Science.gov

Sample records for injection moulded santoprene

  1. Injection moulding of optical functional micro structures using laser structured, PVD-coated mould inserts

    SciTech Connect

    Hopmann, Ch.; Weber, M.; Schöngart, M.; Schäfer, C.; Bobzin, K.; Bagcivan, N.; Brögelmann, T.; Theiß, S.; Münstermann, T.; Steger, M.

    2015-05-22

    Micro structured optical plastics components are intensively used i. e. in consumer electronics, for optical sensors in metrology, innovative LED-lighting or laser technology. Injection moulding has proven to be successful for the large-scale production of those parts. However, the production of those parts still causes difficulties due to challenges in the moulding and demoulding of plastics parts created with laser structured mould inserts. A complete moulding of the structures often leads to increased demoulding forces, which then cause a breaking of the structures and a clogging of the mould. An innovative approach is to combine PVD-coated (physical vapour deposition), laser structured inserts and a variothermal moulding process to create functional mic8iüro structures in a one-step process. Therefore, a PVD-coating is applied after the laser structuring process in order to improve the wear resistance and the anti-adhesive properties against the plastics melt. In a series of moulding trials with polycarbonate (PC) and polymethylmethacrylate (PMMA) using different coated moulds, the mould temperature during injection was varied in the range of the glass transition and the melt temperature of the polymers. Subsequently, the surface topography of the moulded parts is evaluated by digital 3D laser-scanning microscopy. The influence of the moulding parameters and the coating of the mould insert on the moulding accuracy and the demoulding behaviour are being analysed. It is shown that micro structures created by ultra-short pulse laser ablation can be successfully replicated in a variothermal moulding process. Due to the mould coating, significant improvements could be achieved in producing micro structured optical plastics components.

  2. Injection moulding of optical functional micro structures using laser structured, PVD-coated mould inserts

    NASA Astrophysics Data System (ADS)

    Hopmann, Ch.; Weber, M.; Schöngart, M.; Schäfer, C.; Bobzin, K.; Bagcivan, N.; Brögelmann, T.; Theiß, S.; Münstermann, T.; Steger, M.

    2015-05-01

    Micro structured optical plastics components are intensively used i. e. in consumer electronics, for optical sensors in metrology, innovative LED-lighting or laser technology. Injection moulding has proven to be successful for the large-scale production of those parts. However, the production of those parts still causes difficulties due to challenges in the moulding and demoulding of plastics parts created with laser structured mould inserts. A complete moulding of the structures often leads to increased demoulding forces, which then cause a breaking of the structures and a clogging of the mould. An innovative approach is to combine PVD-coated (physical vapour deposition), laser structured inserts and a variothermal moulding process to create functional mic8iüro structures in a one-step process. Therefore, a PVD-coating is applied after the laser structuring process in order to improve the wear resistance and the anti-adhesive properties against the plastics melt. In a series of moulding trials with polycarbonate (PC) and polymethylmethacrylate (PMMA) using different coated moulds, the mould temperature during injection was varied in the range of the glass transition and the melt temperature of the polymers. Subsequently, the surface topography of the moulded parts is evaluated by digital 3D laser-scanning microscopy. The influence of the moulding parameters and the coating of the mould insert on the moulding accuracy and the demoulding behaviour are being analysed. It is shown that micro structures created by ultra-short pulse laser ablation can be successfully replicated in a variothermal moulding process. Due to the mould coating, significant improvements could be achieved in producing micro structured optical plastics components.

  3. Self-optimizing MPC of melt temperature in injection moulding.

    PubMed

    Dubay, R

    2002-01-01

    The parameters in plastic injection moulding are highly nonlinear and interacting. Good control of plastic melt temperature for injection moulding is very important in reducing operator setup time, assuring consistent product quality, and preventing thermal degradation of the melt. Step response testing was performed on the barrel heating zones on an industrial injection moulding machine (IMM). The open loop responses indicated a high degree of process coupling between the heating zones. From these experimental step responses, a multiple-input-multiple-output model predictive control strategy was developed and practically implemented. The requirement of negligible overshoot is important to the plastics industry for preventing material overheating and wastage, and reducing machine operator setup time. A generic learning and self-optimizing MPC methodology was developed and implemented on the IMM to control melt temperature for any polymer to be moulded on any machine having different electrical heater capacities. The control performance was tested for varying setpoint trajectories typical of normal machine operations. The results showed that the predictive controller provided good control of melt temperature for all zones with negligible oscillations, and, therefore, eliminated material degradation and extended machine setup time. PMID:12014805

  4. Simulation of the injection moulding process

    NASA Astrophysics Data System (ADS)

    Hu, J.; Christensen, T.

    1993-12-01

    Simulation of the injection molding process is a helpful way for the engineers who work with plastics processing. By simulation, they will get some important parameters which sometimes are highly necessary for the mold design and processing. Thus, the engineers will save much time to do experiments for the parameters. Two simulation programs are used in this report, namely CADMOULD and CADMOULD MEFISTO which are designed by Institut fur Kunststoffverarbeitung (IKV) in Aachen, W. Germany. CADMOULD works with 2-D geometry and is specialized for rheological, thermal and mechanical calculation. It is installed on a personal computer, while CADMOULD MEFISTO works in 3-D and is installed on a VAX 8530 computer at SINTEF. A PC version of this program is also available. This report deals with CADMOULD and CADMOULD MEFISTO. The construction of flow lines, balancing of sprue system, the optimizing of injection time, and gate(s) optimizing are mainly included.

  5. Development of Metal/Polymer Mixtures for Micro Powder Injection Moulding

    SciTech Connect

    Quinard, C.; Barriere, T.; Gelin, J. C.

    2007-04-07

    Important research tasks at ENSMM/LMA are concerned for the development of mixtures of Fine powders associated to polymer binders dedicated to the powder injection moulding (PIM) and to the powder injection micro-moulding ({mu}PIM) in accordance with many works already carried out with different feedstock suppliers dedicated to the macro-components.

  6. Rotational moulding.

    PubMed

    Crawford, R J; Kearns, M P

    2003-10-01

    Rotational moulding promises designers attractive economics and a low-pressure process. The benefits of rotational moulding are compared here with other manufacturing methods such as injection and blow moulding. PMID:14603714

  7. Isotachophoretic analysis using injection-moulded polystyrene chip devices

    NASA Astrophysics Data System (ADS)

    Prest, Jeff E.; Fielden, Peter R.; Goddard, Nicholas J.; Treves Brown, Bernard J.

    2008-06-01

    A new type of miniaturized separation chip for performing isotachophoresis has been produced. The design uses polystyrene as a substrate material and incorporates carbon fibre loaded polystyrene drive and conductivity detection electrodes. This fully polymeric composition allows for the devices to be produced using injection moulding. Ultrasonic welding is used for sealing to give robust chips that can potentially be easily transported and used outside of a laboratory environment. A batch of devices was produced and tested with a number of inorganic cationic species as samples. The entire batch of 22 devices were successfully used for isotachophoretic separations. Good reproducibility was observed in the qualitative behaviour of the devices. For example, with lithium a relative step height ± standard deviation of 1.49 ± 0.01 was observed on a run-to-run basis with a single chip and of 1.47 ± 0.03 on a chip-to-chip basis over the entire batch of devices.

  8. Modelling and experimental verification of pressure prediction in the in-mould coating (IMC) process for injection moulded parts

    NASA Astrophysics Data System (ADS)

    Bhagavatula, Narayan; Castro, Jose M.

    2007-03-01

    In-mould coating (IMC) is carried out by injecting a liquid low viscosity thermosetting material onto the surface of the injection moulded part after it has solidified, while it is still in the mould. The coating then cures and adheres to the substrate. Due to its successful application to exterior body panels made from compression moulded sheet moulding compound, IMC is being developed as an environmentally friendly technology that would ultimately replace painting of injection moulded thermoplastic parts. In the short term, however, we believe IMC has the potential of being a substitute for primers. In a previous paper, we presented a Hele-Shaw based mathematical model to simulate the coating flow during the IMC process assuming the coating to be a power law fluid and using the traditional no-slip boundary condition. This model adequately predicted the fill patterns but did not predict pressures correctly. This deviation has been attributed to slip (or apparent slip) at the wall, as often found in flow through microchannels, due to the microscopic length scale of the flow, and the existence of a high shear rate Newtonian plateau for the coating viscosity. In this paper we present a mathematical model that includes the slip boundary condition and the Carreau viscosity model to properly describe the rheological behaviour of the coating material at high shear rates. The rheological and slip parameters of the coating material were measured using a customized micro slit rheometer. The predicted pressures are compared with experimental results obtained using our IMC pilot facility. It was found that the predicted pressures and coating thickness agree well with the measured values.

  9. A hollow waveguide infrared thermometer for polymer temperature measurement during injection moulding

    NASA Astrophysics Data System (ADS)

    Bendada, A.; Cole, K.; Lamontagne, M.; Simard, Y.

    2003-09-01

    We describe a novel on-line infrared method for remote sensing of the surface and the bulk temperatures of a polymer film during injection moulding. The method may also be applied to other polymer forming processes such as extrusion and blow moulding. The key feature of the new method is the use of a hollow waveguide that is incorporated into the injection mould to transmit the thermal radiation from the target to the sensor. The main characteristic of the hollow waveguide is that it exhibits low transmission loss of the thermal energy in the mid-and far-infrared, and no end reflection. This allows measurement of quite low temperatures, as low as near room temperature. Conventional optical fibre thermometers can neither measure such low temperature ranges nor measure the polymer surface temperature. In this paper, we present the first on-line results of critical tests of the new device. A Husky injection moulding press was used for the experiments. Good correlation was found between the radiometric results and those obtained with a thermal sensor inserted near the polymer mould interface, and with infrared imaging after the polymer part was ejected from the injection mould.

  10. Electrical, Thermal, and Machining Behaviour of Injection Moulded Polymeric CNT Nanocomposites

    NASA Astrophysics Data System (ADS)

    Mahmoodi, Mehdi

    Carbon nanotubes (CNTs) are promising additives for thermoplastics, resulting from their superior electrical, thermal and mechanical properties. Due to the desirable properties of CNT/polymer composites and their wide application in technological devices, these materials have attracted a great deal of attention from both academia and industry. A considerable amount of research has been devoted to the processing of CNT-filled nanocomposites, but only a few investigations have focussed on the injection moulding of these nanocomposites. This research was aimed at the study of the flow-induced alignment of CNT/polymer nanocomposites through the injection moulding process. We focussed on the understanding of the alignment of multi-walled carbon nanotubes (MWCNTs) in a thermoplastic matrix and the investigation of the alignment's effect on the electrical, thermal and machining characteristics of the injection moulded nanocomposites. The nanocomposites were first prepared with a melt mixing technique (i.e. twin screw extrusion), and they were then injection moulded under various processing conditions and mould geometries. High aspect ratio nanotubes could be partially aligned in the parallel-to-flow direction, resulting from the in-plane shear flow exerted on the polymeric melt in the injection cavity. It can be concluded that the volume resistivity of the moulded samples could be varied up to 7 orders of magnitude by changing the processing conditions and gate type in the injection moulding process. The electromagnetic interference shielding effectiveness (EMI SE) of the moulded composites was studied by considering the alignment of the MWCNTs. The EMI SE decreased with an increase in the alignment of the injection moulded MWCNTs in the polymer matrix. Anisotropic thermal conductivity was observed for the injection moulded nanocomposites. It was shown that thermal conductivity can be enhanced by aligning the nanotubes in the parallel-to-flow direction. The post

  11. Development of Metal/Polymer Mixtures Dedicated to Macro and Micro powder Injection Moulding : Experiments and Simulations

    SciTech Connect

    Quinard, C.; Barriere, T.; Gelin, J. C.; Song, J. P.; Cheng, Z. Q.; Liu, B. S.

    2007-05-17

    Important research tasks at ENSMM/LMA are concerned for the development of mixtures of fine powders associated to polymer binders dedicated to the powder injection moulding (PIM) and to the powder injection micro-moulding ({mu}PIM) in accordance with many works already carried out with different feedstock suppliers dedicated to the macro-components. These research tasks are completed with the simulations of injection and sintering for solid state diffusion for to validate the mumerical models.

  12. A concept for non-invasive temperature measurement during injection moulding processes

    NASA Astrophysics Data System (ADS)

    Hopmann, Christian; Spekowius, Marcel; Wipperfürth, Jens; Schöngart, Maximilian

    2016-03-01

    Current models of the injection moulding process insufficiently consider the thermal interactions between melt, solidified material and the mould. A detailed description requires a deep understanding of the underlying processes and a precise observation of the temperature. Because todays measurement concepts do not allow a non-invasive analysis it is necessary to find new measurement techniques for temperature measurements during the manufacturing process. In this work we present the idea of a set up for a tomographic ultrasound measurement of the temperature field inside a plastics melt. The goal is to identify a concept that can be installed on a specialized mould for the injection moulding process. The challenges are discussed and the design of a prototype is shown. Special attention is given to the spatial arrangement of the sensors. Besides the design of a measurement set up a reconstruction strategy for the ultrasound signals is required. We present an approach in which an image processing algorithm can be used to calculate a temperature distribution from the ultrasound scans. We discuss a reconstruction strategy in which the ultrasound signals are converted into a spartial temperature distribution by using pvT curves that are obtained by dilatometer measurements.

  13. Numerical Predictions on the Final Properties of Metal Injection Moulded Components after Sintering Process

    SciTech Connect

    Song, J.; Barriere, T.; Gelin, J. C.

    2007-04-07

    A macroscopic model based on a viscoplastic constitutive law is presented to describe the sintering process of metallic powder components obtained by injection moulding. The model parameters are identified by the gravitational beam-bending tests in sintering and the sintering experiments in dilatometer. The finite element simulations are carried out to predict the shrinkage, density and strength after sintering. The simulation results have been compared to the experimental ones, and a good agreement has been obtained.

  14. Free flow isotachophoresis in an injection moulded miniaturised separation chamber with integrated electrodes.

    PubMed

    Stone, Victoria N; Baldock, Sara J; Croasdell, Laura A; Dillon, Leonard A; Fielden, Peter R; Goddard, Nick J; Thomas, C L Paul; Treves Brown, Bernard J

    2007-07-01

    An injection moulded free flow isotachophoresis (FFITP) microdevice with integrated carbon fibre loaded electrodes with a separation chamber of 36.4mm wide, 28.7 mm long and 100 microm deep is presented. The microdevice was completely fabricated by injection moulding in carbon fibre loaded polystyrene for the electrodes and crystal polystyrene for the remainder of the chip and was bonded together using ultrasonic welding. Two injection moulded electrode designs were compared, one with the electrode surface level with the separation chamber and one with a recessed electrode. Separations of two anionic dyes, 0.2mM each of amaranth and acid green and separations of 0.2mM each of amaranth, bromophenol blue and glutamate were performed on the microdevice. Flow rates of 1.25 ml min(-1) for the leading and terminating electrolytes were used and a flow rate of 0.63 ml min(-1) for the sample. Electric fields of up to 370 V cm(-1) were applied across the separation chamber. Joule heating was not found to be significant although out-gassing was observed at drive currents greater than 3 mA.

  15. 3D filling simulation of micro- and nanostructures in comparison to iso- and variothermal injection moulding trials

    NASA Astrophysics Data System (ADS)

    Rytka, C.; Lungershausen, J.; Kristiansen, P. M.; Neyer, A.

    2016-06-01

    Flow simulations can cut down both costs and time for the development of injection moulded polymer parts with functional surfaces used in life science and optical applications. We simulated the polymer melt flow into 3D micro- and nanostructures with Moldflow and Comsol and compared the results to real iso- and variothermal injection moulding trials below, at and above the transition temperature of the polymer. By adjusting the heat transfer coefficient and the transition temperature in the simulation it was possible to achieve good correlation with experimental findings at different processing conditions (mould temperature, injection velocity) for two polymers, namely polymethylmethacrylate and amorphous polyamide. The macroscopic model can be scaled down in volume and number of elements to save computational time for microstructure simulation and to enable first and foremost the nanostructure simulation, as long as local boundary conditions such as flow front speed are transferred correctly. The heat transfer boundary condition used in Moldflow was further evaluated in Comsol. Results showed that the heat transfer coefficient needs to be increased compared to macroscopic moulding in order to represent interfacial polymer/mould effects correctly. The transition temperature is most important in the packing phase for variothermal injection moulding.

  16. A bio-inspired microstructure induced by slow injection moulding of cylindrical block copolymers.

    PubMed

    Stasiak, Joanna; Brubert, Jacob; Serrani, Marta; Nair, Sukumaran; de Gaetano, Francesco; Costantino, Maria Laura; Moggridge, Geoff D

    2014-08-28

    It is well known that block copolymers with cylindrical morphology show alignment with shear, resulting in anisotropic mechanical properties. Here we show that well-ordered bi-directional orientation can be achieved in such materials by slow injection moulding. This results in a microstructure, and anisotropic mechanical properties, similar to many natural tissues, making this method attractive for engineering prosthetic fibrous tissues. An application of particular interest to us is prosthetic polymeric heart valve leaflets, mimicking the shape, microstructure and hence performance of the native valve. Anisotropic layers have been observed for cylinder-forming block copolymers centrally injected into thin circular discs. The skin layers exhibit orientation parallel to the flow direction, whilst the core layer shows perpendicularly oriented domains; the balance of skin to core layers can be controlled by processing parameters such as temperature and injection rate. Heart valve leaflets with a similar layered structure have been prepared by injection moulding. Numerical modelling demonstrates that such complex orientation can be explained and predicted by the balance of shear and extensional flow.

  17. Utilizing of inner porous structure in injection moulds for application of special cooling method

    NASA Astrophysics Data System (ADS)

    Seidl, M.; Bobek, J.; Šafka, J.; Habr, J.; Nováková, I.; Běhálek, L.

    2016-04-01

    The article is focused on impact evaluation of controlled inner structure of production tools and new cooling method on regulation of thermal processes for injection moulding technology. The mould inserts with porous structure were cooled by means of liquid CO2 which is very progressive cooling method and enables very fast and intensive heat transfer among the plastic product, the production tool and cooling medium. The inserts were created using rapid prototype technology (DLSM) and they had a bi-component structure consisting of thin compact surface layer and defined porous inner structure of open cell character where liquid CO2 was flowing through. This analyse includes the evaluation of cooling efficiency for different inner structures and different time profiles for dosing of liquid CO2 into the porous structure. The thermal processes were monitored using thermocouples and IR thermal analyse of product surface and experimental device. Intensive heat removal influenced also the final structure and the shape and dimensional accuracy of the moulded parts that were made of semi-crystalline polymer. The range of final impacts of using intensive cooling method on the plastic parts was defined by DSC and dimensional analyses.

  18. Numerical Simulation of Sintering Process in Ceramic Powder Injection Moulded Components

    SciTech Connect

    Song, J.; Barriere, T.; Gelin, J. C.

    2007-05-17

    A phenomenological model based on viscoplastic constitutive law is presented to describe the sintering process of ceramic components obtained by powder injection moulding. The parameters entering in the model are identified through sintering experiments in dilatometer with the proposed optimization method. The finite element simulations are carried out to predict the density variations and dimensional changes of the components during sintering. A simulation example on the sintering process of hip implant in alumina has been conducted. The simulation results have been compared with the experimental ones. A good agreement is obtained.

  19. Investigation of Plasma Treatment on Micro-Injection Moulded Microneedle for Drug Delivery.

    PubMed

    Nair, Karthik; Whiteside, Benjamin; Grant, Colin; Patel, Rajnikant; Tuinea-Bobe, Cristina; Norris, Keith; Paradkar, Anant

    2015-10-30

    Plasma technology has been widely used to increase the surface energy of the polymer surfaces for many industrial applications; in particular to increase in wettability. The present work was carried out to investigate how surface modification using plasma treatment modifies the surface energy of micro-injection moulded microneedles and its influence on drug delivery. Microneedles of polyether ether ketone and polycarbonate and have been manufactured using micro-injection moulding and samples from each production batch have been subsequently subjected to a range of plasma treatment. These samples were coated with bovine serum albumin to study the protein adsorption on these treated polymer surfaces. Sample surfaces structures, before and after treatment, were studied using atomic force microscope and surface energies have been obtained using contact angle measurement and calculated using the Owens-Wendt theory. Adsorption performance of bovine serum albumin and release kinetics for each sample set was assessed using a Franz diffusion cell. Results indicate that plasma treatment significantly increases the surface energy and roughness of the microneedles resulting in better adsorption and release of BSA.

  20. Investigation of Plasma Treatment on Micro-Injection Moulded Microneedle for Drug Delivery

    PubMed Central

    Nair, Karthik; Whiteside, Benjamin; Grant, Colin; Patel, Rajnikant; Tuinea-Bobe, Cristina; Norris, Keith; Paradkar, Anant

    2015-01-01

    Plasma technology has been widely used to increase the surface energy of the polymer surfaces for many industrial applications; in particular to increase in wettability. The present work was carried out to investigate how surface modification using plasma treatment modifies the surface energy of micro-injection moulded microneedles and its influence on drug delivery. Microneedles of polyether ether ketone and polycarbonate and have been manufactured using micro-injection moulding and samples from each production batch have been subsequently subjected to a range of plasma treatment. These samples were coated with bovine serum albumin to study the protein adsorption on these treated polymer surfaces. Sample surfaces structures, before and after treatment, were studied using atomic force microscope and surface energies have been obtained using contact angle measurement and calculated using the Owens-Wendt theory. Adsorption performance of bovine serum albumin and release kinetics for each sample set was assessed using a Franz diffusion cell. Results indicate that plasma treatment significantly increases the surface energy and roughness of the microneedles resulting in better adsorption and release of BSA. PMID:26529005

  1. Fabrication and modelling of injection moulded all-polymer capillary microvalves for passive microfluidic control

    NASA Astrophysics Data System (ADS)

    Kistrup, Kasper; Esben Poulsen, Carl; Østergaard, Peter Friis; Haugshøj, Kenneth Brian; Taboryski, Rafael; Wolff, Anders; Fougt Hansen, Mikkel

    2014-12-01

    Rapid prototyping is desirable when developing products. One example of such a product is all-polymer, passive flow controlled lab-on-a-chip systems that are preferential when developing low-cost disposable chips for point-of-care use. In this paper we investigate the following aspects of going from rapid prototyping to pilot (mass) production. (1) Fabrication of an all-polymer microfluidic system using a rapid prototyped master insert for injection moulding and ultrasonic welding, including a systematic experimental characterisation of chip featured geometric capillary microvalve test structures. (2) Numerical modelling of the microvalve burst pressures. Numerical modelling of burst pressures is challenging due to its non-equilibrium nature. We have implemented and tested the level-set method modified with a damped driving term and show that the introduction of the damping term leads to numerically robust results with limited computational demands and a low number of iterations. Numerical and simplified analytical results are validated against the experimental results. We find that injection moulding and ultrasonic welding are effective for chip production and that the experimental burst pressures could be estimated with an average accuracy of 5% using the presented numerical model.

  2. Investigation of Plasma Treatment on Micro-Injection Moulded Microneedle for Drug Delivery.

    PubMed

    Nair, Karthik; Whiteside, Benjamin; Grant, Colin; Patel, Rajnikant; Tuinea-Bobe, Cristina; Norris, Keith; Paradkar, Anant

    2015-01-01

    Plasma technology has been widely used to increase the surface energy of the polymer surfaces for many industrial applications; in particular to increase in wettability. The present work was carried out to investigate how surface modification using plasma treatment modifies the surface energy of micro-injection moulded microneedles and its influence on drug delivery. Microneedles of polyether ether ketone and polycarbonate and have been manufactured using micro-injection moulding and samples from each production batch have been subsequently subjected to a range of plasma treatment. These samples were coated with bovine serum albumin to study the protein adsorption on these treated polymer surfaces. Sample surfaces structures, before and after treatment, were studied using atomic force microscope and surface energies have been obtained using contact angle measurement and calculated using the Owens-Wendt theory. Adsorption performance of bovine serum albumin and release kinetics for each sample set was assessed using a Franz diffusion cell. Results indicate that plasma treatment significantly increases the surface energy and roughness of the microneedles resulting in better adsorption and release of BSA. PMID:26529005

  3. Smoothed particle hydrodynamics simulation of shear-induced powder migration in injection moulding.

    PubMed

    Kauzlarić, David; Pastewka, Lars; Meyer, Hagen; Heldele, Richard; Schulz, Michael; Weber, Oxana; Piotter, Volker; Hausselt, Jürgen; Greiner, Andreas; Korvink, Jan G

    2011-06-13

    We present the application of the smoothed particle hydrodynamics (SPH) discretization scheme to Phillips' model for shear-induced particle migration in concentrated suspensions. This model provides an evolution equation for the scalar mean volume fraction of idealized spherical solid particles of equal diameter which is discretized by the SPH formalism. In order to obtain a discrete evolution equation with exact conservation properties we treat in fact the occupied volume of the solid particles as the degree of freedom for the fluid particles. We present simulation results in two- and three-dimensional channel flow. The two-dimensional results serve as a verification by a comparison to analytic solutions. The three-dimensional results are used for a comparison with experimental measurements obtained from computer tomography of injection moulded ceramic microparts. We observe the best agreement of measurements with snapshots of the transient simulation for a ratio D(c)/D(η)=0.1 of the two model parameters. PMID:21536579

  4. Material- and feature-dependent effects on cell adhesion to micro injection moulded medical polymers.

    PubMed

    Choi, Seong Ying; Habimana, Olivier; Flood, Peter; Reynaud, Emmanuel G; Rodriguez, Brian J; Zhang, Nan; Casey, Eoin; Gilchrist, Michael D

    2016-09-01

    Two polymers, polymethylmethacrylate (PMMA) and cyclic olefin copolymer (COC), containing a range of nano- to micron- roughness surfaces (Ra 0.01, 0.1, 0.4, 1.0, 2.0, 3.2 and 5.0μm) were fabricated using electrical discharge machining (EDM) and replicated using micro injection moulding (μIM). Polymer samples were characterized using optical profilometry, atomic force microscopy (AFM) and water surface contact angle. Cell adhesion tests were carried out using bacterial Pseudomonas fluorescens and mammalian Madin-Darby Canine Kidney (MDCK) cells to determine the effect of surface hydrophobicity, surface roughness and stiffness. It is found that there are features which gave insignificant differences (feature-dependent effect) in cell adhesion, albeit a significant difference in the physicochemical properties (material-dependent effect) of substrata. In bacterial cell adhesion, the strongest feature-dependence is found at Ra 0.4μm surfaces, with material-dependent effects strongest at Ra 0.01μm. Ra 0.1μm surfaces exhibited strongest feature-dependent effects and Ra 5.0μm has strongest material-dependent effects on mammalian cell adhesion. Bacterial cell adhesion is found to be favourable to hydrophobic surfaces (COC), with the lowest adhesion at Ra 0.4μm for both materials. Mammalian cell adhesion is lowest in Ra 0.1μm and highest in Ra 1.0μm, and generally favours hydrophilic surfaces (PMMA). These findings can be used as a basis for developing medical implants or microfluidic devices using micro injection moulding for diagnostic purposes, by tuning the cell adhesion on different areas containing different surface roughnesses on the diagnostic microfluidic devices or medical implants. PMID:27137802

  5. Material- and feature-dependent effects on cell adhesion to micro injection moulded medical polymers.

    PubMed

    Choi, Seong Ying; Habimana, Olivier; Flood, Peter; Reynaud, Emmanuel G; Rodriguez, Brian J; Zhang, Nan; Casey, Eoin; Gilchrist, Michael D

    2016-09-01

    Two polymers, polymethylmethacrylate (PMMA) and cyclic olefin copolymer (COC), containing a range of nano- to micron- roughness surfaces (Ra 0.01, 0.1, 0.4, 1.0, 2.0, 3.2 and 5.0μm) were fabricated using electrical discharge machining (EDM) and replicated using micro injection moulding (μIM). Polymer samples were characterized using optical profilometry, atomic force microscopy (AFM) and water surface contact angle. Cell adhesion tests were carried out using bacterial Pseudomonas fluorescens and mammalian Madin-Darby Canine Kidney (MDCK) cells to determine the effect of surface hydrophobicity, surface roughness and stiffness. It is found that there are features which gave insignificant differences (feature-dependent effect) in cell adhesion, albeit a significant difference in the physicochemical properties (material-dependent effect) of substrata. In bacterial cell adhesion, the strongest feature-dependence is found at Ra 0.4μm surfaces, with material-dependent effects strongest at Ra 0.01μm. Ra 0.1μm surfaces exhibited strongest feature-dependent effects and Ra 5.0μm has strongest material-dependent effects on mammalian cell adhesion. Bacterial cell adhesion is found to be favourable to hydrophobic surfaces (COC), with the lowest adhesion at Ra 0.4μm for both materials. Mammalian cell adhesion is lowest in Ra 0.1μm and highest in Ra 1.0μm, and generally favours hydrophilic surfaces (PMMA). These findings can be used as a basis for developing medical implants or microfluidic devices using micro injection moulding for diagnostic purposes, by tuning the cell adhesion on different areas containing different surface roughnesses on the diagnostic microfluidic devices or medical implants.

  6. Study of injection moulded long glass fibre-reinforced polypropylene and the effect on the fibre length and orientation distribution

    NASA Astrophysics Data System (ADS)

    Parveeen, B.; Caton-Rose, P.; Costa, F.; Jin, X.; Hine, P.

    2014-05-01

    Long glass fibre (LGF) composites are extensively used in manufacturing to produce components with enhanced mechanical properties. Long fibres with length 12 to 25mm are added to a thermoplastic matrix. However severe fibre breakage can occur in the injection moulding process resulting in shorter fibre length distribution (FLD). The majority of this breakage occurs due to the melt experiencing extreme shear stress during the preparation and injection stage. Care should be taken to ensure that the longer fibres make it through the injection moulding process without their length being significantly degraded. This study is based on commercial 12 mm long glass-fibre reinforced polypropylene (PP) and short glass fibre Nylon. Due to the semi-flexiable behaviour of long glass fibres, the fibre orientation distribution (FOD) will differ from the orientation distribution of short glass fibre in an injection molded part. In order to investigate the effect the change in fibre length has on the fibre orientation distribution or vice versa, FOD data was measured using the 2D section image analyser. The overall purpose of the research is to show how the orientation distribution chnages in an injection moulded centre gated disc and end gated plaque geometry and to compare this data against fibre orientation predictions obtained from Autodesk Moldflow Simulation Insight.

  7. Influence of wood species on properties of injection mould natural flour-HDPE composites

    NASA Astrophysics Data System (ADS)

    Ratanawilai, Thanate; Leeyoa, Massalan; Tiptong, Yoawanat

    2016-05-01

    Four combinations of wood flour, HDPE, and maleic anhydride (MA) include; (1) rubberwood:HDPE (30:70), (2) rubberwood: HDPE:MA (30:67:3), (3) palm oil:HDPE (30:70), and (4) palm oil:HDPE:MA (30:67:3) were studied. The injection moulding machine was used to produce wood plastic composites (WPCs). Maleic anhydride is an ingredient in bonding agents used to manufacture wood plastic composites. Extrusion molding process was conducted to prefabricate WPCs. Consequently, the effect of temperature and pressure ranging from 180, 190, 200°C and 2300, 2400, 2500 bar on injection molding was evaluated. Mechanical properties were tested including flexural testing and tensile testing according to ASTM D790 and D638, respectively. Hardness testing according to ASTM D2240 and scanning electron microscope (SEM) were also performed. Five replications were done on each test. The result showed that rubberwood:HDPE (30:70) gave a highest strength. The values of ultimate tensile strength, flexural strength, and hardness are 24.9 MPa, 33.3 MPa and 67.2 shore D, respectively. Finally, the uniform distribution of particle in WPCs, examined through SEM was achieved.

  8. High Power Picosecond Laser Surface Micro-texturing of H13 Tool Steel and Pattern Replication onto ABS Plastics via Injection Moulding

    NASA Astrophysics Data System (ADS)

    Otanocha, Omonigho B.; Li, Lin; Zhong, Shan; Liu, Zhu

    2016-03-01

    H13 tool steels are often used as dies and moulds for injection moulding of plastic components. Certain injection moulded components require micro-patterns on their surfaces in order to modify the physical properties of the components or for better mould release to reduce mould contamination. With these applications it is necessary to study micro-patterning to moulds and to ensure effective pattern transfer and replication onto the plastic component during moulding. In this paper, we report an investigation into high average powered (100 W) picosecond laser interactions with H13 tool steel during surface micro-patterning (texturing) and the subsequent pattern replication on ABS plastic material through injection moulding. Design of experiments and statistical modelling were used to understand the influences of laser pulse repetition rate, laser fluence, scanning velocity, and number of scans on the depth of cut, kerf width and heat affected zones (HAZ) size. The characteristics of the surface patterns are analysed. The process parameter interactions and significance of process parameters on the processing quality and efficiency are characterised. An optimum operating window is recommended. The transferred geometry is compared with the patterns generated on the dies. A discussion is made to explain the characteristics of laser texturing and pattern replication on plastics.

  9. Magnetic multipole cylinders from mould-injection Nd2Fe14B plastic bonded magnets (abstract)

    NASA Astrophysics Data System (ADS)

    Nicolaides, G. K.; Niarchos, D.; Tsamakis, D.; Koubouros, I.; Mitsis, A.

    1996-04-01

    Mould injection Nd2Fe14B magnetic material of density ρ˜4 g/cc and of an energy product (BH)max˜4 MGOe, has been pressed into the form of cylindrical segments in order to investigate the possibility of preparing cylindrical magnetic multipoles which could be used as magnetic gears. The obtained cylindrical bonded magnet segments have a length of 3 cm and an angle width of φ=90° or φ=45°. These segments are easily magnetized along a radial direction at the angle φ/2, using a conventional electromagnet at a magnetic field of 2 T. Subsequently, the opposite magnetized segments are combined and bonded together with ultrasonic technique. The final result of the above procedure is the formation of a magnetic multipole cylinder which could be used as a magnetic gear. Here, except the preparation technique, we report the maximum torque applied versus the magnetization M of the poles and the distance between the gears. The dependence of the applied torque on the rotational frequency is also examined.

  10. Ultrasound based monitoring of the injection moulding process - Methods, applications and limitations

    SciTech Connect

    Praher, B. E-mail: klaus.straka@jku.at E-mail: georg.steinbichler@jku.at; Straka, K. E-mail: klaus.straka@jku.at E-mail: georg.steinbichler@jku.at; Usanovic, J. E-mail: klaus.straka@jku.at E-mail: georg.steinbichler@jku.at; Steinbichler, G. E-mail: klaus.straka@jku.at E-mail: georg.steinbichler@jku.at

    2014-05-15

    We developed novel non-invasive ultrasound based systems for the measurement of temperature distributions in the screw-ante chamber, the detection of unmelted granules and for the monitoring of the plasticizing process along the screw channel. The temperature of the polymer melt stored in the screw ante-chamber after the plasticization should be homogeneous. However, in reality the polymer melt in the screw ante-chamber is not homogeneous. Due to the fact the sound velocity in a polymer melt is temperature depending, we developed a tomography system using the measured transit times of ultrasonic pulses along different sound paths for calculating the temperature distribution in radial direction of a polymer melt in the screw ante-chamber of an injection moulding machine. For the detection of unmelted granules in the polymer melt we implemented an ultrasound transmission measurement. By analyzing the attenuation of the received pulses it is possible to detect unwanted inclusions. For the monitoring of the plasticizing process in the channels of the screw an ultrasonic pulse is transmitted into the barrel. By analyzing the reflected pulses it is possible to estimate solid bed and melt regions in the screw channel. The proposed systems were tested for accuracy and validity by simulations and test measurements.

  11. Foam injection moulding of a TPO/TPC-blend and the effect of different nucleating agents on the resulting foam structure

    NASA Astrophysics Data System (ADS)

    Mueller, J.; Spoerrer, A.; Altstaedt, V.

    2014-05-01

    The manufacturing of car interior parts with a soft touch surface is possible in a one-step injection moulding process, in which an injection moulded carrier is overmoulded with a compatible foamed thermoplastic elastomer (TPE). In contrast to the complex conventional process the structural foaming of the TPE component allows a saving of one material component as it combines a compact skin and a foamed core. Furthermore the manufacturing process can be achieved on a two component injection moulding machine which offers a much higher economic efficiency. One approach to reach an adhesion between a reinforced PP carrier and the foamed TPE component including good surface resistance is the use of an olefinic-/polyester-based TPE blend (TPO/TPC-blend). This paper is going to show the possibility to process a TPO/TPC-blend system by foam injection moulding with MuCell® and how the resulting foam structure can be influenced by various nucleating agents. For this purpose particles which differ in type, form and size were added in various concentrations to the TPE-blend. Before the structure elucidation of the foamed samples the particle dispersion and their effects on the polymers rheological properties were investigated. Finally abrasion tests were performed to investigate the influence of the particles on the performance characteristics of the foamed blend system. The results showed that the foam structure as well as the surface quality of the foamed TPO/TPC-blend can be improved with the use of suitable nucleating agents. Furthermore the abrasion properties can be advanced with appropriate additives in the right dosage.

  12. Influence of Mold Surface Treatments on Flow of Polymer in Injection Moulding. Application to Weldlines

    NASA Astrophysics Data System (ADS)

    Chailly, M.; Charmeau, J.-Y.; Bereaux, Y.; Monasse, B.

    2007-04-01

    Due to increasing expectations from the market, the aspect of molded parts has to be improved constantly. Some of the defects observed on these parts such as weldlines are related to the filling stage. To limit this, we investigated the influence on weldlines using various surface deposits on the mold surface, mainly PVD and PACVD deposits : Chromium nitride (CrN), Titanium nitride (TiN), Diamond like Carbon (DLC), Chromium and polished steel (PG) on an instrumented plate mold. Injection campaign was led on three polymers which differ in terms of nature (amorphous, semi-crystalline, copolymers). We studied the evolution of the dimensions of weldlines appearing on the plate using the same injection parameters for a given polymer, but with various deposits and thicknesses. Another aspect that had been investigated is the morphology of the weldline through the thickness of the part, depending on polymer nature. Adhesion of polymer at the flow front with the mold surface proved to change. The modification of the initial contact in the filling stage and thus the thermal resistance at the mold implied a change in the process, increasing or reducing the pressure loss in the flow and differential shrinkage in the final part. The induced impact on dimensions of the weldlines allowed to distinguish which surface treatments were able to reduce the defect. A complementary study was led on both polymers in molten state and deposits in terms of wetting using a sessile drop method to confirm the adhesion at the polymer/mold interface. This study proved the influence of the use of surface treatments has clearly an impact on the filling stage of the injection molding process, and it is necessary to get a better knowledge of the interactions between physical adhesion, tribology of polymer/mold contact, and thermal properties of the coatings and their impact on solidification of the polymer.

  13. Effect of Biaxial Stretching at Temperatures and Strain Histories Comparable to Injection Stretch Blow Moulding on Tensile Modulus for Polyethylene Terephthalate (PET)

    NASA Astrophysics Data System (ADS)

    Tan, C. W.; Menary, G. H.; Harkin-Jones, E. M. A.; Armstrong, C. G.; Martin, P. J.

    2007-04-01

    This study is particularly relevant to the injection stretch blow moulding (ISBM) process where PET material is typically biaxially stretched to form bottles for the water and carbonated soft drinks industry. The aim of this paper is to investigate the effect of biaxial stretching on the mechanical properties of Polyethylene Terephthalate (PET) using a custom built biaxial testing machine. An initially amorphous PET sample was prepared via injection moulding to form a square sample (76mm × 76mm) suitable for stretching on the machine. This sample was then subjected to a series of biaxial tests (simultaneous and sequential) within a temperature range between 85°C and 110 °C, strain rates in the range of 1s-1 to 32s-1 and stretch ratios in the range of 1.5 to 3. Specimens were subsequently cut from the biaxial stretched sheets and used to measure the tensile modulus. Results showed that there is almost no effect found for strain rate and temperature on modulus development whilst stretch ratio and mode of deformation played the most important role on modulus development on PET under biaxial deformation.

  14. Liquid carry-over in an injection moulded all-polymer chip system for immiscible phase magnetic bead-based solid-phase extraction

    NASA Astrophysics Data System (ADS)

    Kistrup, Kasper; Skotte Sørensen, Karen; Wolff, Anders; Fougt Hansen, Mikkel

    2015-04-01

    We present an all-polymer, single-use microfluidic chip system produced by injection moulding and bonded by ultrasonic welding. Both techniques are compatible with low-cost industrial mass-production. The chip is produced for magnetic bead-based solid-phase extraction facilitated by immiscible phase filtration and features passive liquid filling and magnetic bead manipulation using an external magnet. In this work, we determine the system compatibility with various surfactants. Moreover, we quantify the volume of liquid co-transported with magnetic bead clusters from Milli-Q water or a lysis-binding buffer for nucleic acid extraction (0.1 (v/v)% Triton X-100 in 5 M guanidine hydrochloride). A linear relationship was found between the liquid carry-over and mass of magnetic beads used. Interestingly, similar average carry-overs of 1.74(8) nL/μg and 1.72(14) nL/μg were found for Milli-Q water and lysis-binding buffer, respectively.

  15. Slime mould biotechnology

    NASA Astrophysics Data System (ADS)

    Mayne, Richard

    2015-03-01

    Slime mould computing is an inherently multi-disciplinary subfield of unconventional computing that draws upon aspects of not only theoretical computer science and electronics, but also the natural sciences. This chapter focuses on the biology of slime moulds and expounds the viewpoint that a deep, intuitive understanding of slime mould life processes is a fundamental requirement for understanding -- and, hence, harnessing -- the incredible behaviour patterns we may characterise as "computation"...

  16. On creativity of slime mould

    NASA Astrophysics Data System (ADS)

    Adamatzky, Andrew; Armstrong, Rachel; Jones, Jeff; Gunji, Yukio-Pegio

    2013-07-01

    Slime mould Physarum polycephalum is large single cell with intriguingly smart behaviour. The slime mould shows outstanding abilities to adapt its protoplasmic network to varying environmental conditions. The slime mould can solve tasks of computational geometry, image processing, logics and arithmetics when data are represented by configurations of attractants and repellents. We attempt to map behavioural patterns of slime onto the cognitive control vs. schizotypy spectrum phase space and thus interpret slime mould's activity in terms of creativity.

  17. Silicone moulding for pressure sore debridement.

    PubMed

    Erba, P; Wettstein, R; Schumacher, R; Schwenzer-Zimmerer, K; Pierer, G; Kalbermatten, D F

    2010-03-01

    The radicality of wound debridement is an important feature of the surgical treatment of pressure sores. Several methods such as injection of methylene blue or hydrogen peroxide have been proposed to facilitate and optimise the surgical debridement technique, but none of them proved to be sufficient. We present an innovative modification of the pseudo-tumour technique consisting in the injection of fluid silicone. Vulcanization of the silicone leads to pressure-sore moulding, permitting a more radical and sterile excision. In a series of 10 paraplegic patients presenting with ischial pressure sores, silicone moulding was used to facilitate debridement. Radical en bloc debridement was achieved in all patients. After a minimal follow-up of 2 years, no complications and recurrences occurred. A three-dimensional (3D) analysis of the silicone prints objectified the pyramidal shape of ischial pressure sores. Our study showed that complete resection without capsular lesion can be easily achieved. Further, it allows the surgeon to analyse the shape and size of the resected defect, which might be helpful to select the appropriate defect coverage technique.

  18. Silicone moulding for pressure sore debridement.

    PubMed

    Erba, P; Wettstein, R; Schumacher, R; Schwenzer-Zimmerer, K; Pierer, G; Kalbermatten, D F

    2010-03-01

    The radicality of wound debridement is an important feature of the surgical treatment of pressure sores. Several methods such as injection of methylene blue or hydrogen peroxide have been proposed to facilitate and optimise the surgical debridement technique, but none of them proved to be sufficient. We present an innovative modification of the pseudo-tumour technique consisting in the injection of fluid silicone. Vulcanization of the silicone leads to pressure-sore moulding, permitting a more radical and sterile excision. In a series of 10 paraplegic patients presenting with ischial pressure sores, silicone moulding was used to facilitate debridement. Radical en bloc debridement was achieved in all patients. After a minimal follow-up of 2 years, no complications and recurrences occurred. A three-dimensional (3D) analysis of the silicone prints objectified the pyramidal shape of ischial pressure sores. Our study showed that complete resection without capsular lesion can be easily achieved. Further, it allows the surgeon to analyse the shape and size of the resected defect, which might be helpful to select the appropriate defect coverage technique. PMID:19167279

  19. A bio-inspired microstructure induced by slow injection moulding of cylindrical block copolymers† †Electronic supplementary information (ESI) available: Azimuthal intensity profiles for X-axis scans (a, b and c) and Y-axis scans (d, e and f) and various sample thicknesses: 0.95 mm (a and d), 0.45 mm (b and e), 0.23 mm (c and f). The injection point was at X = 0 and Y = 0 and the injection rate was 7 × 10–8 m3 s–1. See DOI: 10.1039/c4sm00884g Click here for additional data file.

    PubMed Central

    Stasiak, Joanna; Brubert, Jacob; Serrani, Marta; Nair, Sukumaran; de Gaetano, Francesco; Costantino, Maria Laura

    2014-01-01

    It is well known that block copolymers with cylindrical morphology show alignment with shear, resulting in anisotropic mechanical properties. Here we show that well-ordered bi-directional orientation can be achieved in such materials by slow injection moulding. This results in a microstructure, and anisotropic mechanical properties, similar to many natural tissues, making this method attractive for engineering prosthetic fibrous tissues. An application of particular interest to us is prosthetic polymeric heart valve leaflets, mimicking the shape, microstructure and hence performance of the native valve. Anisotropic layers have been observed for cylinder-forming block copolymers centrally injected into thin circular discs. The skin layers exhibit orientation parallel to the flow direction, whilst the core layer shows perpendicularly oriented domains; the balance of skin to core layers can be controlled by processing parameters such as temperature and injection rate. Heart valve leaflets with a similar layered structure have been prepared by injection moulding. Numerical modelling demonstrates that such complex orientation can be explained and predicted by the balance of shear and extensional flow. PMID:25005426

  20. On chirality of slime mould.

    PubMed

    Dimonte, Alice; Adamatzky, Andrew; Erokhin, Victor; Levin, Michael

    2016-02-01

    Left-right patterning and lateralised behaviour is an ubiquitous aspect of plants and animals. The mechanisms linking cellular chirality to the large-scale asymmetry of multicellular structures are incompletely understood, and it has been suggested that the chirality of living cells is hardwired in their cytoskeleton. We examined the question of biased asymmetry in a unique organism: the slime mould Physarum polycephalum, which is unicellular yet possesses macroscopic, complex structure and behaviour. In laboratory experiment using a T-shape, we found that Physarum turns right in more than 74% of trials. The results are in agreement with previously published studies on asymmetric movement of muscle cells, neutrophils, liver cells and growing neural filaments, and for the first time reveal the presence of consistently-biased laterality in the fungi kingdom. Exact mechanisms of the slime mould's direction preference remain unknown.

  1. On chirality of slime mould.

    PubMed

    Dimonte, Alice; Adamatzky, Andrew; Erokhin, Victor; Levin, Michael

    2016-02-01

    Left-right patterning and lateralised behaviour is an ubiquitous aspect of plants and animals. The mechanisms linking cellular chirality to the large-scale asymmetry of multicellular structures are incompletely understood, and it has been suggested that the chirality of living cells is hardwired in their cytoskeleton. We examined the question of biased asymmetry in a unique organism: the slime mould Physarum polycephalum, which is unicellular yet possesses macroscopic, complex structure and behaviour. In laboratory experiment using a T-shape, we found that Physarum turns right in more than 74% of trials. The results are in agreement with previously published studies on asymmetric movement of muscle cells, neutrophils, liver cells and growing neural filaments, and for the first time reveal the presence of consistently-biased laterality in the fungi kingdom. Exact mechanisms of the slime mould's direction preference remain unknown. PMID:26747637

  2. Mould exposure in museum personnel.

    PubMed

    Kolmodin-Hedman, B; Blomquist, G; Sikström, E

    1986-01-01

    In the basement archives of a local arts and crafts museum where the books and bookkeeping registers were handled, a woman on the museum staff had had ten attacks of fever, chill, nausea and cough during one year. The symptoms appeared at the end of the working day and disappeared after one to three days at home. No symptoms could be detected during the summer holidays. The books stored in the basement archives had earlier been stored in a small house with a leaky roof, which had led to the growth of mould on the books. When the books were handled at the museum, they were still covered with mould. The exposure measurements showed 10(6) CFU/m3 and a total of 10(8) microorganisms/m3. PMID:3710604

  3. [Moulds--occupational and environmental hazards].

    PubMed

    Wiszniewska, Marta; Walusiak, Jolanta; Gutarowska, Beata; Zakowska, Zofia; Pałczyński, Cezary

    2004-01-01

    This paper reviews the most common health effects of exposure to moulds. Allergens of mould may induce rhinitis or bronchial asthma, whereas occupational exposure frequently leads to hypersensitivity pneumonitis. Moulds also reveal cancerogenic and neurotoxic properties. They may cause serious infections, organic dust toxic syndrome and sick building syndrome. Methods used to evaluate exposures and decrease concentrations of spores in the house environment are also presented. PMID:15493501

  4. Alternative technology for fabrication of nano- or microstructured mould inserts used for optical components

    NASA Astrophysics Data System (ADS)

    Wissmann, M.; Guttmann, M.; Hartmann, M.

    2010-02-01

    For mass production of multiscale-optical components, micro- and nanostructured moulding tools are needed. Metal tools are used for hot embossing or injection moulding of microcomponents in plastics. Tools are typically produced by classical forming processes such as mechanical manufacturing e.g. turning or milling, laser manufacturing or electrical discharge machining (EDM). Microstructures with extremely tight specifications, e.g. low side wall roughness and high aspect ratios are generally made by lithographic procedures such as LIGA or DPW technology. However, these processes are unsuitable for low-cost mass production. They are limited by the exposure area and structure design. In cooperation with international partners alternative manufacturing methods of moulding tools have been developed at the Institute of Microstructure Technology (IMT). In a new replication procedure, mould inserts are fabricated using micro- and nanoscale optics. The multiscale structured prototypes, either in plastics, glass, metal or material combinations are used as sacrificial parts. Using joining technology, electroforming and EDM technology, a negative copy of a prototype is transferred into metal to be used as a moulding tool. The benefits of this replication technique are rapid and economical production of moulding tools with extremely precise micro- and nanostructures, large structured area and long tool life. Low-cost mass replication is possible with these moulding tools. In this paper, an established manufacturing chain will be presented. Multiscale and multimaterial optical prototypes e.g. out-of-plane coupler or microinterferometer were made by DPW or laser technology. The mould insert fabrication of each individual manufacturing step will be shown. The process reliability and suitability for mass production was tested by hot embossing.

  5. A proper strategy for combating mould.

    PubMed

    Cheong, Cedric

    2014-02-01

    managing director of Mycologia & Mould Worx, MSc, B.(Env. Sci.), TAE40110, examines the topic of mould exposure in healthcare facilities, and the associated duty of care for hospital facility managers and engineers. The article, published here in slightly adapted form, also focuses on the need for additional training of key personnel on the risks associated with exposure to environmental microbial contamination.

  6. Predicting fill patterns for the in-mould coating process for thermoplastic parts

    NASA Astrophysics Data System (ADS)

    Chen, Xu; Bhagavatula, Narayan; Castro, Jose M.

    2004-05-01

    In-mould coating (IMC) is an environmentally friendly alternative to painting for injection moulded plastic parts. IMC is carried out by injecting a liquid low viscosity thermoset material onto the surface of the thermoplastic substrate while it is still in the mould. The coating then solidifies and adheres to the substrate. The IMC process is being integrated with conventional thermoplastic injection moulding to improve the part surface quality and to protect it from outdoor exposure. In a previous paper, we presented a Hele-Shaw based mathematical model to simulate the coating flow during the IMC process assuming the coating to be a Newtonian fluid. It has been shown that the coating behaves like a shear thinning fluid. In this paper, a power-law viscosity model is employed to describe the rheological behaviour of the coating material. The continuous deformation of the thermoplastic substrate caused by the coating injection is analysed by means of the PVT relationship of the substrate. The corresponding model is solved using the control volume based finite element method to predict the fill pattern and pressure distribution during the coating flow. The predicted results are compared to experimentally obtained fill patterns. The need to include the 'edge effect' is also discussed.

  7. Diversity of slime mould circuits

    NASA Astrophysics Data System (ADS)

    Grube, Martin

    2015-03-01

    Once fused from single amoebae to form an initial plasmodium, P. polycephalum and related species in the order Physarales continue growth via synchronous cell division and extension of the megacells by a contractile plasmodial vein network. These display the phenomenon of shuttle streaming, a rhythmic back-and-forth flow of the protoplasm within a tubular system at a period of approximately 1 to 2 min, with the frequency depending on the nutritional benefits. With time, this develops as a microfluidic circuitry that adapts patterns of contraction to size to optimise the transport throughout an organism. This control of fluid also creates dynamic changes in network architecture seen over time in an individual. Food quality is of considerable importance for slime mould growth dynamics...

  8. Rotational moulding in the production of prostheses.

    PubMed

    Coombs, A G; Lawrence, R B; Davies, R M

    1985-04-01

    This paper discusses the place of rotational moulding in the provision of prosthetic shanks and shank sections. It covers the selection of thermoplastic material, the moulding conditions and their automation in a machine process, and the development of a suitable range of moulds. Also covered is the question of interfacing between the moulded shank sections and other limb components, fatigue strength as tested to date and early results of patient field trials. The most developed of the possible prosthetic options available consists of a hollow tapered column having inserts at each end by which it is clamped through alignment couplings to the socket and foot respectively. For a below-knee application, the complete tapered column prosthesis weighs typically 1 kg. Static and fatigue testing of representative samples by the simultaneous application of compressive and bending loads to the maximum values specified by international standards exposed no failures by the time a million cycles had been reached. This method of fabrication has the merit of being capable of implementation locally on an "as required" basis. Additional advantages include the low cost of the mould tooling and the flexibility to mould a variety of shapes. Prosthetic feet are a possibility as are special shoes and orthotic parts. These may require other materials and experimentation is proceeding using structural and resilient foams.

  9. Investigations on the processing of solid silicon rubber in blow moulding

    NASA Astrophysics Data System (ADS)

    Hopmann, Ch.; Funk, A.; Windeck, C.

    2015-05-01

    Complex hollow parts made of thermoplastics are often produced in the extrusion blow moulding process. This cost-efficient production technique with a high reproducibility, a high degree of automation and short cycle times has not been adapted for rubber processing until now. Current research activities at IKV focus on the processing of silicone rubber in extrusion blow moulding with an adapted processing and rapid cross-linking systems. The blow moulding process allows an automated and effective production of complex hollow parts made of solid silicone rubber in one step. The use of expensive core techniques, which lead to comparatively high reject rates in injection moulding, is not necessary. Expensive and time-consuming assembly steps can be reduced. This substantially increases the efficiency of the process. A systematic material selection of different solid silicone rubber compounds and cross-linking systems for the extrusion blow moulding process is a major focus of investigation. In this context, the term blow mouldability of polymers is defined and the suitability of solid silicone rubbers in combination with cross-linking systems for the blow moulding process is analysed. Characteristic mechanical and physical properties allow the identification of suitable material systems and give advice for the implementation of the new process. Extrusion blow moulding of solid silicone rubber is a new and innovative manufacturing concept to produce elastomeric hollow parts. Influences on the forming process are not known for silicone rubber yet. Therefore, to obtain a detailed process description is another focus of the research project. This includes the forming process, the processing and the influences of the material and the curing reaction on the processing. In the first instance, the investigation and description of the forming process as well as the detailed analysis of the processing parameters, such as curing time, mould temperature, wall thickness of the

  10. Slime mould processors, logic gates and sensors.

    PubMed

    Adamatzky, A

    2015-07-28

    A heterotic, or hybrid, computation implies that two or more substrates of different physical nature are merged into a single device with indistinguishable parts. These hybrid devices then undertake coherent acts on programmable and sensible processing of information. We study the potential of heterotic computers using slime mould acting under the guidance of chemical, mechanical and optical stimuli. Plasmodium of acellular slime mould Physarum polycephalum is a gigantic single cell visible to the unaided eye. The cell shows a rich spectrum of behavioural morphological patterns in response to changing environmental conditions. Given data represented by chemical or physical stimuli, we can employ and modify the behaviour of the slime mould to make it solve a range of computing and sensing tasks. We overview results of laboratory experimental studies on prototyping of the slime mould morphological processors for approximation of Voronoi diagrams, planar shapes and solving mazes, and discuss logic gates implemented via collision of active growing zones and tactile responses of P. polycephalum. We also overview a range of electronic components--memristor, chemical, tactile and colour sensors-made of the slime mould.

  11. Sick Building Syndrome: is mould the cause?

    PubMed

    Terr, Abba I

    2009-01-01

    Moulds are responsible for diseases in humans through the three pathogenetic mechanisms of infection, allergy, and toxicity. Fungal infection is especially a risk factor for immunodeficient patients, but it occurs in immunocompetent patients as well. Fungal allergy is manifested as bronchial asthma, hypersensitivity pneumonitis, allergic bronchopulmonary aspergillosis, or allergic fungal sinusitis. Mycotoxicosis is almost exclusively the result of ingestion of mould-contaminated foodstuffs. In each case there is specificity for the etiologic mould. There is controversy regarding the ability of indoor airborne mould spores to cause human disease through non-specific toxicity via the inhalation route. Pulmonary mycotoxicosis is an established, although rare, occupational disease of farmers who inhale enormous quantities of mycotoxins, endotoxins, and other toxic chemicals from contaminated silage. Other conditions attributed to indoor airborne mycotoxin are unproven. These include infantile pulmonary hemosiderosis, epistaxis, 'toxic encephalopathy', immune dysregulation and a variety of subjective complaints without objective signs of pathology such as fatigue, headache, dyspnea, gastrointestinal distress, neuromuscular and skeletal complaints, etc. Non-specific irritation from moulds via the inhalation route is also a controversial subject that remains unproven. Published studies alleging an epidemiologic causal relationship are unconvincing. PMID:19255924

  12. Sick Building Syndrome: is mould the cause?

    PubMed

    Terr, Abba I

    2009-01-01

    Moulds are responsible for diseases in humans through the three pathogenetic mechanisms of infection, allergy, and toxicity. Fungal infection is especially a risk factor for immunodeficient patients, but it occurs in immunocompetent patients as well. Fungal allergy is manifested as bronchial asthma, hypersensitivity pneumonitis, allergic bronchopulmonary aspergillosis, or allergic fungal sinusitis. Mycotoxicosis is almost exclusively the result of ingestion of mould-contaminated foodstuffs. In each case there is specificity for the etiologic mould. There is controversy regarding the ability of indoor airborne mould spores to cause human disease through non-specific toxicity via the inhalation route. Pulmonary mycotoxicosis is an established, although rare, occupational disease of farmers who inhale enormous quantities of mycotoxins, endotoxins, and other toxic chemicals from contaminated silage. Other conditions attributed to indoor airborne mycotoxin are unproven. These include infantile pulmonary hemosiderosis, epistaxis, 'toxic encephalopathy', immune dysregulation and a variety of subjective complaints without objective signs of pathology such as fatigue, headache, dyspnea, gastrointestinal distress, neuromuscular and skeletal complaints, etc. Non-specific irritation from moulds via the inhalation route is also a controversial subject that remains unproven. Published studies alleging an epidemiologic causal relationship are unconvincing.

  13. Mould insert fabrication of a single-mode fibre connector alignment structure optimized by justified partial metallization

    NASA Astrophysics Data System (ADS)

    Wissmann, Markus; Barié, Nicole; Guttmann, Markus; Schneider, Marc; Kolew, Alexander; Besser, Heino; Pfleging, Wilhelm; Hofmann, Andreas; Van Erps, Jürgen; Beri, Stefano; Watté, Jan

    2015-03-01

    For mass production of multiscale-optical components, microstructured moulding tools are needed. Metal tools are used for hot embossing or injection moulding of microcomponents made of a thermoplastic polymer. Microstructures with extremely tight specifications, e.g. low side wall roughness and high aspect ratios are generally made by lithographic procedures such as x-ray lithography or deep proton writing. However, these processes are unsuitable for low-cost mass production. An alternative manufacturing method of moulding tools has been developed at the Karlsruhe Institute of Technology (KIT). This article describes a mould insert fabrication and a new replication process for self-centring fibre alignment structures for low loss field installable single-mode fibre connectors, developed and fabricated by the Vrije Universiteit Brussel (VUB) in collaboration with TE Connectivity. These components are to be used in fibre-to-the-home networks and support the deployment and maintenance of fibre optic links. The special feature of this particular fibre connector is a self-centring fibre alignment, achieved by means of a through hole with deflectable cantilevers acting as micro-springs. The particular challenge is the electroforming of through holes with a centre hole diameter smaller than 125 µm. The fibre connector structure is prototyped by deep proton writing in polymethylmethacrylate and used as a sacrificial part. Using joining, physical vapour deposition and electroforming technology, a negative copy of the prototyped connector is transferred into nickel to be used as a moulding tool. The benefits of this replication technique are a rapid and economical fabrication of moulding tools with high-precision microstructures and a long tool life. With these moulding tools low-cost mass production is possible. We present the manufacturing chain we have established. Each individual manufacturing step of the mould insert fabrication will be shown in this report. The

  14. FTIR analysis of bentonite in moulding sands

    NASA Astrophysics Data System (ADS)

    Paluszkiewicz, C.; Holtzer, M.; Bobrowski, A.

    2008-05-01

    Bentonite is used in a wide range of applications. One of them is the foundry industry. The aim of this study was to investigate modification of moulding sands by dust which is generated during foundry process. Recycling of this dust is very important from ecological point of view. The samples of moulding sands were examined by Fourier Transform Infrared spectroscopy (FTIR). Analysis of the bands due to the Si-O stretching vibrations allows to reveal the changes of active bentonite and silica sand, i.e. the main components of the moulding sands. FTIR results are compared with technological properties of the materials studied. Scanning electron microscopy (SEM) and X-ray diffraction (XRD) methods have been used as the complementary measurement.

  15. Slime mould gates, roads and sensors

    NASA Astrophysics Data System (ADS)

    Adamatzky, Andrew

    2015-03-01

    The photographs present a wide range of problems solved by the slime mould P. polycephalum: imitation of human-made transport pathways, realisation of Boolean logical gates, fabrication of self-repairing routable biowires, implementation of delay elements in computing circuits, computational geometry, sensors and a would-be nervous system...

  16. Mathematical model of the metal mould surface temperature optimization

    NASA Astrophysics Data System (ADS)

    Mlynek, Jaroslav; Knobloch, Roman; Srb, Radek

    2015-11-01

    The article is focused on the problem of generating a uniform temperature field on the inner surface of shell metal moulds. Such moulds are used e.g. in the automotive industry for artificial leather production. To produce artificial leather with uniform surface structure and colour shade the temperature on the inner surface of the mould has to be as homogeneous as possible. The heating of the mould is realized by infrared heaters located above the outer mould surface. The conceived mathematical model allows us to optimize the locations of infrared heaters over the mould, so that approximately uniform heat radiation intensity is generated. A version of differential evolution algorithm programmed in Matlab development environment was created by the authors for the optimization process. For temperate calculations software system ANSYS was used. A practical example of optimization of heaters locations and calculation of the temperature of the mould is included at the end of the article.

  17. Mathematical model of the metal mould surface temperature optimization

    SciTech Connect

    Mlynek, Jaroslav Knobloch, Roman; Srb, Radek

    2015-11-30

    The article is focused on the problem of generating a uniform temperature field on the inner surface of shell metal moulds. Such moulds are used e.g. in the automotive industry for artificial leather production. To produce artificial leather with uniform surface structure and colour shade the temperature on the inner surface of the mould has to be as homogeneous as possible. The heating of the mould is realized by infrared heaters located above the outer mould surface. The conceived mathematical model allows us to optimize the locations of infrared heaters over the mould, so that approximately uniform heat radiation intensity is generated. A version of differential evolution algorithm programmed in Matlab development environment was created by the authors for the optimization process. For temperate calculations software system ANSYS was used. A practical example of optimization of heaters locations and calculation of the temperature of the mould is included at the end of the article.

  18. Influence Of The Microinjection Moulding Process On The Crystalline Orientation And Morphology Of Semicrystalline Polymers

    NASA Astrophysics Data System (ADS)

    Malhab, Nada Bou; Régnier, Gilles

    2011-05-01

    Microinjection moulding (μIM) seems to be a key for the large scale production of polymer microparts. For semicrystalline polymers, the crystallisation under high shear and cooling rates induces specific morphologies and properties and thus takes tremendous importance in microinjection process compared to classical injection moulding (IM) process where wall thicknesses are generally larger than 1mm. Two semicrystalline polymers were microinjected, a high density polyethylene and a polyamide 12 in plaque cavities having thicknesses of 0.3 and 0.5mm. Analyses obtained by optical microscopy show that the crystalline morphologies vary between micro- and macro- parts. While a `skin-core' morphology is present for the macropart, the μpart exhibits a specific morphology. The X-ray scattering at small angles (SAXS) studies show an orientation of HDPE lamellae whatever the conditions of microinjection whereas the orientation of PA12 lamellae is either isotropic or anisotropic depending on the thickness of molded parts.

  19. Moulding techniques in lipstick manufacture: a comparative evaluation.

    PubMed

    Dweck, A C; Burnham, C A

    1980-06-01

    Synopsis This paper examines two methods of lipstick bulk manufacture: one via a direct method and the other via stock concentrates. The paper continues with a comparison of two manufactured bulks moulded in three different ways - first by split moulding, secondly by Rotamoulding, and finally by Ejectoret moulding. Full consideration is paid to time, labour and cost standards of each approach and the resultant moulding examined using some novel physical testing methods. The results of these tests are statistically analysed. Finally, on the basis of the gathered data and photomicrographical work a theoretical lipstick structure is proposed by which the results may be explained.

  20. Moulding techniques in lipstick manufacture: a comparative evaluation.

    PubMed

    Dweck, A C; Burnham, C A

    1980-06-01

    Synopsis This paper examines two methods of lipstick bulk manufacture: one via a direct method and the other via stock concentrates. The paper continues with a comparison of two manufactured bulks moulded in three different ways - first by split moulding, secondly by Rotamoulding, and finally by Ejectoret moulding. Full consideration is paid to time, labour and cost standards of each approach and the resultant moulding examined using some novel physical testing methods. The results of these tests are statistically analysed. Finally, on the basis of the gathered data and photomicrographical work a theoretical lipstick structure is proposed by which the results may be explained. PMID:19467086

  1. Sooty Mould Disease Caused by Leptoxyphium kurandae on Kenaf

    PubMed Central

    Choi, In-Young; Kang, Chan-Ho; Lee, Geon-Hwi; Park, Ji-Hyun

    2015-01-01

    In September 2013, we discovered sooty mould growing on kenaf with the extrafloral nectaries in Iksan, Korea and identified the causative fungus as Leptoxyphium kurandae based on morphological characteristics and phylogenetic analyses. This is the first report of sooty mould caused by L. kurandae on kenaf in Korea and globally. PMID:26539054

  2. Sooty Mould Disease Caused by Leptoxyphium kurandae on Kenaf.

    PubMed

    Choi, In-Young; Kang, Chan-Ho; Lee, Geon-Hwi; Park, Ji-Hyun; Shin, Hyeon-Dong

    2015-09-01

    In September 2013, we discovered sooty mould growing on kenaf with the extrafloral nectaries in Iksan, Korea and identified the causative fungus as Leptoxyphium kurandae based on morphological characteristics and phylogenetic analyses. This is the first report of sooty mould caused by L. kurandae on kenaf in Korea and globally. PMID:26539054

  3. Resin Transfer Moulding Of An Engine Thrust Frame Cone Cap

    NASA Astrophysics Data System (ADS)

    Brodsjo, Anders; Fatemi, Javad; de Vries, Henri

    2012-07-01

    For the Ariane 5 Midlife Evolution, a new Engine Thrust Frame for the upper stage is being developed. Part of this Engine Thrust Frame is the so-called Cone Cap, which closes the inverted cone shape of the structure. This part is highly loaded, as it transfers all the loads from the engines to the cone shape, and includes the hinge points for the mechanism that steer the engines. Besides strength to cope with the loads, stiffness is a very important design parameter. A composite design of this structure has been developed, which is approximately 15 kg’s lighter than the aluminium structure. To manufacture such a part in composites is challenging, because of the complexity of the shape and large laminate thickness. Due to these requirements, Resin Transfer Moulding has been selected as manufacturing method, which allows this highly integrated structure to be made in one step. As part of this project, a quarter segment of the full-scale design has been manufactured. From the design model, a detailed design for the dry fibre preform has been made using advanced composite laminate software tools. This preform was placed inside a heated, double sided tool and injected with the resin.

  4. CAE applications in a thermoforming mould design

    NASA Astrophysics Data System (ADS)

    Marjuki, AR; Mohd Ghazali, FA; Ismail, N. M.; Sulaiman, S.; Mohd Khairuddin, I.; Majeed, Anwar P. P. A.; Jaafar, AA; Mustapha, F.; Basri, S.

    2016-02-01

    Preparation of honeycomb layer is a critical step for successful fabrications of thermoformed based sandwiched structures. This paper deals with an initial investigation on the rapid manufacturing process of corrugated sheet with 120° dihedral angles. Time history of local displacements and thickness, assuming viscous dominated material model for a 1mm thick thermoformable material, was computed by using ANSYS® Polyflow solver. The quality of formed surfaces was evaluated for selection of mould geometry and assessment of two common variants of thermoforming process. Inadequate mesh refinement of a membrane elements produces satisfactorily detailing and incomplete forming. A perfectly uniform material distribution was predicted using drape forming process. However, the geometrical properties of vacuum formed part are poorly distributed and difficult to control with increasing inflation volumes. Details of the discrepancies and the contributions of the CAE tool to complement traditional trial and error methodology in the process and design development are discussed.

  5. Hybrid slime mould-based system for unconventional computing

    NASA Astrophysics Data System (ADS)

    Berzina, T.; Dimonte, A.; Cifarelli, A.; Erokhin, V.

    2015-04-01

    Physarum polycephalum is considered to be promising for the realization of unconventional computational systems. In this work, we present results of three slime mould-based systems. We have demonstrated the possibility of transporting biocompatible microparticles using attractors, repellents and a DEFLECTOR. The latter is an external tool that enables to conduct Physarum motion. We also present interactions between slime mould and conducting polymers, resulting in a variation of their colour and conductivity. Finally, incorporation of the Physarum into the organic memristive device resulted in a variation of its electrical characteristics due to the slime mould internal activity.

  6. Slime mould foraging behaviour as optically coupled logical operations

    NASA Astrophysics Data System (ADS)

    Mayne, R.; Adamatzky, A.

    2015-04-01

    Physarum polycephalum is a macroscopic plasmodial slime mould whose apparently 'intelligent' behaviour patterns may be interpreted as computation. We employ plasmodial phototactic responses to construct laboratory prototypes of NOT and NAND logical gates with electrical inputs/outputs and optical coupling in which the slime mould plays dual roles of computing device and electrical conductor. Slime mould logical gates are fault tolerant and resettable. The results presented here demonstrate the malleability and resilience of biological systems and highlight how the innate behaviour patterns of living substrates may be used to implement useful computation.

  7. Effect of casting/mould interfacial heat transfer during solidification of aluminium alloys cast in CO2-sand mould

    NASA Astrophysics Data System (ADS)

    Kulkarni, S. N.; Radhakrishna, D. K.

    2011-06-01

    The ability of heat to flow across the casting and through the interface from the casting to the mold directly affects the evolution of solidification and plays a notable role in determining the freezing conditions within the casting, mainly in foundry systems of high thermal diffusivity such as chill castings. An experimental procedure has been utilized to measure the formation process of an interfacial gap and metal-mould interfacial movement during solidification of hollow cylindrical castings of Al-4.5 % Cu alloy cast in CO2-sand mould. Heat flow between the casting and the mould during solidification of Al-4.5 % Cu alloy in CO2-sand mould was assessed using an inverse modeling technique. The analysis yielded the interfacial heat flux ( q), heat transfer coefficient ( h) and the surface temperatures of the casting and the mould during solidification of the casting. The peak heat flux was incorporated as a dimensionless number and modeled as a function of the thermal diffusivities of the casting and the mould materials. Heat flux transients were normalized with respect to the peak heat flux and modeled as a function of time. The heat flux model proposed was to estimate the heat flux transients during solidification of Al-4.5 % Cu alloy cast in CO2-sand moulds.

  8. 45. SOUTHERN INTERIOR VIEW OF MOULD CONDITIONING BUILDING SHOWING FINK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    45. SOUTHERN INTERIOR VIEW OF MOULD CONDITIONING BUILDING SHOWING FINK TRUSSES AND CORRUGATED METAL SHEETING. - U.S. Steel Duquesne Works, Basic Oxygen Steelmaking Plant, Along Monongahela River, Duquesne, Allegheny County, PA

  9. 44. LOOKING SOUTH IN MOULD CONDITIONING BUILDING, WITH HOT TOPPING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    44. LOOKING SOUTH IN MOULD CONDITIONING BUILDING, WITH HOT TOPPING PLATFORM ON LEFT. - U.S. Steel Duquesne Works, Basic Oxygen Steelmaking Plant, Along Monongahela River, Duquesne, Allegheny County, PA

  10. 43. NORTHEASTERN VIEW OF MOULD CONDITIONING BUILDING AND BOP SHOP, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    43. NORTHEASTERN VIEW OF MOULD CONDITIONING BUILDING AND BOP SHOP, WITH OPEN HEARTH No. 2 BUILDING ON LEFT. - U.S. Steel Duquesne Works, Basic Oxygen Steelmaking Plant, Along Monongahela River, Duquesne, Allegheny County, PA

  11. Sharp tipped plastic hollow microneedle array by microinjection moulding

    NASA Astrophysics Data System (ADS)

    Yung, K. L.; Xu, Yan; Kang, Chunlei; Liu, H.; Tam, K. F.; Ko, S. M.; Kwan, F. Y.; Lee, Thomas M. H.

    2012-01-01

    A method of producing sharp tipped plastic hollow microneedle arrays using microinjection moulding is presented in this paper. Unlike traditional approaches, three mould inserts were used to create the sharp tips of the microneedles. Mould inserts with low surface roughness were fabricated using a picosecond laser machine. Sharp tipped plastic hollow microneedles 500 µm in height were fabricated using a microinjection moulding machine developed by the authors’ group. In addition, the strength of the microneedle was studied by simulation and penetration experiments. Results show that the microneedles can penetrate into skin, delivering liquid successfully without any breakage or severe deformation. Techniques presented in this paper can be used to fabricate sharp tipped plastic hollow microneedle arrays massively with low cost.

  12. DETAIL OF CORNICE MOULDING WITH RAM'S HEAD MOTIF. EIGHT SHADES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    DETAIL OF CORNICE MOULDING WITH RAM'S HEAD MOTIF. EIGHT SHADES OF GOLD LEAF AND BURNISHED GOLD LEAF WERE USED FOR THE INTERIOR FINISHES. - Anaconda Historic District, Washoe Theater, 305 Main Street, Anaconda, Deer Lodge County, MT

  13. 10. DETAIL OF CORNICE MOULDING WITH RAM'S HEAD MOTIF. EIGHT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. DETAIL OF CORNICE MOULDING WITH RAM'S HEAD MOTIF. EIGHT SHADES OF GOLD LEAF AND BURNISHED GOLD LEAF WERE USED FOR THE INTERIOR FINISHES - Anaconda Historic District, Washoe Theater, 305 Main Street, Anaconda, Deer Lodge County, MT

  14. Micro moulding: the route to a successful product.

    PubMed

    Whiteside, B; Manser, P

    2009-01-01

    This account of a company's struggle to take its product from concept to market reality details how micro moulding techniques can help meet difficult design requirements and create successful products with increased output.

  15. Energy optimization aspects by injection process technology

    NASA Astrophysics Data System (ADS)

    Tulbure, A.; Ciortea, M.; Hutanu, C.; Farcas, V.

    2016-08-01

    In the proposed paper, the authors examine the energy aspects related to the injection moulding process technology in the automotive industry. Theoretical considerations have been validated by experimental measurements on the manufacturing process, for two types of injections moulding machines, hydraulic and electric. Practical measurements have been taken with professional equipment separately on each technological operation: lamination, compression, injection and expansion. For results traceability, the following parameters were, whenever possible, maintained: cycle time, product weight and the relative time. The aim of the investigations was to carry out a professional energy audit with accurate losses identification. Base on technological diagram for each production cycle, at the end of this contribution, some measure to reduce the energy consumption were proposed.

  16. Slime Mould Analogue Models of Space Exploration and Planet Colonisation

    NASA Astrophysics Data System (ADS)

    Adamatzky, A.; Armstrong, R.; De Lacy Costello, B.; Deng, Y.; Jones, J.; Mayne, R.; Schubert, T.; Sirakoulis, G. Ch.; Zhang, X.

    Slime mould Physarum polycephalum is a single cell that is visible by the unaided eye. When spanning sources of nutrients the slime mould builds a network of protoplasmic tubes which is sometimes considered to be optimal in terms of the minimization of metabolite transportation time and distance away from repellents. Previously we have shown that the slime mould is efficient in imitating the formation of man-made road networks in major countries, where major urban areas are sources of nutrients. We used a similar approach to grow slime mould on a three-dimensional template of the Moon to speculate on potential colonisation scenarios. The slime mould imitated the propagation of colonisation in an exploratory mode, i.e. without any definite targets. Additional transportation hubs/targets were added after the initial network was formed, to imitate the development of colonies in parallel with slime mould growth. We provide analyses of proximity graphs representing colonisation networks and support the findings with Physarum-inspired algorithms to inform supply chain design. We speculate on how living Physarum, or its incorporation into a polymer hybrid material, can be used as a wearable smart wetware based on laboratory experiments interacting with chemical components.

  17. Thermally induced atomic diffusion at the interface between release agent coating and mould substrate in a glass moulding press

    NASA Astrophysics Data System (ADS)

    Masuda, Jun; Yan, Jiwang; Zhou, Tianfeng; Kuriyagawa, Tsunemoto; Fukase, Yasushi

    2011-06-01

    In a glass moulding press (GMP) for refractive/diffractive hybrid lenses, to improve the service life of nickel-phosphorus (Ni-P) plated moulds, it is necessary to control the diffusion of constituent elements from the mould into the release agent coating. In this study, diffusion phenomena of constituents of Ni-P plating are investigated for two types of release agent coatings, iridium-platinum (Ir-Pt) and iridium-rhenium (Ir-Re), by cross-sectional observation, compositional analysis and stress measurements. The results show that Ni atoms in the plating layer flow from regions of compressive stress to regions of tensile stress. In the case of the Ir-Pt coated mould, the diffusion of Ni is promoted from the grain boundaries between the Ni and Ni3P phases in the plating towards the surface of the Ir-Pt coating. However, in the Ir-Re coated mould, the diffusion of Ni is suppressed because the diffusion coefficient of Ni in the Ir-Re alloy is smaller than that in the Ir-Pt alloy, although the stress state is similar in both cases. By controlling the diffusion of Ni atoms, the use of Ir-Re alloy as a release agent coating for Ni-P plated moulds is expected to lead to a high degree of durability.

  18. Moulds in containers with biological wastes.

    PubMed

    Reiss, J

    1995-03-01

    The collection of biological wastes in separate bio-containers can lead to a favoured development of thermophilic and thermotolerant moulds, especially of mucoraceous species and aspergilli, among which the human pathogen A. fumigatus is especially frequent. The abundantly produced spores are released into the air and can evoke severe infections in persons with immune-deficiencies. In two series of experiments it was demonstrated that the following procedures can reduce the number of spores in the air in the bio-containers above the biological wastes: (1) wrapping the wastes in portions in newsprint: the number of colony-forming units (CFU) decreases for about 50-70%; (2) cleaning of the container after each emptying with diluted vinegar: the number of CFU is reduced for up to 80%; (3) placing the container at shady sites: the temperature of the air inside the bio-containers at shady sites is approximately 5-8 degrees C lower than at sunny places with the consequence that the number of CFU in the air above the biological wastes is decreased. Based on these results principles for the handling of biological wastes are set up.

  19. Christmas tree allergy: mould and pollen studies.

    PubMed

    Wyse, D M; Malloch, D

    1970-12-01

    A history of respiratory or other allergic symptoms during the Christmas season is occasionally obtained from allergic patients and can be related to exposure to conifers at home or in school. Incidence and mechanism of production of these symptoms were studied. Of 1657 allergic patients, respiratory and skin allergies to conifers occurred in 7%. This seasonal syndrome includes sneezing, wheezing and transitory skin rashes. The majority of patients develop their disease within 24 hours, but 15% experience symptoms after several days' delay. Mould and pollen studies were carried out in 10 test sites before, during and after tree placement in the home. Scrapings from pine and spruce bark yielded large numbers of Penicillium, Epicoccum and Alternaria, but these failed to become airborne. No significant alteration was discovered in the airborne fungi in houses when trees were present. Pollen studies showed release into air of weed, grass and tree pollens while Christmas trees were in the house. Oleoresins of the tree balsam are thought to be the most likely cause of the symptoms designated as Christmas tree allergy.

  20. The first report on mushroom green mould disease in Croatia.

    PubMed

    Hatvani, Lóránt; Sabolić, Petra; Kocsubé, Sándor; Kredics, László; Czifra, Dorina; Vágvölgyi, Csaba; Kaliterna, Joško; Ivić, Dario; Đermić, Edyta; Kosalec, Ivan

    2012-12-01

    Green mould disease, caused by Trichoderma species, is a severe problem for mushroom growers worldwide, including Croatia. Trichoderma strains were isolated from green mould-affected Agaricus bisporus (button or common mushroom) compost and Pleurotus ostreatus (oyster mushroom) substrate samples collected from Croatian mushroom farms. The causal agents of green mould disease in the oyster mushroom were T. pleurotum and T. pleuroticola, similar to other countries. At the same time, the pathogen of A. bisporus was exclusively the species T. harzianum, which is different from earlier findings and indicates that the range of mushroom pathogens is widening. The temperature profiles of the isolates and their hosts overlapped, thus no range was found that would allow optimal growth of the mushrooms without mould contamination. Ferulic acid and certain phenolic compounds, such as thymol showed remarkable fungistatic effect on the Trichoderma isolates, but inhibited the host mushrooms as well. However, commercial fungicides prochloraz and carbendazim were effective agents for pest management. This is the first report on green mould disease of cultivated mushrooms in Croatia.

  1. Ochratoxigenic moulds and ochratoxin A in forages and grain feeds.

    PubMed

    Skrinjar, M; Stubblefield, R D; Vujicić, I F

    1992-01-01

    The contamination of forages and grain feeds with ochratoxigenic moulds and ochratoxin A was examined. The investigations were carried out over a period of three years in all seasons. Feeds were found to be contaminated with moulds at a high level throughout the three research years. The highest percentage (95 to 100) of contaminated feed samples was noticed during the second year. Total viable counts of moulds established in 1 g of feed samples ranged from 0.5 to 7.8 x 10(6). Penicillium spp. were dominant in mycopopulations isolated from feeds. Ochratoxin-A producing moulds were present permanently. In the summer period of the second research year as much as 94% of the feed samples were contaminated by ochratoxigenic Penicillium species. P. verrucosum var. cyclopium P. verrucosum var. verrucosum, P. commune and P. chrysogenum, i.e. ochratoxin-producing moulds, were the most prevalent Penicillium species throughout the three-year investigation. Ochratoxin A was found in various feeds in all seasons, except in summer of the first research year. Concentrations of the toxin varied from traces to 400 micrograms/kg. It occurred consistently in the same types of feeds (hay, dried alfalfa, fresh alfalfa, concentrate, pelleted sugar beet pulp, corn silage).

  2. On hybrid circuits exploiting thermistive properties of slime mould.

    PubMed

    Walter, Xavier Alexis; Horsfield, Ian; Mayne, Richard; Ieropoulos, Ioannis A; Adamatzky, Andrew

    2016-04-06

    Slime mould Physarum polycephalum is a single cell visible by the unaided eye. Let the slime mould span two electrodes with a single protoplasmic tube: if the tube is heated to approximately ≈40 °C, the electrical resistance of the protoplasmic tube increases from ≈3 MΩ to ≈10,000 MΩ. The organism's resistance is not proportional nor correlated to the temperature of its environment. Slime mould can therefore not be considered as a thermistor but rather as a thermic switch. We employ the P. polycephalum thermic switch to prototype hybrid electrical analog summator, NAND gates, and cascade the gates into Flip-Flop latch. Computing operations performed on this bio-hybrid computing circuitry feature high repeatability, reproducibility and comparably low propagation delays.

  3. On hybrid circuits exploiting thermistive properties of slime mould

    NASA Astrophysics Data System (ADS)

    Walter, Xavier Alexis; Horsfield, Ian; Mayne, Richard; Ieropoulos, Ioannis A.; Adamatzky, Andrew

    2016-04-01

    Slime mould Physarum polycephalum is a single cell visible by the unaided eye. Let the slime mould span two electrodes with a single protoplasmic tube: if the tube is heated to approximately ≈40 °C, the electrical resistance of the protoplasmic tube increases from ≈3 MΩ to ≈10,000 MΩ. The organism’s resistance is not proportional nor correlated to the temperature of its environment. Slime mould can therefore not be considered as a thermistor but rather as a thermic switch. We employ the P. polycephalum thermic switch to prototype hybrid electrical analog summator, NAND gates, and cascade the gates into Flip-Flop latch. Computing operations performed on this bio-hybrid computing circuitry feature high repeatability, reproducibility and comparably low propagation delays.

  4. On hybrid circuits exploiting thermistive properties of slime mould

    PubMed Central

    Walter, Xavier Alexis; Horsfield, Ian; Mayne, Richard; Ieropoulos, Ioannis A.; Adamatzky, Andrew

    2016-01-01

    Slime mould Physarum polycephalum is a single cell visible by the unaided eye. Let the slime mould span two electrodes with a single protoplasmic tube: if the tube is heated to approximately ≈40 °C, the electrical resistance of the protoplasmic tube increases from ≈3 MΩ to ≈10,000 MΩ. The organism’s resistance is not proportional nor correlated to the temperature of its environment. Slime mould can therefore not be considered as a thermistor but rather as a thermic switch. We employ the P. polycephalum thermic switch to prototype hybrid electrical analog summator, NAND gates, and cascade the gates into Flip-Flop latch. Computing operations performed on this bio-hybrid computing circuitry feature high repeatability, reproducibility and comparably low propagation delays. PMID:27048713

  5. Multilayered Glass Fibre-reinforced Composites In Rotational Moulding

    NASA Astrophysics Data System (ADS)

    Chang, W. C.; Harkin-Jones, E.; Kearns, M.; McCourt, M.

    2011-05-01

    The potential of multiple layer fibre-reinforced mouldings is of growing interest to the rotational moulding industry because of their cost/performance ratio. The particular problem that arises when using reinforcements in this process relate to the fact that the process is low shear and good mixing of resin and reinforcement is not optimum under those conditions. There is also a problem of the larger/heavier reinforcing agents segregating out of the powder to lay up on the inner part surface. In this study, short glass fibres were incorporated and distributed into a polymer matrix to produce fibre-reinforced polymer composites using the rotational moulding process and characterised in terms of morphology and mechanical properties.

  6. Modelling of air pressure effects in casting moulds

    NASA Astrophysics Data System (ADS)

    Attar, E.; Homayonifar, P.; Babaei, R.; Asgari, K.; Davami, P.

    2005-09-01

    In the casting process, as a mould is filled with molten metal, air escapes through the vents. Air pressure in the mould cavity has serious effects upon the filling behaviour such as surface profile of the molten metal and filling time. In this project a computational model was developed for calculation of air pressure during the mould filling. A 3D single phase code based on the SOLA-VOF algorithm was used for the prediction of the fluid flow. The ideal gas assumption, conservation of mass equation and Bernoulli law were used for the calculation of air pressure. A new algorithm was developed to interpolate air pressure on the surface cells. The creation of air pressure was correlated with the sizes of the vents and their locations. An experimental test was designed to verify the modelling results. Comparison between the experimental data and simulation results has shown a good agreement.

  7. On hybrid circuits exploiting thermistive properties of slime mould.

    PubMed

    Walter, Xavier Alexis; Horsfield, Ian; Mayne, Richard; Ieropoulos, Ioannis A; Adamatzky, Andrew

    2016-01-01

    Slime mould Physarum polycephalum is a single cell visible by the unaided eye. Let the slime mould span two electrodes with a single protoplasmic tube: if the tube is heated to approximately ≈40 °C, the electrical resistance of the protoplasmic tube increases from ≈3 MΩ to ≈10,000 MΩ. The organism's resistance is not proportional nor correlated to the temperature of its environment. Slime mould can therefore not be considered as a thermistor but rather as a thermic switch. We employ the P. polycephalum thermic switch to prototype hybrid electrical analog summator, NAND gates, and cascade the gates into Flip-Flop latch. Computing operations performed on this bio-hybrid computing circuitry feature high repeatability, reproducibility and comparably low propagation delays. PMID:27048713

  8. Moulds and mycotoxins in rice from the Swedish retail market.

    PubMed

    Fredlund, E; Thim, A-M; Gidlund, A; Brostedt, S; Nyberg, M; Olsen, M

    2009-04-01

    A survey of moulds and mycotoxins was performed on 99 rice samples taken from the Swedish retail market. The main objective was to study the mould and mycotoxin content in basmati rice and rice with a high content of fibre. Samples of jasmine rice as well as long-grain rice were also included. The samples were analysed for their content of ochratoxin A (high-performance liquid chromatography (HPLC)), aflatoxin B(1), B(2), G(1), and G(2) (HPLC, RIDA(R)QUICK), and mould (traditional cultivation methods in combination with morphological analysis). The majority of samples were sampled according to European Commission Regulation 401/2006. Subsamples were pooled and mixed before milling and both mould and mycotoxin analyses were performed on milled rice. The results showed that the majority of basmati rice (71%) and many jasmine rice samples (20%) contained detectable levels of aflatoxin B(1) (level of quantification = 0.1 microg aflatoxin kg(-1) rice). Two samples of jasmine rice and ten basmati rice samples contained levels over the regulated European maximum limits of 2 microg kg(-1) for aflatoxin B(1) or 4 microg kg(-1) for total aflatoxins. Aspergillus was the most common mould genus isolated, but also Penicillium, Eurotium, Wallemia, Cladosporium, Epicoccum, Alternaria, and Trichotecium were found. The presence of Aspergillus flavus in 21% of the samples indicates that incorrect management of rice during production and storage implies a risk of mould growth and subsequent production of aflatoxin. Rough estimates showed that high rice consumers may have an intake of 2-3 ng aflatoxin kg(-1) bodyweight and day(-1) from rice alone. This survey shows that aflatoxin is a common contaminant in rice imported to Europe.

  9. Energy reduction in the pultrusion and the rotational moulding processes

    NASA Astrophysics Data System (ADS)

    Khan, W. A.

    This work embraces two different manufacturing processes: pultrusion and rotational moulding. One (pultrusion) is concerned with manufacture with a thermosetting composite while the other is concerned with manufacture of an unfilled thermoplastic. The connecting theme is one of energy usage in manufacture with these processes. While a large number of comprehensive computer models of pultrusion have been generated, most are focused on the prediction of the temperature and conversion distributions within the profile; by contrast, the analysis presented here is directed towards the prediction of the duty cycle of the mould heaters as a first step in recognising the significance of the energy consumed in the process. The results of the model are compared with experimental measurements of the duty cycle of an industrial machine. The nature of this particular investigation was predominantly applied and in particular directed towards industrial use. It is shown that the line speed could be increased significantly by preheating the profile before it enter the die. For example, line speed for one particular profile was increased from 0.4m/min to 0.5 m/min by using a pre-heater set at 80oC. This work also showed that the specific energy consumption of the process was 0.2 kWh/kg to 0.3 kWh/kg; under different line speeds and operating conditions. This was achieved by measuring the duty cycle of the heaters on the die. This increase in line speed means a saving of up to 30 % of the specific energy consumption in the pultrusion. The energy theme continues through the work on rotational moulding. It is shown that the specific energy consumption in rotational moulding can be reduced by up to 70% by direct heating of the mould by using electrical resistance heaters instead of current method of using hot air to heat the mould.

  10. Milling of Sand Blocks to Make Casting Moulds

    SciTech Connect

    Lopez de Lacalle, L. N.; Rodriguez, A.; Lamikiz, A.; Penafiel, F. J.

    2011-01-17

    In this paper a full procedure to make moulds in sand for direct casting of metallic parts is presented. The technology aims at unique pieces or art pieces, where only one prototype or components is required, but lead times are much reduced. The key of the procedure is to achieve enough tool life when milling with carbide tools, avoiding the risk of sand destruction or damage.The use of inverse techniques is a common input due to the industrial sectors where the direct milling is interesting. Two examples of moulds are presented, evaluating times and costs. A special study of tool wear is also presented.

  11. Replication of microchannel structures in WC-Co feedstock using elastomeric replica moulds by hot embossing process.

    PubMed

    Sahli, M; Gelin, J-C; Barrière, T

    2015-10-01

    Hot embossing is a net shaping process that is able to produce the micro-components of polymers with intrinsic and complex shapes at lower cost compared with machining and injection moulding. However, the emboss of hard metals, such as WC-Co, is more challenging due to their high thermal conductivity and ease of agglomeration. Thus, a WC-Co alloy mixed with a wax-based binder feedstock was selected. The formed feedstock exhibited pseudo-plastic flow and was successfully embossed (green part). Here, we developed a novel process that is used to replicate polymer microfluidic chips while simultaneously reducing the channel surface roughness of the mould insert, yielding optical-grade (less than 100 nm surface roughness) channels and reservoirs. This paper concerns the replication of metallic microfluidic mould inserts in WC-Co and the parameters associated with feedstock formation via a hot embossing process. A suitable formulation for micro-powder hot embossing has been established and characterised by thermogravimetric analyses and measurements of mixing torques to verify and quantify the homogeneity of the proposed feedstocks. The relative density of the samples increased with processing temperature, and almost fully dense materials were obtained. In this work, the effects of the sintering temperature on the physical properties were systematically analysed. The evolution of the metal surface morphology during the hot embossing process was also investigated. The results indicate that the feedstock can be used to manufacture micro-fluidic die mould cavities with a low roughness, proper dimensions and good shape retention. The shrinkage of the sintered part was approximately 19-24% compared with that of the brown part. PMID:26117760

  12. Antifungal properties of silver nanoparticles against indoor mould growth.

    PubMed

    Ogar, Anna; Tylko, Grzegorz; Turnau, Katarzyna

    2015-07-15

    The presence of moulds in indoor environments causes serious diseases and acute or chronic toxicological syndromes. In order to inhibit or prevent the growth of microorganisms on building materials, the disruption of their vital processes or the reduction of reproduction is required. The development of novel techniques that impair the growth of microorganisms on building materials is usually based on silver nanoparticles (AgNPs). It makes them an alternative to other biocides. AgNPs have proven antibacterial activity and became promising in relation to fungi. The aim of the study was to assess growth and morphology of mycelia of typical indoor fungal species: Penicillium brevicompactum, Aspergillus fumigatus, Cladosporium cladosporoides, Chaetomium globosum and Stachybotrys chartarum as well as Mortierella alpina, cultured on agar media. The antifungal activity of AgNPs was also tested in relation to C. globosum and S. chartarum grown on the surface of gypsum drywall. It was found that the presence of AgNPs in concentrations of 30-200mg/l significantly decreased the growth of fungi. However, in the case of M. alpina, AgNPs stimulated its growth. Moreover, strong changes in moulds morphology and colour were observed after administration of AgNPs. Parameters of conidiophores/sporangiophores varied depending on mould region and changed significantly after treatment with AgNPs. The experiments have shown antifungal properties of AgNPs against common indoor mould species. Their application to building materials could effectively protect indoor environments from mould development. However, consideration must be given to the fact that the growth of some fungal strains might be stimulated by AgNPs.

  13. In Vitro Antifungal Activities against Moulds Isolated from Dermatological Specimens

    PubMed Central

    Mohd Nizam, Tzar; Binting, Rabiatul Adawiyah AG.; Mohd Saari, Shafika; Kumar, Thivyananthini Vijaya; Muhammad, Marianayati; Satim, Hartini; Yusoff, Hamidah; Santhanam, Jacinta

    2016-01-01

    Background This study aimed to determine the minimum inhibitory concentrations (MICs) of various antifungal agents against moulds isolated from dermatological specimens. Methods We identified 29 moulds from dermatological specimens between October 2012 and March 2013 by conventional methods. We performed antifungal susceptibility testing on six antifungal agents, amphotericin B, clotrimazole, itraconazole, ketoconazole, miconazole and terbinafine, according to the Clinical and Laboratory Standards Institute guidelines contained in the M38-A2 document. Results Most antifungal agents were active against the dermatophytes, except for terbinafine against Trichophyton rubrum (geometric mean MIC, MICGM 3.17 μg/mL). The dematiaceous moulds were relatively susceptible to amphotericin B and azoles (MICGM 0.17–0.34 μg/mL), but not to terbinafine (MICGM 3.62 μg/mL). Septate hyaline moulds showed variable results between the relatively more susceptible Aspergillus spp. (MICGM 0.25–4 μg/mL) and the more resistant Fusarium spp. (MICGM 5.66–32 μg/mL). The zygomycetes were susceptible to amphotericin B (MICGM 0.5 μg/mL) and clotrimazole (MICGM 0.08 μg/mL), but not to other azoles (MICGM 2.52–4 μg/mL). Conclusion Amphotericin B and clotrimazole were the most effective antifungal agents against all moulds excepting Fusarium spp., while terbinafine was useful against dermatophytes (except T. rubrum) and Aspergillus spp. However, a larger study is required to draw more solid conclusions. PMID:27418867

  14. Emission of organic compounds from mould and core binders used for casting iron, aluminium and bronze in sand moulds.

    PubMed

    Tiedje, Niels; Crepaz, Rudolf; Eggert, Torben; Bey, Niki

    2010-12-01

    Emissions from mould and core sand binders commonly used in the foundry industry have been investigated. Degradation of three different types of binders was investigated: Furfuryl alcohol (FA), phenolic urethane (PU) and resol-CO2 (RC). In each group of binders, at least two different binder compositions were tested. A test method that provides uniform test conditions is described. The method can be used as a general test method to analyse off gases from binders. Moulds, containing a standard size casting, were produced and the amount and type of organic compounds, resulting from thermal degradation of binders, was monitored when cast iron, bronze and aluminium was poured in the moulds. Binder degradation was measured by collecting off gases in a specially designed ventilation hood at a constant flow rate. Samples were taken from the ventilation system and analysed for hydrocarbons and CO content. It is shown how off-gases vary with time after pouring and shake out. Also the composition of off-gases is analysed and shown. It is further shown how the composition of off-gasses varies between different types of binders and with varying composition of the binders as well as function of the thermal load on the moulding sand. PMID:20954042

  15. Mechanical properties of micro-injected HDPE composites

    NASA Astrophysics Data System (ADS)

    Bongiorno, A.; Pagano, C.; Agnelli, S.; Baldi, F.; Fassi, I.

    2016-03-01

    Micro-injection moulding is one of the key manufacturing technologies for the mass production of high value polymeric miniaturized-components. However, this process is not just a straightforward down scaling of the conventional injection moulding technique. Indeed, during the micro-injection the polymer melt is forced to flow at high strain rates through very small channels in non-isothermal conditions, and this can lead to complex microstructures and to parts with unexpected performances. In this work, the relationships among the processing conditions, the mechanical properties and the microstructural characteristics of miniaturized specimens obtained by injection moulding were investigated. Two model systems were considered with the same filler content of 15% wt. (HDPE-talc and HDPE-glass beads), representative of two different types of micro-composites: containing lamellar and spherical micro-particles, respectively. The attention was focused on the influence of the filler type and the process conditions on the mechanical behaviour, examined by uniaxial tensile tests and dynamic-mechanical analyses, and on the morphological characteristics of the specimens, examined by microscopy analyses. The results highlight that mechanical response of the miniaturized specimens is significantly affected by both the filler and the process conditions that can have an influence on the polymer microstructure. Lamellar composites showed the best performance due to the orientation of the talc particles during the micro-injection process, while, different morphologies of the skin/core transition region in dependence on the process temperatures were observable.

  16. Two underestimated threats in food transportation: mould and acceleration.

    PubMed

    Janssen, S; Pankoke, I; Klus, K; Schmitt, K; Stephan, U; Wöllenstein, J

    2014-06-13

    Two important parameters are often neglected in the monitoring of perishable goods during transport: mould contamination of fresh food and the influence of acceleration or vibration on the quality of a product. We assert the claim that it is necessary to focus research on these two topics in the context of intelligent logistics in this opinion paper. Further, the technical possibilities for future measurement systems are discussed. By measuring taste deviations, we verified the effect on the quality of beer at different vibration frequencies. The practical importance is shown by examining transport routes and market shares. The general feasibility of a mobile mould detection system is established by examining the measurement resolution of semiconductor sensors for mould-related gases. Furthermore, as an alternative solution, we present a concept for a miniaturized and automated culture-medium-based system. Although there is a lack of related research to date, new efforts can make a vital contribution to the reduction of losses in the logistic chains for several products. PMID:24797139

  17. Two underestimated threats in food transportation: mould and acceleration

    PubMed Central

    Janssen, S.; Pankoke, I.; Klus, K.; Schmitt, K.; Stephan, U.; Wöllenstein, J.

    2014-01-01

    Two important parameters are often neglected in the monitoring of perishable goods during transport: mould contamination of fresh food and the influence of acceleration or vibration on the quality of a product. We assert the claim that it is necessary to focus research on these two topics in the context of intelligent logistics in this opinion paper. Further, the technical possibilities for future measurement systems are discussed. By measuring taste deviations, we verified the effect on the quality of beer at different vibration frequencies. The practical importance is shown by examining transport routes and market shares. The general feasibility of a mobile mould detection system is established by examining the measurement resolution of semiconductor sensors for mould-related gases. Furthermore, as an alternative solution, we present a concept for a miniaturized and automated culture-medium-based system. Although there is a lack of related research to date, new efforts can make a vital contribution to the reduction of losses in the logistic chains for several products. PMID:24797139

  18. Flavor production from a non-stick oil by moulds.

    PubMed

    Fujikawa, H; Ibe, A; Wauke, T; Morozumi, S; Mori, H

    2001-02-01

    Natural flavor was accidentally produced from rice cake products in Japan. A non-stick oil had been sprayed on the products during the production process. It was found that a Penicillium corylophilum strain, a contaminant of the oil, produced the flavor from the oil. The ingredients of the flavor were four volatile substances, 2-heptanone, 2-nonanone, 2-heptanol, and 2-nonanol. Challenge tests with the mould strain in a rice cake system were performed under various conditions. The volatile substances were produced in the largest amounts at 25 degrees C, followed by 20 or 30 degrees C then 10 degrees C. 2-Heptanone was produced most remarkably at 25 degrees C, followed by 2-nonanone, 2-heptanol, and 2-nonanol. The growth patterns of the mould were similar between 20-30 degrees C, and the growth at 10 degrees C was delayed. The non-stick oil itself had neither flavor nor volatile substance. The flavor was also produced from coconut oil, which was one of the materials of the non-stick oil. No bacteria or yeasts tested produced any flavor from the non-stick oil, whereas most of the moulds tested produced flavor components.

  19. Pegfilgrastim Injection

    MedlinePlus

    ... a pre-filled automatic injection device (On-body Injector) to inject subcutaneously (under the skin). If you ... a pre-filled automatic injection device (On-body Injector), the device will usually be applied to your ...

  20. Cabazitaxel Injection

    MedlinePlus

    ... injection is used along with prednisone to treat prostate cancer (cancer of a male reproductive organ) that has ... cabazitaxel injection is usually used in men with prostate cancer. If used by pregnant women, cabazitaxel injection can ...

  1. Morphine Injection

    MedlinePlus

    Morphine injection is used to relieve moderate to severe pain. Morphine is in a class of medications called opiate ( ... Morphine injection comes as a solution (liquid) to inject intramuscularly (into a muscle) or intravenously (into a ...

  2. Romidepsin Injection

    MedlinePlus

    Romidepsin injection is used to treat cutaneous T-cell lymphoma (CTCL; a group of cancers of the ... other medication given by mouth or by injection. Romidepsin injection is in a class of medications called ...

  3. Plasticising and injecting lowest quantities of plastic

    NASA Astrophysics Data System (ADS)

    Hopmann, Ch.; Neuß, A.; Weber, M.; Fischer, T.

    2014-05-01

    For an economic production of thermoplastic micro parts a reproducible quality is one of the key aspects. Therefore, injection moulding is one of the most common production technologies. The material and process oriented plasticising of the required amount of plastic material are still challenging. Due to the concept of standard injection moulding machines the plasticising screw with a non-return valve is used as the injection plunger. This principle can only realise injection volumes which arise directly from the screw diameter D and the injection stroke. Miniaturisation of this design is limited, since the screw core must absorb the required torque while a feeding of the granules is to ensure by a sufficient flight depth. Even the smallest standard diameters of 14 mm and minimum injection strokes result in shot volumes, which account for multiples of the component volume of common micro parts. At present a new plasticising concept is developed by the Institute of Plastics Processing (IKV), Aachen, Germany. The concept is characterised by the position of the screw flights, which are attached to the inside of the plasticising cylinder. The injection piston is mounted coaxially within the cylinder. The so-called 'inverted plastication' is based on the kinematic reversal of the screw flights' arrangement. As the injection piston does not have to feature neither a special feed section nor screw flights, it is exposed to lower mechanical stresses. It therefore features a smaller diameter than common plasticising screws. Thus, the entire plasticising unit can be adapted to the volume of micro parts. Currently, an experimental setup is built which allows a systematical analysis of the different influencing parameters.

  4. 3D-printed surface mould applicator for high-dose-rate brachytherapy

    NASA Astrophysics Data System (ADS)

    Schumacher, Mark; Lasso, Andras; Cumming, Ian; Rankin, Adam; Falkson, Conrad B.; Schreiner, L. John; Joshi, Chandra; Fichtinger, Gabor

    2015-03-01

    In contemporary high-dose-rate brachytherapy treatment of superficial tumors, catheters are placed in a wax mould. The creation of current wax models is a difficult and time consuming proces.The irradiation plan can only be computed post-construction and requires a second CT scan. In case no satisfactory dose plan can be created, the mould is discarded and the process is repeated. The objective of this work was to develop an automated method to replace suboptimal wax moulding. We developed a method to design and manufacture moulds that guarantee to yield satisfactory dosimetry. A 3D-printed mould with channels for the catheters designed from the patient's CT and mounted on a patient-specific thermoplastic mesh mask. The mould planner was implemented as an open-source module in the 3D Slicer platform. Series of test moulds were created to accommodate standard brachytherapy catheters of 1.70mm diameter. A calibration object was used to conclude that tunnels with a diameter of 2.25mm, minimum 12mm radius of curvature, and 1.0mm open channel gave the best fit for this printer/catheter combination. Moulds were created from the CT scan of thermoplastic mesh masks of actual patients. The patient-specific moulds have been visually verified to fit on the thermoplastic meshes. The masks were visually shown to fit onto the thermoplastic meshes, next the resulting dosimetry will have to be compared with treatment plans and dosimetry achieved with conventional wax moulds in order to validate our 3D printed moulds.

  5. Microbial quality and presence of moulds in Kuflu cheese.

    PubMed

    Hayaloglu, A A; Kirbag, S

    2007-04-20

    The chemical and microbial qualities, including fungal flora, of 30 samples of Kuflu cheese randomly purchased from different markets in Turkey were investigated. The gross composition of the cheese samples ranged between 37.65-53.65% moisture, 6.21-40.09% fat-in-dry matter, 4.70-10.07% salt-in-moisture and 26.18-44.85% protein. The mean pH value of the cheeses was 6.29+/-0.28 and pH values ranged from 5.52 to 7.22. Variations between the samples in terms of their gross composition suggested a lack of quality standards in cheesemilk, cheesemaking procedure and ripening conditions. The levels of main microbial groups including total mesophilic and coliform bacteria, yeasts and moulds and the presence of some potentially pathogenic microorganisms (E. coli, Salmonella spp. and Staphylococcus aureus) were determined. The high numbers of all microbial groups and presence of potentially pathogenic organisms in the cheese samples suggested that the production and maturation of Kuflu cheese should be improved by better hygiene. Moulds at the cheese surface were isolated and identified. A total of 24 different mould species were detected and the genus most frequently isolated was Penicillium spp. which represented 70.25% of total isolates. Penicillium commune, P. roqueforti and P. verrucosum were the most abundant species in the cheeses sampled. The other dominant fungal groups were Geotrichum candidum, Penicillium expansum and P. chrysogenum. Other genera isolated from the cheese were Acremonium, Alternaria, Aspergillus, Cladosporium, Geotrichum, Mucor, Rhizopus and Trichoderma. The potentially toxigenic species, including some Penicillum spp. and Aspergillus flavus, were also detected.

  6. Multi-agent model of slime mould for computing and robotics

    NASA Astrophysics Data System (ADS)

    Jones, Jeff

    2015-03-01

    This chapter features results from a multi-agent model of slime mould. Slime mould is a remarkable organism because it possesses no nervous system, no skeleton, no organised musculature and no special senses. Despite these limitations, slime mould is capable of remarkable biological and computational feats by dynamically adapting its body plan in response to environmental stimuli. Because slime mould consists of simple component parts, its behaviour requires no specialised or critical components and the mechanisms which govern its behaviour are distributed throughout -- and embedded within -- the organism itself. This multi-agent approach to modelling slime mould is a bottom-up model and attempts to specifically use the same -- apparently limiting -- properties found in the organism itself: simple component parts, local interactions and self-organised collective emergent behaviour. The aim of the model is to show how the complexity of slime mould can emerge from these very simple local interactions. The model has successfully been applied to reproducing the biological behaviour of slime mould (growth patterns, network adaptation, oscillatory phenomena) and also the computational and robotic behaviour of slime mould. The images in this chapter give a flavour of the model with topics relating to the complex pattern formation phenomena, amoeboid movement and collective transport phenomena, and its utilisation as a spatially represented unconventional computing substrate...

  7. UV-assisted rotational moulding of microstructures using a conventional flexographic printing machine

    NASA Astrophysics Data System (ADS)

    Lindvold, Lars R.; Stensborg, Jan; Rasmussen, Torben P.

    2003-01-01

    This paper pertains to the development of a system for micro replication that has been successfully implemented on a conventional flexographic printing machine. The core technology in the system is UV assisted rotational moulding using an elastomer as the micro mould and UV curable polymers as the casting material.

  8. Adalimumab Injection

    MedlinePlus

    ... not improved when treated with other medications, ulcerative colitis (a condition which causes swelling and sores in ... adalimumab injection to treat Crohn's disease or ulcerative colitis, your doctor may tell you to inject the ...

  9. Denosumab Injection

    MedlinePlus

    ... Denosumab injection (Prolia) is also used to treat bone loss in men with prostate cancer and in women with breast cancer who are receiving certain treatments that increase their risk for fractures. Denosumab injection ( ...

  10. Diphenhydramine Injection

    MedlinePlus

    ... the nervous system that causes difficulties with movement, muscle control, and balance). Diphenhydramine injection should not be ... solution (liquid) to be injected intramuscularly (into a muscle) or intravenously (into a vein). Your dosing schedule ...

  11. Leucovorin Injection

    MedlinePlus

    ... red blood cells) caused by low levels of folic acid in the body. Leucovorin injection is also used ... injection is in a class of medications called folic acid analogs. It treats people who are receiving methotrexate ...

  12. Glatiramer Injection

    MedlinePlus

    ... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS; a disease in which ... to inject glatiramer, inject it around the same time every day. Follow the directions on your prescription ...

  13. Naltrexone Injection

    MedlinePlus

    Naltrexone injection is used along with counseling and social support to help people who have stopped drinking large ... injection is also used along with counseling and social support to help people who have stopped abusing opiate ...

  14. Estrogen Injection

    MedlinePlus

    ... forms of estrogen injection are used to treat hot flushes (hot flashes; sudden strong feelings of heat and sweating) ... If you are using estrogen injection to treat hot flushes, your symptoms should improve within 1 to ...

  15. Cefazolin Injection

    MedlinePlus

    Cefazolin injection is also sometimes used for certain penicillin allergic patients who have a heart condition and ... injection is also sometimes used to treat certain penicillin allergic women who are in labor in order ...

  16. Paclitaxel Injection

    MedlinePlus

    ... with other medications. Paclitaxel injection manufactured with polyoxyethylated castor oil is used to treat ovarian cancer (cancer that ... cancer, and lung cancer. Paclitaxel injection with polyoxyethylated castor oil is also used to treat Kaposi's sarcoma (a ...

  17. Aripiprazole Injection

    MedlinePlus

    ... aripiprazole injection and aripiprazole extended-release injection developed gambling problems or other intense urges or behaviors that ... even if you do not realize that your gambling or any other intense urges or unusual behaviors ...

  18. Testosterone Injection

    MedlinePlus

    ... Testopel) are also used to stimulate puberty in males with delayed puberty. Testosterone enanthate (Delatestryl) injection may ... to the growth, development, and functioning of the male sexual organs and typical male characteristics. Testosterone injection ...

  19. Degarelix Injection

    MedlinePlus

    Degarelix injection is used to treat advanced prostate cancer (cancer that begins in the prostate [a male reproductive gland]). Degarelix injection is in a class of medications called gonadotropin-releasing hormone (GnRH) ...

  20. Naloxone Injection

    MedlinePlus

    ... injection device.The automatic injection device has an electronic voice system that provides step by step directions ... of opiate withdrawal such as body aches, diarrhea, fast heart beat, fever, runny nose, sneezing, sweating, yawning, ...

  1. Cefoxitin Injection

    MedlinePlus

    ... injection is used to treat infections caused by bacteria including pneumonia and other lower respiratory tract (lung) ... medications called cephamycin antibiotics. It works by killing bacteria.Antibiotics such as cefoxitin injection will not work ...

  2. Doripenem Injection

    MedlinePlus

    ... tract, kidney, and abdomen that are caused by bacteria. Doripenem injection is not approved by the Food ... medications called carbapenem antibiotics. It works by killing bacteria.Antibiotics such as doripenem injection will not work ...

  3. Chloramphenicol Injection

    MedlinePlus

    ... treat certain types of serious infections caused by bacteria when other antibiotics cannot be used. Chloramphenicol injection ... antibiotics. It works by stopping the growth of bacteria..Antibiotics such as chloramphenicol injection will not work ...

  4. Medroxyprogesterone Injection

    MedlinePlus

    ... Medroxyprogesterone subcutaneous injection is also used to treat endometriosis (a condition in which the type of tissue ... parts of the body in women who have endometriosis. Medroxyprogesterone injection is a very effective method of ...

  5. Levoleucovorin Injection

    MedlinePlus

    ... injection is used to prevent harmful effects of methotrexate (Rheumatrex, Trexall) when methotrexate is used to to treat certain types of ... people who have accidentally received an overdose of methotrexate or similar medications. Levoleucovorin injection is in a ...

  6. Vancomycin Injection

    MedlinePlus

    Vancomycin injection is used alone or in combination with other medications to treat certain serious infections such ... infections of the lungs, skin, blood, and bones. Vancomycin injection is in a class of medications called ...

  7. Effects of essential oil combinations on pathogenic yeasts and moulds.

    PubMed

    Horváth, Györgyi; Jenei, Julianna Török; Vágvölgyi, Csaba; Böszörményi, Andrea; Krisch, Judit

    2016-06-01

    Essential oils (EOs) can be used as alternative or complementary antifungal agents against human pathogenic moulds and yeasts. To reduce the effective dose of antimicrobial agents, EOs are combined which can lead to synergistic or additive effect. In this study the anti-yeast and anti-mould activities of selected EOs were investigated, alone and in combinations, against clinical isolates of Candida albicans, C. parapsilosis, Aspergillus fumigatus, A. terreus, Rhizopus microsporus, Fusarium solani and Lichtheimia corymbifera. Minimum inhibitory concentrations (MICs) were determined for the EOs of cinnamon, citronella, clove, spearmint and thyme. To investigate the combination effect of the EOs, fractional inhibitory concentrations (FICs) were defined by the checkerboard method and the type of interaction was determined by the FIC index (FICI). FIC index below 0.5 was considered as synergism and between 0.5 and 1 as additive effect. Strongest antifungal activity was showed by thyme EO with MIC values below 1.0 mg/ml. Combination of EOs resulted in additive or indifferent effect, with occasional "borderline synergism". The best combination was cinnamon with clove leading to additive effect in all cases.

  8. Habituation in non-neural organisms: evidence from slime moulds.

    PubMed

    Boisseau, Romain P; Vogel, David; Dussutour, Audrey

    2016-04-27

    Learning, defined as a change in behaviour evoked by experience, has hitherto been investigated almost exclusively in multicellular neural organisms. Evidence for learning in non-neural multicellular organisms is scant, and only a few unequivocal reports of learning have been described in single-celled organisms. Here we demonstrate habituation, an unmistakable form of learning, in the non-neural organism Physarum polycephalum In our experiment, using chemotaxis as the behavioural output and quinine or caffeine as the stimulus, we showed that P. polycephalum learnt to ignore quinine or caffeine when the stimuli were repeated, but responded again when the stimulus was withheld for a certain time. Our results meet the principle criteria that have been used to demonstrate habituation: responsiveness decline and spontaneous recovery. To distinguish habituation from sensory adaptation or motor fatigue, we also show stimulus specificity. Our results point to the diversity of organisms lacking neurons, which likely display a hitherto unrecognized capacity for learning, and suggest that slime moulds may be an ideal model system in which to investigate fundamental mechanisms underlying learning processes. Besides, documenting learning in non-neural organisms such as slime moulds is centrally important to a comprehensive, phylogenetic understanding of when and where in the tree of life the earliest manifestations of learning evolved.

  9. Effects of essential oil combinations on pathogenic yeasts and moulds.

    PubMed

    Horváth, Györgyi; Jenei, Julianna Török; Vágvölgyi, Csaba; Böszörményi, Andrea; Krisch, Judit

    2016-06-01

    Essential oils (EOs) can be used as alternative or complementary antifungal agents against human pathogenic moulds and yeasts. To reduce the effective dose of antimicrobial agents, EOs are combined which can lead to synergistic or additive effect. In this study the anti-yeast and anti-mould activities of selected EOs were investigated, alone and in combinations, against clinical isolates of Candida albicans, C. parapsilosis, Aspergillus fumigatus, A. terreus, Rhizopus microsporus, Fusarium solani and Lichtheimia corymbifera. Minimum inhibitory concentrations (MICs) were determined for the EOs of cinnamon, citronella, clove, spearmint and thyme. To investigate the combination effect of the EOs, fractional inhibitory concentrations (FICs) were defined by the checkerboard method and the type of interaction was determined by the FIC index (FICI). FIC index below 0.5 was considered as synergism and between 0.5 and 1 as additive effect. Strongest antifungal activity was showed by thyme EO with MIC values below 1.0 mg/ml. Combination of EOs resulted in additive or indifferent effect, with occasional "borderline synergism". The best combination was cinnamon with clove leading to additive effect in all cases. PMID:27165531

  10. Habituation in non-neural organisms: evidence from slime moulds.

    PubMed

    Boisseau, Romain P; Vogel, David; Dussutour, Audrey

    2016-04-27

    Learning, defined as a change in behaviour evoked by experience, has hitherto been investigated almost exclusively in multicellular neural organisms. Evidence for learning in non-neural multicellular organisms is scant, and only a few unequivocal reports of learning have been described in single-celled organisms. Here we demonstrate habituation, an unmistakable form of learning, in the non-neural organism Physarum polycephalum In our experiment, using chemotaxis as the behavioural output and quinine or caffeine as the stimulus, we showed that P. polycephalum learnt to ignore quinine or caffeine when the stimuli were repeated, but responded again when the stimulus was withheld for a certain time. Our results meet the principle criteria that have been used to demonstrate habituation: responsiveness decline and spontaneous recovery. To distinguish habituation from sensory adaptation or motor fatigue, we also show stimulus specificity. Our results point to the diversity of organisms lacking neurons, which likely display a hitherto unrecognized capacity for learning, and suggest that slime moulds may be an ideal model system in which to investigate fundamental mechanisms underlying learning processes. Besides, documenting learning in non-neural organisms such as slime moulds is centrally important to a comprehensive, phylogenetic understanding of when and where in the tree of life the earliest manifestations of learning evolved. PMID:27122563

  11. Laser welding process in PP moulding parts: Evaluation of seam performance

    NASA Astrophysics Data System (ADS)

    Oliveira, N.; Pontes, A. J.

    2015-12-01

    The Polypropylene is one of the most versatile polymer materials used in the industry. Due to this versatility, it is possible to use it in different products. This material can also be mixed with several additives namely glass fiber, carbon nanotubes, etc. This compatibility with different additives allows also obtaining products with characteristics that goes from an impact absorber to an electricity conductor. When is necessary to join components in PP they could be welded through hot plate, ultrasonic weld and also by laser. This study had the objective of study the influence of several variables, capable of influence the final quality of the seam. In this case were studied variables of the injection molding process as mold temperature and cooling time. Was also studied laser welding variables and different materials. The results showed that the variables that have the most influence were mould temperature, laser velocity and laser diameter. The seams were analyzed using Optical Microscopy technique. The seams showed perfect contact between the materials analyzed, despite the high standard variation presented in the mechanical testes.

  12. Innate immunity against moulds: lessons learned from invertebrate models.

    PubMed

    Ben-Ami, Ronen

    2011-01-01

    The emergence over the past two decades of invasive mycoses as a significant problem in immunocompromised patients underscores the importance of deciphering innate immunity against filamentous fungi. However, the complexity and cost of traditionally used mammalian model hosts presents a bottleneck that has limited the rate of advances in this field. In contrast, invertebrate model hosts have several important advantages, including simple immune systems, genetic tractability, and amenity to high-throughput experiments. The application of these models to studies of host-pathogen interactions is contingent on two tenets: (1) host innate defenses are preserved across widely disparate taxa, and (2) similar fungal virulence factors are operative in insects and in mammals. Validation of these principles paved the way for the use of invertebrates as facile models for studying invasive mould infections. These studies have helped shape our understanding of human pattern recognition receptors, phagocytic cell function and antimicrobial proteins, and their roles in host defense against filamentous fungi.

  13. Development and initial testing of a novel slime mould biosensor.

    PubMed

    Whiting, James G H; de Lacy Costello, Ben; Adamatzky, Andrew

    2014-01-01

    A plurality of whole cell biosensors have been developed using many different cell types. Biosensors incorporate biomolecular components or whole cells to facilitate specific analyte interaction; research documented here presents a novel whole cell biosensor based on the slime mould Physarum polycephalum (PP). The electrical response of PP when exposed to multiple chemicals are measured and quantified in terms of amplitude and frequency response. The PP biosensor is capable of detecting the tested chemicals and individually identifying a large number in terms of a specific shift in either oscillation frequency or amplitude. However, it does exhibit a sensitivity to environmental changes such as light level and temperature which may interfere with the detection of the target analyte but could also be used for wider sensing applications. It is proposed that this novel biosensor is capable of detecting many organic chemicals beyond those presented in this work and that the biosensor may be used for environmental monitoring and toxicity evaluation.

  14. Electric moulding of dispersed lipid nanotubes into a nanofluidic device

    PubMed Central

    Frusawa, Hiroshi; Manabe, Tatsuhiko; Kagiyama, Eri; Hirano, Ken; Kameta, Naohiro; Masuda, Mitsutoshi; Shimizu, Toshimi

    2013-01-01

    Hydrophilic nanotubes formed by lipid molecules have potential applications as platforms for chemical or biological events occurring in an attolitre volume inside a hollow cylinder. Here, we have integrated the lipid nanotubes (LNTs) by applying an AC electric field via plug-in electrode needles placed above a substrate. The off-chip assembly method has the on-demand adjustability of an electrode configuration, enabling the dispersed LNT to be electrically moulded into a separate film of parallel LNT arrays in one-step. The fluorescence resonance energy transfer technique as well as the digital microscopy visualised the overall filling of gold nanoparticles up to the inner capacity of an LNT film by capillary action, thereby showing the potential of this flexible film for use as a high-throughput nanofluidic device where not only is the endo-signalling and product in each LNT multiplied but also the encapsulated objects are efficiently transported and reacted. PMID:23835525

  15. Electric moulding of dispersed lipid nanotubes into a nanofluidic device.

    PubMed

    Frusawa, Hiroshi; Manabe, Tatsuhiko; Kagiyama, Eri; Hirano, Ken; Kameta, Naohiro; Masuda, Mitsutoshi; Shimizu, Toshimi

    2013-01-01

    Hydrophilic nanotubes formed by lipid molecules have potential applications as platforms for chemical or biological events occurring in an attolitre volume inside a hollow cylinder. Here, we have integrated the lipid nanotubes (LNTs) by applying an AC electric field via plug-in electrode needles placed above a substrate. The off-chip assembly method has the on-demand adjustability of an electrode configuration, enabling the dispersed LNT to be electrically moulded into a separate film of parallel LNT arrays in one-step. The fluorescence resonance energy transfer technique as well as the digital microscopy visualised the overall filling of gold nanoparticles up to the inner capacity of an LNT film by capillary action, thereby showing the potential of this flexible film for use as a high-throughput nanofluidic device where not only is the endo-signalling and product in each LNT multiplied but also the encapsulated objects are efficiently transported and reacted.

  16. Cellular automaton model of crowd evacuation inspired by slime mould

    NASA Astrophysics Data System (ADS)

    Kalogeiton, V. S.; Papadopoulos, D. P.; Georgilas, I. P.; Sirakoulis, G. Ch.; Adamatzky, A. I.

    2015-04-01

    In all the living organisms, the self-preservation behaviour is almost universal. Even the most simple of living organisms, like slime mould, is typically under intense selective pressure to evolve a response to ensure their evolution and safety in the best possible way. On the other hand, evacuation of a place can be easily characterized as one of the most stressful situations for the individuals taking part on it. Taking inspiration from the slime mould behaviour, we are introducing a computational bio-inspired model crowd evacuation model. Cellular Automata (CA) were selected as a fully parallel advanced computation tool able to mimic the Physarum's behaviour. In particular, the proposed CA model takes into account while mimicking the Physarum foraging process, the food diffusion, the organism's growth, the creation of tubes for each organism, the selection of optimum tube for each human in correspondence to the crowd evacuation under study and finally, the movement of all humans at each time step towards near exit. To test the model's efficiency and robustness, several simulation scenarios were proposed both in virtual and real-life indoor environments (namely, the first floor of office building B of the Department of Electrical and Computer Engineering of Democritus University of Thrace). The proposed model is further evaluated in a purely quantitative way by comparing the simulation results with the corresponding ones from the bibliography taken by real data. The examined fundamental diagrams of velocity-density and flow-density are found in full agreement with many of the already published corresponding results proving the adequacy, the fitness and the resulting dynamics of the model. Finally, several real Physarum experiments were conducted in an archetype of the aforementioned real-life environment proving at last that the proposed model succeeded in reproducing sufficiently the Physarum's recorded behaviour derived from observation of the aforementioned

  17. Events in the mould during heat processing of poly(methyl methacrylate).

    PubMed

    Clark, Robert K F; Cheng, Y Y; Chow, T W

    2003-03-01

    Recordings of temperature and pressure in the mould have raised questions concerning the flow of poly(methylmethacrylate) during heat processing. Three simple experiments investigated flow of polymerised and partly polymerised poly(methylmethacrylate). Flow was not observed at normal processing temperatures. These results, combined with the results of previous work, suggest that as the mould heats up, thermal expansion of the dough exceeds polymerisation contraction, causing increase in pressure rather than flow. Maximum pressure occurs at maximum temperature. Thereafter, thermal expansion is reduced, polymerisation contraction increases and pressure in the mould drops. When the lowest pressure is reached the poly(methylmethacrylate) is polymerised.

  18. Breakpoint detection of heating wire in wind blade moulds using infrared thermography

    NASA Astrophysics Data System (ADS)

    Zeng, Zhi; Tao, Ning; Feng, Lichun; Li, Yeshu; Ma, Yan; Zhang, Cunlin

    2014-05-01

    In order to manufacture the fibre glass wind blades, one kind of mould embedded with heating wire is used not only for making numerous 'copies' of the original sample, and also heating the mould to a certain temperature for curing. The heating wire is embedded in fibre glass as a sandwich structure, and it may break after a long time usage at high temperatures. In this study, a high voltage discharging (HVD) circuit is used to trigger HVD at the breakpoint, which generates heat and therefore causes temperature increase at the corresponding front surface, one infrared camera is used to monitor the temperature evolution. It successfully and quickly detects breakpoints in spar moulds.

  19. Triptorelin Injection

    MedlinePlus

    ... response to triptorelin injection. Your blood sugar and glycosylated hemoglobin (HbA1c) should be checked regularly.Ask your pharmacist any questions you have about triptorelin injection.It is important for you to keep a written list of all of the prescription and ...

  20. Leuprolide Injection

    MedlinePlus

    ... response to leuprolide injection. Your blood sugar and glycosylated hemoglobin (HbA1c) should be checked regularly.Ask your pharmacist any questions you have about leuprolide injection.It is important for you to keep a written list of all of the prescription and ...

  1. Musculoskeletal Injection

    PubMed Central

    Wittich, Christopher M.; Ficalora, Robert D.; Mason, Thomas G.; Beckman, Thomas J.

    2009-01-01

    Patients commonly present to primary care physicians with musculoskeletal symptoms. Clinicians certified in internal medicine must be knowledgeable about the diagnosis and management of musculoskeletal diseases, yet they often receive inadequate postgraduate training on this topic. The musculoskeletal problems most frequently encountered in our busy injection practice involve, in decreasing order, the knees, trochanteric bursae, and glenohumeral joints. This article reviews the clinical presentations of these problems. It also discusses musculoskeletal injections for these problems in terms of medications, indications, injection technique, and supporting evidence from the literature. Experience with joint injection and the pharmacological principles described in this article should allow primary care physicians to become comfortable and proficient with musculoskeletal injections. PMID:19720781

  2. Experimental study on horizontal combustion technique for bitumite-moulded coal

    SciTech Connect

    Shao, Y.; Lu, C.; Cheng, S.; Deng, J.; Chen, Z.

    1994-12-31

    Through a lot of experiments, a new kind of stove using horizontal combustion technique for bitumite-moulded coal has been developed. Making use of this stove, studies have been made on the burning process of bitumite-moulded coal: distribution of temperature field in the stove, the regularities of evolution and combustion of volatile matter, the burning rate and efficiency of bitumite-moulded coal, characteristics of fire-sealing and sulfur-solidification. The results show that, with the technique, some achievements can be obtained in combustion of bitumite-moulded coal, such as lower pollution in that the flue gas opacity is below 0.5 R and dust concentration is below 90 mg/Nm{sup 3}. The stove`s combustion efficiency reaches 90%, sulfur fixing efficiency is 60%, and CO concentration is decreased by 40% compared with other traditional stoves. With so many advantages, the stove can be used extensively in civil stoves and smaller industrial boilers.

  3. Manuscript title: antifungal proteins from moulds: analytical tools and potential application to dry-ripened foods.

    PubMed

    Delgado, Josué; Owens, Rebecca A; Doyle, Sean; Asensio, Miguel A; Núñez, Félix

    2016-08-01

    Moulds growing on the surface of dry-ripened foods contribute to their sensory qualities, but some of them are able to produce mycotoxins that pose a hazard to consumers. Small cysteine-rich antifungal proteins (AFPs) from moulds are highly stable to pH and proteolysis and exhibit a broad inhibition spectrum against filamentous fungi, providing new chances to control hazardous moulds in fermented foods. The analytical tools for characterizing the cellular targets and affected pathways are reviewed. Strategies currently employed to study these mechanisms of action include 'omics' approaches that have come to the forefront in recent years, developing in tandem with genome sequencing of relevant organisms. These techniques contribute to a better understanding of the response of moulds against AFPs, allowing the design of complementary strategies to maximize or overcome the limitations of using AFPs on foods. AFPs alter chitin biosynthesis, and some fungi react inducing cell wall integrity (CWI) pathway. However, moulds able to increase chitin content at the cell wall by increasing proteins in either CWI or calmodulin-calcineurin signalling pathways will resist AFPs. Similarly, AFPs increase the intracellular levels of reactive oxygen species (ROS), and moulds increasing G-protein complex β subunit CpcB and/or enzymes to efficiently produce glutathione may evade apoptosis. Unknown aspects that need to be addressed include the interaction with mycotoxin production by less sensitive toxigenic moulds. However, significant steps have been taken to encourage the use of AFPs in intermediate-moisture foods, particularly for mould-ripened cheese and meat products. PMID:27394712

  4. Particle Filled Polyethylene Composites Used in the Technology of Rotational Moulding

    NASA Astrophysics Data System (ADS)

    Bútora, Peter; Náplava, Antonín; Ridzoň, Martin; Bílik, Jozef; Tittel, Viktor

    2011-01-01

    The submitted article discusses rotational moulding technology and filled plastics. For testing, linear low density polyethylene filled with talc was used. The materials tested varied way of mixing the filler into the polymer. For the prepared samples were evaluated by tensile, elongation, melt flow index, density, Shore hardness and Vicat softening temperature. Experiments showed that, in principle, it is possible to produce rotational moulding technology filled thermoplastics.

  5. Use of the selective agar medium CREAD for monitoring the level of airborne spoilage moulds in cheese production.

    PubMed

    Kure, Cathrine Finne; Borch, Elisabeth; Karlsson, Ingela; Homleid, Jens Petter; Langsrud, Solveig

    2008-02-29

    It was investigated if a selective medium for common cheese spoiling moulds (CREAD) could give more relevant information than a general mould medium in hygienic air-sampling in cheese factories. A total of 126 air-samples were taken in six Nordic cheese factories using the general mould medium DG18 and CREAD. The level and genera of air-borne mould was determined. Identification to species-level was performed for a selection of samples. In five cheese factories the mycobiota was dominated by Penicillium spp. and in one cheese factory by Cladosporium spp. The concentration of air-borne moulds varied between the cheese factories ranging from 1 to 270 cfu/m3 on DG18 with a median value of 17. The number of mould colonies was in general lower at CREAD. Identification indicated that CREAD supported growth of common spoilage moulds for cheese, such as Penicillium palitans and P. commune. The mycobiota on DG18 also consisted of moulds not commonly associated with spoilage of cheese, such as Cladosporium spp., P. brevicompactum and P. chrysogenum. Contamination of cheese with mould is periodically a problem in production of semi-hard cheese and the level of air-borne mould is therefore routinely monitored in cheese factories. A clear correlation between the total number of moulds in air and mould growth on products is not always found. The conclusion from the investigation is that it is recommended to use a selective medium for cheese spoilage moulds, such as CREAD in hygienic monitoring.

  6. Metabolic activity of moulds as a factor of building materials biodegradation.

    PubMed

    Gutarowska, Beata

    2010-01-01

    This paper presents the effect of building materials on the growth and metabolic activity of moulds. In cultures of Aspergillus and Penicillium moulds grown on a model medium with the addition of building materials, the biomass of mycelium, its cellular components--glucan, chitin, ergosterol and the spectrum of enzymes and organic acids produced in the medium were investigated. It was found that on the medium with wallpaper moulds produced more biomass and extracellular enzymes, mainly glycolytic ones. On medium with mortar the growth of mycelium was impeded, production of biomass was 60% smaller, the quantity of chitin, glucan and ergosterol decreased 13-41%, and the activity of most enzymes was reduced; however the moulds intensively produced organic acids: malic, succinic and oxalic acid. The largest acid production activity was found in medium with addition of mortar; moulds produced the greatest variety of acids and in greater quantities than in the control medium. Metabolic activity of the moulds depends on the type of building material, and may lead to biodeterioration of these materials.

  7. Mipomersen Injection

    MedlinePlus

    ... the refrigerator at least 30 minutes before you plan to inject it to allow the medication to ... supplements, and herbal products you are taking or plan to take. Be sure to mention the medications ...

  8. Ibritumomab Injection

    MedlinePlus

    ... is in a class of medications called monoclonal antibodies with radioisotopes. It works by attaching to cancer ... you receive ibritumomab injection, your body may develop antibodies (substances in the blood that help the immune ...

  9. Romiplostim Injection

    MedlinePlus

    ... including other medications or surgery to remove the spleen. Romiplostim injection should not be used to treat ... tell your doctor if you have had your spleen removed.tell your doctor if you are pregnant, ...

  10. Golimumab Injection

    MedlinePlus

    ... and swelling and scales on the skin). ulcerative colitis (a condition which causes swelling and sores in ... you are using golimumab injection to treat ulcerative colitis (a condition which causes swelling and sores in ...

  11. Colistimethate Injection

    MedlinePlus

    ... antibiotics. It works by killing bacteria that cause infection.Antibiotics such as colistimethate injection will not work for colds, flu, or other viral infections. Taking or using antibiotics when they are not needed increases your risk ...

  12. Doxycycline Injection

    MedlinePlus

    ... antibiotics. It works by killing bacteria that cause infections.Antibiotics such as doxycycline injection will not work for colds, flu, or other viral infections. Taking or using antibiotics when they are not needed increases your risk ...

  13. Tigecycline Injection

    MedlinePlus

    ... in a person who was not in the hospital), skin infections, and infections of the abdomen (area between the ... that developed in people who were in a hospital or foot infections in people who have diabetes. Tigecycline injection is ...

  14. Thiotepa Injection

    MedlinePlus

    ... reproductive organs where eggs are formed), breast, and bladder cancer. It is also used to treat malignant effusions ( ... how you respond to thiotepa.When used for bladder cancer, thiotepa is infused (injected slowly) into your bladder ...

  15. Ferumoxytol Injection

    MedlinePlus

    Ferumoxytol injection is used to treat iron-deficiency anemia (a lower than normal number of red blood cells due to too little iron) in adults with chronic kidney disease (damage to the kidneys which may worsen over ...

  16. Daclizumab Injection

    MedlinePlus

    ... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS; a disease in which ... injections. Before you use daclizumab yourself the first time, read the written instructions that come with it. ...

  17. Olanzapine Injection

    MedlinePlus

    Olanzapine extended-release injection is used to treat schizophrenia (a mental illness that causes disturbed or unusual ... treat episodes of agitation in people who have schizophrenia or in people who have bipolar I disorder ( ...

  18. Risperidone Injection

    MedlinePlus

    ... release (long-acting) injection is used to treat schizophrenia (a mental illness that causes disturbed or unusual ... do not already have diabetes. If you have schizophrenia, you are more likely to develop diabetes than ...

  19. Acetaminophen Injection

    MedlinePlus

    ... injection is also used in combination with opioid (narcotic) medications to relieve moderate to severe pain. Acetaminophen is in a class of medications called analgesics (pain relievers) and antipyretics (fever reducers). It works by changing ...

  20. Panitumumab Injection

    MedlinePlus

    ... as a solution (liquid) to be given by infusion (injected into a vein). It is usually given ... doctor or nurse in a doctor's office or infusion center. Panitumumab is usually given once every 2 ...

  1. Dolasetron Injection

    MedlinePlus

    Dolasetron injection is used to prevent and treat nausea and vomiting that may occur after surgery. Dolasetron ... should not be used to prevent or treat nausea and vomiting in people receiving cancer chemotherapy medications. ...

  2. Teduglutide Injection

    MedlinePlus

    ... syndrome in people who need additional nutrition or fluids from intravenous (IV) therapy. Teduglutide injection is in ... analogs. It works by improving the absorption of fluids and nutrients in the intestines.

  3. Ampicillin Injection

    MedlinePlus

    ... injection is in a class of medications called penicillins. It works by killing bacteria.Antibiotics such as ... and pharmacist if you are allergic to ampicillin; penicillins; cephalosporin antibiotics such as cefaclor, cefadroxil, cefazolin (Ancef, ...

  4. Nafcillin Injection

    MedlinePlus

    ... injection is in a class of medications called penicillins. It works by killing bacteria.Antibiotics such as ... and pharmacist if you are allergic to nafcillin; penicillins; cephalosporin antibiotics such as cefaclor, cefadroxil, cefazolin, cefdinir, ...

  5. Oxacillin Injection

    MedlinePlus

    ... injection is in a class of medications called penicillins. It works by killing bacteria.Antibiotics such as ... and pharmacist if you are allergic to oxacillin; penicillins; cephalosporin antibiotics such as cefaclor, cefadroxil, cefazolin, cefdinir, ...

  6. Lacosamide Injection

    MedlinePlus

    ... drowsiness uncontrollable shaking of a part of the body problems with coordination, balance, or walking weakness itching redness, irritation, pain, or discomfort at the injection spot Some side effects can be serious. If you experience any of ...

  7. Epinephrine Injection

    MedlinePlus

    ... emergency medical treatment to treat life-threatening allergic reactions caused by insect bites or stings, foods, medications, ... at the first sign of a serious allergic reaction.Use epinephrine injection exactly as directed; do not ...

  8. Vedolizumab Injection

    MedlinePlus

    ... injection may cause serious allergic reactions during an infusion and for several hours afterward. A doctor or ... of the following symptoms during or after your infusion: rash; itching; swelling of the face, eyes, mouth, ...

  9. Mitoxantrone Injection

    MedlinePlus

    ... medications to relieve pain in people with advanced prostate cancer who did not respond to other medications. Mitoxantrone ... doses). When mitoxantrone injection is used to treat prostate cancer, it is usually given once every 21 days. ...

  10. Bendamustine Injection

    MedlinePlus

    ... leukemia (CLL; a type of cancer of the white blood cells). Bendamustine injection is also used to treat a ... NHL: cancer that begins in a type of white blood cell that normally fights infection) that is slow spreading, ...

  11. Moxifloxacin Injection

    MedlinePlus

    ... is used to treat certain infections caused by bacteria such as pneumonia; ; and , skin, and abdominal (stomach ... antibiotics called fluoroquinolones. It works by killing the bacteria that cause infections.Antibiotics such as moxifloxacin injection ...

  12. Ceftazidime Injection

    MedlinePlus

    ... is used to treat certain infections caused by bacteria including pneumonia and other lower respiratory tract (lung) ... medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as ceftazidime injection will not work ...

  13. Gentamicin Injection

    MedlinePlus

    ... treat certain serious infections that are caused by bacteria such as meningitis (infection of the membranes that ... medications called aminoglycoside antibiotics. It works by killing bacteria.Antibiotics such as gentamicin injection will not work ...

  14. Meropenem Injection

    MedlinePlus

    ... skin and abdominal (stomach area) infections caused by bacteria and meningitis (infection of the membranes that surround ... of medications called antibiotics. It works by killing bacteria that cause infection.Antibiotics such as meropenem injection ...

  15. Tobramycin Injection

    MedlinePlus

    ... treat certain serious infections that are caused by bacteria such as meningitis (infection of the membranes that ... medications called aminoglycoside antibiotics. It works by killing bacteria.Antibiotics such as tobramycin injection will not work ...

  16. Ceftaroline Injection

    MedlinePlus

    ... infections and pneumonia (lung infection) caused by certain bacteria. Ceftaroline is in a class of medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as ceftaroline injection will not work ...

  17. Telavancin Injection

    MedlinePlus

    ... serious skin infections caused by certain types of bacteria. Telavancin injection is in a class of medications ... antibiotics. It works by stopping the growth of bacteria. Antibiotics will not work for colds, flu, or ...

  18. Daptomycin Injection

    MedlinePlus

    ... blood infections or serious skin infections caused by bacteria. Daptomycin injection is in a class of medications called cyclic lipopeptide antibiotics. It works by killing bacteria. Antibiotics will not work for treating colds, flu, ...

  19. Aztreonam Injection

    MedlinePlus

    ... to treat certain infections that are caused by bacteria, including respiratory tract (including pneumonia and bronchitis), urinary ... abdominal (stomach area) infections, that are caused by bacteria. Aztreonam injection also may be used before, during, ...

  20. Cefepime Injection

    MedlinePlus

    ... is used to treat certain infections caused by bacteria including pneumonia, and skin, urinary tract, and kidney ... medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as cefepime injection will not work ...

  1. Amikacin Injection

    MedlinePlus

    ... treat certain serious infections that are caused by bacteria such as meningitis (infection of the membranes that ... medications called aminoglycoside antibiotics. It works by killing bacteria.Antibiotics such as amikacin injection will not work ...

  2. Ertapenem Injection

    MedlinePlus

    ... abdominal (stomach area) infections, that are caused by bacteria. It is also used for the prevention of ... medications called carbapenem antibiotics. It works by killing bacteria.Antibiotics such as ertapenem injection will not work ...

  3. Ciprofloxacin Injection

    MedlinePlus

    ... Ciprofloxacin injection is also sometimes used to treat cat scratch disease (an infection that may develop after a person is bitten or scratched by a cat), Legionnaires' disease (type of lung infection), and infections of the ...

  4. Ganciclovir Injection

    MedlinePlus

    Ganciclovir injection is used to treat cytomegalovirus (CMV) retinitis (eye infection that can cause blindness) in people whose immune system is not working normally, including those people who have ...

  5. Levofloxacin Injection

    MedlinePlus

    ... infections. Levofloxacin injection is also used to prevent anthrax (a serious infection that may be spread on ... in people who may have been exposed to anthrax germs in the air and treat and prevent ...

  6. Ibandronate Injection

    MedlinePlus

    ... Ibandronate is in a class of medications called bisphosphonates. It works by preventing bone breakdown and increasing ... while receiving this medication.Being treated with a bisphosphonate medication such as ibandronate injection for osteoporosis may ...

  7. Fondaparinux Injection

    MedlinePlus

    ... the leg), which can lead to pulmonary embolism (PE; a blood clot in the lung), in people ... with warfarin (Coumadin, Jantoven) to treat DVT or PE. Fondaparinux injection is in a class of medications ...

  8. Pertuzumab Injection

    MedlinePlus

    ... docetaxel (Taxotere) to treat a certain type of breast cancer that has spread to other parts of the body. Pertuzumab injection is in a class of medications called monoclonal antibodies. It works by stopping the growth of cancer ...

  9. Octreotide Injection

    MedlinePlus

    ... injection is used to decrease the amount of growth hormone (a natural substance) produced by people with acromegaly (condition in which the body produces too much growth hormone, causing enlargement of the hands, feet, and facial ...

  10. Haloperidol Injection

    MedlinePlus

    ... release injection are used to treat schizophrenia (a mental illness that causes disturbed or unusual thinking, loss of ... medications); medications for anxiety, depression, irritable bowel disease, mental illness, motion sickness, Parkinson's disease, seizures, ulcers, or urinary ...

  11. Sumatriptan Injection

    MedlinePlus

    ... accompanied by nausea and sensitivity to sound and light). Sumatriptan injection is also used to treat the ... children. Store it at room temperature, away from light, excess heat, and moisture (not in the bathroom). ...

  12. Topotecan Injection

    MedlinePlus

    ... organs where eggs are formed) and small cell lung cancer (a type of cancer that begins in the ... topotecan injection is used to treat ovarian or lung cancer, it is usually given once a day for ...

  13. Pembrolizumab Injection

    MedlinePlus

    ... treat a certain type of non-small-cell lung cancer that has spread to nearby tissues or to ... successfully with other medications for non-small-cell lung cancer. Pembrolizumab injection is in a class of medications ...

  14. Oritavancin Injection

    MedlinePlus

    ... for at least 5 days after receiving oritavancin injection.tell your doctor and pharmacist what other prescription and nonprescription medications, vitamins, nutritional supplements, and herbal products you are taking ...

  15. Cefuroxime Injection

    MedlinePlus

    ... pneumonia and other lower respiratory tract (lung) infections; meningitis (infection of the membranes that surround the brain ... hearing loss, if you are being treated for meningitis Cefuroxime injection may cause other side effects. Call ...

  16. Alirocumab Injection

    MedlinePlus

    ... further decrease the amount of low-density lipoprotein (LDL) cholesterol ('bad cholesterol') in the blood. Alirocumab injection is ... antibodies. It works by blocking the production of LDL cholesterol in the body to decrease the amount of ...

  17. Secukinumab Injection

    MedlinePlus

    ... to see if you need to receive any vaccinations. It is important to have all vaccines appropriate ... treatment with secukinumab injection. Do not have any vaccinations during your treatment without talking to your doctor. ...

  18. Error analysis in predictive modelling demonstrated on mould data.

    PubMed

    Baranyi, József; Csernus, Olívia; Beczner, Judit

    2014-01-17

    The purpose of this paper was to develop a predictive model for the effect of temperature and water activity on the growth rate of Aspergillus niger and to determine the sources of the error when the model is used for prediction. Parallel mould growth curves, derived from the same spore batch, were generated and fitted to determine their growth rate. The variances of replicate ln(growth-rate) estimates were used to quantify the experimental variability, inherent to the method of determining the growth rate. The environmental variability was quantified by the variance of the respective means of replicates. The idea is analogous to the "within group" and "between groups" variability concepts of ANOVA procedures. A (secondary) model, with temperature and water activity as explanatory variables, was fitted to the natural logarithm of the growth rates determined by the primary model. The model error and the experimental and environmental errors were ranked according to their contribution to the total error of prediction. Our method can readily be applied to analysing the error structure of predictive models of bacterial growth models, too.

  19. Genetic variability of grey snow mould (Typhula incarnata).

    PubMed

    Vergara, Georgina V; Bughrara, Suleiman S; Jung, Geunhwa

    2004-11-01

    Randomly amplified polymorphic DNA (RAPD) markers were used to assess the genetic diversity of isolates of grey snow mould ('gray snow mold'), Typhula incarnata, taken from infected turfgrasses from 40 different locations in the northern USA. Data from 115 markers using 37 RAPD primers showed 48 % polymorphism. The distance coefficients between isolates indicate the wide genetic diversity of T. incarnata across the sample area. Dendrograms generated using neighbour-joining (NJ) bootstrap analyses showed three clades and suggest possible recent colonization from common founder groups. Partitioning of the genetic variance using analysis of molecular variance (AMOVA) of four groups based on geographic locations (Michigan, lower and upper peninsula; Minnesota; Wisconsin) showed that genetic variation attributable among groups and within groups was 12.67 and 87.33 %, respectively. No correlation was found between geographic distance and pairwise genetic distance of the groups. High outcrossing and sexual recombination of T. incarnata may well be key factors explaining the genetic variability as shown with the low Fixation index (FST) and high average of genetic diversity per locus within groups.

  20. Taxonomy of Penicillium nalgiovense isolates from mould-fermented sausages.

    PubMed

    Andersen, S J

    1995-08-01

    A large number of Penicillium nalgiovense isolates from mould fermented sausages and the ex type culture were examined for characters of morphology, physiology and production of secondary metabolites. To separate biotypes within the P. nalgiovense species, the data obtained were evaluated using multivariate statistical methods. The macromorphological characters of the ex type culture and isolates from meat products appeared to be distinctive. The ex type culture is characterized by a brown reverse on both Czapek yeast extract and malt extract agar while the isolates from meat products have a yellow to orange reverse. Proteolytic and/or lipolytic activity was demonstrated by 75% of the examined cultures and all of them demonstrated ability to utilize lactate as sole carbon source. Growth on creatine sucrose agar was very inhibited and acid production was absent or very weak. TLC analysis showed production of three unknown secondary metabolites that constituted the characteristic profile. HPLC analysis showed production of only three known secondary metabolites; chrysogine (96%), nalgiolaxin and nalgiovensin (9%). The ex type culture produced nalgiolaxin and nalgiovensin but not chrysogine. The chemometric evaluation showed that P. nalgiovense isolates from meat products from a homogenous species, which can not be divided into biotypes. The only indication of grouping, beside a separation of the ex type culture, was related to the conidium colour (white, turquoise or grey green). The examined P. nalgiovense isolates showed some resemblance (morphologically and chemically) to P. chrysogenum.

  1. Fire Retardancy of Natural Fibre Reinforced Sheet Moulding Compound

    NASA Astrophysics Data System (ADS)

    Hapuarachchi, T. D.; Ren, G.; Fan, M.; Hogg, P. J.; Peijs, T.

    2007-07-01

    Due to environmental awareness and economical considerations, natural fibre reinforced polymer composites seem to present a viable alternative to synthetic fibre reinforced polymer composites such as glass fibres. This is a feasibility study to asses the potential application of natural fibre reinforced sheet moulding compound materials (NF-SMC) for the use in building applications, with particular emphases to their reaction to fire. The reinforcing fibres in this study were industrial hemp fibres. The cone calorimeter which asses the fire hazard of materials by Heat Release Rate (HRR) was used, radiant heat fluxes of 25 and 50 kW/m2 were utilised to simulate an ignition source and fully developed room fire conditions respectively. The results acquired here demonstrate that the NF-SMC can compete with current building materials in terms of their fire behaviour. The peak heat release value for the fire retardant (FR) NF-SMC was 176 kW/m2 conversely for a non-FR NF-SMC was 361 kW/m2.

  2. Effectiveness of phenolic compounds against citrus green mould.

    PubMed

    Sanzani, Simona M; Schena, Leonardo; Ippolito, Antonio

    2014-08-18

    Stored citrus fruit suffer huge losses because of the development of green mould caused by Penicillium digitatum. Usually synthetic fungicides are employed to control this disease, but their use is facing some obstacles, such public concern about possible adverse effects on human and environmental health and the development of resistant pathogen populations. In the present study quercetin, scopoletin and scoparone--phenolic compounds present in several agricultural commodities and associated with response to stresses--were firstly tested in vitro against P. digitatum and then applied in vivo on oranges cv. Navelina. Fruits were wound-treated (100 µg), pathogen-inoculated, stored and surveyed for disease incidence and severity. Although only a minor (≤13%) control effect on P. digitatum growth was recorded in vitro, the in vivo trial results were encouraging. In fact, on phenolic-treated oranges, symptoms appeared at 6 days post-inoculation (DPI), i.e., with a 2 day-delay as compared to the untreated control. Moreover, at 8 DPI, quercetin, scopoletin, and scoparone significantly reduced disease incidence and severity by 69%-40% and 85%-70%, respectively, as compared to the control. At 14 DPI, scoparone was the most active molecule. Based on the results, these compounds might represent an interesting alternative to synthetic fungicides.

  3. Effectiveness of phenolic compounds against citrus green mould.

    PubMed

    Sanzani, Simona M; Schena, Leonardo; Ippolito, Antonio

    2014-01-01

    Stored citrus fruit suffer huge losses because of the development of green mould caused by Penicillium digitatum. Usually synthetic fungicides are employed to control this disease, but their use is facing some obstacles, such public concern about possible adverse effects on human and environmental health and the development of resistant pathogen populations. In the present study quercetin, scopoletin and scoparone--phenolic compounds present in several agricultural commodities and associated with response to stresses--were firstly tested in vitro against P. digitatum and then applied in vivo on oranges cv. Navelina. Fruits were wound-treated (100 µg), pathogen-inoculated, stored and surveyed for disease incidence and severity. Although only a minor (≤13%) control effect on P. digitatum growth was recorded in vitro, the in vivo trial results were encouraging. In fact, on phenolic-treated oranges, symptoms appeared at 6 days post-inoculation (DPI), i.e., with a 2 day-delay as compared to the untreated control. Moreover, at 8 DPI, quercetin, scopoletin, and scoparone significantly reduced disease incidence and severity by 69%-40% and 85%-70%, respectively, as compared to the control. At 14 DPI, scoparone was the most active molecule. Based on the results, these compounds might represent an interesting alternative to synthetic fungicides. PMID:25153867

  4. Modelling mould growth under suboptimal environmental conditions and inoculum size.

    PubMed

    Garcia, Daiana; Ramos, Antonio J; Sanchis, Vicente; Marín, Sonia

    2010-10-01

    Predictive models can be a tool to develop strategies to prevent mould development and consequently mycotoxin production. The aims of this work were to assess the impact of a) high/low levels of inoculum and b) optimal/suboptimal environmental conditions on fungal responses based on both kinetic and probabilistic models. Different levels of spore suspensions of Aspergillus carbonarius and Penicillium expansum were prepared and inoculated centrally with a needlepoint load on malt extract agar (MEA) with 50 replicates. While optimum conditions led to a colony diameter increase which followed Baranyi's function, suboptimal conditions led to different grow functions. In general, growth rate (mu) and lag phase (lambda) were normally distributed. Specifically, the growth rate (mu) showed similar distributions under optimal growth conditions, regardless of the inoculum level, while suboptimal a(w) and temperature conditions led to higher kurtosis distributions, mainly when the inoculum levels were low. Regarding lambda, more skewed distributions were observed, mainly when the inoculum levels were low. Probability models were not much affected by the inoculum size. Lower probabilities of growth were in general predicted under marginal conditions at a given time for both strains. The slopes of the probability curves were smaller under suboptimal growth conditions due to wider distributions. Results showed that a low inoculum level and suboptimal conditions lead to high variability of the estimated growth parameters and growth probability.

  5. Development of Rapid Pipe Moulding Process for Carbon Fiber Reinforced Thermoplastics by Direct Resistance Heating

    NASA Astrophysics Data System (ADS)

    Tanaka, Kazuto; Harada, Ryuki; Uemura, Toshiki; Katayama, Tsutao; Kuwahara, Hideyuki

    To deal with environmental issues, the gasoline mileage of passenger cars can be improved by reduction of the car weight. The use of car components made of Carbon Fiber Reinforced Plastics (CFRP) is increasing because of its superior mechanical properties and relatively low density. Many vehicle structural parts are pipe-shaped, such as suspension arms, torsion beams, door guard bars and impact beams. A reduction of the car weight is expected by using CFRP for these parts. Especially, when considering the recyclability and ease of production, Carbon Fiber Reinforced Thermoplastics are a prime candidate. On the other hand, the moulding process of CFRTP pipes for mass production has not been well established yet. For this pipe moulding process an induction heating method has been investigated already, however, this method requires a complicated coil system. To reduce the production cost, another system without such complicated equipment is to be developed. In this study, the pipe moulding process of CFRTP using direct resistance heating was developed. This heating method heats up the mould by Joule heating using skin effect of high-frequency current. The direct resistance heating method is desirable from a cost perspective, because this method can heat the mould directly without using any coils. Formerly developed Non-woven Stitched Multi-axial Cloth (NSMC) was used as semi-product material. NSMC is very suitable for the lamination process due to the fact that non-crimp stitched carbon fiber of [0°/+45°/90°/-45°] and polyamide 6 non-woven fabric are stitched to one sheet, resulting in a short production cycle time. The use of the pipe moulding process with the direct resistance heating method in combination with the NSMC, has resulted in the successful moulding of a CFRTP pipe of 300 mm in length, 40 mm in diameter and 2 mm in thickness.

  6. Presurgical nasoalveolar moulding in unilateral cleft lip and palate

    PubMed Central

    Zuhaib, Mohammed; Bonanthaya, Krishnamurthy; Parmar, Renu; Shetty, Pritham N.; Sharma, Pradeep

    2016-01-01

    Context: Presurgical nasoalveolar moulding (PNAM) is a non-surgical method of reshaping the cleft lip, alveolus, palate and the nose to minimize the severity of the cleft deformity, before primary cheiloplastyand palatoplasty. In this context, PNAM proves to be an invaluable asset in the management of unilateral cleft lip and palate. Aims: The study was conducted to evaluate the efficacy of PNAM in the management of unilateral cleft lip and palate with the following objectives: (1) To assess and compare the degree of reduction in the size of cleft palate and alveolus (pre-PNAM and post-PNAM). (2) To evaluate and compare the improvement in columellar length and correction of columellar deviation (pre-PNAM and post-PNAM). (3) To assess the changes in the position of the alar base and the alar cartilages. Settings and Design: Prospective study. Subjects and Methods: A prospective study consisting of, which included 20 patients with complete unilateral cleft lip and palate was conducted. The age at the start of PNAM treatment of the infants ranged from 2 to 44 days of age reporting to our institute between December 2011 and August 2013. All the patients underwent PNAM therapy before primary cheiloplasty at 6 months of age; clinical parameters were assessed pre- and post-therapy using photographs and dental study models of the maxilla. Statistical Analysis Used: Student's t-test for paired comparisons. Results: Results of the study showed a promising reduction in the cleft size before the surgery, significant improvement in nasal symmetry, including the columellar length on the cleft side. Conclusions: PNAM is a valuable adjunct to our surgical armamentarium in dealing with the challenges of primary closure of unilateral cleft lip and palate thereby enhancing the overall surgical outcome. The advantages of this method include the simplicity of the procedure and improving the quality of surgical repair, particularly in obtaining tension free muscle closure in unilateral

  7. Fungi associated with black mould on baobab trees in southern Africa.

    PubMed

    Cruywagen, Elsie M; Crous, Pedro W; Roux, Jolanda; Slippers, Bernard; Wingfield, Michael J

    2015-07-01

    There have been numerous reports in the scientific and popular literature suggesting that African baobab (Adansonia digitata) trees are dying, with symptoms including a black mould on their bark. The aim of this study was to determine the identity of the fungi causing this black mould and to consider whether they might be affecting the health of trees. The fungi were identified by sequencing directly from mycelium on the infected tissue as well as from cultures on agar. Sequence data for the ITS region of the rDNA resulted in the identification of four fungi including Aureobasidium pullulans, Toxicocladosporium irritans and a new species of Rachicladosporium described here as Rachicladosporium africanum. A single isolate of an unknown Cladosporium sp. was also found. These fungi, referred to here as black mould, are not true sooty mould fungi and they were shown to penetrate below the bark of infected tissue, causing a distinct host reaction. Although infections can lead to dieback of small twigs on severely infected branches, the mould was not found to kill trees.

  8. Using imprinting technology to fabricate three-dimensional devices from moulds of thermosetting polymer patterns

    NASA Astrophysics Data System (ADS)

    Chen, Jem-Kun; Ko, Fu-Hsiang; Chan, Chia-Hao; Huang, Chih-Feng; Chang, Feng-Chih

    2006-09-01

    The fabrication of moulds for imprinting can be simplified significantly by using specialized cross-linking polymers to define the pattern on a silicon wafer. Thermosetting polymers (SU-8) can be used to pattern silicon moulds for imprinting technologies because (1) silicon oxide moulds bearing a thermosetting polymer pattern can be obtained using conventional semiconductor technologies and (2) thermosetting polymers have no obvious glass transition temperature (Tg) because of their cross-linked structure, but the hardness decreases significantly when the temperature is above the Tg. In this study, we used Su-8 resist as the thermosetting polymer pattern to obtain moulds on a silicon wafer. We have tested the thermal properties of thermosetting (SU-8) and thermoplastic polymers (22A4) for use as imprinting patterns and imprinted resists. We fabricated a hill-like structure by applying an electron beam strategy and used this thick film to increase the adhesion between the pattern and the silicon wafer. We used scanning electron microscopy to investigate the resolution of the thermoplastic polymer resist (22A4) pattern that we imprinted using the thermosetting polymer (SU-8) pattern. To define the feature size after imprinting, we determined the feature size shrink factor after separation of the thermosetting polymer pattern (SU-8) from the thermoplastic polymer (22A4) resist. In addition, we have fabricated a microlens of polydimethylsiloxane (PDMS) through replication using the thermoplastic polymer resist (22A4) obtained after imprinting the mould with the microlens structure of the thermosetting polymer (SU-8).

  9. Remediation of mould damaged building materials--efficiency of a broad spectrum of treatments.

    PubMed

    Peitzsch, Mirko; Bloom, Erica; Haase, Rocco; Must, Aime; Larsson, Lennart

    2012-03-01

    We compared the efficiency of some commercially available products and methods used for remediation of mould-contaminated building materials. Samples of gypsum board and pinewood were artificially contaminated with toxin-producing isolates of Stachybotrys chartarum and Aspergillus versicolor, respectively, then, ten different remediation treatments were applied according to the manufacturers' instructions. Microbial and chemical analyses of the infested materials were carried out both immediately before and after treatment, after six weeks of drying at room temperature, and after another six weeks of remoistening. The aim of the study was to determine whether the investigated methods could inhibit the mould growth and destroy some selected mycotoxins produced by the moulds. None of the decontamination methods tested could completely eliminate viable moulds. Some methods, especially boron based chemicals, ammonium based chemicals, and oxidation reduced the contents of mycotoxins produced by S. chartarum (satratoxin G and H, verrucarol), whereas the one which uses an ammonium based chemical reduced the amount of sterigmatocystin produced by A. versicolor with statistical significance. No remediation treatment eliminated all the toxins from the damaged materials. These results emphasize the importance to work preventively with moisture safety throughout the construction processes and management to prevent mould growth on building materials.

  10. Hydromorphone Injection

    MedlinePlus

    ... the body, vomiting, diarrhea, or failure to gain weight.tell your doctor if you are breast-feeding.if you ... Hydromorphone injection may cause side effects. Tell your doctor if any of these ... vomiting constipation dry mouth lightheadedness dizziness drowsiness ...

  11. Eculizumab Injection

    MedlinePlus

    ... which too many red blood cells are broken down in the body, so there are not enough healthy cells to bring oxygen to all parts of the body). Eculizumab injection is also used to treat atypical hemolytic uremic syndrome (aHUS; an inherited condition in which small blood ...

  12. Fluconazole Injection

    MedlinePlus

    ... injection is used to treat fungal infections, including yeast infections of the mouth, throat, esophagus (tube leading from the mouth to the stomach), abdomen (area between the chest and waist), lungs, blood, and ... to prevent yeast infections in patients who are likely to become infected ...

  13. Tositumomab Injection

    MedlinePlus

    ... has not improved or that had improved after treatment with other medications, but later returned. Tositumomab injection is in a class of medications called monoclonal antibodies with radioisotopes. It works by attaching to cancer cells and releasing radiation to damage the cancer ...

  14. Lanreotide Injection

    MedlinePlus

    Lanreotide injection is used to treat people with acromegaly (condition in which the body produces too much growth hormone, causing enlargement of the hands, feet, and facial features; joint pain; and other symptoms) who have not successfully, or cannot be treated ...

  15. Eribulin Injection

    MedlinePlus

    ... tests to check your body's response to eribulin injection.It is important for you to keep a written list of all of the prescription and nonprescription (over-the-counter) medicines you are taking, as well as any products such as vitamins, minerals, or other dietary supplements. You should bring ...

  16. Pegaptanib Injection

    MedlinePlus

    ... to 7 days after you receive each pegaptanib injection.It is important for you to keep a written list of all of the prescription and nonprescription (over-the-counter) medicines you are taking, as well as any products such as vitamins, minerals, or other dietary supplements. You should bring ...

  17. 78 FR 12357 - Brockway Mould, Inc., a Division of Ross International Ltd. Including Robert Lerch From BJR...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-22

    ..., 2012 (77 FR 61030). At the request of a company official, the Department reviewed the certification for... Employment and Training Administration Brockway Mould, Inc., a Division of Ross International Ltd. Including... Brockway Mould, Inc., a division of Ross International Ltd, Brockport, Pennsylvania (subject firm)....

  18. Imprinted and injection-molded nano-structured optical surfaces

    NASA Astrophysics Data System (ADS)

    Christiansen, Alexander B.; Højlund-Nielsen, Emil; Clausen, Jeppe; Caringal, Gideon P.; Mortensen, N. Asger; Kristensen, Anders

    2013-09-01

    Inspired by nature, nano-textured surfaces have attracted much attention as a method to realize optical surface functionality. The moth-eye antireflective structure and the structural colors of Morpho butterflies are well- known examples used for inspiration for such biomimetic research. In this paper, nanostructured polymer surfaces suitable for up-scalable polymer replication methods, such as imprinting/embossing and injection-molding, are discussed. The limiting case of injection-moulding compatible designs is investigated. Anti-reflective polymer surfaces are realized by replication of Black Silicon (BSi) random nanostructure surfaces. The optical transmission at normal incidence is measured for wavelengths from 400 nm to 900 nm. For samples with optimized nanostructures, the reflectance is reduced by 50 % compared to samples with planar surfaces. The specular and diffusive reflection of light from polymer surfaces and their implication for creating structural colors is discussed. In the case of injection-moulding compatible designs, the maximum reflection of nano-scale textured surfaces cannot exceed the Fresnel reflection of a corresponding flat polymer surface, which is approx. 4 % for normal incidence. Diffraction gratings provide strong color reflection defined by the diffraction orders. However, the apperance varies strongly with viewing angles. Three different methods to address the strong angular-dependence of diffraction grating based structural color are discussed.

  19. Investigating the effects of laser beams (532 and 660 nm) in annihilation of pistachio mould fungus using spectrophotometry analysis

    NASA Astrophysics Data System (ADS)

    Saghafi, S.; Penjweini, R.; Becker, K.; Kratky, K. W.; Dodt, H.-U.

    2010-09-01

    When moulds are illuminated by visible electromagnetic-EM radiations, several effects on nucleus materials and nucleotides can be detected. These effects have a significant influence on mould generation or destruction. This paper presents the effects and implications of a red diode laser beam (660 nm), a second-harmonics of a Nd:YAG laser emitting green beam (532 nm), or the combination of both, on the eradication of Pistachio mould fungus. Incident doses (ID) of both beams are kept identical throughout the experiment. The absorption spectrums of irradiated mouldy samples and the bright-greenish-yellow-fluorescence (BGYF) of fungus occurring in mould texture due to electronic excitation are investigated. We found that a combination of a green and a red laser beam with an ID of 0.5 J/cm2 provides the optimal effects on Pistachio mould fungus eradication.

  20. Effects of Na2CO3 on properties of low fluoride content mould flux for thin slab continuous casting.

    PubMed

    Lu, Yanqing; Zhang, Guodong; Jiang, Maofa; Liu, Haixiao; Li, Ting

    2011-06-01

    To reduce fluorine pollution, partial fluoride could be replaced by Na2C03 in mould flux for continuous casting. The properties including melting temperature, viscosity fluidity, surface tension and A1203 inclusion adsorption of low fluoride content mould flux with addition of Na2C03 for thin slab casting were studied. The results showed that with the increase in Na2C03 content, melting temperature, viscosity and viscous activation energy of mould flux decreased obviously, fluidity increased, surface tension changed little, and A1203 inclusion adsorption of mould flux increased. The Na2C03 could play effective role when its content was less than 9%. The results would play a guiding role in designing of low fluoride content mould flux for thin slab continuous casting. PMID:25084585

  1. Effects of Na2CO3 on properties of low fluoride content mould flux for thin slab continuous casting.

    PubMed

    Lu, Yanqing; Zhang, Guodong; Jiang, Maofa; Liu, Haixiao; Li, Ting

    2011-06-01

    To reduce fluorine pollution, partial fluoride could be replaced by Na2C03 in mould flux for continuous casting. The properties including melting temperature, viscosity fluidity, surface tension and A1203 inclusion adsorption of low fluoride content mould flux with addition of Na2C03 for thin slab casting were studied. The results showed that with the increase in Na2C03 content, melting temperature, viscosity and viscous activation energy of mould flux decreased obviously, fluidity increased, surface tension changed little, and A1203 inclusion adsorption of mould flux increased. The Na2C03 could play effective role when its content was less than 9%. The results would play a guiding role in designing of low fluoride content mould flux for thin slab continuous casting.

  2. SU-E-T-04: 3D Printed Patient-Specific Surface Mould Applicators for Brachytherapy Treatment of Superficial Lesions

    SciTech Connect

    Cumming, I; Lasso, A; Rankin, A; Fichtinger, G; Joshi, C P; Falkson, C; Schreiner, L John

    2014-06-01

    Purpose: Evaluate the feasibility of constructing 3D-printed patient-specific surface mould applicators for HDR brachytherapy treatment of superficial lesions. Methods: We propose using computer-aided design software to create 3D printed surface mould applicators for brachytherapy. A mould generation module was developed in the open-source 3D Slicer ( http://www.slicer.org ) medical image analysis platform. The system extracts the skin surface from CT images, and generates smooth catheter paths over the region of interest based on user-defined start and end points at a specified stand-off distance from the skin surface. The catheter paths are radially extended to create catheter channels that are sufficiently wide to ensure smooth insertion of catheters for a safe source travel. An outer mould surface is generated to encompass the channels. The mould is also equipped with fiducial markers to ensure its reproducible placement. A surface mould applicator with eight parallel catheter channels of 4mm diameters was fabricated for the nose region of a head phantom; flexible plastic catheters of 2mm diameter were threaded through these channels maintaining 10mm catheter separations and a 5mm stand-off distance from the skin surface. The apparatus yielded 3mm thickness of mould material between channels and the skin. The mould design was exported as a stereolithography file to a Dimension SST1200es 3D printer and printed using ABS Plus plastic material. Results: The applicator closely matched its design and was found to be sufficiently rigid without deformation during repeated application on the head phantom. Catheters were easily threaded into channels carved along catheter paths. Further tests are required to evaluate feasibility of channel diameters smaller than 4mm. Conclusion: Construction of 3D-printed mould applicators show promise for use in patient specific brachytherapy of superficial lesions. Further evaluation of 3D printing techniques and materials is required

  3. Injectable contraception.

    PubMed

    Kaunitz, A M

    1989-06-01

    The most effective, convenient, reversible method of birth control is considered to be long-acting progestogen injections. Used by over 90 countries, Depot medroxy-progesterone acetate (DMPA, Depo-Provera, Upjohn) has yet to be approved by the U.S. Food and Drug Administration. The reluctance of the FDA to approve DMPA and much of the controversy surrounding this method revolve around the results of testing done on animals who were given large doses of the progestogen over a long period of time and developed tumors. However, the large body of research and records on this method that have been compiled over the past 30 years is positive. The injectable method works like oral contraceptives, inhibiting ovulation. Changes in menstruation have been the chief complaint of women who use this method; however, the duration and frequency of spotting and bleeding diminish over time. Other side effects of DMPA and Norethindrone enanthate (NET EN, Noristerat, Schering) are discussed. Also discussed is the history of development and testing for the 2 methods and subdermal implants, specifically Norplant.

  4. Mold, Mould, Mole-d: The Three M's of Career Development

    ERIC Educational Resources Information Center

    Amundson, Norman E.

    2008-01-01

    The author explores a creative idea development process wherein one begins by applying the image of "breaking the mold" to career development and then extending the process further by considering other related images. In this article, the related images include synonyms for mold such as mould and mole-d (the mole is a small burrowing animal with…

  5. Characterisation and detection of spoilage mould responsible for black spot in dry-cured fermented sausages.

    PubMed

    Lozano-Ojalvo, Daniel; Rodríguez, Alicia; Cordero, Mirian; Bernáldez, Victoria; Reyes-Prieto, Mariana; Córdoba, Juan J

    2015-02-01

    Moulds responsible for black spot spoilage of dry-cured fermented sausages were characterised. For this purpose, samples were taken from those dry-cured fermented sausages which showed black spot alteration. Most of the mould strains were first tentatively identified as Penicillium spp. due to their morphological characteristics in different culture conditions, with one strain as Cladosporium sp. The Cladosporium strain was the only one which provoked blackening in culture media. This strain was further characterised by sequencing of ITS1-5.8S-ITS2 rRNA and β-tubulin genes. This mould strain was able to reproduce black spot formation in dry-cured fermented sausage 'salchichón' throughout the ripening process. In addition, a specific and sensitive real-time PCR method was also developed to detect Cladosporium oxysporum responsible for the black spot formation in sausages. This method could be of great interest for the meat industry to detect samples contaminated with this mould before spoilage of product avoiding economic losses for this sector.

  6. Association between Maternal Pelvis Height and Intrapartum Foetal Head Moulding in Ugandan Mothers with Spontaneous Vertex Deliveries

    PubMed Central

    Luboga, Samuel Abilemech; Luboobi, Livingstone; Mirembe, Florence

    2016-01-01

    Introduction. In Sub-Saharan Africa, excessive foetal head moulding is commonly associated with cephalopelvic disproportion and obstructed labour. This study set out to determine the associations of maternal pelvis height and maternal height with intrapartum foetal head moulding. Methods. This was a multisite secondary analysis of maternal birth records of mothers with singleton pregnancies ending in a spontaneous vertex delivery. A summary of the details of the pregnancy and delivery records were reviewed and analysed using multilevel logistic regression respect to foetal head moulding. The alpha level was set at P < 0.05. Results. 412 records were obtained, of which 108/385 (28%) observed foetal head moulding. There was a significant reduction in risk of foetal head moulding with increasing maternal height (Adj. IRR 0.97, P = 0.05), maternal pelvis height (Adj. IRR 0.88, P < 0.01), and raptured membranes (Adj. IRR 0.10, P < 0.01). There was a significant increased risk of foetal head moulding with increasing birth weight (Adj. IRR 1.90, P < 0.01) and duration of monitored active labour (Adj. IRR 1.21, P < 0.01) in the final model. Conclusion. This study showed that increasing maternal height and maternal pelvis height were associated with a significant reduction in intrapartum foetal head moulding. PMID:27034678

  7. Shear Strength of Remoulding Clay Samples Using Different Methods of Moulding

    NASA Astrophysics Data System (ADS)

    Norhaliza, W.; Ismail, B.; Azhar, A. T. S.; Nurul, N. J.

    2016-07-01

    Shear strength for clay soil was required to determine the soil stability. Clay was known as a soil with complex natural formations and very difficult to obtain undisturbed samples at the site. The aim of this paper was to determine the unconfined shear strength of remoulded clay on different methods in moulding samples which were proctor compaction, hand operated soil compacter and miniature mould methods. All the samples were remoulded with the same optimum moisture content (OMC) and density that were 18% and 1880 kg/m3 respectively. The unconfined shear strength results of remoulding clay soils for proctor compaction method was 289.56kPa with the strain 4.8%, hand operated method was 261.66kPa with the strain 4.4% and miniature mould method was 247.52kPa with the strain 3.9%. Based on the proctor compaction method, the reduction percentage of unconfined shear strength of remoulded clay soil of hand operated method was 9.66%, and for miniature mould method was 14.52%. Thus, because there was no significant difference of reduction percentage of unconfined shear strength between three different methods, so it can be concluded that remoulding clay by hand operated method and miniature mould method were accepted and suggested to perform remoulding clay samples by other future researcher. However for comparison, the hand operated method was more suitable to form remoulded clay sample in term of easiness, saving time and less energy for unconfined shear strength determination purposes.

  8. Evolving Transport Networks With Cellular Automata Models Inspired by Slime Mould.

    PubMed

    Tsompanas, Michail-Antisthenis I; Sirakoulis, Georgios Ch; Adamatzky, Andrew I

    2015-09-01

    Man-made transport networks and their design are closely related to the shortest path problem and considered amongst the most debated problems of computational intelligence. Apart from using conventional or bio-inspired computer algorithms, many researchers tried to solve this kind of problem using biological computing substrates, gas-discharge solvers, prototypes of a mobile droplet, and hot ice computers. In this aspect, another example of biological computer is the plasmodium of acellular slime mould Physarum polycephalum (P. polycephalum), which is a large single cell visible by an unaided eye and has been proven as a reliable living substrate for implementing biological computing devices for computational geometry, graph-theoretical problems, and optimization and imitation of transport networks. Although P. polycephalum is easy to experiment with, computing devices built with the living slime mould are extremely slow; it takes slime mould days to execute a computation. Consequently, mapping key computing mechanisms of the slime mould onto silicon would allow us to produce efficient bio-inspired computing devices to tackle with hard to solve computational intelligence problems like the aforementioned. Toward this direction, a cellular automaton (CA)-based, Physarum-inspired, network designing model is proposed. This novel CA-based model is inspired by the propagating strategy, the formation of tubular networks, and the computing abilities of the plasmodium of P. polycephalum. The results delivered by the CA model demonstrate a good match with several previously published results of experimental laboratory studies on imitation of man-made transport networks with P. polycephalum. Consequently, the proposed CA model can be used as a virtual, easy-to-access, and biomimicking laboratory emulator that will economize large time periods needed for biological experiments while producing networks almost identical to the tubular networks of the real-slime mould.

  9. Epidural Steroid Injections

    MedlinePlus

    ... Assessment Tools Injection Treatments for Spinal Pain Epidural Steroid Injections Lumbar Zygapophysial (Facet) Joint Injections Surgical Options Nonsurgical Treatments Alternative Medicine Epidural Steroid Injections General Information Why Get an Epidural Steroid ...

  10. Fibre laser machining for glassy carbon master mould and soft lithography based two-step printing for Ag nanoparticle structures

    NASA Astrophysics Data System (ADS)

    Hu, Qin; Chopra, Pranav

    2011-04-01

    Traditional manufacturing techniques widely used in semiconductor industries involve many processing steps that consume both time and material and lead to high cost. Soft Lithography (SL) offers a new way to print micro/nano structures, which is a fast and low cost alternative to the conventional route, although the high processing temperature of metals, semiconductors and ceramics limits the application SL techniques. In this paper we report the use of Ag nanoparticles as building blocks to make structures by combing the merits of SL, nanotechnology and laser engineering, which provide a simple additive route with low capital investment. Glassy carbon (GC) was chosen as the material for the rigid master mould, as no release coating is needed for replicating the polydimethylsiloxane (PDMS) mould. GC moulds were machined by a nanosecond-pulsed Yb fibre laser. The machined GC moulds were further cleaned by PDMS and the same fibre laser system to remove the process debris. The master mould was further replicated by PDMS. PDMS replicas with either positive or negative features from the master mould were attainable. A two-step strategy was used to print patterns using PDMS mould and Ag nanoparticle paste. Metal patterns were formed on various substrates, and the PDMS mould was left clean and ready for reuse. The resultant printed patterns were found to be uniform over millimetre range, with negligible residual layer, and the thickness of up to several micrometres. The thermal responses of Ag nanoparticles at various sintering temperatures were investigated. The factors affecting the resolution of printed structures were discussed.

  11. The Fabrication of PDMS mould for Microelectrode Array Biochip using NIL

    NASA Astrophysics Data System (ADS)

    Beh, Khi Khim; Samsuri, Fahmi; Lee, Tze Pin; Mohamed, Khairudin

    2016-02-01

    In recent years, low-cost micro and nano fabrication process have gain intention from the manufacturing industry. Biochip is a platform of miniaturized microarrays arranged on a solid substrate that allows various biological tests to achieve immediate results. The development of biochip has established a new platform in biomedical industry. However, to fulfill the demands and availability in the market with affordable cost requires high volume manufacturing techniques for the fabrication of the biochips. In this article we will discuss the fabrication of PDMS mould for replicating microelectrode array of biochip. The fabrication of the microelectrodes utilizes the Nanoimprint lithography (NIL) technique. Finally, the fabrication of PDMS mould has been demonstrated successfully for using Nanoimprint lithography (NIL) technique and achieved 13% of size difference in overall.

  12. Melt state behaviour of PEEK and processing window interpretation for fast compression moulding process

    NASA Astrophysics Data System (ADS)

    Bessard, Emeline; De Almeida, Olivier; Bernhart, Gérard

    2011-01-01

    Fast mould heating is nowadays possible by using induction technology for example with the Cage System® developed by RocTool. It allows heating and cooling kinetics of about 100° C per minute and new perspectives are thus possible to optimize the compression moulding process of long fibre reinforced thermoplastic composites. Indeed, a high forming temperature may favour polymer creep and so on composite consolidation. Nevertheless, the processing time of PEEK composite above melt temperature must be reduced to a few minutes due to the fast thermal degradation of the matrix. On the other hand, high cooling rates may have negative effect on matrix crystallinity. The proposed procedure consist in performing a few minutes isotherm around 300° C during the fast cooling. It would favour a high degree of crystallinity of PEEK without extending the cycle time.

  13. Melt state behaviour of PEEK and processing window interpretation for fast compression moulding process

    SciTech Connect

    Bessard, Emeline; De Almeida, Olivier; Bernhart, Gerard

    2011-01-17

    Fast mould heating is nowadays possible by using induction technology for example with the Cage System registered developed by RocTool. It allows heating and cooling kinetics of about 100 deg. C per minute and new perspectives are thus possible to optimize the compression moulding process of long fibre reinforced thermoplastic composites. Indeed, a high forming temperature may favour polymer creep and so on composite consolidation. Nevertheless, the processing time of PEEK composite above melt temperature must be reduced to a few minutes due to the fast thermal degradation of the matrix. On the other hand, high cooling rates may have negative effect on matrix crystallinity. The proposed procedure consist in performing a few minutes isotherm around 300 deg. C during the fast cooling. It would favour a high degree of crystallinity of PEEK without extending the cycle time.

  14. Simulation on the Effect of Bottle Wall Thickness Distribution using Blow Moulding Technique

    NASA Astrophysics Data System (ADS)

    Suraya, S.; Azman, M. D.; Fatchurrohman, N.; Jaafar, A. A.; Yusoff, A. R.

    2016-02-01

    The aims of this study are to assess the deformation behavior of a polymeric material during a blow moulding process. Transient computations of two dimensional model of a PP bottle were performed using ANSYS Polyflow computer code to predict the wall thickness distribution at four different parison's diameter; 8mm, 10mm, 18mm, and 20mm. Effects on the final wall thickness diameter and time step are studied. The simulated data shows that the inflation performance degrades with increasing parison diameter. It is concluded that the blow moulding process using 10mm parison successfully meet the product processing requirements. Factors that contribute to the variation in deformation behaviour of the plastic during the manufacturing process are discussed.

  15. Gel-cast glass-ceramic tissue scaffolds of controlled architecture produced via stereolithography of moulds.

    PubMed

    Chopra, K; Mummery, P M; Derby, B; Gough, J E

    2012-12-01

    Two glass-ceramic scaffolds with a simple cubic structure of 500 µm square ligaments and square channels of width 400 or 600 µm have been fabricated by gel-casting into moulds produced by stereolithography, followed by mould removal, polymer burnout and sintering. The scaffolds have crushing strengths of 41 ± 14 and 17 ± 5 Mpa, respectively. Using a method of assembling discrete slices of scaffold, we are able to study cell behaviour within a scaffold by disassembly. Both scaffold structures were seeded with primary human osteoblasts and these penetrate, adhere, spread and proliferate on the scaffold structure. The larger channel diameter scaffold shows a greater cell population (despite its smaller surface area) and more pronounced production of ECM components (collagen and mineralization) with increased time in culture. Studies of sectioned scaffolds show that cell density and ECM production decrease with depth and that the difference between the two scaffold architectures is maintained.

  16. [Allergic alveolitis following inhalation of mould spores from pot plant earth (author's transl)].

    PubMed

    Velcovsky, H G; Graubner, M

    1981-01-23

    Acute exogenous allergic alveolitis with the typical symptoms of unproductive cough, dyspnoea on exertion, fever, loss of weight, headache and limb pains was observed in a 24-year-old bank employee. Leucocytosis was accompanied by raised ESR; pronounced hypoxaemia and marked restrictive ventilatory defects were found. X-ray changes consisted of severely increased fine reticular interstitial shadowing. The differential diagnosis of allergic alveolitis was confirmed by the demonstration of precipitating antibodies in serum against Pullularia pullulans, Trichoderma viride, Cephalosporium acremonium and Aspergillus fumigatus, moulds with an ubiquitous occurrence. Typical changes of alveolitis were found histopathologically and immunohistologically in the lung tissue after a mini-thoracotomy. The source of exposition leading to the disease were pot plant earth and containers in the patient's flat. Moulds could be isolated from these substrates.

  17. Analysis of computer-aided techniques for virtual planning in nasoalveolar moulding.

    PubMed

    Loeffelbein, D J; Ritschl, L M; Rau, A; Wolff, K-D; Barbarino, M; Pfeifer, S; Schönberger, M; Wintermantel, E

    2015-05-01

    We compared two methods of planning virtual alveolar moulding as the first step in nasoalveolar moulding to provide the basis for an automated process to fabricate nasoalveolar moulding appliances by using computer-assisted design and computer-aided manufacturing (CAD/CAM). First, the initial intraoral casts taken from seven newborn babies with complete unilateral cleft lip and palate were digitised. This was repeated for the target models after conventional nasoalveolar moulding had been completed. The initial digital model for each patient was then virtually modified by two different modelling techniques to achieve the corresponding target model: parametric and freeform modelling with the software Geomagic(®). The digitally-remodelled casts were quantitatively compared with the actual target model for each patient, and the comparison between the two modified models and the target model showed that freeform modelling of the initial cast was successful (mean (SD) deviation n=7, +0.723 (0.148) to -0.694 (0.157)mm) but needed continuous orientation and was difficult to automate. The results from the parametric modelling (mean (SD) deviation, n=7, +1.168 (0.185) to -1.067 (0.221)mm) were not as good as those from freeform modelling. During parametric modelling, we found some irregularities on the surface, and transverse growth of the maxilla was not accounted for. However, this method seems to be the right one as far as automation is concerned. In addition, an external algorithm must be implemented because the function of the commercial software is limited.

  18. Conditions that regulate the growth of moulds inoculated into bottled mineral water.

    PubMed

    Criado, Maria Victoria; Fernández Pinto, Virginia E; Badessari, Alicia; Cabral, Daniel

    2005-04-01

    The influence of different storage conditions (temperature, illumination, brand of mineral water and storage time) on growth of mould spores was studied. Alternaria alternata, Penicillium citrinum and Cladosporium cladosporioides spores were inoculated in bottles of mineral and mineralised water, packaged in polyethylene terephtalate (PET). The bottles were incubated under different storage conditions. The strains had been isolated from bottled mineral water in a previous study. Storage time was the parameter that had the most important influence in mould growth. The spores grew into visible colonies after 5 month of incubation in bottles just filled, and in a month in bottles that had been stored for 5 month. This could be due to the migration of compounds from PET packaging material into mineral water. This compounds could be used as nutrients (organic matter) for mould growth. The plasticizer additive di-n-butyl phthalate (DBP) concentration in recently bottled mineral water and in 5-month stored bottles was measured. An increase of 20% of DBP concentration was observed. A. alternata and P. citrinum strains were toxicological characterised. Both strains produced mycotoxins in vitro, and P. citrinum produced citrinin in mineral water, posing a potential health risk for consumers.

  19. Foundry waste recycling in moulding operations and in the ceramic industry.

    PubMed

    Zanetti, Maria Chiara; Fiore, Silvia

    2003-06-01

    An industrial treatment was performed by the Sasil plant of Brusnengo (Biella, Northern Italy), which is part of the Gruppo Minerali S.p.A. (Novara, Northern Italy), to consider the reclamation of bentonite bonded moulding sands obtained from the Teksid Italia S.p.A. cast iron foundry plant in Crescentino (Vercelli, Northern Italy). An evaluation of the fine particles produced by the wet-mechanical regeneration treatment was made with the purpose of proposing their recycling as binding agents in moulding operations in the cast iron foundry and for the production of tiles in the ceramic industry. The pre-mixed product sold by bentonite suppliers (35% coal dust and 65% bentonite, 0.15 Euro/kg) could be made from the recovered fine fraction below 0.025 mm with the addition of active clay and coal dust, thus obtaining a product that will have physico-chemical properties similar to those of calcic bentonite. The improvements due to the addition of the fine particles to the usually employed clay for tile production were also underlined from the results of several baking tests. The recovery and recycling of sands and fine particles obtained from the reclamation of bentonite moulding sands will lead to a saving of raw materials and landfill space, with economic and environmental advantages.

  20. Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet

    NASA Astrophysics Data System (ADS)

    Hoskins, Jessica L.; Janion-Scheepers, Charlene; Chown, Steven L.; Duffy, Grant A.

    2015-07-01

    Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the ‘suctorial’ mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods.

  1. Brainless but Multi-Headed: Decision Making by the Acellular Slime Mould Physarum polycephalum.

    PubMed

    Beekman, Madeleine; Latty, Tanya

    2015-11-20

    Because of its peculiar biology and the ease with which it can be cultured, the acellular slime mould Physarum polycephalum has long been a model organism in a range of disciplines. Due to its macroscopic, syncytial nature, it is no surprise that it has been a favourite amongst cell biologists. Its inclusion in the experimental tool kit of behavioural ecologists is much more recent. These recent studies have certainly paid off. They have shown that, for an organism that lacks a brain or central nervous system, P. polycephalum shows rather complex behaviour. For example, it is capable of finding the shortest path through a maze, it can construct networks as efficient as those designed by humans, it can solve computationally difficult puzzles, it makes multi-objective foraging decisions, it balances its nutrient intake and it even behaves irrationally. Are the slime mould's achievements simply "cute", worthy of mentioning in passing but nothing to take too seriously? Or do they hint at the fundamental processes underlying all decision making? We will address this question after reviewing the decision-making abilities of the slime mould.

  2. Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet.

    PubMed

    Hoskins, Jessica L; Janion-Scheepers, Charlene; Chown, Steven L; Duffy, Grant A

    2015-07-08

    Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the 'suctorial' mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods.

  3. Identification and control of moulds responsible for black spot spoilage in dry-cured ham.

    PubMed

    Alía, Alberto; Andrade, María J; Rodríguez, Alicia; Reyes-Prieto, Mariana; Bernáldez, Victoria; Córdoba, Juan J

    2016-12-01

    The aims of this work were to identify moulds responsible for black spot spoilage in the drying and cellar stages of dry-cured ham processing and evaluate the effectiveness of preventive actions for controlling this alteration. Four mould strains isolated from spoiled hams were identified by morphological characteristics and the ITS and β-tubulin sequencing. Two of them were Cladosporium oxysporum, one was C. cladosporioides and the remaining one was C. herbarum. These spoiling strains reproduced the black spots on dry-cured ham-based media and ham slices. Additionally, the effect of water activity (aw) conditions reached throughout dry-cured ham ripening and the activity of the protective culture Penicillium chrysogenum CECT 20922 against the spoiling moulds were evaluated. In the dry-cured ham model system the growth of the Cladosporium strains was minimised when the aw approaches 0.84 or in P. chrysogenum CECT 20922 inoculated dry-cured ham slices. Therefore such combination could be used to avoid the black spot formation in dry-cured ham.

  4. Conditions that regulate the growth of moulds inoculated into bottled mineral water.

    PubMed

    Criado, Maria Victoria; Fernández Pinto, Virginia E; Badessari, Alicia; Cabral, Daniel

    2005-04-01

    The influence of different storage conditions (temperature, illumination, brand of mineral water and storage time) on growth of mould spores was studied. Alternaria alternata, Penicillium citrinum and Cladosporium cladosporioides spores were inoculated in bottles of mineral and mineralised water, packaged in polyethylene terephtalate (PET). The bottles were incubated under different storage conditions. The strains had been isolated from bottled mineral water in a previous study. Storage time was the parameter that had the most important influence in mould growth. The spores grew into visible colonies after 5 month of incubation in bottles just filled, and in a month in bottles that had been stored for 5 month. This could be due to the migration of compounds from PET packaging material into mineral water. This compounds could be used as nutrients (organic matter) for mould growth. The plasticizer additive di-n-butyl phthalate (DBP) concentration in recently bottled mineral water and in 5-month stored bottles was measured. An increase of 20% of DBP concentration was observed. A. alternata and P. citrinum strains were toxicological characterised. Both strains produced mycotoxins in vitro, and P. citrinum produced citrinin in mineral water, posing a potential health risk for consumers. PMID:15808368

  5. Identification and control of moulds responsible for black spot spoilage in dry-cured ham.

    PubMed

    Alía, Alberto; Andrade, María J; Rodríguez, Alicia; Reyes-Prieto, Mariana; Bernáldez, Victoria; Córdoba, Juan J

    2016-12-01

    The aims of this work were to identify moulds responsible for black spot spoilage in the drying and cellar stages of dry-cured ham processing and evaluate the effectiveness of preventive actions for controlling this alteration. Four mould strains isolated from spoiled hams were identified by morphological characteristics and the ITS and β-tubulin sequencing. Two of them were Cladosporium oxysporum, one was C. cladosporioides and the remaining one was C. herbarum. These spoiling strains reproduced the black spots on dry-cured ham-based media and ham slices. Additionally, the effect of water activity (aw) conditions reached throughout dry-cured ham ripening and the activity of the protective culture Penicillium chrysogenum CECT 20922 against the spoiling moulds were evaluated. In the dry-cured ham model system the growth of the Cladosporium strains was minimised when the aw approaches 0.84 or in P. chrysogenum CECT 20922 inoculated dry-cured ham slices. Therefore such combination could be used to avoid the black spot formation in dry-cured ham. PMID:27468139

  6. Brainless but Multi-Headed: Decision Making by the Acellular Slime Mould Physarum polycephalum.

    PubMed

    Beekman, Madeleine; Latty, Tanya

    2015-11-20

    Because of its peculiar biology and the ease with which it can be cultured, the acellular slime mould Physarum polycephalum has long been a model organism in a range of disciplines. Due to its macroscopic, syncytial nature, it is no surprise that it has been a favourite amongst cell biologists. Its inclusion in the experimental tool kit of behavioural ecologists is much more recent. These recent studies have certainly paid off. They have shown that, for an organism that lacks a brain or central nervous system, P. polycephalum shows rather complex behaviour. For example, it is capable of finding the shortest path through a maze, it can construct networks as efficient as those designed by humans, it can solve computationally difficult puzzles, it makes multi-objective foraging decisions, it balances its nutrient intake and it even behaves irrationally. Are the slime mould's achievements simply "cute", worthy of mentioning in passing but nothing to take too seriously? Or do they hint at the fundamental processes underlying all decision making? We will address this question after reviewing the decision-making abilities of the slime mould. PMID:26189159

  7. Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet.

    PubMed

    Hoskins, Jessica L; Janion-Scheepers, Charlene; Chown, Steven L; Duffy, Grant A

    2015-01-01

    Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the 'suctorial' mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods. PMID:26153104

  8. Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet

    PubMed Central

    Hoskins, Jessica L.; Janion-Scheepers, Charlene; Chown, Steven L.; Duffy, Grant A.

    2015-01-01

    Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the ‘suctorial’ mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods. PMID:26153104

  9. Foundry waste recycling in moulding operations and in the ceramic industry.

    PubMed

    Zanetti, Maria Chiara; Fiore, Silvia

    2003-06-01

    An industrial treatment was performed by the Sasil plant of Brusnengo (Biella, Northern Italy), which is part of the Gruppo Minerali S.p.A. (Novara, Northern Italy), to consider the reclamation of bentonite bonded moulding sands obtained from the Teksid Italia S.p.A. cast iron foundry plant in Crescentino (Vercelli, Northern Italy). An evaluation of the fine particles produced by the wet-mechanical regeneration treatment was made with the purpose of proposing their recycling as binding agents in moulding operations in the cast iron foundry and for the production of tiles in the ceramic industry. The pre-mixed product sold by bentonite suppliers (35% coal dust and 65% bentonite, 0.15 Euro/kg) could be made from the recovered fine fraction below 0.025 mm with the addition of active clay and coal dust, thus obtaining a product that will have physico-chemical properties similar to those of calcic bentonite. The improvements due to the addition of the fine particles to the usually employed clay for tile production were also underlined from the results of several baking tests. The recovery and recycling of sands and fine particles obtained from the reclamation of bentonite moulding sands will lead to a saving of raw materials and landfill space, with economic and environmental advantages. PMID:12870643

  10. Differential Control Efficacies of Vitamin Treatments against Bacterial Wilt and Grey Mould Diseases in Tomato Plants

    PubMed Central

    Hong, Jeum Kyu; Kim, Hyeon Ji; Jung, Heesoo; Yang, Hye Ji; Kim, Do Hoon; Sung, Chang Hyun; Park, Chang-Jin; Chang, Seog Won

    2016-01-01

    Bacterial wilt and grey mould in tomato plants are economically destructive bacterial and fungal diseases caused by Ralstonia solanacearum and Botrytis cinerea, respectively. Various approaches including chemical and biological controls have been attempted to arrest the tomato diseases so far. In this study, in vitro growths of bacterial R. solanacearum and fungal B. cinerea were evaluated using four different vitamins including thiamine (vitamin B1), niacin (vitamin B3), pyridoxine (vitamin B6), and menadione (vitamin K3). In planta efficacies of the four vitamin treatments on tomato protection against both diseases were also demonstrated. All four vitamins showed different in vitro antibacterial activities against R. solanacearum in dose-dependent manners. However, treatment with 2 mM thiamine was only effective in reducing bacterial wilt of detached tomato leaves without phytotoxicity under lower disease pressure (106 colony-forming unit [cfu]/ml). Treatment with the vitamins also differentially reduced in vitro conidial germination and mycelial growth of B. cinerea. The four vitamins slightly reduced the conidial germination, and thiamine, pyridoxine and menadione inhibited the mycelial growth of B. cinerea. Menadione began to drastically suppress the conidial germination and mycelial growth by 5 and 0.5 mM, respectively. Grey mould symptoms on the inoculated tomato leaves were significantly reduced by pyridoxine and menadione pretreatments one day prior to the fungal challenge inoculation. These findings suggest that disease-specific vitamin treatment will be integrated for eco-friendly management of tomato bacterial wilt and grey mould. PMID:27721697

  11. The radiation crosslinking of moulded plastic parts of different shape and size

    NASA Astrophysics Data System (ADS)

    Wiesner, L.

    The crosslinking of moulded plastic parts extends the range of application of thermoplastic polymers by the improvement of their thermal and chemical stability. Radiation processing is unique for many of these products because the application of other crosslinking methods is not possible or has at least large drawbacks. Some technical aspects of the radiation treatment of moulded plastic parts on a production scale are discussed. Accelerators, supplying electron beams with energies above 2 MeV, are generally the preferred radiation source in this field. The temperature rise within the irradiated product has to be taken into account when higher doses must be applied. Examples of areas of application are given in which the improvement of the thermal stability and the resistance against stress corrosion of moulded plastic parts by radiation crosslinking are of importance. The reduction of the premeation rate through polymers resulting from crosslinking, is of interest for the gas tanks of passenger cars. The production of plastic parts with different properties in fractions of one single item by using shielding masks opens the designer new possibilities. In the case of elastomers a radiation treatment can supplement the heat vulcanization process and improve the uniformity of the product quality.

  12. Hip joint injection

    MedlinePlus

    ... injected so the provider can see where to place the medicine. The steroid medicine is slowly injected into the joint. After the injection, you will remain on the table for another 5 to 10 minutes or so. ...

  13. Inhibition of ochratoxigenic moulds by Debaryomyces hansenii strains for biopreservation of dry-cured meat products.

    PubMed

    Andrade, Maria J; Thorsen, Line; Rodríguez, Alicia; Córdoba, Juan J; Jespersen, Lene

    2014-01-17

    The ability of the osmotolerant yeast Debaryomyces hansenii to inhibit Penicillium nordicum, the most common ochratoxigenic mould encountered in dry-cured meat products, was evaluated. The antagonistic effect of ten D. hansenii strains isolated from dry-cured ham was screened in vitro using malt extract media and meat extract peptone media with the water activity (a(w)) adjusted to 0.97 and 0.90. A significant inhibition of the two tested P. nordicum strains by D. hansenii cells and cell-free supernatants was observed. At 0.97 a(w), increasing D. hansenii inoculum concentrations significantly improved the inhibition of mould growth on solid medium, whereas at 0.90 a(w) this was not always the case. As observed by bright field microscopy, most D. hansenii strains were able to delay P. nordicum spore germination when co-cultured in malt extract broth. D. hansenii FHSCC 253H showed the highest overall in vitro inhibition of ochratoxigenic mould growth, and was therefore chosen for co-cultivation assays in dry-cured ham slices incubated at 0.94 and 0.84 a(w) simulating ham ripening. Regardless of the experimental conditions tested, lower levels of the inoculated P. nordicum strain were detected in co-cultivation batches compared with batches without D. hansenii. The highest level of mould growth inhibition was observed in batches at 0.94 a(w). Ochratoxin A (OTA) production in ham samples was detected by HPLC-MS. Co-culturing of P. nordicum with D. hansenii FHSCC 253H resulted in lower OTA levels compared with control samples without D. hansenii. The decrease of the mycotoxin presence due to D. hansenii FHSCC 253H was more efficient at 0.94 a(w) (OTA was below the detection limit). In conclusion, D. hansenii is potentially suitable as a biopreservative agent for preventing ochratoxigenic mould growth and OTA accumulation in dry-cured meat products. The inoculation of D. hansenii should be made at the beginning of processing (at the end of post salting) when the a(w) of

  14. FE-Analysis of Stretch-Blow Moulded Bottles Using an Integrative Process Simulation

    NASA Astrophysics Data System (ADS)

    Hopmann, C.; Michaeli, W.; Rasche, S.

    2011-05-01

    The two-stage stretch-blow moulding process has been established for the large scale production of high quality PET containers with excellent mechanical and optical properties. The total production costs of a bottle are significantly caused by the material costs. Due to this dominant share of the bottle material, the PET industry is interested in reducing the total production costs by an optimised material efficiency. However, a reduced material inventory means decreasing wall thicknesses and therewith a reduction of the bottle properties (e.g. mechanical properties, barrier properties). Therefore, there is often a trade-off between a minimal bottle weight and adequate properties of the bottle. In order to achieve the objectives Computer Aided Engineering (CAE) techniques can assist the designer of new stretch-blow moulded containers. Hence, tools such as the process simulation and the structural analysis have become important in the blow moulding sector. The Institute of Plastics Processing (IKV) at RWTH Aachen University, Germany, has developed an integrative three-dimensional process simulation which models the complete path of a preform through a stretch-blow moulding machine. At first, the reheating of the preform is calculated by a thermal simulation. Afterwards, the inflation of the preform to a bottle is calculated by finite element analysis (FEA). The results of this step are e.g. the local wall thickness distribution and the local biaxial stretch ratios. Not only the material distribution but also the material properties that result from the deformation history of the polymer have significant influence on the bottle properties. Therefore, a correlation between the material properties and stretch ratios is considered in an integrative simulation approach developed at IKV. The results of the process simulation (wall thickness, stretch ratios) are transferred to a further simulation program and mapped on the bottles FE mesh. This approach allows a local

  15. Low temperature induced defence gene expression in winter wheat in relation to resistance to snow moulds and other wheat diseases.

    PubMed

    Gaudet, D A; Wang, Y; Frick, M; Puchalski, B; Penniket, C; Ouellet, T; Robert, L; Singh, J; Laroche, A

    2011-01-01

    Cold hardening of winter wheat at 2 °C for 1-6 wks increased resistance to the snow mould pathogens LTB, Typhula incarnata, and Microdochium nivale as well as to powdery mildew (Blumaria graminis f. sp. graminis) and stripe rust (Puccinia striiformis). Using microarrays and hardening of winter wheat for 0.25, 0.5, 1, 7, 21 and 49 d, an upregulation of a wide range of stress-response genes that include defence-related and abiotic stress-related genes, transcription factors including several lipoxygenases and ethylene responsive factors, and WRKY genes was observed. For the majority of these genes, the upregulation occurred later in the 21-49 d hardening treatments and coincided with the highest expression levels of snow mould resistance. Defence-related sequences were upregulated to a greater extent and were more numerous in the snow mould resistant line CI14106 compared to cold hardy DH+268. Transcript profiling of candidate defence and other stress-related genes under prolonged conditions at -3 °C with or without snow mould infection showed that there was a decline in transcripts of the defence-related genes PR1.1b and NPR3 during the 12wks incubation. Additionally, 14 d hardening was insufficient to permit full expression of the jasmonic acid synthesis gene, allene oxide synthase (AOS) and the fructan degrading enzyme β-fructofuranosidase compared the 42 d hardening treatment. The snow mould resistant line CI14106 was able to maintain higher transcript levels of AOS for longer conditions compared to the susceptible line Norstar under artificial snow mould conditions. These results explain the nature of cold-induced resistance to snow moulds and provide direction on establishing selection criteria for improving resistance and cold tolerance in winter wheat.

  16. New species of Simona Moulds, 2012 and Chelapsalta Moulds, 2012 cicadas (Cicadidae: Cicadettinae: Cicadettini) from Australia: comparative morphology, songs, behaviour and distributions.

    PubMed

    Ewart, A; Popple, L W; Marshall, D C

    2015-01-01

    In 2012, Moulds established the morphologically similar cicada genera Simona and Chelapsalta, each with one Australian species (sancta Distant and puer Walker, respectively). In this paper, two new species are described within the genus Simona Moulds 2012, S. erema sp. nov. and S. retracta sp. nov., and one within the genus Chelapsalta Moulds 2012, C. myoporae sp. nov. The type species of Simona (female holotype), S. sancta (Distant, 1913), is redescribed based on a contemporary male, nominated a plesiotype, held in the Australian National Insect Collection. Melampsalta subgulosa Ashton 1914 is supported as a junior synonym of S. sancta. The species within the two genera of Simona and Chelapsalta are morphologically very similar. S. erema occurs widely through the arid regions of inland Australia, extending west from western Queensland through the Northern Territory, to central-western Western Australia, a linear distance of approximately 2200 km. S. retracta is known from a single semi-arid locality in southern inland Queensland. C. myoporae occurs widely through southeast, central and southwest Queensland, extending southwards into inland and western N.S.W. and southeastern South Australia. It tends to occur most commonly within vegetation associated with seasonal riverine floodplains, and in some areas of poorly drained and clay-rich soils. The calling songs of these three species, together with those of S. sancta and C. puer, are described. Detailed comparisons made of the songs of S. erema and C. myoporae, each from three widely separated locations, clearly exhibit structural consistency in their calling songs across their distributions. The Simona songs are complex and contain multiple elements; the species are very mobile and wary, and inhabit low dense shrubland. The songs of the two Chelapsalta species, both relatively sedentary in behaviour, in contrast consist of relatively uniform chirping and buzzing elements. It is suggested that, although the two

  17. Beam Injection into RHIC

    NASA Astrophysics Data System (ADS)

    Fischer, W.; Hahn, H.; Mackay, W. W.; Tsoupas, N.

    1997-05-01

    During the RHIC sextant test in January 1997 beam was injected into a sixth of one of the rings for the first time. We describe the injection zone and its bottlenecks, the application program to steer the beam and the injection kickers. We report on the commissioning of the injection systems and on measurements of the kickers.

  18. Aspergillus fumigatus and mesophilic moulds in air in the surrounding environment downwind of non-hazardous waste landfill sites.

    PubMed

    Schlosser, Olivier; Robert, Samuel; Debeaupuis, Catherine

    2016-05-01

    Non-hazardous waste landfilling has the potential to release biological agents into the air, notably mould spores. Some species, such as Aspergillus fumigatus, may be a cause of concern for at-risk nearby residents. However, air concentration in the surrounding environment of non-hazardous waste landfill sites is poorly documented. An extensive sampling programme was designed to investigate the relationship between culturable mesophilic moulds and A. fumigatus concentrations in air and distance downwind of non-hazardous waste landfill sites. On-site and off-site repeated measurements were performed at four landfill sites during cold and warm seasons. A high-flow air-sampler device was selected so as to allow peak concentration measurement. Linear mixed-effects models were used to explain variability in the concentrations in air over time and across sites, seasons, instantaneous meteorological conditions and discharged waste tonnage. Concentrations of mesophilic moulds and A. fumigatus at off-site upwind sampling locations were compared with concentrations at each of the downwind sampling locations. At the tipping face location, peak concentration reached 480,000CFUm(-3) for mesophilic moulds and 9300CFUm(-3) for A. fumigatus. Compared with upwind background levels, these concentrations were, on average, approximately 20 and 40 times higher respectively. A steep decline in the concentration of both mesophilic moulds and A. fumigatus was observed between the tipping face location and the downwind property boundary (reduction by 77% and 84% respectively), followed by a low decline leading to a 90% and 94% reduction in concentration at 200m from the property boundary and beyond. With the 200m and 500m downwind sampling point values added together, the 97.5th percentile of concentration was 6013CFUm(-3) and 87CFUm(-3) for mesophilic moulds and A. fumigatus, respectively. Other determining factors were the discharged waste tonnage, the season, instantaneous temperature

  19. Mycotoxin production capability of Penicillium roqueforti in strains isolated from mould-ripened traditional Turkish civil cheese.

    PubMed

    Cakmakci, Songul; Gurses, Mustafa; Hayaloglu, A Adnan; Cetin, Bulent; Sekerci, Pinar; Dagdemir, Elif

    2015-01-01

    Mould-ripened civil is a traditional cheese produced mainly in eastern Turkey. The cheese is produced with a mixture of civil and whey curd cheeses (lor). This mixture is pressed into goat skins or plastic bags and is ripened for more than three months. Naturally occurring moulds grow on the surface and inside of the cheese during ripening. In this research, 140 Penicillium roqueforti strains were isolated from 41 samples of mould-ripened civil cheese collected from Erzurum and around towns in eastern Turkey. All strains were capable of mycotoxin production and were analysed using an HPLC method. It was established that all the strains (albeit at very low levels) produced roquefortine C, penicillic acid, mycophenolic acid and patulin. The amounts of toxins were in the ranges 0.4-47.0, 0.2-43.6, 0.1-23.1 and 0.1-2.3 mg kg(-1), respectively. Patulin levels of the samples were lower than the others. The lowest level and highest total mycotoxin levels were determined as 1.2 and 70.1 mg kg(-1) respectively. The results of this preliminary study may help in the choice of secondary cultures for mould-ripened civil cheese and other mould-ripened cheeses.

  20. Comparative study of some factors affecting enumeration of moulds using dilution plate techniques.

    PubMed

    Bragulat, M R; Abarca, M L; Bruguera, M T; Cabañes, F J

    1992-11-01

    The influence of dilution plating technique, nature of diluent, culture media and incubation period on the enumeration of moulds have been studied. Three new culture media containing Auramine, Gentian Violet and Malachite Green respectively have been induced in this study. No significant differences were observed between results obtained after 3, 5 and 7 days of incubation. Significantly higher recoveries were obtained using the surface-spread method than pour plate method. Using the first technique no effect of diluent was observed, and among the different culture media studied higher counts were obtained with medium containing Auramine.

  1. Slime mould fluids and networks from an artist's point of view

    NASA Astrophysics Data System (ADS)

    Schubert, Theresa

    2015-03-01

    Slime mould is a fascinating creature. It is the largest acellular organism known on this planet and a primordial being that had no need to undergo evolution. In nature, this proves it to be a very successful creature. As a biological curiosity, the species P. polycephalum serves as a model for network optimisation and cell motility in scientific experiments. It can be interpreted as an "agent" which distributively solves geometrical problems. The starting points for the experiments displayed here are sophisticated setups or growing environments that allow the organism to propagate and grow, yet under conditions that the artist has predefined, sometimes with interaction between human organisms...

  2. Determination of moulds and mycotoxins in dry dog and cat food using liquid chromatography with mass spectrometry and fluorescence detection.

    PubMed

    Błajet-Kosicka, A; Kosicki, R; Twarużek, M; Grajewski, J

    2014-01-01

    In this study moulds and 12 mycotoxins in dry pet food samples (25 for dogs and 24 for cats) were determined. Primary moulds identified were Aspergillus, Mucor and Penicillium, found in 55% of the samples. Deoxynivalenol and zearalenone (ZEN) were detected in all samples with mean respective concentrations being 97.3 and 38.3 µg kg(-1) in cat food and 114 and 20.1 µg kg(-1) in dog food. T-2 and HT-2 toxins were present in 88% and 84% of the samples, respectively. Two samples contained fumonisins, with a maximum concentration of 108 µg kg(-1). Aflatoxin B1 and ochratoxin A were detected in 8% and 45% of the samples, respectively. The measured mould and mycotoxin levels were consistent with results obtained by other studies. However, potential exposure to relatively high concentrations of an oestrogen mycotoxin as is ZEN, especially when in combination with other mycotoxins, needs attention.

  3. Elastomeric inverse moulding and vacuum casting process characterization for the fabrication of arrays of concave refractive microlenses

    NASA Astrophysics Data System (ADS)

    Desmet, L.; Van Overmeire, S.; Van Erps, J.; Ottevaere, H.; Debaes, C.; Thienpont, H.

    2007-01-01

    We present a complete and precise quantitative characterization of the different process steps used in an elastomeric inverse moulding and vacuum casting technique. We use the latter replication technique to fabricate concave replicas from an array of convex thermal reflow microlenses. During the inverse elastomeric moulding we obtain a secondary silicone mould of the original silicone mould in which the master component is embedded. Using vacuum casting, we are then able to cast out of the second mould several optical transparent poly-urethane arrays of concave refractive microlenses. We select ten particular representative microlenses on the original, the silicone moulds and replica sample and quantitatively characterize and statistically compare them during the various fabrication steps. For this purpose, we use several state-of-the-art and ultra-precise characterization tools such as a stereo microscope, a stylus surface profilometer, a non-contact optical profilometer, a Mach-Zehnder interferometer, a Twyman-Green interferometer and an atomic force microscope to compare various microlens parameters such as the lens height, the diameter, the paraxial focal length, the radius of curvature, the Strehl ratio, the peak-to-valley and the root-mean-square wave aberrations and the surface roughness. When appropriate, the microlens parameter under test is measured with several different measuring tools to check for consistency in the measurement data. Although none of the lens samples shows diffraction-limited performance, we prove that the obtained replicated arrays of concave microlenses exhibit sufficiently low surface roughness and sufficiently high lens quality for various imaging applications.

  4. Fungal growth pattern, sources and factors of mould contamination in a dry-cured meat production facility.

    PubMed

    Asefa, Dereje T; Kure, Cathrine F; Gjerde, Ragnhild O; Omer, Mohamed K; Langsrud, Solveig; Nesbakken, Truls; Skaar, Ida

    2010-06-15

    The aims of this study were to investigate the patterns of fungal growth on dry-cured meat products, identify the important sources and factors of contamination and recommend intervention measures. The production processes of two smoked dry-cured hams and one unsmoked dry-cured leg of lamb were studied. A longitudinal observational study was performed to collect 642 samples from the meat, production materials, room installations and indoor and outdoor air of the production facility. Standard mycological isolation and identification procedures were followed. Totally, 901 fungal isolates were obtained; of which 57% were moulds while 43% were yeast. Yeasts were dominant on meat surfaces by covering 64% of the isolates. Mould growth was not observed until late in the dry-ripening stage. Yeasts and moulds were isolated from half of the environmental samples, of which moulds contributed by 80%. More than 39 mould species were isolated from the entire production process with a 77% contribution by the species of Penicillium. Penicillium nalgiovense dominated the species composition of moulds isolated from the products and the production environment. A preliminary bioassay analysis on bacterial colonies indicated that most of the P. nalgiovense isolates have the ability to produce penicillin. Such isolates might produce penicillin on the products and can become potential food safety hazards. Improper pressing at the salting process, the air quality in salting, brining and smoking rooms and activities in the sorting room were identified as important factors and sources of fungal contamination. Technical solutions and organized production activities that reduce crack formation, airborne spore concentration and improve air circulation in the facility are recommended as intervention measures.

  5. Global transcriptome changes in perennial ryegrass during early infection by pink snow mould.

    PubMed

    Kovi, Mallikarjuna Rao; Abdelhalim, Mohamed; Kunapareddy, Anil; Ergon, Åshild; Tronsmo, Anne Marte; Brurberg, May Bente; Hofgaard, Ingerd Skow; Asp, Torben; Rognli, Odd Arne

    2016-01-01

    Lack of resistance to pink snow mould (Microdochium nivale) is a major constraint for adaptation of perennial ryegrass (Lolium perenne L.) to continental regions with long-lasting snow cover at higher latitudes. Almost all investigations of genetic variation in resistance have been performed using cold acclimated plants. However, there may be variation in resistance mechanisms that are functioning independently of cold acclimation. In this study our aim was to identify candidate genes involved in such resistance mechanisms. We first characterized variation in resistance to M. nivale among non-acclimated genotypes from the Norwegian cultivar 'Fagerlin' based on relative regrowth and fungal quantification by real-time qPCR. One resistant and one susceptible genotype were selected for transcriptome analysis using paired-end sequencing by Illumina Hiseq 2000. Transcriptome profiles, GO enrichment and KEGG pathway analysis indicate that defense response related genes are differentially expressed between the resistant and the susceptible genotype. A significant up-regulation of defense related genes, as well as genes involved in cell wall cellulose metabolic processes and aryl-alcohol dehydrogenase (NADP+) activity, was observed in the resistant genotype. The candidate genes identified in this study might be potential molecular marker resources for breeding perennial ryegrass cultivars with improved resistance to pink snow mould.

  6. Global transcriptome changes in perennial ryegrass during early infection by pink snow mould

    PubMed Central

    Kovi, Mallikarjuna Rao; Abdelhalim, Mohamed; Kunapareddy, Anil; Ergon, Åshild; Tronsmo, Anne Marte; Brurberg, May Bente; Hofgaard, Ingerd Skow; Asp, Torben; Rognli, Odd Arne

    2016-01-01

    Lack of resistance to pink snow mould (Microdochium nivale) is a major constraint for adaptation of perennial ryegrass (Lolium perenne L.) to continental regions with long-lasting snow cover at higher latitudes. Almost all investigations of genetic variation in resistance have been performed using cold acclimated plants. However, there may be variation in resistance mechanisms that are functioning independently of cold acclimation. In this study our aim was to identify candidate genes involved in such resistance mechanisms. We first characterized variation in resistance to M. nivale among non-acclimated genotypes from the Norwegian cultivar ‘Fagerlin’ based on relative regrowth and fungal quantification by real-time qPCR. One resistant and one susceptible genotype were selected for transcriptome analysis using paired-end sequencing by Illumina Hiseq 2000. Transcriptome profiles, GO enrichment and KEGG pathway analysis indicate that defense response related genes are differentially expressed between the resistant and the susceptible genotype. A significant up-regulation of defense related genes, as well as genes involved in cell wall cellulose metabolic processes and aryl-alcohol dehydrogenase (NADP+) activity, was observed in the resistant genotype. The candidate genes identified in this study might be potential molecular marker resources for breeding perennial ryegrass cultivars with improved resistance to pink snow mould. PMID:27346054

  7. A morphological adaptation approach to path planning inspired by slime mould

    NASA Astrophysics Data System (ADS)

    Jones, Jeff

    2015-04-01

    Path planning is a classic problem in computer science and robotics which has recently been implemented in unconventional computing substrates such as chemical reaction-diffusion computers. These novel computing schemes utilise the parallel spatial propagation of information and often use a two-stage method involving diffusive propagation to discover all paths and a second stage to highlight or visualise the path between two particular points in the arena. The true slime mould Physarum polycephalum is known to construct efficient transport networks between nutrients in its environment. These networks are continuously remodelled as the organism adapts its body plan to changing spatial stimuli. It can be guided towards attractant stimuli (nutrients, warm regions) and it avoids locations containing hazardous stimuli (light irradiation, repellents, or regions occupied by predatory threats). Using a particle model of slime mould we demonstrate scoping experiments which explore how path planning may be performed by morphological adaptation. We initially demonstrate simple path planning by a shrinking blob of virtual plasmodium between two attractant sources within a polygonal arena. We examine the case where multiple paths are required and the subsequent selection of a single path from multiple options. Collision-free paths are implemented via repulsion from the borders of the arena. Finally, obstacle avoidance is implemented by repulsion from obstacles as they are uncovered by the shrinking blob. These examples show proof-of-concept results of path planning by morphological adaptation which complement existing research on path planning in novel computing substrates.

  8. Global transcriptome changes in perennial ryegrass during early infection by pink snow mould.

    PubMed

    Kovi, Mallikarjuna Rao; Abdelhalim, Mohamed; Kunapareddy, Anil; Ergon, Åshild; Tronsmo, Anne Marte; Brurberg, May Bente; Hofgaard, Ingerd Skow; Asp, Torben; Rognli, Odd Arne

    2016-01-01

    Lack of resistance to pink snow mould (Microdochium nivale) is a major constraint for adaptation of perennial ryegrass (Lolium perenne L.) to continental regions with long-lasting snow cover at higher latitudes. Almost all investigations of genetic variation in resistance have been performed using cold acclimated plants. However, there may be variation in resistance mechanisms that are functioning independently of cold acclimation. In this study our aim was to identify candidate genes involved in such resistance mechanisms. We first characterized variation in resistance to M. nivale among non-acclimated genotypes from the Norwegian cultivar 'Fagerlin' based on relative regrowth and fungal quantification by real-time qPCR. One resistant and one susceptible genotype were selected for transcriptome analysis using paired-end sequencing by Illumina Hiseq 2000. Transcriptome profiles, GO enrichment and KEGG pathway analysis indicate that defense response related genes are differentially expressed between the resistant and the susceptible genotype. A significant up-regulation of defense related genes, as well as genes involved in cell wall cellulose metabolic processes and aryl-alcohol dehydrogenase (NADP+) activity, was observed in the resistant genotype. The candidate genes identified in this study might be potential molecular marker resources for breeding perennial ryegrass cultivars with improved resistance to pink snow mould. PMID:27346054

  9. Fabrication of scalable and structured tissue engineering scaffolds using water dissolvable sacrificial 3D printed moulds.

    PubMed

    Mohanty, Soumyaranjan; Larsen, Layla Bashir; Trifol, Jon; Szabo, Peter; Burri, Harsha Vardhan Reddy; Canali, Chiara; Dufva, Marin; Emnéus, Jenny; Wolff, Anders

    2015-10-01

    One of the major challenges in producing large scale engineered tissue is the lack of ability to create large highly perfused scaffolds in which cells can grow at a high cell density and viability. Here, we explore 3D printed polyvinyl alcohol (PVA) as a sacrificial mould in a polymer casting process. The PVA mould network defines the channels and is dissolved after curing the polymer casted around it. The printing parameters determined the PVA filament density in the sacrificial structure and this density resulted in different stiffness of the corresponding elastomer replica. It was possible to achieve 80% porosity corresponding to about 150 cm(2)/cm(3) surface to volume ratio. The process is easily scalable as demonstrated by fabricating a 75 cm(3) scaffold with about 16,000 interconnected channels (about 1m(2) surface area) and with a channel to channel distance of only 78 μm. To our knowledge this is the largest scaffold ever to be produced with such small feature sizes and with so many structured channels. The fabricated scaffolds were applied for in-vitro culturing of hepatocytes over a 12-day culture period. Smaller scaffolds (6×4 mm) were tested for cell culturing and could support homogeneous cell growth throughout the scaffold. Presumably, the diffusion of oxygen and nutrient throughout the channel network is rapid enough to support cell growth. In conclusion, the described process is scalable, compatible with cell culture, rapid, and inexpensive. PMID:26117791

  10. Optical measurement and modelling of parison sag and swell in blow moulding

    NASA Astrophysics Data System (ADS)

    Béreaux, Yves; Charmeau, Jean-Yves; Balcaen, Jean

    2011-05-01

    Blow moulding is a process whereby a cylindrical parison is extruded first, then pinched between the two halves of a mould and, finally, blown into the product. Parison size and shape result from complex interactions between mandrel and die geometries, processing parameters and viscoelastic properties of the polymeric material. Moreover, parison size changes with time due to sag. An innovative, contactless and online measurement technique of the parison is shown to be an effective tool to measure precisely parison diameter and thickness and to capture dimensional changes with time. This technique employs laser lighting of the parison and hinges on the refractive properties of molten polymer. Images taken with a digital camera are processed to give a precise measurement of diameter and thickness, at different time step during extrusion. Thus, parison swell and sag have been recorded for a commercial HDPE. Influence of processing parameters such as the rotational screw speed or die gap width can be brought forward. Thickness swell is found to possess a different behaviour from diameter swell. Swell is a purely viscoelastic phenomenon, therefore requiring a numerical modelling with an integral viscoelastic constitutive equation. On the other hand, sag has been measured and could be modelled from a Newtonian perspective using one dimensional convected coordinates. A sagging susceptibility coefficient of the polymer is deduced.

  11. Research on impact behaviour and silicon insert fracture phenomenon in microinjection moulding

    NASA Astrophysics Data System (ADS)

    Xu, Zheng; Lv, Zhi-bin; Wang, Lin-gang; Jiang, Kai-yu; Ji, Zhi; Liu, Chong; Liu, Jun-shan

    2015-04-01

    Silicon insert is a promising tool for microinjection moulding (MIM). However, its fracture problem induced by impact in MIM creates a bottleneck for application. The purpose of this paper is to investigate the impact behaviour in MIM and the effect on the fracture of silicon inserts. The finite element method is utilised to calculate the crack propagation of silicon inserts with pressure load and thermal load in the MIM process. The simulation result shows that the crack propagation is more easily induced by the increase of pressure load, while the temperature change has little effect on the crack propagation. An experimental platform, including a novel rotatable insert mould, is developed to investigate the dynamic pressure in the MIM process. The result shows that both the maximum pressure and the maximum loading rate occur in the initial period of MIM process. It indicates that the silicon insert is more prone to fracture at the beginning of the MIM process, and spatial pressure peaks are observed in the cavity as well. The nearly consistent distribution between the peak positions and the insert fracture zones shows that the pressure distribution is quite relevant to the fracture of the silicon insert. The result is helpful because it reveals the fracture phenomenon of silicon inserts.

  12. Slit injection device

    DOEpatents

    Alger, Terry W.; Schlitt, Leland G.; Bradley, Laird P.

    1976-06-15

    A laser cavity electron beam injection device provided with a single elongated slit window for passing a suitably shaped electron beam and means for varying the current density of the injected electron beam.

  13. Deoxycholic Acid Injection

    MedlinePlus

    Deoxycholic acid injection is used to improve the appearance and profile of moderate to severe submental fat ('double chin'; fatty tissue located under the chin). Deoxycholic acid injection is in a class of medications called ...

  14. Aminocaproic Acid Injection

    MedlinePlus

    Aminocaproic acid injection is used to control bleeding that occurs when blood clots are broken down too quickly. This ... the baby is ready to be born). Aminocaproic acid injection is also used to control bleeding in ...

  15. Calcitonin Salmon Injection

    MedlinePlus

    Calcitonin salmon injection is used to treat osteoporosis in postmenopausal women. Osteoporosis is a disease that causes bones to weaken and break more easily. Calcitonin salmon injection is also used to ...

  16. Sodium Ferric Gluconate Injection

    MedlinePlus

    Sodium ferric gluconate injection is used to treat iron-deficiency anemia (a lower than normal number of ... are also receiving the medication epoetin (Epogen, Procrit). Sodium ferric gluconate injection is in a class of ...

  17. Rich catalytic injection

    DOEpatents

    Veninger, Albert

    2008-12-30

    A gas turbine engine includes a compressor, a rich catalytic injector, a combustor, and a turbine. The rich catalytic injector includes a rich catalytic device, a mixing zone, and an injection assembly. The injection assembly provides an interface between the mixing zone and the combustor. The injection assembly can inject diffusion fuel into the combustor, provides flame aerodynamic stabilization in the combustor, and may include an ignition device.

  18. Beam injection into RHIC

    SciTech Connect

    Fischer, W.; Hahn, H.; MacKay, W.W.; Satogata, T.; Tsoupas, N.; Zhang, W.

    1997-07-01

    During the RHIC sextant test in January 1997 beam was injected into a sixth of one of the rings for the first time. The authors describe the injection zone and its bottlenecks. They report on the commissioning of the injection system, on beam based measurements of the kickers and the application program to steer the beam.

  19. Strategies for safe injections.

    PubMed Central

    Battersby, A.; Feilden, R.; Stoeckel, P.; Da Silva, A.; Nelson, C.; Bass, A.

    1999-01-01

    In 1998, faced with growing international concern, WHO set out an approach for achieving injection safety that encompassed all elements from patients' expectations and doctors' prescribing habits to waste disposal. This article follows that lead and describes the implications of the approach for two injection technologies: sterilizable and disposable. It argues that focusing on any single technology diverts attention from the more fundamental need for health services to develop their own comprehensive strategies for safe injections. National health authorities will only be able to ensure that injections are administered safely if they take an approach that encompasses the whole system, and choose injection technologies that fit their circumstances. PMID:10680247

  20. Secreted effectors of the tomato leaf mould fungus Cladosporium fulvum are virulence factors that target host defense

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cladosporium fulvum is a biotrophic fungal pathogen that causes leaf mould of tomato. Inside the leaf, C. fulvum does not penetrate host cells or develop haustoria but remains confined to the intercellular space between mesophyll cells. Ten effector proteins that are secreted during host colonizatio...

  1. Sensitisation to airborne moulds and severity of asthma: cross sectional study from European Community respiratory health survey

    PubMed Central

    Zureik, Mahmoud; Neukirch, Catherine; Leynaert, Bénédicte; Liard, Renata; Bousquet, Jean; Neukirch, Françoise

    2002-01-01

    Objective To assess whether the severity of asthma is associated with sensitisation to airborne moulds rather than to other seasonal or perennial allergens. Design Multicentre epidemiological survey in 30 centres. Setting European Community respiratory health survey. Participants 1132 adults aged 20-44 years with current asthma and with skin prick test results. Main outcome measure Severity of asthma according to score based on forced expiratory volume in one second, number of asthma attacks, hospital admissions for breathing problems, and use of corticosteroids in past 12 months. Results The frequency of sensitisation to moulds (Alternaria alternata or Cladosporium herbarum, or both) increased significantly with increasing asthma severity (odds ratio 2.34 (95% confidence interval 1.56 to 3.52) for either for severe v mild asthma). This association existed in all of the study areas (gathered into regions), although there were differences in the frequency of sensitisation. There was no association between asthma severity and sensitisation to pollens or cats. Sensitisation to Dermatophagoides pteronyssinus was also positively associated with severity. In multivariable logistic regressions including sensitisation to moulds, pollens, D pteronyssinus, and cats simultaneously, the odds ratios for sensitisation to moulds were 1.48 (0.97 to 2.26) for moderate v mild asthma and 2.16 (1.37 to 3.35) for severe v mild asthma (P<0.001 for trend). Conclusions Sensitisation to moulds is a powerful risk factor for severe asthma in adults. This should be taken into account in primary prevention, management, and patients' education. What is already known on this topicSensitisation to moulds is a known risk factor for life threatening exacerbations of asthmaIt is unknown whether such sensitisation is generally associated with severity of asthmaWhat this study addsThe prevalence of sensitisation to moulds (Alternaria alternata or Cladosporium herbarum, or both) increased with

  2. Biological control of Botrytis gray mould on tomato cultivated in greenhouse.

    PubMed

    Fiume, F; Fiume, G

    2006-01-01

    Research was carried out to evaluate the effectiveness of the biological control of the Botrytis gray mould, caused by Botrytis cinerea Pers., one of the most important fungal diseases of the tomato (Lycopersicon esculentum Mill.). Biological control was performed by using Trichoderma harzianum Rifai, an antagonist that is a naturally occurring fungus found on some plants and in the soil worldwide. Trichoderma spp. are fungi diffused in nearly all agricultural soils and in other environments such as decaying wood. The object of this research is to find control strategies to reduce chemical treatments that cause damage to the environment and increase the pathogen resistance, applying the biological control by using T. harzianum against B. cinerea. A commercial product containing a natural isolate of T. harzianum is trichodex (Makhteshim Chemical Works, LTD). The research was performed in laboratory and in greenhouse. In laboratory, radial growth reduction of B. cinerea, in presence of T. harzianum, was calculated in relation to the growth of the pathogen control, by using a specific formula that measures the percentage of the inhibition of the radial mycelial growth. In greenhouse, starting from the tomato fruit setting, the research was carried out comparing, by a randomized complete block experiment design, replicated four times, the following treatments:1) untreated control; 2) pyrimethanil (400 g/L of a.i.), at 200 cc/hL of c.i. (pyrimidine fungicides); 3) trichodex at 100g/hL (1 kg/ha); 4) trichodex at 200 g/hL (2 kg/ha); 5) trichodex at 400 g/hL (4 kg/ha). Before fruit setting, the plots were all treated against Botrytis gray mould with iprodione 50% (100 g/hL), procymidone 50% (100 g/hL) and switch (Novartis plant protection) at 80 g/hL. In dual culture, the inhibition of B. cinerea radial mycelial growth was 76%. No inhibition halo was observed between B. cinerea and T. harzianum colonies but, after 3 days, the pathogen colony radius resulted no more than 1

  3. High diversity of non-sporulating moulds in respiratory specimens of immunocompromised patients: should all the species be reported when diagnosing invasive aspergillosis?

    PubMed

    Garcia-Hermoso, Dea; Alanio, Alexandre; Cabaret, Odile; Olivi, Martine; Foulet, Françoise; Cordonnier, Catherine; Costa, Jean-Marc; Bretagne, Stéphane

    2015-09-01

    Non-sporulating moulds (NSMs) isolated from respiratory specimens are usually discarded without further testing although they may have pathogenic effects in immunocompromised patients. The objective of this study was to determine the identity and frequency of NSMs in patients with haematological malignancies. We analysed the mycological results of 251 consecutive respiratory samples from 104 haematology patients. Yeast and sporulating moulds were identified at the genus/species level according to their phenotypic features. NSMs were identified by internal transcribed spacer (ITS) sequencing. We detected 179 positive samples, of which 10.1% (18/179) were mixtures of moulds and 26.3% (47/179) were mixtures of moulds and yeast. We identified 142 moulds belonging to 11 different genera/species or groups, with Aspergillus fumigatus (n = 50), Penicillium spp. (n = 31) and NSM (n = 24) being the most frequently isolated species. Twenty-two NSMs were successfully sequenced: 18 were basidiomycetes and six were ascomycetes, corresponding to 16 different genera/species. NSMs were isolated with A. fumigatus in the same sample or in a subsequent sample in five patients with probable invasive aspergillosis. The conclusion is that the respiratory specimens of immunocompromised patients frequently contain very diverse mould species that may increase the virulence of pathogenic species. Reporting all mould species isolated when diagnosing invasive fungal infection could test this hypothesis.

  4. Application of waste bulk moulded composite (BMC) as a filler for isotactic polypropylene composites.

    PubMed

    Barczewski, Mateusz; Matykiewicz, Danuta; Andrzejewski, Jacek; Skórczewska, Katarzyna

    2016-05-01

    The aim of this study was to produce isotactic polypropylene based composites filled with waste thermosetting bulk moulded composite (BMC). The influence of BMC waste addition (5, 10, 20 wt%) on composites structure and properties was investigated. Moreover, additional studies of chemical treatment of the filler were prepared. Modification of BMC waste by calcium stearate (CaSt) powder allows to assess the possibility of the production of composites with better dispersion of the filler and more uniform properties. The mechanical, processing, and thermal properties, as well as structural investigations were examined by means of static tensile test, Dynstat impact strength test, differential scanning calorimetry (DSC), wide angle X-ray scattering (WAXS), melt flow index (MFI) and scanning electron microscopy (SEM). Developed composites with different amounts of non-reactive filler exhibited satisfactory thermal and mechanical properties. Moreover, application of the low cost modifier (CaSt) allows to obtain composites with better dispersion of the filler and improved processability.

  5. Study of mould design and forming process on advanced polymer-matrix composite complex structure

    NASA Astrophysics Data System (ADS)

    Li, S. J.; Zhan, L. H.; Bai, H. M.; Chen, X. P.; Zhou, Y. Q.

    2015-07-01

    Advanced carbon fibre-reinforced polymer-matrix composites are widely applied to aviation manufacturing field due to their outstanding performance. In this paper, the mould design and forming process of the complex composite structure were discussed in detail using the hat stiffened structure as an example. The key issues of the moulddesign were analyzed, and the corresponding solutions were also presented. The crucial control points of the forming process such as the determination of materials and stacking sequence, the temperature and pressure route of the co-curing process were introduced. In order to guarantee the forming quality of the composite hat stiffened structure, a mathematical model about the aperture of rubber mandrel was introduced. The study presented in this paper may provide some actual references for the design and manufacture of the important complex composite structures.

  6. French vineyards provide information that opens ways for effective resistance management of Botrytis cinerea (grey mould).

    PubMed

    Walker, Anne-Sophie; Micoud, Annie; Rémuson, Florent; Grosman, Jacques; Gredt, Michel; Leroux, Pierre

    2013-06-01

    Resistance to fungicides is an evolutionary process resulting from the selection of advantageous genotypes in naturally diverse populations. Seven fungicide modes of action are authorised to control grey mould caused by Botrytis cinerea on grapevine in France, and five of them have encountered specific resistance, with variable frequencies in populations and possible consequences for field fungicide efficacy. Moreover, multidrug resistance is caused by fungicide efflux and allows a weak resistance towards six unrelated modes of action. Here, a review is given of the fungicide resistance status of B. cinerea in France, particularly in the vineyards of Champagne, which are the most affected. Recently developed resistance and recent findings concerning the associated resistance mechanisms are focused upon in particular. Finally, antiresistance strategies are presented, and examples of managed resistance are discussed in a more general manner with the aim of extending this knowledge to other crops and countries undergoing similar resistance problems.

  7. Epidural injections for back pain

    MedlinePlus

    ESI; Spinal injection for back pain; Back pain injection; Steroid injection - epidural; Steroid injection - back ... pillow under your stomach. If this position causes pain, you either sit up or lie on your ...

  8. An unfortunate injection.

    PubMed

    Shah, Bhavik Sandip; Yarbrough, Chase; Price, Amy; Biswas, Rakesh

    2016-01-01

    Intramuscular injection has been used to administer medications for more than a hundred years. However, despite our profession's long experience with intramuscular administration, preventable complications such as injection nerve palsies are still prevalent in developing countries. Injections account for one-fifth of all traumatic nerve injuries. These injuries largely occur due to indiscriminate use of intramuscular injections for treating common illnesses, frequently by unlicensed or undertrained practitioners administering unnecessary treatment to impoverished patients. The sciatic nerve is the most commonly injured, and frequently the resulting muscle weakness and associated disability are irreversible. This case report includes a video of a patient with foot drop 6 weeks after gluteal intramuscular injection. Such injuries can be prevented by proper awareness and training, the implementation of safer injection techniques, and quality assurance methods. PMID:26931130

  9. Preparing injectable medicines safely.

    PubMed

    Beaney, Alison M; Black, Anne

    Risks to patients are greater when injectable medicines are prepared in clinical areas (wards, theatres, clinics or even patients' homes), rather than provided in ready-to-use form. This article describes the risks involved in preparing injectable medicines in such areas and outlines key principles to ensure they are prepared safely. It also suggests that high-risk injectable medicines be provided in ready-to-use form, either in house, by pharmacy or by pharmaceutical companies. PMID:22359855

  10. Botulinum toxin injection - larynx

    MedlinePlus

    Injection laryngoplasty; Botox-larynx: spasmodic dysphonia-BTX; Essential voice tremor (EVT)-btx; Glottic insufficiency; Percutaneous electromyography-guided botulinum toxin treatment; Percutaneous indirect laryngoscopy- ...

  11. Fungi and bacteria in mould-damaged and non-damaged office environments in a subarctic climate

    NASA Astrophysics Data System (ADS)

    Salonen, Heidi; Lappalainen, Sanna; Lindroos, Outi; Harju, Riitta; Reijula, Kari

    The fungi and bacterial levels of the indoor air environments of 77 office buildings were measured in winter and a comparison was made between the buildings with microbe sources in their structures and those without such sources. Penicillium, yeasts, Cladosporium and non-sporing isolates were the commonest fungi detected in the indoor air and in settled dust, in both the mould-damaged and control buildings. Aspergillus ochraceus, Aspergillus glaucus and Stachybotrys chartarium were found only in environmental samples from the mould-damaged buildings. Some other fungi, with growth requiring of water activity, aw, above 0.85, occurred in both the reference and mould-damaged buildings, but such fungi were commoner in the latter type of buildings. The airborne concentrations of Penicillium, Aspergillus versicolor and yeasts were the best indicators of mould damage in the buildings studied. Penicillium species and A. versicolor were also the most abundant fungi in the material samples. This study showed that the fungi concentrations were very low (2-45 cfu m -3 90% of the concentrations being <15 cfu m -3) in the indoor air of the normal office buildings. Although the concentration range of airborne fungi was wider for the mould-damaged buildings (2-2470 cfu m -3), only about 20% of the samples exceeded 100 cfu m -3. The concentrations of airborne bacteria ranged from 12 to 540 cfu m -3 in the control buildings and from 14 to 1550 cfu m -3 in the mould-damaged buildings. A statistical analysis of the results indicated that bacteria levels are generally <600 cfu m -3 in office buildings in winter and fungi levels are <50 cfu m -3. These normal levels are applicable to subarctic climates for urban, modern office buildings when measurements are made using a six-stage impactor. These levels should not be used in evaluations of health risks, but elevated levels may indicate the presence of abnormal microbe sources in indoor air and a need for additional environmental

  12. Glenohumeral Joint Injections

    PubMed Central

    Gross, Christopher; Dhawan, Aman; Harwood, Daniel; Gochanour, Eric; Romeo, Anthony

    2013-01-01

    Context: Intra-articular injections into the glenohumeral joint are commonly performed by musculoskeletal providers, including orthopaedic surgeons, family medicine physicians, rheumatologists, and physician assistants. Despite their frequent use, there is little guidance for injectable treatments to the glenohumeral joint for conditions such as osteoarthritis, adhesive capsulitis, and rheumatoid arthritis. Evidence Acquisition: We performed a comprehensive review of the available literature on glenohumeral injections to help clarify the current evidence-based practice and identify deficits in our understanding. We searched MEDLINE (1948 to December 2011 [week 1]) and EMBASE (1980 to 2011 [week 49]) using various permutations of intra-articular injections AND (corticosteroid OR hyaluronic acid) and (adhesive capsulitis OR arthritis). Results: We identified 1 and 7 studies that investigated intra-articular corticosteroid injections for the treatment of osteoarthritis and adhesive capsulitis, respectively. Two and 3 studies investigated the use of hyaluronic acid in osteoarthritis and adhesive capsulitis, respectively. One study compared corticosteroids and hyaluronic acid injections in the treatment of osteoarthritis, and another discussed adhesive capsulitis. Conclusion: Based on existing studies and their level of evidence, there is only expert opinion to guide corticosteroid injection for osteoarthritis as well as hyaluronic acid injection for osteoarthritis and adhesive capsulitis. PMID:24427384

  13. Penicillin G Procaine Injection

    MedlinePlus

    Duracillin A-S ® ... Pfizerpen A-S® ... injection should not be used to treat gonorrhea (a sexually transmitted disease) or early in the treatment ... serious infections. Penicillin G procaine injection is in a class of medications called penicillins. It works by ...

  14. Gas injected vacuum switch

    DOEpatents

    Hardin, K. Dan

    1977-01-01

    The disclosure relates to a gas injected vacuum switch comprising a housing having an interior chamber, a conduit for evacuating the interior chamber, within the chamber an anode and a cathode spaced from the anode, and a detonator for injecting electrically conductive gas into the chamber between the anode and the cathode to provide a current path therebetween.

  15. [Intra-articular injections].

    PubMed

    Chapelle, Ch

    2015-09-01

    It is not unusual for a specialist or general practitioner to be presented with a pathology which necessitates the use of an intra-articular injection of corticosteroids, hyaluronic acid or a local anaesthetic. It would seem to be interesting to update and to precise the techniques and methods of intraarticular injections which have appeared in recent international publications, when we know that 30 % of the injections given into the knee and so called "dry" are incorrect and, therefore, inefficient. The indication of an articular injection depends, firstly, on the diagnosis which should be done with great care; after which should be an objective analysis complete with secondary effects linked to both the injection and the product used. The conditions of asepsis, the choice of needles and quantities of the injection and even the ways of the injections should be reviewed in detail. The last studies clearly question the secondary effects of the cartilage degradations of the cortisone given as an intra-articular injection and shows its efficiency on the pain and inflammatory phenomonen in osteoarthritis. Studies on hyaluronic acid are often contradictory going from a modest result to an important pain relief but it is necessary to be aware that the objective criteria are difficult to interpret. The use of local anaesthetics in intra-articular is limited by the few indications in view of the major risk of aggravating the pre-existing lesions by the disappearing signs of pain.

  16. Injection rate control cam

    SciTech Connect

    Perr, J.P.; Liang, E.; Yu, R.C.; Ghuman, A.S.

    1990-10-16

    This patent describes a cam for controlling the injection rate of fuel in a fuel injection system of an engine. The fuel injection system including a cyclically operating unit injector having a body, an injector plunger mounted for reciprocating movement in the injector body between an advanced position and a retracted portion to pump into the engine during each cycle a variable quantity of fuel up to a maximum quantity under rated engine conditions, and a drive train for converting rotational movement of the cam into reciprocating movement of the pumping plunger depending on the profile of the cam. The cam profile comprises at least a plunger retraction segment and a plunger advancement segment for controlling the velocity if injector plunger retraction and advancement, respectively, the plunger advancement segment including a pre-injection subsequent shaped to cause an initial quantity of fuel to be injected into the engine during each cycle at rated engine conditions while the pre-injection subsegment is in contact with the drive train, and an injection subsegment following the pre-injection subsegment.

  17. Health Instruction Packages: Injections.

    ERIC Educational Resources Information Center

    Dunkleman, Ellie; And Others

    Text, illustrations, and exercises are utilized in this set of four learning modules designed to instruct nursing students in techniques and equipment utilized for intramuscular injections. The first module, "Equipment for Intramuscular Injections" by Ellie Dunkleman, presents guidelines for selecting needles of the proper length and gauge…

  18. "Minimum pruning", "minimal pruning" and "physiological pruning" as new techniques in grey mould agronomic eco-compatible (natural) control. Researches and considerations.

    PubMed

    Cargnello, G; Pezza, L; Camatta, T; Gallo, G; Lot, S; Pascarella, G; Di Gaetano, R; Lovat, L; Spera, G; La Torre, A; Scaglione, M; Casadei, G; Moretti, S

    2006-01-01

    The aim of this work was to find agronomic eco-compatible ("natural") control solutions against grey mould of grapevine too. Our researches about "minimum pruning", "minimal pruning" and "physiological pruning" started in 1980, and in 1983 with specific relation to grey mould on vines of Merlot, Cabernet sauvignon and Chardonnay previously set in vegetative and productive growth balance. These researches were conducted to verify the affordability of innovative winter pruning techniques like "minimum pruning", "minimal pruning" and the so called 'physiological pruning", in the natural agronomic eco-compatible grey mould control. As a result we found that the new techniques contribute to limit the incidence of grey mould; especially "physiological pruning" followed by "minimal pruning" and 'minimum pruning". The best results were observed on Chardonnay, followed by Merlot and Cabernet sauvignon. PMID:17390860

  19. Yeasts from native Brazilian Cerrado plants: Occurrence, diversity and use in the biocontrol of citrus green mould.

    PubMed

    Sperandio, Eugenio Miranda; do Vale, Helson Mario Martins; Moreira, Geisianny Augusta Monteiro

    2015-11-01

    Yeasts are some of the most important postharvest biocontrol agents. Postharvest oranges frequently deteriorate due to green mould (Penicillium digitatum), which causes significant losses. The aims of this study were to determine the composition and diversity of yeasts on plants of the Brazilian Cerrado and to explore their potential for inhibiting citrus green mould. Leaves and fruit of Byrsonima crassifolia and Eugenia dysenterica were collected from Cerrado conservation areas, and thirty-five yeasts were isolated and identified by sequencing the D1-D2 domain of the rDNA large subunit (26S). The isolates represented the Aureobasidium, Meyerozyma, Candida, and Pichia genera. Three isolates identified as Aureobasidium pullulans exhibited potential for the control of P. digitatum in both in vitro and in vivo tests; these isolates reduced the incidence of disease and increased the storage time of fruit. Aureobasidium. pullulans has immense potential for the biological control of filamentous fungi.

  20. Some Investigations on Hardness of Investment Casting Process After Advancements in Shell Moulding for Reduction in Cycle Time

    NASA Astrophysics Data System (ADS)

    Singh, R.; Mahajan, V.

    2014-07-01

    In the present work surface hardness investigations have been made on acrylonitrile butadiene styrene (ABS) pattern based investment castings after advancements in shell moulding for replication of biomedical implants. For the present study, a hip joint, made of ABS material, was fabricated as a master pattern by fused deposition modelling (FDM). After preparation of master pattern, mold was prepared by deposition of primary (1°), secondary (2°) and tertiary (3°) coatings with the addition of nylon fibre (1-2 cm in length of 1.5D). This study outlines the surface hardness mechanism for cast component prepared from ABS master pattern after advancement in shell moulding. The results of study highlight that during shell production, fibre modified shells have a much reduced drain time. Further the results are supported by cooling rate and micro structure analysis of casting.

  1. Some Investigations on Effect of Cooling Rate on Al2O3 Reinforced Al-MMC Prepared by Vacuum Moulding

    NASA Astrophysics Data System (ADS)

    Singh, Rupinder; Sahni, Kanwalpreet

    2016-07-01

    In the present research work effort has been made to study the effect of cooling rate of Al2O3 reinforced; aluminum metal matrix composites (Al-MMC) on hardness of component prepared by vacuum moulding (VM) process. The study started with selection of the component for industrial application. This study also highlights the effect of reinforcement in form of double particle size and triple particle size on hardness of Al-Al2O3 MMC. The input parameters of process are composition of MMC, vacuum moulding silica sand AFS No., vacuum pressure and component volume. The results of study supported by microstructure analysis suggest the geometric model for MMC hardness prepared by VM process.

  2. Yeasts from native Brazilian Cerrado plants: Occurrence, diversity and use in the biocontrol of citrus green mould.

    PubMed

    Sperandio, Eugenio Miranda; do Vale, Helson Mario Martins; Moreira, Geisianny Augusta Monteiro

    2015-11-01

    Yeasts are some of the most important postharvest biocontrol agents. Postharvest oranges frequently deteriorate due to green mould (Penicillium digitatum), which causes significant losses. The aims of this study were to determine the composition and diversity of yeasts on plants of the Brazilian Cerrado and to explore their potential for inhibiting citrus green mould. Leaves and fruit of Byrsonima crassifolia and Eugenia dysenterica were collected from Cerrado conservation areas, and thirty-five yeasts were isolated and identified by sequencing the D1-D2 domain of the rDNA large subunit (26S). The isolates represented the Aureobasidium, Meyerozyma, Candida, and Pichia genera. Three isolates identified as Aureobasidium pullulans exhibited potential for the control of P. digitatum in both in vitro and in vivo tests; these isolates reduced the incidence of disease and increased the storage time of fruit. Aureobasidium. pullulans has immense potential for the biological control of filamentous fungi. PMID:26466874

  3. [Effect of alcoholic extracts of wild plants on the inhibition of growth of Aspergillus flavus, Aspergillus niger, Penicillium chrysogenum, Penicillium expansum, Fusarium moniliforme and Fusarium poae moulds].

    PubMed

    Tequida-Meneses, Martín; Cortez-Rocha, Mario; Rosas-Burgos, Ema Carina; López-Sandoval, Susana; Corrales-Maldonado, Consuelo

    2002-06-01

    Fungicidal activity of wild plants Larrea tridentata, Karwinskia humboldtiana, Ricinus communis, Eucalyptus globulus, Ambrosia ambrosioides, Nicotiana glauca, Ambrosia confertiflora, Datura discolor, Baccharis glutinosa, Proboscidea parviflora, Solanum rostratum, Jatropha cinerea, Salpianthus macrodonthus y Sarcostemma cynanchoides was evaluated against the moulds species Aspergillus flavus, Aspergillus niger, Penicillium chrysogenum, Penicillium expansum, Fusarium poae y Fusarium moniliforme moulds species. Alcoholic extracts 6% (w/v) were prepared using six grams of dried plant powders (leaves and stems) and alcohol (70% ethanol or 70% methanol). A spore suspension (1x10(6); ufc/ml) of each mould was prepared by adding saline solution (0.85%) and 0.1% tween 80. The extracts were mixed with Czapeck yeast agar (CYA) at 45-50 degrees C in 1:10 relation on Petri dishes. Triplicate Petri dishes of each treatment and for each mould were centrally inoculated and three Petri dishes were used without treatment as controls. The inoculated dishes and controls were incubated at 25 +/- 2 degrees C for eight days. The incubated dishes were examined each 48 h and after the colony diameter (radial growth) was measured. Two mould species were controlled by L. tridentata, B. glutinosa and P. parviflora. Extracts of L. tridentata in methanol or ethanol at 41.5-100% inhibited all six species of moulds.

  4. Community dynamics of coagulase-negative staphylococci during spontaneous artisan-type meat fermentations differ between smoking and moulding treatments.

    PubMed

    Janssens, M; Myter, N; De Vuyst, L; Leroy, F

    2013-08-16

    Coagulase-negative staphylococci (CNS) that are naturally present in the raw meat batter of fermented sausages or that originate from the addition of a starter culture play a role in flavour development. A wide species diversity of CNS can be present in fermented meats, but it is not fully clear yet how specific process parameters select for specific CNS by affecting their community dynamics. Therefore, the influence of smoking and moulding treatments on the CNS community dynamics in spontaneously fermented, artisan-type sausages was investigated. During the fermentation stage, the meat batter was in all cases dominated by Staphylococcus saprophyticus, in addition to Lactobacillus sakei as governing lactic acid bacterium. Following fermentation, the bacterial communities were not perturbed by the smoking treatment, since both L. sakei and S. saprophyticus remained dominant throughout the ripening stage and prevailed in the end-products. Yet, when fermentation was followed by a moulding step with Penicillium nalgiovense, a shift of the CNS communities towards dominance by Staphyloccocus equorum was seen, despite a similar evolution of L. sakei. This effect was possibly due to a pH rise caused by the mould, a hypothesis which was reinforced by the finding that the isolated strain S. equorum DBX-S-17 was more sensitive to low pH than the isolated strain S. saprophyticus DFL-S-12 during growth experiments in brain heart infusion (BHI). Differences in CNS communities may affect sausage flavour, due to intraspecies variations in metabolic conversions of, for instance, amino acids. The fact that 3-methyl-butanal was only found in the moulded sausage, which was dominated by S. equorum, may be related to the finding that the isolated strain of this species was able to produce this compound in BHI medium, whereas the isolated strain of S. saprophyticus was not.

  5. Chronic mould exposure as a risk factor for severe community acquired pneumonia in a patient requiring extra corporeal membrane oxygenation.

    PubMed

    Thomas, Stephanie; Hassan, Ibrahim; Barker, Julian; Ashworth, Alan; Barnes, Anita; Fedor, Igor; Feddy, Lee; Hayes, Tim; Malagon, Ignacio; Stirling, Sarah; Szentgyorgyi, Lajos; Mutton, Ken; Richardson, Malcolm

    2015-01-01

    A previously fit and well man developed acute respiratory failure due to environmental mould exposure from living in damp rental accommodation. Despite aggressive intensive care management he rapidly deteriorated and required respiratory and cardiac Extracorporeal Membrane Oxygenation. We hypothesize that poor domiciliary conditions may make an underestimated contribution to community respiratory disease. These conditions may present as acute and severe illness with non-typical pathogens identified. PMID:26236598

  6. Chronic mould exposure as a risk factor for severe community acquired pneumonia in a patient requiring extra corporeal membrane oxygenation

    PubMed Central

    Thomas, Stephanie; Hassan, Ibrahim; Barker, Julian; Ashworth, Alan; Barnes, Anita; Fedor, Igor; Feddy, Lee; Hayes, Tim; Malagon, Ignacio; Stirling, Sarah; Szentgyorgyi, Lajos; Mutton, Ken; Richardson, Malcolm

    2015-01-01

    A previously fit and well man developed acute respiratory failure due to environmental mould exposure from living in damp rental accommodation. Despite aggressive intensive care management he rapidly deteriorated and required respiratory and cardiac Extracorporeal Membrane Oxygenation. We hypothesize that poor domiciliary conditions may make an underestimated contribution to community respiratory disease. These conditions may present as acute and severe illness with non-typical pathogens identified. PMID:26236598

  7. THE RHIC INJECTION SYSTEM.

    SciTech Connect

    FISCHER,W.; GLENN,J.W.; MACKAY,W.W.; PTITSIN,V.; ROBINSON,T.G.; TSOUPAS,N.

    1999-03-29

    The RHIC injection system has to transport beam from the AGS-to-RHIC transfer line onto the closed orbits of the RHIC Blue and Yellow rings. This task can be divided into three problems. First, the beam has to be injected into either ring. Second, once injected the beam needs to be transported around the ring for one turn. Third, the orbit must be closed and coherent beam oscillations around the closed orbit should be minimized. We describe our solutions for these problems and report on system tests conducted during the RHIC Sextant test performed in 1997. The system will be fully commissioned in 1999.

  8. [Intravitreal injections of corticoids].

    PubMed

    Demols, P

    2007-01-01

    Intravitreal injections of triamcinolone acetonide are today widely performed as a therapeutic tool for a large variety of ocular diseases. The risk of toxicity of the product and its vehicle is quite real and is still at the center of investigations. Complications related to the substance and the technique of injections are already well-known (intraocular pressure rise, cataract, endophthalmitis, pseudo-endophthalmitis, vitreous haemorrhage and retinal detachment). Carefulness and rigor in the indication, realization and follow-up of these injections are therefore mandatory.

  9. OnabotulinumtoxinA Injection

    MedlinePlus

    ... onabotulinumtoxinA injection may cause loss of strength or muscle weakness all over the body or impaired vision. If you have any of these symptoms, do not drive a car, operate machinery, or do other dangerous activities.

  10. AbobotulinumtoxinA Injection

    MedlinePlus

    ... abobotulinumtoxinA injection may cause loss of strength or muscle weakness all over the body; blurred vision; or drooping eyelids. If you have any of these symptoms, do not drive a car, operate machinery, or do other dangerous activities.

  11. IncobotulinumtoxinA Injection

    MedlinePlus

    ... incobotulinumtoxinA injection may cause loss of strength or muscle weakness all over the body or impaired vision. If you have any of these symptoms, do not drive a car, operate machinery, or do other dangerous activities.if ...

  12. RimabotulinumtoxinB Injection

    MedlinePlus

    ... rimabotulinumtoxinB injection may cause loss of strength or muscle weakness all over the body or impaired vision. If you have any of these symptoms, do not drive a car, operate machinery, or do other dangerous activities.

  13. Urinary incontinence - injectable implant

    MedlinePlus

    ... deficiency repair; ISD repair; Injectable bulking agents for stress urinary incontinence ... RR, Blaivas JM, Gormley EA, et al. Female Stress Urinary Incontinence Update Panel of the American Urological Association Education ...

  14. Mouse bladder wall injection.

    PubMed

    Fu, Chi-Ling; Apelo, Charity A; Torres, Baldemar; Thai, Kim H; Hsieh, Michael H

    2011-07-12

    Mouse bladder wall injection is a useful technique to orthotopically study bladder phenomena, including stem cell, smooth muscle, and cancer biology. Before starting injections, the surgical area must be cleaned with soap and water and antiseptic solution. Surgical equipment must be sterilized before use and between each animal. Each mouse is placed under inhaled isoflurane anesthesia (2-5% for induction, 1-3% for maintenance) and its bladder exposed by making a midline abdominal incision with scissors. If the bladder is full, it is partially decompressed by gentle squeezing between two fingers. The cell suspension of interest is intramurally injected into the wall of the bladder dome using a 29 or 30 gauge needle and 1 cc or smaller syringe. The wound is then closed using wound clips and the mouse allowed to recover on a warming pad. Bladder wall injection is a delicate microsurgical technique that can be mastered with practice.

  15. Sipuleucel-T Injection

    MedlinePlus

    ... doctor or nurse in a doctor's office or infusion center. It is usually given once every 2 ... injection may cause serious allergic reactions during an infusion and for about 30 minutes afterwards. A doctor ...

  16. Interferon Alfacon-1 Injection

    MedlinePlus

    ... ordered interferon alfacon-1 to help treat your hepatitis C infection. The drug will be injected under your ... a synthetic interferon that helps to prevent the hepatitis C virus from growing inside your body. This medication ...

  17. Ferric Carboxymaltose Injection

    MedlinePlus

    ... carboxymaltose injection is used to treat iron-deficiency anemia (a lower than normal number of red blood ... medication is also used to treat iron deficiency anemia in adults with chronic kidney disease (damage to ...

  18. Penicillin G Benzathine Injection

    MedlinePlus

    ... to treat and prevent certain infections caused by bacteria. Penicillin G benzathine injection is in a class of antibiotics called penicillins. It works by killing bacteria that cause infections.Antibiotics such as penicillin G ...

  19. Corticotropin, Repository Injection

    MedlinePlus

    ... position or distract the child with a noisy toy while you are injecting the medication. You can ... recognizing reality vision problems excessive tiredness increased thirst ... the Food and Drug Administration's (FDA) MedWatch Adverse Event Reporting ...

  20. Supersonic Pulsed Injection

    NASA Technical Reports Server (NTRS)

    Cutler, A. D.; Harding, G. C.; Diskin, G. S.

    2001-01-01

    An injector has been developed to provide high-speed high-frequency (order 10 kHz) pulsed a supersonic crossflow. The injector nozzle is formed between the fixed internal surface of the nozzle and a freely rotating three- or four-sided wheel embedded within the device. Flow-induced rotation of the wheel causes the nozzle throat to open and close at a frequency proportional to the speed of sound of the injected gas. Measurements of frequency and mass flow rate as a function of supply pressure are discussed for various injector designs. Preliminary results are presented for wall-normal injection of helium into a Mach-2 ducted airflow. The data include schlieren images in the injectant plume in a plane normal to the flow, downstream of injection.

  1. Iron Sucrose Injection

    MedlinePlus

    ... often you receive iron sucrose injection and your total number of doses based on your condition and ... hands or feet; swelling of the hands, feet, ankles, or lower legs; loss of consciousness; or seizures. ...

  2. Premixed direct injection disk

    SciTech Connect

    York, William David; Ziminsky, Willy Steve; Johnson, Thomas Edward; Lacy, Benjamin; Zuo, Baifang; Uhm, Jong Ho

    2013-04-23

    A fuel/air mixing disk for use in a fuel/air mixing combustor assembly is provided. The disk includes a first face, a second face, and at least one fuel plenum disposed therebetween. A plurality of fuel/air mixing tubes extend through the pre-mixing disk, each mixing tube including an outer tube wall extending axially along a tube axis and in fluid communication with the at least one fuel plenum. At least a portion of the plurality of fuel/air mixing tubes further includes at least one fuel injection hole have a fuel injection hole diameter extending through said outer tube wall, the fuel injection hole having an injection angle relative to the tube axis. The invention provides good fuel air mixing with low combustion generated NOx and low flow pressure loss translating to a high gas turbine efficiency, that is durable, and resistant to flame holding and flash back.

  3. Tevatron injection timing

    SciTech Connect

    Saritepe, S.; Annala, G.

    1993-06-01

    Bunched beam transfer from one accelerator to another requires coordination and synchronization of many ramped devices. During collider operation timing issues are more complicated since one has to switch from proton injection devices to antiproton injection devices. Proton and antiproton transfers are clearly distinct sequences since protons and antiprotons circulate in opposite directions in the Main Ring (MR) and in the Tevatron. The time bumps are different, the kicker firing delays are different, the kickers and lambertson magnets are different, etc. Antiprotons are too precious to be used for tuning purposes, therefore protons are transferred from the Tevatron back into the Main Ring, tracing the path of antiprotons backwards. This tuning operation is called ``reverse injection.`` Previously, the reverse injection was handled in one supercycle. One batch of uncoalesced bunches was injected into the Tevatron and ejected after 40 seconds. Then the orbit closure was performed in the MR. In the new scheme the lambertson magnets have to be moved and separator polarities have to be switched, activities that cannot be completed in one supercycle. Therefore, the reverse injection sequence was changed. This involved the redefinition of TVBS clock event $D8 as MRBS $D8 thus making it possible to inject 6 proton batches (or coalesced bunches) and eject them one at a time on command, performing orbit closure each time in the MR. Injection devices are clock event driven. The TCLK is used as the reference clock. Certain TCLK events are triggered by the MR beam synchronized clock (MRBS) events. Some delays are measured in terms of MRBS ticks and MR revolutions. See Appendix A for a brief description of the beam synchronized clocks.

  4. Origanum dictamnus oil vapour suppresses the development of grey mould in eggplant fruit in vitro.

    PubMed

    Stavropoulou, Andriana; Loulakakis, Kostas; Magan, Naresh; Tzortzakis, Nikos

    2014-01-01

    Grey mould rot (Botrytis cinerea) development in vitro or in eggplant (Solanum melongena L.) fruit was evaluated after treatment with dittany (Origanum dictamnus L.) oil (DIT) and storage at 12°C and 95% relative humidity during or following exposure to the volatiles. DIT volatiles used in different concentration (0-50-100-250 μL/L) and times of exposure (up to 120 h) examined the effects on pathogen development as well as fruit quality parameters. In vitro, fungal colony growth was inhibited with the application of DIT oil (during or after exposure) and/or time of application. Continuous exposure to oils reduced conidial germination and production with fungistatic effects observed in 250 μL/L. In vivo, fungal lesion growth and conidial production reduced in DIT-treated fruits. Interesting, in fruits preexposed to volatiles before fungal inoculation, DIT application induced fruit resistance against the pathogen, by reduced lesion growth and conidial production. Conidial viability reduced in >100 μL/L DIT oil. Fruits exposed to essential oil did not affect fruit quality related attributes in general, while skin lightness (L value) increased in 50 and 100 μL/L DIT oil. The results of the current study indicated that dittany volatiles may be considered as an alternative food preservative, eliminating disease spread in the storage/transit atmospheres. PMID:25254209

  5. Continuous gluconic acid production by isolated yeast-like mould strains of Aureobasidium pullulans.

    PubMed

    Anastassiadis, S; Aivasidis, A; Wandrey, C

    2003-04-01

    By extensive microbial screening, about 50 strains with the ability to secrete gluconic acid were isolated from wild flowers. The strains belong to the yeast-like mould Aureobasidium pullulans (de Bary) Arnaud. In shake flask experiments, gluconic acid concentrations between 23 and 140 g/l were produced within 2 days using a mineral medium. In batch experiments, various important fermentation parameters influencing gluconic acid production by A. pullulans isolate 70 (DSM 7085) were identified. Continuous production of gluconic acid with free-growing cells of the isolated yeast-like microorganisms was studied. About 260 g/l gluconic acid at total glucose conversion could be achieved using continuous stirred tank reactors in defined media with residence times (RT) of about 26 h. The highest space-time-yield of 19.3 g l(-1) x h(-1)) with a gluconic acid concentration of 207.5 g/l was achieved with a RT of 10.8 h. The possibility of gluconic acid production with biomass retention by immobilised cells on porous sinter glass is discussed. The new continuous gluconate fermentation process provides significant advantages over traditional discontinuous operation employing Aspergillus niger. The aim of this work was the development of a continuous fermentation process for the production of gluconic acid. Process control becomes easier, offering constant product quality and quantity.

  6. Application of waste bulk moulded composite (BMC) as a filler for isotactic polypropylene composites.

    PubMed

    Barczewski, Mateusz; Matykiewicz, Danuta; Andrzejewski, Jacek; Skórczewska, Katarzyna

    2016-05-01

    The aim of this study was to produce isotactic polypropylene based composites filled with waste thermosetting bulk moulded composite (BMC). The influence of BMC waste addition (5, 10, 20 wt%) on composites structure and properties was investigated. Moreover, additional studies of chemical treatment of the filler were prepared. Modification of BMC waste by calcium stearate (CaSt) powder allows to assess the possibility of the production of composites with better dispersion of the filler and more uniform properties. The mechanical, processing, and thermal properties, as well as structural investigations were examined by means of static tensile test, Dynstat impact strength test, differential scanning calorimetry (DSC), wide angle X-ray scattering (WAXS), melt flow index (MFI) and scanning electron microscopy (SEM). Developed composites with different amounts of non-reactive filler exhibited satisfactory thermal and mechanical properties. Moreover, application of the low cost modifier (CaSt) allows to obtain composites with better dispersion of the filler and improved processability. PMID:27222742

  7. Diversity of Trichoderma spp. causing Pleurotus green mould diseases in Central Europe.

    PubMed

    Błaszczyk, Lidia; Siwulski, Marek; Sobieralski, Krzysztof; Frużyńska-Jóźwiak, Dorota

    2013-07-01

    The present study includes the molecular characteristics of Trichoderma pleurotum and Trichoderma pleuroticola isolates collected from green moulded cereal straw substrates at 47 oyster mushroom farms in Poland. The screening of the 80 Trichoderma isolates was performed by morphological observation and by using the multiplex PCR assay. This approach enabled specific detection of 47 strains of T. pleurotum and 2 strains of T. pleuroticola. Initial identifications were confirmed by sequencing the fragment of internal transcribed spacer regions 1 and 2 (ITS1 and ITS2) of the rRNA gene cluster and the fragment including the fourth and fifth introns and the last long exon of the translation-elongation factor 1-alpha (tef1) gene. ITS and tef1 sequence information was also used to establish the intra- and interspecies relationship of T. pleurotum and T. pleuroticola originating from the oyster mushroom farms in Poland and from other countries. Comparative analysis of the ITS sequences showed that all T. pleurotum isolates from Poland represent one haplotype, identical to that of T. pleurotum strains from Hungary and Romania. Sequence analysis of the tef1 locus revealed two haplotypes ("T" and "N") of Polish T. pleurotum isolates. The "T" type isolates of T. pleurotum were identical to those of strains from Hungary and Romania. The "N" type isolates possessed a unique tef1 allele. Detailed analysis of the ITS and tef1 sequences of two T. pleuroticola isolates showed their identicalness to Italian strain C.P.K. 1540.

  8. Origanum dictamnus oil vapour suppresses the development of grey mould in eggplant fruit in vitro.

    PubMed

    Stavropoulou, Andriana; Loulakakis, Kostas; Magan, Naresh; Tzortzakis, Nikos

    2014-01-01

    Grey mould rot (Botrytis cinerea) development in vitro or in eggplant (Solanum melongena L.) fruit was evaluated after treatment with dittany (Origanum dictamnus L.) oil (DIT) and storage at 12°C and 95% relative humidity during or following exposure to the volatiles. DIT volatiles used in different concentration (0-50-100-250 μL/L) and times of exposure (up to 120 h) examined the effects on pathogen development as well as fruit quality parameters. In vitro, fungal colony growth was inhibited with the application of DIT oil (during or after exposure) and/or time of application. Continuous exposure to oils reduced conidial germination and production with fungistatic effects observed in 250 μL/L. In vivo, fungal lesion growth and conidial production reduced in DIT-treated fruits. Interesting, in fruits preexposed to volatiles before fungal inoculation, DIT application induced fruit resistance against the pathogen, by reduced lesion growth and conidial production. Conidial viability reduced in >100 μL/L DIT oil. Fruits exposed to essential oil did not affect fruit quality related attributes in general, while skin lightness (L value) increased in 50 and 100 μL/L DIT oil. The results of the current study indicated that dittany volatiles may be considered as an alternative food preservative, eliminating disease spread in the storage/transit atmospheres.

  9. True-slime-mould-inspired hydrostatically coupled oscillator system exhibiting versatile behaviours.

    PubMed

    Umedachi, Takuya; Idei, Ryo; Ito, Kentaro; Ishiguro, Akio

    2013-09-01

    Behavioural diversity is an indispensable attribute of living systems, which makes them intrinsically adaptive and responsive to the demands of a dynamically changing environment. In contrast, conventional engineering approaches struggle to suppress behavioural diversity in artificial systems to reach optimal performance in given environments for desired tasks. The goals of this research include understanding the essential mechanism that endows living systems with behavioural diversity and implementing the mechanism in robots to exhibit adaptive behaviours. For this purpose, we have focused on an amoeba-like unicellular organism: the plasmodium of true slime mould. Despite the absence of a central nervous system, the plasmodium exhibits versatile spatiotemporal oscillatory patterns and switches spontaneously among these patterns. By exploiting this behavioural diversity, it is able to exhibit adaptive behaviour according to the situation encountered. Inspired by this organism, we built a real physical robot using hydrostatically coupled oscillators that produce versatile oscillatory patterns and spontaneous transitions among the patterns. The experimental results show that exploiting physical hydrostatic interplay—the physical dynamics of the robot—allows simple phase oscillators to promote versatile behaviours. The results can contribute to an understanding of how a living system generates versatile and adaptive behaviours with physical interplays among body parts.

  10. The search for better epilepsy treatments: from slime mould to coconuts.

    PubMed

    Walker, Matthew C; Williams, Robin S B

    2013-12-01

    Drug-resistant epilepsy has remained a problem since the inception of antiepileptic drug development, despite the large variety of antiepileptic drugs available today. Moreover, the mechanism-of-action of these drugs is often unknown. This is due to the widespread screening of compounds through animal models. We have taken a different approach to antiepileptic drug discovery and have identified a biochemical pathway in Dictyostelium discoideum (a 'slime mould') that may relate to the mechanism-of-action of valproate, one of the most commonly used and effective antiepileptic drugs. Through screening in this pathway, we have been able to identify a whole host of fatty acids and fatty acid derivatives with potential antiepileptic activity; this was then confirmed in in vitro and in vivo mammalian seizure models. Some of these compounds are more potent than valproate and potentially lack many of the major side effects of valproate (including birth defects and liver toxicity). In addition, one of the compounds that we have identified is a major constituent of the ketogenic diet, strongly arguing that it may be the fatty acids and not the ketogenesis that are mediating the effect of this diet.

  11. Two-gene phylogeny of bright-spored Myxomycetes (slime moulds, superorder Lucisporidia).

    PubMed

    Fiore-Donno, Anna Maria; Clissmann, Fionn; Meyer, Marianne; Schnittler, Martin; Cavalier-Smith, Thomas

    2013-01-01

    Myxomycetes, or plasmodial slime-moulds, are one of the largest groups in phylum Amoebozoa. Nonetheless, only ∼10% are in the database for the small subunit (SSU) ribosomal RNA gene, the most widely used gene for phylogenetics and barcoding. Most sequences belong to dark-spored Myxomycetes (order Fuscisporida); the 318 species of superorder Lucisporidia (bright-spored) are represented by only eleven genuine sequences. To compensate for this, we provide 66 new sequences, 37 SSU rRNA and 29 elongation factor 1-alpha (EF-1α), for 82% of the genera of Lucisporidia. Phylogenetic analyses of single- and two-gene alignments produce congruent topologies and reveal both morphological characters that have been overemphasised and those that have been overlooked in past classifications. Both classical orders, Liceida and Trichiida, and several families and genera are para/polyphyletic; some previously unrecognised clades emerge. We discuss possible evolutionary pathways. Our study fills a gap in the phylogeny of Amoebozoa and provides an extensive SSU rRNA sequence reference database for environmental sampling and barcoding. We report a new group I intron insertion site for Myxomycetes in one Licea.

  12. Exploring slime mould diversity in high-altitude forests and grasslands by environmental RNA analysis.

    PubMed

    Kamono, Akiko; Meyer, Marianne; Cavalier-Smith, Thomas; Fukui, Manabu; Fiore-Donno, Anna Maria

    2013-04-01

    In spite of the ecological importance of protists, very little data is available on their distribution in soil. This investigation is the first of its kind on what could be the major components of the soil protistan community, the Myxomycetes, or plasmodial slime-moulds, a monophyletic class in the phylum Amoebozoa. Myxomycetes have a complex life cycle culminating in the formation of mainly macroscopic fruiting bodies, highly variable in shape and colour, which can be found in every terrestrial biome. Despite their prevalence, they are paradoxically absent from environmental DNA sampling studies. We obtained myxomycete SSU rRNA gene sequences from soil-extracted RNAs using specific primers. Soil samples were collected in three mountain ranges (France, Scotland and Japan). Our study revealed an unexpectedly high diversity of dark-spored Myxomycetes, with the recovery of 74 phylotypes. Of these, 74% had < 98% identity with known sequences, showing a hidden diversity; there was little overlap between localities, implying biogeographical patterns. Few phylotypes were dominant and many were unique, consistent with the 'rare biosphere' phenomenon. Our study provides the first detailed insight into the community composition of this ecologically important group of protists, establishing means for future studies of their distribution, abundance and ecology.

  13. Slime moulds use heuristics based on within-patch experience to decide when to leave.

    PubMed

    Latty, Tanya; Beekman, Madeleine

    2015-04-15

    Animals foraging in patchy, non-renewing or slowly renewing environments must make decisions about how long to remain within a patch. Organisms can use heuristics ('rules of thumb') based on available information to decide when to leave the patch. Here, we investigated proximate patch-departure heuristics in two species of giant, brainless amoeba: the slime moulds Didymium bahiense and Physarum polycephalum. We explicitly tested the importance of information obtained through experience by eliminating chemosensory cues of patch quality. In P. polycephalum, patch departure was influenced by the consumption of high, and to a much lesser extent low, quality food items such that engulfing a food item increased patch-residency time. Physarum polycephalum also tended to forage for longer in darkened, 'safe' patches. In D. bahiense, engulfment of any food item increased patch residency irrespective of that food item's quality. Exposure to light had no effect on the patch-residency time of D. bahiense. Given that these organisms lack a brain, our results illustrate how the use of simple heuristics can give the impression that individuals make sophisticated foraging decisions.

  14. Origanum dictamnus Oil Vapour Suppresses the Development of Grey Mould in Eggplant Fruit In Vitro

    PubMed Central

    Loulakakis, Kostas; Magan, Naresh; Tzortzakis, Nikos

    2014-01-01

    Grey mould rot (Botrytis cinerea) development in vitro or in eggplant (Solanum melongena L.) fruit was evaluated after treatment with dittany (Origanum dictamnus L.) oil (DIT) and storage at 12°C and 95% relative humidity during or following exposure to the volatiles. DIT volatiles used in different concentration (0-50-100-250 μL/L) and times of exposure (up to 120 h) examined the effects on pathogen development as well as fruit quality parameters. In vitro, fungal colony growth was inhibited with the application of DIT oil (during or after exposure) and/or time of application. Continuous exposure to oils reduced conidial germination and production with fungistatic effects observed in 250 μL/L. In vivo, fungal lesion growth and conidial production reduced in DIT-treated fruits. Interesting, in fruits preexposed to volatiles before fungal inoculation, DIT application induced fruit resistance against the pathogen, by reduced lesion growth and conidial production. Conidial viability reduced in >100 μL/L DIT oil. Fruits exposed to essential oil did not affect fruit quality related attributes in general, while skin lightness (L value) increased in 50 and 100 μL/L DIT oil. The results of the current study indicated that dittany volatiles may be considered as an alternative food preservative, eliminating disease spread in the storage/transit atmospheres. PMID:25254209

  15. Application of glass-nonmetals of waste printed circuit boards to produce phenolic moulding compound.

    PubMed

    Guo, Jie; Rao, Qunli; Xu, Zhenming

    2008-05-01

    The aim of this study was to investigate the feasibility of using glass-nonmetals, a byproduct of recycling waste printed circuit boards (PCBs), to replace wood flour in production of phenolic moulding compound (PMC). Glass-nonmetals were attained by two-step crushing and corona electrostatic separating processes. Glass-nonmetals with particle size shorter than 0.07 mm were in the form of single fibers and resin powder, with the biggest portion (up to 34.6 wt%). Properties of PMC with glass-nonmetals (PMCGN) were compared with reference PMC and the national standard of PMC (PF2C3). When the adding content of glass-nonmetals was 40 wt%, PMCGN exhibited flexural strength of 82 MPa, notched impact strength of 2.4 kJ/m(2), heat deflection temperature of 175 degrees C, and dielectric strength of 4.8 MV/m, all of which met the national standard. Scanning electron microscopy (SEM) showed strong interfacial bonding between glass fibers and the phenolic resin. All the results showed that the use of glass-nonmetals as filler in PMC represented a promising method for resolving the environmental pollutions and reducing the cost of PMC, thus attaining both environmental and economic benefits.

  16. Application of waste bulk moulded composite (BMC) as a filler for isotactic polypropylene composites

    PubMed Central

    Barczewski, Mateusz; Matykiewicz, Danuta; Andrzejewski, Jacek; Skórczewska, Katarzyna

    2016-01-01

    The aim of this study was to produce isotactic polypropylene based composites filled with waste thermosetting bulk moulded composite (BMC). The influence of BMC waste addition (5, 10, 20 wt%) on composites structure and properties was investigated. Moreover, additional studies of chemical treatment of the filler were prepared. Modification of BMC waste by calcium stearate (CaSt) powder allows to assess the possibility of the production of composites with better dispersion of the filler and more uniform properties. The mechanical, processing, and thermal properties, as well as structural investigations were examined by means of static tensile test, Dynstat impact strength test, differential scanning calorimetry (DSC), wide angle X-ray scattering (WAXS), melt flow index (MFI) and scanning electron microscopy (SEM). Developed composites with different amounts of non-reactive filler exhibited satisfactory thermal and mechanical properties. Moreover, application of the low cost modifier (CaSt) allows to obtain composites with better dispersion of the filler and improved processability. PMID:27222742

  17. Two-Gene Phylogeny of Bright-Spored Myxomycetes (Slime Moulds, Superorder Lucisporidia)

    PubMed Central

    Fiore-Donno, Anna Maria; Clissmann, Fionn; Meyer, Marianne; Schnittler, Martin; Cavalier-Smith, Thomas

    2013-01-01

    Myxomycetes, or plasmodial slime-moulds, are one of the largest groups in phylum Amoebozoa. Nonetheless, only ∼10% are in the database for the small subunit (SSU) ribosomal RNA gene, the most widely used gene for phylogenetics and barcoding. Most sequences belong to dark-spored Myxomycetes (order Fuscisporida); the 318 species of superorder Lucisporidia (bright-spored) are represented by only eleven genuine sequences. To compensate for this, we provide 66 new sequences, 37 SSU rRNA and 29 elongation factor 1-alpha (EF-1α), for 82% of the genera of Lucisporidia. Phylogenetic analyses of single- and two-gene alignments produce congruent topologies and reveal both morphological characters that have been overemphasised and those that have been overlooked in past classifications. Both classical orders, Liceida and Trichiida, and several families and genera are para/polyphyletic; some previously unrecognised clades emerge. We discuss possible evolutionary pathways. Our study fills a gap in the phylogeny of Amoebozoa and provides an extensive SSU rRNA sequence reference database for environmental sampling and barcoding. We report a new group I intron insertion site for Myxomycetes in one Licea. PMID:23667494

  18. [Effect of fluorine in mould fluxes on microstructural units of silicates slag].

    PubMed

    He, Sheng-Ping; You, Jing-Lin; Wang, Qian; Xu, Chu-Shao

    2008-11-01

    In the continuous casting of steel, mold fluxes play an important role in improving surface quality of casting strands and maintaining the continuous casting process. The physiochemical property of mold fluxes is definitely correlated with the microstructure. Fluorides play an important role in modifying the high temperature properties of mold fluxes. So, studying the effect of fluoride on multicomponent silicate structure is helpful to understanding the performance of fluoride in mould fluxes. In the present paper, effects of fluorine on melt, glass and crystal structure of silicate were studied by using Raman spectroscopy and in situ high temperature technique. The results were as follows: While the content of CaF2 increased, the varieties and relative quantities of microstructural units of silicates changed, the polymerization of the silicate network decreased, and the viscosity of the melt decreased; comparing non-fluoride with high-fluorine mold fluxes, the main kind of microstructure of silicates in mold fluxes with high fluorine was mostly monomer, while in fluorine free mold fluxes it was mainly chain of microstructure. It would help to develop fluorine free mold fluxes.

  19. Triazole fungicides and the selection of resistance to medical triazoles in the opportunistic mould Aspergillus fumigatus.

    PubMed

    Verweij, Paul E; Kema, Gert H J; Zwaan, Bas; Melchers, Willem J G

    2013-02-01

    Azole resistance is an emerging problem in the opportunistic mould Aspergillus fumigatus. The triazoles are the most important agents for the management of Aspergillus diseases in humans. Selection for acquired resistance may occur in the hospital setting through exposure to high doses of azoles during azole therapy, but evidence is accumulating that A. fumigatus may become resistant to medical triazoles through environmental exposure to fungicides. The recovery of A. fumigatus isolates resistant to the medical triazoles from azole-naive patients as well as from the environment strongly indicates an environmental route of resistance selection. Molecule alignment studies have identified five fungicides that share a very similar molecule structure with the medical triazoles, and thus may have selected for mechanisms that confer resistance to both groups of compounds. It is important to explore further the presumed fungicide-driven route of resistance selection in order to implement effective preventive measures as the prevalence of azole resistance in A. fumigatus continues to increase and causes major challenges in the management of azole-resistant Aspergillus diseases.

  20. Injections--how safe.

    PubMed

    Sharma, Saurabh

    2005-04-01

    Injection, is a skin-piercing event performed by a syringe and needle with the purpose of introducing a curative substance or vaccine in a patient. According to WHO, safe injection is one which does not harm to the recepient, does not expose the health worker to any risk and does not result in waste that is dangerous for the community. To achieve this injection should be prepared on a clean workspace, provider should clean his hands appropriately, sterility of the syringe and needle to be maintained, skin of the recipient should be cleaned and above all sharps waste should be managed appropriately. Common danger of unsafe injection is infection. Most medication used in primary care can be administered orally. So firstly the behaviour of healthcare providers and patients must be changed so as to decrease overuse of injections, secondly provision of sufficient quantities of appropriate injection equipment and infection control supplies should be made available and thirdly a sharp waste management system should be set up. PMID:16173426

  1. Fuel injection nozzle

    SciTech Connect

    Kato, M.; Tojo, S.; Arai, K.

    1986-07-22

    A fuel injection nozzle is described connected to a fuel injection pump to inject fuel into a combustion chamber of an internal combustion engine consisting of: a nozzle housing defining therein a fuel sump chamber, an injection hole communicating with the sump chamber and opened at the outer surface of the nozzle housing, a stepped cylinder bore having a smaller diameter bore section and a larger diameter bore section and a fuel passage communicating at one end with the sump chamber and at the other end with the smaller diameter bore section of the stepped cylinder bore; a stepped plunger fitted in the stepped cylinder bore and having a smaller diameter plunger section fitted into the smaller diameter bore section and a larger diameter plunger section fitted into the larger diameter bore section in which the smaller diameter bore section together with the end face of the smaller diameter plunger section defines a pump chamber communicating with the fuel passage and the larger diameter bore section together with the end face of the larger diameter plunger section defines a main fuel chamber into which a main fuel is supplied from the fuel injection pump; auxiliary fuel supply means for supplying an auxiliary fuel into the sump chamber and pump chamber through the fuel passage; valve means for opening and closing an injection hole; communication means for permitting the main fuel chamber to communicate with the fuel passage when the main fuel is supplied from the injection pump into the main fuel chamber to cause the stepped plunger to be moved a predetermined distance in a direction in which the auxiliary fuel in the pump chamber is pressurized.

  2. Injectable Multiple Sclerosis Medications

    PubMed Central

    Tran, Zung Vu

    2012-01-01

    Although injection-site reactions (ISRs) occur with US Food and Drug Administration–approved injectable disease-modifying therapies (DMTs) for multiple sclerosis, there are currently few reports of real-world data on ISR management strategies or possible correlations between ISRs and patient demographics, disease characteristics, and missed injections. Patient-reported data on the use of DMTs, patient demographic and disease characteristics, missed injections, and ISR reduction strategies were collected via e-mail, a patient registry (www.ms-cam.org), and a Web-based survey. Of the 1380 respondents, 1201 (87%) indicated that they had used injectable DMTs, of whom 377 (31%) had used intramuscular (IM) interferon beta-1a (IFNβ-1a), 172 (14%) had used subcutaneous (SC) IFNβ-1a, 183 (15%) had used SC IFNβ-1b, and 469 (39%) had used glatiramer acetate (GA). The majority of respondents were older (73% were ≥40 years), female (79%), married or living with a partner (72%), white (94%), and nonsmoking (82%). Injection-site reaction incidence, grouped according to severity, varied among DMTs, with IM IFNβ-1a causing significantly (P < .001) fewer mild, moderate, or severe ISRs than the other therapies. Female sex and younger age were significantly (P < .05) associated with more moderate ISRs among users of IM IFNβ-1a, SC IFNβ-1b, and GA. Nonwhites reported severe ISRs more often than whites. For all DMTs injection-site massage and avoidance of sensitive sites were the most frequently used strategies to minimize ISRs. These data may help identify patients with characteristics associated with a higher risk for ISRs, allowing health-care professionals to provide anticipatory guidance to patients at risk for decreased adherence or discontinuation. PMID:24453732

  3. Syringe-injectable electronics

    NASA Astrophysics Data System (ADS)

    Liu, Jia; Fu, Tian-Ming; Cheng, Zengguang; Hong, Guosong; Zhou, Tao; Jin, Lihua; Duvvuri, Madhavi; Jiang, Zhe; Kruskal, Peter; Xie, Chong; Suo, Zhigang; Fang, Ying; Lieber, Charles M.

    2015-07-01

    Seamless and minimally invasive three-dimensional interpenetration of electronics within artificial or natural structures could allow for continuous monitoring and manipulation of their properties. Flexible electronics provide a means for conforming electronics to non-planar surfaces, yet targeted delivery of flexible electronics to internal regions remains difficult. Here, we overcome this challenge by demonstrating the syringe injection (and subsequent unfolding) of sub-micrometre-thick, centimetre-scale macroporous mesh electronics through needles with a diameter as small as 100 μm. Our results show that electronic components can be injected into man-made and biological cavities, as well as dense gels and tissue, with >90% device yield. We demonstrate several applications of syringe-injectable electronics as a general approach for interpenetrating flexible electronics with three-dimensional structures, including (1) monitoring internal mechanical strains in polymer cavities, (2) tight integration and low chronic immunoreactivity with several distinct regions of the brain, and (3) in vivo multiplexed neural recording. Moreover, syringe injection enables the delivery of flexible electronics through a rigid shell, the delivery of large-volume flexible electronics that can fill internal cavities, and co-injection of electronics with other materials into host structures, opening up unique applications for flexible electronics.

  4. Syringe-injectable electronics.

    PubMed

    Liu, Jia; Fu, Tian-Ming; Cheng, Zengguang; Hong, Guosong; Zhou, Tao; Jin, Lihua; Duvvuri, Madhavi; Jiang, Zhe; Kruskal, Peter; Xie, Chong; Suo, Zhigang; Fang, Ying; Lieber, Charles M

    2015-07-01

    Seamless and minimally invasive three-dimensional interpenetration of electronics within artificial or natural structures could allow for continuous monitoring and manipulation of their properties. Flexible electronics provide a means for conforming electronics to non-planar surfaces, yet targeted delivery of flexible electronics to internal regions remains difficult. Here, we overcome this challenge by demonstrating the syringe injection (and subsequent unfolding) of sub-micrometre-thick, centimetre-scale macroporous mesh electronics through needles with a diameter as small as 100 μm. Our results show that electronic components can be injected into man-made and biological cavities, as well as dense gels and tissue, with >90% device yield. We demonstrate several applications of syringe-injectable electronics as a general approach for interpenetrating flexible electronics with three-dimensional structures, including (1) monitoring internal mechanical strains in polymer cavities, (2) tight integration and low chronic immunoreactivity with several distinct regions of the brain, and (3) in vivo multiplexed neural recording. Moreover, syringe injection enables the delivery of flexible electronics through a rigid shell, the delivery of large-volume flexible electronics that can fill internal cavities, and co-injection of electronics with other materials into host structures, opening up unique applications for flexible electronics.

  5. Fuel injection pump

    SciTech Connect

    Hishinuma, O.; Masuda, A.; Ohmori, T.; Miyaki, M.; Takemoto, E.

    1987-06-09

    This patent describes a fuel injection pump for an internal combustion engine comprising: a housing having a cylindrical inner surface; a shaft having a portion disposed in rotatably sliding engagement with the cylindrical inner surface and having a first axial bore and a second radial bore therein; at least one pumping plunger slidably disposed in the second radial bore to cooperate therewith to define a compression chamber; a pumping plunger is adapted to be moved in the second radial bore to vary the volume of the compression chamber; an injection plunger slidably disposed in the first axial, bore to cooperate in defining the first and second pressure chambers separated from each other by the injection plunger.

  6. Material approximation of data smoothing and spline curves inspired by slime mould.

    PubMed

    Jones, Jeff; Adamatzky, Andrew

    2014-09-01

    The giant single-celled slime mould Physarum polycephalum is known to approximate a number of network problems via growth and adaptation of its protoplasmic transport network and can serve as an inspiration towards unconventional, material-based computation. In Physarum, predictable morphological adaptation is prevented by its adhesion to the underlying substrate. We investigate what possible computations could be achieved if these limitations were removed and the organism was free to completely adapt its morphology in response to changing stimuli. Using a particle model of Physarum displaying emergent morphological adaptation behaviour, we demonstrate how a minimal approach to collective material computation may be used to transform and summarise properties of spatially represented datasets. We find that the virtual material relaxes more strongly to high-frequency changes in data, which can be used for the smoothing (or filtering) of data by approximating moving average and low-pass filters in 1D datasets. The relaxation and minimisation properties of the model enable the spatial computation of B-spline curves (approximating splines) in 2D datasets. Both clamped and unclamped spline curves of open and closed shapes can be represented, and the degree of spline curvature corresponds to the relaxation time of the material. The material computation of spline curves also includes novel quasi-mechanical properties, including unwinding of the shape between control points and a preferential adhesion to longer, straighter paths. Interpolating splines could not directly be approximated due to the formation and evolution of Steiner points at narrow vertices, but were approximated after rectilinear pre-processing of the source data. This pre-processing was further simplified by transforming the original data to contain the material inside the polyline. These exemplary results expand the repertoire of spatially represented unconventional computing devices by demonstrating a

  7. Social selection and the evolution of cooperative groups: the example of the cellular slime moulds.

    PubMed

    Nanjundiah, Vidyanand; Sathe, Santosh

    2011-04-01

    In social selection the phenotype of an individual depends on its own genotype as well as on the phenotypes, and so genotypes, of other individuals. This makes it impossible to associate an invariant phenotype with a genotype: the social context is crucial. Descriptions of metazoan development, which often is viewed as the acme of cooperative social behaviour, ignore or downplay this fact. The implicit justification for doing so is based on a group-selectionist point of view. Namely, embryos are clones, therefore all cells have the same evolutionary interest, and the visible differences between cells result from a common strategy. The reasoning is flawed, because phenotypic heterogeneity within groups can result from contingent choices made by cells from a flexible repertoire as in multicellular development. What makes that possible is phenotypic plasticity, namely the ability of a genotype to exhibit different phenotypes. However, co-operative social behaviour with division of labour requires that different phenotypes interact appropriately, not that they belong to the same genotype, or have overlapping genetic interests. We sketch a possible route to the evolution of social groups that involves many steps: (a) individuals that happen to be in spatial proximity benefit simply by virtue of their number; (b) traits that are already present act as preadaptations and improve the efficiency of the group; and (c) new adaptations evolve under selection in the social context--that is, via interactions between individuals--and further strengthen group behaviour. The Dictyostelid or cellular slime mould amoebae (CSMs) become multicellular in an unusual way, by the aggregation of free-living cells. In nature the resulting group can be genetically homogeneous (clonal) or heterogeneous (polyclonal); in either case its development, which displays strong cooperation between cells (to the extent of so-called altruism) is not affected. This makes the CSMs exemplars for the study

  8. Effect of different GRAS compounds in the control of apples blue mould.

    PubMed

    Venditti, T; Cubaiu, L; Ladu, G; D'Hallewin, G

    2013-01-01

    The most important pathogen for apples is Penicillium expansum that is the causal organism of blue mould. Postharvest losses are controlled with chemical fungicides such as TBZ but a growing concern for human health and a greater awareness for environmental conservation have multiplied the studies on new ecological technologies. In the search of new environment and consumer friendly technologies that can reduce toxic residues, the use of GRAS compounds represent a valid alternative to the use of synthetic postharvest fungicides. The aims of the present work were: (1) To evaluate the effectiveness of different GRAS compounds in the control of P. expansum in artificially inoculated fruit; (2) To assess the capability of injured and treated fruit with GRAS compounds, used alone or combined, to heal the wounds in order to resist to infection. Fruit was injured with a steel rod and after 1 hour was (1) Inoculated with the pathogen and after 24 hours treated or (2) Treated and after 24 hours inoculated. Treatments were performed with the following compounds: sodium bicarbonate (SBC), boric acid (BA) and calcium chloride (CC) by using a 1% solution for all of them. After 9 or 14 days fruit lesion diameters were assessed. In the trial (1) the combined treatment with BA and SBC was the most effective reducing the lesion diameter by 86.5% with respect to untreated fruit, after 9 days from infection. A good pathogen control was also obtained with BA used alone or combined with CC. When the treatment was performed before infection the best results were achieved with the combination of SBC and CC, with 87% of reduction of the lesion diameter. The addition of CC also reduced the lesion if combined with BA (66.8%). These preliminary results showed that GRAS compounds can be effective in reducing blue mold by a direct effect on the pathogen, and by modulating fruit responses enhancing host resistance.

  9. Simulation based flow distribution network optimization for vacuum assisted resin transfer moulding process

    NASA Astrophysics Data System (ADS)

    Hsiao, Kuang-Ting; Devillard, Mathieu; Advani, Suresh G.

    2004-05-01

    In the vacuum assisted resin transfer moulding (VARTM) process, using a flow distribution network such as flow channels and high permeability fabrics can accelerate the resin infiltration of the fibre reinforcement during the manufacture of composite parts. The flow distribution network significantly influences the fill time and fill pattern and is essential for the process design. The current practice has been to cover the top surface of the fibre preform with the distribution media with the hope that the resin will flood the top surface immediately and penetrate through the thickness. However, this approach has some drawbacks. One is when the resin finds its way to the vent before it has penetrated the preform entirely, which results in a defective part or resin wastage. Also, if the composite structure contains ribs or inserts, this approach invariably results in dry spots. Instead of this intuitive approach, we propose a science-based approach to design the layout of the distribution network. Our approach uses flow simulation of the resin into the network and the preform and a genetic algorithm to optimize the flow distribution network. An experimental case study of a co-cured rib structure is conducted to demonstrate the design procedure and validate the optimized flow distribution network design. Good agreement between the flow simulations and the experimental results was observed. It was found that the proposed design algorithm effectively optimized the flow distribution network of the part considered in our case study and hence should prove to be a useful tool to extend the VARTM process to manufacture of complex structures with effective use of the distribution network layup.

  10. Rapid enumeration of low numbers of moulds in tea based drinks using an automated system.

    PubMed

    Tanaka, Kouichi; Yamaguchi, Nobuyasu; Baba, Takashi; Amano, Norihide; Nasu, Masao

    2011-01-31

    Aseptically prepared cold drinks based on tea have become popular worldwide. Contamination of these drinks with harmful microbes is a potential health problem because such drinks are kept free from preservatives to maximize aroma and flavour. Heat-tolerant conidia and ascospores of fungi can survive pasteurization, and need to be detected as quickly as possible. We were able to rapidly and accurately detect low numbers of conidia and ascospores in tea-based drinks using fluorescent staining followed by an automated counting system. Conidia or ascospores were inoculated into green tea and oolong tea, and samples were immediately filtered through nitrocellulose membranes (pore size: 0.8 μm) to concentrate fungal propagules. These were transferred onto potato dextrose agar and incubated for 23 h at 28 °C. Fungi germinating on the membranes were fluorescently stained for 30 min. The stained mycelia were counted selectively within 90s using an automated counting system (MGS-10LD; Chuo Electric Works, Osaka, Japan). Very low numbers (1 CFU/100ml) of conidia or ascospores could be rapidly counted, in contrast to traditional labour intensive techniques. All tested mould strains were detected within 24h while conventional plate counting required 72 h for colony enumeration. Counts of slow-growing fungi (Cladosporium cladosporioides) obtained by automated counting and by conventional plate counting were close (r(2) = 0.986). Our combination of methods enables counting of both fast- and slow-growing fungi, and should be useful for microbiological quality control of tea-based and also other drinks.

  11. Water Injected Turbomachinery

    NASA Technical Reports Server (NTRS)

    Hendricks, R. C.; Shouse, D. T.; Roquemore, W. M.

    2005-01-01

    From antiquity, water has been a source of cooling, lubrication, and power for energy transfer devices. More recent applications in gas turbines demonstrate an added facet, emissions control. Fogging gas turbine inlets or direct injection of water into gas turbine combustors, decreases NOx and increases power. Herein we demonstrate that injection of water into the air upstream of the combustor reduces NOx by factors up to three in a natural gas fueled Trapped Vortex Combustor (TVC) and up to two in a liquid JP-8 fueled (TVC) for a range in water/fuel and fuel/air ratios.

  12. The ultrahigh precision form measurement of small, steep-sided aspheric moulds, incorporating novel hardware and software developments; Technical Digest

    NASA Astrophysics Data System (ADS)

    Mills, M. W.; Hutchinson, Matthew J.

    2005-05-01

    A variety of consumer applications, eg cellphone camera lenses, optical storage devices, digital cameras, etc, are driving the demand for small, high aspheric departure rotationally-symmetric moulded optics, manufactured both in polymer and glass materials. The mould tools for such components are manufactured by ultra-high precision techniques such as single point diamond turning and ultra-precision grinding, and must be accurate to <1/10μm levels for form, and exhibit nanometric surface finish quality. The aspheric forms of such components" optical surfaces exhibit high departure from best-fit sphere towards their outer edge, which renders this outer region especially critical for optical performance. The high slope of these components at the clear aperture has caused some restrictions on the use of profilometry in the measurement of form across their full diameter. Taylor Hobson designs and manufactures a range of ultra-precision profilometers for use in such industries as aspheric optics fabrication. In order to address the issues described, a new measurement system, Taylor Hobson Form Talysurf PGI 1250, has been developed, which contains new Aspheric Data Fusion Software, as well as Asphero-Diffractive Analysis Software, allowing the entire diametric profile to be analysed to the desired level of accuracy. This development removes the previous limitation of maximum slope for this type of measurement, thus enabling better quality control of high slope, high aspheric departure optics. Measurement data from the Form Talysurf PGI 1250 can be fed back directly to the machine tool, in order to optimize the form of the optical mould.

  13. Characterization of 430L porous supports obtained by powder extrusion moulding for their application in solid oxide fuel cells

    SciTech Connect

    Sotomayor, María Eugenia Ospina, Liliana María Levenfeld, Belén Várez, Alejandro

    2013-12-15

    The characterization of 430L stainless steel planar porous supports obtained by powder extrusion moulding was performed in this work. A thermoplastic multicomponent binder based on high density polyethylene and paraffin wax was selected for the process. Green supports were shaped by extrusion moulding, and subsequently the binder was removed by a thermal cycle previously optimized. Sintering was carried out at different temperatures in low vacuum. Density of sintered parts was measured by Archimedes' method and porosity was also evaluated through a microstructural analysis by optical microscopy. The porosity degree of samples sintered at low temperature was close to 35% which is a very suitable value for their application in SOFCs. Tensile tests were carried out in order to determine mechanical strength as a function of porosity degree. Based on these results, the best feedstock composition and processing parameters were selected. The oxidation behaviour in static air at high temperature was studied, and formed oxides were characterized in a scanning electron microscope equipped with energy dispersive analysis of X-rays. X-ray diffraction experiments were performed in order to identify the formed oxides based on formula Fe{sub 2−x}Cr{sub x}O{sub 3}. The results of these studies showed that this kind of ferritic stainless steel would be more suitable to be used as anodic supports where a rich hydrogen atmosphere is employed. Preliminary deposition tests allowed obtaining a homogeneous Ni–YSZ anode layer with a thickness of 10 μm on the porous metallic substrates. - Highlights: • 430L stainless steel porous supports were obtained by powder extrusion moulding. • Porosity degree was controlled sintering at different temperatures in low vacuum. • Tensile tests allowed determining mechanical strength of porous supports. • A study about its oxidation behaviour in static air at high temperature was realized. • After oxidation, formed oxides were

  14. Iron Dextran Injection

    MedlinePlus

    ... called iron replacement products. It works by replenishing iron stores so that the body can make more red blood cells. ... and order certain lab tests to check your body's response to iron dextran injection.Before having any laboratory test, tell ...

  15. More than just someone to inject drugs with: injecting within primary injection partnerships

    PubMed Central

    Morris, Meghan D.; Bates, Anna; Andrew, Erin; Hahn, Judith; Page, Kimberly; Maher, Lisa

    2015-01-01

    Background Studies have shown intimate injection partners engage in higher rates of syringe and injecting equipment sharing. We examined the drug use context and development of injection drug use behaviors within intimate injection partnerships. Methods In-depth interviews (n=18) were conducted with both members of nine injecting partnerships in Sydney, Australia. Content analysis identified key domains related to the reasons for injecting with a primary injection partner and development of drug injection patterns. Main Findings Most partnerships (n=5) were also sexual; three were blood-relatives and one a friend dyad. The main drug injected was heroin (66%) with high rates of recent sharing behaviors (88%) reported within dyads. Injecting within a primary injection partnership provided perceived protection against overdose events, helped reduce stress, increased control over when, where, and how drugs were used, and promoted the development of an injecting pattern where responsibilities could be shared. Unique to injecting within primary injection partnerships was the social connection and companionship resulted in a feeling of fulfillment while also blinding one from recognizing risky behavior. Conclusions Findings illuminated the tension between protection and risks within primary injection partnerships. Primary injection partnerships provide a potential platform to expand risk reduction strategies. PMID:26460140

  16. Inverse problem for the solidification of binary alloy in the casting mould solved by using the bee optimization algorithm

    NASA Astrophysics Data System (ADS)

    Hetmaniok, Edyta

    2016-07-01

    In this paper the procedure for solving the inverse problem for the binary alloy solidification in the casting mould is presented. Proposed approach is based on the mathematical model suitable for describing the investigated solidification process, the lever arm model describing the macrosegregation process, the finite element method for solving the direct problem and the artificial bee colony algorithm for minimizing the functional expressing the error of approximate solution. Goal of the discussed inverse problem is the reconstruction of heat transfer coefficient and distribution of temperature in investigated region on the basis of known measurements of temperature.

  17. An arbitrary lagrangian-eulerian finite element approach to non-steady state fluid flows. Application to mould filling

    SciTech Connect

    Gaston, L.; Glut, B.; Bellet, M.; Chenot, J.L.

    1995-12-31

    This paper presents a two-dimensional lagrangian-eulerian finite element approach of non-steady state Navier-Stokes fluid flows with free surfaces, like those occurring during the mould filling stage in casting processes. The proposed model is based on a mixed velocity-pressure finite element formulation, including an augmented Lagrangian technique and an iterative solver of Uzawa type. Mesh updating is carried out through an arbitrary lagrangian-eulerian method in order to describe properly the free surface evolution. Heat transfer through the fluid flow is solved by a convection-diffusion splitting technique. The efficiency of the method is illustrated on an example of gravity casting.

  18. Injection-controlled laser resonator

    DOEpatents

    Chang, J.J.

    1995-07-18

    A new injection-controlled laser resonator incorporates self-filtering and self-imaging characteristics with an efficient injection scheme. A low-divergence laser signal is injected into the resonator, which enables the injection signal to be converted to the desired resonator modes before the main laser pulse starts. This injection technique and resonator design enable the laser cavity to improve the quality of the injection signal through self-filtering before the main laser pulse starts. The self-imaging property of the present resonator reduces the cavity induced diffraction effects and, in turn, improves the laser beam quality. 5 figs.

  19. Injection-controlled laser resonator

    DOEpatents

    Chang, Jim J.

    1995-07-18

    A new injection-controlled laser resonator incorporates self-filtering and self-imaging characteristics with an efficient injection scheme. A low-divergence laser signal is injected into the resonator, which enables the injection signal to be converted to the desired resonator modes before the main laser pulse starts. This injection technique and resonator design enable the laser cavity to improve the quality of the injection signal through self-filtering before the main laser pulse starts. The self-imaging property of the present resonator reduces the cavity induced diffraction effects and, in turn, improves the laser beam quality.

  20. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022. PMID:26768363

  1. Injectable nanocarriers for biodetoxification

    NASA Astrophysics Data System (ADS)

    Leroux, Jean-Christophe

    2007-11-01

    Hospitals routinely treat patients suffering from overdoses of drugs or other toxic chemicals as a result of illicit drug consumption, suicide attempts or accidental exposures. However, for many life-threatening situations, specific antidotes are not available and treatment is largely based on emptying the stomach, administering activated charcoal or other general measures of intoxication support. A promising strategy for managing such overdoses is to inject nanocarriers that can extract toxic agents from intoxicated tissues. To be effective, the nanocarriers must remain in the blood long enough to sequester the toxic components and/or their metabolites, and the toxin bound complex must also remain stable until it is removed from the bloodstream. Here, we discuss the principles that govern the use of injectable nanocarriers in biodetoxification and review the pharmacological performance of a number of different approaches.

  2. Fuel injection valve connection

    SciTech Connect

    Eshleman, E.S.; Field, M.J.; Penwright, J.L.

    1987-09-15

    A fuel injection valve connection is described which consists of a fuel injection valve having a cylindrical inlet fitting. The fitting has a threaded internal surface and a cylindrical external surface. A fuel connector has a projection with a threaded external surface that mates with the threaded internal surface of the fitting. The connector also has a sleeve with a cylindrical internal surface surrounding the fitting and an O-ring sealingly engaging the internal surface of the sleeve and the external surface of the fitting, whereby the valve may be rotated relative to the connector without breaking the sealing engagement between the valve and the connector, and wherein the connector also has a tab engageable with the injector to prevent unthreading of the valve from the connector.

  3. INJECTION-MOLDING APPARATUS

    DOEpatents

    Lobell, G.M.

    1958-02-11

    This patent is drawn to an injection molding apparatus for producing a tube closed at one end wherein the normally unsupported end of the core located in the cavity during the injection of the molten material to fill the space between the core and cavity wall, which supporting means is automatically removed from operation during the forming of the closed end of the tube. This support means is a plug extending through the end of the core into a recess in the bottom of the cavity where the closed end of the tube is to be formed. The plug is spring pressed into said recess and is forced out of the recess by a slidable bushing at the top of the cavity which is moved against the force of the spring by the molten material when it fills the uppormost open end portion of the cavity, thereby permitting the closed end of the tube to be formed.

  4. Magnetron injection gun scaling

    NASA Astrophysics Data System (ADS)

    Lawson, W.

    1988-04-01

    A set of tradeoff equations was simplified to obtain scaling laws for magnetron injection guns (MIGs). The constraints are chosen to examine the maximum-peak-power capabilities of MIGs. The scaling laws are compared with exact solutions of the design equations and are supported by MIG simulations in which each MIG is designed to double the beam power of an existing design by adjusting one of the four fundamental parameters.

  5. Spear 3 Injection Kicker

    NASA Astrophysics Data System (ADS)

    Sebek, J.; Arnett, D.; Langton, J.; Pappas, C.

    2002-08-01

    The design of the SPEAR 3 injection kicker system is presented. This system will include three kicker magnets and their associated pulsers. The magnet design is based on the DELTA kicker magnets, which present a low RF impedance to the beam, and are relatively straightforward to construct. The pulsers use cascaded IGBT stages that are based on the modulator pulsers developed by a SLAC/LLNL collaboration for the NLC. Design considerations and the results of prototype tests will be discussed.

  6. Ink-jet printing technology enables self-aligned mould patterning for electroplating in a single step

    NASA Astrophysics Data System (ADS)

    Meissner, M. V.; Spengler, N.; Mager, D.; Wang, N.; Kiss, S. Z.; Höfflin, J.; While, P. T.; Korvink, J. G.

    2015-06-01

    We present a new self-aligned, mask-free micro-fabrication method with which to form thick-layered conductive metal micro-structures inside electroplating moulds. Seed layer patterning for electroplating was performed by ink-jet printing using a silver nano-particle ink deposited on SU-8 or Ordyl SY permanent resist. The silver ink contact angle on SU-8 was adjusted by oxygen plasma followed by a hard bake. Besides functioning as a seed layer, the printed structures further served as a shadow mask during patterning of electroplating moulds into negative photoresist. The printed silver tracks remained in strong adhesion to the substrate when exposed to the acidic chemistry of the electroplating bath. To demonstrate the process, we manufactured rectangular, low-resistivity planar micro-coils for use in magnetic resonance microscopy. MRI images of a spring onion with an in-plane resolution down to 10 µm × 10 µm were acquired using a micro-coil on an 11.7 T MRI scanner.

  7. Effect of hot air treatment on postharvest mould decay in Chinese bayberry fruit and the possible mechanisms.

    PubMed

    Wang, Kaituo; Cao, Shifeng; Jin, Peng; Rui, Huaijing; Zheng, Yonghua

    2010-06-30

    The effect of hot air treatment (HAT) on reducing natural fungal decay and green mould decay caused by Leptographium abietinum on postharvest Chinese bayberry fruit and the possible mechanisms were investigated. Freshly harvested Chinese bayberry fruit were firstly pretreated with hot air at 36-60 degrees C for 1-3h, and then stored at 20 degrees C for 3d or at 1 degrees C for 12d to investigate the optimum condition of hot air treatment (HAT) for inhibiting decay development. Results demonstrated that HAT at 48 degrees C for 3h was the most effective in reducing natural decay without impairing quality. This treatment also enhanced the resistance of Chinese bayberry fruit against green mould rot caused by L. abietinum and reduced the severity of the disease. The activities of defense-related enzymes including chitinase, beta-1, 3-glucanase, peroxidase and polyphenol oxidase were significantly enhanced by HAT. In addition, the in vitro experiment showed that HAT significantly inhibited spore germination, germ tube elongation and mycelial growth of L. abietinum. These results indicate that HAT can effectively reduce fruit decay possibly by directly inhibiting pathogen growth and indirectly inducing disease resistance.

  8. Rapid identification of moulds and arthroconidial yeasts from positive blood cultures by MALDI-TOF mass spectrometry.

    PubMed

    de Almeida, João N; Sztajnbok, Jaques; da Silva, Afonso Rafael; Vieira, Vinicius Adriano; Galastri, Anne Layze; Bissoli, Leandro; Litvinov, Nadia; Del Negro, Gilda Maria Barbaro; Motta, Adriana Lopes; Rossi, Flávia; Benard, Gil

    2016-11-01

    Moulds and arthroconidial yeasts are potential life-threatening agents of fungemia in immunocompromised patients. Fast and accurate identification (ID) of these pathogens hastens initiation of targeted antifungal therapy, thereby improving the patients' prognosis. We describe a new strategy that enabled the identification of moulds and arthroconidial yeasts directly from positive blood cultures by MALDI-TOF mass spectrometry (MS). Positive blood cultures (BCs) with Gram staining showing hyphae and/or arthroconidia were prospectively selected and submitted to an in-house protein extraction protocol. Mass spectra were obtained by Vitek MS™ system, and identifications were carried out with in the research use only (RUO) mode with an extended database (SARAMIS™ [v.4.12] plus in-house database). Fusarium solani, Fusarium verticillioides, Exophiala dermatitidis, Saprochaete clavata, and Trichosporon asahii had correct species ID by MALDI-TOF MS analysis of positive BCs. All cases were related to critically ill patients with high mortality fungemia and direct ID from positive BCs was helpful for rapid administration of targeted antifungal therapy. PMID:27317582

  9. Exposure assessment of residential mould, fungi and microbial components in relation to children's health: achievements and challenges.

    PubMed

    Tischer, Christina G; Heinrich, Joachim

    2013-03-01

    Each day we are exposed to a complex mixture of microbial agents and components in indoor environments. A major part of this mixture derives from fungal and bacterial origin. The impact between those microbial agents in the home environment in relation to respiratory health in children is still a major issue in research. There is little known about the causal agents that provoke or arrest the development of allergic respiratory disorders in children. Identification is complicated by the biodiversity and variability of microbial components in indoor air as well as the lack of validated and standardized exposure assessment methods. In this review, we aim to consider all important aspects in terms of research which may encounter an epidemiological study. Apart from the need for standardized exposure assessment methods which consider cost, handling and effort, especially for the participants, we suggest that a combination of different analysis methods such as chemical and molecular methods may have the potential to best describe the microbial milieu in indoor environments at present. Further, the impact of mould and moisture remediation activities on health is still heavily under investigated, especially in larger prospective cohorts of children and should be a topic of future research. Moreover, the exposure to mould and microbial agents might be embedded in a broader spectrum of children's health such as behavior and cognitive development.

  10. The Ability of the Antagonist Yeast Pichia Guilliermondii Strain Z1 to Suppress Green Mould Infection in Citrus Fruit

    PubMed Central

    Hamadi, Younes; El Guilli, Mohammed; Jijakli, M. Haissam

    2014-01-01

    In previous studies it was shown that Pichia guilliermondii strain Z1, isolated from healthy Moroccan citrus Valencia-Late oranges, was effective against Penicillium italicum. Here the effectiveness of strain Z1 was assessed against Penicillium digitatum, the causal agent of green mould, under different temperature (5-25°C) and relative humidity (RH) (45-100%) regimes for its reliable and large-scale application in packinghouse. All main effects and interactions were significant (P<0.0001). In the pathogen control, the largest lesion diameter was at an RH range between 98 and 100%, regardless of the incubation temperature. The efficacy of strain Z1 was not dependent on the environment and reduced disease incidence by >80%. Its applications as a formulated product significantly reduced the incidence of infected fruit (55%) and the percentage of infected wounds (47%) compared to the only pathogen control treatment. However, disease control with formulated product was significantly less than that obtained with thiabendazole (30%) or strain Z1 culturable cells (35%). These results highlight that strain Z1 is an effective biological control agent for control of green mould under varying environmental conditions, and control may be optimized by combining its use with other environmentally-safe post-harvest treatments or improved formulation. PMID:27800373

  11. Injection-induced earthquakes

    USGS Publications Warehouse

    Ellsworth, William L.

    2013-01-01

    Earthquakes in unusual locations have become an important topic of discussion in both North America and Europe, owing to the concern that industrial activity could cause damaging earthquakes. It has long been understood that earthquakes can be induced by impoundment of reservoirs, surface and underground mining, withdrawal of fluids and gas from the subsurface, and injection of fluids into underground formations. Injection-induced earthquakes have, in particular, become a focus of discussion as the application of hydraulic fracturing to tight shale formations is enabling the production of oil and gas from previously unproductive formations. Earthquakes can be induced as part of the process to stimulate the production from tight shale formations, or by disposal of wastewater associated with stimulation and production. Here, I review recent seismic activity that may be associated with industrial activity, with a focus on the disposal of wastewater by injection in deep wells; assess the scientific understanding of induced earthquakes; and discuss the key scientific challenges to be met for assessing this hazard.

  12. Snowplow Injection Front Effects

    NASA Technical Reports Server (NTRS)

    Moore, T. E.; Chandler, M. O.; Buzulukova, N.; Collinson, G. A.; Kepko, E. L.; Garcia-Sage, K. S.; Henderson, M. G.; Sitnov, M. I.

    2013-01-01

    As the Polar spacecraft apogee precessed through the magnetic equator in 2001, Polar encountered numerous substorm events in the region between geosynchronous orbit and 10 RE geocentric distance; most of them in the plasma sheet boundary layers. Of these, a small number was recorded near the neutral sheet in the evening sector. Polar/Thermal Ion Dynamics Experiment provides a unique perspective on the lowest-energy ion plasma, showing that these events exhibited a damped wavelike character, initiated by a burst of radially outward flow transverse to the local magnetic field at approximately 80 km/s. They then exhibit strongly damped cycles of inward/outward flow with a period of several minutes. After one or two cycles, they culminated in a hot plasma electron and ion injection, quite similar to those observed at geosynchronous orbit. Cold plasmaspheric plasmas comprise the outward flow cycles, while the inward flow cycles contain counterstreaming field-parallel polar wind-like flows. The observed wavelike structure, preceding the arrival of an earthward moving substorm injection front, suggests an outward displacement driven by the inward motion at local times closer to midnight, that is, a "snowplow" effect. The damped in/out flows are consistent with interchange oscillations driven by the arrival at the observed local time by an injection originating at greater radius and local time.

  13. Peginterferon Beta-1a Injection

    MedlinePlus

    ... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS, a disease in which ... peginterferon beta-1a injection at around the same time of day each time you inject it. Follow ...

  14. Interferon Beta-1b Injection

    MedlinePlus

    ... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS, a disease in which ... interferon beta-1b injection at around the same time of day each time you inject it. Follow ...

  15. Interferon Alfa-2b Injection

    MedlinePlus

    ... medication either subcutaneously or intramuscularly three times a week. HBV, inject the medication either subcutaneously or intramuscularly three times a week usually for 16 weeks. hairy cell leukemia, inject ...

  16. Gaseous Fuel Injection Modeling using a Gaseous Sphere Injection Methodology

    SciTech Connect

    Hessel, R P; Aceves, S M; Flowers, D L

    2006-03-06

    The growing interest in gaseous fuels (hydrogen and natural gas) for internal combustion engines calls for the development of computer models for simulation of gaseous fuel injection, air entrainment and the ensuing combustion. This paper introduces a new method for modeling the injection and air entrainment processes for gaseous fuels. The model uses a gaseous sphere injection methodology, similar to liquid droplet in injection techniques used for liquid fuel injection. In this paper, the model concept is introduced and model results are compared with correctly- and under-expanded experimental data.

  17. Reductant injection and mixing system

    DOEpatents

    Reeves, Matt; Henry, Cary A.; Ruth, Michael J.

    2016-02-16

    A gaseous reductant injection and mixing system is described herein. The system includes an injector for injecting a gaseous reductant into an exhaust gas stream, and a mixer attached to a surface of the injector. The injector includes a plurality of apertures through which the gaseous reductant is injected into an exhaust gas stream. The mixer includes a plurality of fluid deflecting elements.

  18. Progress of snow mould infection in crowns of winter rye (Secale cereale L.) is related to photosynthetic activity during cold acclimation.

    PubMed

    Pociecha, E; Janowiak, F; Dubas, E; Żur, I; Tokarz, K; Kolasińska, I; Płażek, A

    2013-09-01

    Resistance to snow mould is a feature determined by multiple genes. Therefore, determining the phenotype of resistant plants is difficult as it requires an investigation over a long period of time from cold acclimation through pathogenesis. The aim of the present study was (i) to determine the characteristics of the resistant genotype and (ii) to clarify the connections between photosynthesis during cold acclimation and then pathogenesis caused by Microdochium nivale. Two inbred lines of winter rye (Secale cereale L.) differing in their susceptibility to snow mould were used in the study. After cold acclimation snow mould resistant (SMR) line was characterised by higher values of CO2 assimilation and electron transport efficiency but did not differ from snow mould susceptible (SMS) line in carboxylation rate of RuBisCO (Vcmax). Higher soluble carbohydrate accumulation, due to higher photosynthesis intensity, as well as an ABA increase at 5 days post infection (DPI) in leaves and crowns were found in SMR line during the pathogenesis period. Callose deposition was found around non-infected bundle sheets and in cortex cells at 5 DPI (at the same time point as ABA peak) only in SMR line, which probably prevented the infection of leaf initials. Early leaf initials infection in SMS line may be responsible for inhibiting leaf growth and plant regeneration after stress cessation. The results show different physiological and biochemical characteristics of the investigated lines, which can be applied in the selection of resistant genotypes and identifying genomic regions responsible for metabolic pathways increasing pathogen resistance.

  19. Rain underscores need for injection

    SciTech Connect

    Stelling, K.F.

    1996-01-01

    Since 1987, steam production totals at The Geysers Geothermal field have fallen and water injection totals have remained quite stable, except for the unusually dry winter months of 1994 when injection fell by a record amount. The heavy rainfall in the first half of 1995 altered the long-term production and injection patterns and underscored the need to increase injection in the field. From January to June 1995, steam production at The Geysers was reduced by 37 percent form the amount produced during the same period in 1994--because the rain increased availability of hydroelectric power. At the same time, water injection in the field rose by 25 percent because more rainwater was available for injection. Consequently, both reservoir pressure and available steam reserves grew, and most power plants that returned on line in the second half of the year produced more megawatts with less steam. This confirmed findings form several injection studies at The Geyser`s.

  20. Epidemiology of Injection Drug Use

    PubMed Central

    Arruda, Nelson; Bruneau, Julie; Jutras-Aswad, Didier

    2016-01-01

    After more than 30 years of research, numerous studies have shown that injection drug use is associated with a wide range of adverse health outcomes such as drug overdoses, drug-related suicidal behaviours, comorbid psychiatric disorders, bloodborne pathogens and other infectious diseases, and traumas. This review explores new trends and prominent issues associated with injection drug use. The dynamic nature of injection drug use is underlined by examining its recent trends and changing patterns in Canada and other “high-income countries.” Three research topics that could further contribute to the development of comprehensive prevention and intervention strategies aimed at people who inject drugs are also discussed: risk behaviours associated with the injection of prescription opioids, binge injection drug use, and mental health problems as determinants of injection risk behaviours. PMID:27254088

  1. [Tropical and travel-related dermatomycoses : Part 2: cutaneous infections due to yeasts, moulds, and dimorphic fungi].

    PubMed

    Nenoff, P; Reinel, D; Krüger, C; Grob, H; Mugisha, P; Süß, A; Mayser, P

    2015-07-01

    Besides dermatophytoses, a broad range of cutaneous infections due to yeasts and moulds may occur in subtropical and tropical countries where they can affect travellers. Not to be forgotten are endemic occurring dimorphic or biphasic fungi in countries with hot climate, which cause systemic and secondary cutaneous infections in immunosuppressed and immunocompetent people. In the tropics, the prevalence of pityriasis versicolor, caused by the lipophilic yeast Malassezia spp., is about 30-40 %, in distinct areas even 50 %. Increased hyperhidrosis under tropical conditions and simultaneously humidity congestion have to be considered as significant disposing factors for pityriasis versicolor. In tropical countries, therefore, an exacerbation of a preexisting pityriasis versicolor in travellers is not rare. Today, mostly genital yeast infections due to the new species Candida africana can be found worldwide. Due to migration from Africa this yeast pathogen has reached Germany and Europe. Eumycetomas due to mould fungi are rarely diagnosed in Europe. These deep cutaneous mould infections are only found in immigrants from African countries. The therapy of eumycetoma is protracted and often not successful. Cutaneous cryptococcoses due to the yeast species Cryptococcus neoformans and Cryptococcus gattii occur worldwide; however, they are found more frequently in the tropics. Immunosuppressed patients, especially those with HIV/AIDS, are affected by cryptococcoses. Furthermore, Cryptococcus gattii also causes infections in immunocompetent hosts in Central Africa, Australia, California, and Central America.Rarely found are infections due to dimorphic fungi after travel to countries where these fungal pathogens are endemic. In individual cases, cutaneous or lymphogenic transferred sporotrichosis due to Sporothrix schenkii can occur. Furthermore, scarcely known is secondary cutaneous coccidioidomycosis due to Coccidioides immitis after travelling to desert-like endemic

  2. Highly conformal CT based surface mould brachytherapy for non-melanoma skin cancers of earlobe and nose

    PubMed Central

    Kozłowski, Sławomir; Pietraszek, Andrzej; Pietrzykowska-Kuncman, Malwina; Danielska, Justyna; Sobotkowski, Janusz; Łuniewska-Bury, Jolanta; Fijuth, Jacek

    2016-01-01

    Purpose Brachytherapy (BT), due to rapid dose fall off and minor set-up errors, should be superior to external beam radiotherapy (EBRT) for treatment of lesions in difficult locations like nose and earlobe. Evidences in this field are scarce. We describe computed tomography (CT) based surface mould BT for non-melanoma skin cancers (NMSC), and compare its conformity, dose coverage, and tissue sparing ability to EBRT. Material and methods We describe procedure of preparation of surface mould applicator and dosimetry parameters of BT plans, which were implemented in 10 individuals with NMSC of nose and earlobe. We evaluated dose coverage by minimal dose to 90% of planning target volume (PTV) (D90), volumes of PTV receiving 90-150% of prescribed dose (PD) (VPTV90-150), conformal index for 90 and 100% of PD (COIN90, COIN100), dose homogeneity index (DHI), dose nonuniformity ratio (DNR), exposure of organs. Prospectively, we created CT-based photons and electrons plans. We compared conformity (COIN90, COIN100), dose coverage of PTV (D90, VPTV90, VPTV100), volumes of body receiving 10-90% of PD (V10-V90) of EBRT and BT plans. Results We obtained mean BT-DHI = 0.76, BT-DNR = 0.23, EBRT-DHI = 1.26. We observed no significant differences in VPTV90 and D90 between BT and EBRT. Mean BT-VPTV100 (89.4%) was higher than EBRT-VPTV100 (71.2%). Both COIN90 (BT-COIN90 = 0.46 vs. EBRT-COIN90 = 0.21) and COIN100 (BT-COIN100 = 0.52 vs. EBRT-COIN100 = 0.26) were superior for BT plans. We observed more exposure of normal tissues for small doses in BT plans (V10, V20), for high doses in EBRT plans (V70, V90). Conclusions Computed tmography-based surface mould brachytherapy for superficial lesions on irregular surfaces is a highly conformal method with good homogeneity. Brachytherapy is superior to EBRT in those locations in terms of conformity and normal tissue sparing ability in high doses. PMID:27504128

  3. [Tropical and travel-related dermatomycoses : Part 2: cutaneous infections due to yeasts, moulds, and dimorphic fungi].

    PubMed

    Nenoff, P; Reinel, D; Krüger, C; Grob, H; Mugisha, P; Süß, A; Mayser, P

    2015-07-01

    Besides dermatophytoses, a broad range of cutaneous infections due to yeasts and moulds may occur in subtropical and tropical countries where they can affect travellers. Not to be forgotten are endemic occurring dimorphic or biphasic fungi in countries with hot climate, which cause systemic and secondary cutaneous infections in immunosuppressed and immunocompetent people. In the tropics, the prevalence of pityriasis versicolor, caused by the lipophilic yeast Malassezia spp., is about 30-40 %, in distinct areas even 50 %. Increased hyperhidrosis under tropical conditions and simultaneously humidity congestion have to be considered as significant disposing factors for pityriasis versicolor. In tropical countries, therefore, an exacerbation of a preexisting pityriasis versicolor in travellers is not rare. Today, mostly genital yeast infections due to the new species Candida africana can be found worldwide. Due to migration from Africa this yeast pathogen has reached Germany and Europe. Eumycetomas due to mould fungi are rarely diagnosed in Europe. These deep cutaneous mould infections are only found in immigrants from African countries. The therapy of eumycetoma is protracted and often not successful. Cutaneous cryptococcoses due to the yeast species Cryptococcus neoformans and Cryptococcus gattii occur worldwide; however, they are found more frequently in the tropics. Immunosuppressed patients, especially those with HIV/AIDS, are affected by cryptococcoses. Furthermore, Cryptococcus gattii also causes infections in immunocompetent hosts in Central Africa, Australia, California, and Central America.Rarely found are infections due to dimorphic fungi after travel to countries where these fungal pathogens are endemic. In individual cases, cutaneous or lymphogenic transferred sporotrichosis due to Sporothrix schenkii can occur. Furthermore, scarcely known is secondary cutaneous coccidioidomycosis due to Coccidioides immitis after travelling to desert-like endemic

  4. A wide variety of injection molding technologies is now applicable to small series and mass production

    SciTech Connect

    Bloß, P. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de; Jüttner, G. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de; Jacob, S. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de; Löser, C. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de; Michaelis, J. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de; Krajewsky, P. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de

    2014-05-15

    Micro plastic parts open new fields for application, e. g., to electronics, sensor technologies, optics, and medical engineering. Before micro parts can go to mass production, there is a strong need of having the possibility for testing different designs and materials including material combinations. Hence, flexible individual technical and technological solutions for processing are necessary. To manufacture high quality micro parts, a micro injection moulding machine named formicaPlast based on a two-step plunger injection technology was developed. Resulting from its design, the residence time and the accuracy problems for managing small shot volumes with reproducible high accuracy are uncompromisingly solved. Due to their simple geometry possessing smooth transitions and non adherent inner surfaces, the plunger units allow to process 'all' thermoplastics from polyolefines to high performance polymers, optical clear polymers, thermally sensitive bioresorbables, highly filled systems (the so-called powder injection molding PIM), and liquid silicon rubber (LSR, here with a special kit). The applied platform strategy in the 1K and 2K version allows integrating automation for assembling, handling and packaging. A perpendicular arrangement allows encapsulation of inserts, also partially, and integration of this machine into process chains. Considering a wide variety of different parts consisting of different materials, the high potential of the technology is demonstrated. Based on challenging industrial parts from electronic applications (2K micro MID and bump mat, where both are highly structured parts), the technological solutions are presented in more detail.

  5. A wide variety of injection molding technologies is now applicable to small series and mass production

    NASA Astrophysics Data System (ADS)

    Bloß, P.; Jüttner, G.; Jacob, S.; Löser, C.; Michaelis, J.; Krajewsky, P.

    2014-05-01

    Micro plastic parts open new fields for application, e. g., to electronics, sensor technologies, optics, and medical engineering. Before micro parts can go to mass production, there is a strong need of having the possibility for testing different designs and materials including material combinations. Hence, flexible individual technical and technological solutions for processing are necessary. To manufacture high quality micro parts, a micro injection moulding machine named formicaPlast based on a two-step plunger injection technology was developed. Resulting from its design, the residence time and the accuracy problems for managing small shot volumes with reproducible high accuracy are uncompromisingly solved. Due to their simple geometry possessing smooth transitions and non adherent inner surfaces, the plunger units allow to process "all" thermoplastics from polyolefines to high performance polymers, optical clear polymers, thermally sensitive bioresorbables, highly filled systems (the so-called powder injection molding PIM), and liquid silicon rubber (LSR, here with a special kit). The applied platform strategy in the 1K and 2K version allows integrating automation for assembling, handling and packaging. A perpendicular arrangement allows encapsulation of inserts, also partially, and integration of this machine into process chains. Considering a wide variety of different parts consisting of different materials, the high potential of the technology is demonstrated. Based on challenging industrial parts from electronic applications (2K micro MID and bump mat, where both are highly structured parts), the technological solutions are presented in more detail.

  6. Combined effects of potassium sorbate, hot water and thiabendazole against green mould of citrus fruit and residue levels.

    PubMed

    D'Aquino, Salvatore; Fadda, Angela; Barberis, Antonio; Palma, Amedeo; Angioni, Alberto; Schirra, Mario

    2013-11-15

    Postharvest treatments of potassium sorbate only controlled recently established infections of Penicillium digitatum on Femminello siracusano lemons but did not confer any persistent protection. The loss of efficacy of potassium sorbate to control green mould decay was related to its irregular deposition on the fruit surface, as revealed by environmental scanning electron microscopy of oranges, and to the brief persistence of potassium sorbate residues. When treatment was done at 53°C, the co-application of potassium sorbate with thiabendazole reduced thiabendazole residues in Moro and Sanguinello oranges, compared to thiabendazole treatment alone. However, treatment efficacy against two isolates of P. digitatum (thiabendazole-sensitive and thiabendazole-resistant) notably improved, indicating that potassium sorbate and hot water potentiated thiabendazole activity. Potassium sorbate residues remarkably decreased during fruit storage and were not affected by the co-application of thiabendazole. PMID:23790859

  7. Fever-range temperature modulates activation and function of human dendritic cells stimulated with the pathogenic mould Aspergillus fumigatus.

    PubMed

    Semmlinger, Anna; Fliesser, Mirjam; Waaga-Gasser, Ana Maria; Dragan, Mariola; Morton, C Oliver; Einsele, Hermann; Loeffler, Juergen

    2014-05-01

    In immunocompromised patients, invasive aspergillosis (IA) is the most frequent disease caused by the pathogenic mould Aspergillus fumigatus. Fever is one of the most common yet nonspecific clinical symptoms of IA. To evaluate the role of hyperthermia in the innate immune response to A. fumigatus in vitro, human monocyte-derived dendritic cells (DCs) were stimulated with germ tubes of A. fumigatus or the fungal cell wall component zymosan at 37°C or 40°C, followed by characterization of specific DC functions. While maturation of DCs was enhanced and DC phagocytic capacity was reduced at 40°C, we observed that DC viability and cytokine release were unaffected. Thus, our results suggest that hyperthermia has substantial impacts on DC function in vitro, which might also influence the course and outcome of IA in immunocompromised patients.

  8. Effects of dog rose and watercress extracts on control of green mould decay and postharvest quality of orange fruits.

    PubMed

    Jafari, Sajad; Hassandokht, Mohammadreza; Javan-Nikkhah, Mohammad

    2014-01-01

    Minimum inhibitory concentration (MIC) and IC50 values and total phenolics of dog rose fruits were 72.5-80 μL mL(- 1), 130 μg mL(- 1) and 5.7 mg GA g(- 1), respectively. The Fashand watercress population and dog rose extracts exhibited mycelia growth inhibition values of 45.08% and 37.12%, respectively. The results of in vivo study indicated that the treatment of inoculated fruits with both methanol extracts especially the watercress plant extract considerably controls the citrus fruits decay (Penicillium digitatum) up to 73%. In conclusion, methanol extracts of dog rose fruits and especially watercress plant had the potential to be used against citrus green mould and even for the improvement of postharvest quality of orange fruits.

  9. The use of mould-templated surface structures for high-quality uniform-lying-helix liquid-crystal alignment

    NASA Astrophysics Data System (ADS)

    Outram, B. I.; Elston, S. J.; Tuffin, R.; Siemianowski, S.; Snow, B.

    2013-06-01

    The chiral-flexoelectrooptic effect in a Uniform Lying Helix (ULH) configuration provides a sub-millisecond in-plane rotation of the optic axis with the application of a transverse field. This enables displays with a wide viewing angle without costly in-plane-type electrodes. The salient challenge is one of alignment of the ULH, which is not topologically compatible with uniform alignment surface treatments. Here, we create a micro-grooved surface structure with features on the micron scale by using a replica-moulding technique. When the cell is assembled, the micro-grooves create channels, and using surface-energy considerations, we explain how and show experimentally that the channels align a cholesteric material in the ULH geometry with the helicoidal axis oriented parallel to the channels. The resultant alignment provides a high level of contrast between crossed polarizers and exhibits an electrooptic response with a switching time of the order of tens of microseconds.

  10. Fungicide-Driven Evolution and Molecular Basis of Multidrug Resistance in Field Populations of the Grey Mould Fungus Botrytis cinerea

    PubMed Central

    Mosbach, Andreas; Walker, Anne-Sophie; Fillinger, Sabine; Mernke, Dennis; Schoonbeek, Henk-Jan; Pradier, Jean-Marc; Leroux, Pierre; De Waard, Maarten A.; Hahn, Matthias

    2009-01-01

    The grey mould fungus Botrytis cinerea causes losses of commercially important fruits, vegetables and ornamentals worldwide. Fungicide treatments are effective for disease control, but bear the risk of resistance development. The major resistance mechanism in fungi is target protein modification resulting in reduced drug binding. Multiple drug resistance (MDR) caused by increased efflux activity is common in human pathogenic microbes, but rarely described for plant pathogens. Annual monitoring for fungicide resistance in field isolates from fungicide-treated vineyards in France and Germany revealed a rapidly increasing appearance of B. cinerea field populations with three distinct MDR phenotypes. All MDR strains showed increased fungicide efflux activity and overexpression of efflux transporter genes. Similar to clinical MDR isolates of Candida yeasts that are due to transcription factor mutations, all MDR1 strains were shown to harbor activating mutations in a transcription factor (Mrr1) that controls the gene encoding ABC transporter AtrB. MDR2 strains had undergone a unique rearrangement in the promoter region of the major facilitator superfamily transporter gene mfsM2, induced by insertion of a retrotransposon-derived sequence. MDR2 strains carrying the same rearranged mfsM2 allele have probably migrated from French to German wine-growing regions. The roles of atrB, mrr1 and mfsM2 were proven by the phenotypes of knock-out and overexpression mutants. As confirmed by sexual crosses, combinations of mrr1 and mfsM2 mutations lead to MDR3 strains with higher broad-spectrum resistance. An MDR3 strain was shown in field experiments to be selected against sensitive strains by fungicide treatments. Our data document for the first time the rising prevalence, spread and molecular basis of MDR populations in a major plant pathogen in agricultural environments. These populations will increase the risk of grey mould rot and hamper the effectiveness of current strategies for

  11. Identifying risk factors for exposure to culturable allergenic moulds in energy efficient homes by using highly specific monoclonal antibodies.

    PubMed

    Sharpe, Richard A; Le Cocq, Kate; Nikolaou, Vasilis; Osborne, Nicholas J; Thornton, Christopher R

    2016-01-01

    The aim of this study was to determine the accuracy of monoclonal antibodies (mAbs) in identifying culturable allergenic fungi present in visible mould growth in energy efficient homes, and to identify risk factors for exposure to these known allergenic fungi. Swabs were taken from fungal contaminated surfaces and culturable yeasts and moulds isolated by using mycological culture. Soluble antigens from cultures were tested by ELISA using mAbs specific to the culturable allergenic fungi Aspergillus and Penicillium spp., Ulocladium, Alternaria, and Epicoccum spp., Cladosporium spp., Fusarium spp., and Trichoderma spp. Diagnostic accuracies of the ELISA tests were determined by sequencing of the internally transcribed spacer 1 (ITS1)-5.8S-ITS2-encoding regions of recovered fungi following ELISA. There was 100% concordance between the two methods, with ELISAs providing genus-level identity and ITS sequencing providing species-level identities (210 out of 210 tested). Species of Aspergillus/Penicillium, Cladosporium, Ulocladium/Alternaria/Epicoccum, Fusarium and Trichoderma were detected in 82% of the samples. The presence of condensation was associated with an increased risk of surfaces being contaminated by Aspergillus/Penicillium spp. and Cladosporium spp., whereas moisture within the building fabric (water ingress/rising damp) was only associated with increased risk of Aspergillus/Penicillium spp. Property type and energy efficiency levels were found to moderate the risk of indoor surfaces becoming contaminated with Aspergillus/Penicillium and Cladosporium which in turn was modified by the presence of condensation, water ingress and rising damp, consistent with previous literature.

  12. Identifying risk factors for exposure to culturable allergenic moulds in energy efficient homes by using highly specific monoclonal antibodies.

    PubMed

    Sharpe, Richard A; Le Cocq, Kate; Nikolaou, Vasilis; Osborne, Nicholas J; Thornton, Christopher R

    2016-01-01

    The aim of this study was to determine the accuracy of monoclonal antibodies (mAbs) in identifying culturable allergenic fungi present in visible mould growth in energy efficient homes, and to identify risk factors for exposure to these known allergenic fungi. Swabs were taken from fungal contaminated surfaces and culturable yeasts and moulds isolated by using mycological culture. Soluble antigens from cultures were tested by ELISA using mAbs specific to the culturable allergenic fungi Aspergillus and Penicillium spp., Ulocladium, Alternaria, and Epicoccum spp., Cladosporium spp., Fusarium spp., and Trichoderma spp. Diagnostic accuracies of the ELISA tests were determined by sequencing of the internally transcribed spacer 1 (ITS1)-5.8S-ITS2-encoding regions of recovered fungi following ELISA. There was 100% concordance between the two methods, with ELISAs providing genus-level identity and ITS sequencing providing species-level identities (210 out of 210 tested). Species of Aspergillus/Penicillium, Cladosporium, Ulocladium/Alternaria/Epicoccum, Fusarium and Trichoderma were detected in 82% of the samples. The presence of condensation was associated with an increased risk of surfaces being contaminated by Aspergillus/Penicillium spp. and Cladosporium spp., whereas moisture within the building fabric (water ingress/rising damp) was only associated with increased risk of Aspergillus/Penicillium spp. Property type and energy efficiency levels were found to moderate the risk of indoor surfaces becoming contaminated with Aspergillus/Penicillium and Cladosporium which in turn was modified by the presence of condensation, water ingress and rising damp, consistent with previous literature. PMID:26546982

  13. Particle beam injection system

    DOEpatents

    Jassby, Daniel L.; Kulsrud, Russell M.

    1977-01-01

    This invention provides a poloidal divertor for stacking counterstreaming ion beams to provide high intensity colliding beams. To this end, method and apparatus are provided that inject high energy, high velocity, ordered, atomic deuterium and tritium beams into a lower energy, toroidal, thermal equilibrium, neutral, target plasma column that is magnetically confined along an endless magnetic axis in a strong restoring force magnetic field having helical field lines to produce counterstreaming deuteron and triton beams that are received bent, stacked and transported along the endless axis, while a poloidal divertor removes thermal ions and electrons all along the axis to increase the density of the counterstreaming ion beams and the reaction products resulting therefrom. By balancing the stacking and removal, colliding, strong focused particle beams, reaction products and reactions are produced that convert one form of energy into another form of energy.

  14. Intracytoplasmic sperm injection.

    PubMed

    Van Steirteghem, André; Devroey, P; Liebaers, I

    2002-01-25

    Intracytoplasmic sperm injection (ICSI) with ejaculated, epididymal or testicular spermatozoa was first successful in 1992 and has since become the widely accepted treatment for couples with severe male-factor infertility. The outcome of several thousands of ICSI cycles in terms of fertilization, embryo cleavage and implantation is similar to that for conventional in-vitro fertilization in couples with tubal or idiopathic infertility. To evaluate the important issue of safety of the new technique of ICSI, a prospective follow-up study of children born after ICSI was carried out. The aim was to compile data on karyotypes, congenital malformations, growth parameters and developmental milestones. Parents' agreement to genetic counseling was obtained, as well as prenatal diagnosis, followed by a physical examination of the children at 2 months, 1 and 2 years. Important outcome data to be examined comprise information on major and minor congenital malformations obtained prenatally or after birth, as well as on the further development of the children.

  15. Premixed direct injection nozzle

    DOEpatents

    Zuo, Baifang; Johnson, Thomas Edward; Lacy, Benjamin Paul; Ziminsky, Willy Steve

    2011-02-15

    An injection nozzle having a main body portion with an outer peripheral wall is disclosed. The nozzle includes a plurality of fuel/air mixing tubes disposed within the main body portion and a fuel flow passage fluidly connected to the plurality of fuel/air mixing tubes. Fuel and air are partially premixed inside the plurality of the tubes. A second body portion, having an outer peripheral wall extending between a first end and an opposite second end, is connected to the main body portion. The partially premixed fuel and air mixture from the first body portion gets further mixed inside the second body portion. The second body portion converges from the first end toward said second end. The second body portion also includes cooling passages that extend along all the walls around the second body to provide thermal damage resistance for occasional flame flash back into the second body.

  16. Propagating substorm injection fronts

    NASA Technical Reports Server (NTRS)

    Moore, T. E.; Arnoldy, R. L.; Feynman, J.; Hardy, D. A.

    1981-01-01

    It is argued that a series of two-satellite observations leads to a clarification of substorm plasma injection, in which boundary motion plays a major role. Emphasis is put on a type of event characterized by abrupt, dispersionless changes in electron intensity and a coincident perturbation that consists of both a field magnitude increase and a small rotation toward more dipolar orientation. Comparing plasma observations at two points, it is found that in active, preinjection conditions the two most important features of the plasma sheet are: (1) the low-energy convection boundary for near-zero energy particles, determined by the magnitude of the large-scale convection electric field; and (2) the precipitation-flow boundary layer between the hot plasma sheet and the atmospherically contaminated inner plasma sheet.

  17. Fuel injection pumping apparatus

    SciTech Connect

    Rouse, J.A.; Mowbray, D.F.

    1987-10-13

    A liquid fuel injection pumping apparatus is described comprising a rotary and axially movable fuel distributor member housed within a body, a reciprocable pumping plunger housed within a bore formed in the distributor member, cam means mounted in the body for effecting inward movement of the plunger as the distributor member rotates, passage means in the body and distributor member and stop means for limiting the extent of outward movement of the plunger. The extent of outward movement depends on the axial setting of the distributor member in the body, resilient means biasing the distributor member in one axial direction, a chamber defined in the body, means for controlling the fluid pressure in the chamber to control the axial setting of the distributor member.

  18. Steam injection method

    SciTech Connect

    Watkins, D.R.

    1986-02-25

    A method is described for injecting steam into a subterranean reservoir via a well penetrating the reservoir, comprising adding to steam generator feedwater used to generate the steam or adding to the steam, or adding to both the feedwater and the steam. The mixture consists of: (a) a compound selected from the group consisting of ammonium salts of inorganic acids, ammonium salts of carboxylic acids, quaternary ammonium halides, amine or substituted amine hydrochlorides, and mixtures thereof; and (b) a compound selected from the group consisting of ammonia, salts which decompose to form acid neutralizers or buffers having alkaline pH values, amides of carbamic acid or thiocarbamic acid and derivatives of such amides, tertiary carboxylic acid amides and their substituted and alkylated derivatives, and mixtures thereof.

  19. Injectors for Multipoint Injection

    NASA Technical Reports Server (NTRS)

    Prociw, Lev Alexander (Inventor); Ryon, Jason (Inventor)

    2015-01-01

    An injector for a multipoint combustor system includes an inner air swirler which defines an interior flow passage and a plurality of swirler inlet ports in an upstream portion thereof. The inlet ports are configured and adapted to impart swirl on flow in the interior flow passage. An outer air cap is mounted outboard of the inner swirler. A fuel passage is defined between the inner air swirler and the outer air cap, and includes a discharge outlet between downstream portions of the inner air swirler and the outer air cap for issuing fuel for combustion. The outer air cap defines an outer air circuit configured for substantially unswirled injection of compressor discharge air outboard of the interior flow passage.

  20. Diesel fuel injection system

    SciTech Connect

    Schechter, M.M.; Simko, A.O.

    1986-04-22

    A fuel injection pump is described of the multiple plunger spill port type for an automotive type internal combustion engine, the pump including at least four axially spaced engine camshaft driven pump plungers grouped in pairs and sequentially and in succession moved in one direction through a fuel pumping stroke and oppositely through a fuel intake stroke. A fuel pressurization/supply chamber is contiquous to the end of each plunger for pressurization of the fuel therein or supply of fuel thereto from a supply passage upon coordinate movement of the plunger, fill/spill passage means connected to a single fuel return spill port and in parallel flow relationship to each of the plunger bores as a function of the position of the plungers, each plunger having a pair of internal passages connected at all times to its chamber and alternately alignable with the supply or fill/spill passage means as a function of the position of the plunger. A fuel discharge passage is operatively connecting each of the chambers to an individual engine cylinder, a single spill port control valve movable to block or permit the spill of fuel through the spill port to a return line to control the pressurization of fuel in all of the fuel chambers and associated discharge passages, a single solenoid connected to the spill control valve for moving it to block or unblock the spill port, and a single shuttle valve operatively associated with all of the fill/spill passage means and spill port reciprocably movable between positions to sequentially connect the plunger chambers one at a time in succession to the spill port during the pumping pressurization stroke of its plunger for the injection of fuel to an individual cylinder while the other chambers are in various stages of being refilled with fuel and preparing for pressurization upon successive actuation of the plungers by the camshaft.

  1. The cost of unsafe injections.

    PubMed Central

    Miller, M. A.; Pisani, E.

    1999-01-01

    Unsafe injection practices are associated with substantial morbidity and mortality, particularly from hepatitis B and C and human immunodeficiency virus (HIV) infections. These inadvertently transmitted bloodborne diseases become manifest some considerable time after infection and hence may not be appropriately accounted for. Annually more than 1.3 million deaths and US$ 535 million are estimated to be due to current unsafe injection practices. With the global increase in the number of injections for vaccination and medical services, safer injecting technologies such as auto-disable syringes must be budgeted for. Investment in health education and safer disposal will also reduce infections associated with unsafe injecting practices. Safer injecting practices are more expensive than current less safe practices, but the additional cost is more than offset by the reduction in disease that would result. PMID:10593028

  2. Worldwide Injection Technique Questionnaire Study: Population Parameters and Injection Practices.

    PubMed

    Frid, Anders H; Hirsch, Laurence J; Menchior, Astrid R; Morel, Didier R; Strauss, Kenneth W

    2016-09-01

    From February 1, 2014, through June 30, 2015, 13,289 insulin-injecting patients from 423 centers in 42 countries took part in one of the largest surveys ever performed in diabetes. The goal was to assess patient characteristics, as well as historical and practical aspects of their injection technique. Results show that 4- and 8-mm needle lengths are each used by nearly 30% of patients and 5- and 6-mm needles each by approximately 20%. Higher consumption of insulin (as measured by total daily dose) is associated with having lipohypertrophy (LH), injecting into LH, leakage from the injection site, and failing to reconstitute cloudy insulin. Glycated hemoglobin values are, on average, 0.5% higher in patients with LH and are significantly higher with incorrect rotation of sites and with needle reuse. Glycated hemoglobin values are lower in patients who distribute their injections over larger injection areas and whose sites are inspected routinely. The frequencies of unexpected hypoglycemia and glucose variability are significantly higher in those with LH, those injecting into LH, those who incorrectly rotate sites, and those who reuse needles. Needles associated with diabetes treatment are the most commonly used medical sharps in the world. However, correct disposal of sharps after use is critically suboptimal. Many used sharps end up in public trash and constitute a major accidental needlestick risk. Use of these data should stimulate renewed interest in and commitment to optimizing injection practices in patients with diabetes.

  3. Worldwide Injection Technique Questionnaire Study: Population Parameters and Injection Practices.

    PubMed

    Frid, Anders H; Hirsch, Laurence J; Menchior, Astrid R; Morel, Didier R; Strauss, Kenneth W

    2016-09-01

    From February 1, 2014, through June 30, 2015, 13,289 insulin-injecting patients from 423 centers in 42 countries took part in one of the largest surveys ever performed in diabetes. The goal was to assess patient characteristics, as well as historical and practical aspects of their injection technique. Results show that 4- and 8-mm needle lengths are each used by nearly 30% of patients and 5- and 6-mm needles each by approximately 20%. Higher consumption of insulin (as measured by total daily dose) is associated with having lipohypertrophy (LH), injecting into LH, leakage from the injection site, and failing to reconstitute cloudy insulin. Glycated hemoglobin values are, on average, 0.5% higher in patients with LH and are significantly higher with incorrect rotation of sites and with needle reuse. Glycated hemoglobin values are lower in patients who distribute their injections over larger injection areas and whose sites are inspected routinely. The frequencies of unexpected hypoglycemia and glucose variability are significantly higher in those with LH, those injecting into LH, those who incorrectly rotate sites, and those who reuse needles. Needles associated with diabetes treatment are the most commonly used medical sharps in the world. However, correct disposal of sharps after use is critically suboptimal. Many used sharps end up in public trash and constitute a major accidental needlestick risk. Use of these data should stimulate renewed interest in and commitment to optimizing injection practices in patients with diabetes. PMID:27594185

  4. A comparison of molding procedures - Contact, injection and vacuum injection

    NASA Astrophysics Data System (ADS)

    Cathiard, G.

    1980-06-01

    The technical and economic aspects of the contact, injection and vacuum injection molding of reinforced plastic components are compared for the example of a tractor roof with a gel-coated surface. Consideration is given to the possibility of reinforcement, number of smooth faces, condition of the gel-coated surface, reliability, and labor and workplace requirements of the three processes, and advantages of molding between the mold and a countermold in smooth faces, reliability, labor requirements, working surface and industrial hygiene are pointed out. The times and labor requirements of each step in the molding cycles are examined, and material requirements and yields, investment costs, amortization and product cost prices of the processes are compared. It is concluded that, for the specific component examined, the processes of vacuum injection and injection molding appear very interesting, with injection molding processes resulting in lower cost prices than contact molding for any production volume.

  5. Effect of electrical field strength applied by PEF processing and storage temperature on the outgrowth of yeasts and moulds naturally present in a fresh fruit smoothie.

    PubMed

    Timmermans, R A H; Nederhoff, A L; Nierop Groot, M N; van Boekel, M A J S; Mastwijk, H C

    2016-08-01

    Pulsed electrical field (PEF) technology offers an alternative to thermal pasteurisation of high-acid fruit juices, by extending the shelf life of food products, while retaining its fresh taste and nutritional value. Substantial research has been performed on the effect of electrical field strength on the inactivation kinetics of spoilage and pathogenic micro-organisms and on the outgrowth of spoilage micro-organisms during shelf life. However, studies on the effect of electrical field strength on the inactivation and outgrowth of surviving populations during shelf life are missing. In this study, we assessed the influence of electrical field strength applied by PEF processing and storage temperature on the outgrowth of surviving yeast and mould populations naturally present in fresh fruit smoothie in time. Therefore, an apple-strawberry-banana smoothie was treated in a continuous-flow PEF system (130L/h), using similar inlet and outlet conditions (preheating temperature 41°C, maximum temperature 58°C) to assure that the amount of energy across the different conditions was kept constant. Smoothies treated with variable electrical field strengths (13.5, 17.0, 20.0 and 24.0kV/cm) were compared to smoothies without treatment for outgrowth of yeasts and moulds. Outgrowth of yeasts and moulds stored at 4°C and 7°C was analysed by plating and visual observation and yeast growth was modelled using the modified logistic growth model (Zwietering model). Results showed that the intensity of the electrical field strength had an influence on the degree of inactivation of yeast cells, resulting in a faster outgrowth over time at lower electrical field strength. Outgrowth of moulds over time was not affected by the intensity of the electrical field strength used. Application of PEF introduces a trade-off between type of spoilage: in untreated smoothie yeasts lead to spoilage after 8days when stored at 4 or 7°C, whereas in PEF treated smoothie yeasts were (partly

  6. Sensor for Injection Rate Measurements

    PubMed Central

    Marcic, Milan

    2006-01-01

    A vast majority of the medium and high speed Diesel engines are equipped with multi-hole injection nozzles nowadays. Inaccuracies in workmanship and changing hydraulic conditions in the nozzles result in differences in injection rates between individual injection nozzle holes. The new deformational measuring method described in the paper allows injection rate measurement in each injection nozzle hole. The differences in injection rates lead to uneven thermal loads of Diesel engine combustion chambers. All today known measuring method, such as Bosch and Zeuch give accurate results of the injection rate in diesel single-hole nozzles. With multihole nozzles they tell us nothing about possible differences in injection rates between individual holes of the nozzle. At deformational measuring method, the criterion of the injected fuel is expressed by the deformation of membrane occurring due to the collision of the pressure wave against the membrane. The pressure wave is generated by the injection of the fuel into the measuring space. For each hole of the nozzle the measuring device must have a measuring space of its own into which fuel is injected as well as its measuring membrane and its own fuel outlet. During measurements procedure the measuring space must be filled with fuel to maintain an overpressure of 5 kPa. Fuel escaping from the measuring device is conducted into the graduated cylinders for measuring the volumetric flow through each hole of the nozzle.The membrane deformation is assessed by strain gauges. They are glued to the membrane and forming the full Wheatstone's bridge. We devoted special attention to the membrane shape and temperature compensation of the strain gauges.

  7. The RHIC Injection Kicker

    NASA Astrophysics Data System (ADS)

    Hahn, H.; Tuozzolo, J. E.; Tsoupas, N.

    1997-05-01

    Beam transfer from the AGS to RHIC is performed in single-bunch mode. Close spacing of the bunches in the collider requires an injection kicker with a rise time of <95 nsec, suggesting adoption of a travelling wave solution. The required vertical kick of 0.186 T.m is provided by 4 units, each 1.12 m long with a 48.4× 48.4 mm aperture and operated at 1.6 kA. The kicker is constructed as a ``C'' cross section magnet, in which ferrite and high-permittivity ( ~ 100) dielectric sections alternate. The dielectric blocks provide the capacity necessary for the nominally 25 Ohm characteristic impedance of the travelling wave structure, but impose the practical limit on the peak voltage, and thus current, achievable. Computer studies to minimize local electric field enhancements resulted in a configuration capable of holding >50 kV, with adequate safety margin over the nominal 40 kV. Tests indicated the possibility of lowering the nominal voltage by operating mismatched into 20 Ohm terminations without degrading the pulse shape. In this paper, the experience gained in the fabrication of the four kicker units for the ``Sextant Test'' and the results from various single-unit tests and operation in beam are reported.

  8. The RHIC injection kicker

    SciTech Connect

    Hahn, H.; Tsoupas, N.; Tuozzolo, J.E.

    1997-07-01

    Beam transfer from the AGS to RHIC is performed in single-bunch mode. Close spacing of the bunches in the collider requires an injection kicker with a rise time of <90 nsec, suggesting adoption of a travelling wave structure. The required vertical kick of 0.186 t{center_dot}m is provided by 4 magnets, each 1.12 m long with a 48.4 x 48.4 mm aperture and operated at 1.6 kA. The kicker is constructed as a {open_quotes}C{close_quotes} cross section magnet, in which ferrite and high-permittivity dielectric sections alternate. The dielectric blocks provide the capacity necessary for the nominally 25 {Omega} characteristic impedance of the travelling wave structure, but impose the practical limit on the peak voltage, and thus current, achievable. Computer studies to minimize local electric field enhancements resulted in a configuration capable of holding {approximately} 50 kV, with adequate safety margin over the nominal 40 kV. Equivalent circuit analysis indicated the possibility of lowering the nominal voltage by operating mismatched into 20 {Omega} terminations without degrading the pulse shape. In this paper, the experience gained in the fabrication of the production units and the results from various single-unit tests and operation of four kickers with beam in the {open_quotes}Sextant Test{close_quotes} are reported.

  9. SNS Injection Foil Experience

    SciTech Connect

    Cousineau, Sarah M; Galambos, John D; Kim, Sang-Ho; Ladd, Peter; Luck, Chris; Peters, Charles C; Polsky, Yarom; Shaw, Robert W; Macek, Robert James; Raparia, Deepak; Plum, Michael A

    2010-01-01

    The Spallation Neutron Source comprises a 1 GeV, 1.4 MW linear accelerator followed by an accumulator ring and a liquid mercury target. To manage the beam loss caused by the H0 excited states created during the H charge exchange injection into the accumulator ring, the stripper foil is located inside one of the chicane dipoles. This has some interesting consequences that were not fully appreciated until the beam power reached about 840 kW. One consequence was sudden failure of the stripper foil system due to convoy electrons stripped from the incoming H beam, which circled around to strike the foil bracket and cause bracket failure. Another consequence is that convoy electrons can reflect back up from the electron catcher and strike the foil and bracket. An additional contributor to foil system failure is vacuum breakdown due to the charge developed on the foil by secondary electron emission. In this paper we will detail these and other interesting failure mechanisms, and describe the improvements we have made to mitigate them.

  10. Fuel injection pump

    SciTech Connect

    Iiyama, A.; Nishimura, T.

    1988-12-06

    This patent describes a fuel injection pump comprising: (a) engageable first and second cam members, the first cam member reciprocating axially as the first cam member moves angularly relative to the second cam member when the first and second cam members are in engagement; (b) means for urging the first cam member toward the second cam member to engage the first and second cam members; (c) a plunger connected to the first cam member for reciprocation with the first cam member, the plunger defining at least a part of a pumping chamber, the pumping chamber contracting and expanding as the plunger reciprocates; (d) means for allowing fuel to move into the pumping chamber as the pumping chamber expands in a fuel intake stroke; (e) means for allowing the fuel to move out of the pumping chamber as the pumping chamber contracts in a fuel compression stroke; and (f) means for resisting movement of the plunger in at least part of the fuel compression stroke and relieving resistance to the movement of the plunger in the fuel intake stroke wherein the resisting means comprises a piston slidably mounted on the plunger, a spring urging the piston to seat the piston on a shoulder on the plunger so that the piston reciprocates as the plunger reciprocates, wherein the piston is seated on the shoulder in the fuel compression stroke and separates from the shoulder against the force of the spring in the fuel intake stroke, a second fluid chamber at least partially defined by the piston.

  11. Blast furnace injection symposium: Proceedings

    SciTech Connect

    1996-12-31

    These proceedings contain 14 papers related to blast furnace injection issues. Topics include coal quality, coal grinding, natural gas injection, stable operation of the blast furnace, oxygen enrichment, coal conveying, and performance at several steel companies. All papers have been processed separately for inclusion on the data base.

  12. Injectable Foams for Regenerative Medicine

    PubMed Central

    Prieto, Edna M.; Page, Jonathan M.; Harmata, Andrew J.

    2013-01-01

    The design of injectable biomaterials has attracted considerable attention in recent years. Many injectable biomaterials, such as hydrogels and calcium phosphate cements, have nanoscale pores that limit the rate of cellular migration and proliferation. While introduction of macroporosity has been suggested to increase cellular infiltration and tissue healing, many conventional methods for generating macropores often require harsh processing conditions that preclude their use in injectable foams. In recent years, processes such as porogen leaching, gas foaming, and emulsion-templating have been adapted to generate macroporosity in injectable calcium phosphate cements, hydrogels, and hydrophobic polymers. While some of the more mature injectable foam technologies have been evaluated in clinical trials, there are challenges remaining to be addressed, such as the biocompatibility and ultimate fate of the sacrificial phase used to generate pores within the foam after it sets in situ. Furthermore, while implantable scaffolds can be washed extensively to remove undesirable impurities, all of the components required to synthesize injectable foams must be injected into the defect. Thus, every compound in the foam must be biocompatible and non-cytotoxic at the concentrations utilized. As future research addresses these critical challenges, injectable macroporous foams are anticipated to have an increasingly significant impact on improving patient outcomes for a number of clinical procedures. PMID:24127230

  13. Amphotericin B Lipid Complex Injection

    MedlinePlus

    Amphotericin B lipid complex injection is used to treat serious, possibly life-threatening fungal infections in people who did not respond or are ... tolerate conventional amphotericin B therapy. Amphotericin B lipid complex injection is in a class of medications called ...

  14. Main tank injection pressurization program

    NASA Technical Reports Server (NTRS)

    Cady, E. C.; Kendle, D. W.

    1972-01-01

    Computer program predicts performance of fluorine-hydrogen main tank injection pressurization system for full range of liquid-hydrogen-fueled space vehicles. Analytical model includes provisions for heat transfer, injectant jet penetration, and ullage gas mixing. Analysis predicts GF2 usage, ullage gas and tank wall temperatures, and LH2 evaporation.

  15. Urine Pretreat Injection System

    NASA Technical Reports Server (NTRS)

    1995-01-01

    A new method of introducing the OXONE (Registered Trademark) Monopersulfate Compound for urine pretreat into a two-phase urine/air flow stream has been successfully tested and evaluated. The feasibility of this innovative method has been established for purposes of providing a simple, convenient, and safe method of handling a chemical pretreat required for urine processing in a microgravity space environment. Also, the Oxone portion of the urine pretreat has demonstrated the following advantages during real time collection of 750 pounds of urine in a Space Station design two-phase urine Fan/Separator: Eliminated urine precipitate buildup on internal hardware and plumbing; Minimized odor from collected urine; and Virtually eliminated airborne bacteria. The urine pretreat, as presently defined for the Space Station program for proper downstream processing of urine, is a two-part chemical treatment of 5.0 grams of Oxone and 2.3 ml of H2SO4 per liter of urine. This study program and test demonstrated only the addition of the proper ratio of Oxone into the urine collection system upstream of the Fan/Separator. This program was divided into the following three major tasks: (1) A trade study, to define and recommend the type of Oxone injection method to pursue further; (2) The design and fabrication of the selected method; and (3) A test program using high fidelity hardware and fresh urine to demonstrate the method feasibility. The trade study was conducted which included defining several methods for injecting Oxone in different forms into a urine system. Oxone was considered in a liquid, solid, paste and powered form. The trade study and the resulting recommendation were presented at a trade study review held at Hamilton Standard on 24-25 October 94. An agreement was reached at the meeting to continue the solid tablet in a bag concept which included a series of tablets suspended in the urine/air flow stream. These Oxone tablets would slowly dissolve at a controlled rate

  16. Facile and cost-effective production of microscale PDMS architectures using a combined micromilling-replica moulding (μMi-REM) technique.

    PubMed

    Carugo, Dario; Lee, Jeong Yu; Pora, Anne; Browning, Richard J; Capretto, Lorenzo; Nastruzzi, Claudio; Stride, Eleanor

    2016-02-01

    We describe a cost-effective and simple method to fabricate PDMS-based microfluidic devices by combining micromilling with replica moulding technology. It relies on the following steps: (i) microchannels are milled in a block of acrylic; (ii) low-cost epoxy adhesive resin is poured over the milled acrylic block and allowed to cure; (iii) the solidified resin layer is peeled off the acrylic block and used as a mould for transferring the microchannel architecture onto a PDMS layer; finally (iv) the PDMS layer is plasma bonded to a glass surface. With this method, microscale architectures can be fabricated without the need for advanced technological equipment or laborious and time-consuming intermediate procedures. In this manuscript, we describe and validate the microfabrication procedure, and we illustrate its applicability to emulsion and microbubble production. PMID:26747434

  17. Apatitic connecting rings in moulds of Baculites sp. from the middle part of the Smoky Hill Member, Niobrara Chalk (Santonian), of western Kansas

    USGS Publications Warehouse

    Hasenmueller, W.A.; Hattin, D.E.

    1985-01-01

    Moulds of Baculites sp. are common in the Smoky Hill Member but only five known specimens contain connecting rings that have been preserved because of mineralisation by carbonate apatite. Analysis of four of these specimens suggests that the connecting rings were originally composed of organic material and were mineralised during early diagenesis. Thin sections and scanning electron microscopy demonstrate that the connecting rings had a two-layered structure consisting of a thick siphuncular wall and a thin pellicle. ?? 1985.

  18. One-step in-mould modification of PDMS surfaces and its application in the fabrication of self-driven microfluidic channels.

    PubMed

    Fatona, Ayodele; Chen, Yang; Reid, Michael; Brook, Michael A; Moran-Mirabal, Jose M

    2015-11-21

    Poly(dimethylsiloxane) (PDMS) has become the material of choice for fabricating microfluidic channels for lab-on-a-chip applications. Key challenges that limit the use of PDMS in microfluidic applications are its hydrophobic nature, and the difficulty in obtaining stable surface modifications. Although a number of approaches exist to render PDMS hydrophilic, they suffer from reversion to hydrophobicity and, frequently, surface cracking or roughening. In this study, we describe a one-step in-mould method for the chemical modification of PDMS surfaces, and its use to assess the ability of different surfactants to render PDMS surfaces hydrophilic. Thin films of ionic and non-ionic surfactants were patterned into an array format, transferred onto silicone pre-polymer, and subsequently immobilized onto the PDMS surface during vulcanization. The hydrophilicity of the resulting surfaces was assessed by contact angle measurements. The wettability was observed to be dependent on the chemical structure of the surfactants, their concentration and interactions with PDMS. The morphology of modified PDMS surfaces and their change after wetting and drying cycles were visualized using atomic force microscopy. Our results show that while all surfactants tested can render PDMS surfaces hydrophilic through the in-mould modification, only those modified with PEG-PDMS-PEG copolymer surfactants were stable over wetting/dying cycles and heat treatments. Finally, the in-mould functionalization approach was used to fabricate self-driven microfluidic devices that exhibited steady flow rates, which could be tuned by the device geometry. It is anticipated that the in-mould method can be applied to a range of surface modifications for applications in analytical separations, biosensing, cell isolation and small molecule discovery. PMID:26400365

  19. One-step in-mould modification of PDMS surfaces and its application in the fabrication of self-driven microfluidic channels.

    PubMed

    Fatona, Ayodele; Chen, Yang; Reid, Michael; Brook, Michael A; Moran-Mirabal, Jose M

    2015-11-21

    Poly(dimethylsiloxane) (PDMS) has become the material of choice for fabricating microfluidic channels for lab-on-a-chip applications. Key challenges that limit the use of PDMS in microfluidic applications are its hydrophobic nature, and the difficulty in obtaining stable surface modifications. Although a number of approaches exist to render PDMS hydrophilic, they suffer from reversion to hydrophobicity and, frequently, surface cracking or roughening. In this study, we describe a one-step in-mould method for the chemical modification of PDMS surfaces, and its use to assess the ability of different surfactants to render PDMS surfaces hydrophilic. Thin films of ionic and non-ionic surfactants were patterned into an array format, transferred onto silicone pre-polymer, and subsequently immobilized onto the PDMS surface during vulcanization. The hydrophilicity of the resulting surfaces was assessed by contact angle measurements. The wettability was observed to be dependent on the chemical structure of the surfactants, their concentration and interactions with PDMS. The morphology of modified PDMS surfaces and their change after wetting and drying cycles were visualized using atomic force microscopy. Our results show that while all surfactants tested can render PDMS surfaces hydrophilic through the in-mould modification, only those modified with PEG-PDMS-PEG copolymer surfactants were stable over wetting/dying cycles and heat treatments. Finally, the in-mould functionalization approach was used to fabricate self-driven microfluidic devices that exhibited steady flow rates, which could be tuned by the device geometry. It is anticipated that the in-mould method can be applied to a range of surface modifications for applications in analytical separations, biosensing, cell isolation and small molecule discovery.

  20. Low-pressure injection molding

    SciTech Connect

    Mangels, J.A. )

    1994-05-01

    Ceramic injection molding experienced a revival in the 1970s and 1980s with the application of ceramics for gas turbine components. Concurrently, techniques were being developed for the injection molding of powdered metal compositions into complex shaped articles. The impetus for the development of injection molding as a ceramic fabrication process lay in the potential to produce complex-shaped components to near-net shape. In the ceramic injection molding process, ceramic powders are processed to obtain the desired particle size, distribution and morphology and blended to obtain a homogeneous distribution. These powders are then mixed with the organic binders, generally in a heated, highshear mixer at temperatures above the melting point of the organic binders. The injection molding mix is pelletized, cooled and fed into an injection molding machine. The molding mix is reheated to a fluid state and injected under high pressure (7--70 MPa) into a die cavity. The molded part is removed from the tooling after the molding mix has solidified in the die. The organic binders are then removed from the component at temperatures up to 400 C, generally by some combination of wicking and thermal decomposition. Finally, the component is sintered to obtain its final ceramic properties, using conventional ceramic processes.

  1. Detection of volatile metabolites of moulds isolated from a contaminated library.

    PubMed

    Micheluz, Anna; Manente, Sabrina; Rovea, Manuela; Slanzi, Debora; Varese, Giovanna Cristina; Ravagnan, Giampietro; Formenton, Gianmaria

    2016-09-01

    The principal fungal species isolated from a contaminated library environment were tested for their microbial volatile organic compound (MVOC) production ability. Aspergillus creber, A. penicillioides, Cladosporium cladosporioides, Eurotium chevalieri, E. halophilicum, Penicillium brevicompactum and P. chrysogenum were cultivated on suitable culture media inside sample bottles specifically designed and created for direct MVOC injection to a GC-MS instrument. The fungal emissions were monitored over several weeks to detect changes with the aging of the colonies, monitored also by respirometric tests. A total of 55 different MVOCs were detected and isopropyl alcohol, 3-methyl-1-butanol and 2-butanone were the principal compounds in common between the selected fungal species. Moreover, 2,4-dimethylheptane, 1,4-pentadiene, styrene, ethanol, 2-methyl-1-butanol, acetone, furan and 2-methylfuran were the most detected compounds. For the first time, the MVOC production for particular fungal species was detected. The species A. creber, which belongs to the recently revised group Aspergillus section Versicolores, was characterized by the production of ethanol, furan and 1,4-pentadiene. For the xerophilic fungus E. halophilicum, specific production of acetone, 2-butanone and 1,4-pentadiene was detected, supported also by respirometric data. The results demonstrated the potential use of this method for the detection of fungal contamination phenomena inside Cultural Heritage's preservation environments. PMID:27392938

  2. NEUTRAL-BEAM INJECTION

    SciTech Connect

    Kunkel, W.B.

    1980-06-01

    The emphasis in the preceding chapters has been on magnetic confinement of high temperature plasmas. The question of production and heating of such plasmas has been dealt with relatively more briefly. It should not be inferred, however, that these matters must therefore be either trivial or unimportant. A review of the history reveals that in the early days all these aspects of the controlled fusion problem were considered to be on a par, and were tackled simultaneously and with equal vigor. Only the confinement problem turned out to be much more complex than initially anticipated, and richer in challenge to the plasma physicist than the questions of plasma production and heating. On the other hand, the properties of high-temperature plasmas and plasma confinement can only be studied experimentally after the problems of production and of heating to adequate temperatures are solved. It is the purpose of this and the next chapter to supplement the preceding discussions with more detail on two important subjects: neutral-beam injection and radio-frequency heating. These are the major contenders for heating in present and future tokamak and mirror fusion experiments, and even in several proposed reactors. For neutral beams we emphasize here the technology involved, which has undergone a rather remarkable development. The physics of particle and energy deposition in the plasma, and the discussion of the resulting effects on the confined plasma, have been included in previous chapters, and some experimental results are quoted there. Other heating processes of relevance to fusion are mentioned elsewhere in this book, in connection with the experiments where they are used: i.e. ohmic heating, adiabatic compression heating, and alpha-particle heating in Chapter 3 by H.P. Furth; more ohmic heating in Chapter 7, and shock-implosion heating, laser heating, and relativistic-electron beam heating in Chapter 8, both by W. E. Quinn. These methods are relatively straightforward in

  3. Ultra-rapid preparation of total genomic DNA from isolates of yeast and mould using Whatman FTA filter paper technology - a reusable DNA archiving system.

    PubMed

    Borman, Andrew M; Linton, Christopher J; Miles, Sarah-Jane; Campbell, Colin K; Johnson, Elizabeth M

    2006-08-01

    Conventional methods for purifying PCR-grade fungal genomic DNA typically require cell disruption (either physical or enzymatic) coupled with laborious organic extraction and precipitation stages, or expensive column-based technologies. Here we present an easy and extremely rapid method of preparing yeast and mould genomic DNAs from living cultures using Whatman FTA filter matrix technology. Aqueous suspensions of yeast cells or hyphal fragments and conidia (in the case of moulds) are applied directly (or after freeze-thawing) to dry FTA filters. Inoculated filters are then subjected to brief microwave treatment, to dry the filters and inactivate the organisms. Filter punches are removed, washed rapidly, dried and placed directly into PCR reactions. We show that this procedure inactivated all of the 38 yeast and 75 mould species tested, and generated PCR-grade DNA preparations in around 15 minutes. A total of 218 out of 226 fungal isolates tested liberated amplifiable DNA after application to FTA filters. Detection limits with yeast cultures were approximately 10 colony-forming units per punch. Moreover, we demonstrate that filter punches can be recovered after PCR, washed and used in fresh PCR reactions without detectable cross-contamination. Whatman FTA technology thus represents a cheap, ultra-rapid method of fungal genomic DNA preparation, and also potentially represents a powerful fungal DNA archiving and storage system. PMID:16882605

  4. The Case for Synthetic Injectables.

    PubMed

    Joseph, John H

    2015-11-01

    There are several different classes of synthetic dermal fillers and volume enhancers including semipermanent and permanent products available in the United States. Based on clinical and scientific evidence, this article reviews the chemical and polymeric properties, clinical data, patient selection, indications for use, injection technique, and adverse event profiles of permanent synthetic injectables currently used in clinical practice in the United States: medical-grade liquid injectable silicone and polymethyl methacrylate. Understanding the unique characteristics of these two products reinforces the advantages and disadvantages of each, including under what circumstances they should be used and why they perform the way they do. PMID:26505540

  5. Injection nozzle for a turbomachine

    SciTech Connect

    Uhm, Jong Ho; Johnson, Thomas Edward; Kim, Kwanwoo

    2012-09-11

    A turbomachine includes a compressor, a combustor operatively connected to the compressor, an end cover mounted to the combustor, and an injection nozzle assembly operatively connected to the combustor. The injection nozzle assembly includes a first end portion that extends to a second end portion, and a plurality of tube elements provided at the second end portion. Each of the plurality of tube elements defining a fluid passage includes a body having a first end section that extends to a second end section. The second end section projects beyond the second end portion of the injection nozzle assembly.

  6. Injectable calcium hydroxylapatite microspheres (Radiesse).

    PubMed

    Ridenour, Brock; Kontis, Theda C

    2009-05-01

    Injectable calcium hydroxylapatite (Radiesse) received FDA approval in 2006 for the correction of facial lipoatrophy and moderate to severe facial wrinkles. This product consists of microspheres of a synthetic bone suspended in a methylcellulose gel matrix. Because the product is thicker than the hyaluronic acids, it is used for the correction of moderate to severe wrinkles, such as deep nasolabial folds. It is also used "off-label" to treat multiple areas of the face, nose, and hands. Radiesse is injected into the subdermal plane, and correction lasts approximately 1 year after injection.

  7. The Case for Synthetic Injectables.

    PubMed

    Joseph, John H

    2015-11-01

    There are several different classes of synthetic dermal fillers and volume enhancers including semipermanent and permanent products available in the United States. Based on clinical and scientific evidence, this article reviews the chemical and polymeric properties, clinical data, patient selection, indications for use, injection technique, and adverse event profiles of permanent synthetic injectables currently used in clinical practice in the United States: medical-grade liquid injectable silicone and polymethyl methacrylate. Understanding the unique characteristics of these two products reinforces the advantages and disadvantages of each, including under what circumstances they should be used and why they perform the way they do.

  8. Non-plugging injection valve

    DOEpatents

    Carey, Jr., Henry S.

    1985-01-01

    A valve for injecting fluid into a conduit carrying a slurry subject to separation to form deposits capable of plugging openings into the conduit. The valve comprises a valve body that is sealed to the conduit about an aperture formed through the wall of the conduit to receive the fluid to be injected and the valve member of the valve includes a punch portion that extends through the injection aperture to the flow passage, when the valve is closed, to provide a clear channel into the conduit, when the valve is opened, through deposits which might have formed on portions of the valve adjacent the conduit.

  9. NSLS-II INJECTION CONCEPT.

    SciTech Connect

    SHAFTAN, T.; PINAYEV, I.; ROSE, J.; WANG, X.J.; ET AL.

    2005-05-16

    Currently the facility upgrade project is in progress at the NSLS (at Brookhaven National Laboratory). The goal of the NSLS-II is a 3 GeV ultra-low-emittance storage ring that will increase radiation brightness by three orders of magnitude over that of the present NSLS X-ray ring. The low emittance of the high brightness ring's lattice results in a short lifetime, so that a top-off injection mode becomes an operational necessity. Therefore, the NSLS-II injection system must provide, and efficiently inject, an electron beam at a high repetition rate. In this paper, we present our concept of the NSLS-II injection system and discuss the conditions for, and constraints on, its design.

  10. Epidural Injections for Spinal Pain

    MedlinePlus

    ... located outside the dural membrane. Steroids, anesthetics and anti-inflammatory medications are typically delivered in an epidural injection. ... create different effects for patients. Corticosteroids act as anti-inflammatory agents, reducing swelling and nerve irritation to allow ...

  11. Comparison of different methods for the recovery of DNA from spores of mycotoxin-producing moulds in spiked food samples.

    PubMed

    Grube, S; Schönling, J; Prange, A

    2015-06-01

    Several food samples were spiked with fungal conidia to test the efficiency of different cell disruption methods and DNA extraction kits for subsequent molecular detection. For disrupting the firm cell walls of the spores, two different pretreatment methods, namely sonication and bead beating, were tested against no pretreatment. The subsequent DNA extraction and purification was performed using three different DNA extraction methods, which are based on a diverse combination of extraction principles, such as precipitation, thermic-enzymatic lysis, pH-enhancement and bonding with a silica membrane. The aim of the study was to find out the suitable pretreatment and DNA extraction method for the recovery of detectable amounts of fungal DNA from different food matrices. Significance and impact of the study: The choice of 'ready-to-use' commercial kits and methods has been of great importance regarding the recovery of extracted DNA. However, these commercially available kits are neither effective nor time-efficient when extracting DNA from fungal spores embedded in complex food matrices. Different extraction principles were compared and their effectiveness tested using real-time PCR. The combination of different principles for the extraction and purification of DNA was found as the most efficient method (quantity and purity) to obtain DNA from moulds and their spores from food samples.

  12. The influence of the mould cooling temperature on the surface appearance and the internal quality of ESR ingots

    NASA Astrophysics Data System (ADS)

    Kubin, M.; Ofner, B.; Holzgruber, H.; Schneider, R.; Enzenhofer, D.; Filzwieser, A.; Konetschnik, S.

    2016-07-01

    One of the main benefits of the ESR process is to obtain an ingot surface which is smooth and allows a subsequent forging operation without any surface dressing. The main influencing factor on surface quality is the precise controlling of the process such as melt rate and electrode immersion depth. However, the relatively strong cooling effect of water as a cooling medium can result in the solidification of the meniscus of the liquid steel on the boundary liquid steel and slag which is most likely the origin of surface defects. The usage of different cooling media like ionic liquids, a salt solution which can be heated up to 250°C operating temperature might diminish the meniscus solidification phenomenon. This paper shows the first results of the usage of an ionic liquid as a mould cooling medium. In doing so, 210mm diameter ESR ingots were produced with the laboratory scale ESR furnace at the university of applied science using an ionic liquid cooling device developed by the company METTOP. For each trial melt different inlet and outlet temperatures of the ionic liquid were chosen and the impact on the surface appearance and internal quality were analyzed. Furthermore the influence on the energy balance is also briefly highlighted. Ultimately, an effect of the usage of ionic liquids as a cooling medium could be determined and these results will be described in detail within the scope of this paper.

  13. 3D evaluation of maxillary arches in unilateral cleft lip and palate patients treated with nasoalveolar moulding vs. Hotz's plate.

    PubMed

    Cerón-Zapata, A M; López-Palacio, A M; Rodriguez-Ardila, M J; Berrio-Gutiérrez, L M; De Menezes, M; Sforza, C

    2016-02-01

    To compare the three-dimensional changes occurring in the maxillary arch during the use of modified pre-surgical nasoalveolar moulding (PNAM) and Hotz's plate. A clinical trial including 32 children with unilateral cleft lip and palate (UCLP), 16 treated with Hotz's plate and 16 with PNAM, was performed. Impressions of the maxillary arches were taken: A. prior to pre-surgical orthopaedics, B. before cheiloplasty and C. after cheiloplasty. Models were digitised using a stereophotogrammetric instrument, and geodesic distances were calculated: anterior, canine and posterior widths of the arch, and lengths and cleft depths of the larger and shorter segments. The time and treatment effects were assessed by two-factor anova. A significant effect of treatment was found for cleft depth at the larger segment: children treated with Hotz's plate had significantly deeper cleft than children treated with PNAM. All distances significantly changed during time: the anterior and canine widths decreased, while the posterior width, the lengths and depths of the cleft segments increased. Significant treatment per time interactions was found. The anterior and canine widths reduced more with PNAM between time points A and B while Hotz's treatment was more effective between B and C. The shorter segment depth increased more between B and C with PNAM, and between A and B with Hotz's plate. During pre-surgical orthopaedics, therapy with PNAM obtained the best results in reducing the width at the anterior segment of the cleft. This treatment gave a lower increase in cleft depth than treatment with Hotz's plate.

  14. Midface volumization with injectable fillers.

    PubMed

    Tan, Marietta; Kontis, Theda C

    2015-05-01

    The aging midface has long been overlooked in cosmetic surgery. Our understanding of facial aging in terms of 3 dimensions has placed increased importance on volume restoration. Although an "off-label" indication for most fillers in this facial region, volumization of the midface with injectable fillers is usually a safe and straightforward procedure technically. Injectors, nevertheless, need to have an excellent understanding of facial anatomy and the characteristics of the injected products should problems arise.

  15. Subcutaneous or intramuscular insulin injections.

    PubMed Central

    Smith, C P; Sargent, M A; Wilson, B P; Price, D A

    1991-01-01

    To find out whether diabetic children may inject their insulin intramuscularly rather than subcutaneously, a random sample of 32 patients aged 4.3-17.9 (median 11.3) years was studied. Distance from skin to muscle fascia was measured by ultrasonography at standard injection sites on the outer arm, anterior and lateral thigh, abdomen, buttock, and calf. Distances were greater in girls (n = 15) than in boys (n = 17). Whereas in most boys the distances were less than the length of the needle (12.5 mm) at all sites except the buttock, in most girls, the distances were greater than 12.5 mm except over the calf. Over the fascial plane just lateral to the rectus muscle the distance from skin to peritoneum was less than 12.5 mm in 14 of the 17 boys and one of the 15 girls. Twenty five of the 32 children injected at an angle of 90 degrees, and 24 children raised a skinfold before injecting. By raising a skinfold over the anterior thigh, the distance from skin to muscle fascia was increased by 19% (range 0-38%). We conclude that most boys and some girls who use the perpendicular injection technique may often inject insulin into muscle, and perhaps on occasions into the peritoneal cavity. PMID:1863105

  16. Adaptive engine injection for emissions reduction

    DOEpatents

    Reitz, Rolf D. : Sun, Yong

    2008-12-16

    NOx and soot emissions from internal combustion engines, and in particular compression ignition (diesel) engines, are reduced by varying fuel injection timing, fuel injection pressure, and injected fuel volume between low and greater engine loads. At low loads, fuel is injected during one or more low-pressure injections occurring at low injection pressures between the start of the intake stroke and approximately 40 degrees before top dead center during the compression stroke. At higher loads, similar injections are used early in each combustion cycle, in addition to later injections which preferably occur between about 90 degrees before top dead center during the compression stroke, and about 90 degrees after top dead center during the expansion stroke (and which most preferably begin at or closely adjacent the end of the compression stroke). These later injections have higher injection pressure, and also lower injected fuel volume, than the earlier injections.

  17. Fluid injection and induced seismicity

    NASA Astrophysics Data System (ADS)

    Kendall, Michael; Verdon, James

    2016-04-01

    The link between fluid injection, or extraction, and induced seismicity has been observed in reservoirs for many decades. In fact spatial mapping of low magnitude events is routinely used to estimate a stimulated reservoir volume. However, the link between subsurface fluid injection and larger felt seismicity is less clear and has attracted recent interest with a dramatic increase in earthquakes associated with the disposal of oilfield waste fluids. In a few cases, hydraulic fracturing has also been linked to induced seismicity. Much can be learned from past case-studies of induced seismicity so that we can better understand the risks posed. Here we examine 12 case examples and consider in particular controls on maximum event size, lateral event distributions, and event depths. Our results suggest that injection volume is a better control on maximum magnitude than past, natural seismicity in a region. This might, however, simply reflect the lack of baseline monitoring and/or long-term seismic records in certain regions. To address this in the UK, the British Geological Survey is leading the deployment of monitoring arrays in prospective shale gas areas in Lancashire and Yorkshire. In most cases, seismicity is generally located in close vicinity to the injection site. However, in some cases, the nearest events are up to 5km from the injection point. This gives an indication of the minimum radius of influence of such fluid injection projects. The most distant events are never more than 20km from the injection point, perhaps implying a maximum radius of influence. Some events are located in the target reservoir, but most occur below the injection depth. In fact, most events lie in the crystalline basement underlying the sedimentary rocks. This suggests that induced seismicity may not pose a leakage risk for fluid migration back to the surface, as it does not impact caprock integrity. A useful application for microseismic data is to try and forecast induced seismicity

  18. Staged direct injection diesel engine

    DOEpatents

    Baker, Quentin A.

    1985-01-01

    A diesel engine having staged injection for using lower cetane number fuels than No. 2 diesel fuel. The engine includes a main fuel injector and a pilot fuel injector. Pilot and main fuel may be the same fuel. The pilot injector injects from five to fifteen percent of the total fuel at timings from 20.degree. to 180.degree. BTDC depending upon the quantity of pilot fuel injected, the fuel cetane number and speed and load. The pilot fuel injector is directed toward the centerline of the diesel cylinder and at an angle toward the top of the piston, avoiding the walls of the cylinder. Stratification of the early injected pilot fuel is needed to reduce the fuel-air mixing rate, prevent loss of pilot fuel to quench zones, and keep the fuel-air mixture from becoming too fuel lean to become effective. In one embodiment, the pilot fuel injector includes a single hole for injection of the fuel and is directed at approximately 48.degree. below the head of the cylinder.

  19. Rapid response gas injection technique.

    PubMed

    Komar, J J

    1978-10-01

    A unique gas injection technique has been developed which has rapid response and is capable of supplying gas flowrates up to 5 kg/s at pressures of 3.45 x 10(6) N/m(2). Rise times to equilibrium pressure varied from 7 to 15 ms over the operating range. The reliability, excellent repeatibility, and uniform pressure have shown the system to be superior to previously utilized expansion tube gas injection techniques associated with very short duration impulse test facilities. The achievement of precise timing control of the valve opening permitted a complex electronic sequencing of facility events. An additional feature of automatic gas supply shut-off resulted in significant cost savings when rare gases were used as injectants. PMID:18698978

  20. The Effects of Temperature Variation on the Sensitivity to Pesticides: a Study on the Slime Mould Dictyostelium discoideum (Protozoa).

    PubMed

    Amaroli, Andrea

    2015-07-01

    Slime moulds live in agricultural ecosystems, where they play an important role in the soil fertilization and in the battle against crop pathogens. In an agricultural soil, the amoebae are exposed to different stress factors such as pesticides and weather conditions. The use of pesticides increased up from 0.49 kg per hectare in 1961 to 2 kg in 2004, and the global greenhouse gas emission has grown 70% between 1970 and 2004 leading to a global fluctuation of average surface temperature. Therefore, the European Directive 2009/128/EC has led to a new approach to agriculture, with the transition from an old concept based on high use of pesticides and fossil fuels to an agriculture aware of biodiversity and health issues. We studied the effects of temperature variations and pesticides on Dictyostelium discoideum. We measured the fission rate, the ability to differentiate and the markers of stress such as the activity and presence of pseudocholinesterase and the presence of heat shock protein 70. Our results highlight how the sensitivity to zinc, aluminium, silver, copper, cadmium, mercury, diazinon and dicofol changes for a 2 °C variation from nothing/low to critical. Our work suggests considering, in future regulations, about the use of pesticides as their toxic effect on non-target organisms is strongly influenced by climate temperatures. In addition, there is a need for a new consideration of the protozoa, which takes into account recent researches about the presence in this microorganism of classical neurotransmitters that, similar to those in animals, make protozoa an innocent target of neurotoxic pesticides in the battle against the pest crops.

  1. The Effects of Temperature Variation on the Sensitivity to Pesticides: a Study on the Slime Mould Dictyostelium discoideum (Protozoa).

    PubMed

    Amaroli, Andrea

    2015-07-01

    Slime moulds live in agricultural ecosystems, where they play an important role in the soil fertilization and in the battle against crop pathogens. In an agricultural soil, the amoebae are exposed to different stress factors such as pesticides and weather conditions. The use of pesticides increased up from 0.49 kg per hectare in 1961 to 2 kg in 2004, and the global greenhouse gas emission has grown 70% between 1970 and 2004 leading to a global fluctuation of average surface temperature. Therefore, the European Directive 2009/128/EC has led to a new approach to agriculture, with the transition from an old concept based on high use of pesticides and fossil fuels to an agriculture aware of biodiversity and health issues. We studied the effects of temperature variations and pesticides on Dictyostelium discoideum. We measured the fission rate, the ability to differentiate and the markers of stress such as the activity and presence of pseudocholinesterase and the presence of heat shock protein 70. Our results highlight how the sensitivity to zinc, aluminium, silver, copper, cadmium, mercury, diazinon and dicofol changes for a 2 °C variation from nothing/low to critical. Our work suggests considering, in future regulations, about the use of pesticides as their toxic effect on non-target organisms is strongly influenced by climate temperatures. In addition, there is a need for a new consideration of the protozoa, which takes into account recent researches about the presence in this microorganism of classical neurotransmitters that, similar to those in animals, make protozoa an innocent target of neurotoxic pesticides in the battle against the pest crops. PMID:25515424

  2. Development of a HOG-based real-time PCR method to detect stress response changes in mycotoxigenic moulds.

    PubMed

    Rodríguez, Alicia; Medina, Ángel; Córdoba, Juan J; Magan, Naresh

    2016-08-01

    There is a need to understand the mechanism of adaptation of toxigenic fungal species which are able to colonise highly specialised foods such as cured meats where there is a high osmotic stress due to the presence up to 20-22% NaCl during the ripening process. A new tool able to detect changes in stress related genes would be useful to understand the ecological reasons for the ability of these species to grow in specialised niches. In this work a real-time PCR (qPCR) using SYBR Green was developed. Primers were designed from the Hog1 gene involved in osmo-adaptation in fungi. For this, conserved regions resulting from the alignment of 26 published partial sequences of such gene were used. Specificity of primers HogF2/R2 was demonstrated when amplified, producing a unique 131-bp PCR product with a Tm value of 84 °C. The qPCR method showed an efficiency of 98%, R(2) value > 0.99 and a detection limit of 0.7 log Hog1 gene copies. The qPCR method to measure changes in the Hog1 gene expression in relation to growth in ionic and non-ionic stressed environments (using 10-40% NaCl and sorbitol concentrations) was found to be suitable for two mycotoxigenic species (Penicillium nordicum, P. expansum). This assay will be a valuable tool for generating relevant Hog1 expression data from different mould species in relation to different stresses in food habitats. It will also be a good tool for a better understanding of the ability of xerophilic and xerotolerant species to colonise extreme environments. PMID:27052709

  3. Effect of medium-chain fatty acids in mould ripened cheese on the growth of Listeria monocytogenes.

    PubMed

    Kinderlerer, J L; Matthias, H E; Finner, P

    1996-11-01

    Listeria monocytogenes and List. innocua were isolated from commercial soft ripened and blue-veined cheeses manufactured in France, mainly from Brie cheese made from unpasteurized milk. Five isolates were List. monocytogenes serotype 1/2 and two were List. innocua. Examination of Bleu d'Auvergne cheese with the cryoscanning electron microscope showed that many conidia spores were present in the blue veins in close contact with the cheese surface. There were few conidia spores in the Brie, mostly on the outside of the cheese but not in contact with the surface. High concentrations of free dodecanoic (lauric) acid (1.77-2.50 g/kg cheese) and tetradecanoic (myristic) acid (2.54-6.38 g/kg cheese) were found in the veins of the blue cheese, but concentrations in the white regions were much lower. Free lauric and myristic acids were not detected in the Brie cheeses. There was no difference in the overall fatty acid composition of the fat in the surface ripened and blue-veined cheeses, although higher concentrations of free medium-chain fatty acids were found in a blue cheese compared with a surface ripened cheese. The pH and fat content were higher in regions with obvious fungal growth, the blue veins of Fourme d'Ambert and the rind of Brie. Free lauric acid dissolved in butteroil inhibited multiplication in broth at pH 7.0 of a test strain of List. monocytogenes isolated from Bleu d'Auvergne. Some inhibition was seen with hexanoic, octanoic, decanoic and tetradecanoic acids. We suggest that the presence of localized concentrations of free medium-chain fatty acids (dissolved in the fat) in the blue veins of blue mould ripened cheese could act as natural preservatives and inhibit the growth of listerias in conditions where (if present), one would otherwise expect them to grow.

  4. Fabrication of anti-adhesion surfaces on aluminium substrates of rubber plastic moulds using electrolysis plasma treatment

    SciTech Connect

    Meng, Jianbing Dong, Xiaojuan; Wei, Xiuting; Yin, Zhanmin

    2015-04-15

    An anti-adhesion surface with a water contact angle of 167° was fabricated on aluminium samples of rubber plastic moulds by electrolysis plasma treatment using mixed electrolytes of C{sub 6}H{sub 5}O{sub 7}(NH{sub 4}){sub 3} and Na{sub 2}SO{sub 4}, followed by fluorination. To optimise the fabrication conditions, several important processing parameters such as the discharge voltage, discharge time, concentrations of supporting electrolyte and stearic acid ethanol solution were examined systematically. Using scanning electron microscopy (SEM) to analyse surfaces morphology, micrometer scale pits, and protrusions were found on the surface, with numerous nanometer mastoids contained in the protrusions. These binary micro/nano-scale structures, which are similar to the micro-structures of soil-burrowing animals, play a critical role in achieving low adhesion properties. Otherwise, the anti-adhesion behaviours of the resulting samples were analysed by the atomic force microscope (AFM), Fourier-transform infrared spectrophotometer (FTIR), electrons probe micro-analyzer (EPMA), optical contact angle meter, digital Vickers microhardness (Hv) tester, and electronic universal testing. The results show that the electrolysis plasma treatment does not require complex processing parameters, using a simple device, and is an environment-friendly and effective method. Under the optimised conditions, the contact angle (CA) for the modified anti-adhesion surface is up to 167°, the sliding angle (SA) is less than 2°, roughness of the sample surface is only 0.409μm. Moreover, the adhesion force and H{sub v} are 0. 9KN and 385, respectively.

  5. Fabrication of anti-adhesion surfaces on aluminium substrates of rubber plastic moulds using electrolysis plasma treatment

    NASA Astrophysics Data System (ADS)

    Meng, Jianbing; Dong, Xiaojuan; Wei, Xiuting; Yin, Zhanmin

    2015-04-01

    An anti-adhesion surface with a water contact angle of 167° was fabricated on aluminium samples of rubber plastic moulds by electrolysis plasma treatment using mixed electrolytes of C6H5O7(NH4)3 and Na2SO4, followed by fluorination. To optimise the fabrication conditions, several important processing parameters such as the discharge voltage, discharge time, concentrations of supporting electrolyte and stearic acid ethanol solution were examined systematically. Using scanning electron microscopy (SEM) to analyse surfaces morphology, micrometer scale pits, and protrusions were found on the surface, with numerous nanometer mastoids contained in the protrusions. These binary micro/nano-scale structures, which are similar to the micro-structures of soil-burrowing animals, play a critical role in achieving low adhesion properties. Otherwise, the anti-adhesion behaviours of the resulting samples were analysed by the atomic force microscope (AFM), Fourier-transform infrared spectrophotometer (FTIR), electrons probe micro-analyzer (EPMA), optical contact angle meter, digital Vickers microhardness (Hv) tester, and electronic universal testing. The results show that the electrolysis plasma treatment does not require complex processing parameters, using a simple device, and is an environment-friendly and effective method. Under the optimised conditions, the contact angle (CA) for the modified anti-adhesion surface is up to 167°, the sliding angle (SA) is less than 2°, roughness of the sample surface is only 0.409μm. Moreover, the adhesion force and Hv are 0. 9KN and 385, respectively.

  6. Intravitreal injection of octreotide acetate.

    PubMed

    Robertson, J E; Westra, I; Woltering, E A; Winthrop, K L; Barrie, R; O'Dorisio, T M; Holmes, D

    1997-04-01

    This study was conducted to determine the feasibility of injecting the somatostatin analogue, octreotide acetate (OA), into the vitreous cavity. Previous work suggests that octreotide effectively inhibits angiogenesis in vitro, thus its use in vivo may slow the progression of proliferative eye disease. Fifty micrograms of aqueous OA in 50 microliters aqueous solution was injected into the mid-vitreous of kitten eyes (n = 6), and OA levels were monitored over 4 days. A long-acting release form of octreotide (OA-LAR) was also injected into the mid-vitreous of rabbit eyes at doses of 0.36 (n = 16), 1.1 (n = 1), 2.1 (n = 1), 4.05 (n = 1), 8.2 (n = 1), and 36 mg (n = 3) in solution; and octreotide concentrations were measured at various time points over 42 days. OA concentrations were determined by a highly specific radioimmunoassay. Aqueous octreotide was eliminated rapidly (t1/2 = 16 hours) from the vitreous of the kitten eye, with only negligible amounts recoverable 4 days post-injection. In the long-acting form, OA in the rabbit eye reached peak levels at 28 days. By 42 days, OA levels had declined to the 14-day level. Doses of OA-LAR of 1.1 mg or less produced no gross evidence of clinical toxicity and elicited no grossly visible ocular side effects. Doses greater than 1.1 mg produced significant toxicity, including cataracts and rubeosis. The 28-day peak release for long-acting OA implies that monthly intravitreal injections could provide continual high levels of OA. Intravitreal injection of long-acting OA provides sustained, high concentrations of drug, and deserves further study as a potential treatment of proliferative eye diseases.

  7. Recent progress in online ultrasonic process monitoring

    NASA Astrophysics Data System (ADS)

    Wen, Szu-Sheng L.; Chen, Tzu-Fang; Ramos-Franca, Demartonne; Nguyen, Ky T.; Jen, Cheng-Kuei; Ihara, Ikuo; Derdouri, A.; Garcia-Rejon, Andres

    1998-03-01

    On-line ultrasonic monitoring of polymer co-extrusion and gas-assisted injection molding are presented. During the co- extrusion of high density polyethylene and Santoprene ultrasonic sensors consisting of piezoelectric transducers and clad ultrasonic buffer rods are used to detect the interface between these two polymers and the stability of the extrusion. The same ultrasonic sensor also measures the surface temperature of the extruded polymer. The results indicate that temperature measurements using ultrasound have a faster response time than those obtained by conventional thermocouple. In gas-assisted injection molding the polymer and gas flow front positions are monitored simultaneously. This information may be used to control the plunger movement.

  8. Line10 Charge Injection Biases

    NASA Astrophysics Data System (ADS)

    Baggett, Sylvia

    2012-10-01

    Radiation damage on-orbit, in the form of charge traps, gradually reduces the charge transfer efficiency {CTE} of CCDs over time. In WFC3, one option for mitigating CTE losses is charge injection i.e. electronically inserting charge every Nth row. The benefit of this method is the significantly lower noise penalty, much less than the traditional Poissonian noise imparted by a pre- or post-flash of the same charge level. This program acquires the calibration data necessary to support science observations using charge injection.

  9. Sodium storage and injection system

    NASA Technical Reports Server (NTRS)

    Keeton, A. R. (Inventor)

    1979-01-01

    A sodium storage and injection system for delivering atomized liquid sodium to a chemical reactor employed in the production of solar grade silicon is disclosed. The system is adapted to accommodate start-up, shut-down, normal and emergency operations, and is characterized by (1) a jacketed injection nozzle adapted to atomize liquefied sodium and (2) a supply circuit connected to the nozzle for delivering the liquefied sodium. The supply circuit is comprised of a plurality of replaceable sodium containment vessels, a pump interposed between the vessels and the nozzle, and a pressurizing circuit including a source of inert gas connected with the vessels for maintaining the sodium under pressure.

  10. ATF neutral beam injection system

    SciTech Connect

    Menon, M.M.; Morris, R.N.; Edmonds, P.H.

    1985-01-01

    The Advanced Toroidal Facility is a stellarator torsatron being built at Oak Ridge National Laboratory to investigate improved plasma confinement schemes. Plasmas heating will be carried out predominantly by means of neutral beam injection. This paper describes the basic parameters of the injection system. Numerical calculations were done to optimize the aiming of the injectors. The results of these calculations and their implications on the neutral power to the machine are elaborated. The effects of improving the beam optics and altering the focal length on the power transmitted to the plasma are discussed.

  11. A feasibility study for using ABS plastic and a low-cost 3D printer for patient-specific brachytherapy mould design.

    PubMed

    Harris, Benjamin D; Nilsson, Sanna; Poole, Christopher M

    2015-09-01

    This feasibility study aims to determine if a low-cost 3D printer (BitsFromBytes 3D Touch) with ABS plastic can print custom mould structures and catheter channels defined in a brachytherapy treatment planning system (Nucletron Oncentra) for patient-specific treatment. Printer accuracy was evaluated through physical measurement, and print quality was investigated by adjusting print parameters (print speed, layer thickness, percentage infill). Catheter positioning and reproducibility were measured over repeated insertions. ABS plastic water equivalency was investigated by comparing Ir-192 HDR source dose distributions, measured with radiochromic film, in ABS plastic and in water. Structures and catheter channels were printed accurately to within 0.5 mm laterally and 1 mm in the vertical print direction. Adjusting print parameters could reduce print time, albeit with reduced print quality. 3.5 mm channel diameters allowed for easy catheter insertion. Catheter positioning was reproducible to within 0.5 mm but, because of catheter flex within the channel, was on average 1 mm offset from defined TPS positions. This offset could be accounted for by repeating the treatment planning CT scan with the printed mould positioned on the patient. Dose attenuation in ABS plastic and in water was equivalent to within the measurement limitations. While clinical uses for this particular low-cost printer and ABS plastic are limited by print size restrictions and non-certification for biocompatibility, it has been demonstrated that a low-cost 3D printer set-up can accurately create custom moulds and catheter channels potentially acceptable for clinical use.

  12. A feasibility study for using ABS plastic and a low-cost 3D printer for patient-specific brachytherapy mould design.

    PubMed

    Harris, Benjamin D; Nilsson, Sanna; Poole, Christopher M

    2015-09-01

    This feasibility study aims to determine if a low-cost 3D printer (BitsFromBytes 3D Touch) with ABS plastic can print custom mould structures and catheter channels defined in a brachytherapy treatment planning system (Nucletron Oncentra) for patient-specific treatment. Printer accuracy was evaluated through physical measurement, and print quality was investigated by adjusting print parameters (print speed, layer thickness, percentage infill). Catheter positioning and reproducibility were measured over repeated insertions. ABS plastic water equivalency was investigated by comparing Ir-192 HDR source dose distributions, measured with radiochromic film, in ABS plastic and in water. Structures and catheter channels were printed accurately to within 0.5 mm laterally and 1 mm in the vertical print direction. Adjusting print parameters could reduce print time, albeit with reduced print quality. 3.5 mm channel diameters allowed for easy catheter insertion. Catheter positioning was reproducible to within 0.5 mm but, because of catheter flex within the channel, was on average 1 mm offset from defined TPS positions. This offset could be accounted for by repeating the treatment planning CT scan with the printed mould positioned on the patient. Dose attenuation in ABS plastic and in water was equivalent to within the measurement limitations. While clinical uses for this particular low-cost printer and ABS plastic are limited by print size restrictions and non-certification for biocompatibility, it has been demonstrated that a low-cost 3D printer set-up can accurately create custom moulds and catheter channels potentially acceptable for clinical use. PMID:26108891

  13. Sciatica and epidural corticosteroid injections.

    PubMed

    2015-02-01

    According to trials conducted in hundreds of patients with sciatica, epidural corticosteroid injections have no demonstrated efficacy beyond the placebo effect, either in the short-term or the long-term. However, they expose patients to a risk of sometimes serious neurological adverse effects.

  14. Mapping the structural requirements of inducers and substrates for decarboxylation of weak acid preservatives by the food spoilage mould Aspergillus niger.

    PubMed

    Stratford, Malcolm; Plumridge, Andrew; Pleasants, Mike W; Novodvorska, Michaela; Baker-Glenn, Charles A G; Pattenden, Gerald; Archer, David B

    2012-07-16

    Moulds are able to cause spoilage in preserved foods through degradation of the preservatives using the Pad-decarboxylation system. This causes, for example, decarboxylation of the preservative sorbic acid to 1,3-pentadiene, a volatile compound with a kerosene-like odour. Neither the natural role of this system nor the range of potential substrates has yet been reported. The Pad-decarboxylation system, encoded by a gene cluster in germinating spores of the mould Aspergillus niger, involves activity by two decarboxylases, PadA1 and OhbA1, and a regulator, SdrA, acting pleiotropically on sorbic acid and cinnamic acid. The structural features of compounds important for the induction of Pad-decarboxylation at both transcriptional and functionality levels were investigated by rtPCR and GCMS. Sorbic and cinnamic acids served as transcriptional inducers but ferulic, coumaric and hexanoic acids did not. 2,3,4,5,6-Pentafluorocinnamic acid was a substrate for the enzyme but had no inducer function; it was used to distinguish induction and competence for decarboxylation in combination with the analogue chemicals. The structural requirements for the substrates of the Pad-decarboxylation system were probed using a variety of sorbic and cinnamic acid analogues. High decarboxylation activity, ~100% conversion of 1mM substrates, required a mono-carboxylic acid with an alkenyl double bond in the trans (E)-configuration at position C2, further unsaturation at C4, and an overall molecular length between 6.5Å and 9Å. Polar groups on the phenyl ring of cinnamic acid abolished activity (no conversion). Furthermore, several compounds were shown to block Pad-decarboxylation. These compounds, primarily aldehyde analogues of active substrates, may serve to reduce food spoilage by moulds such as A. niger. The possible ecological role of Pad-decarboxylation of spore self-inhibitors is unlikely and the most probable role for Pad-decarboxylation is to remove cinnamic acid-type inhibitors from

  15. Use of NH4Cl-H2O Analogue Castings to Model Aspects of Continuous Casting. Part 1; Asymmetry in Inclined Moulds

    NASA Technical Reports Server (NTRS)

    Jang, J.; Hellawell, A.

    1991-01-01

    Crystallisation of NH4Cl from aqueous solutions has been used to examine grain formation in a configuration similar to that existing in the curved mould of a continuous, steel casting machine. The observations show how falling equiaxed crystals accumulate at the lower (outer) columnar front earlier than at the upper (inner) front and, thus, lead to an asymmetric grain structure. The usefulness of the aqueous system as a realistic model for steel casting is discussed in terms of relative temperature profiles, materials properties, and observed columnar and eutectic growth rates.

  16. Sequential injection gas guns for accelerating projectiles

    DOEpatents

    Lacy, Jeffrey M.; Chu, Henry S.; Novascone, Stephen R.

    2011-11-15

    Gas guns and methods for accelerating projectiles through such gas guns are described. More particularly, gas guns having a first injection port located proximate a breech end of a barrel and a second injection port located longitudinally between the first injection port and a muzzle end of the barrel are described. Additionally, modular gas guns that include a plurality of modules are described, wherein each module may include a barrel segment having one or more longitudinally spaced injection ports. Also, methods of accelerating a projectile through a gas gun, such as injecting a first pressurized gas into a barrel through a first injection port to accelerate the projectile and propel the projectile down the barrel past a second injection port and injecting a second pressurized gas into the barrel through the second injection port after passage of the projectile and to further accelerate the projectile are described.

  17. Diesel engine fuel injection pump capable of injection timing adjustment

    SciTech Connect

    Wakasa, S.; Okazaki, T.

    1987-12-15

    A diesel engine fuel injection pump capable of injection timing adjustment is described comprising: (a) housing means; (b) a plunger assembly reciprocably mounted within the housing means and defining a pumping chamber therein; (c) the housing means having defined therein a fuel inlet port to the pumping chamber in a predetermined position in the longitudinal direction of the pumping chamber; (d) drive means for reciprocably moving the plunger assembly within the pumping chamber between a first extreme position; (e) the plunger assembly being formed of at least two transversely split segments movable toward and away from each other within limits and including resilient means biasing the segments of the plunger assembly toward each other; and (f) the housing means further including a timing fluid inlet port for introduction of a timing fluid under variable pressure between the segments of the plunger assembly to move the plunger assembly segments away from each other to an extent that timing fluid pressure is counterbalanced by force of the resilient means for controllably varying the distance therebetween and, in consequence, for varying the prestroke of the plunger assembly solely in response to variation of the timing fluid pressure to effect adjustment of injection timing.

  18. Miniaturized flow injection analysis system

    DOEpatents

    Folta, James A.

    1997-01-01

    A chemical analysis technique known as flow injection analysis, wherein small quantities of chemical reagents and sample are intermixed and reacted within a capillary flow system and the reaction products are detected optically, electrochemically, or by other means. A highly miniaturized version of a flow injection analysis system has been fabricated utilizing microfabrication techniques common to the microelectronics industry. The microflow system uses flow capillaries formed by etching microchannels in a silicon or glass wafer followed by bonding to another wafer, commercially available microvalves bonded directly to the microflow channels, and an optical absorption detector cell formed near the capillary outlet, with light being both delivered and collected with fiber optics. The microflow system is designed mainly for analysis of liquids and currently measures 38.times.25.times.3 mm, but can be designed for gas analysis and be substantially smaller in construction.

  19. Miniaturized flow injection analysis system

    DOEpatents

    Folta, J.A.

    1997-07-01

    A chemical analysis technique known as flow injection analysis is described, wherein small quantities of chemical reagents and sample are intermixed and reacted within a capillary flow system and the reaction products are detected optically, electrochemically, or by other means. A highly miniaturized version of a flow injection analysis system has been fabricated utilizing microfabrication techniques common to the microelectronics industry. The microflow system uses flow capillaries formed by etching microchannels in a silicon or glass wafer followed by bonding to another wafer, commercially available microvalves bonded directly to the microflow channels, and an optical absorption detector cell formed near the capillary outlet, with light being both delivered and collected with fiber optics. The microflow system is designed mainly for analysis of liquids and currently measures 38{times}25{times}3 mm, but can be designed for gas analysis and be substantially smaller in construction. 9 figs.

  20. Chitosan/whey Protein (CWP) Edible Films Efficiency for Controlling Mould Growth and on Microbiological, Chemical and Sensory Properties During Storage of Göbek Kashar Cheese.

    PubMed

    Yangılar, Filiz

    2015-01-01

    The objective of present study was to evaluate the effects of the application of chitosan and chitosan/whey protein on the chemical, microbial and organoleptic properties of Göbek Kashar cheese during ripening time (on 3(rd), 30(th), 60(th) and 90(th) d). Difference in microbiological and chemical changes between samples was found to be significant (p<0.05) during ripening period. Cheese samples with edible coating had statistically lower mould counts compared to the uncoated samples. Furthermore the highest and lowest mould counts were determined in control (4.20 Log CFU/g) and other samples (<1 Log CFU/g) at 60(th) and 90(th) d of storage. All samples exhibited higher levels of water soluble nitrogen and ripening index at the end of storage process. At the end of 90 day storage period, no signicant dierences in salt and fat values were observed among the cheeses studied. The edible coatings had a beneficial effect on the sensory quality of cheese samples. In the result of sensory analysis, while cheese C and the chitosan coated cheese samples were more preferred by the panellists, the chitosan/whey protein film-coated cheese samples received the lowest scores. This study shows coating suggests could be used to improve the quality of cheese during ripening time. PMID:26761831

  1. [Study on the methods for establishing virtual three-dimensional models of cerebral arteries with the three-dimensional moulding software].

    PubMed

    Wei, Xin; Xie, Xiaodong; Wang, Chaohua

    2007-12-01

    This study was conducted to establish the methods of virtual three-dimensional cerebral arteries models by use of three-dimensional moulding software. The virtual models of the cerebral arteries were established using the three-dimensional moulding software of 3D Studio MAX R3 with 46 cases of normal cerebral DSA image as the original. The results showed there was similarity in appearance between the virtual cerebral arteries and DSA image. This is of benefit to understanding the vascular three-dimensional spatial relation in visual sense. Several models of different variant anatomy could be easily established on the copy files of the virtual cerebral arteries model. The virtual model could help learners to create and increase the three-dimensional space concept of arteries and aneurysms in clinical teaching. The results indicated that the virtual three-dimensional cerebral arteries models could display the three-dimensional spatial relation of the cerebral arterial system distinctly, and could serve as a morphologic foundation in the researches on vascular disease. PMID:18232470

  2. Chitosan/whey Protein (CWP) Edible Films Efficiency for Controlling Mould Growth and on Microbiological, Chemical and Sensory Properties During Storage of Göbek Kashar Cheese

    PubMed Central

    2015-01-01

    The objective of present study was to evaluate the effects of the application of chitosan and chitosan/whey protein on the chemical, microbial and organoleptic properties of Göbek Kashar cheese during ripening time (on 3rd, 30th, 60th and 90th d). Difference in microbiological and chemical changes between samples was found to be significant (p<0.05) during ripening period. Cheese samples with edible coating had statistically lower mould counts compared to the uncoated samples. Furthermore the highest and lowest mould counts were determined in control (4.20 Log CFU/g) and other samples (<1 Log CFU/g) at 60th and 90th d of storage. All samples exhibited higher levels of water soluble nitrogen and ripening index at the end of storage process. At the end of 90 day storage period, no signicant dierences in salt and fat values were observed among the cheeses studied. The edible coatings had a beneficial effect on the sensory quality of cheese samples. In the result of sensory analysis, while cheese C and the chitosan coated cheese samples were more preferred by the panellists, the chitosan/whey protein film-coated cheese samples received the lowest scores. This study shows coating suggests could be used to improve the quality of cheese during ripening time. PMID:26761831

  3. D.M.R. ("Double Reasoned Maturing"): innovative technique of agronomic ecologic control of grey mould on grapevine. trials and various considerations.

    PubMed

    Cargnello, G; Pezza, L; Gallo, G; Camatta, T; Coccato, S; Pascarella, G; Di Gaetano, R; Casadei, G; La Torre, A; Spera, G; Scaglione, M; Moretti, S; Garofalo, A

    2006-01-01

    A study was carried out in order to identify agronomic ecologic solutions in the indirect grey mould control on grapevine. These specific trials started since 1990 and, after years of validation, now they are applied by the entrepreneur to the business practice in the different pedological and climatic area and on different cultivars and forms of growing. The technique of "Doppia Maturazione Ragionata" (D.M.R.) ("Doubles Reasoned Maturing") consists of far "completing" the maturing of the grape for wilting on the plant through the reasoned cut of the heads to fruit e/o of shoots. The application of D.M.R., besides determining valid and important technical and qualitative (organoleptic, economic and social quality) improvements on the product, is particularly effective in the indirect grey mould control on grapevine. Such technique, in fact, allows us to vintage the grape during the business demands and not when imposed by Botrytis cinerea; it has been possible, in some cases, to vintage in December and over, without problems of B. cinerea. The trials have shown the technical, economic, social sustainability of D.M.R. application. This paper reports all trials that have brought, by now from years, to apply in the practice DMR (Double Reasoned Maturing). PMID:17390859

  4. Abscisic acid- and cold-induced thaumatin-like protein in winter wheat has an antifungal activity against snow mould, Microdochium nivale.

    PubMed

    Kuwabara, Chikako; Takezawa, Daisuke; Shimada, Takiko; Hamada, Tatsurou; Fujikawa, Seizo; Arakawa, Keita

    2002-05-01

    Cold acclimation of winter wheat (Triticum aestivum L.) seedlings induces accumulation in the apoplast of taTLPs that are similar to thaumatin-like proteins (TLPs), which are pathogenesis-related proteins. We characterized a cDNA of WAS-3a encoding the major isoform of taTLPs from winter wheat cells and showed that WAS-3a transcripts were markedly increased by treatment with ABA and by treatment with elicitors (chitosan, beta-glucan and cell wall fractions of Fusarium oxysporum and Microdochium nivale) in wheat cells. To analyse the function of WAS-3a, a highly efficient expression system using wheat cells was established, and a large amount of recombinant WAS-3a protein (rWAS-3a) was obtained with near homogeneity. Antifungal assays using various fungi grown on agar plates revealed that rWAS-3a inhibits hyphal growth of pink snow mould, Microdochium nivale, at a low temperature. The results suggest that cold-induced taTLPs that accumulate in the apoplast contribute to snow mould resistance of winter wheat.

  5. Rapid evaluation technique to differentiate mushroom disease-related moulds by detecting microbial volatile organic compounds using HS-SPME-GC-MS.

    PubMed

    Radványi, Dalma; Gere, Attila; Jókai, Zsuzsa; Fodor, Péter

    2015-01-01

    Headspace solid-phase microextraction (HS-SPME) coupled with gas chromatography-mass spectrometry (GC-MS) was used to analyse microbial volatile organic compounds (MVOCs) of mushroom disease-related microorganisms. Mycogone perniciosa, Lecanicillum fungicola var. fungicola, and Trichoderma aggressivum f. europaeum species, which are typically harmful in mushroom cultivation, were examined, and Agaricus bisporus (bisporic button mushroom) was also examined as a control. For internal standard, a mixture of alkanes was used; these were introduced as the memory effect of primed septa in the vial seal. Several different marker compounds were found in each sample, which enabled us to distinguish the different moulds and the mushroom mycelium from each other. Monitoring of marker compounds enabled us to investigate the behaviour of moulds. The records of the temporal pattern changes were used to produce partial least squares regression (PLS-R) models that enabled determination of the exact time of contamination (the infection time of the media). Using these evaluation techniques, the presence of mushroom disease-related fungi can be easily detected and monitored via their emitted MVOCs.

  6. Chitosan/whey Protein (CWP) Edible Films Efficiency for Controlling Mould Growth and on Microbiological, Chemical and Sensory Properties During Storage of Göbek Kashar Cheese.

    PubMed

    Yangılar, Filiz

    2015-01-01

    The objective of present study was to evaluate the effects of the application of chitosan and chitosan/whey protein on the chemical, microbial and organoleptic properties of Göbek Kashar cheese during ripening time (on 3(rd), 30(th), 60(th) and 90(th) d). Difference in microbiological and chemical changes between samples was found to be significant (p<0.05) during ripening period. Cheese samples with edible coating had statistically lower mould counts compared to the uncoated samples. Furthermore the highest and lowest mould counts were determined in control (4.20 Log CFU/g) and other samples (<1 Log CFU/g) at 60(th) and 90(th) d of storage. All samples exhibited higher levels of water soluble nitrogen and ripening index at the end of storage process. At the end of 90 day storage period, no signicant dierences in salt and fat values were observed among the cheeses studied. The edible coatings had a beneficial effect on the sensory quality of cheese samples. In the result of sensory analysis, while cheese C and the chitosan coated cheese samples were more preferred by the panellists, the chitosan/whey protein film-coated cheese samples received the lowest scores. This study shows coating suggests could be used to improve the quality of cheese during ripening time.

  7. Model for pneumatic pellet injection

    SciTech Connect

    Hogan, J.T.; Milora, S.L.; Schuresko, D.D.

    1983-07-01

    A hydrodynamic code has been developed to model the performance of pneumatic pellet injection systems. The code describes one dimensional, unsteady compressible gas dynamics, including gas friction and heat transfer to the walls in a system with variable area. The mass, momentum, and energy equations are solved with an iterated Lax-Wendroff scheme with additional numerical viscosity. The code is described and comparisons with experimental data are presented.

  8. Radial lean direct injection burner

    DOEpatents

    Khan, Abdul Rafey; Kraemer, Gilbert Otto; Stevenson, Christian Xavier

    2012-09-04

    A burner for use in a gas turbine engine includes a burner tube having an inlet end and an outlet end; a plurality of air passages extending axially in the burner tube configured to convey air flows from the inlet end to the outlet end; a plurality of fuel passages extending axially along the burner tube and spaced around the plurality of air passage configured to convey fuel from the inlet end to the outlet end; and a radial air swirler provided at the outlet end configured to direct the air flows radially toward the outlet end and impart swirl to the air flows. The radial air swirler includes a plurality of vanes to direct and swirl the air flows and an end plate. The end plate includes a plurality of fuel injection holes to inject the fuel radially into the swirling air flows. A method of mixing air and fuel in a burner of a gas turbine is also provided. The burner includes a burner tube including an inlet end, an outlet end, a plurality of axial air passages, and a plurality of axial fuel passages. The method includes introducing an air flow into the air passages at the inlet end; introducing a fuel into fuel passages; swirling the air flow at the outlet end; and radially injecting the fuel into the swirling air flow.

  9. Catalytic combustion with steam injection

    NASA Astrophysics Data System (ADS)

    Anderson, D. N.; Tacina, R. R.

    The effects of steam injection on (1) catalytic combustion performance, and (2) the tendency of residual fuel to burn in the premixing duct upstream of the catalytic reactor were determined. A petroleum residual, no. 2 diesel, and a blend of middle and heavy distillate coal derived fuels were tested. Fuel and steam were injected together into the preheated airflow entering a 12 cm diameter catalytic combustion test section. The inlet air velocity and pressure were constant at 10 m/s and 600 kPa, respectively. Steam flow rates were varied from 24 percent to 52 percent of the air flow rate. The resulting steam air mixture temperatures varied from 630 to 740 K. Combustion temperatures were in the range of 1200 to 1400 K. The steam had little effect on combustion efficiency or emissions. It was concluded that the steam acts as a diluent which has no adverse effect on catalytic combustion performance for no. 2 diesel and coal derived liquid fuels. Tests with the residual fuel showed that upstream burning could be eliminated with steam injection rates greater than 30 percent of the air flow rate, but inlet mixture temperatures were too low to permit stable catalytic combustion of this fuel.

  10. Catalytic combustion with steam injection

    NASA Technical Reports Server (NTRS)

    Anderson, D. N.; Tacina, R. R.

    1982-01-01

    The effects of steam injection on (1) catalytic combustion performance, and (2) the tendency of residual fuel to burn in the premixing duct upstream of the catalytic reactor were determined. A petroleum residual, no. 2 diesel, and a blend of middle and heavy distillate coal derived fuels were tested. Fuel and steam were injected together into the preheated airflow entering a 12 cm diameter catalytic combustion test section. The inlet air velocity and pressure were constant at 10 m/s and 600 kPa, respectively. Steam flow rates were varied from 24 percent to 52 percent of the air flow rate. The resulting steam air mixture temperatures varied from 630 to 740 K. Combustion temperatures were in the range of 1200 to 1400 K. The steam had little effect on combustion efficiency or emissions. It was concluded that the steam acts as a diluent which has no adverse effect on catalytic combustion performance for no. 2 diesel and coal derived liquid fuels. Tests with the residual fuel showed that upstream burning could be eliminated with steam injection rates greater than 30 percent of the air flow rate, but inlet mixture temperatures were too low to permit stable catalytic combustion of this fuel.

  11. Helpful tips for performing musculoskeletal injections.

    PubMed

    Metz, John P

    2010-01-01

    Injections are valuable procedures for managing musculoskeletal conditions commonly encountered by family physicians. Corticosteroid injections into articular, periarticular, or soft tissue structures relieve pain, reduce inflammation, and improve mobility. Injections can provide diagnostic information and are commonly used for postoperative pain control. Local anesthetics may be injected with corticosteroids to provide additional, rapid pain relief. Steroid injection is the preferred and definitive treatment for de Quervain tenosynovitis and trochanteric bursitis. Steroid injections can also be helpful in controlling pain during physical rehabilitation from rotator cuff syndrome and lateral epicondylitis. Intra-articular steroid injection provides pain relief in rheumatoid arthritis and osteoarthritis. There is little systematic evidence to guide medication selection for therapeutic injections. The medication used and the frequency of injection should be guided by the goal of the injection (i.e., diagnostic or therapeutic), the underlying musculoskeletal diagnosis, and clinical experience. Complications from steroid injections are rare, but physicians should understand the potential risks and counsel patients appropriately. Patients with diabetes who receive periarticular or soft tissue steroid injections should closely monitor their blood glucose for two weeks following injection. PMID:20052957

  12. Musculoskeletal injections: a review of the evidence.

    PubMed

    Stephens, Mark B; Beutler, Anthony I; O'Connor, Francis G

    2008-10-15

    Injections are valuable procedures for managing musculoskeletal conditions commonly encountered by family physicians. Corticosteroid injections into articular, periarticular, or soft tissue structures relieve pain, reduce inflammation, and improve mobility. Injections can provide diagnostic information and are commonly used for postoperative pain control. Local anesthetics may be injected with corticosteroids to provide additional, rapid pain relief. Steroid injection is the preferred and definitive treatment for de Quervain tenosynovitis and trochanteric bursitis. Steroid injections can also be helpful in controlling pain during physical rehabilitation from rotator cuff syndrome and lateral epicondylitis. Intra-articular steroid injection provides pain relief in rheumatoid arthritis and osteoarthritis. There is little systematic evidence to guide medication selection for therapeutic injections. The medication used and the frequency of injection should be guided by the goal of the injection (i.e., diagnostic or therapeutic), the underlying musculoskeletal diagnosis, and clinical experience. Complications from steroid injections are rare, but physicians should understand the potential risks and counsel patients appropriately. Patients with diabetes who receive periarticular or soft tissue steroid injections should closely monitor their blood glucose for two weeks following injection. PMID:18953975

  13. The taphonomy of unmineralised Palaeozoic fossils preserved as siliciclastic moulds and casts, and their utility in assessing the interaction between environmental change and the fossil record

    NASA Astrophysics Data System (ADS)

    MacGabhann, Breandán; Schiffbauer, James; Hagadorn, James; Van Roy, Peter; Lynch, Edward; Morrsion, Liam; Murray, John

    2015-04-01

    The enhanced preservation potential of biomineralised tissues in fossil organisms is a key factor in their utility in the investigation of palaeoenvironmental change on fossil ecosystems. By contrast, the considerably lower preservation potential of entirely unmineralised organisms severely reduces the utility of their temporal and spatial distribution in such analyses. However, understanding the taphonomic processes which lead to the preservation of such soft-bodied fossils may be an under-appreciated source of information, particularly in the case of specimens preserved as moulds and casts in coarser siliciclastic sediments. This information potential is well demonstrated by fossil eldonids, a Cambrian to Devonian clade of unmineralised asymmetrical discoidal basal or stem deuterostomes, with an apparently conservative biology and no clear palaeoenvironmental or biogeographical controls on their distribution. We investigated the taphonomic processes involved in the preservation of fossil eldonids as moulds and casts on bedding surfaces and within event beds from sandstones of the Ordovician Tafilalt lagerstätte in south-eastern Morocco, and from siltstones of the Devonian West Falls Group of New York, USA. Laser Raman microspectroscopy, SEM BSE imaging and EDS elemental mapping of fossil specimens reveals that moulded biological surfaces are coated by a fossil surface veneer primarily consisting of mixed iron oxides and oxyhydroxides (including pseudomorphs after pyrite), and aluminosilicate clay minerals. Moreover, comparison to fossil eldonids preserved as carbonaceous compressions in the Burgess Shale reveals that the biological structures preserved in the Tafilalt and New York specimens - the dorsal surface and a coiled sac containing the digestive tract - represent only specific portions of the anatomy of the complete animal. We suggest that the preserved remains were the only parts of these eldonid organisms composed primarily of complex organic

  14. Corticosteroid Injections for Common Musculoskeletal Conditions.

    PubMed

    Foster, Zoë J; Voss, Tyler T; Hatch, Jacquelynn; Frimodig, Adam

    2015-10-15

    Family physicians considering corticosteroid injections as part of a comprehensive treatment plan for musculoskeletal diagnoses will find few high-quality studies to assist with evidence-based decision making. Most studies of corticosteroid injections for the treatment of osteoarthritis, tendinopathy, bursitis, or neuropathy include only small numbers of patients and have inconsistent long-term follow-up. Corticosteroid injections for the treatment of adhesive capsulitis result in short-term improvements in pain and range of motion. For subacromial impingement syndrome, corticosteroid injections provide short-term pain relief and improvement in function. In medial and lateral epicondylitis, corticosteroid injections offer only short-term improvement of symptoms and have a high rate of symptom recurrence. Corticosteroid injections for carpal tunnel syndrome may help patients avoid or delay surgery. Trigger finger and de Quervain tenosynovitis may be treated effectively with corticosteroid injections. Patients with hip or knee osteoarthritis may have short-term symptom relief with corticosteroid injections.

  15. Interferon Beta-1a Subcutaneous Injection

    MedlinePlus

    ... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS, a disease in which ... under the skin). It is usually injected three times a week. You should inject this medication on ...

  16. Side Effects of Injectable Fertility Drugs (Gonadotropins)

    MedlinePlus

    ... usually are used during fertility treatments such as intrauterine insemination (IUI) or in vitro fertilization (IVF). Injections of gonadotropins ... Gestation. When using injectable gonadotropins alone or with IUI, up to 30% of pregnancies are associated with ...

  17. A New Look at Trigger Point Injections

    PubMed Central

    Wong, Clara S. M.; Wong, Steven H. S.

    2012-01-01

    Trigger point injections are commonly practised pain interventional techniques. However, there is still lack of objective diagnostic criteria for trigger points. The mechanisms of action of trigger point injection remain obscure and its efficacy remains heterogeneous. The advent of ultrasound technology in the noninvasive real-time imaging of soft tissues sheds new light on visualization of trigger points, explaining the effect of trigger point injection by blockade of peripheral nerves, and minimizing the complications of blind injection. PMID:21969825

  18. Injectivity Testing for Vapour Dominated Feed Zones

    SciTech Connect

    Clotworthy, A.W.; Hingoyon, C.S.

    1995-01-01

    Wells with vapor dominated feed zones yield abnormal pressure data. This is caused by the condensation of vapor during water injection. A revised injectivity test procedure currently applied by PNOC at the Leyte Geothermal Power Project has improved the injectivity test results.

  19. Injection dynamics of gelled propellants

    NASA Astrophysics Data System (ADS)

    Yoon, Changjin

    Gel propellants have been recognized as attractive candidates for future propulsion systems due to the reduced tendency to spill and the energy advantages over solid propellants. One of strong benefits emphasized in gel propellant applications is a throttling capability, but the accurate flow control is more complicated and difficult than with conventional Newtonian propellants because of the unique rheological behaviors of gels. This study is a computational effort directed to enhance understanding of the injector internal flow characteristics for gel propellants under rocket injection conditions. In simulations, the emphasized rheology is a shear-thinning which represents a viscosity decrease with increasing a shear rate. It is described by a generalized Newtonian fluid constitutive equation and Carreau-Yasuda model. Using this rheological model, two injection schemes are considered in the present study: axially-fed and cross-fed injection for single-element and multi-element impinging injectors, respectively. An axisymmetric model is developed to describe the axially-fed injector flows and fully three-dimensional model is utilized to simulate cross-fed injector flows. Under axially-fed injection conditions investigated, three distinct modes, an unsteady, steady, and hydraulic flip mode, are observed and mapped in terms of Reynolds number and orifice design. In an unsteady mode, quasi-periodic oscillations occur near the inlet lip leading mass pulsations and viscosity fluctuations at the orifice exit. This dynamic behavior is characterized using a time-averaged discharge coefficient, oscillation magnitude and frequency by a parametric study with respect to an orifice design, Reynolds number and rheology. As a result, orifice exit flows for gel propellants appear to be significantly influenced by a viscous damping and flow resistance due to a shear thinning behavior and these are observed in each factors considered. Under conditions driven by a manifold crossflow

  20. Acoustic fault injection tool (AFIT)

    NASA Astrophysics Data System (ADS)

    Schoess, Jeffrey N.

    1999-05-01

    On September 18, 1997, Honeywell Technology Center (HTC) successfully completed a three-week flight test of its rotor acoustic monitoring system (RAMS) at Patuxent River Flight Test Center. This flight test was the culmination of an ambitious 38-month proof-of-concept effort directed at demonstrating the feasibility of detecting crack propagation in helicopter rotor components. The program was funded as part of the U.S. Navy's Air Vehicle Diagnostic Systems (AVDS) program. Reductions in Navy maintenance budgets and available personnel have dictated the need to transition from time-based to 'condition-based' maintenance. Achieving this will require new enabling diagnostic technologies. The application of acoustic emission for the early detection of helicopter rotor head dynamic component faults has proven the feasibility of the technology. The flight-test results demonstrated that stress-wave acoustic emission technology can detect signals equivalent to small fatigue cracks in rotor head components and can do so across the rotating articulated rotor head joints and in the presence of other background acoustic noise generated during flight operation. During the RAMS flight test, 12 test flights were flown from which 25 Gbyte of digital acoustic data and about 15 hours of analog flight data recorder (FDR) data were collected from the eight on-rotor acoustic sensors. The focus of this paper is to describe the CH-46 flight-test configuration and present design details about a new innovative machinery diagnostic technology called acoustic fault injection. This technology involves the injection of acoustic sound into machinery to assess health and characterize operational status. The paper will also address the development of the Acoustic Fault Injection Tool (AFIT), which was successfully demonstrated during the CH-46 flight tests.

  1. Governor for fuel injection pump

    SciTech Connect

    Yogome, Y.; Itsuki, S.; Shimizu, T.; Shimizu, T.; Hamada, H.

    1987-05-19

    This patent describes double-lever type governor for a fuel injection pump comprising: a governor case; a governor lever and a tension lever rotatably supported in the case and operatively associated with each other; a start spring interposed between the governor lever and the tension lever securing a start fuel increment stroke in the governor lever; a fuel regulating rack connected to the governor lever; a supporting shaft mounted in the case supporting both the governor lever and the tension lever for rotation; and a locking mechanism which connects both levers at the time when the start fuel increment stroke of the governor lever becomes zero or approximately zero to be eliminated.

  2. Semipermanent and permanent injectable fillers.

    PubMed

    Jones, Derek H

    2009-10-01

    Today, an impressive array of injectable dermal fillers for facial soft-tissue augmentation is available in the United States. These agents, most of which were introduced in the last half decade, represent a variety of semipermanent and permanent fillers across several categories. Physicians can choose between semipermanent fillers, such as hyaluronic acid derivatives (HA), calcium hydroxylapatite (CaHA), and poly-L-lactic acid (PLA), and longer-lasting, so-called "permanent fillers," such as polymethyl methacrylate microspheres (PMMA), highly purified forms of liquid silicone, and hydrogel polymers. PMID:19850193

  3. Injectable collagen implant--update.

    PubMed

    Castrow, F F; Krull, E A

    1983-12-01

    Injectable collagen implant (ICI), a new biomaterial reportedly useful for correction of scars and certain aging skin lines (wrinkles), was recently introduced. The purpose of this paper is to evaluate the safety and efficacy of this product. Data for this study were obtained from a survey which was sent to a group of cutaneous surgeons. They were asked about test site and treatment site reactions and about their satisfaction with ICI. The incidence of adverse reactions is low, and the severity of the reactions does not appear to be serious. The long-term benefit of ICI has not been established.

  4. Fuel injection device and method

    DOEpatents

    Carlson, Larry W.

    1986-02-04

    A fuel injection system and method provide for shaping a combustion plume within a combustion chamber to effectively recirculate hot combustion gases for stable combustion conditions while providing symmetrical combustion conditions. Char and molten slag are passed to the outer boundary layer to complete combustion of char while permitting initial substoichiometric combustion in a reductive atmosphere for reducing discharge of nitrogen oxides. Shaping of the plume is accomplished by an axially adjustable pintle which permits apportionment of driving pressure between elements which contribute tangential and those which contribute radial directional components to oxidant flow entering the combustion chamber.

  5. Porous media heat transfer for injection molding

    DOEpatents

    Beer, Neil Reginald

    2016-05-31

    The cooling of injection molded plastic is targeted. Coolant flows into a porous medium disposed within an injection molding component via a porous medium inlet. The porous medium is thermally coupled to a mold cavity configured to receive injected liquid plastic. The porous medium beneficially allows for an increased rate of heat transfer from the injected liquid plastic to the coolant and provides additional structural support over a hollow cooling well. When the temperature of the injected liquid plastic falls below a solidifying temperature threshold, the molded component is ejected and collected.

  6. Dependence of injection locking of a TEA CO2 laser on intensity of injected radiation

    NASA Technical Reports Server (NTRS)

    Oppenheim, U. P.; Menzies, R. T.; Kavaya, M. J.

    1982-01-01

    The results of an experimental study to determine the minimum required injected power to control the output frequency of a TEA CO2 laser are reported. A CW CO2 waveguide laser was used as the injection oscillator. Both the power and the frequency of the injected radiation were varied, while the TEA resonator cavity length was adjusted to match the frequency of the injected signal. Single-longitudinal mode (SLM) TEA laser radiation was produced for injected power levels which are several orders of magnitude below those previously reported. The ratio of SLM output power to injection power exceeded 10 to the 12th at the lowest levels of injected intensity.

  7. Compressor Stability Enhancement Using Discrete Tip Injection

    NASA Technical Reports Server (NTRS)

    Suder, Kenneth L.; Hathaway, Michael D.; Thorp, Scott A.; Strazisar, Anthony J.; Bright, Michelle B.

    2001-01-01

    Mass injection upstream of the tip of a high-speed axial compressor rotor is a stability enhancement approach known to be effective in suppressing small in tip-critical rotors. This process is examined in a transonic axial compressor rotor through experiments and time-averaged Navier-Stokes CFD simulations. Measurements and simulations for discrete injection are presented for a range of injection rates and distributions of injectors around the annulus. The simulations indicate that tip injection increases stability by unloading the rotor tip and that increasing injection velocity improves the effectiveness of tip injection. For the tested rotor, experimental results demonstrate that at 70 percent speed the stalling flow coefficient can be reduced by 30 percent using an injected mass- flow equivalent to 1 percent of the annulus flow. At design speed, the stalling flow coefficient was reduced by 6 percent using an injected mass-fiow equivalent to 2 percent of the annulus flow. The experiments show that stability enhancement is related to the mass-averaged axial velocity at the tip. For a given injected mass-flow, the mass-averaged axial velocity at the tip is increased by injecting flow over discrete portions of the circumference as opposed to full-annular injection. The implications of these results on the design of recirculating casing treatments and other methods to enhance stability will be discussed.

  8. Maximum magnitude earthquakes induced by fluid injection

    NASA Astrophysics Data System (ADS)

    McGarr, A.

    2014-02-01

    Analysis of numerous case histories of earthquake sequences induced by fluid injection at depth reveals that the maximum magnitude appears to be limited according to the total volume of fluid injected. Similarly, the maximum seismic moment seems to have an upper bound proportional to the total volume of injected fluid. Activities involving fluid injection include (1) hydraulic fracturing of shale formations or coal seams to extract gas and oil, (2) disposal of wastewater from these gas and oil activities by injection into deep aquifers, and (3) the development of enhanced geothermal systems by injecting water into hot, low-permeability rock. Of these three operations, wastewater disposal is observed to be associated with the largest earthquakes, with maximum magnitudes sometimes exceeding 5. To estimate the maximum earthquake that could be induced by a given fluid injection project, the rock mass is assumed to be fully saturated, brittle, to respond to injection with a sequence of earthquakes localized to the region weakened by the pore pressure increase of the injection operation and to have a Gutenberg-Richter magnitude distribution with a b value of 1. If these assumptions correctly describe the circumstances of the largest earthquake, then the maximum seismic moment is limited to the volume of injected liquid times the modulus of rigidity. Observations from the available case histories of earthquakes induced by fluid injection are consistent with this bound on seismic moment. In view of the uncertainties in this analysis, however, this should not be regarded as an absolute physical limit.

  9. Acetaminophen injection: a review of clinical information.

    PubMed

    Jones, Virginia M

    2011-01-01

    Acetaminophen injection is an antipyretic and analgesic agent recently marketed in the United States as Ofirmev. Five published trials directly compare acetaminophen injection to drugs available in the United States. For management of pain in adults, acetaminophen injection was at least as effective as morphine injection in renal colic, oral ibuprofen after cesarean delivery, and oral acetaminophen after coronary artery bypass surgery. In children (3 to 16 years old), single-dose acetaminophen injection was similar to meperidine intramuscular (i.m.) for pain after tonsillectomy; readiness for discharge from the recovery room was shorter with acetaminophen injection (median 15 minutes) compared with meperidine i.m. (median 25 minutes), P = .005. In children (2 to 5 years old) postoperative adenotonsillectomy or adenoidectomy, the time to rescue analgesia was superior with high-dose acetaminophen rectal suppository (median 10 hours) compared with acetaminophen injection (median 7 hours), P = .01. One published trial demonstrated acetaminophen injection is noninferior to propacetamol injection for fever related to infection in pediatric patients. Dosing adjustments are not required when switching between oral and injectable acetaminophen formulations in adult and adolescent patients. Acetaminophen injection represents another agent for multimodal pain management. PMID:21936636

  10. FDDI network test adaptor error injection circuit

    NASA Technical Reports Server (NTRS)

    Eckenrode, Thomas (Inventor); Stauffer, David R. (Inventor); Stempski, Rebecca (Inventor)

    1994-01-01

    An apparatus for injecting errors into a FDDI token ring network is disclosed. The error injection scheme operates by fooling a FORMAC into thinking it sent a real frame of data. This is done by using two RAM buffers. The RAM buffer normally accessed by the RBC/DPC becomes a SHADOW RAM during error injection operation. A dummy frame is loaded into the shadow RAM in order to fool the FORMAC. This data is just like the data that would be used if sending a normal frame, with the restriction that it must be shorter than the error injection data. The other buffer, the error injection RAM, contains the error injection frame. The error injection data is sent out to the media by switching a multiplexor. When the FORMAC is done transmitting the data, the multiplexor is switched back to the normal mode. Thus, the FORMAC is unaware of what happened and the token ring remains operational.

  11. Anthropological perspectives on injections: a review.

    PubMed Central

    Reeler, A. V.

    2000-01-01

    Qualitative studies from developing countries have pointed to the widespread popularity of injections. In addition to their use by formal and informal providers and traditional healers, there is now increasing evidence of the use of injections and injection equipment by lay people. Epidemiological research links the large number of unsafe injections to serious bloodborne infections such as viral hepatitis B and C and acquired immunodeficiency syndrome (AIDS). The present article examines the reasons behind the demand for injections by consumers and the administration of unnecessary or unsafe injections by different types of provider. Interventions aimed at reducing the risk of unsafe injections are discussed in relation to cultural and social factors as well as those factors associated with health systems. Suggestions are made for approaches to the design of such interventions. PMID:10686748

  12. Robotic ICSI (intracytoplasmic sperm injection).

    PubMed

    Lu, Zhe; Zhang, Xuping; Leung, Clement; Esfandiari, Navid; Casper, Robert F; Sun, Yu

    2011-07-01

    This paper is the first report of robotic intracytoplasmic sperm injection (ICSI). ICSI is a clinical procedure performed worldwide in fertility clinics, requiring pick-up of a single sperm and insertion of it into an oocyte (i.e., egg cell). Since its invention 20 years ago, ICSI has been conducted manually by a handful of highly skilled embryologists; however, success rates vary significantly among clinics due to poor reproducibility and inconsistency across operators. We leverage our work in robotic cell injection to realize robotic ICSI and aim ultimately, to standardize how clinical ICSI is performed. This paper presents some of the technical aspects of our robotic ICSI system, including a cell holding device, motion control, and computer vision algorithms. The system performs visual tracking of single sperm, robotic immobilization of sperm, aspiration of sperm with picoliter volume, and insertion of sperm into an oocyte with a high degree of reproducibility. The system requires minimal human involvement (requiring only a few computer mouse clicks), and is human operator skill independent. Using the hamster oocyte-human sperm model in preliminary trials, the robotic system demonstrated a high success rate of 90.0% and survival rate of 90.7% (n=120). PMID:21521663

  13. Robotic ICSI (intracytoplasmic sperm injection).

    PubMed

    Lu, Zhe; Zhang, Xuping; Leung, Clement; Esfandiari, Navid; Casper, Robert F; Sun, Yu

    2011-07-01

    This paper is the first report of robotic intracytoplasmic sperm injection (ICSI). ICSI is a clinical procedure performed worldwide in fertility clinics, requiring pick-up of a single sperm and insertion of it into an oocyte (i.e., egg cell). Since its invention 20 years ago, ICSI has been conducted manually by a handful of highly skilled embryologists; however, success rates vary significantly among clinics due to poor reproducibility and inconsistency across operators. We leverage our work in robotic cell injection to realize robotic ICSI and aim ultimately, to standardize how clinical ICSI is performed. This paper presents some of the technical aspects of our robotic ICSI system, including a cell holding device, motion control, and computer vision algorithms. The system performs visual tracking of single sperm, robotic immobilization of sperm, aspiration of sperm with picoliter volume, and insertion of sperm into an oocyte with a high degree of reproducibility. The system requires minimal human involvement (requiring only a few computer mouse clicks), and is human operator skill independent. Using the hamster oocyte-human sperm model in preliminary trials, the robotic system demonstrated a high success rate of 90.0% and survival rate of 90.7% (n=120).

  14. Prevalence and correlates of neck injection among people who inject drugs in Tijuana, Mexico

    PubMed Central

    RAFFUL, CLAUDIA; WAGNER, KARLA D.; WERB, DAN; GONZÁLEZ-ZÚÑIGA, PATRICIA E.; VERDUGO, SILVIA; RANGEL, GUDELIA; STRATHDEE, STEFFANIE A.

    2016-01-01

    Introduction and Aims Injecting drugs in the neck has been related to adverse health conditions such as jugular vein thrombosis, deep neck infections, aneurysm, haematomas, airway obstruction, vocal cord paralysis and wound botulism, among others. We identified prevalence and correlates of neck injection among people who inject drugs (PWID) in Tijuana, Mexico. Design and Methods Beginning in 2011, PWID aged ≥18 years who injected drugs within the last month were recruited into a prospective cohort. At baseline and semi-annually, PWID completed interviewer-administered surveys soliciting data on drug-injecting practices. Logistic regression was used to identify predictors of injecting in the neck as the most frequent injection site at a single visit. Results Of 380 PWID, 35.3% injected in the neck at least once in the past 6 months, among whom 71.6% reported it as their most common injection site, the most common injecting site after the arms (47%). Controlling for age, years injecting and injecting frequency, injecting heroin and methamphetamine two or more times per day and having sought injection assistance were associated with injecting in the neck [adjusted odds ratios (AOR): 2.12; 95% confidence intervals (CI): 1.27–3.53 and AOR: 2.65; 95% CI: 1.52–4.53 respectively]. Discussion and Conclusions Injecting in the neck was very common among PWID in Tijuana and was associated with polydrug use and seeking injection assistance. Tailoring harm reduction education interventions for individuals who provide injection assistance (‘hit doctors’) may allow for the dissemination of safe injecting knowledge to reduce injection-related morbidity and mortality. PMID:25867795

  15. Determination of Pb(II) by sequential injection/stripping analysis at all-plastic electrochemical fluidic cells with integrated composite electrodes.

    PubMed

    Kokkinos, Christos; Economou, Anastasios; Goddard, Nicholas G; Fielden, Peter R; Baldock, Sara J

    2016-06-01

    This work reports the development of a sequential injection/stripping analysis method for the determination of trace Pb(II) at injection-moulded electrochemical fluidic cells. Conducting carbon fibre-loaded polystyrene electrodes were integrated within the plastic cells. The flow-through cells were incorporated into a home-made sequential injection analysis (SIA) manifold. Different experimental parameters for the detection of Pb(II) were investigated including the type and concentration of the supporting electrolyte, the conditions of the stripping step, the volume of the sample, the flow rate and the accumulation potential. The LOD for Pb(II) was 0.5μgL(-1), the within-cell % relative standard deviation (n=8) was 3.1% and the between-cell % relative standard deviation (n=5) was 8.9% for 25μgL(-1) Pb(II). The cells were applied to the determination of Pb(II) in tapwater and a phosphate fertilizer sample. PMID:27130105

  16. Guidelines for the prevention of invasive mould diseases caused by filamentous fungi by the Spanish Society of Infectious Diseases and Clinical Microbiology (SEIMC).

    PubMed

    Ruiz-Camps, I; Aguado, J M; Almirante, B; Bouza, E; Ferrer-Barbera, C F; Len, O; Lopez-Cerero, L; Rodríguez-Tudela, J L; Ruiz, M; Solé, A; Vallejo, C; Vazquez, L; Zaragoza, R; Cuenca-Estrella, M

    2011-04-01

    Invasive fungal infections (IFIs) caused by filamentous fungi still have high rates of mortality, associated with difficulties in early detection of the infection and therapeutic limitations. Consequently, a useful approach is to prevent patients at risk of fungal infection from coming into contact with conidia of Aspergillus and other mould species. This document describes the recommendations for preventing IFI caused by filamentous fungi worked out by Spanish experts from different medical and professional fields. The article reviews the incidence of IFI in different risk populations, and questions related to environmental measures for prevention, control of hospital infections, additional procedures for prevention, prevention of IFI outside of hospital facilities and antifungal prophylaxis are also analysed.

  17. Modeling injection well performance during deep-well injection of liquid wastes

    NASA Astrophysics Data System (ADS)

    Saripalli, K. P.; Sharma, M. M.; Bryant, S. L.

    2000-01-01

    Deep-well injection of municipal and industrial wastes, and liquid hazardous wastes is an important waste disposal practice worldwide. Performance of injection wells during the deep-well injection of liquid wastes and waste waters is critically dependent upon the physico-chemical properties of the waste, the operational parameters such as injection rates and pressures, as well as the hydrogeologic and geochemical character of the host formation. Development of theories and models that can predict the injection well performance as a function of these parameters is a vital research need. This paper presents the development and application of a well injectivity decline (WID) simulator, that can be used to model injection well performance during deep-well injection. Injectivity decline due to particulates in the injection fluid is modeled for various types of well completions. Results from the simulator are presented with an emphasis on the resulting well plugging and injectivity decline. The significant role played by injected wastewater quality, host formation properties, injection rate and pressure, well completion type, initial damage to the well/formation and the presence of gravel packs around the wellbore is discussed. The results quantitatively show that under typical injection conditions a high total suspended solids (TSS) concentration in the waste stream, low injection rate, low injection pressures, formation heterogeneity (layering), low porosity and permeability of the formation all contribute to a rapid decline in injection well performance. The simulator provides a tool for predicting well performance during waste injection as a function of the waste, formation and operational characteristics. Such simulations can be valuable during planning and operating injection wells to achieve and sustain satisfactory well performance.

  18. Safety of intracytoplasmic sperm injection.

    PubMed

    Palermo, Gianpiero D; Neri, Queenie V; Rosenwaks, Zev

    2014-01-01

    Early follow-up studies of IVF children showed that the frequency of birth anomalies resembled those arising with natural conception. More detailed analyses confirmed these findings, reinforcing the concept of the preimplantation period as teratologically "safe." The use of intracytoplasmic sperm injection (ICSI) to achieve fertilization introduced another variable.ICSI's safety has often been criticized because the fertilizing spermatozoon neither binds to the zona pellucida nor fuses with oolemma. Bypassing these physiologic steps together with the arbitrary selection of the spermatozoon has been reason for concern. Thus far, ICSI offspring undergoing adolescence and beyond has provided sufficient information to reassure these qualms. In fact, the health of the offspring generated through ICSI, once taken into consideration the gestational order, the age and the genetic makeup of the couples are generally reassuring.

  19. Fault Injection Techniques and Tools

    NASA Technical Reports Server (NTRS)

    Hsueh, Mei-Chen; Tsai, Timothy K.; Iyer, Ravishankar K.

    1997-01-01

    Dependability evaluation involves the study of failures and errors. The destructive nature of a crash and long error latency make it difficult to identify the causes of failures in the operational environment. It is particularly hard to recreate a failure scenario for a large, complex system. To identify and understand potential failures, we use an experiment-based approach for studying the dependability of a system. Such an approach is applied not only during the conception and design phases, but also during the prototype and operational phases. To take an experiment-based approach, we must first understand a system's architecture, structure, and behavior. Specifically, we need to know its tolerance for faults and failures, including its built-in detection and recovery mechanisms, and we need specific instruments and tools to inject faults, create failures or errors, and monitor their effects.

  20. Distinguishing among electron injection types

    NASA Technical Reports Server (NTRS)

    Feynman, J.

    1987-01-01

    Three types of electron injections taking place in the near-earth region of the magnetotail have been distinguished previously using SCATHA particle and field data. Defining characteristics are given here for each type of event, and the positions of the magnetosphere where they are expected to occur are discussed. These three event types can be difficult to distinguish in data sets that are more limited than the SCATHA set that carried instruments detecting magnetic fields and charged particles over an energy range from eVs to MeVs. It is suggested that determining the magnetospheric regions at which each of these event types occurs will considerably clarify the phenomenological description of substorms available for theoretical analysis.