9% were in codon 13. The most frequent mutation at KRAS codon 12 was Gly12Asp; BRAF mutations were not found in any mCRC patients (n=242). In addition, we observed a strong correlation of KRAS mutations with some clinicopathological characteristics. KRAS mutations are frequent in mCRCs while presence of BRAF mutations in these patients is rare. Moreover, associations of KRAS genotypes with non-mucinous adenocarcinoma and depth of invasion (pT3) were remarkable.

Immune-escape mutations and stop-codons in HBsAg develop in a large proportion of patients with chronic HBV infection exposed to anti-HBV drugs in Europe.

PubMed

Colagrossi, Luna; Hermans, Lucas E; Salpini, Romina; Di Carlo, Domenico; Pas, Suzan D; Alvarez, Marta; Ben-Ari, Ziv; Boland, Greet; Bruzzone, Bianca; Coppola, Nicola; Seguin-Devaux, Carole; Dyda, Tomasz; Garcia, Federico; Kaiser, Rolf; Köse, Sukran; Krarup, Henrik; Lazarevic, Ivana; Lunar, Maja M; Maylin, Sarah; Micheli, Valeria; Mor, Orna; Paraschiv, Simona; Paraskevis, Dimitros; Poljak, Mario; Puchhammer-Stöckl, Elisabeth; Simon, François; Stanojevic, Maja; Stene-Johansen, Kathrine; Tihic, Nijaz; Trimoulet, Pascale; Verheyen, Jens; Vince, Adriana; Lepej, Snjezana Zidovec; Weis, Nina; Yalcinkaya, Tülay; Boucher, Charles A B; Wensing, Annemarie M J; Perno, Carlo F; Svicher, Valentina

2018-06-01

HBsAg immune-escape mutations can favor HBV-transmission also in vaccinated individuals, promote immunosuppression-driven HBV-reactivation, and increase fitness of drug-resistant strains. Stop-codons can enhance HBV oncogenic-properties. Furthermore, as a consequence of the overlapping structure of HBV genome, some immune-escape mutations or stop-codons in HBsAg can derive from drug-resistance mutations in RT. This study is aimed at gaining insight in prevalence and characteristics of immune-associated escape mutations, and stop-codons in HBsAg in chronically HBV-infected patients experiencing nucleos(t)ide analogues (NA) in Europe. This study analyzed 828 chronically HBV-infected European patients exposed to ≥ 1 NA, with detectable HBV-DNA and with an available HBsAg-sequence. The immune-associated escape mutations and the NA-induced immune-escape mutations sI195M, sI196S, and sE164D (resulting from drug-resistance mutation rtM204 V, rtM204I, and rtV173L) were retrieved from literature and examined. Mutations were defined as an aminoacid substitution with respect to a genotype A or D reference sequence. At least one immune-associated escape mutation was detected in 22.1% of patients with rising temporal-trend. By multivariable-analysis, genotype-D correlated with higher selection of ≥ 1 immune-associated escape mutation (OR[95%CI]:2.20[1.32-3.67], P = 0.002). In genotype-D, the presence of ≥ 1 immune-associated escape mutations was significantly higher in drug-exposed patients with drug-resistant strains than with wild-type virus (29.5% vs 20.3% P = 0.012). Result confirmed by analysing drug-naïve patients (29.5% vs 21.2%, P = 0.032). Strong correlation was observed between sP120T and rtM204I/V (P < 0.001), and their co-presence determined an increased HBV-DNA. At least one NA-induced immune-escape mutation occurred in 28.6% of patients, and their selection correlated with genotype-A (OR[95%CI]:2.03[1.32-3.10],P = 0.001). Finally, stop-codons are present in 8.4% of patients also at HBsAg-positions 172 and 182, described to enhance viral oncogenic-properties. Immune-escape mutations and stop-codons develop in a large fraction of NA-exposed patients from Europe. This may represent a potential threat for horizontal and vertical HBV transmission also to vaccinated persons, and fuel drug-resistance emergence.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baserga, S.J.; Benz, E.J. Jr.

A number of premature translation termination mutations (nonsense mutations) have been described in the human {alpha}- and {beta}-globin genes. Studies on mRNA isolated from patients with {beta}{sup 0}-thalassemia have shown that for both the {beta}-17 and the {beta}-39 mutations less than normal levels of {beta}-globin mRNA accumulate in peripheral blood cells. (The codon at which the mutation occurs designates the name of the mutation; there are 146 codons in human {beta}-globin mRNA). In vitro studies using the cloned {beta}-39 gene have reproduced this effect in a heterologous transfection system and have suggested that the defect resides in intranuclear metabolism. Themore » authors have asked if this phenomenon of decreased mRNA accumulation is a general property of nonsense mutations and if the effect depends on the location or the type of mutation. Toward this end, they have studied the effect of five nonsense mutations and two missense mutations on the expression of human {beta}-globin mRNA in a heterologous transfection system. In all cases studied, the presence of a translation termination codon correlates with a decrease in the steady-state level of mRNA. The data suggest that the metabolism of a mammalian mRNA is affected by the presence of a mutation that affects translation.« less

The detection of pfcrt and pfmdr1 point mutations as molecular markers of chloroquine drug resistance, Pahang, Malaysia

PubMed Central

2012-01-01

Background Malaria is still a public health problem in Malaysia with chloroquine (CQ) being the first-line drug in the treatment policy of uncomplicated malaria. There is a scarcity in information about the magnitude of Plasmodium falciparum CQ resistance. This study aims to investigate the presence of single point mutations in the P. falciparum chloroquine-resistance transporter gene (pfcrt) at codons 76, 271, 326, 356 and 371 and in P. falciparum multi-drug resistance-1 gene (pfmdr1) at codons 86 and 1246, as molecular markers of CQ resistance. Methods A total of 75 P. falciparum blood samples were collected from different districts of Pahang state, Malaysia. Single nucleotide polymorphisms in pfcrt gene (codons 76, 271, 326, 356 and 371) and pfmdr1 gene (codons 86 and 1246) were analysed by using mutation-specific nested PCR and restriction fragment length polymorphism (PCR-RFLP) methods. Results Mutations of pfcrt K76T and pfcrt R371I were the most prevalent among pfcrt gene mutations reported by this study; 52% and 77%, respectively. Other codons of the pfcrt gene and the positions 86 and 1246 of the pfmdr1 gene were found mostly of wild type. Significant associations of pfcrt K76T, pfcrt N326S and pfcrt I356T mutations with parasitaemia were also reported. Conclusion The high existence of mutant pfcrt T76 may indicate the low susceptibility of P. falciparum isolates to CQ in Peninsular Malaysia. The findings of this study establish baseline data on the molecular markers of P. falciparum CQ resistance, which may help in the surveillance of drug resistance in Peninsular Malaysia. PMID:22853645

Introduction of a point mutation into the mouse genome by homologous recombination in embryonic stem cells using a replacement type vector with a selectable marker.

PubMed

Rubinstein, M; Japón, M A; Low, M J

1993-06-11

The introduction of small mutations instead of null alleles into the mouse genome has broad applications to the study of protein structure-function relationships and the creation of animal models of human genetic diseases. To test a simple mutational strategy we designed a targeting vector for the mouse proopiomelanocortin (POMC) gene containing a single nucleotide insertion that converts the initial tyrosine codon of beta-endorphin 1-31 to a premature translational termination codon and introduces a unique Hpal endonuclease restriction site. The targeting vector also contains a neo cassette immediately 3' to the last POMC exon and a herpes simplex virus thymidine kinase cassette to allow positive and negative selection. Homologous recombination occurred at a frequency of 1/30 clones of electroporated embryonic stem cells selected in G418 and gancyclovir. 10/11 clones identified initially by a polymerase chain reaction (PCR) strategy had the predicted structure without evidence of concatemer formation by Southern blot analysis. We used a combination of Hpa I digestion of PCR amplified fragments and direct nucleotide sequencing to further confirm that the point mutation was retained in 9/10 clones. The POMC gene was transcriptionally silent in embryonic stem cells and the targeted allele was not activated by the downstream phosphoglycerate kinase-1 promoter that transcribed the neo gene. Under the electroporation conditions used, we have demonstrated that a point mutation can be introduced with high efficiency and precision into the POMC gene using a replacement type vector containing a retained selectable marker without affecting expression of the allele in the embryonic stem cells. A similar strategy may be useful for a wide range of genes.

Introduction of a point mutation into the mouse genome by homologous recombination in embryonic stem cells using a replacement type vector with a selectable marker.

PubMed Central

Rubinstein, M; Japón, M A; Low, M J

1993-01-01

The introduction of small mutations instead of null alleles into the mouse genome has broad applications to the study of protein structure-function relationships and the creation of animal models of human genetic diseases. To test a simple mutational strategy we designed a targeting vector for the mouse proopiomelanocortin (POMC) gene containing a single nucleotide insertion that converts the initial tyrosine codon of beta-endorphin 1-31 to a premature translational termination codon and introduces a unique Hpal endonuclease restriction site. The targeting vector also contains a neo cassette immediately 3' to the last POMC exon and a herpes simplex virus thymidine kinase cassette to allow positive and negative selection. Homologous recombination occurred at a frequency of 1/30 clones of electroporated embryonic stem cells selected in G418 and gancyclovir. 10/11 clones identified initially by a polymerase chain reaction (PCR) strategy had the predicted structure without evidence of concatemer formation by Southern blot analysis. We used a combination of Hpa I digestion of PCR amplified fragments and direct nucleotide sequencing to further confirm that the point mutation was retained in 9/10 clones. The POMC gene was transcriptionally silent in embryonic stem cells and the targeted allele was not activated by the downstream phosphoglycerate kinase-1 promoter that transcribed the neo gene. Under the electroporation conditions used, we have demonstrated that a point mutation can be introduced with high efficiency and precision into the POMC gene using a replacement type vector containing a retained selectable marker without affecting expression of the allele in the embryonic stem cells. A similar strategy may be useful for a wide range of genes. Images PMID:8392702

Screening for mutations in exon 4 of the LDL receptor gene: identification of a new deletion mutation.

PubMed Central

Theart, L; Kotze, M J; Langenhoven, E; Loubser, O; Peeters, A V; Lintott, C J; Scott, R S

1995-01-01

DNA from 14 unrelated New Zealand familial hypercholesterolaemia (FH) heterozygotes, originating from the United Kingdom, was screened for mutations in exon 4 of the low density lipoprotein receptor (LDLR) gene. One patient was heterozygous for mutation D206E, which was initially identified in South Africa. The chromosomal background of this mutant allele was compatible with that described previously in Afrikaner and English patients, suggesting that this mutation originated in the United Kingdom. The 2 bp deletion in codon 206 and mutations D154N and D200G, previously reported in English FH patients, were not detected in this sample. In one of the patients, however, a new deletion of 7 bp was identified after nucleotide 581 (or 582) in exon 4 of the LDLR gene. Images PMID:7616546

Analysis of transcriptome data reveals multifactor constraint on codon usage in Taenia multiceps.

PubMed

Huang, Xing; Xu, Jing; Chen, Lin; Wang, Yu; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

2017-04-20

Codon usage bias (CUB) is an important evolutionary feature in genomes that has been widely observed in many organisms. However, the synonymous codon usage pattern in the genome of T. multiceps remains to be clarified. In this study, we analyzed the codon usage of T. multiceps based on the transcriptome data to reveal the constraint factors and to gain an improved understanding of the mechanisms that shape synonymous CUB. Analysis of a total of 8,620 annotated mRNA sequences from T. multiceps indicated only a weak codon bias, with mean GC and GC3 content values of 49.29% and 51.43%, respectively. Our analysis indicated that nucleotide composition, mutational pressure, natural selection, gene expression level, amino acids with grand average of hydropathicity (GRAVY) and aromaticity (Aromo) and the effective selection of amino-acids all contributed to the codon usage in T. multiceps. Among these factors, natural selection was implicated as the major factor affecting the codon usage variation in T. multiceps. The codon usage of ribosome genes was affected mainly by mutations, while the essential genes were affected mainly by selection. In addition, 21codons were identified as "optimal codons". Overall, the optimal codons were GC-rich (GC:AU, 41:22), and ended with G or C (except CGU). Furthermore, different degrees of variation in codon usage were found between T. multiceps and Escherichia coli, yeast, Homo sapiens. However, little difference was found between T. multiceps and Taenia pisiformis. In this study, the codon usage pattern of T. multiceps was analyzed systematically and factors affected CUB were also identified. This is the first study of codon biology in T. multiceps. Understanding the codon usage pattern in T. multiceps can be helpful for the discovery of new genes, molecular genetic engineering and evolutionary studies.

A Non-Canonical Initiation Site Is Required for Efficient Translation of the Dendritically Localized Shank1 mRNA

PubMed Central

Studtmann, Katrin; Ölschläger-Schütt, Janin; Buck, Friedrich; Richter, Dietmar; Sala, Carlo; Bockmann, Jürgen; Kindler, Stefan; Kreienkamp, Hans-Jürgen

2014-01-01

Local protein synthesis in dendrites enables neurons to selectively change the protein complement of individual postsynaptic sites. Though it is generally assumed that this mechanism requires tight translational control of dendritically transported mRNAs, it is unclear how translation of dendritic mRNAs is regulated. We have analyzed here translational control elements of the dendritically localized mRNA coding for the postsynaptic scaffold protein Shank1. In its 5′ region, the human Shank1 mRNA exhibits two alternative translation initiation sites (AUG+1 and AUG+214), three canonical upstream open reading frames (uORFs1-3) and a high GC content. In reporter assays, fragments of the 5′UTR with high GC content inhibit translation, suggesting a contribution of secondary structures. uORF3 is most relevant to translation control as it overlaps with the first in frame start codon (AUG+1), directing translation initiation to the second in frame start codon (AUG+214). Surprisingly, our analysis points to an additional uORF initiated at a non-canonical ACG start codon. Mutation of this start site leads to an almost complete loss of translation initiation at AUG+1, demonstrating that this unconventional uORF is required for Shank1 synthesis. Our data identify a novel mechanism whereby initiation at a non-canonical site allows for translation of the main Shank1 ORF despite a highly structured 5′UTR. PMID:24533096

Analysis of codon usage bias of envelope glycoprotein genes in nuclear polyhedrosis virus (NPV) and its relation to evolution.

PubMed

Zhao, Yongchao; Zheng, Hao; Xu, Anying; Yan, Donghua; Jiang, Zijian; Qi, Qi; Sun, Jingchen

2016-08-24

Analysis of codon usage bias is an extremely versatile method using in furthering understanding of the genetic and evolutionary paths of species. Codon usage bias of envelope glycoprotein genes in nuclear polyhedrosis virus (NPV) has remained largely unexplored at present. Hence, the codon usage bias of NPV envelope glycoprotein was analyzed here to reveal the genetic and evolutionary relationships between different viral species in baculovirus genus. A total of 9236 codons from 18 different species of NPV of the baculovirus genera were used to perform this analysis. Glycoprotein of NPV exhibits weaker codon usage bias. Neutrality plot analysis and correlation analysis of effective number of codons (ENC) values indicate that natural selection is the main factor influencing codon usage bias, and that the impact of mutation pressure is relatively smaller. Another cluster analysis shows that the kinship or evolutionary relationships of these viral species can be divided into two broad categories despite all of these 18 species are from the same baculovirus genus. There are many elements that can affect codon bias, such as the composition of amino acids, mutation pressure, natural selection, gene expression level, and etc. In the meantime, cluster analysis also illustrates that codon usage bias of virus envelope glycoprotein can serve as an effective means of evolutionary classification in baculovirus genus.

B cell Variable genes have evolved their codon usage to focus the targeted patterns of somatic mutation on the complementarity determining regions

PubMed Central

Saini, Jasmine; Hershberg, Uri

2015-01-01

The exceptional ability of B cells to diversify through somatic mutation and improve affinity of the repertoire towards the antigens is the cornerstone of adaptive immunity. Somatic mutation is not evenly distributed and exhibits certain micro-sequence specificities. We show here that the combination of somatic mutation targeting and the codon usage in human B cell receptor (BCR) Variable (V) genes create expected patterns of mutation and post mutation changes that are focused on their complementarity determining regions (CDR). T cell V genes are also skewed in targeting mutations but to a lesser extent and are lacking the codon usage bias observed in BCRs. This suggests that the observed skew in T cell receptors is due to their amino acid usage, which is similar to that of BCRs. The mutation targeting and the codon bias allow B cell CDRs to diversify by specifically accumulating nonconservative changes. We counted the distribution of mutations to CDR in 4 different human datasets. In all four cases we found that the number of actual mutations in the CDR correlated significantly with the V gene mutation biases to the CDR predicted by our models. Finally, it appears that the mutation bias in V genes indeed relates to their long-term survival in actual human repertoires. We observed that resting repertoires of B cells overexpressed V genes that were especially biased towards focused mutation and change in the CDR. This bias in V gene usage was somewhat relaxed at the height of the immune response to a vaccine, presumably because of the need for a wider diversity in a primary response. However, older patients did not retain this flexibility and were biased towards using only highly skewed V genes at all stages of their response. PMID:25660968

B cell variable genes have evolved their codon usage to focus the targeted patterns of somatic mutation on the complementarity determining regions.

PubMed

Saini, Jasmine; Hershberg, Uri

2015-05-01

The exceptional ability of B cells to diversify through somatic mutation and improve affinity of the repertoire toward the antigens is the cornerstone of adaptive immunity. Somatic mutation is not evenly distributed and exhibits certain micro-sequence specificities. We show here that the combination of somatic mutation targeting and the codon usage in human B cell receptor (BCR) Variable (V) genes create expected patterns of mutation and post mutation changes that are focused on their complementarity determining regions (CDR). T cell V genes are also skewed in targeting mutations but to a lesser extent and are lacking the codon usage bias observed in BCRs. This suggests that the observed skew in T cell receptors is due to their amino acid usage, which is similar to that of BCRs. The mutation targeting and the codon bias allow B cell CDRs to diversify by specifically accumulating nonconservative changes. We counted the distribution of mutations to CDR in 4 different human datasets. In all four cases we found that the number of actual mutations in the CDR correlated significantly with the V gene mutation biases to the CDR predicted by our models. Finally, it appears that the mutation bias in V genes indeed relates to their long-term survival in actual human repertoires. We observed that resting repertoires of B cells overexpressed V genes that were especially biased toward focused mutation and change in the CDR. This bias in V gene usage was somewhat relaxed at the height of the immune response to a vaccine, presumably because of the need for a wider diversity in a primary response. However, older patients did not retain this flexibility and were biased toward using only highly skewed V genes at all stages of their response. Copyright © 2015 Elsevier Ltd. All rights reserved.

A universal method for the mutational analysis of K-ras and p53 gene in non-small-cell lung cancer using formalin-fixed paraffin-embedded tissue.

PubMed

Sarkar, F H; Valdivieso, M; Borders, J; Yao, K L; Raval, M M; Madan, S K; Sreepathi, P; Shimoyama, R; Steiger, Z; Visscher, D W

1995-12-01

The p53 tumor suppressor gene has been found to be altered in almost all human solid tumors, whereas K-ras gene mutations have been observed in a limited number of human cancers (adenocarcinoma of colon, pancreas, and lung). Studies of mutational inactivation for both genes in the same patient's sample on non-small-cell lung cancer have been limited. In an effort to perform such an analysis, we developed and compared methods (for the mutational detection of p53 and K-ras gene) that represent a modified and universal protocol, in terms of DNA extraction, polymerase chain reaction (PCR) amplification, and nonradioisotopic PCR-single-strand conformation polymorphism (PCR-SSCP) analysis, which is readily applicable to either formalin-fixed, paraffin-embedded tissues or frozen tumor specimens. We applied this method to the evaluation of p53 (exons 5-8) and K-ras (codon 12 and 13) gene mutations in 55 cases of non-small-cell lung cancer. The mutational status in the p53 gene was evaluated by radioisotopic PCR-SSCP and compared with PCR-SSCP utilizing our standardized nonradioisotopic detection system using a single 6-microns tissue section. The mutational patterns observed by PCR-SSCP were subsequently confirmed by PCR-DNA sequencing. The mutational status in the K-ras gene was similarly evaluated by PCR-SSCP, and the specific mutation was confirmed by Southern slot-blot hybridization using 32P-labeled sequence-specific oligonucleotide probes for codons 12 and 13. Mutational changes in K-ras (codon 12) were found in 10 of 55 (18%) of non-small-cell lung cancers. Whereas adenocarcinoma showed K-ras mutation in 33% of the cases at codon 12, only one mutation was found at codon 13. As expected, squamous cell carcinoma samples (25 cases) did not show K-ras mutations. Mutations at exons 5-8 of the p53 gene were documented in 19 of 55 (34.5%) cases. Ten of the 19 mutations were single nucleotide point mutations, leading to amino acid substitution. Six showed insertional mutation, and three showed deletion mutations. Only three samples showed mutations of both K-ras and p53 genes. We conclude that although K-ras and p53 gene mutations are frequent in non-small-cell lung cancer, mutations of both genes in the same patient's samples are not common. We also conclude that this universal nonradioisotopic method is superior to other similar methods and is readily applicable to the rapid screening of large numbers of formalin-fixed, paraffin-embedded or frozen samples for the mutational analysis of multiple genes.

Application of temperature-gradient gel electrophoresis for detection of prion protein gene polymorphisms in Polish Swiniarka sheep.

PubMed

Jasik, Agnieszka; Reichert, Michal

2006-05-01

This study presents preliminary data on the polymorphism in the prion protein gene of Swiniarka sheep using temperature gradient gel electrophoresis (TGGE). Available data indicate that sensitivity to scrapie is associated with polymorphisms in three codons of prion protein gene: 136,154, and 171. The TGGE method was used to detect point mutations in these codons responsible for sensitivity or resistance to scrapie. This study revealed presence of an allele encoding valine (V) in codon 136, which is associated with high sensitivity to scrapie and occurred in the form of heterozygous allele together with alanine (AV). The highest variability was observed in codon 171, with presence of arginine (R) and glutamine (Q) in the homozygous (RR or QQ) as well as the heterozygous form (RQ). The results of examination of fifty sheep DNA samples with mutations in codons 136, 154, and 171 demonstrated that TGGE can be used as a simple and rapid method to detect mutations in the PrP gene of sheep. Several samples can be run at the same time, making TGGE ideal for the screening of large numbers of samples.

Disease-associated mitochondrial mutations and the evolution of primate mitogenomes

PubMed Central

Tavares, William Corrêa

2017-01-01

Several human diseases have been associated with mutations in mitochondrial genes comprising a set of confirmed and reported mutations according to the MITOMAP database. An analysis of complete mitogenomes across 139 primate species showed that most confirmed disease-associated mutations occurred in aligned codon positions and gene regions under strong purifying selection resulting in a strong evolutionary conservation. Only two confirmed variants (7.1%), coding for the same amino acids accounting for severe human diseases, were identified without apparent pathogenicity in non-human primates, like the closely related Bornean orangutan. Conversely, reported disease-associated mutations were not especially concentrated in conserved codon positions, and a large fraction of them occurred in highly variable ones. Additionally, 88 (45.8%) of reported mutations showed similar variants in several non-human primates and some of them have been present in extinct species of the genus Homo. Considering that recurrent mutations leading to persistent variants throughout the evolutionary diversification of primates are less likely to be severely damaging to fitness, we suggest that these 88 mutations are less likely to be pathogenic. Conversely, 69 (35.9%) of reported disease-associated mutations occurred in extremely conserved aligned codon positions which makes them more likely to damage the primate mitochondrial physiology. PMID:28510580

Genome-wide analysis of codon usage bias in four sequenced cotton species.

PubMed

Wang, Liyuan; Xing, Huixian; Yuan, Yanchao; Wang, Xianlin; Saeed, Muhammad; Tao, Jincai; Feng, Wei; Zhang, Guihua; Song, Xianliang; Sun, Xuezhen

2018-01-01

Codon usage bias (CUB) is an important evolutionary feature in a genome which provides important information for studying organism evolution, gene function and exogenous gene expression. The CUB and its shaping factors in the nuclear genomes of four sequenced cotton species, G. arboreum (A2), G. raimondii (D5), G. hirsutum (AD1) and G. barbadense (AD2) were analyzed in the present study. The effective number of codons (ENC) analysis showed the CUB was weak in these four species and the four subgenomes of the two tetraploids. Codon composition analysis revealed these four species preferred to use pyrimidine-rich codons more frequently than purine-rich codons. Correlation analysis indicated that the base content at the third position of codons affect the degree of codon preference. PR2-bias plot and ENC-plot analyses revealed that the CUB patterns in these genomes and subgenomes were influenced by combined effects of translational selection, directional mutation and other factors. The translational selection (P2) analysis results, together with the non-significant correlation between GC12 and GC3, further revealed that translational selection played the dominant role over mutation pressure in the codon usage bias. Through relative synonymous codon usage (RSCU) analysis, we detected 25 high frequency codons preferred to end with T or A, and 31 low frequency codons inclined to end with C or G in these four species and four subgenomes. Finally, 19 to 26 optimal codons with 19 common ones were determined for each species and subgenomes, which preferred to end with A or T. We concluded that the codon usage bias was weak and the translation selection was the main shaping factor in nuclear genes of these four cotton genomes and four subgenomes.

Nevirapine resistance mutation at codon 181 of the HIV-1 reverse transcriptase confers stavudine resistance by increasing nucleotide substrate discrimination and phosphorolytic activity.

PubMed

Blanca, Giuseppina; Baldanti, Fausto; Paolucci, Stefania; Skoblov, Alexander Yu; Victorova, Lyubov; Hübscher, Ulrich; Gerna, Giuseppe; Spadari, Silvio; Maga, Giovanni

2003-05-02

Recombinant HIV-1 reverse transcriptase (RT) carrying non-nucleoside inhibitors (NNRTIs) resistance mutation at codon 181 showed reduced incorporation and high efficiency of phosphorolytic removal of stavudine, a nucleoside RT inhibitor. These results reveal a new mechanism for cross-resistance between different classes of HIV-1 RT inhibitors.

Revelation of Influencing Factors in Overall Codon Usage Bias of Equine Influenza Viruses

PubMed Central

Bhatia, Sandeep; Sood, Richa; Selvaraj, Pavulraj

2016-01-01

Equine influenza viruses (EIVs) of H3N8 subtype are culprits of severe acute respiratory infections in horses, and are still responsible for significant outbreaks worldwide. Adaptability of influenza viruses to a particular host is significantly influenced by their codon usage preference, due to an absolute dependence on the host cellular machinery for their replication. In the present study, we analyzed genome-wide codon usage patterns in 92 EIV strains, including both H3N8 and H7N7 subtypes by computing several codon usage indices and applying multivariate statistical methods. Relative synonymous codon usage (RSCU) analysis disclosed bias of preferred synonymous codons towards A/U-ended codons. The overall codon usage bias in EIVs was slightly lower, and mainly affected by the nucleotide compositional constraints as inferred from the RSCU and effective number of codon (ENc) analysis. Our data suggested that codon usage pattern in EIVs is governed by the interplay of mutation pressure, natural selection from its hosts and undefined factors. The H7N7 subtype was found less fit to its host (horse) in comparison to H3N8, by possessing higher codon bias, lower mutation pressure and much less adaptation to tRNA pool of equine cells. To the best of our knowledge, this is the first report describing the codon usage analysis of the complete genomes of EIVs. The outcome of our study is likely to enhance our understanding of factors involved in viral adaptation, evolution, and fitness towards their hosts. PMID:27119730

Tumour MLH1 promoter region methylation testing is an effective pre-screen for Lynch Syndrome (HNPCC)

PubMed Central

Newton, K; Jorgensen, NM; Wallace, AJ; Buchanan, DD; Lalloo, F; McMahon, RFT; Hill, J; Evans, DG

2016-01-01

Background & Aims Lynch syndrome patients have DNA mismatch repair deficiency and up to 80% life-time risk of colorectal cancer. Screening of mutation carriers reduces colorectal cancer incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from Lynch Syndrome (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Methods Tumour DNA was extracted (FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Findings Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2–98.4%), specificity 87.7% (95% CI 77.9–94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7–76.5%), specificity 98.6% (95% CI 92.4–100.0%) for the identification of those with pathogenic MLH1 mutations. Conclusions Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. PMID:25280751

GTG mutation in the start codon of the androgen receptor gene in a family of horses with 64,XY disorder of sex development.

PubMed

Révay, T; Villagómez, D A F; Brewer, D; Chenier, T; King, W A

2012-01-01

Genetic sex in mammals is determined by the sex chromosomal composition of the zygote. The X and Y chromosomes are responsible for numerous factors that must work in close concert for the proper development of a healthy sexual phenotype. The role of androgens in case of XY chromosomal constitution is crucial for normal male sex differentiation. The intracellular androgenic action is mediated by the androgen receptor (AR), and its impaired function leads to a myriad of syndromes with severe clinical consequences, most notably androgen insensitivity syndrome and prostate cancer. In this paper, we investigated the possibility that an alteration of the equine AR gene explains a recently described familial XY, SRY + disorder of sex development. We uncovered a transition in the first nucleotide of the AR start codon (c.1A>G). To our knowledge, this represents the first causative AR mutation described in domestic animals. It is also a rarely observed mutation in eukaryotes and is unique among the >750 entries of the human androgen receptor mutation database. In addition, we found another quiet missense mutation in exon 1 (c.322C>T). Transcription of AR was confirmed by RT-PCR amplification of several exons. Translation of the full-length AR protein from the initiating GTG start codon was confirmed by Western blot using N- and C-terminal-specific antibodies. Two smaller peptides (25 and 14 amino acids long) were identified from the middle of exon 1 and across exons 5 and 6 by mass spectrometry. Based upon our experimental data and the supporting literature, it appears that the AR is expressed as a full-length protein and in a functional form, and the observed phenotype is the result of reduced AR protein expression levels. Copyright © 2011 S. Karger AG, Basel.

Novel BRCA1 splice-site mutation in ovarian cancer patients of Slavic origin.

PubMed

Krivokuca, Ana; Dragos, Vita Setrajcic; Stamatovic, Ljiljana; Blatnik, Ana; Boljevic, Ivana; Stegel, Vida; Rakobradovic, Jelena; Skerl, Petra; Jovandic, Stevo; Krajc, Mateja; Magic, Mirjana Brankovic; Novakovic, Srdjan

2018-04-01

Mutations in breast cancer susceptibility gene 1 (BRCA1) lead to defects in a number of cellular pathways including DNA damage repair and transcriptional regulation, resulting in the elevated genome instability and predisposing to breast and ovarian cancers. We report a novel mutation LRG_292t1:c.4356delA,p.(Ala1453Glnfs*3) in the 12th exon of BRCA1, in the splice site region near the donor site of intron 12. It is a frameshift mutation with the termination codon generated on the third amino acid position from the site of deletion. Human Splice Finder 3.0 and MutationTaster have assessed this variation as disease causing, based on the alteration of splicing, creation of premature stop codon and other potential alterations initiated by nucleotide deletion. Among the most important alterations are frameshift and splice site changes (score of the newly created donor splice site: 0.82). c.4356delA was associated with two ovarian cancer cases in two families of Slavic origin. It was detected by next generation sequencing, and confirmed with Sanger sequencing in both cases. Because of the fact that it changes the reading frame of the protein, novel mutation c.4356delA p.(Ala1453Glnfs*3) in BRCA1 gene might be of clinical significance for hereditary ovarian cancer. Further functional as well as segregation analyses within the families are necessary for appropriate clinical classification of this variant. Since it has been detected in two ovarian cancer patients of Slavic origin, it is worth investigating founder effect of this mutation in Slavic populations.

A new compound heterozygous frameshift mutation in the type II 3{beta}-hydroxysteroid dehydrogenase 3{beta}-HSD gene causes salt-wasting 3{beta}-HSD deficiency congenital adrenal hyperplasia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, L.; Sakkal-Alkaddour, S.; Chang, Ying T.

1996-01-01

We report a new compound heterozygous frameshift mutation in the type II 3{Beta}-hydroxysteroid dehydrogenase (3{beta}-HSD) gene in a Pakistanian female child with the salt-wasting form of 3{Beta}-HSD deficiency congenital adrenal hyperplasia. The etiology for her congenital adrenal hyperplasia was not defined. Although the family history suggested possible 3{beta}-HSd deficiency disorder, suppressed adrenal function caused by excess glucocorticoid therapy in this child at 7 yr of age did not allow hormonal diagnosis. To confirm 3{beta}-HSD deficiency, we sequenced the type II 3{beta}-HSD gene in the patient, her family, and the parents of her deceased paternal cousins. The type II 3{beta}-HSD genemore » region of a putative promotor, exons I, II, III, and IV, and exon-intron boundaries were amplified by PCR and sequenced in all subjects. The DNA sequence of the child revealed a single nucleotide deletion at codon 318 [ACA(Thr){r_arrow}AA] in exon IV in one allele, and two nucleotide deletions at codon 273 [AAA(Lys){r_arrow}A] in exon IV in the other allele. The remaining gene sequences were normal. The codon 318 mutation was found in one allele from the father, brother, and parents of the deceased paternal cousins. The codon 273 mutation was found in one allele of the mother and a sister. These findings confirmed inherited 3{beta}-HSD deficiency in the child caused by the compound heterozygous type II 3{beta}-HSD gene mutation. Both codons at codons 279 and 367, respectively, are predicted to result in an altered and truncated type II 3{beta}-HSD protein, thereby causing salt-wasting 3{beta}-HSD deficiency in the patient. 21 refs., 2 figs., 1 tab.« less

Identification of seven haplotypes of the caprine PrP gene at codons 127, 142, 154, 211, 222 and 240 in French Alpine and Saanen breeds and their association with classical scrapie.

PubMed

Barillet, F; Mariat, D; Amigues, Y; Faugeras, R; Caillat, H; Moazami-Goudarzi, K; Rupp, R; Babilliot, J M; Lacroux, C; Lugan, S; Schelcher, F; Chartier, C; Corbière, F; Andréoletti, O; Perrin-Chauvineau, C

2009-03-01

In sheep, susceptibility to scrapie is mainly influenced by polymorphisms of the PrP gene. In goats, there are to date few data related to scrapie susceptibility association with PrP gene polymorphisms. In this study, we first investigated PrP gene polymorphisms of the French Alpine and Saanen breeds. Based on PrP gene open reading frame sequencing of artificial insemination bucks (n=404), six encoding mutations were identified at codons 127, 142, 154, 211, 222 and 240. However, only seven haplotypes could be detected: four (GIH(154)RQS, GIRQ(211)QS, GIRRK(222)S and GIRRQP(240)) derived from the wild-type allele (G(127)I(142)R(154)R(211)Q(222)S(240)) by a single-codon mutation, and two (S(127)IRRQP(240) and GM(142)RRQP(240)) by a double-codon mutation. A case-control study was then implemented in a highly affected Alpine and Saanen breed herd (90 cases/164 controls). Mutations at codon 142 (I/M), 154 (R/H), 211 (R/Q) and 222 (Q/K) were found to induce a significant degree of protection towards natural scrapie infection. Compared with the baseline homozygote wild-type genotype I(142)R(154)R(211)Q(222)/IRRQ goats, the odds of scrapie cases in IRQ(211)Q/IRRQ and IRRK(222)/IRRQ heterozygous animals were significantly lower [odds ratio (OR)=0.133, P<0.0001; and OR=0.048, P<0.0001, respectively]. The heterozygote M(142)RRQ/IRRQ genotype was only protective (OR=0.243, P=0.0186) in goats also PP(240) homozygous at codon 240. However, mutated allele frequencies in French Alpine and Saanen breeds were low (0.5-18.5 %), which prevent us from assessing the influence of all the possible genotypes in natural exposure conditions.

HRAS mutations in Costello syndrome: detection of constitutional activating mutations in codon 12 and 13 and loss of wild-type allele in malignancy.

PubMed

Estep, Anne L; Tidyman, William E; Teitell, Michael A; Cotter, Philip D; Rauen, Katherine A

2006-01-01

Costello syndrome (CS) is a complex developmental disorder involving characteristic craniofacial features, failure to thrive, developmental delay, cardiac and skeletal anomalies, and a predisposition to develop neoplasia. Based on similarities with other cancer syndromes, we previously hypothesized that CS is likely due to activation of signal transduction through the Ras/MAPK pathway [Tartaglia et al., 2003]. In this study, the HRAS coding region was sequenced for mutations in a large, well-characterized cohort of 36 CS patients. Heterogeneous missense point mutations predicting an amino acid substitution were identified in 33/36 (92%) patients. The majority (91%) had a 34G --> A transition in codon 12. Less frequent mutations included 35G --> C (codon 12) and 37G --> T (codon 13). Parental samples did not have an HRAS mutation supporting the hypothesis of de novo heterogeneous mutations. There is phenotypic variability among patients with a 34G --> A transition. The most consistent features included characteristic facies and skin, failure to thrive, developmental delay, musculoskeletal abnormalities, visual impairment, cardiac abnormalities, and generalized hyperpigmentation. The two patients with 35G --> C had cardiac arrhythmias whereas one patient with a 37G --> T transversion had an enlarged aortic root. Of the patients with a clinical diagnosis of CS, neoplasia was the most consistent phenotypic feature for predicating an HRAS mutation. To gain an understanding of the relationship between constitutional HRAS mutations and malignancy, HRAS was sequenced in an advanced biphasic rhabdomyosarcoma/fibrosarcoma from an individual with a 34G --> A mutation. Loss of the wild-type HRAS allele was observed, suggesting tumorigenesis in CS patients is accompanied by additional somatic changes affecting HRAS. Finally, due to phenotypic overlap between CS and cardio-facio-cutaneous (CFC) syndromes, the HRAS coding region was sequenced in a well-characterized CFC cohort. No mutations were found which support a distinct genetic etiology between CS and CFC syndromes. (c) 2005 Wiley-Liss, Inc.

Prevalence of c-KIT Mutations in Gonadoblastoma and Dysgerminomas of Patients with Disorders of Sex Development (DSD) and Ovarian Dysgerminomas

PubMed Central

Hersmus, Remko; Stoop, Hans; van de Geijn, Gert Jan; Eini, Ronak; Biermann, Katharina; Oosterhuis, J. Wolter; DHooge, Catharina; Schneider, Dominik T.; Meijssen, Isabelle C.; Dinjens, Winand N. M.; Dubbink, Hendrikus Jan; Drop, Stenvert L. S.; Looijenga, Leendert H. J.

2012-01-01

Activating c-KIT mutations (exons 11 and 17) are found in 10–40% of testicular seminomas, the majority being missense point mutations (codon 816). Malignant ovarian dysgerminomas represent ∼3% of all ovarian cancers in Western countries, resembling testicular seminomas, regarding chromosomal aberrations and c-KIT mutations. DSD patients with specific Y-sequences have an increased risk for Type II Germ Cell Tumor/Cancer, with gonadoblastoma as precursor progressing to dysgerminoma. Here we present analysis of c-KIT exon 8, 9, 11, 13 and 17, and PDGFRA exon 12, 14 and 18 by conventional sequencing together with mutational analysis of c-KIT codon 816 by a sensitive and specific LightCycler melting curve analysis, confirmed by sequencing. The results are combined with data on TSPY and OCT3/4 expression in a series of 16 DSD patients presenting with gonadoblastoma and dysgerminoma and 15 patients presenting pure ovarian dysgerminomas without DSD. c-KIT codon 816 mutations were detected in five out of the total of 31 cases (all found in pure ovarian dysgerminomas). A synonymous SNP (rs 5578615) was detected in two patients, one DSD patient (with bilateral disease) and one patient with dysgerminoma. Next to these, three codon N822K mutations were detected in the group of 15 pure ovarian dysgerminomas. In total activating c-KIT mutations were found in 53% of ovarian dysgerminomas without DSD. In the group of 16 DSD cases a N505I and D820E mutation was found in a single tumor of a patient with gonadoblastoma and dysgerminoma. No PDGFRA mutations were found. Positive OCT3/4 staining was present in all gonadoblastomas and dysgerminomas investigated, TSPY expression was only seen in the gonadoblastoma/dysgerminoma lesions of the 16 DSD patients. This data supports the existence of two distinct but parallel pathways in the development of dysgerminoma, in which mutational status of c-KIT might parallel the presence of TSPY. PMID:22937135

A new look at an old virus: patterns of mutation accumulation in the human H1N1 influenza virus since 1918

PubMed Central

2012-01-01

Background The H1N1 influenza A virus has been circulating in the human population for over 95 years, first manifesting itself in the pandemic of 1917–1918. Initial mortality was extremely high, but dropped exponentially over time. Influenza viruses have high mutation rates, and H1N1 has undergone significant genetic changes since 1918. The exact nature of H1N1 mutation accumulation over time has not been fully explored. Methods We have made a comprehensive historical analysis of mutational changes within H1N1 by examining over 4100 fully-sequenced H1N1 genomes. This has allowed us to examine the genetic changes arising within H1N1 from 1918 to the present. Results We document multiple extinction events, including the previously known extinction of the human H1N1 lineage in the 1950s, and an apparent second extinction of the human H1N1 lineage in 2009. These extinctions appear to be due to a continuous accumulation of mutations. At the time of its disappearance in 2009, the human H1N1 lineage had accumulated over 1400 point mutations (more than 10% of the genome), including approximately 330 non-synonymous changes (7.4% of all codons). The accumulation of both point mutations and non-synonymous amino acid changes occurred at constant rates (μ = 14.4 and 2.4 new mutations/year, respectively), and mutations accumulated uniformly across the entire influenza genome. We observed a continuous erosion over time of codon-specificity in H1N1, including a shift away from host (human, swine, and bird [duck]) codon preference patterns. Conclusions While there have been numerous adaptations within the H1N1 genome, most of the genetic changes we document here appear to be non-adaptive, and much of the change appears to be degenerative. We suggest H1N1 has been undergoing natural genetic attenuation, and that significant attenuation may even occur during a single pandemic. This process may play a role in natural pandemic cessation and has apparently contributed to the exponential decline in mortality rates over time, as seen in all major human influenza strains. These findings may be relevant to the development of strategies for managing influenza pandemics and strain evolution. PMID:23062055

In Vitro Acquisition of Secondary Azole Resistance in Aspergillus fumigatus Isolates after Prolonged Exposure to Itraconazole: Presence of Heteroresistant Populations

PubMed Central

Escribano, Pilar; Recio, Sandra; Peláez, Teresa; González-Rivera, Milagros; Bouza, Emilio

2012-01-01

Secondary resistance to azoles in Aspergillus fumigatus isolates from patients taking long-term itraconazole therapy has been described. We studied the acquisition of secondary azole resistance in 20 A. fumigatus isolates with no mutations at codon 54, 98, 138, 220, 432, or 448 in the cyp51A gene. Adjusted conidium inocula (3 × 107 CFU/ml) of each isolate were prepared and progressively or directly exposed to increasing itraconazole concentrations, ranging from 0.5 μg/ml to 16 μg/ml. Itraconazole, voriconazole, and posaconazole MICs were determined using the CLSI M38-A2 procedure before (MICinitial) and after (MICfinal) exposure to itraconazole. In both procedures, the MICfinal was significantly higher than the MICinitial. However, after progressive exposure to itraconazole, the MICs of the three azoles were higher than after direct exposure. No mutations were found at codon 54, 98, 138, 220, 432, or 448 in the cyp51A gene of isolates growing at the highest concentration of itraconazole. More concentrated conidium inocula (2 × 109 CFU/ml) plated in itraconazole at 4 μg/ml revealed the presence of heteroresistant populations in two initially wild-type isolates. These isolates became resistant to itraconazole and posaconazole only after use of the concentrated inoculum. These heteroresistant isolates harbored a mutation at codon G54, and the MICs of itraconazole and posaconazole were >16 μg/ml. In all procedures, A. fumigatus short tandem repeat (STRAf) typing was used to demonstrate that the genotype did not change before or after exposure to itraconazole. PMID:22006000

Simple-MSSM: a simple and efficient method for simultaneous multi-site saturation mutagenesis.

PubMed

Cheng, Feng; Xu, Jian-Miao; Xiang, Chao; Liu, Zhi-Qiang; Zhao, Li-Qing; Zheng, Yu-Guo

2017-04-01

To develop a practically simple and robust multi-site saturation mutagenesis (MSSM) method that enables simultaneously recombination of amino acid positions for focused mutant library generation. A general restriction enzyme-free and ligase-free MSSM method (Simple-MSSM) based on prolonged overlap extension PCR (POE-PCR) and Simple Cloning techniques. As a proof of principle of Simple-MSSM, the gene of eGFP (enhanced green fluorescent protein) was used as a template gene for simultaneous mutagenesis of five codons. Forty-eight randomly selected clones were sequenced. Sequencing revealed that all the 48 clones showed at least one mutant codon (mutation efficiency = 100%), and 46 out of the 48 clones had mutations at all the five codons. The obtained diversities at these five codons are 27, 24, 26, 26 and 22, respectively, which correspond to 84, 75, 81, 81, 69% of the theoretical diversity offered by NNK-degeneration (32 codons; NNK, K = T or G). The enzyme-free Simple-MSSM method can simultaneously and efficiently saturate five codons within one day, and therefore avoid missing interactions between residues in interacting amino acid networks.

Evidence that the recA441 (tif-1) mutant of Escherichia coli K-12 contains a thermosensitive intragenic suppressor of RecA constitutive protease activity.

PubMed Central

Wang, W B; Tessman, E S

1985-01-01

The recA441 mutant of Escherichia coli, which has been thought to have thermoinducible constitutive RecA protease activity, is known to have two mutations within recA. We show here that the mutation that alters codon 38 actually confers temperature-independent constitutive protease activity; the second mutation in recA441, which is at codon 298, appears to be acting as a temperature-sensitive suppressor of the protease activity. Images PMID:3891740

Evidence that the recA441 (tif-1) mutant of Escherichia coli K-12 contains a thermosensitive intragenic suppressor of RecA constitutive protease activity.

PubMed

Wang, W B; Tessman, E S

1985-07-01

The recA441 mutant of Escherichia coli, which has been thought to have thermoinducible constitutive RecA protease activity, is known to have two mutations within recA. We show here that the mutation that alters codon 38 actually confers temperature-independent constitutive protease activity; the second mutation in recA441, which is at codon 298, appears to be acting as a temperature-sensitive suppressor of the protease activity.

Antimalarial drug susceptibility and point mutations associated with drug resistance in 248 Plasmodium falciparum isolates imported from Comoros to Marseille, France in 2004 2006.

PubMed

Parola, Philippe; Pradines, Bruno; Simon, Fabrice; Carlotti, Marie-Paule; Minodier, Philippe; Ranjeva, Marie-Pierre; Badiaga, Sékéné; Bertaux, Lionel; Delmont, Jean; Morillon, Marc; Silai, Ramatou; Brouqui, Philippe; Parzy, Daniel

2007-09-01

A total of 248 Plasmodium falciparum isolates were sampled in travelers with malaria who came to Marseille, France from Comoros to investigate in vitro activities of antimalarial drugs and molecular markers of drug resistance. Of the 248 isolates, 126 were maintained in culture. Of these, 53% were resistant to chloroquine, and 3% had reduced susceptibility to quinine, mefloquine, and atovaquone; 1% had reduced susceptibility to halofantrine and dihydroartemisinin; 7% had reduced susceptibility to monodesethylamodiaquine; 37% had reduced susceptibility to cycloguanil; and none had reduced susceptibility to lumefantrine. Resistance-associated point mutations were screened in 207 isolates. No mutations in the cytochrome b gene were found. Of the 207 isolates, 119 (58%) had a mutation in the P. falciparum dihydrofolate reductase (Pfdhfr) gene at codon 108, 6 (5%) had mutations in both Pfdhfr codon 108 and the P. falciparum dihydropteroate synthase codon 437, and 115 (56%) had the chloroquine resistance-associated K76T mutation in the P. falciparum chloroquine resistance transporter gene. This study represents a unique opportunity to improve surveillance of P. falciparum drug resistance in Comoros with consequences for treatment and chemoprophylaxis guidelines.

Nonsense mutations in the alcohol dehydrogenase gene of Drosophila melanogaster correlate with an abnormal 3' end processing of the corresponding pre-mRNA.

PubMed Central

Brogna, S

1999-01-01

From bacteria to mammals, mutations that generate premature termination codons have been shown to result in the reduction in the abundance of the corresponding mRNA. In mammalian cells, more often than not, the reduction happens while the RNA is still associated with the nucleus. Here, it is reported that mutations in the alcohol dehydrogenase gene (Adh) of Drosophila melanogaster that generate premature termination codons lead to reduced levels of cytoplasmic and nuclear mRNA. Unexpectedly, it has been found that the poly(A) tails of Adh mRNAs and pre-mRNAs that carry a premature termination codon are longer than in the wild-type transcript. The more 5' terminal the mutation is, the longer is the poly(A) tail of the transcript. These findings suggest that the integrity of the coding region may be required for accurate mRNA 3' end processing. PMID:10199572

Is high pressure liquid chromatography an effective screening tool for characterization of molecular defects in hemoglobinopathies?

PubMed

Moorchung, Nikhil; Phillip, Joseph; Sarkar, Ravi Shankar; Prasad, Rupesh; Dutta, Vibha

2013-01-01

Hemoglobinopathies constitute entities that are generated by either abnormal hemoglobin or thalassemias. high pressure liquid chromatography (HPLC) is one of the best methods for screening and detection of various hemoglobinopathies but it has intrinsic interpretive problems. The study was designed to evaluate the different mutations seen in cases of hemoglobinopathies and compare the same with screening tests. 68 patients of hemoglobinopathies were screened by HPLC. Mutation studies in the beta globin gene was performed using the polymerase chain reaction (PCR)-based allele-specific Amplification Refractory Mutation System (ARMS). Molecular analysis for the sickle cell mutation was done by standard methods. The IVS 1/5 mutation was the commonest mutation seen and it was seen in 26 (38.23%) of the cases. This was followed by the IVS 1/1, codon 41/42, codon 8/9, del 22 mutation, codon 15 mutation and the -619 bp deletion. No mutation was seen in eight cases. There was a 100% concordance between the sickle cell trait as diagnosed by HPLC and genetic testing. Our study underlies the importance of molecular testing in all cases of hemoglobinopathies. Although HPLC is a useful screening tool, molecular testing is very useful in accurately diagnosing the mutations. Molecular testing is especially applicable in cases with an abnormal hemoglobin (HbD, HbE and HbS) because there may be a concomitant inheritance of a beta thalassemia mutation. Molecular testing is the gold standard when it comes to the diagnosis of hemoglobinopathies.

Molecular Characterisation of α- and β-Thalassaemia among Indigenous Senoi Orang Asli Communities in Peninsular Malaysia.

PubMed

Koh, Danny Xuan Rong; Raja Sabudin, Raja Zahratul Azma; Mohd Yusoff, Malisa; Hussin, Noor Hamidah; Ahmad, Rahimah; Othman, Ainoon; Ismail, Endom

2017-09-01

Thalassaemia is a public health problem in Malaysia, with each ethnic group having their own common mutations. However, there is a lack on data on the prevalence and common mutations among the indigenous people. This cross-sectional study was performed to determine the common mutations of α- and β-thalassaemia among the subethnic groups of Senoi, the largest Orang Asli group in Peninsular Malaysia. Blood samples collected from six Senoi subethnic groups were analysed for full blood count and haemoglobin analysis (HbAn). Samples with abnormal findings were then screened for α- and β-globin gene mutations. Out of the 752 samples collected, 255 showed abnormal HbAn results, and 122 cases showing abnormal red cell indices with normal HbAn findings were subjected to molecular screening. DNA analysis revealed a mixture of α- and β-globin gene mutations with 25 concomitant cases. The types of gene abnormalities detected for α-thalassaemia were termination codon (T>C) Hb CS (α CS α), Cd59 (G>A) haemoglobin Adana (Hb Adana) (α Cd59 α), initiation codon (ATG>A-G) (α IniCd α), two-gene deletion (- SEA ), and single-gene 3.7-kb deletion (-α 3.7 ). For β-thalassaemia, there were Cd26 (G>A) Hb E (β E ), Cd19 (A>G) Haemoglobin Malay (Hb Malay) (β Cd19 ), and IVS 1-5 (G>C) (β IVS 1-5 ). © 2017 John Wiley & Sons Ltd/University College London.

Divergence and codon usage bias of Betanodavirus, a neurotropic pathogen in fish.

PubMed

He, Mei; Teng, Chun-Bo

2015-02-01

Betanodavirus is a small bipartite RNA virus of global economical significance that can cause severe neurological disorders to an increasing number of marine fish species. Herein, to further the understanding of the evolution of betanodavirus, Bayesian coalescent analyses were conducted to the time-stamped entire coding sequences of their RNA polymerase and coat protein genes. Similar moderate nucleotide substitution rates were then estimated for the two genes. According to age calculations, the divergence of the two genes into the four genotypes initiated nearly simultaneously at ∼700 years ago, despite the different scenarios, whereas the seven analyzed chimeric isolates might be the outcomes of a single genetic reassortment event taking place in the early 1980s in Southern Europe. Furthermore, codon usage bias analyses indicated that each gene had influences in addition to mutational bias and codon choice of betanodavirus was not completely complied with that of fish host. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular investigations of β-thalassemic children in Erbil governorate

NASA Astrophysics Data System (ADS)

Hasan, Ahmad N.; Al-Attar, Mustafa S.

2017-09-01

The present work studies the molecular investigation of 40 thalassemic carriers using polymerase chain reaction. Forty thalassemic carriers who were registered and treated at Erbil thalassemic center and twenty apparently healthy children have been included in the present study. Ages of both groups ranged between 1-18 years. Four primers used to detect four different beta thalassemia mutations they were codon 8/9, codon 8, codon 41/42 and IVS-1-5. The two most common mutations detected among thalassemia group were Cd8/9 with 8 cases (20%) and Cd-8 with 6 cases (15%) followed by codon 41/42 with 4 cases (10%) which investigated and detected for the first time in Erbil governorate through the present study and finally IVS-1-5 with 3 cases (7.5%), while no any cases detected among control group.

Crenolanib is a type I tyrosine kinase inhibitor that inhibits mutant KIT D816 isoforms prevalent in systemic mastocytosis and core binding factor leukemia.

PubMed

Kampa-Schittenhelm, Kerstin Maria; Frey, Julia; Haeusser, Lara A; Illing, Barbara; Pavlovsky, Ashly A; Blumenstock, Gunnar; Schittenhelm, Marcus Matthias

2017-10-10

Activating D816 mutations of the class III receptor tyrosine kinase KIT are associated with the majority of patients with systemic mastocytosis (SM), but also core binding factor (CBF) AML, making KIT mutations attractive therapeutic targets for the treatment of these cancers. Crenolanib is a potent and selective inhibitor of wild-type as well as mutant isoforms of the class III receptor tyrosine kinases FLT3 and PDGFRα/β. Notably, crenolanib inhibits constitutively active mutant-FLT3 isoforms resulting from amino acid substitutions of aspartic acid at codon 835, which is homologous to codon 816 in the KIT gene - suggesting sensitivity against mutant-KIT D816 isoforms as well. Here we demonstrate that crenolanib targets KIT D816 in SM and CBF AML models: crenolanib inhibits cellular proliferation and initiates apoptosis of mastocytosis cell lines expressing these mutations. Target-specificity was confirmed using an isogenic cell model. In addition, we demonstrate that KIT D816 mutations are targetable with clinically achievable doses of crenolanib. Further, a rationale to combine cladribine (2-CDA), the therapeutic standard in SM, with crenolanib is provided. In conclusion, we demonstrate that crenolanib is an inhibitor of mutant-KIT D816 isoforms at clinically achievable concentrations, and thus may be a potential treatment for SM and CBF AML as a monotherapy or in combination approaches.

Neutropenia-associated ELANE mutations disrupting translation initiation produce novel neutrophil elastase isoforms

PubMed Central

Tidwell, Timothy; Wechsler, Jeremy; Nayak, Ramesh C.; Trump, Lisa; Salipante, Stephen J.; Cheng, Jerry C.; Donadieu, Jean; Glaubach, Taly; Corey, Seth J.; Grimes, H. Leighton; Lutzko, Carolyn; Cancelas, Jose A.

2014-01-01

Hereditary neutropenia is usually caused by heterozygous germline mutations in the ELANE gene encoding neutrophil elastase (NE). How mutations cause disease remains uncertain, but two hypotheses have been proposed. In one, ELANE mutations lead to mislocalization of NE. In the other, ELANE mutations disturb protein folding, inducing an unfolded protein response in the endoplasmic reticulum (ER). In this study, we describe new types of mutations that disrupt the translational start site. At first glance, they should block translation and are incompatible with either the mislocalization or misfolding hypotheses, which require mutant protein for pathogenicity. We find that start-site mutations, instead, force translation from downstream in-frame initiation codons, yielding amino-terminally truncated isoforms lacking ER-localizing (pre) and zymogen-maintaining (pro) sequences, yet retain essential catalytic residues. Patient-derived induced pluripotent stem cells recapitulate hematopoietic and molecular phenotypes. Expression of the amino-terminally deleted isoforms in vitro reduces myeloid cell clonogenic capacity. We define an internal ribosome entry site (IRES) within ELANE and demonstrate that adjacent mutations modulate IRES activity, independently of protein-coding sequence alterations. Some ELANE mutations, therefore, appear to cause neutropenia via the production of amino-terminally deleted NE isoforms rather than by altering the coding sequence of the full-length protein. PMID:24184683

Prion protein gene analysis in three kindreds with fatal familial insomnia (FFI): Codon 178 mutation and codon 129 polymorphism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Medori, R.; Tritschler, H.J.

1993-10-01

Fatal familial insomnia (FFI) is a disease linked to a GAC(Asp) [yields] AAC(Asn) mutation in codon 178 of the prion protein (PrP) gene. FFI is characterized clinically by untreatable progressive insomnia, dysautonomia, and motor dysfunctions and is characterized pathologically by selective thalamic atrophy. The authors confirmed the 178[sup Asn] mutation in the PrP gene of a third FFI family of French ancestry. Three family members who are under 40 years of age and who inherited the mutation showed only reduced perfusion in the basal ganglia on single photon emission computerized tomography. Some FFI features differ from the clinical and neuropathologicmore » findings associated with 178[sup Asn] reported elsewhere. However, additional intragenic mutations accounting for the phenotypic differences were not observed in two affected individuals. In other sporadic and familial forms of Creutzfeldt-Jakob disease and Gerstmann-Straeussler syndrome, Met or Val homozygosity at polymorphic codon 129 is associated with a more severe phenotype, younger age at onset, and faster progression. In FFI, young and old individuals at disease onset had 129[sup Met/Val]. Moreover, of five 178[sup Asn] individuals who are above age-at-onset range and who are well, two have 129[sup Met] and three have 129[sup Met/Val], suggesting that polymorphic site 129 does not modulate FFI phenotypic expression. Genetic heterogeneity and environment may play an important role in inter- and intrafamilial variability of the 178[sup Asn] mutation. 32 refs., 5 figs., 1 tab.« less

Mucopolysaccharidosis type I: Identification and characterization of mutations affecting alpha-L-iduronidase activity.

PubMed

Lee-Chen, Guey-Jen; Lin, Shuan-Pei; Chen, I-Shen; Chang, Jui-Hung; Yang, Chyau-Wen; Chin, Yi-Wen

2002-06-01

Mucopolysaccharidosis type I (MPS I) is caused by a deficiency of the lysosomal enzyme alpha-L-iduronidase (IDUA). MPS I covers a broad spectrum of clinical severity ranging from severe Hurler syndrome through intermediate Hurler/Scheie syndrome to mild Scheie syndrome. Mutation screening was performed in two unrelated Taiwanese MPS I patients. A Hurler/Scheie patient had A79V (C to T transition in codon 79) in exon 2 and R619G (C to G transversion in codon 619) in exon 14. R619G has been shown to cause disease. Expression of A79V in COS-7 cells showed trace amounts of IDUA activity, demonstrating the deleterious nature of the mutation. A79V mutation did not cause a reduction in IDUA mRNA levels. The reduced level of IDUA protein suggests increased degradation of the mutant enzyme. A Hurler patient had 134del12 (in-frame deletion of codons 16-19 in signal peptide) in exon 1 and Q584X (C to T transition in codon 584) in exon 13. Transfection of COS-7 cells with Q584X did not yield active enzyme. Q584X mutation caused an apparent reduction in the IDUA mRNA level and no IDUA protein was detected. Conversely, 134del12 showed 124.6% of normal activity in transfected cells and a 77-kDa precursor protein was observed on Western blot, suggesting biologic activity of precursor IDUA without posttranslational cleavage. These findings provide further evidence of the molecular heterogeneity in mutations in MPS I.

X-Linked Retinoschisis: Phenotypic Variability in a Chinese Family

PubMed Central

Xiao, Yangyan; Liu, Xiao; Tang, Luosheng; Wang, Xia; Coursy, Terry; Guo, Xiaojian; Li, Zhuo

2016-01-01

X-linked juvenile retinoschisis (XLRS), a leading cause of juvenile macular degeneration, is characterized by a spoke-wheel pattern in the macular region of the retina and splitting of the neurosensory retina. Our study is to describe the clinical characteristics of a four generations of this family (a total of 18 members)with X-linked retinoschisis (XLRS) and detected a novel mutations of c.3G > A (p.M1?) in the initiation codon of the RS1 gene. by direct sequencing.Identification of this mutation in this family provides evidence about potential genetic or environmental factors on its phenotypic variance, as patients presented with different phenotypes regardless of having the same mutation. Importantly, OCT has proven vital for XLRS diagnosis in children. PMID:26823236

X-Linked Retinoschisis: Phenotypic Variability in a Chinese Family.

PubMed

Xiao, Yangyan; Liu, Xiao; Tang, Luosheng; Wang, Xia; Coursey, Terry G; Coursy, Terry; Guo, Xiaojian; Li, Zhuo

2016-01-29

X-linked juvenile retinoschisis (XLRS), a leading cause of juvenile macular degeneration, is characterized by a spoke-wheel pattern in the macular region of the retina and splitting of the neurosensory retina. Our study is to describe the clinical characteristics of a four generations of this family (a total of 18 members)with X-linked retinoschisis (XLRS) and detected a novel mutations of c.3G > A (p.M1?) in the initiation codon of the RS1 gene. by direct sequencing.Identification of this mutation in this family provides evidence about potential genetic or environmental factors on its phenotypic variance, as patients presented with different phenotypes regardless of having the same mutation. Importantly, OCT has proven vital for XLRS diagnosis in children.

Pandemic influenza A virus codon usage revisited: biases, adaptation and implications for vaccine strain development

PubMed Central

2012-01-01

Background Influenza A virus (IAV) is a member of the family Orthomyxoviridae and contains eight segments of a single-stranded RNA genome with negative polarity. The first influenza pandemic of this century was declared in April of 2009, with the emergence of a novel H1N1 IAV strain (H1N1pdm) in Mexico and USA. Understanding the extent and causes of biases in codon usage is essential to the understanding of viral evolution. A comprehensive study to investigate the effect of selection pressure imposed by the human host on the codon usage of an emerging, pandemic IAV strain and the trends in viral codon usage involved over the pandemic time period is much needed. Results We performed a comprehensive codon usage analysis of 310 IAV strains from the pandemic of 2009. Highly biased codon usage for Ala, Arg, Pro, Thr and Ser were found. Codon usage is strongly influenced by underlying biases in base composition. When correspondence analysis (COA) on relative synonymous codon usage (RSCU) is applied, the distribution of IAV ORFs in the plane defined by the first two major dimensional factors showed that different strains are located at different places, suggesting that IAV codon usage also reflects an evolutionary process. Conclusions A general association between codon usage bias, base composition and poor adaptation of the virus to the respective host tRNA pool, suggests that mutational pressure is the main force shaping H1N1 pdm IAV codon usage. A dynamic process is observed in the variation of codon usage of the strains enrolled in these studies. These results suggest a balance of mutational bias and natural selection, which allow the virus to explore and re-adapt its codon usage to different environments. Recoding of IAV taking into account codon bias, base composition and adaptation to host tRNA may provide important clues to develop new and appropriate vaccines. PMID:23134595

Codon Usage Bias and Determining Forces in Taenia solium Genome.

PubMed

Yang, Xing; Ma, Xusheng; Luo, Xuenong; Ling, Houjun; Zhang, Xichen; Cai, Xuepeng

2015-12-01

The tapeworm Taenia solium is an important human zoonotic parasite that causes great economic loss and also endangers public health. At present, an effective vaccine that will prevent infection and chemotherapy without any side effect remains to be developed. In this study, codon usage patterns in the T. solium genome were examined through 8,484 protein-coding genes. Neutrality analysis showed that T. solium had a narrow GC distribution, and a significant correlation was observed between GC12 and GC3. Examination of an NC (ENC vs GC3s)-plot showed a few genes on or close to the expected curve, but the majority of points with low-ENC (the effective number of codons) values were detected below the expected curve, suggesting that mutational bias plays a major role in shaping codon usage. The Parity Rule 2 plot (PR2) analysis showed that GC and AT were not used proportionally. We also identified 26 optimal codons in the T. solium genome, all of which ended with either a G or C residue. These optimal codons in the T. solium genome are likely consistent with tRNAs that are highly expressed in the cell, suggesting that mutational and translational selection forces are probably driving factors of codon usage bias in the T. solium genome.

K-ras mutations and HLA-DR expression in large bowel adenomas.

PubMed Central

Norheim Andersen, S.; Breivik, J.; Løvig, T.; Meling, G. I.; Gaudernack, G.; Clausen, O. P.; Schjölberg, A.; Fausa, O.; Langmark, F.; Lund, E.; Rognum, T. O.

1996-01-01

A total of 72 sporadic colorectal adenomas in 56 patients were studied for the presence of point mutations in codons 12 and 13 of the K-ras gene and for HLA-DR antigen expression related to clinicopathological variables. Forty K-ras mutations in 39 adenomas were found (54%): 31 (77%) in codon 12 and nine (23%) in codon 13. There was a strong relationship between the incidence of K-ras mutations and adenoma type, degree of dysplasia and sex. The highest frequency of K-ras mutations was seen in large adenomas of the villous type with high-grade dysplasia. Fourteen out of 15 adenomas obtained from 14 women above 65 years of age carried mutations. HLA-DR positivity was found in 38% of the adenomas, large tumours and those with high-grade dysplasia having the strongest staining. Coexpression of K-ras mutations and HLA-DR was found significantly more frequently in large and highly dysplastic adenomas, although two-way analysis of variance showing size and grade of dysplasia to be the most important variable. None of the adenomas with low-grade dysplasia showed both K-ras mutation and HLA-DR positivity (P = 0.004). K-ras mutation is recognised as an early event in colorectal carcinogenesis. The mutation might give rise to peptides that may be presented on the tumour cell surface by class II molecules, and thereby induce immune responses against neoplastic cells. Images Figure 3 Figure 4 Figure 5 Figure 6 PMID:8679466

Acquired Resistance to Crizotinib from a Mutation in CD74–ROS1

PubMed Central

Awad, Mark M.; Katayama, Ryohei; McTigue, Michele; Liu, Wei; Deng, Ya-Li; Brooun, Alexei; Friboulet, Luc; Huang, Donghui; Falk, Matthew D.; Timofeevski, Sergei; Wilner, Keith D.; Lockerman, Elizabeth L.; Khan, Tahsin M.; Mahmood, Sidra; Gainor, Justin F.; Digumarthy, Subba R.; Stone, James R.; Mino-Kenudson, Mari; Christensen, James G.; Iafrate, A. John; Engelman, Jeffrey A.; Shaw, Alice T.

2013-01-01

Summary Crizotinib, an inhibitor of anaplastic lymphoma kinase (ALK), has also recently shown efficacy in the treatment of lung cancers with ROS1 translocations. Resistance to crizotinib developed in a patient with metastatic lung adenocarcinoma harboring a CD74–ROS1 rearrangement who had initially shown a dramatic response to treatment. We performed a biopsy of a resistant tumor and identified an acquired mutation leading to a glycine-to-arginine substitution at codon 2032 in the ROS1 kinase domain. Although this mutation does not lie at the gatekeeper residue, it confers resistance to ROS1 kinase inhibition through steric interference with drug binding. The same resistance mutation was observed at all the meta-static sites that were examined at autopsy, suggesting that this mutation was an early event in the clonal evolution of resistance. (Funded by Pfizer and others; ClinicalTrials.gov number, NCT00585195.) PMID:23724914

Activation of RAS family genes in urothelial carcinoma.

PubMed

Boulalas, I; Zaravinos, A; Karyotis, I; Delakas, D; Spandidos, D A

2009-05-01

Bladder cancer is the fifth most common malignancy in men in Western society. We determined RAS codon 12 and 13 point mutations and evaluated mRNA expression levels in transitional cell carcinoma cases. Samples from 30 human bladder cancers and 30 normal tissues were analyzed by polymerase chain reaction/restriction fragment length polymorphism and direct sequencing to determine the occurrence of mutations in codons 12 and 13 of RAS family genes. Moreover, we used real-time reverse transcriptase-polymerase chain reaction to evaluate the expression profile of RAS genes in bladder cancer specimens compared to that in adjacent normal tissues. Overall H-RAS mutations in codon 12 were observed in 9 tumor samples (30%). Two of the 9 patients (22%) had invasive bladder cancer and 7 (77%) had noninvasive bladder cancer. One H-RAS mutation (11%) was homozygous and the remaining 89% were heterozygous. All samples were WT for K and N-RAS oncogenes. Moreover, 23 of 30 samples (77%) showed over expression in at least 1 RAS family gene compared to adjacent normal tissue. K and N-RAS had the highest levels of over expression in bladder cancer specimens (50%), whereas 27% of transitional cell carcinomas demonstrated H-RAS over expression relative to paired normal tissues. Our results underline the importance of H-RAS activation in human bladder cancer by codon 12 mutations. Moreover, they provide evidence that increased expression of all 3 RAS genes is a common event in bladder cancer that is associated with disease development.

Evaluation of dihydrofolate reductase and dihydropteroate synthetase genotypes that confer resistance to sulphadoxine-pyrimethamine in Plasmodium falciparum in Haiti

PubMed Central

2012-01-01

Background Malaria caused by Plasmodium falciparum infects roughly 30,000 individuals in Haiti each year. Haiti has used chloroquine (CQ) as a first-line treatment for malaria for many years and as a result there are concerns that malaria parasites may develop resistance to CQ over time. Therefore it is important to prepare for alternative malaria treatment options should CQ resistance develop. In many other malaria-endemic regions, antifolates, particularly pyrimethamine (PYR) and sulphadoxine (SDX) treatment combination (SP), have been used as an alternative when CQ resistance has developed. This study evaluated mutations in the dihydrofolate reductase (dhfr) and dihydropteroate synthetase (dhps) genes that confer PYR and SDX resistance, respectively, in P. falciparum to provide baseline data in Haiti. This study is the first comprehensive study to examine PYR and SDX resistance genotypes in P. falciparum in Haiti. Methods DNA was extracted from dried blood spots and genotyped for PYR and SDX resistance mutations in P. falciparum using PCR and DNA sequencing methods. Sixty-one samples were genotyped for PYR resistance in codons 51, 59, 108 and 164 of the dhfr gene and 58 samples were genotyped for SDX resistance codons 436, 437, 540 of the dhps gene in P. falciparum. Results Thirty-three percent (20/61) of the samples carried a mutation at codon 108 (S108N) of the dhfr gene. No mutations in dhfr at codons 51, 59, 164 were observed in any of the samples. In addition, no mutations were observed in dhps at the three codons (436, 437, 540) examined. No significant difference was observed between samples collected in urban vs rural sites (Welch’s T-test p-value = 0.53 and permutations p-value = 0.59). Conclusion This study has shown the presence of the S108N mutation in P. falciparum that confers low-level PYR resistance in Haiti. However, the absence of SDX resistance mutations suggests that SP resistance may not be present in Haiti. These results have important implications for ongoing discussions on alternative malaria treatment options in Haiti. PMID:22889367

Nonneutral GC3 and retroelement codon mimicry in Phytophthora.

PubMed

Jiang, Rays H Y; Govers, Francine

2006-10-01

Phytophthora is a genus entirely comprised of destructive plant pathogens. It belongs to the Stramenopila, a unique branch of eukaryotes, phylogenetically distinct from plants, animals, or fungi. Phytophthora genes show a strong preference for usage of codons ending with G or C (high GC3). The presence of high GC3 in genes can be utilized to differentiate coding regions from noncoding regions in the genome. We found that both selective pressure and mutation bias drive codon bias in Phytophthora. Indicative for selection pressure is the higher GC3 value of highly expressed genes in different Phytophthora species. Lineage specific GC increase of noncoding regions is reminiscent of whole-genome mutation bias, whereas the elevated Phytophthora GC3 is primarily a result of translation efficiency-driven selection. Heterogeneous retrotransposons exist in Phytophthora genomes and many of them vary in their GC content. Interestingly, the most widespread groups of retroelements in Phytophthora show high GC3 and a codon bias that is similar to host genes. Apparently, selection pressure has been exerted on the retroelement's codon usage, and such mimicry of host codon bias might be beneficial for the propagation of retrotransposons.

Translational autocontrol of the Escherichia coli ribosomal protein S15.

PubMed

Portier, C; Dondon, L; Grunberg-Manago, M

1990-01-20

When rpsO, the gene encoding the ribosomal protein S15 in Escherichia coli, is carried by a multicopy plasmid, the mRNA synthesis rate of S15 increases with the gene dosage but the rate of synthesis of S15 does not rise. A translational fusion between S15 and beta-galactosidase was introduced on the chromosome in a delta lac strain and the expression of beta-galactosidase studied under different conditions. The presence of S15 in trans represses the beta-galactosidase level five- to sixfold, while the synthesis rate of the S15-beta-galactosidase mRNA decreases by only 30 to 50%. These data indicate that S15 is subject to autogenous translational control. Derepressed mutants were isolated and sequenced. All the point mutations map in the second codon of S15, suggesting a location for the operator site that is very near to the translation initiation codon. However, the creation of deletion mutations shows that the operator extends into the 5' non-coding part of the message, thus overlapping the ribosome loading site.

PreTIS: A Tool to Predict Non-canonical 5’ UTR Translational Initiation Sites in Human and Mouse

PubMed Central

Reuter, Kerstin; Helms, Volkhard

2016-01-01

Translation of mRNA sequences into proteins typically starts at an AUG triplet. In rare cases, translation may also start at alternative non–AUG codons located in the annotated 5’ UTR which leads to an increased regulatory complexity. Since ribosome profiling detects translational start sites at the nucleotide level, the properties of these start sites can then be used for the statistical evaluation of functional open reading frames. We developed a linear regression approach to predict in–frame and out–of–frame translational start sites within the 5’ UTR from mRNA sequence information together with their translation initiation confidence. Predicted start codons comprise AUG as well as near–cognate codons. The underlying datasets are based on published translational start sites for human HEK293 and mouse embryonic stem cells that were derived by the original authors from ribosome profiling data. The average prediction accuracy of true vs. false start sites for HEK293 cells was 80%. When applied to mouse mRNA sequences, the same model predicted translation initiation sites observed in mouse ES cells with an accuracy of 76%. Moreover, we illustrate the effect of in silico mutations in the flanking sequence context of a start site on the predicted initiation confidence. Our new webservice PreTIS visualizes alternative start sites and their respective ORFs and predicts their ability to initiate translation. Solely, the mRNA sequence is required as input. PreTIS is accessible at http://service.bioinformatik.uni-saarland.de/pretis. PMID:27768687

Molecular characterization of isoniazid-resistant Mycobacterium tuberculosis clinical strains isolated in the Philippines.

PubMed

Herrera, Laura; Valverde, Azucena; Saiz, Pilar; Sáez-Nieto, Juan A; Portero, José L; Jiménez, M Soledad

2004-06-01

The prevalence of mutations in the katG, inhA and oxyR-ahpC genes of isoniazid (INH)-resistant Mycobacterium tuberculosis isolates in the Philippines were determined. Of 306 M. tuberculosis isolates studied, 81 (26.5%) exhibited INH-resistance. Forty-four strains (54.3%) had mutations in the katG gene, eighteen strains (22.2%) had mutations in the putative inhA locus region, seven had mutations in both regions and five strains had mutations in the oxyR-ahpC operon. Only seven strains had no mutations. A total of 71 of the 81 (87.6%) resistant strains and 65 of the 72 (90.3%) INH sensitive randomly selected strains showed amino acid substitution in codon 463 (Arg to Leu) (88.9%). This fact supports the hypothesis that mutations at codon 463 are independent of INH-resistance and are linked to the geographical origins of the strains. Copyright 2004 Elsevier B.V.

Silent mutations at codons 65 and 66 in reverse transcriptase alleviate indel formation and restore fitness in subtype B HIV-1 containing D67N and K70R drug resistance mutations

PubMed Central

Telwatte, Sushama; Hearps, Anna C.; Johnson, Adam; Latham, Catherine F.; Moore, Katie; Agius, Paul; Tachedjian, Mary; Sonza, Secondo; Sluis-Cremer, Nicolas; Harrigan, P. Richard; Tachedjian, Gilda

2015-01-01

Resistance to combined antiretroviral therapy (cART) in HIV-1-infected individuals is typically due to nonsynonymous mutations that change the protein sequence; however, the selection of synonymous or ‘silent’ mutations in the HIV-1 genome with cART has been reported. These silent K65K and K66K mutations in the HIV-1 reverse transcriptase (RT) occur in over 35% of drug-experienced individuals and are highly associated with the thymidine analog mutations D67N and K70R, which confer decreased susceptibility to most nucleoside and nucleotide RT inhibitors. However, the basis for selection of these silent mutations under selective drug pressure is unknown. Using Illumina next-generation sequencing, we demonstrate that the D67N/K70R substitutions in HIV-1 RT increase indel frequency by 100-fold at RT codons 65–67, consequently impairing viral fitness. Introduction of either K65K or K66K into HIV-1 containing D67N/K70R reversed the error-prone DNA synthesis at codons 65–67 in RT and improved viral replication fitness, but did not impact RT inhibitor drug susceptibility. These data provide new mechanistic insights into the role of silent mutations selected during antiretroviral therapy and have broader implications for the relevance of silent mutations in the evolution and fitness of RNA viruses. PMID:25765644

Molecular Mechanisms of Fluoroquinolone Resistance in Pseudomonas aeruginosa Isolates from Cystic Fibrosis Patients

PubMed Central

Jalal, Shah; Ciofu, Oana; Høiby, Niels; Gotoh, Naomasa; Wretlind, Bengt

2000-01-01

Twenty P. aeruginosa isolates were collected from six cystic fibrosis (CF) patients, aged 27 to 33, in 1994 (9 isolates) and 1997 (11 isolates) at the CF Center, Copenhagen, Denmark, and were typed by pulse-field gel electrophoresis (PFGE) or ribotyping. Five of the patients had isolates with the same PFGE or ribotyping patterns in 1997 as in 1994, and ciprofloxacin had a two- to fourfold higher MIC for the isolates collected in 1997 than those from 1994. Genomic DNA was amplified for gyrA, parC, mexR, and nfxB by PCR and sequenced. Eleven isolates had mutations in gyrA, seven isolates had mutations at codon 83 (Thr to Ile), and four isolates had mutations at codon 87 (Asp to Asn or Tyr). Sixteen isolates had mutations in nfxB at codon 82 (Arg to Leu). Increased amounts of OprN were found in six isolates and OprJ in eight isolates as determined by immunoblotting. No isolates had mutations in parC or mexR. Six isolates had mutations in efflux pumps without gyrA mutations. The average number of mutations was higher in isolates from 1997 than in those from 1994. The results also suggested that efflux resistance mechanisms are more common in isolates from CF patients than in strains from urine and wounds from non-CF patients, in which mutations in gyrA and parC dominate (S. Jalal and B. Wretlind, Microb. Drug Resist. 4:257–261, 1998). PMID:10681343

Mutational analysis of a patient with mucopolysaccharidosis type VII, and identification of pseudogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shipley, J.M.; Klinkenberg, M.; Wu, B.M.

1993-03-01

PCR of cDNA produced from patient fibroblasts allowed the authors to determine the paternal mutation in the first patient reported with [beta]-glucuronidase-deficiency mucopolysaccharidosis type VII (MPS VII). The G[r arrow]T transversion 1,881 bp downstream of the ATG translation initiation codon destroys an MboII restriction site and converts Trp627 to Cys (W627C). Digestion of genomic DNA PCR fragments with MboII indicated that the patient and the father were heterozygous for this missense mutation in exon 12. Failure to find cDNAs from patient RNA which did not contain this mutation suggested that the maternal mutation leads to greatly reduced synthesis or reducedmore » stability of mRNA from the mutant allele. In order to identify the maternal mutation, it was necessary to analyze genomic sequences. This approach was complicated by the finding of multiple unprocessed pseudogenes and/or closely related genes. Using PCR with a panel of human/rodent hybrid cell lines, the authors found that these pseudogenes were present over chromosomes 5-7, 20, and 22 and the Y chromosome. Conditions were defined which allowed them to amplify and characterize genomic sequences for the true [beta]-glucuronidase gene despite this background of related sequences. The patient proved to be heterozygous for a second mutation, in which a C[r arrow]T transition introduces a termination codon (R356STOP) in exon 7. The mother was also heterozygous for this mutation. Expression of a cDNA containing the maternal mutation produced no enzyme activity, as expected. Expression of the paternal mutation in COS-7 cells produced a surprisingly high (65% of control) level of activity. However, activity was 13% of control in transiently transfected murine MPS VII cells. The level of activity of this mutant allele appears to correlate with the level of overexpression. 39 refs., 5 figs., 1 tab.« less

Characterization of Novel Hepatitis B Virus PreS/S-Gene Mutations in a Patient with Occult Hepatitis B Virus Infection

PubMed Central

Xu, Zhihui; Chen, Rongjuan; Si, Lanlan; Lu, Shanshan; Li, Xiaodong; Wang, Shuai; Zhang, Kai; Li, Jin; Han, Juqiang; Xu, Dongping

2016-01-01

Objective The impact of hepatitis B virus (HBV) preS/S-gene mutations on occult HBV infection (OBI) is not fully understood. This study characterized multiple novel HBV preS/S-gene mutants obtained from an OBI patient. Methods PreS/S-gene mutants were analyzed by clonal sequencing. Viral replication and expression were analyzed by transfecting HBV genomic recombinants into HepG2 cells. Results Twenty-one preS/S-gene mutants were cloned from four sequential serum samples, including 13 mutants that were not previously documented: (1) sI/T126V+sG145R; (2) preS1 nt 3014−3198 deletion; (3) preS1 nt 3046−3177 deletion; (4) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion; (5) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion+sG145R; (6) preS1 nt 3115−3123 deletion+sQ129N; (7) preS1 nt 3115−3123 deletion+s126−127 “RPCMNCTI” insertion; (8) s115−116 “INGTST” insertion; (9) s115−116 “INGTST” insertion+sG145R; (10) s126−127 “RPCMNCTI” insertion; (11) preS1 nt 2848−2862 deletion+preS2 initiation codon M→I; (12) s122−123 “KSTGLCK” insertion+sQ129N; and (13) preS2 initiation codon M→I+s131−133TSM→NST. The proportion of preS1 nt 3046−3177 deletion and preS2 initiation codon M→I+s131−133TSM→NST mutants increased in the viral pool with prolonged disease. The 13 novel OBI-related mutants showed a 51.2−99.9% decrease in HBsAg levels compared with that of the wild type. Additional N-glycosylation-associated mutations, sQ129N and s131−133TSM→NST, but not s126−127 “RPCMNCTI,” greatly attenuated anti-HBs binding to HBsAg. Compared with the wild type, replication and surface antigen promoter II activity of the preS1 nt 3046−3177 deletion mutant decreased by 43.3% and 97.0%, respectively. Conclusion PreS/S-gene mutations may play coordinated roles in the presentation of OBI and might be associated with disease progression. This has implications for HBV diagnosis and vaccine improvement. PMID:27182775

Disruption of the Opal Stop Codon Attenuates Chikungunya Virus-Induced Arthritis and Pathology

PubMed Central

Jones, Jennifer E.; Long, Kristin M.; Whitmore, Alan C.; Sanders, Wes; Thurlow, Lance R.; Brown, Julia A.; Morrison, Clayton R.; Vincent, Heather; Browning, Christian; Moorman, Nathaniel; Lim, Jean K.

2017-01-01

ABSTRACT Chikungunya virus (CHIKV) is a mosquito-borne alphavirus responsible for several significant outbreaks of debilitating acute and chronic arthritis and arthralgia over the past decade. These include a recent outbreak in the Caribbean islands and the Americas that caused more than 1 million cases of viral arthralgia. Despite the major impact of CHIKV on global health, viral determinants that promote CHIKV-induced disease are incompletely understood. Most CHIKV strains contain a conserved opal stop codon at the end of the viral nsP3 gene. However, CHIKV strains that encode an arginine codon in place of the opal stop codon have been described, and deep-sequencing analysis of a CHIKV isolate from the Caribbean identified both arginine and opal variants within this strain. Therefore, we hypothesized that the introduction of the arginine mutation in place of the opal termination codon may influence CHIKV virulence. We tested this by introducing the arginine mutation into a well-characterized infectious clone of a CHIKV strain from Sri Lanka and designated this virus Opal524R. This mutation did not impair viral replication kinetics in vitro or in vivo. Despite this, the Opal524R virus induced significantly less swelling, inflammation, and damage within the feet and ankles of infected mice. Further, we observed delayed induction of proinflammatory cytokines and chemokines, as well as reduced CD4+ T cell and NK cell recruitment compared to those in the parental strain. Therefore, the opal termination codon plays an important role in CHIKV pathogenesis, independently of effects on viral replication. PMID:29138302

Two cloned β thalassemia genes are associated with amber mutations at codon 39

PubMed Central

Pergolizzi, Robert; Spritz, Richard A.; Spence, Sally; Goossens, Michel; Kan, Yuet Wai; Bank, Arthur

1981-01-01

Two β globin genes from patients with the β+ thalassemia phenotype have been cloned and sequenced. A single nucleotide change from CAG to TAG (an amber mutation) at codon 39 is the only difference from normal in both genes analyzed. The results are consistent with the assumption that both patients are doubly heterozygous for β+ and β° thalassemia, and that we have isolated and analyzed the β° thalassemia gene. Images PMID:6278453

Codon usage bias and phylogenetic analysis of mitochondrial ND1 gene in pisces, aves, and mammals.

PubMed

Uddin, Arif; Choudhury, Monisha Nath; Chakraborty, Supriyo

2018-01-01

The mitochondrially encoded NADH:ubiquinone oxidoreductase core subunit 1 (MT-ND1) gene is a subunit of the respiratory chain complex I and involved in the first step of the electron transport chain of oxidative phosphorylation (OXPHOS). To understand the pattern of compositional properties, codon usage and expression level of mitochondrial ND1 genes in pisces, aves, and mammals, we used bioinformatic approaches as no work was reported earlier. In this study, a perl script was used for calculating nucleotide contents and different codon usage bias parameters. The codon usage bias of MT-ND1 was low but the expression level was high as revealed from high ENC and CAI value. Correspondence analysis (COA) suggests that the pattern of codon usage for MT-ND1 gene is not same across species and that compositional constraint played an important role in codon usage pattern of this gene among pisces, aves, and mammals. From the regression equation of GC12 on GC3, it can be inferred that the natural selection might have played a dominant role while mutation pressure played a minor role in influencing the codon usage patterns. Further, ND1 gene has a discrepancy with cytochrome B (CYB) gene in preference of codons as evident from COA. The codon usage bias was low. It is influenced by nucleotide composition, natural selection, mutation pressure, length (number) of amino acids, and relative dinucleotide composition. This study helps in understanding the molecular biology, genetics, evolution of MT-ND1 gene, and also for designing a synthetic gene.

Inferring Selection on Amino Acid Preference in Protein Domains

PubMed Central

Durbin, Richard

2009-01-01

Models that explicitly account for the effect of selection on new mutations have been proposed to account for “codon bias” or the excess of “preferred” codons that results from selection for translational efficiency and/or accuracy. In principle, such models can be applied to any mutation that results in a preferred allele, but in most cases, the fitness effect of a specific mutation cannot be predicted. Here we show that it is possible to assign preferred and unpreferred states to amino acid changing mutations that occur in protein domains. We propose that mutations that lead to more common amino acids (at a given position in a domain) can be considered “preferred alleles” just as are synonymous mutations leading to codons for more abundant tRNAs. We use genome-scale polymorphism data to show that alleles for preferred amino acids in protein domains occur at higher frequencies in the population, as has been shown for preferred codons. We show that this effect is quantitative, such that there is a correlation between the shift in frequency of preferred alleles and the predicted fitness effect. As expected, we also observe a reduction in the numbers of polymorphisms and substitutions at more important positions in domains, consistent with stronger selection at those positions. We examine the derived allele frequency distribution and polymorphism to divergence ratios of preferred and unpreferred differences and find evidence for both negative and positive selections acting to maintain protein domains in the human population. Finally, we analyze a model for selection on amino acid preferences in protein domains and find that it is consistent with the quantitative effects that we observe. PMID:19095755

Mutation at embB Codon 306, a Potential Marker for the Identification of Multidrug Resistance Associated with Ethambutol in Mycobacterium tuberculosis

PubMed Central

Cuevas-Córdoba, Betzaida; Juárez-Eusebio, Dulce María; Almaraz-Velasco, Raquel; Muñiz-Salazar, Raquel; Laniado-Laborin, Rafael

2015-01-01

Ethambutol inhibits arabinogalactan and lipoarabinomannan biosynthesis in mycobacteria. The occurrence of mutations in embB codon 306 in ethambutol-susceptible isolates and their absence in resistant isolates has raised questions regarding the utility of this codon as a potential marker for resistance against ethambutol. The characterization of mutations on embB 306 will contribute to a better understanding of the mechanisms of resistance to this drug; therefore, the purpose of this study was to investigate the association between embB 306 mutations and first-line drug resistance profiles in tuberculosis isolates. We sequenced the region surrounding the embB 306 codon in 175 tuberculosis clinical isolates, divided according to drug sensitivity, in three groups: 110 were resistant to at least one first-line drug, of which 61 were resistant to ethambutol (EMBr), 49 were sensitive to ethambutol (EMBs) but were resistant to another drug, and 65 were pansensitive isolates (Ps). The associations between embB 306 mutations and phenotypic resistance to all first-line drugs were determined, and their validity and safety as a diagnostic marker were assessed. One of the Ps isolates (1/65), one of the EMBs isolates (1/49), and 20 of the EMBr isolates (20/61) presented with an embB 306 mutation. Four different single-nucleotide polymorphisms (SNPs) at embB 306 were associated with simultaneous resistance to ethambutol, isoniazid, and rifampin (odds ratio [OR], 17.7; confidence interval [CI], 5.6 to 56.1) and showed a positive predictive value of 82%, with a specificity of 97% for diagnosing multidrug resistance associated with ethambutol, indicating its potential as a molecular marker for several drugs. PMID:26124153

hOGG1 Ser326Cys polymorphism and G:C-to-T:A mutations: no evidence for a role in tobacco-related non small cell lung cancer.

PubMed

Hu, Ying Chuan; Ahrendt, Steven A

2005-04-10

Human 8-oxoguanine DNA glycosylase 1 (hOGG1) plays a major role in the repair of 8-hydroxyguanine, one of the major forms of DNA damage generated by reactive oxygen species in tobacco smoke. If left unrepaired by hOGG1, 8-hydroxyguanine can produce G:C-to-T:A transversions. Recent studies have suggested that the hOGG1 Ser326Cys polymorphism is associated with both a decrease in enzyme activity and an increased risk of lung cancer. To define the interaction between tobacco carcinogens, hOGG1-mediated DNA repair and DNA damage, we examined the role of the hOGG1 Ser326Cys polymorphism in mutation of the p53 gene in non small cell lung cancer (NSCLC). Tumor and nonneoplastic DNA were collected from 141 cigarette smokers with NSCLC. p53 mutations were detected by direct dideoxy sequencing and/or the GeneChip p53 assay in 74 of the 141 (52%) tumors. hOGG1 codon 326 polymorphisms were identified by polymerase chain reaction-restriction fragment length polymorphism analysis. The distribution of hOGG1 codon 326 genotypes was Ser/Ser, 90 of 141 (64%); Ser/Cys, 45 of 141 (32%); and Cys/Cys, 6 of 141 (4%). p53 mutations were significantly (p = 0.04) less common in NSCLC from patients with codon 326 Ser/Cys or Cys/Cys genotypes (21 of 51; 41%) than in NSCLC from Ser/Ser homozygotes (53 of 90; 59%). The decrease in p53 mutation frequency among carriers of the Cys allele was more evident in lung squamous cell cancer [7 of 17 (41%) for Cys/Cys and Ser/Cys vs. 27 of 38 (71%) for Ser/Ser; p = 0.04] than in nonbronchoalveolar adenocarcinoma [11 of 26 (42%) for Cys/Cys and Ser/Cys vs. 20 of 35 (57%) for Ser/Ser; p = 0.25]. The prevalence of G:C-to-T:A transversions was similar among hOGG1 codon 326 genotypes. In summary, the hOGG1 codon 326 Cys allele was associated with a decrease in p53 mutations and no effect on G:C-to-T:A transversions in NSCLC. This decrease in p53 mutations in vivo is not consistent with a decrease in the repair of 8-hydroxyguanine among carriers of the hOGG1 codon 326 Cys allele in vitro. (c) 2004 Wiley-Liss, Inc.

Comparative Genomic Analysis MERS CoV Isolated from Humans and Camels with Special Reference to Virus Encoded Helicase.

PubMed

Alnazawi, Mohamed; Altaher, Abdallah; Kandeel, Mahmoud

2017-01-01

Middle East Respiratory Syndrome Coronavirus (MERS CoV) is a new emerging viral disease characterized by high fatality rate. Understanding MERS CoV genetic aspects and codon usage pattern is important to understand MERS CoV survival, adaptation, evolution, resistance to innate immunity, and help in finding the unique aspects of the virus for future drug discovery experiments. In this work, we provide comprehensive analysis of 238 MERS CoV full genomes comprised of human (hMERS) and camel (cMERS) isolates of the virus. MERS CoV genome shaping seems to be under compositional and mutational bias, as revealed by preference of A/T over G/C nucleotides, preferred codons, nucleotides at the third position of codons (NT3s), relative synonymous codon usage, hydropathicity (Gravy), and aromaticity (Aromo) indices. Effective number of codons (ENc) analysis reveals a general slight codon usage bias. Codon adaptation index reveals incomplete adaptation to host environment. MERS CoV showed high ability to resist the innate immune response by showing lower CpG frequencies. Neutrality evolution analysis revealed a more significant role of mutation pressure in cMERS over hMERS. Correspondence analysis revealed that MERS CoV genomes have three genetic clusters, which were distinct in their codon usage, host, and geographic distribution. Additionally, virtual screening and binding experiments were able to identify three new virus-encoded helicase binding compounds. These compounds can be used for further optimization of inhibitors.

Non-uniqueness of factors constraint on the codon usage in Bombyx mori.

PubMed

Jia, Xian; Liu, Shuyu; Zheng, Hao; Li, Bo; Qi, Qi; Wei, Lei; Zhao, Taiyi; He, Jian; Sun, Jingchen

2015-05-06

The analysis of codon usage is a good way to understand the genetic and evolutionary characteristics of an organism. However, there are only a few reports related with the codon usage of the domesticated silkworm, Bombyx mori (B. mori). Hence, the codon usage of B. mori was analyzed here to reveal the constraint factors and it could be helpful to improve the bioreactor based on B. mori. A total of 1,097 annotated mRNA sequences from B. mori were analyzed, revealing there is only a weak codon bias. It also shows that the gene expression level is related to the GC content, and the amino acids with higher general average hydropathicity (GRAVY) and aromaticity (Aromo). And the genes on the primary axis are strongly positively correlated with the GC content, and GC3s. Meanwhile, the effective number of codons (ENc) is strongly correlated with codon adaptation index (CAI), gene length, and Aromo values. However, the ENc values are correlated with the second axis, which indicates that the codon usage in B. mori is affected by not only mutation pressure and natural selection, but also nucleotide composition and the gene expression level. It is also associated with Aromo values, and gene length. Additionally, B. mori has a greater relative discrepancy in codon preferences with Drosophila melanogaster (D. melanogaster) or Saccharomyces cerevisiae (S. cerevisiae) than with Arabidopsis thaliana (A. thaliana), Escherichia coli (E. coli), or Caenorhabditis elegans (C. elegans). The codon usage bias in B. mori is relatively weak, and many influence factors are found here, such as nucleotide composition, mutation pressure, natural selection, and expression level. Additionally, it is also associated with Aromo values, and gene length. Among them, natural selection might play a major role. Moreover, the "optimal codons" of B. mori are all encoded by G and C, which provides useful information for enhancing the gene expression in B. mori through codon optimization.

Population-Based Genetic Study of β-Thalassemia Mutations in Mardan Division, Khyber Pakhtunkhwa Province, Pakistan.

PubMed

Muhammad, Raj; Shakeel, Muhammad; Rehman, Shoaib U; Lodhi, Muhammad A

2017-03-01

β-Thalassemia (β-thal) is the most prevalent hereditary blood disorder in Pakistan with a carrier rate of 5.0-8.0%. The homozygous affected children require frequent blood transfusions for their survival. This autosomal recessive disease can only be prevented through awareness programs, carrier screening, mutation detection, genetic counseling and prenatal diagnosis (PND). The present study aimed to determine the prevalence of various mutations causing β-thal and also to detect carriers of these mutations in families living in the Mardan Division, Khyber Pakhtunkhwa (KP) Province, Pakistan. The study was conducted at the Department of Biochemistry, Abdul Wali Khan University Mardan, Pakistan. Blood samples of β-thalassemic families were collected from various transfusion centers in Mardan Division. Using the amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) technique, all samples were analyzed for the six most common mutations causing β-thal in this area. Six different mutant primers for the detection of different mutations were used. The most common mutations detected in thalassemic patients were frameshift codons (FSC) 8/9 (+G) (HBB: c.27_28insG), codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), and IVS-I-5 (G>C) (HBB: c.92+5G>C). The predominant mutation for carrying the mutant genes for β-thal were FSC 8/9, IVS-I-5, codons 41/42, IVS-I-1. It was also found that 66.7% of marriages were consanguineous. The FSC 8/9 mutation was found to be the most common β-thal mutation with a frequency of 44.4%. This research project provides a strong incentive for the establishment of large scale mutation detection and PND services in the Mardan Division.

Whole genome sequencing based characterization of extensively drug-resistant Mycobacterium tuberculosis isolates from Pakistan.

PubMed

Ali, Asho; Hasan, Zahra; McNerney, Ruth; Mallard, Kim; Hill-Cawthorne, Grant; Coll, Francesc; Nair, Mridul; Pain, Arnab; Clark, Taane G; Hasan, Rumina

2015-01-01

Improved molecular diagnostic methods for detection drug resistance in Mycobacterium tuberculosis (MTB) strains are required. Resistance to first- and second- line anti-tuberculous drugs has been associated with single nucleotide polymorphisms (SNPs) in particular genes. However, these SNPs can vary between MTB lineages therefore local data is required to describe different strain populations. We used whole genome sequencing (WGS) to characterize 37 extensively drug-resistant (XDR) MTB isolates from Pakistan and investigated 40 genes associated with drug resistance. Rifampicin resistance was attributable to SNPs in the rpoB hot-spot region. Isoniazid resistance was most commonly associated with the katG codon 315 (92%) mutation followed by inhA S94A (8%) however, one strain did not have SNPs in katG, inhA or oxyR-ahpC. All strains were pyrazimamide resistant but only 43% had pncA SNPs. Ethambutol resistant strains predominantly had embB codon 306 (62%) mutations, but additional SNPs at embB codons 406, 378 and 328 were also present. Fluoroquinolone resistance was associated with gyrA 91-94 codons in 81% of strains; four strains had only gyrB mutations, while others did not have SNPs in either gyrA or gyrB. Streptomycin resistant strains had mutations in ribosomal RNA genes; rpsL codon 43 (42%); rrs 500 region (16%), and gidB (34%) while six strains did not have mutations in any of these genes. Amikacin/kanamycin/capreomycin resistance was associated with SNPs in rrs at nt1401 (78%) and nt1484 (3%), except in seven (19%) strains. We estimate that if only the common hot-spot region targets of current commercial assays were used, the concordance between phenotypic and genotypic testing for these XDR strains would vary between rifampicin (100%), isoniazid (92%), flouroquinolones (81%), aminoglycoside (78%) and ethambutol (62%); while pncA sequencing would provide genotypic resistance in less than half the isolates. This work highlights the importance of expanded targets for drug resistance detection in MTB isolates.

β-Thalassemia mutations in Western India: outcome of prenatal diagnosis in a hemoglobinopathies project.

PubMed

Patel, Ashwin P; Patel, Rupesh B; Patel, Saumyaa A; Vaniawala, Salil N; Patel, Dipika S; Shrivastava, Naina S; Sharma, Narmadeshwar P; Zala, Jayendrasinh V; Parmar, Prakash H; Naik, Madhuben R

2014-01-01

Prenatal diagnosis (PND) is one of the most cost effective preventive methods, but it is available only in the large cities of India. Therefore, we initiated a program that offers PND and allows us to determine the prevalence of various mutations. Pregnant females (n = 111,426) were screened for hemoglobinopathies using complete blood count (CBC) and high performance liquid chromatography (HPLC). If the female had a hemoglobinopathy, her husband was then tested. If hemoglobinopathies were seen in both partners, a genetic mutation study was performed on the couple. Fetal samples were obtained by either chorionic villus sampling (CVS) in 70.6% or amniocentesis in 29.4%. The study included 282 couples. IVS-I-5 (G > C) was the most common mutation in all castes except in the Sindhis and Lohanas, where the 619 bp deletion was the most common. Prenatal testing was informative in 97.9% of the couples. A significant number of couples (41.0%) underwent PND during their first pregnancy. Seven patients with β-thalassemia (β-thal) trait had normal Hb A2 levels. The Hb A2 and Hb F values varied significantly (p < 0.0001 and 0.0082, respectively) among mutations associated with β-thal. The IVS-I-5, 619 bp deletion, codons 41/42 (-CTTT), codons 8/9 (+G) and IVS-I-1 (G > T or G > A), were present in 81.0% of the couples tested. β-Thalassemia mutation frequency varied among the different castes, underlining the need for evolving a testing strategy that considers the caste system. Targeting antenatal clinics could also prove to be a most cost effective way of preventing hemoglobinopathies.

JGH Foundation emerging leadership lecture. Significance of hepatitis B virus genotypes and mutations in the development of hepatocellular carcinoma in Asia.

PubMed

Chan, Henry Lik-Yuen

2011-01-01

Advances in molecular biology technology in the last two decades have allowed detailed study of the viral mutations and genomic heterogeneity of hepatitis B virus (HBV). The first mutant discovered was precore stop codon mutation. It was reported in HBeAg-negative patients and initially thought to associate with fulminant hepatitis. Subsequent studies have suggested that it is merely one of the mechanisms of losing HBeAg by the virus. Another mutation that can downregulate the production of HBeAg is the basal core promoter mutation, which is located in the X gene upstream of the precore region. Based on the configuration of codon 15 and the stability of the epsilon of the precore region, these two mutants will be differentially selected during the course of HBeAg seroconversion. The most common HBV genotypes in South-East Asia are genotype B and C HBV. The higher hepatocellular carcinoma (HCC) risk of genotype C HBV has been confirmed by longitudinal studies in Hong Kong and Taiwan. One possible carcinogenic mechanism is its association with basal core promoter mutation, which has also been found to be a risk factor of HCC. Within genotype C HBV, subgenotype Cs is predominant in South-East Asia and subgenotype Ce is predominant in East Asia. Subgenotype Ce HBV has been found to have the highest risk of HCC as compared with subgenotype Cs or genotype B HBV. The understanding of the carcinogenic mechanisms of these HBV strains may shed light into future therapeutics in the prevention and treatment of HBV-related HCC. © 2010 Journal of Gastroenterology and Hepatology Foundation and Blackwell Publishing Asia Pty Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rafi, M.A.; Luzi, P.; Hershberger, M.

Globoid cell leukodystrophy (GCL) or Krabbe disease is an autosomal recessive disorder resulting from a deficiency of galactocerebrosidase (GALC) activity. The typical human patient presents with symptoms of spasticity, developmental delay and irritability by 6 months of age. Older patients, including adults, are also diagnosed with this disorder. While patients from all ethnic groups are included within the more than 230 patients diagnosed in this laboratory, many trace their ancestry to Northern Europe. Patients are easy to diagnose by their low GALC activity. However, carriers are difficult to identify due to a large overlap in the {open_quotes}control{close_quotes} and carrier ranges.more » With our cloning of the GALC gene we have undertaken a study to identify mutations causing GCL in some of our families. We have identified a C to T transition at position {open_quotes}502{close_quotes} (counting form the A of the initiation codon) in about 65% of the mutant alleles in patients with Northern European ancestry. Identification of an intron 32 nucleotides downstream from the site of the mutation permits amplification of genomic DNA samples and rapid cycle sequencing. This mutation was found primarily in classic infantile patients, however it was found in the heterozygous state in a juvenile patient and in an African-American patient. This mutation changes the codon for arginine to one for cysteine, and computer analysis predicts a significant change in the secondary structure of this multi-subunit enzyme. A G to A transition at position {open_quotes}694{close_quotes} was found in the homozygous state in another infantile patient from a consanguineous mating. We are in the process of looking for this mutation in other patients. It is hoped that a few mutations will be found to be responsible for infantile Krabbe disease so that carrier identification can be improved for some families.« less

Detecting Adaptation in Protein-Coding Genes Using a Bayesian Site-Heterogeneous Mutation-Selection Codon Substitution Model.

PubMed

Rodrigue, Nicolas; Lartillot, Nicolas

2017-01-01

Codon substitution models have traditionally attempted to uncover signatures of adaptation within protein-coding genes by contrasting the rates of synonymous and non-synonymous substitutions. Another modeling approach, known as the mutation-selection framework, attempts to explicitly account for selective patterns at the amino acid level, with some approaches allowing for heterogeneity in these patterns across codon sites. Under such a model, substitutions at a given position occur at the neutral or nearly neutral rate when they are synonymous, or when they correspond to replacements between amino acids of similar fitness; substitutions from high to low (low to high) fitness amino acids have comparatively low (high) rates. Here, we study the use of such a mutation-selection framework as a null model for the detection of adaptation. Following previous works in this direction, we include a deviation parameter that has the effect of capturing the surplus, or deficit, in non-synonymous rates, relative to what would be expected under a mutation-selection modeling framework that includes a Dirichlet process approach to account for across-codon-site variation in amino acid fitness profiles. We use simulations, along with a few real data sets, to study the behavior of the approach, and find it to have good power with a low false-positive rate. Altogether, we emphasize the potential of recent mutation-selection models in the detection of adaptation, calling for further model refinements as well as large-scale applications. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Tumour MLH1 promoter region methylation testing is an effective prescreen for Lynch Syndrome (HNPCC).

PubMed

Newton, K; Jorgensen, N M; Wallace, A J; Buchanan, D D; Lalloo, F; McMahon, R F T; Hill, J; Evans, D G

2014-12-01

Lynch syndrome (LS) patients have DNA mismatch repair deficiency and up to 80% lifetime risk of colorectal cancer (CRC). Screening of mutation carriers reduces CRC incidence and mortality. Selection for constitutional mutation testing relies on family history (Amsterdam and Bethesda Guidelines) and tumour-derived biomarkers. Initial biomarker analysis uses mismatch repair protein immunohistochemistry and microsatellite instability. Abnormalities in either identify mismatch repair deficiency but do not differentiate sporadic epigenetic defects, due to MLH1 promoter region methylation (13% of CRCs) from LS (4% of CRCs). A diagnostic biomarker capable of making this distinction would be valuable. This study compared two biomarkers in tumours with mismatch repair deficiency; quantification of methylation of the MLH1 promoter region using a novel assay and BRAF c.1799T>A, p.(Val600Glu) mutation status in the identification of constitutional mutations. Tumour DNA was extracted (formalin fixed, paraffin embedded, FFPE tissue) and pyrosequencing used to test for MLH1 promoter methylation and presence of the BRAF c.1799T>A, p.(Val600Glu) mutation 71 CRCs from individuals with pathogenic MLH1 mutations and 73 CRCs with sporadic MLH1 loss. Specificity and sensitivity was compared. Unmethylated MLH1 promoter: sensitivity 94.4% (95% CI 86.2% to 98.4%), specificity 87.7% (95% CI 77.9% to 94.2%), Wild-type BRAF (codon 600): sensitivity 65.8% (95% CI 53.7% to 76.5%), specificity 98.6% (95% CI 92.4% to 100.0%) for the identification of those with pathogenic MLH1 mutations. Quantitative MLH1 promoter region methylation using pyrosequencing is superior to BRAF codon 600 mutation status in identifying constitutional mutations in mismatch repair deficient tumours. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Impact of KRAS codon subtypes from a randomised phase II trial of selumetinib plus docetaxel in KRAS mutant advanced non-small-cell lung cancer.

PubMed

Jänne, P A; Smith, I; McWalter, G; Mann, H; Dougherty, B; Walker, J; Orr, M C M; Hodgson, D R; Shaw, A T; Pereira, J R; Jeannin, G; Vansteenkiste, J; Barrios, C H; Franke, F A; Crinò, L; Smith, P

2015-07-14

Selumetinib (AZD6244, ARRY-142886)+docetaxel increases median overall survival (OS) and significantly improves progression-free survival (PFS) and objective response rate (ORR) compared with docetaxel alone in patients with KRAS mutant, stage IIIB/IV non-small-cell lung cancer (NSCLC; NCT00890825). Retrospective analysis of OS, PFS, ORR and change in tumour size at week 6 for different sub-populations of KRAS codon mutations. In patients receiving selumetinib+docetaxel and harbouring KRAS G12C or G12V mutations there were trends towards greater improvement in OS, PFS and ORR compared with other KRAS mutations. Different KRAS mutations in NSCLC may influence selumetinib/docetaxel sensitivity.

Identification of a novel mutation in the human growth hormone receptor gene (GHR) in a patient with Laron syndrome.

PubMed

Gennero, Isabelle; Edouard, Thomas; Rashad, Mona; Bieth, Eric; Conte-Aurio, Françoise; Marin, Françoise; Tauber, Maithé; Salles, Jean Pierre; El Kholy, Mohamed

2007-07-01

Deletions and mutations in the growth hormone receptor (GHR) gene are the underlying etiology of Laron syndrome (LS) or growth hormone (GH) insensitivity syndrome (GHIS), an autosomal recessive disease. Most patients are distributed in or originate from Mediterranean and Middle-Eastern countries. Sixty mutations have been described so far. We report a novel mutation in the GHR gene in a patient with LS. Genomic DNA sequencing of exon 5 revealed a TT insertion at nucleotide 422 after codon 122. The insertion resulted in a frameshift introducing a premature termination codon that led to a truncated receptor. We present clinical, biochemical and molecular evidence of LS as the result of this homozygous insertion.

Meningocerebrovascular amyloidosis associated with a novel transthyretin mis-sense mutation at codon 18 (TTRD 18G)

PubMed Central

Vidal, R.; Garzuly, F.; Budka, H.; Lalowski, M.; Linke, R. P.; Brittig, F.; Frangione, B.; Wisniewski, T.

1996-01-01

We describe a novel transthyretin mutation at codon 18 where Asp is replaced by Gly (D18G) in a Hungarian kindred. This mutation is associated with meningocerebrovascular amyloidosis, producing dementia, ataxia, and spasticity. Fifty different transthyretin mutations are related to amyloid deposition, typically producing a peripheral neuropathy or cardiac dysfunction. These symptoms are absent in this family. Up to now, amyloid-beta (A beta), cystatin C, and prion proteins have been known to be deposited as amyloid in the brain, leading to stroke or dementia. With this report we establish that transthyretin amyloid deposition can also produce central nervous system dysfunction as the major clinical symptom. Images Figure 2 Figure 4 PMID:8579098

Two novel mutations in the alpha-galactosidase gene in Japanese classical hemizygotes with Fabry disease.

PubMed

Okumiya, T; Takenaka, T; Ishii, S; Kase, R; Kamei, S; Sakuraba, H

1996-09-01

Four alpha-galactosidase gene mutations were identified in Japanese male patients with Fabry disease who had no detectable alpha-galactosidase activity. Two of them were novel mutations, an 11-bp deletion in exon 2 and a g-1 to t substitution at the 3' end of the splice acceptor site in intron 1. The former caused a frameshift and led to the creation of a new stop codon at codon 118. The latter was predicted to provoke aberrant mRNA splicing followed by accelerated degradation of the mRNA. A nonsense mutation, R301X, and a 2-bp deletion starting at nucleotide position 718, which were reported previously, were also identified in unrelated patients.

The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

PubMed

Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

2000-03-01

Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

Comprehensive analysis of the codon usage patterns in the envelope glycoprotein E2 gene of the classical swine fever virus

PubMed Central

Chi, Xiaojuan; Wang, Song; Ma, Yanmei; Chen, Jilong

2017-01-01

The classical swine fever virus (CSFV), circulating worldwide, is a highly contagious virus. Since the emergence of CSFV, it has caused great economic loss in swine industry. The envelope glycoprotein E2 gene of the CSFV is an immunoprotective antigen that induces the immune system to produce neutralizing antibodies. Therefore, it is essential to study the codon usage of the E2 gene of the CSFV. In this study, 140 coding sequences of the E2 gene were analyzed. The value of effective number of codons (ENC) showed low codon usage bias in the E2 gene. Our study showed that codon usage could be described mainly by mutation pressure ENC plot analysis combined with principal component analysis (PCA) and translational selection-correlation analysis between the general average hydropathicity (Gravy) and aromaticity (Aroma), and nucleotides at the third position of codons (A3s, T3s, G3s, C3s and GC3s). Furthermore, the neutrality analysis, which explained the relationship between GC12s and GC3s, revealed that natural selection had a key role compared with mutational bias during the evolution of the E2 gene. These results lay a foundation for further research on the molecular evolution of CSFV. PMID:28880881

Comprehensive analysis of the codon usage patterns in the envelope glycoprotein E2 gene of the classical swine fever virus.

PubMed

Chen, Ye; Li, Xinxin; Chi, Xiaojuan; Wang, Song; Ma, Yanmei; Chen, Jilong

2017-01-01

The classical swine fever virus (CSFV), circulating worldwide, is a highly contagious virus. Since the emergence of CSFV, it has caused great economic loss in swine industry. The envelope glycoprotein E2 gene of the CSFV is an immunoprotective antigen that induces the immune system to produce neutralizing antibodies. Therefore, it is essential to study the codon usage of the E2 gene of the CSFV. In this study, 140 coding sequences of the E2 gene were analyzed. The value of effective number of codons (ENC) showed low codon usage bias in the E2 gene. Our study showed that codon usage could be described mainly by mutation pressure ENC plot analysis combined with principal component analysis (PCA) and translational selection-correlation analysis between the general average hydropathicity (Gravy) and aromaticity (Aroma), and nucleotides at the third position of codons (A3s, T3s, G3s, C3s and GC3s). Furthermore, the neutrality analysis, which explained the relationship between GC12s and GC3s, revealed that natural selection had a key role compared with mutational bias during the evolution of the E2 gene. These results lay a foundation for further research on the molecular evolution of CSFV.

Genome-wide comparative analysis of codon usage bias and codon context patterns among cyanobacterial genomes.

PubMed

Prabha, Ratna; Singh, Dhananjaya P; Sinha, Swati; Ahmad, Khurshid; Rai, Anil

2017-04-01

With the increasing accumulation of genomic sequence information of prokaryotes, the study of codon usage bias has gained renewed attention. The purpose of this study was to examine codon selection pattern within and across cyanobacterial species belonging to diverse taxonomic orders and habitats. We performed detailed comparative analysis of cyanobacterial genomes with respect to codon bias. Our analysis reflects that in cyanobacterial genomes, A- and/or T-ending codons were used predominantly in the genes whereas G- and/or C-ending codons were largely avoided. Variation in the codon context usage of cyanobacterial genes corresponded to the clustering of cyanobacteria as per their GC content. Analysis of codon adaptation index (CAI) and synonymous codon usage order (SCUO) revealed that majority of genes are associated with low codon bias. Codon selection pattern in cyanobacterial genomes reflected compositional constraints as major influencing factor. It is also identified that although, mutational constraint may play some role in affecting codon usage bias in cyanobacteria, compositional constraint in terms of genomic GC composition coupled with environmental factors affected codon selection pattern in cyanobacterial genomes. Copyright © 2016 Elsevier B.V. All rights reserved.

Consequences of germline variation disrupting the constitutional translational initiation codon start sites of MLH1 and BRCA2: use of potential alternative start sites and implications for predicting variant pathogenicity

PubMed Central

Parsons, Michael T.; Whiley, Phillip J.; Beesley, Jonathan; Drost, Mark; de Wind, Niels; Thompson, Bryony A.; Marquart, Louise; Hopper, John L.; Jenkins, Mark A.; Brown, Melissa A.; Tucker, Kathy; Warwick, Linda; Buchanan, Daniel D.; Spurdle, Amanda B.

2014-01-01

Variants that disrupt the translation initiation sequences in cancer predisposition genes are generally assumed to be deleterious. However few studies have validated these assumptions with functional and clinical data. Two cancer syndrome gene variants likely to affect native translation initiation were identified by clinical genetic testing: MLH1:c.1A>G p.(Met1?) and BRCA2:c.67+3A>G. In vitro GFP-reporter assays were conducted to assess the consequences of translation initiation disruption on alternative downstream initiation codon usage. Analysis of MLH1:c.1A>G p.(Met1?) showed that translation was mostly initiated at an in-frame position 103 nucleotides downstream, but also at two ATG sequences downstream. The protein product encoded by the in-frame transcript initiating from position c.103 showed loss of in vitro mismatch repair activity comparable to known pathogenic mutations. BRCA2:c.67+3A>G was shown by mRNA analysis to result in an aberrantly spliced transcript deleting exon 2 and the consensus ATG site. In the absence of exon 2, translation initiated mostly at an out-of-frame ATG 323 nucleotides downstream, and to a lesser extent at an in-frame ATG 370 nucleotides downstream. Initiation from any of the downstream alternative sites tested in both genes would lead to loss of protein function, but further clinical data is required to confirm if these variants are associated with a high cancer risk. Importantly, our results highlight the need for caution in interpreting the functional and clinical consequences of variation that leads to disruption of the initiation codon, since translation may not necessarily occur from the first downstream alternative start site, or from a single alternative start site. PMID:24302565

Linkage and mutational analysis of familial Alzheimer disease kindreds for the APP gene region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kamino, K.; Anderson, L.; O'dahl, S.

1992-11-01

A large number of familial Alzheimer disease (FAD) kindreds were examined to determine whether mutations in the amyloid precursor protein (APP) gene could be responsible for the disease. Previous studies have identified three mutations at APP codon 717 which are pathogenic for Alzheimer disease (AD). Samples from affected subjects were examined for mutations in exons 16 and 17 of the APP gene. A combination of direct sequencing and single-strand conformational polymorphism analysis was used. Sporadic AD and normal controls were also examined by the same methods. Five sequence variants were identified. One variant at APP codon 693 resulted in amore » Glu[yields]Gly change. This is the same codon as the hereditary cerebral hemorrhage with amyloidosis-Dutch type Glu[yields]Gln mutation. Another single-base change at APP codon 708 did not alter the amino acid encoded at this site. Two point mutations and a 6-bp deletion were identified in the intronic sequences surrounding exon 17. None of the variants could be unambigously determined to be responsible for FAD. The larger families were also analyzed by testing for linkage of FAD to a highly polymorphic short tandem repeat marker (D21S210) that is tightly linked to APP. Highly negative LOD scores were obtained for the family groups tested, and linkage was formally excluded beyond [theta] = .10 for the Volga German kindreds, [theta] = .20 for early-onset non-Volga Germans, and [theta] = .10 for late-onset families. LOD scores for linkage of FAD to markers centromeric to APP (D21S1/S11, D21S13, and D21S215) were also negative in the three family groups. These studies show that APP mutations account for AD in only a small fraction of FAD kindreds. 49 refs., 6 figs., 4 tabs.« less

Genome-wide analysis of codon usage bias in Ebolavirus.

PubMed

Cristina, Juan; Moreno, Pilar; Moratorio, Gonzalo; Musto, Héctor

2015-01-22

Ebola virus (EBOV) is a member of the family Filoviridae and its genome consists of a 19-kb, single-stranded, negative sense RNA. EBOV is subdivided into five distinct species with different pathogenicities, being Zaire ebolavirus (ZEBOV) the most lethal species. The interplay of codon usage among viruses and their hosts is expected to affect overall viral survival, fitness, evasion from host's immune system and evolution. In the present study, we performed comprehensive analyses of codon usage and composition of ZEBOV. Effective number of codons (ENC) indicates that the overall codon usage among ZEBOV strains is slightly biased. Different codon preferences in ZEBOV genes in relation to codon usage of human genes were found. Highly preferred codons are all A-ending triplets, which strongly suggests that mutational bias is a main force shaping codon usage in ZEBOV. Dinucleotide composition also plays a role in the overall pattern of ZEBOV codon usage. ZEBOV does not seem to use the most abundant tRNAs present in the human cells for most of their preferred codons. Copyright © 2014 Elsevier B.V. All rights reserved.

Quantitative Detection and Resolution of BRAF V600 Status in Colorectal Cancer Using Droplet Digital PCR and a Novel Wild-Type Negative Assay.

PubMed

Bidshahri, Roza; Attali, Dean; Fakhfakh, Kareem; McNeil, Kelly; Karsan, Aly; Won, Jennifer R; Wolber, Robert; Bryan, Jennifer; Hughesman, Curtis; Haynes, Charles

2016-03-01

A need exists for robust and cost-effective assays to detect a single or small set of actionable point mutations, or a complete set of clinically informative mutant alleles. Knowledge of these mutations can be used to alert the clinician to a rare mutation that might necessitate more aggressive clinical monitoring or a personalized course of treatment. An example is BRAF, a (proto)oncogene susceptible to either common or rare mutations in codon V600 and adjacent codons. We report a diagnostic technology that leverages the unique capabilities of droplet digital PCR to achieve not only accurate and sensitive detection of BRAF(V600E) but also all known somatic point mutations within the BRAF V600 codon. The simple and inexpensive two-well droplet digital PCR assay uses a chimeric locked nucleic acid/DNA probe against wild-type BRAF and a novel wild-type-negative screening paradigm. The assay shows complete diagnostic accuracy when applied to formalin-fixed, paraffin-embedded tumor specimens from metastatic colorectal cancer patients deficient for Mut L homologue-1. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Demonstration of GTG as an endogenous initiation codon for a human mRNA transcript revealed by molecular cloning of the serpin endopin 2B.

PubMed

Hwang, Shin-Rong; Garza, Christina Z; Wegrzyn, Jill; Hook, Vivian Y H

2004-08-16

This study demonstrates utilization of the novel GTG initiation codon for translation of a human mRNA transcript that encodes the serpin endopin 2B, a protease inhibitor. Molecular cloning revealed the nucleotide sequence of the human endopin 2B cDNA. Its deduced primary sequence shows high homology to bovine endopin 2A that possesses cross-class protease inhibition of elastase and papain. Notably, the human endopin 2B cDNA sequence revealed GTG as the predicted translation initiation codon; the predicted translation product of 46 kDa endopin 2B was produced by in vitro translation of 35S-endopin 2B with mammalian (rabbit) protein translation components. Importantly, bioinformatic studies demonstrated the presence of the entire human endopin 2B cDNA sequence with GTG as initiation codon within the human genome on chromosome 14. Further evidence for GTG as a functional initiation codon was illustrated by GTG-mediated in vitro translation of the heterologous protein EGFP, and by GTG-mediated expression of EGFP in mammalian PC12 cells. Mutagenesis of GTG to GTC resulted in the absence of EGFP expression in PC12 cells, indicating the function of GTG as an initiation codon. In addition, it was apparent that the GTG initiation codon produces lower levels of translated protein compared to ATG as initiation codon. Significantly, GTG-mediated translation of endopin 2B demonstrates a functional human gene product not previously predicted from initial analyses of the human genome. Further analyses based on GTG as an alternative initiation codon may predict new candidate genes of the human genome.

Codon Usage Selection Can Bias Estimation of the Fraction of Adaptive Amino Acid Fixations.

PubMed

Matsumoto, Tomotaka; John, Anoop; Baeza-Centurion, Pablo; Li, Boyang; Akashi, Hiroshi

2016-06-01

A growing number of molecular evolutionary studies are estimating the proportion of adaptive amino acid substitutions (α) from comparisons of ratios of polymorphic and fixed DNA mutations. Here, we examine how violations of two of the model assumptions, neutral evolution of synonymous mutations and stationary base composition, affect α estimation. We simulated the evolution of coding sequences assuming weak selection on synonymous codon usage bias and neutral protein evolution, α = 0. We show that weak selection on synonymous mutations can give polymorphism/divergence ratios that yield α-hat (estimated α) considerably larger than its true value. Nonstationary evolution (changes in population size, selection, or mutation) can exacerbate such biases or, in some scenarios, give biases in the opposite direction, α-hat < α. These results demonstrate that two factors that appear to be prevalent among taxa, weak selection on synonymous mutations and non-steady-state nucleotide composition, should be considered when estimating α. Estimates of the proportion of adaptive amino acid fixations from large-scale analyses of Drosophila melanogaster polymorphism and divergence data are positively correlated with codon usage bias. Such patterns are consistent with α-hat inflation from weak selection on synonymous mutations and/or mutational changes within the examined gene trees. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A novel start codon mutation of the MERTK gene in a patient with retinitis pigmentosa

PubMed Central

Jinda, Worapoj; Poungvarin, Naravat; Taylor, Todd D.; Suzuki, Yutaka; Thongnoppakhun, Wanna; Limwongse, Chanin; Lertrit, Patcharee; Suriyaphol, Prapat

2016-01-01

Purpose Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of inherited retinal degenerations characterized by progressive loss of photoreceptor cells and RPE functions. More than 70 causative genes are known to be responsible for RP. This study aimed to identify the causative gene in a patient from a consanguineous family with childhood-onset severe retinal dystrophy. Methods To identify the defective gene, whole exome sequencing was performed. Candidate causative variants were selected and validated using Sanger sequencing. Segregation analysis of the causative gene was performed in additional family members. To verify that the mutation has an effect on protein synthesis, an expression vector containing the first ten amino acids of the mutant protein fused with the DsRed2 fluorescent protein was constructed and transfected into HEK293T cells. Expression of the fusion protein in the transfected cells was measured using fluorescence microscopy. Results By filtering against public variant databases, a novel homozygous missense mutation (c.3G>A) localized in the start codon of the MERTK gene was detected as a potentially pathogenic mutation for autosomal recessive RP. The c.3G>A mutation cosegregated with the disease phenotype in the family. No expression of the first ten amino acids of the MerTK mutant fused with the DsRed2 fluorescent protein was detected in HEK293T cells, indicating that the mutation affects the translation initiation site of the gene that may lead to loss of function of the MerTK signaling pathway. Conclusions We report a novel missense mutation (c.3G>A, p.0?) in the MERTK gene that causes severe vision impairment in a patient. Taken together with previous reports, our results expand the spectrum of MERTK mutations and extend our understanding of the role of the MerTK protein in the pathogenesis of retinitis pigmentosa. PMID:27122965

Alexander Disease: A Novel Mutation in GFAP Leading to Epilepsia Partialis Continua.

PubMed

Bonthius, Daniel J; Karacay, Bahri

2016-06-01

Alexander disease is a genetically induced leukodystrophy, due to dominant mutations in the glial fibrillary acidic protein (GFAP ) gene, causing dysfunction of astrocytes. We have identified a novel GFAP mutation, associated with a novel phenotype for Alexander disease. A boy with global developmental delay and hypertonia was found to have a leukodystrophy. Genetic analysis revealed a heterozygous point mutation in exon 6 of the GFAP gene. The guanine-to-adenine change causes substitution of the normal glutamic acid codon (GAG) with a mutant lysine codon (AAG) at position 312 (E312 K mutation). At the age of 4 years, the child developed epilepsia partialis continua, consisting of unabating motor seizures involving the unilateral perioral muscles. Epilepsia partialis continua has not previously been reported in association with Alexander disease. Whether and how the E312 K mutation produces pathologic changes and clinical signs that are unique from other Alexander disease-inducing mutations in GFAP remain to be determined. © The Author(s) 2015.

Incidence of Ganciclovir Resistance in CMV-positive Renal Transplant Recipients and its Association with UL97 Gene Mutations.

PubMed

Aslani, Hamid Reza; Ziaie, Shadi; Salamzadeh, Jamshid; Zaheri, Sara; Samadian, Fariba; Mastoor-Tehrani, Shayan

2017-01-01

Human cytomegalovirus (CMV) remains the most common infection affecting organ transplant recipients. Despite advances in the prophylaxis and acute treatment of CMV, it remains an important pathogen affecting the short- and long-term clinical outcome of solid organ transplant recipient. The emergence of CMV resistance in a patient reduces the clinical efficacy of antiviral therapy, complicates therapeutic and clinical management decisions, and in some cases results in loss of the allograft and/or death of the patient. Common mechanisms of CMV resistance to ganciclovir have been described chiefly with the UL97 mutations. Here we evaluate Incidence of ganciclovir resistance in 144 CMV-positive renal transplant recipients and its association with UL97 gene mutations. Active CMV infection was monitored by viral DNA quantification in whole blood, and CMV resistance was assessed by UL97 gene sequencing. Six mutations in six patients were detected. Three patients (2.6%) of 112 patients with history of ganciclovir (GCV) treatment had clinical resistance with single UL97 mutations at loci known to be related to resistance (including mutations at codon 594, codon 460, and codon 520). three patients who were anti-CMV drug naïve had single UL97 mutations (D605E) without clinical resistance. Our results confirm and extend our earlier findings on the specific mutations in the UL97 phosphotransferase gene in loci that have established role in ganciclovir resistance and also indicate that clinical ganciclovir resistance due to UL97 gene mutations is an issue in subjects with history of with ganciclovir treatment. D605E mutations remains a controversial issue that needs further investigations.

Prognostic value of mutational characteristics in gastrointestinal stromal tumors: a single-center experience in 275 cases.

PubMed

Wang, Ming; Xu, Jia; Zhao, Wenyi; Tu, Lin; Qiu, Weiqing; Wang, Chaojie; Shen, Yangyin; Liu, Qiang; Cao, Hui

2014-01-01

The objective of this study was to investigate the impact of KIT/PDGFRA mutations on the prognosis of gastrointestinal stromal tumors (GISTs). In the present study, genotype analyses were performed based on GIST samples from 275 patients. The relationship between mutation and clinicopathological characteristics were explored. All factors were evaluated for their impacts on relapse-free survival (RFS). Briefly, the results of genotype analyses showed that mutations were identified in 258 (93.8 %) patients, and deletion was the most frequent type of mutation accounting for 47.3 % (122/258) of all mutation cases, followed by substitution (87/258, 33.7 %) and duplication (49/258, 19.0 %). Moreover, for KIT exon 11 mutation, the most frequently involved area was from codon 557 to 560. Deep analyses showed that the mutation types were correlated with tumor location (P = 0.005), tumor size (P = 0.022), mitosis rate (P < 0.001), risk grade (P < 0.001), and relapse (P = 0.004). Furthermore, delW557-K558 correlated with mitosis rate (P = 0.042) and relapse (P = 0.036), and delTyr568/570 correlated with tumor origin (P = 0.018). Most importantly, mitotic rate [HR = 2.901 (95 % CI 1.094-7.695), P = 0.032] and risk grade [HR = 9.629 (95 % CI 1.997-46.416), P = 0.005] would be the representative traditional prognostic factors, and deletion with >3 codons would be an novel independent predictor of poor outcome for RFS in GIST patients with deletion mutation of KIT exon 11 [HR = 7.970 (95 % CI 1.774-35.803), P = 0.007]. All results indicated that mutation determined clinicopathological features and prognosis of GISTs, and more than three codons involvement may be a novel adverse indicator.

Impact of KRAS codon subtypes from a randomised phase II trial of selumetinib plus docetaxel in KRAS mutant advanced non-small-cell lung cancer

PubMed Central

Jänne, P A; Smith, I; McWalter, G; Mann, H; Dougherty, B; Walker, J; Orr, M C M; Hodgson, D R; Shaw, A T; Pereira, J R; Jeannin, G; Vansteenkiste, J; Barrios, C H; Franke, F A; Crinò, L; Smith, P

2015-01-01

Background: Selumetinib (AZD6244, ARRY-142886)+docetaxel increases median overall survival (OS) and significantly improves progression-free survival (PFS) and objective response rate (ORR) compared with docetaxel alone in patients with KRAS mutant, stage IIIB/IV non-small-cell lung cancer (NSCLC; NCT00890825). Methods: Retrospective analysis of OS, PFS, ORR and change in tumour size at week 6 for different sub-populations of KRAS codon mutations. Results: In patients receiving selumetinib+docetaxel and harbouring KRAS G12C or G12V mutations there were trends towards greater improvement in OS, PFS and ORR compared with other KRAS mutations. Conclusion: Different KRAS mutations in NSCLC may influence selumetinib/docetaxel sensitivity. PMID:26125448

Codon-Resolution Analysis Reveals a Direct and Context-Dependent Impact of Individual Synonymous Mutations on mRNA Level

PubMed Central

Chen, Siyu; Li, Ke; Cao, Wenqing; Wang, Jia; Zhao, Tong; Huan, Qing; Yang, Yu-Fei; Wu, Shaohuan; Qian, Wenfeng

2017-01-01

Abstract Codon usage bias (CUB) refers to the observation that synonymous codons are not used equally frequently in a genome. CUB is stronger in more highly expressed genes, a phenomenon commonly explained by stronger natural selection on translational accuracy and/or efficiency among these genes. Nevertheless, this phenomenon could also occur if CUB regulates gene expression at the mRNA level, a hypothesis that has not been tested until recently. Here, we attempt to quantify the impact of synonymous mutations on mRNA level in yeast using 3,556 synonymous variants of a heterologous gene encoding green fluorescent protein (GFP) and 523 synonymous variants of an endogenous gene TDH3. We found that mRNA level was positively correlated with CUB among these synonymous variants, demonstrating a direct role of CUB in regulating transcript concentration, likely via regulating mRNA degradation rate, as our additional experiments suggested. More importantly, we quantified the effects of individual synonymous mutations on mRNA level and found them dependent on 1) CUB and 2) mRNA secondary structure, both in proximal sequence contexts. Our study reveals the pleiotropic effects of synonymous codon usage and provides an additional explanation for the well-known correlation between CUB and gene expression level. PMID:28961875

Codon Usage Patterns of Tyrosinase Genes in Clonorchis sinensis.

PubMed

Bae, Young-An

2017-04-01

Codon usage bias (CUB) is a unique property of genomes and has contributed to the better understanding of the molecular features and the evolution processes of particular gene. In this study, genetic indices associated with CUB, including relative synonymous codon usage and effective numbers of codons, as well as the nucleotide composition, were investigated in the Clonorchis sinensis tyrosinase genes and their platyhelminth orthologs, which play an important role in the eggshell formation. The relative synonymous codon usage patterns substantially differed among tyrosinase genes examined. In a neutrality analysis, the correlation between GC 12 and GC 3 was statistically significant, and the regression line had a relatively gradual slope (0.218). NC-plot, i.e., GC 3 vs effective number of codons (ENC), showed that most of the tyrosinase genes were below the expected curve. The codon adaptation index (CAI) values of the platyhelminth tyrosinases had a narrow distribution between 0.685/0.714 and 0.797/0.837, and were negatively correlated with their ENC. Taken together, these results suggested that CUB in the tyrosinase genes seemed to be basically governed by selection pressures rather than mutational bias, although the latter factor provided an additional force in shaping CUB of the C. sinensis and Opisthorchis viverrini genes. It was also apparent that the equilibrium point between selection pressure and mutational bias is much more inclined to selection pressure in highly expressed C. sinensis genes, than in poorly expressed genes.

Mutations in the ADAR1 gene in Chinese families with dyschromatosis symmetrica hereditaria.

PubMed

Zhang, G L; Shi, H J; Shao, M H; Li, M; Mu, H J; Gu, Y; Du, X F; Xie, P

2013-01-04

We investigated 2 Chinese families with dyschromatosis symmetrica hereditaria (DSH) and search for mutations in the adenosine deaminase acting on RNA1 (ADAR1) gene in these 2 pedigrees. We performed a mutation analysis of the ADAR1 gene in 2 Chinese families with DSH and reviewed all articles published regarding ADAR1 mutations reported since 2003 by using PubMed. By direct sequencing, a 2-nucleotide AG deletion, 2099-2100delAG, was found in family 1, and a C→T mutation was identified at nucleotide 1420 that changed codon 474 from arginine to a translational termination codon in family 2. Two different pathogenic mutations were identified, c.2099-2100delAG and c.1420C>T, the former being a novel mutation, and the latter previously reported in 3 other families with DSH. To date, a total of 110 mutations in the ADAR1 gene have been reported, and 10 of them were recurrent; the mutations R474X, R1083C, R1096X, and R1155W might be the DSH-related hotspots.

[Mutations of amyloid precursor protein in early-onset familial Alzheimer's disease].

PubMed

Naruse, S; Tsuji, S; Miyatake, T

1992-09-01

Genetic linkage studies of familial Alzheimer's disease (FAD) have suggested that some form of early-onset FAD is linked to proximal long arm of chromosome 21. It has been also suggested that some form of late-onset FAD is linked to long arm of chromosome 19. Goate et al have identified a mis-sense mutation (Val to Ile) in exon 17 of the amyloid precursor protein (APP) gene in 2 of 16 early-onset FAD families, and have shown that the FAD locus in an FAD family is tightly linked to the mis-sense mutation. To determine if the mis-sense mutation is observed in different ethnic origine, we have studied some early-onset FAD families. Two early-onset FAD families showed the existence of the mutation. As the mutation has been identified in different ethnic origine and the mutation has not been observed in normal individuals, it strengthen hypothesis that the mutation is pathogenic. Recently, Val to Phe and Val to Gly mutations have been also identified at the same codon (Codon 717) of the APP gene.

Atypical radiological findings in achondroplasia with uncommon mutation of the fibroblast growth factor receptor-3 (FGFR-3) gene (Gly to Cys transition at codon 375)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimuri, Gen; Fukushima, Yoshimitsu; Ohashi, Hirofumi

1995-11-20

The recent discovery of mutations in the FGFR-3 (fibroblast growth factor receptor-3) gene (FGFR3) as the cause of achondroplasia has provided new insight into understanding genetic diseases. It was surprising from the viewpoint of molecular genetics that most patients with achondroplasia showed the same mutation at nucleotide 1138, leading to a single amino acid substitution from glycine to arginine at codon 380 (Gly380Arg). All 39 patients examined by two groups had the Gly380Arg; 38 patients and the other demonstrated a G to A and a G to C transition at nucleotide 1138, respectively. Subsequently another group disclosed a G tomore » A transition at the same nucleotide 1138 in 21/23 patients of diverse ethnic origin, although mutations were not identified in two patients. To date, a total of 193 patients with the mutation of the G380Arg have been reported; a single patient with another mutation resulting in a substitution from glycine to cysteine at codon 375 (Gly375Cys) has been described. The presence of this common mutation is consistent with the clinical fact that achondroplastic individuals show less phenotypic variability than is unusual for autosomal dominant diseases. We encountered a Japanese boy with the Gly375Cys. His mother with achondroplasia has the same mutation. The molecular investigation of these patients was reported elsewhere. Here we report the clinical and radiological findings in this boy who demonstrated some atypical manifestations from those of typical achondroplasia. 8 refs., 1 fig.« less

[DNA mutations associated to rifampicin or isoniazid resistance in M. tuberculosis clinical isolates from Sonora, Mexico].

PubMed

Bolado-Martínez, Enrique; Pérez-Mendoza, Ansix; Alegría-Morquecho, Francisco Monserrat; Candia-Plata, María del Carmen; Aguayo-Verdugo, María del Rosario; Alvarez-Hernández, Gerardo

2012-01-01

To perform the analysis of specific regions of the major genes associated with resistance to isoniazid or rifampin. Twenty two M. tuberculosis strains, isolated from human samples obtained in Sonora, Mexico. Specific primers for hotspots of the rpoB, katG, inhA genes and the ahpC-oxyR intergenic region were used. The purified PCR products were sequenced. Mutations in the promoter of inhA, the ahpC-oxyR region, and codon 315 of katG and in 451 or 456 codons of rpoB, were identified. Detection of mutations not previously reported requires further genotypic analysis of Mycobacterium tuberculosis isolates in Sonora.

Congenital deficiency of alpha feto-protein.

PubMed

Sharony, Reuven; Zadik, Idit; Parvari, Ruti

2004-10-01

Alpha-fetoprotein (AFP) is the main fetus serum glycoprotein with a very low concentration in the adult. AFP deficiency is a rare phenomenon. We studied two families with congenital AFP deficiency and searched for mutations in the AFP gene. We identified one mutation of 2 base deletion in exon 8, in both families, that leads to the congenital deficiency of AFP. The mutation nt930-931delCT (T294fs25X) creates a frameshift after codon 294 that leads to a stop codon after 24 amino acids, thus truncating the normal length of AFP of 609 amino acids. All the affected children were found to be homozygous for the mutation as was one of the fathers. The affected individuals were asymptomatic and presented normal development. This first identification of a mutation in the AFP gene demonstrates for the first time that deficiency of AFP is compatible with human normal fetal development and further reproduction in males.

Detection of sdhB Gene Mutations in SDHI-Resistant Isolates of Botrytis cinerea Using High Resolution Melting (HRM) Analysis.

PubMed

Samaras, Anastasios; Madesis, Panagiotis; Karaoglanidis, George S

2016-01-01

Botrytis cinerea , is a high risk pathogen for fungicide resistance development. Pathogen' resistance to SDHIs is associated with several mutations in sdh gene. The diversity of mutations and their differential effect on cross-resistance patterns among SDHIs and the fitness of resistant strains necessitate the availability of a tool for their rapid identification. This study was initiated to develop and validate a high-resolution melting (HRM) analysis for the identification of P225H/F/L//T, N230I, and H272L/R/Y mutations. Based on the sequence of sdh B subunit of resistant and sensitive isolates, a universal primer pair was designed. The specificity of the HRM analysis primers was verified to ensure against the cross-reaction with other fungal species and its sensitivity was evaluated using concentrations of known amounts of mutant's DNA. The melting curve analysis generated nine distinct curve profiles, enabling the discrimination of all the four mutations located at codon 225, the N230I mutation, the three mutations located in codon 272, and the non-mutated isolates (isolates of wild-type sensitivity). Similar results were obtained when DNA was extracted directly from artificially inoculated strawberry fruit. The method was validated by monitoring the presence of sdh B mutations in samples of naturally infected strawberry fruits and stone fruit rootstock seedling plants showing damping-off symptoms. HRM analysis data were compared with a standard PIRA-PCR technique and an absolute agreement was observed suggesting that in both populations the H272R mutation was the predominant one, while H272Y, N230I, and P225H were detected in lower frequencies. The results of the study suggest that HRM analysis can be a useful tool for sensate, accurate, and rapid identification of several sdh B mutations in B. cinerea and it is expected to contribute in routine fungicide resistance monitoring or assessments of the effectiveness of anti-resistance strategies implemented in crops heavily treated with botryticides.

Detection of sdhB Gene Mutations in SDHI-Resistant Isolates of Botrytis cinerea Using High Resolution Melting (HRM) Analysis

PubMed Central

Samaras, Anastasios; Madesis, Panagiotis; Karaoglanidis, George S.

2016-01-01

Botrytis cinerea, is a high risk pathogen for fungicide resistance development. Pathogen’ resistance to SDHIs is associated with several mutations in sdh gene. The diversity of mutations and their differential effect on cross-resistance patterns among SDHIs and the fitness of resistant strains necessitate the availability of a tool for their rapid identification. This study was initiated to develop and validate a high-resolution melting (HRM) analysis for the identification of P225H/F/L//T, N230I, and H272L/R/Y mutations. Based on the sequence of sdhB subunit of resistant and sensitive isolates, a universal primer pair was designed. The specificity of the HRM analysis primers was verified to ensure against the cross-reaction with other fungal species and its sensitivity was evaluated using concentrations of known amounts of mutant’s DNA. The melting curve analysis generated nine distinct curve profiles, enabling the discrimination of all the four mutations located at codon 225, the N230I mutation, the three mutations located in codon 272, and the non-mutated isolates (isolates of wild-type sensitivity). Similar results were obtained when DNA was extracted directly from artificially inoculated strawberry fruit. The method was validated by monitoring the presence of sdhB mutations in samples of naturally infected strawberry fruits and stone fruit rootstock seedling plants showing damping-off symptoms. HRM analysis data were compared with a standard PIRA–PCR technique and an absolute agreement was observed suggesting that in both populations the H272R mutation was the predominant one, while H272Y, N230I, and P225H were detected in lower frequencies. The results of the study suggest that HRM analysis can be a useful tool for sensate, accurate, and rapid identification of several sdhB mutations in B. cinerea and it is expected to contribute in routine fungicide resistance monitoring or assessments of the effectiveness of anti-resistance strategies implemented in crops heavily treated with botryticides. PMID:27895633

Molecular evaluation of PIK3CA gene mutation in breast cancer: determination of frequency, distribution pattern and its association with clinicopathological findings in Indian patients.

PubMed

Ahmad, Firoz; Badwe, Anuya; Verma, Geeta; Bhatia, Simi; Das, Bibhu Ranjan

2016-07-01

Somatic mutations in the PIK3CA gene are common in breast cancer and represent a clinically useful marker for prognosis and therapeutic target. Activating mutations in the PI3K p110 catalytic subunit (PIK3CA) have been identified in 18-40 % of breast carcinomas. In this study, we evaluated PIK3CA mutation in 185 Indian breast cancer patients by direct DNA sequencing. PIK3CA mutations were observed in 23.2 % (43/185) of breast tumor samples. PIK3CA mutations were more frequent exon 30 (76.8 %) than in exon 9 (23.2 %). Mutations were mostly clustered within two hotspot region between nucleotides 1624 and 1636 or between 3129 and 3140. Sequencing analysis revealed four different missense mutations at codon 542 and 545 (E542K, E545K, E545A and E545G) in the helical domain and two different amino acid substitutions at codon 1047 (H1047R and H1047L) in the kinase domain. None of the cases harbored concomitant mutations at multiple codons. PIK3CA mutations were more frequent in older patients, smaller size tumors, ductal carcinomas, grade II tumors, lymph node-positive tumors and non-DCIS tumors; however, none of the differences were significant. In addition, PIK3CA mutations were common in ER+, PR+ and HER2+ cases (30 %), and a comparatively low frequency were noted in triple-negative tumors (13.6 %). In conclusion, to our knowledge, this is the largest study to evaluate the PIK3CA mutation in Indian breast cancer patients. The frequency and distribution pattern of PIK3CA mutations is similar to global reports. Furthermore, identification of molecular markers has unique strengths and can provide insights into the pathogenic process of breast carcinomas.

Improving Escherichia coli FucO for furfural tolerance by saturation mutagenesis of individual amino acid positions.

PubMed

Zheng, Huabao; Wang, Xuan; Yomano, Lorraine P; Geddes, Ryan D; Shanmugam, Keelnatham T; Ingram, Lonnie O

2013-05-01

Furfural is an inhibitory side product formed during the depolymerization of hemicellulose with mineral acids. In Escherichia coli, furfural tolerance can be increased by expressing the native fucO gene (encoding lactaldehyde oxidoreductase). This enzyme also catalyzes the NADH-dependent reduction of furfural to the less toxic alcohol. Saturation mutagenesis was combined with growth-based selection to isolate a mutated form of fucO that confers increased furfural tolerance. The mutation responsible, L7F, is located within the interfacial region of FucO homodimers, replacing the most abundant codon for leucine with the most abundant codon for phenylalanine. Plasmid expression of the mutant gene increased FucO activity by more than 10-fold compared to the wild-type fucO gene and doubled the rate of furfural metabolism during fermentation. No inclusion bodies were evident with either the native or the mutated gene. mRNA abundance for the wild-type and mutant fucO genes differed by less than 2-fold. The Km (furfural) for the mutant enzyme was 3-fold lower than that for the native enzyme, increasing efficiency at low substrate concentrations. The L7F mutation is located near the FucO N terminus, within the ribosomal binding region associated with translational initiation. Free-energy calculations for mRNA folding in this region (nucleotides -7 to +37) were weak for the native gene (-4.1 kcal mol(-1)) but weaker still for the fucO mutant (-1.0 to -0.1 kcal mol(-1)). The beneficial L7F mutation in FucO is proposed to increase furfural tolerance by improving gene expression and increasing enzyme effectiveness at low substrate levels.

Improving Escherichia coli FucO for Furfural Tolerance by Saturation Mutagenesis of Individual Amino Acid Positions

PubMed Central

Zheng, Huabao; Wang, Xuan; Yomano, Lorraine P.; Geddes, Ryan D.; Shanmugam, Keelnatham T.

2013-01-01

Furfural is an inhibitory side product formed during the depolymerization of hemicellulose with mineral acids. In Escherichia coli, furfural tolerance can be increased by expressing the native fucO gene (encoding lactaldehyde oxidoreductase). This enzyme also catalyzes the NADH-dependent reduction of furfural to the less toxic alcohol. Saturation mutagenesis was combined with growth-based selection to isolate a mutated form of fucO that confers increased furfural tolerance. The mutation responsible, L7F, is located within the interfacial region of FucO homodimers, replacing the most abundant codon for leucine with the most abundant codon for phenylalanine. Plasmid expression of the mutant gene increased FucO activity by more than 10-fold compared to the wild-type fucO gene and doubled the rate of furfural metabolism during fermentation. No inclusion bodies were evident with either the native or the mutated gene. mRNA abundance for the wild-type and mutant fucO genes differed by less than 2-fold. The Km (furfural) for the mutant enzyme was 3-fold lower than that for the native enzyme, increasing efficiency at low substrate concentrations. The L7F mutation is located near the FucO N terminus, within the ribosomal binding region associated with translational initiation. Free-energy calculations for mRNA folding in this region (nucleotides −7 to +37) were weak for the native gene (−4.1 kcal mol−1) but weaker still for the fucO mutant (−1.0 to −0.1 kcal mol−1). The beneficial L7F mutation in FucO is proposed to increase furfural tolerance by improving gene expression and increasing enzyme effectiveness at low substrate levels. PMID:23475621

Characterization of six mutations in Exon 37 of neurofibromatosis type 1 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Upadhyaya, M.; Osborn, M.; Maynard, J.

Neurofibromatosis type 1 (NF1) is one of the most common inherited disorders, with an incidence of 1 in 3,000. We screened a total of 320 unrelated NF1 patients for mutations in exon 37 of the NF1 gene. Six independent mutations were identified, of which three are novel, and these include a recurrent nonsense mutation identified in 2 unrelated patients at codon 2281 (G2281X), a 1-bp insertion (6791 ins A) resulting in a change of TAG (tyrosine) to a TAA (stop codon), and a 3-bp deletion (6839 del TAC) which generated a frameshift. Another recurrent nonsense mutation, Y2264X, which was detectedmore » in 2 unrelated patients in this study, was also previously reported in 2 NF1 individuals. All the mutations were identified within a contiguous 49-bp sequence. Further studies are warranted to support the notion that this region of the gene contains highly mutable sequences. 17 refs., 2 figs., 1 tab.« less

Single nucleotide polymorphisms of Helicobacter pylori dupA that lead to premature stop codons.

PubMed

Moura, Sílvia B; Costa, Rafaella F A; Anacleto, Charles; Rocha, Gifone A; Rocha, Andreia M C; Queiroz, Dulciene M M

2012-06-01

 The detection of the putative disease-specific Helicobacter pylori marker duodenal ulcer promoting gene A (dupA) is currently based on PCR detection of jhp0917 and jhp0918 that form the gene. However, mutations that lead to premature stop codons that split off the dupA leading to truncated products cannot be evaluated by PCR. We directly sequence the complete dupA of 75 dupA-positive strains of H. pylori isolated from patients with gastritis (n = 26), duodenal ulcer (n = 29), and gastric carcinoma (n = 20), to search for frame-shifting mutations that lead to stop codon. Thirty-four strains had single nucleotide mutations in dupA that lead to premature stop codon creating smaller products than the predicted 1839 bp product and, for this reason, were considered as dupA-negative. Intact dupA was more frequently observed in strains isolated from duodenal ulcer patients (65.5%) than in patients with gastritis only (46.2%) or with gastric carcinoma (50%). In logistic analysis, the presence of the intact dupA independently associated with duodenal ulcer (OR = 5.06; 95% CI = 1.22-20.96, p = .02).  We propose the primer walking methodology as a simple technique to sequence the gene. When we considered as dupA-positive only those strains that carry dupA gene without premature stop codons, the gene was associated with duodenal ulcer and, therefore, can be used as a marker for this disease in our population. © 2012 Blackwell Publishing Ltd.

Global analysis of translation termination in E. coli.

PubMed

Baggett, Natalie E; Zhang, Yan; Gross, Carol A

2017-03-01

Terminating protein translation accurately and efficiently is critical for both protein fidelity and ribosome recycling for continued translation. The three bacterial release factors (RFs) play key roles: RF1 and 2 recognize stop codons and terminate translation; and RF3 promotes disassociation of bound release factors. Probing release factors mutations with reporter constructs containing programmed frameshifting sequences or premature stop codons had revealed a propensity for readthrough or frameshifting at these specific sites, but their effects on translation genome-wide have not been examined. We performed ribosome profiling on a set of isogenic strains with well-characterized release factor mutations to determine how they alter translation globally. Consistent with their known defects, strains with increasingly severe release factor defects exhibit increasingly severe accumulation of ribosomes over stop codons, indicative of an increased duration of the termination/release phase of translation. Release factor mutant strains also exhibit increased occupancy in the region following the stop codon at a significant number of genes. Our global analysis revealed that, as expected, translation termination is generally efficient and accurate, but that at a significant number of genes (≥ 50) the ribosome signature after the stop codon is suggestive of translation past the stop codon. Even native E. coli K-12 exhibits the ribosome signature suggestive of protein extension, especially at UGA codons, which rely exclusively on the reduced function RF2 variant of the K-12 strain for termination. Deletion of RF3 increases the severity of the defect. We unambiguously demonstrate readthrough and frameshifting protein extensions and their further accumulation in mutant strains for a few select cases. In addition to enhancing recoding, ribosome accumulation over stop codons disrupts attenuation control of biosynthetic operons, and may alter expression of some overlapping genes. Together, these functional alterations may either augment the protein repertoire or produce deleterious proteins.

Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Kuwait and Dubai.

PubMed

Ahmad, Suhail; Mokaddas, Eiman; Fares, Esther

2002-11-01

Mutations conferring resistance to rifampin in rifampin-resistant clinical Mycobacterium tuberculosis isolates occur mostly in the 81 bp rifampin-resistance-determining region (RRDR) of the rpoB gene. In this study, 29 rifampin-resistant and 12 -susceptible clinical M. tuberculosis isolates were tested for characterization of mutations in the rpoB gene by line probe (INNO-LiPA Rif. TB) assay and the results were confirmed and extended by DNA sequencing of the PCR amplified target DNA. The line probe assay identified all 12 susceptible strains as rifampin-sensitive and the DNA sequence of RRDR in the amplified rpoB gene from two isolates matched perfectly with the wild-type sequence. The line probe assay identified 28 resistant isolates as rifampin-resistant with specific detection of mutation in 22 isolates including one isolate that exhibited hetro-resistance containing both the wild-type pattern as well as a specific mutation within RRDR while one of the rifampin-resistant strain was identified as rifampin-susceptible. DNA sequencing confirmed these results and, in addition, led to the specific detection of mutations in 5 rifampin-resistant isolates in which specific base changes within RRDR could not be determined by the line probe assay. These analyses identified 8 different mutations within RRDR of the rpoB gene including one novel mutation (S522W) that has not been reported so far. The genotyping performed on the isolates carrying similar mutations showed that majority of these isolates were unique as they exhibited varying DNA banding patterns. Correlating the ethnic origin of the infected TB patients with the occurrence of specific mutations at three main codon positions (516, 526 and 531) in the rpoB gene showed that most patients (11 of 15) from South Asian region contained mutations at codon 526 while majority of isolates from patients (6 of 11) of Middle Eastern origin contained mutations at codon 531.

Whole Genome Sequencing Based Characterization of Extensively Drug-Resistant Mycobacterium tuberculosis Isolates from Pakistan

PubMed Central

Ali, Asho; Hasan, Zahra; McNerney, Ruth; Mallard, Kim; Hill-Cawthorne, Grant; Coll, Francesc; Nair, Mridul; Pain, Arnab; Clark, Taane G.; Hasan, Rumina

2015-01-01

Improved molecular diagnostic methods for detection drug resistance in Mycobacterium tuberculosis (MTB) strains are required. Resistance to first- and second- line anti-tuberculous drugs has been associated with single nucleotide polymorphisms (SNPs) in particular genes. However, these SNPs can vary between MTB lineages therefore local data is required to describe different strain populations. We used whole genome sequencing (WGS) to characterize 37 extensively drug-resistant (XDR) MTB isolates from Pakistan and investigated 40 genes associated with drug resistance. Rifampicin resistance was attributable to SNPs in the rpoB hot-spot region. Isoniazid resistance was most commonly associated with the katG codon 315 (92%) mutation followed by inhA S94A (8%) however, one strain did not have SNPs in katG, inhA or oxyR-ahpC. All strains were pyrazimamide resistant but only 43% had pncA SNPs. Ethambutol resistant strains predominantly had embB codon 306 (62%) mutations, but additional SNPs at embB codons 406, 378 and 328 were also present. Fluoroquinolone resistance was associated with gyrA 91–94 codons in 81% of strains; four strains had only gyrB mutations, while others did not have SNPs in either gyrA or gyrB. Streptomycin resistant strains had mutations in ribosomal RNA genes; rpsL codon 43 (42%); rrs 500 region (16%), and gidB (34%) while six strains did not have mutations in any of these genes. Amikacin/kanamycin/capreomycin resistance was associated with SNPs in rrs at nt1401 (78%) and nt1484 (3%), except in seven (19%) strains. We estimate that if only the common hot-spot region targets of current commercial assays were used, the concordance between phenotypic and genotypic testing for these XDR strains would vary between rifampicin (100%), isoniazid (92%), flouroquinolones (81%), aminoglycoside (78%) and ethambutol (62%); while pncA sequencing would provide genotypic resistance in less than half the isolates. This work highlights the importance of expanded targets for drug resistance detection in MTB isolates. PMID:25719196

Mutational analysis in a patient with a variant form of Gaucher disease caused by SAP-2 deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rafi, M.A.; Gala, G. de; Xunling Zhang

1993-01-01

It is now clear that the lysosomal hydrolysis of sphingolipids requires both lysosomal enzymes and so-called sphingolipid activator proteins (SAPs). One gene, called prosaposin, codes for a precursor protein that is proteolytically cut into four putative SAPs. These four SAPs, of about 80 amino acids, share some structural features but differ somewhat in their specificity. Domain 3 of prosaposin mRNA contains the coding region for SAP-2, an activator of glucocerebrosidase. While most patients with Gaucher disease store glucosylceramide due to defects in glucocerebrosidase, a few patients store this lipid in the presence of normal enzyme levels. In this paper themore » authors describe the identification of a point mutation in domain 3 of a patient who died with this variant form of Gaucher disease. Polymerase chain reaction amplification was performed in the small amount of genomic DNA available using primers generated from the intronic sequence surrounding domain 3. The patient was found to have a T-to-G substitution at position 1144 (counting from the A of ATG initiation codon) in half of the M13 recombinant clones. This changes the codon for cysteine[sub 382] to glycine. His father and unaffected brother also had this mutation, but his mother did not. She was found to have half of the normal amount of mRNA for prosaposin in her cultured skin fibroblasts. Therefore, this child inherited a point mutation in domain 3 from his father and a deficiency of all four SAPs coded for by prosaposin from his mother. 29 refs., 3 figs., 1 tab.« less

GNAq mutations are not identified in papillary thyroid carcinomas and hyperfunctioning thyroid nodules.

PubMed

Cassol, Clarissa A; Guo, Miao; Ezzat, Shereen; Asa, Sylvia L

2010-12-01

Activating mutations of GNAq protein in a hotspot at codon 209 have been recently described in uveal melanomas. Since these neoplasms share with thyroid carcinomas a high frequency of MAP kinase pathway-activating mutations, we hypothesized whether GNAq mutations could also play a role in the development of thyroid carcinomas. Additionally, activating mutations of another subtype of G protein (GNAS1) are frequently found in hyperfunctioning thyroid adenomas, making it plausible that GNAq-activating mutations could also be found in some of these nodules. To investigate thyroid papillary carcinomas and thyroid hyperfunctioning nodules for GNAq mutations in exon 5, codon 209, a total of 32 RET/PTC, BRAF, and RAS negative thyroid papillary carcinomas and 13 hyperfunctioning thyroid nodules were evaluated. No mutations were identified. Although plausible, GNAq mutations seem not to play an important role in the development of thyroid follicular neoplasms, either benign hyperfunctioning nodules or malignant papillary carcinomas. Our results are in accordance with the literature, in which no GNAq hotspot mutations were found in thyroid papillary carcinomas, as well as in an extensive panel of other tumors. The molecular basis for MAP-kinase pathway activation in RET-PTC/BRAF/RAS negative thyroid carcinomas remains to be determined.

Identification of a splicing enhancer in MLH1 using COMPARE a new assay for determination of relative RNA splicing efficiencies

PubMed Central

Xu, Dong-Qing; Mattox, William

2006-01-01

Exonic splicing enhancers (ESEs) are sequences that facilitate recognition of splice sites and prevent exon-skipping. Because ESEs are often embedded within proteincoding sequences, alterations in them can also often be interpreted as nonsense, missense or silent mutations. To correctly interpret exonic mutations and their roles in disease, it is important to develop strategies that identify ESE mutations. Potential ESEs can be found computationally in many exons but it has proven difficult to predict if a given mutation will have effects on splicing based on sequence alone. Here we describe a flexible in vitro method that can be used to functionally compare the effects of multiple sequence variants on ESE activity in a single in vitro splicing reaction. We have applied this method in parallel with conventional splicing assays to test for a splicing enhancer in exon 17 of the human MLH1 gene. Point mutations associated with hereditary nonpolyposis colorectal cancer (HNPCC) have previously been found to correlate with exon-skipping in both lymphocytes and tumors from patients. We show that sequences from this exon can replace an ESE from the mouse IgM gene to support RNA splicing in HeLa nuclear extracts. ESE activity was reduced by HNPCC point mutations in codon 659 indicating that their primary effect is on splicing. Surprisingly the strongest enhancer function mapped to a different region of the exon upstream of this codon. Together our results indicate that HNPCC point mutations in codon 659 affect an auxillary element that augments the enhancer function to ensure exon inclusion. PMID:16357104

Novel SIL1 nonstop mutation in a Chinese consanguineous family with Marinesco-Sjögren syndrome and Dandy-Walker syndrome.

PubMed

Gai, Nan; Jiang, Chen; Zou, Yong-Yi; Zheng, Yu; Liang, De-Sheng; Wu, Ling-Qian

2016-07-01

Marinesco-Sjögren syndrome (MSS) is a rare autosomal recessive disorder, which is characterized by congenital cataracts, cerebellar ataxia, progressive muscle weakness, and delayed psychomotor development. SIL1, which is located at 5q31.2, is the only gene known to cause MSS. Dandy-Walker syndrome (DWS) is defined by hypoplasia, upward rotation of the cerebellar vermis, and cystic dilation of the fourth ventricle; however, its genetic pathogeny remains unclear. Here, we report a Chinese consanguineous family with MSS and DWS. Whole exome sequencing identified a novel nonstop mutation in SIL1. Sanger sequencing revealed that the mutation was segregated in this family according to a recessive mode of inheritance. We found that the mutation changed a stop codon (TGA) to an arginine codon (CGA), and no in-frame termination codon in the 3' untranslated region (UTR) of SIL1 could be found. The mRNA levels of SIL1 were decreased by 56.6% and 37.5% in immortalized lymphoblasts of the patients respectively; the protein levels of SIL1 were substantially decreased. This case study is the first report on Chinese MSS patients, MSS complicated by DWS, and a nonstop mutation in SIL1. Our findings imply the pathogenetic association between DWS and MSS. Copyright © 2016 Elsevier B.V. All rights reserved.

Human immunodeficiency virus type 1 pol gene mutations which cause decreased susceptibility to 2',3'-dideoxycytidine.

PubMed Central

Fitzgibbon, J E; Howell, R M; Haberzettl, C A; Sperber, S J; Gocke, D J; Dubin, D T

1992-01-01

To investigate whether human immunodeficiency virus type 1 pol gene mutations are selected during prolonged 2',3'-dideoxycytidine (ddC) therapy, we used the polymerase chain reaction to amplify a portion of the reverse transcriptase segment of the pol gene from the peripheral blood mononuclear cell DNA of a patient with AIDS before and after an 80-week course of ddC therapy. The consensus sequence from the second sample contained a unique double mutation (ACT to GAT) in the codon for reverse transcriptase amino acid 69, causing substitution of aspartic acid (Asp) for the wild-type threonine (Thr). A mutation (ACA to ATA) also occurred in the codon for position 165, causing substitution of isoleucine (Ile) for Thr. The GAT (Asp) codon was introduced into the pol gene of a molecular clone of human immunodeficiency virus via site-directed mutagenesis. Following transfection, mutant and wild-type viruses were tested for susceptibility to ddC by a plaque reduction assay. The mutant virus was fivefold less susceptible to ddC than the wild type; cross-resistance to 3'-azido-3'-deoxythymidine or 2'3'-dideoxyinosine was not found. The Ile-165 mutation did not confer additional ddC resistance. The Asp-69 substitution may have contributed to the generation of resistant virus in this patient. Images PMID:1317143

Mycobacterium tuberculosis embB codon 306 mutations confer moderately increased resistance to ethambutol in vitro and in vivo.

PubMed

Plinke, Claudia; Walter, Kerstin; Aly, Sahar; Ehlers, Stefan; Niemann, Stefan

2011-06-01

Ethambutol (EMB) is a major component of the first-line therapy of tuberculosis. Mutations in codon 306 of embB (embB306) were suggested as a major resistance mechanism in clinical isolates. To directly analyze the impact of individual embB306 mutations on EMB resistance, we used allelic exchange experiments to generate embB306 mutants of M. tuberculosis H37Rv. The level of EMB resistance conferred by particular mutations was measured in vitro and in vivo after EMB therapy by daily gavage in a mouse model of aerogenic tuberculosis. The wild-type embB306 ATG codon was replaced by embB306 ATC, ATA, or GTG, respectively. All of the obtained embB306 mutants exhibited a 2- to 4-fold increase in EMB MIC compared to the wild-type H37Rv. In vivo, the one selected embB306 GTG mutant required a higher dose of ethambutol to restrict its growth in the lung compared to wild-type H37Rv. These experiments demonstrate that embB306 point mutations enhance the EMB MIC in vitro to a moderate, but significant extent, and reduce the efficacy of EMB treatment in the animal model. We propose that conventional EMB susceptibility testing, in combination with embB306 genotyping, may guide dose adjustment to avoid clinical treatment failure in these low-level resistant strains.

Neuropathology of Autosomal Dominant Alzheimer Disease in the National Alzheimer Coordinating Center Database.

PubMed

Ringman, John M; Monsell, Sarah; Ng, Denise W; Zhou, Yan; Nguyen, Andy; Coppola, Giovanni; Van Berlo, Victoria; Mendez, Mario F; Tung, Spencer; Weintraub, Sandra; Mesulam, Marek-Marsel; Bigio, Eileen H; Gitelman, Darren R; Fisher-Hubbard, Amanda O; Albin, Roger L; Vinters, Harry V

2016-03-01

Alzheimer disease (AD) represents a genetically heterogeneous entity. To elucidate neuropathologic features of autosomal dominant AD ([ADAD] due to PSEN1, APP, or PSEN2 mutations), we compared hallmark AD pathologic findings in 60 cases of ADAD and 120 cases of sporadic AD matched for sex, race, ethnicity, and disease duration. Greater degrees of neuritic plaque and neurofibrillary tangle formation and cerebral amyloid angiopathy (CAA) were found in ADAD (p values < 0.01). Moderate to severe CAA was more prevalent in ADAD (63.3% vs. 39.2%, p = 0.003), and persons with PSEN1 mutations beyond codon 200 had higher average Braak scores and severity and prevalence of CAA than those with mutations before codon 200. Lewy body pathology was less extensive in ADAD but was present in 27.1% of cases. We also describe a novel pathogenic PSEN1 mutation (P267A). The finding of more severe neurofibrillary pathology and CAA in ADAD, particularly in carriers of PSEN1 mutations beyond codon 200, warrants consideration when designing trials to treat or prevent ADAD. The finding of Lewy body pathology in a substantial minority of ADAD cases supports the assertion that development of Lewy bodies may be in part driven by abnormal β-amyloid protein precursor processing. © 2016 American Association of Neuropathologists, Inc. All rights reserved.

A protocol for isolating insect mitochondrial genomes: a case study of NUMT in Melipona flavolineata (Hymenoptera: Apidae).

PubMed

Françoso, Elaine; Gomes, Fernando; Arias, Maria Cristina

2016-07-01

Nuclear mitochondrial DNA insertions (NUMTs) are mitochondrial DNA sequences that have been transferred into the nucleus and are recognized by the presence of indels and stop codons. Although NUMTs have been identified in a diverse range of species, their discovery was frequently accidental. Here, our initial goal was to develop and standardize a simple method for isolating NUMTs from the nuclear genome of a single bee. Subsequently, we tested our new protocol by determining whether the indels and stop codons of the cytochrome c oxidase subunit I (COI) sequence of Melipona flavolineata are of nuclear origin. The new protocol successfully demonstrated the presence of a COI NUMT. In addition to NUMT investigations, the protocol described here will also be very useful for studying mitochondrial mutations related to diseases and for sequencing complete mitochondrial genomes with high read coverage by Next-Generation technology.

Monoclonal origin of peritoneal implants and lymph node deposits in serous borderline ovarian tumors (s-BOT) with high intratumoral homogeneity.

PubMed

Horn, Lars-Christian; Höhn, Anne K; Einenkel, Jens; Siebolts, Udo

2014-11-01

Molecular studies have shown that the most prevalent mutations in serous ovarian borderline tumors (s-BOT) are BRAF and/or KRAS alterations. About one third of s-BOT represent peritoneal implants and/or lymph node involvement. These extraovarian deposits may be monoclonal or polyclonal in origin. To test both the hypotheses, mutational analyses using pyrosequencing for BRAF codon 600 and KRAS codon 12/13 and 61 of microdissected tissue was performed in 15 s-BOT and their invasive and noninvasive peritoneal implants. Two to 6 implants from different peritoneal sites were examined in 13 cases. Lymph node deposits were available for the analysis in 3 cases. Six s-BOT showed mutation in exon 2 codon 12 of the KRAS proto-oncogen. Five additional cases showed BRAF p.V600E mutation representing an overall mutation rate of 73.3%. Multiple (2-6) peritoneal implants were analyzed after microdissection in 13 of 15 cases. All showed identical mutational results when compared with the ovarian site of the disease. All lymph node deposits, including those with multiple deposits in different nodes, showed identical results, suggesting high intratumoral mutational homogeneity. The evidence presented in this study and the majority of data reported in the literature support the hypothesis that s-BOT with their peritoneal implants and lymph node deposits show identical mutational status of BRAF and KRAS suggesting a monoclonal rather than a polyclonal disease regarding these both tested genetic loci. In addition, a high intratumoral genetic homogeneity can be suggested. In conclusion, the results of the present study support the monoclonal origin of s-BOT and their peritoneal implants and lymph node deposits.

Co-amplification at lower denaturation-temperature PCR combined with unlabled-probe high-resolution melting to detect KRAS codon 12 and 13 mutations in plasma-circulating DNA of pancreatic adenocarcinoma cases.

PubMed

Wu, Jiong; Zhou, Yan; Zhang, Chun-Yan; Song, Bin-Bin; Wang, Bei-Li; Pan, Bai-Shen; Lou, Wen-Hui; Guo, Wei

2014-01-01

The aim of our study was to establish COLD-PCR combined with an unlabeled-probe HRM approach for detecting KRAS codon 12 and 13 mutations in plasma-circulating DNA of pancreatic adenocarcinoma (PA) cases as a novel and effective diagnostic technique. We tested the sensitivity and specificity of this approach with dilutions of known mutated cell lines. We screened 36 plasma-circulating DNA samples, 24 from the disease control group and 25 of a healthy group, to be subsequently sequenced to confirm mutations. Simultaneously, we tested the specimens using conventional PCR followed by HRM and then used target-DNA cloning and sequencing for verification. The ROC and respective AUC were calculated for KRAS mutations and/or serum CA 19-9. It was found that the sensitivity of Sanger reached 0.5% with COLD- PCR, whereas that obtained after conventional PCR did 20%; that of COLD-PCR based on unlabeled-probe HRM, 0.1%. KRAS mutations were identified in 26 of 36 PA cases (72.2%), while none were detected in the disease control and/or healthy group. KRAS mutations were identified both in 26 PA tissues and plasma samples. The AUC of COLD-PCR based unlabeled probe HRM turned out to be 0.861, which when combined with CA 19-9 increased to 0.934. It was concluded that COLD-PCR with unlabeled-probe HRM can be a sensitive and accurate screening technique to detect KRAS codon 12 and 13 mutations in plasma-circulating DNA for diagnosing and treating PA.

Coinheritance of a novel mutation on the HBA1 gene: c.187delG (p.W62fsX66) [codon 62 (-G) (α1)] with the α212 patchwork allele and Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T].

PubMed

Scheps, Karen G; De Paula, Silvia M; Bitsman, Alicia R; Freigeiro, Daniel H; Basack, F Nora; Pennesi, Sandra P; Varela, Viviana

2013-01-01

We describe a novel frameshift mutation on the HBA1 gene (c.187delG), causative of α-thalassemia (α-thal) in a Black Cuban family with multiple sequence variants in the HBA genes and the Hb S [β6(A3)Glu→Val, GAG>GTG; HBB: c.20A>T] mutation. The deletion of the first base of codon 62 resulted in a frameshift at amino acid 62 with a putative premature termination codon (PTC) at amino acid 66 on the same exon (p.W62fsX66), which most likely triggers nonsense mediated decay of the resulting mRNA. This study also presents the first report of the α212 patchwork allele in Latin America and the description of two new sequence variants in the HBA2 region (c.-614G>A in the promoter region and c.95+39 C>T on the first intron).

Translational Control of the SigR-Directed Oxidative Stress Response in Streptomyces via IF3-Mediated Repression of a Noncanonical GTC Start Codon

PubMed Central

Feeney, Morgan A.; Chandra, Govind; Findlay, Kim C.; Paget, Mark S. B.

2017-01-01

ABSTRACT The major oxidative stress response in Streptomyces is controlled by the sigma factor SigR and its cognate antisigma factor RsrA, and SigR activity is tightly controlled through multiple mechanisms at both the transcriptional and posttranslational levels. Here we show that sigR has a highly unusual GTC start codon and that this leads to another level of SigR regulation, in which SigR translation is repressed by translation initiation factor 3 (IF3). Changing the GTC to a canonical start codon causes SigR to be overproduced relative to RsrA, resulting in unregulated and constitutive expression of the SigR regulon. Similarly, introducing IF3* mutations that impair its ability to repress SigR translation has the same effect. Thus, the noncanonical GTC sigR start codon and its repression by IF3 are critical for the correct and proper functioning of the oxidative stress regulatory system. sigR and rsrA are cotranscribed and translationally coupled, and it had therefore been assumed that SigR and RsrA are produced in stoichiometric amounts. Here we show that RsrA can be transcribed and translated independently of SigR, present evidence that RsrA is normally produced in excess of SigR, and describe the factors that determine SigR-RsrA stoichiometry. PMID:28611250

Translational repression of mouse mu opioid receptor expression via leaky scanning

PubMed Central

Song, Kyu Young; Hwang, Cheol Kyu; Kim, Chun Sung; Choi, Hack Sun; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H.

2007-01-01

Mu opioid receptor (MOR) expression is under temporal and spatial controls, but expression levels of the MOR gene are relatively low in vivo. In addition to transcriptional regulations, upstream AUGs (uAUGs) and open reading frames (uORFs) profoundly affect the translation of the primary ORF and thus the protein levels in several genes. The 5′-untranslated region (UTR) of mouse MOR mRNA contains three uORFs preceding the MOR main initiation codon. In MOR-fused EGFP or MOR promoter/luciferase reporter constructs, mutating each uAUG individually or in combinations increased MOR transient heterologous expression in neuroblastoma NMB and HEK293 cells significantly. Translation of such constructs increased up to 3-fold without altering the mRNA levels if either the third uAUG or both the second and third AUGs were mutated. Additionally, these uAUG-mediated translational inhibitions were independent of their peptide as confirmed by internal mutation analyses in each uORF. Translational studies indicated that protein syntheses were initiated at these uAUG initiation sites, with the third uAUG initiating the highest translation level. These results support the hypothesis that uORFs in mouse MOR mRNA act as negative regulators through a ribosome leaky scanning mechanism. Such leaky scanning resulted in the suppression of mouse MOR under normal conditions. PMID:17284463

Mutagenesis of the three bases preceding the start codon of the beta-galactosidase mRNA and its effect on translation in Escherichia coli.

PubMed Central

Hui, A; Hayflick, J; Dinkelspiel, K; de Boer, H A

1984-01-01

The effect on the translation efficiency of various mutations in the three bases (the -1 triplet) that precede the AUG start codon of the beta-galactosidase mRNA in Escherichia coli was studied. Of the 39 mutants examined, the level of expression varies over a 20-fold range. The most favorable combinations of bases in the -1 triplet are UAU and CUU. The expression levels in the mutants with UUC, UCA or AGG as the -1 triplet are 20-fold lower than those with UAU or CUU. In general, a U residue immediately preceding the start codon is more favorable for expression than any other base; furthermore, an A residue at the -2 position enhances the translation efficiency in most instances. In both cases, however, the degree of enhancement depends on its context, i.e. the neighboring bases. Although the rules derived from this study are complex, the results show that mutations in any of the three bases preceding the start codon can strongly affect the translational efficiency of the beta-galactosidase mRNA. PMID:6425057

Characterization of the mutations in the glucose-6-phosphatase gene in Israeli patients with glycogen storage disease type 1a: R83C in six Jews and a novel V166G mutation in a Muslim Arab.

PubMed

Parvari, R; Moses, S; Hershkovitz, E; Carmi, R; Bashan, N

1995-01-01

Glycogen storage disease type 1a (GSD 1a), an autosomal recessive disease, is caused by the inactivity of glucose-6-phosphatase, the gene of which has been recently cloned. We report on the missense mutation C-->T at nucleotide 326 of the G6Pase gene, causing the change of the Arg codon at position 83 into a Cys codon, as the single mutation detected in six Jewish patients. This finding suggests that this mutation might be prevalent among the Jewish population. A new missense mutation T-->G at nucleotide 576 resulting in V166G was found in an Arab Muslim patient. These families may benefit now from pre- and postnatal diagnosis by analysis of DNA from blood and amniotic fluid or chorionic villus cells rather than liver biopsy. No mutations in the G6Pase gene were detected in two GSD 1b patients.

Complex codon usage pattern and compositional features of retroviruses.

PubMed

RoyChoudhury, Sourav; Mukherjee, Debaprasad

2013-01-01

Retroviruses infect a wide range of organisms including humans. Among them, HIV-1, which causes AIDS, has now become a major threat for world health. Some of these viruses are also potential gene transfer vectors. In this study, the patterns of synonymous codon usage in retroviruses have been studied through multivariate statistical methods on ORFs sequences from the available 56 retroviruses. The principal determinant for evolution of the codon usage pattern in retroviruses seemed to be the compositional constraints, while selection for translation of the viral genes plays a secondary role. This was further supported by multivariate analysis on relative synonymous codon usage. Thus, it seems that mutational bias might have dominated role over translational selection in shaping the codon usage of retroviruses. Codon adaptation index was used to identify translationally optimal codons among genes from retroviruses. The comparative analysis of the preferred and optimal codons among different retroviral groups revealed that four codons GAA, AAA, AGA, and GGA were significantly more frequent in most of the retroviral genes inspite of some differences. Cluster analysis also revealed that phylogenetically related groups of retroviruses have probably evolved their codon usage in a concerted manner under the influence of their nucleotide composition.

Translation efficiency is determined by both codon bias and folding energy

PubMed Central

Tuller, Tamir; Waldman, Yedael Y.; Kupiec, Martin; Ruppin, Eytan

2010-01-01

Synonymous mutations do not alter the protein produced yet can have a significant effect on protein levels. The mechanisms by which this effect is achieved are controversial; although some previous studies have suggested that codon bias is the most important determinant of translation efficiency, a recent study suggested that mRNA folding at the beginning of genes is the dominant factor via its effect on translation initiation. Using the Escherichia coli and Saccharomyces cerevisiae transcriptomes, we conducted a genome-scale study aiming at dissecting the determinants of translation efficiency. There is a significant association between codon bias and translation efficiency across all endogenous genes in E. coli and S. cerevisiae but no association between folding energy and translation efficiency, demonstrating the role of codon bias as an important determinant of translation efficiency. However, folding energy does modulate the strength of association between codon bias and translation efficiency, which is maximized at very weak mRNA folding (i.e., high folding energy) levels. We find a strong correlation between the genomic profiles of ribosomal density and genomic profiles of folding energy across mRNA, suggesting that lower folding energies slow down the ribosomes and decrease translation efficiency. Accordingly, we find that selection forces act near uniformly to decrease the folding energy at the beginning of genes. In summary, these findings testify that in endogenous genes, folding energy affects translation efficiency in a global manner that is not related to the expression levels of individual genes, and thus cannot be detected by correlation with their expression levels. PMID:20133581

Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.

PubMed

Rujito, Lantip; Basalamah, Muhammad; Mulatsih, Sri; Sofro, Abdul Salam M

2015-08-03

Thalassemia is the most prevalent genetic blood disorder worldwide, and particularly prevalent in Indonesia. The purpose of this study was to determine the spectrum of β-thalassemia (β-thal) mutations found in the southern region of Central Java, Indonesia. The subjects of the study included 209 β-thal Javanese patients from Banyumas Residency, a southwest region of Central Java Province. DNA analysis was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), amplification refractory mutation system (ARMS), and the direct sequencing method. The results showed that 14 alleles were found in the following order: IVS-I-5 (G > C) (HBB: c.92 + 5G > C) 43.5%, codon 26 (Hb E; HBB: c.79G > A) 28.2%, IVS-I-1 (G > A) (HBB: c.92 + 1G > A) 5.0%, codon 15 (TGG > TAG) (HBB: c.47G > A) 3.8%, IVS-I-1 (G > T) (HBB: c.92 + 1G > T) 3.1%, codon 35 (-C) (HBB: c.110delC) 2.4%. The rest, including codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), codons 8/9 (+G) (HBB: c.27_28insG), codon 19 (AAC > AGC) (HBB: c.59A > G), codon 17 (AAG > TAG) (HBB: c.52A > T), IVS-I-2 (T > C) (HBB: c.92 + 2T > C), codons 123/124/125 (-ACCCCACC) (HBB: c.370_378delACCCCACCA), codon 40 (-G) (HBB: c.123delG) and Cap +1 (A > C) (HBB: c.-50A > C), accounted for up to 1.0% each. The most prevalent alleles would be recommended to be used as part of β-thal screening for the Javanese, one of the major ethnic groups in the country.

Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.

PubMed

Rujito, Lantip; Basalamah, Muhammad; Mulatsih, Sri; Sofro, Abdul Salam M

2015-01-01

Thalassemia is the most prevalent genetic blood disorder worldwide, and particularly prevalent in Indonesia. The purpose of this study was to determine the spectrum of β-thalassemia (β-thal) mutations found in the southern region of Central Java, Indonesia. The subjects of the study included 209 β-thal Javanese patients from Banyumas Residency, a southwest region of Central Java Province. DNA analysis was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), amplification refractory mutation system (ARMS), and the direct sequencing method. The results showed that 14 alleles were found in the following order: IVS-I-5 (G > C) (HBB: c.92 + 5G > C) 43.5%, codon 26 (Hb E; HBB: c.79G > A) 28.2%, IVS-I-1 (G > A) (HBB: c.92 + 1G > A) 5.0%, codon 15 (TGG > TAG) (HBB: c.47G > A) 3.8%, IVS-I-1 (G > T) (HBB: c.92 + 1G > T) 3.1%, codon 35 (-C) (HBB: c.110delC) 2.4%. The rest, including codons 41/42 (-TTCT) (HBB: c.126_129delCTTT), codons 8/9 (+G) (HBB: c.27_28insG), codon 19 (AAC > AGC) (HBB: c.59A > G), codon 17 (AAG > TAG) (HBB: c.52A > T), IVS-I-2 (T > C) (HBB: c.92 + 2T > C), codons 123/124/125 (-ACCCCACC) (HBB: c.370_378delACCCCACCA), codon 40 (-G) (HBB: c.123delG) and Cap +1 (A > C) (HBB: c.-50A > C), accounted for up to 1.0% each. The most prevalent alleles would be recommended to be used as part of β-thal screening for the Javanese, one of the major ethnic groups in the country.

Evolutionary and genetic analysis of the VP2 gene of canine parvovirus.

PubMed

Li, Gairu; Ji, Senlin; Zhai, Xiaofeng; Zhang, Yuxiang; Liu, Jie; Zhu, Mengyan; Zhou, Jiyong; Su, Shuo

2017-07-17

Canine parvovirus (CPV) type 2 emerged in 1978 in the USA and quickly spread among dog populations all over the world with high morbidity. Although CPV is a DNA virus, its genomic substitution rate is similar to some RNA viruses. Therefore, it is important to trace the evolution of CPV to monitor the appearance of mutations that might affect vaccine effectiveness. Our analysis shows that the VP2 genes of CPV isolated from 1979 to 2016 are divided into six groups: GI, GII, GIII, GIV, GV, and GVI. Amino acid mutation analysis revealed several undiscovered important mutation sites: F267Y, Y324I, and T440A. Of note, the evolutionary rate of the CPV VP2 gene from Asia and Europe decreased. Codon usage analysis showed that the VP2 gene of CPV exhibits high bias with an ENC ranging from 34.93 to 36.7. Furthermore, we demonstrate that natural selection plays a major role compared to mutation pressure driving CPV evolution. There are few studies on the codon usage of CPV. Here, we comprehensively studied the genetic evolution, codon usage pattern, and evolutionary characterization of the VP2 gene of CPV. The novel findings revealing the evolutionary process of CPV will greatly serve future CPV research.

uAUG-mediated translational initiations are responsible for human mu opioid receptor gene expression

PubMed Central

Song, Kyu Young; Kim, Chun Sung; Hwang, Cheol Kyu; Choi, Hack Sun; Law, Ping-Yee; Wei, Li-Na; Loh, Horace H

2010-01-01

Abstract Mu opioid receptor (MOR) is the main site of interaction for major clinical analgesics, particularly morphine. MOR expression is regulated at the transcriptional and post-transcriptional levels. However, the protein expression of the MOR gene is relatively low and the translational control of MOR gene has not been well studied. The 5′-untranslated region (UTR) of the human MOR (OPRM1) mRNA contains four upstream AUG codons (uAUG) preceding the main translation initiation site. We mutated the four uAUGs individually and in combination. Mutations of the third uAUG, containing the same open reading frame, had the strongest inhibitory effect. The inhibitory effect caused by the third in-frame uAUG was confirmed by in vitro translation and receptor-binding assays. Toeprinting results showed that OPRM1 ribosomes initiated efficiently at the first uAUG, and subsequently re-initiated at the in-frame #3 uAUG and the physiological AUG site. This re-initiation resulted in negative expression of OPRM1 under normal conditions. These results indicate that re-initiation in MOR gene expression could play an important role in OPRM1 regulation. PMID:19438807

Activation of K-ras by codon 13 mutations in C57BL/6 X C3H F1 mouse tumors induced by exposure to 1,3-butadiene.

PubMed

Goodrow, T; Reynolds, S; Maronpot, R; Anderson, M

1990-08-01

1,3-Butadiene has been detected in urban air, gasoline vapors, and cigarette smoke. It has been estimated that 65,000 workers are exposed to this chemical in occupational settings in the United States. Lymphomas, lung, and liver tumors were induced in female and male C57BL/6 X C3H F1 (hereafter called B6C3F1) mice by inhalation of 6.25 to 625 ppm 1,3-butadiene for 1 to 2 years. The objective of this study was to examine these tumors for the presence of activated protooncogenes by the NIH 3T3 transfection and nude mouse tumorigenicity assays. Transfection of DNA isolated from 7 of 9 lung tumors and 7 of 12 liver tumors induced morphological transformation of NIH 3T3 cells. Southern blot analysis indicated that the transformation induced by 6 lung and 3 liver tumor DNA samples was due to transfer of a K-ras oncogene. Four of the 7 liver tumors that were positive upon transfection contained an activated H-ras gene. The identity of the transforming gene in one of the lung tumors has not been determined but was not a member of the ras family or a met or raf gene. Eleven 1,3-butadiene-induced lymphomas were examined for transforming genes using the nude mouse tumorigenicity assay. Activated K-ras genes were detected in 2 of the 11 lymphomas assayed. DNA sequencing of polymerase chain reaction-amplified ras gene exons revealed that 9 of 11 of the activating K-ras mutations were G to C transversions in codon 13. One liver tumor contained an activated K-ras gene with mutations in both codons 60 and 61. The activating mutation in one of the K-ras genes from a lymphoma was not identified but DNA sequence analysis of amplified regions in proximity to codons 12, 13, and 61 demonstrated that the mutation was not located in or near these codons. Activation of K-ras genes by codon 13 mutations has not been found in any lung or liver tumors or lymphomas from untreated B6C3F1 mice. Thus, the K-ras activation found in 1,3-butadiene-induced B6C3F1 mouse tumors probably occurred as a result of genotoxic effects of this chemical. The oncogenes most frequently detected in human pulmonary adenocarcinomas are K-ras genes. Activated K-ras genes have also been found in some human lymphomas. This suggest that activation of K-ras may be important in the induction of human pulmonary adenocarcinomas and lymphomas.(ABSTRACT TRUNCATED AT 400 WORDS)

Codon usage in Chlamydia trachomatis is the result of strand-specific mutational biases and a complex pattern of selective forces

PubMed Central

Romero, Héctor; Zavala, Alejandro; Musto, Héctor

2000-01-01

The patterns of synonymous codon choices of the completely sequenced genome of the bacterium Chlamydia trachomatis were analysed. We found that the most important source of variation among the genes results from whether the sequence is located on the leading or lagging strand of replication, resulting in an over representation of G or C, respectively. This can be explained by different mutational biases associated to the different enzymes that replicate each strand. Next we found that most highly expressed sequences are located on the leading strand of replication. From this result, replicational-transcriptional selection can be invoked. Then, when the genes located on the leading strand are studied separately, the correspondence analysis detects a principal trend which discriminates between lowly and highly expressed sequences, the latter displaying a different codon usage pattern than the former, suggesting selection for translation, which is reinforced by the fact that Ks values between orthologous sequences from C.trachomatis and Chlamydia pneumoniae are much smaller in highly expressed genes. Finally, synonymous codon choices appear to be influenced by the hydropathy of each encoded protein and by the degree of amino acid conservation. Therefore, synonymous codon usage in C.trachomatis seems to be the result of a very complex balance among different factors, which rises the problem of whether the forces driving codon usage patterns among microorganisms are rather more complex than generally accepted. PMID:10773076

Codon usage in Chlamydia trachomatis is the result of strand-specific mutational biases and a complex pattern of selective forces.

PubMed

Romero, H; Zavala, A; Musto, H

2000-05-15

The patterns of synonymous codon choices of the completely sequenced genome of the bacterium Chlamydia trachomatis were analysed. We found that the most important source of variation among the genes results from whether the sequence is located on the leading or lagging strand of replication, resulting in an over representation of G or C, respectively. This can be explained by different mutational biases associated to the different enzymes that replicate each strand. Next we found that most highly expressed sequences are located on the leading strand of replication. From this result, replicational-transcriptional selection can be invoked. Then, when the genes located on the leading strand are studied separately, the correspondence analysis detects a principal trend which discriminates between lowly and highly expressed sequences, the latter displaying a different codon usage pattern than the former, suggesting selection for translation, which is reinforced by the fact that Ks values between orthologous sequences from C. trachomatis and Chlamydia pneumoniae are much smaller in highly expressed genes. Finally, synonymous codon choices appear to be influenced by the hydropathy of each encoded protein and by the degree of amino acid conservation. Therefore, synonymous codon usage in C.trachomatis seems to be the result of a very complex balance among different factors, which rises the problem of whether the forces driving codon usage patterns among microorganisms are rather more complex than generally accepted.

Synonymous codon usage of genes in polymerase complex of Newcastle disease virus.

PubMed

Kumar, Chandra Shekhar; Kumar, Sachin

2017-06-01

Newcastle disease virus (NDV) is pathogenic to both avian and non-avian species but extensively finds poultry as its primary host and causes heavy economic losses in the poultry industry. In this study, a total of 186 polymerase complex comprising of nucleoprotein (N), phosphoprotein (P), and large polymerase (L) genes of NDV was analyzed for synonymous codon usage. The relative synonymous codon usage and effective number of codons (ENC) values were used to estimate codon usage variation in each gene. Correspondence analysis (COA) was used to study the major trend in codon usage variation. Analyzing the ENC plot values against GC3s (at synonymous third codon position) we concluded that mutational pressure was the main factor determining codon usage bias than translational selection in NDV N, P, and L genes. Moreover, correlation analysis indicated, that aromaticity of N, P, and L genes also influenced the codon usage variation. The varied distribution of pathotypes for N, P, and L gene clearly suggests that change in codon usage for NDV is pathotype specific. The codon usage preference similarity in N, P, and L gene might be detrimental for polymerase complex functioning. The study represents a comprehensive analysis to date of N, P, and L genes codon usage pattern of NDV and provides a basic understanding of the mechanisms for codon usage bias. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Using Student Writing and Lexical Analysis to Reveal Student Thinking about the Role of Stop Codons in the Central Dogma

PubMed Central

Prevost, Luanna B.; Smith, Michelle K.; Knight, Jennifer K.

2016-01-01

Previous work has shown that students have persistent difficulties in understanding how central dogma processes can be affected by a stop codon mutation. To explore these difficulties, we modified two multiple-choice questions from the Genetics Concept Assessment into three open-ended questions that asked students to write about how a stop codon mutation potentially impacts replication, transcription, and translation. We then used computer-assisted lexical analysis combined with human scoring to categorize student responses. The lexical analysis models showed high agreement with human scoring, demonstrating that this approach can be successfully used to analyze large numbers of student written responses. The results of this analysis show that students’ ideas about one process in the central dogma can affect their thinking about subsequent and previous processes, leading to mixed models of conceptual understanding. PMID:27909016

Multiple primary tumors of the upper aerodigestive tract: is there a role for constitutional mutations in the p53 gene?

PubMed

Gallo, O; Sardi, I; Pepe, G; Franchi, A; Attanasio, M; Giusti, B; Bocciolini, C; Abbate, R

1999-07-19

Head-and-neck cancer (HNC) patients have a high risk of developing second primary tumors of the upper aerodigestive tract, the main cause of death. Although the roles of tobacco and diet in multiple head-and-neck carcinogenesis have been thoroughly investigated, little is known about individual genetic susceptibility factors involved in this process. Genomic instability, reflecting the propensity and the susceptibility of the genome to acquire multiple alterations, could be considered a driving force behind multiple carcinogenesis. Mutation of the p53 tumor-suppressor gene has been proposed to play an important role in this process. Therefore, we evaluated the incidence of inherited p53 germ-line alteration(s) in a population of 24 consecutive HNC patients and their first-degree relatives affected by multiple malignancies as well as the occurrence of p53 somatic acquired mutation(s) in 16 cancers, including first and second primaries from 5 HNCs of the same group. Mutations in exons 4-11 of the p53 gene were investigated using SSCP-PCR analysis and DNA sequencing. Analysis was extended to the peripheral blood and cancer biopsies available from first-degree relatives of cancer-prone families with p53 germ-line mutations. p53 germ-line mutations were identified in the peripheral blood and corresponding cancers of 3 HNC patients who had multiple malignancies. The only missense mutation detected was mapped in exon 6; it is a GTG to GAG substitution with an amino acid change from Val to Glu at codon 197. The remaining 2 p53 germ-line mutations were single-nucleotide substitutions without amino acid change in exon 6 (codon 213, CGA to CGG) and in exon 8 (codon 295, CCT to CCC), respectively. These mutations were found in HNC patients with a family history of cancer. Abnormal expression of wild-type p53 protein in normal and pathological tissues from patients with the same sense single-nucleotide substitutions was detected by immuno-histochemistry.

The frequency of EGFR and KRAS mutations in non-small cell lung cancer (NSCLC): routine screening data for central Europe from a cohort study

PubMed Central

Boch, Christian; Kollmeier, Jens; Roth, Andreas; Stephan-Falkenau, Susann; Misch, Daniel; Grüning, Wolfram; Bauer, Torsten Thomas; Mairinger, Thomas

2013-01-01

Objectives Owing to novel therapy strategies in epidermal growth factor receptor (EGFR)-mutated patients, molecular analysis of the EGFR and KRAS genome has become crucial for routine diagnostics. Till date these data have been derived mostly from clinical trials, and thus collected in pre-selected populations. We therefore screened ‘allcomers’ with a newly diagnosed non-small cell lung carcinoma (NSCLC) for the frequencies of these mutations. Design A cohort study. Setting Lung cancer centre in a tertiary care hospital. Participants Within 15 months, a total of 552 cases with NSCLC were eligible for analysis. Primary and secondary outcome measures Frequency of scrutinising exons 18, 19 and 21 for the presence of activating EGFR mutation and secondary codon 12 and 13 for activating KRAS mutations. Results Of the 552 patients, 27 (4.9%) showed a mutation of EGFR. 19 of these patients (70%) had deletion E746-A750 in codon 19 or deletion L858R in codon 21. Adenocarcinoma (ACA) was the most frequent histology among patients with EGFR mutations (ACA, 22/254 (8.7%) vs non-ACA, 5/298 (1.7%); p<0.001). Regarding only ACA, the percentage of EGFR mutations was higher in women (16/116 (14%) women vs 6/138 (4.3%) men; p=0.008). Tumours with an activating EGFR mutation were more likely to be from non-smokers (18/27; 67%) rather than smoker (9/27; 33%). KRAS mutation was present in 85 (15%) of all cases. In 73 patients (86%), the mutation was found in exon 12 and in 12 cases (14%) in exon 13. Similarly, ACA had a higher frequency of KRAS mutations than non-ACA (67/254 (26%) vs 18/298 (6.0%); p<0.001). Conclusions We found a lower frequency for EGFR and KRAS mutations in an unselected Caucasian patient cohort as previously published. Taking our results into account, clinical trials may overestimate the mutation frequency for EGFR and KRAS in NSCLC due to important selection biases. PMID:23558737

Large-Scale Genomic Analysis of Codon Usage in Dengue Virus and Evaluation of Its Phylogenetic Dependence

PubMed Central

Lara-Ramírez, Edgar E.; Salazar, Ma Isabel; López-López, María de Jesús; Salas-Benito, Juan Santiago; Sánchez-Varela, Alejandro

2014-01-01

The increasing number of dengue virus (DENV) genome sequences available allows identifying the contributing factors to DENV evolution. In the present study, the codon usage in serotypes 1–4 (DENV1–4) has been explored for 3047 sequenced genomes using different statistics methods. The correlation analysis of total GC content (GC) with GC content at the three nucleotide positions of codons (GC1, GC2, and GC3) as well as the effective number of codons (ENC, ENCp) versus GC3 plots revealed mutational bias and purifying selection pressures as the major forces influencing the codon usage, but with distinct pressure on specific nucleotide position in the codon. The correspondence analysis (CA) and clustering analysis on relative synonymous codon usage (RSCU) within each serotype showed similar clustering patterns to the phylogenetic analysis of nucleotide sequences for DENV1–4. These clustering patterns are strongly related to the virus geographic origin. The phylogenetic dependence analysis also suggests that stabilizing selection acts on the codon usage bias. Our analysis of a large scale reveals new feature on DENV genomic evolution. PMID:25136631

Severe Hemophilia A in a Male Old English Sheep Dog with a C→T Transition that Created a Premature Stop Codon in Factor VIII

PubMed Central

Lozier, Jay N; Kloos, Mark T; Merricks, Elizabeth P; Lemoine, Nathaly; Whitford, Margaret H; Raymer, Robin A; Bellinger, Dwight A; Nichols, Timothy C

2016-01-01

Animals with hemophilia are models for gene therapy, factor replacement, and inhibitor development in humans. We have actively sought dogs with severe hemophilia A that have novel factor VIII mutations unlike the previously described factor VIII intron 22 inversion. A male Old English Sheepdog with recurrent soft-tissue hemorrhage and hemarthrosis was diagnosed with severe hemophilia A (factor VIII activity less than 1% of normal). We purified genomic DNA from this dog and ruled out the common intron 22 inversion; we then sequenced all 26 exons. Comparing the results with the normal canine factor VIII sequence revealed a C→T transition in exon 12 of the factor VIII gene that created a premature stop codon at amino acid 577 in the A2 domain of the protein. In addition, 2 previously described polymorphisms that do not cause hemophilia were present at amino acids 909 and 1184. The hemophilia mutation creates a new TaqI site that facilitates rapid genotyping of affected offspring by PCR and restriction endonuclease analyses. This mutation is analogous to the previously described human factor VIII mutation at Arg583, which likewise is a CpG dinucleotide transition causing a premature stop codon in exon 12. Thus far, despite extensive treatment with factor VIII, this dog has not developed neutralizing antibodies (‘inhibitors’) to the protein. This novel mutation in a dog gives rise to severe hemophilia A analogous to a mutation seen in humans. This model will be useful for studies of the treatment of hemophilia. PMID:27780008

Comparative analysis of KRAS codon 12, 13, 18, 61, and 117 mutations using human MCF10A isogenic cell lines

PubMed Central

Stolze, Britta; Reinhart, Stefanie; Bulllinger, Lars; Fröhling, Stefan; Scholl, Claudia

2015-01-01

KRAS mutations occur in one third of human cancers and cluster in several hotspots, with codons 12 and 13 being most commonly affected. It has been suggested that the position and type of amino acid exchange influence the transforming capacity of mutant KRAS proteins. We used MCF10A human mammary epithelial cells to establish isogenic cell lines that express different cancer-associated KRAS mutations (G12C, G12D, G12V, G13C, G13D, A18D, Q61H, K117N) at physiological or elevated levels, and investigated the biochemical and functional consequences of the different variants. The overall effects of low-expressing mutants were moderate compared to overexpressed variants, but allowed delineation of biological functions that were related to specific alleles rather than KRAS expression level. None of the mutations induced morphological changes, migratory abilities, or increased phosphorylation of ERK, PDK1, and AKT. KRAS-G12D, G12V, G13D, and K117N mediated EGF-independent proliferation, whereas anchorage-independent growth was primarily induced by K117N and Q61H. Both codon 13 mutations were associated with increased EGFR expression. Finally, global gene expression analysis of MCF10A-G13D versus MCF10A-G12D revealed distinct transcriptional changes. Together, we describe a useful resource for investigating the function of multiple KRAS mutations and provide insights into the differential effects of these variants in MCF10A cells. PMID:25705018

Dihydropteroate synthase (DHPS) gene mutation study in HIV-Infected Indian patients with Pneumocystis jirovecii pneumonia.

PubMed

Tyagi, Anuj Kumar; Mirdha, Bijay Ranjan; Luthra, Kalpana; Guleria, Randeep; Mohan, Anant; Singh, Urvashi Balbir; Samantaray, Jyotish Chandra; Dar, Lalit; Iyer, Venkateswaran K; Chaudhry, Rama

2010-11-24

Pneumocystis jirovecii dihydropteroate synthase (DHPS) gene mutations' (55th and 57th codon) association with prior sulfa prophylaxis failure has been reported from both developed and developing countries. We conducted a prospective study to determine the prevalence of P. jirovecii DHPS mutations from 2006 to 2009 on P. jirovecii isolates obtained from HIV-infected patients with a clinical diagnosis of Pneumocystis carinii pneumonia (PCP) admitted to our tertiary care reference health center in New Delhi, India. Detection of P. jirovecii cysts was performed by direct fluorescent antibody (DFA) staining and by Grocott's-Gomori methenamine silver staining (GMS). DNA detection was performed by polymerase chain reaction (PCR) using primers for the major surface glycoprotein (MSG) gene. P. jirovecii DHPS gene was amplified by nested PCR protocol and sequenced for detecting mutations at the 55th and 57th codons. Out of 147 HIV-positive patients with suspected Pneumocystis pneumonia (PCP), 16 (10.8%) PCP positive cases were detected. Of 16 cases, nine (56.2%) were positive by DFA staining, four (25%) were positive by Grocott's-Gomori methenamine silver staining, and all 16 were positive by MSG PCR. DHPS mutations at the 55th and 57th codons were observed in 6.2% of HIV patients studied, which was relatively low compared to reports from developed nations.   Prevalence of Pneumocystis jirovecii DHPS mutations associated with cotrimoxazole treatment failure may be low in the Indian subpopulation of HIV-positive patients and warrants larger studies to elucidate the true picture of Pneumocystis jirovecii sulfa drug resistance in India.

Optimization of routine KRAS mutation PCR-based testing procedure for rational individualized first-line-targeted therapy selection in metastatic colorectal cancer.

PubMed

Chretien, Anne-Sophie; Harlé, Alexandre; Meyer-Lefebvre, Magali; Rouyer, Marie; Husson, Marie; Ramacci, Carole; Harter, Valentin; Genin, Pascal; Leroux, Agnès; Merlin, Jean-Louis

2013-02-01

KRAS mutation detection represents a crucial issue in metastatic colorectal cancer (mCRC). The optimization of KRAS mutation detection delay enabling rational prescription of first-line treatment in mCRC including anti-EGFR-targeted therapy requires robust and rapid molecular biology techniques. Routine analysis of mutations in codons 12 and 13 on 674 paraffin-embedded tissue specimens of mCRC has been performed for KRAS mutations detection using three molecular biology techniques, that is, high-resolution melting (HRM), polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP), and allelic discrimination PCR (TaqMan PCR). Discordant cases were assessed with COBAS 4800 KRAS CE-IVD assay. Among the 674 tumor specimens, 1.5% (10/674) had excessive DNA degradation and could not be analyzed. KRAS mutations were detected in 38.0% (256/674) of the analysable specimens (82.4% in codon 12 and 17.6% in codon 13). Among 613 specimens in whom all three techniques were used, 12 (2.0%) cases of discordance between the three techniques were observed. 83.3% (10/12) of the discordances were due to PCR-RFLP as confirmed by COBAS 4800 retrospective analysis. The three techniques were statistically comparable (κ > 0.9; P < 0.001). From these results, optimization of the routine procedure consisted of proceeding to systematic KRAS detection using HRM and TaqMan and PCR-RFLP in case of discordance and allowed significant decrease in delays. The results showed an excellent correlation between the three techniques. Using HRM and TaqMan warrants high-quality and rapid-routine KRAS mutation detection in paraffin-embedded tumor specimens. The new procedure allowed a significant decrease in delays for reporting results, enabling rational prescription of first-line-targeted therapy in mCRC.

Macular corneal dystrophy in a Chinese family related with novel mutations of CHST6

PubMed Central

Dang, Xiuhong; Zhu, Qingguo; Wang, Li; Su, Hong; Lin, Hui; Zhou, Nan; Liang, Ting; Wang, Zheng; Huang, Shangzhi; Ren, Qiushi

2009-01-01

Purpose To identify mutations in the carbohydrate sulfotransferase gene (CHST6) for a Chinese family with macular corneal dystrophy (MCD) and to investigate the histopathological changes in the affected cornea. Methods A corneal button of the proband was obtained by penetrating keratoplasty. The half button and ultrathin sections from the other half button were examined with special stains under a light microscope (LM) and an electron microscope (EM) separately. Genomic DNA was extracted from peripheral blood of 11 family members, and the coding region of CHST6 was amplified by the polymerase chain reaction (PCR) method. The PCR products were analyzed by direct sequencing and restriction enzyme digestion. Results The positive reaction to colloidal iron stain (extracellular blue accumulations in the stroma) was detected under light microscopy. Transmission electron microscopy revealed the enlargement of smooth endoplasmic reticulum and the presence of intracytoplasmic vacuoles. The compound heterozygous mutations, c.892C>T and c.1072T>C, were identified in exon 3 of CHST6 in three patients. The two transversions resulted in the substitution of a stop codon for glutamine at codon 298 (p.Q298X) and a missense mutation at codon 358, tyrosine to histidine (p.Y358H). The six unaffected family individuals carried alternative heterozygous mutations. These two mutations were not detected in any of the 100 control subjects. Conclusions Those novel compound heterozygous mutations were thought to contribute to the loss of CHST6 function, which induced the abnormal metabolism of keratan sulfate (KS) that deposited in the corneal stroma. It could be proved by the observation of a positive stain reaction and the enlarged collagen fibers as well as hyperplastic fibroblasts under microscopes. PMID:19365571

Severe Gardner syndrome in families with mutations restricted to a specific region of the APC gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davies, D.R.; Armstrong, J.G.; Thakker, N.

Familial adenomatous polyposis (FAP) is associated with a number of extraintestinal manifestations, which include osteomas, epidermoid cysts, and desmoid tumors, often referred to as {open_quotes}Gardner syndrome.{close_quotes} Recent studies have suggested that some of the phenotypic features of FAP are dependent on the position of the mutation within the APC gene. In particular, the correlation between congenital hypertrophy of the retinal pigment epithelium (CHRPE) and APC genotype indicates that affected families may be divided into distinct groups. We have investigated the association between the dento-osseous features of GS on dental panoramic radiographs (DPRs) and APC genotype in a regional cohort ofmore » FAP families. DPRs were performed on 84 affected individuals from 36 families, and the dento-osseous features of FAP were quantified by a weighted scoring system. Significant DPR abnormalities were present in 69% of affected individuals. The APC gene mutation was identified in 27 of these families, and for statistical analysis these were subdivided into three groups. Group 1 comprised 18 affected individuals from seven families with mutations 5{prime} of exon 9; these families (except one) did not express CHRPE. Groups 2 comprised 38 individuals from 16 families with mutations between exon 9 and codon 1444, all of whom expressed CHRPE. Group 3 comprised 11 individuals from four families with mutations 3{prime} of codon 1444, none of whom expressed CHRPE. Families with mutations 3{prime} of codon 1444 had significantly more lesions on DPRs (P < .001) and appeared to have a higher incidence of desmoid tumors. These results suggest that severity of some of the features of Gardner syndrome may correlate with genotype in FAP. 32 refs., 2 figs., 2 tabs.« less

Demonstration of GTG as an alternative initiation codon for the serpin endopin 2B-2.

PubMed

Hwang, Shin-Rong; Garza, Christina Z; Wegrzyn, Jill L; Hook, Vivian Y H

2005-02-18

This study demonstrates GTG as a novel, alternative initiation codon for translation of bovine endopin 2B-2, a serpin protease inhibitor. Molecular cDNA cloning revealed the endopin 2B-1 and endopin 2B-2 isoforms that are predicted to inhibit papain and elastase. Notably, GTG was demonstrated as the initiation codon for endopin 2B-2, whereas endopin 2B-1 possesses ATG as its initiation codon. GTG mediated in vitro translation of 46kDa endopin 2B-2. GTG also mediated translation of EGFP by in vitro translation and by expression in mammalian cells. Notably, mutagenesis of GTG to GTC resulted in the absence of EGFP expression in cells. GTG produced a lower level of protein expression compared to ATG. The use of GTG as an initiation codon to direct translation of endopin 2B, as well as the heterologous protein EGFP, demonstrates the role of GTG in the regulation of mRNA translation in mammalian cells. Significantly, further analyses of mammalian genomes based on GTG as an alternative initiation codon may predict new candidate gene products expressed by mammalian and human genomes.

Sickle cell disease in the Kurdish population of northern Iraq.

PubMed

Al-Allawi, Nasir A S; Jalal, Sana D; Nerwey, Farida F; Al-Sayan, Galawezh O O; Al-Zebari, Sahima S M; Alshingaly, Awny A; Markous, Raji D; Jubrael, Jaladet M S; Hamamy, Hanan

2012-01-01

Epidemiological studies have revealed that sickle cell disease patients are clustered in two geographical areas in Iraq, one among the Arabs in the extreme south, another among the Kurdish population in the extreme north, where they constitute major health problems. However, no studies have focused on the genotypes responsible for sickle cell disease or the β-globin gene haplotypes associated with it. For the latter purpose, a total of 103 unrelated Kurdish sickle cell disease patients were evaluated by restriction fragment length polymorphism (RFLP) for the sickle cell mutation, followed by multiplex polymerase chain reaction (PCR) and reverse hybridization for β- and α-thalassemia (β- and α-thal) mutations, whenever indicated. Results showed that the most common genotype was sickle cell anemia (68.0%) followed by Hb S/β(0)-thal and Hb S/β(+)-thal at frequencies of 24.2 and 7.8%, respectively. Eight β-thal mutations were associated with the latter two genotypes including: IVS-II-1 (G>A), IVS-I-110 (G>A), codon 8 (-AA), codon 44 (-C), codon 22 (-7 bp), IVS-I-1 (G>A), codon 30 (G>C) and IVS-I-6 (T>C). In Hb SS patients, the -α(3.7) deletion was documented in 10.0% and was the only α-thal mutation detected. Furthermore, 5' β-globin gene cluster haplotyping of 128 β(S) chromosomes revealed that the most common haplotype seen in 69.5% was the Benin haplotype, followed by the Arab-Indian haplotype in 12.5%. These latter findings closely resemble reports from neighboring Turkey, Syria, Jordan, Lebanon and Mediterranean countries, suggesting a possible common origin, but are in contrast to findings from the Eastern Arabian Peninsula and Iran.

Is Mutation Random or Targeted?: No Evidence for Hypermutability in Snail Toxin Genes.

PubMed

Roy, Scott W

2016-10-01

Ever since Luria and Delbruck, the notion that mutation is random with respect to fitness has been foundational to modern biology. However, various studies have claimed striking exceptions to this rule. One influential case involves toxin-encoding genes in snails of the genus Conus, termed conotoxins, a large gene family that undergoes rapid diversification of their protein-coding sequences by positive selection. Previous reconstructions of the sequence evolution of conotoxin genes claimed striking patterns: (1) elevated synonymous change, interpreted as being due to targeted "hypermutation" in this region; (2) elevated transversion-to-transition ratios, interpreted as reflective of the particular mechanism of hypermutation; and (3) much lower rates of synonymous change in the codons encoding several highly conserved cysteine residues, interpreted as strong position-specific codon bias. This work has spawned a variety of studies on the potential mechanisms of hypermutation and on causes for cysteine codon bias, and has inspired hypermutation hypotheses for various other fast-evolving genes. Here, I show that all three findings are likely to be artifacts of statistical reconstruction. First, by simulating nonsynonymous change I show that high rates of dN can lead to overestimation of dS. Second, I show that there is no evidence for any of these three patterns in comparisons of closely related conotoxin sequences, suggesting that the reported findings are due to breakdown of statistical methods at high levels of sequence divergence. The current findings suggest that mutation and codon bias in conotoxin genes may not be atypical, and that random mutation and selection can explain the evolution of even these exceptional loci. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Determination of BRAF V600E (VE1) protein expression and BRAF gene mutation status in codon 600 in borderline and low-grade ovarian cancers.

PubMed

Sadlecki, Pawel; Walentowicz, Pawel; Bodnar, Magdalena; Marszalek, Andrzej; Grabiec, Marek; Walentowicz-Sadlecka, Malgorzata

2017-05-01

Epithelial ovarian tumors are a group of morphologically and genetically heterogeneous neoplasms. Based on differences in clinical phenotype and genetic background, ovarian neoplasms are classified as low-grade and high-grade tumor. Borderline ovarian tumors represent approximately 10%-20% of all epithelial ovarian masses. Various histological subtypes of ovarian malignancies differ in terms of their risk factor profiles, precursor lesions, clinical course, patterns of spread, molecular genetics, response to conventional chemotherapy, and prognosis. The most frequent genetic aberrations found in low-grade serous ovarian carcinomas and serous borderline tumors, as well as in mucinous cancers, are mutations in BRAF and KRAS genes. The most commonly observed BRAF mutation is substitution of glutamic acid for valine in codon 600 (V600E) in exon 15. The primary aim of this study was to determine whether fully integrated, real-time polymerase chain reaction-based Idylla™ system may be useful in determination of BRAF gene mutation status in codon 600 in patients with borderline ovarian tumors and low-grade ovarian carcinomas. The study included tissue specimens from 42 patients with histopathologically verified ovarian masses, who were operated on at the Department of Obstetrics and Gynecology, Nicolaus Copernicus University Collegium Medicum in Bydgoszcz (Poland). Based on histopathological examination of surgical specimens, 35 lesions were classified as low-grade ovarian carcinomas, and 7 as borderline ovarian tumors. Specimens with expression of BRAF V600E (VE1) protein were tested for mutations in codon 600 of the BRAF gene, using an automated molecular diagnostics platform Idylla™. Cytoplasmic immunoexpression of BRAF V600E (VE1) protein was found in three specimens: serous superficial papilloma, serous papillary cystadenoma of borderline malignancy, and partially proliferative serous cystadenoma. All specimens with the expression of BRAF V600E (VE1) protein were tested positively for BRAF V600E/E2/D mutation. No statistically significant relationship (p > 0.05) was found between the presence of BRAF V600E mutation and the probability of 5-year survival. BRAF mutation testing with a rapid, fully integrated molecular diagnostics system Idylla™ may be also a powerful prognostic tool in subjects with newly diagnosed serous borderline tumors, identifying a subset of patients who are unlikely to progress.

Levels of H-ras codon 61 CAA to AAA mutation: response to 4-ABP-treatment and Pms2-deficiency.

PubMed

Parsons, Barbara L; Delongchamp, Robert R; Beland, Frederick A; Heflich, Robert H

2006-01-01

DNA mismatch repair (MMR) deficiencies result in increased frequencies of spontaneous mutation and tumor formation. In the present study, we tested the hypothesis that a chemically-induced mutational response would be greater in a mouse with an MMR-deficiency than in the MMR-proficient mouse models commonly used to assay for chemical carcinogenicity. To accomplish this, the induction of H-ras codon 61 CAA-->AAA mutation was examined in Pms2 knockout mice (Pms2-/-, C57BL/6 background) and sibling wild-type mice (Pms2+/+). Groups of five or six neonatal male mice were treated with 0.3 micromol 4-aminobiphenyl (4-ABP) or the vehicle control, dimethylsulfoxide. Eight months after treatment, liver DNAs were isolated and analysed for levels of H-ras codon 61 CAA-->AAA mutation using allele-specific competitive blocker-PCR. In Pms2-proficient and Pms2-deficient mice, 4-ABP treatment caused an increase in mutant fraction (MF) from 1.65x10(-5) to 2.91x10(-5) and from 3.40x10(-5) to 4.70x10(-5), respectively. Pooling data from 4-ABP-treated and control mice, the approximately 2-fold increase in MF observed in Pms2-deficient as compared with Pms2-proficient mice was statistically significant (P=0.0207) and consistent with what has been reported previously in terms of induction of G:C-->T:A mutation in a Pms2-deficient background. Pooling data from both genotypes, the increase in H-ras MF in 4-ABP-treated mice, as compared with control mice, did not reach the 95% confidence level of statistical significance (P=0.0606). The 4-ABP treatment caused a 1.76-fold and 1.38-fold increase in average H-ras MF in Pms2-proficient and Pms2-deficient mice, respectively. Furthermore, the levels of induced mutation in Pms2-proficient and Pms2-deficient mice were nearly identical (1.26x10(-5) and 1.30x10(-5), respectively). We conclude that Pms2-deficiency does not result in an amplification of the H-ras codon 61 CAA-->AAA mutational response induced by 4-ABP.

A Simple Combinatorial Codon Mutagenesis Method for Targeted Protein Engineering.

PubMed

Belsare, Ketaki D; Andorfer, Mary C; Cardenas, Frida S; Chael, Julia R; Park, Hyun June; Lewis, Jared C

2017-03-17

Directed evolution is a powerful tool for optimizing enzymes, and mutagenesis methods that improve enzyme library quality can significantly expedite the evolution process. Here, we report a simple method for targeted combinatorial codon mutagenesis (CCM). To demonstrate the utility of this method for protein engineering, CCM libraries were constructed for cytochrome P450 BM3 , pfu prolyl oligopeptidase, and the flavin-dependent halogenase RebH; 10-26 sites were targeted for codon mutagenesis in each of these enzymes, and libraries with a tunable average of 1-7 codon mutations per gene were generated. Each of these libraries provided improved enzymes for their respective transformations, which highlights the generality, simplicity, and tunability of CCM for targeted protein engineering.

A second mutation in the type II procollagen gene (COL2AI) causing stickler syndrome (arthro-ophthalmopathy) is also a premature termination codon.

PubMed Central

Ahmad, N N; McDonald-McGinn, D M; Zackai, E H; Knowlton, R G; LaRossa, D; DiMascio, J; Prockop, D J

1993-01-01

Genetic linkage analyses suggest that mutations in type II collagen may be responsible for Stickler syndrome, or arthro-ophthalmopathy (AO), in many families. In the present study oligonucleotide primers were developed to amplify and directly sequence eight of the first nine exons of the gene for type II procollagen (COL2A1). Analysis of the eight exons in 10 unrelated probands with AO revealed that one had a single-base mutation in one allele that changed the codon of -CGA- for arginine at amino acid position alpha 1-9 in exon 7 to a premature termination signal for translation. The second mutation found to cause AO was, therefore, similar to the first in that both created premature termination signals in the COL2A1 gene. Since mutations producing premature termination signals have not previously been detected in genes for fibrillar collagens, the results raise the possibility that such mutations in the COL2A1 gene are a common cause of AO. Images Figure 2 Figure 3 PMID:8434604

Unusual AIP mutation and phenocopy in the family of a young patient with acromegalic gigantism.

PubMed

Imran, Syed Ali; Aldahmani, Khaled A; Penney, Lynette; Croul, Sidney E; Clarke, David B; Collier, David M; Iacovazzo, Donato; Korbonits, Márta

2018-01-01

Early-onset acromegaly causing gigantism is often associated with aryl-hydrocarbon-interacting receptor protein ( AIP ) mutation, especially if there is a positive family history. A15y male presented with tiredness and visual problems. He was 201 cm tall with a span of 217 cm. He had typical facial features of acromegaly, elevated IGF-1, secondary hypogonadism and a large macroadenoma. His paternal aunt had a history of acromegaly presenting at the age of 35 years. Following transsphenoidal surgery, his IGF-1 normalized and clinical symptoms improved. He was found to have a novel AIP mutation destroying the stop codon c.991T>C; p.*331R. Unexpectedly, his father and paternal aunt were negative for this mutation while his mother and older sister were unaffected carriers, suggesting that his aunt represents a phenocopy. Typical presentation for a patient with AIP mutation with excess growth and eunuchoid proportions.Unusual, previously not described AIP variant with loss of the stop codon.Phenocopy may occur in families with a disease-causing germline mutation.

Unusual AIP mutation and phenocopy in the family of a young patient with acromegalic gigantism

PubMed Central

Aldahmani, Khaled A; Penney, Lynette; Croul, Sidney E; Clarke, David B; Collier, David M; Iacovazzo, Donato; Korbonits, Márta

2018-01-01

Summary Early-onset acromegaly causing gigantism is often associated with aryl-hydrocarbon-interacting receptor protein (AIP) mutation, especially if there is a positive family history. A15y male presented with tiredness and visual problems. He was 201 cm tall with a span of 217 cm. He had typical facial features of acromegaly, elevated IGF-1, secondary hypogonadism and a large macroadenoma. His paternal aunt had a history of acromegaly presenting at the age of 35 years. Following transsphenoidal surgery, his IGF-1 normalized and clinical symptoms improved. He was found to have a novel AIP mutation destroying the stop codon c.991T>C; p.*331R. Unexpectedly, his father and paternal aunt were negative for this mutation while his mother and older sister were unaffected carriers, suggesting that his aunt represents a phenocopy. Learning points: Typical presentation for a patient with AIP mutation with excess growth and eunuchoid proportions. Unusual, previously not described AIP variant with loss of the stop codon. Phenocopy may occur in families with a disease-causing germline mutation. PMID:29472986

The Relation of Codon Bias to Tissue-Specific Gene Expression in Arabidopsis thaliana

PubMed Central

Camiolo, Salvatore; Farina, Lorenzo; Porceddu, Andrea

2012-01-01

The codon composition of coding sequences plays an important role in the regulation of gene expression. Herein, we report systematic differences in the usage of synonymous codons among Arabidopsis thaliana genes that are expressed specifically in distinct tissues. Although we observed that both regionally and transcriptionally associated mutational biases were associated significantly with codon bias, they could not explain the observed differences fully. Similarly, given that transcript abundances did not account for the differences in codon usage, it is unlikely that selection for translational efficiency can account exclusively for the observed codon bias. Thus, we considered the possible evolution of codon bias as an adaptive response to the different abundances of tRNAs in different tissues. Our analysis demonstrated that in some cases, codon usage in genes that were expressed in a broad range of tissues was influenced primarily by the tissue in which the gene was expressed maximally. On the basis of this finding we propose that genes that are expressed in certain tissues might show a tissue-specific compositional signature in relation to codon usage. These findings might have implications for the design of transgenes in relation to optimizing their expression. PMID:22865738

Analysis of the synonymous codon usage bias in recently emerged enterovirus D68 strains.

PubMed

Karniychuk, Uladzimir U

2016-09-02

Understanding the codon usage pattern of a pathogen and relationship between pathogen and host's codon usage patterns has fundamental and applied interests. Enterovirus D68 (EV-D68) is an emerging pathogen with a potentially high public health significance. In the present study, the synonymous codon usage bias of 27 recently emerged, and historical EV-D68 strains was analyzed. In contrast to previously studied enteroviruses (enterovirus 71 and poliovirus), EV-D68 and human host have a high discrepancy between favored codons. Analysis of viral synonymous codon usage bias metrics, viral nucleotide/dinucleotide compositional parameters, and viral protein properties showed that mutational pressure is more involved in shaping the synonymous codon usage bias of EV-D68 than translation selection. Computation of codon adaptation indices allowed to estimate expression potential of the EV-D68 genome in several commonly used laboratory animals. This approach requires experimental validation and may provide an auxiliary tool for the rational selection of laboratory animals to model emerging viral diseases. Enterovirus D68 genome compositional and codon usage data can be useful for further pathogenesis, animal model, and vaccine design studies. Copyright © 2016 Elsevier B.V. All rights reserved.

Clinical and ERG data in a family with autosomal dominant RP and Pro-347-Arg mutation in the rhodopsin gene.

PubMed

Niemeyer, G; Trüb, P; Schinzel, A; Gal, A

1992-01-01

In a family with autosomal dominant retinitis pigmentosa, documented over six generations, a previously undescribed point mutation in the rhodopsin gene could be identified. The mutation found in the six affected members examined but in none of the controls, including healthy members of the family, was a point mutation in codon 347 predicting a substitution of the amino acid arginine for proline, designated Pro-347-Arg. Six affected members from two generations were examined clinically and with ganzfeld rod and cone electroretinography. The cone and, more dramatically, the rod electroretinograms were reduced to residual b-wave amplitudes or were non-detectable as early as ages 18 to 22 years. The Pro-347-Arg mutation resulted in a subjectively and clinically homogeneous phenotype: early onset of night blindness before age 11, relatively preserved usable visual fields until about age 30, blindness at ages 40 to 60, and change from an initial apparently sine pigmento to a hyperpigmented and atrophic fundus picture between 30 and 50 years of age.

Lost in Translation: Bioinformatic Analysis of Variations Affecting the Translation Initiation Codon in the Human Genome.

PubMed

Abad, Francisco; de la Morena-Barrio, María Eugenia; Fernández-Breis, Jesualdo Tomás; Corral, Javier

2018-06-01

Translation is a key biological process controlled in eukaryotes by the initiation AUG codon. Variations affecting this codon may have pathological consequences by disturbing the correct initiation of translation. Unfortunately, there is no systematic study describing these variations in the human genome. Moreover, we aimed to develop new tools for in silico prediction of the pathogenicity of gene variations affecting AUG codons, because to date, these gene defects have been wrongly classified as missense. Whole-exome analysis revealed the mean of 12 gene variations per person affecting initiation codons, mostly with high (> 0:01) minor allele frequency (MAF). Moreover, analysis of Ensembl data (December 2017) revealed 11,261 genetic variations affecting the initiation AUG codon of 7,205 genes. Most of these variations (99.5%) have low or unknown MAF, probably reflecting deleterious consequences. Only 62 variations had high MAF. Genetic variations with high MAF had closer alternative AUG downstream codons than did those with low MAF. Besides, the high-MAF group better maintained both the signal peptide and reading frame. These differentiating elements could help to determine the pathogenicity of this kind of variation. Data and scripts in Perl and R are freely available at https://github.com/fanavarro/hemodonacion. jfernand@um.es. Supplementary data are available at Bioinformatics online.

Probing the Effect of Two Heterozygous Mutations in Codon 723 of SLC26A4 on Deafness Phenotype Based on Molecular Dynamics Simulations.

PubMed

Yao, Jun; Qian, Xuli; Bao, Jingxiao; Wei, Qinjun; Lu, Yajie; Zheng, Heng; Cao, Xin; Xing, Guangqian

2015-06-02

A Chinese family was identified with clinical features of enlarged vestibular aqueduct syndrome (EVAS). The mutational analysis showed that the proband (III-2) had EVAS with bilateral sensorineural hearing loss and carried a rare compound heterozygous mutation of SLC26A4 (IVS7-2A>G, c.2167C>G), which was inherited from the same mutant alleles of IVS7-2A>G heterozygous father and c.2167C>G heterozygous mother. Compared with another confirmed pathogenic biallelic mutation in SLC26A4 (IVS7-2A>G, c.2168A>G), these two biallelic mutations shared one common mutant allele and the same codon of the other mutant allele, but led to different changes of amino acid (p.H723D, p.H723R) and both resulted in the deafness phenotype. Structure-modeling indicated that these two mutant alleles changed the shape of pendrin protein encoded by SLC26A4 with increasing randomness in conformation, and might impair pendrin's ability as an anion transporter. The molecular dynamics simulations also revealed that the stability of mutant pendrins was reduced with increased flexibility of backbone atoms, which was consistent with the structure-modeling results. These evidences indicated that codon 723 was a hot-spot region in SLC26A4 with a significant impact on the structure and function of pendrin, and acted as one of the genetic factors responsible for the development of hearing loss.

Quinolone Resistance Determinants of Clinical Salmonella Enteritidis in Thailand.

PubMed

Utrarachkij, Fuangfa; Nakajima, Chie; Changkwanyeun, Ruchirada; Siripanichgon, Kanokrat; Kongsoi, Siriporn; Pornruangwong, Srirat; Changkaew, Kanjana; Tsunoda, Risa; Tamura, Yutaka; Suthienkul, Orasa; Suzuki, Yasuhiko

2017-10-01

Salmonella Enteritidis has emerged as a global concern regarding quinolone resistance and invasive potential. Although quinolone-resistant S. Enteritidis has been observed with high frequency in Thailand, information on the mechanism of resistance acquisition is limited. To elucidate the mechanism, a total of 158 clinical isolates of nalidixic acid (NAL)-resistant S. Enteritidis were collected throughout Thailand, and the quinolone resistance determinants were investigated in the context of resistance levels to NAL, norfloxacin (NOR), and ciprofloxacin (CIP). The analysis of point mutations in type II topoisomerase genes and the detection of plasmid-mediated quinolone resistance genes showed that all but two harbored a gyrA mutation, the qnrS1 gene, or both. The most commonly affected codon in mutant gyrA was 87, followed by 83. Double codon mutation in gyrA was found in an isolate with high-level resistance to NAL, NOR, and CIP. A new mutation causing serine to isoleucine substitution at codon 83 was identified in eight isolates. In addition to eighteen qnrS1-carrying isolates showing nontypical quinolone resistance, one carrying both the qnrS1 gene and a gyrA mutation also showed a high level of resistance. Genotyping by multilocus variable number of tandem repeat analysis suggested a possible clonal expansion of NAL-resistant strains nationwide. Our data suggested that NAL-resistant isolates with single quinolone resistance determinant may potentially become fluoroquinolone resistant by acquiring secondary determinants. Restricted therapeutic and farming usage of quinolones is strongly recommended to prevent the emergence of fluoroquinolone-resistant isolates.

The positive regulatory function of the 5'-proximal open reading frames in GCN4 mRNA can be mimicked by heterologous, short coding sequences.

PubMed Central

Williams, N P; Mueller, P P; Hinnebusch, A G

1988-01-01

Translational control of GCN4 expression in the yeast Saccharomyces cerevisiae is mediated by multiple AUG codons present in the leader of GCN4 mRNA, each of which initiates a short open reading frame of only two or three codons. Upstream AUG codons 3 and 4 are required to repress GCN4 expression in normal growth conditions; AUG codons 1 and 2 are needed to overcome this repression in amino acid starvation conditions. We show that the regulatory function of AUG codons 1 and 2 can be qualitatively mimicked by the AUG codons of two heterologous upstream open reading frames (URFs) containing the initiation regions of the yeast genes PGK and TRP1. These AUG codons inhibit GCN4 expression when present singly in the mRNA leader; however, they stimulate GCN4 expression in derepressing conditions when inserted upstream from AUG codons 3 and 4. This finding supports the idea that AUG codons 1 and 2 function in the control mechanism as translation initiation sites and further suggests that suppression of the inhibitory effects of AUG codons 3 and 4 is a general consequence of the translation of URF 1 and 2 sequences upstream. Several observations suggest that AUG codons 3 and 4 are efficient initiation sites; however, these sequences do not act as positive regulatory elements when placed upstream from URF 1. This result suggests that efficient translation is only one of the important properties of the 5' proximal URFs in GCN4 mRNA. We propose that a second property is the ability to permit reinitiation following termination of translation and that URF 1 is optimized for this regulatory function. Images PMID:3065626

Dural ectasia and FBN1 mutation screening of 40 patients with Marfan syndrome and related disorders: role of dural ectasia for the diagnosis.

PubMed

Attanasio, Monica; Pratelli, Elisa; Porciani, Maria Cristina; Evangelisti, Lucia; Torricelli, Elena; Pellicanò, Giannantonio; Abbate, Rosanna; Gensini, Gian Franco; Pepe, Guglielmina

2013-07-01

Marfan syndrome is an autosomal dominant disorder of connective tissue caused by mutations in the gene encoding fibrillin-1 (FBN1), a matrix component of microfibrils. Dural ectasia, i.e. enlargement of the neural canal mainly located in the lower lumbar and sacral region, frequently occurs in Marfan patients. The aim of our study was to investigate the role of dural ectasia in raising the diagnosis of Marfan syndrome and its association with FBN1 mutations. We studied 40 unrelated patients suspected for MFS, who underwent magnetic resonance imaging searching for dural ectasia. In all of them FBN1 gene analysis was also performed. Thirty-seven patients resulted affected by Marfan syndrome according to the '96 Ghent criteria; in 30 of them the diagnosis was confirmed when revaluated by the recently revised criteria (2010). Thirty-six patients resulted positive for dural ectasia. The degree of dural ectasia was grade 1 in 19 patients, grade 2 in 11 patients, and grade 3 in 6 patients. In 7 (24%) patients, the presence of dural ectasia allowed to reach a positive score for systemic feature criterion. Twenty-four patients carried an FBN1 mutation, that were represented by 13 missense (54%), and 11 (46%) mutations generating a premature termination codon (PTC, frameshifts and stop codons). No mutation was detected in the remaining 16 (6 patients with MFS and 10 with related disorders according to revised Ghent criteria). The prevalence of severe (grade 2 and grade 3) involvement of dura mater was higher in patients harbouring premature termination codon (PTC) mutations than those carrying missense-mutations (8/11 vs 2/13, P = 0.0111). Our data emphasizes the importance of dural ectasia screening to reach the diagnosis of Marfan syndrome especially when it is uncertain and indicates an association between PTC mutations and severe dural ectasia in Marfan patients. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Premature termination of SMARCB1 translation may be followed by reinitiation in schwannomatosis-associated schwannomas, but results in absence of SMARCB1 expression in rhabdoid tumors.

PubMed

Hulsebos, Theo J M; Kenter, Susan; Verhagen, Wim I M; Baas, Frank; Flucke, Uta; Wesseling, Pieter

2014-09-01

In schwannomatosis, germline SMARCB1 mutations predispose to the development of multiple schwannomas, but not vestibular schwannomas. Many of these are missense or splice-site mutations or in-frame deletions, which are presumed to result in the synthesis of altered SMARCB1 proteins. However, also nonsense and frameshift mutations, which are characteristic for rhabdoid tumors and are predicted to result in the absence of SMARCB1 protein via nonsense-mediated mRNA decay, have been reported in schwannomatosis patients. We investigated the consequences of four of the latter mutations, i.e. c.30delC, c.34C>T, c.38delA, and c.46A>T, all in SMARCB1-exon 1. We could demonstrate for the c.30delC and c.34C>T mutations that the respective mRNAs were still present in the schwannomas of the patients. We hypothesized that these were prevented from degradation by translation reinitiation at the AUG codon encoding methionine at position 27 of the SMARCB1 protein. To test this, we expressed the mutations in MON cells, rhabdoid cells without endogenous SMARCB1 protein, and found that all four resulted in synthesis of the N-terminally truncated protein. Mutation of the reinitiation methionine codon into a valine codon prevented synthesis of the truncated protein, thereby confirming its identity. Immunohistochemistry with a SMARCB1 antibody revealed a mosaic staining pattern in schwannomas of the patients with the c.30delC and c.34C>T mutations. Our findings support the concept that, in contrast to the complete absence of SMARCB1 expression in rhabdoid tumors, altered SMARCB1 proteins with modified activity and reduced (mosaic) expression are formed in the schwannomas of schwannomatosis patients with a germline SMARCB1 mutation.

Codon adaptation and synonymous substitution rate in diatom plastid genes.

PubMed

Morton, Brian R; Sorhannus, Ulf; Fox, Martin

2002-07-01

Diatom plastid genes are examined with respect to codon adaptation and rates of silent substitution (Ks). It is shown that diatom genes follow the same pattern of codon usage as other plastid genes studied previously. Highly expressed diatom genes display codon adaptation, or a bias toward specific major codons, and these major codons are the same as those in red algae, green algae, and land plants. It is also found that there is a strong correlation between Ks and variation in codon adaptation across diatom genes, providing the first evidence for such a relationship in the algae. It is argued that this finding supports the notion that the correlation arises from selective constraints, not from variation in mutation rate among genes. Finally, the diatom genes are examined with respect to variation in Ks among different synonymous groups. Diatom genes with strong codon adaptation do not show the same variation in synonymous substitution rate among codon groups as the flowering plant psbA gene which, previous studies have shown, has strong codon adaptation but unusually high rates of silent change in certain synonymous groups. The lack of a similar finding in diatoms supports the suggestion that the feature is unique to the flowering plant psbA due to recent relaxations in selective pressure in that lineage.

Genetic Code Optimization for Cotranslational Protein Folding: Codon Directional Asymmetry Correlates with Antiparallel Betasheets, tRNA Synthetase Classes.

PubMed

Seligmann, Hervé; Warthi, Ganesh

2017-01-01

A new codon property, codon directional asymmetry in nucleotide content (CDA), reveals a biologically meaningful genetic code dimension: palindromic codons (first and last nucleotides identical, codon structure XZX) are symmetric (CDA = 0), codons with structures ZXX/XXZ are 5'/3' asymmetric (CDA = - 1/1; CDA = - 0.5/0.5 if Z and X are both purines or both pyrimidines, assigning negative/positive (-/+) signs is an arbitrary convention). Negative/positive CDAs associate with (a) Fujimoto's tetrahedral codon stereo-table; (b) tRNA synthetase class I/II (aminoacylate the 2'/3' hydroxyl group of the tRNA's last ribose, respectively); and (c) high/low antiparallel (not parallel) betasheet conformation parameters. Preliminary results suggest CDA-whole organism associations (body temperature, developmental stability, lifespan). Presumably, CDA impacts spatial kinetics of codon-anticodon interactions, affecting cotranslational protein folding. Some synonymous codons have opposite CDA sign (alanine, leucine, serine, and valine), putatively explaining how synonymous mutations sometimes affect protein function. Correlations between CDA and tRNA synthetase classes are weaker than between CDA and antiparallel betasheet conformation parameters. This effect is stronger for mitochondrial genetic codes, and potentially drives mitochondrial codon-amino acid reassignments. CDA reveals information ruling nucleotide-protein relations embedded in reversed (not reverse-complement) sequences (5'-ZXX-3'/5'-XXZ-3').

Global analysis of translation termination in E. coli

PubMed Central

Baggett, Natalie E.

2017-01-01

Terminating protein translation accurately and efficiently is critical for both protein fidelity and ribosome recycling for continued translation. The three bacterial release factors (RFs) play key roles: RF1 and 2 recognize stop codons and terminate translation; and RF3 promotes disassociation of bound release factors. Probing release factors mutations with reporter constructs containing programmed frameshifting sequences or premature stop codons had revealed a propensity for readthrough or frameshifting at these specific sites, but their effects on translation genome-wide have not been examined. We performed ribosome profiling on a set of isogenic strains with well-characterized release factor mutations to determine how they alter translation globally. Consistent with their known defects, strains with increasingly severe release factor defects exhibit increasingly severe accumulation of ribosomes over stop codons, indicative of an increased duration of the termination/release phase of translation. Release factor mutant strains also exhibit increased occupancy in the region following the stop codon at a significant number of genes. Our global analysis revealed that, as expected, translation termination is generally efficient and accurate, but that at a significant number of genes (≥ 50) the ribosome signature after the stop codon is suggestive of translation past the stop codon. Even native E. coli K-12 exhibits the ribosome signature suggestive of protein extension, especially at UGA codons, which rely exclusively on the reduced function RF2 variant of the K-12 strain for termination. Deletion of RF3 increases the severity of the defect. We unambiguously demonstrate readthrough and frameshifting protein extensions and their further accumulation in mutant strains for a few select cases. In addition to enhancing recoding, ribosome accumulation over stop codons disrupts attenuation control of biosynthetic operons, and may alter expression of some overlapping genes. Together, these functional alterations may either augment the protein repertoire or produce deleterious proteins. PMID:28301469

Genetic and codon usage bias analyses of polymerase genes of equine influenza virus and its relation to evolution.

PubMed

Bera, Bidhan Ch; Virmani, Nitin; Kumar, Naveen; Anand, Taruna; Pavulraj, S; Rash, Adam; Elton, Debra; Rash, Nicola; Bhatia, Sandeep; Sood, Richa; Singh, Raj Kumar; Tripathi, Bhupendra Nath

2017-08-23

Equine influenza is a major health problem of equines worldwide. The polymerase genes of influenza virus have key roles in virus replication, transcription, transmission between hosts and pathogenesis. Hence, the comprehensive genetic and codon usage bias of polymerase genes of equine influenza virus (EIV) were analyzed to elucidate the genetic and evolutionary relationships in a novel perspective. The group - specific consensus amino acid substitutions were identified in all polymerase genes of EIVs that led to divergence of EIVs into various clades. The consistent amino acid changes were also detected in the Florida clade 2 EIVs circulating in Europe and Asia since 2007. To study the codon usage patterns, a total of 281,324 codons of polymerase genes of EIV H3N8 isolates from 1963 to 2015 were systemically analyzed. The polymerase genes of EIVs exhibit a weak codon usage bias. The ENc-GC3s and Neutrality plots indicated that natural selection is the major influencing factor of codon usage bias, and that the impact of mutation pressure is comparatively minor. The methods for estimating host imposed translation pressure suggested that the polymerase acidic (PA) gene seems to be under less translational pressure compared to polymerase basic 1 (PB1) and polymerase basic 2 (PB2) genes. The multivariate statistical analysis of polymerase genes divided EIVs into four evolutionary diverged clusters - Pre-divergent, Eurasian, Florida sub-lineage 1 and 2. Various lineage specific amino acid substitutions observed in all polymerase genes of EIVs and especially, clade 2 EIVs underwent major variations which led to the emergence of a phylogenetically distinct group of EIVs originating from Richmond/1/07. The codon usage bias was low in all the polymerase genes of EIVs that was influenced by the multiple factors such as the nucleotide compositions, mutation pressure, aromaticity and hydropathicity. However, natural selection was the major influencing factor in defining the codon usage patterns and evolution of polymerase genes of EIVs.

Child with RET proto-oncogene codon 634 mutation.

PubMed

İnce, Dilek; Demirağ, Bengü; Ataseven, Eda; Oymak, Yeşim; Tuhan, Hale; Karakuş, Osman Zeki; Hazan, Filiz; Abacı, Ayhan; Özer, Erdener; Mutafoglu, Kamer; Olgun, Nur

2017-01-01

İnce D, Demirağ B, Ataseven E, Oymak Y, Tuhan H, Karakuş OZ, Hazan F, Abacı A, Özer E, Mutafoglu K, Olgun N. Child with RET proto-oncogene codon 634 mutation. Turk J Pediatr 2017; 59: 590-593. Herein we reported a 7-year-old child with RET proto-oncogene c634 mutation. Her mother had been diagnosed with medullary thyroid carcinoma (MTC), and treated six years ago. Heterozygous mutation of the RET proto-oncogene at c634 had been detected in her mother. Genetic analysis showed the presence of the same mutation in our patient. Thyroid functions were normal. Serum calcitonin level was found mildly elevated. Parathormone (PTH) and carcinoembrionic antigen (CEA) levels were normal. Prophylactic thyroidectomy and sampling of cervical lymph nodes were performed. Histopathologic examination revealed hyperplasia in thyroid C cells, and reactive lymphadenopathy. The risk of MTC has been reported 100% through the life of patients with RET proto-oncogene mutation. It has been reported that particularly patients with c634 mutation have more risk of occurence of metastatic and progressive/recurrent MTC. Prophylactic `thyroidectomy, cervical lymph node dissection` before 5-years-of-age should be considered for these patients.

Hereditary medullary thyroid carcinoma: the management dilemma.

PubMed

Zhou, Ping; Liu, Jian; Cheng, Shao-Wen; Wang, Bing; Yang, Rong; Peng, Ling

2012-06-01

Hereditary medullary thyroid carcinoma (hereditary MTC) is a rare malignancy, accounting for 25-30% of all MTC. It occurs as part of multiple endocrine neoplasia type 2 (MEN 2). Autosomal dominant gain-of-function mutations in the RET proto-oncogene is the cause of the disease, in which the common mutations are codons 609, 611, 618, 620, 630, 634 and 918. In recent years, the spectrum of RET gene mutations has changed. The classical mutations reduced, whereas the less aggressive mutations increased. Hereditary MTC is a time-dependent disease. Stages of the disorder at diagnosis can significantly influence survival rates. Based on the genotype-phenotype, RET mutations have been classified into four risk levels by American Thyroid Association (ATA) at 2009. The classification system guides the hereditary MTC management, including risk assessment, biochemical screenings and surgical intervention. Though the application of genetic testing and codon-specific phenotypes in hereditary MTC diagnosis is effective with high accuracy, there are some difficulties in implementing RET gene testing as a routine for MTC diagnosis. And most of carriers with RET mutations did not undergo thyroidectomy at the age recommended by the ATA guidelines. The aim of the study is to review the hereditary MTC and discuss the management dilemma.

Identification of a novel deletion in SURF1 gene: Heterogeneity in Leigh syndrome with COX deficiency.

PubMed

Ribeiro, Carolina; do Carmo Macário, Maria; Viegas, Ana Teresa; Pratas, João; Santos, Maria João; Simões, Marta; Mendes, Cândida; Bacalhau, Mafalda; Garcia, Paula; Diogo, Luísa; Grazina, Manuela

2016-11-01

Leigh syndrome (LS) is a rare, progressive neurodegenerative mitochondrial disorder of infancy. It is a genetically heterogeneous disease. The mutations in SURF1 gene are the most frequently known cause. Here two cases of LS likely caused by SURF1 gene variants are reported: a 39-year-old male patient with a novel homozygous deletion (c.-11_13del), and a case of a 6-year-old boy with the same deletion and a nonsense mutation (c.868dupT), both in heterozygosity. Blue native PAGE showed absence of assembled complex IV. This is the first report of a variant that may abolish the SURF1 gene initiation codon in two LS patients. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

A decamer duplication in the 3′ region of the BRI gene originates an amyloid peptide that is associated with dementia in a Danish kindred

PubMed Central

Vidal, Ruben; Révész, Tamas; Rostagno, Agueda; Kim, Eugene; Holton, Janice L.; Bek, Toke; Bojsen-Møller, Marie; Braendgaard, Hans; Plant, Gordon; Ghiso, Jorge; Frangione, Blas

2000-01-01

Familial Danish dementia (FDD), also known as heredopathia ophthalmo-oto-encephalica, is an autosomal dominant disorder characterized by cataracts, deafness, progressive ataxia, and dementia. Neuropathological findings include severe widespread cerebral amyloid angiopathy, hippocampal plaques, and neurofibrillary tangles, similar to Alzheimer's disease. N-terminal sequence analysis of isolated leptomeningeal amyloid fibrils revealed homology to ABri, the peptide originated by a point mutation at the stop codon of gene BRI in familial British dementia. Molecular genetic analysis of the BRI gene in the Danish kindred showed a different defect, namely the presence of a 10-nt duplication (795–796insTTTAATTTGT) between codons 265 and 266, one codon before the normal stop codon 267. The decamer duplication mutation produces a frame-shift in the BRI sequence generating a larger-than-normal precursor protein, of which the amyloid subunit (designated ADan) comprises the last 34 C-terminal amino acids. This de novo-created amyloidogenic peptide, associated with a genetic defect in the Danish kindred, stresses the importance of amyloid formation as a causative factor in neurodegeneration and dementia. PMID:10781099

DNA analysis of herbarium Specimens of the grass weed Alopecurus myosuroides reveals herbicide resistance pre-dated herbicides.

PubMed

Délye, Christophe; Deulvot, Chrystel; Chauvel, Bruno

2013-01-01

Acetyl-CoA carboxylase (ACCase) alleles carrying one point mutation that confers resistance to herbicides have been identified in arable grass weed populations where resistance has evolved under the selective pressure of herbicides. In an effort to determine whether herbicide resistance evolves from newly arisen mutations or from standing genetic variation in weed populations, we used herbarium specimens of the grass weed Alopecurus myosuroides to seek mutant ACCase alleles carrying an isoleucine-to-leucine substitution at codon 1781 that endows herbicide resistance. These specimens had been collected between 1788 and 1975, i.e., prior to the commercial release of herbicides inhibiting ACCase. Among the 734 specimens investigated, 685 yielded DNA suitable for PCR. Genotyping the ACCase locus using the derived Cleaved Amplified Polymorphic Sequence (dCAPS) technique identified one heterozygous mutant specimen that had been collected in 1888. Occurrence of a mutant codon encoding a leucine residue at codon 1781 at the heterozygous state was confirmed in this specimen by sequencing, clearly demonstrating that resistance to herbicides can pre-date herbicides in weeds. We conclude that point mutations endowing resistance to herbicides without having associated deleterious pleiotropic effects can be present in weed populations as part of their standing genetic variation, in frequencies higher than the mutation frequency, thereby facilitating their subsequent selection by herbicide applications.

Ocular phenotypes associated with two mutations (R121W, C126X) in the Norrie disease gene.

PubMed

Kellner, U; Fuchs, S; Bornfeld, N; Foerster, M H; Gal, A

1996-06-01

To describe the ocular phenotypes associated with 2 mutations in the Norrie disease gene including a manifesting carrier. Ophthalmological examinations were performed in 2 affected males and one manifesting carrier. Genomic DNA was analyzed by direct sequencing of the Norrie disease gene. Family I: A 29-year-old male had the right eye enucleated at the age of 3 years. His left eye showed severe temporal dragging of the retina and central scars. Visual acuity was 20/300. DNA analysis revealed a C-to-T transition of the first nucleotide in codon 121 predicting the replacement of arginine-121 by tryptophan (R121W). Both the mother and maternal grandmother carry the same mutation in heterozygous form. Family 2: A 3-month-old boy presented with severe temporal dragging of the retina on both eyes and subsequently developed retinal detachment. Visual acuity was limited to light perception. His mother's left eye was amaurotic and phthitic. Her right eye showed severe retinal dragging, visual acuity was reduced to 20/60. DNA analysis revealed a T-to-A transversion of the third nucleotide in codon 126 creating a stop codon (C126X). The mother and maternal grandmother were carriers. Mutations in the Norrie disease gene can lead to retinal malformations of variable severity both in hemizygous males and manifesting carriers.

Molecular mimicry of human tRNALys anti-codon domain by HIV-1 RNA genome facilitates tRNA primer annealing.

PubMed

Jones, Christopher P; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin

2013-02-01

The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNA(Lys3). Host cell tRNA(Lys) is selectively packaged into HIV-1 through a specific interaction between the major tRNA(Lys)-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNA(Lys3) is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNA(Lys) and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNA(Lys3) in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNA(Lys) to increase the efficiency of tRNA(Lys3) annealing to viral RNA.

Molecular mimicry of human tRNALys anti-codon domain by HIV-1 RNA genome facilitates tRNA primer annealing

PubMed Central

Jones, Christopher P.; Saadatmand, Jenan; Kleiman, Lawrence; Musier-Forsyth, Karin

2013-01-01

The primer for initiating reverse transcription in human immunodeficiency virus type 1 (HIV-1) is tRNALys3. Host cell tRNALys is selectively packaged into HIV-1 through a specific interaction between the major tRNALys-binding protein, human lysyl-tRNA synthetase (hLysRS), and the viral proteins Gag and GagPol. Annealing of the tRNA primer onto the complementary primer-binding site (PBS) in viral RNA is mediated by the nucleocapsid domain of Gag. The mechanism by which tRNALys3 is targeted to the PBS and released from hLysRS prior to annealing is unknown. Here, we show that hLysRS specifically binds to a tRNA anti-codon-like element (TLE) in the HIV-1 genome, which mimics the anti-codon loop of tRNALys and is located proximal to the PBS. Mutation of the U-rich sequence within the TLE attenuates binding of hLysRS in vitro and reduces the amount of annealed tRNALys3 in virions. Thus, LysRS binds specifically to the TLE, which is part of a larger LysRS binding domain in the viral RNA that includes elements of the Psi packaging signal. Our results suggest that HIV-1 uses molecular mimicry of the anti-codon of tRNALys to increase the efficiency of tRNALys3 annealing to viral RNA. PMID:23264568

Essential and Dispensable Virus-Encoded Replication Elements Revealed by Efforts To Develop Hypoviruses as Gene Expression Vectors

PubMed Central

Suzuki, Nobuhiro; Geletka, Lynn M.; Nuss, Donald L.

2000-01-01

We have investigated whether hypoviruses, viral agents responsible for virulence attenuation (hypovirulence) of the chestnut blight fungus Cryphonectria parasitica, could serve as gene expression vectors. The infectious cDNA clone of the prototypic hypovirus CHV1-EP713 was modified to generate 20 different vector candidates. Although transient expression was achieved for a subset of vectors that contained the green fluorescent protein gene from Aequorea victoria, long-term expression (past day 8) was not observed for any vector construct. Analysis of viral RNAs recovered from transfected fungal colonies revealed that the foreign genes were readily deleted from the replicating virus, although small portions of foreign sequences were retained by some vectors after months of replication. However, the results of vector viability and progeny characterization provided unexpected new insights into essential and dispensable elements of hypovirus replication. The N-terminal portion (codons 1 to 24) of the 5′-proximal open reading frame (ORF), ORF A, was found to be required for virus replication, while the remaining 598 codons of this ORF were completely dispensable. Substantial alterations were tolerated in the pentanucleotide UAAUG that contains the ORF A termination codon and the overlapping putative initiation codon of the second of the two hypovirus ORFs, ORF B. Replication competence was maintained following either a frameshift mutation that caused a two-codon extension of ORF A or a modification that produced a single-ORF genomic organization. These results are discussed in terms of determinants of hypovirus replication, the potential utility of hypoviruses as gene expression vectors, and possible mechanisms by which hypoviruses recognize and delete foreign sequences. PMID:10906211

LUNG TUMOR KRAS AND TP53 MUTATIONS IN NON-SMOKERS REFLECT EXPOSURE TO PAH-RICH COAL COMBUSTION EMISSIONS

EPA Science Inventory

Abstract

We determined the TP53 and codon 12 KRAS mutations in lung tumors from 24 nonsmokers whose tumors were associated with exposure to smoky coal. Among any tumors studied previously, these showed the highest percentage of mutations that (a) were G -+ T transver...

Competitive allele-specific TaqMan PCR (Cast-PCR) is a sensitive, specific and fast method for BRAF V600 mutation detection in Melanoma patients

PubMed Central

Barbano, Raffaela; Pasculli, Barbara; Coco, Michelina; Fontana, Andrea; Copetti, Massimiliano; Rendina, Michelina; Valori, Vanna Maria; Graziano, Paolo; Maiello, Evaristo; Fazio, Vito Michele; Parrella, Paola

2015-01-01

BRAF codon 600 mutation testing of melanoma patients is mandatory for the choice of the most appropriate therapy in the clinical setting. Competitive allele specific TaqMan PCR (Cast-PCR) technology allows not only the selective amplification of minor alleles, but it also blocks the amplification of non-mutant allele. We genotyped codon 600 of the BRAF gene in 54 patients’ samples by Cast-PCR and bidirectional direct sequence analysis. All the mutations detected by sequencing were also identified by Cast-PCR. In addition, Cast-PCR assay detected four samples carrying mutations and was able to clearly identify two mutations of uncertain interpretation by Sanger sequencing. The limit of detection of Cast-PCR was evaluated by constructing dilution curves of BRAFV600E and BRAFV600K mutated clinical samples mixed with a not-mutated specimens. Both mutations could be detected until a 1:100 mutated/not mutated ratio. Cloning and sequencing of the clones was used to confirm mutations on representative discrepant cases. Cast PCR performances were not affected by intratumour heterogeneity, and less affected by melanin content. Our results indicate that Cast-PCR is a reliable diagnostic tool for the identification of melanoma patients as eligible to be treated with TKIs and might be implemented in the clinical setting as elective screening method. PMID:26690267

Point mutation in the MITF gene causing Waardenburg syndrome type II in a three-generation Indian family.

PubMed

Lalwani, A K; Attaie, A; Randolph, F T; Deshmukh, D; Wang, C; Mhatre, A; Wilcox, E

1998-12-04

Waardenburg syndrome (WS) is an autosomal-dominant neural crest cell disorder phenotypically characterized by hearing impairment and disturbance of pigmentation. A presence of dystopia canthorum is indicative of WS type 1, caused by loss of function mutation in the PAX3 gene. In contrast, type 2 WS (WS2) is characterized by normally placed medial canthi and is genetically heterogeneous; mutations in MITF (microphthalmia associated transcription factor) associated with WS2 have been identified in some but not all affected families. Here, we report on a three-generation Indian family with a point mutation in the MITF gene causing WS2. This mutation, initially reported in a Northern European family, creates a stop codon in exon 7 and is predicted to result in a truncated protein lacking the HLH-Zip or Zip structure necessary for normal interaction with its target DNA motif. Comparison of the phenotype between the two families demonstrates a significant difference in pigmentary disturbance of the eye. This family, with the first documented case of two unrelated WS2 families harboring identical mutations, provides additional evidence for the importance of genetic background on the clinical phenotype.

Mutation in the Auxiliary Calcium-Channel Subunit CACNA2D4 Causes Autosomal Recessive Cone Dystrophy

PubMed Central

Wycisk, Katharina Agnes; Zeitz, Christina; Feil, Silke; Wittmer, Mariana; Forster, Ursula; Neidhardt, John; Wissinger, Bernd; Zrenner, Eberhart; Wilke, Robert; Kohl, Susanne; Berger, Wolfgang

2006-01-01

Retinal signal transmission depends on the activity of high voltage–gated l-type calcium channels in photoreceptor ribbon synapses. We recently identified a truncating frameshift mutation in the Cacna2d4 gene in a spontaneous mouse mutant with profound loss of retinal signaling and an abnormal morphology of ribbon synapses in rods and cones. The Cacna2d4 gene encodes an l-type calcium-channel auxiliary subunit of the α2δ type. Mutations in its human orthologue, CACNA2D4, were not yet known to be associated with a disease. We performed mutation analyses of 34 patients who received an initial diagnosis of night blindness, and, in two affected siblings, we detected a homozygous nucleotide substitution (c.2406C→A) in CACNA2D4. The mutation introduces a premature stop codon that truncates one-third of the corresponding open reading frame. Both patients share symptoms of slowly progressing cone dystrophy. These findings represent the first report of a mutation in the human CACNA2D4 gene and define a novel gene defect that causes autosomal recessive cone dystrophy. PMID:17033974

Comparison of codon usage bias across Leishmania and Trypanosomatids to understand mRNA secondary structure, relative protein abundance and pathway functions.

PubMed

Subramanian, Abhishek; Sarkar, Ram Rup

2015-10-01

Understanding the variations in gene organization and its effect on the phenotype across different Leishmania species, and to study differential clinical manifestations of parasite within the host, we performed large scale analysis of codon usage patterns between Leishmania and other known Trypanosomatid species. We present the causes and consequences of codon usage bias in Leishmania genomes with respect to mutational pressure, translational selection and amino acid composition bias. We establish GC bias at wobble position that governs codon usage bias across Leishmania species, rather than amino acid composition bias. We found that, within Leishmania, homogenous codon context coding for less frequent amino acid pairs and codons avoiding formation of folding structures in mRNA are essentially chosen. We predicted putative differences in global expression between genes belonging to specific pathways across Leishmania. This explains the role of evolution in shaping the otherwise conserved genome to demonstrate species-specific function-level differences for efficient survival. Copyright © 2015 Elsevier Inc. All rights reserved.

Codon 61 mutations in the c-Harvey-ras gene in mouse skin tumors induced by 7,12-dimethylbenz[a]anthracene plus okadaic acid class tumor promoters.

PubMed

Fujiki, H; Suganuma, M; Yoshizawa, S; Kanazawa, H; Sugimura, T; Manam, S; Kahn, S M; Jiang, W; Hoshina, S; Weinstein, I B

1989-01-01

Three okadaic acid class tumor promoters, okadaic acid, dinophysistoxin-1, and calyculin A, have potent tumor-promoting activity in two-stage carcinogenesis experiments on mouse skin. DNA isolated from tumors induced by 7,12-dimethylbenz[a]anthracene (DMBA) and each of these tumor promoters revealed the same mutation at the second nucleotide of codon 61 (CAA----CTA) in the c-Ha-ras gene, determined by the polymerase chain reaction procedure and DNA sequencing. Three potent 12-O-tetradecanoylphorbol-13-acetate (TPA)-type tumor promoters, TPA, teleocidin, and aplysiatoxin, showed the same effects. These results provide strong evidence that this mutation in the c-Ha-ras gene is due to a direct effect of DMBA rather than a selective effect of specific tumor promoters.

Identification of single-nucleotide polymorphisms of the prion protein gene in sika deer (Cervus nippon laiouanus)

PubMed Central

Jeong, Hyun-Jeong; Lee, Joong-Bok; Park, Seung-Yong; Song, Chang-Seon; Kim, Bo-Sook; Rho, Jung-Rae; Yoo, Mi-Hyun; Jeong, Byung-Hoon; Kim, Yong-Sun

2007-01-01

Polymorphisms of the prion protein gene (PRNP) have been detected in several cervid species. In order to confirm the genetic variations, this study examined the DNA sequences of the PRNP obtained from 33 captive sika deer (Cervus nippon laiouanus) in Korea. A total of three single-nucleotide polymorphisms (SNPs) at codons 100, 136 and 226 in the PRNP of the sika deer were identified. The polymorphic site located at codon 100 has not been reported. The SNPs detected at codons 100 and 226 induced amino acid substitutions. The SNP at codon 136 was a silent mutation that does not induce any amino acid change. The genotype and allele frequencies were determined for each of the SNPs. PMID:17679779

Modeling Treatment Response for Lamin A/C Related Dilated Cardiomyopathy in Human Induced Pluripotent Stem Cells.

PubMed

Lee, Yee-Ki; Lau, Yee-Man; Cai, Zhu-Jun; Lai, Wing-Hon; Wong, Lai-Yung; Tse, Hung-Fat; Ng, Kwong-Man; Siu, Chung-Wah

2017-07-28

Precision medicine is an emerging approach to disease treatment and prevention that takes into account individual variability in the environment, lifestyle, and genetic makeup of patients. Patient-specific human induced pluripotent stem cells hold promise to transform precision medicine into real-life clinical practice. Lamin A/C (LMNA)-related cardiomyopathy is the most common inherited cardiomyopathy in which a substantial proportion of mutations in the LMNA gene are of nonsense mutation. PTC124 induces translational read-through over the premature stop codon and restores production of the full-length proteins from the affected genes. In this study we generated human induced pluripotent stem cells-derived cardiomyocytes from patients who harbored different LMNA mutations (nonsense and frameshift) to evaluate the potential therapeutic effects of PTC124 in LMNA -related cardiomyopathy. We generated human induced pluripotent stem cells lines from 3 patients who carried distinctive mutations (R225X, Q354X, and T518fs) in the LMNA gene. The cardiomyocytes derived from these human induced pluripotent stem cells lines reproduced the pathophysiological hallmarks of LMNA -related cardiomyopathy. Interestingly, PTC124 treatment increased the production of full-length LMNA proteins in only the R225X mutant, not in other mutations. Functional evaluation experiments on the R225X mutant further demonstrated that PTC124 treatment not only reduced nuclear blebbing and electrical stress-induced apoptosis but also improved the excitation-contraction coupling of the affected cardiomyocytes. Using cardiomyocytes derived from human induced pluripotent stem cells carrying different LMNA mutations, we demonstrated that the effect of PTC124 is codon selective. A premature stop codon UGA appeared to be most responsive to PTC124 treatment. © 2017 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

The Enterococcus faecalis EbpA Pilus Protein: Attenuation of Expression, Biofilm Formation, and Adherence to Fibrinogen Start with the Rare Initiation Codon ATT

PubMed Central

Montealegre, Maria Camila; La Rosa, Sabina Leanti; Roh, Jung Hyeob; Harvey, Barrett R.

2015-01-01

ABSTRACT The endocarditis and biofilm-associated pili (Ebp) are important in Enterococcus faecalis pathogenesis, and the pilus tip, EbpA, has been shown to play a major role in pilus biogenesis, biofilm formation, and experimental infections. Based on in silico analyses, we previously predicted that ATT is the EbpA translational start codon, not the ATG codon, 120 bp downstream of ATT, which is annotated as the translational start. ATT is rarely used to initiate protein synthesis, leading to our hypothesis that this codon participates in translational regulation of Ebp production. To investigate this possibility, site-directed mutagenesis was used to introduce consecutive stop codons in place of two lysines at positions 5 and 6 from the ATT, to replace the ATT codon in situ with ATG, and then to revert this ATG to ATT; translational fusions of ebpA to lacZ were also constructed to investigate the effect of these start codons on translation. Our results showed that the annotated ATG does not start translation of EbpA, implicating ATT as the start codon; moreover, the presence of ATT, compared to the engineered ATG, resulted in significantly decreased EbpA surface display, attenuated biofilm, and reduced adherence to fibrinogen. Corroborating these findings, the translational fusion with the native ATT as the initiation codon showed significantly decreased expression of β-galactosidase compared to the construct with ATG in place of ATT. Thus, these results demonstrate that the rare initiation codon of EbpA negatively regulates EbpA surface display and negatively affects Ebp-associated functions, including biofilm and adherence to fibrinogen. PMID:26015496

Codon usage bias and tRNA over-expression in Buchnera aphidicola after aromatic amino acid nutritional stress on its host Acyrthosiphon pisum.

PubMed

Charles, Hubert; Calevro, Federica; Vinuelas, José; Fayard, Jean-Michel; Rahbe, Yvan

2006-01-01

Codon usage bias and relative abundances of tRNA isoacceptors were analysed in the obligate intracellular symbiotic bacterium, Buchnera aphidicola from the aphid Acyrthosiphon pisum, using a dedicated 35mer oligonucleotide microarray. Buchnera is archetypal of organisms living with minimal metabolic requirements and presents a reduced genome with high-evolutionary rate. Codonusage in Buchnera has been overcome by the high mutational bias towards AT bases. However, several lines of evidence for codon usage selection are given here. A significant correlation was found between tRNA relative abundances and codon composition of Buchnera genes. A significant codon usage bias was found for the choice of rare codons in Buchnera: C-ending codons are preferred in highly expressed genes, whereas G-ending codons are avoided. This bias is not explained by GC skew in the bacteria and might correspond to a selection for perfect matching between codon-anticodon pairs for some essential amino acids in Buchnera proteins. Nutritional stress applied to the aphid host induced a significant overexpression of most of the tRNA isoacceptors in bacteria. Although, molecular regulation of the tRNA operons in Buchnera was not investigated, a correlation between relative expression levels and organization in transcription unit was found in the genome of Buchnera.

Efficient Coproduction of Mannanase and Cellulase by the Transformation of a Codon-Optimized Endomannanase Gene from Aspergillus niger into Trichoderma reesei.

PubMed

Sun, Xianhua; Xue, Xianli; Li, Mengzhu; Gao, Fei; Hao, Zhenzhen; Huang, Huoqing; Luo, Huiying; Qin, Lina; Yao, Bin; Su, Xiaoyun

2017-12-20

Cellulase and mannanase are both important enzyme additives in animal feeds. Expressing the two enzymes simultaneously within one microbial host could potentially lead to cost reductions in the feeding of animals. For this purpose, we codon-optimized the Aspergillus niger Man5A gene to the codon-usage bias of Trichoderma reesei. By comparing the free energies and the local structures of the nucleotide sequences, one optimized sequence was finally selected and transformed into the T. reesei pyridine-auxotrophic strain TU-6. The codon-optimized gene was expressed to a higher level than the original one. Further expressing the codon-optimized gene in a mutated T. reesei strain through fed-batch cultivation resulted in coproduction of cellulase and mannanase up to 1376 U·mL -1 and 1204 U·mL -1 , respectively.

Codon usage patterns in Nematoda: analysis based on over 25 million codons in thirty-two species

PubMed Central

2006-01-01

Background Codon usage has direct utility in molecular characterization of species and is also a marker for molecular evolution. To understand codon usage within the diverse phylum Nematoda, we analyzed a total of 265,494 expressed sequence tags (ESTs) from 30 nematode species. The full genomes of Caenorhabditis elegans and C. briggsae were also examined. A total of 25,871,325 codons were analyzed and a comprehensive codon usage table for all species was generated. This is the first codon usage table available for 24 of these organisms. Results Codon usage similarity in Nematoda usually persists over the breadth of a genus but then rapidly diminishes even within each clade. Globodera, Meloidogyne, Pristionchus, and Strongyloides have the most highly derived patterns of codon usage. The major factor affecting differences in codon usage between species is the coding sequence GC content, which varies in nematodes from 32% to 51%. Coding GC content (measured as GC3) also explains much of the observed variation in the effective number of codons (R = 0.70), which is a measure of codon bias, and it even accounts for differences in amino acid frequency. Codon usage is also affected by neighboring nucleotides (N1 context). Coding GC content correlates strongly with estimated noncoding genomic GC content (R = 0.92). On examining abundant clusters in five species, candidate optimal codons were identified that may be preferred in highly expressed transcripts. Conclusion Evolutionary models indicate that total genomic GC content, probably the product of directional mutation pressure, drives codon usage rather than the converse, a conclusion that is supported by examination of nematode genomes. PMID:26271136

A novel mutation causing complete thyroxine-binding globulin deficiency (TBG-CD-Negev) among the Bedouins in southern Israel.

PubMed

Miura, Y; Hershkovitz, E; Inagaki, A; Parvari, R; Oiso, Y; Phillip, M

2000-10-01

T4-binding globulin (TBG) is the major thyroid hormone transport protein in human serum. Inherited TBG abnormalities do not usually alter the metabolic status and are transmitted in X-linked inheritance. A high prevalence of complete TBG deficiency (TBG-CD) has been reported among the Bedouin population in the Negev (southern Israel). In this study we report a novel single mutation causing complete TBG deficiency due to a deletion of the last base of codon 38 (exon 1), which led to a frame shift resulting in a premature stop at codon 51 and a presumed truncated peptide of 50 residues. This new variant of TBG (TBG-CD-Negev) was found among all of the patients studied. We conclude that a single mutation may account for TBG deficiency among the Bedouins in the Negev. This report is the first to describe a mutation in a population with an unusually high prevalence of TBG-CD.

A novel mutation affecting the arginine-137 residue of AVPR2 in dizygous twins leads to nephrogenic diabetes insipidus and attenuated urine exosome aquaporin-2.

PubMed

Hinrichs, Gitte R; Hansen, Louise H; Nielsen, Maria R; Fagerberg, Christina; Dieperink, Hans; Rittig, Søren; Jensen, Boye L

2016-04-01

Mutations in the vasopressin V2 receptor gene AVPR2 may cause X-linked nephrogenic diabetes insipidus by defective apical insertion of aquaporin-2 in the renal collecting duct principal cell. Substitution mutations with exchange of arginine at codon 137 can cause nephrogenic syndrome of inappropriate antidiuresis or congenital X-linked nephrogenic diabetes insipidus. We present a novel mutation in codon 137 within AVPR2 with substitution of glycine for arginine in male dizygotic twins. Nephrogenic diabetes insipidus was demonstrated by water deprivation test and resistance to vasopressin administration. While a similar urine exosome release rate was shown between probands and controls by western blotting for the marker ALIX, there was a selective decrease in exosome aquaporin-2 versus aquaporin-1 protein in probands compared to controls. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Using Student Writing and Lexical Analysis to Reveal Student Thinking about the Role of Stop Codons in the Central Dogma

ERIC Educational Resources Information Center

Prevost, Luanna B.; Smith, Michelle K.; Knight, Jennifer K.

2016-01-01

Previous work has shown that students have persistent difficulties in understanding how central dogma processes can be affected by a stop codon mutation. To explore these difficulties, we modified two multiple-choice questions from the Genetics Concept Assessment into three open-ended questions that asked students to write about how a stop codon…

Systematic screening for mutations in the human serotonin 1F receptor gene in patients with bipolar affective disorder and schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shimron-Abarbanell, D.; Harms, H.; Erdmann, J.

1996-04-09

Using single strand conformational analysis we screened the complete coding sequence of the serotonin 1F (5-HT{sub 1F}) receptor gene for the presence of DNA sequence variation in a sample of 137 unrelated individuals including 45 schizophrenic patients, 46 bipolar patients, as well as 46 healthy controls. We detected only three rare sequence variants which are characterized by single base pair substitutions, namely a silent T{r_arrow}A transversion in the third position of codon 261 (encoding isoleucine), a silent C{r_arrow}T transition in the third position of codon 176 (encoding histidine), and a C{r_arrow}T transition in position -78 upstream from the start codon.more » The lack of significant mutations in patients suffering from schizophrenia and bipolar affective disorder indicates that the 5-HT{sub 1F} receptor is not commonly involved in the etiology of these diseases. 12 refs., 1 fig., 2 tabs.« less

TTA codons in some genes prevent their expression in a class of developmental, antibiotic-negative, Streptomyces mutants.

PubMed Central

Leskiw, B K; Lawlor, E J; Fernandez-Abalos, J M; Chater, K F

1991-01-01

In Streptomyces coelicolor A3(2) and the related species Streptomyces lividans 66, aerial mycelium formation and antibiotic production are blocked by mutations in bldA, which specifies a tRNA(Leu)-like gene product which would recognize the UUA codon. Here we show that phenotypic expression of three disparate genes (carB, lacZ, and ampC) containing TTA codons depends strongly on bldA. Site-directed mutagenesis of carB, changing its two TTA codons to CTC (leucine) codons, resulted in bldA-independent expression; hence the bldA product is the principal tRNA for the UUA codon. Two other genes (hyg and aad) containing TTA codons show a medium-dependent reduction in phenotypic expression (hygromycin resistance and spectinomycin resistance, respectively) in bldA mutants. For hyg, evidence is presented that the UUA codon is probably being translated by a tRNA with an imperfectly matched anticodon, giving very low levels of gene product but relatively high resistance to hygromycin. It is proposed that TTA codons may be generally absent from genes expressed during vegetative growth and from the structural genes for differentiation and antibiotic production but present in some regulatory and resistance genes associated with the latter processes. The codon may therefore play a role in developmental regulation. Images PMID:1826053

Identification of ALK germline mutation (3605delG) in pediatric anaplastic medulloblastoma.

PubMed

Coco, Simona; De Mariano, Marilena; Valdora, Francesca; Servidei, Tiziana; Ridola, Vita; Andolfo, Immacolata; Oberthuer, André; Tonini, Gian Paolo; Longo, Luca

2012-10-01

The anaplastic lymphoma kinase (ALK) gene has been found either rearranged or mutated in several neoplasms such as anaplastic large-cell lymphoma, non-small-cell lung cancer, neuroblastoma and anaplastic thyroid cancer. Medulloblastoma (MB) is an embryonic pediatric cancer arising from nervous system, a tissue in which ALK is expressed during embryonic development. We performed an ALK mutation screening in 52 MBs and we found a novel heterozygous germline deletion of a single base in exon 23 (3605delG) in a case with marked anaplasia. This G deletion results in a frameshift mutation producing a premature stop codon in exon 25 of ALK tyrosine kinase domain. We also screened three human MB cell lines without finding any mutation of ALK gene. Quantitative expression analysis of 16 out of 52 samples showed overexpression of ALK mRNA in three MBs. In the present study, we report the first mutation of ALK found in MB. Moreover, a deletion of ALK gene producing a stop codon has not been detected in human tumors up to now. Further investigations are now required to elucidate whether the truncated form of ALK may have a role in signal transduction.

A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.

PubMed

Liu, H X; Cartegni, L; Zhang, M Q; Krainer, A R

2001-01-01

Point mutations can generate defective and sometimes harmful proteins. The nonsense-mediated mRNA decay (NMD) pathway minimizes the potential damage caused by nonsense mutations. In-frame nonsense codons located at a minimum distance upstream of the last exon-exon junction are recognized as premature termination codons (PTCs), targeting the mRNA for degradation. Some nonsense mutations cause skipping of one or more exons, presumably during pre-mRNA splicing in the nucleus; this phenomenon is termed nonsense-mediated altered splicing (NAS), and its underlying mechanism is unclear. By analyzing NAS in BRCA1, we show here that inappropriate exon skipping can be reproduced in vitro, and results from disruption of a splicing enhancer in the coding sequence. Enhancers can be disrupted by single nonsense, missense and translationally silent point mutations, without recognition of an open reading frame as such. These results argue against a nuclear reading-frame scanning mechanism for NAS. Coding-region single-nucleotide polymorphisms (cSNPs) within exonic splicing enhancers or silencers may affect the patterns or efficiency of mRNA splicing, which may in turn cause phenotypic variability and variable penetrance of mutations elsewhere in a gene.

Problem-Solving Test: The Effect of Synonymous Codons on Gene Expression

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2009-01-01

Terms to be familiar with before you start to solve the test: the genetic code, codon, degenerate codons, protein synthesis, aminoacyl-tRNA, anticodon, antiparallel orientation, wobble, unambiguous codons, ribosomes, initiation, elongation and termination of translation, peptidyl transferase, translocation, degenerate oligonucleotides, green…

Introduction of translation stop codons into the viral glycoprotein gene in a fish DNA vaccine eliminates induction of protective immunity

USGS Publications Warehouse

Garver, K.A.; Conway, C.M.; Kurath, G.

2006-01-01

A highly efficacious DNA vaccine against a fish rhabdovirus, infectious hematopoietic necrosis virus (IHNV), was mutated to introduce two stop codons to prevent glycoprotein translation while maintaining the plasmid DNA integrity and RNA transcription ability. The mutated plasmid vaccine, denoted pIHNw-G2stop, when injected intramuscularly into fish at high doses, lacked detectable glycoprotein expression in the injection site muscle, and did not provide protection against lethal virus challenge 7 days post-vaccination. These results suggest that the G-protein itself is required to stimulate the early protective antiviral response observed after vaccination with the nonmutated parental DNA vaccine. ?? Springer Science+Business Media, Inc. 2006.

Prophylactic thyroidectomy for asymptomatic 3-year-old boy with positive multiple endocrine neoplasia type 2A mutation (codon 634).

PubMed

Jesić, Maja D; Tancić-Gajić, Milina; Jesić, Milos M; Zivaljević, Vladan; Sajić, Silvija; Vujović, Svetlana; Damjanović, Svetozar

2014-01-01

The multiple endocrine neoplasia type 2A (MEN 2A) syndrome, comprising medullary thyroid carcinoma (MTC), pheochromocytoma and primary hyperparathyroidism (PHPT) is most frequently caused by codon 634 activating mutations of the RET (rearranged during transfection) proto-oncogene on chromosome 10. For this codon-mutation carriers, earlier thyroidectomy (before the age of 5 years) would be advantageous in limiting the potential for the development of MTC as well as parathyroid adenomas. This is a case report of 3-year-old boy from the MEN 2A family (the boy's father and grandmother and paternal aunt) in which cysteine substitutes for phenylalanine at codon 634 in exon 11 of the RET proto-oncogene, who underwent thyroidectomy solely on the basis of genetic information. A boy had no thyromegaly, thyroidal irregularities or lymphadenopathy and no abnormality on the neck ultrasound examination. The pathology finding of thyroid gland was negative for MTC. Two years after total thyroidectomy, 5-year-old boy is healthy with permanent thyroxine replacement. His serum calcitonin level is < 2 pg/ml (normal < 13 pg/ml), has normal serum calcium and parathyroid hormone levels and negative urinary catecholamines. Long-term follow-up of this patient is required to determine whether very early thyroidectomy improves the long-term outcome of PHPT. Children with familial antecedents of MEN 2A should be genetically studied for the purpose of determining the risk of MTC and assessing the possibilities of making prophylactic thyroidectomy before the age of 5 years.

Comparative Analysis of Syntenic Genes in Grass Genomes Reveals Accelerated Rates of Gene Structure and Coding Sequence Evolution in Polyploid Wheat1[W][OA

PubMed Central

Akhunov, Eduard D.; Sehgal, Sunish; Liang, Hanquan; Wang, Shichen; Akhunova, Alina R.; Kaur, Gaganpreet; Li, Wanlong; Forrest, Kerrie L.; See, Deven; Šimková, Hana; Ma, Yaqin; Hayden, Matthew J.; Luo, Mingcheng; Faris, Justin D.; Doležel, Jaroslav; Gill, Bikram S.

2013-01-01

Cycles of whole-genome duplication (WGD) and diploidization are hallmarks of eukaryotic genome evolution and speciation. Polyploid wheat (Triticum aestivum) has had a massive increase in genome size largely due to recent WGDs. How these processes may impact the dynamics of gene evolution was studied by comparing the patterns of gene structure changes, alternative splicing (AS), and codon substitution rates among wheat and model grass genomes. In orthologous gene sets, significantly more acquired and lost exonic sequences were detected in wheat than in model grasses. In wheat, 35% of these gene structure rearrangements resulted in frame-shift mutations and premature termination codons. An increased codon mutation rate in the wheat lineage compared with Brachypodium distachyon was found for 17% of orthologs. The discovery of premature termination codons in 38% of expressed genes was consistent with ongoing pseudogenization of the wheat genome. The rates of AS within the individual wheat subgenomes (21%–25%) were similar to diploid plants. However, we uncovered a high level of AS pattern divergence between the duplicated homeologous copies of genes. Our results are consistent with the accelerated accumulation of AS isoforms, nonsynonymous mutations, and gene structure rearrangements in the wheat lineage, likely due to genetic redundancy created by WGDs. Whereas these processes mostly contribute to the degeneration of a duplicated genome and its diploidization, they have the potential to facilitate the origin of new functional variations, which, upon selection in the evolutionary lineage, may play an important role in the origin of novel traits. PMID:23124323

[Identifying and sequence analysis of HLA-B*2736].

PubMed

Li, Zhen; Zou, Hong-Yan; Shao, Chao-Peng; Tang, Si; Wang, Da-Ming; Cheng, Liang-Hong

2007-11-01

An unknown HLA-B allele which was similar to HLA-B*270401 was detected by FLOW-SSOPCR-SSP and heterozygous sequence-based typing (SBT) in Chinese Han individual. Its anomalous patterns suggested the possible presence of new allele. Amplifying exon 2-5(include intron 2-4) of the HLA-B*27 allele separately by using allele-specific primers and sequencing in both directions. Identifying the difference between the novel B*27 allele and B*270401. The sequence of novel B*27 from exon 2 to partial exon 5 is 1 815 bp. There are 10 nt changes from B*270401 in exon 3-4, at nt634where A-->C(codon130 AGC-->CGC, 130 S-->R); nt670 where A-->T (codon142 ACC-->TCC, 142 T-->S); nt683 where G-->T (codon146 TGG-->TTG, 146 W-->L); nt698 where A-->T (codon151 GAG-->GTG, 151 E-->V); nt774 where G-->C (codon176 GAG-->GAC, 176 E-->D); nt776 where C-->A (codon177 ACG-->AAG, 177 T-->K); nt781 where C-->G (codon179 CAG-->GAG, 179Q-->E); nt789 where G-->T (codon181 GCG-->GCT) resulting no coding change; nt1438 where C-->T (codon206 GGC-->GGT) resulting no coding change; nt1449 where G-->C (codon210 GGG-->GCG, 210G-->A). In IMGT/HLA database, only three alleles (B*270502/2706/2732) have sequences of introns. The same sequence in intron 2 showed homology between the novel HLA-B*27 allele and B*2706, but their homology could not be supported in intron 3-4. Comparing the sequence of the novel B*27 allele in intron 3 and 4 with B*27 group, it showed there are three mutations at nt106 C-->G, nt179 G-->A, nt536 G-->A and one deletion at nt168 in intron 3 and one mutations at nt82 T-->C in intron 4, but the sequence of the novel B*27 allele in intron 3 and 4 was all the same to B*070201. The sequence was submitted to Gen-Bank and the accession number was DQ915176. The allele has been confirmed as an extension of B*2736 by the WHO Nomenclature committee in November 2006.

Zika Virus Attenuation by Codon Pair Deoptimization Induces Sterilizing Immunity in Mouse Models.

PubMed

Li, Penghui; Ke, Xianliang; Wang, Ting; Tan, Zhongyuan; Luo, Dan; Miao, Yuanjiu; Sun, Jianhong; Zhang, Yuan; Liu, Yan; Hu, Qinxue; Xu, Fuqiang; Wang, Hanzhong; Zheng, Zhenhua

2018-06-20

Zika virus (ZIKV) infection during the large epidemics in the Americas is related to congenital abnormities or fetal demise. To date, there is no vaccine, antiviral drug, or other modality available to prevent or treat Zika virus infection. Here we designed novel live attenuated ZIKV vaccine candidates using a codon pair deoptimization strategy. Three codon pair-deoptimized ZIKVs (Min E, Min NS1, and Min E+NS1) were de novo synthesized, and recovered by reverse genetics, containing large amounts of underrepresented codon pairs in E gene and/or NS1 gene. Amino acid sequence was 100% unchanged. The codon pair-deoptimized variants had decreased replication fitness in Vero cells (Min NS1 ≫ Min E > Min E+NS1), replicated more efficiently in insect cells than in mammalian cells, and demonstrated diminished virulence in a mouse model. In particular, Min E+NS1, the most restrictive variant, induced sterilizing immunity with a robust neutralizing antibody titer, and a single immunization achieved complete protection against lethal challenge and vertical ZIKV transmission during pregnancy. More importantly, due to the numerous synonymous substitutions in the codon pair-deoptimized strains, reversion to wild-type virulence through gradual nucleotide sequence mutations is unlikely. Our results collectively demonstrate that ZIKV can be effectively attenuated by codon pair deoptimization, highlighting the potential of Min E+NS1 as a safe vaccine candidate to prevent ZIKV infections. IMPORTANCE Due to unprecedented epidemics of Zika virus (ZIKV) across the Americas and the unexpected clinical symptoms including Guillain-Barré syndrome, microcephaly and other birth defects in human, there is an urgent need for ZIKV vaccine development. Here, we provided the first attenuated versions of ZIKV with two important genes (E and/or NS1) that were subjected to codon pair deoptimization. Compared to parental ZIKV, the codon pair-deoptimized ZIKVs were mammalian-attenuated, and preferred insect to mammalian Cells. Min E+NS1, the most restrictive variant, induced sterilizing immunity with a robust neutralizing antibody titer, and achieved complete protection against lethal challenge and vertical virus transmission during pregnancy. More importantly, the massive synonymous mutational approach made it impossible to revert to wild-type virulence. Our results have proven the feasibility of codon pair deoptimization as a strategy to develop live-attenuated vaccine candidates against flavivirues like ZIKV, Japanese encephalitis virus and West Nile virus. Copyright © 2018 American Society for Microbiology.

Whole exome sequencing in recurrent early pregnancy loss.

PubMed

Qiao, Ying; Wen, Jiadi; Tang, Flamingo; Martell, Sally; Shomer, Naomi; Leung, Peter C K; Stephenson, Mary D; Rajcan-Separovic, Evica

2016-05-01

Exome sequencing can identify genetic causes of idiopathic recurrent pregnancy loss (RPL). We identified compound heterozygous deleterious mutations affecting DYNC2H1 and ALOX15 in two out of four families with RPL. Both genes have a role in early development. Bioinformatics analysis of all genes with rare and putatively pathogenic mutations in miscarriages and couples showed enrichment in pathways relevant to pregnancy loss, including the complement and coagulation cascades pathways. Next generation sequencing (NGS) is increasingly being used to identify known and novel gene mutations in children with developmental delay and in fetuses with ultrasound-detected anomalies. In contrast, NGS is rarely used to study pregnancy loss. Chromosome microarray analysis detects putatively causative DNA copy number variants (CNVs) in ∼2% of miscarriages and CNVs of unknown significance (predominantly parental in origin) in up to 40% of miscarriages. Therefore, a large number of miscarriages still have an unknown cause. Whole exome sequencing (WES) was performed using Illumina HiSeq 2000 platform on seven euploid miscarriages from four families with RPL. Golden Helix SVS v8.1.5 was used for data assessment and inheritance analysis for deleterious DNA variants predicted to severely disrupt protein-coding genes by introducing a frameshift, loss of the stop codon, gain of the stop codon, changes in splicing or the initial codon. Webgestalt (http://bioinfo.vanderbilt.edu/webgestalt/) was used for pathway and disease association enrichment analysis of a gene pool containing putatively pathogenic variants in miscarriages and couples in comparison to control gene pools. Compound heterozygous mutations in DYNC2H1 and ALOX15 were identified in miscarriages from two families with RPL. DYNC2H1 is involved in cilia biogenesis and has been associated with fetal lethality in humans. ALOX15 is expressed in placenta and its dysregulation has been associated with inflammation, placental, dysfunction, abnormal oxidative stress response and angiogenesis. The pool of putatively pathogenic single nucleotide variants (SNVs) and small insertions and deletions (indels) detected in the miscarriages showed enrichment in 'complement and coagulation cascades pathway', and 'ciliary motility disorders'. We conclude that CNVs, individual SNVs and pool of deleterious gene mutations identified by exome sequencing could contribute to RPL. The size of our sample cohort is small. The functional effect of candidate mutations should be evaluated to determine whether the mutations are causative. This is the first study to assess whether SNVs may contribute to the pathogenesis of miscarriage. Furthermore, our findings suggest that collective effect of mutations in relevant biological pathways could be implicated in RPL. The study was funded by Canadian Institutes of Health Research (grant MOP 106467) and Michael Smith Foundation of Health Research Career Scholar salary award to ERS. © The Author 2016. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Whole exome sequencing in recurrent early pregnancy loss

PubMed Central

Qiao, Ying; Wen, Jiadi; Tang, Flamingo; Martell, Sally; Shomer, Naomi; Leung, Peter C.K.; Stephenson, Mary D.; Rajcan-Separovic, Evica

2016-01-01

STUDY HYPOTHESIS Exome sequencing can identify genetic causes of idiopathic recurrent pregnancy loss (RPL). STUDY FINDING We identified compound heterozygous deleterious mutations affecting DYNC2H1 and ALOX15 in two out of four families with RPL. Both genes have a role in early development. Bioinformatics analysis of all genes with rare and putatively pathogenic mutations in miscarriages and couples showed enrichment in pathways relevant to pregnancy loss, including the complement and coagulation cascades pathways. WHAT IS KNOWN ALREADY Next generation sequencing (NGS) is increasingly being used to identify known and novel gene mutations in children with developmental delay and in fetuses with ultrasound-detected anomalies. In contrast, NGS is rarely used to study pregnancy loss. Chromosome microarray analysis detects putatively causative DNA copy number variants (CNVs) in ∼2% of miscarriages and CNVs of unknown significance (predominantly parental in origin) in up to 40% of miscarriages. Therefore, a large number of miscarriages still have an unknown cause. STUDY DESIGN, SAMPLES/MATERIALS, METHODS Whole exome sequencing (WES) was performed using Illumina HiSeq 2000 platform on seven euploid miscarriages from four families with RPL. Golden Helix SVS v8.1.5 was used for data assessment and inheritance analysis for deleterious DNA variants predicted to severely disrupt protein-coding genes by introducing a frameshift, loss of the stop codon, gain of the stop codon, changes in splicing or the initial codon. Webgestalt (http://bioinfo.vanderbilt.edu/webgestalt/) was used for pathway and disease association enrichment analysis of a gene pool containing putatively pathogenic variants in miscarriages and couples in comparison to control gene pools. MAIN RESULTS AND THE ROLE OF CHANCE Compound heterozygous mutations in DYNC2H1 and ALOX15 were identified in miscarriages from two families with RPL. DYNC2H1 is involved in cilia biogenesis and has been associated with fetal lethality in humans. ALOX15 is expressed in placenta and its dysregulation has been associated with inflammation, placental, dysfunction, abnormal oxidative stress response and angiogenesis. The pool of putatively pathogenic single nucleotide variants (SNVs) and small insertions and deletions (indels) detected in the miscarriages showed enrichment in ‘complement and coagulation cascades pathway’, and ‘ciliary motility disorders’. We conclude that CNVs, individual SNVs and pool of deleterious gene mutations identified by exome sequencing could contribute to RPL. LIMITATIONS, REASONS FOR CAUTION The size of our sample cohort is small. The functional effect of candidate mutations should be evaluated to determine whether the mutations are causative. WIDER IMPLICATIONS OF THE FINDINGS This is the first study to assess whether SNVs may contribute to the pathogenesis of miscarriage. Furthermore, our findings suggest that collective effect of mutations in relevant biological pathways could be implicated in RPL. STUDY FUNDING AND COMPETING INTEREST(S) The study was funded by Canadian Institutes of Health Research (grant MOP 106467) and Michael Smith Foundation of Health Research Career Scholar salary award to ERS. PMID:26826164

Analysis of Synonymous Codon Usage Bias of Zika Virus and Its Adaption to the Hosts

PubMed Central

Wang, Hongju; Liu, Siqing; Zhang, Bo

2016-01-01

Zika virus (ZIKV) is a mosquito-borne virus (arbovirus) in the family Flaviviridae, and the symptoms caused by ZIKV infection in humans include rash, fever, arthralgia, myalgia, asthenia and conjunctivitis. Codon usage bias analysis can reveal much about the molecular evolution and host adaption of ZIKV. To gain insight into the evolutionary characteristics of ZIKV, we performed a comprehensive analysis on the codon usage pattern in 46 ZIKV strains by calculating the effective number of codons (ENc), codon adaptation index (CAI), relative synonymous codon usage (RSCU), and other indicators. The results indicate that the codon usage bias of ZIKV is relatively low. Several lines of evidence support the hypothesis that translational selection plays a role in shaping the codon usage pattern of ZIKV. The results from a correspondence analysis (CA) indicate that other factors, such as base composition, aromaticity, and hydrophobicity may also be involved in shaping the codon usage pattern of ZIKV. Additionally, the results from a comparative analysis of RSCU between ZIKV and its hosts suggest that ZIKV tends to evolve codon usage patterns that are comparable to those of its hosts. Moreover, selection pressure from Homo sapiens on the ZIKV RSCU patterns was found to be dominant compared with that from Aedes aegypti and Aedes albopictus. Taken together, both natural translational selection and mutation pressure are important for shaping the codon usage pattern of ZIKV. Our findings contribute to understanding the evolution of ZIKV and its adaption to its hosts. PMID:27893824

Contributions of intrinsic mutation rate and selfish selection to levels of de novo HRAS mutations in the paternal germline

PubMed Central

Giannoulatou, Eleni; McVean, Gilean; Taylor, Indira B.; McGowan, Simon J.; Maher, Geoffrey J.; Iqbal, Zamin; Pfeifer, Susanne P.; Turner, Isaac; Burkitt Wright, Emma M. M.; Shorto, Jennifer; Itani, Aysha; Turner, Karen; Gregory, Lorna; Buck, David; Rajpert-De Meyts, Ewa; Looijenga, Leendert H. J.; Kerr, Bronwyn; Wilkie, Andrew O. M.; Goriely, Anne

2013-01-01

The RAS proto-oncogene Harvey rat sarcoma viral oncogene homolog (HRAS) encodes a small GTPase that transduces signals from cell surface receptors to intracellular effectors to control cellular behavior. Although somatic HRAS mutations have been described in many cancers, germline mutations cause Costello syndrome (CS), a congenital disorder associated with predisposition to malignancy. Based on the epidemiology of CS and the occurrence of HRAS mutations in spermatocytic seminoma, we proposed that activating HRAS mutations become enriched in sperm through a process akin to tumorigenesis, termed selfish spermatogonial selection. To test this hypothesis, we quantified the levels, in blood and sperm samples, of HRAS mutations at the p.G12 codon and compared the results to changes at the p.A11 codon, at which activating mutations do not occur. The data strongly support the role of selection in determining HRAS mutation levels in sperm, and hence the occurrence of CS, but we also found differences from the mutation pattern in tumorigenesis. First, the relative prevalence of mutations in sperm correlates weakly with their in vitro activating properties and occurrence in cancers. Second, specific tandem base substitutions (predominantly GC>TT/AA) occur in sperm but not in cancers; genomewide analysis showed that this same mutation is also overrepresented in constitutional pathogenic and polymorphic variants, suggesting a heightened vulnerability to these mutations in the germline. We developed a statistical model to show how both intrinsic mutation rate and selfish selection contribute to the mutational burden borne by the paternal germline. PMID:24259709

Contributions of intrinsic mutation rate and selfish selection to levels of de novo HRAS mutations in the paternal germline.

PubMed

Giannoulatou, Eleni; McVean, Gilean; Taylor, Indira B; McGowan, Simon J; Maher, Geoffrey J; Iqbal, Zamin; Pfeifer, Susanne P; Turner, Isaac; Burkitt Wright, Emma M M; Shorto, Jennifer; Itani, Aysha; Turner, Karen; Gregory, Lorna; Buck, David; Rajpert-De Meyts, Ewa; Looijenga, Leendert H J; Kerr, Bronwyn; Wilkie, Andrew O M; Goriely, Anne

2013-12-10

The RAS proto-oncogene Harvey rat sarcoma viral oncogene homolog (HRAS) encodes a small GTPase that transduces signals from cell surface receptors to intracellular effectors to control cellular behavior. Although somatic HRAS mutations have been described in many cancers, germline mutations cause Costello syndrome (CS), a congenital disorder associated with predisposition to malignancy. Based on the epidemiology of CS and the occurrence of HRAS mutations in spermatocytic seminoma, we proposed that activating HRAS mutations become enriched in sperm through a process akin to tumorigenesis, termed selfish spermatogonial selection. To test this hypothesis, we quantified the levels, in blood and sperm samples, of HRAS mutations at the p.G12 codon and compared the results to changes at the p.A11 codon, at which activating mutations do not occur. The data strongly support the role of selection in determining HRAS mutation levels in sperm, and hence the occurrence of CS, but we also found differences from the mutation pattern in tumorigenesis. First, the relative prevalence of mutations in sperm correlates weakly with their in vitro activating properties and occurrence in cancers. Second, specific tandem base substitutions (predominantly GC>TT/AA) occur in sperm but not in cancers; genomewide analysis showed that this same mutation is also overrepresented in constitutional pathogenic and polymorphic variants, suggesting a heightened vulnerability to these mutations in the germline. We developed a statistical model to show how both intrinsic mutation rate and selfish selection contribute to the mutational burden borne by the paternal germline.

Clinical mutational profiling of 1006 lung cancers by next generation sequencing

PubMed Central

Illei, Peter B.; Belchis, Deborah; Tseng, Li-Hui; Nguyen, Doreen; De Marchi, Federico; Haley, Lisa; Riel, Stacy; Beierl, Katie; Zheng, Gang; Brahmer, Julie R.; Askin, Frederic B.; Gocke, Christopher D.; Eshleman, James R.; Forde, Patrick M.; Lin, Ming-Tseh

2017-01-01

Analysis of lung adenocarcinomas for actionable mutations has become standard of care. Here, we report our experience using next generation sequencing (NGS) to examine AKT1, BRAF, EGFR, ERBB2, KRAS, NRAS, and PIK3CA genes in 1006 non-small cell lung cancers in a clinical diagnostic setting. NGS demonstrated high sensitivity. Among 760 mutations detected, the variant allele frequency (VAF) was 2–5% in 33 (4.3%) mutations and 2–10% in 101 (13%) mutations. A single bioinformatics pipeline using Torrent Variant Caller, however, missed a variety of EGFR mutations. Mutations were detected in KRAS (36% of tumors), EGFR (19%) including 8 (0.8%) within the extracellular domain (4 at codons 108 and 4 at codon 289), BRAF (6.3%), and PIK3CA (3.7%). With a broader reportable range, exon 19 deletion and p.L858R accounted for only 36% and 26% of EGFR mutations and p.V600E accounted for only 24% of BRAF mutations. NGS provided accurate sequencing of complex mutations seen in 19% of EGFR exon 19 deletion mutations. Doublet (compound) EGFR mutations were observed in 29 (16%) of 187 EGFR-mutated tumors, including 69% with two non-p.L858R missense mutations and 24% with p.L858 and non-p.L858R missense mutations. Concordant VAFs suggests doublet EGFR mutations were present in a dominant clone and cooperated in oncogenesis. Mutants with predicted impaired kinase, observed in 25% of BRAF-mutated tumors, were associated with a higher incidence of concomitant activating KRAS mutations. NGS demonstrates high analytic sensitivity, broad reportable range, quantitative VAF measurement, single molecule sequencing to resolve complex deletion mutations, and simultaneous detection of concomitant mutations. PMID:29228562

Multi-country Survey Revealed Prevalent and Novel F1534S Mutation in Voltage-Gated Sodium Channel (VGSC) Gene in Aedes albopictus.

PubMed

Xu, Jiabao; Bonizzoni, Mariangela; Zhong, Daibin; Zhou, Guofa; Cai, Songwu; Li, Yiji; Wang, Xiaoming; Lo, Eugenia; Lee, Rebecca; Sheen, Roger; Duan, Jinhua; Yan, Guiyun; Chen, Xiao-Guang

2016-05-01

Aedes albopictus is an important dengue vector because of its aggressive biting behavior and rapid spread out of its native home range in Southeast Asia. Pyrethroids are widely used for adult mosquito control, and resistance to pyrethroids should be carefully monitored because vector control is the only effective method currently available to prevent dengue transmission. The voltage-gated sodium channel gene is the target site of pyrethroids, and mutations in this gene cause knockdown resistance (kdr). Previous studies reported various mutations in the voltage-gated sodium channel (VGSC) gene, but the spatial distribution of kdr mutations in Ae. albopictus has not been systematically examined, and the association between kdr mutation and phenotypic resistance has not been established. A total of 597 Ae. albopictus individuals from 12 populations across Asia, Africa, America and Europe were examined for mutations in the voltage-gated sodium channel gene. Three domains for a total of 1,107 bp were sequenced for every individual. Two populations from southern China were examined for pyrethroid resistance using the World Health Organization standard tube bioassay, and the association between kdr mutations and phenotypic resistance was tested. A total of 29 synonymous mutations were found across domain II, III and IV of the VGSC gene. Non-synonymous mutations in two codons of the VGSC gene were detected in 5 populations from 4 countries. A novel mutation at 1532 codon (I1532T) was found in Rome, Italy with a frequency of 19.7%. The second novel mutation at codon 1534 (F1534S) was detected in southern China and Florida, USA with a frequency ranging from 9.5-22.6%. The WHO insecticide susceptibility bioassay found 90.1% and 96.1% mortality in the two populations from southern China, suggesting resistance and probable resistance. Positive association between kdr mutations with deltamethrin resistance was established in these two populations. Two novel kdr mutations, I1532T and F1534S were found in Ae. albopictus. This is the first report of I1532T mutations in Italy and F1534S mutation in China and US. Significant association between kdr mutation and protection from deltamethrin raised the possibility that kdr mutation may be a viable biomarker for pyrethroid resistance surveillance in Ae. albopictus. The patchy distribution of kdr mutations in Ae. albopictus mosquitoes calls for developing global surveillance plan for pyrethroid resistance and developing countermeasures to mitigate the spread of resistance.

Analysis of Serine Codon Conservation Reveals Diverse Phenotypic Constraints on Hepatitis C Virus Glycoprotein Evolution

PubMed Central

Koutsoudakis, George; Urbanowicz, Richard A.; Mirza, Deeman; Ginkel, Corinne; Riebesehl, Nina; Calland, Noémie; Albecka, Anna; Price, Louisa; Hudson, Natalia; Descamps, Véronique; Backx, Matthijs; McClure, C. Patrick; Duverlie, Gilles; Pecheur, Eve-Isabelle; Dubuisson, Jean; Perez-del-Pulgar, Sofia; Forns, Xavier; Steinmann, Eike; Tarr, Alexander W.; Pietschmann, Thomas

2014-01-01

Serine is encoded by two divergent codon types, UCN and AGY, which are not interchangeable by a single nucleotide substitution. Switching between codon types therefore occurs via intermediates (threonine or cysteine) or via simultaneous tandem substitutions. Hepatitis C virus (HCV) chronically infects 2 to 3% of the global population. The highly variable glycoproteins E1 and E2 decorate the surface of the viral envelope, facilitate cellular entry, and are targets for host immunity. Comparative sequence analysis of globally sampled E1E2 genes, coupled with phylogenetic analysis, reveals the signatures of multiple archaic codon-switching events at seven highly conserved serine residues. Limited detection of intermediate phenotypes indicates that associated fitness costs restrict their fixation in divergent HCV lineages. Mutational pathways underlying codon switching were probed via reverse genetics, assessing glycoprotein functionality using multiple in vitro systems. These data demonstrate selection against intermediate phenotypes can act at the structural/functional level, with some intermediates displaying impaired virion assembly and/or decreased capacity for target cell entry. These effects act in residue/isolate-specific manner. Selection against intermediates is also provided by humoral targeting, with some intermediates exhibiting increased epitope exposure and enhanced neutralization sensitivity, despite maintaining a capacity for target cell entry. Thus, purifying selection against intermediates limits their frequencies in globally sampled strains, with divergent functional constraints at the protein level restricting the fixation of deleterious mutations. Overall our study provides an experimental framework for identification of barriers limiting viral substitutional evolution and indicates that serine codon-switching represents a genomic “fossil record” of historical purifying selection against E1E2 intermediate phenotypes. PMID:24173227

Molecular Characteristics of Rifampin- and Isoniazid-Resistant Mycobacterium tuberculosis Strains Isolated in Vietnam

PubMed Central

Van Bac, Nguyen; Son, Nguyen Thai; Lien, Vu Thi Kim; Ha, Chu Hoang; Cuong, Nguyen Huu; Mai, Cung Thi Ngoc; Le, Thanh Hoa

2012-01-01

Molecular characterization of the drug resistance of Mycobacterium tuberculosis strains with different origins can generate information that is useful for developing molecular methods. These methods are widely applicable for rapid detection of drug resistance. A total of 166 rifampin (RIF)- and/or isoniazid (INH)-resistant strains of M. tuberculosis have been isolated from different parts of Vietnam; they were screened for mutations associated with resistance to these drugs by sequence analysis investigating genetic mutations associated with RIF and INH resistance. Seventeen different mutations were identified in 74 RIF-resistant strains, 56 of which (approximately 76%) had mutations in the so-called 81-bp “hot-spot” region of the rpoB gene. The most common point mutations were in codons 531 (37.8%), 526 (23%), and 516 (9.46%) of the rpoB gene. Mutations were not found in three strains (4.05%). In the case of INH resistance, five different mutations in the katG genes of 82 resistant strains were detected, among which the nucleotide substitution at codon 315 (76.83%) is the most common mutation. This study provided the first molecular characterization of INH and RIF resistance of M. tuberculosis strains from Vietnam, and detection of the katG and rpoB mutations of the INH and RIF-resistant strains should be useful for rapid detection of the INH- and RIF-resistant strains by molecular tests. PMID:22170905

Benzo[a]pyrene, Aflatoxine B1 and Acetaldehyde Mutational Patterns in TP53 Gene Using a Functional Assay: Relevance to Human Cancer Aetiology

PubMed Central

Paget, Vincent; Lechevrel, Mathilde; André, Véronique; Le Goff, Jérémie; Pottier, Didier; Billet, Sylvain; Garçon, Guillaume; Shirali, Pirouz; Sichel, François

2012-01-01

Mutations in the TP53 gene are the most common alterations in human tumours. TP53 mutational patterns have sometimes been linked to carcinogen exposure. In hepatocellular carcinoma, a specific G>T transversion on codon 249 is classically described as a fingerprint of aflatoxin B1 exposure. Likewise G>T transversions in codons 157 and 158 have been related to tobacco exposure in human lung cancers. However, controversies remain about the interpretation of TP53 mutational pattern in tumours as the fingerprint of genotoxin exposure. By using a functional assay, the Functional Analysis of Separated Alleles in Yeast (FASAY), the present study depicts the mutational pattern of TP53 in normal human fibroblasts after in vitro exposure to well-known carcinogens: benzo[a]pyrene, aflatoxin B1 and acetaldehyde. These in vitro patterns of mutations were then compared to those found in human tumours by using the IARC database of TP53 mutations. The results show that the TP53 mutational patterns found in human tumours can be only partly ascribed to genotoxin exposure. A complex interplay between the functional impact of the mutations on p53 phenotype and the cancer natural history may affect these patterns. However, our results strongly support that genotoxins exposure plays a major role in the aetiology of the considered cancers. PMID:22319594

Molecular characteristics of rifampin- and isoniazid-resistant mycobacterium tuberculosis strains isolated in Vietnam.

PubMed

Minh, Nghiem Ngoc; Van Bac, Nguyen; Son, Nguyen Thai; Lien, Vu Thi Kim; Ha, Chu Hoang; Cuong, Nguyen Huu; Mai, Cung Thi Ngoc; Le, Thanh Hoa

2012-03-01

Molecular characterization of the drug resistance of Mycobacterium tuberculosis strains with different origins can generate information that is useful for developing molecular methods. These methods are widely applicable for rapid detection of drug resistance. A total of 166 rifampin (RIF)- and/or isoniazid (INH)-resistant strains of M. tuberculosis have been isolated from different parts of Vietnam; they were screened for mutations associated with resistance to these drugs by sequence analysis investigating genetic mutations associated with RIF and INH resistance. Seventeen different mutations were identified in 74 RIF-resistant strains, 56 of which (approximately 76%) had mutations in the so-called 81-bp "hot-spot" region of the rpoB gene. The most common point mutations were in codons 531 (37.8%), 526 (23%), and 516 (9.46%) of the rpoB gene. Mutations were not found in three strains (4.05%). In the case of INH resistance, five different mutations in the katG genes of 82 resistant strains were detected, among which the nucleotide substitution at codon 315 (76.83%) is the most common mutation. This study provided the first molecular characterization of INH and RIF resistance of M. tuberculosis strains from Vietnam, and detection of the katG and rpoB mutations of the INH and RIF-resistant strains should be useful for rapid detection of the INH- and RIF-resistant strains by molecular tests.

Amino acid usage is asymmetrically biased in AT- and GC-rich microbial genomes.

PubMed

Bohlin, Jon; Brynildsrud, Ola; Vesth, Tammi; Skjerve, Eystein; Ussery, David W

2013-01-01

Genomic base composition ranges from less than 25% AT to more than 85% AT in prokaryotes. Since only a small fraction of prokaryotic genomes is not protein coding even a minor change in genomic base composition will induce profound protein changes. We examined how amino acid and codon frequencies were distributed in over 2000 microbial genomes and how these distributions were affected by base compositional changes. In addition, we wanted to know how genome-wide amino acid usage was biased in the different genomes and how changes to base composition and mutations affected this bias. To carry this out, we used a Generalized Additive Mixed-effects Model (GAMM) to explore non-linear associations and strong data dependences in closely related microbes; principal component analysis (PCA) was used to examine genomic amino acid- and codon frequencies, while the concept of relative entropy was used to analyze genomic mutation rates. We found that genomic amino acid frequencies carried a stronger phylogenetic signal than codon frequencies, but that this signal was weak compared to that of genomic %AT. Further, in contrast to codon usage bias (CUB), amino acid usage bias (AAUB) was differently distributed in AT- and GC-rich genomes in the sense that AT-rich genomes did not prefer specific amino acids over others to the same extent as GC-rich genomes. AAUB was also associated with relative entropy; genomes with low AAUB contained more random mutations as a consequence of relaxed purifying selection than genomes with higher AAUB. Genomic base composition has a substantial effect on both amino acid- and codon frequencies in bacterial genomes. While phylogeny influenced amino acid usage more in GC-rich genomes, AT-content was driving amino acid usage in AT-rich genomes. We found the GAMM model to be an excellent tool to analyze the genomic data used in this study.

Amino Acid Usage Is Asymmetrically Biased in AT- and GC-Rich Microbial Genomes

PubMed Central

Bohlin, Jon; Brynildsrud, Ola; Vesth, Tammi; Skjerve, Eystein; Ussery, David W.

2013-01-01

Introduction Genomic base composition ranges from less than 25% AT to more than 85% AT in prokaryotes. Since only a small fraction of prokaryotic genomes is not protein coding even a minor change in genomic base composition will induce profound protein changes. We examined how amino acid and codon frequencies were distributed in over 2000 microbial genomes and how these distributions were affected by base compositional changes. In addition, we wanted to know how genome-wide amino acid usage was biased in the different genomes and how changes to base composition and mutations affected this bias. To carry this out, we used a Generalized Additive Mixed-effects Model (GAMM) to explore non-linear associations and strong data dependences in closely related microbes; principal component analysis (PCA) was used to examine genomic amino acid- and codon frequencies, while the concept of relative entropy was used to analyze genomic mutation rates. Results We found that genomic amino acid frequencies carried a stronger phylogenetic signal than codon frequencies, but that this signal was weak compared to that of genomic %AT. Further, in contrast to codon usage bias (CUB), amino acid usage bias (AAUB) was differently distributed in AT- and GC-rich genomes in the sense that AT-rich genomes did not prefer specific amino acids over others to the same extent as GC-rich genomes. AAUB was also associated with relative entropy; genomes with low AAUB contained more random mutations as a consequence of relaxed purifying selection than genomes with higher AAUB. Conclusion Genomic base composition has a substantial effect on both amino acid- and codon frequencies in bacterial genomes. While phylogeny influenced amino acid usage more in GC-rich genomes, AT-content was driving amino acid usage in AT-rich genomes. We found the GAMM model to be an excellent tool to analyze the genomic data used in this study. PMID:23922837

Targeting Nonsense Mutations in Diseases with Translational Read-Through-Inducing Drugs (TRIDs).

PubMed

Nagel-Wolfrum, Kerstin; Möller, Fabian; Penner, Inessa; Baasov, Timor; Wolfrum, Uwe

2016-04-01

In recent years, remarkable advances in the ability to diagnose genetic disorders have been made. The identification of disease-causing genes allows the development of gene-specific therapies with the ultimate goal to develop personalized medicines for each patient according to their own specific genetic defect. In-depth genotyping of many different genes has revealed that ~12% of inherited genetic disorders are caused by in-frame nonsense mutations. Nonsense (non-coding) mutations are caused by point mutations, which generate premature termination codons (PTCs) that cause premature translational termination of the mRNA, and subsequently inhibit normal full-length protein expression. Recently, a gene-based therapeutic approach for genetic diseases caused by nonsense mutations has emerged, namely the so-called translational read-through (TR) therapy. Read-through therapy is based on the discovery that small molecules, known as TR-inducing drugs (TRIDs), allow the translation machinery to suppress a nonsense codon, elongate the nascent peptide chain, and consequently result in the synthesis of full-length protein. Several TRIDs are currently under investigation and research has been performed on several genetic disorders caused by nonsense mutations over the years. These findings have raised hope for the usage of TR therapy as a gene-based pharmacogenetic therapy for nonsense mutations in various genes responsible for a variety of genetic diseases.

Mutation-Specific RAS Oncogenicity Explains N-RAS Codon 61 Selection in Melanoma

PubMed Central

Burd, Christin E.; Liu, Wenjin; Huynh, Minh V.; Waqas, Meriam A.; Gillahan, James E.; Clark, Kelly S.; Fu, Kailing; Martin, Brit L.; Jeck, William R.; Souroullas, George P.; Darr, David B.; Zedek, Daniel C.; Miley, Michael J.; Baguley, Bruce C.; Campbell, Sharon L.

2014-01-01

N-RAS mutation at codon 12, 13 or 61 is associated with transformation; yet, in melanoma, such alterations are nearly exclusive to codon 61. Here, we compared the melanoma susceptibility of an N-RasQ61R knock-in allele to similarly designed K-RasG12D and N-RasG12D alleles. With concomitant p16INK4a inactivation, K-RasG12D or N-RasQ61R expression efficiently promoted melanoma in vivo, whereas N-RasG12D did not. Additionally, N-RasQ61R mutation potently cooperated with Lkb1/Stk11 loss to induce highly metastatic disease. Functional comparisons of N-RasQ61R and N-RasG12D revealed little difference in the ability of these proteins to engage PI3K or RAF. Instead, N-RasQ61R showed enhanced nucleotide binding, decreased intrinsic GTPase activity and increased stability when compared to N-RasG12D. This work identifies a faithful model of human N-RAS mutant melanoma, and suggests that the increased melanomagenecity of N-RasQ61R over N-RasG12D is due to heightened abundance of the active, GTP-bound form rather than differences in the engagement of downstream effector pathways. PMID:25252692

A novel two-nucleotide deletion in the ATP7A gene associated with delayed infantile onset of Menkes disease.

PubMed

Wada, Takahito; Haddad, Marie Reine; Yi, Ling; Murakami, Tomomi; Sasaki, Akiko; Shimbo, Hiroko; Kodama, Hiroko; Osaka, Hitoshi; Kaler, Stephen G

2014-04-01

Determining the relationship between clinical phenotype and genotype in genetic diseases is important in clinical practice. In general, frameshift mutations are expected to produce premature termination codons, leading to production of mutant transcripts destined for degradation by nonsense-mediated decay. In X-linked recessive diseases, male patients with frameshift mutations typically have a severe or even lethal phenotype. We report a case of a 17-month-old boy with Menkes disease (NIM #309400), an X-linked recessive copper metabolism disorder caused by mutations in the ATP7A copper transporter gene. He exhibited an unexpectedly late onset and experienced milder symptoms. His genomic DNA showed a de novo two-nucleotide deletion in exon 4 of ATP7A, predicting a translational frameshift and premature stop codon, and a classic severe phenotype. Characterization of his ATP7A mRNA showed no abnormal splicing. We speculate that translation reinitiation could occur downstream to the premature termination codon and produce a partially functional ATP7A protein. Study of the child's fibroblasts found no evidence of translation reinitiation; however, the possibility remains that this phenomenon occurred in neural tissues and influenced the clinical phenotype. Copyright © 2014 Elsevier Inc. All rights reserved.

[The Spectrum of Mutations in Genes Associated with Resistance to Rifampicin, Isoniazid, and Fluoroquinolones in the Clinical Strains of M. tuberculosis Reflects the Transmissibility of Mutant Clones].

PubMed

Ergeshov, A; Andreevskaya, S N; Larionova, E E; Smirnova, T G; Chernousova, L N

2017-01-01

To study the transmissibility of drug resistant mutant clones, M. tuberculosis samples were isolated from the patients of the clinical department and the polyclinic of the Central TB Research Institute (n = 1455) for 2011-2014. A number of clones were phenotypically resistant to rifampicin (n = 829), isoniazid (n = 968), and fluoroquinolones (n = 220). We have detected 21 resistance-associated variants in eight codons of rpoB, six variants in three codons of katG, three variants in two positions of inhA, four variants in four positions of ahpC, and nine variants in five codons of gyrA, which were represented in the analyzed samples with varied frequencies. Most common mutations were rpoB 531 Ser→Leu (77.93%), katG 315 (Ser→Thr) (94.11%), and gyrA 94 (Asp→Gly) (45.45%). We found that the mutations at position 15 of inhA (C→T) (frequency of 25.72%) are commonly associated with katG 315 (Ser→Thr). This association of two DNA variants may arise due to the double selection by coexposure of M. tuberculosis to isoniazid and ethionamide. The high transmissibility of mutated strains was observed, which may be explained by the minimal influence of the resistance determinants on strain viability. The high transmissibility of resistant variants may also explain the large populational prevalence of drug-resistant TB strains.

Nonsense mutation in the phosphofructokinase muscle subunit gene associated with retention of intron 10 in one of the isolated transcripts in Ashkenazi Jewish patients with Tarui disease.

PubMed Central

Vasconcelos, O; Sivakumar, K; Dalakas, M C; Quezado, M; Nagle, J; Leon-Monzon, M; Dubnick, M; Gajdusek, D C; Goldfarb, L G

1995-01-01

Mutations in the human phosphofructokinase muscle subunit gene (PFKM) are known to cause myopathy classified as glycogenosis type VII (Tarui disease). Previously described molecular defects include base substitutions altering encoded amino acids or resulting in abnormal splicing. We report a mutation resulting in phosphofructokinase deficiency in three patients from an Ashkenazi Jewish family. Using a reverse transcription PCR assay, PFKM subunit transcripts differing by length were detected in skeletal muscle tissue of all three affected subjects. In the longer transcript, an insertion of 252 nucleotides totally homologous to the structure of the 10th intron of the PFKM gene was found separating exon 10 from exon 11. In addition, two single base transitions were identified by direct sequencing: [exon 6; codon 95; CGA (Arg) to TGA (stop)] and [exon 7; codon 172; ACC (Thr) to ACT (Thr)] in either transcript. Single-stranded conformational polymorphism and restriction enzyme analyses confirmed the presence of these point substitutions in genomic DNA and strongly suggested homozygosity for the pathogenic allele. The nonsense mutation at codon 95 appeared solely responsible for the phenotype in these patients, further expanding genetic heterogeneity of Tarui disease. Transcripts with and without intron 10 arising from identical mutant alleles probably resulted from differential pre-mRNA processing and may represent a novel message from the PFKM gene. Images Fig. 2 Fig. 4 Fig. 5 PMID:7479776

Mutation at Tyrosine in AMLRY (GILRY Like) Motif of Yeast eRF1 on Nonsense Codons Suppression and Binding Affinity to eRF3

PubMed Central

Akhmaloka; Susilowati, Prima Endang; Subandi; Madayanti, Fida

2008-01-01

Termination translation in Saccharomyces cerevisiae is controlled by two interacting polypeptide chain release factors, eRF1 and eRF3. Two regions in human eRF1, position at 281-305 and position at 411-415, were proposed to be involved on the interaction to eRF3. In this study we have constructed and characterized yeast eRF1 mutant at position 410 (correspond to 415 human eRF1) from tyrosine to serine residue resulting eRF1(Y410S). The mutations did not affect the viability and temperature sensitivity of the cell. The stop codons suppression of the mutant was analyzed in vivo using PGK-stop codon-LACZ gene fusion and showed that the suppression of the mutant was significantly increased in all of codon terminations. The suppression on UAG codon was the highest increased among the stop codons by comparing the suppression of the wild type respectively. In vitro interaction between eRF1 (mutant and wild type) to eRF3 were carried out using eRF1-(His)6 and eRF1(Y410S)-(His)6 expressed in Escherichia coli and indigenous Saccharomyces cerevisiae eRF3. The results showed that the binding affinity of eRF1(Y410S) to eRF3 was decreased up to 20% of the wild type binding affinity. Computer modeling analysis using Swiss-Prot and Amber version 9.0 programs revealed that the overall structure of eRF1(Y410S) has no significant different with the wild type. However, substitution of tyrosine to serine triggered the structural change on the other motif of C-terminal domain of eRF1. The data suggested that increasing stop codon suppression and decreasing of the binding affinity of eRF1(Y410S) were probably due to the slight modification on the structure of the C-terminal domain. PMID:18463713

Statistical Analysis of Readthrough Levels for Nonsense Mutations in Mammalian Cells Reveals a Major Determinant of Response to Gentamicin

PubMed Central

Floquet, Célia; Hatin, Isabelle; Rousset, Jean-Pierre; Bidou, Laure

2012-01-01

The efficiency of translation termination depends on the nature of the stop codon and the surrounding nucleotides. Some molecules, such as aminoglycoside antibiotics (gentamicin), decrease termination efficiency and are currently being evaluated for diseases caused by premature termination codons. However, the readthrough response to treatment is highly variable and little is known about the rules governing readthrough level and response to aminoglycosides. In this study, we carried out in-depth statistical analysis on a very large set of nonsense mutations to decipher the elements of nucleotide context responsible for modulating readthrough levels and gentamicin response. We quantified readthrough for 66 sequences containing a stop codon, in the presence and absence of gentamicin, in cultured mammalian cells. We demonstrated that the efficiency of readthrough after treatment is determined by the complex interplay between the stop codon and a larger sequence context. There was a strong positive correlation between basal and induced readthrough levels, and a weak negative correlation between basal readthrough level and gentamicin response (i.e. the factor of increase from basal to induced readthrough levels). The identity of the stop codon did not affect the response to gentamicin treatment. In agreement with a previous report, we confirm that the presence of a cytosine in +4 position promotes higher basal and gentamicin-induced readthrough than other nucleotides. We highlight for the first time that the presence of a uracil residue immediately upstream from the stop codon is a major determinant of the response to gentamicin. Moreover, this effect was mediated by the nucleotide itself, rather than by the amino-acid or tRNA corresponding to the −1 codon. Finally, we point out that a uracil at this position associated with a cytosine at +4 results in an optimal gentamicin-induced readthrough, which is the therapeutically relevant variable. PMID:22479203

Molecular characterization and phenotypical study of β-thalassemia in Tucumán, Argentina.

PubMed

Lazarte, Sandra S; Mónaco, María E; Haro, Ana C; Jiménez, Cecilia L; Ledesma Achem, Myriam E; Issé, Blanca A

2014-01-01

The main hereditary hemoglobin (Hb) disorder in Argentina is β-thalassemia (β-thal). Molecular studies performed in the center of the country exhibited a marked prevalence of the codon 39 (C > T) and IVS-I-110 (G > A) mutations. The northwest region of Argentina has a different demographic history characterized by an important Spanish influx. Seventy-one β-thal carriers attending the Instituto de Bioquímica Aplicada, Tucumán, Argentina, were investigated for β-globin gene mutations by real-time polymerase chain reaction (RT-PCR). To examine the genotype-phenotype relationship, mean corpuscular volume (MCV), mean corpuscular Hb (MCH) and Hb A2 were measured. In order to recognize β-thal, Mentzer Index, Shine & Lal and Red Cell Distribution Width Index (RDWI), were calculated. The ethnic background of subjects revealed that 82.0% of the population was of Italian, Spanish and Arab origin. Seven mutations were detected: codon 39 (45.0%), IVS-I-1 (G > A) (22.5%), IVS-I-110 (16.3%), IVS-II-1 (G > A) (4.1%), IVS-I-1 (G > T) (2.0%), IVS-I-6 (T > C) (2.0%) and IVS-II-745 (G > C) (2.0%). In three families (6.1%), β-thal mutations were not determined. These results differed from other Argentinian studies because at present codon 39 and IVS-I-1 are the most prevalent; MCV, MCH and Hb A2 did not correlate with the type of mutation (β(0)/β(+)). Values of MCV (67.0 fL) and Hb A2 (4.85%) were unable to discriminate between them. Significant differences (p < 0.05) in MCV, MCH and Shine & Lal were observed between the undetermined group and the three most common mutations. These data show different patterns of β-thal mutations in the center and northwest regions of Argentina. Differences might represent the influence of Spanish immigration.

Molecular evaluation of pvdhfr and pvmdr-1 mutants in Plasmodium vivax isolates after treatment with sulfadoxine/pyrimethamine and chloroquine in Iran during 2001-2016.

PubMed

Parsaei, Mahdi; Raeisi, Ahmad; Spotin, Adel; Shahbazi, Abbas; Mahami-Oskouei, Mahmoud; Hazratian, Teimour; Khorashad, Alireza Salimi; Zaman, Jalal; Bazmani, Ahad; Sarafraz, Sedighe

2018-06-19

The rising use of sulfadoxine/pyrimethamine (SP) in the treatment of chloroquine (CQ)-resistant Plasmodium falciparum has resulted in increased exposure to P. vivax isolates in Iran, where both species are being circulated. In this investigation, the frequency of pvdhfr and pvmdr-1 mutants was assessed in P. vivax strains during 2001-2016 after the introduction of SP/CQ in malarious areas of Iran. The P. vivax isolates (n, 52) were obtained from autochthonous samples in Southeast Iran during 2015-2016. The genomic DNA was extracted and examined using nested polymerase chain reaction-(PCR) and sequencing. Mutations were detected in pvdhfr codons P33L (21.2%), T61 M (25%), S93H (3.9%), and S117 T (1.9%) and 5 isolates showed double mutations (33 L/61 M, 7.7%; 33 L/117 T, 1.9%). No mutation was identified in pvdhfr codons F57 and S58. The pvmdr-1 1076 L mutation was detected in 93.3% of P. vivax isolates. The findings indicated that the frequency of three codons of pvdhfr F57/S58/S117 has decreased from 2001 (1.05%/7.0%/16.9%) to 2016 (0%/0%/1.9%). Genomic analysis of pvmdr-1 showed that the frequency of 1076 L has gradually increased from 2013 (93%) to 2016 (93.3%) (P > .05). The results demonstrated that P. vivax isolates are probably being exited under SP pressure, which reflects the appropriate level of training for field microscopists, as established by Iranian policymakers. Emergent pvdhfr codons 33L, 61M, and 93H should be noticed in plausible drug tolerance and treatment plans. The high prevalence of pvmdr-1 1076L mutation shows that efficacy of CQ combination with primaquine may be in danger of being compromised, however further investigations are needed to evaluate the clinical importance of CQ-resistant P. vivax isolates. Copyright © 2018 Elsevier B.V. All rights reserved.

Identification of new molecular alterations in Fatal Familial Insomnia

USDA-ARS?s Scientific Manuscript database

Fatal Familial Insomnia (FFI) is a rare disease caused by a D178N mutation in combination with methionine (Met) at codon 129 in the mutated allele of PRNP (D178N-129M haplotype). FFI is manifested by sleep disturbances with insomnia, autonomic disorders, hallucinations, delirium, and spontaneous and...

Codon usage bias and tRNA over-expression in Buchnera aphidicola after aromatic amino acid nutritional stress on its host Acyrthosiphon pisum

PubMed Central

Charles, Hubert; Calevro, Federica; Vinuelas, José; Fayard, Jean-Michel; Rahbe, Yvan

2006-01-01

Codon usage bias and relative abundances of tRNA isoacceptors were analysed in the obligate intracellular symbiotic bacterium, Buchnera aphidicola from the aphid Acyrthosiphon pisum, using a dedicated 35mer oligonucleotide microarray. Buchnera is archetypal of organisms living with minimal metabolic requirements and presents a reduced genome with high-evolutionary rate. Codonusage in Buchnera has been overcome by the high mutational bias towards AT bases. However, several lines of evidence for codon usage selection are given here. A significant correlation was found between tRNA relative abundances and codon composition of Buchnera genes. A significant codon usage bias was found for the choice of rare codons in Buchnera: C-ending codons are preferred in highly expressed genes, whereas G-ending codons are avoided. This bias is not explained by GC skew in the bacteria and might correspond to a selection for perfect matching between codon–anticodon pairs for some essential amino acids in Buchnera proteins. Nutritional stress applied to the aphid host induced a significant overexpression of most of the tRNA isoacceptors in bacteria. Although, molecular regulation of the tRNA operons in Buchnera was not investigated, a correlation between relative expression levels and organization in transcription unit was found in the genome of Buchnera. PMID:16963497

Relative codon adaptation: a generic codon bias index for prediction of gene expression.

PubMed

Fox, Jesse M; Erill, Ivan

2010-06-01

The development of codon bias indices (CBIs) remains an active field of research due to their myriad applications in computational biology. Recently, the relative codon usage bias (RCBS) was introduced as a novel CBI able to estimate codon bias without using a reference set. The results of this new index when applied to Escherichia coli and Saccharomyces cerevisiae led the authors of the original publications to conclude that natural selection favours higher expression and enhanced codon usage optimization in short genes. Here, we show that this conclusion was flawed and based on the systematic oversight of an intrinsic bias for short sequences in the RCBS index and of biases in the small data sets used for validation in E. coli. Furthermore, we reveal that how the RCBS can be corrected to produce useful results and how its underlying principle, which we here term relative codon adaptation (RCA), can be made into a powerful reference-set-based index that directly takes into account the genomic base composition. Finally, we show that RCA outperforms the codon adaptation index (CAI) as a predictor of gene expression when operating on the CAI reference set and that this improvement is significantly larger when analysing genomes with high mutational bias.

Antibiotic Resistance and Single-Nucleotide Polymorphism Cluster Grouping Type in a Multinational Sample of Resistant Mycobacterium tuberculosis Isolates▿

PubMed Central

Brimacombe, M.; Hazbon, M.; Motiwala, A. S.; Alland, D.

2007-01-01

A single-nucleotide polymorphism-based cluster grouping (SCG) classification system for Mycobacterium tuberculosis was used to examine antibiotic resistance type and resistance mutations in relationship to specific evolutionary lineages. Drug resistance and resistance mutations were seen across all SCGs. SCG-2 had higher proportions of katG codon 315 mutations and resistance to four drugs. PMID:17846140

A founder mutation in PET100 causes isolated complex IV deficiency in Lebanese individuals with Leigh syndrome.

PubMed

Lim, Sze Chern; Smith, Katherine R; Stroud, David A; Compton, Alison G; Tucker, Elena J; Dasvarma, Ayan; Gandolfo, Luke C; Marum, Justine E; McKenzie, Matthew; Peters, Heidi L; Mowat, David; Procopis, Peter G; Wilcken, Bridget; Christodoulou, John; Brown, Garry K; Ryan, Michael T; Bahlo, Melanie; Thorburn, David R

2014-02-06

Leigh syndrome (LS) is a severe neurodegenerative disorder with characteristic bilateral lesions, typically in the brainstem and basal ganglia. It usually presents in infancy and is genetically heterogeneous, but most individuals with mitochondrial complex IV (or cytochrome c oxidase) deficiency have mutations in the biogenesis factor SURF1. We studied eight complex IV-deficient LS individuals from six families of Lebanese origin. They differed from individuals with SURF1 mutations in having seizures as a prominent feature. Complementation analysis suggested they had mutation(s) in the same gene but targeted massively parallel sequencing (MPS) of 1,034 genes encoding known mitochondrial proteins failed to identify a likely candidate. Linkage and haplotype analyses mapped the location of the gene to chromosome 19 and targeted MPS of the linkage region identified a homozygous c.3G>C (p.Met1?) mutation in C19orf79. Abolishing the initiation codon could potentially still allow initiation at a downstream methionine residue but we showed that this would not result in a functional protein. We confirmed that mutation of this gene was causative by lentiviral-mediated phenotypic correction. C19orf79 was recently renamed PET100 and predicted to encode a complex IV biogenesis factor. We showed that it is located in the mitochondrial inner membrane and forms a ∼300 kDa subcomplex with complex IV subunits. Previous proteomic analyses of mitochondria had overlooked PET100 because its small size was below the cutoff for annotating bona fide proteins. The mutation was estimated to have arisen at least 520 years ago, explaining how the families could have different religions and different geographic origins within Lebanon. Copyright © 2014 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Evolution of Nucleotide Punctuation Marks: From Structural to Linear Signals.

PubMed

El Houmami, Nawal; Seligmann, Hervé

2017-01-01

We present an evolutionary hypothesis assuming that signals marking nucleotide synthesis (DNA replication and RNA transcription) evolved from multi- to unidimensional structures, and were carried over from transcription to translation. This evolutionary scenario presumes that signals combining secondary and primary nucleotide structures are evolutionary transitions. Mitochondrial replication initiation fits this scenario. Some observations reported in the literature corroborate that several signals for nucleotide synthesis function in translation, and vice versa. (a) Polymerase-induced frameshift mutations occur preferentially at translational termination signals (nucleotide deletion is interpreted as termination of nucleotide polymerization, paralleling the role of stop codons in translation). (b) Stem-loop hairpin presence/absence modulates codon-amino acid assignments, showing that translational signals sometimes combine primary and secondary nucleotide structures (here codon and stem-loop). (c) Homopolymer nucleotide triplets (AAA, CCC, GGG, TTT) cause transcriptional and ribosomal frameshifts. Here we find in recently described human mitochondrial RNAs that systematically lack mono-, dinucleotides after each trinucleotide (delRNAs) that delRNA triplets include 2x more homopolymers than mitogenome regions not covered by delRNA. Further analyses of delRNAs show that the natural circular code X (a little-known group of 20 translational signals enabling ribosomal frame retrieval consisting of 20 codons {AAC, AAT, ACC, ATC, ATT, CAG, CTC, CTG, GAA, GAC, GAG, GAT, GCC, GGC, GGT, GTA, GTC, GTT, TAC, TTC} universally overrepresented in coding versus other frames of gene sequences), regulates frameshift in transcription and translation. This dual transcription and translation role confirms for X the hypothesis that translational signals were carried over from transcriptional signals.

A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes

PubMed Central

Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

2016-01-01

The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including “codon capture,” “genome streamlining,” and “ambiguous intermediate” theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNAAla containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. PMID:27197221

Diagnostic utility of IDH1/2 mutations to distinguish dedifferentiated chondrosarcoma from undifferentiated pleomorphic sarcoma of bone.

PubMed

Chen, Shaoxiong; Fritchie, Karen; Wei, Shi; Ali, Naser; Curless, Kendra; Shen, Tiansheng; Brini, Anna T; Latif, Farida; Sumathi, Vaiyapuri; Siegal, Gene P; Cheng, Liang

2017-07-01

Histologically, it is nearly impossible to distinguish the dedifferentiated component of dedifferentiated chondrosarcoma from undifferentiated pleomorphic sarcoma (UPS) of bone when the low-grade cartilaginous component is absent. Previous studies have revealed that isocitrate dehydrogenase 1 (IDH1) and IDH2 mutations are present in a significant number of cartilaginous tumors including most conventional chondrosarcomas and dedifferentiated chondrosarcomas. These mutations have not been studied in UPSs of bone. We sought to investigate whether an IDH1 or IDH2 mutation signature could be used as a clinically diagnostic marker for the distinction of dedifferentiated component of chondrosarcoma from UPS of bone. Sixty-eight bone tumor cases, including 31 conventional chondrosarcomas, 23 dedifferentiated chondrosarcomas, and 14 UPSs of bone, were collected for IDH1/2 mutation analysis either using the Qiagen IDH1/2 RGQ PCR Kit or using whole-exome sequencing. IDH1/2 mutations were detected in 87% (20/23) of dedifferentiated chondrosarcomas and 30% (6/20) of conventional chondrosarcomas. No mutations were detected in the IDH1/2 codon 132 or codon 172 among 14 UPSs of bone. Identification of IDH1 or IDH2 mutations supports the diagnosis of dedifferentiated chondrosarcoma rather than UPS of bone while also providing some insight into the pathogenesis of these 2 lesions. Copyright © 2017 Elsevier Inc. All rights reserved.

Identification of a novel mutation in a Chinese family with Nance-Horan syndrome by whole exome sequencing.

PubMed

Hong, Nan; Chen, Yan-hua; Xie, Chen; Xu, Bai-sheng; Huang, Hui; Li, Xin; Yang, Yue-qing; Huang, Ying-ping; Deng, Jian-lian; Qi, Ming; Gu, Yang-shun

2014-08-01

Nance-Horan syndrome (NHS) is a rare X-linked disorder characterized by congenital nuclear cataracts, dental anomalies, and craniofacial dysmorphisms. Mental retardation was present in about 30% of the reported cases. The purpose of this study was to investigate the genetic and clinical features of NHS in a Chinese family. Whole exome sequencing analysis was performed on DNA from an affected male to scan for candidate mutations on the X-chromosome. Sanger sequencing was used to verify these candidate mutations in the whole family. Clinical and ophthalmological examinations were performed on all members of the family. A combination of exome sequencing and Sanger sequencing revealed a nonsense mutation c.322G>T (E108X) in exon 1 of NHS gene, co-segregating with the disease in the family. The nonsense mutation led to the conversion of glutamic acid to a stop codon (E108X), resulting in truncation of the NHS protein. Multiple sequence alignments showed that codon 108, where the mutation (c.322G>T) occurred, was located within a phylogenetically conserved region. The clinical features in all affected males and female carriers are described in detail. We report a nonsense mutation c.322G>T (E108X) in a Chinese family with NHS. Our findings broaden the spectrum of NHS mutations and provide molecular insight into future NHS clinical genetic diagnosis.

Primary hyperoxaluria type 1: a cluster of new mutations in exon 7 of the AGXT gene.

PubMed

von Schnakenburg, C; Rumsby, G

1997-06-01

Primary hyperoxaluria type 1 (PH1) is a severe autosomal recessive inborn error of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase. This enzyme is encoded by the AGXT gene on chromosome 2q37.3. DNA samples from 79 PH1 patients were studied using single strand conformation polymorphism analysis to detect sequence variants, which were then characterised by direct sequencing and confirmed by restriction enzyme digestion. Four novel mutations were identified in exon 7 of AGXT: a point mutation T853C, which leads to a predicted Ile244Thr amino acid substitution, occurred in nine patients. Two other mutations in adjacent nucleotides, C819T and G820A, mutated the same codon at residue 233 from arginine to cysteine and histidine, respectively. The fourth mutation, G860A, introduced a stop codon at amino acid residue 246. Enzyme studies in these patients showed that AGT catalytic activity was either very low or absent and that little or no immunoreactive protein was present. Together with a new polymorphism in exon 11 (C1342A) these findings underline the genetic heterogeneity of the AGXT gene. The novel mutation T853C is the second most common mutation found to date with an allelic frequency of 9% and will therefore be of clinical importance for the diagnosis of PH1.

Primary hyperoxaluria type 1: a cluster of new mutations in exon 7 of the AGXT gene.

PubMed Central

von Schnakenburg, C; Rumsby, G

1997-01-01

Primary hyperoxaluria type 1 (PH1) is a severe autosomal recessive inborn error of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase. This enzyme is encoded by the AGXT gene on chromosome 2q37.3. DNA samples from 79 PH1 patients were studied using single strand conformation polymorphism analysis to detect sequence variants, which were then characterised by direct sequencing and confirmed by restriction enzyme digestion. Four novel mutations were identified in exon 7 of AGXT: a point mutation T853C, which leads to a predicted Ile244Thr amino acid substitution, occurred in nine patients. Two other mutations in adjacent nucleotides, C819T and G820A, mutated the same codon at residue 233 from arginine to cysteine and histidine, respectively. The fourth mutation, G860A, introduced a stop codon at amino acid residue 246. Enzyme studies in these patients showed that AGT catalytic activity was either very low or absent and that little or no immunoreactive protein was present. Together with a new polymorphism in exon 11 (C1342A) these findings underline the genetic heterogeneity of the AGXT gene. The novel mutation T853C is the second most common mutation found to date with an allelic frequency of 9% and will therefore be of clinical importance for the diagnosis of PH1. Images PMID:9192270

Congenital nephrogenic diabetes insipidus with a novel mutation in the aquaporin 2 gene.

PubMed

Park, Youn Jong; Baik, Haing Woon; Cheong, Hae Il; Kang, Ju Hyung

2014-07-01

Congenital nephrogenic diabetes insipidus (CNDI) is a rare disorder caused by mutations of the arginine vasopressin (AVP) V2 receptor or aquaporin 2 ( AQP2 ) genes. The current study presented the case of CNDI in a 1-month-old male with a novel mutation in the AQP2 gene. The patient was referred due to the occurrence of hypernatremia and mild-intermittent fever since birth. An AVP stimulation test was compatible with CNDI as there was no significant response to desmopressin. Molecular genetic analysis demonstrated two mutations in exon 1 of the AQP2 gene: C to T transition, which resulted in a missense mutation of 108 Thr (ACG) to Met (ATG); and a 127, 128 delCA, which resulted in a deletion mutation of glutamine in position 43 at codon CAG as the first affected amino acid, with the new reading frame endign in a termination codon at position 62. The molecular genetic analysis of the parents showed that the missense mutation was inherited maternally and the deletion mutation was inherited paternally. The parents showed no signs or symptoms of CNDI, indicating autosomal recessive inheritance. The 108 Thr (ACG) to Met (ATG) mutation was confirmed as a novel mutation. Therefore, the molecular identification of the AQP2 gene has clinical significance, as early recognition of CNDI in infants that show only non-specific symptoms, can be facilitated. Thus, repeated episodes of dehydration, which may cause physical and mental retardation can be avoided.

Congenital nephrogenic diabetes insipidus with a novel mutation in the aquaporin 2 gene

PubMed Central

PARK, YOUN JONG; BAIK, HAING WOON; CHEONG, HAE IL; KANG, JU HYUNG

2014-01-01

Congenital nephrogenic diabetes insipidus (CNDI) is a rare disorder caused by mutations of the arginine vasopressin (AVP) V2 receptor or aquaporin 2 (AQP2) genes. The current study presented the case of CNDI in a 1-month-old male with a novel mutation in the AQP2 gene. The patient was referred due to the occurrence of hypernatremia and mild-intermittent fever since birth. An AVP stimulation test was compatible with CNDI as there was no significant response to desmopressin. Molecular genetic analysis demonstrated two mutations in exon 1 of the AQP2 gene: C to T transition, which resulted in a missense mutation of 108Thr (ACG) to Met (ATG); and a 127, 128 delCA, which resulted in a deletion mutation of glutamine in position 43 at codon CAG as the first affected amino acid, with the new reading frame endign in a termination codon at position 62. The molecular genetic analysis of the parents showed that the missense mutation was inherited maternally and the deletion mutation was inherited paternally. The parents showed no signs or symptoms of CNDI, indicating autosomal recessive inheritance. The 108Thr (ACG) to Met (ATG) mutation was confirmed as a novel mutation. Therefore, the molecular identification of the AQP2 gene has clinical significance, as early recognition of CNDI in infants that show only non-specific symptoms, can be facilitated. Thus, repeated episodes of dehydration, which may cause physical and mental retardation can be avoided. PMID:24944815

Novel PHEX nonsense mutation in a patient with X-linked hypophosphatemic rickets and review of current therapeutic regimens.

PubMed

Kienitz, T; Ventz, M; Kaminsky, E; Quinkler, M

2011-07-01

The most common form of familial hypophosphatemic rickets is X-linked. PHEX has been identified as the gene defective in this phosphate wasting disorder leading to decreased renal phosphate reabsorption, hypophosphatemia and inappropriate concentrations of 1,25-dihydroxyvitamin D in regard to hypophosphatemia. Clinical manifestation are skeletal deformities, short stature, osteomalacia, dental abscesses, bone pain, and loss of hearing. We report 3 cases of hypophosphatemic rickets with genetic mutational analysis of the PHEX gene. In 1 male patient an unknown nonsense mutation was found in exon 7, codon 245 (c.735T>G, Tyr245Term, Y245X). In both female patients known mutations were found: c.682delTC (exon 6, codon 228) and c.1952G>C (exon 19, codon 651, R651P). Age at diagnosis ranged from early childhood to the age of 35 years. Clinical complications were hip replacement in 1 patient, mild nephrocalcinosis in 2 patients and loss of hearing in 1 patient. All 3 patients have been treated with phosphate supplements and receive 1,25-dihydroxyvitamin D. Under this regimen all patients show stable biochemical markers with slight hyperparathyreoidism. In all patients at least one family member is affected by rickets, as well. We report a novel nonsense mutation of PHEX that has not been identified so far. The recent discovery of FGF23 and MEPE has changed our understanding of the kidney-bone metabolism, but also raises concerns about the efficacy of current therapeutic regimens that are reviewed in this context. © J. A. Barth Verlag in Georg Thieme Verlag KG Stuttgart · New York.

Molecular Analysis of Colorectal Tumors within a Diverse Patient Cohort at a Single Institution

PubMed Central

Sylvester, Brooke E.; Huo, Dezheng; Khramtsov, Andrey; Zhang, Jing; Smalling, Rana V.; Olugbile, Sope; Polite, Blase N.; Olopade, Olufunmilayo I.

2012-01-01

Purpose African American colorectal cancer (CRC) patients have worse survival outcomes than Caucasian patients. To determine if differences exist in the molecular mechanisms driving CRC between African Americans and Caucasians, we characterized patient tumors from a single institution by assessing genetic alterations involved in CRC progression and response to treatment. Experimental Design We retrospectively examined 448 African Americans and Caucasians diagnosed with CRC at The University of Chicago Medical Center between 1992 and 2002. Microsatellite instability (MSI) status was determined by genotyping the BAT25, BAT26, BAT40, D5S346, and BAX loci. Mutations in KRAS codons 12 and 13 and BRAF codon 600 were identified by direct sequencing. MSI and detected mutations were correlated with clinicopathological features. Results Overall, no difference existed in MSI or BRAF mutation frequencies between African Americans and Caucasians. However, African Americans with microsatellite stable (MSS)/MSI-low (MSI-L) tumors had a higher proportion of KRAS mutations than Caucasians (34% v. 23%, p=0.048) that was isolated to proximal colon cancers and primarily driven by mutations in codon 13. There was no racial/ethnic difference in receipt of chemotherapy, but African Americans with MSS/MSI-L tumors had a 73% increased risk of death over Caucasians that could not be explained by known prognostic factors. Conclusions The significantly higher risk of death among African Americans with MSS/MSI-L tumors may be related to differences in the distribution of factors influencing response to standard therapies. These data underscore the need for further research into the molecular mechanisms driving CRC progression in underserved and understudied populations. PMID:22114137

SYTO9 and SYBR GREEN1 with a high-resolution melting analysis for prenatal diagnosis of β⁰-thalassemia/hemoglobin-E.

PubMed

Pornprasert, Sakorn; Sukunthamala, Kanyakan

2010-11-01

The β⁰-thalassemia/Hb-E causes a wide range of severe conditions. A high medical cost is incurred in severe cases. Thus, the prevention of new cases of β⁰-thalassemia/Hb-E is required. The aim of this study is to use the SYTO9 and SYBR GREEN1 high-resolution melting (HRM) analysis for prenatal diagnosis of β⁰-thalassemia/Hb-E. DNA samples were extracted from amniotic fluid or cord blood of 11 pregnancies whose fetuses were at risk for β-thalassemia/Hb-E. PCR products from multiplex amplification refractory mutation system PCR for the detection of β⁰-thalassemia mutations at codons 17(A>T), 41/42(-TCTT), and 71/72(+A) and from amplification refractory mutation system PCR for the detection of Hb-E were characterized by SYTO9 HRM analysis. Moreover, β⁰-thalassemia 3.5- kb deletion was detected using real-time PCR with SYBR GREEN1 HRM analysis. Seven of 11 fetuses (64%) were diagnosed as β⁰-thalassemia/Hb-E (4 fetuses with mutation at codon 17, 2 with mutation at codon 41/42, and 1 with 3.5- kb deletion). Results from HRM analysis were completely consistent with those from fetal blood samplings analyzed at the time of delivery or pregnancy termination using HPLC. Therefore, the HRM analysis is easy to use. It is simple, flexible, non-destructive and has superb sensitivity and specificity. This approach might facilitate the laboratory diagnosis and genetic counseling for regions with a high prevalence of β⁰-thalassemia/Hb-E. © 2010 John Wiley & Sons A/S.

Codon usage analysis of photolyase encoding genes of cyanobacteria inhabiting diverse habitats.

PubMed

Rajneesh; Pathak, Jainendra; Kannaujiya, Vinod K; Singh, Shailendra P; Sinha, Rajeshwar P

2017-07-01

Nucleotide and amino acid compositions were studied to determine the genomic and structural relationship of photolyase gene in freshwater, marine and hot spring cyanobacteria. Among three habitats, photolyase encoding genes from hot spring cyanobacteria were found to have highest GC content. The genomic GC content was found to influence the codon usage and amino acid variability in photolyases. The third position of codon was found to have more effect on amino acid variability in photolyases than the first and second positions of codon. The variation of amino acids Ala, Asp, Glu, Gly, His, Leu, Pro, Gln, Arg and Val in photolyases of three different habitats was found to be controlled by first position of codon (G1C1). However, second position (G2C2) of codon regulates variation of Ala, Cys, Gly, Pro, Arg, Ser, Thr and Tyr contents in photolyases. Third position (G3C3) of codon controls incorporation of amino acids such as Ala, Phe, Gly, Leu, Gln, Pro, Arg, Ser, Thr and Tyr in photolyases from three habitats. Photolyase encoding genes of hot spring cyanobacteria have 85% codons with G or C at third position, whereas marine and freshwater cyanobacteria showed 82 and 60% codons, respectively, with G or C at third position. Principal component analysis (PCA) showed that GC content has a profound effect in separating the genes along the first major axis according to their RSCU (relative synonymous codon usage) values, and neutrality analysis indicated that mutational pressure has resulted in codon bias in photolyase genes of cyanobacteria.

Diverse growth hormone receptor gene mutations in Laron syndrome.

PubMed Central

Berg, M A; Argente, J; Chernausek, S; Gracia, R; Guevara-Aguirre, J; Hopp, M; Pérez-Jurado, L; Rosenbloom, A; Toledo, S P; Francke, U

1993-01-01

To better understand the molecular genetic basis and genetic epidemiology of Laron syndrome (growth-hormone insensitivity syndrome), we analyzed the growth-hormone receptor (GHR) genes of seven unrelated affected individuals from the United States, South America, Europe, and Africa. We amplified all nine GHR gene exons and splice junctions from these individuals by PCR and screened the products for mutations by using denaturing gradient gel electrophoresis (DGGE). We identified a single GHR gene fragment with abnormal DGGE results for each affected individual, sequenced this fragment, and, in each case, identified a mutation likely to cause Laron syndrome, including two nonsense mutations (R43X and R217X), two splice-junction mutations, (189-1 G to T and 71 + 1 G to A), and two frameshift mutations (46 del TT and 230 del TA or AT). Only one of these mutations, R43X, has been previously reported. Using haplotype analysis, we determined that this mutation, which involves a CpG dinucleotide hot spot, likely arose as a separate event in this case, relative to the two prior reports of R43X. Aside from R43X, the mutations we identified are unique to patients from particular geographic regions. Ten GHR gene mutations have now been described in this disorder. We conclude that Laron syndrome is caused by diverse GHR gene mutations, including deletions, RNA processing defects, translational stop codons, and missense codons. All the identified mutations involve the extracellular domain of the receptor, and most are unique to particular families or geographic areas. Images Figure 1 Figure 2 PMID:8488849

Performance of PCR-reverse blot hybridization assay for detection of rifampicin-resistant Mycobacterium leprae.

PubMed

Wang, Hye-young; Kim, Hyunjung; Kim, Yeun; Bang, Hyeeun; Kim, Jong-Pill; Hwang, Joo Hwan; Cho, Sang-Nae; Kim, Tae Ue; Lee, Hyeyoung

2015-10-01

Drug resistance in Mycobacterium leprae is a significant problem in countries where leprosy is endemic. A sensitive, specific, and high-throughput reverse blot hybridization assay (REBA) for the detection of genotypic resistance to rifampicin (RIF) was designed and evaluated. It has been shown that resistance to RIF in M. leprae involves mutations in the rpoB gene encoding the -subunit of the RNA polymerase. The PCR-REBA simultaneously detects both 6 wild-type regions and 5 different mutations (507 AGC, 513 GTG, 516 TAT, 531 ATG, and 531 TTC) including the most prevalent mutations at positions 507 and 531. Thirty-one clinical isolates provided by Korea Institute of Hansen-s Disease were analyzed by PCR-REBA with RIF resistance of rpoB gene. As a result, missense mutations at codons 507 AGC and 531 ATG with 2-nucleotide substitutions were found in one sample, and a missense mutation at codon 516 TAT and ΔWT6 (deletion of 530-534) was found in another sample. These cases were confirmed by DNA sequence analysis. This rapid, simple, and highly sensitive assay provides a practical alternative to sequencing for genotypic evaluation of RIF resistance in M. leprae.

OprD mutations and inactivation in imipenem-resistant Pseudomonas aeruginosa isolates from China.

PubMed

Fang, Zhi-Li; Zhang, Li-Yan; Huang, Ying-Min; Qing, Yun; Cao, Kai-Yuan; Tian, Guo-Bao; Huang, Xi

2014-01-01

To investigate the mechanisms involved in imipenem resistance of Pseudomonas aeruginosa in southern China, 61 imipenem-resistant P. aeruginosa clinical isolates were collected from 4 hospitals between October 2011 and June 2012. All isolates were resistant to imipenem, whereas 21.3% were susceptible or intermediate to meropenem. Variable degrees of resistance to other β-lactam and non-β-lactam antimicrobials were observed. PFGE revealed high-level of clonal diversity. Among the 61 isolates, 50 isolates had OprD loss by disrupted oprD mutations, including 43 with frameshift mutations of oprD and 7 with a premature stop codon by single point mutation. Six isolates were oprD-negative by PCR, suggestive of a major disruption of oprD genes. Five isolates had intact oprD but had reduced expression of oprD genes. In addition, only one isolate with disrupted oprD mutation by a premature stop codon was confirmed to be a metallo-β-lactamase producer (IMP-9). Our results show that the loss of OprD, as well as reduced expression of oprD and MBL production, were the predominant mechanisms of imipenem resistance in P. aeruginosa in southern China. Copyright © 2013 Elsevier B.V. All rights reserved.

Clinical and mutation-type analysis from an international series of 198 probands with a pathogenic FBN1 exons 24–32 mutation

PubMed Central

Faivre, L; Collod-Beroud, G; Callewaert, B; Child, A; Binquet, C; Gautier, E; Loeys, B L; Arbustini, E; Mayer, K; Arslan-Kirchner, M; Stheneur, C; Kiotsekoglou, A; Comeglio, P; Marziliano, N; Wolf, J E; Bouchot, O; Khau-Van-Kien, P; Beroud, C; Claustres, M; Bonithon-Kopp, C; Robinson, P N; Adès, L; De Backer, J; Coucke, P; Francke, U; De Paepe, A; Jondeau, G; Boileau, C

2009-01-01

Mutations in the FBN1 gene cause Marfan syndrome (MFS) and a wide range of overlapping phenotypes. The severe end of the spectrum is represented by neonatal MFS, the vast majority of probands carrying a mutation within exons 24–32. We previously showed that a mutation in exons 24–32 is predictive of a severe cardiovascular phenotype even in non-neonatal cases, and that mutations leading to premature truncation codons are under-represented in this region. To describe patients carrying a mutation in this so-called ‘neonatal' region, we studied the clinical and molecular characteristics of 198 probands with a mutation in exons 24–32 from a series of 1013 probands with a FBN1 mutation (20%). When comparing patients with mutations leading to a premature termination codon (PTC) within exons 24–32 to patients with an in-frame mutation within the same region, a significantly higher probability of developing ectopia lentis and mitral insufficiency were found in the second group. Patients with a PTC within exons 24–32 rarely displayed a neonatal or severe MFS presentation. We also found a higher probability of neonatal presentations associated with exon 25 mutations, as well as a higher probability of cardiovascular manifestations. A high phenotypic heterogeneity could be described for recurrent mutations, ranging from neonatal to classical MFS phenotype. In conclusion, even if the exons 24–32 location appears as a major cause of the severity of the phenotype in patients with a mutation in this region, other factors such as the type of mutation or modifier genes might also be relevant. PMID:19002209

New Universal Rules of Eukaryotic Translation Initiation Fidelity

PubMed Central

Zur, Hadas; Tuller, Tamir

2013-01-01

The accepted model of eukaryotic translation initiation begins with the scanning of the transcript by the pre-initiation complex from the 5′end until an ATG codon with a specific nucleotide (nt) context surrounding it is recognized (Kozak rule). According to this model, ATG codons upstream to the beginning of the ORF should affect translation. We perform for the first time, a genome-wide statistical analysis, uncovering a new, more comprehensive and quantitative, set of initiation rules for improving the cost of translation and its efficiency. Analyzing dozens of eukaryotic genomes, we find that in all frames there is a universal trend of selection for low numbers of ATG codons; specifically, 16–27 codons upstream, but also 5–11 codons downstream of the START ATG, include less ATG codons than expected. We further suggest that there is selection for anti optimal ATG contexts in the vicinity of the START ATG. Thus, the efficiency and fidelity of translation initiation is encoded in the 5′UTR as required by the scanning model, but also at the beginning of the ORF. The observed nt patterns suggest that in all the analyzed organisms the pre-initiation complex often misses the START ATG of the ORF, and may start translation from an alternative initiation start-site. Thus, to prevent the translation of undesired proteins, there is selection for nucleotide sequences with low affinity to the pre-initiation complex near the beginning of the ORF. With the new suggested rules we were able to obtain a twice higher correlation with ribosomal density and protein levels in comparison to the Kozak rule alone (e.g. for protein levels r = 0.7 vs. r = 0.31; p<10−12). PMID:23874179

A novel APOC2 gene mutation identified in a Chinese patient with severe hypertriglyceridemia and recurrent pancreatitis.

PubMed

Jiang, Jingjing; Wang, Yuhui; Ling, Yan; Kayoumu, Abudurexiti; Liu, George; Gao, Xin

2016-01-16

The severe forms of hypertriglyceridemia are usually caused by genetic defects. In this study, we described a Chinese female with severe hypertriglyceridemia caused by a novel homozygous mutation in the APOC2 gene. Lipid profiles of the pedigree were studied in detail. LPL and HL activity were also measured. The coding regions of 5 candidate genes (namely LPL, APOC2, APOA5, LMF1, and GPIHBP1) were sequenced using genomic DNA from peripheral leucocytes. The ApoE gene was also genotyped. Serum triglyceride level was extremely high in the proband, compared with other family members. Plasma LPL activity was also significantly reduced in the proband. Serum ApoCII was very low in the proband as well as in the heterozygous mutation carriers. A novel mutation (c.86A > CC) was identified on exon 3 [corrected] of the APOC2 gene, which converted the Asp [corrected] codon at position 29 into Ala, followed by a termination codon (TGA). This study presented the first case of ApoCII deficiency in the Chinese population, with a novel mutation c.86A > CC in the APOC2 gene identified. Serum ApoCII protein might be a useful screening test for identifying mutation carriers.

Identification of new molecular alterations in Fatal Familial Insomnia.

USDA-ARS?s Scientific Manuscript database

Fatal familial insomnia (FFI) is an autosomal dominant prion disease caused by a D178N mutation in PRNP in combination with methionine (Met) at codon 129 in the mutated allele of the same gene (D178N-129M haplotype). The present study analyzes pathological and molecular features in seven FFI cases c...

Identification of a novel mutation in a patient with pseudohypoparathyroidism type Ia

PubMed Central

Lee, Ye Seung; Kim, Hui Kwon; Kim, Hye Rim; Lee, Jong Yoon; Choi, Joong Wan; Bae, Eun Ju; Oh, Phil Soo; Park, Won Il; Ki, Chang Seok

2014-01-01

Pseudohypoparathyroidism type Ia (PHP Ia) is a disorder characterized by multiform hormonal resistance including parathyroid hormone (PTH) resistance and Albright hereditary osteodystrophy (AHO). It is caused by heterozygous inactivating mutations within the Gs alpha-encoding GNAS exons. A 9-year-old boy presented with clinical and laboratory abnormalities including hypocalcemia, hyperphosphatemia, PTH resistance, multihormone resistance and AHO (round face, short stature, obesity, brachydactyly and osteoma cutis) which were typical of PHP Ia. He had a history of repeated convulsive episodes that started from the age of 2 months. A cranial computed tomography scan showed bilateral calcifications in the basal ganglia and his intelligence quotient testing indicated mild mental retardation. Family history revealed that the patient's maternal relatives, including his grandmother and 2 of his mother's siblings, had features suggestive of AHO. Sequencing of the GNAS gene of the patient identified a heterozygous nonsense mutation within exon 11 (c.637 C>T). The C>T transversion results in an amino acid substitution from Gln to stop codon at codon 213 (p.Gln213*). To our knowledge, this is a novel mutation in GNAS. PMID:25045367

Truncated variants of apolipoprotein B cause hypobetalipoproteinaemia.

PubMed Central

Collins, D R; Knott, T J; Pease, R J; Powell, L M; Wallis, S C; Robertson, S; Pullinger, C R; Milne, R W; Marcel, Y L; Humphries, S E

1988-01-01

Familial hypobetalipoproteinaemia is a rare autosomal dominant disorder in which levels of apo-B-containing plasma lipoproteins are approximately half-normal in heterozygotes and virtually absent in homozygotes. Here we describe mutations of the apo-B gene that cause two different truncated variants of apo-B in unrelated individuals with hypobetalipoproteinaemia. One variant, apo-B(His1795----Met-Trp-Leu-Val-Thr-Term) is predicted to be 1799 amino acids long and arises from deletion of a single nucleotide (G) from leucine codon 1794. This protein was found at low levels in very low density and low density lipoprotein fractions in the blood. The second, shorter variant, apo-B(Arg1306----Term), is caused by mutation of a CpG dinucleotide in arginine codon 1306 converting it to a stop codon and predicting a protein of 1305 residues. The product of this allele could not be detected in the circulation. The differences in size and behaviour of these two variants compared to apo-B100 or apo-B48 point to domains that may be important for the assembly, secretion or stability of apo-B-containing lipoproteins. Images PMID:2843815

Identification and Characterization of Benzimidazole Resistance in Monilinia fructicola from Stone Fruit Orchards in California

PubMed Central

Ma, Zhonghua; Yoshimura, Michael A.; Michailides, Themis J.

2003-01-01

Low and high levels of resistance to the benzimidazole fungicides benomyl and thiophanate-methyl were observed in field isolates of Monilinia fructicola, which is the causative agent of brown rot of stone fruit. Isolates that had low levels of resistance (hereafter referred to as LR isolates) and high levels of resistance (hereafter referred to as HR isolates) were also cold and heat sensitive, respectively. Results from microsatellite DNA fingerprints showed that genetic identities among the populations of sensitive (S), LR, and HR isolates were very high (>0.96). Analysis of DNA sequences of the β-tubulin gene showed that the LR isolates had a point mutation at codon 6, causing a replacement of the amino acid histidine by tyrosine. Codon 198, which encodes a glutamic acid in S and LR isolates, was converted to a codon for alanine in HR isolates. Based on these point mutations in the β-tubulin gene, allele-specific PCR assays were developed for rapid detection of benzimidazole-resistant isolates of M. fructicola from stone fruit. PMID:14660360

Evolution of CCL11: genetic characterization in lagomorphs and evidence of positive and purifying selection in mammals.

PubMed

Neves, Fabiana; Abrantes, Joana; Esteves, Pedro J

2016-07-01

The interactions between chemokines and their receptors are crucial for differentiation and activation of inflammatory cells. CC chemokine ligand 11 (CCL11) binds to CCR3 and to CCR5 that in leporids underwent gene conversion with CCR2. Here, we genetically characterized CCL11 in lagomorphs (leporids and pikas). All lagomorphs have a potentially functional CCL11, and the Pygmy rabbit has a mutation in the stop codon that leads to a longer protein. Other mammals also have mutations at the stop codon that result in proteins with different lengths. By employing maximum likelihood methods, we observed that, in mammals, CCL11 exhibits both signatures of purifying and positive selection. Signatures of purifying selection were detected in sites important for receptor binding and activation. Of the three sites detected as under positive selection, two were located close to the stop codon. Our results suggest that CCL11 is functional in all lagomorphs, and that the signatures of purifying and positive selection in mammalian CCL11 probably reflect the protein's biological roles. © The Author(s) 2016.

Epidermolysis bullosa with congenital pyloric atresia: novel mutations in the beta 4 integrin gene (ITGB4) and genotype/phenotype correlations.

PubMed

Nakano, A; Pulkkinen, L; Murrell, D; Rico, J; Lucky, A W; Garzon, M; Stevens, C A; Robertson, S; Pfendner, E; Uitto, J

2001-05-01

Epidermolysis bullosa with pyloric atresia (EB-PA: OMIM 226730), also known as Carmi syndrome, is a rare autosomal recessive genodermatosis that manifests with neonatal mucocutaneous fragility associated with congenital pyloric atresia. The disease is frequently lethal within the first year, but nonlethal cases have been reported. Mutations in the genes encoding subunit polypeptides of the alpha 6 beta 4 integrin (ITGA6 and ITGB4) have been demonstrated in EB-PA patients. To extend the repertoire of mutations and to identify genotype-phenotype correlations, we examined seven new EB-PA families, four with lethal and three with nonlethal disease variants. DNA from patients was screened for mutations using heteroduplex analysis followed by nucleotide sequencing of PCR products spanning all beta 4 integrin-coding sequences. Mutation analysis disclosed 12 distinct mutations, 11 of them novel. Four mutations predicted a premature termination codon as a result of nonsense mutations or small out-of-frame insertions or deletions, whereas seven were missense mutations. This brings the total number of distinct ITGB4 mutations to 33. The mutation database indicates that premature termination codons are associated predominantly with the lethal EB-PA variants, whereas missense mutations are more prevalent in nonlethal forms. However, the consequences of the missense mutations are position dependent, and substitutions of highly conserved amino acids may have lethal consequences. In general, indirect immunofluorescence studies of affected skin revealed negative staining for beta 4 integrin in lethal cases and positive, but attenuated, staining in nonlethal cases and correlated with clinical phenotype. The data on specific mutations in EB-PA patients allows prenatal testing and preimplantation genetic diagnosis in families at risk.

Isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma.

PubMed

Kipp, Benjamin R; Voss, Jesse S; Kerr, Sarah E; Barr Fritcher, Emily G; Graham, Rondell P; Zhang, Lizhi; Highsmith, W Edward; Zhang, Jun; Roberts, Lewis R; Gores, Gregory J; Halling, Kevin C

2012-10-01

Somatic mutations in isocitrate dehydrogenase 1 and 2 genes are common in gliomas and help stratify patients with brain cancer into histologic and molecular subtypes. However, these mutations are considered rare in other solid tumors. The aims of this study were to determine the frequency of isocitrate dehydrogenase 1 and 2 mutations in cholangiocarcinoma and to assess histopathologic differences between specimens with and without an isocitrate dehydrogenase mutation. We sequenced 94 formalin-fixed, paraffin-embedded cholangiocarcinoma (67 intrahepatic and 27 extrahepatic) assessing for isocitrate dehydrogenase 1 (codon 132) and isocitrate dehydrogenase 2 (codons 140 and 172) mutations. Multiple histopathologic characteristics were also evaluated and compared with isocitrate dehydrogenase 1/2 mutation status. Of the 94 evaluated specimens, 21 (22%) had a mutation including 14 isocitrate dehydrogenase 1 and 7 isocitrate dehydrogenase 2 mutations. Isocitrate dehydrogenase mutations were more frequently observed in intrahepatic cholangiocarcinoma than in extrahepatic cholangiocarcinoma (28% versus 7%, respectively; P = .030). The 14 isocitrate dehydrogenase 1 mutations were R132C (n = 9), R132S (n = 2), R132G (n = 2), and R132L (n = 1). The 7 isocitrate dehydrogenase 2 mutations were R172K (n = 5), R172M (n = 1), and R172G (n = 1). Isocitrate dehydrogenase mutations were more frequently observed in tumors with clear cell change (P < .001) and poorly differentiated histology (P = .012). The results of this study show for the first time that isocitrate dehydrogenase 1 and 2 genes are mutated in cholangiocarcinoma. The results of this study are encouraging because it identifies a new potential target for genotype-directed therapeutic trials and may represent a potential biomarker for earlier detection of cholangiocarcinoma in a subset of cases. Copyright © 2012 Elsevier Inc. All rights reserved.

Upstream open reading frames regulate the expression of the nuclear Wnt13 isoforms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang Tao; Rector, Kyle; Barnett, Corey D.

2008-02-22

Wnt proteins control cell survival and cell fate during development. Although Wnt expression is tightly regulated in a spatio-temporal manner, the mechanisms involved both at the transcriptional and translational levels are poorly defined. We have identified a downstream translation initiation codon, AUG(+74), in Wnt13B and Wnt13C mRNAs responsible for the expression of Wnt13 nuclear forms. In this report, we demonstrate that the expression of the nuclear Wnt13C form is translationally regulated in response to stress and apoptosis. Though the 5'-leaders of both Wnt13C and Wnt13B mRNAs have an inhibitory effect on translation, they did not display an internal ribosome entrymore » site activity as demonstrated by dicistronic reporter assays. However, mutations or deletions of the upstream AUG(-99) and AUG(+1) initiation codons abrogate these translation inhibitory effects, demonstrating that Wnt13C expression is controlled by upstream open reading frames. Since long 5'-untranslated region with short upstream open reading frames characterize other Wnt transcripts, our present data on the translational control of Wnt13 expression open the way to further studies on the translation control of Wnt expression as a modulator of their subcellular localization and activity.« less

Comparison between two widely used laboratory methods in BRAF V600 mutation detection in a large cohort of clinical samples of cutaneous melanoma metastases to the lymph nodes.

PubMed

Jurkowska, Monika; Gos, Aleksandra; Ptaszyński, Konrad; Michej, Wanda; Tysarowski, Andrzej; Zub, Renata; Siedlecki, Janusz A; Rutkowski, Piotr

2015-01-01

The study compares detection rates of oncogenic BRAF mutations in a homogenous group of 236 FFPE cutaneous melanoma lymph node metastases, collected in one cancer center. BRAF mutational status was verified by two independent in-house PCR/Sanger sequencing tests, and the Cobas® 4800 BRAF V600 Mutation Test. The best of two sequencing approaches returned results for 230/236 samples. In 140 (60.9%), the mutation in codon 600 of BRAF was found. 91.4% of all mutated cases (128 samples) represented p.V600E. Both Sanger-based tests gave reproducible results although they differed significantly in the percentage of amplifiable samples: 230/236 to 109/143. Cobas generated results in all 236 cases, mutations changing codon V600 were detected in 144 of them (61.0%), including 5 not amplifiable and 5 negative in the standard sequencing. However, 6 cases positive in sequencing turned out to be negative in Cobas. Both tests provided us with the same BRAF V600 mutational status in 219 out of 230 cases with valid results (95.2%). The total BRAF V600 mutation detection rate didn't differ significantly between the two methodological approaches (60.9% vs. 61.0%). Sequencing was a reproducible method of V600 mutation detection and more powerful to detect mutations other than p.V600E, while Cobas test proved to be less susceptible to the poor DNA quality or investigator's bias. The study underlined an important role of pathologists in quality assurance of molecular diagnostics.

Follicular variant of papillary thyroid carcinoma presenting as toxic nodule in an adolescent: coexistent polymorphism of the TSHR and Gsα genes.

PubMed

Ruggeri, Rosaria Maddalena; Campennì, Alfredo; Giovinazzo, Salvatore; Saraceno, Giovanna; Vicchio, Teresa Manuela; Carlotta, Dario; Cucinotta, Maria Paola; Micali, Carmelo; Trimarchi, Francesco; Tuccari, Giovanni; Baldari, Sergio; Benvenga, Salvatore

2013-02-01

Autonomously functioning, "hot", thyroid nodules are not common in children and adolescents. Such nodules are not considered alarming because they are assumed to be benign adenomas. Herein, we present a 15-year-old girl with a papillary thyroid carcinoma of 3.5 cm in diameter, which was functionally autonomous and scintigraphically hot. The patient, initially referred to our Endocrine Unit because of a thyroid nodule, returned 6 months later for symptoms of hyperthyroidism. Hyperthyroidism was confirmed biochemically. Radioactive iodine ((131)I) thyroid scintigraphy was consistent with an autonomous thyroid nodule. As per guidelines, the patient underwent surgery and a pathological examination revealed papillary carcinoma, follicular variant. The excised nodule was examined for activating mutations of the thyrotropin receptor (TSHR), Gsα (GNAS1), H-RAS, N-RAS, K-RAS, and BRAF genes by direct sequencing. No mutations were found. Nevertheless, two combined nonfunctioning mutations were detected: a single-nucleotide polymorphism (SNP) of the TSHR gene, in exon 7, at codon 187 (AAT→AAC, both encoding asparagine), and a SNP within exon 8 of the Gsα gene at codon 185 (ATC→ATT, both encoding isoleucine). Both SNPs were also identified in the germline DNA of the patient. The same SNPs were sought in the parents and brother of our patient. Her father was heterozygous for the TSHR SNP, her mother heterozygous for the Gsα SNP, and her brother was wild type. This case demonstrates that the presence of hyperfunctioning thyroid nodule(s) does not rule out cancer and warrants careful evaluation, especially in childhood and adolescence to overlook malignancy.

Prevalence of mutations in genes associated with isoniazid resistance Mycobacterium tuberculosis isolates from retreated smear positive pulmonary tuberculosis patients: A Meta-analysis.

PubMed

Alagappan, Chitra; Shivekar, Smita Sunil; Brammacharry, Usharani; Kapalamurthy, Vidya Raj Cuppusamy; Sakkaravarthy, Anbazhagi; Subashkumar, Rathinasamy; Muthaiah, Muthuraj

2018-03-28

The prevalence of isoniazid mono resistance is high in India. We investigated the molecular epidemiological characteristics association with the isoniazid resistance mutations in Mycobacterium tuberculosis in codon katG315 and in the promoter region of the inhA gene. Sputum specimens of smear-positive tuberculosis patients were subjected to Genotype MTBDRplus testing to identify katG and inhA mutations. Seventeen publications along with this current study assessed 14,100 genotypically resistant isolates for mutations in katG inclusive of codon position 315. In total, 1821 of 15438 isoniazid-resistant strains (11.8%) had detectable mutations: 71.0% in katG codon 315 (katG315) and 29.0% in the inhA promoter region. Economically active age group had 89.1%, paediatric age group had 0.4% and in the age group >60years had 10.5% isoniazid mono resistant and in males and females were 17.7% and 15.9% respectively. The meta-analysis derived a pooled katGS315T resistant TB prevalence of 64.5% (95% CI; 0.593±0.754%) with Q value 732.19, I2 98.35% and p-0.000 for treated TB cases. Isoniazid resistant was transferred widely and its prevalence and transmission of INH resistant isolates especially with katG315Thr mutation was confirmed. Therefore, it is important to diagnose the katG315Thr mutants among INH-resistant strains as it could be seen as a risk factor for subsequent development of MDR-TB. Prompt detection of the patients with INH resistant strains would expedite the modification of treatment regimens and appropriate infection control measures could be taken in time to diminish the risk of further development and transmission of MDR-TB. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Codon usage bias: causative factors, quantification methods and genome-wide patterns: with emphasis on insect genomes.

PubMed

Behura, Susanta K; Severson, David W

2013-02-01

Codon usage bias refers to the phenomenon where specific codons are used more often than other synonymous codons during translation of genes, the extent of which varies within and among species. Molecular evolutionary investigations suggest that codon bias is manifested as a result of balance between mutational and translational selection of such genes and that this phenomenon is widespread across species and may contribute to genome evolution in a significant manner. With the advent of whole-genome sequencing of numerous species, both prokaryotes and eukaryotes, genome-wide patterns of codon bias are emerging in different organisms. Various factors such as expression level, GC content, recombination rates, RNA stability, codon position, gene length and others (including environmental stress and population size) can influence codon usage bias within and among species. Moreover, there has been a continuous quest towards developing new concepts and tools to measure the extent of codon usage bias of genes. In this review, we outline the fundamental concepts of evolution of the genetic code, discuss various factors that may influence biased usage of synonymous codons and then outline different principles and methods of measurement of codon usage bias. Finally, we discuss selected studies performed using whole-genome sequences of different insect species to show how codon bias patterns vary within and among genomes. We conclude with generalized remarks on specific emerging aspects of codon bias studies and highlight the recent explosion of genome-sequencing efforts on arthropods (such as twelve Drosophila species, species of ants, honeybee, Nasonia and Anopheles mosquitoes as well as the recent launch of a genome-sequencing project involving 5000 insects and other arthropods) that may help us to understand better the evolution of codon bias and its biological significance. © 2012 The Authors. Biological Reviews © 2012 Cambridge Philosophical Society.

Species Based Synonymous Codon Usage in Fusion Protein Gene of Newcastle Disease Virus

PubMed Central

Kumar, Chandra Shekhar; Kumar, Sachin

2014-01-01

Newcastle disease is highly pathogenic to poultry and many other avian species. However, the Newcastle disease virus (NDV) has also been reported from many non-avian species. The NDV fusion protein (F) is a major determinant of its pathogenicity and virulence. The functionalities of F gene have been explored for the development of vaccine and diagnostics against NDV. Although the F protein is well studied but the codon usage and its nucleotide composition from NDV isolated from different species have not yet been explored. In present study, we have analyzed the factors responsible for the determination of codon usage in NDV isolated from four major avian host species. The F gene of NDV is analyzed for its base composition and its correlation with the bias in codon usage. Our result showed that random mutational pressure is responsible for codon usage bias in F protein of NDV isolates. Aromaticity, GC3s, and aliphatic index were not found responsible for species based synonymous codon usage bias in F gene of NDV. Moreover, the low amount of codon usage bias and expression level was further confirmed by a low CAI value. The phylogenetic analysis of isolates was found in corroboration with the relatedness of species based on codon usage bias. The relationship between the host species and the NDV isolates from the host does not represent a significant correlation in our study. The present study provides a basic understanding of the mechanism involved in codon usage among species. PMID:25479071

Role of specific DNA mutations in the peripheral blood of colorectal cancer patients for the assessment of tumor stage and residual disease following tumor resection

PubMed Central

Norcic, Gregor; Jelenc, Franc; Cerkovnik, Petra; Stegel, Vida; Novakovic, Srdjan

2016-01-01

In the present study, the detection of tumor-specific KRAS proto-oncogene, GTPase (KRAS) and B-Raf proto-oncogene, serine/threonine kinase (BRAF) mutations in the peripheral blood of colorectal cancer (CRC) patients at all stages and adenomas was used for the estimation of disease stage prior to surgery and for residual disease following surgery. A total of 65 CRC patients were enrolled. The primary tumor tested positive for the specific mutations (KRAS mutations in codons 12, 13, 61, 117 or 146 and BRAF mutations in codon 600) in 35 patients. In all these patients, the specimen of normal bowel resected with the tumor was also tested for the presence of the same mutations in order to exclude the germ-line mutations. Only patients who tested positive for the specific mutation in the primary tumor were included in further analysis for the presence of tumor-specific mutation in the peripheral blood. No statistically significant differences were found between the detection rates of tumor mutations in the blood and different tumor stages (P=0.491). However, statistically significant differences in the proportions of patients with detected tumor-specific DNA mutations in the peripheral blood were found when comparing the groups of patients with R0 and R2 resections (P=0.038). Tumor-specific DNA mutations in the peripheral blood were more frequently detected in the patients with an incomplete surgical clearance of the tumor due to macroscopic residual disease (R2 resections). Therefore, the study concludes that the follow-up of somatic KRAS- and BRAF-mutated DNA in the peripheral blood of CRC patients may be useful in assessing the surgical clearance of the disease. PMID:27900004

A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes.

PubMed

Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

2016-07-01

The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including "codon capture," "genome streamlining," and "ambiguous intermediate" theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNA(Ala) containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. © 2016 Mühlhausen et al.; Published by Cold Spring Harbor Laboratory Press.

Towards a prevention program for β-thalassemia. The molecular spectrum in East Java, Indonesia.

PubMed

Hernanda, Pratika Yuhyi; Tursilowati, Luluk; Arkesteijn, Sandra G J; Ugrasena, I Dewa Gede; Larasati, Marian C Shanty; Soeatmadji, Sentot Mustajab; Giordano, Piero C; Harteveld, Cornelis L

2012-01-01

Defining the spectrum of specific thalassemia mutations is an important issue when planning prevention programs in large multi ethnic countries as is Indonesia. In a first attempt to define the prevalence of the common mutations in East Java we selected a cohort of 17 transfusion-dependent patients attending the Dr. Soetomo Hospital, Surabaya, Indonesia. After basic diagnostics we performed direct DNA sequencing for all β-globin genes. The results obtained on 34 independent chromosomes revealed the following prevalence rates: c.79 G>A p. Glu27Lys (Hb E) 47.0%; c.92+5G>C (IVS-I-5 G>C) 20.6%; c.109_110 delC p.Pro37Leu fs X7 [codon 35 (-C)] 17.6%; c.46del T p.Trp16Gly fsX4 [codon 15 (-T)] 5.9%; c.126_129delCTTT p. Phe42Leu fs X19 (codons 41/42) 2.9%; c.316-197 C>T [IVS-II-654 (C>T)] 2.9%; c*112 A>G (PolyA) 2.9%. Our preliminary results show that the distribution of the prevalent mutations in our cohort is quite homogeneous but with different forms than previously reported. This indicates that more studies on a larger scale and in different geographical areas are needed to refine our provisional results and to characterize the molecular background of the disease in the whole country.

Alterations of p53 in tumorigenic human bronchial epithelial cells correlate with metastatic potential

NASA Technical Reports Server (NTRS)

Piao, C. Q.; Willey, J. C.; Hei, T. K.; Hall, E. J. (Principal Investigator)

1999-01-01

The cellular and molecular mechanisms of radiation-induced lung cancer are not known. In the present study, alterations of p53 in tumorigenic human papillomavirus-immortalized human bronchial epithelial (BEP2D) cells induced by a single low dose of either alpha-particles or 1 GeV/nucleon (56)Fe were analyzed by PCR-single-stranded conformation polymorphism (SSCP) coupled with sequencing analysis and immunoprecipitation assay. A total of nine primary and four secondary tumor cell lines, three of which were metastatic, together with the parental BEP2D and primary human bronchial epithelial (NHBE) cells were studied. The immunoprecipitation assay showed overexpression of mutant p53 proteins in all the tumor lines but not in NHBE and BEP2D cells. PCR-SSCP and sequencing analysis found band shifts and gene mutations in all four of the secondary tumors. A G-->T transversion in codon 139 in exon 5 that replaced Lys with Asn was detected in two tumor lines. One mutation each, involving a G-->T transversion in codon 215 in exon 6 (Ser-->lle) and a G-->A transition in codon 373 in exon 8 (Arg-->His), was identified in the remaining two secondary tumors. These results suggest that p53 alterations correlate with tumorigenesis in the BEP2D cell model and that mutations in the p53 gene may be indicative of metastatic potential.

Biochemical features of genetic Creutzfeldt-Jakob disease with valine-to-isoleucine substitution at codon 180 on the prion protein gene.

PubMed

Ito, Yoko; Sanjo, Nobuo; Hizume, Masaki; Kobayashi, Atsushi; Ohgami, Tetsuya; Satoh, Katsuya; Hamaguchi, Tsuyoshi; Yamada, Masahito; Kitamoto, Tetsuyuki; Mizusawa, Hidehiro; Yokota, Takanori

2018-02-19

Valine-to-isoleucine substitution at codon 180 of the prion protein gene is only observed in patients with Creutzfeldt-Jakob disease and accounts for approximately half of all cases of genetic prion disease in Japan. In the present study, we investigated the biochemical characteristics of valine-to-isoleucine substitution at codon 180 in the prion protein gene, using samples obtained from the autopsied brains of seven patients with genetic Creutzfeldt-Jakob disease exhibiting this mutation (diagnoses confirmed via neuropathological examination). Among these patients, we observed an absence of diglycosylated and monoglycosylated forms of PrP res at codon 181. Our findings further indicated that the abnormal prion proteins were composed of at least three components, although smaller carboxyl-terminal fragments were predominant. Western blot analyses revealed large amounts of PrP res in the cerebral neocortices, where neuropathological examination revealed marked spongiosis. Relatively smaller amounts of PrP res were detected in the hippocampus, where milder spongiosis was observed, than in the cerebral neocortex. These findings indicate that abnormal prion proteins in the neocortex are associated with severe toxicity, resulting in severe spongiosis. Our findings further indicate that the valine-to-isoleucine substitution is not a polymorphism, but rather an authentic pathogenic mutation associated with specific biochemical characteristics that differ from those observed in sporadic Creutzfeldt-Jakob disease. Copyright © 2018 Elsevier Inc. All rights reserved.

p53 in pure epithelioid PEComa: an immunohistochemistry study and gene mutation analysis.

PubMed

Bing, Zhanyong; Yao, Yuan; Pasha, Theresa; Tomaszewski, John E; Zhang, Paul J

2012-04-01

Pure epithelioid PEComa (PEP; so-called epithelioid angiomyolipoma) is rare and is more often associated with aggressive behaviors. The pathogenesis of PEP has been poorly understood. The authors studied p53 expression and gene mutation in PEPs by immunohistochemistry, single-strand conformation polymorphism, and direct sequencing in paraffin material from 8 PEPs. A group of classic angiomyolipomas (AMLs) were also analyzed for comparison. Five PEPs were from kidneys and 1 each from the heart, the liver, and the uterus. PEPs showed much stronger p53 nuclear staining (Allred score 6.4 ± 2.5) than the classic AML (2.3 ± 2.9) (P < .01). There was no p53 single-strand conformation polymorphism identified in either the PEPs or the 8 classic AMLs. p53 mutation analyses by direct sequencing of exons 5 to 9 showed 4 mutations in 3 of 8 PEPs but none in any of the 8 classic AMLs. The mutations included 2 missense mutations in a hepatic PEComa and 2 silent mutations in 2 renal PEPs. Both the missense mutations in the hepatic PEComa involved the exon 5, one involving codon 165, with change from CAG to CAC (coding amino acid changed from glutamine to histidine), and the other involving codon 182, with change from TGC to TAC (coding amino acid changed from cysteine to tyrosine). The finding of stronger p53 expression and mutations in epithelioid angiomyolipomas might have contributed to their less predictable behavior. However, the abnormal p53 expression cannot be entirely explained by p53 mutations in the exons examined in the PEPs.

A Novel Deletion Mutation in the MEN1 Gene in a Patient with Prolactinoma and a Family History of Pancreatic Tumors.

PubMed

Kageyama, Kazunori; Usui, Takeshi; Yoshizawa, Kaori; Daimon, Makoto

2014-09-01

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant tumor syndrome caused by mutations in the MEN1 gene. Mutations in this tumor suppressor gene are often associated with neuroendocrine tumors. Here we describe a novel deletion mutation at codon 304 in the MEN1 gene of a patient with a prolactinoma and strong family history of pancreatic tumors. We describe the patient's clinical course and mutational analysis and review the relevant literature. A 30-year-old pregnant female was referred to our institution's psychological department for treatment of depression. She had developed a prolactinoma at age 17 and was being treated with 1 mg/week of cabergoline. A medical interview revealed a family history of pancreatic islet cell and other tumors; her mother died of pancreatic cancer, her brother is living with gastrinoma, and her sister died of leiomyosarcoma. Extensive examinations performed after delivery, including laboratory tests and computed tomography (CT) scans, did not reveal any other tumors. Mutational analysis of the MEN1 gene identified a heterozygous deletion mutation (c911_914delAGGT) at codon 304. This mutation produces a frameshift at p.304Lys and might disturb the splicing of intron 6 due to the lack of a donor site. The predicted menin protein from the mutated allele is truncated at amino acid 328. We report a novel deletion mutation (c911_914delAGGT) in the MEN1 gene that was likely associated with the patient's prolactinoma and her strong family history of pancreatic tumors.

Rapid and accurate detection of KRAS mutations in colorectal cancers using the isothermal-based optical sensor for companion diagnostics

PubMed Central

Koo, Bonhan; Lee, Tae Yoon; Lee, Jeong Hoon; Shin, Yong; Lim, Seok-Byung

2017-01-01

Although KRAS mutational status testing is becoming a companion diagnostic tool for managing patients with colorectal cancer (CRC), there are still several difficulties when analyzing KRAS mutations using the existing assays, particularly with regard to low sensitivity, its time-consuming, and the need for large instruments. We developed a rapid, sensitive, and specific mutation detection assay based on the bio-photonic sensor termed ISAD (isothermal solid-phase amplification/detection), and used it to analyze KRAS gene mutations in human clinical samples. To validate the ISAD-KRAS assay for use in clinical diagnostics, we examined for hotspot KRAS mutations (codon 12 and codon 13) in 70 CRC specimens using PCR and direct sequencing methods. In a serial dilution study, ISAD-KRAS could detect mutations in a sample containing only 1% of the mutant allele in a mixture of wild-type DNA, whereas both PCR and direct sequencing methods could detect mutations in a sample containing approximately 30% of mutant cells. The results of the ISAD-KRAS assay from 70 clinical samples matched those from PCR and direct sequencing, except in 5 cases, wherein ISAD-KRAS could detect mutations that were not detected by PCR and direct sequencing. We also found that the sensitivity and specificity of ISAD-KRAS were 100% within 30 min. The ISAD-KRAS assay provides a rapid, highly sensitive, and label-free method for KRAS mutation testing, and can serve as a robust and near patient testing approach for the rapid detection of patients most likely to respond to anti-EGFR drugs. PMID:29137388

Four novel germline mutations in the MLH1 and PMS2 mismatch repair genes in patients with hereditary nonpolyposis colorectal cancer.

PubMed

Montazer Haghighi, Mahdi; Radpour, Ramin; Aghajani, Katayoun; Zali, Narges; Molaei, Mahsa; Zali, Mohammad Reza

2009-08-01

Hereditary nonpolyposis colorectal cancer (HNPCC) is the most common cause of early onset hereditary colorectal cancer. In the majority of HNPCC families, microsatellite instability (MSI) and germline mutation in one of the DNA mismatch repair (MMR) genes are found. The entire coding sequence of MMR genes (MLH1, MLH2, MLH6, and PMS2) was analyzed using direct sequencing. Also, tumor tests were done as MSI and immunohistochemistry testing. We were able to find three novel MLH1 and one novel PMS2 germline mutations in three Iranian HNPCC patients. The first was a transversion mutation c.346A>C (T116P) and happened in the highly conserved HATPase-c region of MLH1 protein. The second was a transversion mutation c.736A>T (I246L), which caused an amino acid change of isoleucine to leucine. The third mutation (c.2145,6 delTG) was frameshift and resulted in an immature stop codon in five codons downstream. All of these three mutations were detected in the MLH1 gene. The other mutation was a transition mutation, c.676G>A (G207E), which has been found in exon six of the PMS2 gene and caused an amino acid change of glycine to glutamic acid. MSI assay revealed high instability in microsatellite for two patients and microsatellite stable for one patient. In all patients, an abnormal expression of the MMR proteins in HNPCC was related to the above novel mutations.

A Stem-Loop Structure in Potato Leafroll Virus Open Reading Frame 5 (ORF5) Is Essential for Readthrough Translation of the Coat Protein ORF Stop Codon 700 Bases Upstream.

PubMed

Xu, Yi; Ju, Ho-Jong; DeBlasio, Stacy; Carino, Elizabeth J; Johnson, Richard; MacCoss, Michael J; Heck, Michelle; Miller, W Allen; Gray, Stewart M

2018-06-01

Translational readthrough of the stop codon of the capsid protein (CP) open reading frame (ORF) is used by members of the Luteoviridae to produce their minor capsid protein as a readthrough protein (RTP). The elements regulating RTP expression are not well understood, but they involve long-distance interactions between RNA domains. Using high-resolution mass spectrometry, glutamine and tyrosine were identified as the primary amino acids inserted at the stop codon of Potato leafroll virus (PLRV) CP ORF. We characterized the contributions of a cytidine-rich domain immediately downstream and a branched stem-loop structure 600 to 700 nucleotides downstream of the CP stop codon. Mutations predicted to disrupt and restore the base of the distal stem-loop structure prevented and restored stop codon readthrough. Motifs in the downstream readthrough element (DRTE) are predicted to base pair to a site within 27 nucleotides (nt) of the CP ORF stop codon. Consistent with a requirement for this base pairing, the DRTE of Cereal yellow dwarf virus was not compatible with the stop codon-proximal element of PLRV in facilitating readthrough. Moreover, deletion of the complementary tract of bases from the stop codon-proximal region or the DRTE of PLRV prevented readthrough. In contrast, the distance and sequence composition between the two domains was flexible. Mutants deficient in RTP translation moved long distances in plants, but fewer infection foci developed in systemically infected leaves. Selective 2'-hydroxyl acylation and primer extension (SHAPE) probing to determine the secondary structure of the mutant DRTEs revealed that the functional mutants were more likely to have bases accessible for long-distance base pairing than the nonfunctional mutants. This study reveals a heretofore unknown combination of RNA structure and sequence that reduces stop codon efficiency, allowing translation of a key viral protein. IMPORTANCE Programmed stop codon readthrough is used by many animal and plant viruses to produce key viral proteins. Moreover, such "leaky" stop codons are used in host mRNAs or can arise from mutations that cause genetic disease. Thus, it is important to understand the mechanism(s) of stop codon readthrough. Here, we shed light on the mechanism of readthrough of the stop codon of the coat protein ORFs of viruses in the Luteoviridae by identifying the amino acids inserted at the stop codon and RNA structures that facilitate this "leakiness" of the stop codon. Members of the Luteoviridae encode a C-terminal extension to the capsid protein known as the readthrough protein (RTP). We characterized two RNA domains in Potato leafroll virus (PLRV), located 600 to 700 nucleotides apart, that are essential for efficient RTP translation. We further determined that the PLRV readthrough process involves both local structures and long-range RNA-RNA interactions. Genetic manipulation of the RNA structure altered the ability of PLRV to translate RTP and systemically infect the plant. This demonstrates that plant virus RNA contains multiple layers of information beyond the primary sequence and extends our understanding of stop codon readthrough. Strategic targets that can be exploited to disrupt the virus life cycle and reduce its ability to move within and between plant hosts were revealed. Copyright © 2018 American Society for Microbiology.

Compound heterozygous mutations in the SRD5A2 gene exon 4 in a male pseudohermaphrodite patient of Chinese origin.

PubMed

Fernández-Cancio, Mónica; Nistal, Manuel; Gracia, Ricardo; Molina, M Antonia; Tovar, Juan Antonio; Esteban, Cristina; Carrascosa, Antonio; Audí, Laura

2004-01-01

The goal of this study was to perform 5-alpha-reductase type 2 gene (SRD5A2) analysis in a male pseudohermaphrodite (MPH) patient with normal testosterone (T) production and normal androgen receptor (AR) gene coding sequences. A patient of Chinese origin with ambiguous genitalia at 14 months, a 46,XY karyotype, and normal T secretion under human chorionic gonadotropin (hCG) stimulation underwent a gonadectomy at 20 months. Exons 1-8 of the AR gene and exons 1-5 of the SRD5A2 gene were sequenced from peripheral blood DNA. AR gene coding sequences were normal. SRD5A2 gene analysis revealed 2 consecutive mutations in exon 4, each located in a different allele: 1) a T nucleotide deletion, which predicts a frameshift mutation from codon 219, and 2) a missense mutation at codon 227, where the substitution of guanine (CGA) by adenine (CAA) predicts a glutamine replacement of arginine (R227Q). Testes located in the inguinal canal showed a normal morphology for age. The patient was a compound heterozygote for SRD5A2 mutations, carrying 2 mutations in exon 4. The patient showed an R227Q mutation that has been described in an Asian population and MPH patients, along with a novel frameshift mutation, Tdel219. Testis morphology showed that, during early infancy, the 5-alpha-reductase enzyme deficiency may not have affected interstitial or tubular development.

Identification of a novel mutation in a Chinese family with Nance-Horan syndrome by whole exome sequencing*

PubMed Central

Hong, Nan; Chen, Yan-hua; Xie, Chen; Xu, Bai-sheng; Huang, Hui; Li, Xin; Yang, Yue-qing; Huang, Ying-ping; Deng, Jian-lian; Qi, Ming; Gu, Yang-shun

2014-01-01

Objective: Nance-Horan syndrome (NHS) is a rare X-linked disorder characterized by congenital nuclear cataracts, dental anomalies, and craniofacial dysmorphisms. Mental retardation was present in about 30% of the reported cases. The purpose of this study was to investigate the genetic and clinical features of NHS in a Chinese family. Methods: Whole exome sequencing analysis was performed on DNA from an affected male to scan for candidate mutations on the X-chromosome. Sanger sequencing was used to verify these candidate mutations in the whole family. Clinical and ophthalmological examinations were performed on all members of the family. Results: A combination of exome sequencing and Sanger sequencing revealed a nonsense mutation c.322G>T (E108X) in exon 1 of NHS gene, co-segregating with the disease in the family. The nonsense mutation led to the conversion of glutamic acid to a stop codon (E108X), resulting in truncation of the NHS protein. Multiple sequence alignments showed that codon 108, where the mutation (c.322G>T) occurred, was located within a phylogenetically conserved region. The clinical features in all affected males and female carriers are described in detail. Conclusions: We report a nonsense mutation c.322G>T (E108X) in a Chinese family with NHS. Our findings broaden the spectrum of NHS mutations and provide molecular insight into future NHS clinical genetic diagnosis. PMID:25091991

KRAS Mutation Test in Korean Patients with Colorectal Carcinomas: A Methodological Comparison between Sanger Sequencing and a Real-Time PCR-Based Assay.

PubMed

Lee, Sung Hak; Chung, Arthur Minwoo; Lee, Ahwon; Oh, Woo Jin; Choi, Yeong Jin; Lee, Youn-Soo; Jung, Eun Sun

2017-01-01

Mutations in the KRAS gene have been identified in approximately 50% of colorectal cancers (CRCs). KRAS mutations are well established biomarkers in anti-epidermal growth factor receptor therapy. Therefore, assessment of KRAS mutations is needed in CRC patients to ensure appropriate treatment. We compared the analytical performance of the cobas test to Sanger sequencing in 264 CRC cases. In addition, discordant specimens were evaluated by 454 pyrosequencing. KRAS mutations for codons 12/13 were detected in 43.2% of cases (114/264) by Sanger sequencing. Of 257 evaluable specimens for comparison, KRAS mutations were detected in 112 cases (43.6%) by Sanger sequencing and 118 cases (45.9%) by the cobas test. Concordance between the cobas test and Sanger sequencing for each lot was 93.8% positive percent agreement (PPA) and 91.0% negative percent agreement (NPA) for codons 12/13. Results from the cobas test and Sanger sequencing were discordant for 20 cases (7.8%). Twenty discrepant cases were subsequently subjected to 454 pyrosequencing. After comprehensive analysis of the results from combined Sanger sequencing-454 pyrosequencing and the cobas test, PPA was 97.5% and NPA was 100%. The cobas test is an accurate and sensitive test for detecting KRAS -activating mutations and has analytical power equivalent to Sanger sequencing. Prescreening using the cobas test with subsequent application of Sanger sequencing is the best strategy for routine detection of KRAS mutations in CRC.

Novel Single-Base Deletional Mutation in Major Intrinsic Protein (MIP) in Autosomal Dominant Cataract

PubMed Central

Geyer, David D.; Spence, M. Anne; Johannes, Meriam; Flodman, Pamela; Clancy, Kevin P.; Berry, Rebecca; Sparkes, Robert S.; Jonsen, Matthew D.; Isenberg, Sherwin J.; Bateman, J. Bronwyn

2006-01-01

PURPOSE To further elucidate the cataract phenotype, and identify the gene and mutation for autosomal dominant cataract (ADC) in an American family of European descent (ADC2) by sequencing the major intrinsic protein gene (MIP), a candidate based on linkage to chromosome 12q13. DESIGN Observational case series and laboratory experimental study. METHODS We examined two at-risk individuals in ADC2. We PCR-amplified and sequenced all four exons and all intron-exon boundaries of the MIP gene from genomic and cloned DNA in affected members to confirm one variant as the putative mutation. RESULTS We found a novel single deletion of nucleotide (nt) 3223 (within codon 235) in exon four, causing a frameshift that alters 41 of 45 subsequent amino acids and creates a premature stop codon. CONCLUSIONS We identified a novel single base pair deletion in the MIP gene and conclude that it is a pathogenic sequence alteration. PMID:16564824

Darwin Assembly: fast, efficient, multi-site bespoke mutagenesis

PubMed Central

Cozens, Christopher

2018-01-01

Abstract Engineering proteins for designer functions and biotechnological applications almost invariably requires (or at least benefits from) multiple mutations to non-contiguous residues. Several methods for multiple site-directed mutagenesis exist, but there remains a need for fast and simple methods to efficiently introduce such mutations – particularly for generating large, high quality libraries for directed evolution. Here, we present Darwin Assembly, which can deliver high quality libraries of >108 transformants, targeting multiple (>10) distal sites with minimal wild-type contamination (<0.25% of total population) and which takes a single working day from purified plasmid to library transformation. We demonstrate its efficacy with whole gene codon reassignment of chloramphenicol acetyl transferase, mutating 19 codons in a single reaction in KOD DNA polymerase and generating high quality, multiple-site libraries in T7 RNA polymerase and Tgo DNA polymerase. Darwin Assembly uses commercially available enzymes, can be readily automated, and offers a cost-effective route to highly complex and customizable library generation. PMID:29409059

Shannon Entropy of the Canonical Genetic Code

NASA Astrophysics Data System (ADS)

Nemzer, Louis

The probability that a non-synonymous point mutation in DNA will adversely affect the functionality of the resultant protein is greatly reduced if the substitution is conservative. In that case, the amino acid coded by the mutated codon has similar physico-chemical properties to the original. Many simplified alphabets, which group the 20 common amino acids into families, have been proposed. To evaluate these schema objectively, we introduce a novel, quantitative method based on the inherent redundancy in the canonical genetic code. By calculating the Shannon information entropy carried by 1- or 2-bit messages, groupings that best leverage the robustness of the code are identified. The relative importance of properties related to protein folding - like hydropathy and size - and function, including side-chain acidity, can also be estimated. In addition, this approach allows us to quantify the average information value of nucleotide codon positions, and explore the physiological basis for distinguishing between transition and transversion mutations. Supported by NSU PFRDG Grant #335347.

Glyphosate resistance: state of knowledge

PubMed Central

Sammons, Robert Douglas; Gaines, Todd A

2014-01-01

Studies of mechanisms of resistance to glyphosate have increased current understanding of herbicide resistance mechanisms. Thus far, single-codon non-synonymous mutations of EPSPS (5-enolypyruvylshikimate-3-phosphate synthase) have been rare and, relative to other herbicide mode of action target-site mutations, unconventionally weak in magnitude for resistance to glyphosate. However, it is possible that weeds will emerge with non-synonymous mutations of two codons of EPSPS to produce an enzyme endowing greater resistance to glyphosate. Today, target-gene duplication is a common glyphosate resistance mechanism and could become a fundamental process for developing any resistance trait. Based on competition and substrate selectivity studies in several species, rapid vacuole sequestration of glyphosate occurs via a transporter mechanism. Conversely, as the chloroplast requires transporters for uptake of important metabolites, transporters associated with the two plastid membranes may separately, or together, successfully block glyphosate delivery. A model based on finite glyphosate dose and limiting time required for chloroplast loading sets the stage for understanding how uniquely different mechanisms can contribute to overall glyphosate resistance. PMID:25180399

Whole exome sequencing identifies a homozygous nonsense variation in ALMS1 gene in a patient with syndromic obesity.

PubMed

Das Bhowmik, Aneek; Gupta, Neerja; Dalal, Ashwin; Kabra, Madhulika

In the present study we report on genetic analysis in a patient with developmental delay, truncal obesity and vision problem, to find the causative mutation. Whole exome sequencing was performed on genomic DNA extracted from whole blood of the patient which revealed a homozygous nonsense variant (c.2816T>A) in exon 8 of ALMS1 gene that results in a stop codon and premature truncation at codon 939 (p.L939Ter) of the protein. The mutation was confirmed by Sanger sequencing. Exome sequencing was helpful in establishing diagnosis of Alstrom syndrome in this patient. This case highlights the utility of exome sequencing in clinical practice. Copyright © 2016 Asia Oceania Association for the Study of Obesity. Published by Elsevier Ltd. All rights reserved.

Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs.

PubMed

Gagnon, James A; Valen, Eivind; Thyme, Summer B; Huang, Peng; Akhmetova, Laila; Ahkmetova, Laila; Pauli, Andrea; Montague, Tessa G; Zimmerman, Steven; Richter, Constance; Schier, Alexander F

2014-01-01

The CRISPR/Cas9 system has been implemented in a variety of model organisms to mediate site-directed mutagenesis. A wide range of mutation rates has been reported, but at a limited number of genomic target sites. To uncover the rules that govern effective Cas9-mediated mutagenesis in zebrafish, we targeted over a hundred genomic loci for mutagenesis using a streamlined and cloning-free method. We generated mutations in 85% of target genes with mutation rates varying across several orders of magnitude, and identified sequence composition rules that influence mutagenesis. We increased rates of mutagenesis by implementing several novel approaches. The activities of poor or unsuccessful single-guide RNAs (sgRNAs) initiating with a 5' adenine were improved by rescuing 5' end homogeneity of the sgRNA. In some cases, direct injection of Cas9 protein/sgRNA complex further increased mutagenic activity. We also observed that low diversity of mutant alleles led to repeated failure to obtain frame-shift mutations. This limitation was overcome by knock-in of a stop codon cassette that ensured coding frame truncation. Our improved methods and detailed protocols make Cas9-mediated mutagenesis an attractive approach for labs of all sizes.

Novel APC gene mutations associated with protein alteration in diffuse type gastric cancer.

PubMed

Ghatak, Souvik; Chakraborty, Payel; Sarkar, Sandeep Roy; Chowdhury, Biswajit; Bhaumik, Arup; Kumar, Nachimuthu Senthil

2017-06-02

The role of adenomatous polyposis coli (APC) gene in mitosis might be critical for regulation of genomic stability and chromosome segregation. APC gene mutations have been associated to have a role in colon cancer and since gastric and colon tumors share some common genetic lesions, it is relevant to investigate the role of APC tumor suppressor gene in gastric cancer. We investigated for somatic mutations in the Exons 14 and 15 of APC gene from 40 diffuse type gastric cancersamples. Rabbit polyclonal anti-APC antibody was used, which detects the wild-type APC protein and was recommended for detection of the respective protein in human tissues. Cell cycle analysis was done from tumor and adjacent normal tissue. APC immunoreactivity showed positive expression of the protein in stages I, II, III and negative expression in Stages III and IV. Two novel deleterious variations (g.127576C > A, g.127583C > T) in exon 14 sequence were found to generate stop codon (Y622* and Q625*)in the tumor samples. Due to the generation of stop codon, the APC protein might be truncated and all the regulatory features could be lost which has led to the down-regulation of protein expression. Our results indicate that aneuploidy might occurdue to the codon 622 and 625 APC-driven gastric tumorigenesis, in agreement with our cell cycle analysis. The APC gene function in mitosis and chromosomal stability might be lost and G1 might be arrested with high quantity of DNA in the S phase. Six missense somatic mutations in tumor samples were detected in exon 15 A-B, twoof which showed pathological and disease causing effects based on SIFT, Polyphen2 and SNPs & GO score and were not previously reported in the literature or the public mutation databases. The two novel pathological somatic mutations (g.127576C > A, g.127583C > T) in exon 14 might be altering the protein expression leading to development of gastric cancer in the study population. Our study showed that mutations in the APC gene alter the protein expression and cell cycle regulation in diffuse type gastric adenocarcinoma.

Identification of a PTEN mutation with reduced protein stability, phosphatase activity, and nuclear localization in Hong Kong patients with autistic features, neurodevelopmental delays, and macrocephaly.

PubMed

Wong, Chi Wai; Or, Penelope Mei Yu; Wang, Yubing; Li, Lisha; Li, Jing; Yan, Mingfei; Cao, Ye; Luk, Ho Ming; Tong, Tony Ming For; Leslie, Nick R; Lo, Ivan Fai-Man; Choy, Kwong Wai; Chan, Andrew Man Lok

2018-04-02

PTEN is a tumor suppressor gene inactivated in over 30% of human cancers. It encodes a lipid phosphatase that serves as a gatekeeper of the phosphoinositide 3-kinase signaling pathway. Germline mutation frequently occurs in this gene in patients diagnosed with PTEN Hamartoma Tumor Syndrome (PHTS). PHTS individuals are characterized by macrocephaly, benign growth of multiple tissues and increased tumor risk. In addition, autistic phenotypes are found in 10-20% of individuals carrying the germline PTEN mutation with macrocephaly. In this report, 13 suspected PHTS patients were screened for mutation in the PTEN gene. A missense variant (c. 302T > C) substituting the isoleucine at codon 101 to a threonine, a single nucleotide insertion (c. 327-328insC) causing a frame shift mutation and termination at codon 109, and a nonsense variant (c. 1003C > T) truncated the protein at codon 335 were identified. The I101T mutation significantly reduced PTEN protein expression levels by 2.5- to 4.0-fold. Mechanistically, I101T reduced the protein half-life of PTEN possibly due to enhanced polyubiquitination at Lysine 13. However, the I101T mutant retained almost 30% of the lipid phosphatase activity of the wild-type protein. Finally, the I101T mutant has reduced phosphorylation at a PTEN auto-dephosphorylation site at Threonine 366 and a lowered ratio of nuclear to cytosolic protein level. These partial losses of multiple PTEN biochemical functions may contribute to the tissue overgrowth and autistic features of this PHTS patient. Autism Res 2018. © 2018 The Authors Autism Research published by International Society for Autism Research and Wiley Periodicals, Inc. The genetics of autism spectrum disorders is highly complex with individual risk influenced by both genetic and environmental factors. Mutation in the human PTEN gene confers a high risk of developing autistic behavior. This report revealed that PTEN mutations occurred in 23% of a selected group of Hong Kong patients harboring autistic features with gross overgrowth symptoms. Detailed characterization of a PTEN mutation revealed reduced protein stability as one of the underlying mechanisms responsible for reduced PTEN activity. © 2018 The Authors Autism Research published by International Society for Autism Research and Wiley Periodicals, Inc.

Novel Codon Insert in HIV Type 1 Clade B Reverse Transcriptase Associated with Low-Level Viremia During Antiretroviral Therapy

PubMed Central

Gianella, Sara; Vazquez, Homero; Ignacio, Caroline; Zweig, Adam C.; Richman, Douglas D.; Smith, Davey M.

2014-01-01

Abstract We investigated the pol genotype in two phylogenetically and epidemiologically linked partners, who were both experiencing persistent low-level viremia during antiretroviral therapy. In one partner we identified a new residue insertion between codon 248 and 249 of the HIV-1 RNA reverse transcriptase (RT) coding region (HXB2 numbering). We then investigated the potential impact of identified mutations in RT and antiretroviral binding affinity using a novel computational approach. PMID:24020934

Novel mutations of androgen receptor: a possible mechanism of bicalutamide withdrawal syndrome.

PubMed

Hara, Takahito; Miyazaki, Jun-ichi; Araki, Hideo; Yamaoka, Masuo; Kanzaki, Naoyuki; Kusaka, Masami; Miyamoto, Masaomi

2003-01-01

Most prostate cancers (PCs) become resistant to combined androgen blockade therapy with surgical or medical castration and antiandrogens after several years. Some of these refractory PCs regress after discontinuation of antiandrogen administration [antiandrogen withdrawal syndrome (AWS)]. Although the molecular mechanisms of the AWS are not fully understood because of the lack of suitable experimental models, one hypothesis of the mechanism is mutation of androgen receptor (AR). However, bicalutamide, which has become the most prevalent pure antiandrogen, does not work as an agonist for any mutant AR detected thus far in PC. To elucidate the mechanisms of the AWS, we established and characterized novel LNCaP cell sublines, LNCaP-cxDs, which were generated in vitro by culturing androgen-dependent LNCaP-FGC human PC cells in androgen-depleted medium with bicalutamide to mimic the combined androgen blockade therapy. LNCaP-FGC cells did not grow at first, but they started to grow after 6-13 weeks of culture. Bicalutamide stimulated LNCaP-cxD cell growth and increased prostate-specific antigen secretion from LNCaP-cxD cells both in vitro and in vivo. Sequencing of AR transcripts revealed that the AR in LNCaP-cxD cells harbors a novel mutation in codon 741, TGG (tryptophan) to TGT (cysteine; W741C), or in codon 741, TGG to TTG (leucine; W741L), in the ligand-binding domain. Transactivation assays showed that bicalutamide worked as an agonist for both W741C and W741L mutant ARs. Importantly, another antiandrogen, hydroxyflutamide, worked as an antagonist for these mutant ARs. In summary, we demonstrate for the first time that within only 6-13 weeks of in vitro exposure to bicalutamide, LNCaP-FGC cells, whose growth had initially been suppressed, came to use bicalutamide as an AR agonist via W741 AR mutation to survive. Our data strongly support the hypothesis that AR mutation is one possible mechanism of the AWS and suggest that flutamide might be effective as a second-line therapy for refractory PC previously treated with bicalutamide.

EZH2 expression is a prognostic biomarker in patients with colorectal cancer treated with anti-EGFR therapeutics.

PubMed

Yamamoto, Itaru; Nosho, Katsuhiko; Kanno, Shinichi; Igarashi, Hisayoshi; Kurihara, Hiroyoshi; Ishigami, Keisuke; Ishiguro, Kazuya; Mitsuhashi, Kei; Maruyama, Reo; Koide, Hideyuki; Okuda, Hiroyuki; Hasegawa, Tadashi; Sukawa, Yasutaka; Okita, Kenji; Takemasa, Ichiro; Yamamoto, Hiroyuki; Shinomura, Yasuhisa; Nakase, Hiroshi

2017-03-14

The polycomb group protein enhancer of zeste homolog 2 (EZH2) is a methyltransferase that suppresses microRNA-31 (miR-31) in various human malignancies including colorectal cancer. We recently suggested that miR-31 regulates the signaling pathway downstream of epidermal growth factor receptor (EGFR) in colorectal cancer. Therefore, we conducted this study for assessing the relationship between EZH2 expression and clinical outcomes in patients with colorectal cancer treated with anti-EGFR therapeutics. We immunohistochemically evaluated EZH2 expression and assessed miR-31 and gene mutations [KRAS (codon 61/146), NRAS (codon 12/13/61), and BRAF (codon 600)] in 109 patients with colorectal cancer harboring KRAS (codon 12/13) wild-type. We also evaluated the progression-free survival (PFS) and overall survival (OS). In the result, low EZH2 expression was significantly associated with shorter PFS (log-rank test: P = 0.023) and OS (P = 0.036) in patients with colorectal cancer. In the low-miR-31-expression group and the KRAS (codon 61/146), NRAS, and BRAF wild-type groups, a significantly shorter PFS (P = 0.022, P = 0.039, P = 0.021, and P = 0.036, respectively) was observed in the EZH2 low-expression groups than in the high-expression groups. In the multivariate analysis, low EZH2 expression was associated with a shorter PFS (P = 0.046), independent of the mutational status and miR-31. In conclusion, EZH2 expression was associated with survival in patients with colorectal cancer who were treated with anti-EGFR therapeutics. Moreover, low EZH2 expression was independently associated with shorter PFS in patients with cancer, suggesting that EZH2 expression is a useful additional prognostic biomarker for anti-EGFR therapy.

Profoundly different prion diseases in knock-in mice carrying single PrP codon substitutions associated with human diseases.

PubMed

Jackson, Walker S; Borkowski, Andrew W; Watson, Nicki E; King, Oliver D; Faas, Henryk; Jasanoff, Alan; Lindquist, Susan

2013-09-03

In man, mutations in different regions of the prion protein (PrP) are associated with infectious neurodegenerative diseases that have remarkably different clinical signs and neuropathological lesions. To explore the roots of this phenomenon, we created a knock-in mouse model carrying the mutation associated with one of these diseases [Creutzfeldt-Jakob disease (CJD)] that was exactly analogous to a previous knock-in model of a different prion disease [fatal familial insomnia (FFI)]. Together with the WT parent, this created an allelic series of three lines, each expressing the same protein with a single amino acid difference, and with all native regulatory elements intact. The previously described FFI mice develop neuronal loss and intense reactive gliosis in the thalamus, as seen in humans with FFI. In contrast, CJD mice had the hallmark features of CJD, spongiosis and proteinase K-resistant PrP aggregates, initially developing in the hippocampus and cerebellum but absent from the thalamus. A molecular transmission barrier protected the mice from any infectious prion agents that might have been present in our mouse facility and allowed us to conclude that the diseases occurred spontaneously. Importantly, both models created agents that caused a transmissible neurodegenerative disease in WT mice. We conclude that single codon differences in a single gene in an otherwise normal genome can cause remarkably different neurodegenerative diseases and are sufficient to create distinct protein-based infectious elements.

Mutations in the gene for X-linked adrenoleukodystrophy in patients with different clinical phenotypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Braun, A.; Ambach, H.; Kammerer, S.

Recently, the gene for the most common peroxisomal disorder, X-linked adrenoleukodystrophy (X-ALD), has been described encoding a peroxisomal membrane transporter protein. We analyzed the entire protein-coding sequence of this gene by reverse-transcription PCR, SSCP, and DNA sequencing in five patients with different clinical expressions were cerebral childhood ALD, adrenomyecloneuropathy (AMN), and {open_quotes}Addison disease only{close_quotes} (AD) phenotype. In the three patients exhibiting the classical picture of severe childhood ALD we identified in the 5{prime} portion of the X-ALD gene a 38-bp deletion that causes a frameshift mutation, a 3-bp deletion leading to a deletion of an amino acid in the ATP-bindingmore » domain of the ALD protein, and a missense mutation. In the patient with the clinical phenotype of AMN, a nonsense mutation in codon 212, along with a second site mutation at codon 178, was observed. Analysis of the patient with the ADO phenotype revealed a further missense mutation at a highly conserved position in the ALDP/PMP70 comparison. The disruptive nature of two mutations (i.e., the frameshift and the nonsense mutation) in patients with biochemically proved childhood ALD and AMN further strongly supports the hypothesis that alterations in this gene play a crucial role in the pathogenesis of X-ALD. Since the current biochemical techniques for X-ALD carrier detection in affected families lack sufficient reliability, our procedure described for systematic mutation scanning is also capable of improving genetic counseling and prenatal diagnosis. 19 refs., 6 figs., 3 tabs.« less

KRAS, NRAS and BRAF mutations in Greek and Romanian patients with colorectal cancer: a cohort study

PubMed Central

Negru, Serban; Papadopoulou, Eirini; Apessos, Angela; Stanculeanu, Dana Lucia; Ciuleanu, Eliade; Volovat, Constantin; Croitoru, Adina; Kakolyris, Stylianos; Aravantinos, Gerasimos; Ziras, Nikolaos; Athanasiadis, Elias; Touroutoglou, Nikolaos; Pavlidis, Nikolaos; Kalofonos, Haralabos P; Nasioulas, George

2014-01-01

Objectives Treatment decision-making in colorectal cancer is often guided by tumour tissue molecular analysis. The aim of this study was the development and validation of a high-resolution melting (HRM) method for the detection of KRAS, NRAS and BRAF mutations in Greek and Romanian patients with colorectal cancer and determination of the frequency of these mutations in the respective populations. Setting Diagnostic molecular laboratory located in Athens, Greece. Participants 2425 patients with colorectal cancer participated in the study. Primary and secondary outcome measures 2071 patients with colorectal cancer (1699 of Greek and 372 of Romanian origin) were analysed for KRAS exon 2 mutations. In addition, 354 tumours from consecutive patients (196 Greek and 161 Romanian) were subjected to full KRAS (exons 2, 3 and 4), NRAS (exons 2, 3 and 4) and BRAF (exon 15) analysis. KRAS, NRAS and BRAF mutation detection was performed by a newly designed HRM analysis protocol, followed by Sanger sequencing. Results KRAS exon 2 mutations (codons 12/13) were detected in 702 of the 1699 Greek patients with colorectal carcinoma analysed (41.3%) and in 39.2% (146/372) of the Romanian patients. Among the 354 patients who were subjected to full KRAS, NRAS and BRAF analysis, 40.96% had KRAS exon 2 mutations (codons 12/13). Among the KRAS exon 2 wild-type patients 15.31% harboured additional RAS mutations and 12.44% BRAF mutations. The newly designed HRM method used showed a higher sensitivity compared with the sequencing method. Conclusions The HRM method developed was shown to be a reliable method for KRAS, NRAS and BRAF mutation detection. Furthermore, no difference in the mutation frequency of KRAS, NRAS and BRAF was observed between Greek and Romanian patients with colorectal cancer. PMID:24859998

KRAS and TP53 mutations in bronchoscopy samples from former lung cancer patients.

PubMed

Gao, Weimin; Jin, Jide; Yin, Jinling; Land, Stephanie; Gaither-Davis, Autumn; Christie, Neil; Luketich, James D; Siegfried, Jill M; Keohavong, Phouthone

2017-02-01

Mutations in the KRAS and TP53 genes have been found frequently in lung tumors and specimens from individuals at high risk for lung cancer and have been suggested as predictive markers for lung cancer. In order to assess the prognostic value of these two genes' mutations in lung cancer recurrence, we analyzed mutations in codon 12 of the KRAS gene and in hotspot codons of the TP53 gene in 176 bronchial biopsies obtained from 77 former lung cancer patients. Forty-seven patients (61.0%) showed mutations, including 35/77 (45.5%) in the KRAS gene and 25/77 (32.5%) in the TP53 gene, among them 13/77 (16.9%) had mutations in both genes. When grouped according to past or current smoking status, a higher proportion of current smokers showed mutations, in particular those in the TP53 gene (P = 0.07), compared with ex-smokers. These mutations were found in both abnormal lesions (8/20 or 40%) and histologically normal tissues (70/156 or 44.9%) (P = 0.812). They consisted primarily of G to A transition and G to T transversion in both the KRAS (41/56 or 73.2%) and TP53 (24/34 or 70.6%) genes, consistent with mutations found in lung tumors of smoking lung cancer patients. Overall, recurrence-free survival (RFS) among all subjects could be explained by age at diagnosis, tumor stage, tumor subtype, and smoking (P < 0.05, Cox proportional hazard). Therefore, KRAS and TP53 mutations were frequently detected in bronchial tissues of former lung cancer patients. However, the presence of mutation of bronchial biopsies was not significantly associated with a shorter RFS time. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Mutation profile of KRAS and BRAF genes in patients with colorectal cancer: association with morphological and prognostic criteria.

PubMed

Samara, M; Kapatou, K; Ioannou, M; Kostopoulou, Ε; Papamichali, R; Papandreou, C; Athanasiadis, A; Koukoulis, G

2015-12-14

KRAS and BRAF mutations are well-recognized molecular alterations during colorectal carcinogenesis, but there is little agreement on their effect on tumor characteristics. Therefore, we aimed to evaluate the distribution of the most common KRAS and BRAF mutations in Greek patients with colorectal cancer and their possible associations with clinical histopathological parameters. In this study, 322 and 188 colorectal carcinomas were used for the mutation analysis of KRAS (exon 2) and BRAF (exon 15) genes, respectively. The mutational status of both genes was evaluated by polymerase chain reaction and sequencing analysis. Although the overall frequency of KRAS mutations (36.6%) seemed to be similar to those reported for other populations, the rate of point mutations at codon 13 was significantly lower (12%) in Greek patients with colorectal cancer and associated with male gender (P < 0.05). Tumors with G>T codon 12 transversions and G>C transitions showed more frequent lymph node metastasis (P < 0.05, P < 0.005, respectively). The rate of KRAS mutations gradually decreased with increasing histological grade (P < 0.05), as opposed to BRAF mutations, which were strongly associated with poorly differentiated tumors (P < 0.005). Additionally, we found that the histological features of preexisting adenoma were associated with the absence of BRAF mutations, in contrast to KRAS (P < 0.05). Our data suggested that there seems to be a correlation between morphological criteria and discrete genetic pathways in colorectal carcinogenesis. Moreover, ethnic or geographic factors may have an impact on genetic background of colorectal carcinomas, and specific types of KRAS mutations may influence the metastatic potential of colorectal tumors.

Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.

PubMed Central

Pi, J; Wookey, P J; Pittard, A J

1991-01-01

The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024

Osteogenesis imperfecta type I: Molecular heterogeneity for COL1A1 null alleles of type I collagen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willing, M.C.; Deschenes, S.P.; Pitts, S.H.

Osteogenesis imperfecta (OI) type I is the mildest form of inherited brittle-bone disease. Dermal fibroblasts from most affected individuals produce about half the usual amount of type I procollagen, as a result of a COL1A1 {open_quotes}null{close_quotes} allele. Using PCR amplification of genomic DNA from affected individuals, followed by denaturing gradient gel electrophoresis (DGGE) and SSCP, we identified seven different COL1A1 gene mutations in eight unrelated families with OI type I. Three families have single nucleotide substitutions that alter 5{prime} donor splice sites; two of these unrelated families have the same mutation. One family has a point mutation, in an exon,more » that creates a premature termination codon, and four have small deletions or insertions, within exons, that create translational frameshifts and new termination codons downstream of the mutation sites. Each mutation leads to both marked reduction in steady-state levels of mRNA from the mutant allele and a quantitative decrease in type I procollagen production. Our data demonstrate that different molecular mechanisms that have the same effect on type I collagen production result in the same clinical phenotype. 58 refs., 4 figs., 1 tab.« less

Novel KRAS Gene Mutations in Sporadic Colorectal Cancer

PubMed Central

Naser, Walid M.; Shawarby, Mohamed A.; Al-Tamimi, Dalal M.; Seth, Arun; Al-Quorain, Abdulaziz; Nemer, Areej M. Al; Albagha, Omar M. E.

2014-01-01

Introduction In this article, we report 7 novel KRAS gene mutations discovered while retrospectively studying the prevalence and pattern of KRAS mutations in cancerous tissue obtained from 56 Saudi sporadic colorectal cancer patients from the Eastern Province. Methods Genomic DNA was extracted from formalin-fixed, paraffin-embedded cancerous and noncancerous colorectal tissues. Successful and specific PCR products were then bi-directionally sequenced to detect exon 4 mutations while Mutector II Detection Kits were used for identifying mutations in codons 12, 13 and 61. The functional impact of the novel mutations was assessed using bioinformatics tools and molecular modeling. Results KRAS gene mutations were detected in the cancer tissue of 24 cases (42.85%). Of these, 11 had exon 4 mutations (19.64%). They harbored 8 different mutations all of which except two altered the KRAS protein amino acid sequence and all except one were novel as revealed by COSMIC database. The detected novel mutations were found to be somatic. One mutation is predicted to be benign. The remaining mutations are predicted to cause substantial changes in the protein structure. Of these, the Q150X nonsense mutation is the second truncating mutation to be reported in colorectal cancer in the literature. Conclusions Our discovery of novel exon 4 KRAS mutations that are, so far, unique to Saudi colorectal cancer patients may be attributed to environmental factors and/or racial/ethnic variations due to genetic differences. Alternatively, it may be related to paucity of clinical studies on mutations other than those in codons 12, 13, 61 and 146. Further KRAS testing on a large number of patients of various ethnicities, particularly beyond the most common hotspot alleles in exons 2 and 3 is needed to assess the prevalence and explore the exact prognostic and predictive significance of the discovered novel mutations as well as their possible role in colorectal carcinogenesis. PMID:25412182

Isolation of Mycobacterium tuberculosis Strains with a Silent Mutation in rpoB Leading to Potential Misassignment of Resistance Category ▿

PubMed Central

Alonso, María; Palacios, Juan José; Herranz, Marta; Penedo, Ana; Menéndez, Ángela; Bouza, Emilio; García de Viedma, Darío

2011-01-01

Our study provides an alert regarding the transmission of rifampin-susceptible strains of Mycobacterium tuberculosis with a silent substitution in codon 514 of rpoB. Among 1,450 cases, we identified 12 isolates sharing this mutation and related restriction fragment length polymorphism (RFLP) types. The mutation impaired hybridization with the wild-type probes in three independent commercial assays, which could lead to misassignment of resistance. PMID:21562104

Compound heterozygosity for Hb S [beta6(A3)GluVal, GAG-->GTG] and a new thalassemic mutation [beta132(H10)Lys-->term, AAA-->TAA] detected in a family from West Africa.

PubMed

Frischknecht, Hannes; Troxler, Heinz; Greiner, Jeanette; Hengartner, Heinz; Dutly, Fabrizio

2008-01-01

We describe a Hb S/beta-thalassemia (beta-thal) mutation involving an AT transition at codon 132 of the beta-globin gene. The mutation, in the heterozygous state, unlike several other mutations in exon 3, shows no signs of dominant thalassemia but those of a typical beta(0) carrier. Compound heterozygosity with Hb S [beta6(A3)GluVal, GAGGTG] showed a severe clinical picture.

Non-hyperfunctioning nodules from multinodular goiters: a minor role in pathogenesis for somatic activating mutations in the TSH-receptor and Gsalpha subunit genes.

PubMed

Derrien, C; Sonnet, E; Gicquel, I; Le Gall, J Y; Poirier, J Y; David, V; Maugendre, D

2001-05-01

Constitutive activation of the cAMP pathway stimulates thyrocyte proliferation. Gain-of-function mutations in Gsalpha protein have already been identified in thyroid nodules which have lost the ability to trap iodine. In contrast, most of the studies failed to detect somatic activating mutations in the thyrotropin receptor (TSH-R) in non-hyperfunctioning thyroid tumors. The aim of this study was to screen for mutations TSH-R exon 10, encoding the whole intracytoplasmic area involved in signal transduction, and Gsalpha exons 8 and 9, containing the two hot-spot codons 201 and 227, in a subset of non-hyperfunctioning nodules from multinodular goiter. Identified by matching ultrasonography and scintiscan, 22 eufunctioning (normal 99Tc uptake) and 15 nonfunctioning (decreased 99Tc uptake) nodules from 27 non-toxic multinodular goiters were isolated. After DNA extraction, TSH-R exon 10 was analyzed by direct sequencing of the PCR products and Gsalpha exons 8 and 9 by Denaturing Gradient Gel Electrophoresis. No mutation of TSH-R or Gsalpha was detected in the 37 nodules analyzed. This absence of mutation, despite the use of two sensitive screening methods associated with the analysis of the TSH-R whole intracytoplasmic area and Gsalpha two hot-spot codons, suggests that TSH-R and Gsalpha play a minor role in the pathogenesis of non-toxic nodules from multinodular goiters.

A novel germline inactivating mutation in the CASR gene in an Italian kindred affected by familial hypocalciuric hypercalcemia.

PubMed

Falchetti, Alberto; Gozzini, Alessia; Terranegra, Annalisa; Soldati, Laura; Vezzoli, Giuseppe; Leoncini, Gigliola; Giusti, Francesca; Franceschelli, Francesco; Masi, Laura; Tanini, Annalisa; Cavalli, Loredana; Brandi, Maria Luisa

2012-05-01

Familial hypocalciuric hypercalcemia (FHH) syndrome is a rare benign condition, inherited as an autosomal dominant trait, in which inactivating mutations of the calcium-sensing receptor (CASR) gene affects the body's ability to regulate calcium homeostasis. Its outcome is featured by increased levels of serum calcium, moderate hypophosphatemia, and inadequately normal or elevated circulating parathyroid hormone levels. Affected patients are mostly asymptomatic and do not benefit from surgical resection of their mildly enlarged parathyroids. We evaluated for hypercalcemia an Italian family that was identified via a young adult male proband referred to our center for parathyroidectomy. The patients and the family members were evaluated both biochemically and genetically as suspected FHH subjects. An in vitro functional study was performed by site-directed mutagenesis, and CASR activity was monitored by measuring intracellular calcium ([Ca(2)(+)](i)). The patient had a novel germline heterozygous CASR mutation (c.361_364GATT; p.D121del/fsX122). The mutation caused a premature stop codon at codon 122, exiting a truncated protein. The biochemical phenotype of all family members carrying the heterozygous deletion was concordant with classic FHH syndrome. Our findings confirm the role of CASR gene mutational analysis to offer a valuable addition for the recognition of FHH in hypercalcemic patients not yet characterized for a positive familial history of hypercalcemia, the only condition that identifies CASR gene mutations in hypercalcemia.

A novel alpha-thalassemia nonsense mutation in HBA2: C.382 A > T globin gene.

PubMed

Hamid, Mohammad; Bokharaei Merci, Hanieh; Galehdari, Hamid; Saberi, Ali Hossein; Kaikhaei, Bijan; Mohammadi-Anaei, Marziye; Ahmadzadeh, Ahmad; Shariati, Gholamreza

2014-07-01

In this study, a new alpha globin gene mutation on the α2-globin gene is reported. This mutation resulted in a Lys > stop codon substitution at position 127 which was detected in four individuals (three males and one female). DNA sequencing revealed this mutation in unrelated persons in Khuzestan province, Southwestern Iran of Lor ethnicity. This mutation caused no severe hematological abnormalities in the carriers. From the nature of substituted residues in α2-globin, it is widely expected that this mutation leads to unstable and truncated protein and should be detected in couples at risk for α-thalassemia.

Codon usage and expression level of human mitochondrial 13 protein coding genes across six continents.

PubMed

Chakraborty, Supriyo; Uddin, Arif; Mazumder, Tarikul Huda; Choudhury, Monisha Nath; Malakar, Arup Kumar; Paul, Prosenjit; Halder, Binata; Deka, Himangshu; Mazumder, Gulshana Akthar; Barbhuiya, Riazul Ahmed; Barbhuiya, Masuk Ahmed; Devi, Warepam Jesmi

2017-12-02

The study of codon usage coupled with phylogenetic analysis is an important tool to understand the genetic and evolutionary relationship of a gene. The 13 protein coding genes of human mitochondria are involved in electron transport chain for the generation of energy currency (ATP). However, no work has yet been reported on the codon usage of the mitochondrial protein coding genes across six continents. To understand the patterns of codon usage in mitochondrial genes across six different continents, we used bioinformatic analyses to analyze the protein coding genes. The codon usage bias was low as revealed from high ENC value. Correlation between codon usage and GC3 suggested that all the codons ending with G/C were positively correlated with GC3 but vice versa for A/T ending codons with the exception of ND4L and ND5 genes. Neutrality plot revealed that for the genes ATP6, COI, COIII, CYB, ND4 and ND4L, natural selection might have played a major role while mutation pressure might have played a dominant role in the codon usage bias of ATP8, COII, ND1, ND2, ND3, ND5 and ND6 genes. Phylogenetic analysis indicated that evolutionary relationships in each of 13 protein coding genes of human mitochondria were different across six continents and further suggested that geographical distance was an important factor for the origin and evolution of 13 protein coding genes of human mitochondria. Copyright © 2017 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

CCC CGA is a weak translational recoding site in Escherichia coli.

PubMed

Shu, Ping; Dai, Huacheng; Mandecki, Wlodek; Goldman, Emanuel

2004-12-08

Previously published experiments had indicated unexpected expression of a control vector in which a beta-galactosidase reporter was in the +1 reading frame relative to the translation start. This control vector contained the codon pair CCC CGA in the zero reading frame, raising the possibility that ribosomes rephased on this sequence, with peptidyl-tRNA(Pro) pairing with CCC in the +1 frame. This putative rephasing might also be exacerbated by the rare CGA Arg codon in the second position due to increased vacancy of the ribosomal A-site. To test this hypothesis, a series of site-directed mutants was constructed, including mutations in both the first and second codons of this codon pair. The results show that interrupting the continuous run of C residues with synonymous codon changes essentially abolishes the frameshift. Further, changing the rare Arg codon to a common Arg codon also reduces the frequency of the frameshift. These results provide strong support for the hypothesis that CCC CGA in the zero frame is indeed a weak translational frameshift site in Escherichia coli, with a 1-2% efficiency. Because the vector sequence also contains another CCC triplet in the +1 reading frame starting within the next codon after the CGA, our data also support possible contribution to expression of a +7 nucleotide ribosome hop into the same +1 reading frame. We also confirm here a previous report that CCC UGA is a translational frameshift site, in these experiments, with about 5% efficiency.

Homozygosity for a newly identified missense mutation in a patient with very severe combined immunodeficiency due to adenosine deaminase deficiency (ADA-SCID).

PubMed Central

Hirschhorn, R; Chakravarti, V; Puck, J; Douglas, S D

1991-01-01

We have identified a previously unrecognized missense mutation in a patient with severe combined immunodeficiency due to adenosine deaminase deficiency (ADA-SCID). The mutation is a G646-to-A transition at a CG dinucleotide and predicts a glycine-to-arginine substitution at codon 216. Computer analysis of secondary structure predicts a major alteration with loss of a beta-pleated sheet in a highly conserved region of the protein. The basepair substitution also generates a new site for the restriction enzyme BstXI in exon 7 of the genomic DNA. Digestion of genomic DNA from the patient and from his parents revealed that he was homozygous for the mutation and that his mother and father were carriers. This mutation in homozygous form appears to be associated with very severe disease, since the patient had perinatal onset of clinical manifestations of SCID, the highest concentration of the toxic metabolite deoxyATP in nine patients studied, and a relatively poor immunologic response during the initial 2 years of therapy with polyethylene glycol-adenosine deaminase. Analysis of DNA from 21 additional patients with ADA-SCID and from 19 unrelated normals revealed that, while none of the normal individuals showed the abnormal restriction fragment, two of the 21 patients studied were heterozygous for the G646-to-A mutation. Images Figure 2 PMID:1680289

KRAS Testing

PubMed Central

Shackelford, Rodney E.; Whitling, Nicholas A.; McNab, Patricia; Japa, Shanker

2012-01-01

Activating point mutations in codons 12, 13, and 61 of the KRAS proto-oncogene are common in colorectal, non–small cell lung, pancreatic, and thyroid cancers. Constitutively activated KRAS mutations are strongly associated with a resistance to anti–epidermal growth factor receptor (EGFR) therapies, such as panitumumab and cetuximab used for treating metastatic colorectal carcinoma and EGFR tyrosine inhibitors used for advanced non–small cell lung cancers. Since anti-EGFR therapies are costly and may exert deleterious effects on individuals without activating mutations, KRAS mutation testing is recommended prior to the initiation of anti-EGFR therapy for these malignancies. The goal of this review is to summarize the KRAS mutation testing methods. Testing is now routinely requested in the clinical practice to provide data to assign the most appropriate anticancer chemotherapy for each given patient. Review of the most relevant literature was performed. Several areas were considered: ordering of the test, selection of the sample to be tested, and review of the testing methodologies. We found that several different methods are used for clinical KRAS mutation testing. Each of the methodologies is described, and information is provided about their performance, cost, turnaround times, detection limits, sensitivities, and specificities. We also provided “tips” for the appropriate selection and preparation of the sample to be tested. This is an important aspect of KRAS testing for clinical use, as the results of the test will affect clinical decisions with consequences for the patient. PMID:23264846

Teaching the fluctuation test in silico by using mutate: a program to distinguish between the adaptive and spontaneous mutation hypotheses.

PubMed

Carvajal-Rodríguez, Antonio

2012-07-01

Mutate is a program developed for teaching purposes to impart a virtual laboratory class for undergraduate students of Genetics in Biology. The program emulates the so-called fluctuation test whose aim is to distinguish between spontaneous and adaptive mutation hypotheses in bacteria. The plan is to train students in certain key multidisciplinary aspects of current genetics such as sequence databases, DNA mutations, and hypothesis testing, while introducing the fluctuation test. This seminal experiment was originally performed studying Escherichia coli resistance to the infection by bacteriophage T1. The fluctuation test initiated the modern bacterial genetics that 25 years later ushered in the era of the recombinant DNA. Nowadays we know that some deletions in fhuA, the gene responsible for E. coli membrane receptor of T1, could cause the E. coli resistance to this phage. For the sake of simplicity, we will introduce the assumption that a single mutation generates the resistance to T1. During the practical, the students use the program to download some fhuA gene sequences, manually introduce some stop codon mutations, and design a fluctuation test to obtain data for distinguishing between preadaptative (spontaneous) and induced (adaptive) mutation hypotheses. The program can be launched from a browser or, if preferred, its executable file can be downloaded from http://webs.uvigo.es/acraaj/MutateWeb/Mutate.html. It requires the Java 5.0 (or higher) Runtime Environment (freely available at http://www.java.com). Copyright © 2012 Wiley Periodicals, Inc.

Growth hormone receptor gene mutations in two Italian patients with Laron Syndrome.

PubMed

Fassone, L; Corneli, G; Bellone, S; Camacho-Hübner, C; Aimaretti, G; Cappa, M; Ubertini, G; Bona, G

2007-05-01

Laron Syndrome (LS) represents a condition characterized by GH insensitivity caused by molecular defects in the GH receptor (GHR) gene or in the post-receptor signalling pathway. We report the molecular characterization of two unrelated Italian girls from Sicily diagnosed with LS. The DNA sequencing of the GHR gene revealed the presence of different nonsense mutations, occurring in the same background haplotype. The molecular defects occurred in the extracellular domain of the GHR leading to a premature termination signal and to a truncated non-functional receptor. In one patient, a homozygous G to T transversion, in exon 6, led to the mutation GAA to TAA at codon 180 (E180X), while in the second patient a homozygous C to T transition in exon 7 was detected, causing the CGA to TAA substitution at codon 217 (R217X). Both probands presented the polymorphisms Gly168Gly and Ile544Leu in a homozygous state in exons 6 and 10, respectively. The E180X represents a novel defect of the GHR gene, while the R217X mutation has been previously reported in several patients from different ethnic backgrounds but all from countries located in the Mediterranean and Middle Eastern region.

Application of a multi-channel microfluidic chip on the simultaneous detection of DNAs by using microbead-quantum dots.

PubMed

Le, Ngoc Tam; Kim, Jong Sung

2014-12-01

Several researches have shown that cancer is caused by genetic mutations especially in genes involved in cell growth and regulation. Ras family members are frequently found in their mutated, oncogenic forms in human tumors. Mutant RAS proteins are constitutively active, owing to reduce intrinsic GTPase activity and insensitivity to GTPase-activating protein (GAPs). In total, activating mutations in the RAS genes occur in approximately 20% of all human cancers, mainly in codon 12, 13 or 61. Activating mutations in the NRAS gene not only result in the reduction of intrinsic GTPase activity but also in the induction of resistance against molecules inducing such activity. In this paper, we reported a rapid, simple and portable method for detecting the mutant types of NRAS genes codon 12 and 61 simultaneously by using bead-quantum dots (QDs) based multi-channel microfluidic chip. Probe DNAs are conjugated to bead-QDs and packed in the pillars of channels in the microfluidic chip. After injection of target DNAs and intercalating dyes, the fluorescence quenching of QDs by intercalating dye was observed due to FRET phenomena. The platform can be effortlessly applied in other biological and clinical areas.

Genotypic characterization of multi-drug-resistant Mycobacterium tuberculosis isolates in Myanmar.

PubMed

Aye, Khin Saw; Nakajima, Chie; Yamaguchi, Tomoyuki; Win, Min Min; Shwe, Mu Mu; Win, Aye Aye; Lwin, Thandar; Nyunt, Wint Wint; Ti, Ti; Suzuki, Yasuhiko

2016-03-01

The number of multi-drug-resistant tuberculosis (MDR-TB) cases is rising worldwide. As a countermeasure against this situation, the implementation of rapid molecular tests to identify MDR-TB would be effective. To develop such tests, information on the frequency and distribution of mutations associating with phenotypic drug resistance in Mycobacterium tuberculosis is required in each country. During 2010, the common mutations in the rpoB, katG and inhA of 178 phenotypically MDR M. tuberculosis isolates collected by the National Tuberculosis Control Program (NTP) in Myanmar were investigated by DNA sequencing. Mutations affecting the 81-bp rifampicin (RIF) resistance-determining region (RRDR) of the rpoB were identified in 127 of 178 isolates (71.3%). Two of the most frequently affected codons were 531 and 526, with percentages of 48.3% and 14.0% respectively. For isoniazid (INH) resistance, 114 of 178 MDR-TB isolates (64.0%) had mutations in the katG in which a mutation-conferring amino acid substitution at codon 315 from Ser to Thr was the most common. Mutations in the inhA regulatory region were also detected in 20 (11.2%) isolates, with the majority at position -15. Distinct mutation rate and pattern from surrounding countries might suggest that MDR-TB has developed and spread domestically in Myanmar. Copyright © 2015 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Turbidostat Culture of Saccharomyces cerevisiae W303-1A under Selective Pressure Elicited by Ethanol Selects for Mutations in SSD1 and UTH1

PubMed Central

Avrahami-Moyal, Liat; Engelberg, David; Wenger, Jared. W.; Sherlock, Gavin; Braun, Sergei

2012-01-01

We investigated the genetic causes of ethanol tolerance by characterizing mutations selected in Saccharomyces cerevisiae W303-1A under the selective pressure of ethanol. W303-1A was subjected to three rounds of turbidostat, in medium supplemented with increasing amounts of ethanol. By the end of selection, the growth rate of the culture has increased from 0.029 h-1 to 0.32 h-1. Unlike the progenitor strain, all yeast cells isolated from this population were able to form colonies on medium supplemented with 7% ethanol within six days, our definition of ethanol tolerance. Several clones selected from all three stages of selection were able to form dense colonies within two days on solid medium supplemented with 9% ethanol. We sequenced the whole genomes of 6 clones and identified mutations responsible for ethanol tolerance. Thirteen additional clones were tested for the presence of similar mutations. In 15 out of 19 tolerant clones the stop-codon in ssd1-d was replaced with an aminoacid-encoding codon. Three other clones contained one of two mutations in UTH1, and one clone did not contain mutations in either SSD1 or UTH1. We showed that the mutations in SSD1 and UTH1 increased tolerance of the cell wall to zymolyase and conclude that stability of the cell wall is a major factor in increased tolerance to ethanol. PMID:22443114

Sequence analysis of the drug‑resistant rpoB gene in the Mycobacterium tuberculosis L‑form among patients with pneumoconiosis complicated by tuberculosis.

PubMed

Lu, Jun; Jiang, Shan; Ye, Song; Deng, Yun; Ma, Shuai; Li, Chao-Pin

2014-04-01

The aim of the present study was to investigate the mutational characteristics of the drug‑resistant Mycobacterium tuberculosis L‑form of the rpoB gene isolated from patients with pneumoconiosis complicated by tuberculosis, in order to reduce the occurrence of the drug resistance of patients and gain a more complete information on the resistance of the Mycobacterium tuberculosis L‑form. A total of 42 clinically isolated strains of Mycobacterium tuberculosis L‑form were collected, including 31 drug‑resistant strains. The genomic DNA was extracted, then the target genes were amplified by polymerase chain reaction and the hot mutational regions of the rpoB gene were analyzed by direct sequencing. The results revealed that no rpoB gene mutation was present in 11 rifampicin (RFP)‑sensitive strains, while conformational changes were identified in 31 RFP‑resistant strains. The mutation rate was 93.55% (29/31) in the resistant strains, and was frequently concentrated in codons 531 (51.61%; 16/31) and 526 (32.26%; 10/31), mainly occurring by case substitutions, including 27 unit point mutations and two two‑point mutations. The novel mutation identified in codon 516 had not been previously reported. The substitution of highly‑conserved amino acids encoded by the rpoB gene resulted in the molecular mechanism responsible for RFP resistance in the Mycobacterium tuberculosis L‑form. This also demonstrated that the rpoB gene is diversiform.

Waardenburg syndrome type II in a Chinese patient caused by a novel nonsense mutation in the SOX10 gene.

PubMed

Ma, Jing; Zhang, Tie-Song; Lin, Ken; Sun, Hao; Jiang, Hong-Chao; Yang, Yan-Li; Low, Fan; Gao, Ying-Qin; Ruan, Biao

2016-06-01

Waardenburg syndrome is a congenital genetic disorder. It is the most common type of syndromic hearing impairment with highly genetic heterogeneity and proved to be related by 6 genes as follows: PAX3, MITF, SNAI2, EDN3, EDNRB and SOX10. This article aims to identify the genetic causes of a Chinese WS child patient. A Chinese WS child was collected for clinical data collection by questionnaire survey. DNA samples of proband and his parents were extracted from peripheral blood samples. Six candidate genes were sequenced by the Trusight One sequencing panel on the illumina NextSeq 500 platform. A novel nonsense heterozygous mutation was found in the coding region of exon 2 in the SOX10 gene of proband. The novel nonsense heterozygous mutation could cause the replacement of the 55th lysine codon by stop codon (484T > C, C142R) and further more possibly cause terminating the protein translation in advance. However, both proband's parents had no mutation of genes above mentioned. The gene mutation of SOX10 [NM_006941.3 c.163A > T] is a novel nonsense mutation. No record of this mutation has been found in dbSNP, HGMD, 1000 Genomes Project, ClinVar and ESP6500 databases. It meets the condition of PS2 of strong evidence in 2015 ACMG Standards and Guidelines. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

New mutations of DAX-1 genes in two Japanese patients with X-linked congenital adrenal hypoplasia and hypogonadotropic hypogonadism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yanase, Toshihiko; Takayanagi, Ryoichi; Oba, Koichi

Congenital adrenal hypoplasia, an X-linked disorder, is characterized by primary adrenal insufficiency and frequent association with hypogonadotropic hypogonadism. The X-chromosome gene DAX-1 has been most recently identified and shown to be responsible for this disorder. We analyzed the DAX-1 genes of two unrelated Japanese patients with congenital adrenal hypoplasia and hypogonadotropic hypogonadism by using PCR amplification of genomic DNA and its complete exonic sequencing. In a family containing several affected individuals, the proband male patient had a stop codon (TGA) in place of tryptophan (TGG) at amino acid position 171. As expected, his mother was a heterozygous carrier for themore » mutation, whereas his father and unaffected brother did not carry this mutation. In another male patient with noncontributory family history, sequencing revealed a 1-bp (T) deletion at amino acid position 280, leading to a frame shift and, subsequently a premature stop codon at amino acid position 371. The presence of this mutation in the patients` genome was further confirmed by digestion of genomic PCR product with MspI created by this mutation. Family studies using MspI digestion of genomic PCR products revealed that neither parent of this individual carried the mutation. These results clearly indicate that congenital adrenal hypoplasia and hypogonadotropic hypogonadism result from not only inherited but also de novo mutation in the DAX-1 gene. 31 refs., 4 figs., 2 tabs.« less

Analysis of base and codon usage by rubella virus.

PubMed

Zhou, Yumei; Chen, Xianfeng; Ushijima, Hiroshi; Frey, Teryl K

2012-05-01

Rubella virus (RUBV), a small, plus-strand RNA virus that is an important human pathogen, has the unique feature that the GC content of its genome (70%) is the highest (by 20%) among RNA viruses. To determine the effect of this GC content on genomic evolution, base and codon usage were analyzed across viruses from eight diverse genotypes of RUBV. Despite differences in frequency of codon use, the favored codons in the RUBV genome matched those in the human genome for 18 of the 20 amino acids, indicating adaptation to the host. Although usage patterns were conserved in corresponding genes in the diverse genotypes, within-genome comparison revealed that both base and codon usages varied regionally, particularly in the hypervariable region (HVR) of the P150 replicase gene. While directional mutation pressure was predominant in determining base and codon usage within most of the genome (with the strongest tendency being towards C's at third codon positions), natural selection was predominant in the HVR region. The GC content of this region was the highest in the genome (>80%), and it was not clear if selection at the nucleotide level accompanied selection at the amino acid level. Dinucleotide frequency analysis of the RUBV genome revealed that TpA usage was lower than expected, similar to mammalian genes; however, CpG usage was not suppressed, and TpG usage was not enhanced, as is the case in mammalian genes.

A novel mutation in the FGB: c.1105C>T turns the codon for amino acid Bβ Q339 into a stop codon causing hypofibrinogenemia.

PubMed

Marchi, Rita; Brennan, Stephen; Meyer, Michael; Rojas, Héctor; Kanzler, Daniela; De Agrela, Marisela; Ruiz-Saez, Arlette

2013-03-01

Routine coagulation tests on a 14year-old male with frequent epistaxis showed a prolonged thrombin time together with diminished functional (162mg/dl) and gravimetric (122mg/dl) fibrinogen concentrations. His father showed similar aberrant results and sequencing of the three fibrinogen genes revealed a novel heterozygous nonsense mutation in the FGB gene c.1105C>T, which converts the codon for residue Bβ 339Q to stop, causing deletion of Bβ chain residues 339-461. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and RP-HPLC (reverse-phase high-pressure liquid chromatography) of purified fibrinogen showed only normal Aα, Bβ, and γ chains, indicating that molecules with the truncated 37,990Da β chain were not secreted into plasma. Functional analysis showed impaired fibrin polymerization, fibrin porosity, and elasticity compared to controls. By laser scanning confocal microscopy the patient's fibers were slightly thinner than normal. Electrospray ionization mass spectrometry (ESI MS) presented normal sialylation of the oligosaccharide chains, and liver function tests showed no evidence of liver dysfunction that might explain the functional abnormalities. Copyright © 2012 Elsevier Inc. All rights reserved.

Structural insights into eRF3 and stop codon recognition by eRF1

PubMed Central

Cheng, Zhihong; Saito, Kazuki; Pisarev, Andrey V.; Wada, Miki; Pisareva, Vera P.; Pestova, Tatyana V.; Gajda, Michal; Round, Adam; Kong, Chunguang; Lim, Mengkiat; Nakamura, Yoshikazu; Svergun, Dmitri I.; Ito, Koichi; Song, Haiwei

2009-01-01

Eukaryotic translation termination is mediated by two interacting release factors, eRF1 and eRF3, which act cooperatively to ensure efficient stop codon recognition and fast polypeptide release. The crystal structures of human and Schizosaccharomyces pombe full-length eRF1 in complex with eRF3 lacking the GTPase domain revealed details of the interaction between these two factors and marked conformational changes in eRF1 that occur upon binding to eRF3, leading eRF1 to resemble a tRNA molecule. Small-angle X-ray scattering analysis of the eRF1/eRF3/GTP complex suggested that eRF1's M domain contacts eRF3's GTPase domain. Consistently, mutation of Arg192, which is predicted to come in close contact with the switch regions of eRF3, revealed its important role for eRF1's stimulatory effect on eRF3's GTPase activity. An ATP molecule used as a crystallization additive was bound in eRF1's putative decoding area. Mutational analysis of the ATP-binding site shed light on the mechanism of stop codon recognition by eRF1. PMID:19417105

Mutation discovery for Mendelian traits in non-laboratory animals: a review of achievements up to 2012

PubMed Central

Nicholas, Frank W; Hobbs, Matthew

2014-01-01

Within two years of the re-discovery of Mendelism, Bateson and Saunders had described six traits in non-laboratory animals (five in chickens and one in cattle) that show single-locus (Mendelian) inheritance. In the ensuing decades, much progress was made in documenting an ever-increasing number of such traits. In 1987 came the first discovery of a causal mutation for a Mendelian trait in non-laboratory animals: a non-sense mutation in the thyroglobulin gene (TG), causing familial goitre in cattle. In the years that followed, the rate of discovery of causal mutations increased, aided mightily by the creation of genome-wide microsatellite maps in the 1990s and even more mightily by genome assemblies and single-nucleotide polymorphism (SNP) chips in the 2000s. With sequencing costs decreasing rapidly, by 2012 causal mutations were being discovered in non-laboratory animals at a rate of more than one per week. By the end of 2012, the total number of Mendelian traits in non-laboratory animals with known causal mutations had reached 499, which was half the number of published single-locus (Mendelian) traits in those species. The distribution of types of mutations documented in non-laboratory animals is fairly similar to that in humans, with almost half being missense or non-sense mutations. The ratio of missense to non-sense mutations in non-laboratory animals to the end of 2012 was 193:78. The fraction of non-sense mutations (78/271 = 0.29) was not very different from the fraction of non-stop codons that are just one base substitution away from a stop codon (21/61 = 0.34). PMID:24372556

High frequency of genes' promoter methylation, but lack of BRAF V600E mutation among Iranian colorectal cancer patients.

PubMed

Naghibalhossaini, Fakhraddin; Hosseini, Hamideh Mahmoodzadeh; Mokarram, Pooneh; Zamani, Mozhdeh

2011-12-01

Gene silencing due to DNA hypermethylation is a major mechanism for loss of tumor suppressor genes function in colorectal cancer. Activating V600E mutation in BRAF gene has been linked with widespread methylation of CpG islands in sporadic colorectal cancers. The aim of the present study was to evaluate the methylation status of three cancer-related genes, APC2, p14ARF, and ECAD in colorectal carcinogenesis and their association with the mutational status of BRAF and KRAS among Iranian colorectal cancer patients. DNA from 110 unselected series of sporadic colorectal cancer patients was examined for BRAF V600E mutation by PCR-RFLP. Promoter methylation of genes in tumors was determined by methylation specific PCR. The frequency of APC2, E-CAD, and p14 methylation was 92.6%, 40.4% and 16.7%, respectively. But, no V600E mutation was identified in the BRAF gene in any sample. No association was found in cases showing epigenetic APC, ECAD, and p14 abnormality with the clinicopathological parameters under study. The association between KRAS mutations and the so called methylator phenotype was previously reported. Therefore, we also analyzed the association between the hot spot KRAS gene mutations in codons of 12 and 13 with genes' promoter hypermethylation in a subset of this group of patients. Out of 86 tumors, KRAS was mutated in 24 (28%) of tumors, the majority occurring in codon 12. KRAS mutations were not associated with genes' methylation in this tumor series. These findings suggest a distinct molecular pathway for methylation of APC2, p14, and ECAD genes from those previously described for colorectal cancers with BRAF or KRAS mutations.

Novel mutation in the adiponectin (ADIPOQ) gene is associated with hypoadiponectinaemia in Japanese-Brazilians.

PubMed

Vendramini, Marcio F; Kasamatsu, Teresa S; Crispim, Felipe; Ferreira, Sandra R; Matioli, Sergio R; Moisés, Regina S

2009-07-01

Adiponectin is an important mediator of insulin sensitivity, encoded by the ADIPOQ gene. Here we describe two Japanese-Brazilian families with hypoadiponectinaemia due to a novel mutation in ADIPOQ. In this study, we examined the entire translated regions of adiponectin in Japanese-Brazilians, a population with one of the highest prevalence rates of diabetes worldwide. We screened 200 patients with type 2 diabetes (DM) and 240 age-matched subjects with normal glucose tolerance. A novel heterozygous T deletion at position 186 in exon 2 of ADIPOQ, causing a frameshift at codon 62 and leading to a premature termination at codon 168 (p.Gly63ValfsX106), was found in two individuals with diabetes. This mutation was not found in 240 nondiabetic control subjects. In addition, we screened the mutation in an expanded set of 100 nondiabetic subjects from the general Brazilian population, but we found no mutations. In addition, six family members of the probands were identified as mutation-carriers. Individuals who were mutation-carriers had markedly low plasma adiponectin concentrations compared with those without the mutation [DM: 0.65 (0.59-1.34) microg/ml vs. 5.30 (3.10-8.55) microg/ml, P < 0.0001; normal glucose tolerance: 0.95 (0.76-1.48) microg/ml vs. 8.50 (5.52-14.55) microg/ml, P = 0.003]. All individuals carrying the p.Gly63ValfsX106 mutation and older than 30 years were found to be diabetic. We describe for the first time a frameshift mutation in exon 2 of the ADIPOQ gene, which modulates adiponectin levels and may contribute to the genetic risk of late-onset diabetes in Japanese-Brazilians.

Seven novel mutations in the factor XIII A-subunit gene causing hereditary factor XIII deficiency in 10 unrelated families.

PubMed

Vysokovsky, A; Saxena, R; Landau, M; Zivelin, A; Eskaraev, R; Rosenberg, N; Seligsohn, U; Inbal, A

2004-10-01

Hereditary factor (F)XIII deficiency is a rare bleeding disorder mostly due to mutations in FXIII A subunit. We studied the molecular basis of FXIII deficiency in patients from 10 unrelated families originating from Israel, India and Tunisia. Exons 2-15 of genomic DNA consisting of coding regions and intron/exon boundaries were amplified and sequenced. Structural analysis of the mutations was undertaken by computer modeling. Seven novel mutations were identified in the FXIIIA gene. The propositus from the Ethiopian-Jewish family was found to be a compound heterozygote for two novel mutations: a 10-bp deletion in exon 12 at nucleotides 1652-1661 (followed by 22 altered amino acids and termination codon) and Ala318Val mutation. The propositus of the Tunisian family was homozygous for C insertion after nucleotide 863 within a stretch of six cytosines of exon 7. This insertion results in generation of eight altered amino acids followed by a termination codon downstream. The propositus from Indian-Jewish origin was found to be homozygous for G to T substitution at IVS 11 [+1] resulting in skipping of exons 10 and 11. In addition to the Ala318Val mutation, three of the novel mutations identified are missense mutations: Arg260Leu, Thr398Asn and Gly210Arg each occurring in a homozygous state in an Israeli-Arab and two Indian families, respectively. Structure-function correlation analysis by computer modeling of the new missense mutations predicted that Gly210Arg will cause protein misfolding, Ala318Val and Thr398Asn will interfere with the catalytic process or protein stability, and Arg260Leu will impair dimerization.

Thiamine-responsive megaloblastic anemia: early diagnosis may be effective in preventing deafness.

PubMed

Onal, Hasan; Bariş, Safa; Ozdil, Mine; Yeşil, Gözde; Altun, Gürkan; Ozyilmaz, Isa; Aydin, Ahmet; Celkan, Tiraje

2009-01-01

Thiamine-responsive megaloblastic anemia syndrome is an autosomal recessive disorder characterized by diabetes mellitus, megaloblastic anemia and sensorineural hearing loss. Mutations in the SLC19A2 gene, encoding a high-affinity thiamine transporter protein, THTR-1, are responsible for the clinical features associated with thiamine-responsive megaloblastic anemia syndrome in which treatment with pharmacological doses of thiamine correct the megaloblastic anemia and diabetes mellitus. The anemia can recur when thiamine is withdrawn. Thiamine may be effective in preventing deafness if started before two months. Our patient was found homozygous for a mutation, 242insA, in the nucleic acid sequence of exon B, with insertion of an adenine introducing a stop codon at codon 52 in the high-affinity thiamine transporter gene, SLC19A2, on chromosome 1q23.3.

Functional analysis of a proline to serine mutation in codon 453 of the thyroid hormone receptor {beta}1 gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ozata, M.; Suzuki, Satoru; Takeda, Teiji

Mutations in the gene encoding human thyroid hormone receptor {beta}(hTR{beta}) have been associated with generalized resistance to thyroid hormone (GRTH). This disorder is associated with significant behavoral abnormalities. We examined the hTR{beta} gene in a family with members who manifest inappropriately normal TSH, elevated free T{sub 4}, and free and total T{sub 3}. Sequence analysis showed a cytosine to thymine transition at nucleotide 1642 in one allele of the index patient`s genomic DNA. This altered proline to serine at codon 453. The resulting mutant receptor when expressed in vitro bound DNA with high affinity, but the T{sub 3} affinity ofmore » the receptor was impaired. The mutant TR demonstrated a dominant negative effect when cotransfected with two isoforms of wild-type receptor and also in the presence of TR variant {alpha}2 in COS-1 cells. Mutations of codon 453 occur more frequently than at other sites, and four different amino acid substitutions have been reported. Significant differences in phenotype occur among affected individuals, varying from normality to moderately severe GRTH. There is no clear correlation between K{sub a} or in vitro function of the mutant receptor, and phenotype. This study extends the association between GRTH and illness, and indicates that early diagnosis and counseling are needed in families with TR{beta}1 abnormalities. 34 refs., 5 figs., 2 tabs.« less

Sequence and structure-specific elements of HERG mRNA determine channel synthesis and trafficking efficiency

PubMed Central

Sroubek, Jakub; Krishnan, Yamini; McDonald, Thomas V.

2013-01-01

Human ether-á-gogo-related gene (HERG) encodes a potassium channel that is highly susceptible to deleterious mutations resulting in susceptibility to fatal cardiac arrhythmias. Most mutations adversely affect HERG channel assembly and trafficking. Why the channel is so vulnerable to missense mutations is not well understood. Since nothing is known of how mRNA structural elements factor in channel processing, we synthesized a codon-modified HERG cDNA (HERG-CM) where the codons were synonymously changed to reduce GC content, secondary structure, and rare codon usage. HERG-CM produced typical IKr-like currents; however, channel synthesis and processing were markedly different. Translation efficiency was reduced for HERG-CM, as determined by heterologous expression, in vitro translation, and polysomal profiling. Trafficking efficiency to the cell surface was greatly enhanced, as assayed by immunofluorescence, subcellular fractionation, and surface labeling. Chimeras of HERG-NT/CM indicated that trafficking efficiency was largely dependent on 5′ sequences, while translation efficiency involved multiple areas. These results suggest that HERG translation and trafficking rates are independently governed by noncoding information in various regions of the mRNA molecule. Noncoding information embedded within the mRNA may play a role in the pathogenesis of hereditary arrhythmia syndromes and could provide an avenue for targeted therapeutics.—Sroubek, J., Krishnan, Y., McDonald, T V. Sequence- and structure-specific elements of HERG mRNA determine channel synthesis and trafficking efficiency. PMID:23608144

Maple Syrup Urine Disease in Cypriot Families: Identification of Three Novel Mutations and Biochemical Characterization of the p.Thr211Met Mutation in the E1α Subunit

PubMed Central

Georgiou, Theodoros; Chuang, Jacinta L.; Wynn, R. Max; Stylianidou, Goula; Korson, Mark; Chuang, David T.

2009-01-01

We report five mutations, three of them novel, responsible for maple syrup urine disease in four unrelated Cypriot families. The five children studied are the first cases of classic maple syrup urine disease to be reported among Cypriots. The first novel mutation identified is a single-base deletion in exon 6 of the Elα gene (c.718delG), which leads to a frameshift after Ala240 and to a stop codon 89 residues further downstream. The other two novel mutations identified are in the Elβ subunit: a two-base deletion in exon 6, c.662_663delCC, which leads to a frameshift after Ala221 and creates a stop codon 17 residues further downstream, as well as a splice mutation, IVS3[+3]delA, which results in the skipping of exon 3. The two known mutations identified are in the Elα gene: the G > C transversion at the 3′-splice acceptor site, (IVS5-1G > C), which results in the deletion of the entire exon 6, and the missense mutation in exon 5 (c.632C > T), which corresponds to a p.Thr211Met substitution. The p.Thr211Met substitution is located in a potassium-ion pocket in the E1 component required for stability of the bound cofactor thiamine diphosphate. The mutant E1 protein harboring the p.Thr211Met substitution was shown unable to bind thiamine diphosphate, leading to undetectable E1 activity. PMID:19715473

Germline mutations of regulator of telomere elongation helicase 1, RTEL1, in Dyskeratosis congenita.

PubMed

Ballew, Bari J; Yeager, Meredith; Jacobs, Kevin; Giri, Neelam; Boland, Joseph; Burdett, Laurie; Alter, Blanche P; Savage, Sharon A

2013-04-01

Dyskeratosis congenita (DC) is an inherited bone marrow failure and cancer predisposition syndrome caused by aberrant telomere biology. The classic triad of dysplastic nails, abnormal skin pigmentation, and oral leukoplakia is diagnostic of DC, but substantial clinical heterogeneity exists; the clinically severe variant Hoyeraal Hreidarsson syndrome (HH) also includes cerebellar hypoplasia, severe immunodeficiency, enteropathy, and intrauterine growth retardation. Germline mutations in telomere biology genes account for approximately one-half of known DC families. Using exome sequencing, we identified mutations in RTEL1, a helicase with critical telomeric functions, in two families with HH. In the first family, two siblings with HH and very short telomeres inherited a premature stop codon from their mother who has short telomeres. The proband from the second family has HH and inherited a premature stop codon in RTEL1 from his father and a missense mutation from his mother, who also has short telomeres. In addition, inheritance of only the missense mutation led to very short telomeres in the proband's brother. Targeted sequencing identified a different RTEL1 missense mutation in one additional DC proband who has bone marrow failure and short telomeres. Both missense mutations affect the helicase domain of RTEL1, and three in silico prediction algorithms suggest that they are likely deleterious. The nonsense mutations both cause truncation of the RTEL1 protein, resulting in loss of the PIP box; this may abrogate an important protein-protein interaction. These findings implicate a new telomere biology gene, RTEL1, in the etiology of DC.

Germline Mutations of Regulator of Telomere Elongation Helicase 1, RTEL1, In Dyskeratosis Congenita

PubMed Central

Ballew, Bari J.; Yeager, Meredith; Jacobs, Kevin; Giri, Neelam; Boland, Joseph; Burdett, Laurie; Alter, Blanche P.; Savage, Sharon A.

2013-01-01

Dyskeratosis congenita (DC) is an inherited bone marrow failure and cancer predisposition syndrome caused by aberrant telomere biology. The classic triad of dysplastic nails, abnormal skin pigmentation, and oral leukoplakia is diagnostic of DC, but substantial clinical heterogeneity exists; the clinically severe variant Hoyeraal Hreidarsson syndrome (HH) also includes cerebellar hypoplasia, severe immunodeficiency, enteropathy, and intrauterine growth retardation. Germline mutations in telomere biology genes account for approximately one-half of known DC families. Using exome sequencing, we identified mutations in RTEL1, a helicase with critical telomeric functions, in two families with HH. In the first family, two siblings with HH and very short telomeres inherited a premature stop codon from their mother who has short telomeres. The proband from the second family has HH and inherited a premature stop codon in RTEL1 from his father and a missense mutation from his mother, who also has short telomeres. Additionally, inheritance of only the missense mutation led to very short telomeres in the proband’s brother. Targeted sequencing identified a different RTEL1 missense mutation in one additional DC proband who has bone marrow failure and short telomeres. Both missense mutations affect the helicase domain of RTEL1, and three in silico prediction algorithms suggest that they are likely deleterious. The nonsense mutations both cause truncation of the RTEL1 protein, resulting in loss of the PIP box; this may abrogate an important protein-protein interaction. These findings implicate a new telomere biology gene, RTEL1, in the etiology of DC. PMID:23329068

The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes.

PubMed Central

Fletcher, Simon P; Ali, Iraj K; Kaminski, Ann; Digard, Paul; Jackson, Richard J

2002-01-01

Classical swine fever virus (CSFV) is a member of the pestivirus family, which shares many features in common with hepatitis C virus (HCV). It is shown here that CSFV has an exceptionally efficient cis-acting internal ribosome entry segment (IRES), which, like that of HCV, is strongly influenced by the sequences immediately downstream of the initiation codon, and is optimal with viral coding sequences in this position. Constructs that retained 17 or more codons of viral coding sequence exhibited full IRES activity, but with only 12 codons, activity was approximately 66% of maximum in vitro (though close to maximum in transfected BHK cells), whereas with just 3 codons or fewer, the activity was only approximately 15% of maximum. The minimal coding region elements required for high activity were exchanged between HCV and CSFV. Although maximum activity was observed in each case with the homologous combination of coding region and 5' UTR, the heterologous combinations were sufficiently active to rule out a highly specific functional interplay between the 5' UTR and coding sequences. On the other hand, inversion of the coding sequences resulted in low IRES activity, particularly with the HCV coding sequences. RNA structure probing showed that the efficiency of internal initiation of these chimeric constructs correlated most closely with the degree of single-strandedness of the region around and immediately downstream of the initiation codon. The low activity IRESs could not be rescued by addition of supplementary eIF4A (the initiation factor with ATP-dependent RNA helicase activity). The extreme sensitivity to secondary structure around the initiation codon is likely to be due to the fact that the eIF4F complex (which has eIF4A as one of its subunits) is not required for and does not participate in initiation on these IRESs. PMID:12515388

Mitochondrial DNA Mutation Associated with Leber's Hereditary Optic Neuropathy

NASA Astrophysics Data System (ADS)

Wallace, Douglas C.; Singh, Gurparkash; Lott, Marie T.; Hodge, Judy A.; Schurr, Theodore G.; Lezza, Angela M. S.; Elsas, Louis J.; Nikoskelainen, Eeva K.

1988-12-01

Leber's hereditary optic neuropathy is a maternally inherited disease resulting in optic nerve degeneration and cardiac dysrhythmia. A mitochondrial DNA replacement mutation was identified that correlated with this disease in multiple families. This mutation converted a highly conserved arginine to a histidine at codon 340 in the NADH dehydrogenase subunit 4 gene and eliminated an Sfa NI site, thus providing a simple diagnostic test. This finding demonstrated that a nucleotide change in a mitochondrial DNA energy production gene can result in a neurological disease.

BATTLE: Biomarker-Based Approaches of Targeted Therapy for Lung Cancer Elimination

DTIC Science & Technology

2008-04-01

although a grade 3 neutropenia was dose-limiting in one importance. Th th ubstrate of the CYP3A4 isoenzyme and P-gp. Its metabolism is sensitive to...tratification in clinis Molecular Pathway Biomarkers Type of Analysis EGFR EGFR Mutation ( exons 18 to 21) DNA sequencing EGFR Increased Copy Number...polysomy/am 1plification) DNA FISH K-Ras/B-Raf K-RAS Mutation (codons 12,13, 61) DNA sequencing B-RAF Mutations ( exons 11 and 15) DNA sequencing

Short stature and decreased insulin-like growth factor I (IGF-I)/growth hormone (GH)-ratio in an adult GH-deficient patient pointing to additional partial GH insensitivity due to a R179C mutation of the growth hormone receptor.

PubMed

Meyer, S; Ipek, M; Keth, A; Minnemann, T; von Mach, M A; Weise, A; Ittner, J R; Nawroth, P P; Plöckinger, U; Stalla, G K; Tuschy, U; Weber, M M; Kann, P H

2007-08-01

Genetic factors play an expanding role in understanding growth hormone (GH) disorders, therefore the German KIMS Pharmacogenetics Study was initiated with the aim of genotyping various GH-/IGF-I-axis-related genes of GH-deficient adult patients to investigate genotype:phenotype relationships and response to GH therapy. 129 consecutively enrolled GH-deficient adult patients were genotyped for variant 1 (V1) of the alternatively spliced noncoding exons in the 5'-untranslated region and for the nine coding exons of the GH receptor (GHR) gene, which obviously play a striking role in the function of the GH-IGF-I-axis. After detection of a heterozygous, non-synonymous mutation R179C in exon 6 in one single patient with acquired GH-deficiency (GHD) in late adulthood, analysis of her clinical data followed, leading to the diagnosis of mild short stature (-1.5SD). For further endocrine evaluation, five pituitary stimulation tests (arginine) of this patient were statistically compared to stimulation tests (arginine) of ten GH-deficient control patients, retrospectively. The formerly in patients with Laron syndrome and idiopathic short stature reported mutation R179C leads to an amino acid change from an arginine residue (codon CGC) to a cysteine residue (codon TGC) in position 179 of the extracellular domain of the GHR. Statistical analysis revealed significant decreased IGF-I/GH(0) ratio (p=0.004) and IGF-I/GH(max) ratio (p=0.001) of the index patient compared to the control patients, implying growth hormone resistance of the index patient at the level of the GHR, according to the detected R179C mutation. This study reports on the unusual case of a patient with mild short stature, who acquired GHD in late adulthood due to a non-secreting pituitary adenoma and get additionally diagnosed for pre-existing growth hormone insensitivity due to a formerly in two short statured patients described, single, heterozygous, non-synonymous mutation in the GHR. Our findings support the theory that heterozygous mutations in the GHR gene can have mild phenotypical consequences.

Full-length genome sequences of porcine epidemic diarrhoea virus strain CV777; Use of NGS to analyse genomic and sub-genomic RNAs

PubMed Central

Rasmussen, Thomas Bruun; Boniotti, Maria Beatrice; Papetti, Alice; Grasland, Béatrice; Frossard, Jean-Pierre; Dastjerdi, Akbar; Hulst, Marcel; Hanke, Dennis; Pohlmann, Anne; Blome, Sandra; van der Poel, Wim H. M.; Steinbach, Falko; Blanchard, Yannick; Lavazza, Antonio; Bøtner, Anette

2018-01-01

Porcine epidemic diarrhoea virus, strain CV777, was initially characterized in 1978 as the causative agent of a disease first identified in the UK in 1971. This coronavirus has been widely distributed among laboratories and has been passaged both within pigs and in cell culture. To determine the variability between different stocks of the PEDV strain CV777, sequencing of the full-length genome (ca. 28kb) has been performed in 6 different laboratories, using different protocols. Not surprisingly, each of the different full genome sequences were distinct from each other and from the reference sequence (Accession number AF353511) but they are >99% identical. Unique and shared differences between sequences were identified. The coding region for the surface-exposed spike protein showed the highest proportion of variability including both point mutations and small deletions. The predicted expression of the ORF3 gene product was more dramatically affected in three different variants of this virus through either loss of the initiation codon or gain of a premature termination codon. The genome of one isolate had a substantially rearranged 5´-terminal sequence. This rearrangement was validated through the analysis of sub-genomic mRNAs from infected cells. It is clearly important to know the features of the specific sample of CV777 being used for experimental studies. PMID:29494671

An activating G{sub s}{alpha} mutation is present in fibrous dysplasia of bone in the McCune-Albright syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shenker, A.; Weinstein, L.S.; Spiegel, A.M.

1994-09-01

McCune-Albright syndrome (MAS) is a sporadic disease characterized by polyostotic fibrous dysplasia, cafe-au-lait spots, and multiple endocrinopathies. The etiology of fibrous dysplasia is unknown. Activating mutations of codon 201 in the gene encoding the {alpha}-subunit of G{sub s}, the G-protein that stimulates adenylyl cyclase, have been found in all affected MAS tissues that have been studied. Initial attempts to amplify DNA from decalcified paraffin-embedded bone specimens from frozen surgical bone specimens from five MAS patients using polymerase chain reaction and allele-specific oligonucleotide hybridization. Most of the cells in four specimens of dysplastic bone contained a heterozygous mutation encoding substitution ofmore » Arg{sup 201} of G{sub s}{alpha} with His, but the mutation was barely detectable in peripheral blood specimens from the patients. Only a small amount of mutant allele was detected in a specimen of normal cortical bone from the fifth patient, although this patients had a high proportion of mutation in other, affected tissues. The mosaic distribution of mutant alleles is consistent with an embryological somatic cell mutation of the G{sub s}{alpha} gene in MAS. The presence of an activating mutation of G{sub s}{alpha} in osteoblastic progenitor cells may cause them to exhibit increased proliferation and abnormal differentiation, thereby producing the lesions of fibrous dysplasia. 43 refs., 2 figs.« less

Analysis of four families with the Stickler syndrome by linkage studies. Identification of a new premature stop codon in the COL2A1 gene in a family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bonaventure, J.; Lasselin, C.; Toutain, A.

1994-09-01

The Stickler syndrome is an arthro-ophthalmopathy which associates progressive myopia with vitreal degeneration and retinal detachment. Cleft palate, cranio-facial abnormalities, deafness and osteoarthritis are often associated symptoms. Genetic heterogeneity of this autosomal dominant disease was consistent with its large clinical variability. Linkage studies have provided evidence for cosegregation of the disease with COL2A1, the gene coding for type II collagen, in about 50% of the families. Four additional families are reported here. Linkage analyses by using a VNTR located in the 3{prime} region of the gene were achieved. In three families, positive lod scores were obtained with a cumulative maximalmore » value of 3.5 at a recombination fraction of 0. In one of these families, single strand conformation analysis of 25 exons disclosed a new mutation in exon 42. Codon for glutamic acid at position a1-803 was converted into a stop codon. The mutation was detected in DNA samples from all the affected members of the family but not in the unaffected. This result confirms that most of the Stickler syndromes linked to COL2A1 are due to premature stop codons. In a second family, an abnormal SSCP pattern of exon 34 was detected in all the affected individuals. The mutation is likely to correspond to a splicing defect in the acceptor site of intron 33. In one family the disease did not segregate with the COL2A1 locus. Further linkage studies with intragenic dimorphic sites in the COL10A1 gene and highly polymorphic markers close to the COL9A1 locus indicated that this disorder did not result from defects in these two genes.« less

Evolutionary characterization of Tembusu virus infection through identification of codon usage patterns.

PubMed

Zhou, Hao; Yan, Bing; Chen, Shun; Wang, Mingshu; Jia, Renyong; Cheng, Anchun

2015-10-01

Tembusu virus (TMUV) is a single-stranded, positive-sense RNA virus. As reported, TMUV infection has resulted in significant poultry losses, and the virus may also pose a threat to public health. To characterize TMUV evolutionarily and to understand the factors accounting for codon usage properties, we performed, for the first time, a comprehensive analysis of codon usage bias for the genomes of 60 TMUV strains. The most recently published TMUV strains were found to be widely distributed in coastal cities of southeastern China. Codon preference among TMUV genomes exhibits a low bias (effective number of codons (ENC)=53.287) and is maintained at a stable level. ENC-GC3 plots and the high correlation between composition constraints and principal component factor analysis of codon usage demonstrated that mutation pressure dominates over natural selection pressure in shaping the TMUV coding sequence composition. The high correlation between the major components of the codon usage pattern and hydrophobicity (Gravy) or aromaticity (Aromo) was obvious, indicating that properties of viral proteins also account for the observed variation in TMUV codon usage. Principal component analysis (PCA) showed that CQW1 isolated from Chongqing may have evolved from GX2013H or GX2013G isolated from Guangxi, thus indicating that TMUV likely disseminated from southeastern China to the mainland. Moreover, the preferred codons encoding eight amino acids were consistent with the optimal codons for human cells, indicating that TMUV may pose a threat to public health due to possible cross-species transmission (birds to birds or birds to humans). The results of this study not only have theoretical value for uncovering the characteristics of synonymous codon usage patterns in TMUV genomes but also have significant meaning with regard to the molecular evolutionary tendencies of TMUV. Copyright © 2015 Elsevier B.V. All rights reserved.

ACB-PCR MEASUREMENT OF K-RAS CODON 12 MUTATION IN A/J MOUSE LUNG EXPOSED TO BENZO[A]PYRENE: A DOSE-RESPONSE ASSESSMENT

EPA Science Inventory

Benzo[a]pyrene (B[a]P) is a known human carcinogen and environmental contaminant. The direct measurement of K-Ras mutant fraction (MF) was developed as a metric with which to examine the default assumption of low dose linearity in the mutational response to B...

Identification and codon reading properties of 5-cyanomethyl uridine, a new modified nucleoside found in the anticodon wobble position of mutant haloarchaeal isoleucine tRNAs

PubMed Central

Mandal, Debabrata; Köhrer, Caroline; Su, Dan; Babu, I. Ramesh; Chan, Clement T.Y.; Liu, Yuchen; Söll, Dieter; Blum, Paul; Kuwahara, Masayasu; Dedon, Peter C.; RajBhandary, Uttam L.

2014-01-01

Most archaea and bacteria use a modified C in the anticodon wobble position of isoleucine tRNA to base pair with A but not with G of the mRNA. This allows the tRNA to read the isoleucine codon AUA without also reading the methionine codon AUG. To understand why a modified C, and not U or modified U, is used to base pair with A, we mutated the C34 in the anticodon of Haloarcula marismortui isoleucine tRNA (tRNA2Ile) to U, expressed the mutant tRNA in Haloferax volcanii, and purified and analyzed the tRNA. Ribosome binding experiments show that although the wild-type tRNA2Ile binds exclusively to the isoleucine codon AUA, the mutant tRNA binds not only to AUA but also to AUU, another isoleucine codon, and to AUG, a methionine codon. The G34 to U mutant in the anticodon of another H. marismortui isoleucine tRNA species showed similar codon binding properties. Binding of the mutant tRNA to AUG could lead to misreading of the AUG codon and insertion of isoleucine in place of methionine. This result would explain why most archaea and bacteria do not normally use U or a modified U in the anticodon wobble position of isoleucine tRNA for reading the codon AUA. Biochemical and mass spectrometric analyses of the mutant tRNAs have led to the discovery of a new modified nucleoside, 5-cyanomethyl U in the anticodon wobble position of the mutant tRNAs. 5-Cyanomethyl U is present in total tRNAs from euryarchaea but not in crenarchaea, eubacteria, or eukaryotes. PMID:24344322

Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.

PubMed

Miri-Moghaddam, Ebrahim; Bahrami, Sara; Naderi, Majid; Bazi, Ali; Karimipoor, Morteza

2016-06-01

Inheritance of mild mutations within the β-globin gene and coinheritance of α-thalassemia (α-thal) are known as two important genetic modifiers in β-thalassemia (β-thal) intermedia (β-TI). We aimed to evaluate the spectrum of β- and α-thal mutations in β-TI patients in Southeast Iran. Common β- and α-globin gene mutations were detected by amplification refractory mutation system-polymerase chain reaction (ARMS-PCR) and multiplex gap-PCR, respectively. There were 26 male (57.8%) and 19 female (42.2%) patients. HBB: c.92 + 5T > C [IVS-I-5 (G > C)] and HBB: c.-138C + 1G > A [IVS-II-I (G > A)] represented the prevalent alleles with respective frequencies of 60.0 and 10.0%. Other β-globin mutations included HBB: c.-138C > T [-88 (C > T)], HBB: c.27_28insG [frameshift codons (FSC) 8/9 (+G)], HBB: c.46delT [codon 15 (-T)], HBB: c.93-22_95del (IVS-I, 25 del), and the 619 bp deletion (NG_000007.3: g.71609_72227del619). The predominant genotypic combinations were β(0)/β(0) (68.9%), β(0)/β(+ )(8.9%) and β(+)/β(+ )(2.2%). Coinheritance of α-thal was observed in 33.0% of the patients, with the -α(3.7) (rightward) (NG_000006.1: g.34164_37967del3804) as the most common deletion (86.0%). One patient was diagnosed with the -α(4.2) (leftward) (AF221717) and one with the - -(MED) (g.24664_41064del16401) deletions, while no patients carried the -(α)(20.5) (g.15164_37864del22701), α(-5 nt) (HBA2: c.95 + 2_95_6delTGAGG) or codon 19 (-G) (HBA2: c.56delG) mutations. The alleviating molecular mechanism was not explainable by β(+ )or concurrent α-thal in more than half of our β-TI patients. This encourages conducting more studies to identify other contributing factors, especially Hb F-inducing genetic modifiers.

Molecular determinants of sulfadoxine-pyrimethamine resistance in Plasmodium falciparum in Nigeria and the regional emergence of dhps 431V.

PubMed

Oguike, Mary C; Falade, Catherine O; Shu, Elvis; Enato, Izehiuwa G; Watila, Ismaila; Baba, Ebenezer S; Bruce, Jane; Webster, Jayne; Hamade, Prudence; Meek, Sylvia; Chandramohan, Daniel; Sutherland, Colin J; Warhurst, David; Roper, Cally

2016-12-01

There are few published reports of mutations in dihydropteroate synthetase (dhps) and dihydrofolate reductase (dhfr) genes in P. falciparum populations in Nigeria, but one previous study has recorded a novel dhps mutation at codon 431 among infections imported to the United Kingdom from Nigeria. To assess how widespread this mutation is among parasites in different parts of the country and consequently fill the gap in sulfadoxine-pyrimethamine (SP) resistance data in Nigeria, we retrospectively analysed 1000 filter paper blood spots collected in surveys of pregnant women and children with uncomplicated falciparum malaria between 2003 and 2015 from four sites in the south and north. Genomic DNA was extracted from filter paper blood spots and placental impressions. Point mutations at codons 16, 50, 51, 59, 108, 140 and 164 of the dhfr gene and codons 431, 436, 437, 540, 581 and 613 of the dhps gene were evaluated by nested PCR amplification followed by direct sequencing. The distribution of the dhps-431V mutation was widespread throughout Nigeria with the highest prevalence in Enugu (46%). In Ibadan where we had sequential sampling, its prevalence increased from 0% to 6.5% between 2003 and 2008. Although there were various combinations of dhps mutations with 431V, the combination 431V + 436A + 437G+581G+613S was the most common. All these observations support the view that dhps-431V is on the increase. In addition, P. falciparum DHPS crystal structure modelling shows that the change from Isoleucine to Valine (dhps-431V) could alter the effects of both S436A/F and A437G, which closely follow the 2nd β-strand. Consequently, it is now a research priority to assess the implications of dhps-VAGKGS mutant haplotype on continuing use of SP in seasonal malaria chemoprevention (SMC) and intermittent preventive treatment in pregnancy (IPTp). Our data also provides surveillance data for SP resistance markers in Nigeria between 2003 and 2015. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

The usability of allele-specific PCR and reverse-hybridization assays for KRAS genotyping in Serbian colorectal cancer patients.

PubMed

Brotto, Ksenija; Malisic, Emina; Cavic, Milena; Krivokuca, Ana; Jankovic, Radmila

2013-04-01

Colorectal cancers (CRCs) with wild-type KRAS respond to EGFR-targeted antibody treatment. Analysis of the hotspot clustered mutations in codons 12 and 13 is compulsory before therapy and no standardized methodology for that purpose has been established so far. Since these mutations may have different biological effects and clinical outcome, reliable frequency and types of KRAS mutations need to be determined for individual therapy. The purpose of this study was to describe the KRAS mutation spectrum in a group of 481 Serbian mCRC patients and to compare the general performances of allele-specific PCR and reverse-hybridization assays. KRAS testing was performed with two diagnostic analyses, DxS TheraScreen K-RAS PCR Kit and KRAS StripAssay™. KRAS mutations in codons 12 and 13 were present in 37.6 % of analyzed formalin-fixed paraffin-embedded (FFPE) DNA samples. The seven most frequent mutation types were observed with both assays: p.G12D 34.6 %, p.G12V 24.9 %, p.G12A 10.3 %, p.G12C 8.1 %, p.G12S 5.4 %, p.G12R 1.6 %, and p.G13D 15.1 %. Regarding double mutants, 0.8 % of them were present among all tested samples and 2.2 % among KRAS mutated ones. Two screening approaches that were used in this study have been shown as suitable tests for detecting KRAS mutations in diagnostic settings. In addition, they appear to be good alternatives to methods presently in use. In our experience, both methods showed capacity to detect and identify double mutations which may be important for potential further subgrouping of CRC patients.

Novel mutations in the helix termination motif of keratin 3 and keratin 12 in 2 Taiwanese families with Meesmann corneal dystrophy.

PubMed

Chen, Ying-Ting; Tseng, Sung-Huei; Chao, Sheau-Chiou

2005-11-01

To analyze mutations of the keratin 3 gene (KRT3) and keratin 12 gene (KRT12) in 2 Taiwanese families with Meesmann corneal dystrophy (MCD). Diagnosis of MCD was confirmed by slit-lamp examination of the cornea in 4 members of family 1 and 6 members of family 2. All exons and flanking intron boundaries of KRT3 and KRT12 were amplified by polymerase chain reaction (PCR), and products were subjected to direct sequencing. Restriction fragment length polymorphism analysis (RFLP) with created mismatch primers, Bst XI and Nsp I, was used to confirm the presence of the mutations in affected individuals in family 1 and family 2, respectively. A novel heterozygous missense mutation (1508G-->C), predicting the substitution of a proline for an arginine (R503P) was detected in the helix termination motif of the keratin 3 polypeptide in family 1. Another novel heterozygous missense mutation (1286A-->G), predicting the substitution of a cysteine for a tyrosine at codon 429 (Y429C) was detected in the helix termination motif of the keratin 12 polypeptide in family 2. These 2 mutations were excluded from 50 normal controls by RFLP analysis, indicating that they were not common polymorphisms. A novel missense mutation (R503P) in KRT3 and another novel missense mutation (Y429C) in KRT12 lead to MCD in 2 unrelated Taiwanese families. The mutant codons in our study are all located in the highly conserved alpha-helix-termination motif, which is essential for keratin filament assembly. Mutation at this area may account for the disruption of keratin filament assembly, leading to MCD.

CRISPR-STOP: gene silencing through base-editing-induced nonsense mutations.

PubMed

Kuscu, Cem; Parlak, Mahmut; Tufan, Turan; Yang, Jiekun; Szlachta, Karol; Wei, Xiaolong; Mammadov, Rashad; Adli, Mazhar

2017-07-01

CRISPR-Cas9-induced DNA damage may have deleterious effects at high-copy-number genomic regions. Here, we use CRISPR base editors to knock out genes by changing single nucleotides to create stop codons. We show that the CRISPR-STOP method is an efficient and less deleterious alternative to wild-type Cas9 for gene-knockout studies. Early stop codons can be introduced in ∼17,000 human genes. CRISPR-STOP-mediated targeted screening demonstrates comparable efficiency to WT Cas9, which indicates the suitability of our approach for genome-wide functional screenings.

Non-AUG translation: a new start for protein synthesis in eukaryotes

PubMed Central

Kearse, Michael G.; Wilusz, Jeremy E.

2017-01-01

Although it was long thought that eukaryotic translation almost always initiates at an AUG start codon, recent advancements in ribosome footprint mapping have revealed that non-AUG start codons are used at an astonishing frequency. These non-AUG initiation events are not simply errors but instead are used to generate or regulate proteins with key cellular functions; for example, during development or stress. Misregulation of non-AUG initiation events contributes to multiple human diseases, including cancer and neurodegeneration, and modulation of non-AUG usage may represent a novel therapeutic strategy. It is thus becoming increasingly clear that start codon selection is regulated by many trans-acting initiation factors as well as sequence/structural elements within messenger RNAs and that non-AUG translation has a profound impact on cellular states. PMID:28982758

Insight into pattern of codon biasness and nucleotide base usage in serotonin receptor gene family from different mammalian species.

PubMed

Dass, J Febin Prabhu; Sudandiradoss, C

2012-07-15

5-HT (5-Hydroxy-tryptamine) or serotonin receptors are found both in central and peripheral nervous system as well as in non-neuronal tissues. In the animal and human nervous system, serotonin produces various functional effects through a variety of membrane bound receptors. In this study, we focus on 5-HT receptor family from different mammals and examined the factors that account for codon and nucleotide usage variation. A total of 110 homologous coding sequences from 11 different mammalian species were analyzed using relative synonymous codon usage (RSCU), correspondence analysis (COA) and hierarchical cluster analysis together with nucleotide base usage frequency of chemically similar amino acid codons. The mean effective number of codon (ENc) value of 37.06 for 5-HT(6) shows very high codon bias within the family and may be due to high selective translational efficiency. The COA and Spearman's rank correlation reveals that the nucleotide compositional mutation bias as the major factors influencing the codon usage in serotonin receptor genes. The hierarchical cluster analysis suggests that gene function is another dominant factor that affects the codon usage bias, while species is a minor factor. Nucleotide base usage was reported using Goldman, Engelman, Stietz (GES) scale reveals the presence of high uracil (>45%) content at functionally important hydrophobic regions. Our in silico approach will certainly help for further investigations on critical inference on evolution, structure, function and gene expression aspects of 5-HT receptors family which are potential antipsychotic drug targets. Copyright © 2012 Elsevier B.V. All rights reserved.

Recent evidence for evolution of the genetic code

NASA Technical Reports Server (NTRS)

Osawa, S.; Jukes, T. H.; Watanabe, K.; Muto, A.

1992-01-01

The genetic code, formerly thought to be frozen, is now known to be in a state of evolution. This was first shown in 1979 by Barrell et al. (G. Barrell, A. T. Bankier, and J. Drouin, Nature [London] 282:189-194, 1979), who found that the universal codons AUA (isoleucine) and UGA (stop) coded for methionine and tryptophan, respectively, in human mitochondria. Subsequent studies have shown that UGA codes for tryptophan in Mycoplasma spp. and in all nonplant mitochondria that have been examined. Universal stop codons UAA and UAG code for glutamine in ciliated protozoa (except Euplotes octacarinatus) and in a green alga, Acetabularia. E. octacarinatus uses UAA for stop and UGA for cysteine. Candida species, which are yeasts, use CUG (leucine) for serine. Other departures from the universal code, all in nonplant mitochondria, are CUN (leucine) for threonine (in yeasts), AAA (lysine) for asparagine (in platyhelminths and echinoderms), UAA (stop) for tyrosine (in planaria), and AGR (arginine) for serine (in several animal orders) and for stop (in vertebrates). We propose that the changes are typically preceded by loss of a codon from all coding sequences in an organism or organelle, often as a result of directional mutation pressure, accompanied by loss of the tRNA that translates the codon. The codon reappears later by conversion of another codon and emergence of a tRNA that translates the reappeared codon with a different assignment. Changes in release factors also contribute to these revised assignments. We also discuss the use of UGA (stop) as a selenocysteine codon and the early history of the code.

Human Salmonella and concurrent decreased susceptibility to quinolones and extended-spectrum cephalosporins.

PubMed

Whichard, Jean M; Gay, Kathryn; Stevenson, Jennifer E; Joyce, Kevin J; Cooper, Kara L; Omondi, Michael; Medalla, Felicita; Jacoby, George A; Barrett, Timothy J

2007-11-01

The National Antimicrobial Resistance Monitoring System monitors susceptibility among Enterobacteriaceae in humans in the United States. We studied isolates exhibiting decreased susceptibility to quinolones (nalidixic acid MIC >32 microg/mL or ciprofloxacin MIC > or =0.12 microg/mL) and extended-spectrum cephalosporins (ceftiofur or ceftriaxone MIC > or =2 microg/mL) during 1996-2004. Of non-Typhi Salmonella, 0.19% (27/14,043) met these criteria: 11 Senftenberg; 6 Typhimurium; 3 Newport; 2 Enteridis; and 1 each Agona, Haifa, Mbandaka, Saintpaul, and Uganda. Twenty-six isolates had gyrA mutations (11 at codon 83 only, 3 at codon 87 only, 12 at both). All Senftenberg isolates had parC mutations (S801 and T57S); 6 others had the T57S mutation. The Mbandaka isolate contained qnrB2. Eight isolates contained bla(CMY-2); 1 Senftenberg contained bla(CMY-23). One Senftenberg and 1 Typhimurium isolate contained bla(SHV-12); the Mbandaka isolate contained bla(SHV-30). Nine Senftenberg isolates contained bla(OXA-1) contained bla(OXA-9). Further studies should address patient outcomes, risk factors, and resistance dissemination prevention strategies.

Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

PubMed

Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

2011-02-01

  This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

Color-deficient cone mosaics associated with Xq28 opsin mutations: A stop codon versus gene deletions

PubMed Central

Wagner-Schuman, Melissa; Neitz, Jay; Rha, Jungtae; Williams, David R.; Neitz, Maureen; Carroll, Joseph

2010-01-01

Our understanding of the etiology of red-green color vision defects is evolving. While missense mutations within the long- (L-) and middle-wavelength sensitive (M-) photopigments and gross rearrangements within the L/M-opsin gene array are commonly associated with red-green defects, recent work using adaptive optics retinal imaging has shown that different genotypes can have distinct consequences for the cone mosaic. Here we examined the cone mosaic in red-green color deficient individuals with multiple X-chromosome opsin genes that encode L opsin, as well as individuals with a single X-chromosome opsin gene that encodes L opsin and a single patient with a novel premature termination codon in his M-opsin gene and a normal L-opsin gene. We observed no difference in cone density between normal trichomats and multiple or single gene dichromats. In addition, we demonstrate different phenotypic effects of a nonsense mutation versus the previously described deleterious polymorphism, (LIAVA), both of which differ from multiple and single gene dichromats. Our results help refine the relationship between opsin genotype and cone photoreceptor mosaic phenotype. PMID:20854834

A novel mutation in the alpha-helix 1 of the C subunit of the F(1)/F(0) ATPase responsible for optochin resistance of a Streptococcus pneumoniae clinical isolate.

PubMed

Cogné, N; Claverys, J; Denis, F; Martin, C

2000-10-01

Previously reported mutations involved in optochin resistance of Streptococcus pneumoniae clinical isolates changed residues 48, 49 or 50, in the transmembrane alpha-helix 2 of the F(1)/F(0) ATPase subunit. We report here an unusual mutation which changes the sequence of the transmembrane alpha-helix 1 of the AtpC subunit. This mutation involves a Gly to Ser substitution resulting from a G to A transition at codon 14 of the atpC gene.

Identification of the initiation site of poliovirus polyprotein synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dorner, A.J.; Dorner, L.F.; Larsen, G.R.

1982-06-01

The complete nucleotide sequence of poliovirus RNA has a long open reading frame capable of encoding the precursor polyprotein NCVPOO. The first AUG codon in this reading frame is located 743 nucleotides from the 5' end of the RNA and is preceded by eight AUG codons in all three reading frames. Because all proteins that map at the amino terminus of the polyprotein (P1-1a, VPO, and VP4) are blocked at their amino termini and previous studies of ribosome binding have been inconclusive, direct identification of the initiation site of protein synthesis was difficult. We separated and identified all of themore » tryptic peptides of capsid protein VP4 and correlated these peptides with the amino acid sequence predicted to follow the AUG codon at nucleotide 743. Our data indicate that VP4 begins with a blocked glycine that is encoded immediately after the AUG codon at nucleotide 743. An S1 nuclease analysis of poliovirus mRNA failed to reveal a splice in the 5' region. We concluded that synthesis of poliovirus polyprotein is initiated at nucleotide 743, the first AUG codon in the long open reading frame.« less

Mutated cancer autoantigen implicated cause of paraneoplastic myasthenia gravis.

PubMed

Zekeridou, Anastasia; Griesmann, Guy E; Lennon, Vanda A

2018-05-09

Anti-tumor immune responses are postulated to initiate paraneoplastic neurological disorders when proteins normally restricted to neural cells are expressed as oncoproteins. Mutated oncopeptides could bypass self-tolerant T-cells to activate cytotoxic effector T-lymphocytes and requisite helper T-lymphocytes to stimulate autoantibody production by B-lymphocytes. We investigated muscle-type nicotinic acetylcholine receptor (AChR) antigen expression at transcriptional and protein levels in a small-cell lung cancer line (SCLC) established from a patient with AChR-IgG-positive myasthenia gravis. I We identified mRNA transcripts encoding the two AChR α1-subunit isoforms, and seven alternative-splicing products, three yielding premature stop codons. Despite detecting native muscle-type AChR pentamers in the tumor, we did not identify mutant α1-peptides. However, we found α1-subunit-derived peptides bound to tumor MHC1-protein. In a control SCLC from an ANNA-1(anti-Hu)-IgG-positive patient, we identified MHC1-complexed Hu protein-derived peptides, but not AChR peptides. Our findings support onconeural protein products as pertinent immunogens initiating paraneoplastic neurological autoimmunity. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

Stabilizing Selection, Purifying Selection, and Mutational Bias in Finite Populations

PubMed Central

Charlesworth, Brian

2013-01-01

Genomic traits such as codon usage and the lengths of noncoding sequences may be subject to stabilizing selection rather than purifying selection. Mutations affecting these traits are often biased in one direction. To investigate the potential role of stabilizing selection on genomic traits, the effects of mutational bias on the equilibrium value of a trait under stabilizing selection in a finite population were investigated, using two different mutational models. Numerical results were generated using a matrix method for calculating the probability distribution of variant frequencies at sites affecting the trait, as well as by Monte Carlo simulations. Analytical approximations were also derived, which provided useful insights into the numerical results. A novel conclusion is that the scaled intensity of selection acting on individual variants is nearly independent of the effective population size over a wide range of parameter space and is strongly determined by the logarithm of the mutational bias parameter. This is true even when there is a very small departure of the mean from the optimum, as is usually the case. This implies that studies of the frequency spectra of DNA sequence variants may be unable to distinguish between stabilizing and purifying selection. A similar investigation of purifying selection against deleterious mutations was also carried out. Contrary to previous suggestions, the scaled intensity of purifying selection with synergistic fitness effects is sensitive to population size, which is inconsistent with the general lack of sensitivity of codon usage to effective population size. PMID:23709636

Frameshift Suppression in SACCHAROMYCES CEREVISIAE. IV. New Suppressors among Spontaneous Co-Revertants of the Group II HIS4-206 and LEU2-3 Frameshift Mutations

PubMed Central

Gaber, Richard F.; Culbertson, Michael R.

1982-01-01

ICR-induced frameshift mutations at the his4 locus in Saccharomyces cerevisiae have been classified into several groups on the basis of their reversion and suppression properties. One group of externally suppressible his4 mutations, designated Group II, have been shown to contain +1 G:C insertions in glycine codons and are suppressed by any one of five suppressor mutations described previously (SUF1, SUF3, SUF4, SUF5, and SUF6). The suppressor genes are believed to encode glycine tRNAs containing four base anticodons.—An analysis of spontaneous co-revertants of the Group II frameshift mutations his4-206 and leu2-3 has revealed the existence of eleven new Group II-specific suppressor genes (SUF15 through SUF25). The locations of the new suppressor loci on the yeast genetic map have been determined.—By comparing the ability or inability of Group II-specific suppressors mapping at 16 different loci to suppress different Group II his4 mutations, two subclasses of suppressors have been defined. One subclass suppresses his4-38 and his4-519, which contain the altered four base mRNA codons 5'-GGGU-3' and 5'-GGGG-3', respectively. The other subclass suppresses his4-38, but fails to suppress his4-519. The mechanism of tRNA-mediated frameshift suppression and the molecular basis for this division of the suppressors into two subclasses is discussed. PMID:6757051

Juxta-articular myxoma and intramuscular myxoma are two distinct entities. Activating Gs alpha mutation at Arg 201 codon does not occur in juxta-articular myxoma.

PubMed

Okamoto, Sumika; Hisaoka, Masanori; Meis-Kindblom, Jeanne M; Kindblom, Lars-Gunnar; Hashimoto, Hiroshi

2002-01-01

Juxta-articular myxoma is a rare myxoid tumor of soft tissue that bears a close histologic resemblance to intramuscular myxoma but is distinguished from the latter by its clinical setting and behavior. Activating missense mutations at the Arg 201 codon of the Gs alpha gene ultimately leading to increased levels of cyclic adenosine monophosphate have been implicated in McCune-Albright syndrome and sporadic fibrous dysplasia of bone. Recently, we have demonstrated that the same Gs alpha mutations occur in intramuscular myxomas associated with fibrous dysplasia of bone (Mazabraud's syndrome) as well as in sporadic intramuscular myxoma. The overlapping histologic appearances of juxta-articular myxoma and intramuscular myxoma prompted us to investigate whether there is a relationship between the two entities. We studied this possibility by looking for Gs alpha mutations in juxta-articular myxoma using polymerase chain reaction (PCR) to amplify appropriate genomic DNA fragments extracted from formalin-fixed, paraffin-embedded specimens of five juxta-articular myxomas, followed by single-strand conformation polymorphism analysis. Using these techniques, no aberrant bands were detected in any of the five juxta-articular myxomas, indicating that they lack Gs alpha mutations. Moreover, DNA sequencing of the PCR products of two JAMs showed no abnormalities. We conclude that juxta-articular myxomas, in contrast to intramuscular myxomas, do not involve Arg 201 mutations of the Gs alpha gene, indicating that they represent distinct entities with different underlying molecular mechanisms.

SensiScreen® KRAS exon 2-sensitive simplex and multiplex real-time PCR-based assays for detection of KRAS exon 2 mutations

PubMed Central

Guldmann-Christensen, Mariann; Hauge Kyneb, Majbritt; Voogd, Kirsten; Andersen, Christina; Epistolio, Samantha; Merlo, Elisabetta; Yding Wolff, Tine; Hamilton-Dutoit, Stephen; Lorenzen, Jan; Christensen, Ulf Bech

2017-01-01

Activating mutations in codon 12 and codon 13 of the KRAS (Kirsten rat sarcoma viral oncogene homolog) gene are implicated in the development of several human cancer types and influence their clinical evaluation, treatment and prognosis. Numerous different methods for KRAS genotyping are currently available displaying a wide range of sensitivities, time to answer and requirements for laboratory equipment and user skills. Here we present SensiScreen® KRAS exon 2 simplex and multiplex CE IVD assays, that use a novel real-time PCR-based method for KRAS mutation detection based on PentaBase’s proprietary DNA analogue technology and designed to work on standard real-time PCR instruments. By means of the included BaseBlocker™ technology, we show that SensiScreen® specifically amplifies the mutated alleles of interest with no or highly subdued amplification of the wild type allele. Furthermore, serial dilutions of mutant DNA in a wild type background demonstrate that all SensiScreen® assays display a limit of detection that falls within the range of 0.25–1%. Finally, in three different colorectal cancer patient populations, SensiScreen® assays confirmed the KRAS genotype previously determined by commonly used methods for KRAS mutation testing, and notably, in two of the populations, SensiScreen® identified additional mutant positive cases not detected by common methods. PMID:28636636

Functional Analyses of c.2268dup in Thyroid Peroxidase Gene Associated with Goitrous Congenital Hypothyroidism

PubMed Central

Harun, Fatimah; Jalaludin, Muhammad Yazid; Lim, Chor Yin; Ng, Khoon Leong

2014-01-01

The c.2268dup mutation in thyroid peroxidase (TPO) gene was reported to be a founder mutation in Taiwanese patients with dyshormonogenetic congenital hypothyroidism (CH). The functional impact of the mutation is not well documented. In this study, homozygous c.2268dup mutation was detected in two Malaysian-Chinese sisters with goitrous CH. Normal and alternatively spliced TPO mRNA transcripts were present in thyroid tissues of the two sisters. The abnormal transcript contained 34 nucleotides originating from intron 12. The c.2268dup is predicted to generate a premature termination codon (PTC) at position 757 (p.Glu757X). Instead of restoring the normal reading frame, the alternatively spliced transcript has led to another stop codon at position 740 (p.Asp739ValfsX740). The two PTCs are located at 116 and 201 nucleotides upstream of the exons 13/14 junction fulfilling the requirement for a nonsense-mediated mRNA decay (NMD). Quantitative RT-PCR revealed an abundance of unidentified transcripts believed to be associated with the NMD. TPO enzyme activity was not detected in both patients, even though a faint TPO band of about 80 kD was present. In conclusion, the c.2268dup mutation leads to the formation of normal and alternatively spliced TPO mRNA transcripts with a consequential loss of TPO enzymatic activity in Malaysian-Chinese patients with goitrous CH. PMID:24745015

uORFs with unusual translational start codons autoregulate expression of eukaryotic ornithine decarboxylase homologs

PubMed Central

Ivanov, Ivaylo P.; Loughran, Gary; Atkins, John F.

2008-01-01

In a minority of eukaryotic mRNAs, a small functional upstream ORF (uORF), often performing a regulatory role, precedes the translation start site for the main product(s). Here, conserved uORFs in numerous ornithine decarboxylase homologs are identified from yeast to mammals. Most have noncanonical evolutionarily conserved start codons, the main one being AUU, which has not been known as an initiator for eukaryotic chromosomal genes. The AUG-less uORF present in mouse antizyme inhibitor, one of the ornithine decarboxylase homologs in mammals, mediates polyamine-induced repression of the downstream main ORF. This repression is part of an autoregulatory circuit, and one of its sensors is the AUU codon, which suggests that translation initiation codon identity is likely used for regulation in eukaryotes. PMID:18626014

Italian familial defective apolipoprotein B patients share a unique haplotype with other Caucasian patients.

PubMed

Cefalù, A B; Barbagallo, C M; Sesti, E; Caldarella, R; Polizzi, F; Marino, G; Noto, D; Rolleri, M; Travali, S; Scalisi, G; Notarbartolo, A; Corsini, A; Bertolini, S; Averna, M R

2001-09-01

Familial defective apolipoprotein (apo) B-100 together with familial hypercholesterolemia are the two common genetic conditions that cause hypercholesterolemia. Familial defective apolipoprotein B-100 is due to mutations around codon 3500 of the apo B gene. The most-characterized mutation is a G>A transition at nucleotide 10,708 that results in the substitution of arginine by glutamine at codon 3500 (Apo B Arg3500Gln). Two other mutations are caused by a C>T transition, one at nucleotide 10,800 (Apo B Arg3531Cys) and the other at nucleotide 10,707 (apo B Arg3500Trp). In the present study we describe three new Italian cases of familial defective apolipoprotein B-100 (Apo B Arg3500Gln), one from the Liguria region and two from Sicily, and the haplotype of the apo B gene co-segregating with the mutation. By screening two groups of probands, clinically diagnosed as having Familial Hypercholesterolemia (700 from mainland Italy and 305 from Sicily), the prevalence of familial defective apolipoprotein B-100 due to Arg3500Gln was found to be very low (0.28% and 0.65%, respectively). The Arg3531Cys mutation was not detected in any proband. In the three new families with Arg3500Gln mutation in the present study and in one previously described in Italy, the mutation was associated with a unique apo B haplotype, which is consistent with data previously reported for Caucasian patients [XbaI-, MspI+, EcoRI-, presence of the 5' signal peptide insertion (Ins) allele, and the 49-repeat allele of the 3'-VNTR].

Analysis of p53 gene mutations in human gliomas by polymerase chain reaction-based single-strand conformation polymorphism and DNA sequencing.

PubMed

Sarkar, F H; Kupsky, W J; Li, Y W; Sreepathi, P

1994-03-01

Mutations in the p53 gene have been recognized in brain tumors, and clonal expansion of p53 mutant cells has been shown to be associated with glioma progression. However, studies on the p53 gene have been limited by the need for frozen tissues. We have developed a method utilizing polymerase chain reaction (PCR) for the direct analysis of p53 mutation by single-strand conformation polymorphism (SSCP) and by direct DNA sequencing of the p53 gene using a single 10-microns paraffin-embedded tissue section. We applied this method to screen for p53 gene mutations in exons 5-8 in human gliomas utilizing paraffin-embedded tissues. Twenty paraffin blocks containing tumor were selected from surgical specimens from 17 different adult patients. Tumors included six anaplastic astrocytomas (AAs), nine glioblastomas (GBs), and two mixed malignant gliomas (MMGs). The tissue section on the stained glass slide was used to guide microdissection of an unstained adjacent tissue section to ensure > 90% of the tumor cell population for p53 mutational analysis. Simultaneously, microdissection of the tissue was also carried out to obtain normal tissue from adjacent areas as a control. Mutations in the p53 gene were identified in 3 of 17 (18%) patients by PCR-SSCP analysis and subsequently confirmed by PCR-based DNA sequencing. Mutations in exon 5 resulting in amino acid substitution were found in one thalamic AA (codon 158, CGC > CTT: Arg > Leu) and one cerebral hemispheric GB (codon 151, CCG > CTG: Pro > Leu).(ABSTRACT TRUNCATED AT 250 WORDS)

Effectors of epidermal growth factor receptor pathway: the genetic profiling ofKRAS, BRAF, PIK3CA, NRAS mutations in colorectal cancer characteristics and personalized medicine.

PubMed

Shen, Yinchen; Wang, Jianfei; Han, Xiaohong; Yang, Hongying; Wang, Shuai; Lin, Dongmei; Shi, Yuankai

2013-01-01

Mutations in KRAS oncogene are recognized biomarkers that predict lack of response to anti- epidermal growth factor receptor (EGFR) antibody therapies. However, some patients with KRAS wild-type tumors still do not respond, so other downstream mutations in BRAF, PIK3CA and NRAS should be investigated. Herein we used direct sequencing to analyze mutation status for 676 patients in KRAS (codons 12, 13 and 61), BRAF (exon 11 and exon 15), PIK3CA (exon 9 and exon 20) and NRAS (codons12, 13 and 61). Clinicopathological characteristics associations were analyzed together with overall survival (OS) of metastatic colorectal cancer patients (mCRC). We found 35.9% (242/674) tumors harbored a KRAS mutation, 6.96% (47/675) harbored a BRAF mutation, 9.9% (62/625) harbored a PIK3CA mutation and 4.19% (26/621) harbored a NRAS mutation. KRAS mutation coexisted with BRAF, PIK3CA and NRAS mutation, PIK3CA exon9 mutation appeared more frequently in KRAS mutant tumors (P = 0.027) while NRAS mutation almost existed in KRAS wild-types (P<0.001). Female patients and older group harbored a higher KRAS mutation (P = 0.018 and P = 0.031, respectively); BRAF (V600E) mutation showed a higher frequency in colon cancer and poor differentiation tumors (P = 0.020 and P = 0.030, respectively); proximal tumors appeared a higher PIK3CA mutation (P<0.001) and distant metastatic tumors shared a higher NRAS mutation (P = 0.010). However, in this study no significant result was found between OS and gene mutation in mCRC group. To our knowledge, the first large-scale retrospective study on comprehensive genetic profile which associated with anti-EGFR MoAbs treatment selection in East Asian CRC population, appeared a specific genotype distribution picture, and the results provided a better understanding between clinicopathological characteristics and gene mutations in CRC patients.

GATA3 mutation in a family with hypoparathyroidism, deafness and renal dysplasia syndrome.

PubMed

Zhu, Zi-Yang; Zhou, Qiao-Li; Ni, Shi-Ning; Gu, Wei

2014-08-01

The hypoparathyroidism, deafness and renal dysplasia (HDR) syndrome is an autosomal dominant disorder primarily caused by GATA3 gene mutation. We report here a case that both of a Chinese boy and his father had HDR syndrome which caused by a novel mutation of GATA3. Polymerase chain reaction and DNA sequencing was performed to detect the exons of the GATA3 gene for mutation analysis. Sequence analysis of GATA3 revealed a heterozygous nonsense mutation in this family: a mutation of GATA3 at exon 2 (c.515C >A) that resulted in a premature stop at codon 172 (p.S172X) with a loss of two zinc finger domains. We identified a novel nonsense mutation which will expand the spectrum of HDR-associated GATA3 mutations.

5’-Terminal AUGs in Escherichia coli mRNAs with Shine-Dalgarno Sequences: Identification and Analysis of Their Roles in Non-Canonical Translation Initiation

PubMed Central

Beck, Heather J.; Fleming, Ian M. C.

2016-01-01

Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs) that contain a conventional untranslated leader and Shine-Dalgarno (SD) sequence upstream of the gene’s start codon while also containing an AUG triplet at the mRNA’s 5’- terminus (5’-uAUG). Fusion of the coding sequence specified by the 5’-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5’-terminal upstream open reading frames (5’-uORFs) tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5’-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5’-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5’-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5’-uORFs may play roles in downstream regulation. Since the 5’-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5’-uAUGs should be examined for their potential to function also as leaderless mRNAs. PMID:27467758

eIF2β is critical for eIF5-mediated GDP-dissociation inhibitor activity and translational control

PubMed Central

Jennings, Martin D.; Kershaw, Christopher J.; White, Christopher; Hoyle, Danielle; Richardson, Jonathan P.; Costello, Joseph L.; Donaldson, Ian J.; Zhou, Yu; Pavitt, Graham D.

2016-01-01

In protein synthesis translation factor eIF2 binds initiator tRNA to ribosomes and facilitates start codon selection. eIF2 GDP/GTP status is regulated by eIF5 (GAP and GDI functions) and eIF2B (GEF and GDF activities), while eIF2α phosphorylation in response to diverse signals is a major point of translational control. Here we characterize a growth suppressor mutation in eIF2β that prevents eIF5 GDI and alters cellular responses to reduced eIF2B activity, including control of GCN4 translation. By monitoring the binding of fluorescent nucleotides and initiator tRNA to purified eIF2 we show that the eIF2β mutation does not affect intrinsic eIF2 affinities for these ligands, neither does it interfere with eIF2 binding to 43S pre-initiation complex components. Instead we show that the eIF2β mutation prevents eIF5 GDI stabilizing nucleotide binding to eIF2, thereby altering the off-rate of GDP from eIF2•GDP/eIF5 complexes. This enables cells to grow with reduced eIF2B GEF activity but impairs activation of GCN4 targets in response to amino acid starvation. These findings provide support for the importance of eIF5 GDI activity in vivo and demonstrate that eIF2β acts in concert with eIF5 to prevent premature release of GDP from eIF2γ and thereby ensure tight control of protein synthesis initiation. PMID:27458202

eIF2β is critical for eIF5-mediated GDP-dissociation inhibitor activity and translational control.

PubMed

Jennings, Martin D; Kershaw, Christopher J; White, Christopher; Hoyle, Danielle; Richardson, Jonathan P; Costello, Joseph L; Donaldson, Ian J; Zhou, Yu; Pavitt, Graham D

2016-11-16

In protein synthesis translation factor eIF2 binds initiator tRNA to ribosomes and facilitates start codon selection. eIF2 GDP/GTP status is regulated by eIF5 (GAP and GDI functions) and eIF2B (GEF and GDF activities), while eIF2α phosphorylation in response to diverse signals is a major point of translational control. Here we characterize a growth suppressor mutation in eIF2β that prevents eIF5 GDI and alters cellular responses to reduced eIF2B activity, including control of GCN4 translation. By monitoring the binding of fluorescent nucleotides and initiator tRNA to purified eIF2 we show that the eIF2β mutation does not affect intrinsic eIF2 affinities for these ligands, neither does it interfere with eIF2 binding to 43S pre-initiation complex components. Instead we show that the eIF2β mutation prevents eIF5 GDI stabilizing nucleotide binding to eIF2, thereby altering the off-rate of GDP from eIF2•GDP/eIF5 complexes. This enables cells to grow with reduced eIF2B GEF activity but impairs activation of GCN4 targets in response to amino acid starvation. These findings provide support for the importance of eIF5 GDI activity in vivo and demonstrate that eIF2β acts in concert with eIF5 to prevent premature release of GDP from eIF2γ and thereby ensure tight control of protein synthesis initiation. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Comparative Mitogenomics of Plant Bugs (Hemiptera: Miridae): Identifying the AGG Codon Reassignments between Serine and Lysine

PubMed Central

Wang, Pei; Song, Fan; Cai, Wanzhi

2014-01-01

Insect mitochondrial genomes are very important to understand the molecular evolution as well as for phylogenetic and phylogeographic studies of the insects. The Miridae are the largest family of Heteroptera encompassing more than 11,000 described species and of great economic importance. For better understanding the diversity and the evolution of plant bugs, we sequence five new mitochondrial genomes and present the first comparative analysis of nine mitochondrial genomes of mirids available to date. Our result showed that gene content, gene arrangement, base composition and sequences of mitochondrial transcription termination factor were conserved in plant bugs. Intra-genus species shared more conserved genomic characteristics, such as nucleotide and amino acid composition of protein-coding genes, secondary structure and anticodon mutations of tRNAs, and non-coding sequences. Control region possessed several distinct characteristics, including: variable size, abundant tandem repetitions, and intra-genus conservation; and was useful in evolutionary and population genetic studies. The AGG codon reassignments were investigated between serine and lysine in the genera Adelphocoris and other cimicomorphans. Our analysis revealed correlated evolution between reassignments of the AGG codon and specific point mutations at the antidocons of tRNALys and tRNASer(AGN). Phylogenetic analysis indicated that mitochondrial genome sequences were useful in resolving family level relationship of Cimicomorpha. Comparative evolutionary analysis of plant bug mitochondrial genomes allowed the identification of previously neglected coding genes or non-coding regions as potential molecular markers. The finding of the AGG codon reassignments between serine and lysine indicated the parallel evolution of the genetic code in Hemiptera mitochondrial genomes. PMID:24988409

EGFR Amplification and IDH Mutations in Glioblastoma Patients of the Northeast of Morocco

PubMed Central

Louati, Sara; Chbani, Laila; El Fatemi, Hind; Hammas, Nawal; Mikou, Karima; Maaroufi, Mustapha; Benzagmout, Mohammed; Boujraf, Said; El Bardai, Sanae; Giry, Marine; Marie, Yannick; Chaoui El Faiz, Mohammed; Mokhtari, Karima; Amarti, Afaf; Bennis, Sanae

2017-01-01

Glioblastomas are the most frequent and aggressive primary brain tumors which are expressing various evolutions, aggressiveness, and prognosis. Thus, the 2007 World Health Organization classification based solely on the histological criteria is no longer sufficient. It should be complemented by molecular analysis for a true histomolecular classification. The new 2016 WHO classification of tumors of the central nervous system uses molecular parameters in addition to histology to reclassify these tumors and reduce the interobserver variability. The aim of this study is to determine the prevalence of IDH mutations and EGFR amplifications in the population of the northeast region of Morocco and then to compare the results with other studies. Methods. IDH1 codon 132 and IDH2 codon 172 were directly sequenced and the amplification of exon 20 of EGFR gene was investigated by qPCR in 65 glioblastoma tumors diagnosed at the University Hospital of Fez between 2010 and 2014. Results. The R132H IDH1 mutation was observed in 8 of 65 tumor samples (12.31%). No mutation of IDH2 was detected. EGFR amplification was identified in 17 cases (26.15%). Conclusion. A systematic search of both histological and molecular markers should be requisite for a good diagnosis and a better management of glioblastomas. PMID:28785587

EGFR Amplification and IDH Mutations in Glioblastoma Patients of the Northeast of Morocco.

PubMed

Senhaji, Nadia; Louati, Sara; Chbani, Laila; El Fatemi, Hind; Hammas, Nawal; Mikou, Karima; Maaroufi, Mustapha; Benzagmout, Mohammed; Boujraf, Said; El Bardai, Sanae; Giry, Marine; Marie, Yannick; Chaoui El Faiz, Mohammed; Mokhtari, Karima; Idbaih, Ahmed; Amarti, Afaf; Bennis, Sanae

2017-01-01

Glioblastomas are the most frequent and aggressive primary brain tumors which are expressing various evolutions, aggressiveness, and prognosis. Thus, the 2007 World Health Organization classification based solely on the histological criteria is no longer sufficient. It should be complemented by molecular analysis for a true histomolecular classification. The new 2016 WHO classification of tumors of the central nervous system uses molecular parameters in addition to histology to reclassify these tumors and reduce the interobserver variability. The aim of this study is to determine the prevalence of IDH mutations and EGFR amplifications in the population of the northeast region of Morocco and then to compare the results with other studies. Methods . IDH1 codon 132 and IDH2 codon 172 were directly sequenced and the amplification of exon 20 of EGFR gene was investigated by qPCR in 65 glioblastoma tumors diagnosed at the University Hospital of Fez between 2010 and 2014. Results . The R132H IDH1 mutation was observed in 8 of 65 tumor samples (12.31%). No mutation of IDH2 was detected. EGFR amplification was identified in 17 cases (26.15%). Conclusion . A systematic search of both histological and molecular markers should be requisite for a good diagnosis and a better management of glioblastomas.

Mannan-binding lectin (MBL) gene polymorphisms in ulcerative colitis and Crohn's disease.

PubMed

Rector, A; Lemey, P; Laffut, W; Keyaerts, E; Struyf, F; Wollants, E; Vermeire, S; Rutgeerts, P; Van Ranst, M

2001-10-01

The inflammatory bowel diseases (IBD), Crohn's disease (CD), and ulcerative colitis (UC), are complex multifactorial traits involving both environmental and genetic factors. Mannan-binding lectin (MBL) plays an important role in non-specific immunity and complement activation. Point mutations in codons 52, 54 and 57 of exon 1 of the MBL gene are associated with decreased MBL plasma concentrations and increased susceptibility to various infectious diseases. If these MBL mutations could lead to susceptibility to putative IBD-etiological microbial agents, or could temper the complement-mediated mucosal damage in IBD, MBL could function as the link between certain microbial, immunological and genetic factors in IBD. In this study, we investigated the presence of the codon 52, 54 and 57 mutations of the MBL gene in 431 unrelated IBD patients, 112 affected and 141 unaffected first-degree relatives, and 308 healthy control individuals. In the group of sporadic IBD patients (n = 340), the frequency of the investigated MBL variants was significantly lower in UC patients when compared with CD patients (P = 0.01) and with controls (P = 0.02). These results suggest that MBL mutations which decrease the formation of functional MBL could protect against the clinical development of sporadic UC, but not of CD. This could be explained by the differential T-helper response in both diseases.

The Promiscuous sumA Missense Suppressor from Salmonella enterica Has an Intriguing Mechanism of Action

PubMed Central

Cole, Ashley E.; Hani, Fatmah M.; Altman, Ronni; Meservy, Megan; Roth, John R.; Altman, Elliot

2017-01-01

While most missense suppressors have very narrow specificities and only suppress the allele against which they were isolated, the sumA missense suppressor from Salmonella enterica serovar Typhimurium is a promiscuous or broad-acting missense suppressor that suppresses numerous missense mutants. The sumA missense suppressor was identified as a glyV tRNA Gly3(GAU/C) missense suppressor that can recognize GAU or GAC aspartic acid codons and insert a glycine amino acid instead of aspartic acid. In addition to rescuing missense mutants caused by glycine to aspartic acid changes as expected, sumA could also rescue a number of other missense mutants as well by changing a neighboring (contacting) aspartic acid to glycine, which compensated for the other amino acid change. Thus the ability of sumA to rescue numerous missense mutants was due in part to the large number of glycine codons in genes that can be mutated to an aspartic acid codon and in part to the general tolerability and/or preference for glycine amino acids in proteins. Because the glyV tRNA Gly3(GAU/C) missense suppressor has also been extensively characterized in Escherichia coli as the mutA mutator, we demonstrated that all gain-of-function mutants isolated in a glyV tRNA Gly3(GAU/C) missense suppressor are transferable to a wild-type background and thus the increased mutation rates, which occur in glyV tRNA Gly3(GAU/C) missense suppressors, are not due to the suppression of these mutants. PMID:27974497

Coinheritance of Hb S [β6(A3)Glu→Val, GAG>GTG] with β0-thalassemia codon 17 (A>T) in a Thai patient.

PubMed

Pornprasert, Sakorn; Panyasai, Sitthichai; Kongthai, Kanyakan; Treesuwan, Kallayanee

2012-01-01

Hb S [β6(A3)Glu→Val, GAG>GTG] is a β-globin gene variant that has a very low incidence in the Thai population. Coinheritance of Hb S and β(0)-thalassemia (β-thal) can result in severe clinical conditions. This study reports the case of a Thai patient with a compound heterozygosity for Hb S and β(0)-thal codon 17 (A>T). His hemoglobin (Hb), hematocrit (packed cell volume, PCV), mean corpuscular volume (MCV) and mean corpuscular Hb (MCH) levels were all less than the lower limits, while red cell distribution width (RDW) was higher than the upper limit. Levels of Hbs S, F and A(2) detected by high performance liquid chromatography (HPLC) were comparable to those from capillary electrophoresis (CE). As Hb S has a similar electrophoretic mobility and the HPLC profile is also similar to those of Hb Tak [β147, Term→Thr (+AC)] and Hb D-Punjab [β121(GH4)Glu→Gln, GAA>CAA], DNA sequencing was then performed. This was to detect β(0)-thal, and to differentiate Hb S from the Hb Tak and Hb D-Punjab mutations. The β(0)-thal codon 17 and Hb S mutations were detected indicating that coinheritance of these two mutations can be found in the Thai population. Therefore, to provide proper clinical management and genetic counseling of this rare case, DNA analysis should be performed in all cases when a peak at the S-window is detected by HPLC or CE.

Using Student Writing and Lexical Analysis to Reveal Student Thinking about the Role of Stop Codons in the Central Dogma.

PubMed

Prevost, Luanna B; Smith, Michelle K; Knight, Jennifer K

2016-01-01

Previous work has shown that students have persistent difficulties in understanding how central dogma processes can be affected by a stop codon mutation. To explore these difficulties, we modified two multiple-choice questions from the Genetics Concept Assessment into three open-ended questions that asked students to write about how a stop codon mutation potentially impacts replication, transcription, and translation. We then used computer-assisted lexical analysis combined with human scoring to categorize student responses. The lexical analysis models showed high agreement with human scoring, demonstrating that this approach can be successfully used to analyze large numbers of student written responses. The results of this analysis show that students' ideas about one process in the central dogma can affect their thinking about subsequent and previous processes, leading to mixed models of conceptual understanding. © 2016 L. B. Prevost et al. CBE—Life Sciences Education © 2016 The American Society for Cell Biology. This article is distributed by The American Society for Cell Biology under license from the author(s). It is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

The androgen receptor gene mutations database.

PubMed

Gottlieb, B; Trifiro, M; Lumbroso, R; Vasiliou, D M; Pinsky, L

1996-01-01

The current version of the androgen receptor (AR) gene mutations database is described. We have added (if available) data on the androgen binding phenotype of the mutant AR, the clinical phenotype of the affected persons, the family history and whether the pathogenicity of a mutation has been proven. Exonic mutations are now listed in 5'-->3' sequence regardless of type and single base pair changes are presented in codon context. Splice site and intronic mutations are listed separately. The database has allowed us to substantiate and amplify the observation of mutational hot spots within exons encoding the AR androgen binding domain. The database is available from EML (ftp://www.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker file (MC33@musica.mcgill.ca).

CMS-dependent prognostic impact of KRAS and BRAFV600E mutations in primary colorectal cancer.

PubMed

Smeby, J; Sveen, A; Merok, M A; Danielsen, S A; Eilertsen, I A; Guren, M G; Dienstmann, R; Nesbakken, A; Lothe, R A

2018-05-01

The prognostic impact of KRAS and BRAFV600E mutations in primary colorectal cancer (CRC) varies with microsatellite instability (MSI) status. The gene expression-based consensus molecular subtypes (CMSs) of CRC define molecularly and clinically distinct subgroups, and represent a novel stratification framework in biomarker analysis. We investigated the prognostic value of these mutations within the CMS groups. Totally 1197 primary tumors from a Norwegian series of CRC stage I-IV were analyzed for MSI and mutation status in hotspots in KRAS (codons 12, 13 and 61) and BRAF (codon 600). A subset was analyzed for gene expression and confident CMS classification was obtained for 317 samples. This cohort was expanded with clinical and molecular data, including CMS classification, from 514 patients in the publically available dataset GSE39582. Gene expression signatures associated with KRAS and BRAFV600E mutations were used to evaluate differential impact of mutations on gene expression among the CMS groups. BRAFV600E and KRAS mutations were both associated with inferior 5-year overall survival (OS) exclusively in MSS tumors (BRAFV600E mutation versus KRAS/BRAF wild-type: Hazard ratio (HR) 2.85, P < 0.001; KRAS mutation versus KRAS/BRAF wild-type: HR 1.30, P = 0.013). BRAFV600E-mutated MSS tumors were strongly enriched and associated with metastatic disease in CMS1, leading to negative prognostic impact in this subtype (OS: BRAFV600E mutation versus wild-type: HR 7.73, P = 0.001). In contrast, the poor prognosis of KRAS mutations was limited to MSS tumors with CMS2/CMS3 epithelial-like gene expression profiles (OS: KRAS mutation versus wild-type: HR 1.51, P = 0.011). The subtype-specific prognostic associations were substantiated by differential effects of BRAFV600E and KRAS mutations on gene expression signatures according to the MSI status and CMS group. BRAFV600E mutations are enriched and associated with metastatic disease in CMS1 MSS tumors, leading to poor prognosis in this subtype. KRAS mutations are associated with adverse outcome in epithelial (CMS2/CMS3) MSS tumors.

The impact of HIV-1 reverse transcriptase polymorphisms on responses to first-line nonnucleoside reverse transcriptase inhibitor-based therapy in HIV-1-infected adults.

PubMed

Mackie, Nicola E; Dunn, David T; Dolling, David; Garvey, Lucy; Harrison, Linda; Fearnhill, Esther; Tilston, Peter; Sabin, Caroline; Geretti, Anna M

2013-09-10

HIV-1 genetic variability may influence antiretroviral therapy (ART) outcomes. The study aim was to determine the impact of polymorphisms in regions known to harbor major nonnucleoside reverse transcriptase inhibitor (NNRTI) resistance mutations (codons 90-108, 135-138, 179-190, 225-348) on virologic responses to first-line NNRTI-based ART. Reverse transcriptase sequences from ART-naive individuals who commenced efavirenz (EFV) or nevirapine (NVP) with at least two nucleos(t)ide reverse transcriptase inhibitors (NRTIs) without major drug resistance mutations were analyzed. The impact of polymorphisms on week 4 viral load decrease and time to virologic failure was measured over a median 97 weeks. Among 4528 patients, most were infected with HIV-1 subtype B (67%) and commenced EFV-based ART (84%). Overall, 2598 (57%) had at least one polymorphism, most frequently at codons 90, 98, 101, 103, 106, 135, 138, 179, and 238. Virologic failure rates were increased in patients with two (n = 597) or more than two (n = 72) polymorphisms [adjusted hazard ratio 1.43; 95% confidence interval (CI) 1.07-1.92; P = 0.016]. Polymorphisms associated with virologic failure occurred at codons 90 (mostly V90I), 98 (mostly A98S), and 103 (mostly K103R), with adjusted hazard ratios of 1.78 (1.15-2.73; P = 0.009), 1.55 (1.16-2.08; P = 0.003), and 1.75 (1.00-3.05: P = 0.049), respectively. Polymorphisms at codon 179, especially V179D/E/T, predicted reduced week 4 responses (P = 0.001) but not virologic failure. The occurrence of multiple polymorphisms, though uncommon, was associated with a small increase in the risk of NNRTI treatment failure; significant effects were seen with polymorphisms at codon 90, 98, and 103. The mechanisms underlying the slower suppression seen with V179D/E/T deserve further investigation.

Minigene-like inhibition of protein synthesis mediated by hungry codons near the start codon

PubMed Central

Jacinto-Loeza, Eva; Vivanco-Domínguez, Serafín; Guarneros, Gabriel; Hernández-Sánchez, Javier

2008-01-01

Rare AGA or AGG codons close to the initiation codon inhibit protein synthesis by a tRNA-sequestering mechanism as toxic minigenes do. To further understand this mechanism, a parallel analysis of protein synthesis and peptidyl-tRNA accumulation was performed using both a set of lacZ constructs where AGAAGA codons were moved codon by codon from +2, +3 up to +7, +8 positions and a series of 3–8 codon minigenes containing AGAAGA codons before the stop codon. β-Galactosidase synthesis from the AGAAGA lacZ constructs (in a Pth defective in vitro system without exogenous tRNA) diminished as the AGAAGA codons were closer to AUG codon. Likewise, β-galactosidase expression from the reporter +7 AGA lacZ gene (plus tRNA, 0.25 μg/μl) waned as the AGAAGAUAA minigene shortened. Pth counteracted both the length-dependent minigene effect on the expression of β-galactosidase from the +7 AGA lacZ reporter gene and the positional effect from the AGAAGA lacZ constructs. The +2, +3 AGAAGA lacZ construct and the shortest +2, +3 AGAAGAUAA minigene accumulated the highest percentage of peptidyl-tRNAArg4. These observations lead us to propose that hungry codons at early positions, albeit with less strength, inhibit protein synthesis by a minigene-like mechanism involving accumulation of peptidyl-tRNA. PMID:18583364

The complete mitochondrial genome of Setaria digitata (Nematoda: Filarioidea): Mitochondrial gene content, arrangement and composition compared with other nematodes.

PubMed

Yatawara, Lalani; Wickramasinghe, Susiji; Rajapakse, R P V J; Agatsuma, Takeshi

2010-09-01

In the present study, we determined the complete mitochondrial (mt) genome sequence (13,839bp) of parasitic nematode Setaria digitata and its structure and organization compared with Onchocerca volvulus, Dirofilaria immitis and Brugia malayi. The mt genome of S. digitata is slightly larger than the mt genomes of other filarial nematodes. S. digitata mt genome contains 36 genes (12 protein-coding genes, 22 transfer RNAs and 2 ribosomal RNAs) that are typically found in metazoans. This genome contains a high A+T (75.1%) content and low G+C content (24.9%). The mt gene order for S. digitata is the same as those for O. volvulus, D. immitis and B. malayi but it is distinctly different from other nematodes compared. The start codons inferred in the mt genome of S. digitata are TTT, ATT, TTG, ATG, GTT and ATA. Interestingly, the initiation codon TTT is unique to S. digitata mt genome and four protein-coding genes use this codon as a translation initiation codon. Five protein-coding genes use TAG as a stop codon whereas three genes use TAA and four genes use T as a termination codon. Out of 64 possible codons, only 57 are used for mitochondrial protein-coding genes of S. digitata. T-rich codons such as TTT (18.9%), GTT (7.9%), TTG (7.8%), TAT (7%), ATT (5.7%), TCT (4.8%) and TTA (4.1%) are used more frequently. This pattern of codon usage reflects the strong bias for T in the mt genome of S. digitata. In conclusion, the present investigation provides new molecular data for future studies of the comparative mitochondrial genomics and systematic of parasitic nematodes of socio-economic importance. 2010 Elsevier B.V. All rights reserved.

Absence of ras-gene hot-spot mutations in canine fibrosarcomas and melanomas.

PubMed

Murua Escobar, Hugo; Günther, Kathrin; Richter, Andreas; Soller, Jan T; Winkler, Susanne; Nolte, Ingo; Bullerdiek, Jörn

2004-01-01

Point mutations within ras proto-oncogenes, particularly within the mutational hot-spot codons 12, 13 and 61, are frequently detected in human malignancies and in different types of experimentally-induced tumours in animals. So far little is known about ras mutations in naturally occurring canine fibrosarcomas or K-ras mutations in canine melanomas. To elucidate whether ras mutations exist in these naturally occurring tumours in dogs, in the present study we screened 13 canine fibrosarcomas, 2 feline fibrosarcomas and 11 canine melanomas for point mutations, particularly within the mutational hot-spots, making this the first study to investigate a large number of canine fibrosarcomas. None of the samples showed a K- or N-ras hot spot mutation. Thus, our data strongly suggest that ras mutations at the hot-spot loci are very rare and do not play a major role in the pathogenesis of the spontaneously occurring canine tumours investigated.

Identification of eight novel mutations in a collaborative analysis of a part of the second transmembrane domain of the CFTR gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mercier, B.; Audrezet, M.P.; Guillermit, H.

Cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible, when mutated, for cystic fibrosis (CF), spans over 230 kb on the long arm of chromosome 7 and is composed of 27 exons. The most common mutation responsible for CF worldwide is the deletion of a phenylalanine amino acid at codon 508 in the first nucleotide-binding fold and accounts for approximately 70% of CF chromosomes studied. More than 250 other mutations have been reported through the CF Genetic Analysis Consortium. The majority of the mutations previously described lie in the two nucleotide-binding folds. To explore exhaustively other regions of the gene,more » particularly exons coding for transmembrane domains, the authors have initiated a collaborative study between different laboratories to screen 369 non-[Delta]F508 CF chromosomes of seven ethnic European populations (Belgian, French, Breton, Irish, Italian, Yugoslavian, Russian). Among these chromosomes carrying an unidentified mutation, 63 were from Brittany, 50 of various French origin, 45 of Irish origin, 56 of Italian origin, 41 of Belgian origin, 2 of Turkish origin, 38 of Yugoslavian origin, 22 of Russian origin, and 52 of Bulgarian origin. Diagnostic criteria for CF included at least one positive sweat test and pulmonary disease with or without pancreatic disease. Using a denaturing gradient gel electrophoresis (DGGE) assay, they have identified eight novel mutations in exon 17b coding for part of the second transmembrane domain of the CFTR and they describe them in this report. 8 refs., 1 fig., 1 tab.« less

High penetrance of pheochromocytoma associated with the novel C634Y/Y791F double germline mutation in the RET protooncogene.

PubMed

Toledo, Rodrigo A; Wagner, Simona M; Coutinho, Flavia L; Lourenço, Delmar M; Azevedo, Juliana A; Longuini, Viviane C; Reis, Mariana T A; Siqueira, Sheila A C; Lucon, Antonio M; Tavares, Marcos R; Fragoso, Maria C B V; Pereira, Adelaide A; Dahia, Patricia L M; Mulligan, Lois M; Toledo, Sergio P A

2010-03-01

Previous studies have shown that double RET mutations may be associated with unusual multiple endocrine neoplasia type 2 (MEN 2) phenotypes. Our objective was to report the clinical features of patients harboring a previously unreported double mutation of the RET gene and to characterize this mutation in vitro. Sixteen patients from four unrelated families and harboring the C634Y/Y791F double RET germline mutation were included in the study. Large pheochromocytomas measuring 6.0-14 cm and weighing up to 640 g were identified in the four index cases. Three of the four tumors were bilateral. High penetrance of pheochromocytoma was also seen in the C634Y/Y791F-mutation-positive relatives (seven of nine, 77.7%). Of these, two cases had bilateral tumors, one presented with multifocal tumors, two cases had large tumors (>5 cm), and one case, which was diagnosed with a large (5.5 x 4.5 x 4.0 cm) pheochromocytoma, reported early onset of symptoms of the disease (14 yr old). The overall penetrance of pheochromocytoma was 84.6% (11 of 13). Development of medullary thyroid carcinoma in our patients seemed similar to that observed in patients with codon 634 mutations. Haplotype analysis demonstrated that the mutation did not arise from a common ancestor. In vitro studies showed the double C634Y/Y791F RET receptor was significantly more phosphorylated than either activated wild-type receptor or single C634Y and Y791F RET mutants. Our data suggest that the natural history of the novel C634Y/Y791F double mutation carries a codon 634-like pattern of medullary thyroid carcinoma development, is associated with increased susceptibility to unusually large bilateral pheochromocytomas, and is likely more biologically active than each individual mutation.

Missense mutation (E150K) of rhodopsin in autosomal recessive retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orth, U.; Oehlmann, R.; Gal, A.

1994-09-01

Missense or nonsense mutations of the rhodopsin gene have been implied in the pathogenesis of at least 3 different traits; autosomal dominant retinitis pigmentosa (adRP), congenital stationary night blindness (CSNB), and autosomal recessive retinitis pigmentosa (arRP). For the latter, a single patient has been reported with a nonsense mutation at codon 249 on both alleles. Heterozygous carriers of missense mutations of rhodopsin develop either adRP or CSNB depending on the particular amino acid substitution. Four of the 9 siblings from a consanguineous marriage in southern India were reported the have arRP. Mutational screening and sequencing of the rhodopsin gene revealedmore » a G-to-A transition of the first nucleotide at codon 150 in exon II, which alters glutamate to lysine. The E150K mutation was present in the 4 patients in homozygous form, whereas the parents and 2 of the siblings were heterozygotes. Two-point analysis produced a Zmax=3.46 at theta=0.00. Two unaffected siblings who are heterozygotes for the E150K mutation underwent a thorough ophthalmological and psychophysical examination. No clinical abnormalities were found although these individuals were over forty, whereas the onset of RP in their affected siblings was in the second decade. Collectively, both the genetic and clinical findings strongly suggest that the E150K mutation of rhodopsin is recessive in this family. Glu150 forms part of the CD cytoplasmic loop of rhodopsin, which has been implicated in the binding and activation of transducin. We speculate that E150K leads to RP because the mutant protein may be incapable of activating transducin. It is tempting to speculate that, in addition to mutations in the genes for rhodopsin and the {beta}-subunit of PDE, mutations in the genes for transducin may also result in arRP.« less

A novel nonsense mutation in CRYBB1 associated with autosomal dominant congenital cataract

PubMed Central

Yang, Juhua; Zhu, Yihua; Gu, Feng; He, Xiang; Cao, Zongfu; Li, Xuexi; Tong, Yi

2008-01-01

Purpose To identify the molecular defect underlying an autosomal dominant congenital nuclear cataract in a Chinese family. Methods Twenty-two members of a three-generation pedigree were recruited, clinical examinations were performed, and genomic DNA was extracted from peripheral blood leukocytes. All members were genotyped with polymorphic microsatellite markers adjacent to each of the known cataract-related genes. Linkage analysis was performed after genotyping. Candidate genes were screened for mutation using direct sequencing. Individuals were screened for presence of a mutation by restriction fragment length polymorphism (RFLP) analysis. Results Linkage analysis identified a maximum LOD score of 3.31 (recombination fraction [θ]=0.0) with marker D22S1167 on chromosome 22, which flanks the β-crystallin gene cluster (CRYBB3, CRYBB2, CRYBB1, and CRYBA4). Sequencing the coding regions and the flanking intronic sequences of these four candidate genes identified a novel, heterozygous C→T transition in exon 6 of CRYBB1 in the affected individuals of the family. This single nucleotide change introduced a novel BfaI site and was predicted to result in a nonsense mutation at codon 223 that changed a phylogenetically conserved amino acid to a stop codon (p.Q223X). RFLP analysis confirmed that this mutation co-segregated with the disease phenotype in all available family members and was not found in 100 normal unrelated individuals from the same ethnic background. Conclusions This study has identified a novel nonsense mutation in CRYBB1 (p.Q223X) associated with autosomal dominant congenital nuclear cataract. PMID:18432316

Assessment of K-Ras mutant frequency and micronucleus incidence in the mouse duodenum following 90-days of exposure to Cr(VI) in drinking water.

PubMed

O'Brien, Travis J; Ding, Hao; Suh, Mina; Thompson, Chad M; Parsons, Barbara L; Harris, Mark A; Winkelman, William A; Wolf, Jeffrey C; Hixon, J Gregory; Schwartz, Arnold M; Myers, Meagan B; Haws, Laurie C; Proctor, Deborah M

2013-06-14

Chronic exposure to high concentrations of hexavalent chromium [Cr(VI)] as sodium dichromate dihydrate (SDD) in drinking water induces duodenal tumors in mice, but the mode of action (MOA) for these tumors has been a subject of scientific debate. To evaluate the tumor-site-specific genotoxicity and cytotoxicity of SDD in the mouse small intestine, tissue pathology and cytogenetic damage were evaluated in duodenal crypt and villus enterocytes from B6C3F1 mice exposed to 0.3-520mg/L SDD in drinking water for 7 and 90 days. Allele-competitive blocker PCR (ACB-PCR) was used to investigate the induction of a sensitive, tumor-relevant mutation, specifically in vivo K-Ras codon 12 GAT mutation, in scraped duodenal epithelium following 90 days of drinking water exposure. Cytotoxicity was evident in the villus as disruption of cellular arrangement, desquamation, nuclear atypia and blunting. Following 90 days of treatment, aberrant nuclei, occurring primarily at villi tips, were significantly increased at ≥60mg/L SDD. However, in the crypt compartment, there were no dose-related effects on mitotic and apoptotic indices or the formation of aberrant nuclei indicating that Cr(VI)-induced cytotoxicity was limited to the villi. Cr(VI) caused a dose-dependent proliferative response in the duodenal crypt as evidenced by an increase in crypt area and increased number of crypt enterocytes. Spontaneous K-Ras codon 12 GAT mutations in untreated mice were higher than expected, in the range of 10(-2) to 10(-3); however no treatment-related trend in the K-Ras codon 12 GAT mutation was observed. The high spontaneous background K-Ras mutant frequency and Cr(VI) dose-related increases in crypt enterocyte proliferation, without dose-related increase in K-Ras mutant frequency, micronuclei formation, or change in mitotic or apoptotic indices, are consistent with a lack of genotoxicity in the crypt compartment, and a MOA involving accumulation of mutations late in carcinogenesis as a consequence of sustained regenerative proliferation. Published by Elsevier B.V.

High MACC1 expression in combination with mutated KRAS G13 indicates poor survival of colorectal cancer patients.

PubMed

Ilm, Katharina; Kemmner, Wolfgang; Osterland, Marc; Burock, Susen; Koch, Gudrun; Herrmann, Pia; Schlag, Peter M; Stein, Ulrike

2015-02-14

The metastasis-associated in colon cancer 1 (MACC1) gene has been identified as prognostic biomarker for colorectal cancer (CRC). Here, we aimed at the refinement of risk assessment by separate and combined survival analyses of MACC1 expression with any of the markers KRAS mutated in codon 12 (KRAS G12) or codon 13 (KRAS G13), BRAF V600 mutation and MSI status in a retrospective study of 99 CRC patients with tumors UICC staged I, II and III. We showed that only high MACC1 expression (HR: 6.09, 95% CI: 2.50-14.85, P < 0.001) and KRAS G13 mutation (HR: 5.19, 95% CI: 1.06-25.45, P = 0.042) were independent prognostic markers for shorter metastasis-free survival (MFS). Accordingly, Cox regression analysis revealed that patients with high MACC1 expression and KRAS G13 mutation exhibited the worst prognosis (HR: 14.48, 95% CI: 3.37-62.18, P < 0.001). Patients were classified based on their molecular characteristics into four clusters with significant differences in MFS (P = 0.003) by using the SPSS 2-step cluster function and Kaplan-Meier survival analysis. According to our results, patients with high MACC1 expression and mutated KRAS G13 exhibited the highest risk for metachronous metastases formation. Moreover, we demonstrated that the "Traditional pathway" with an intermediate risk for metastasis formation can be further subdivided by assessing MACC1 expression into a low and high risk group with regard to MFS prognosis. This is the first report showing that identification of CRC patients at high risk for metastasis is possible by assessing MACC1 expression in combination with KRAS G13 mutation.

Refactoring the Genetic Code for Increased Evolvability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pines, Gur; Winkler, James D.; Pines, Assaf

ABSTRACT The standard genetic code is robust to mutations during transcription and translation. Point mutations are likely to be synonymous or to preserve the chemical properties of the original amino acid. Saturation mutagenesis experiments suggest that in some cases the best-performing mutant requires replacement of more than a single nucleotide within a codon. These replacements are essentially inaccessible to common error-based laboratory engineering techniques that alter a single nucleotide per mutation event, due to the extreme rarity of adjacent mutations. In this theoretical study, we suggest a radical reordering of the genetic code that maximizes the mutagenic potential of singlemore » nucleotide replacements. We explore several possible genetic codes that allow a greater degree of accessibility to the mutational landscape and may result in a hyperevolvable organism that could serve as an ideal platform for directed evolution experiments. We then conclude by evaluating the challenges of constructing such recoded organisms and their potential applications within the field of synthetic biology. IMPORTANCE The conservative nature of the genetic code prevents bioengineers from efficiently accessing the full mutational landscape of a gene via common error-prone methods. Here, we present two computational approaches to generate alternative genetic codes with increased accessibility. These new codes allow mutational transitions to a larger pool of amino acids and with a greater extent of chemical differences, based on a single nucleotide replacement within the codon, thus increasing evolvability both at the single-gene and at the genome levels. Given the widespread use of these techniques for strain and protein improvement, along with more fundamental evolutionary biology questions, the use of recoded organisms that maximize evolvability should significantly improve the efficiency of directed evolution, library generation, and fitness maximization.« less

Functioning and nonfunctioning thyroid adenomas involve different molecular pathogenetic mechanisms.

PubMed

Tonacchera, M; Vitti, P; Agretti, P; Ceccarini, G; Perri, A; Cavaliere, R; Mazzi, B; Naccarato, A G; Viacava, P; Miccoli, P; Pinchera, A; Chiovato, L

1999-11-01

The molecular biology of follicular cell growth in thyroid nodules is still poorly understood. Because gain-of-function (activating) mutations of the thyroid-stimulating hormone receptor (TShR) and/or Gs alpha genes may confer TSh-independent growth advantage to neoplastic thyroid cells, we searched for somatic mutations of these genes in a series of hyperfunctioning and nonfunctioning follicular thyroid adenomas specifically selected for their homogeneous gross anatomy (single nodule in an otherwise normal thyroid gland). TShR gene mutations were identified by direct sequencing of exons 9 and 10 of the TShR gene in genomic DNA obtained from surgical specimens. Codons 201 and 227 of the Gs alpha gene were also analyzed. At histology, all hyperfunctioning nodules and 13 of 15 nonfunctioning nodules were diagnosed as follicular adenomas. Two nonfunctioning thyroid nodules, although showing a prevalent microfollicular pattern of growth, had histological features indicating malignant transformation (a minimally invasive follicular carcinoma and a focal papillary carcinoma). Activating mutations of the TShR gene were found in 12 of 15 hyperfunctioning follicular thyroid adenomas. In one hyperfunctioning adenoma, which was negative for TShR mutations, a mutation in codon 227 of the Gs alpha gene was identified. At variance with hyperfunctioning thyroid adenomas, no mutation of the TShR or Gs alpha genes was detected in nonfunctioning thyroid nodules. In conclusion, our findings clearly define a different molecular pathogenetic mechanism in hyperfunctioning and nonfunctioning follicular thyroid adenomas. Activation of the cAMP cascade, which leads to proliferation but maintains differentiation of follicular thyroid cells, typically occurs in hyperfunctioning thyroid adenomas. Oncogenes other than the TShR and Gs alpha genes are probably involved in nonfunctioning follicular adenomas.

Refactoring the Genetic Code for Increased Evolvability

DOE PAGES

Pines, Gur; Winkler, James D.; Pines, Assaf; ...

2017-11-14

ABSTRACT The standard genetic code is robust to mutations during transcription and translation. Point mutations are likely to be synonymous or to preserve the chemical properties of the original amino acid. Saturation mutagenesis experiments suggest that in some cases the best-performing mutant requires replacement of more than a single nucleotide within a codon. These replacements are essentially inaccessible to common error-based laboratory engineering techniques that alter a single nucleotide per mutation event, due to the extreme rarity of adjacent mutations. In this theoretical study, we suggest a radical reordering of the genetic code that maximizes the mutagenic potential of singlemore » nucleotide replacements. We explore several possible genetic codes that allow a greater degree of accessibility to the mutational landscape and may result in a hyperevolvable organism that could serve as an ideal platform for directed evolution experiments. We then conclude by evaluating the challenges of constructing such recoded organisms and their potential applications within the field of synthetic biology. IMPORTANCE The conservative nature of the genetic code prevents bioengineers from efficiently accessing the full mutational landscape of a gene via common error-prone methods. Here, we present two computational approaches to generate alternative genetic codes with increased accessibility. These new codes allow mutational transitions to a larger pool of amino acids and with a greater extent of chemical differences, based on a single nucleotide replacement within the codon, thus increasing evolvability both at the single-gene and at the genome levels. Given the widespread use of these techniques for strain and protein improvement, along with more fundamental evolutionary biology questions, the use of recoded organisms that maximize evolvability should significantly improve the efficiency of directed evolution, library generation, and fitness maximization.« less

C-kit mutations in gastrointestinal stromal tumours.

PubMed

Morey, Adrienne L; Wanigesekera, G David; Hawkins, Nicholas J; Ward, Robyn L

2002-08-01

Gastrointestinal stromal tumours (GISTs), once assumed to be of smooth muscle origin, generally express CD117 and CD34, similar to the interstitial cells of Cajal. Assessment of malignant potential in GISTs is problematic, especially on small biopsies. Some recent data indicate that mutations in the juxtamembrane domain (exon 11) of the c-kit (CD117) proto-oncogene may be associated with a worse prognosis. In this study, the frequency of c-kit exon 11 mutations has been determined in a series of 18 gut stromal tumours. Immunophenotype was assessed by immunoperoxidase stains for smooth muscle actin, desmin, S100, CD34 and CD117, and each tumour classified as being of low, uncertain (intermediate) or high malignant potential based on standard histological criteria. DNA from each tumour was extracted from fresh (n = 5) or formalin-fixed, paraffin-embedded (n= 13) tissues using the direct lysis method. Exon 11 was amplified by PCR and sequencing of both sense and antisense strands was performed on two occasions using an ABI 377 sequencer. Mutations in exon 11 were detected in three of 14 confirmed GISTs, two being point mutations at codon 560 and one a 3-bp deletion resulting in the in-frame deletion of glutamine at codon 561. All three tumours were of high or intermediate malignant potential histologically. Three other 'high risk' primary GISTs and a metastatic GIST deposit were negative for exon 11 mutations. Data on this relatively small cohort of Australian patients indicate that c-kit exon 11 mutation analysis does not correlate well with histological assessment of malignant potential, and cannot be regarded as a reliable objective marker for poor prognosis in GISTs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ngo, K.Y.; Liu, D.; Lee, J.

During the past two years we have tested 2,300 Southeast Asians for alpha- and beta-thaleassemia mutations. We found the incidence of hemoglobin E ({beta}{sup 26}) to be 47% among Laotians and 38% among Cambodians. The incidence of beta thalassemia trait is 9% for Laotians and 6% for Cambodians. Thus, the risk for hemoglobin E/{beta}{sup 26} thalassemia, a transfusion-dependent disorder, is increased in these two population groups. Denaturing gradient gel electrophoresis (DGGE) has proven to be useful in testing for beta-thalassemia carriers and identifying new mutations in the beta globin gene. DNA was extracted from venous blood obtained from patients withmore » elevated Hgb A2 (>4%). Five DNA fragments, encompassing the beta globin gene cluster, were amplified by PCR and analyzed, along with known beta gene mutations as controls, by DGGE using different denaturing gradient concentrations. Different mutations at the same nucleotide position can be distinguished by migration pattern on the DGGE (e.g., in IVS-I-1, G{r_arrow}A and T). Compound heterozygotes for {beta}-thalassemia can be detected on the same gel (e.g., HbE/mutation codon 17). New mutations are identified by their migration pattern compared with controls and determined by subsequent sequencing. We have identified three new mutations: codon 82 CAA{r_arrow}AAA in one Cambodian patient; IVS-II-667, T{r_arrow}C and IVS-II-672, A{r_arrow}C in two Laotian patients. When the parent`s genotypes are known, prenatal diagnosis can be obtained within 24 hours. Thus, PCR/DGGE combination is a rapid and reliable diagnostic approach to clinically significant {beta}-thalassemia. The most important steps are carefully designed primers and predetermined gradient concentrations for DGGE.« less

CRISPR-Mediated Base Editing Enables Efficient Disruption of Eukaryotic Genes through Induction of STOP Codons.

PubMed

Billon, Pierre; Bryant, Eric E; Joseph, Sarah A; Nambiar, Tarun S; Hayward, Samuel B; Rothstein, Rodney; Ciccia, Alberto

2017-09-21

Standard CRISPR-mediated gene disruption strategies rely on Cas9-induced DNA double-strand breaks (DSBs). Here, we show that CRISPR-dependent base editing efficiently inactivates genes by precisely converting four codons (CAA, CAG, CGA, and TGG) into STOP codons without DSB formation. To facilitate gene inactivation by induction of STOP codons (iSTOP), we provide access to a database of over 3.4 million single guide RNAs (sgRNAs) for iSTOP (sgSTOPs) targeting 97%-99% of genes in eight eukaryotic species, and we describe a restriction fragment length polymorphism (RFLP) assay that allows the rapid detection of iSTOP-mediated editing in cell populations and clones. To simplify the selection of sgSTOPs, our resource includes annotations for off-target propensity, percentage of isoforms targeted, prediction of nonsense-mediated decay, and restriction enzymes for RFLP analysis. Additionally, our database includes sgSTOPs that could be employed to precisely model over 32,000 cancer-associated nonsense mutations. Altogether, this work provides a comprehensive resource for DSB-free gene disruption by iSTOP. Copyright © 2017 Elsevier Inc. All rights reserved.

Gene analysis of steroid 5 alpha-reductase 1 in hyperandrogenic women.

PubMed

Eminović, Izet; Komel, Radovan; Prezelj, Janez; Karamehić, Jasenko; Gavrankapetanović, Faris; Heljić, Becir

2005-08-01

To examine the gene encoding for 5alpha-reductase type 1 in hyperandrogenic women, and assess the association of its eventual mutations or polymorphisms with the development of the hyperandrogenic female pattern. Sixteen hyperandrogenic women were included in the study. Single-stranded conformation polymorphism analysis (SSCP) and DNA sequencing were performed after polymerase chain reaction amplification of each of the 5 exons of the SRD5A1 gene in both hyperandrogenic and control group (16 participants). Sequence analysis identified the existence of many polymorphisms; in codon 24 of exon 1, GGC (Gly) into GAC (Asp); in codon 30 of exon 1, CGG (Arg) into CGC (Arg); in exon 3 codon 169, ACA to ACG (both encoding for threonine); in exon 5, AGA to AGG (both encoding for arginine, codon 260); and T/C polymorphism in intron 2. Polymorphisms were found in both groups. Polymorphisms of SRD5A1 gene were the same in both hyperandrogenic and healthy women, indicating no significant associations of genetic polymorphisms/variations of SRD5A1 gene with clinical manifestations of hyperandrogenic disorders in women.

Transcriptional regulation of the human mitochondrial peptide deformylase (PDF).

PubMed

Pereira-Castro, Isabel; Costa, Luís Teixeira da; Amorim, António; Azevedo, Luisa

2012-05-18

The last years of research have been particularly dynamic in establishing the importance of peptide deformylase (PDF), a protein of the N-terminal methionine excision (NME) pathway that removes formyl-methionine from mitochondrial-encoded proteins. The genomic sequence of the human PDF gene is shared with the COG8 gene, which encodes a component of the oligomeric golgi complex, a very unusual case in Eukaryotic genomes. Since PDF is crucial in maintaining mitochondrial function and given the atypical short distance between the end of COG8 coding sequence and the PDF initiation codon, we investigated whether the regulation of the human PDF is affected by the COG8 overlapping partner. Our data reveals that PDF has several transcription start sites, the most important of which only 18 bp from the initiation codon. Furthermore, luciferase-activation assays using differently-sized fragments defined a 97 bp minimal promoter region for human PDF, which is capable of very strong transcriptional activity. This fragment contains a potential Sp1 binding site highly conserved in mammalian species. We show that this binding site, whose mutation significantly reduces transcription activation, is a target for the Sp1 transcription factor, and possibly of other members of the Sp family. Importantly, the entire minimal promoter region is located after the end of COG8's coding region, strongly suggesting that the human PDF preserves an independent regulation from its overlapping partner. Copyright © 2012 Elsevier Inc. All rights reserved.

Linkage to D3S47 (C17) in one large autosomal dominant retinitis pigmentosa family and exclusion in another: confirmation of genetic heterogeneity.

PubMed Central

Lester, D H; Inglehearn, C F; Bashir, R; Ackford, H; Esakowitz, L; Jay, M; Bird, A C; Wright, A F; Papiha, S S; Bhattacharya, S S

1990-01-01

Recently Dryja and his co-workers observed a mutation in the 23d codon of the rhodopsin gene in a proportion of autosomal dominant retinitis pigmentosa (ADRP) patients. Linkage analysis with a rhodopsin-linked probe C17 (D3S47) was carried out in two large British ADRP families, one with diffuse-type (D-type) RP and the other with regional-type (R-type) RP. Significantly positive lod scores (lod score maximum [Zmax] = +5.58 at recombination fraction [theta] = .0) were obtained between C17 and our D-type ADRP family showing complete penetrance. Sequence and oligonucleotide analysis has, however, shown that no point mutation at the 23d codon exists in affected individuals in our complete-penetrance pedigree, indicating that another rhodopsin mutation is probably responsible for ADRP in this family. Significantly negative lod scores (Z less than -2 at theta = .045) were, however, obtained between C17 and our R-type family which showed incomplete penetrance. Previous results presented by this laboratory also showed no linkage between C17 and another large British R-type ADRP family with incomplete penetrance. This confirms genetic heterogeneity. Some types of ADRP are being caused by different mutations in the rhodopsin locus (3q21-24) or another tightly linked gene in this region, while other types of ADRP are the result of mutations elsewhere in the genome. Images Figure 2 Figure 3 Figure 4 PMID:2393026

Prevalence of Skin Lesions in Familial Adenomatous Polyposis: A Marker for Presymptomatic Diagnosis?

PubMed Central

Cattani, Nadja; Trueb, Swantje; de Lorenzo, Rosaria; Albertini, Mauro; Bontognali, Emanuele; Itin, Christoph; Schaub, Nathalie; Itin, Peter H.

2011-01-01

Background and Aims. Benign skin tumors such as lipomas, fibromas, and epidermal cysts are among the extracolonic manifestations of familial adenomatous polyposis (FAP). Readily detectable by inspection, they could serve as presymptomatic diagnostic markers to identify FAP patients. We therefore prospectively determined the prevalence of cutaneous lesions in genetically confirmed adenomatous polyposis coli (APC) mutation carriers and assessed their potential usefulness in the identification of FAP patients. Methods. Whole-skin examination was performed in 56 adult APC mutation carriers, compared with a control group (n = 116). In addition, FAP patients were investigated for the presence of congenital hypertrophy of the retinal pigment epithelium (CHRPE), an established clinical marker for FAP, and a detailed review of medical records was performed. Results. Nearly half of all FAP patients (48.2%) had at least one FAP-associated skin lesion, compared with one third (34.5%) of controls. Only multiple lipomas and combined skin lesions were significantly more prevalent in APC mutation carriers. CHRPE was observed in 22 (43.1%) of 51 FAP patients, including 14 (37.8%) of 37 individuals with APC mutations outside the CHRPE-associated region between codons 311 and 1465. Conclusions. Despite a significantly higher prevalence of multiple lipomas, occurring at younger age, and combined skin lesions in APC mutation carriers, the low diagnostic sensitivity of FAP-associated skin lesions precludes their use as markers for FAP in clinical practice. Based on our findings, the common CHRPE-associated region should be extended to APC codons 148-2043. PMID:22135120

The cyc1-11 mutation in yeast reverts by recombination with a nonallelic gene: composite genes determining the iso-cytochromes c.

PubMed Central

Ernst, J F; Stewart, J W; Sherman, F

1981-01-01

DNA sequence analysis of a cloned fragment directly established that the cyc1-11 mutation of iso-1-cytochrome c in the yeast Saccharomyces cerevisiae is a two-base-pair substitution that changes the CCA proline codon at amino acid position 76 to a UAA nonsense codon. Analysis of 11 revertant proteins and one cloned revertant gene showed that reversion of the cyc1-11 mutation can occur in three ways: a single base-pair substitution, which produces a serine replacement at position 76; recombination with the nonallelic CYC7 gene of iso-2-cytochrome c, which causes replacement of a segment in the cyc1-11 gene by the corresponding segment of the CYC7 gene; and either a two-base-pair substitution or recombination with the CYC7 gene, which causes the formation of the normal iso-1-cytochrome c sequence. These results demonstrate the occurrence of low frequencies of recombination between nonallelic genes having extensive but not complete homology. The formation of composite genes that share sequences from nonallelic genes may be an evolutionary mechanism for producing protein diversities and for maintaining identical sequences at different loci. Images PMID:6273865

Emerging genetic therapies to treat Duchenne muscular dystrophy

PubMed Central

Nelson, Stanley F.; Crosbie, Rachelle H.; Miceli, M. Carrie; Spencer, Melissa J.

2010-01-01

Purpose of review Duchenne muscular dystrophy is a progressive muscle degenerative disease caused by dystrophin mutations. The purpose of this review is to highlight two emerging therapies designed to repair the primary genetic defect, called `exon skipping' and `nonsense codon suppression'. Recent findings A drug, PTC124, was identified that suppresses nonsense codon translation termination. PTC124 can lead to restoration of some dystrophin expression in human Duchenne muscular dystrophy muscles with mutations resulting in premature stops. Two drugs developed for exon skipping, PRO051 and AVI-4658, result in the exclusion of exon 51 from mature mRNA. They can restore the translational reading frame to dystrophin transcripts from patients with a particular subset of dystrophin gene deletions and lead to some restoration of dystrophin expression in affected boys' muscle in vivo. Both approaches have concluded phase I trials with no serious adverse events. Summary These novel therapies that act to correct the primary genetic defect of dystrophin deficiency are among the first generation of therapies tailored to correct specific mutations in humans. Thus, they represent paradigm forming approaches to personalized medicine with the potential to lead to life changing treatment for those affected by Duchenne muscular dystrophy. PMID:19745732

Dental anomalies in pediatric patients with familial adenomatous polyposis.

PubMed

Septer, Seth; Bohaty, Brenda; Onikul, Robin; Kumar, Vandana; Williams, Karen B; Attard, Thomas M; Friesen, Craig A; Friesen, Lynn Roosa

2018-04-01

Familial adenomatous polyposis patients often present with non-malignant extra-intestinal manifestations which include dental anomalies that may be evident prior to the appearance of the colonic adenomas. The aims of this study were to describe the prevalence and type of dental anomalies and the relationships between gene mutations and dental anomalies in these patients. Twenty-two pediatric familial adenomatous polyposis patients and 46 controls, who were age and gender matched participated. Familial adenomatous polyposis patient's had a dental examination with panoramic radiograph and medical record review for age at diagnosis, the presence of the adenomatous polyposis coli gene mutation, and determination of other extra-intestinal manifestations on the body. The control group was identified from a retrospective chart review and selected if there was a current panoramic radiograph. The only significant difference between familial adenomatous polyposis patients and controls were the presence of jaw osteomas and sclerosis (p = .0001). Patients with a mutation in, or upstream of codon 1309 had a higher frequency of osteomas (77.8%) and jaw-bone sclerosis (44.4%), and 77% of these had at least one dental anomaly. This preliminary study showed an association between a genetic variant at, or upstream of codon 1309, and radiographic dental anomalies.

Human Salmonella and Concurrent Decreased Susceptibility to Quinolones and Extended-Spectrum Cephalosporins

PubMed Central

Gay, Kathryn; Stevenson, Jennifer E.; Joyce, Kevin J.; Cooper, Kara L.; Omondi, Michael; Medalla, Felicita; Jacoby, George A.; Barrett, Timothy J.

2007-01-01

The National Antimicrobial Resistance Monitoring System monitors susceptibility among Enterobacteriaceae in humans in the United States. We studied isolates exhibiting decreased susceptibility to quinolones (nalidixic acid MIC >32 µg/mL or ciprofloxacin MIC >0.12 µg/mL) and extended-spectrum cephalosporins (ceftiofur or ceftriaxone MIC >2 µg/mL) during 1996–2004. Of non-Typhi Salmonella, 0.19% (27/14,043) met these criteria: 11 Senftenberg; 6 Typhimurium; 3 Newport; 2 Enteridis; and 1 each Agona, Haifa, Mbandaka, Saintpaul, and Uganda. Twenty-six isolates had gyrA mutations (11 at codon 83 only, 3 at codon 87 only, 12 at both). All Senftenberg isolates had parC mutations (S80I and T57S); 6 others had the T57S mutation. The Mbandaka isolate contained qnrB2. Eight isolates contained blaCMY-2; 1 Senftenberg contained blaCMY-23. One Senftenberg and 1Typhimurium isolate contained blaSHV-12; the Mbandaka isolate contained blaSHV-30. Nine Senftenberg isolates contained blaOXA-1; 1 contained blaOXA-9. Further studies should address patient outcomes, risk factors, and resistance dissemination prevention strategies. PMID:18217551

Culture adaptation of malaria parasites selects for convergent loss-of-function mutants.

PubMed

Claessens, Antoine; Affara, Muna; Assefa, Samuel A; Kwiatkowski, Dominic P; Conway, David J

2017-01-24

Cultured human pathogens may differ significantly from source populations. To investigate the genetic basis of laboratory adaptation in malaria parasites, clinical Plasmodium falciparum isolates were sampled from patients and cultured in vitro for up to three months. Genome sequence analysis was performed on multiple culture time point samples from six monoclonal isolates, and single nucleotide polymorphism (SNP) variants emerging over time were detected. Out of a total of five positively selected SNPs, four represented nonsense mutations resulting in stop codons, three of these in a single ApiAP2 transcription factor gene, and one in SRPK1. To survey further for nonsense mutants associated with culture, genome sequences of eleven long-term laboratory-adapted parasite strains were examined, revealing four independently acquired nonsense mutations in two other ApiAP2 genes, and five in Epac. No mutants of these genes exist in a large database of parasite sequences from uncultured clinical samples. This implicates putative master regulator genes in which multiple independent stop codon mutations have convergently led to culture adaptation, affecting most laboratory lines of P. falciparum. Understanding the adaptive processes should guide development of experimental models, which could include targeted gene disruption to adapt fastidious malaria parasite species to culture.

CMV-promoter driven codon-optimized expression alters the assembly type and morphology of a reconstituted HERV-K(HML-2).

PubMed

Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert

2014-11-11

The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.

CMV-Promoter Driven Codon-Optimized Expression Alters the Assembly Type and Morphology of a Reconstituted HERV-K(HML-2)

PubMed Central

Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert

2014-01-01

The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations. PMID:25393897

Alterations in epidermal growth factor receptors 1 and 2 in esophageal squamous cell carcinomas

PubMed Central

2012-01-01

Background Esophageal squamous cell carcinoma (ESCC) shows a 5-year survival rate below 10%, demonstrating the urgency in improving its treatment. Alterations in epidermal growth factor receptors are closely related to malignancy transformation in a number of tumors and recent successful targeted therapies have been directed to these molecules. Therefore, in this study, we analyzed the expression of EGFR and HER2 and evaluated EGFR mutation profile as well as the presence of mutations in hotspots of KRAS and BRAF in ESCC patients. Methods We performed RT-qPCR, immunohistochemistry and Fluorescent in situ hybridization to determine EGFR and HER2 expression in ESCC patients, and direct sequencing and PCR-RFLP for mutations and polymorphism analysis. Results Our results showed an increased EGFR mRNA expression in tumors compared to surrounding tissue (p <0.05), with 11% of the cases presenting at least a four-fold difference between tumor and paired adjacent mucosa. EGFR protein overexpression was present only in 4% of the cases. The median expression of HER2 mRNA was not different between tumors and adjacent mucosa. Still, 7% of the tumors presented at least a 25-fold higher expression of this gene when compared to its paired counterpart. Immunohistochemical analysis revealed that 21% of the tumors were positive for HER2 (scores 2+ and 3+), although only 3+ tumors presented amplification of this gene. Mutation analysis for EGFR (exons 18-21), KRAS (codons 12 and 13) and BRAF (V600E) showed no mutations in any of the hotspots of these genes in almost 100 patients analyzed. EGFR presented synonymous polymorphisms at codon 836 (C>T) in 2.1% of the patients, and at codon 787 (G>A) in 79.2% of the cases. This last polymorphism was also evaluated in 304 healthy controls, which presented a similar frequency (73.7%) in comparison with ESCC patients. The absence of mutations of EGFR, KRAS and BRAF as well as the overexpression of EGFR and HER2 in less than 10% of the patients suggest that this signaling pathway is altered in only a small proportion of patients with ESCC. Conclusion HER receptors target therapies may have the potential to be effective in only a minor fraction of patients with ESCC. PMID:23207070

A new nonsense mutation in the NF1 gene with neurofibromatosis-Noonan syndrome phenotype.

PubMed

Yimenicioğlu, Sevgi; Yakut, Ayten; Karaer, Kadri; Zenker, Martin; Ekici, Arzu; Carman, Kürşat Bora

2012-12-01

Neurofibromatosis-Noonan syndrome is a rare autosomal dominant disorder which combines neurofibromatosis type 1 (NF1) features with Noonan syndrome. NF1 gene mutations are reported in the majority of these patients. Sequence analysis of the established genes for Noonan syndrome revealed no mutation; a heterozygous NF1 point mutation c.7549C>T in exon 51, creating a premature stop codon (p.R2517X), had been demonstrated. Neurofibromatosis-Noonan syndrome recently has been considered a subtype of NF1 and caused by different NF1 mutations. We report the case of a 14-year-old boy with neurofibromatosis type 1 with Noonan-like features, who complained of headache with triventricular hydrocephaly and a heterozygous NF1 point mutation c.7549C>T in exon 51.

A novel CYP27B1 mutation causes a feline vitamin D-dependent rickets type IA.

PubMed

Grahn, Robert A; Ellis, Melanie R; Grahn, Jennifer C; Lyons, Leslie A

2012-08-01

A 12-week-old domestic cat presented at a local veterinary clinic with hypocalcemia and skeletal abnormalities suggestive of rickets. Osteomalacia (rickets) is a disease caused by impaired bone mineralization leading to an increased prevalence of fractures and deformity. Described in a variety of species, rickets is most commonly caused by vitamin D or calcium deficiencies owing to both environmental and or genetic abnormalities. Vitamin D-dependent rickets type 1A (VDDR-1A) is a result of the enzymatic pathway defect caused by mutations in the 25-hydroxyvitamin D(3)-1-alpha-hydroxylase gene [cytochrome P27 B1 (CYP27B1)]. Calcitriol, the active form of vitamin D(3), regulates calcium homeostasis, which requires sufficient dietary calcium availability and correct hormonal function for proper bone growth and maintenance. Patient calcitriol concentrations were low while calcidiol levels were normal suggestive of VDDR-1A. The entire DNA coding sequencing of CYP27B1 was evaluated. The affected cat was wild type for previously identified VDDR-1A causative mutations. However, six novel mutations were identified, one of which was a nonsense mutation at G637T in exon 4. The exon 4 G637T nonsense mutation results in a premature protein truncation, changing a glutamic acid to a stop codon, E213X, likely causing the clinical presentation of rickets. The previously documented genetic mutation resulting in feline VDDR-1A rickets, as well as the case presented in this research, result from novel exon 4 CYP27B1 mutations, thus exon 4 should be the initial focus of future sequencing efforts.

Behçet's disease and hereditary periodic fever syndromes: casual association or causal relationship?

PubMed

Espinosa, G; Arostegui, J I; Plaza, S; Rius, J; Cervera, R; Yagüe, J; Font, J

2005-01-01

Mutations in the MEFV and the type 1 TNF receptor (TNFRSF 1A) genes have recently been linked to familial Mediterranean fever (FMF) and TNF receptor-associated periodic syndrome (TRAPS), respectively. A higher prevalence of Behçet's disease (BD) among FMF patients has been described compared to the general population. The aim of this study was to evaluate whether FMF TRAPS and BD could be genetically related. We screened a cohort of 50 BD patients and 100 healthy subjects for the common MEFV and TNFRSF 1A mutations. An initial screening of exons 10 and 2 of the MEFV gene and exon 4 of the TNFRSF 1A was performed in all chromosomes. The heterozygous MEFV mutation (K695R) was found in one (2%) BD patient. Analysis for FMF mutations in the control group revealed that 5 (5%) individuals bore MEFV gene mutations (3 were heterozygous for the E148Q and 2 were heterozygous for the A744S). At codon 202, there were no differences in allele frequencies between BD and control population: 73%R 27%Q in the BD patients vs 75%R 25%Q in controls. Concerning mutations in the TNFRSF 1A gene, the R92Q mutation was present in heterozygous state in one (2%) BD patient and in 4 (4%) controls without differences between allele frequencies: 99%R 1%Q in BD patients vs 98%R 2%Q in controls, respectively. There was no association between the clinical manifestations of BD patients and the presence of a particular polymorphism or a mutation. Neither FMF nor TRAPS are genetically associated with BD in our cohort of Spanish patients.

Molecular Characterization of β-Thalassemia in the Czech and Slovak Populations: Mediterranean, Asian and Unique Mutations.

PubMed

Divoka, Martina; Partschova, Martina; Kucerova, Jana; Mojzikova, Renata; Cermak, Jaroslav; Pospisilova, Dagmar; Fabryova, Viera; Prochazkova, Daniela; Indrak, Karel; Divoky, Vladimir

2016-06-01

β-Thalassemia (β-thal) is considered rare in Central Europe. As in other malaria-free regions, the presence of β-thal in Central Europe reflects historical and recent immigration, and demographic changes that have influenced the genetic variability of the current populations living in this area. This study assesses the frequency and spectrum of mutations on the β-globin gene in Czech and Slovak subjects with clinical symptoms of thalassemia. The results of the initial part of this research were published more than two decades ago; the aim of this study was to update these original reports. During the period from 2002 to 2015, 400 cases from Czech and Slovak hematological centers were analyzed. Twenty-nine β-thal mutations, identified in 356 heterozygotes from 218 unrelated families, involve five unique mutations including a recently described insertion of a transposable L1 element into the β-globin gene. One mutation described here is reported for the first time. Most of the mutations were of Mediterranean origin and accounted for 82.0% of cases. All but one case studied were heterozygous carriers, manifesting β-thal minor, with rare exceptions represented by the rare (β(0)) codons 46/47 (+G) (HBB: c.142_142dupG) mutation associated with an α-globin gene quadruplication and by dominantly inherited β-thal with a more severe phenotype. One double heterozygous β-thal patient was a recent immigrant from Moldavia. The list of δβ-thal alleles (26 carriers, 16 families) contains Hb Lepore and two types of δβ(0)-thal deletions. In the past, genetic drift and migration as well as recent immigrations were responsible for the introduction of Mediterranean alleles, while several mutations described in single families were of local origin.

Limits of variation, specific infectivity, and genome packaging of massively recoded poliovirus genomes.

PubMed

Song, Yutong; Gorbatsevych, Oleksandr; Liu, Ying; Mugavero, JoAnn; Shen, Sam H; Ward, Charles B; Asare, Emmanuel; Jiang, Ping; Paul, Aniko V; Mueller, Steffen; Wimmer, Eckard

2017-10-10

Computer design and chemical synthesis generated viable variants of poliovirus type 1 (PV1), whose ORF (6,189 nucleotides) carried up to 1,297 "Max" mutations (excess of overrepresented synonymous codon pairs) or up to 2,104 "SD" mutations (randomly scrambled synonymous codons). "Min" variants (excess of underrepresented synonymous codon pairs) are nonviable except for P2 Min , a variant temperature-sensitive at 33 and 39.5 °C. Compared with WT PV1, P2 Min displayed a vastly reduced specific infectivity (si) (WT, 1 PFU/118 particles vs. P2 Min , 1 PFU/35,000 particles), a phenotype that will be discussed broadly. Si of haploid PV presents cellular infectivity of a single genotype. We performed a comprehensive analysis of sequence and structures of the PV genome to determine if evolutionary conserved cis-acting packaging signal(s) were preserved after recoding. We showed that conserved synonymous sites and/or local secondary structures that might play a role in determining packaging specificity do not survive codon pair recoding. This makes it unlikely that numerous "cryptic, sequence-degenerate, dispersed RNA packaging signals mapping along the entire viral genome" [Patel N, et al. (2017) Nat Microbiol 2:17098] play the critical role in poliovirus packaging specificity. Considering all available evidence, we propose a two-step assembly strategy for +ssRNA viruses: step I, acquisition of packaging specificity, either ( a ) by specific recognition between capsid protein(s) and replication proteins (poliovirus), or ( b ) by the high affinity interaction of a single RNA packaging signal (PS) with capsid protein(s) (most +ssRNA viruses so far studied); step II, cocondensation of genome/capsid precursors in which an array of hairpin structures plays a role in virion formation.

HIV1 V3 loop hypermutability is enhanced by the guanine usage bias in the part of env gene coding for it.

PubMed

Khrustalev, Vladislav Victorovich

2009-01-01

Guanine is the most mutable nucleotide in HIV genes because of frequently occurring G to A transitions, which are caused by cytosine deamination in viral DNA minus strands catalyzed by APOBEC enzymes. Distribution of guanine between three codon positions should influence the probability for G to A mutation to be nonsynonymous (to occur in first or second codon position). We discovered that nucleotide sequences of env genes coding for third variable regions (V3 loops) of gp120 from HIV1 and HIV2 have different kinds of guanine usage biases. In the HIV1 reference strain and 100 additionally analyzed HIV1 strains the guanine usage bias in V3 loop coding regions (2G>1G>3G) should lead to elevated nonsynonymous G to A transitions occurrence rates. In the HIV2 reference strain and 100 other HIV2 strains guanine usage bias in V3 loop coding regions (3G>2G>1G) should protect V3 loops from hypermutability. According to the HIV1 and HIV2 V3 alignment, insertion of the sequence enriched with 2G (21 codons in length) occurred during the evolution of HIV1 predecessor, while insertion of the different sequence enriched with 3G (19 codons in length) occurred during the evolution of HIV2 predecessor. The higher is the level of 3G in the V3 coding region, the lower should be the immune escaping mutation occurrence rates. This hypothesis was tested in this study by comparing the guanine usage in V3 loop coding regions from HIV1 fast and slow progressors. All calculations have been performed by our algorithms "VVK In length", "VVK Dinucleotides" and "VVK Consensus" (www.barkovsky.hotmail.ru).

Novel mutation of OCRL1 in Lowe syndrome.

PubMed

Liu, Ting; Yue, Zhihui; Wang, Haiyan; Tong, Huajuan; Sun, Liangzhong

2015-01-01

Lowe syndrome is a rare, X-linked recessive genetic disease with multi-organ involvement. The pathogenic gene is OCRL1. The authors analyzed the OCRL1 mutation and summarized the clinical features of a Chinese child with Lowe syndrome. The patient is a 3 year 7 mo-old boy. He presented with hypotonia at birth and gradually presented with bilateral congenital cataracts, psychomotor retardation, hypophosphatemic rickets and renal tubular function disorder. Sequence analysis of OCRL1 revealed a novel insertion mutation, c.2367insA (p. Ala813X), in exon 22. This mutation was suspected to cause a premature stop codon of OCRL1 and truncation of the OCRL1 protein. His mother, who carried a heterozygous mutation, had no sign of abnormality.

Compound heterozygous HAX1 mutations in a Swedish patient with severe congenital neutropenia and no neurodevelopmental abnormalities.

PubMed

Carlsson, Göran; Elinder, Göran; Malmgren, Helena; Trebinska, Alicja; Grzybowska, Ewa; Dahl, Niklas; Nordenskjöld, Magnus; Fadeel, Bengt

2009-12-01

Kostmann disease or severe congenital neutropenia (SCN) is an autosomal recessive disorder of neutrophil production. Homozygous HAX1 mutations were recently identified in SCN patients belonging to the original family in northern Sweden described by Kostmann. Moreover, recent studies have suggested an association between neurological dysfunction and HAX1 deficiency. Here we describe a patient with a compound heterozygous HAX1 mutation consisting of a nonsense mutation (c.568C > T, p.Glu190X) and a frame-shift mutation (c.91delG, p.Glu31LysfsX54) resulting in a premature stop codon. The patient has a history of neutropenia and a propensity for infections, but has shown no signs of neurodevelopmental abnormalities.

A Novel Loss-of-Sclerostin Function Mutation in a First Egyptian Family with Sclerosteosis

PubMed Central

Fayez, Alaaeldin; Aglan, Mona; Esmaiel, Nora; El Zanaty, Taher; Abdel Kader, Mohamed; El Ruby, Mona

2015-01-01

Sclerosteosis is a rare autosomal recessive condition characterized by increased bone density. Mutations in SOST gene coding for sclerostin are linked to sclerosteosis. Two Egyptian brothers with sclerosteosis and their apparently normal consanguineous parents were included in this study. Clinical evaluation and genomic sequencing of the SOST gene were performed followed by in silico analysis of the resulting variation. A novel homozygous frameshift mutation in the SOST gene, characterized as one nucleotide cytosine insertion that led to premature stop codon and loss of functional sclerostin, was identified in the two affected brothers. Their parents were heterozygous for the same mutation. To our knowledge this is the first Egyptian study of sclerosteosis and SOST gene causing mutation. PMID:25984533