Science.gov

Sample records for injection moulded santoprene

  1. Mould temperature control during injection moulding process

    NASA Astrophysics Data System (ADS)

    Postawa, Przemyslaw; Stachowiak, Tomasz

    2015-05-01

    Mould temperature is one of the most important parameter in injection moulding process of thermoplastic polymers in particular semi crystalline polymers. There are a lots of methods of control mould temperature but it is not simple and easy to measure heat transfer precisely. Injection moulds have usually a large mass and this is equal also to large heat capacity of tools and its thermal inertia. Measuring temperature by using contact equipment causes a lot of mistakes, because that method is based on heat transfer between thermocouple and measured area of mould. Result of research of 3 different method of temperature control of mould surface were present in the publication. For this purpose a special experimental mould was made. Mould has eight independent cooling circuits which were connected to the thermo controller Wittmann with two circuits. The main aim of research was to determine the effect of normal process of injection moulding on temperature changing in different area of mould. Under the cavity 4 thermocouple were placed and connect to the recorder what gave a possibility of uploading data during injection process. For that research mould temperature was change in many different layouts. Data and sequences of changes in temperature collected during tests gave very interesting result for discussion. Furthermore use of differences in temperature profile of the mould causes different temperature profile recorded during injection moulding. Tests were made by using fallowing equipment: Krauss Maffei injection moulding machine KM65-C4 and thermo controller Wittmann TPplus2, Shini Rotameter, infrared camera TESTO-890 and thermocouple signal recorder with 4 thermocouples of diameter 1mm located in injection mould 3mm under cavity surface. Draft of experimental mould and thermocouple location were presented in the article, and results of research as a drafts and charts of temperature changing in different area of mould were included.

  2. Injection moulding of optical functional micro structures using laser structured, PVD-coated mould inserts

    NASA Astrophysics Data System (ADS)

    Hopmann, Ch.; Weber, M.; Schöngart, M.; Schäfer, C.; Bobzin, K.; Bagcivan, N.; Brögelmann, T.; Theiß, S.; Münstermann, T.; Steger, M.

    2015-05-01

    Micro structured optical plastics components are intensively used i. e. in consumer electronics, for optical sensors in metrology, innovative LED-lighting or laser technology. Injection moulding has proven to be successful for the large-scale production of those parts. However, the production of those parts still causes difficulties due to challenges in the moulding and demoulding of plastics parts created with laser structured mould inserts. A complete moulding of the structures often leads to increased demoulding forces, which then cause a breaking of the structures and a clogging of the mould. An innovative approach is to combine PVD-coated (physical vapour deposition), laser structured inserts and a variothermal moulding process to create functional mic8iüro structures in a one-step process. Therefore, a PVD-coating is applied after the laser structuring process in order to improve the wear resistance and the anti-adhesive properties against the plastics melt. In a series of moulding trials with polycarbonate (PC) and polymethylmethacrylate (PMMA) using different coated moulds, the mould temperature during injection was varied in the range of the glass transition and the melt temperature of the polymers. Subsequently, the surface topography of the moulded parts is evaluated by digital 3D laser-scanning microscopy. The influence of the moulding parameters and the coating of the mould insert on the moulding accuracy and the demoulding behaviour are being analysed. It is shown that micro structures created by ultra-short pulse laser ablation can be successfully replicated in a variothermal moulding process. Due to the mould coating, significant improvements could be achieved in producing micro structured optical plastics components.

  3. Injection moulding of optical functional micro structures using laser structured, PVD-coated mould inserts

    SciTech Connect

    Hopmann, Ch.; Weber, M.; Schöngart, M.; Schäfer, C.; Bobzin, K.; Bagcivan, N.; Brögelmann, T.; Theiß, S.; Münstermann, T.; Steger, M.

    2015-05-22

    Micro structured optical plastics components are intensively used i. e. in consumer electronics, for optical sensors in metrology, innovative LED-lighting or laser technology. Injection moulding has proven to be successful for the large-scale production of those parts. However, the production of those parts still causes difficulties due to challenges in the moulding and demoulding of plastics parts created with laser structured mould inserts. A complete moulding of the structures often leads to increased demoulding forces, which then cause a breaking of the structures and a clogging of the mould. An innovative approach is to combine PVD-coated (physical vapour deposition), laser structured inserts and a variothermal moulding process to create functional mic8iüro structures in a one-step process. Therefore, a PVD-coating is applied after the laser structuring process in order to improve the wear resistance and the anti-adhesive properties against the plastics melt. In a series of moulding trials with polycarbonate (PC) and polymethylmethacrylate (PMMA) using different coated moulds, the mould temperature during injection was varied in the range of the glass transition and the melt temperature of the polymers. Subsequently, the surface topography of the moulded parts is evaluated by digital 3D laser-scanning microscopy. The influence of the moulding parameters and the coating of the mould insert on the moulding accuracy and the demoulding behaviour are being analysed. It is shown that micro structures created by ultra-short pulse laser ablation can be successfully replicated in a variothermal moulding process. Due to the mould coating, significant improvements could be achieved in producing micro structured optical plastics components.

  4. Multilayer injection moulding of thick-walled optical plastics parts

    NASA Astrophysics Data System (ADS)

    Hopmann, Ch.; Neuss, A.; Weber, M.; Walach, P.

    2014-05-01

    Optical components are often thick-walled. The cycle time of precise polymer optics with a wall thickness of more than 20 mm exceeds several minutes. The multilayer injection moulding or compression moulding lowers the cycle time and increases the quality of the moulded parts. For the production of multilayer moulded lenses the mould design plays an important role. An innovative mould concept is presented with the possiblity to produce double or triple layer lenses. To ensure the quality and the endurance of multilayer moulded optical components in their applications, the cohesion in the interface is important. Tensile shear tests show the ability of multilayer moulded parts with high cohesion values for optical applications.

  5. Injection Moulding of Wood Powder with Low Binder Content

    NASA Astrophysics Data System (ADS)

    Miki, Tsunehisa; Takakura, Norio; Iizuka, Takashi; Yamaguchi, Katsuhiko; Imanishi, Hiroshi; Kanayama, Kouzou

    This study is aimed at exploring possibilities to improve the injectability of wood powder and the mechanical properties of the injected product while keeping the amount of binder to its minimum. In the preliminary experiment, injection moulding of Japanese cedar wood powder was conducted. The effects of binder content (PE; pellet-size) and nozzle temperature on the tensile strength and strain at break of the product were investigated. Results showed that under such conditions, injection moulding of wood powder only was not possible due to insufficient fluidity. Increasing the binder content and the nozzle temperature resulted to a decrease in the maximum injection pressure and improvement in the fluidity of the powder. Using the same PE content, increasing the temperature resulted to an increase in tensile strength of the injected product. However, the strain at break was decreased. Moreover, at PE content below 50%, the strength and strain decreased considerably.

  6. Simulation of the injection moulding process

    NASA Astrophysics Data System (ADS)

    Hu, J.; Christensen, T.

    1993-12-01

    Simulation of the injection molding process is a helpful way for the engineers who work with plastics processing. By simulation, they will get some important parameters which sometimes are highly necessary for the mold design and processing. Thus, the engineers will save much time to do experiments for the parameters. Two simulation programs are used in this report, namely CADMOULD and CADMOULD MEFISTO which are designed by Institut fur Kunststoffverarbeitung (IKV) in Aachen, W. Germany. CADMOULD works with 2-D geometry and is specialized for rheological, thermal and mechanical calculation. It is installed on a personal computer, while CADMOULD MEFISTO works in 3-D and is installed on a VAX 8530 computer at SINTEF. A PC version of this program is also available. This report deals with CADMOULD and CADMOULD MEFISTO. The construction of flow lines, balancing of sprue system, the optimizing of injection time, and gate(s) optimizing are mainly included.

  7. Multiphase and multiscale approaches for modelling the injection of textured moulds

    NASA Astrophysics Data System (ADS)

    Nakhoul, Rebecca; Laure, Patrice; Silva, Luisa; Vincent, Michel

    2016-10-01

    Micro-injection moulding is frequently used for the mass production of devices in micro-medical technologies, micro-optics and micro-mechanics. This work focuses mainly on offering numerical tools to model the injection of micro-textured moulds. Such tools can predict the different filling scenarios of the micro-details and consequently offer optimal operating conditions (mould and melt temperatures, melt flow, stresses, etc.) to analyse the final part quality. To do so, a full Eulerian approach is used to model the injection of textured moulds at both the macroscopic and microscopic scales as usual industrial software cannot handle the filling of micro details. Since heat transfers with the mould are very relevant due to high cooling rates, the coupling between micro- and macro- simulations is primordial to insure a complete and accurate representation of textured mould injection.

  8. Development of Metal/Polymer Mixtures for Micro Powder Injection Moulding

    NASA Astrophysics Data System (ADS)

    Quinard, C.; Barriere, T.; Gelin, J. C.

    2007-04-01

    Important research tasks at ENSMM/LMA are concerned for the development of mixtures of Fine powders associated to polymer binders dedicated to the powder injection moulding (PIM) and to the powder injection micro-moulding (μPIM) in accordance with many works already carried out with different feedstock suppliers dedicated to the macro-components.

  9. TiB2 nanostructured coating for GFRP injection moulds.

    PubMed

    Martinho, R P; Silva, F J G; Alexandre, R J D; Baptista, A P M

    2011-06-01

    In the injection moulding of polypropylene reinforced with hard glass fibres, die materials are commonly subjected to severe abrasive wear. In order to improve its wear resistance, an unbalanced magnetron sputtering PVD compositional monolayered coating has been produced. The film was composed by a nanostructured TiB2 monolayer. Microstructure characterization and thickness evaluation were conducted by scanning electron microscopy (SEM). Film topography and roughness were accessed by SEM and Atomic Force Microscopy (AFM). The phase analyse was investigated by X-ray diffraction (XRD), using Cu Kalpha radiation. Scratch tests were conducted in order to study the film adhesion to the substrate. Load-Displacement curves (nanoindentation analysis) allowed measuring the film hardness and Young's modulus. A ball-cratering tribometer was used to determine the micro-abrasion laboratorial wear resistance, under different tests conditions, using SiC particles in distilled water slurry. At the end of these tests, the worn surfaces were analyzed by SEM and Energy Dispersive X-ray Spectroscopy (EDS) in order to compare these results with some other coatings already tested in the same conditions. To test the practical wear resistance, 135000 injection cycles were done in a plastic injection industrial mould. Coated samples were put on the plastic feed canal, after a turbulent zone. In these tests, a 30% (wt) glass fibres reinforced polypropylene was used. Worn sample surfaces were analyzed by SEM after 45.000 and 90.000 cycles. Image analyses were made in order to evaluate the damage increases and to observe the wear mechanisms involved.

  10. Morphology and mechanical properties relationships in non-conventional melt manipulation injection moulding techniques

    NASA Astrophysics Data System (ADS)

    Kouyumdzhiev, Anton D.; Viana, Júlio C.

    2007-04-01

    Shear Controlled Orientation in Injection Moulding and Push-Pull Injection Moulding with abbreviations respectively SCORIM and PPIM, are two non-conventional injection moulding techniques based on the concept of in-mould shear manipulation of the melt during the solidification phase. In this work a diversity of microstructures were developed by SCORIM and PPIM by systematic variations of the processing conditions (total of 16 moulding conditions). The microstructures were observed by polarized light microscopy, being assessed the multi-laminated skin-to-core ratio. The level of molecular orientation of the skin and the relative degree of crystallinity of the core were evaluated by Wide-Angle X-ray scattering. The mechanical behaviour was assessed by flexural, tensile and fracture tests. The relationships between the morphology and the mechanical properties of the mouldings were established, regardless the processing technique, combining the results of both SCORIM and PPIM.

  11. Injection blow moulding single stage process: Validation of the numerical simulation through tomography analysis

    NASA Astrophysics Data System (ADS)

    Biglione, Jordan; Béreaux, Yves; Charmeau, Jean-Yves

    2016-10-01

    The injection blow moulding single stage process has been made available on standard injection moulding machine. Both the injection moulding stage and the blow moulding stage are being taken care of in an injection mould. Thus the dimensions of this mould are those of a conventional injection moulding mould. The fact that the two stages are located in the same mould leads to a process more constrained than the conventional one. This process introduces temperature gradients, molecular orientation, high stretch rates and high cooling rates. These constraints lead to a small processing window. In practice, the preform has to remain sufficiently melted to be blown so that the process takes place between the melting temperature and the crystallization temperature. In our numerical approach, the polymer is supposed to be blown in its molten state. Hence we have identified the mechanical behaviour of the polymer in its molten state through dynamical rheology experiments. A viscous Cross model has been proved to be relevant to the problem. Thermal dependence is assumed by an Arrhenius law. The process is simulated through a finite element code (POLYFLOW software) in the Ansys Workbench framework. Thickness measurements using image analysis of tomography data are performed and comparisons with the simulation results show good agreements.

  12. GTE blade injection moulding modeling and verification of models during process approbation

    NASA Astrophysics Data System (ADS)

    Stepanenko, I. S.; Khaimovich, A. I.

    2017-02-01

    The simulation model for filling the mould was developed using Moldex3D, and it was experimentally verified in order to perform further optimization calculations of the moulding process conditions. The method described in the article allows adjusting the finite-element model by minimizing the airfoil profile difference between the design and experimental melt motion front due to the differentiated change of power supplied to heating elements, which heat the injection mould in simulation. As a result of calibrating the injection mould for the gas-turbine engine blade, the mean difference between the design melt motion profile and the experimental airfoil profile of no more than 4% was achieved.

  13. Integrated Simulation of an Aspheric Lens Combining Injection Moulding Analysis with Ray Tracing

    NASA Astrophysics Data System (ADS)

    Park, Keun; Joo, Wonjong

    2007-05-01

    The present study covers an integrated simulation method for injection-moulded plastic lenses by combining a ray tracing simulation with a finite element (FE) analysis of injection moulding. Traditional ray tracing methods have based on the assumption that the optical properties of a lens are homogeneous throughout the entire volume. This assumption is to a certain extent unrealistic for injection-moulded plastic lenses because material properties vary at every point due to the injection moulding effects. To take into account the effects of the inhomogeneous optical properties of the moulded lens, a new ray tracing scheme is proposed in conjunction with an FE analysis of the injection moulding. A numerical scheme is developed to estimate the distribution of refractive indices from injection moulding analysis, and to calculate ray paths on every element layer with more realistic information of the refractive indices. A fully three-dimensional FE analysis is then performed for the aspheric lens moulding process. Through the FE analysis, the distribution of the refractive indices of the lens can be obtained on every mesh point. This information is then used to calculate the ray paths based on the FE mesh of which nodal points have unique index values. The proposed tracing scheme is implemented on the tracing of an aspheric lens, and its validity is ascertained through experimental verification.

  14. Fabrication of nano-structure anti-reflective lens using platinum nanoparticles in injection moulding

    NASA Astrophysics Data System (ADS)

    Kurihara, K.; Saitou, Y.; Souma, N.; Makihara, S.; Kato, H.; Nakano, T.

    2015-01-01

    We provide a lens mould to attain an anti-reflection sub-wavelength structure (SWS) for plastic replica in the injection moulding process. To obtain the SWS on the lens mould, platinum nanoparticles formed by decomposition of a platinum oxide were employed. The fabricated platinum nanoparticles were estimated to be 90 nm in diameter, on average, and the dispersion of the particle diameter was evaluated to be ±20 nm. Through nanostructure replication by injection moulding, antireflection of less than 0.5% was achieved, and transmittance increased over 98%. In addition, a high-replication durability of over 10 000 times was attained. The variation of the minimum reflection ratio was evaluated to be 0.38% ± 0.04%. The usefulness of the proposed SWS mould for mass-production was confirmed, as it allows for high durability and SWS formation on the lens surface.

  15. Tailoring the heat transfer on the injection moulding cavity by plasma sprayed ceramic coatings

    NASA Astrophysics Data System (ADS)

    Bobzin, K.; Hopmann, Ch; Öte, M.; Knoch, M. A.; Alkhasli, I.; Dornebusch, H.; Schmitz, M.

    2017-03-01

    Inhomogeneous material shrinkage in injection moulding can cause warpage in thermoplastic components. To minimise the deformations of the injection moulding parts, the heat transfer during the cooling phase can be adjusted according to the local cooling demand on the surface of the mould cavity by means of plasma sprayed coatings with locally variable thermal resistance over the surface of the mould. Thermal resistance is a function of thermal conductivity and thickness of the coatings, where thermal conductivity of thermal barrier coatings can be adjusted by altering the chemical composition and the microstructure, which is depending on the thickness. This work evaluates the application of plasma sprayed coatings with variable thickness as thermal barrier coatings in the mould cavity. The thermal resistance of the coating and thereby the heat transfer from the melt into the mould will be influenced locally by varying the coating thickness over the cavity area according to the local cooling demand. Using the laser flash method, the thermal conduction of coatings with different thicknesses will be determined. On the basis of the experimentally determined thermal conduction, the effect of the coatings on the temperature field of the mould cavity will be numerically calculated and the required thickness distribution of the coating for an optimal temperature gradient will be determined.

  16. Electrical, Thermal, and Machining Behaviour of Injection Moulded Polymeric CNT Nanocomposites

    NASA Astrophysics Data System (ADS)

    Mahmoodi, Mehdi

    Carbon nanotubes (CNTs) are promising additives for thermoplastics, resulting from their superior electrical, thermal and mechanical properties. Due to the desirable properties of CNT/polymer composites and their wide application in technological devices, these materials have attracted a great deal of attention from both academia and industry. A considerable amount of research has been devoted to the processing of CNT-filled nanocomposites, but only a few investigations have focussed on the injection moulding of these nanocomposites. This research was aimed at the study of the flow-induced alignment of CNT/polymer nanocomposites through the injection moulding process. We focussed on the understanding of the alignment of multi-walled carbon nanotubes (MWCNTs) in a thermoplastic matrix and the investigation of the alignment's effect on the electrical, thermal and machining characteristics of the injection moulded nanocomposites. The nanocomposites were first prepared with a melt mixing technique (i.e. twin screw extrusion), and they were then injection moulded under various processing conditions and mould geometries. High aspect ratio nanotubes could be partially aligned in the parallel-to-flow direction, resulting from the in-plane shear flow exerted on the polymeric melt in the injection cavity. It can be concluded that the volume resistivity of the moulded samples could be varied up to 7 orders of magnitude by changing the processing conditions and gate type in the injection moulding process. The electromagnetic interference shielding effectiveness (EMI SE) of the moulded composites was studied by considering the alignment of the MWCNTs. The EMI SE decreased with an increase in the alignment of the injection moulded MWCNTs in the polymer matrix. Anisotropic thermal conductivity was observed for the injection moulded nanocomposites. It was shown that thermal conductivity can be enhanced by aligning the nanotubes in the parallel-to-flow direction. The post

  17. Experimental Investigation of Process Conditions in Injection Stretch Blow Moulding

    NASA Astrophysics Data System (ADS)

    Salomeia, Y.; Menary, G.; Armstrong, C. G.

    2007-04-01

    Various processing parameters influence the final product properties in the stretch blow moulding process. These properties are highly dependent on the balance between the stretching of the polymer and blowing times as well as the level of the pressure inside the bottle. A data acquisition system capable of accurately measuring the process conditions within an industrial environment is discussed. Experimental work has been conducted on an industrial stretch blow moulding machine by means of replacing the original stretch rod with one that contains a force cell and a pressure transducer. Correlation between the stretching force, displacement of the rod and the pressure inside the bottle give a better understanding of the process and should allow a more precise final element simulation of the process to be developed.

  18. Injection moulding of micro-parts: applications to micro-gears

    NASA Astrophysics Data System (ADS)

    Barriere, T.; Gelin, J. C.; Michel, G.; Sahli, M.; Quinard, C.

    2007-04-01

    The paper is concerned with the development of the injection molding process for micro-parts with an application to injection moulding of micro-gears with the volume less than 0.2 mm3. First the paper describes the equipment that is used consisting in a micro-injection equipment that that is used consisting in a micro-injection that permits simultaneously bi-polymer injection. A polypropylene polymer is then used and characterized. The mould cavity corresponding to a micro-gear and related equipment is related. Finally the micro-injections are realized and the geometry of the micro-gears is reported in using an optical measurement system.

  19. Application Of Moldex3D For Thin-wall Injection Moulding Simulation

    NASA Astrophysics Data System (ADS)

    Šercer, Mladen; Godec, Damir; Bujanić, Božo

    2007-05-01

    The benefits associated with decreasing wall thicknesses below their current values are still measurable and desired even if the final wall thickness is nowhere near those of the aggressive portable electronics industry. It is important to note that gains in wall section reduction do not always occur without investment, in this case, in tooling and machinery upgrades. Equally important is the fact that productivity and performance benefits of reduced material usage, fast cycle times, and lighter weight can often outweigh most of the added costs. In order to eliminate unnecessary mould trials, minimize product development cycle, reduce overall costs and improve product quality, polymeric engineers use new CAE technology (Computer Aided Engineering). This technology is a simulation tool, which combines proven theories, material properties and process conditions to generate realistic simulations and produce valuable recommendations. Based on these recommendations, an optional combination of product design, material and process conditions can be identified. In this work, Moldex3D software was used for simulation of injection moulding in order to avoid potential moulding problems. The results gained from the simulation were used for the optimization of an existing product design, for mould development and for optimization of processing parameters, e.g. injection pressure, mould cavity temperature, etc.

  20. Part weight verification between simulation and experiment of plastic part in injection moulding process

    NASA Astrophysics Data System (ADS)

    Amran, M. A. M.; Idayu, N.; Faizal, K. M.; Sanusi, M.; Izamshah, R.; Shahir, M.

    2016-11-01

    In this study, the main objective is to determine the percentage difference of part weight between experimental and simulation work. The effect of process parameters on weight of plastic part is also investigated. The process parameters involved were mould temperature, melt temperature, injection time and cooling time. Autodesk Simulation Moldflow software was used to run the simulation of the plastic part. Taguchi method was selected as Design of Experiment to conduct the experiment. Then, the simulation result was validated with the experimental result. It was found that the minimum and maximum percentage of differential of part weight between simulation and experimental work are 0.35 % and 1.43 % respectively. In addition, the most significant parameter that affected part weight is the mould temperature, followed by melt temperature, injection time and cooling time.

  1. Effect of the crystallization on the surface temperature of a polymer during injection moulding

    NASA Astrophysics Data System (ADS)

    Le Goff, Ronan; Delaunay, Didier

    2007-04-01

    We present experimental results and theoretical analysis of heat transfer during injection moulding of a fibber reinforced semi-crystalline thermoplastic (IXEF). This one is a PA MXD6, with a mass fibber ratio of 30% and 50%. We illustrate the influence of the source term of crystallization on the surface temperature of the polymer, inducing strong influence of the pressure and of the shear during filling on this temperature.

  2. Development of bio-sourced binder to metal injection moulding

    NASA Astrophysics Data System (ADS)

    Royer, Alexandre; Barrière, Thierry; Gelin, Jean-Claude

    2016-10-01

    In the MIM process the binder play the most important role. It provides fluidity of the feedstock mixture for injection molding and adhesion of the powder to keep the molded shape. The binder must provide strength and cohesion for the molded part, must be easy to be removed from the molded part, and must be the recyclable, environmentally friendly and economical ones. The goal of this study is to develop a binder environmentally friendly. For this, a study of formulation based on polyethylene glycol, because of is water debinding properties, was made. Polylactic acid and Polyhydroxyalkanoates were investigated as bio sourced polymers. The chemical, miscibility and rheological behavior of the binder formulation were investigated.

  3. A New Approach For The Validation Of Filling Simulations In Micro Injection Moulding

    NASA Astrophysics Data System (ADS)

    Gava, A.; Tosello, G.; Hansen, H. N.; Salvador, M.; Lucchetta, G.

    2007-05-01

    In manufacturing polymer micro products, numerical simulations are used with the same purposes as in conventional injection moulding, mainly the optimization of micro components design, the optimization of process parameters and the decrease of production costs. Dedicated simulations softwares fail to correctly describe the melt flow in microstructures, mainly because phenomena such as tendency of polymers to slip in micro-channels, micro scale surface effects, and micro scale rheological behaviour are not considered. Therefore, accuracy of computer aided engineering simulations still needs to be improved. The main objective of this work is to evaluate whether the present numerical codes are suitable to characterize melt flow patterns in a micro cavity. In order to test the accuracy of the software, real and simulated experiments were performed and used to investigate the filling of a micro moulded component.

  4. Investigation of Plasma Treatment on Micro-Injection Moulded Microneedle for Drug Delivery

    PubMed Central

    Nair, Karthik; Whiteside, Benjamin; Grant, Colin; Patel, Rajnikant; Tuinea-Bobe, Cristina; Norris, Keith; Paradkar, Anant

    2015-01-01

    Plasma technology has been widely used to increase the surface energy of the polymer surfaces for many industrial applications; in particular to increase in wettability. The present work was carried out to investigate how surface modification using plasma treatment modifies the surface energy of micro-injection moulded microneedles and its influence on drug delivery. Microneedles of polyether ether ketone and polycarbonate and have been manufactured using micro-injection moulding and samples from each production batch have been subsequently subjected to a range of plasma treatment. These samples were coated with bovine serum albumin to study the protein adsorption on these treated polymer surfaces. Sample surfaces structures, before and after treatment, were studied using atomic force microscope and surface energies have been obtained using contact angle measurement and calculated using the Owens-Wendt theory. Adsorption performance of bovine serum albumin and release kinetics for each sample set was assessed using a Franz diffusion cell. Results indicate that plasma treatment significantly increases the surface energy and roughness of the microneedles resulting in better adsorption and release of BSA. PMID:26529005

  5. Optimization of Gate, Runner and Sprue in Two-Plate Family Plastic Injection Mould

    NASA Astrophysics Data System (ADS)

    Amran, M. A.; Hadzley, M.; Amri, S.; Izamshah, R.; Hassan, A.; Samsi, S.; Shahir, K.

    2010-03-01

    This paper describes the optimization size of gate, runner and sprue in two-plate family plastic injection mould. An Electronic Cash Register (ECR) plastic product was used in this study, which there are three components in electronic cast register plastic product consist of top casing, bottom casing and paper holder. The objectives of this paper are to find out the optimum size of gate, runner and sprue, to locate the optimum layout of cavities and to recognize the defect problems due to the wrong size of gate, runner and sprue. Three types of software were used in this study, which Unigraphics software as CAD tool was used to design 3D modeling, Rhinoceros software as post processing tool was used to design gate, runner and sprue and Moldex software as simulation tool was used to analyze the plastic flow. As result, some modifications were made on size of feeding system and location of cavity to eliminate the short- shot, over filling and welding line problems in two-plate family plastic injection mould.

  6. Material- and feature-dependent effects on cell adhesion to micro injection moulded medical polymers.

    PubMed

    Choi, Seong Ying; Habimana, Olivier; Flood, Peter; Reynaud, Emmanuel G; Rodriguez, Brian J; Zhang, Nan; Casey, Eoin; Gilchrist, Michael D

    2016-09-01

    Two polymers, polymethylmethacrylate (PMMA) and cyclic olefin copolymer (COC), containing a range of nano- to micron- roughness surfaces (Ra 0.01, 0.1, 0.4, 1.0, 2.0, 3.2 and 5.0μm) were fabricated using electrical discharge machining (EDM) and replicated using micro injection moulding (μIM). Polymer samples were characterized using optical profilometry, atomic force microscopy (AFM) and water surface contact angle. Cell adhesion tests were carried out using bacterial Pseudomonas fluorescens and mammalian Madin-Darby Canine Kidney (MDCK) cells to determine the effect of surface hydrophobicity, surface roughness and stiffness. It is found that there are features which gave insignificant differences (feature-dependent effect) in cell adhesion, albeit a significant difference in the physicochemical properties (material-dependent effect) of substrata. In bacterial cell adhesion, the strongest feature-dependence is found at Ra 0.4μm surfaces, with material-dependent effects strongest at Ra 0.01μm. Ra 0.1μm surfaces exhibited strongest feature-dependent effects and Ra 5.0μm has strongest material-dependent effects on mammalian cell adhesion. Bacterial cell adhesion is found to be favourable to hydrophobic surfaces (COC), with the lowest adhesion at Ra 0.4μm for both materials. Mammalian cell adhesion is lowest in Ra 0.1μm and highest in Ra 1.0μm, and generally favours hydrophilic surfaces (PMMA). These findings can be used as a basis for developing medical implants or microfluidic devices using micro injection moulding for diagnostic purposes, by tuning the cell adhesion on different areas containing different surface roughnesses on the diagnostic microfluidic devices or medical implants.

  7. Evaluation of injection moulding as a pharmaceutical technology to produce matrix tablets.

    PubMed

    Quinten, Thomas; De Beer, Thomas; Vervaet, Chris; Remon, Jean Paul

    2009-01-01

    The aim of this study was to develop sustained-release matrix tablets by means of injection moulding and to evaluate the influence of process temperature, matrix composition (EC and HPMC concentration) and viscosity grade of ethylcellulose (EC) and hydroxypropylmethylcellulose (HPMC) on processability and drug release. The drug release data were analyzed to get insight in the release kinetics and mechanism. Formulations containing metoprolol tartrate (30%, model drug), EC with dibutyl sebacate (matrix former and plasticizer) and hydrophilic polymer HPMC were extruded and subsequently injection moulded into tablets (375 mg, 10 mm diameter, convex-shaped) at temperatures ranging from 110 to 140 degrees C. Tablets containing 30% metoprolol and 70% ethylcellulose (EC 4mPa s) showed an incomplete drug release within 24 h (<50%). Increasing production temperatures resulted in a lower drug release rate. Substituting part of the EC fraction by HPMC (HPMC/EC-ratio: 20/50 and 35/35) resulted in faster and constant drug release rates. Formulations containing 50% HPMC had a complete and first-order drug release profile with drug release controlled via the combination of diffusion and swelling/erosion. Faster drug release rates were observed for higher viscosity grades of EC (Mw>20 mPa s) and HPMC (4000 and 10,000 mPa s). Tablet porosity was low (<4%). Differential scanning calorimetry (DSC) and X-ray powder diffraction studies (X-RD) showed that solid dispersions were formed during processing. Using thermogravimetrical analysis (TGA) and gel-permeation chromatography no degradation of drug and matrix polymer was observed. The surface morphology was investigated with the aid of scanning electron microscopy (SEM) showing an influence of the process temperature. Raman spectroscopy demonstrated that the drug is distributed in the entire matrix, however, some drug clusters were identified.

  8. Influence of wood species on properties of injection mould natural flour-HDPE composites

    NASA Astrophysics Data System (ADS)

    Ratanawilai, Thanate; Leeyoa, Massalan; Tiptong, Yoawanat

    2016-05-01

    Four combinations of wood flour, HDPE, and maleic anhydride (MA) include; (1) rubberwood:HDPE (30:70), (2) rubberwood: HDPE:MA (30:67:3), (3) palm oil:HDPE (30:70), and (4) palm oil:HDPE:MA (30:67:3) were studied. The injection moulding machine was used to produce wood plastic composites (WPCs). Maleic anhydride is an ingredient in bonding agents used to manufacture wood plastic composites. Extrusion molding process was conducted to prefabricate WPCs. Consequently, the effect of temperature and pressure ranging from 180, 190, 200°C and 2300, 2400, 2500 bar on injection molding was evaluated. Mechanical properties were tested including flexural testing and tensile testing according to ASTM D790 and D638, respectively. Hardness testing according to ASTM D2240 and scanning electron microscope (SEM) were also performed. Five replications were done on each test. The result showed that rubberwood:HDPE (30:70) gave a highest strength. The values of ultimate tensile strength, flexural strength, and hardness are 24.9 MPa, 33.3 MPa and 67.2 shore D, respectively. Finally, the uniform distribution of particle in WPCs, examined through SEM was achieved.

  9. A Streamline-Upwind Model for Filling Front Advection in Powder Injection Moulding

    NASA Astrophysics Data System (ADS)

    Larsen, Guillaume; Cheng, Zhi Qiang; Barriere, Thierry; Liu, Bao Sheng; Gelin, Jean-Claude

    2010-06-01

    The filling process of powder injection molding is modeled by the flows of two variably adjacent domains in the mold cavity. The feedstock is filled into the cavity while the air is expelled out by the injected feedstock [1]. Eulerian description is adopted. The filling patterns are determined by the solution of an advection equation, governed by the velocity field in both the feedstock flow and air flow [2]. In the real physics, the advance of filling front depends mainly on the flow of feedstock that locates behind the front. The flow of air in front of the injected material plays in fact no meaningful effect. However, the actual algorithm for solution of the advection equation takes equally the importance for both the flow of viscous feedstock and that of the slight air. Under such a condition, the injection flow of feedstock in simulation may be misdirected unrealistically by the velocity field in the air portion of the mold cavity. To correct this defect, an upwind scheme is proposed to reinforce the effect of upwind flow and reduce the effect of downstream flow. The present paper involves the investigation of an upwind algorithm for simulation of the filling state during powder injection molding. A Petrov-Galerkin upwind based method (SUPG) is adopted for numerical simulation of the transport equation instead of the Taylor-Galerkin method in previous work. In the proposed implementation of the Streamline-Upwind/Petrov-Galerkin (SUPG) approach. A stabilization method is used to prevent oscillations in the convection-dominated problems. It consists in the introduction of an artificial diffusion in streamline direction. Suitable modification of the test function is the important issue. It ensures the stable simulation of filling process and results in the more realistic prediction of filling patterns. The implementation of upwind scheme in mould filling state simulation, based on an advection equation and the whole velocity field of feedstock and air flow, makes

  10. High Power Picosecond Laser Surface Micro-texturing of H13 Tool Steel and Pattern Replication onto ABS Plastics via Injection Moulding

    NASA Astrophysics Data System (ADS)

    Otanocha, Omonigho B.; Li, Lin; Zhong, Shan; Liu, Zhu

    2016-03-01

    H13 tool steels are often used as dies and moulds for injection moulding of plastic components. Certain injection moulded components require micro-patterns on their surfaces in order to modify the physical properties of the components or for better mould release to reduce mould contamination. With these applications it is necessary to study micro-patterning to moulds and to ensure effective pattern transfer and replication onto the plastic component during moulding. In this paper, we report an investigation into high average powered (100 W) picosecond laser interactions with H13 tool steel during surface micro-patterning (texturing) and the subsequent pattern replication on ABS plastic material through injection moulding. Design of experiments and statistical modelling were used to understand the influences of laser pulse repetition rate, laser fluence, scanning velocity, and number of scans on the depth of cut, kerf width and heat affected zones (HAZ) size. The characteristics of the surface patterns are analysed. The process parameter interactions and significance of process parameters on the processing quality and efficiency are characterised. An optimum operating window is recommended. The transferred geometry is compared with the patterns generated on the dies. A discussion is made to explain the characteristics of laser texturing and pattern replication on plastics.

  11. In vitro bioactivity of micro metal injection moulded stainless steel with defined surface features.

    PubMed

    Bitar, Malak; Friederici, Vera; Imgrund, Philipp; Brose, Claudia; Bruinink, Arie

    2012-05-04

    Micrometre- and nanometre-scale surface structuring with ordered topography features may dramatically enhance orthopaedic implant integration. In this study we utilised a previously optimised micron metal injection moulding (µ-MIM) process to produce medical grade stainless steel surfaces bearing micrometre scale, protruding, hemispheres of controlled dimensions and spatial distribution. Additionally, the structured surfaces were characterised by the presence of submicrometre surface roughness resulting from metal grain boundary formation. Following cytocompatibility (cytotoxicity) evaluation using 3T3 mouse fibroblast cell line, the effect on primary human cell functionality was assessed focusing on cell attachment, shape and cytoskeleton conformation. In this respect, and by day 7 in culture, significant increase in focal adhesion size was associated with the microstructured surfaces compared to the planar control. The morphological conformation of the seeded cells, as revealed by fluorescence cytoskeleton labelling, also appeared to be guided in the vertical dimension between the hemisphere bodies. Quantitative evaluation of this guidance took place using live cytoplasm fluorescence labelling and image morphometry analysis utilising both, compactness and elongation shape descriptors. Significant increase in cell compactness was associated with the hemisphere arrays indicating collective increase in focused cell attachment to the hemisphere bodies across the entire cell population. Micrometre-scale hemisphere array patterns have therefore influenced cell attachment and conformation. Such influence may potentially aid in enhancing key cellular events such as, for example, neo-osteogenesis on implanted orthopaedic surfaces.

  12. Ultrasound based monitoring of the injection moulding process - Methods, applications and limitations

    SciTech Connect

    Praher, B. E-mail: klaus.straka@jku.at E-mail: georg.steinbichler@jku.at; Straka, K. E-mail: klaus.straka@jku.at E-mail: georg.steinbichler@jku.at; Usanovic, J. E-mail: klaus.straka@jku.at E-mail: georg.steinbichler@jku.at; Steinbichler, G. E-mail: klaus.straka@jku.at E-mail: georg.steinbichler@jku.at

    2014-05-15

    We developed novel non-invasive ultrasound based systems for the measurement of temperature distributions in the screw-ante chamber, the detection of unmelted granules and for the monitoring of the plasticizing process along the screw channel. The temperature of the polymer melt stored in the screw ante-chamber after the plasticization should be homogeneous. However, in reality the polymer melt in the screw ante-chamber is not homogeneous. Due to the fact the sound velocity in a polymer melt is temperature depending, we developed a tomography system using the measured transit times of ultrasonic pulses along different sound paths for calculating the temperature distribution in radial direction of a polymer melt in the screw ante-chamber of an injection moulding machine. For the detection of unmelted granules in the polymer melt we implemented an ultrasound transmission measurement. By analyzing the attenuation of the received pulses it is possible to detect unwanted inclusions. For the monitoring of the plasticizing process in the channels of the screw an ultrasonic pulse is transmitted into the barrel. By analyzing the reflected pulses it is possible to estimate solid bed and melt regions in the screw channel. The proposed systems were tested for accuracy and validity by simulations and test measurements.

  13. Influence of binding composition on the structure and properties of steel work-pieces obtained by injection moulding

    NASA Astrophysics Data System (ADS)

    Darenskaia, E. A.; Vaulina, O. Yu; Myachin, Yu V.; Kulkov, S. N.

    2017-02-01

    The paper presents the results of the research analyzing the influence of binding composition on the structure and properties of the stainless steel samples obtained by injection moulding technique. It have been determined the tailored composition of binding, which provides sufficient feedstock viscosity, low porosity of work-pieces, etc. Three binding compositions polypropylene and paraffin wax have been studied: 1:6, 1:2, 2:1, respectively. Stearic acid has been used as a SAS (surface active substance). The results have shown that the binding compositions between 1:6 and 1:2 polypropylene and paraffin wax provides sufficient viscosity feedstock, dimensional stability during debinding and sintering, and the high density of the final product.

  14. Injection-moulded models of major and minor arteries: the variability of model wall thickness owing to casting technique.

    PubMed

    O'Brien, T; Morris, L; O'Donnell, M; Walsh, M; McGloughlin, T

    2005-09-01

    Cardiovascular disease of major and minor arteries is a common cause of death in Western society. The wall mechanics and haemodynamics within the arteries are considered to be important factors in the disease formation process. This paper is concerned with the development of an efficient computer-integrated technique to manufacture idealized and realistic models of diseased major and minor arteries from radiological images and to address the issue of model wall thickness variability. Variations in wall thickness from the original computer models to the final castings are quantified using a CCD camera. The results found that wall thickness variation from the major and minor idealized artery models to design specification were insignificant, up to a maximum of 16 per cent. In realistic models, however, differences were up to 23 per cent in the major arterial models and 58 per cent in the minor arterial models, but the wall thickness variability remained within the limits of previously reported wall thickness results. It is concluded that the described injection moulding procedure yields idealized and realistic castings suitable for use in experimental investigations, with idealized models giving better agreement with design. Wall thickness is variable and should be assessed after the models are manufactured.

  15. Foam injection moulding of a TPO/TPC-blend and the effect of different nucleating agents on the resulting foam structure

    NASA Astrophysics Data System (ADS)

    Mueller, J.; Spoerrer, A.; Altstaedt, V.

    2014-05-01

    The manufacturing of car interior parts with a soft touch surface is possible in a one-step injection moulding process, in which an injection moulded carrier is overmoulded with a compatible foamed thermoplastic elastomer (TPE). In contrast to the complex conventional process the structural foaming of the TPE component allows a saving of one material component as it combines a compact skin and a foamed core. Furthermore the manufacturing process can be achieved on a two component injection moulding machine which offers a much higher economic efficiency. One approach to reach an adhesion between a reinforced PP carrier and the foamed TPE component including good surface resistance is the use of an olefinic-/polyester-based TPE blend (TPO/TPC-blend). This paper is going to show the possibility to process a TPO/TPC-blend system by foam injection moulding with MuCell® and how the resulting foam structure can be influenced by various nucleating agents. For this purpose particles which differ in type, form and size were added in various concentrations to the TPE-blend. Before the structure elucidation of the foamed samples the particle dispersion and their effects on the polymers rheological properties were investigated. Finally abrasion tests were performed to investigate the influence of the particles on the performance characteristics of the foamed blend system. The results showed that the foam structure as well as the surface quality of the foamed TPO/TPC-blend can be improved with the use of suitable nucleating agents. Furthermore the abrasion properties can be advanced with appropriate additives in the right dosage.

  16. Metal Injection Moulding: A Near Net Shape Fabrication Method for the Manufacture of Turbine Engine Component

    DTIC Science & Technology

    2006-05-01

    Mechanical Properties of Inconel 625 and 718 Alloys Processed by Powder Injection Molding, Superalloys 718 , 625, 706 and Various Derivatives, ed...on the processing and characterization of Inconel 625 LPIM material are presented. In depth microstructural characterization was performed on the... dissolution of second phase particles in the microstructure can be achieved and needs to be optimized with secondary heat treatment such as solution

  17. Influence of Mold Surface Treatments on Flow of Polymer in Injection Moulding. Application to Weldlines

    NASA Astrophysics Data System (ADS)

    Chailly, M.; Charmeau, J.-Y.; Bereaux, Y.; Monasse, B.

    2007-04-01

    Due to increasing expectations from the market, the aspect of molded parts has to be improved constantly. Some of the defects observed on these parts such as weldlines are related to the filling stage. To limit this, we investigated the influence on weldlines using various surface deposits on the mold surface, mainly PVD and PACVD deposits : Chromium nitride (CrN), Titanium nitride (TiN), Diamond like Carbon (DLC), Chromium and polished steel (PG) on an instrumented plate mold. Injection campaign was led on three polymers which differ in terms of nature (amorphous, semi-crystalline, copolymers). We studied the evolution of the dimensions of weldlines appearing on the plate using the same injection parameters for a given polymer, but with various deposits and thicknesses. Another aspect that had been investigated is the morphology of the weldline through the thickness of the part, depending on polymer nature. Adhesion of polymer at the flow front with the mold surface proved to change. The modification of the initial contact in the filling stage and thus the thermal resistance at the mold implied a change in the process, increasing or reducing the pressure loss in the flow and differential shrinkage in the final part. The induced impact on dimensions of the weldlines allowed to distinguish which surface treatments were able to reduce the defect. A complementary study was led on both polymers in molten state and deposits in terms of wetting using a sessile drop method to confirm the adhesion at the polymer/mold interface. This study proved the influence of the use of surface treatments has clearly an impact on the filling stage of the injection molding process, and it is necessary to get a better knowledge of the interactions between physical adhesion, tribology of polymer/mold contact, and thermal properties of the coatings and their impact on solidification of the polymer.

  18. Artificial neural networks to model formulation-property correlations in the process of inline-compounding on an injection moulding machine

    NASA Astrophysics Data System (ADS)

    Moritzer, Elmar; Müller, Ellen; Martin, Yannick; Kleeschulte, Rainer

    2015-05-01

    Today the global market poses great challenges for industrial product development. Complexity, diversity of variants, flexibility and individuality are just some of the features that products have to offer today. In addition, the product series have shorter lifetimes. Because of their high capacity for adaption, polymers are increasingly able to displace traditional materials such as wood, glass and metals from various fields of application. Polymers can only be used to substitute other materials, however, if they are optimally suited to the applications in question. Hence, product-specific material development is becoming increasingly important. Integrating the compounding step in the injection moulding process permits a more efficient and faster development process for a new polymer formulation, making it possible to create new product-specific materials. This process is called inline-compounding on an injection moulding machine. The entire process sequence is supported by software from Bayer Technology called Product Design Workbench (PDWB), which provides assistance in all the individual steps from data management, via analysis and model compilation, right through to the optimization of the formulation and the design of experiments. The software is based on artificial neural networks and can model the formulation-property correlations and thus enable different formulations to be optimized. In the study presented, the workflow and the modelling with the software are presented.

  19. Effect of Biaxial Stretching at Temperatures and Strain Histories Comparable to Injection Stretch Blow Moulding on Tensile Modulus for Polyethylene Terephthalate (PET)

    NASA Astrophysics Data System (ADS)

    Tan, C. W.; Menary, G. H.; Harkin-Jones, E. M. A.; Armstrong, C. G.; Martin, P. J.

    2007-04-01

    This study is particularly relevant to the injection stretch blow moulding (ISBM) process where PET material is typically biaxially stretched to form bottles for the water and carbonated soft drinks industry. The aim of this paper is to investigate the effect of biaxial stretching on the mechanical properties of Polyethylene Terephthalate (PET) using a custom built biaxial testing machine. An initially amorphous PET sample was prepared via injection moulding to form a square sample (76mm × 76mm) suitable for stretching on the machine. This sample was then subjected to a series of biaxial tests (simultaneous and sequential) within a temperature range between 85°C and 110 °C, strain rates in the range of 1s-1 to 32s-1 and stretch ratios in the range of 1.5 to 3. Specimens were subsequently cut from the biaxial stretched sheets and used to measure the tensile modulus. Results showed that there is almost no effect found for strain rate and temperature on modulus development whilst stretch ratio and mode of deformation played the most important role on modulus development on PET under biaxial deformation.

  20. The influence of different screw concepts while processing fibre reinforced thermoplastics with the concept of inline-compounding on an injection moulding machine

    NASA Astrophysics Data System (ADS)

    Moritzer, E.; Müller, E.; Kleeschulte, R.

    2014-05-01

    Today, the global market poses major challenges for industrial product development. Complexity, the wide range of variants, flexibility and individuality are just some of the features that products have to fulfil. Product series additionally have shorter and shorter lifetimes. Because of their high capacity for adaptation, polymers are increasingly able to substitute traditional materials such as wood, glass and metals in various fields of application [1]. But polymers can only substitute other materials if they are optimally suited to the applications in question. Hence, product-specific material development is becoming increasingly important [2]. The problem is that the traditional development process for new polymer formulations is much too complex, too slow and therefore too expensive. Product-specific material development is thus out of the question for most processors. Integrating the compounding step in the injection moulding process would lead to a more efficient and faster development process for a new polymer formulation, providing an opportunity to create new product-specific materials. This process is called inline-compounding on an injection moulding machine. In order to develop this innovative formulation concept, with the focus on fibre reinforced thermoplastics, different screw-concepts are compared with regard to the resultant performance characteristics in the part, such as mechanical properties and fibre length distribution.

  1. Micro Powder Injection Moulding of 316L Stainless Steel Feedstock and Numerical Simulation of the Sintering Stage

    NASA Astrophysics Data System (ADS)

    Kong, X.; Quinard, C.; Barriere, T.; Gelin, J.-C.

    2010-06-01

    Manufacturing of 3D micro-components by powder injection molding process consists of four main stages: preparation of the feedstock of metal powders and binders, injection of powder/binder feedstock using micro-injection molding equipment, thermal or solvent debinding and sintering by solid state diffusion. For our research pruposes, the feedstocks have been realized with stainless steel 316L powders of 3.4 μm (D50) and polymer binders. Finite element method has been used for the simulation in order to estimate shrinkage, relative density and evolution of the shapes of the micro-components, the parameters used in the sintering model have been identified in using Matlab® procedures before to be used in the simulation with Abaqus®.

  2. Liquid carry-over in an injection moulded all-polymer chip system for immiscible phase magnetic bead-based solid-phase extraction

    NASA Astrophysics Data System (ADS)

    Kistrup, Kasper; Skotte Sørensen, Karen; Wolff, Anders; Fougt Hansen, Mikkel

    2015-04-01

    We present an all-polymer, single-use microfluidic chip system produced by injection moulding and bonded by ultrasonic welding. Both techniques are compatible with low-cost industrial mass-production. The chip is produced for magnetic bead-based solid-phase extraction facilitated by immiscible phase filtration and features passive liquid filling and magnetic bead manipulation using an external magnet. In this work, we determine the system compatibility with various surfactants. Moreover, we quantify the volume of liquid co-transported with magnetic bead clusters from Milli-Q water or a lysis-binding buffer for nucleic acid extraction (0.1 (v/v)% Triton X-100 in 5 M guanidine hydrochloride). A linear relationship was found between the liquid carry-over and mass of magnetic beads used. Interestingly, similar average carry-overs of 1.74(8) nL/μg and 1.72(14) nL/μg were found for Milli-Q water and lysis-binding buffer, respectively.

  3. Stochastic Flow Modeling for Resin Transfer Moulding

    NASA Astrophysics Data System (ADS)

    Desplentere, Frederik; Verpoest, Ignaas; Lomov, Stepan

    2009-07-01

    Liquid moulding processes suffer from inherently present scatter in the textile reinforcement properties. This variability can lead to unwanted filling patterns within the mould resulting in bad parts. If thermoplastic resins are used with the in-situ polymerisation technique, an additional difficulty appears. The time window to inject the material is small if industrial processing parameters are used (<5 minutes). To model the stochastic nature of RTM, Darcy's description of the mould filling process has been used with the permeability distribution of the preform given as a random field. The random field of the permeability is constructed as a correlated field with an exponential correlation function. Optical microscopy and X-ray micro-CT have been used to study the stochastic parameters of the geometry for 2D and 3D woven textile preforms. The parameters describing the random permeability field (average, standard deviation and correlation length) are identified based on the stochastic parameters of the geometry for the preforms, analytical estimations and CFD modelling of the permeability. In order to implement the random field for the permeability and the variability for the resin viscosity, an add-on to the mould filling simulation software PAM-RTM™ has been developed. This analysis has been validated on case studies.

  4. A bio-inspired microstructure induced by slow injection moulding of cylindrical block copolymers† †Electronic supplementary information (ESI) available: Azimuthal intensity profiles for X-axis scans (a, b and c) and Y-axis scans (d, e and f) and various sample thicknesses: 0.95 mm (a and d), 0.45 mm (b and e), 0.23 mm (c and f). The injection point was at X = 0 and Y = 0 and the injection rate was 7 × 10–8 m3 s–1. See DOI: 10.1039/c4sm00884g Click here for additional data file.

    PubMed Central

    Stasiak, Joanna; Brubert, Jacob; Serrani, Marta; Nair, Sukumaran; de Gaetano, Francesco; Costantino, Maria Laura

    2014-01-01

    It is well known that block copolymers with cylindrical morphology show alignment with shear, resulting in anisotropic mechanical properties. Here we show that well-ordered bi-directional orientation can be achieved in such materials by slow injection moulding. This results in a microstructure, and anisotropic mechanical properties, similar to many natural tissues, making this method attractive for engineering prosthetic fibrous tissues. An application of particular interest to us is prosthetic polymeric heart valve leaflets, mimicking the shape, microstructure and hence performance of the native valve. Anisotropic layers have been observed for cylinder-forming block copolymers centrally injected into thin circular discs. The skin layers exhibit orientation parallel to the flow direction, whilst the core layer shows perpendicularly oriented domains; the balance of skin to core layers can be controlled by processing parameters such as temperature and injection rate. Heart valve leaflets with a similar layered structure have been prepared by injection moulding. Numerical modelling demonstrates that such complex orientation can be explained and predicted by the balance of shear and extensional flow. PMID:25005426

  5. Alternative technology for fabrication of nano- or microstructured mould inserts used for optical components

    NASA Astrophysics Data System (ADS)

    Wissmann, M.; Guttmann, M.; Hartmann, M.

    2010-02-01

    For mass production of multiscale-optical components, micro- and nanostructured moulding tools are needed. Metal tools are used for hot embossing or injection moulding of microcomponents in plastics. Tools are typically produced by classical forming processes such as mechanical manufacturing e.g. turning or milling, laser manufacturing or electrical discharge machining (EDM). Microstructures with extremely tight specifications, e.g. low side wall roughness and high aspect ratios are generally made by lithographic procedures such as LIGA or DPW technology. However, these processes are unsuitable for low-cost mass production. They are limited by the exposure area and structure design. In cooperation with international partners alternative manufacturing methods of moulding tools have been developed at the Institute of Microstructure Technology (IMT). In a new replication procedure, mould inserts are fabricated using micro- and nanoscale optics. The multiscale structured prototypes, either in plastics, glass, metal or material combinations are used as sacrificial parts. Using joining technology, electroforming and EDM technology, a negative copy of a prototype is transferred into metal to be used as a moulding tool. The benefits of this replication technique are rapid and economical production of moulding tools with extremely precise micro- and nanostructures, large structured area and long tool life. Low-cost mass replication is possible with these moulding tools. In this paper, an established manufacturing chain will be presented. Multiscale and multimaterial optical prototypes e.g. out-of-plane coupler or microinterferometer were made by DPW or laser technology. The mould insert fabrication of each individual manufacturing step will be shown. The process reliability and suitability for mass production was tested by hot embossing.

  6. Corona Discharge Influence on Moulds

    NASA Astrophysics Data System (ADS)

    Scholtz, Vladimir

    2004-09-01

    It is known that the electric discharge has bacteriocid effect. We are interesting on influence of corona discharge on moulds and searching for it's fungicide effect. In this work we study the mould penicillium digitatum by using an easy apparatus, where may be situated two measured samples. One in the burning corona discharge and one in the area with ozone generated by this corona only. We expose the spores of penicillium digitatum on a metal plate and on a cultivating medium on cca 0.01mA, 5kV corona discharge and on generated ozone only for time cca two days. It is the time needed for sprouting of spores and growing of they to a visible size. The pilot results show, that the ozone generated by the corona discharge has none or very low influence on the sprouting and growing of the spores. Direct corona discharge inhibit the sprouting only, but does not kill the spores. In next experiments we will try to find some minimum inhibit and killing concentration of ozone and try to expose the sprout inhibition.

  7. Diversity of slime mould circuits

    NASA Astrophysics Data System (ADS)

    Grube, Martin

    2015-03-01

    Once fused from single amoebae to form an initial plasmodium, P. polycephalum and related species in the order Physarales continue growth via synchronous cell division and extension of the megacells by a contractile plasmodial vein network. These display the phenomenon of shuttle streaming, a rhythmic back-and-forth flow of the protoplasm within a tubular system at a period of approximately 1 to 2 min, with the frequency depending on the nutritional benefits. With time, this develops as a microfluidic circuitry that adapts patterns of contraction to size to optimise the transport throughout an organism. This control of fluid also creates dynamic changes in network architecture seen over time in an individual. Food quality is of considerable importance for slime mould growth dynamics...

  8. Investigations on the processing of solid silicon rubber in blow moulding

    NASA Astrophysics Data System (ADS)

    Hopmann, Ch.; Funk, A.; Windeck, C.

    2015-05-01

    Complex hollow parts made of thermoplastics are often produced in the extrusion blow moulding process. This cost-efficient production technique with a high reproducibility, a high degree of automation and short cycle times has not been adapted for rubber processing until now. Current research activities at IKV focus on the processing of silicone rubber in extrusion blow moulding with an adapted processing and rapid cross-linking systems. The blow moulding process allows an automated and effective production of complex hollow parts made of solid silicone rubber in one step. The use of expensive core techniques, which lead to comparatively high reject rates in injection moulding, is not necessary. Expensive and time-consuming assembly steps can be reduced. This substantially increases the efficiency of the process. A systematic material selection of different solid silicone rubber compounds and cross-linking systems for the extrusion blow moulding process is a major focus of investigation. In this context, the term blow mouldability of polymers is defined and the suitability of solid silicone rubbers in combination with cross-linking systems for the blow moulding process is analysed. Characteristic mechanical and physical properties allow the identification of suitable material systems and give advice for the implementation of the new process. Extrusion blow moulding of solid silicone rubber is a new and innovative manufacturing concept to produce elastomeric hollow parts. Influences on the forming process are not known for silicone rubber yet. Therefore, to obtain a detailed process description is another focus of the research project. This includes the forming process, the processing and the influences of the material and the curing reaction on the processing. In the first instance, the investigation and description of the forming process as well as the detailed analysis of the processing parameters, such as curing time, mould temperature, wall thickness of the

  9. Mould insert fabrication of a single-mode fibre connector alignment structure optimized by justified partial metallization

    NASA Astrophysics Data System (ADS)

    Wissmann, Markus; Barié, Nicole; Guttmann, Markus; Schneider, Marc; Kolew, Alexander; Besser, Heino; Pfleging, Wilhelm; Hofmann, Andreas; Van Erps, Jürgen; Beri, Stefano; Watté, Jan

    2015-03-01

    For mass production of multiscale-optical components, microstructured moulding tools are needed. Metal tools are used for hot embossing or injection moulding of microcomponents made of a thermoplastic polymer. Microstructures with extremely tight specifications, e.g. low side wall roughness and high aspect ratios are generally made by lithographic procedures such as x-ray lithography or deep proton writing. However, these processes are unsuitable for low-cost mass production. An alternative manufacturing method of moulding tools has been developed at the Karlsruhe Institute of Technology (KIT). This article describes a mould insert fabrication and a new replication process for self-centring fibre alignment structures for low loss field installable single-mode fibre connectors, developed and fabricated by the Vrije Universiteit Brussel (VUB) in collaboration with TE Connectivity. These components are to be used in fibre-to-the-home networks and support the deployment and maintenance of fibre optic links. The special feature of this particular fibre connector is a self-centring fibre alignment, achieved by means of a through hole with deflectable cantilevers acting as micro-springs. The particular challenge is the electroforming of through holes with a centre hole diameter smaller than 125 µm. The fibre connector structure is prototyped by deep proton writing in polymethylmethacrylate and used as a sacrificial part. Using joining, physical vapour deposition and electroforming technology, a negative copy of the prototyped connector is transferred into nickel to be used as a moulding tool. The benefits of this replication technique are a rapid and economical fabrication of moulding tools with high-precision microstructures and a long tool life. With these moulding tools low-cost mass production is possible. We present the manufacturing chain we have established. Each individual manufacturing step of the mould insert fabrication will be shown in this report. The

  10. Are mould hepatotoxins responsible for kava hepatotoxicity?

    PubMed

    Rowe, Anthony; Ramzan, Iqbal

    2012-11-01

    Previous studies with kava components such as kavalactones, pipermethystine and flavokavain B have demonstrated hepatotoxicity from these constituents. Regardless, there has recently been speculation that adulterants or impurities such as the mould hepatotoxin aflatoxin are a more likely cause of kava hepatotoxicity, despite a paucity of supporting evidence. Although there is limited similarity between acute kava hepatotoxicity and acute aflatoxicosis, and background levels of aflatoxin have been detected in kava samples, unless epidemiological investigations can uncover direct evidence implicating mould hepatotoxins, it remains more likely that chemical constituents of kava are the cause of the hepatotoxicity from kava.

  11. Ion beam modification of injection moulded polymere materials

    NASA Astrophysics Data System (ADS)

    Wolf, G. K.; Kersten, H. J.

    1998-05-01

    Ion beam based treatments and processes are an ecologically friendly alternative for the metallization of polymers. Nowadays mainly chemical and electrochemical and plasma assisted techniques are used. In this contribution the copper metallization of high temperature thermoplasts using ion beam assisted deposition (IBAD) was studied. The applications in mind were magnetic shielding of cases for sensors. The influence of ion beam intensity and energy, deposition rate, preconditioning and substrate material on the Cu adhesion was investigated. As materials PPS (Polyphenylene sulfide) and LCP (Liquid Crystal Polymer) with different filling materials were used. It could be shown that the adhesion reacts very critical to the type of polymer and the type and concentration of filling material. The IBAD parameters giving best results are I/A ratios of 0.005-0.01 and energies of 0.5-2 keV. The highest adhesion force (≈27 N/mm 2) was measured on PPS. For LCP thin Ti interlayers increased the adhesion force ≈50% up to values above 10 N/mm 2.

  12. A Process for Semi-Solid Moulding of High Viscosity Thermoplastic Polymers

    NASA Astrophysics Data System (ADS)

    Frick, Achim; Rochman, Arif; Martin, Peter

    2011-05-01

    A new moulding process for manufacturing micro parts made from high viscosity polymers has been developed as a result of a feasibility study. The process basically involves compression moulding of a polymeric preform by heating it up to its semi-solid state, i.e. between its glass transition temperature and melting temperature. The apparatus is made up of three main parts: a forming device, a single cavity micro mould and an induction heating system. The processing technique was successfully tested in the manufacturing of 10 mm round discs with a flange and inner bore using high viscosity polymers such as polyphenylene sulfide (PPS), polyetheretherketone (PEEK), ultra-high molecular weight polyethylene (UHMW PE) and polytetrafluoroethylene (PTFE). In a further miniaturization study, U-shaped micro seals with an outer diameter up to 2.5 mm were also successfully manufactured from non-injection mouldable PTFE. Thus, the new process is a realistic alternative technique to the existing micro moulding processes with respect to its capability to process a huge variety of polymers, even ultra high viscosity materials and the possibility to create micro parts with non-uniform wall thickness distributions.

  13. Mathematical model of the metal mould surface temperature optimization

    SciTech Connect

    Mlynek, Jaroslav Knobloch, Roman; Srb, Radek

    2015-11-30

    The article is focused on the problem of generating a uniform temperature field on the inner surface of shell metal moulds. Such moulds are used e.g. in the automotive industry for artificial leather production. To produce artificial leather with uniform surface structure and colour shade the temperature on the inner surface of the mould has to be as homogeneous as possible. The heating of the mould is realized by infrared heaters located above the outer mould surface. The conceived mathematical model allows us to optimize the locations of infrared heaters over the mould, so that approximately uniform heat radiation intensity is generated. A version of differential evolution algorithm programmed in Matlab development environment was created by the authors for the optimization process. For temperate calculations software system ANSYS was used. A practical example of optimization of heaters locations and calculation of the temperature of the mould is included at the end of the article.

  14. Mathematical model of the metal mould surface temperature optimization

    NASA Astrophysics Data System (ADS)

    Mlynek, Jaroslav; Knobloch, Roman; Srb, Radek

    2015-11-01

    The article is focused on the problem of generating a uniform temperature field on the inner surface of shell metal moulds. Such moulds are used e.g. in the automotive industry for artificial leather production. To produce artificial leather with uniform surface structure and colour shade the temperature on the inner surface of the mould has to be as homogeneous as possible. The heating of the mould is realized by infrared heaters located above the outer mould surface. The conceived mathematical model allows us to optimize the locations of infrared heaters over the mould, so that approximately uniform heat radiation intensity is generated. A version of differential evolution algorithm programmed in Matlab development environment was created by the authors for the optimization process. For temperate calculations software system ANSYS was used. A practical example of optimization of heaters locations and calculation of the temperature of the mould is included at the end of the article.

  15. [Invasive mould disease in haematological patients].

    PubMed

    Ruiz-Camps, Isabel; Jarque, Isidro

    2014-01-01

    Invasive mould infections (IMI) are a persistent problem with high morbidity and mortality rates among patients receiving chemotherapy for hematological malignancies and hematopoietic stem cell transplant recipients. Management of IMI in this setting has become increasingly complex with the advent of new antifungal agents and diagnostic tests, which have resulted in different therapeutic strategies (prophylactic, empirical, pre-emptive, and directed). A proper assessment of the individual risk for IMI appears to be critical in order to use the best prophylactic and therapeutic approach and increase the survival rates. Among the available antifungal drugs, the most frequently used in the hematologic patient are fluconazole, mould-active azoles (itraconazole, posaconazole and voriconazole), candins (anidulafungin, caspofungin and micafungin), and lipid formulations of amphotericin B. Specific recommendations for their use, and criteria for selecting the antifungal agents are discussed in this paper.

  16. Influence Of The Microinjection Moulding Process On The Crystalline Orientation And Morphology Of Semicrystalline Polymers

    NASA Astrophysics Data System (ADS)

    Malhab, Nada Bou; Régnier, Gilles

    2011-05-01

    Microinjection moulding (μIM) seems to be a key for the large scale production of polymer microparts. For semicrystalline polymers, the crystallisation under high shear and cooling rates induces specific morphologies and properties and thus takes tremendous importance in microinjection process compared to classical injection moulding (IM) process where wall thicknesses are generally larger than 1mm. Two semicrystalline polymers were microinjected, a high density polyethylene and a polyamide 12 in plaque cavities having thicknesses of 0.3 and 0.5mm. Analyses obtained by optical microscopy show that the crystalline morphologies vary between micro- and macro- parts. While a `skin-core' morphology is present for the macropart, the μpart exhibits a specific morphology. The X-ray scattering at small angles (SAXS) studies show an orientation of HDPE lamellae whatever the conditions of microinjection whereas the orientation of PA12 lamellae is either isotropic or anisotropic depending on the thickness of molded parts.

  17. Advances in precision machining and moulding technology bring design opportunities.

    PubMed

    Glendening, Paul

    2008-09-01

    Machining of materials for medical applications has moved to a new level of precision. In parallel with this, moulding technology has improved through the increased use of sensors in moulds, enhanced design simulation and processes such as micromoulding. This article examines the opportunities offered by these developments and includes examples of mass produced parts that demonstrate the new capabilities useful to product designers.

  18. Sooty Mould Disease Caused by Leptoxyphium kurandae on Kenaf

    PubMed Central

    Choi, In-Young; Kang, Chan-Ho; Lee, Geon-Hwi; Park, Ji-Hyun

    2015-01-01

    In September 2013, we discovered sooty mould growing on kenaf with the extrafloral nectaries in Iksan, Korea and identified the causative fungus as Leptoxyphium kurandae based on morphological characteristics and phylogenetic analyses. This is the first report of sooty mould caused by L. kurandae on kenaf in Korea and globally. PMID:26539054

  19. Thermoforming mechanism of precision glass moulding.

    PubMed

    Liu, Weidong; Zhang, Liangchi

    2015-08-01

    Precision glass moulding (PGM) enables the production of an aspherical lens and irregular optical products in a single step, but its product quality depends highly on the control of both material properties and process parameters. This paper investigates the thermoforming mechanism of a glass lens in PGM. To precisely describe the material behavior in PGM, a modulus-based constitutive model was framed and integrated with the finite element analysis. This model can be parameterized conveniently by an impulse excitation technique. Key processing parameters that influence the final profile and residual stresses of a lens were identified with the aid of dimensional analysis. The study found that the cooling stage above the glass transition temperature can bring about large geometry deviations of a lens. The residual stresses in a lens depend mainly on the temperature history in the supercooled liquid region caused by the variability and heterogeneity of thermal expansion. However, the stresses can be reduced effectively by decreasing the cooling rate from moulding temperature to glass transition temperature.

  20. Secondary chemicals protect mould from fungivory.

    PubMed

    Rohlfs, Marko; Albert, Martin; Keller, Nancy P; Kempken, Frank

    2007-10-22

    The vast repertoire of toxic fungal secondary metabolites has long been assumed to have an evolved protective role against fungivory. It still remains elusive, however, whether fungi contain these compounds as an anti-predator adaptation. We demonstrate that loss of secondary metabolites in the soil mould Aspergillus nidulans causes, under the attack of the fungivorous springtail Folsomia candida, a disadvantage to the fungus. Springtails exhibited a distinct preference for feeding on a mutant deleted for LaeA, a global regulator of Aspergillus secondary metabolites. Consumption of the mutant yielded a reproductive advantage to the arthropod but detrimental effects on fungal biomass compared with a wild-type fungus capable of producing the entire arsenal of secondary metabolites. Our results demonstrate that fungal secondary metabolites shape food choice behaviour, can affect population dynamics of fungivores, and suggest that fungivores may provide a selective force favouring secondary metabolites synthesis in fungi.

  1. CAE applications in a thermoforming mould design

    NASA Astrophysics Data System (ADS)

    Marjuki, AR; Mohd Ghazali, FA; Ismail, N. M.; Sulaiman, S.; Mohd Khairuddin, I.; Majeed, Anwar P. P. A.; Jaafar, AA; Mustapha, F.; Basri, S.

    2016-02-01

    Preparation of honeycomb layer is a critical step for successful fabrications of thermoformed based sandwiched structures. This paper deals with an initial investigation on the rapid manufacturing process of corrugated sheet with 120° dihedral angles. Time history of local displacements and thickness, assuming viscous dominated material model for a 1mm thick thermoformable material, was computed by using ANSYS® Polyflow solver. The quality of formed surfaces was evaluated for selection of mould geometry and assessment of two common variants of thermoforming process. Inadequate mesh refinement of a membrane elements produces satisfactorily detailing and incomplete forming. A perfectly uniform material distribution was predicted using drape forming process. However, the geometrical properties of vacuum formed part are poorly distributed and difficult to control with increasing inflation volumes. Details of the discrepancies and the contributions of the CAE tool to complement traditional trial and error methodology in the process and design development are discussed.

  2. Direct nanoprinting by liquid-bridge-mediated nanotransfer moulding.

    PubMed

    Hwang, Jae K; Cho, Sangho; Dang, Jeong M; Kwak, Eun B; Song, Keunkyu; Moon, Jooho; Sung, Myung M

    2010-10-01

    Several techniques for the direct printing of functional materials have been developed to fabricate micro- and nanoscale structures and devices. We report a new direct patterning method, liquid-bridge-mediated nanotransfer moulding, for the formation of two- or three-dimensional structures with feature sizes as small as tens of nanometres over large areas up to 4 inches across. Liquid-bridge-mediated nanotransfer moulding is based on the direct transfer of various materials from a mould to a substrate through a liquid bridge between them. We demonstrate its usefulness by fabricating nanowire field-effect transistors and arrays of pentacene thin-film transistors.

  3. Sharp tipped plastic hollow microneedle array by microinjection moulding

    NASA Astrophysics Data System (ADS)

    Yung, K. L.; Xu, Yan; Kang, Chunlei; Liu, H.; Tam, K. F.; Ko, S. M.; Kwan, F. Y.; Lee, Thomas M. H.

    2012-01-01

    A method of producing sharp tipped plastic hollow microneedle arrays using microinjection moulding is presented in this paper. Unlike traditional approaches, three mould inserts were used to create the sharp tips of the microneedles. Mould inserts with low surface roughness were fabricated using a picosecond laser machine. Sharp tipped plastic hollow microneedles 500 µm in height were fabricated using a microinjection moulding machine developed by the authors’ group. In addition, the strength of the microneedle was studied by simulation and penetration experiments. Results show that the microneedles can penetrate into skin, delivering liquid successfully without any breakage or severe deformation. Techniques presented in this paper can be used to fabricate sharp tipped plastic hollow microneedle arrays massively with low cost.

  4. Influence of silver nanoparticles on metabolism and toxicity of moulds.

    PubMed

    Pietrzak, Katarzyna; Twarużek, Magdalena; Czyżowska, Agata; Kosicki, Robert; Gutarowska, Beata

    2015-01-01

    The unique antimicrobial features of silver nanoparticles (AgNPs) are commonly applied in innumerable products. The lack of published studies on the mechanisms of AgNPs action on fungi resulted in identification of the aim of this study, which was: the determination of the influence of AgNPs on the mould cytotoxicity for swine kidney cells (MTT test) and the production of selected mycotoxins, organic acids, extracellular enzymes by moulds. The conducted study had shown that silver nanoparticles can change the metabolism and toxicity of moulds. AgNPs decrease the mycotoxin production of Aspergillus sp. (81-96%) and reduce mould cytotoxicity (50-75%). AgNPs influence the organic acid production of A. niger and P. chrysogenum by decreasing their concentration (especially of the oxalic and citric acid). Also, a change in the extracellular enzyme profile of A. niger and P. chrysogenum was observed, however, the total enzymatic activity was increased.

  5. DETAIL OF CORNICE MOULDING WITH RAM'S HEAD MOTIF. EIGHT SHADES ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    DETAIL OF CORNICE MOULDING WITH RAM'S HEAD MOTIF. EIGHT SHADES OF GOLD LEAF AND BURNISHED GOLD LEAF WERE USED FOR THE INTERIOR FINISHES. - Anaconda Historic District, Washoe Theater, 305 Main Street, Anaconda, Deer Lodge County, MT

  6. 10. DETAIL OF CORNICE MOULDING WITH RAM'S HEAD MOTIF. EIGHT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. DETAIL OF CORNICE MOULDING WITH RAM'S HEAD MOTIF. EIGHT SHADES OF GOLD LEAF AND BURNISHED GOLD LEAF WERE USED FOR THE INTERIOR FINISHES - Anaconda Historic District, Washoe Theater, 305 Main Street, Anaconda, Deer Lodge County, MT

  7. Slime Mould Analogue Models of Space Exploration and Planet Colonisation

    NASA Astrophysics Data System (ADS)

    Adamatzky, A.; Armstrong, R.; De Lacy Costello, B.; Deng, Y.; Jones, J.; Mayne, R.; Schubert, T.; Sirakoulis, G. Ch.; Zhang, X.

    Slime mould Physarum polycephalum is a single cell that is visible by the unaided eye. When spanning sources of nutrients the slime mould builds a network of protoplasmic tubes which is sometimes considered to be optimal in terms of the minimization of metabolite transportation time and distance away from repellents. Previously we have shown that the slime mould is efficient in imitating the formation of man-made road networks in major countries, where major urban areas are sources of nutrients. We used a similar approach to grow slime mould on a three-dimensional template of the Moon to speculate on potential colonisation scenarios. The slime mould imitated the propagation of colonisation in an exploratory mode, i.e. without any definite targets. Additional transportation hubs/targets were added after the initial network was formed, to imitate the development of colonies in parallel with slime mould growth. We provide analyses of proximity graphs representing colonisation networks and support the findings with Physarum-inspired algorithms to inform supply chain design. We speculate on how living Physarum, or its incorporation into a polymer hybrid material, can be used as a wearable smart wetware based on laboratory experiments interacting with chemical components.

  8. Energy optimization aspects by injection process technology

    NASA Astrophysics Data System (ADS)

    Tulbure, A.; Ciortea, M.; Hutanu, C.; Farcas, V.

    2016-08-01

    In the proposed paper, the authors examine the energy aspects related to the injection moulding process technology in the automotive industry. Theoretical considerations have been validated by experimental measurements on the manufacturing process, for two types of injections moulding machines, hydraulic and electric. Practical measurements have been taken with professional equipment separately on each technological operation: lamination, compression, injection and expansion. For results traceability, the following parameters were, whenever possible, maintained: cycle time, product weight and the relative time. The aim of the investigations was to carry out a professional energy audit with accurate losses identification. Base on technological diagram for each production cycle, at the end of this contribution, some measure to reduce the energy consumption were proposed.

  9. Maize silage: incidence of moulds during conservation.

    PubMed

    Pelhate, J

    1977-01-01

    The basic principle of silage making--preservation under anaerobiosis--is recognized. With this environment the substrate can harbour a spontaneous and active microflora that can be divided into two sequential phases; a bacterial phase followed by a yeast phase. The imperfections of the techniques used in making silage, however, frequently result in invasion by fungi. The moulds that are responsible for serious changes (loss of nutrients, mycotoxins) are classified into a dozen characteristic divisions (species or groups of ecologically related species). These appear in a definite chronological order and form a relatively simple model of the development of the flora. This dynamic transformation can also be utilized profitably to determine the quality of the fodder and estimate the storage life. A simple mycological puncture analysis reveals in fact the stage reached in the fixed sequence, and the results enable extrapolations to be made regarding the history and the future of the material. It is also hoped that a better knowledge of the biotope will lead to complete control of the floral equilibrium, good conservation and high quality foodstuffs.

  10. Christmas tree allergy: mould and pollen studies.

    PubMed

    Wyse, D M; Malloch, D

    1970-12-05

    A history of respiratory or other allergic symptoms during the Christmas season is occasionally obtained from allergic patients and can be related to exposure to conifers at home or in school. Incidence and mechanism of production of these symptoms were studied. Of 1657 allergic patients, respiratory and skin allergies to conifers occurred in 7%. This seasonal syndrome includes sneezing, wheezing and transitory skin rashes. The majority of patients develop their disease within 24 hours, but 15% experience symptoms after several days' delay. Mould and pollen studies were carried out in 10 test sites before, during and after tree placement in the home. Scrapings from pine and spruce bark yielded large numbers of Penicillium, Epicoccum and Alternaria, but these failed to become airborne. No significant alteration was discovered in the airborne fungi in houses when trees were present. Pollen studies showed release into air of weed, grass and tree pollens while Christmas trees were in the house. Oleoresins of the tree balsam are thought to be the most likely cause of the symptoms designated as Christmas tree allergy.

  11. The first report on mushroom green mould disease in Croatia.

    PubMed

    Hatvani, Lóránt; Sabolić, Petra; Kocsubé, Sándor; Kredics, László; Czifra, Dorina; Vágvölgyi, Csaba; Kaliterna, Joško; Ivić, Dario; Đermić, Edyta; Kosalec, Ivan

    2012-12-01

    Green mould disease, caused by Trichoderma species, is a severe problem for mushroom growers worldwide, including Croatia. Trichoderma strains were isolated from green mould-affected Agaricus bisporus (button or common mushroom) compost and Pleurotus ostreatus (oyster mushroom) substrate samples collected from Croatian mushroom farms. The causal agents of green mould disease in the oyster mushroom were T. pleurotum and T. pleuroticola, similar to other countries. At the same time, the pathogen of A. bisporus was exclusively the species T. harzianum, which is different from earlier findings and indicates that the range of mushroom pathogens is widening. The temperature profiles of the isolates and their hosts overlapped, thus no range was found that would allow optimal growth of the mushrooms without mould contamination. Ferulic acid and certain phenolic compounds, such as thymol showed remarkable fungistatic effect on the Trichoderma isolates, but inhibited the host mushrooms as well. However, commercial fungicides prochloraz and carbendazim were effective agents for pest management. This is the first report on green mould disease of cultivated mushrooms in Croatia.

  12. On hybrid circuits exploiting thermistive properties of slime mould

    PubMed Central

    Walter, Xavier Alexis; Horsfield, Ian; Mayne, Richard; Ieropoulos, Ioannis A.; Adamatzky, Andrew

    2016-01-01

    Slime mould Physarum polycephalum is a single cell visible by the unaided eye. Let the slime mould span two electrodes with a single protoplasmic tube: if the tube is heated to approximately ≈40 °C, the electrical resistance of the protoplasmic tube increases from ≈3 MΩ to ≈10,000 MΩ. The organism’s resistance is not proportional nor correlated to the temperature of its environment. Slime mould can therefore not be considered as a thermistor but rather as a thermic switch. We employ the P. polycephalum thermic switch to prototype hybrid electrical analog summator, NAND gates, and cascade the gates into Flip-Flop latch. Computing operations performed on this bio-hybrid computing circuitry feature high repeatability, reproducibility and comparably low propagation delays. PMID:27048713

  13. Multilayered Glass Fibre-reinforced Composites In Rotational Moulding

    NASA Astrophysics Data System (ADS)

    Chang, W. C.; Harkin-Jones, E.; Kearns, M.; McCourt, M.

    2011-05-01

    The potential of multiple layer fibre-reinforced mouldings is of growing interest to the rotational moulding industry because of their cost/performance ratio. The particular problem that arises when using reinforcements in this process relate to the fact that the process is low shear and good mixing of resin and reinforcement is not optimum under those conditions. There is also a problem of the larger/heavier reinforcing agents segregating out of the powder to lay up on the inner part surface. In this study, short glass fibres were incorporated and distributed into a polymer matrix to produce fibre-reinforced polymer composites using the rotational moulding process and characterised in terms of morphology and mechanical properties.

  14. Collective behaviour and swarm intelligence in slime moulds.

    PubMed

    Reid, Chris R; Latty, Tanya

    2016-08-29

    The study of collective behaviour aims to understand how individual-level behaviours can lead to complex group-level patterns. Collective behaviour has primarily been studied in animal groups such as colonies of insects, flocks of birds and schools of fish. Although less studied, collective behaviour also occurs in microorganisms. Here, we argue that slime moulds are powerful model systems for solving several outstanding questions in collective behaviour. In particular, slime mould may hold the key to linking individual-level mechanisms to colony-level behaviours. Using well-established principles of collective animal behaviour as a framework, we discuss the extent to which slime mould collectives are comparable to animal groups, and we highlight some potentially fruitful areas for future research.

  15. Multilayered Glass Fibre-reinforced Composites In Rotational Moulding

    SciTech Connect

    Chang, W. C.; Harkin-Jones, E.; Kearns, M.; McCourt, M.

    2011-05-04

    The potential of multiple layer fibre-reinforced mouldings is of growing interest to the rotational moulding industry because of their cost/performance ratio. The particular problem that arises when using reinforcements in this process relate to the fact that the process is low shear and good mixing of resin and reinforcement is not optimum under those conditions. There is also a problem of the larger/heavier reinforcing agents segregating out of the powder to lay up on the inner part surface. In this study, short glass fibres were incorporated and distributed into a polymer matrix to produce fibre-reinforced polymer composites using the rotational moulding process and characterised in terms of morphology and mechanical properties.

  16. On hybrid circuits exploiting thermistive properties of slime mould.

    PubMed

    Walter, Xavier Alexis; Horsfield, Ian; Mayne, Richard; Ieropoulos, Ioannis A; Adamatzky, Andrew

    2016-04-06

    Slime mould Physarum polycephalum is a single cell visible by the unaided eye. Let the slime mould span two electrodes with a single protoplasmic tube: if the tube is heated to approximately ≈40 °C, the electrical resistance of the protoplasmic tube increases from ≈3 MΩ to ≈10,000 MΩ. The organism's resistance is not proportional nor correlated to the temperature of its environment. Slime mould can therefore not be considered as a thermistor but rather as a thermic switch. We employ the P. polycephalum thermic switch to prototype hybrid electrical analog summator, NAND gates, and cascade the gates into Flip-Flop latch. Computing operations performed on this bio-hybrid computing circuitry feature high repeatability, reproducibility and comparably low propagation delays.

  17. Milling of Sand Blocks to Make Casting Moulds

    SciTech Connect

    Lopez de Lacalle, L. N.; Rodriguez, A.; Lamikiz, A.; Penafiel, F. J.

    2011-01-17

    In this paper a full procedure to make moulds in sand for direct casting of metallic parts is presented. The technology aims at unique pieces or art pieces, where only one prototype or components is required, but lead times are much reduced. The key of the procedure is to achieve enough tool life when milling with carbide tools, avoiding the risk of sand destruction or damage.The use of inverse techniques is a common input due to the industrial sectors where the direct milling is interesting. Two examples of moulds are presented, evaluating times and costs. A special study of tool wear is also presented.

  18. Milling of Sand Blocks to Make Casting Moulds

    NASA Astrophysics Data System (ADS)

    de Lacalle, L. N. López; Rodríguez, A.; Lamikiz, A.; Peñafiel, F. J.

    2011-01-01

    In this paper a full procedure to make moulds in sand for direct casting of metallic parts is presented. The technology aims at unique pieces or art pieces, where only one prototype or components is required, but lead times are much reduced. The key of the procedure is to achieve enough tool life when milling with carbide tools, avoiding the risk of sand destruction or damage. The use of inverse techniques is a common input due to the industrial sectors where the direct milling is interesting. Two examples of moulds are presented, evaluating times and costs. A special study of tool wear is also presented.

  19. Presurgical nasal moulding in a neonate with cleft lip

    PubMed Central

    Deshpande, Anshula; Shah, Dixit; Macwan, Chirag S

    2014-01-01

    The concept of presurgical nasoalveolar moulding (PNM) was developed to improve the aesthetic result of surgically corrected cleft lip. This paper presents the method of fabrication of PNM appliance and the case of a 30-day-old neonate with unilateral cleft lip in whom nasal moulding was performed. Treatment was initiated at 30 days and continued for 60 days after which the surgical correction of cleft lip was performed. Significant improvement in aesthetics and symmetry of the nose was achieved at the end of the treatment. PMID:24928928

  20. Indirect slumping of D263 glass on Fused Silica mould

    NASA Astrophysics Data System (ADS)

    Proserpio, Laura; Wen, Mingwu; Breunig, Elias; Burwitz, Vadim; Friedrich, Peter; Madarasz, Emanuel

    2016-07-01

    The Slumped Glass Optic (SGO) group of the Max Planck Institute for Extraterrestrial physics (MPE) is studying the indirect slumping technology for its application to X-ray telescope manufacturing. Several aspects of the technology have been analyzed in the past. During the last months, we concentrated our activities on the slumping of Schott D263 glass on a precise machined Fused Silica mould: The concave mould was produced by the Italian company Media Lario Technologies with the parabola and hyperbola side of the typical Wolter I design in one single piece. Its shape quality was estimated by optical metrology to be around 6 arcsec Half Energy Width (HEW) in double reflection. The application of an anti-sticking Boron Nitride layer was necessary to avoid the adhesion of the glass on the mould during the forming process at high temperatures. The mould has been used for the slumping of seven mirror segments 200 mm long, 100 mm wide, and with thickness of 200 μm or 400 μm. The influence of the holding time at maximum temperature was explored in this first run of tests. The current results of the activities are described in the paper and plans for further investigations are outlined.

  1. High Explosive Moulding Powders from RDX and Aqueous Polyurethane Dispersions,

    DTIC Science & Technology

    1987-05-01

    polybutadiene (17] type by reaction with low molecular weight diisocyanates in the absence of water. Explosive moulding powders incorporating...polyaddition reaction . The final polymers have predominantly hydrophobic long chain segments of the polyether or polyester type and also contain some...reacted with isocyanate groups in reaction sequences which ultimately yield either polyurethane or polyurethane-urea polymers. Three of the methods for

  2. In Vitro Antifungal Activities against Moulds Isolated from Dermatological Specimens

    PubMed Central

    Mohd Nizam, Tzar; Binting, Rabiatul Adawiyah AG.; Mohd Saari, Shafika; Kumar, Thivyananthini Vijaya; Muhammad, Marianayati; Satim, Hartini; Yusoff, Hamidah; Santhanam, Jacinta

    2016-01-01

    Background This study aimed to determine the minimum inhibitory concentrations (MICs) of various antifungal agents against moulds isolated from dermatological specimens. Methods We identified 29 moulds from dermatological specimens between October 2012 and March 2013 by conventional methods. We performed antifungal susceptibility testing on six antifungal agents, amphotericin B, clotrimazole, itraconazole, ketoconazole, miconazole and terbinafine, according to the Clinical and Laboratory Standards Institute guidelines contained in the M38-A2 document. Results Most antifungal agents were active against the dermatophytes, except for terbinafine against Trichophyton rubrum (geometric mean MIC, MICGM 3.17 μg/mL). The dematiaceous moulds were relatively susceptible to amphotericin B and azoles (MICGM 0.17–0.34 μg/mL), but not to terbinafine (MICGM 3.62 μg/mL). Septate hyaline moulds showed variable results between the relatively more susceptible Aspergillus spp. (MICGM 0.25–4 μg/mL) and the more resistant Fusarium spp. (MICGM 5.66–32 μg/mL). The zygomycetes were susceptible to amphotericin B (MICGM 0.5 μg/mL) and clotrimazole (MICGM 0.08 μg/mL), but not to other azoles (MICGM 2.52–4 μg/mL). Conclusion Amphotericin B and clotrimazole were the most effective antifungal agents against all moulds excepting Fusarium spp., while terbinafine was useful against dermatophytes (except T. rubrum) and Aspergillus spp. However, a larger study is required to draw more solid conclusions. PMID:27418867

  3. Antifungal properties of silver nanoparticles against indoor mould growth.

    PubMed

    Ogar, Anna; Tylko, Grzegorz; Turnau, Katarzyna

    2015-07-15

    The presence of moulds in indoor environments causes serious diseases and acute or chronic toxicological syndromes. In order to inhibit or prevent the growth of microorganisms on building materials, the disruption of their vital processes or the reduction of reproduction is required. The development of novel techniques that impair the growth of microorganisms on building materials is usually based on silver nanoparticles (AgNPs). It makes them an alternative to other biocides. AgNPs have proven antibacterial activity and became promising in relation to fungi. The aim of the study was to assess growth and morphology of mycelia of typical indoor fungal species: Penicillium brevicompactum, Aspergillus fumigatus, Cladosporium cladosporoides, Chaetomium globosum and Stachybotrys chartarum as well as Mortierella alpina, cultured on agar media. The antifungal activity of AgNPs was also tested in relation to C. globosum and S. chartarum grown on the surface of gypsum drywall. It was found that the presence of AgNPs in concentrations of 30-200mg/l significantly decreased the growth of fungi. However, in the case of M. alpina, AgNPs stimulated its growth. Moreover, strong changes in moulds morphology and colour were observed after administration of AgNPs. Parameters of conidiophores/sporangiophores varied depending on mould region and changed significantly after treatment with AgNPs. The experiments have shown antifungal properties of AgNPs against common indoor mould species. Their application to building materials could effectively protect indoor environments from mould development. However, consideration must be given to the fact that the growth of some fungal strains might be stimulated by AgNPs.

  4. Flow Dynamics of green sand in the DISAMATIC moulding process using Discrete element method (DEM)

    NASA Astrophysics Data System (ADS)

    Hovad, E.; Larsen, P.; Walther, J. H.; Thorborg, J.; Hattel, J. H.

    2015-06-01

    The DISAMATIC casting process production of sand moulds is simulated with DEM (discrete element method). The main purpose is to simulate the dynamics of the flow of green sand, during the production of the sand mould with DEM. The sand shot is simulated, which is the first stage of the DISAMATIC casting process. Depending on the actual casting geometry the mould can be geometrically quite complex involving e.g. shadowing effects and this is directly reflected in the sand flow during the moulding process. In the present work a mould chamber with “ribs” at the walls is chosen as a baseline geometry to emulate some of these important conditions found in the real moulding process. The sand flow is simulated with the DEM and compared with corresponding video footages from the interior of the chamber during the moulding process. The effect of the rolling resistance and the static friction coefficient is analysed and discussed in relation to the experimental findings.

  5. Two underestimated threats in food transportation: mould and acceleration

    PubMed Central

    Janssen, S.; Pankoke, I.; Klus, K.; Schmitt, K.; Stephan, U.; Wöllenstein, J.

    2014-01-01

    Two important parameters are often neglected in the monitoring of perishable goods during transport: mould contamination of fresh food and the influence of acceleration or vibration on the quality of a product. We assert the claim that it is necessary to focus research on these two topics in the context of intelligent logistics in this opinion paper. Further, the technical possibilities for future measurement systems are discussed. By measuring taste deviations, we verified the effect on the quality of beer at different vibration frequencies. The practical importance is shown by examining transport routes and market shares. The general feasibility of a mobile mould detection system is established by examining the measurement resolution of semiconductor sensors for mould-related gases. Furthermore, as an alternative solution, we present a concept for a miniaturized and automated culture-medium-based system. Although there is a lack of related research to date, new efforts can make a vital contribution to the reduction of losses in the logistic chains for several products. PMID:24797139

  6. Silver nanoparticles: a mechanism of action on moulds.

    PubMed

    Pietrzak, Katarzyna; Glińska, Sława; Gapińska, Magdalena; Ruman, Tomasz; Nowak, Adriana; Aydin, Egemen; Gutarowska, Beata

    2016-12-07

    Silver nanoparticles (AgNPs) are widely used in all branches of industry. However, their mechanisms of action towards moulds have not been studied yet. Thus we conducted this study in which we have used laser desorption/ionization time-of-flight mass spectrometry (LDI-ToF-MS) analysis to determine metabolomic changes, and microscopic analysis (transmission electron microscopy, fluorescent microscopy) to observe changes in mould cells. The AgNP treatment caused the downregulation of 162 (15 ppm) and 284 (62 ppm), and 19 (15 ppm) and 29 (62 ppm) metabolites of Aspergillus niger and Penicillium chrysogenum, respectively. All influenced features were below m/z 600 (mass-to-charge ratio). We have observed silver ions and their clusters (Ag, Ag2, and Ag3) accumulated in the mould mycelium. As well as, mono-silver ion adducts with nucleotide derivatives (Coenzyme A), amino acids (phenylglycine), peptides (LeuSerAlaLeuGlu) and lipids (fatty acids, diacylglycerophosphoglycerols, monoglicerides and glycerophospholipids). The ultrastructure analysis revealed many sever alterations due to the action of AgNPs, such us shortening and condensation of hyphae, ultrastructural reorganisation, cell plasmolysis, increased vacuolisation, numerous membranous structures, collapsed cytoplasm, accumulation of lipid material, condensed mitochondria, disintegration of organelles, nuclear deformation, condensation and fragmentation of chromatin, creation of apoptotic bodies, as well as a new inside cell wall in P. chrysogenum.

  7. Cabazitaxel Injection

    MedlinePlus

    ... injection is used along with prednisone to treat prostate cancer (cancer of a male reproductive organ) that has ... cabazitaxel injection is usually used in men with prostate cancer. If used by pregnant women, cabazitaxel injection can ...

  8. Fondaparinux Injection

    MedlinePlus

    ... fondaparinux injection.Talk to your doctor about the risk of using fondaparinux injection. ... Fondaparinux injection is used to prevent deep vein thrombosis (DVT; a blood ... Xa inhibitors. It works by decreasing the clotting ability of the blood.

  9. Morphine Injection

    MedlinePlus

    Morphine injection is used to relieve moderate to severe pain. Morphine is in a class of medications called opiate ( ... Morphine injection comes as a solution (liquid) to inject intramuscularly (into a muscle) or intravenously (into a ...

  10. Dexamethasone Injection

    MedlinePlus

    Dexamethasone injection is used to treat severe allergic reactions. It is used in the management of certain types of ... gastrointestinal disease, and certain types of arthritis. Dexamethasone injection is also used for diagnostic testing. Dexamethasone injection ...

  11. Romidepsin Injection

    MedlinePlus

    Romidepsin injection is used to treat cutaneous T-cell lymphoma (CTCL; a group of cancers of the immune system ... one other medication given by mouth or by injection. Romidepsin injection is in a class of medications ...

  12. Ondansetron Injection

    MedlinePlus

    Zofran® Injection ... Ondansetron injection is used to prevent nausea and vomiting caused by cancer chemotherapy and surgery. Ondansetron is in a ... medications: or any of the ingredients in ondansetron injection. Ask your pharmacist for a list of the ...

  13. [Comparison of methods for the quantitative detection of moulds in foods. II. Communication: effect of homogenisation conditions on mould plate count (author's transl)].

    PubMed

    Blaser, P

    1978-05-01

    The different effects of homogenisation of four commonly used homogenisating apparatus, such as Stomacher, Ultraturrax, Waring-Blender, Bühler-homogenisator) were compared with each other by applying 1 artificially and 6 naturally moulded, non-fluid food products. Furthermore the influence of sedimentation in the homogenisate as well as the time of homogenisation was examined. One part of the examination was the direct microscopic observation on stained Breed-smears, the other part the cultural methods (number of mould plate count on malt extract agar). The homogenisation effect of the Stomacher was as good as with all other mentioned apparatus with the food products applied, except for the home-made smoked sausage. With this home made smoked sausage, much better results were obtained by these homogenisating apparatus, especially by the Bühler Homogenisator. This is due to the fact that the sausage was minced to a much higher degree and thus the inner mould flora was set free.--A more tender effect of the Stomacher on hyphal elements could not be achieved.--Prolonging the time of homogenisation from 1 minute to 2 up to 4 minutes did not give any better results.--A short sedimentation of coarser food particles facilitates the pipetting of the homogenisates without influencing the mould counts.--The naturally moulded foods, which were kept at room temperature for several weeks, showed a significantly smaller number of plate count than of total mould count in contrary to those foods moulded just before experimental beginning.

  14. Plasticising and injecting lowest quantities of plastic

    NASA Astrophysics Data System (ADS)

    Hopmann, Ch.; Neuß, A.; Weber, M.; Fischer, T.

    2014-05-01

    For an economic production of thermoplastic micro parts a reproducible quality is one of the key aspects. Therefore, injection moulding is one of the most common production technologies. The material and process oriented plasticising of the required amount of plastic material are still challenging. Due to the concept of standard injection moulding machines the plasticising screw with a non-return valve is used as the injection plunger. This principle can only realise injection volumes which arise directly from the screw diameter D and the injection stroke. Miniaturisation of this design is limited, since the screw core must absorb the required torque while a feeding of the granules is to ensure by a sufficient flight depth. Even the smallest standard diameters of 14 mm and minimum injection strokes result in shot volumes, which account for multiples of the component volume of common micro parts. At present a new plasticising concept is developed by the Institute of Plastics Processing (IKV), Aachen, Germany. The concept is characterised by the position of the screw flights, which are attached to the inside of the plasticising cylinder. The injection piston is mounted coaxially within the cylinder. The so-called 'inverted plastication' is based on the kinematic reversal of the screw flights' arrangement. As the injection piston does not have to feature neither a special feed section nor screw flights, it is exposed to lower mechanical stresses. It therefore features a smaller diameter than common plasticising screws. Thus, the entire plasticising unit can be adapted to the volume of micro parts. Currently, an experimental setup is built which allows a systematical analysis of the different influencing parameters.

  15. Ibandronate Injection

    MedlinePlus

    Boniva® Injection ... Ibandronate injection is used to treat osteoporosis (a condition in which the bones become thin and weak and break ... Ibandronate injection comes as a solution (liquid) to be injected into a vein by a doctor or nurse in ...

  16. Leuprolide Injection

    MedlinePlus

    Leuprolide injection comes as a long-acting suspension (Lupron) that is injected intramuscularly (into a muscle) by a doctor or nurse in a medical ... Depot-4 month, Lupron Depot-6 Month). Leuprolide injection also comes as a long-acting suspension (Eligard) that is injected subcutaneously (just under ...

  17. Microbial quality and presence of moulds in Kuflu cheese.

    PubMed

    Hayaloglu, A A; Kirbag, S

    2007-04-20

    The chemical and microbial qualities, including fungal flora, of 30 samples of Kuflu cheese randomly purchased from different markets in Turkey were investigated. The gross composition of the cheese samples ranged between 37.65-53.65% moisture, 6.21-40.09% fat-in-dry matter, 4.70-10.07% salt-in-moisture and 26.18-44.85% protein. The mean pH value of the cheeses was 6.29+/-0.28 and pH values ranged from 5.52 to 7.22. Variations between the samples in terms of their gross composition suggested a lack of quality standards in cheesemilk, cheesemaking procedure and ripening conditions. The levels of main microbial groups including total mesophilic and coliform bacteria, yeasts and moulds and the presence of some potentially pathogenic microorganisms (E. coli, Salmonella spp. and Staphylococcus aureus) were determined. The high numbers of all microbial groups and presence of potentially pathogenic organisms in the cheese samples suggested that the production and maturation of Kuflu cheese should be improved by better hygiene. Moulds at the cheese surface were isolated and identified. A total of 24 different mould species were detected and the genus most frequently isolated was Penicillium spp. which represented 70.25% of total isolates. Penicillium commune, P. roqueforti and P. verrucosum were the most abundant species in the cheeses sampled. The other dominant fungal groups were Geotrichum candidum, Penicillium expansum and P. chrysogenum. Other genera isolated from the cheese were Acremonium, Alternaria, Aspergillus, Cladosporium, Geotrichum, Mucor, Rhizopus and Trichoderma. The potentially toxigenic species, including some Penicillum spp. and Aspergillus flavus, were also detected.

  18. Reliability of sheet moulding composites (SMC) for the automotive industry

    NASA Astrophysics Data System (ADS)

    Lamanna, Giuseppe; Ceparano, Angelo; Sartore, Luciana

    2014-05-01

    The reliability of Sheet Moulding Composite (SMC) has been analysed by means of mechanical static and fatigue tests. SMCs showed substantial in-plane anisotropy either in terms of stiffness or strength reflecting the preferential orientation of the short fibres along the direction of the conveyor belt during the processing operations. The static data were modelled on a statistical basis assuming that the monotonic tensile strength follows a two-parameter Weibull distribution, while for the fatigue test we adopted a two parameters model already validated for Glass Fibre Reinforced Plastics (GFRP). Overall, the procedure indicated that he material reliability and its applicability limits can be achieved with a minimum of experimental tests.

  19. Multi-agent model of slime mould for computing and robotics

    NASA Astrophysics Data System (ADS)

    Jones, Jeff

    2015-03-01

    This chapter features results from a multi-agent model of slime mould. Slime mould is a remarkable organism because it possesses no nervous system, no skeleton, no organised musculature and no special senses. Despite these limitations, slime mould is capable of remarkable biological and computational feats by dynamically adapting its body plan in response to environmental stimuli. Because slime mould consists of simple component parts, its behaviour requires no specialised or critical components and the mechanisms which govern its behaviour are distributed throughout -- and embedded within -- the organism itself. This multi-agent approach to modelling slime mould is a bottom-up model and attempts to specifically use the same -- apparently limiting -- properties found in the organism itself: simple component parts, local interactions and self-organised collective emergent behaviour. The aim of the model is to show how the complexity of slime mould can emerge from these very simple local interactions. The model has successfully been applied to reproducing the biological behaviour of slime mould (growth patterns, network adaptation, oscillatory phenomena) and also the computational and robotic behaviour of slime mould. The images in this chapter give a flavour of the model with topics relating to the complex pattern formation phenomena, amoeboid movement and collective transport phenomena, and its utilisation as a spatially represented unconventional computing substrate...

  20. Mucoraceous moulds involved in the commercial fermentation of Sufu Pehtze.

    PubMed

    Han, Bei-Zhong; Kuijpers, Angelina F A; Thanh, Nguyen V; Nout, M J Robert

    2004-04-01

    Sufu is a fermented cheese-like soybean product in China and Vietnam, obtained by fungal solid-state fermentation of soybean curd (tofu), which results in moulded tofu or 'pehtze'. The final product sufu is obtained by maturing pehtze in a brine containing alcohol and salt during a period of several months. The present report deals with the identity and phylogenetic relationships of mould starter cultures used for the preparation ofpehtze. Starter cultures used in commercial pehtze fermentation were obtained from factories located in several provinces of China and Vietnam, isolated from their pehtze and some were obtained from culture collections. They were identified as Actinomucor repens, Actinomucor taiwanensis, Mucor circinelloides, Mocur hiemalis, Mocur racemosus, and Rhizopus microsporus var. microsporus. Phylogenetic relations based on sequencing of genomic DNA of these starters and of relevant control strains from collections indicate that the genera Mucor, Actinomucor and Rhizopus form distinct and homogenous clusters, with Mucor and Actinomucor showing a slightly closer relationship with each other than with Rhizopus.

  1. Beneficiation of graphite fines from moulding factory wastes.

    PubMed

    Koca, Sabina; Koca, Huseyin

    2005-08-01

    As the costs of waste disposal increase, more attention is being placed upon the re-use and recycling of valuable minerals contained within the waste streams. In this article, the waste streams from a moulding factory were treated by physical methods to obtain a re-usable graphite fraction. Multi-gravity separators (MGS) and shaking tables (ST) are being used in coal processing and heavy minerals beneficiation. In the present study, the possibility of using an MGS and ST to separate graphite from moulding sand was analysed as part of such investigations. The effects of changes in different process variables on the concentrate sand content and graphite recovery values were studied. Several parameters, thought to have an effect on the separation were tested. After the ST experiments, a graphite concentrate was obtained having 4.5% sand content with 60.8% recovery. After the investigations carried out by MGS, a graphite concentrate was obtained having 0.95% sand content with 68.0% recovery. The results demonstrated that recovered graphite fractions can be re-used in the factory, thus reducing the quantity of waste and costs.

  2. 78 FR 12357 - Brockway Mould, Inc., a Division of Ross International Ltd. Including Robert Lerch From BJR...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-02-22

    ... Employment and Training Administration Brockway Mould, Inc., a Division of Ross International Ltd. Including... Brockway Mould, Inc., a division of Ross International Ltd, Brockport, Pennsylvania (subject firm). The...,862 is hereby issued as follows: ``All workers from Brockway Mould, Inc., a division of...

  3. Laser welding process in PP moulding parts: Evaluation of seam performance

    NASA Astrophysics Data System (ADS)

    Oliveira, N.; Pontes, A. J.

    2015-12-01

    The Polypropylene is one of the most versatile polymer materials used in the industry. Due to this versatility, it is possible to use it in different products. This material can also be mixed with several additives namely glass fiber, carbon nanotubes, etc. This compatibility with different additives allows also obtaining products with characteristics that goes from an impact absorber to an electricity conductor. When is necessary to join components in PP they could be welded through hot plate, ultrasonic weld and also by laser. This study had the objective of study the influence of several variables, capable of influence the final quality of the seam. In this case were studied variables of the injection molding process as mold temperature and cooling time. Was also studied laser welding variables and different materials. The results showed that the variables that have the most influence were mould temperature, laser velocity and laser diameter. The seams were analyzed using Optical Microscopy technique. The seams showed perfect contact between the materials analyzed, despite the high standard variation presented in the mechanical testes.

  4. Organic dust induced pulmonary disease - the role of mould derived beta-glucan.

    PubMed

    Rylander, Ragnar

    2010-01-01

    The objective of the study was to evaluate the role of the mould cell wall agent beta-glucan in environmentally related pulmonary disease. All published articles where beta-glucan was administered by the airways, either as intratracheal injection or as inhalation were utilised as data sources. Data reporting consisted of analysis of data reports concerning the effects of beta-glucan on the immune system on the cellular level, particularly on the aggregation of inflammatory cells or production of inflammatory cytokines. High doses of soluble and particulate beta-glucan cause an inflammatory response characterized by cytokine activation and neutrophil invasion in the lung tissue. At lower doses, closer to environmental exposure levels, the predominant effect is an influence on the response to antigens, the reactivity of eosinophils and other Th2 driven immune responses. It is concluded that, beta-glucan can induce Th1 as well asTh2 driven immune responses. The pathology of atopy/allergy, hypersensitivity pneumonitis, and toxic penumonitis might be induced by exposure to beta-glucan. Measurements of beta-glucan in different environments are useful for risk control and prevention.

  5. Golimumab Injection

    MedlinePlus

    ... body and causes pain, swelling, and damage) including: rheumatoid arthritis (condition in which the body attacks its own ... doctor.If golimumab injection is used to treat rheumatoid arthritis, it may also be injected intravenously (into a ...

  6. Adalimumab Injection

    MedlinePlus

    ... causes pain, swelling, and damage) including the following: rheumatoid arthritis (a condition in which the body attacks its ... If you are using adalimumab injection to treat rheumatoid arthritis, your doctor may tell you to inject the ...

  7. Aripiprazole Injection

    MedlinePlus

    ... aripiprazole injection and aripiprazole extended-release injection developed gambling problems or other intense urges or behaviors that ... even if you do not realize that your gambling or any other intense urges or unusual behaviors ...

  8. Teduglutide Injection

    MedlinePlus

    ... mix and inject it.Teduglutide comes as a kit containing vials of teduglutide powder for injection, prefilled syringes containing diluent (liquid to be mixed with teduglutide powder), needles to attach to the diluent syringe, dosing syringes ...

  9. Degarelix Injection

    MedlinePlus

    Degarelix injection is used to treat advanced prostate cancer (cancer that begins in the prostate [a male reproductive gland]). Degarelix injection is in a class of medications called gonadotropin-releasing hormone (GnRH) ...

  10. Cyclosporine Injection

    MedlinePlus

    ... injection is used with other medications to prevent transplant rejection (attack of the transplanted organ by the ... people who have received kidney, liver, and heart transplants. Cyclosporine injection should only be used to treat ...

  11. Colistimethate Injection

    MedlinePlus

    ... is used to treat certain infections caused by bacteria. Colistimethate injection is in a class of medications called antibiotics. It works by killing bacteria.Antibiotics such as colistimethate injection will not work ...

  12. Chloramphenicol Injection

    MedlinePlus

    ... treat certain types of serious infections caused by bacteria when other antibiotics cannot be used. Chloramphenicol injection ... antibiotics. It works by stopping the growth of bacteria..Antibiotics such as chloramphenicol injection will not work ...

  13. Estrogen Injection

    MedlinePlus

    ... forms of estrogen injection are used to treat hot flushes (hot flashes; sudden strong feelings of heat and sweating) ... If you are using estrogen injection to treat hot flushes, your symptoms should improve within 1 to ...

  14. Medroxyprogesterone Injection

    MedlinePlus

    ... Medroxyprogesterone injection is a very effective method of birth control but does not prevent the spread of human ... you have been using a different method of birth control and are switching to medroxyprogesterone injection, your doctor ...

  15. Etanercept Injection

    MedlinePlus

    ... areas causing pain and joint damage), chronic plaque psoriasis (a skin disease in which red, scaly patches ... etanercept injection is used to treat chronic plaque psoriasis, it may be injected twice a week during ...

  16. Levoleucovorin Injection

    MedlinePlus

    Levoleucovorin injection is used to prevent harmful effects of methotrexate (Rheumatrex, Trexall) when methotrexate is used to to treat certain types of cancer. Levoleucovorin injection is also used to treat people ...

  17. Leucovorin Injection

    MedlinePlus

    Leucovorin injection is used to prevent harmful effects of methotrexate (Rheumatrex, Trexall; cancer chemotherapy medication) when methotrexate is used to to treat certain types of cancer. Leucovorin injection is used to ...

  18. Teniposide Injection

    MedlinePlus

    ... in men. You should not become pregnant or breast-feed while you are receiving teniposide injection. If you or your partner become pregnant while receiving teniposide injection, call your doctor. Teniposide may harm the fetus.

  19. Ipilimumab Injection

    MedlinePlus

    ... are pregnant, plan to become pregnant, or are breast-feeding. If you become pregnant while receiving ipilimumab injection, call your doctor. Ipilimumab injection may cause your baby to be born too early or to die before birth.

  20. Pralatrexate Injection

    MedlinePlus

    Pralatrexate injection is used to treat peripheral T-cell lymphoma (PTCL; a form of cancer that begins in a ... come back after treatment with other medications. Pralatrexate injection has not been shown to help people who ...

  1. Cyanocobalamin Injection

    MedlinePlus

    Cyanocobalamin injection is used to treat and prevent a lack of vitamin B12 that may be caused by any ... organs) and permanent damage to the nerves. Cyanocobalamin injection also may be given as a test to ...

  2. Paclitaxel Injection

    MedlinePlus

    Paclitaxel injection manufactured with human albumin is used to treat breast cancer that has not improved or that has come back after treatment with other medications. Paclitaxel injection manufactured with polyoxyethylated castor oil is used to ...

  3. Diphenhydramine Injection

    MedlinePlus

    Diphenhydramine injection is used to treat allergic reactions, especially for people who are unable to take diphenhydramine by mouth. ... is used also to treat motion sickness. Diphenhydramine injection is also used alone or along with other ...

  4. Peramivir Injection

    MedlinePlus

    Peramivir injection is used to treat some types of influenza infection ('flu') in people who have had symptoms of ... flu for no longer than 2 days. Peramivir injection is in a class of medications called neuraminidase ...

  5. Cefotetan Injection

    MedlinePlus

    Cefotetan injection is used to treat infections of the lungs, skin, bones, joints, stomach area, blood, female reproductive organs, and urinary tract. Cefotetan injection is also used before surgery to prevent infections. ...

  6. Mipomersen Injection

    MedlinePlus

    Mipomersen injection is used to decrease levels of cholesterol and other fatty substances in the blood in people who ... that removes LDL from the blood), but mipomersen injection should not be used along with this treatment. ...

  7. Romiplostim Injection

    MedlinePlus

    Romiplostim injection is used to increase the number of platelets (cells that help the blood to clot) in order ... low number of platelets in the blood). Romiplostim injection should only be used in people who cannot ...

  8. Hydrocortisone Injection

    MedlinePlus

    Hydrocortisone injection is used to treat symptoms of low corticosteroid levels (lack of certain substances that are usually produced ... also used to treat severe allergic reactions. Hydrocortisone injection is used in the management of multiple sclerosis ( ...

  9. Palivizumab Injection

    MedlinePlus

    Palivizumab injection is used to help prevent respiratory syncytial virus (RSV; common virus that can cause serious lung infections) ... or have certain heart or lung diseases. Palivizumab injection is not used to treat the symptoms of ...

  10. Naltrexone Injection

    MedlinePlus

    Naltrexone injection is used along with counseling and social support to help people who have stopped drinking large amounts of alcohol to avoid drinking again. Naltrexone injection is also used along with counseling and social ...

  11. Tesamorelin Injection

    MedlinePlus

    Tesamorelin injection is used to decrease the amount of extra fat in the stomach area in adults with human ... fat in certain areas of the body). Tesamorelin injection is not used to help with weight loss. ...

  12. Testosterone Injection

    MedlinePlus

    ... and testosterone pellet (Testopel) are forms of testosterone injection used to treat symptoms of low testosterone in ... are low before you begin to use testosterone injection. Testosterone enanthate (Delatestryl) and testosterone pellet (Testopel) are ...

  13. Tigecycline Injection

    MedlinePlus

    Tigecycline injection used to treat certain serious infections including community acquired pneumonia (a lung infection that developed in a ... area between the chest and the waist). Tigecycline injection should not be used to treat pneumonia that ...

  14. Eculizumab Injection

    MedlinePlus

    Eculizumab injection is used to treat paroxysmal nocturnal hemoglobinuria (PNH: a type of anemia in which too many red ... oxygen to all parts of the body). Eculizumab injection is also used to treat atypical hemolytic uremic ...

  15. Pembrolizumab Injection

    MedlinePlus

    Pembrolizumab injection is used to treat melanoma (a type of skin cancer) that cannot be treated with surgery or ... spread to other parts of the body. Pembrolizumab injection is also used to treat a certain type ...

  16. Methylprednisolone Injection

    MedlinePlus

    ... allergic reactions. Methylprednisolone injection is used in the management of multiple sclerosis (a disease in which the ... laboratory test, tell your doctor and the laboratory personnel that you are using methylprednisolone injection.If you ...

  17. Obinutuzumab Injection

    MedlinePlus

    Obinutuzumab injection is used with chlorambucil (Leukeran) to treat chronic lymphocytic leukemia (CLL; a type of cancer of the white blood cells). Obinutuzumab injection is in a class of medications called ...

  18. Busulfan Injection

    MedlinePlus

    Busulfex® Injection ... Busulfan injection is used to treat a certain type of chronic myelogenous leukemia (CML; a type of cancer of ... of 16 doses) before bone marrow transplant.Busulfan injection may cause seizures during therapy with the medication. ...

  19. Studies on mould growth and biomass production using waste banana peel.

    PubMed

    Essien, J P; Akpan, E J; Essien, E P

    2005-09-01

    Hyphomycetous (Aspergillus fumigatus) and Phycomycetous (Mucor hiemalis) moulds were cultivated in vitro at room temperature (28 + 20 degrees C) to examined their growth and biomass production on waste banana peel agar (BPA) and broth (BPB) using commercial malt extract agar (MEA) and broth (MEB) as control. The moulds grew comparatively well on banana peel substrates. No significant difference (p > 0.05) in radial growth rates was observed between moulds cultivated on PBA and MEA, although growth rates on MEA were slightly better. Slight variations in sizes of asexual spores and reproductive hyphae were also observed between moulds grown on MEA and BPA. Smaller conidia and sporangiospores, and shorter aerial hyphae (conidiophores and sporangiophores) were noticed in moulds grown on BPA than on MEA. The biomass weight of the test moulds obtained after one month of incubation with BPB were only about 1.8 mg and 1.4 mg less than values recorded for A. fumigatus and M. hiemalis respectively, grown on MEB. The impressive performance of the moulds on banana peel substrate may be attributed to the rich nutrient (particularly the crude protein 7.8% and crude fat 11.6% contents) composition of banana peels. The value of this agricultural waste can therefore be increased by its use not only in the manufacture of mycological medium but also in the production of valuable microfungal biomass which is rich in protein and fatty acids.

  20. Moulded infrared optics making night vision for cars within reach

    NASA Astrophysics Data System (ADS)

    Bourget, Antoine; Guimond, Yann; Franks, John; Van Den Bergh, Marleen

    2005-02-01

    Sustainable mobility is a major public concern, making increased safety one of the major challenges for the car of the future. About half of all serious traffic accidents occur at night, while only a minority of journeys is at night. Reduced visibility is one of the main reasons for these striking statistics and this explains the interest of the automobile industry in Enhanced Night Vision Systems. As an answer to the need for high volume, low cost optics for these applications, Umicore has developed GASIR. This material is transparent in the NEAR and FAR infrared, and is mouldable into high quality finished spherical, aspherical and diffractive lenses. Umicore's GASIR moulded lenses are an ideal solution for thermal imaging for cars (Night Vision) and for sensing systems like pedestrian detection, collision avoidance, occupation detection, intelligent airbag systems etc.

  1. Optimising efficiency in diamond turned Fresnel mould masters

    NASA Astrophysics Data System (ADS)

    Allsop, John L.; Mateboer, Arjen; Shore, Paul

    2011-05-01

    Radial and Linear Fresnel Lenses are finding application as light concentrators for Concentrated Photovoltaic and Concentrated Solar Thermal power applications. The efficiency of these diffractive lenses directly affects the yield of such systems. Peaks and valleys of the optical facets of the Fresnel lens must be sharp in order to prevent diffusion and transmission loss due to rounding. For diamond turned mould masters, optical facet tip sharpness is affected by machining accuracy, tool-path and tool wear/mileage. Strategies to optimise optical facet tip sharpness are presented which enable production of large lenses with minimal degradation of optical quality. Radial Fresnel produced with diameters over 500mm and Linear Fresnel over 1m long are discussed with data on structure fidelity and tool wear.

  2. [Moulds and yeasts in bottled water and soft drinks].

    PubMed

    Ancasi, E G; Carrillo, L; Benítez Ahrendts, M R

    2006-01-01

    Some damaged cartons of soft drinks and carbonated water were analyzed to detect the microorganisms that caused the damage. The contaminants of sugar used in the production of one of the drinks were also studied. The methods of Déak & Beuchat and Pitt & Hocking were used for the identification of yeasts and moulds, respectively. The agents of the spoilage of soft drinks were Debaryomyces hansenii, Debaryomyces polymorphus, Galactomyces geotrichum, Metschnikowia pulcherrima, Mucor circinelloides, Pichia anomala, Pichia jadinii, Pichia subpelliculosa, Rhodotorula glutinis and Zygosaccharomyces bailii. The microorganisms found in sugar were Aspergillus niger, Aspergillus penicilloides, Aspergillus versicolor, Cladosporium sphaerospermum, Mucor racemosus, P. anomala and Rhizopus stolonifer. Paecilomyces fulvus and Penicillium glabrum were observed in carbonated water.

  3. Cellular automaton model of crowd evacuation inspired by slime mould

    NASA Astrophysics Data System (ADS)

    Kalogeiton, V. S.; Papadopoulos, D. P.; Georgilas, I. P.; Sirakoulis, G. Ch.; Adamatzky, A. I.

    2015-04-01

    In all the living organisms, the self-preservation behaviour is almost universal. Even the most simple of living organisms, like slime mould, is typically under intense selective pressure to evolve a response to ensure their evolution and safety in the best possible way. On the other hand, evacuation of a place can be easily characterized as one of the most stressful situations for the individuals taking part on it. Taking inspiration from the slime mould behaviour, we are introducing a computational bio-inspired model crowd evacuation model. Cellular Automata (CA) were selected as a fully parallel advanced computation tool able to mimic the Physarum's behaviour. In particular, the proposed CA model takes into account while mimicking the Physarum foraging process, the food diffusion, the organism's growth, the creation of tubes for each organism, the selection of optimum tube for each human in correspondence to the crowd evacuation under study and finally, the movement of all humans at each time step towards near exit. To test the model's efficiency and robustness, several simulation scenarios were proposed both in virtual and real-life indoor environments (namely, the first floor of office building B of the Department of Electrical and Computer Engineering of Democritus University of Thrace). The proposed model is further evaluated in a purely quantitative way by comparing the simulation results with the corresponding ones from the bibliography taken by real data. The examined fundamental diagrams of velocity-density and flow-density are found in full agreement with many of the already published corresponding results proving the adequacy, the fitness and the resulting dynamics of the model. Finally, several real Physarum experiments were conducted in an archetype of the aforementioned real-life environment proving at last that the proposed model succeeded in reproducing sufficiently the Physarum's recorded behaviour derived from observation of the aforementioned

  4. Using the head as a mould for cranioplasty with methylmethacrylate.

    PubMed

    Bot, G M; Ismail, N J; Usman, B; Shilong, D J; Obande, J O; Aliu, S; Sale, D; Shehu, B B

    2013-10-01

    Methacrylate is a valuable tool to the neurosurgeon, even though it is currently being replaced by custom bone. During cranioplasty in the absence of custom bone, which is preformed based on the patients imaging, one has to make a cast to cover the cranial defect with or without the use of a mould. A good artificial skull outline is necessary for prevention of implant extrusion and acceptable cosmetic outcome. Using the patients head as a mould is a simple, cheap, and useful technique. An incision is made, and either a craniectomy or an attempt at skull elevation or separation of the scalp from dura is done based on the indication for the cranioplasty. The methacrylate monomer is mixed with its solvent. It is placed in between a sliced glove and then thinned out. Several layers of drapes are placed on the patients head, the acrylate which is in between the gloves is then placed on the drapes. As soon as it starts setting and the required shape obtained, it is removed and place on the sterile tray. It is then anchored and the wound closed. This technique produces good cosmetic outcome. However, the head must be properly protected from the risk of burns from the exothermic reaction. The technique is described in a 40-year-old driver who had a compound depressed skull fracture. He had a methylmethacrylate cranioplasty in the 9(th) week post trauma after allowing for wound healing. We recommend that this technique may be used in centers where custom bone is either too expensive or not available during cranioplasty in order to obtain a good outcome.

  5. Rapid fabrication of microdevices using laser direct writing and replica moulding technique

    NASA Astrophysics Data System (ADS)

    Antończak, A. J.; Stepak, B. D.; Abramski, K. M.

    2016-03-01

    This paper presents a method that enables fast and low-cost fabrication of microchannels with oval cross-section. The procedure is based on formation of a concave meniscus at the interface between an initially cured PDMS and a polymeric mould fabricated using excimer laser. The replica is formed by expanding gas trapped within the structures of the mould during thermal curing. A second shaping factor is connected with surface phenomena at the interface between the mould, gas and partially cured PDMS. The final shape of the meniscus is determined when the PDMS reaches the high cure extent.

  6. Penile cancer brachytherapy HDR mould technique used at the Holycross Cancer Center

    PubMed Central

    Kubicka-Mendak, Iwona; Łyczek, Jarosław; Pawłowski, Piotr; Stawiarska, Iwona; Miedzinska, Joanna; Banatkiewicz, Paweł; Łaskawska-Wiatr, Aldona; Wittych, Justyna

    2011-01-01

    The aim of this pictorial essay is to present the mould based HDR brachytherapy technique used at the Holycross Cancer Center for penile cancer patients. We use images to describe this method step by step. PMID:23346132

  7. Penile cancer brachytherapy HDR mould technique used at the Holycross Cancer Center.

    PubMed

    Matys, Robert; Kubicka-Mendak, Iwona; Lyczek, Jarosław; Pawłowski, Piotr; Stawiarska, Iwona; Miedzinska, Joanna; Banatkiewicz, Paweł; Laskawska-Wiatr, Aldona; Wittych, Justyna

    2011-12-01

    The aim of this pictorial essay is to present the mould based HDR brachytherapy technique used at the Holycross Cancer Center for penile cancer patients. We use images to describe this method step by step.

  8. Using the anti-adherence paints to manufacturing of the moulds intended for iron castings

    NASA Astrophysics Data System (ADS)

    Josan, A.; Pinca Bretotean, C.

    2017-01-01

    The paper presents the critical technology for obtaining of the lamellar graphite grey cast iron castings (Supporting roll type). Are presented the stages of achievement of the mould and the elaboration technology of the liquid alloy. A view to improving the qualitative characteristics of the castings and reducing the defects due to achievement of moulds it is necessary to use the antiadherence paints for moulds and cores. From the point of view of the cost the antiadherence paints belong to the expensive material category. But these expenses are done with their acquisition are amortized into account of improving the commercial aspect of the castings and shortening of the cleaning-finishing operations. Due to increase the resistance of the moulds and cores which they apply it is possible to decrease the machining allowance.

  9. Impression technique for monitoring and virtual treatment planning in nasoalveolar moulding.

    PubMed

    Loeffelbein, Denys J; Rau, Andrea; Wolff, Klaus-Dietrich

    2013-12-01

    We describe our experience with various silicone materials for making one-step and two-step impressions of the cleft-lip-palate-nose complex during nasoalveolar moulding. Our technique is superior to common alginate-based impression techniques, as it provides precise reproduction of the complex anatomy of the cleft, and is compatible with the latest available methods of planning treatment with nasoalveolar moulding, such as computer-aided reverse engineering and rapid prototyping.

  10. Use of the selective agar medium CREAD for monitoring the level of airborne spoilage moulds in cheese production.

    PubMed

    Kure, Cathrine Finne; Borch, Elisabeth; Karlsson, Ingela; Homleid, Jens Petter; Langsrud, Solveig

    2008-02-29

    It was investigated if a selective medium for common cheese spoiling moulds (CREAD) could give more relevant information than a general mould medium in hygienic air-sampling in cheese factories. A total of 126 air-samples were taken in six Nordic cheese factories using the general mould medium DG18 and CREAD. The level and genera of air-borne mould was determined. Identification to species-level was performed for a selection of samples. In five cheese factories the mycobiota was dominated by Penicillium spp. and in one cheese factory by Cladosporium spp. The concentration of air-borne moulds varied between the cheese factories ranging from 1 to 270 cfu/m3 on DG18 with a median value of 17. The number of mould colonies was in general lower at CREAD. Identification indicated that CREAD supported growth of common spoilage moulds for cheese, such as Penicillium palitans and P. commune. The mycobiota on DG18 also consisted of moulds not commonly associated with spoilage of cheese, such as Cladosporium spp., P. brevicompactum and P. chrysogenum. Contamination of cheese with mould is periodically a problem in production of semi-hard cheese and the level of air-borne mould is therefore routinely monitored in cheese factories. A clear correlation between the total number of moulds in air and mould growth on products is not always found. The conclusion from the investigation is that it is recommended to use a selective medium for cheese spoilage moulds, such as CREAD in hygienic monitoring.

  11. Musculoskeletal Injection

    PubMed Central

    Wittich, Christopher M.; Ficalora, Robert D.; Mason, Thomas G.; Beckman, Thomas J.

    2009-01-01

    Patients commonly present to primary care physicians with musculoskeletal symptoms. Clinicians certified in internal medicine must be knowledgeable about the diagnosis and management of musculoskeletal diseases, yet they often receive inadequate postgraduate training on this topic. The musculoskeletal problems most frequently encountered in our busy injection practice involve, in decreasing order, the knees, trochanteric bursae, and glenohumeral joints. This article reviews the clinical presentations of these problems. It also discusses musculoskeletal injections for these problems in terms of medications, indications, injection technique, and supporting evidence from the literature. Experience with joint injection and the pharmacological principles described in this article should allow primary care physicians to become comfortable and proficient with musculoskeletal injections. PMID:19720781

  12. Metabolic activity of moulds as a factor of building materials biodegradation.

    PubMed

    Gutarowska, Beata

    2010-01-01

    This paper presents the effect of building materials on the growth and metabolic activity of moulds. In cultures of Aspergillus and Penicillium moulds grown on a model medium with the addition of building materials, the biomass of mycelium, its cellular components--glucan, chitin, ergosterol and the spectrum of enzymes and organic acids produced in the medium were investigated. It was found that on the medium with wallpaper moulds produced more biomass and extracellular enzymes, mainly glycolytic ones. On medium with mortar the growth of mycelium was impeded, production of biomass was 60% smaller, the quantity of chitin, glucan and ergosterol decreased 13-41%, and the activity of most enzymes was reduced; however the moulds intensively produced organic acids: malic, succinic and oxalic acid. The largest acid production activity was found in medium with addition of mortar; moulds produced the greatest variety of acids and in greater quantities than in the control medium. Metabolic activity of the moulds depends on the type of building material, and may lead to biodeterioration of these materials.

  13. Early diagnosis of invasive mould infections and disease.

    PubMed

    Lamoth, Frédéric; Calandra, Thierry

    2017-03-01

    Invasive mould infections (IMIs), such as invasive aspergillosis or mucormycosis, are a major cause of death in patients with haematological cancer and in patients receiving long-term immunosuppressive therapy. Early diagnosis and prompt initiation of antifungal therapy are crucial steps in the management of patients with IMI. The diagnosis of IMI remains a major challenge, with an increased spectrum of fungal pathogens and a diversity of clinical and radiological presentations within the expanding spectrum of immunocompromised hosts. Diagnosis is difficult to establish and is expressed on a scale of probability (proven, probable and possible). Imaging (CT scan), microbiological tools (direct examination, culture, PCR, fungal biomarkers) and histopathology are the pillars of the diagnostic work-up of IMI. None of the currently available diagnostic tests provides sufficient sensitivity and specificity alone, so the optimal approach relies on a combination of multiple diagnostic strategies, including imaging, fungal biomarkers (galactomannan and 1,3-β-d-glucan) and molecular tools. In recent years, the development of PCR for filamentous fungi (primarily Aspergillus or Mucorales) and the progress made in the standardization of fungal PCR technology, may lead to future advances in the field. The appropriate diagnostic approach for IMI should be individualized to each centre, taking into account the local epidemiology of IMI and the availability of diagnostic tests.

  14. Deep phylogeny and evolution of slime moulds (mycetozoa).

    PubMed

    Fiore-Donno, Anna Maria; Nikolaev, Sergey I; Nelson, Michaela; Pawlowski, Jan; Cavalier-Smith, Thomas; Baldauf, Sandra L

    2010-01-01

    Mycetozoa, characterized by spore-bearing fruiting bodies, are the most diverse Amoebozoa. They traditionally comprise three taxa: Myxogastria, Dictyostelia and Protostelia. Myxogastria and Dictyostelia typically have multispored fruiting bodies, but controversy exists whether they are related or arose independently from different unicellular ancestors. Protostelid slime moulds, with single-spored fruiting bodies, are possible evolutionary intermediates between them and typical amoebae, but have received almost no molecular study. Protostelid morphology is so varied that they might not be monophyletic. We therefore provide 38 new 18S rRNA and/or EF-1alpha gene sequences from Mycetozoa and related species, including four protostelids and the enigmatic Ceratiomyxa fruticulosa. Phylogenetic analyses support the monophyly of Dictyostelia, Myxogastria, and Ceratiomyxa (here collectively called "macromycetozoa") and show that protostelids are Amoebozoa, mostly related to non-fruiting amoebae of the class Variosea, but may not be monophyletic; some phylogenetic relationships remain poorly resolved. Ceratiomyxa fruticulosa, originally regarded as a myxogastrid, but in recent decades included in Protostelia, is a deeply diverging sister to Myxogastria. The protostelids studied here plus varipodid amoebae and the flagellates Phalansterium and Multicilia together probably form the outgroup to macromycetozoa plus Archamoebae. Thus protostelids and Variosea are especially significant for understanding the evolutionary transition from solitary amoebae to macromycetozoa.

  15. Modelling mould growth under suboptimal environmental conditions and inoculum size.

    PubMed

    Garcia, Daiana; Ramos, Antonio J; Sanchis, Vicente; Marín, Sonia

    2010-10-01

    Predictive models can be a tool to develop strategies to prevent mould development and consequently mycotoxin production. The aims of this work were to assess the impact of a) high/low levels of inoculum and b) optimal/suboptimal environmental conditions on fungal responses based on both kinetic and probabilistic models. Different levels of spore suspensions of Aspergillus carbonarius and Penicillium expansum were prepared and inoculated centrally with a needlepoint load on malt extract agar (MEA) with 50 replicates. While optimum conditions led to a colony diameter increase which followed Baranyi's function, suboptimal conditions led to different grow functions. In general, growth rate (mu) and lag phase (lambda) were normally distributed. Specifically, the growth rate (mu) showed similar distributions under optimal growth conditions, regardless of the inoculum level, while suboptimal a(w) and temperature conditions led to higher kurtosis distributions, mainly when the inoculum levels were low. Regarding lambda, more skewed distributions were observed, mainly when the inoculum levels were low. Probability models were not much affected by the inoculum size. Lower probabilities of growth were in general predicted under marginal conditions at a given time for both strains. The slopes of the probability curves were smaller under suboptimal growth conditions due to wider distributions. Results showed that a low inoculum level and suboptimal conditions lead to high variability of the estimated growth parameters and growth probability.

  16. Exposure to the airborne mould Botrytis and its health effects.

    PubMed

    Jurgensen, Claudia Wurtz; Madsen, Anne

    2009-01-01

    Most investigations into the correlation between exposure to fungi and detrimental health effects focus on the 2-4 most prevalent genera in ambient air, both outdoors and indoors. Yet over 80 genera of fungi have been shown to have allergenic potential. Also, there is no agreement about threshold values for exposure to fungi. One of the fungal genera expected to be less prevalent in ambient air and known to cause allergy is Botrytis. In this review, we investigate the airborne exposure level and health effect of Botrytis, both at general exposure and in occupational settings. The surveyed papers show that Botrytis is found globally with different spore seasons depending on the region investigated. The levels of Botrytis in the percentage of all fungi have a calculated median of around 1.1% in the different environments, confirming that it is among the less prevalent fungi. Furthermore, a substantial proportion of patients and workers are allergic to Botrytis cinerea, and when B. cinerea was included in extended test panels additional allergic patients were found. Thus, B. cinerea is as important as the more prevalent mould genera Cladosporium and Alternaria and we suggest that it should be included in standard allergic tests panels.

  17. Effectiveness of phenolic compounds against citrus green mould.

    PubMed

    Sanzani, Simona M; Schena, Leonardo; Ippolito, Antonio

    2014-08-18

    Stored citrus fruit suffer huge losses because of the development of green mould caused by Penicillium digitatum. Usually synthetic fungicides are employed to control this disease, but their use is facing some obstacles, such public concern about possible adverse effects on human and environmental health and the development of resistant pathogen populations. In the present study quercetin, scopoletin and scoparone--phenolic compounds present in several agricultural commodities and associated with response to stresses--were firstly tested in vitro against P. digitatum and then applied in vivo on oranges cv. Navelina. Fruits were wound-treated (100 µg), pathogen-inoculated, stored and surveyed for disease incidence and severity. Although only a minor (≤13%) control effect on P. digitatum growth was recorded in vitro, the in vivo trial results were encouraging. In fact, on phenolic-treated oranges, symptoms appeared at 6 days post-inoculation (DPI), i.e., with a 2 day-delay as compared to the untreated control. Moreover, at 8 DPI, quercetin, scopoletin, and scoparone significantly reduced disease incidence and severity by 69%-40% and 85%-70%, respectively, as compared to the control. At 14 DPI, scoparone was the most active molecule. Based on the results, these compounds might represent an interesting alternative to synthetic fungicides.

  18. Certolizumab Injection

    MedlinePlus

    ... has not improved when treated with other medications, rheumatoid arthritis (a condition in which the body attacks its ... continues. When certolizumab injection is used to treat rheumatoid arthritis, it is usually given every other week and ...

  19. Natalizumab Injection

    MedlinePlus

    ... prevent episodes of symptoms in people who have Crohn's disease (a condition in which the body attacks the ... If you are receiving natalizumab injection to treat Crohn's disease, your symptoms should improve during the first few ...

  20. Vedolizumab Injection

    MedlinePlus

    ... injection may cause serious allergic reactions during an infusion and for several hours afterward. A doctor or ... of the following symptoms during or after your infusion: rash; itching; swelling of the face, eyes, mouth, ...

  1. Panitumumab Injection

    MedlinePlus

    ... as a solution (liquid) to be given by infusion (injected into a vein). It is usually given ... doctor or nurse in a doctor's office or infusion center. Panitumumab is usually given once every 2 ...

  2. Methotrexate Injection

    MedlinePlus

    ... woman's uterus while she is pregnant), breast cancer, lung cancer, certain cancers of the head and neck; certain ... Methotrexate injection is also used along with rest, physical therapy and ... treat rheumatoid arthritis by decreasing the activity of the immune system.

  3. Alirocumab Injection

    MedlinePlus

    ... injection is used along with diet and certain cholesterol-lowering medications (HMG-CoA reductase inhibitors [statins]) in ... familial heterozygous hypercholesterolemia (an inherited condition in which cholesterol cannot be removed from the body normally) or ...

  4. Evolocumab Injection

    MedlinePlus

    ... injection is used along with diet and certain cholesterol-lowering medications, HMG-CoA reductase inhibitors (statins), in ... heterozygous hypercholesterolemia (HeFH; an inherited condition in which cholesterol cannot be removed from the body normally) or ...

  5. Pentamidine Injection

    MedlinePlus

    Pentamidine injection is used to treat pneumonia caused by a fungus called Pneumocystis carinii. It is in a class of medications called antiprotozoals. It works by stopping the growth of protozoa that can cause pneumonia.

  6. Oxytocin Injection

    MedlinePlus

    Oxytocin injection is used to begin or improve contractions during labor. Oxytocin also is used to reduce bleeding after childbirth. ... other medications or procedures to end a pregnancy. Oxytocin is in a class of medications called oxytocic ...

  7. Ibritumomab Injection

    MedlinePlus

    ... is in a class of medications called monoclonal antibodies with radioisotopes. It works by attaching to cancer ... you receive ibritumomab injection, your body may develop antibodies (substances in the blood that help the immune ...

  8. Ganciclovir Injection

    MedlinePlus

    ... problems, eye problems other than CMV retinitis, or kidney disease.tell your doctor if you are pregnant or plan to become pregnant. Ganciclovir injection may cause infertility (difficulty becoming pregnant). However, if you are a ...

  9. Bendamustine Injection

    MedlinePlus

    ... a type of cancer of the white blood cells). Bendamustine injection is also used to treat a ... that begins in a type of white blood cell that normally fights infection) that is slow spreading, ...

  10. Vancomycin Injection

    MedlinePlus

    ... medications called glycopeptide antibiotics. It works by killing bacteria that cause infections.Antibiotics such as vancomycin injection ... infection may not be completely treated and the bacteria may become resistant to antibiotics.

  11. Levofloxacin Injection

    MedlinePlus

    ... of antibiotics called fluoroquinolones. It works by killing bacteria that cause infections.Antibiotics such as levofloxacin injection ... infection may not be completely treated and the bacteria may become resistant to antibiotics.

  12. Doxycycline Injection

    MedlinePlus

    ... medications called tetracycline antibiotics. It works by killing bacteria that cause infections.Antibiotics such as doxycycline injection ... infection may not be completely treated and the bacteria may become resistant to antibiotics.

  13. Sumatriptan Injection

    MedlinePlus

    ... accompanied by nausea and sensitivity to sound and light). Sumatriptan injection is also used to treat the ... children. Store it at room temperature, away from light, excess heat, and moisture (not in the bathroom). ...

  14. Alemtuzumab Injection

    MedlinePlus

    ... injection, the medication is usually given three times weekly on alternate days (usually Monday, Wednesday, and Friday) ... that you eat foods that are rich in iron such as meats, leafy green vegetables, and fortified ...

  15. Epinephrine Injection

    MedlinePlus

    Epinephrine injection is used along with emergency medical treatment to treat life-threatening allergic reactions caused by ... or stings, foods, medications, latex, and other causes. Epinephrine is in a class of medications called alpha- ...

  16. Mitoxantrone Injection

    MedlinePlus

    ... medications to relieve pain in people with advanced prostate cancer who did not respond to other medications. Mitoxantrone ... doses). When mitoxantrone injection is used to treat prostate cancer, it is usually given once every 21 days. ...

  17. Trastuzumab Injection

    MedlinePlus

    ... with other medications to treat certain types of stomach cancer that have spread to other parts of the ... weeks. When trastuzumab injection is used to treat stomach cancer, it is usually given once every 3 weeks. ...

  18. Topotecan Injection

    MedlinePlus

    ... organs where eggs are formed) and small cell lung cancer (a type of cancer that begins in the ... topotecan injection is used to treat ovarian or lung cancer, it is usually given once a day for ...

  19. Palonosetron Injection

    MedlinePlus

    ... that may occur several days after receiving certain chemotherapy medications. Palonosetron injection is in a class of medications called 5-HT3 receptor antagonists. It works by blocking the action of serotonin, a natural ...

  20. Meropenem Injection

    MedlinePlus

    ... skin and abdominal (stomach area) infections caused by bacteria and meningitis (infection of the membranes that surround ... of medications called antibiotics. It works by killing bacteria that cause infection.Antibiotics such as meropenem injection ...

  1. Amikacin Injection

    MedlinePlus

    ... treat certain serious infections that are caused by bacteria such as meningitis (infection of the membranes that ... medications called aminoglycoside antibiotics. It works by killing bacteria.Antibiotics such as amikacin injection will not work ...

  2. Ertapenem Injection

    MedlinePlus

    ... abdominal (stomach area) infections, that are caused by bacteria. It is also used for the prevention of ... medications called carbapenem antibiotics. It works by killing bacteria.Antibiotics such as ertapenem injection will not work ...

  3. Moxifloxacin Injection

    MedlinePlus

    ... is used to treat certain infections caused by bacteria such as pneumonia; ; and , skin, and abdominal (stomach ... antibiotics called fluoroquinolones. It works by killing the bacteria that cause infections.Antibiotics such as moxifloxacin injection ...

  4. Cefepime Injection

    MedlinePlus

    ... is used to treat certain infections caused by bacteria including pneumonia, and skin, urinary tract, and kidney ... medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as cefepime injection will not work ...

  5. Cefazolin Injection

    MedlinePlus

    ... is used to treat certain infections caused by bacteria including skin, bone, joint, genital, blood, heart valve, ... medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as cefazolin injection will not work ...

  6. Daptomycin Injection

    MedlinePlus

    ... blood infections or serious skin infections caused by bacteria. Daptomycin injection is in a class of medications called cyclic lipopeptide antibiotics. It works by killing bacteria. Antibiotics will not work for treating colds, flu, ...

  7. Aztreonam Injection

    MedlinePlus

    ... to treat certain infections that are caused by bacteria, including respiratory tract (including pneumonia and bronchitis), urinary ... abdominal (stomach area) infections, that are caused by bacteria. Aztreonam injection also may be used before, during, ...

  8. Ceftazidime Injection

    MedlinePlus

    ... is used to treat certain infections caused by bacteria including pneumonia and other lower respiratory tract (lung) ... medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as ceftazidime injection will not work ...

  9. Tobramycin Injection

    MedlinePlus

    ... treat certain serious infections that are caused by bacteria such as meningitis (infection of the membranes that ... medications called aminoglycoside antibiotics. It works by killing bacteria.Antibiotics such as tobramycin injection will not work ...

  10. Ciprofloxacin Injection

    MedlinePlus

    ... is used to treat certain infections caused by bacteria such as pneumonia; and infections of the skin, ... of antibiotics called fluoroquinolones. It works by killing bacteria that cause infections.Antibiotics such as ciprofloxacin injection ...

  11. Gentamicin Injection

    MedlinePlus

    ... treat certain serious infections that are caused by bacteria such as meningitis (infection of the membranes that ... medications called aminoglycoside antibiotics. It works by killing bacteria.Antibiotics such as gentamicin injection will not work ...

  12. Ceftaroline Injection

    MedlinePlus

    ... infections and pneumonia (lung infection) caused by certain bacteria. Ceftaroline is in a class of medications called cephalosporin antibiotics. It works by killing bacteria.Antibiotics such as ceftaroline injection will not work ...

  13. Daclizumab Injection

    MedlinePlus

    ... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS; a disease in which ... injections. Before you use daclizumab yourself the first time, read the written instructions that come with it. ...

  14. Risperidone Injection

    MedlinePlus

    ... release (long-acting) injection is used to treat schizophrenia (a mental illness that causes disturbed or unusual ... do not already have diabetes. If you have schizophrenia, you are more likely to develop diabetes than ...

  15. Acyclovir Injection

    MedlinePlus

    ... chickenpox in the past) in people with weak immune systems. It is also used to treat first-time ... from time to time) in people with normal immune systems. Acyclovir injection is used to treat herpes simplex ...

  16. Omalizumab Injection

    MedlinePlus

    ... steroids. Omalizumab is also used to treat chronic hives without a known cause that cannot successfully be ... is not used to treat other forms of hives or allergic conditions. Omalizumab injection is in a ...

  17. Pegloticase Injection

    MedlinePlus

    ... doctor if you have glucose-6-phosphate dehydrogenase (G6PD) deficiency (an inherited blood disease). Your doctor may test you for G6PD deficiency before you start to receive pegloticase injection. If ...

  18. Lacosamide Injection

    MedlinePlus

    ... with other medications to control certain types of seizures in people who cannot take oral medications. Lacosamide ... If you suddenly stop using lacosamide injection, your seizures may happen more often. Your doctor will probably ...

  19. Oxacillin Injection

    MedlinePlus

    ... injection is in a class of medications called penicillins. It works by killing bacteria.Antibiotics such as ... and pharmacist if you are allergic to oxacillin; penicillins; cephalosporin antibiotics such as cefaclor, cefadroxil, cefazolin, cefdinir, ...

  20. Nafcillin Injection

    MedlinePlus

    ... injection is in a class of medications called penicillins. It works by killing bacteria.Antibiotics such as ... and pharmacist if you are allergic to nafcillin; penicillins; cephalosporin antibiotics such as cefaclor, cefadroxil, cefazolin, cefdinir, ...

  1. Ampicillin Injection

    MedlinePlus

    ... injection is in a class of medications called penicillins. It works by killing bacteria.Antibiotics such as ... and pharmacist if you are allergic to ampicillin; penicillins; cephalosporin antibiotics such as cefaclor, cefadroxil, cefazolin (Ancef, ...

  2. Naloxone Injection

    MedlinePlus

    ... emergency medical treatment to reverse the life-threatening effects of a known or suspected opiate (narcotic) overdose. ... is also used after surgery to reverse the effects of opiates given during surgery. Naloxone injection is ...

  3. Omacetaxine Injection

    MedlinePlus

    ... or cannot take these medications due to side effects. Omacetaxine injection is in a class of medications ... a treatment cycle if you experience serious side effects of the medication or if blood tests show ...

  4. Methylnaltrexone Injection

    MedlinePlus

    ... injection is used to treat constipation caused by opioid (narcotic) pain medications in patients with chronic (on-going) pain that is not caused by ... by protecting the bowel from the effects of opioid (narcotic) medications.

  5. Denosumab Injection

    MedlinePlus

    ... menstrual periods), who have an increased risk for fractures (broken bones) or who cannot take or did ... receiving certain treatments that increase their risk for fractures. Denosumab injection (Xgeva) is used to reduce fractures ...

  6. Rasburicase Injection

    MedlinePlus

    ... break down) in people with certain types of cancer who are being treated with chemotherapy medications. Rasburicase injection is in a class of medications called enzymes. It works by breaking down uric acid so that the body can eliminate it.

  7. Gemcitabine Injection

    MedlinePlus

    ... with surgery. Gemcitabine is also used to treat cancer of the pancreas that has spread to other parts of the ... 4 weeks. When gemcitabine is used to treat cancer of pancreas it may be injected once every week. The ...

  8. Doxercalciferol Injection

    MedlinePlus

    Doxercalciferol injection is used to treat secondary hyperparathyroidism (a condition in which the body produces too much parathyroid hormone [PTH; a natural substance needed to control the amount of calcium in ...

  9. Granisetron Injection

    MedlinePlus

    ... that may occur after surgery. Granisetron extended-release (long-acting) injection is used with other medications to prevent nausea and vomiting caused by cancer chemotherapy that may occur immediately ...

  10. Fluconazole Injection

    MedlinePlus

    ... injection is used to treat fungal infections, including yeast infections of the mouth, throat, esophagus (tube leading ... by fungus. Fluconazole is also used to prevent yeast infections in patients who are likely to become ...

  11. Docetaxel Injection

    MedlinePlus

    ... allergic to docetaxel injection or drugs made with polysorbate 80, an ingredient found in some medications. Ask ... if a medication you are allergic to contains polysorbate 80. If you experience any of the following ...

  12. Haloperidol Injection

    MedlinePlus

    ... emotions). Haloperidol injection is also used to control motor tics (uncontrollable need to repeat certain body movements) ... people who have Tourette's disorder (condition characterized by motor or verbal tics). Haloperidol is in a class ...

  13. [Comparison of methods for the quantitative detection of moulds in foods. I. Communication: selective staining procedures for the directmicroscopic mould count (author's transl)].

    PubMed

    Blaser, P

    1978-01-01

    The most important proposed direct microscopic method for the detection of moulds were critically compared in 9 different nonfluid foods, of which 7 were naturally and 2 were artifically moulded.--Neither the Rot fragment test, nor the Howard Mould count or the NaOH treatment method proposed by Mossel (1975) were satisfying with non-fluid foods.--A significant improvement of the direct microscopic detection in the Breed-smear could be achieved by selective product specific staining of the fungi elements.--For low protein foods, a modified Pianese staining, and for low polysaccharide foods the Perjod-Schiff reaction proved to be appropriate and easy to carry out.--The slides of the selectively stained Breed-smears also allow a microscopic examination with high magnifications, so that a differenciation of fungus spores and hyphaes is possible.--Fungus spores, yeast cells and hyphal fragments can be counted by the method of Seck (1976). Hyphal fragments can also be recorded according to the prescription of the Howard Mould Count method.

  14. Injection overview

    SciTech Connect

    Prestwich, S.

    1983-12-01

    The test program was initiated at the Raft River Geothermal Field in southern Idaho in September 1982. A series of eight short-term injection and backflow tests, followed by a long-term injection test, were conducted on one well in the field. Tracers were added during injection and monitored during backflow as well. The principal objective was to determine if tracers could be effectively used as a means to assess reservoir characteristics in a one-well test. The test program resulted in a unique data set which shows promise as a means to improve understanding of the reservoir characteristics. In December 1982, an RFP was issued to obtain an industrial partner to obtain follow-on data on the injection/backflow technique in a second field, and to study any alternate advanced concepts for injection testing which the industrial community might recommend. The East Mesa Geothermal Field was selected for the second test series. Two wells were utilized for testing, and a series of ten tests were conducted in July and August 1983, aimed principally at further evaluation of the injection/backflow technique.

  15. Development of Rapid Pipe Moulding Process for Carbon Fiber Reinforced Thermoplastics by Direct Resistance Heating

    NASA Astrophysics Data System (ADS)

    Tanaka, Kazuto; Harada, Ryuki; Uemura, Toshiki; Katayama, Tsutao; Kuwahara, Hideyuki

    To deal with environmental issues, the gasoline mileage of passenger cars can be improved by reduction of the car weight. The use of car components made of Carbon Fiber Reinforced Plastics (CFRP) is increasing because of its superior mechanical properties and relatively low density. Many vehicle structural parts are pipe-shaped, such as suspension arms, torsion beams, door guard bars and impact beams. A reduction of the car weight is expected by using CFRP for these parts. Especially, when considering the recyclability and ease of production, Carbon Fiber Reinforced Thermoplastics are a prime candidate. On the other hand, the moulding process of CFRTP pipes for mass production has not been well established yet. For this pipe moulding process an induction heating method has been investigated already, however, this method requires a complicated coil system. To reduce the production cost, another system without such complicated equipment is to be developed. In this study, the pipe moulding process of CFRTP using direct resistance heating was developed. This heating method heats up the mould by Joule heating using skin effect of high-frequency current. The direct resistance heating method is desirable from a cost perspective, because this method can heat the mould directly without using any coils. Formerly developed Non-woven Stitched Multi-axial Cloth (NSMC) was used as semi-product material. NSMC is very suitable for the lamination process due to the fact that non-crimp stitched carbon fiber of [0°/+45°/90°/-45°] and polyamide 6 non-woven fabric are stitched to one sheet, resulting in a short production cycle time. The use of the pipe moulding process with the direct resistance heating method in combination with the NSMC, has resulted in the successful moulding of a CFRTP pipe of 300 mm in length, 40 mm in diameter and 2 mm in thickness.

  16. Remediation of mould damaged building materials--efficiency of a broad spectrum of treatments.

    PubMed

    Peitzsch, Mirko; Bloom, Erica; Haase, Rocco; Must, Aime; Larsson, Lennart

    2012-03-01

    We compared the efficiency of some commercially available products and methods used for remediation of mould-contaminated building materials. Samples of gypsum board and pinewood were artificially contaminated with toxin-producing isolates of Stachybotrys chartarum and Aspergillus versicolor, respectively, then, ten different remediation treatments were applied according to the manufacturers' instructions. Microbial and chemical analyses of the infested materials were carried out both immediately before and after treatment, after six weeks of drying at room temperature, and after another six weeks of remoistening. The aim of the study was to determine whether the investigated methods could inhibit the mould growth and destroy some selected mycotoxins produced by the moulds. None of the decontamination methods tested could completely eliminate viable moulds. Some methods, especially boron based chemicals, ammonium based chemicals, and oxidation reduced the contents of mycotoxins produced by S. chartarum (satratoxin G and H, verrucarol), whereas the one which uses an ammonium based chemical reduced the amount of sterigmatocystin produced by A. versicolor with statistical significance. No remediation treatment eliminated all the toxins from the damaged materials. These results emphasize the importance to work preventively with moisture safety throughout the construction processes and management to prevent mould growth on building materials.

  17. [Mould infection causing obstructive bronchitis. Diagnostik and therapeutic approaches (author's transl)].

    PubMed

    Osváth, P; Micskey, E; Dobolyi, C; micskey, E; Fornai, K

    1977-04-01

    The authors compared the results of mycologic examinations of asthmatic and control patient's throat. Fungi other than Candida were cultivated from the throat in 15% of asthmatic children and 3% of controls. In secrets from the lower respiratory tract gained by bronchoscopy, laryngoscopy, or through tracheostomy there were moulds in 34% among the asthmatics and in 15% of the other cases. Allergic respiratory tract diseases facilitate the harbouring of moulds in the respiratory tract but do not influence the presence of Candida albicans. Moulds could often be cultivated even in patient not allergic to them. However there are chronic cases caused by immun reaction to the moulds in the patients' respiratory tract. Microscopic detection of budding and branching, myceliform fungi in the secret produced by coughing supports the diagnosis of mould causing chronic asthmoid bronchitis. New peroral broad spectrum antimycotics facilitate the treatment of such cases. The authors succesfully treated some patients with Clotrimazol (Canesten, Bayer) and all cases responded well to 5-Fluorocytosan (Ancotyl, Roche).

  18. Fungi associated with black mould on baobab trees in southern Africa.

    PubMed

    Cruywagen, Elsie M; Crous, Pedro W; Roux, Jolanda; Slippers, Bernard; Wingfield, Michael J

    2015-07-01

    There have been numerous reports in the scientific and popular literature suggesting that African baobab (Adansonia digitata) trees are dying, with symptoms including a black mould on their bark. The aim of this study was to determine the identity of the fungi causing this black mould and to consider whether they might be affecting the health of trees. The fungi were identified by sequencing directly from mycelium on the infected tissue as well as from cultures on agar. Sequence data for the ITS region of the rDNA resulted in the identification of four fungi including Aureobasidium pullulans, Toxicocladosporium irritans and a new species of Rachicladosporium described here as Rachicladosporium africanum. A single isolate of an unknown Cladosporium sp. was also found. These fungi, referred to here as black mould, are not true sooty mould fungi and they were shown to penetrate below the bark of infected tissue, causing a distinct host reaction. Although infections can lead to dieback of small twigs on severely infected branches, the mould was not found to kill trees.

  19. Pegaptanib Injection

    MedlinePlus

    ... if you have or have ever had diabetes, high blood pressure, a heart attack, or a stroke.tell your doctor if you are pregnant, plan to become pregnant, or are breast-feeding. If you become pregnant while using pegaptanib injection, ...

  20. Ramucirumab Injection

    MedlinePlus

    ... doctor if you have or have ever had high blood pressure, a wound that has not healed, or liver disease.tell your doctor if you are pregnant, plan to become pregnant, or are breastfeeding. Ramucirumab injection may harm your unborn baby. You ...

  1. Reslizumab Injection

    MedlinePlus

    ... the infusion or for a short period of time after the infusion has finished.You will receive each injection of reslizumab in a doctor's office or medical facility. You will stay in the office for some time after you receive the medication so your doctor ...

  2. Dexrazoxane Injection

    MedlinePlus

    ... are used to treat or prevent certain side effects that may be caused by chemotherapy medications. Dexrazoxane ... Dexrazoxane injection may cause side effects. Tell your doctor if any of these symptoms are severe or do not go away: pain or swelling in the place ...

  3. Spatial characteristics of white mould epidemics and the development of sequential sampling plans in Australian bean fields

    Technology Transfer Automated Retrieval System (TEKTRAN)

    White mould, caused by Sclerotinia sclerotiorum, causes losses to bean through reducing the marketable yield of pods by flower infections and stem rot. In Australia, entire fields may be rejected due to high disease incidence. The spatial characteristics of white mould epidemics were characterised...

  4. Mathieu beams as versatile light moulds for 3D micro particle assemblies.

    PubMed

    Alpmann, C; Bowman, R; Woerdemann, M; Padgett, M; Denz, C

    2010-12-06

    We present tailoring of three dimensional light fields which act as light moulds for elaborate particle micro structures of variable shapes. Stereo microscopy is used for visualization of the 3D particle assemblies. The powerful method is demonstrated for the class of propagation invariant beams, where we introduce the use of Mathieu beams as light moulds with non-rotationally-symmetric structure. They offer multifarious field distributions and facilitate the creation of versatile particle structures. This general technique may find its application in micro fluidics, chemistry, biology, and medicine, to create highly efficient mixing tools, for hierarchical supramolecular organization or in 3D tissue engineering.

  5. The fuzzy algorithm in the die casting mould for the application of multi-channel temperature control

    NASA Astrophysics Data System (ADS)

    Sun, Jin-gen; Chen, Yi; Zhang, Jia-nan

    2017-01-01

    Mould manufacturing is one of the most basic elements in the production chain of China. The mould manufacturing technology has become an important symbol to measure the level of a country's manufacturing industry. The die-casting mould multichannel intelligent temperature control method is studied by cooling water circulation, which uses fuzzy control to realize, aiming at solving the shortcomings of slow speed and big energy consumption during the cooling process of current die-casting mould. At present, the traditional PID control method is used to control the temperature, but it is difficult to ensure the control precision. While , the fuzzy algorithm is used to realize precise control of mould temperature in cooling process. The design is simple, fast response, strong anti-interference ability and good robustness. Simulation results show that the control method is completely feasible, which has higher control precision.

  6. Investigating the effects of laser beams (532 and 660 nm) in annihilation of pistachio mould fungus using spectrophotometry analysis

    NASA Astrophysics Data System (ADS)

    Saghafi, S.; Penjweini, R.; Becker, K.; Kratky, K. W.; Dodt, H.-U.

    2010-09-01

    When moulds are illuminated by visible electromagnetic-EM radiations, several effects on nucleus materials and nucleotides can be detected. These effects have a significant influence on mould generation or destruction. This paper presents the effects and implications of a red diode laser beam (660 nm), a second-harmonics of a Nd:YAG laser emitting green beam (532 nm), or the combination of both, on the eradication of Pistachio mould fungus. Incident doses (ID) of both beams are kept identical throughout the experiment. The absorption spectrums of irradiated mouldy samples and the bright-greenish-yellow-fluorescence (BGYF) of fungus occurring in mould texture due to electronic excitation are investigated. We found that a combination of a green and a red laser beam with an ID of 0.5 J/cm2 provides the optimal effects on Pistachio mould fungus eradication.

  7. SU-E-T-04: 3D Printed Patient-Specific Surface Mould Applicators for Brachytherapy Treatment of Superficial Lesions

    SciTech Connect

    Cumming, I; Lasso, A; Rankin, A; Fichtinger, G; Joshi, C P; Falkson, C; Schreiner, L John

    2014-06-01

    Purpose: Evaluate the feasibility of constructing 3D-printed patient-specific surface mould applicators for HDR brachytherapy treatment of superficial lesions. Methods: We propose using computer-aided design software to create 3D printed surface mould applicators for brachytherapy. A mould generation module was developed in the open-source 3D Slicer ( http://www.slicer.org ) medical image analysis platform. The system extracts the skin surface from CT images, and generates smooth catheter paths over the region of interest based on user-defined start and end points at a specified stand-off distance from the skin surface. The catheter paths are radially extended to create catheter channels that are sufficiently wide to ensure smooth insertion of catheters for a safe source travel. An outer mould surface is generated to encompass the channels. The mould is also equipped with fiducial markers to ensure its reproducible placement. A surface mould applicator with eight parallel catheter channels of 4mm diameters was fabricated for the nose region of a head phantom; flexible plastic catheters of 2mm diameter were threaded through these channels maintaining 10mm catheter separations and a 5mm stand-off distance from the skin surface. The apparatus yielded 3mm thickness of mould material between channels and the skin. The mould design was exported as a stereolithography file to a Dimension SST1200es 3D printer and printed using ABS Plus plastic material. Results: The applicator closely matched its design and was found to be sufficiently rigid without deformation during repeated application on the head phantom. Catheters were easily threaded into channels carved along catheter paths. Further tests are required to evaluate feasibility of channel diameters smaller than 4mm. Conclusion: Construction of 3D-printed mould applicators show promise for use in patient specific brachytherapy of superficial lesions. Further evaluation of 3D printing techniques and materials is required

  8. Mold, Mould, Mole-d: The Three M's of Career Development

    ERIC Educational Resources Information Center

    Amundson, Norman E.

    2008-01-01

    The author explores a creative idea development process wherein one begins by applying the image of "breaking the mold" to career development and then extending the process further by considering other related images. In this article, the related images include synonyms for mold such as mould and mole-d (the mole is a small burrowing animal with…

  9. Site-specific risk factors of white mould epidemics in bean (Phaseolus vulgaris) in Tasmania

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In Tasmania, Australia, if more than 5% of bean pods are found to be affected by white mould (caused by Sclerotinia sclerotiorum) entire crops can be rejected by contracting processors. This strict quality standard is one of the main reasons for prophylactic application of fungicides over flowering...

  10. Characterisation and detection of spoilage mould responsible for black spot in dry-cured fermented sausages.

    PubMed

    Lozano-Ojalvo, Daniel; Rodríguez, Alicia; Cordero, Mirian; Bernáldez, Victoria; Reyes-Prieto, Mariana; Córdoba, Juan J

    2015-02-01

    Moulds responsible for black spot spoilage of dry-cured fermented sausages were characterised. For this purpose, samples were taken from those dry-cured fermented sausages which showed black spot alteration. Most of the mould strains were first tentatively identified as Penicillium spp. due to their morphological characteristics in different culture conditions, with one strain as Cladosporium sp. The Cladosporium strain was the only one which provoked blackening in culture media. This strain was further characterised by sequencing of ITS1-5.8S-ITS2 rRNA and β-tubulin genes. This mould strain was able to reproduce black spot formation in dry-cured fermented sausage 'salchichón' throughout the ripening process. In addition, a specific and sensitive real-time PCR method was also developed to detect Cladosporium oxysporum responsible for the black spot formation in sausages. This method could be of great interest for the meat industry to detect samples contaminated with this mould before spoilage of product avoiding economic losses for this sector.

  11. Force controller design and evaluation for robot-assisted die and mould polishing

    NASA Astrophysics Data System (ADS)

    Güvenç, Levent; Srinivasan, Krishnaswamy

    1995-01-01

    A significant portion of the total manufacturing time for a die or a mould, both used extensively in producing complex shaped parts, is spent on surface finishing operations following the primary machining of the die or mould cavity. Hence, there is considerable incentive in pursuing even partial automation of die or mould surface finishing operations. This paper concentrates on the control issues that arise during automation of die and mould surface finishing using industrial robot held tools, with particular attention being devoted to the design and evaluation of force controllers to maintain the desired tool-workpiece interaction. Simplified models of the polishing process including the effect of robot structural compliance are presented first, for analysing and designing controllers. A through-the-arm robot force control implementation using off-the-shelf tooling is discussed next. However, the major focus of this paper is on active end effector force control since there are limitations in the performance of the through-the-arm force control loop. Active end effector force controller design requirements and a simple robust stability test in the face of model uncertainty are given and applied to several design examples. Results of force controller analysis and design are verified by experiments where force regulation during polishing and trajectory tracking are demonstrated.

  12. Transient thermal behavior of multilayer media: Modeling and application to stratified moulds

    NASA Astrophysics Data System (ADS)

    Lazard, M.

    2006-07-01

    Transient and steady-state heat transfer in multilayer media is investigated by the thermal quadrupole method. A semi-analytical solution is proposed for the cases of layers parallel or orthogonal to the main heat-flux direction. The principal application is the study of the effect of the brazing metal used in stratified steel moulds.

  13. The Influence of Mixed Composition and Hole Mould on the Quality of Chicken Feed

    NASA Astrophysics Data System (ADS)

    Rasyid, S.; Susanto, T. A.; Nur, R.

    2017-03-01

    This study aims to determine the effect of feed mixturecomposition and shape of mould hole on the quality pellets using a pellet moulding machine with the roller wheel system. Methods of testing were performed to obtain the composition of the feed mixture that was optimal. The method was following: 250 grams of feed ingredients are added to the adhesive (starch) of 50 grams and then mixed with warm water (± 90°C) in quantities of 50, 100, 150, 200, 250 cc. Furthermore, the feed mixture materials printed on pellet machines with roller wheel system. Parameter testing is 400 rpm engine rev diameter mould hole 5 mm, and the shape of the hole to a second print. The test results on the optimal material composition testing the feed mixture will be used as a parameter to the next test is a variation form of holes. Measuring the quality of feed pellets based heavily shaped pellet intact and non-intact. A ratio of feed ingredients best to produce pellets occurred in the composition of the feed mixture of 250 grams of feed, 50 grams of adhesive, and 250 grams of warm water with percentage shaped feed pellets of 91%. While the best pellet quality resulting from pellet machine roller wheel system occurs in the form of mould 2nd hole with a percentage of 90% pellets.

  14. Mould and yeast flora in fresh berries, grapes and citrus fruits.

    PubMed

    Tournas, V H; Katsoudas, Eugenia

    2005-11-15

    Fresh fruits are prone to fungal contamination in the field, during harvest, transport, marketing, and with the consumer. It is important to identify fungal contaminants in fresh fruits because some moulds can grow and produce mycotoxins on these commodities while certain yeasts and moulds can cause infections or allergies. In this study, 251 fresh fruit samples including several varieties of grapes, strawberries, blueberries, raspberries, blackberries, and various citrus fruits were surface-disinfected, incubated at room temperature for up to 14 days without supplemental media, and subsequently examined for mould and yeast growth. The level of contamination (percent of contaminated items/sample) varied depending on the type of fruit. All raspberry and blackberry samples were contaminated at levels ranging from 33% to 100%, whereas 95% of the blueberry samples supported mould growth at levels between 10% and 100% of the tested berries, and 97% of strawberry samples showed fungal growth on 33-100% of tested berries. The most common moulds isolated from these commodities were Botrytis cinerea, Rhizopus (in strawberries), Alternaria, Penicillium, Cladosporium and Fusarium followed by yeasts, Trichoderma and Aureobasidium. Thirty-five percent of the grape samples tested were contaminated and supported fungal growth; the levels of contamination ranged from 9% to 80%. The most common fungi spoiling grapes were Alternaria, B. cinerea and Cladosporium. Eighty-three percent of the citrus fruit samples showed fungal growth at levels ranging from 25% to 100% of tested fruits. The most common fungi in citrus fruits were Alternaria, Cladosporium, Penicillium, Fusarium and yeasts. Less common were Trichoderma, Geotrichum and Rhizopus.

  15. Evolving Transport Networks With Cellular Automata Models Inspired by Slime Mould.

    PubMed

    Tsompanas, Michail-Antisthenis I; Sirakoulis, Georgios Ch; Adamatzky, Andrew I

    2015-09-01

    Man-made transport networks and their design are closely related to the shortest path problem and considered amongst the most debated problems of computational intelligence. Apart from using conventional or bio-inspired computer algorithms, many researchers tried to solve this kind of problem using biological computing substrates, gas-discharge solvers, prototypes of a mobile droplet, and hot ice computers. In this aspect, another example of biological computer is the plasmodium of acellular slime mould Physarum polycephalum (P. polycephalum), which is a large single cell visible by an unaided eye and has been proven as a reliable living substrate for implementing biological computing devices for computational geometry, graph-theoretical problems, and optimization and imitation of transport networks. Although P. polycephalum is easy to experiment with, computing devices built with the living slime mould are extremely slow; it takes slime mould days to execute a computation. Consequently, mapping key computing mechanisms of the slime mould onto silicon would allow us to produce efficient bio-inspired computing devices to tackle with hard to solve computational intelligence problems like the aforementioned. Toward this direction, a cellular automaton (CA)-based, Physarum-inspired, network designing model is proposed. This novel CA-based model is inspired by the propagating strategy, the formation of tubular networks, and the computing abilities of the plasmodium of P. polycephalum. The results delivered by the CA model demonstrate a good match with several previously published results of experimental laboratory studies on imitation of man-made transport networks with P. polycephalum. Consequently, the proposed CA model can be used as a virtual, easy-to-access, and biomimicking laboratory emulator that will economize large time periods needed for biological experiments while producing networks almost identical to the tubular networks of the real-slime mould.

  16. Surface topography study of prepared 3D printed moulds via 3D printer for silicone elastomer based nasal prosthesis

    NASA Astrophysics Data System (ADS)

    Abdullah, Abdul Manaf; Din, Tengku Noor Daimah Tengku; Mohamad, Dasmawati; Rahim, Tuan Noraihan Azila Tuan; Akil, Hazizan Md; Rajion, Zainul Ahmad

    2016-12-01

    Conventional prosthesis fabrication is highly depends on the hand creativity of laboratory technologist. The development in 3D printing technology offers a great help in fabricating affordable and fast yet esthetically acceptable prostheses. This study was conducted to discover the potential of 3D printed moulds for indirect silicone elastomer based nasal prosthesis fabrication. Moulds were designed using computer aided design (CAD) software (Solidworks, USA) and converted into the standard tessellation language (STL) file. Three moulds with layer thickness of 0.1, 0.2 and 0.3mm were printed utilizing polymer filament based 3D printer (Makerbot Replicator 2X, Makerbot, USA). Another one mould was printed utilizing liquid resin based 3D printer (Objet 30 Scholar, Stratasys, USA) as control. The printed moulds were then used to fabricate maxillofacial silicone specimens (n=10)/mould. Surface profilometer (Surfcom Flex, Accretech, Japan), digital microscope (KH77000, Hirox, USA) and scanning electron microscope (Quanta FEG 450, Fei, USA) were used to measure the surface roughness as well as the topological properties of fabricated silicone. Statistical analysis of One-Way ANOVA was employed to compare the surface roughness of the fabricated silicone elastomer. Result obtained demonstrated significant differences in surface roughness of the fabricated silicone (p<0.01). Further post hoc analysis also revealed significant differences in silicone fabricated using different 3D printed moulds (p<0.01). A 3D printed mould was successfully prepared and characterized. With surface topography that could be enhanced, inexpensive and rapid mould fabrication techniques, polymer filament based 3D printer is potential for indirect silicone elastomer based nasal prosthesis fabrication.

  17. Fibre laser machining for glassy carbon master mould and soft lithography based two-step printing for Ag nanoparticle structures

    NASA Astrophysics Data System (ADS)

    Hu, Qin; Chopra, Pranav

    2011-04-01

    Traditional manufacturing techniques widely used in semiconductor industries involve many processing steps that consume both time and material and lead to high cost. Soft Lithography (SL) offers a new way to print micro/nano structures, which is a fast and low cost alternative to the conventional route, although the high processing temperature of metals, semiconductors and ceramics limits the application SL techniques. In this paper we report the use of Ag nanoparticles as building blocks to make structures by combing the merits of SL, nanotechnology and laser engineering, which provide a simple additive route with low capital investment. Glassy carbon (GC) was chosen as the material for the rigid master mould, as no release coating is needed for replicating the polydimethylsiloxane (PDMS) mould. GC moulds were machined by a nanosecond-pulsed Yb fibre laser. The machined GC moulds were further cleaned by PDMS and the same fibre laser system to remove the process debris. The master mould was further replicated by PDMS. PDMS replicas with either positive or negative features from the master mould were attainable. A two-step strategy was used to print patterns using PDMS mould and Ag nanoparticle paste. Metal patterns were formed on various substrates, and the PDMS mould was left clean and ready for reuse. The resultant printed patterns were found to be uniform over millimetre range, with negligible residual layer, and the thickness of up to several micrometres. The thermal responses of Ag nanoparticles at various sintering temperatures were investigated. The factors affecting the resolution of printed structures were discussed.

  18. Simulation on the Effect of Bottle Wall Thickness Distribution using Blow Moulding Technique

    NASA Astrophysics Data System (ADS)

    Suraya, S.; Azman, M. D.; Fatchurrohman, N.; Jaafar, A. A.; Yusoff, A. R.

    2016-02-01

    The aims of this study are to assess the deformation behavior of a polymeric material during a blow moulding process. Transient computations of two dimensional model of a PP bottle were performed using ANSYS Polyflow computer code to predict the wall thickness distribution at four different parison's diameter; 8mm, 10mm, 18mm, and 20mm. Effects on the final wall thickness diameter and time step are studied. The simulated data shows that the inflation performance degrades with increasing parison diameter. It is concluded that the blow moulding process using 10mm parison successfully meet the product processing requirements. Factors that contribute to the variation in deformation behaviour of the plastic during the manufacturing process are discussed.

  19. Biocontrol of ochratoxigenic moulds (Aspergillus ochraceus and Penicillium nordicum) by Debaryomyces hansenii and Saccharomycopsis fibuligera during speck production.

    PubMed

    Iacumin, Lucilla; Manzano, Marisa; Andyanto, Debbie; Comi, Giuseppe

    2017-04-01

    Speck is a meat product obtained from the deboned leg of pork that is salted, smoked and seasoned for four to six months. During speck seasoning, Eurotium rubrum and Penicillium solitum grow on the surface and collaborate with other moulds and tissue enzymes to produce the typical aroma. Both of these strains usually predominate over other moulds. However, moulds producing ochratoxins, such as Aspergillus ochraceus and Penicillium nordicum, can also co-grow on speck and produce ochratoxin A (OTA). Consequently, speck could represent a potential health risk for consumers. Because A. ochraceus and P. nordicum could represent a problem for artisanal speck production, the aim of this study was to inhibit these mould strains using Debaryomyces hansenii and Saccharomycopsis fibuligera. Six D. hansenii and six S. fibuligera strains were tested in vitro to inhibit A. ochraceus and P. nordicum. The D. hansenii DIAL 1 and S. fibuligera DIAL 3 strains demonstrated the highest inhibitory activity and were selected for in vivo tests. The strains were co-inoculated on fresh meat cuts for speck production with both of the OTA-producing moulds prior to drying and seasoning. At the end of seasoning (six months), OTA was not detected in the speck treated with both yeast strains. Because the yeasts did not adversely affect the speck odour or flavour, the strains are proposed as starters for the inhibition of ochratoxigenic moulds.

  20. Non-dermatophyte mould onychomycosis: a clinical and epidemiological study at a dermatology referral centre in Bogota, Colombia.

    PubMed

    Morales-Cardona, Camilo A; Valbuena-Mesa, Martha C; Alvarado, Zulma; Solorzano-Amador, Andrea

    2014-05-01

    Worldwide prevalence of non-dermatophyte mould onychomycosis has increased in recent years; however, available information on the topic is confusing and oftentimes contradictory, probably due to the small number of reported cases. The aim of this study was to determine and describe the aetiological agents, as well as the epidemiological and clinical characteristics of non-dermatophyte mould onychomycosis in a dermatology referral centre in Bogota, Colombia. A cross-sectional descriptive study was conducted between January 2001 and December 2011 among patients who attend the National Institute of Dermatology with a confirmed diagnosis of onychomycosis by non-dermatophytes moulds. There were 317 confirmed cases of non-dermatophyte mould onychomycosis in 196 women and 121 men whose average age was 43 years. Twenty-seven per cent of them had a history of systemic disease. The habit of walking and showering barefoot was the major infection-related factor. Distal and lateral subungual presentation was the most common pattern of clinical presentation. The most frequent non-dermatophyte mould was Neoscytalidium dimidiatum followed by Fusarium spp. No relationship was observed with predisposing factors previously reported in the literature. Clinical features found in this population are indistinguishable from onychomycosis caused by dermatophytes. High prevalence of N. dimidiatum found here was in contrast to a large number of studies where other types of moulds predominate.

  1. Optimizing Vacuum Assisted Resin Transfer Moulding (VARTM) Processing Parameters to Improve Part Quality

    NASA Astrophysics Data System (ADS)

    Polowick, Christopher

    The Low Cost Composites (LCC) group at Carleton University is studying out-of-autoclave composite manufacturing processes such as Vacuum Assisted Resin Transfer Moulding (VARTM) and Closed Cavity Bag Moulding (CCBM). These processes are used to produce inexpensive and high performance components for the GeoSurv II, an Unmanned Aerial Vehicle (UAV) being developed at Carleton University. This research has focused on optimizing VARTM processing parameters to reduce the weight and improve the strength and surface finish of GeoSurv II composite components. A simulation was developed to model resin flow through in VARTM infusions and was used to simulate mould filling and resin emptying of the GeoSurv II inverted V-empennage and mission avionics hatch. The resin infusion schemes of these parts were designed to ensure full preform resin saturation, and minimize thickness variations. An experimental study of the effects of the presence of a corner on composite thickness, void content, and strength was conducted. It was found that inside corners result in local increases in thickness and void content due to poor preform compaction. A novel bagging technique was developed to improve corner compaction, and this technique was shown to reduce thickness variability and void content. The strength, void content, and thickness variation were found to be heavily dependent on corner radius, with corner radii greater than 6.4 mm displaying the greatest improvement in performance for the layups considered. The design of the empennage and hatch mould incorporated the results of this study to improve the quality of these components.

  2. A new immunoassay to quantify fungal antigens from the indoor mould Aspergillus versicolor.

    PubMed

    Zahradnik, Eva; Kespohl, Sabine; Sander, Ingrid; Schies, Ursula; Khosravie-Hohn, Janett; Lorenz, Wolfgang; Engelhart, Steffen; Kolk, Annette; Schneider, Gerd; Brüning, Thomas; Raulf-Heimsoth, Monika

    2013-06-01

    Aspergillus versicolor is among the most commonly found moulds in moisture-damaged buildings and can be associated with adverse health effects in humans. This paper reports the development, validation and application of an enzyme immunoassay to quantify A. versicolor antigens. A sandwich ELISA was developed using polyclonal antibodies that recognize a broad range of A. versicolor proteins present in fungal spores and in mycelia fragments. To validate the new method, A. versicolor antigens were quantified in samples collected from homes with visible mould growth, including dust from vacuumed walls and bulk samples of building materials. Antigen concentrations were compared to the results of a commercial ELISA based on monoclonal antibodies (AveX ELISA, Indoor Biotechnologies, Charlottesville, USA) and correlated with colony forming units (CFU) of A. versicolor. The A. versicolor ELISA was very sensitive with a lower detection limit of 120 pg ml(-1). The assay also showed some reactivity to other moulds with strongest reactions with other Aspergillus species (1-3% reactivity). The new assay detected A. versicolor antigens in a much higher percentage of dust samples (88% vs. 27%) and bulk samples (89% vs. 24%) than the AveX assay. A significant correlation (r = 0.67, and p < 0.0001) was found between antigen concentrations and CFU of A. versicolor. Based on its low detection limit and good correlation with the culture-based method, this new immunoassay seems to be a useful tool for the measurement of A. versicolor exposure levels and a reliable complement to the traditional monitoring techniques, such as mould cultivation or microscopy.

  3. Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet

    PubMed Central

    Hoskins, Jessica L.; Janion-Scheepers, Charlene; Chown, Steven L.; Duffy, Grant A.

    2015-01-01

    Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the ‘suctorial’ mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods. PMID:26153104

  4. The contribution of moulds and yeasts to the fermentation of 'agbelima' cassava dough.

    PubMed

    Amoa-Awua, W K; Frisvad, J C; Sefa-Dedeh, S; Jakobsen, M

    1997-09-01

    Agbelima, a fermented cassava meal widely consumed in Ghana, Togo and Benin, is produced by fermenting grated cassava with one of several types of traditional cassava dough inoculum. During fermentation a smooth textured sour dough is produced, the toxicity of cassava is reduced and there is a build up of volatile aroma compounds. Four types of inocula were included in the present investigation. In one type moulds were found to form a dominant part of the microbiota, the species present being Penicillium sclerotiorum, P. citrinum, P. nodulum, Geotrichum candidum and a basidiomycete. All these moulds were found to possess cellulase activity which was responsible for the hydrolysis of cassava tuber cellulose during fermentation leading to a breakdown of the coarse texture of cassava dough. The yeasts Candida krusei, C. tropicalis and Zygosaccharomyces spp. were present in high numbers in the four types of inocula including the moudly inoculum. The yeasts C. tropicalis and some strains of Zygosaccharomyces, all of which possessed cellulase activity, were also found to contribute to the modification of cassava texture during fermentation. All yeasts and moulds exhibited linamarase activity and were therefore capable of breaking down the cyanogenic glucosides present in cassava.

  5. Differential Control Efficacies of Vitamin Treatments against Bacterial Wilt and Grey Mould Diseases in Tomato Plants

    PubMed Central

    Hong, Jeum Kyu; Kim, Hyeon Ji; Jung, Heesoo; Yang, Hye Ji; Kim, Do Hoon; Sung, Chang Hyun; Park, Chang-Jin; Chang, Seog Won

    2016-01-01

    Bacterial wilt and grey mould in tomato plants are economically destructive bacterial and fungal diseases caused by Ralstonia solanacearum and Botrytis cinerea, respectively. Various approaches including chemical and biological controls have been attempted to arrest the tomato diseases so far. In this study, in vitro growths of bacterial R. solanacearum and fungal B. cinerea were evaluated using four different vitamins including thiamine (vitamin B1), niacin (vitamin B3), pyridoxine (vitamin B6), and menadione (vitamin K3). In planta efficacies of the four vitamin treatments on tomato protection against both diseases were also demonstrated. All four vitamins showed different in vitro antibacterial activities against R. solanacearum in dose-dependent manners. However, treatment with 2 mM thiamine was only effective in reducing bacterial wilt of detached tomato leaves without phytotoxicity under lower disease pressure (106 colony-forming unit [cfu]/ml). Treatment with the vitamins also differentially reduced in vitro conidial germination and mycelial growth of B. cinerea. The four vitamins slightly reduced the conidial germination, and thiamine, pyridoxine and menadione inhibited the mycelial growth of B. cinerea. Menadione began to drastically suppress the conidial germination and mycelial growth by 5 and 0.5 mM, respectively. Grey mould symptoms on the inoculated tomato leaves were significantly reduced by pyridoxine and menadione pretreatments one day prior to the fungal challenge inoculation. These findings suggest that disease-specific vitamin treatment will be integrated for eco-friendly management of tomato bacterial wilt and grey mould. PMID:27721697

  6. Herbal hepatotoxicity by kava: update on pipermethystine, flavokavain B, and mould hepatotoxins as primarily assumed culprits.

    PubMed

    Teschke, Rolf; Qiu, Samuel X; Lebot, Vincent

    2011-09-01

    Herbal hepatotoxicity by the anxiolytic kava (Piper methysticum Forst. f.) emerged unexpectedly and was observed in a few patients worldwide. Liver injury occurred after the use of traditional aqueous kava extracts in the South Pacific region and of acetonic and ethanolic extracts in Western countries in rare cases, suggesting that the solvents used play no major causative role. In this review, we discuss actual pathogenetic issues of kava hepatotoxicity with special focus on developments regarding pipermethystine, flavokavain B, and mould hepatotoxins as possible culprits. There is abundant data of in vitro cytotoxicity including apoptosis by pipermethystine and flavokavain B added to the incubation media, yet evidence is lacking of in vivo hepatotoxicity in experimental animals under conditions similar to human kava use. Furthermore, in commercial Western kava extracts, pipermethystine was not detectable and flavokavain B was present as a natural compound in amounts much too low to cause experimental liver injury. There is concern, however, that due to high temperature and humidity in the South Pacific area, kava raw material might have been contaminated by mould hepatotoxins such as aflatoxins after harvest and during storage. Whether kava hepatotoxicity may be due to aflatoxicosis or other mould hepatotoxins, requires further studies.

  7. Growth and reproduction of laboratory-reared neanurid Collembola using a novel slime mould diet

    NASA Astrophysics Data System (ADS)

    Hoskins, Jessica L.; Janion-Scheepers, Charlene; Chown, Steven L.; Duffy, Grant A.

    2015-07-01

    Although significant progress has been made using insect taxa as model organisms, non-tracheated terrestrial arthropods, such as Collembola, are underrepresented as model species. This underrepresentation reflects the difficulty in maintaining populations of specialist Collembola species in the laboratory. Until now, no species from the family Neanuridae have been successfully reared. Here we use controlled growth experiments to provide explicit evidence that the species Neanura muscorum can be raised under laboratory conditions when its diet is supplemented with slime mould. Significant gains in growth were observed in Collembola given slime mould rather than a standard diet of algae-covered bark. These benefits are further highlighted by the reproductive success of the experimental group and persistence of laboratory breeding stocks of this species and others in the family. The necessity for slime mould in the diet is attributed to the ‘suctorial’ mouthpart morphology characteristic of the Neanuridae. Maintaining laboratory populations of neanurid Collembola species will facilitate their use as model organisms, paving the way for studies that will broaden the current understanding of the environmental physiology of arthropods.

  8. FE-Analysis of Stretch-Blow Moulded Bottles Using an Integrative Process Simulation

    NASA Astrophysics Data System (ADS)

    Hopmann, C.; Michaeli, W.; Rasche, S.

    2011-05-01

    The two-stage stretch-blow moulding process has been established for the large scale production of high quality PET containers with excellent mechanical and optical properties. The total production costs of a bottle are significantly caused by the material costs. Due to this dominant share of the bottle material, the PET industry is interested in reducing the total production costs by an optimised material efficiency. However, a reduced material inventory means decreasing wall thicknesses and therewith a reduction of the bottle properties (e.g. mechanical properties, barrier properties). Therefore, there is often a trade-off between a minimal bottle weight and adequate properties of the bottle. In order to achieve the objectives Computer Aided Engineering (CAE) techniques can assist the designer of new stretch-blow moulded containers. Hence, tools such as the process simulation and the structural analysis have become important in the blow moulding sector. The Institute of Plastics Processing (IKV) at RWTH Aachen University, Germany, has developed an integrative three-dimensional process simulation which models the complete path of a preform through a stretch-blow moulding machine. At first, the reheating of the preform is calculated by a thermal simulation. Afterwards, the inflation of the preform to a bottle is calculated by finite element analysis (FEA). The results of this step are e.g. the local wall thickness distribution and the local biaxial stretch ratios. Not only the material distribution but also the material properties that result from the deformation history of the polymer have significant influence on the bottle properties. Therefore, a correlation between the material properties and stretch ratios is considered in an integrative simulation approach developed at IKV. The results of the process simulation (wall thickness, stretch ratios) are transferred to a further simulation program and mapped on the bottles FE mesh. This approach allows a local

  9. Inhibition of ochratoxigenic moulds by Debaryomyces hansenii strains for biopreservation of dry-cured meat products.

    PubMed

    Andrade, Maria J; Thorsen, Line; Rodríguez, Alicia; Córdoba, Juan J; Jespersen, Lene

    2014-01-17

    The ability of the osmotolerant yeast Debaryomyces hansenii to inhibit Penicillium nordicum, the most common ochratoxigenic mould encountered in dry-cured meat products, was evaluated. The antagonistic effect of ten D. hansenii strains isolated from dry-cured ham was screened in vitro using malt extract media and meat extract peptone media with the water activity (a(w)) adjusted to 0.97 and 0.90. A significant inhibition of the two tested P. nordicum strains by D. hansenii cells and cell-free supernatants was observed. At 0.97 a(w), increasing D. hansenii inoculum concentrations significantly improved the inhibition of mould growth on solid medium, whereas at 0.90 a(w) this was not always the case. As observed by bright field microscopy, most D. hansenii strains were able to delay P. nordicum spore germination when co-cultured in malt extract broth. D. hansenii FHSCC 253H showed the highest overall in vitro inhibition of ochratoxigenic mould growth, and was therefore chosen for co-cultivation assays in dry-cured ham slices incubated at 0.94 and 0.84 a(w) simulating ham ripening. Regardless of the experimental conditions tested, lower levels of the inoculated P. nordicum strain were detected in co-cultivation batches compared with batches without D. hansenii. The highest level of mould growth inhibition was observed in batches at 0.94 a(w). Ochratoxin A (OTA) production in ham samples was detected by HPLC-MS. Co-culturing of P. nordicum with D. hansenii FHSCC 253H resulted in lower OTA levels compared with control samples without D. hansenii. The decrease of the mycotoxin presence due to D. hansenii FHSCC 253H was more efficient at 0.94 a(w) (OTA was below the detection limit). In conclusion, D. hansenii is potentially suitable as a biopreservative agent for preventing ochratoxigenic mould growth and OTA accumulation in dry-cured meat products. The inoculation of D. hansenii should be made at the beginning of processing (at the end of post salting) when the a(w) of

  10. Epidural Injections for Spinal Pain

    MedlinePlus

    ... Physician Resources Professions Site Index A-Z Epidural Injections An epidural injection provides temporary or prolonged relief ... limitations of Epidural Injection? What is an Epidural Injection? An epidural injection is an injection of medication ...

  11. Allergen-specific IgE levels against crude mould and storage mite extracts and recombinant mould allergens in sera from horses affected with chronic bronchitis.

    PubMed

    Eder, C; Crameri, R; Mayer, C; Eicher, R; Straub, R; Gerber, H; Lazary, S; Marti, E

    2000-03-15

    Immunoglobulin E antibody (IgE) levels against four recombinant (r) mould allergens (r-Aspergillus fumigatus [rAsp f] 7, 8 and 9; r-Alternaria alternata 1 [rAlta1]) and crude mould (Aspergillus fumigatus, Alternaria alternata, Penicillium notatum) and storage mite extracts were determined by ELISA in sera from 24 pulmonary sound control horses and 26 horses suffering from chronic bronchitis/bronchiolitis (CB), also called chronic obstructive pulmonary disease (COPD). Serum IgG and IgA titres were also determined against Aspergillus fumigatus extract and rAsp f 8.IgE against the crude extracts could be measured in all sera, but there was no significant difference between CB-affected and control horses. In contrast, only 8-30% of the horses, depending on the r-allergen tested, had detectable IgE levels in serum against the r-allergens. Horses with CB had significantly more often detectable IgE levels than controls against rAlt a 1 (10/26 and 3/24, respectively, p=0. 054), rAsp f 7 (13/26 and 2/24, respectively, p<0.01) and rAsp f 8 (11/26 and 1/24, respectively, p<0.01). Only four horses (three CB-affected and one healthy, p0.05) had detectable IgE levels against rAsp f 9. Furthermore, CB-affected horses were often sensitised against two or more r-allergens (13/26 of the CB-affected horses) while only one of the 24 healthy horses had positive IgE levels against more than one r-allergens. Similarly to IgE levels, no significant differences between CB-affected and healthy horses were found for IgG titres against the Aspergillus fumigatus extract. However, horses with CB had significantly higher serum IgG titres against rAsp f 8 than healthy controls (median=28 versus 10 relative ELISA units [REU], p<0.01). Additionally, horses with detectable IgE titres against rAsp f 8 had significantly higher IgG titres against this r-allergen than horses with undetectable IgE titres (median IgG titres=46 and 13 REU, respectively; p<0.01). For serum IgA titres, neither differences

  12. Aspergillus fumigatus and mesophilic moulds in air in the surrounding environment downwind of non-hazardous waste landfill sites.

    PubMed

    Schlosser, Olivier; Robert, Samuel; Debeaupuis, Catherine

    2016-05-01

    Non-hazardous waste landfilling has the potential to release biological agents into the air, notably mould spores. Some species, such as Aspergillus fumigatus, may be a cause of concern for at-risk nearby residents. However, air concentration in the surrounding environment of non-hazardous waste landfill sites is poorly documented. An extensive sampling programme was designed to investigate the relationship between culturable mesophilic moulds and A. fumigatus concentrations in air and distance downwind of non-hazardous waste landfill sites. On-site and off-site repeated measurements were performed at four landfill sites during cold and warm seasons. A high-flow air-sampler device was selected so as to allow peak concentration measurement. Linear mixed-effects models were used to explain variability in the concentrations in air over time and across sites, seasons, instantaneous meteorological conditions and discharged waste tonnage. Concentrations of mesophilic moulds and A. fumigatus at off-site upwind sampling locations were compared with concentrations at each of the downwind sampling locations. At the tipping face location, peak concentration reached 480,000CFUm(-3) for mesophilic moulds and 9300CFUm(-3) for A. fumigatus. Compared with upwind background levels, these concentrations were, on average, approximately 20 and 40 times higher respectively. A steep decline in the concentration of both mesophilic moulds and A. fumigatus was observed between the tipping face location and the downwind property boundary (reduction by 77% and 84% respectively), followed by a low decline leading to a 90% and 94% reduction in concentration at 200m from the property boundary and beyond. With the 200m and 500m downwind sampling point values added together, the 97.5th percentile of concentration was 6013CFUm(-3) and 87CFUm(-3) for mesophilic moulds and A. fumigatus, respectively. Other determining factors were the discharged waste tonnage, the season, instantaneous temperature

  13. Mycotoxin production capability of Penicillium roqueforti in strains isolated from mould-ripened traditional Turkish civil cheese.

    PubMed

    Cakmakci, Songul; Gurses, Mustafa; Hayaloglu, A Adnan; Cetin, Bulent; Sekerci, Pinar; Dagdemir, Elif

    2015-01-01

    Mould-ripened civil is a traditional cheese produced mainly in eastern Turkey. The cheese is produced with a mixture of civil and whey curd cheeses (lor). This mixture is pressed into goat skins or plastic bags and is ripened for more than three months. Naturally occurring moulds grow on the surface and inside of the cheese during ripening. In this research, 140 Penicillium roqueforti strains were isolated from 41 samples of mould-ripened civil cheese collected from Erzurum and around towns in eastern Turkey. All strains were capable of mycotoxin production and were analysed using an HPLC method. It was established that all the strains (albeit at very low levels) produced roquefortine C, penicillic acid, mycophenolic acid and patulin. The amounts of toxins were in the ranges 0.4-47.0, 0.2-43.6, 0.1-23.1 and 0.1-2.3 mg kg(-1), respectively. Patulin levels of the samples were lower than the others. The lowest level and highest total mycotoxin levels were determined as 1.2 and 70.1 mg kg(-1) respectively. The results of this preliminary study may help in the choice of secondary cultures for mould-ripened civil cheese and other mould-ripened cheeses.

  14. Recognition of Mould Colony on Unhulled Paddy Based on Computer Vision using Conventional Machine-learning and Deep Learning Techniques.

    PubMed

    Sun, Ke; Wang, Zhengjie; Tu, Kang; Wang, Shaojin; Pan, Leiqing

    2016-11-29

    To investigate the potential of conventional and deep learning techniques to recognize the species and distribution of mould in unhulled paddy, samples were inoculated and cultivated with five species of mould, and sample images were captured. The mould recognition methods were built using support vector machine (SVM), back-propagation neural network (BPNN), convolutional neural network (CNN), and deep belief network (DBN) models. An accuracy rate of 100% was achieved by using the DBN model to identify the mould species in the sample images based on selected colour-histogram parameters, followed by the SVM and BPNN models. A pitch segmentation recognition method combined with different classification models was developed to recognize the mould colony areas in the image. The accuracy rates of the SVM and CNN models for pitch classification were approximately 90% and were higher than those of the BPNN and DBN models. The CNN and DBN models showed quicker calculation speeds for recognizing all of the pitches segmented from a single sample image. Finally, an efficient uniform CNN pitch classification model for all five types of sample images was built. This work compares multiple classification models and provides feasible recognition methods for mouldy unhulled paddy recognition.

  15. Deep reactive ion etching of silicon moulds for the fabrication of diamond x-ray focusing lenses

    NASA Astrophysics Data System (ADS)

    Malik, A. M.; Fox, O. J. L.; Alianelli, L.; Korsunsky, A. M.; Stevens, R.; Loader, I. M.; Wilson, M. C.; Pape, I.; Sawhney, K. J. S.; May, P. W.

    2013-12-01

    Diamond is a highly desirable material for use in x-ray optics and instrumentation. However, due to its extreme hardness and resistance to chemical attack, diamond is difficult to form into a structure suitable for x-ray lenses. Refractive lenses are capable of delivering x-ray beams with nanoscale resolution. A moulding technique for the fabrication of diamond lenses is reported. High-quality silicon moulds were made using photolithography and deep reactive ion etching. The study of the etch process conducted to achieve silicon moulds with vertical sidewalls and minimal surface roughness is discussed. Issues experienced when attempting to deposit diamond into a high-aspect-ratio mould by chemical vapour deposition are highlighted. Two generations of lenses have been successfully fabricated using this transfer-moulding approach with significant improvement in the quality and performance of the optics observed in the second iteration. Testing of the diamond x-ray optics on the Diamond Light Source Ltd synchrotron B16 beamline has yielded a line focus of sub-micrometre width.

  16. Recognition of Mould Colony on Unhulled Paddy Based on Computer Vision using Conventional Machine-learning and Deep Learning Techniques

    NASA Astrophysics Data System (ADS)

    Sun, Ke; Wang, Zhengjie; Tu, Kang; Wang, Shaojin; Pan, Leiqing

    2016-11-01

    To investigate the potential of conventional and deep learning techniques to recognize the species and distribution of mould in unhulled paddy, samples were inoculated and cultivated with five species of mould, and sample images were captured. The mould recognition methods were built using support vector machine (SVM), back-propagation neural network (BPNN), convolutional neural network (CNN), and deep belief network (DBN) models. An accuracy rate of 100% was achieved by using the DBN model to identify the mould species in the sample images based on selected colour-histogram parameters, followed by the SVM and BPNN models. A pitch segmentation recognition method combined with different classification models was developed to recognize the mould colony areas in the image. The accuracy rates of the SVM and CNN models for pitch classification were approximately 90% and were higher than those of the BPNN and DBN models. The CNN and DBN models showed quicker calculation speeds for recognizing all of the pitches segmented from a single sample image. Finally, an efficient uniform CNN pitch classification model for all five types of sample images was built. This work compares multiple classification models and provides feasible recognition methods for mouldy unhulled paddy recognition.

  17. Recognition of Mould Colony on Unhulled Paddy Based on Computer Vision using Conventional Machine-learning and Deep Learning Techniques

    PubMed Central

    Sun, Ke; Wang, Zhengjie; Tu, Kang; Wang, Shaojin; Pan, Leiqing

    2016-01-01

    To investigate the potential of conventional and deep learning techniques to recognize the species and distribution of mould in unhulled paddy, samples were inoculated and cultivated with five species of mould, and sample images were captured. The mould recognition methods were built using support vector machine (SVM), back-propagation neural network (BPNN), convolutional neural network (CNN), and deep belief network (DBN) models. An accuracy rate of 100% was achieved by using the DBN model to identify the mould species in the sample images based on selected colour-histogram parameters, followed by the SVM and BPNN models. A pitch segmentation recognition method combined with different classification models was developed to recognize the mould colony areas in the image. The accuracy rates of the SVM and CNN models for pitch classification were approximately 90% and were higher than those of the BPNN and DBN models. The CNN and DBN models showed quicker calculation speeds for recognizing all of the pitches segmented from a single sample image. Finally, an efficient uniform CNN pitch classification model for all five types of sample images was built. This work compares multiple classification models and provides feasible recognition methods for mouldy unhulled paddy recognition. PMID:27897236

  18. Skin-prick test findings in students from moisture- and mould-damaged schools: a 3-year follow-up study.

    PubMed

    Immonen, J; Meklin, T; Taskinen, T; Nevalainen, A; Korppi, M

    2001-04-01

    Dampness and moisture problems in a building may cause growth of moulds, leading to sensitization and symptoms in the inhabitants. The mechanism by which sensitization to moulds takes place has remained obscure; in particular, the role of atopy is not clear. In 1996, 622 pupils (7-13 years of age) attending a school with a moisture problem (index school; 414 pupils) and a control school (208 pupils) were screened using a questionnaire. Two-hundred and twelve children had doctor-diagnosed asthma, parental-reported wheezing or prolonged cough, and they participated in a clinical study, which included skin prick tests (SPT) to 12 moulds. An identical, follow-up study was performed 3 years later in 1999. In the follow-up study, 144 of the original 212 students participated. They were now attending four different schools: the index primary school had been renovated and the control school remained unchanged, but the two secondary schools had moisture and mould problems. The purpose of the study was to evaluate the occurrence of mould allergy in children of school age and to compare sensitization to moulds in relation to age, exposure, asthma, and atopy. In 1999, SPT responses to moulds were demonstrated in 17 (12%) of the 144 children. Six children had SPT reactions > or = 3 mm and all but one were older than 14 years. During the 3-year follow-up period, mould allergy developed in five children and disappeared in two children. Five of the six children with reactions > or = 3 mm to moulds had positive responses to other allergens, five had clinical atopy but only two had asthma. Likewise, all six children had been exposed to moisture and dampness in the school buildings. In conclusion, mould allergy diagnosed by SPTs was rare in students. Most reactions to moulds were in students older than 14 years with multiple SPT reactions to common allergens, and there was no significant association with asthma.

  19. Exposure to moulds and actinomycetes in Alpine farms: a nested environmental study of the PASTURE cohort.

    PubMed

    Roussel, S; Sudre, B; Reboux, G; Waser, M; Buchele, G; Vacheyrou, M; Dalphin, J C; Millon, L; Braun-Fahrländer, C; von Mutius, E; Piarroux, R

    2011-08-01

    Several studies have suggested that children exposed to a farm environment are protected against allergies and asthma. The present work is an environmental study nested within the PASTURE cohort and includes 97 farmers and 74 non-farmers in three regions of the Alpine Arc (Switzerland, France and Germany). The objectives were to determine and compare the fungi and actinomycetes present in farming and non-farming environments (children's bedrooms and cowsheds), and to identify the agricultural practices associated with an increase in airborne fungi and actinomycetes in cowsheds. Air samples were collected by air pump and were analysed by culture and by direct counting of spores on membranes. During their stay in bedrooms, children living on farms were exposed to significantly greater amounts of Absidia spp., Eurotium spp., Cladosporium spp., Penicillium spp. and mesophilic actinomycetes than children who did not live on farms. Depending on the season, the levels of moulds, yeasts and actinomycetes were from 14 to 82 times higher in cowsheds before feeding the cattle than in children's bedrooms, and from 12 to 464 times higher in cowsheds after feeding than in children's bedrooms. Feeding cattle in cowsheds was associated with a significant peak in airborne moulds and actinomycetes, and this peak was higher in winter than in summer. Silage distribution was associated with low amounts of moulds and actinomycetes. Other significant agricultural factors were the type of cowshed, cowshed volume, method of food distribution to cattle and use of fresh grass. An assessment of the microbiological diversity on farms and in children's rooms may help to determine the factors protecting children from asthma and atopic diseases.

  20. Beam Injection into RHIC

    NASA Astrophysics Data System (ADS)

    Fischer, W.; Hahn, H.; Mackay, W. W.; Tsoupas, N.

    1997-05-01

    During the RHIC sextant test in January 1997 beam was injected into a sixth of one of the rings for the first time. We describe the injection zone and its bottlenecks, the application program to steer the beam and the injection kickers. We report on the commissioning of the injection systems and on measurements of the kickers.

  1. Monitoring of vacuum assisted resin transfer moulding (VARTM) process with superimposed Fiber-Bragg-gratings

    NASA Astrophysics Data System (ADS)

    Triollet, S.; Robert, L.; Marin, E.; Ouerdane, Y.

    2011-05-01

    We report the instrumentation of a manufacturing composite process using an optical fiber sensor based on Bragg gratings. The sensor is made of superimposed Long Period (LPG) and short period (FBG) Bragg gratings written in the same fiber section. The monitoring of the process needs simultaneous measurements of temperature and strain. It has been shown that these two solicitations can be determined and discriminated with a superimposed FBG/LPG sensor [1]. In this paper we present the device based on the dual superimposed gratings. The sensor is embedded in a composite specimen manufactured by Vacuum Assisted Resin Transfer Moulding (VARTM) process for monitoring purpose.

  2. Determination of moulds and mycotoxins in dry dog and cat food using liquid chromatography with mass spectrometry and fluorescence detection.

    PubMed

    Błajet-Kosicka, A; Kosicki, R; Twarużek, M; Grajewski, J

    2014-01-01

    In this study moulds and 12 mycotoxins in dry pet food samples (25 for dogs and 24 for cats) were determined. Primary moulds identified were Aspergillus, Mucor and Penicillium, found in 55% of the samples. Deoxynivalenol and zearalenone (ZEN) were detected in all samples with mean respective concentrations being 97.3 and 38.3 µg kg(-1) in cat food and 114 and 20.1 µg kg(-1) in dog food. T-2 and HT-2 toxins were present in 88% and 84% of the samples, respectively. Two samples contained fumonisins, with a maximum concentration of 108 µg kg(-1). Aflatoxin B1 and ochratoxin A were detected in 8% and 45% of the samples, respectively. The measured mould and mycotoxin levels were consistent with results obtained by other studies. However, potential exposure to relatively high concentrations of an oestrogen mycotoxin as is ZEN, especially when in combination with other mycotoxins, needs attention.

  3. Integration of a macro/micro architectured compartmentalised neuronal culture device using a rapid prototyping moulding process.

    PubMed

    Arundell, Martin; Perry, V Hugh; Newman, Tracey A

    2011-09-07

    The rapid prototyping of a reversible and one step moulded compartmentalised neuron glass/PDMS device with a thin wall barrier directly adjacent to the reservoirs is presented. A simple moulding technique to produce these devices results in a barrier of 560 μm where the 3 μm deep by 8 μm wide channels can be reversibly fabricated in either the glass base or PDMS compartmentalised mould depending on the type of application required. Using glass substrates with commercially laser engraved microchannels, both the PDMS planar and PDMS channelled device can be easily fabricated in a standard laboratory. The compartmentalised device has several advantages including good experimental accessibility and versatility with a variety of end user applications.

  4. Yield improvement for lost mould rapid infiltration forming process by a multistage fractional factorial split plot design.

    PubMed

    Yuangyai, Chumpol; Nembhard, Harriet Black; Hayes, Gregory; Antolino, Nicholas; Adair, James H

    2009-07-01

    Statistical design of experiments is widely used among scientists and engineers to understand influential factors in a laboratory or manufacturing process. One of the underlying principles of using the statistical design of experiments method is randomisation, each run of experimental settings will be determined completely unsystematically. In practice, especially in a complicated process that consists of multiple stages, randomisation may pose too high a burden on time and cost.In this study, the multistage fraction factorial split plot design is proposed for green yield improvement in a lost mould rapid infiltration process that has been developed to fabricate zirconia ceramic parts. This design allows a relaxation of the randomisation principle so that certain experimental runs can be carried out in convenient groups. The results indicate that the type of immersion chemical and mould coating play a role in improving process yield. Additionally, the results suggest that a mould infiltration machine should be used to improve the reproducibility of the process.

  5. Elastomeric inverse moulding and vacuum casting process characterization for the fabrication of arrays of concave refractive microlenses

    NASA Astrophysics Data System (ADS)

    Desmet, L.; Van Overmeire, S.; Van Erps, J.; Ottevaere, H.; Debaes, C.; Thienpont, H.

    2007-01-01

    We present a complete and precise quantitative characterization of the different process steps used in an elastomeric inverse moulding and vacuum casting technique. We use the latter replication technique to fabricate concave replicas from an array of convex thermal reflow microlenses. During the inverse elastomeric moulding we obtain a secondary silicone mould of the original silicone mould in which the master component is embedded. Using vacuum casting, we are then able to cast out of the second mould several optical transparent poly-urethane arrays of concave refractive microlenses. We select ten particular representative microlenses on the original, the silicone moulds and replica sample and quantitatively characterize and statistically compare them during the various fabrication steps. For this purpose, we use several state-of-the-art and ultra-precise characterization tools such as a stereo microscope, a stylus surface profilometer, a non-contact optical profilometer, a Mach-Zehnder interferometer, a Twyman-Green interferometer and an atomic force microscope to compare various microlens parameters such as the lens height, the diameter, the paraxial focal length, the radius of curvature, the Strehl ratio, the peak-to-valley and the root-mean-square wave aberrations and the surface roughness. When appropriate, the microlens parameter under test is measured with several different measuring tools to check for consistency in the measurement data. Although none of the lens samples shows diffraction-limited performance, we prove that the obtained replicated arrays of concave microlenses exhibit sufficiently low surface roughness and sufficiently high lens quality for various imaging applications.

  6. The use of sodium carbonate to improve curing treatments against green and blue moulds on citrus fruits.

    PubMed

    Plaza, Pilar; Usall, Josep; Torres, Rosario; Abadias, Maribel; Smilanick, Joseph L; Viñas, Immaculada

    2004-08-01

    The effectiveness of curing oranges and lemons at 33 degrees C for 65h followed by storage under ambient and cold-storage conditions was investigated. This treatment effectively reduced the incidence of Penicillium digitatum (Pers) Sacc and P italicum Wehmer decay on inoculated and naturally infected oranges and lemons stored at 20 degrees C for 7 days. However, it failed to control green and blue mould infections on fruits placed in long-term cold storage, except green mould on oranges, which was effectively controlled. Dipping fruits in a sodium carbonate solution (20 g litre(-1)) for 2.5 min following a curing treatment at 33 degrees C for 65 h satisfactorily reduced green and blue mould incidence during subsequent long-term storage at 4 degrees C on oranges and at 10 degrees C on lemons. The efficacy was greater on injured fruits inoculated after the combination of treatments was applied, achieving a 60-80% reduction in decay in comparison with the curing treatment alone in all cases. A significant reduction of blue mould was also observed on fruits inoculated both before the treatments and on those re-inoculated after the treatments, demonstrating both protectant and eradicant activity. Thus, combining curing at 33 degrees C for 65 h with sodium carbonate treatment effectively controlled these post-harvest diseases on artificially inoculated citrus fruits and protected against re-infection. With naturally inoculated lemons, curing followed by sodium carbonate significantly reduced both green and blue mould incidence, but was not superior to curing alone. With naturally infected oranges, curing significantly reduced blue mould, but decay was not reduced further when followed by sodium carbonate treatment.

  7. Numerical simulation of casting processes: coupled mould filling and solidification using VOF and enthalpy-porosity method

    NASA Astrophysics Data System (ADS)

    Richter, Ole; Turnow, Johann; Kornev, Nikolai; Hassel, Egon

    2016-12-01

    Within the scope of industrial casting applications a numerical model for the simultaneous mould filling and solidification process has been formulated, implemented in a finite volume code and successfully validated using analytical and experimental data. In order to account for the developing of free surface flow and the liquid/solid phase change, respectively, the volume-of-fluid and enthalpy-porosity method have been coupled under a volume averaging framework on a fixed Eulerian grid. The coupled method captures the basic physical effects of a combined mould filling and solidification process and provides a trustful method for comprehensive casting simulations.

  8. A three-dimensional hybrid finite element-volume tracking model for mould filling in casting processes

    NASA Astrophysics Data System (ADS)

    Gao, D. M.

    1999-04-01

    Metal casting is a complicated process in which flow momentum plays a crucial role in the mould filling process due to the high velocity of the liquid metal. Inertia and gravity effects may cause splashing, jetting or undesirable filling of the metal flow into the mould cavity. When considering complex parts, the accurate prediction of mould filling behaviour using empirical knowledge and intuition is nearly impossible. Therefore, numerical modelling and simulation are essential to predict such a complex physical problem and assist in part with mould design. A mould filling analysis can help the mould designer to determine the size and location of the gate as well as a proper runner system design for ensuring a complete and balanced filling of the part. Such an analysis can also be used to predict potential product defects, such as air entrapment, porosities, and help in correct positioning of overflows and venting systems. A three-dimensional finite element model combined with a volume tracking method has been developed in this work to simulate the cavity filling for casting processes. A mixed formulation based on a four node tetrahedral element with a bubble function at the centroid (P1+/P1) is employed to solve the flow equations. Such a finite element provides a small dimension of the element matrices and satisfies the Brezzi-Babuska condition to ensure a stable solution of the Navier-Stokes equations. A slip boundary condition combined with a friction model is implemented to better simulate the metal flow near the mould walls. An algebraic model is used to account for the turbulence effects during the mould filling. The flow fronts are tracked by a volume tracking method developed for the tetrahedral elements. This method can handle complicated flow front shapes and complex situations like merging and separation of flow fronts. The combination of a volume tracking technique with a FEM flow solver in three-dimensional unstructured meshes constitutes the major

  9. Global transcriptome changes in perennial ryegrass during early infection by pink snow mould

    PubMed Central

    Kovi, Mallikarjuna Rao; Abdelhalim, Mohamed; Kunapareddy, Anil; Ergon, Åshild; Tronsmo, Anne Marte; Brurberg, May Bente; Hofgaard, Ingerd Skow; Asp, Torben; Rognli, Odd Arne

    2016-01-01

    Lack of resistance to pink snow mould (Microdochium nivale) is a major constraint for adaptation of perennial ryegrass (Lolium perenne L.) to continental regions with long-lasting snow cover at higher latitudes. Almost all investigations of genetic variation in resistance have been performed using cold acclimated plants. However, there may be variation in resistance mechanisms that are functioning independently of cold acclimation. In this study our aim was to identify candidate genes involved in such resistance mechanisms. We first characterized variation in resistance to M. nivale among non-acclimated genotypes from the Norwegian cultivar ‘Fagerlin’ based on relative regrowth and fungal quantification by real-time qPCR. One resistant and one susceptible genotype were selected for transcriptome analysis using paired-end sequencing by Illumina Hiseq 2000. Transcriptome profiles, GO enrichment and KEGG pathway analysis indicate that defense response related genes are differentially expressed between the resistant and the susceptible genotype. A significant up-regulation of defense related genes, as well as genes involved in cell wall cellulose metabolic processes and aryl-alcohol dehydrogenase (NADP+) activity, was observed in the resistant genotype. The candidate genes identified in this study might be potential molecular marker resources for breeding perennial ryegrass cultivars with improved resistance to pink snow mould. PMID:27346054

  10. Comparison of the toxicity of reference mycotoxins and spore extracts of common indoor moulds.

    PubMed

    Schulz, Torsten; Senkpiel, Klaus; Ohgke, Helge

    2004-07-01

    There is an unclear endangering potential by toxic influences of inhaled conidiospores and therefore the conidia of indoor mould species were cultured and toxicologically examined after their mechanical disintegration. For this purpose high-performance liquid chromatography (HPLC) and three colorimetric bioassays, the PTGT (pollen tube growth test), the MB (methylene blue) and the MTT (methylthiazoltetrazolium) assay were applied. The sensitivity of the biological methods was evaluated by using 12 reference mycotoxins and 3 structural cell wall components. Only in one extract of disintegrated spores (Aspergillus fumigatus) a mycotoxin (0.22 microg gliotoxin/6.2 x 10(8) spores) was determined. All nine spore extracts, however, turned out to be cytotoxic and in this case the MTT assay was remarkably more sensitive than the two other test methods. The IC50 values of six different spore extracts determined by the MTT assay were lower than 10(6) spores/well (well = 0.2 ml) whereas the IC50 values determined by the MB assay and PTGT were higher than 10(6) spores per 0.2 ml for each spore extract. An examination of four spore extracts, which were fractionated depending on their polarity by HPLC, showed that single substances as well as synergistic effects contribute to the toxic properties of the spores. The results of this work indicate a health hazard due to toxic effects after the inhalation of extremely high spore concentrations of indoor moulds. This risk will also exist if the spores do not contain any mycotoxins.

  11. Fabrication of scalable and structured tissue engineering scaffolds using water dissolvable sacrificial 3D printed moulds.

    PubMed

    Mohanty, Soumyaranjan; Larsen, Layla Bashir; Trifol, Jon; Szabo, Peter; Burri, Harsha Vardhan Reddy; Canali, Chiara; Dufva, Marin; Emnéus, Jenny; Wolff, Anders

    2015-10-01

    One of the major challenges in producing large scale engineered tissue is the lack of ability to create large highly perfused scaffolds in which cells can grow at a high cell density and viability. Here, we explore 3D printed polyvinyl alcohol (PVA) as a sacrificial mould in a polymer casting process. The PVA mould network defines the channels and is dissolved after curing the polymer casted around it. The printing parameters determined the PVA filament density in the sacrificial structure and this density resulted in different stiffness of the corresponding elastomer replica. It was possible to achieve 80% porosity corresponding to about 150 cm(2)/cm(3) surface to volume ratio. The process is easily scalable as demonstrated by fabricating a 75 cm(3) scaffold with about 16,000 interconnected channels (about 1m(2) surface area) and with a channel to channel distance of only 78 μm. To our knowledge this is the largest scaffold ever to be produced with such small feature sizes and with so many structured channels. The fabricated scaffolds were applied for in-vitro culturing of hepatocytes over a 12-day culture period. Smaller scaffolds (6×4 mm) were tested for cell culturing and could support homogeneous cell growth throughout the scaffold. Presumably, the diffusion of oxygen and nutrient throughout the channel network is rapid enough to support cell growth. In conclusion, the described process is scalable, compatible with cell culture, rapid, and inexpensive.

  12. Global transcriptome changes in perennial ryegrass during early infection by pink snow mould.

    PubMed

    Kovi, Mallikarjuna Rao; Abdelhalim, Mohamed; Kunapareddy, Anil; Ergon, Åshild; Tronsmo, Anne Marte; Brurberg, May Bente; Hofgaard, Ingerd Skow; Asp, Torben; Rognli, Odd Arne

    2016-06-27

    Lack of resistance to pink snow mould (Microdochium nivale) is a major constraint for adaptation of perennial ryegrass (Lolium perenne L.) to continental regions with long-lasting snow cover at higher latitudes. Almost all investigations of genetic variation in resistance have been performed using cold acclimated plants. However, there may be variation in resistance mechanisms that are functioning independently of cold acclimation. In this study our aim was to identify candidate genes involved in such resistance mechanisms. We first characterized variation in resistance to M. nivale among non-acclimated genotypes from the Norwegian cultivar 'Fagerlin' based on relative regrowth and fungal quantification by real-time qPCR. One resistant and one susceptible genotype were selected for transcriptome analysis using paired-end sequencing by Illumina Hiseq 2000. Transcriptome profiles, GO enrichment and KEGG pathway analysis indicate that defense response related genes are differentially expressed between the resistant and the susceptible genotype. A significant up-regulation of defense related genes, as well as genes involved in cell wall cellulose metabolic processes and aryl-alcohol dehydrogenase (NADP+) activity, was observed in the resistant genotype. The candidate genes identified in this study might be potential molecular marker resources for breeding perennial ryegrass cultivars with improved resistance to pink snow mould.

  13. Speed-accuracy trade-offs during foraging decisions in the acellular slime mould Physarum polycephalum.

    PubMed

    Latty, Tanya; Beekman, Madeleine

    2011-02-22

    Speed-accuracy trade-offs (SATs) are thought to be a fundamental feature of biological information processing, yet most evidence of SATs comes from animals. Here, we examine SATs in the foraging decisions of an acellular, amoeboid organism: the slime mould Physarum polycephalum. Slime moulds were given a simple discrimination task: selecting the highest-quality food item from a set of three options. We investigated the effect of two stressors, light exposure and hunger, on the speed and accuracy of decision-making. We also examined the effect of task difficulty. When given a difficult discrimination task, stressed individuals tend to make faster decisions than non-stressed individuals. This effect was reversed in plasmodia given easy discrimination tasks, where stressed individuals made slower decisions than non-stressed individuals. We found evidence of SATs, such that individuals who made fast decisions were more likely to make costly errors by selecting the worst possible food option. Our results suggest that SATs occur in a wider range of taxa than previously considered.

  14. Compression moulding simulations of SMC using a multiobjective surrogate-based inverse modeling approach

    NASA Astrophysics Data System (ADS)

    Marjavaara, B. D.; Ebermark, S.; Lundström, T. S.

    2009-09-01

    A multiobjective surrogate-based inverse modeling technique to predict the spatial and temporal pressure distribution numerically during the fabrication of sheet moulding compounds (SMCs) is introduced. Specifically, an isotropic temperature-dependent Newtonian viscosity model of a SMC charge is fitted to experimental measurements via numerical simulations in order to mimic the temporal pressure distribution at two spatial locations simultaneously. The simulations are performed by using the commercial computational fluid dynamics (CFD) code ANSYS CFX-10.0, and the multiobjective surrogate-based fitting procedure proposed is carried out with a hybrid formulation of the NSGA-IIa evolutionary algorithm and the response surface methodology in Matlab. The outcome of the analysis shows the ability of the optimization framework to efficiently reduce the total computational load of the problem. Furthermore, the viscosity model assumed seems to be able to re solve the temporal pressure distribution and the advancing flow front accurately, which can not be said of the spatial pressure distribution. Hence, it is recommended to improve the CFD model proposed in order to better capture the true behaviour of the mould flow.

  15. Modeling and optimization of shape change in shell spatial cross-sections under superplastic moulding

    NASA Astrophysics Data System (ADS)

    Chumachenko, E. N.

    2008-08-01

    The necessity to develop and optimize new technological processes of gas moulding of shells under the superplasticity conditions, which ensure large elongation and complexity of the shape of end items, makes the specialists in the field of mathematical simulation to pose and solve problems of constant improvement of the imitation models. Because of a large number of "embedded" nonlinearities (the physical properties of the material, friction, and unknown boundaries), the solution of such problems requires large computer resources, high qualification of designers, and large amount of labor. In the present paper, we consider the problems of express analysis of pattern change of spatial shells on the basis of estimation of the behavior of their critical cross-sections. We solve problems of moulding of titan shells (made of VT6 alloy) in a matrix of complicated shape. We theoretically and experimentally justify the methods for predicting and constructing the optimal technological processes of shell deformation under conditions close to superplasticity by using the 2.5D designing procedures.

  16. A morphological adaptation approach to path planning inspired by slime mould

    NASA Astrophysics Data System (ADS)

    Jones, Jeff

    2015-04-01

    Path planning is a classic problem in computer science and robotics which has recently been implemented in unconventional computing substrates such as chemical reaction-diffusion computers. These novel computing schemes utilise the parallel spatial propagation of information and often use a two-stage method involving diffusive propagation to discover all paths and a second stage to highlight or visualise the path between two particular points in the arena. The true slime mould Physarum polycephalum is known to construct efficient transport networks between nutrients in its environment. These networks are continuously remodelled as the organism adapts its body plan to changing spatial stimuli. It can be guided towards attractant stimuli (nutrients, warm regions) and it avoids locations containing hazardous stimuli (light irradiation, repellents, or regions occupied by predatory threats). Using a particle model of slime mould we demonstrate scoping experiments which explore how path planning may be performed by morphological adaptation. We initially demonstrate simple path planning by a shrinking blob of virtual plasmodium between two attractant sources within a polygonal arena. We examine the case where multiple paths are required and the subsequent selection of a single path from multiple options. Collision-free paths are implemented via repulsion from the borders of the arena. Finally, obstacle avoidance is implemented by repulsion from obstacles as they are uncovered by the shrinking blob. These examples show proof-of-concept results of path planning by morphological adaptation which complement existing research on path planning in novel computing substrates.

  17. Iron Sucrose Injection

    MedlinePlus

    Iron sucrose injection is used treat iron-deficiency anemia (a lower than normal number of red blood cells due ... and may cause the kidneys to stop working). Iron sucrose injection is in a class of medications called iron ...

  18. Antigen injection (image)

    MedlinePlus

    Leprosy is caused by the organism Mycobacterium leprae . The leprosy test involves injection of an antigen just under ... if your body has a current or recent leprosy infection. The injection site is labeled and examined ...

  19. Corticotropin, Repository Injection

    MedlinePlus

    ... age; episodes of symptoms in people who have multiple sclerosis (MS; a disease in which the nerves do ... When corticotropin repository injection is used to treat multiple sclerosis, it is usually injected once a day for ...

  20. Sodium Ferric Gluconate Injection

    MedlinePlus

    Sodium ferric gluconate injection is used to treat iron-deficiency anemia (a lower than normal number of ... are also receiving the medication epoetin (Epogen, Procrit). Sodium ferric gluconate injection is in a class of ...

  1. Amphotericin B Liposomal Injection

    MedlinePlus

    Amphotericin B liposomal injection is used to treat fungal infections such as cryptococcal meningitis (a fungal infection of the ... infections in people who cannot receive conventional amphotericin B therapy. Amphotericin B liposomal injection is in a ...

  2. Calcitonin Salmon Injection

    MedlinePlus

    Calcitonin salmon injection is used to treat osteoporosis in postmenopausal women. Osteoporosis is a disease that causes bones to weaken and break more easily. Calcitonin salmon injection is also used to ...

  3. Urinary incontinence - injectable implant

    MedlinePlus

    Intrinsic sphincter deficiency repair; ISD repair; Injectable bulking agents for stress urinary incontinence ... Urine leakage that gets worse Pain where the injection was done Allergic reaction to the material Implant ...

  4. Slit injection device

    DOEpatents

    Alger, Terry W.; Schlitt, Leland G.; Bradley, Laird P.

    1976-06-15

    A laser cavity electron beam injection device provided with a single elongated slit window for passing a suitably shaped electron beam and means for varying the current density of the injected electron beam.

  5. Hip joint injection

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/007633.htm Hip joint injection To use the sharing features on this ... injection is a shot of medicine into the hip joint. The medicine helps relieve pain and inflammation. It ...

  6. Aminocaproic Acid Injection

    MedlinePlus

    Aminocaproic acid injection is used to control bleeding that occurs when blood clots are broken down too quickly. This ... the baby is ready to be born). Aminocaproic acid injection is also used to control bleeding in ...

  7. Deoxycholic Acid Injection

    MedlinePlus

    Deoxycholic acid injection is used to improve the appearance and profile of moderate to severe submental fat ('double chin'; fatty tissue located under the chin). Deoxycholic acid injection is in a class of medications called ...

  8. Rich catalytic injection

    DOEpatents

    Veninger, Albert

    2008-12-30

    A gas turbine engine includes a compressor, a rich catalytic injector, a combustor, and a turbine. The rich catalytic injector includes a rich catalytic device, a mixing zone, and an injection assembly. The injection assembly provides an interface between the mixing zone and the combustor. The injection assembly can inject diffusion fuel into the combustor, provides flame aerodynamic stabilization in the combustor, and may include an ignition device.

  9. Beam injection into RHIC

    SciTech Connect

    Fischer, W.; Hahn, H.; MacKay, W.W.; Satogata, T.; Tsoupas, N.; Zhang, W.

    1997-07-01

    During the RHIC sextant test in January 1997 beam was injected into a sixth of one of the rings for the first time. The authors describe the injection zone and its bottlenecks. They report on the commissioning of the injection system, on beam based measurements of the kickers and the application program to steer the beam.

  10. Industrial application of a numerical model to simulate lubrication, mould oscillation, solidification and defect formation during continuous casting

    NASA Astrophysics Data System (ADS)

    Ramirez Lopez, Pavel E.; Sjöström, Ulf; Jonsson, Thomas; Lee, Peter D.; Mills, Kenneth C.; Petäjäjärvi, Marko; Pirinen, Jarno

    2012-07-01

    In recent years, the addition of the slag phase to numerical models of the Continuous Casting (CC) process has opened the door to a whole new range of predictions. These include the estimation of slag infiltration and powder consumption (lubrication), heat transfer and cooling through the cooper mould (solidification) and investigating the effect of operational parameters such as mould oscillation and powder composition on surface quality / defect formation. This work presents 2D and 3D CC models capable of describing the dynamic behaviour of the liquid/solid slag in both the shell mould-gap and bed as well as its effects on heat extraction and shell formation. The present paper also illustrates the application of the model to a variety of casters and the challenges faced during its implementation. The model attained good agreement on the prediction of mould temperatures and shell thicknesses as well as slag film formation and heat flux variations during the casting sequence. The effect of different oscillation strategies (sinusoidal and non-sinusoidal) was explored in order to enhance powder consumption and surface quality. Furthermore, the modelling approach allows one to predict the conditions leading to irregular shell growth and uneven lubrication; these are responsible for defects such as, stickers, cracking and, in the worst case scenario, to breakouts. Possible mechanisms for defect formation are presented together with strategies to enhance process stability and productivity of the CC machine.

  11. Bolted Joints in Three Axially Braided Carbon Fibre/Epoxy Textile Composites with Moulded-in and Drilled Fastener Holes

    NASA Astrophysics Data System (ADS)

    Ataş, Akın; Gautam, Mayank; Soutis, Constantinos; Potluri, Prasad

    2016-10-01

    Experimental behaviour of bolted joints in triaxial braided (0°/±45°) carbon fibre/epoxy composite laminates with drilled and moulded-in fastener holes has been investigated in this paper. Braided laminates were manufactured by vacuum infusion process using 12 K T700S carbon fibres (for bias and axial tows) and Araldite LY-564 epoxy resin. Moulded-in fastener holes were formed using guide pins which were inserted in the braided structure prior to the vacuum infusion process. The damage mechanism of the specimens was investigated using ultrasonic C-Scan technique. The specimens were dimensioned to obtain a bearing mode of failure. The bearing strength of the specimens with moulded-in hole was reduced in comparison to the specimens with drilled hole, due to the increased fibre misalignment angle following the pin insertion procedure. An improvement on the bearing strength of moulded-in hole specimens might be developed if the specimen dimensions would be prepared for a net-tension mode of failure where the fibre misalignment would not have an effect as significant as in the case of bearing failure mode, but this mode should be avoided since it leads to sudden catastrophic failures.

  12. Bolted Joints in Three Axially Braided Carbon Fibre/Epoxy Textile Composites with Moulded-in and Drilled Fastener Holes

    NASA Astrophysics Data System (ADS)

    Ataş, Akın; Gautam, Mayank; Soutis, Constantinos; Potluri, Prasad

    2017-04-01

    Experimental behaviour of bolted joints in triaxial braided (0°/±45°) carbon fibre/epoxy composite laminates with drilled and moulded-in fastener holes has been investigated in this paper. Braided laminates were manufactured by vacuum infusion process using 12 K T700S carbon fibres (for bias and axial tows) and Araldite LY-564 epoxy resin. Moulded-in fastener holes were formed using guide pins which were inserted in the braided structure prior to the vacuum infusion process. The damage mechanism of the specimens was investigated using ultrasonic C-Scan technique. The specimens were dimensioned to obtain a bearing mode of failure. The bearing strength of the specimens with moulded-in hole was reduced in comparison to the specimens with drilled hole, due to the increased fibre misalignment angle following the pin insertion procedure. An improvement on the bearing strength of moulded-in hole specimens might be developed if the specimen dimensions would be prepared for a net-tension mode of failure where the fibre misalignment would not have an effect as significant as in the case of bearing failure mode, but this mode should be avoided since it leads to sudden catastrophic failures.

  13. Epidemiology and outcomes of patients with invasive mould infections: a retrospective observational study from a single centre (2005-2009).

    PubMed

    Klingspor, Lena; Saaedi, Baharak; Ljungman, Per; Szakos, Attila

    2015-08-01

    Invasive mould infection (IMI) is an important cause of morbidity and mortality in immunocompromised patients. However, Swedish epidemiology data are lacking. The aim of this study was to investigate the epidemiology and outcome of IMI. Cases of proven/probable IMI at Karolinska University Hospital, Stockholm, from 2005 to 2009, were included. A total of 100 patients with 104 episodes of IMI were enrolled. Identified isolates included 101 mould isolates. The majority of the isolates were Aspergillus spp. (74.3%), followed by Mucorales spp. (13.9%), Fusarium spp. (4.9%) and other mould spp. (6.9%). In 13% of the episodes, more than one mould caused the IMI. The lung was most often affected (88.5%). The most frequent underlying disease was haematological malignancies (70%). Following diagnosis, 83.7% initially received antifungal monotherapy, 9.6% received combination therapy and 6.7% no treatment. The overall 90-day and 1-year overall survival was 49% and 46% respectively. Survival at 90 days post diagnosis was 71.4% in the solid tumour cohort, 62.5% in patients with solid organ transplants, 43.5% in haematological malignancy (HMs) and 37% in those undergoing allogeneic haematopoietic stem cell transplantation (HSCT). Overall survival was poor in the studied cohort, but is variable among different host categories, with particular opportunities for improvement in patients with underlying HMs and allogeneic HSCT.

  14. Biological control of Botrytis gray mould on tomato cultivated in greenhouse.

    PubMed

    Fiume, F; Fiume, G

    2006-01-01

    Research was carried out to evaluate the effectiveness of the biological control of the Botrytis gray mould, caused by Botrytis cinerea Pers., one of the most important fungal diseases of the tomato (Lycopersicon esculentum Mill.). Biological control was performed by using Trichoderma harzianum Rifai, an antagonist that is a naturally occurring fungus found on some plants and in the soil worldwide. Trichoderma spp. are fungi diffused in nearly all agricultural soils and in other environments such as decaying wood. The object of this research is to find control strategies to reduce chemical treatments that cause damage to the environment and increase the pathogen resistance, applying the biological control by using T. harzianum against B. cinerea. A commercial product containing a natural isolate of T. harzianum is trichodex (Makhteshim Chemical Works, LTD). The research was performed in laboratory and in greenhouse. In laboratory, radial growth reduction of B. cinerea, in presence of T. harzianum, was calculated in relation to the growth of the pathogen control, by using a specific formula that measures the percentage of the inhibition of the radial mycelial growth. In greenhouse, starting from the tomato fruit setting, the research was carried out comparing, by a randomized complete block experiment design, replicated four times, the following treatments:1) untreated control; 2) pyrimethanil (400 g/L of a.i.), at 200 cc/hL of c.i. (pyrimidine fungicides); 3) trichodex at 100g/hL (1 kg/ha); 4) trichodex at 200 g/hL (2 kg/ha); 5) trichodex at 400 g/hL (4 kg/ha). Before fruit setting, the plots were all treated against Botrytis gray mould with iprodione 50% (100 g/hL), procymidone 50% (100 g/hL) and switch (Novartis plant protection) at 80 g/hL. In dual culture, the inhibition of B. cinerea radial mycelial growth was 76%. No inhibition halo was observed between B. cinerea and T. harzianum colonies but, after 3 days, the pathogen colony radius resulted no more than 1

  15. Strategies for safe injections.

    PubMed Central

    Battersby, A.; Feilden, R.; Stoeckel, P.; Da Silva, A.; Nelson, C.; Bass, A.

    1999-01-01

    In 1998, faced with growing international concern, WHO set out an approach for achieving injection safety that encompassed all elements from patients' expectations and doctors' prescribing habits to waste disposal. This article follows that lead and describes the implications of the approach for two injection technologies: sterilizable and disposable. It argues that focusing on any single technology diverts attention from the more fundamental need for health services to develop their own comprehensive strategies for safe injections. National health authorities will only be able to ensure that injections are administered safely if they take an approach that encompasses the whole system, and choose injection technologies that fit their circumstances. PMID:10680247

  16. High diversity of non-sporulating moulds in respiratory specimens of immunocompromised patients: should all the species be reported when diagnosing invasive aspergillosis?

    PubMed

    Garcia-Hermoso, Dea; Alanio, Alexandre; Cabaret, Odile; Olivi, Martine; Foulet, Françoise; Cordonnier, Catherine; Costa, Jean-Marc; Bretagne, Stéphane

    2015-09-01

    Non-sporulating moulds (NSMs) isolated from respiratory specimens are usually discarded without further testing although they may have pathogenic effects in immunocompromised patients. The objective of this study was to determine the identity and frequency of NSMs in patients with haematological malignancies. We analysed the mycological results of 251 consecutive respiratory samples from 104 haematology patients. Yeast and sporulating moulds were identified at the genus/species level according to their phenotypic features. NSMs were identified by internal transcribed spacer (ITS) sequencing. We detected 179 positive samples, of which 10.1% (18/179) were mixtures of moulds and 26.3% (47/179) were mixtures of moulds and yeast. We identified 142 moulds belonging to 11 different genera/species or groups, with Aspergillus fumigatus (n = 50), Penicillium spp. (n = 31) and NSM (n = 24) being the most frequently isolated species. Twenty-two NSMs were successfully sequenced: 18 were basidiomycetes and six were ascomycetes, corresponding to 16 different genera/species. NSMs were isolated with A. fumigatus in the same sample or in a subsequent sample in five patients with probable invasive aspergillosis. The conclusion is that the respiratory specimens of immunocompromised patients frequently contain very diverse mould species that may increase the virulence of pathogenic species. Reporting all mould species isolated when diagnosing invasive fungal infection could test this hypothesis.

  17. Inhibitory activity of Indian spice plant Cinnamomum zeylanicum extracts against Alternaria solani and Curvularia lunata, the pathogenic dematiaceous moulds

    PubMed Central

    Mishra, Ajay K; Mishra, Amita; Kehri, HK; Sharma, Bechan; Pandey, Abhay K

    2009-01-01

    Background Dematiaceous moulds are pathogenic microorganisms and act as etiological agents of mycoses with different degrees of severity in humans and animals. These moulds also cause loss of food crops and storage food products. The information regarding antimicrobial efficacy of the plant preparations on these moulds is scanty. The present study reveals phytochemical characterization and the effect of bark and leaf extracts of Indian spice plant, Cinnamomum zeylanicum (Cz), against the growth of two species of dematiaceous moulds, Alternaria solani and Curvularia lunata. Methods Cz bark and leaf samples were sequentially extracted in different solvents using Soxhlet apparatus. Phytochemical analyses of extracts were done as per standard protocols. The antifungal bioassay of extracts was done by hanging drop technique. The inhibition of fungal spore germination was monitored under influence of three different concentrations of extracts. Results The lowest test concentration (50 μg/ml) of extracts of Cz bark prepared into acetone and that of Cz leaf into petroleum ether and ethanol exhibited complete inhibition (100%) of spore germination in both the moulds. At 100 μg/ml concentration all the extracts showed about 50 to 100% inhibition. However, the treatment of the spores of the two fungal species with highest concentration (500 μg/ml) of bark and leaf extracts in all the solvents showed 100% fungicidal activity as it completely arrested the germination of spores. Relatively lower activity of aqueous extracts at 50 and 100 μg/ml concentrations suggests that the antifungal ingredients present in Cz bark and leaf are more soluble in organic solvents than water. Conclusion The results demonstrated that the Cz bark and leaves contain certain fungicidal constituents exhibiting potential antimould activity against A. solani and C. lunata. PMID:19267932

  18. Dosimetric analysis and clinical outcomes in CT-based mould brachytherapy in early oral cancers in patients unfit for surgery

    PubMed Central

    Mourougan, Sinnatamby; Saravannan, Kandasamy; Vivekanandam, Singhavajala; Reddy, K. Sathyanarayana

    2015-01-01

    Purpose Brachytherapy in the oral cavity is an important alternative to conventional treatment, and provides a high localized dose and short overall treatment time. A rapid fall of dose beyond radioactive source makes it possible for increased tumour control and sparing surrounding tissue, while short overall treatment duration reduces risk of tumour repopulation. Moulds are fabricated to hold the catheters in position as closely as possible to tumour surface to provide adequate dose coverage of tumour volume and increase distance to other normal surrounding structures. Image based planning and dose optimisation help in better defining target volume and dose coverage. Material and methods A retrospective analysis of patients of early squamous cell carcinomas of lip and buccal mucosa from September 2011 to June 2014 to study response to mould brachytherapy. Double plane moulds were prepared for all lip cancer cases and single plane for buccal mucosa cases. Patients are being followed up till disease recurrence. In this study evaluation was done of the technique used, planning details, response to therapy, and reactions encountered. Results Nine patients treated by mould therapy were reviewed; seven cases were of lip and two of buccal mucosal cancers. Dose delivered ranged from 12.5-48 Gy in fraction sizes of 2.5-3.5 Gy. Equivalent dose in 2 Gy fractions (EQD2) ranged from 18-64 Gy. Maximum dose to organs at risk (OAR) was 91% of prescribed dose. Local mucositis was only reaction in all cases, which resolved in 3-6 weeks. Median follow-up was 19 months. Eight out of nine patients are in remission at a minimum of 7 months (1 case, rest over 14 months) post therapy and only patient had nodal recurrence at 18 months. Conclusions Mould therapy is an effective treatment method for selected early and superficial squamous cell carcinomas of the oral cavity, although indications are limited. PMID:26034496

  19. Application of waste bulk moulded composite (BMC) as a filler for isotactic polypropylene composites.

    PubMed

    Barczewski, Mateusz; Matykiewicz, Danuta; Andrzejewski, Jacek; Skórczewska, Katarzyna

    2016-05-01

    The aim of this study was to produce isotactic polypropylene based composites filled with waste thermosetting bulk moulded composite (BMC). The influence of BMC waste addition (5, 10, 20 wt%) on composites structure and properties was investigated. Moreover, additional studies of chemical treatment of the filler were prepared. Modification of BMC waste by calcium stearate (CaSt) powder allows to assess the possibility of the production of composites with better dispersion of the filler and more uniform properties. The mechanical, processing, and thermal properties, as well as structural investigations were examined by means of static tensile test, Dynstat impact strength test, differential scanning calorimetry (DSC), wide angle X-ray scattering (WAXS), melt flow index (MFI) and scanning electron microscopy (SEM). Developed composites with different amounts of non-reactive filler exhibited satisfactory thermal and mechanical properties. Moreover, application of the low cost modifier (CaSt) allows to obtain composites with better dispersion of the filler and improved processability.

  20. French vineyards provide information that opens ways for effective resistance management of Botrytis cinerea (grey mould).

    PubMed

    Walker, Anne-Sophie; Micoud, Annie; Rémuson, Florent; Grosman, Jacques; Gredt, Michel; Leroux, Pierre

    2013-06-01

    Resistance to fungicides is an evolutionary process resulting from the selection of advantageous genotypes in naturally diverse populations. Seven fungicide modes of action are authorised to control grey mould caused by Botrytis cinerea on grapevine in France, and five of them have encountered specific resistance, with variable frequencies in populations and possible consequences for field fungicide efficacy. Moreover, multidrug resistance is caused by fungicide efflux and allows a weak resistance towards six unrelated modes of action. Here, a review is given of the fungicide resistance status of B. cinerea in France, particularly in the vineyards of Champagne, which are the most affected. Recently developed resistance and recent findings concerning the associated resistance mechanisms are focused upon in particular. Finally, antiresistance strategies are presented, and examples of managed resistance are discussed in a more general manner with the aim of extending this knowledge to other crops and countries undergoing similar resistance problems.

  1. Effection of grinding system rigidity ultra-precision grinding of aspheric mould and error compensation

    NASA Astrophysics Data System (ADS)

    Yin, S. H.; Gong, S.

    2016-10-01

    In ultra-precision oblique axis grinding process for machining micro aspherical mould, form error of aspherical surface is caused by the inconsistence elastic deformation of grinding system, which derived from differences velocity from inside to out. In this case, whole PV value can meet requirements, however, pits are produced in central after error compensation, which is unworkable. In this paper, mechanism of machining error caused by grinding system rigidity is analyzed, and experiments are carried out. Form error compensation grinding are carried out in the central local area, based on traditional error compensation method, which can effectively eliminate the pits of surface center. In this method, cemented carbide YG8 which diameter is about 6mm is ground. The results showed that the form accuracy under PV 200 nm and under PV 50 nm within the scope of 1 mm, and the surface roughness under Ra2nm.

  2. Improved phytase production by a thermophilic mould Sporotrichum thermophile in submerged fermentation due to statistical optimization.

    PubMed

    Singh, Bijender; Satyanarayana, T

    2008-03-01

    Culture variables affecting phytase production by a thermophilic mould Sporotrichum thermophile in submerged fermentation were optimized. Soluble starch, peptone, Tween-80 and sodium phytate were identified by Plackett-Burman design as the most significant factors to affect phytase production. The 2(4) full factorial central composite design of response surface methodology was applied for optimizing the concentrations of the significant variables and to delineate their interactions. Starch, Tween-80, peptone and sodium phytate at 0.4%, 1.0%, 0.3% and 0.3% supported maximum enzyme titres, respectively. An overall 3.73-fold improvement in phytase production was achieved due to optimization. When sodium phytate was substituted with wheat bran (3%), the phytase titre in the former was comparable with that in the latter.

  3. Study of mould design and forming process on advanced polymer-matrix composite complex structure

    NASA Astrophysics Data System (ADS)

    Li, S. J.; Zhan, L. H.; Bai, H. M.; Chen, X. P.; Zhou, Y. Q.

    2015-07-01

    Advanced carbon fibre-reinforced polymer-matrix composites are widely applied to aviation manufacturing field due to their outstanding performance. In this paper, the mould design and forming process of the complex composite structure were discussed in detail using the hat stiffened structure as an example. The key issues of the moulddesign were analyzed, and the corresponding solutions were also presented. The crucial control points of the forming process such as the determination of materials and stacking sequence, the temperature and pressure route of the co-curing process were introduced. In order to guarantee the forming quality of the composite hat stiffened structure, a mathematical model about the aperture of rubber mandrel was introduced. The study presented in this paper may provide some actual references for the design and manufacture of the important complex composite structures.

  4. Process Capability Analysis of Vacuum Moulding for Development of Al-Al2O3 MMC

    NASA Astrophysics Data System (ADS)

    Singh, R.

    2013-01-01

    The purpose of the present study is to investigate process capability of vacuum moulding (VM) for development of Al-Al2O3 metal matrix composite (MMC). Starting from the identification of component, prototypes were prepared (with three different input parameters namely: vacuum pressure; component volume and sand grit size to give output in form of dimensional accuracy). Measurements on the coordinate measuring machine helped in calculating the dimensional tolerances of the Al-Al2O3 MMC prepared. Some important mechanical properties were also compared to verify the suitability of the components. Final components produced are acceptable as per ISO standard UNI EN 20286-I (1995). The results of study suggest that VM process lies in ±4.5 sigma (σ) limit as regard to dimensional accuracy of Al-Al2O3 MMC is concerned. This process ensures rapid production of pre-series technological prototypes and proof of concept at less production cost and time.

  5. Modelling the effect of ethanol on growth rate of food spoilage moulds.

    PubMed

    Dantigny, Philippe; Guilmart, Audrey; Radoi, Florentina; Bensoussan, Maurice; Zwietering, Marcel

    2005-02-15

    The effect of ethanol (E) on the radial growth rate (mu) of food spoilage moulds (Aspergillus candidus, Aspergillus flavus, Aspergillus niger, Cladosporium cladosporioides, Eurotium herbariorum, Mucor circinelloides, Mucor racemosus, Paecilomyces variotii, Penicillium chrysogenum, Penicillium digitatum, Rhizopus oryzae and Trichoderma harzianum) was assessed in Potato Dextrose Agar (PDA) medium at a(w) 0.99, 25 degrees C. In order to model this effect, the Monod type equation described previously by Houtsma et al. (Houtsma, P.C., Kusters, B.J.M., de Wit, J.C., Rombouts, F.M., Zwietering, M.H., 1994. Modelling growth rates of Listeria monocytogenes as a function of lactate concentration. Int. J. Food. Microbiol. 24, 113-123.) was re-parameterised: mu = mu(opt)[K(E(max)-E)/K E(max)-2KE+E(max)E]; E(max) (%, wt/wt): ethanol concentration at which no growth occurs, K (%, wt/wt): ethanol concentration at which mu = mu(opt)/2, mu(opt) (mm day(-1)): growth rate at 0% ethanol. The model was capable of describing curves, mu vs. E, with either a concave shape (KE(max)/2) with a good accuracy (root mean square error (RMSE) < or = 0.136) with the notable exception of R. oryzae and T. harzianum. After growth rate data were square-root transformed to stabilise the variance, E(max) was estimated in the range 3% to 5% for all moulds with the exception of T. harzianum (E(max) 2.14%) and P. variotii (E(max) 6.43%). Ethanol would appear an effective additional barrier to inhibit fungal growth in food products and would represent an interesting alternative to the use of preservatives.

  6. Direct contact membrane inoculation of yeasts and moulds for evaluating preservative efficacy in solid cosmetics.

    PubMed

    Tran, T T; Collier, S W

    1992-08-01

    Synopsis A direct contact membrane inoculation technique for yeasts and moulds was used to evaluate the preservation efficacy and antimicrobial activity of Germall 115 and Germall II in pressed eye shadows. Test organisms on membrane filters were placed in direct contact with cosmetics at room temperature under humid conditions. Growth on membranes was removed daily, or as appropriate, and cultured on potato dextrose agar containing lecithin and Tween 80. Linear regression analysis was used to determine product preservation efficacy. Average D values of 1 and 3 days for Candida albicans American Type Culture Collection (ATCC) 10231 and 17 and 29 days for Aspergillus niger ATCC 16404 were obtained on two eye shadows we prepared (in-house eye shadows) with parabens and either Germall II or Germall 115 as preservatives. A decimal reduction time (D value) of 6-7 days was calculated for the yeast on a commercial eye shadow preserved with parabens and Germall 115. A. niger multiplied on six of seven replicates of this commercial product to attain a nearly 3 log(10) increase in 20 days. On one replicate, A. niger showed a 1 log(10) increase in the first 10 days, and then decreased linearly (r =- 0.95) to <10 colony-forming units per membrane by day 24. The method used with C. albicans and A. niger was then used with bacteria. The method was sensitive enough to differentiate the antimicrobial activity of the Germall 115 and Germall II against fungi but not against bacteria. The in-house and commercial products were preserved most effectively against the three bacteria tested and least effectively against the mould.

  7. Mould filling of Ag-Pd-Cu-Au and Ag-Zn-Sn-In alloy castings made using a rapidly prepared gypsum-bonded investment material.

    PubMed

    Shimizu, Hiroshi; Inoue, Shoko; Miyauchi, Hideaki; Watanabe, Kouichi; Takahashi, Yutaka

    2008-12-01

    Mandibular premolar-shaped wax patterns of full crowns with a marginal angle of 300 were prepared. Two semiprecious alloys were cast using a rapidly prepared gypsum-bonded investment material or a conventional gypsum-bonded investment. A precise impression was taken and cut into four segments. Scanning electron microscopy was used to evaluate the mould filling of each segment. The mould filling of the silver-palladium-copper-gold alloy was worse than that of the silver-zinc-tin-indium alloy. The mould filling of both alloys cast with the rapidly prepared gypsum-bonded investment material was superior to that using the conventional investment.

  8. Fuel injection apparatus

    SciTech Connect

    Omori, T.; Sakakibara, S.; Kato, M.; Masuda, A.

    1986-06-10

    A fuel injection apparatus is described for supplying fuel from a fuel tank to at least one combustion chamber of an internal combustion engine, comprising: an injector housing defining therein a pressure cylinder bore, an injection cylinder bore and a timing cylinder bore connected in series with the pressure cylinder bore; a pressure plunger, fitted in the pressure cylinder bore and having one end defining, in the pressure cylinder bore, a pressure pump chamber communicating with the injection cylinder bore and the timing cylinder bore; first fuel supply means for supplying fuel from the fuel tank to the pressure pump chamber; pressurizing means for reciprocating the pressure plunger in the pressure cylinder bore in synchronism with the engine operation so as to pressurize fuel in the pressure pump chamber; an injection plunger, having a diameter smaller than the pressure plunger, fitted in the injection cylinder bore and having two ends defining, in the injection cylinder bore, an injection pump chamber and a first communicating chamber communicating with the pressure pump chamber; second fuel supply means for adjusting the quantity of the fuel from the fuel tank in accordance with engine operation conditions so as to supply the adjusted fuel quantity to the injection pump chamber; injection valve means for injecting the fuel into the fuel pump chamber toward a combustion chamber of the engine when the pressure in the pressure pump chamber is applied to the injection plunger through the first communicating chamber, and the fuel pressure in the injection pump chamber reaches a predetermined injection pressure.

  9. Epidural injections for back pain

    MedlinePlus

    ESI; Spinal injection for back pain; Back pain injection; Steroid injection - epidural; Steroid injection - back ... pillow under your stomach. If this position causes pain, you either sit up or lie on your ...

  10. Injection-water quality

    SciTech Connect

    Patton, C.C. )

    1990-10-01

    Ideally, injection water should enter the reservoir free of suspended solids or oil. It should also be compatible with the reservoir rock and fluids and would be sterile and nonscaling. This paper discusses how the objective of any water-injection operation is to inject water into the reservoir rock without plugging or permeability reduction from particulates, dispersed oil, scale formation, bacterial growth, or clay swelling. In addition, souring of sweet reservoirs by sulfate-reducing bacteria should be prevented if possible.

  11. [Stability of liensinine injection].

    PubMed

    Hu, X M; Zhou, B H; Luo, S D

    1993-06-01

    The stability of liensinine injection was studied by accelarating test with classical isothermal method. Results of the study showed that the decomposition of the injection was found to be a first-order reaction. The activation energy was 75030 J.mol-1. The shelf life at 10 degrees C and 25 degrees C was predicted to be about 15 months and 3 months respectively. This experiment provides a reference for the storage of the injection.

  12. Mould Routine Identification in the Clinical Laboratory by Matrix-Assisted Laser Desorption Ionization Time-Of-Flight Mass Spectrometry

    PubMed Central

    Cassagne, Carole; Ranque, Stéphane; Normand, Anne-Cécile; Fourquet, Patrick; Thiebault, Sandrine; Planard, Chantal; Hendrickx, Marijke; Piarroux, Renaud

    2011-01-01

    Background MALDI-TOF MS recently emerged as a valuable identification tool for bacteria and yeasts and revolutionized the daily clinical laboratory routine. But it has not been established for routine mould identification. This study aimed to validate a standardized procedure for MALDI-TOF MS-based mould identification in clinical laboratory. Materials and Methods First, pre-extraction and extraction procedures were optimized. With this standardized procedure, a 143 mould strains reference spectra library was built. Then, the mould isolates cultured from sequential clinical samples were prospectively subjected to this MALDI-TOF MS based-identification assay. MALDI-TOF MS-based identification was considered correct if it was concordant with the phenotypic identification; otherwise, the gold standard was DNA sequence comparison-based identification. Results The optimized procedure comprised a culture on sabouraud-gentamicin-chloramphenicol agar followed by a chemical extraction of the fungal colonies with formic acid and acetonitril. The identification was done using a reference database built with references from at least four culture replicates. For five months, 197 clinical isolates were analyzed; 20 were excluded because they were not identified at the species level. MALDI-TOF MS-based approach correctly identified 87% (154/177) of the isolates analyzed in a routine clinical laboratory activity. It failed in 12% (21/177), whose species were not represented in the reference library. MALDI-TOF MS-based identification was correct in 154 out of the remaining 156 isolates. One Beauveria bassiana was not identified and one Rhizopus oryzae was misidentified as Mucor circinelloides. Conclusions This work's seminal finding is that a standardized procedure can also be used for MALDI-TOF MS-based identification of a wide array of clinically relevant mould species. It thus makes it possible to identify moulds in the routine clinical laboratory setting and opens new avenues

  13. Botulinum toxin injection - larynx

    MedlinePlus

    Injection laryngoplasty; Botox-larynx: spasmodic dysphonia-BTX; Essential voice tremor (EVT)-btx; Glottic insufficiency; Percutaneous electromyography-guided botulinum toxin treatment; Percutaneous indirect laryngoscopy- ...

  14. Underground Injection Control (UIC)

    EPA Pesticide Factsheets

    Provide information on: individual injection well classes; regulations specific to each well class; technical guidance; compliance assistance; federal, state, and tribal/territory roles and responsibilities.

  15. Piezoelectric Injection Systems

    NASA Astrophysics Data System (ADS)

    Mock, R.; Lubitz, K.

    The origin of direct injection can be doubtlessly attributed to Rudolf Diesel who used air assisted injection for fuel atomisation in his first self-ignition engine. Although it became apparent already at that time that direct injection leads to reduced specific fuel consumption compared to other methods of fuel injection, it was not used in passenger cars for the moment because of its disadvantageous noise generation as the requirements with regard to comfort were seen as more important than a reduced specific consumption.

  16. Gas injected vacuum switch

    DOEpatents

    Hardin, K. Dan

    1977-01-01

    The disclosure relates to a gas injected vacuum switch comprising a housing having an interior chamber, a conduit for evacuating the interior chamber, within the chamber an anode and a cathode spaced from the anode, and a detonator for injecting electrically conductive gas into the chamber between the anode and the cathode to provide a current path therebetween.

  17. Injection rate control cam

    SciTech Connect

    Perr, J.P.; Liang, E.; Yu, R.C.; Ghuman, A.S.

    1990-10-16

    This patent describes a cam for controlling the injection rate of fuel in a fuel injection system of an engine. The fuel injection system including a cyclically operating unit injector having a body, an injector plunger mounted for reciprocating movement in the injector body between an advanced position and a retracted portion to pump into the engine during each cycle a variable quantity of fuel up to a maximum quantity under rated engine conditions, and a drive train for converting rotational movement of the cam into reciprocating movement of the pumping plunger depending on the profile of the cam. The cam profile comprises at least a plunger retraction segment and a plunger advancement segment for controlling the velocity if injector plunger retraction and advancement, respectively, the plunger advancement segment including a pre-injection subsequent shaped to cause an initial quantity of fuel to be injected into the engine during each cycle at rated engine conditions while the pre-injection subsegment is in contact with the drive train, and an injection subsegment following the pre-injection subsegment.

  18. Health Instruction Packages: Injections.

    ERIC Educational Resources Information Center

    Dunkleman, Ellie; And Others

    Text, illustrations, and exercises are utilized in this set of four learning modules designed to instruct nursing students in techniques and equipment utilized for intramuscular injections. The first module, "Equipment for Intramuscular Injections" by Ellie Dunkleman, presents guidelines for selecting needles of the proper length and…

  19. [Effects of 33% grapefruit extract on the growth of the yeast--like fungi, dermatopytes and moulds].

    PubMed

    Krajewska-Kułak, E; Lukaszuk, C; Niczyporuk, W

    2001-01-01

    Grapefruit seed extract was discovered by Jacob Harich an american immunologist in 1980. Assessment of the influence of grapefruit extract on the yeast-like fungi strains--Candida albicans growth. Material used in this investigation was ATCC test Candida albicans strains no 10231, 200 of Candida albicans strains, 5 of Candida sp. strains isolated from patients with candidiasis symptoms from different ontocenosis and 12 of dermatophytes and moulds isolated from patients. The susceptibility of the Candida was determined by serial dilution method. It seems that 33% grapefruit extract exert a potent antifungal activity against the yeast like fungi strains and had low activity against dermatophytes and moulds. Further studies in vitro and in vivo on greater number of the yeast-like fungi strains and other fungi species are needed.

  20. Yeasts from native Brazilian Cerrado plants: Occurrence, diversity and use in the biocontrol of citrus green mould.

    PubMed

    Sperandio, Eugenio Miranda; do Vale, Helson Mario Martins; Moreira, Geisianny Augusta Monteiro

    2015-11-01

    Yeasts are some of the most important postharvest biocontrol agents. Postharvest oranges frequently deteriorate due to green mould (Penicillium digitatum), which causes significant losses. The aims of this study were to determine the composition and diversity of yeasts on plants of the Brazilian Cerrado and to explore their potential for inhibiting citrus green mould. Leaves and fruit of Byrsonima crassifolia and Eugenia dysenterica were collected from Cerrado conservation areas, and thirty-five yeasts were isolated and identified by sequencing the D1-D2 domain of the rDNA large subunit (26S). The isolates represented the Aureobasidium, Meyerozyma, Candida, and Pichia genera. Three isolates identified as Aureobasidium pullulans exhibited potential for the control of P. digitatum in both in vitro and in vivo tests; these isolates reduced the incidence of disease and increased the storage time of fruit. Aureobasidium. pullulans has immense potential for the biological control of filamentous fungi.

  1. Some Investigations on Hardness of Investment Casting Process After Advancements in Shell Moulding for Reduction in Cycle Time

    NASA Astrophysics Data System (ADS)

    Singh, R.; Mahajan, V.

    2014-07-01

    In the present work surface hardness investigations have been made on acrylonitrile butadiene styrene (ABS) pattern based investment castings after advancements in shell moulding for replication of biomedical implants. For the present study, a hip joint, made of ABS material, was fabricated as a master pattern by fused deposition modelling (FDM). After preparation of master pattern, mold was prepared by deposition of primary (1°), secondary (2°) and tertiary (3°) coatings with the addition of nylon fibre (1-2 cm in length of 1.5D). This study outlines the surface hardness mechanism for cast component prepared from ABS master pattern after advancement in shell moulding. The results of study highlight that during shell production, fibre modified shells have a much reduced drain time. Further the results are supported by cooling rate and micro structure analysis of casting.

  2. Application of solid-phase microextraction with gas chromatography and mass spectrometry for the early detection of active moulds on historical woollen objects.

    PubMed

    Sawoszczuk, Tomasz; Syguła-Cholewińska, Justyna; Del Hoyo-Meléndez, Julio M

    2017-02-01

    The goal of this work was to determine the microbial volatile organic compounds emitted by moulds growing on wool in search of particular volatiles mentioned in the literature as indicators of active mould growth. The keratinolytically active fungi were inoculated on two types of media: (1) samples of wool placed on broths, and (2) on broths containing amino acids that are elements of the structure of keratin. All samples were prepared inside 20 mL vials (closed system). In the first case (1) the broths did not contain any sources of organic carbon, nitrogen, or sulfur, i.e. wool was the only nutrient for the moulds. A third type of sample was historical wool prepared in a Petri dish without a broth and inoculated with a keratinolytically active mould (open system). The microbial volatiles emitted by moulds were sampled with the headspace solid-phase microextraction method. Volatiles extracted on solid-phase microextraction fibers were analyzed in a gas chromatography with mass spectrometry system. Qualitative and quantitative analyses of chromatograms were carried out in search of indicators of metabolic activity. The results showed that there are three groups of volatiles that can be used for the detection of active forms of moulds on woollen objects.

  3. Chronic mould exposure as a risk factor for severe community acquired pneumonia in a patient requiring extra corporeal membrane oxygenation

    PubMed Central

    Thomas, Stephanie; Hassan, Ibrahim; Barker, Julian; Ashworth, Alan; Barnes, Anita; Fedor, Igor; Feddy, Lee; Hayes, Tim; Malagon, Ignacio; Stirling, Sarah; Szentgyorgyi, Lajos; Mutton, Ken; Richardson, Malcolm

    2015-01-01

    A previously fit and well man developed acute respiratory failure due to environmental mould exposure from living in damp rental accommodation. Despite aggressive intensive care management he rapidly deteriorated and required respiratory and cardiac Extracorporeal Membrane Oxygenation. We hypothesize that poor domiciliary conditions may make an underestimated contribution to community respiratory disease. These conditions may present as acute and severe illness with non-typical pathogens identified. PMID:26236598

  4. Community dynamics of coagulase-negative staphylococci during spontaneous artisan-type meat fermentations differ between smoking and moulding treatments.

    PubMed

    Janssens, M; Myter, N; De Vuyst, L; Leroy, F

    2013-08-16

    Coagulase-negative staphylococci (CNS) that are naturally present in the raw meat batter of fermented sausages or that originate from the addition of a starter culture play a role in flavour development. A wide species diversity of CNS can be present in fermented meats, but it is not fully clear yet how specific process parameters select for specific CNS by affecting their community dynamics. Therefore, the influence of smoking and moulding treatments on the CNS community dynamics in spontaneously fermented, artisan-type sausages was investigated. During the fermentation stage, the meat batter was in all cases dominated by Staphylococcus saprophyticus, in addition to Lactobacillus sakei as governing lactic acid bacterium. Following fermentation, the bacterial communities were not perturbed by the smoking treatment, since both L. sakei and S. saprophyticus remained dominant throughout the ripening stage and prevailed in the end-products. Yet, when fermentation was followed by a moulding step with Penicillium nalgiovense, a shift of the CNS communities towards dominance by Staphyloccocus equorum was seen, despite a similar evolution of L. sakei. This effect was possibly due to a pH rise caused by the mould, a hypothesis which was reinforced by the finding that the isolated strain S. equorum DBX-S-17 was more sensitive to low pH than the isolated strain S. saprophyticus DFL-S-12 during growth experiments in brain heart infusion (BHI). Differences in CNS communities may affect sausage flavour, due to intraspecies variations in metabolic conversions of, for instance, amino acids. The fact that 3-methyl-butanal was only found in the moulded sausage, which was dominated by S. equorum, may be related to the finding that the isolated strain of this species was able to produce this compound in BHI medium, whereas the isolated strain of S. saprophyticus was not.

  5. A Genetic System Controlling Mitochondrial Fusion in the Slime Mould, Physarum Polycephalum

    PubMed Central

    Kawano, S.; Takano, H.; Imai, J.; Mori, K.; Kuroiwa, T.

    1993-01-01

    We have identified two distinct mitochondrial phenotypes, namely, Mif(+) (mitochondrial fusion) and Mif(-) (mitochondrial fusion-deficient), and have studied the genetic system that controls mitochondrial fusion in the slime mould, Physarum polycephalum. A mitochondrial plasmid of approximately 16 kbp was identified in all Mif(+) plasmodial strains. This plasmid is apparently responsible for promoting mitochondrial fusion, and it is inserted into the mitochondrial DNA (mtDNA) in successive sexual crossing with Mif(-) strains. This recombinant mtDNA and the unchanged free plasmid spread through the mitochondrial population via the promotion of mitochondrial fusion. The Mif(+) strains with the plasmid were further classified as being two types: high frequency and low frequency mitochondrial fusion. Restriction analysis of the mtDNA suggested that the high frequency mitochondrial fusion type was more often heteroplasmic; within each plasmodium, mtDNAs of both parental types were usually present, in addition to the presence of the plasmid. Genetic analysis with the progeny obtained from crossing myxamoebae derived from three different isolates suggested that these progeny carried different alleles at a nuclear locus that controlled the frequency of mitochondrial fusion. These alleles (mitochondrial mating-type alleles, mitA1, 2 and 3) appear to function like the mating type of the myxamoebae; mitochondrial fusion occurs at high frequency with the combination of unlike alleles, but at low frequency with the combination of like alleles. PMID:8436271

  6. Impact of the Fibre Bed on Resin Viscosity in Liquid Composite Moulding Simulations

    NASA Astrophysics Data System (ADS)

    Gascons, Marc; Blanco, Norbert; Simacek, Pavel; Peiro, Joaquim; Advani, Suresh; Matthys, Koen

    2012-06-01

    In the past, simulation of liquid composite moulding processes was often based on the assumption that resin viscosity could be implemented as a constant value. However, viscosity can be subject to changes during the infusion process and now, non-constant and process parameter dependent expressions have become more common in simulation practice. Nevertheless, even with the inclusion of more advanced resin viscosity models, the prediction of flow front propagation in large, thick composite parts or in slow infusion processes is often still inaccurate when compared to the real application. Discrepancies are found to be most pronounced in the final stages of the infusion process, exactly where high accuracy predictions are most valued. A new simulation method based on an infusion time-dependent resin viscosity expression is proposed in this work. The method not only incorporates non-linear viscosity behaviour, but also takes into account the impact of reinforcement fibre sizing and fibre bed architecture on resin viscosity characteristics. Such fibre bed effects are not identifiable in neat resin viscosity characterization tests but are thought to have substantial impact on in-situ viscosity values during infusion, especially for large, thick composite part applications and slow infusion processes. An application case study has been included to demonstrate the prediction capability of the proposed simulation method. The design of an infusion process for a composite pressure vessel was selected for this purpose. Results show high predictive power throughout the infusion process, with most pronounced benefit in the final infusion stages.

  7. Two-gene phylogeny of bright-spored Myxomycetes (slime moulds, superorder Lucisporidia).

    PubMed

    Fiore-Donno, Anna Maria; Clissmann, Fionn; Meyer, Marianne; Schnittler, Martin; Cavalier-Smith, Thomas

    2013-01-01

    Myxomycetes, or plasmodial slime-moulds, are one of the largest groups in phylum Amoebozoa. Nonetheless, only ∼10% are in the database for the small subunit (SSU) ribosomal RNA gene, the most widely used gene for phylogenetics and barcoding. Most sequences belong to dark-spored Myxomycetes (order Fuscisporida); the 318 species of superorder Lucisporidia (bright-spored) are represented by only eleven genuine sequences. To compensate for this, we provide 66 new sequences, 37 SSU rRNA and 29 elongation factor 1-alpha (EF-1α), for 82% of the genera of Lucisporidia. Phylogenetic analyses of single- and two-gene alignments produce congruent topologies and reveal both morphological characters that have been overemphasised and those that have been overlooked in past classifications. Both classical orders, Liceida and Trichiida, and several families and genera are para/polyphyletic; some previously unrecognised clades emerge. We discuss possible evolutionary pathways. Our study fills a gap in the phylogeny of Amoebozoa and provides an extensive SSU rRNA sequence reference database for environmental sampling and barcoding. We report a new group I intron insertion site for Myxomycetes in one Licea.

  8. Exploring slime mould diversity in high-altitude forests and grasslands by environmental RNA analysis.

    PubMed

    Kamono, Akiko; Meyer, Marianne; Cavalier-Smith, Thomas; Fukui, Manabu; Fiore-Donno, Anna Maria

    2013-04-01

    In spite of the ecological importance of protists, very little data is available on their distribution in soil. This investigation is the first of its kind on what could be the major components of the soil protistan community, the Myxomycetes, or plasmodial slime-moulds, a monophyletic class in the phylum Amoebozoa. Myxomycetes have a complex life cycle culminating in the formation of mainly macroscopic fruiting bodies, highly variable in shape and colour, which can be found in every terrestrial biome. Despite their prevalence, they are paradoxically absent from environmental DNA sampling studies. We obtained myxomycete SSU rRNA gene sequences from soil-extracted RNAs using specific primers. Soil samples were collected in three mountain ranges (France, Scotland and Japan). Our study revealed an unexpectedly high diversity of dark-spored Myxomycetes, with the recovery of 74 phylotypes. Of these, 74% had < 98% identity with known sequences, showing a hidden diversity; there was little overlap between localities, implying biogeographical patterns. Few phylotypes were dominant and many were unique, consistent with the 'rare biosphere' phenomenon. Our study provides the first detailed insight into the community composition of this ecologically important group of protists, establishing means for future studies of their distribution, abundance and ecology.

  9. Origanum dictamnus Oil Vapour Suppresses the Development of Grey Mould in Eggplant Fruit In Vitro

    PubMed Central

    Loulakakis, Kostas; Magan, Naresh; Tzortzakis, Nikos

    2014-01-01

    Grey mould rot (Botrytis cinerea) development in vitro or in eggplant (Solanum melongena L.) fruit was evaluated after treatment with dittany (Origanum dictamnus L.) oil (DIT) and storage at 12°C and 95% relative humidity during or following exposure to the volatiles. DIT volatiles used in different concentration (0-50-100-250 μL/L) and times of exposure (up to 120 h) examined the effects on pathogen development as well as fruit quality parameters. In vitro, fungal colony growth was inhibited with the application of DIT oil (during or after exposure) and/or time of application. Continuous exposure to oils reduced conidial germination and production with fungistatic effects observed in 250 μL/L. In vivo, fungal lesion growth and conidial production reduced in DIT-treated fruits. Interesting, in fruits preexposed to volatiles before fungal inoculation, DIT application induced fruit resistance against the pathogen, by reduced lesion growth and conidial production. Conidial viability reduced in >100 μL/L DIT oil. Fruits exposed to essential oil did not affect fruit quality related attributes in general, while skin lightness (L value) increased in 50 and 100 μL/L DIT oil. The results of the current study indicated that dittany volatiles may be considered as an alternative food preservative, eliminating disease spread in the storage/transit atmospheres. PMID:25254209

  10. Two-Gene Phylogeny of Bright-Spored Myxomycetes (Slime Moulds, Superorder Lucisporidia)

    PubMed Central

    Fiore-Donno, Anna Maria; Clissmann, Fionn; Meyer, Marianne; Schnittler, Martin; Cavalier-Smith, Thomas

    2013-01-01

    Myxomycetes, or plasmodial slime-moulds, are one of the largest groups in phylum Amoebozoa. Nonetheless, only ∼10% are in the database for the small subunit (SSU) ribosomal RNA gene, the most widely used gene for phylogenetics and barcoding. Most sequences belong to dark-spored Myxomycetes (order Fuscisporida); the 318 species of superorder Lucisporidia (bright-spored) are represented by only eleven genuine sequences. To compensate for this, we provide 66 new sequences, 37 SSU rRNA and 29 elongation factor 1-alpha (EF-1α), for 82% of the genera of Lucisporidia. Phylogenetic analyses of single- and two-gene alignments produce congruent topologies and reveal both morphological characters that have been overemphasised and those that have been overlooked in past classifications. Both classical orders, Liceida and Trichiida, and several families and genera are para/polyphyletic; some previously unrecognised clades emerge. We discuss possible evolutionary pathways. Our study fills a gap in the phylogeny of Amoebozoa and provides an extensive SSU rRNA sequence reference database for environmental sampling and barcoding. We report a new group I intron insertion site for Myxomycetes in one Licea. PMID:23667494

  11. Application of waste bulk moulded composite (BMC) as a filler for isotactic polypropylene composites

    PubMed Central

    Barczewski, Mateusz; Matykiewicz, Danuta; Andrzejewski, Jacek; Skórczewska, Katarzyna

    2016-01-01

    The aim of this study was to produce isotactic polypropylene based composites filled with waste thermosetting bulk moulded composite (BMC). The influence of BMC waste addition (5, 10, 20 wt%) on composites structure and properties was investigated. Moreover, additional studies of chemical treatment of the filler were prepared. Modification of BMC waste by calcium stearate (CaSt) powder allows to assess the possibility of the production of composites with better dispersion of the filler and more uniform properties. The mechanical, processing, and thermal properties, as well as structural investigations were examined by means of static tensile test, Dynstat impact strength test, differential scanning calorimetry (DSC), wide angle X-ray scattering (WAXS), melt flow index (MFI) and scanning electron microscopy (SEM). Developed composites with different amounts of non-reactive filler exhibited satisfactory thermal and mechanical properties. Moreover, application of the low cost modifier (CaSt) allows to obtain composites with better dispersion of the filler and improved processability. PMID:27222742

  12. Application of glass-nonmetals of waste printed circuit boards to produce phenolic moulding compound.

    PubMed

    Guo, Jie; Rao, Qunli; Xu, Zhenming

    2008-05-01

    The aim of this study was to investigate the feasibility of using glass-nonmetals, a byproduct of recycling waste printed circuit boards (PCBs), to replace wood flour in production of phenolic moulding compound (PMC). Glass-nonmetals were attained by two-step crushing and corona electrostatic separating processes. Glass-nonmetals with particle size shorter than 0.07 mm were in the form of single fibers and resin powder, with the biggest portion (up to 34.6 wt%). Properties of PMC with glass-nonmetals (PMCGN) were compared with reference PMC and the national standard of PMC (PF2C3). When the adding content of glass-nonmetals was 40 wt%, PMCGN exhibited flexural strength of 82 MPa, notched impact strength of 2.4 kJ/m(2), heat deflection temperature of 175 degrees C, and dielectric strength of 4.8 MV/m, all of which met the national standard. Scanning electron microscopy (SEM) showed strong interfacial bonding between glass fibers and the phenolic resin. All the results showed that the use of glass-nonmetals as filler in PMC represented a promising method for resolving the environmental pollutions and reducing the cost of PMC, thus attaining both environmental and economic benefits.

  13. Experimental characterizations of non-seizing solutions for plastic moulding tools

    NASA Astrophysics Data System (ADS)

    Jacquet, P.; Gołąbczak, M.; Lourdin, P.

    2012-11-01

    In the plastics moulding industry many parts sustain movement in relation to other pieces: ejectors, slides, dies, etc. Some seizing or micro-welding may appear, especially when lubrication is not used. For many years, different kinds of hard coatings were developed to avoid such problems. In this paper, the investigation analyses these problems related with nitride layers which were obtained thanks to four different processes: salt bath nitriding, salt bath nitriding followed by a post-oxidation, gaseous low pressure nitriding and plasma nitriding. Several properties of the layers were investigated such as hardness, microstructure and constitution of the surface by means of X-ray diffraction (XRD), roughness, and friction coefficient at both room temperature and 100 °C. Some important differences were pointed out between the different layers. The solution provided by a salt bath nitriding followed with an oxidation sequence gave, in terms of tribology, as good results as a physical vapour deposition (PVD) WC-C coating which was used as a reference for this study.

  14. Slime moulds use heuristics based on within-patch experience to decide when to leave.

    PubMed

    Latty, Tanya; Beekman, Madeleine

    2015-04-15

    Animals foraging in patchy, non-renewing or slowly renewing environments must make decisions about how long to remain within a patch. Organisms can use heuristics ('rules of thumb') based on available information to decide when to leave the patch. Here, we investigated proximate patch-departure heuristics in two species of giant, brainless amoeba: the slime moulds Didymium bahiense and Physarum polycephalum. We explicitly tested the importance of information obtained through experience by eliminating chemosensory cues of patch quality. In P. polycephalum, patch departure was influenced by the consumption of high, and to a much lesser extent low, quality food items such that engulfing a food item increased patch-residency time. Physarum polycephalum also tended to forage for longer in darkened, 'safe' patches. In D. bahiense, engulfment of any food item increased patch residency irrespective of that food item's quality. Exposure to light had no effect on the patch-residency time of D. bahiense. Given that these organisms lack a brain, our results illustrate how the use of simple heuristics can give the impression that individuals make sophisticated foraging decisions.

  15. Comparison of the indoor air quality in mould damaged and reference buildings in a subarctic climate.

    PubMed

    Hyvärinen, A; Reponen, T; Husman, T; Nevalainen, A

    2001-08-01

    The purpose of this study was to search for objective parameters most relevant to indicate microbial problems of buildings in cold climate. Various indoor characteristics were compared in nine buildings with known history of moisture problems and visible mould (index) and in nine matched reference buildings. The concentrations of airborne viable fungal had a clear difference between the two groups of buildings. In this study, airborne concentrations of viable bacteria, formaldehyde, total volatile organic compounds (TVOC) and the occurrence of house dust mites in these index buildings were compared with the levels of the pollutants in matched reference buildings. Fungal growth and flora on moist building materials were also studied. The concentrations of TVOC were slightly higher in the index buildings than in the reference buildings. However, the differences in the concentrations or appearance of any of the studied pollutants were not significant. These parameters do not seem to be relevant indicators of microbial growth or surrogates of microbial exposure. Thus, fungal concentration and composition of fungal genera in the air still seems to be the best indicator for moisture problems among the studied pollutants. In the moist building materials, some fungal genera, such as Ulocladium and Chaetophoma were detected that were not found in indoor air showing that building material samples give additional information on the microflora of the building.

  16. Mould design and manufacturing considerations of honeycomb biocomposites with transverse fibre direction for aerospace application

    NASA Astrophysics Data System (ADS)

    Manan, N. H.; Majid, D. L.; Romli, F. I.

    2016-10-01

    Sandwich structures with honeycomb core are known to significantly improve stiffness at lower weight and possess high flexural rigidity. They have found wide applications in aerospace as part of the primary structures, as well as the interior paneling and floors. High performance aluminum and aramid are the typical materials used for the purpose of honeycomb core whereas in other industries, materials such as fibre glass, carbon fibre, Nomex and also Kevlar reinforced with polymer are used. Recently, growing interest in developing composite structures with natural fibre reinforcement has also spurred research in natural fibre honeycomb material. The majority of the researches done, however, have generally emphasized on the usage of random chopped fibre and only a few are reported on development of honeycomb structure using unidirectional fibre as the reinforcement. This is mainly due to its processing difficulties, which often involve several stages to account for the arrangement of fibres and curing. Since the use of unidirectional fibre supports greater strength compared to random chopped fibre, a single-stage process in conjunction with vacuum infusion is suggested with a mould design that supports fibre arrangement in the direction of honeycomb loading.

  17. White mould of common bean incited by Sclerotinia sclerotiorum Lib. de Bary in Egypt.

    PubMed

    Amer, M A; Abou-el-Seoud, I; Rasmy, M R; Khater, Manar M

    2009-01-01

    White mould, caused by Sclerotinia sclerotiorum (Lib.) de Bary, is a destructive yield-limiting disease of common bean (Phaseolus vulgaris L.) in Egypt. Forty eight isolate of S. sclerotiorum were isolated from diseased bean tissues taken from 9 geographical regions (Al-Behaira, Alexandria and Assiut governorates) during winter season in 2008. The pathogenicity studies showed that the tested bean cultivars (Bronco, Contender, Giza 6 and Nebraska) varied in disease incidence. Contender bean cultivar was more resistant than other cultivars. Whereas, the more virulent isolates were S5 and S6. Histology investigation of seedlings bean hypocotyls inoculated with S. sclerotiorum after 24, 48, 72 and 96 hours after inoculation indicated that penetration of bean seedlings occurred, during the first 48 hours after inoculation, through the epidermis and the outer layer of the cortex. 72 hours after inoculation, damage extended deeper into the cortical cells. Infection took place inter-and interacellularly after 96 hours more damage occurred. In addition, the invasion of the fungal hyphae through the cortical cells occurred both inter-, and intracellularly. Moreover, the observed of electron microscope both transmission and scanning investigations concluded that penetrating hyphae progressed through bean seedlings tissues leading to complete destruction of epidermis, fully colonization and death of cortical cells, partial invasion of vascular tissues. However, presence of the fungal structures in pith cells was observed.

  18. THE RHIC INJECTION SYSTEM.

    SciTech Connect

    FISCHER,W.; GLENN,J.W.; MACKAY,W.W.; PTITSIN,V.; ROBINSON,T.G.; TSOUPAS,N.

    1999-03-29

    The RHIC injection system has to transport beam from the AGS-to-RHIC transfer line onto the closed orbits of the RHIC Blue and Yellow rings. This task can be divided into three problems. First, the beam has to be injected into either ring. Second, once injected the beam needs to be transported around the ring for one turn. Third, the orbit must be closed and coherent beam oscillations around the closed orbit should be minimized. We describe our solutions for these problems and report on system tests conducted during the RHIC Sextant test performed in 1997. The system will be fully commissioned in 1999.

  19. Common injections in musculoskeletal medicine.

    PubMed

    Monseau, Aaron J; Nizran, Parminder Singh

    2013-12-01

    Musculoskeletal injections are a common procedure in primary care and sports medicine but can be intimidating for some clinicians. This article addresses current evidence for corticosteroid injections, and common injection indications and techniques, namely knee, subacromial bursa, glenohumeral joint, lateral epicondyle, de Quervain tenosynovitis, and greater trochanteric bursa injections. Preparation for injections and some evidence for ultrasound guidance are also reviewed.

  20. Significance of molecular identification and antifungal susceptibility of clinically significant yeasts and moulds in a global antifungal surveillance programme.

    PubMed

    Pfaller, Michael A; Woosley, Leah N; Messer, Shawn A; Jones, Ronald N; Castanheira, Mariana

    2012-10-01

    The increasing diversity of opportunistic fungi causing serious invasive fungal infections (IFI) has been documented. Accurate identification (ID) is important in guiding therapy, determining prognosis for IFIs and in epidemiological surveys. We assessed the utility of PCR-based methods for the ID of yeasts and moulds that either were uncommon, failed conventional ID, or represented unusual biochemical or phenotypic profiles of common species. Among 1,790 viable fungal clinical isolates received during the SENTRY Program in 2010, 322 strains from 40 study sites had ID confirmed by molecular methods. Isolates were previously identified in participant institutions. Yeasts that were not confirmed by morphology on CHROMagar, growth at 45 °C (Candida albicans/dubliniensis), or assimilation of trehalose (C. glabrata) as well as non-Candida yeasts and all moulds were amplified and sequenced using primers amplifying one or more of the following genes: ITS, 28S, β-tubulin (Aspergillus spp.), TEF (Fusarium spp.), IGS (Trichosporon spp.). The isolates selected for molecular ID included 149 isolates of Candida species, 77 of Aspergillus species, 73 non-Candida yeasts, and 23 other moulds (a total of 41 different species). Overall, the ID determined by the submitting site was confirmed for 189 isolates (58.7 %): Aspergillus spp. (64.1 % correct); Candida spp. (60.1 % correct); non-Candida yeasts (58.9 % correct); non-Aspergillus moulds (30.4 % correct). Species with high levels of concordance between conventional and molecular ID included A. fumigatus (95.0  %), C. lusitaniae (100 %), C. dubliniensis (92.3 %), C. kefyr (100 %), and C. neoformans (90.2 %). Only 50.0 % of isolates of C. albicans and 59.1 % of C. glabrata selected due to unusual phenotypic or biochemical features were found to be correctly identified by the submitting site. Molecular methods for the identification of fungal pathogens are an important adjunct to the conventional identification of

  1. Mould/dampness exposure at home is associated with respiratory disorders in Italian children and adolescents: the SIDRIA-2 Study

    PubMed Central

    Simoni, M; Lombardi, E; Berti, G; Rusconi, F; La Grutta, S; Piffer, S; Petronio, M; Galassi, C; Forastiere, F; Viegi, G; the, S

    2005-01-01

    Aims: To report on the relation between home mould and/or dampness exposure and respiratory disorders in a large sample of children and adolescents in Italy, accounting for age at time of exposure. Methods: 20 016 children (mean age 7 years) and 13 266 adolescents (mean age 13 years) completed questionnaires on indoor exposures and respiratory symptoms/diseases. Statistical analyses were adjusted for sex, age, questionnaire's compiler, area of residence, season of interview, parental educational status, family history of asthma, rhinitis, eczema, chronic obstructive pulmonary disease, presence of gas water heaters, passive smoking, pets, and active smoking (only for adolescents). Population attributable risk % (PAR) was also computed. Results: Asthma was more strongly related to only early than to only current exposure, both in children (OR 1.80, 95% CI 1.41 to 2.30) and adolescents (OR 1.89, 95% CI 1.38 to 2.59). The same result was found for rhino-conjunctivitis (OR 1.46, 95% CI 1.17 to 1.82), in children, and for wheeze among adolescents (OR 1.56, 95% CI 1.15 to 2.11). In children, wheeze (OR 1.98, 95% CI 1.47 to 2.66) and eczema (OR 1.44, 95% CI 1.09 to 1.91) were more strongly related to mould/dampness when exposed both early and currently; the same occurred in adolescents for rhino-conjunctivitis (1.78, 95% CI 1.30 to 2.45). Although persistent cough/phlegm was significantly related to mould/dampness exposure in children, regardless of exposure timing, no significant association between mould/dampness exposure and eczema or cough/phlegm was found among adolescents. PAR estimates were higher for only early than only current exposures. Avoiding early only exposure would abate wheeze by 6%, asthma or cough/phlegm by 7%, rhino-conjunctivitis in children by 4%, and in adolescents, asthma by 6%, and wheeze by 4%. Conclusions: Respiratory disorders such as wheeze and asthma can often be explained by exposure to home mould/dampness, especially early in life. The

  2. OnabotulinumtoxinA Injection

    MedlinePlus

    ... years of age and older; treat severe underarm sweating in people 18 years of age and older ... the muscle. When onabotulinumtoxinA is injected into a sweat gland, it decreases the activity of the gland ...

  3. Collagenase Clostridium Histolyticum Injection

    MedlinePlus

    ... disease (a thickening of tissue [plaque] inside the penis that causes the penis to curve). Collagenase Clostridium histolyticum injection is in ... the plaque of thickened tissue and allows the penis to be straightened.

  4. Sipuleucel-T Injection

    MedlinePlus

    ... doctor or nurse in a doctor's office or infusion center. It is usually given once every 2 ... injection may cause serious allergic reactions during an infusion and for about 30 minutes afterwards. A doctor ...

  5. Albumin injection (image)

    MedlinePlus

    ... a nuclear scan test that is performed to measure the supply of blood through the lungs. After the injection, the lungs are scanned to detect the location of the radioactive particles as blood flows through the lungs.

  6. Talimogene Laherparepvec Injection

    MedlinePlus

    Talimogene laherparepvec injection is used to treat certain melanoma (a type of skin cancer) tumors that cannot ... had radiation treatment in the area of the melanoma tumors, multiple myeloma (cancer of the plasma cells ...

  7. Iron Dextran Injection

    MedlinePlus

    ... the area where the medication was injected brown skin discoloration numbness, burning, or tingling in the arms, hands, feet, or legs sweating changes in taste Some side effects can be serious. If you experience these symptoms ...

  8. Supersonic Pulsed Injection

    NASA Technical Reports Server (NTRS)

    Cutler, A. D.; Harding, G. C.; Diskin, G. S.

    2001-01-01

    An injector has been developed to provide high-speed high-frequency (order 10 kHz) pulsed a supersonic crossflow. The injector nozzle is formed between the fixed internal surface of the nozzle and a freely rotating three- or four-sided wheel embedded within the device. Flow-induced rotation of the wheel causes the nozzle throat to open and close at a frequency proportional to the speed of sound of the injected gas. Measurements of frequency and mass flow rate as a function of supply pressure are discussed for various injector designs. Preliminary results are presented for wall-normal injection of helium into a Mach-2 ducted airflow. The data include schlieren images in the injectant plume in a plane normal to the flow, downstream of injection.

  9. Co-trimoxazole Injection

    MedlinePlus

    ... to treat certain infections that are caused by bacteria such as infection of the intestine, lungs (pneumonia), ... of medications called sulfonamides. It works by killing bacteria.Antibiotics such as co-trimoxazole injection will not ...

  10. Mouse bladder wall injection.

    PubMed

    Fu, Chi-Ling; Apelo, Charity A; Torres, Baldemar; Thai, Kim H; Hsieh, Michael H

    2011-07-12

    Mouse bladder wall injection is a useful technique to orthotopically study bladder phenomena, including stem cell, smooth muscle, and cancer biology. Before starting injections, the surgical area must be cleaned with soap and water and antiseptic solution. Surgical equipment must be sterilized before use and between each animal. Each mouse is placed under inhaled isoflurane anesthesia (2-5% for induction, 1-3% for maintenance) and its bladder exposed by making a midline abdominal incision with scissors. If the bladder is full, it is partially decompressed by gentle squeezing between two fingers. The cell suspension of interest is intramurally injected into the wall of the bladder dome using a 29 or 30 gauge needle and 1 cc or smaller syringe. The wound is then closed using wound clips and the mouse allowed to recover on a warming pad. Bladder wall injection is a delicate microsurgical technique that can be mastered with practice.

  11. Premixed direct injection disk

    SciTech Connect

    York, William David; Ziminsky, Willy Steve; Johnson, Thomas Edward; Lacy, Benjamin; Zuo, Baifang; Uhm, Jong Ho

    2013-04-23

    A fuel/air mixing disk for use in a fuel/air mixing combustor assembly is provided. The disk includes a first face, a second face, and at least one fuel plenum disposed therebetween. A plurality of fuel/air mixing tubes extend through the pre-mixing disk, each mixing tube including an outer tube wall extending axially along a tube axis and in fluid communication with the at least one fuel plenum. At least a portion of the plurality of fuel/air mixing tubes further includes at least one fuel injection hole have a fuel injection hole diameter extending through said outer tube wall, the fuel injection hole having an injection angle relative to the tube axis. The invention provides good fuel air mixing with low combustion generated NOx and low flow pressure loss translating to a high gas turbine efficiency, that is durable, and resistant to flame holding and flash back.

  12. Epoetin Alfa Injection

    MedlinePlus

    ... surgery to decrease the chance that blood transfusions (transfer of one person's blood to another person's body) ... wheezing difficulty breathing or swallowing hoarseness lack of energy dizziness fainting Epoetin alfa injection may cause other ...

  13. AbobotulinumtoxinA Injection

    MedlinePlus

    ... the area of injection and cause symptoms of botulism, including severe or life-threatening difficulty breathing or ... effect, you or your doctor may send a report to the Food and Drug Administration's (FDA) MedWatch ...

  14. RimabotulinumtoxinB Injection

    MedlinePlus

    ... the area of injection and cause symptoms of botulism, including severe or life-threatening difficulty breathing or ... effect, you or your doctor may send a report to the Food and Drug Administration's (FDA) MedWatch ...

  15. IncobotulinumtoxinA Injection

    MedlinePlus

    ... the area of injection and cause symptoms of botulism, including severe or life threatening difficulty breathing or ... effect, you or your doctor may send a report to the Food and Drug Administration's (FDA) MedWatch ...

  16. Fuel injection system

    SciTech Connect

    Herth, H.; Kraus, B.; Sautter, W.; Wessel, W.

    1983-03-15

    A fuel injection system for an internal combustion engine includes electromagnetic injection valves controlled by a fuel control unit which receives signals from a camshaft actuated switch, a position-dependent throttle transducer and an oxygen sensor. When the oxygen sensor changes output levels, the transmission of this information is delayed, by the action of a switching transistor controlled by a monostable multivibrator, for a period of time equal to the internal time constant of the multivibrator.

  17. Gas chromatograph injection system

    NASA Technical Reports Server (NTRS)

    Pollock, G. E.; Henderson, M. E.; Donaldson, R. W., Jr. (Inventor)

    1975-01-01

    An injection system for a gas chromatograph is described which uses a small injector chamber (available in various configurations). The sample is placed in the chamber while the chamber is not under pressure and is not heated, and there is no chance of leakage caused by either pressure or heat. It is injected into the apparatus by changing the position of a valve and heating the chamber, and is volatilized and swept by a carrier gas into the analysis apparatus.

  18. Session 20: Injection Overview

    SciTech Connect

    Prestwich, Susan

    1983-12-01

    The test program was initiated at the Raft River Geothermal Field in southern Idaho in September 1982. A series of eight short-term injection and backflow tests, followed by a long-term injection test, were conducted on one well in the field. Tracers were added during injection and monitored during backflow as well. The principal objective was to determine if tracers could be effectively used as a means to assess reservoir characteristics in a one-well test. The test program resulted in a unique data set which shows promise as a means to improve understanding of the reservoir characteristics. In December 1982, an RFP was issued to obtain an industrial partner to obtain follow-on data on the injection/backflow technique in a second field, and to study any alternate advanced concepts for injection testing which the industrial community might recommend. The East Mesa Geothermal Field was selected for the second test series. Two wells were utilized for testing, and a series of ten tests were conducted in July and August 1983, aimed principally at further evaluation of the injection/backflow technique.

  19. Fuel injection nozzle

    SciTech Connect

    Kato, M.; Tojo, S.; Arai, K.

    1986-07-22

    A fuel injection nozzle is described connected to a fuel injection pump to inject fuel into a combustion chamber of an internal combustion engine consisting of: a nozzle housing defining therein a fuel sump chamber, an injection hole communicating with the sump chamber and opened at the outer surface of the nozzle housing, a stepped cylinder bore having a smaller diameter bore section and a larger diameter bore section and a fuel passage communicating at one end with the sump chamber and at the other end with the smaller diameter bore section of the stepped cylinder bore; a stepped plunger fitted in the stepped cylinder bore and having a smaller diameter plunger section fitted into the smaller diameter bore section and a larger diameter plunger section fitted into the larger diameter bore section in which the smaller diameter bore section together with the end face of the smaller diameter plunger section defines a pump chamber communicating with the fuel passage and the larger diameter bore section together with the end face of the larger diameter plunger section defines a main fuel chamber into which a main fuel is supplied from the fuel injection pump; auxiliary fuel supply means for supplying an auxiliary fuel into the sump chamber and pump chamber through the fuel passage; valve means for opening and closing an injection hole; communication means for permitting the main fuel chamber to communicate with the fuel passage when the main fuel is supplied from the injection pump into the main fuel chamber to cause the stepped plunger to be moved a predetermined distance in a direction in which the auxiliary fuel in the pump chamber is pressurized.

  20. Simulation based flow distribution network optimization for vacuum assisted resin transfer moulding process

    NASA Astrophysics Data System (ADS)

    Hsiao, Kuang-Ting; Devillard, Mathieu; Advani, Suresh G.

    2004-05-01

    In the vacuum assisted resin transfer moulding (VARTM) process, using a flow distribution network such as flow channels and high permeability fabrics can accelerate the resin infiltration of the fibre reinforcement during the manufacture of composite parts. The flow distribution network significantly influences the fill time and fill pattern and is essential for the process design. The current practice has been to cover the top surface of the fibre preform with the distribution media with the hope that the resin will flood the top surface immediately and penetrate through the thickness. However, this approach has some drawbacks. One is when the resin finds its way to the vent before it has penetrated the preform entirely, which results in a defective part or resin wastage. Also, if the composite structure contains ribs or inserts, this approach invariably results in dry spots. Instead of this intuitive approach, we propose a science-based approach to design the layout of the distribution network. Our approach uses flow simulation of the resin into the network and the preform and a genetic algorithm to optimize the flow distribution network. An experimental case study of a co-cured rib structure is conducted to demonstrate the design procedure and validate the optimized flow distribution network design. Good agreement between the flow simulations and the experimental results was observed. It was found that the proposed design algorithm effectively optimized the flow distribution network of the part considered in our case study and hence should prove to be a useful tool to extend the VARTM process to manufacture of complex structures with effective use of the distribution network layup.

  1. Material approximation of data smoothing and spline curves inspired by slime mould.

    PubMed

    Jones, Jeff; Adamatzky, Andrew

    2014-09-01

    The giant single-celled slime mould Physarum polycephalum is known to approximate a number of network problems via growth and adaptation of its protoplasmic transport network and can serve as an inspiration towards unconventional, material-based computation. In Physarum, predictable morphological adaptation is prevented by its adhesion to the underlying substrate. We investigate what possible computations could be achieved if these limitations were removed and the organism was free to completely adapt its morphology in response to changing stimuli. Using a particle model of Physarum displaying emergent morphological adaptation behaviour, we demonstrate how a minimal approach to collective material computation may be used to transform and summarise properties of spatially represented datasets. We find that the virtual material relaxes more strongly to high-frequency changes in data, which can be used for the smoothing (or filtering) of data by approximating moving average and low-pass filters in 1D datasets. The relaxation and minimisation properties of the model enable the spatial computation of B-spline curves (approximating splines) in 2D datasets. Both clamped and unclamped spline curves of open and closed shapes can be represented, and the degree of spline curvature corresponds to the relaxation time of the material. The material computation of spline curves also includes novel quasi-mechanical properties, including unwinding of the shape between control points and a preferential adhesion to longer, straighter paths. Interpolating splines could not directly be approximated due to the formation and evolution of Steiner points at narrow vertices, but were approximated after rectilinear pre-processing of the source data. This pre-processing was further simplified by transforming the original data to contain the material inside the polyline. These exemplary results expand the repertoire of spatially represented unconventional computing devices by demonstrating a

  2. Effect of different GRAS compounds in the control of apples blue mould.

    PubMed

    Venditti, T; Cubaiu, L; Ladu, G; D'Hallewin, G

    2013-01-01

    The most important pathogen for apples is Penicillium expansum that is the causal organism of blue mould. Postharvest losses are controlled with chemical fungicides such as TBZ but a growing concern for human health and a greater awareness for environmental conservation have multiplied the studies on new ecological technologies. In the search of new environment and consumer friendly technologies that can reduce toxic residues, the use of GRAS compounds represent a valid alternative to the use of synthetic postharvest fungicides. The aims of the present work were: (1) To evaluate the effectiveness of different GRAS compounds in the control of P. expansum in artificially inoculated fruit; (2) To assess the capability of injured and treated fruit with GRAS compounds, used alone or combined, to heal the wounds in order to resist to infection. Fruit was injured with a steel rod and after 1 hour was (1) Inoculated with the pathogen and after 24 hours treated or (2) Treated and after 24 hours inoculated. Treatments were performed with the following compounds: sodium bicarbonate (SBC), boric acid (BA) and calcium chloride (CC) by using a 1% solution for all of them. After 9 or 14 days fruit lesion diameters were assessed. In the trial (1) the combined treatment with BA and SBC was the most effective reducing the lesion diameter by 86.5% with respect to untreated fruit, after 9 days from infection. A good pathogen control was also obtained with BA used alone or combined with CC. When the treatment was performed before infection the best results were achieved with the combination of SBC and CC, with 87% of reduction of the lesion diameter. The addition of CC also reduced the lesion if combined with BA (66.8%). These preliminary results showed that GRAS compounds can be effective in reducing blue mold by a direct effect on the pathogen, and by modulating fruit responses enhancing host resistance.

  3. Synergic interactions between 2-deoxy-D-glucose and Candida saitoana enhances citrus green mould control.

    PubMed

    Arras, G; Pani, G; Molinu, M G; Dore, A; Venditti, T; Petretto, A; Marceddu, S; D'Hallewin, G

    2010-01-01

    The activity of 2-deoxy-D-gLucose (2-DG) alone or in combination with a biocontrol yeast (Candida saitoana, strain 8C) was evaluated in vitro and in vivo against citrus green mould (Penicillium digitatum Sacc.). The in vitro assays were performed on amended potato dextrose agar (PDA) containing 0, 1.5, 3.0, 6.0, 15.0, 30.0 or 60.0 mM of 2-DG. P. digitatum conidia were sown on the amended media and growth inhibition occurred starting from 6.0 mM. A nearly total inhibition of the growth and spore germination occurred with 60.0 mM of 2-DG. The antagonist was not affected by any of the 2-DG concentrations employed and the amended plates resulted well colonized within 2 d post-treatment. In vivo assays were carried out with 'Hamlin' oranges, inoculated with P. digitatum 24 h before treating with: the antagonist; the above reported concentrations of 2-DG, or by combining the two treatments. Seven days post-treatment the inhibition activity exerted by 3.0, 6.0, 15.0, 30.0 and 60.0 mM of 2-DG combined with the yeast was 15, 37, 42, 63 and 84%, respectively. While that exerted by the antagonist was 22% and that by the different concentrations of 2-DG were 7, 11, 27, 42 and 57%, respectively. Compared to single treatments, the co-application significantly and in a synergic mode improved the control of decay. Alterations to the hyphae were observed by SEM when the pathogen was cultured on amended media and into the wounds of inoculated oranges.

  4. Clinical considerations in the early treatment of invasive mould infections and disease.

    PubMed

    Mercier, Toine; Maertens, Johan

    2017-03-01

    Different therapeutic strategies for invasive fungal diseases have been explored, each with particular strengths and weaknesses. Broad-spectrum antifungal prophylaxis seems logical, but selective use is important due to its substantial disadvantages, including interference with diagnostic assays, selection for resistance, drug toxicity and drug-drug interactions. Antimould prophylaxis should be restricted to high-risk groups, such as patients undergoing intensive chemotherapy for acute myeloid leukaemia or myelodysplastic syndrome, allogeneic HSCT patients with prior invasive fungal infection, graft-versus-host-disease or extended neutropenia, recipients of a solid organ transplant, or patients with a high-risk inherited immunodeficiency. An empirical approach, whereby mould-active therapy is started in neutropenic patients with fever unresponsive to broad-spectrum antibiotics, is widely applied but incurs the clinical and cost penalties associated with overtreatment. A benefit for all-cause mortality using empirical therapy has not been shown, but it is recommended for high-risk patients who remain febrile after 4-7 days of broad-spectrum antibiotics and in whom extended neutropenia is anticipated. There is growing interest in delaying antifungal treatment until an invasive fungal infection is confirmed ('pre-emptive' or 'diagnostics-driven' management), prompted by the development of more sensitive diagnostic techniques. Comparisons of empirical versus pre-emptive regimens are sparse, particularly with modern triazole agents, but treatment costs are lower with pre-emptive therapy and the available evidence has not indicated reduced efficacy. Pre-emptive treatment may be appropriate in neutropenic patients who remain febrile after administration of broad-spectrum antibiotics but who are clinically stable. Further work is required to define accurately the specific patient subgroups in which each management approach is optimal.

  5. Syringe injectable electronics

    PubMed Central

    Hong, Guosong; Zhou, Tao; Jin, Lihua; Duvvuri, Madhavi; Jiang, Zhe; Kruskal, Peter; Xie, Chong; Suo, Zhigang; Fang, Ying; Lieber, Charles M.

    2015-01-01

    Seamless and minimally-invasive three-dimensional (3D) interpenetration of electronics within artificial or natural structures could allow for continuous monitoring and manipulation of their properties. Flexible electronics provide a means for conforming electronics to non-planar surfaces, yet targeted delivery of flexible electronics to internal regions remains difficult. Here, we overcome this challenge by demonstrating syringe injection and subsequent unfolding of submicrometer-thick, centimeter-scale macroporous mesh electronics through needles with a diameter as small as 100 micrometers. Our results show that electronic components can be injected into man-made and biological cavities, as well as dense gels and tissue, with > 90% device yield. We demonstrate several applications of syringe injectable electronics as a general approach for interpenetrating flexible electronics with 3D structures, including (i) monitoring of internal mechanical strains in polymer cavities, (ii) tight integration and low chronic immunoreactivity with several distinct regions of the brain, and (iii) in vivo multiplexed neural recording. Moreover, syringe injection enables delivery of flexible electronics through a rigid shell, delivery of large volume flexible electronics that can fill internal cavities and co-injection of electronics with other materials into host structures, opening up unique applications for flexible electronics. PMID:26053995

  6. Fuel injection nozzle

    SciTech Connect

    Kato, M.; Nakatsuka, H.; Tojo, S.; Arai, K.

    1986-12-09

    A fuel injection nozzle is described which is adapted to be connected to a fuel injection pump and which serves to inject fuel into a combustion chamber in an internal combustion engine. The nozzle consists of: a body in which a suction passage and an accumulating chamber are defined, the suction passage being adapted to be connected with a fuel injection pump and the accumulating chamber being connected with the suction passage; a non-return valve means for allowing the fuel to flow from the suction passage to the accumulating chamber but prohibiting the fuel from flowing from the accumulating chamber to the suction passage; a needle valve means for injecting the fuel stored in the accumulating chamber into a combustion chamber in an engine, the needle valve means including a nozzle needle arranged coaxially and in series with the valve with end portions thereof being adjacent; a damping plunger coaxially fitted into the valve member in the manner that the damping plunger is urged toward the nozzle needle and has one end protruding into the damping chamber and engageable by the nozzle needle, throttle means disposed in the through hole in the damping plunger, for restricting the fuel flow between the damping chamber and the connector recess.

  7. Fuel injection pump

    SciTech Connect

    Luscomb, D.A.

    1984-05-22

    A fuel injection pump including a plunger and a piston movably disposed in a pumping chamber, means for initiating fuel injection and means for terminating fuel injection, the plunger periodically pressurizing fuel in a pressure chamber and the piston spaced from the plunger and allowing a metering chamber to fill with a metered quantity of fuel to be injected to an engine. The means for initiating injection comprises a pilot valve having a solenoid to selectively operate between either of two states and a control valve movable between first and second positions in response to the state of pilot valve, the first position filling the metering chamber with the metered quantity of fuel. The pilot valve determines the fuel quantity to be delivered to the engine relative to a signal from an electronic controller. An accumulator is pressurized during each cycle of the plunger to provide pressurized fuel during a metering phase. A variable orifice adjusts the rate of flow during the time fuel is being metered to metering chamber.

  8. Syringe-injectable electronics

    NASA Astrophysics Data System (ADS)

    Liu, Jia; Fu, Tian-Ming; Cheng, Zengguang; Hong, Guosong; Zhou, Tao; Jin, Lihua; Duvvuri, Madhavi; Jiang, Zhe; Kruskal, Peter; Xie, Chong; Suo, Zhigang; Fang, Ying; Lieber, Charles M.

    2015-07-01

    Seamless and minimally invasive three-dimensional interpenetration of electronics within artificial or natural structures could allow for continuous monitoring and manipulation of their properties. Flexible electronics provide a means for conforming electronics to non-planar surfaces, yet targeted delivery of flexible electronics to internal regions remains difficult. Here, we overcome this challenge by demonstrating the syringe injection (and subsequent unfolding) of sub-micrometre-thick, centimetre-scale macroporous mesh electronics through needles with a diameter as small as 100 μm. Our results show that electronic components can be injected into man-made and biological cavities, as well as dense gels and tissue, with >90% device yield. We demonstrate several applications of syringe-injectable electronics as a general approach for interpenetrating flexible electronics with three-dimensional structures, including (1) monitoring internal mechanical strains in polymer cavities, (2) tight integration and low chronic immunoreactivity with several distinct regions of the brain, and (3) in vivo multiplexed neural recording. Moreover, syringe injection enables the delivery of flexible electronics through a rigid shell, the delivery of large-volume flexible electronics that can fill internal cavities, and co-injection of electronics with other materials into host structures, opening up unique applications for flexible electronics.

  9. Storage ring injection

    SciTech Connect

    Burke, R.J.

    1980-01-01

    Some basic issues involved in injecting the beam into storage rings with the principal parameters of those studied at the workshop have been considered. The main conclusion is that straightforward adjustments of the storage ring parameters makes injection easy. The largest number of injected turns is fourteen, and the phase space dilution allowance seems adequate to ensure very small beam loss during injection. The adjustments also result in lower bending magnet fields, and high field superconducting magnets (e.g., 5 Tesla) are not necessary. The design changes do not necessarily affect the Keil-Schnell criterion for stability of the longitudinal microwave instability, although that criterion appears to be irrelevant. Because the beams are expected to be unstable, but with slow growth rates, the vacuum chamber impedances required to give equal risetimes for the various designs are compared for systems posing various degrees of difficulty for injection. Finally, the impact of the parameters on cost is noted, and a system is considered that cuts the length of the linac in half by using doubly charged ions.

  10. Syringe-injectable electronics.

    PubMed

    Liu, Jia; Fu, Tian-Ming; Cheng, Zengguang; Hong, Guosong; Zhou, Tao; Jin, Lihua; Duvvuri, Madhavi; Jiang, Zhe; Kruskal, Peter; Xie, Chong; Suo, Zhigang; Fang, Ying; Lieber, Charles M

    2015-07-01

    Seamless and minimally invasive three-dimensional interpenetration of electronics within artificial or natural structures could allow for continuous monitoring and manipulation of their properties. Flexible electronics provide a means for conforming electronics to non-planar surfaces, yet targeted delivery of flexible electronics to internal regions remains difficult. Here, we overcome this challenge by demonstrating the syringe injection (and subsequent unfolding) of sub-micrometre-thick, centimetre-scale macroporous mesh electronics through needles with a diameter as small as 100 μm. Our results show that electronic components can be injected into man-made and biological cavities, as well as dense gels and tissue, with >90% device yield. We demonstrate several applications of syringe-injectable electronics as a general approach for interpenetrating flexible electronics with three-dimensional structures, including (1) monitoring internal mechanical strains in polymer cavities, (2) tight integration and low chronic immunoreactivity with several distinct regions of the brain, and (3) in vivo multiplexed neural recording. Moreover, syringe injection enables the delivery of flexible electronics through a rigid shell, the delivery of large-volume flexible electronics that can fill internal cavities, and co-injection of electronics with other materials into host structures, opening up unique applications for flexible electronics.

  11. Fuel injection pump

    SciTech Connect

    Hishinuma, O.; Masuda, A.; Ohmori, T.; Miyaki, M.; Takemoto, E.

    1987-06-09

    This patent describes a fuel injection pump for an internal combustion engine comprising: a housing having a cylindrical inner surface; a shaft having a portion disposed in rotatably sliding engagement with the cylindrical inner surface and having a first axial bore and a second radial bore therein; at least one pumping plunger slidably disposed in the second radial bore to cooperate therewith to define a compression chamber; a pumping plunger is adapted to be moved in the second radial bore to vary the volume of the compression chamber; an injection plunger slidably disposed in the first axial, bore to cooperate in defining the first and second pressure chambers separated from each other by the injection plunger.

  12. Characterization of 430L porous supports obtained by powder extrusion moulding for their application in solid oxide fuel cells

    SciTech Connect

    Sotomayor, María Eugenia Ospina, Liliana María Levenfeld, Belén Várez, Alejandro

    2013-12-15

    The characterization of 430L stainless steel planar porous supports obtained by powder extrusion moulding was performed in this work. A thermoplastic multicomponent binder based on high density polyethylene and paraffin wax was selected for the process. Green supports were shaped by extrusion moulding, and subsequently the binder was removed by a thermal cycle previously optimized. Sintering was carried out at different temperatures in low vacuum. Density of sintered parts was measured by Archimedes' method and porosity was also evaluated through a microstructural analysis by optical microscopy. The porosity degree of samples sintered at low temperature was close to 35% which is a very suitable value for their application in SOFCs. Tensile tests were carried out in order to determine mechanical strength as a function of porosity degree. Based on these results, the best feedstock composition and processing parameters were selected. The oxidation behaviour in static air at high temperature was studied, and formed oxides were characterized in a scanning electron microscope equipped with energy dispersive analysis of X-rays. X-ray diffraction experiments were performed in order to identify the formed oxides based on formula Fe{sub 2−x}Cr{sub x}O{sub 3}. The results of these studies showed that this kind of ferritic stainless steel would be more suitable to be used as anodic supports where a rich hydrogen atmosphere is employed. Preliminary deposition tests allowed obtaining a homogeneous Ni–YSZ anode layer with a thickness of 10 μm on the porous metallic substrates. - Highlights: • 430L stainless steel porous supports were obtained by powder extrusion moulding. • Porosity degree was controlled sintering at different temperatures in low vacuum. • Tensile tests allowed determining mechanical strength of porous supports. • A study about its oxidation behaviour in static air at high temperature was realized. • After oxidation, formed oxides were

  13. The ultrahigh precision form measurement of small, steep-sided aspheric moulds, incorporating novel hardware and software developments; Technical Digest

    NASA Astrophysics Data System (ADS)

    Mills, M. W.; Hutchinson, Matthew J.

    2005-05-01

    A variety of consumer applications, eg cellphone camera lenses, optical storage devices, digital cameras, etc, are driving the demand for small, high aspheric departure rotationally-symmetric moulded optics, manufactured both in polymer and glass materials. The mould tools for such components are manufactured by ultra-high precision techniques such as single point diamond turning and ultra-precision grinding, and must be accurate to <1/10μm levels for form, and exhibit nanometric surface finish quality. The aspheric forms of such components" optical surfaces exhibit high departure from best-fit sphere towards their outer edge, which renders this outer region especially critical for optical performance. The high slope of these components at the clear aperture has caused some restrictions on the use of profilometry in the measurement of form across their full diameter. Taylor Hobson designs and manufactures a range of ultra-precision profilometers for use in such industries as aspheric optics fabrication. In order to address the issues described, a new measurement system, Taylor Hobson Form Talysurf PGI 1250, has been developed, which contains new Aspheric Data Fusion Software, as well as Asphero-Diffractive Analysis Software, allowing the entire diametric profile to be analysed to the desired level of accuracy. This development removes the previous limitation of maximum slope for this type of measurement, thus enabling better quality control of high slope, high aspheric departure optics. Measurement data from the Form Talysurf PGI 1250 can be fed back directly to the machine tool, in order to optimize the form of the optical mould.

  14. Water Injected Turbomachinery

    NASA Technical Reports Server (NTRS)

    Hendricks, R. C.; Shouse, D. T.; Roquemore, W. M.

    2005-01-01

    From antiquity, water has been a source of cooling, lubrication, and power for energy transfer devices. More recent applications in gas turbines demonstrate an added facet, emissions control. Fogging gas turbine inlets or direct injection of water into gas turbine combustors, decreases NOx and increases power. Herein we demonstrate that injection of water into the air upstream of the combustor reduces NOx by factors up to three in a natural gas fueled Trapped Vortex Combustor (TVC) and up to two in a liquid JP-8 fueled (TVC) for a range in water/fuel and fuel/air ratios.

  15. Inverse problem for the solidification of binary alloy in the casting mould solved by using the bee optimization algorithm

    NASA Astrophysics Data System (ADS)

    Hetmaniok, Edyta

    2016-07-01

    In this paper the procedure for solving the inverse problem for the binary alloy solidification in the casting mould is presented. Proposed approach is based on the mathematical model suitable for describing the investigated solidification process, the lever arm model describing the macrosegregation process, the finite element method for solving the direct problem and the artificial bee colony algorithm for minimizing the functional expressing the error of approximate solution. Goal of the discussed inverse problem is the reconstruction of heat transfer coefficient and distribution of temperature in investigated region on the basis of known measurements of temperature.

  16. Fuel injection device

    SciTech Connect

    Ohmori, T.; Nakatsuka, H.; Kanou, H.

    1987-03-31

    A fuel injection device is described for injecting fuel into a combustion chamber of an internal combustion engine, comprising: a body having first and second bores formed therein and extending in the axial direction thereof; a delivering plunger fitted into the first bore and defining a delivering pump chamber therein; driving means for reciprocating the delivering plunger in synchronism to the engine; pressurized medium supplying means for supplying a pressurized medium under a constant pressure to the delivering pump chamber, the pressurized medium supplying means including a pressurized medium source and a control passage linking the pressurized medium source to the delivering pump chamber; an electromagnetic valve provided on the control passage for opening and closing the control passage; and an injection plunger fitted into the second bore and defining, in the second bore, a linking chamber communicating with the delivering pump chamber and an injection pump chamber, the linking chamber and the delivering chamber becoming a liquid-tight chamber when the electromagnetic valve closes the control passage.

  17. Penicillin G Procaine Injection

    MedlinePlus

    ... if you have or have ever had asthma, allergies, hay fever, hives, or kidney disease.tell your doctor if you are pregnant, plan to become pregnant, or are breastfeeding. If you become pregnant while receiving penicillin G procaine injection, call your doctor.

  18. Penicillin G Benzathine Injection

    MedlinePlus

    ... if you have or have ever had asthma, allergies, hay fever, hives, or kidney disease.tell your doctor if you are pregnant, plan to become pregnant, or are breastfeeding. If you become pregnant while receiving penicillin G benzathine injection, call your doctor.

  19. More than just someone to inject drugs with: injecting within primary injection partnerships

    PubMed Central

    Morris, Meghan D.; Bates, Anna; Andrew, Erin; Hahn, Judith; Page, Kimberly; Maher, Lisa

    2015-01-01

    Background Studies have shown intimate injection partners engage in higher rates of syringe and injecting equipment sharing. We examined the drug use context and development of injection drug use behaviors within intimate injection partnerships. Methods In-depth interviews (n=18) were conducted with both members of nine injecting partnerships in Sydney, Australia. Content analysis identified key domains related to the reasons for injecting with a primary injection partner and development of drug injection patterns. Main Findings Most partnerships (n=5) were also sexual; three were blood-relatives and one a friend dyad. The main drug injected was heroin (66%) with high rates of recent sharing behaviors (88%) reported within dyads. Injecting within a primary injection partnership provided perceived protection against overdose events, helped reduce stress, increased control over when, where, and how drugs were used, and promoted the development of an injecting pattern where responsibilities could be shared. Unique to injecting within primary injection partnerships was the social connection and companionship resulted in a feeling of fulfillment while also blinding one from recognizing risky behavior. Conclusions Findings illuminated the tension between protection and risks within primary injection partnerships. Primary injection partnerships provide a potential platform to expand risk reduction strategies. PMID:26460140

  20. Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.

    PubMed

    Li, Wen; Xu, You-Ping; Cai, Xin-Zhong

    2016-01-29

    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.

  1. Combination of Pichia membranifaciens and ammonium molybdate for controlling blue mould caused by Penicillium expansum in peach fruit.

    PubMed

    Cao, Shifeng; Yuan, Yongjun; Hu, Zhichao; Zheng, Yonghua

    2010-07-15

    The potential enhancement of Pichia membranifaciens by ammonium molybdate (NH(4)Mo) to control blue mould caused by Penicillium expansum on peach fruit was investigated. Combining P. membranifaciens at 1x10(8) cell/ml with 1 mM NH(4)Mo provided a more effective control of blue mould rot than applying the yeast or NH(4)Mo alone. Addition of 1 mM NH(4)Mo significantly increased the growth of P. membranifaciens in peach wounds, but did not affect the population in nutrient yeast dextrose broth medium. The in vitro experiment showed that the combined treatment inhibited spore germination and germ tube elongation of P. expansum in comparison with the treatment of P. membranifaciens or NH(4)Mo alone. Moreover, P. membranifaciens, NH(4)Mo, and the combination of them did not impair the quality parameters including fruit firmness and content of total soluble solids, titratable acidity and vitamin C of peach fruit after 6 days of storage at 20 degrees C. These results suggested that the use of NH(4)Mo is a useful approach to improve the efficacy of P. membranifaciens for postharvest disease control in peach fruit.

  2. Sclerotia of the acellular (true) slime mould Fuligo septica as a model to study melanization and anabiosis.

    PubMed

    Krzywda, Anna; Petelenz, Elzbieta; Michalczyk, Dominika; Płonka, Przemysław M

    2008-01-01

    Acellular (true) slime moulds (Myxomycetes) are capable of a transition to the stage of sclerotium - a dormant form of plasmodium produced under unfavourable environmental conditions. In this study, sclerotia of Fuligo septica were analyzed by means of electron paramagnetic resonance (EPR) spectroscopy. The moulds were cultivated in vitro on filter paper, fed with oat flour, and kept until the plasmodia began to produce sclerotia. The obtained sclerotia differed in colour from yellow through orange to dark-brown. The EPR spectra revealed a free radical, melanin-like signal correlated with the depth of the colour; it was strongest in the dark sclerotia. Sclerotization only took place when the plasmodia were starved and very slowly dried. Only the yellow sclerotia were able to regenerate into viable plasmodia. This suggests that myxomycete cytoplasm dehydration is an active process regulated metabolically. Plasmodial sclerotization may therefore serve as a convenient model system to study the regulation of cytoplasmatic water balance, and sclerotia as a convenient material for EPR measurements, combining the quality of plasmodia with the technical simplicity of the measurements characteristic of dry spores. Darkening of the sclerotia is most probably a pathological phenomenon connected with the impairment of water balance during sclerotization.

  3. The Ability of the Antagonist Yeast Pichia Guilliermondii Strain Z1 to Suppress Green Mould Infection in Citrus Fruit

    PubMed Central

    Hamadi, Younes; El Guilli, Mohammed; Jijakli, M. Haissam

    2014-01-01

    In previous studies it was shown that Pichia guilliermondii strain Z1, isolated from healthy Moroccan citrus Valencia-Late oranges, was effective against Penicillium italicum. Here the effectiveness of strain Z1 was assessed against Penicillium digitatum, the causal agent of green mould, under different temperature (5-25°C) and relative humidity (RH) (45-100%) regimes for its reliable and large-scale application in packinghouse. All main effects and interactions were significant (P<0.0001). In the pathogen control, the largest lesion diameter was at an RH range between 98 and 100%, regardless of the incubation temperature. The efficacy of strain Z1 was not dependent on the environment and reduced disease incidence by >80%. Its applications as a formulated product significantly reduced the incidence of infected fruit (55%) and the percentage of infected wounds (47%) compared to the only pathogen control treatment. However, disease control with formulated product was significantly less than that obtained with thiabendazole (30%) or strain Z1 culturable cells (35%). These results highlight that strain Z1 is an effective biological control agent for control of green mould under varying environmental conditions, and control may be optimized by combining its use with other environmentally-safe post-harvest treatments or improved formulation. PMID:27800373

  4. Investigation of the dynamics of growth of polymer materials obtained by combined pervaporation and micro-moulding.

    PubMed

    Laval, Cédric; Poulin, Philippe; Salmon, Jean-Baptiste

    2016-02-14

    We report an extensive study of the concentration process of aqueous polymer solutions confined within microfluidic channels, owing to the pervaporation of water through the matrix of the chip. Concentration of polymer continuously increases up to the formation of a dense material which eventually invades the channel. This technology can be used to fabricate micro-composites of different shapes starting from dilute inks. We use both theory and screening experiments to show that the dynamics of growth can be predicted by simple conservation equations. More precisely, we establish a quantitative prediction of the growth dynamics taking into account deformations of the soft channels of the moulds, and the solvent chemical activity of the polymer solution. The present results based on general transport equations for binary mixtures provide direct guidance for the design of micro-fabricated materials considering their shape, dimensions, time scale of fabrication, and chemical composition. This quantitative framework is indeed essential to engineer integrated polymer-based micro-devices by using combined pervaporation and microfluidic moulding.

  5. Rapid identification of moulds and arthroconidial yeasts from positive blood cultures by MALDI-TOF mass spectrometry.

    PubMed

    de Almeida, João N; Sztajnbok, Jaques; da Silva, Afonso Rafael; Vieira, Vinicius Adriano; Galastri, Anne Layze; Bissoli, Leandro; Litvinov, Nadia; Del Negro, Gilda Maria Barbaro; Motta, Adriana Lopes; Rossi, Flávia; Benard, Gil

    2016-11-01

    Moulds and arthroconidial yeasts are potential life-threatening agents of fungemia in immunocompromised patients. Fast and accurate identification (ID) of these pathogens hastens initiation of targeted antifungal therapy, thereby improving the patients' prognosis. We describe a new strategy that enabled the identification of moulds and arthroconidial yeasts directly from positive blood cultures by MALDI-TOF mass spectrometry (MS). Positive blood cultures (BCs) with Gram staining showing hyphae and/or arthroconidia were prospectively selected and submitted to an in-house protein extraction protocol. Mass spectra were obtained by Vitek MS™ system, and identifications were carried out with in the research use only (RUO) mode with an extended database (SARAMIS™ [v.4.12] plus in-house database). Fusarium solani, Fusarium verticillioides, Exophiala dermatitidis, Saprochaete clavata, and Trichosporon asahii had correct species ID by MALDI-TOF MS analysis of positive BCs. All cases were related to critically ill patients with high mortality fungemia and direct ID from positive BCs was helpful for rapid administration of targeted antifungal therapy.

  6. Ink-jet printing technology enables self-aligned mould patterning for electroplating in a single step

    NASA Astrophysics Data System (ADS)

    Meissner, M. V.; Spengler, N.; Mager, D.; Wang, N.; Kiss, S. Z.; Höfflin, J.; While, P. T.; Korvink, J. G.

    2015-06-01

    We present a new self-aligned, mask-free micro-fabrication method with which to form thick-layered conductive metal micro-structures inside electroplating moulds. Seed layer patterning for electroplating was performed by ink-jet printing using a silver nano-particle ink deposited on SU-8 or Ordyl SY permanent resist. The silver ink contact angle on SU-8 was adjusted by oxygen plasma followed by a hard bake. Besides functioning as a seed layer, the printed structures further served as a shadow mask during patterning of electroplating moulds into negative photoresist. The printed silver tracks remained in strong adhesion to the substrate when exposed to the acidic chemistry of the electroplating bath. To demonstrate the process, we manufactured rectangular, low-resistivity planar micro-coils for use in magnetic resonance microscopy. MRI images of a spring onion with an in-plane resolution down to 10 µm × 10 µm were acquired using a micro-coil on an 11.7 T MRI scanner.

  7. The Ability of the Antagonist Yeast Pichia Guilliermondii Strain Z1 to Suppress Green Mould Infection in Citrus Fruit.

    PubMed

    Lahlali, Rachid; Hamadi, Younes; El Guilli, Mohammed; Jijakli, M Haissam

    2014-12-09

    In previous studies it was shown that Pichia guilliermondii strain Z1, isolated from healthy Moroccan citrus Valencia-Late oranges, was effective against Penicillium italicum. Here the effectiveness of strain Z1 was assessed against Penicillium digitatum, the causal agent of green mould, under different temperature (5-25°C) and relative humidity (RH) (45-100%) regimes for its reliable and large-scale application in packinghouse. All main effects and interactions were significant (P<0.0001). In the pathogen control, the largest lesion diameter was at an RH range between 98 and 100%, regardless of the incubation temperature. The efficacy of strain Z1 was not dependent on the environment and reduced disease incidence by >80%. Its applications as a formulated product significantly reduced the incidence of infected fruit (55%) and the percentage of infected wounds (47%) compared to the only pathogen control treatment. However, disease control with formulated product was significantly less than that obtained with thiabendazole (30%) or strain Z1 culturable cells (35%). These results highlight that strain Z1 is an effective biological control agent for control of green mould under varying environmental conditions, and control may be optimized by combining its use with other environmentally-safe post-harvest treatments or improved formulation.

  8. Mould incidence and mycotoxin contamination in maize kernels from Swat Valley, North West Frontier Province of Pakistan.

    PubMed

    Shah, Hamid Ullah; Simpson, Thomas J; Alam, Sahib; Khattak, Khanzadi Fatima; Perveen, Sajida

    2010-04-01

    Mould incidence and aflatoxin B1 (AFB1) and ochratoxin A (OTA) contamination as well as proximate composition and minerals content of maize kernels from Swat Valley, North West Frontier Province of Pakistan was studied during the year, 2007. Results indicated that the mean moisture content of the kernels was within the recommended safe storage levels of 15%. Across the whole valley, Aspergillus, Fusarium, Penicillium and Rhizopus were the most predominant fungal genera identified and amongst the mycotoxigenic species, Aspergillus flavus had the highest incidence. AFB1 content ranged from none to 30.92 microg/kg with the average values of 14.94 and 16.22 microg/kg for Upper and Lower Swat regions, respectively. Similar trend was observed for OTA with the contamination level ranged from <0.001 to 7.32 microg/kg. A significant numbers of samples contained AFB1 and OTA levels above the safe limits as recommended by the USFDA and EU but on the average the results were within the safe limit. These results indicate that maize consumers in Swat Valley may be exposed to the danger of aflatoxins and ochratoxins poisoning. Thus, there is a need for policy makers to establish and enforce maize quality standards and regulations related to moulds and mycotoxins across the area.

  9. Injection-controlled laser resonator

    DOEpatents

    Chang, Jim J.

    1995-07-18

    A new injection-controlled laser resonator incorporates self-filtering and self-imaging characteristics with an efficient injection scheme. A low-divergence laser signal is injected into the resonator, which enables the injection signal to be converted to the desired resonator modes before the main laser pulse starts. This injection technique and resonator design enable the laser cavity to improve the quality of the injection signal through self-filtering before the main laser pulse starts. The self-imaging property of the present resonator reduces the cavity induced diffraction effects and, in turn, improves the laser beam quality.

  10. Injection-controlled laser resonator

    DOEpatents

    Chang, J.J.

    1995-07-18

    A new injection-controlled laser resonator incorporates self-filtering and self-imaging characteristics with an efficient injection scheme. A low-divergence laser signal is injected into the resonator, which enables the injection signal to be converted to the desired resonator modes before the main laser pulse starts. This injection technique and resonator design enable the laser cavity to improve the quality of the injection signal through self-filtering before the main laser pulse starts. The self-imaging property of the present resonator reduces the cavity induced diffraction effects and, in turn, improves the laser beam quality. 5 figs.

  11. INJECTION-MOLDING APPARATUS

    DOEpatents

    Lobell, G.M.

    1958-02-11

    This patent is drawn to an injection molding apparatus for producing a tube closed at one end wherein the normally unsupported end of the core located in the cavity during the injection of the molten material to fill the space between the core and cavity wall, which supporting means is automatically removed from operation during the forming of the closed end of the tube. This support means is a plug extending through the end of the core into a recess in the bottom of the cavity where the closed end of the tube is to be formed. The plug is spring pressed into said recess and is forced out of the recess by a slidable bushing at the top of the cavity which is moved against the force of the spring by the molten material when it fills the uppormost open end portion of the cavity, thereby permitting the closed end of the tube to be formed.

  12. Injectable nanocarriers for biodetoxification

    NASA Astrophysics Data System (ADS)

    Leroux, Jean-Christophe

    2007-11-01

    Hospitals routinely treat patients suffering from overdoses of drugs or other toxic chemicals as a result of illicit drug consumption, suicide attempts or accidental exposures. However, for many life-threatening situations, specific antidotes are not available and treatment is largely based on emptying the stomach, administering activated charcoal or other general measures of intoxication support. A promising strategy for managing such overdoses is to inject nanocarriers that can extract toxic agents from intoxicated tissues. To be effective, the nanocarriers must remain in the blood long enough to sequester the toxic components and/or their metabolites, and the toxin bound complex must also remain stable until it is removed from the bloodstream. Here, we discuss the principles that govern the use of injectable nanocarriers in biodetoxification and review the pharmacological performance of a number of different approaches.

  13. SPEAR 3 INJECTION KICKER

    SciTech Connect

    Armett, Donald W.

    2002-08-20

    The design of the SPEAR 3 injection kicker system is presented. This system will include three kicker magnets and their associated pulsers. The magnet design is based on the DELTA kicker magnets, which present a low RF impedance to the beam, and are relatively straight-forward to construct. The pulsers use cascaded IGBT stages that are based on the modulator pulsers developed by a SLAC/LLNL collaboration for the NLC. Design considerations and the results of prototype tests will be discussed.

  14. Workshop on injectable contraceptives.

    PubMed

    1994-01-01

    At a workshop in Dhaka on February 10, 1994, district and thana level managers discussed the problems associated with a project that delivers injectable contraceptives to the doorsteps of clients. The workshop, which was organized by the Bangladesh government and the Maternal and Child Health-Family Planning (MCH-FP) Extension Project of the International Centre for Diarrhoeal Disease Research, Bangladesh (ICDDR,B), identified lack of appropriate training, inefficient supervision, and inadequate knowledge about and facilities for the disposal of used syringes and needles as problems. There was agreement among participants that use of the injectables, depot medroxyprogesterone acetate (DMPA) and norethisterone enanthate (NET-EN), had led to increases in contraceptive use. The 6-month old project had been initiated in 8 thanas by the Directorate of Family Planning of the government of Bangladesh, with the technical assistance of the MCH-FP Extension Project, after ICDDR,B noticed that the rates of use for all types of contraceptives had increased in the rural areas of Matlab, Abhoynagar, and Sirajganj with doorstep delivery by field workers. During the same period, use of injectables that were offered by female paramedics at static centers had remained low. At the workshop, Dr. Rushikesh Maru of the Extension Project spoke about the effective administration of the injectables within 15 days before or after the due date. Mr. AKM Rafiquz Zaman, former director general of Family Planning, government of Bangladesh, requested further expansion in at least 1 thana of each district and in all municipalities and urban slums.

  15. Magnetron injection gun scaling

    NASA Astrophysics Data System (ADS)

    Lawson, W.

    1988-04-01

    A set of tradeoff equations was simplified to obtain scaling laws for magnetron injection guns (MIGs). The constraints are chosen to examine the maximum-peak-power capabilities of MIGs. The scaling laws are compared with exact solutions of the design equations and are supported by MIG simulations in which each MIG is designed to double the beam power of an existing design by adjusting one of the four fundamental parameters.

  16. Alkaline flooding injection strategy

    SciTech Connect

    French, T.R.; Josephson, C.B.

    1992-03-01

    The objective of this project is to improved alkali-surfactant flooding methods, and this includes determining the proper design of injection strategy. Several different injection strategies have been used or suggested for recovering heavy oils with surfactant-enhanced alkaline flooding methods. Oil recovery was compared for four different injection strategies: (1) surfactant followed by polymer, (2) surfactant followed by alkaline polymer, (3) alkaline surfactant followed by polymer, and (4) alkali, surfactant, and polymer mixed in a single formulation. The effect of alkaline preflush was also studied under two different conditions. All of the oil recovery experiments were conducted under optimal conditions with a viscous, non-acidic oil from Hepler (KS) oil field. The coreflood experiments were conducted with Berea sandstone cores since field core was not available in sufficient quantity for coreflood tests. The Tucker sand of Hepler field is a Class I fluvial dominated deltaic reservoir, as classified by the Department of Energy, which has been selected as the site of a DOE-sponsored field pilot test.

  17. Air injection system diagnostic

    SciTech Connect

    Kotzan, J.M.; Labus, G.E.

    1992-05-19

    This patent describes a method for diagnosing failures in an air control system that controls a quantity of air admitted into an exhaust path of an internal combustion engine. It comprises sensing the oxygen content of the exhaust gas of the engine at predetermined time intervals at a first predetermined point in the exhaust path of the engine, the oxygen content normally oscillating between a rich oxygen condition and a lean oxygen condition in the absence of air injected into the exhaust path above the first predetermined point; injecting a quantity of air into the exhaust path of the engine at a second predetermined point in the exhaust port, the second predetermined point being above the first predetermined point; counting the number of intervals at which the sensed oxygen content indicates a rich oxygen condition over a predetermined period of time; comparing the counted number of rich oxygen intervals to a predetermined threshold value, the threshold value being greater than a counted number of rich oxygen intervals over the predetermined period of time resulting from the normal oscillations between rich and lean oxygen conditions in the absence of air injected into the exhaust path; indicating the existence of a fault in the air control system when the number of rich oxygen intervals does not exceed the predetermined threshold value.

  18. Injection-induced earthquakes.

    PubMed

    Ellsworth, William L

    2013-07-12

    Earthquakes in unusual locations have become an important topic of discussion in both North America and Europe, owing to the concern that industrial activity could cause damaging earthquakes. It has long been understood that earthquakes can be induced by impoundment of reservoirs, surface and underground mining, withdrawal of fluids and gas from the subsurface, and injection of fluids into underground formations. Injection-induced earthquakes have, in particular, become a focus of discussion as the application of hydraulic fracturing to tight shale formations is enabling the production of oil and gas from previously unproductive formations. Earthquakes can be induced as part of the process to stimulate the production from tight shale formations, or by disposal of wastewater associated with stimulation and production. Here, I review recent seismic activity that may be associated with industrial activity, with a focus on the disposal of wastewater by injection in deep wells; assess the scientific understanding of induced earthquakes; and discuss the key scientific challenges to be met for assessing this hazard.

  19. Snowplow Injection Front Effects

    NASA Technical Reports Server (NTRS)

    Moore, T. E.; Chandler, M. O.; Buzulukova, N.; Collinson, G. A.; Kepko, E. L.; Garcia-Sage, K. S.; Henderson, M. G.; Sitnov, M. I.

    2013-01-01

    As the Polar spacecraft apogee precessed through the magnetic equator in 2001, Polar encountered numerous substorm events in the region between geosynchronous orbit and 10 RE geocentric distance; most of them in the plasma sheet boundary layers. Of these, a small number was recorded near the neutral sheet in the evening sector. Polar/Thermal Ion Dynamics Experiment provides a unique perspective on the lowest-energy ion plasma, showing that these events exhibited a damped wavelike character, initiated by a burst of radially outward flow transverse to the local magnetic field at approximately 80 km/s. They then exhibit strongly damped cycles of inward/outward flow with a period of several minutes. After one or two cycles, they culminated in a hot plasma electron and ion injection, quite similar to those observed at geosynchronous orbit. Cold plasmaspheric plasmas comprise the outward flow cycles, while the inward flow cycles contain counterstreaming field-parallel polar wind-like flows. The observed wavelike structure, preceding the arrival of an earthward moving substorm injection front, suggests an outward displacement driven by the inward motion at local times closer to midnight, that is, a "snowplow" effect. The damped in/out flows are consistent with interchange oscillations driven by the arrival at the observed local time by an injection originating at greater radius and local time.

  20. Injection-induced earthquakes

    USGS Publications Warehouse

    Ellsworth, William L.

    2013-01-01

    Earthquakes in unusual locations have become an important topic of discussion in both North America and Europe, owing to the concern that industrial activity could cause damaging earthquakes. It has long been understood that earthquakes can be induced by impoundment of reservoirs, surface and underground mining, withdrawal of fluids and gas from the subsurface, and injection of fluids into underground formations. Injection-induced earthquakes have, in particular, become a focus of discussion as the application of hydraulic fracturing to tight shale formations is enabling the production of oil and gas from previously unproductive formations. Earthquakes can be induced as part of the process to stimulate the production from tight shale formations, or by disposal of wastewater associated with stimulation and production. Here, I review recent seismic activity that may be associated with industrial activity, with a focus on the disposal of wastewater by injection in deep wells; assess the scientific understanding of induced earthquakes; and discuss the key scientific challenges to be met for assessing this hazard.

  1. Interferon Alfa-2b Injection

    MedlinePlus

    ... medication either subcutaneously or intramuscularly three times a week. HBV, inject the medication either subcutaneously or intramuscularly three times a week usually for 16 weeks. hairy cell leukemia, inject ...

  2. Interferon Beta-1b Injection

    MedlinePlus

    ... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS, a disease in which ... interferon beta-1b injection at around the same time of day each time you inject it. Follow ...

  3. Peginterferon Beta-1a Injection

    MedlinePlus

    ... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS, a disease in which ... peginterferon beta-1a injection at around the same time of day each time you inject it. Follow ...

  4. Steroid injections - tendon, bursa, joint

    MedlinePlus

    ... ency/article/007678.htm Steroid injections - tendon, bursa, joint To use the sharing features on this page, ... often painful. It can be injected into a joint, tendon, or bursa. Description Your health care provider ...

  5. Amphotericin B Lipid Complex Injection

    MedlinePlus

    Amphotericin B lipid complex injection is used to treat serious, possibly life-threatening fungal infections in people who did ... respond or are unable to tolerate conventional amphotericin B therapy. Amphotericin B lipid complex injection is in ...

  6. Gaseous Fuel Injection Modeling using a Gaseous Sphere Injection Methodology

    SciTech Connect

    Hessel, R P; Aceves, S M; Flowers, D L

    2006-03-06

    The growing interest in gaseous fuels (hydrogen and natural gas) for internal combustion engines calls for the development of computer models for simulation of gaseous fuel injection, air entrainment and the ensuing combustion. This paper introduces a new method for modeling the injection and air entrainment processes for gaseous fuels. The model uses a gaseous sphere injection methodology, similar to liquid droplet in injection techniques used for liquid fuel injection. In this paper, the model concept is introduced and model results are compared with correctly- and under-expanded experimental data.

  7. Indigenous technique of fabricating vaginal mould for vaginal reconstruction and uterine drainage in McIndoe vaginoplasty using 10 ml syringe.

    PubMed

    Mishra, Brijesh; Janavar, Gaurav; Pradeep, Yashodhara; Singh, Arun K; Kumar, Vijay; Upadhyay, Divya N

    2016-01-01

    Absence of vagina poses multitude of physical and psychosocial problems in woman's life. 10% of Mayer- Rokitansky-üster-Hauser (MRKH) syndrome patients with high vaginal septum and vaginal atreisa has additional issue of draining uterine cavity. MC Indoe vaginoplasty is universally acceptable and widely practiced procedure for neocolposis reconstruction. Simultaneous reconstruction of vagina with simultaneous continued uterine drainage presents surgical challenge. We offer a simple solution of creating a vaginal mould using a 10 ml disposable syringe, which enables graft application of neovaginal cavity with simultaneous protected uterine drainage per vaginum. Total 10 patients were included in this study of which 4 needed uterine drainage procedure in addition to neovaginal creation. All the patients fared well, there were no problems regarding graft loss or vaginal mould extrusion etc. Fabrication of mould for graft enables easy dressing changes with out disturbing the skin graft. This innovation offers a simple easily reproducible and cheap way of fabricating vaginal mould for McIndoe vaginoplasty. It is especially useful for neovaginal graft application and simultaneous uterine drainage.

  8. The extreme xerophilic mould Xeromyces bisporus--growth and competition at various water activities.

    PubMed

    Leong, Su-Lin L; Pettersson, Olga Vinnere; Rice, Therese; Hocking, Ailsa D; Schnürer, Johan

    2011-01-31

    Little is known about the mould, Xeromyces bisporus, unique in its strong xerophilicity and ability to grow at water activity (a(w)) 0.62, lower than for any other known organism. The linear growth rates of one fast and one slow-growing strain of X. bisporus were assessed at 20, 25, 30 and 37 °C on solid agar media containing a mixture of glucose and fructose to reduce a(w) to 0.94, 0.88, 0.84, 0.80, 0.76 and 0.66. Growth rates of xerophilic species closely related to X. bisporus, viz. Chrysosporium inops, C. xerophilum and Monascus eremophilus, were also assessed. Optimal conditions for growth of both X. bisporus strains were approx. 0.84 a(w) and 30°C, despite FRR 2347 growing two- to five-fold faster than CBS 185.75. X. bisporus FRR 2347 even grew well at 0.66 a(w) (0.48 mm/day). C. inops and C. xerophilum were more tolerant of high a(w) than X. bisporus, and could be differentiated from each other based on: the faster growth of C. xerophilum; its preference for temperatures ≥ 30 °C and a(w) ≥ 0.94 (c.f.≤ 25 °C and ~0.88 a(w) for C. inops); and its ability to grow at 0.66 a(w), which is the lowest a(w) reported to date for this species. M. eremophilus grew slowly (max. 0.4mm/day) even in its optimal conditions of ~0.88 a(w) and 25 °C. To investigate the competitive characteristics of X. bisporus at low a(w), both X. bisporus strains were grown in dual-culture with xerotolerant species Aspergillus flavus and Penicillium roqueforti, and xerophilic species A. penicillioides, C. inops, C. xerophilum and Eurotium chevalieri, on glucose-fructose agar plates at 0.94, 0.84, 0.80 and 0.76 a(w) and at 25 °C. Growth rates and types of interactions were assessed. Excretion of inhibitory substances acting over a long-range was not observed by any species; inhibitors acting over a short-range that temporarily slowed competitors' growth or produced a protective zone around the colony were occasionally observed for A. penicillioides, C. inops and C. xerophilum

  9. Portable Liquid-Injecting System

    NASA Technical Reports Server (NTRS)

    Shuck, T.; Chin, F.; Hansen, M.

    1988-01-01

    Portable injecting-gun system dispenses predetermined amount of liquid at moderately high pressure. Tool belt holds components of liquid-injecting system. Pump and four-way valve combined in nylon housing. Connected to injecting nozzle and other components by polyvinyl tubing.

  10. Reductant injection and mixing system

    SciTech Connect

    Reeves, Matt; Henry, Cary A.; Ruth, Michael J.

    2016-02-16

    A gaseous reductant injection and mixing system is described herein. The system includes an injector for injecting a gaseous reductant into an exhaust gas stream, and a mixer attached to a surface of the injector. The injector includes a plurality of apertures through which the gaseous reductant is injected into an exhaust gas stream. The mixer includes a plurality of fluid deflecting elements.

  11. Acupuncture Injection Combined with Electrokinetic Injection for Polydimethylsiloxane Microfluidic Devices

    PubMed Central

    2017-01-01

    We recently reported acupuncture sample injection that leads to reproducible injection of nL-scale sample segments into a polydimethylsiloxane (PDMS) microchannel for microchip capillary electrophoresis. The advantages of the acupuncture injection in microchip capillary electrophoresis include capability of minimizing sample loss and voltage control hardware and capability of introducing sample plugs into any desired position of a microchannel. However, the challenge in the previous study was to achieve reproducible, pL-scale sample injections into PDMS microchannels. In the present study, we introduce an acupuncture injection technique combined with electrokinetic injection (AICEI) technique to inject pL-scale sample segments for microchip capillary electrophoresis. We carried out the capillary zone electrophoresis (CZE) separation of FITC and fluorescein, and the mixture of 10 μM FITC and 10 μM fluorescein was separated completely by using the AICEI method. PMID:28326222

  12. Effect of organic acids on numbers of yeasts and mould fungi and aerobic stability in the silage of corn.

    PubMed

    Selwet, M

    2008-01-01

    The aim of these studies was to assess the effect of chemical conservants (FA = formic acid, PA = propionic acid, FPA+i = formic acid, propionic acid and ammonium ions) on the cell counts of yeasts and mould fungi in silage. The silage was prepared from corn (Zea mays L), cultivar Buran FAO (240). The effect of the applied conservants on silage aerobic stability was also assessed. The performed chemical analyses comprised the determination of: the content of dry matter (DM), lactic acid (LA), acetic acid (AA), ethanol, water soluble sugars (WSC), crude protein (CP) and pH. The applied preparations were found to reduce the number of yeast and mould fungi cells in all the examined silages. The growth of fungi was inhibited most strongly by the FPA+i preparation (containing a mixture of formic and propionic acids and ammonium ions). The yeast cell counts dropped (P<0.05) from 8.50 107 CFU g(-1) silage in the control (CCS = control corn silage) to 2.60 107 CFU g(-1) in silage treated with FPA+i, whereas counts of the mould fungi cells - from 15.20 104 CFU g(-1) silage in the control to 4.60 104 CFU g(-1) in silage treated with FPA+i. The applied conservants increased (P<0.05) the content of DM from 255.00 g kg(-1) in control to 266.60 g kg(-1) with PA, WSC from 27.10 g kg(-1) DM to 30.50 g kg(-1) DM with FPA+i and ethanol from 9.10 g kg(-1) DM to 11.21 g kg(-1) DM with FPA+i in the silage. The additives decreased concentrations of lactic acid, acetic acid and crude protein concentration after opening the barrels. The diversifying factors decreased the pH value in the examined silage. The experimental conservants were found to improve the aerobic stability of silages after 7 days of air exposure.

  13. [Tropical and travel-related dermatomycoses : Part 2: cutaneous infections due to yeasts, moulds, and dimorphic fungi].

    PubMed

    Nenoff, P; Reinel, D; Krüger, C; Grob, H; Mugisha, P; Süß, A; Mayser, P

    2015-07-01

    Besides dermatophytoses, a broad range of cutaneous infections due to yeasts and moulds may occur in subtropical and tropical countries where they can affect travellers. Not to be forgotten are endemic occurring dimorphic or biphasic fungi in countries with hot climate, which cause systemic and secondary cutaneous infections in immunosuppressed and immunocompetent people. In the tropics, the prevalence of pityriasis versicolor, caused by the lipophilic yeast Malassezia spp., is about 30-40 %, in distinct areas even 50 %. Increased hyperhidrosis under tropical conditions and simultaneously humidity congestion have to be considered as significant disposing factors for pityriasis versicolor. In tropical countries, therefore, an exacerbation of a preexisting pityriasis versicolor in travellers is not rare. Today, mostly genital yeast infections due to the new species Candida africana can be found worldwide. Due to migration from Africa this yeast pathogen has reached Germany and Europe. Eumycetomas due to mould fungi are rarely diagnosed in Europe. These deep cutaneous mould infections are only found in immigrants from African countries. The therapy of eumycetoma is protracted and often not successful. Cutaneous cryptococcoses due to the yeast species Cryptococcus neoformans and Cryptococcus gattii occur worldwide; however, they are found more frequently in the tropics. Immunosuppressed patients, especially those with HIV/AIDS, are affected by cryptococcoses. Furthermore, Cryptococcus gattii also causes infections in immunocompetent hosts in Central Africa, Australia, California, and Central America.Rarely found are infections due to dimorphic fungi after travel to countries where these fungal pathogens are endemic. In individual cases, cutaneous or lymphogenic transferred sporotrichosis due to Sporothrix schenkii can occur. Furthermore, scarcely known is secondary cutaneous coccidioidomycosis due to Coccidioides immitis after travelling to desert-like endemic

  14. Highly conformal CT based surface mould brachytherapy for non-melanoma skin cancers of earlobe and nose

    PubMed Central

    Kozłowski, Sławomir; Pietraszek, Andrzej; Pietrzykowska-Kuncman, Malwina; Danielska, Justyna; Sobotkowski, Janusz; Łuniewska-Bury, Jolanta; Fijuth, Jacek

    2016-01-01

    Purpose Brachytherapy (BT), due to rapid dose fall off and minor set-up errors, should be superior to external beam radiotherapy (EBRT) for treatment of lesions in difficult locations like nose and earlobe. Evidences in this field are scarce. We describe computed tomography (CT) based surface mould BT for non-melanoma skin cancers (NMSC), and compare its conformity, dose coverage, and tissue sparing ability to EBRT. Material and methods We describe procedure of preparation of surface mould applicator and dosimetry parameters of BT plans, which were implemented in 10 individuals with NMSC of nose and earlobe. We evaluated dose coverage by minimal dose to 90% of planning target volume (PTV) (D90), volumes of PTV receiving 90-150% of prescribed dose (PD) (VPTV90-150), conformal index for 90 and 100% of PD (COIN90, COIN100), dose homogeneity index (DHI), dose nonuniformity ratio (DNR), exposure of organs. Prospectively, we created CT-based photons and electrons plans. We compared conformity (COIN90, COIN100), dose coverage of PTV (D90, VPTV90, VPTV100), volumes of body receiving 10-90% of PD (V10-V90) of EBRT and BT plans. Results We obtained mean BT-DHI = 0.76, BT-DNR = 0.23, EBRT-DHI = 1.26. We observed no significant differences in VPTV90 and D90 between BT and EBRT. Mean BT-VPTV100 (89.4%) was higher than EBRT-VPTV100 (71.2%). Both COIN90 (BT-COIN90 = 0.46 vs. EBRT-COIN90 = 0.21) and COIN100 (BT-COIN100 = 0.52 vs. EBRT-COIN100 = 0.26) were superior for BT plans. We observed more exposure of normal tissues for small doses in BT plans (V10, V20), for high doses in EBRT plans (V70, V90). Conclusions Computed tmography-based surface mould brachytherapy for superficial lesions on irregular surfaces is a highly conformal method with good homogeneity. Brachytherapy is superior to EBRT in those locations in terms of conformity and normal tissue sparing ability in high doses. PMID:27504128

  15. Neutral beam injection system

    SciTech Connect

    Duesing, G.; Altmann, H.; Falter, H.; Goede, A.; Haange, R.; Hemsworth, R.S.; Kupschus, P.; Stork, D.; Thompson, E.

    1987-01-01

    The development of the neutral injection (NI) system for the Joint European Torus and its status in 1985 are reported. First the system parameters are discussed and the layout is described, followed by a summary of the physics design calculations, the development, production, and testing of the components and the subsystem assembly. The system commissioning is presented, including a description of the function and the realization of the NI test bed. A summary of performance predictions for 80-keV beam heating experiments, and of the experimental evidence on balanced versus coinjection, is presented. The operational experience with the first injector and the plasma physics results obtained so far are summarized.

  16. Epidemiology of Injection Drug Use

    PubMed Central

    Arruda, Nelson; Bruneau, Julie; Jutras-Aswad, Didier

    2016-01-01

    After more than 30 years of research, numerous studies have shown that injection drug use is associated with a wide range of adverse health outcomes such as drug overdoses, drug-related suicidal behaviours, comorbid psychiatric disorders, bloodborne pathogens and other infectious diseases, and traumas. This review explores new trends and prominent issues associated with injection drug use. The dynamic nature of injection drug use is underlined by examining its recent trends and changing patterns in Canada and other “high-income countries.” Three research topics that could further contribute to the development of comprehensive prevention and intervention strategies aimed at people who inject drugs are also discussed: risk behaviours associated with the injection of prescription opioids, binge injection drug use, and mental health problems as determinants of injection risk behaviours. PMID:27254088

  17. Rain underscores need for injection

    SciTech Connect

    Stelling, K.F.

    1996-01-01

    Since 1987, steam production totals at The Geysers Geothermal field have fallen and water injection totals have remained quite stable, except for the unusually dry winter months of 1994 when injection fell by a record amount. The heavy rainfall in the first half of 1995 altered the long-term production and injection patterns and underscored the need to increase injection in the field. From January to June 1995, steam production at The Geysers was reduced by 37 percent form the amount produced during the same period in 1994--because the rain increased availability of hydroelectric power. At the same time, water injection in the field rose by 25 percent because more rainwater was available for injection. Consequently, both reservoir pressure and available steam reserves grew, and most power plants that returned on line in the second half of the year produced more megawatts with less steam. This confirmed findings form several injection studies at The Geyser`s.

  18. Effects of dog rose and watercress extracts on control of green mould decay and postharvest quality of orange fruits.

    PubMed

    Jafari, Sajad; Hassandokht, Mohammadreza; Javan-Nikkhah, Mohammad

    2014-01-01

    Minimum inhibitory concentration (MIC) and IC50 values and total phenolics of dog rose fruits were 72.5-80 μL mL(- 1), 130 μg mL(- 1) and 5.7 mg GA g(- 1), respectively. The Fashand watercress population and dog rose extracts exhibited mycelia growth inhibition values of 45.08% and 37.12%, respectively. The results of in vivo study indicated that the treatment of inoculated fruits with both methanol extracts especially the watercress plant extract considerably controls the citrus fruits decay (Penicillium digitatum) up to 73%. In conclusion, methanol extracts of dog rose fruits and especially watercress plant had the potential to be used against citrus green mould and even for the improvement of postharvest quality of orange fruits.

  19. XPS identification of surface-initiated polymerisation during monomer transfer moulding of poly(ɛ-caprolactone)/Bioglass ® fibre composite

    NASA Astrophysics Data System (ADS)

    Jiang, G.; Walker, G. S.; Jones, I. A.; Rudd, C. D.

    2005-12-01

    In this work, X-ray photoelectron spectroscopy (XPS) was demonstrated to be a useful method to characterise surface-initiated polymerisation. Both E-glass fibre and Bioglass ® fibre were treated using 3-aminopropyltrimethoxysilane (and propyltrimethoxysilane as a control) and then they were used as a reinforcement, respectively, in monomer transfer moulding to prepare poly(ɛ-caprolactone)/glass fibre composites with stannous octoate as the catalyst for ɛ-caprolactone polymerisation. The fibre was extracted and then analysed using XPS to probe the presence of PCL chemically bonded to the glass fibre surface. Both tin and PCL were detected on the surface of the fibres sized with 3-aminopropyltrimethoxysilane, confirming surface-initiated polymerisation of ɛ-caprolactone.

  20. Combined effects of potassium sorbate, hot water and thiabendazole against green mould of citrus fruit and residue levels.

    PubMed

    D'Aquino, Salvatore; Fadda, Angela; Barberis, Antonio; Palma, Amedeo; Angioni, Alberto; Schirra, Mario

    2013-11-15

    Postharvest treatments of potassium sorbate only controlled recently established infections of Penicillium digitatum on Femminello siracusano lemons but did not confer any persistent protection. The loss of efficacy of potassium sorbate to control green mould decay was related to its irregular deposition on the fruit surface, as revealed by environmental scanning electron microscopy of oranges, and to the brief persistence of potassium sorbate residues. When treatment was done at 53°C, the co-application of potassium sorbate with thiabendazole reduced thiabendazole residues in Moro and Sanguinello oranges, compared to thiabendazole treatment alone. However, treatment efficacy against two isolates of P. digitatum (thiabendazole-sensitive and thiabendazole-resistant) notably improved, indicating that potassium sorbate and hot water potentiated thiabendazole activity. Potassium sorbate residues remarkably decreased during fruit storage and were not affected by the co-application of thiabendazole.

  1. Fungicide-Driven Evolution and Molecular Basis of Multidrug Resistance in Field Populations of the Grey Mould Fungus Botrytis cinerea

    PubMed Central

    Mosbach, Andreas; Walker, Anne-Sophie; Fillinger, Sabine; Mernke, Dennis; Schoonbeek, Henk-Jan; Pradier, Jean-Marc; Leroux, Pierre; De Waard, Maarten A.; Hahn, Matthias

    2009-01-01

    The grey mould fungus Botrytis cinerea causes losses of commercially important fruits, vegetables and ornamentals worldwide. Fungicide treatments are effective for disease control, but bear the risk of resistance development. The major resistance mechanism in fungi is target protein modification resulting in reduced drug binding. Multiple drug resistance (MDR) caused by increased efflux activity is common in human pathogenic microbes, but rarely described for plant pathogens. Annual monitoring for fungicide resistance in field isolates from fungicide-treated vineyards in France and Germany revealed a rapidly increasing appearance of B. cinerea field populations with three distinct MDR phenotypes. All MDR strains showed increased fungicide efflux activity and overexpression of efflux transporter genes. Similar to clinical MDR isolates of Candida yeasts that are due to transcription factor mutations, all MDR1 strains were shown to harbor activating mutations in a transcription factor (Mrr1) that controls the gene encoding ABC transporter AtrB. MDR2 strains had undergone a unique rearrangement in the promoter region of the major facilitator superfamily transporter gene mfsM2, induced by insertion of a retrotransposon-derived sequence. MDR2 strains carrying the same rearranged mfsM2 allele have probably migrated from French to German wine-growing regions. The roles of atrB, mrr1 and mfsM2 were proven by the phenotypes of knock-out and overexpression mutants. As confirmed by sexual crosses, combinations of mrr1 and mfsM2 mutations lead to MDR3 strains with higher broad-spectrum resistance. An MDR3 strain was shown in field experiments to be selected against sensitive strains by fungicide treatments. Our data document for the first time the rising prevalence, spread and molecular basis of MDR populations in a major plant pathogen in agricultural environments. These populations will increase the risk of grey mould rot and hamper the effectiveness of current strategies for

  2. Identifying risk factors for exposure to culturable allergenic moulds in energy efficient homes by using highly specific monoclonal antibodies.

    PubMed

    Sharpe, Richard A; Le Cocq, Kate; Nikolaou, Vasilis; Osborne, Nicholas J; Thornton, Christopher R

    2016-01-01

    The aim of this study was to determine the accuracy of monoclonal antibodies (mAbs) in identifying culturable allergenic fungi present in visible mould growth in energy efficient homes, and to identify risk factors for exposure to these known allergenic fungi. Swabs were taken from fungal contaminated surfaces and culturable yeasts and moulds isolated by using mycological culture. Soluble antigens from cultures were tested by ELISA using mAbs specific to the culturable allergenic fungi Aspergillus and Penicillium spp., Ulocladium, Alternaria, and Epicoccum spp., Cladosporium spp., Fusarium spp., and Trichoderma spp. Diagnostic accuracies of the ELISA tests were determined by sequencing of the internally transcribed spacer 1 (ITS1)-5.8S-ITS2-encoding regions of recovered fungi following ELISA. There was 100% concordance between the two methods, with ELISAs providing genus-level identity and ITS sequencing providing species-level identities (210 out of 210 tested). Species of Aspergillus/Penicillium, Cladosporium, Ulocladium/Alternaria/Epicoccum, Fusarium and Trichoderma were detected in 82% of the samples. The presence of condensation was associated with an increased risk of surfaces being contaminated by Aspergillus/Penicillium spp. and Cladosporium spp., whereas moisture within the building fabric (water ingress/rising damp) was only associated with increased risk of Aspergillus/Penicillium spp. Property type and energy efficiency levels were found to moderate the risk of indoor surfaces becoming contaminated with Aspergillus/Penicillium and Cladosporium which in turn was modified by the presence of condensation, water ingress and rising damp, consistent with previous literature.

  3. Interaction of media on production and biocontrol efficacy of Pseudomonas fluorescens and Bacillus subtilis against grey mould of apple.

    PubMed

    Peighamy-Ashnaei, S; Sharifi-Tehrani, A; Ahmadzadeh, M; Behboudi, K

    2008-01-01

    The medium has a profound effect on biocontrol agents, including ability to grow and effectiveness in disease control. In this study, growth and antagonistic efficacy of strains P-5 and P-35 (P. fluorescens), B-3 and B-16 (B. subtilis) were evaluated in combinations of two carbon (sucrose and molasses) and two nitrogen (urea and yeast extract) sources to optimize control of Botrytis cinerea on apple. All of the strains were grown in different liquid media (pH = 6.9) including: sucrose + yeast extract, molasses of sugar beet + yeast extract in 2:1 and 1:1 w/w ratios, molasses of sugar beet + urea, molasses, malt extract and nutrient broth. Apples (Golden Delicious) were inoculated by a 25-microl suspension of 10(6) spores of B. cinerea per ml, wounding each fruit (in two sites separately). Then a 25-microl suspension of each strain, containing 2 x 10(8) cfu ml(-1) grown in each of the above culture media, was applied to each wound. Results indicated that Molasses + Yeast extract (1:1 w/w) medium supported rapid growth in all of the strains. The final growth of B. subtilis B-16 in Molasses + Yeast extract (1:1 w/w) medium was 5 x 10(9) cfu ml(-1). After ten days, all of the strains significantly inhibited pathogenicity of B. cinerea on apples. The biocontrol efficacy of B. subtilis B-3 in Molasses + Yeast extract (1:1 w/w) medium reduced the severity of grey mould from 100% (inoculated control) to less than 26.9%. After 20 days, Strain B-3 showed a considerable biocontrol efficacy in Molasses medium and reduced the severity of grey mould from 100% (inoculated control) to less than 38.2%. The results obtained in this study could be used to provide a reliable basis for the increase of population of biocontrol agents in fermentation process.

  4. A wide variety of injection molding technologies is now applicable to small series and mass production

    SciTech Connect

    Bloß, P. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de; Jüttner, G. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de; Jacob, S. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de; Löser, C. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de; Michaelis, J. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de; Krajewsky, P. E-mail: juettner@kuz-leipzig.de E-mail: loeser@kuz-leipzig.de E-mail: krajewsky@kuz-leipzig.de

    2014-05-15

    Micro plastic parts open new fields for application, e. g., to electronics, sensor technologies, optics, and medical engineering. Before micro parts can go to mass production, there is a strong need of having the possibility for testing different designs and materials including material combinations. Hence, flexible individual technical and technological solutions for processing are necessary. To manufacture high quality micro parts, a micro injection moulding machine named formicaPlast based on a two-step plunger injection technology was developed. Resulting from its design, the residence time and the accuracy problems for managing small shot volumes with reproducible high accuracy are uncompromisingly solved. Due to their simple geometry possessing smooth transitions and non adherent inner surfaces, the plunger units allow to process 'all' thermoplastics from polyolefines to high performance polymers, optical clear polymers, thermally sensitive bioresorbables, highly filled systems (the so-called powder injection molding PIM), and liquid silicon rubber (LSR, here with a special kit). The applied platform strategy in the 1K and 2K version allows integrating automation for assembling, handling and packaging. A perpendicular arrangement allows encapsulation of inserts, also partially, and integration of this machine into process chains. Considering a wide variety of different parts consisting of different materials, the high potential of the technology is demonstrated. Based on challenging industrial parts from electronic applications (2K micro MID and bump mat, where both are highly structured parts), the technological solutions are presented in more detail.

  5. A wide variety of injection molding technologies is now applicable to small series and mass production

    NASA Astrophysics Data System (ADS)

    Bloß, P.; Jüttner, G.; Jacob, S.; Löser, C.; Michaelis, J.; Krajewsky, P.

    2014-05-01

    Micro plastic parts open new fields for application, e. g., to electronics, sensor technologies, optics, and medical engineering. Before micro parts can go to mass production, there is a strong need of having the possibility for testing different designs and materials including material combinations. Hence, flexible individual technical and technological solutions for processing are necessary. To manufacture high quality micro parts, a micro injection moulding machine named formicaPlast based on a two-step plunger injection technology was developed. Resulting from its design, the residence time and the accuracy problems for managing small shot volumes with reproducible high accuracy are uncompromisingly solved. Due to their simple geometry possessing smooth transitions and non adherent inner surfaces, the plunger units allow to process "all" thermoplastics from polyolefines to high performance polymers, optical clear polymers, thermally sensitive bioresorbables, highly filled systems (the so-called powder injection molding PIM), and liquid silicon rubber (LSR, here with a special kit). The applied platform strategy in the 1K and 2K version allows integrating automation for assembling, handling and packaging. A perpendicular arrangement allows encapsulation of inserts, also partially, and integration of this machine into process chains. Considering a wide variety of different parts consisting of different materials, the high potential of the technology is demonstrated. Based on challenging industrial parts from electronic applications (2K micro MID and bump mat, where both are highly structured parts), the technological solutions are presented in more detail.

  6. Numerical Simulation of the Flow Behavior and Breakthrough Phenomenon in Co-Injection Molding

    NASA Astrophysics Data System (ADS)

    Ilinca, Florin; Hétu, Jean-François

    2007-05-01

    A study of the flow behavior during sequential co-injection molding is shown using a three-dimensional finite element flow analysis code. Solutions of the non-Newtonian, non-isothermal melt flow are obtained by solving the momentum, continuity and energy equations. Two additional transport equations are solved for tracking polymer/air and skin/core polymers interfaces. The co-injection model is integrated into the NRC's 3D injection molding software. Solutions are shown for the filling of a spiral-flow mould for which experimental measurements are available. The numerical approach predicts the core advance stage during which the core flow front catches up on the skin flow front and the core expansion phase when the flow fronts of core and skin materials advance together without breakthrough. The breakthrough phenomenon is also predicted. The predicted flow front behavior is compared to the experimental observations for various skin/core melt temperature and skin/core viscosity ratio. Simulation results are in good agreement with experimental data and indicate correctly the trends in solution change when processing parameters are changing.

  7. Propagating substorm injection fronts

    NASA Technical Reports Server (NTRS)

    Moore, T. E.; Arnoldy, R. L.; Feynman, J.; Hardy, D. A.

    1981-01-01

    It is argued that a series of two-satellite observations leads to a clarification of substorm plasma injection, in which boundary motion plays a major role. Emphasis is put on a type of event characterized by abrupt, dispersionless changes in electron intensity and a coincident perturbation that consists of both a field magnitude increase and a small rotation toward more dipolar orientation. Comparing plasma observations at two points, it is found that in active, preinjection conditions the two most important features of the plasma sheet are: (1) the low-energy convection boundary for near-zero energy particles, determined by the magnitude of the large-scale convection electric field; and (2) the precipitation-flow boundary layer between the hot plasma sheet and the atmospherically contaminated inner plasma sheet.

  8. Fuel injection pumps

    SciTech Connect

    Howes, P.

    1985-04-02

    A fuel injection pump of the rotary distributor type includes a cam actuated plunger housing in a bore and an adjustable fuel control member which varies the amount of fuel supplied to the bore. The pump also includes a timing piston connected to the cam, the piston being biased by a spring against the action of fuel under pressure. In order to vary the timing under certain conditions a control piston serves as an abutment for the spring and the application of pressure to the control piston is controlled by a valve which has a valve element coupled to a throttle member of the pump the valve having a housing which is secured on the exterior of the pump.

  9. Particle beam injection system

    DOEpatents

    Jassby, Daniel L.; Kulsrud, Russell M.

    1977-01-01

    This invention provides a poloidal divertor for stacking counterstreaming ion beams to provide high intensity colliding beams. To this end, method and apparatus are provided that inject high energy, high velocity, ordered, atomic deuterium and tritium beams into a lower energy, toroidal, thermal equilibrium, neutral, target plasma column that is magnetically confined along an endless magnetic axis in a strong restoring force magnetic field having helical field lines to produce counterstreaming deuteron and triton beams that are received bent, stacked and transported along the endless axis, while a poloidal divertor removes thermal ions and electrons all along the axis to increase the density of the counterstreaming ion beams and the reaction products resulting therefrom. By balancing the stacking and removal, colliding, strong focused particle beams, reaction products and reactions are produced that convert one form of energy into another form of energy.

  10. Injectors for Multipoint Injection

    NASA Technical Reports Server (NTRS)

    Prociw, Lev Alexander (Inventor); Ryon, Jason (Inventor)

    2015-01-01

    An injector for a multipoint combustor system includes an inner air swirler which defines an interior flow passage and a plurality of swirler inlet ports in an upstream portion thereof. The inlet ports are configured and adapted to impart swirl on flow in the interior flow passage. An outer air cap is mounted outboard of the inner swirler. A fuel passage is defined between the inner air swirler and the outer air cap, and includes a discharge outlet between downstream portions of the inner air swirler and the outer air cap for issuing fuel for combustion. The outer air cap defines an outer air circuit configured for substantially unswirled injection of compressor discharge air outboard of the interior flow passage.

  11. Diesel fuel injection system

    SciTech Connect

    Schechter, M.M.; Simko, A.O.

    1986-04-22

    A fuel injection pump is described of the multiple plunger spill port type for an automotive type internal combustion engine, the pump including at least four axially spaced engine camshaft driven pump plungers grouped in pairs and sequentially and in succession moved in one direction through a fuel pumping stroke and oppositely through a fuel intake stroke. A fuel pressurization/supply chamber is contiquous to the end of each plunger for pressurization of the fuel therein or supply of fuel thereto from a supply passage upon coordinate movement of the plunger, fill/spill passage means connected to a single fuel return spill port and in parallel flow relationship to each of the plunger bores as a function of the position of the plungers, each plunger having a pair of internal passages connected at all times to its chamber and alternately alignable with the supply or fill/spill passage means as a function of the position of the plunger. A fuel discharge passage is operatively connecting each of the chambers to an individual engine cylinder, a single spill port control valve movable to block or permit the spill of fuel through the spill port to a return line to control the pressurization of fuel in all of the fuel chambers and associated discharge passages, a single solenoid connected to the spill control valve for moving it to block or unblock the spill port, and a single shuttle valve operatively associated with all of the fill/spill passage means and spill port reciprocably movable between positions to sequentially connect the plunger chambers one at a time in succession to the spill port during the pumping pressurization stroke of its plunger for the injection of fuel to an individual cylinder while the other chambers are in various stages of being refilled with fuel and preparing for pressurization upon successive actuation of the plungers by the camshaft.

  12. The cost of unsafe injections.

    PubMed Central

    Miller, M. A.; Pisani, E.

    1999-01-01

    Unsafe injection practices are associated with substantial morbidity and mortality, particularly from hepatitis B and C and human immunodeficiency virus (HIV) infections. These inadvertently transmitted bloodborne diseases become manifest some considerable time after infection and hence may not be appropriately accounted for. Annually more than 1.3 million deaths and US$ 535 million are estimated to be due to current unsafe injection practices. With the global increase in the number of injections for vaccination and medical services, safer injecting technologies such as auto-disable syringes must be budgeted for. Investment in health education and safer disposal will also reduce infections associated with unsafe injecting practices. Safer injecting practices are more expensive than current less safe practices, but the additional cost is more than offset by the reduction in disease that would result. PMID:10593028

  13. [Physicochemical incompatibilities of injectable drugs].

    PubMed

    Hofmann, Christelle; Rouault, Médéric; Cailleteau, Jérémy

    2016-02-01

    The physicochemical interactions of injectable drugs administered through a Y-site injection port are little known phenomena, poorly documented but very frequent. Physicochemical incompatibility is defined as a chemical reaction between two injectable drugs which come into contact with each other. This chemical reaction may be visible on a macroscopic level or completely invisible. The risks of these interactions are not harmless, ranging from inefficacy to the toxicity of the newly-formed compounds.

  14. Effect of electrical field strength applied by PEF processing and storage temperature on the outgrowth of yeasts and moulds naturally present in a fresh fruit smoothie.

    PubMed

    Timmermans, R A H; Nederhoff, A L; Nierop Groot, M N; van Boekel, M A J S; Mastwijk, H C

    2016-08-02

    Pulsed electrical field (PEF) technology offers an alternative to thermal pasteurisation of high-acid fruit juices, by extending the shelf life of food products, while retaining its fresh taste and nutritional value. Substantial research has been performed on the effect of electrical field strength on the inactivation kinetics of spoilage and pathogenic micro-organisms and on the outgrowth of spoilage micro-organisms during shelf life. However, studies on the effect of electrical field strength on the inactivation and outgrowth of surviving populations during shelf life are missing. In this study, we assessed the influence of electrical field strength applied by PEF processing and storage temperature on the outgrowth of surviving yeast and mould populations naturally present in fresh fruit smoothie in time. Therefore, an apple-strawberry-banana smoothie was treated in a continuous-flow PEF system (130L/h), using similar inlet and outlet conditions (preheating temperature 41°C, maximum temperature 58°C) to assure that the amount of energy across the different conditions was kept constant. Smoothies treated with variable electrical field strengths (13.5, 17.0, 20.0 and 24.0kV/cm) were compared to smoothies without treatment for outgrowth of yeasts and moulds. Outgrowth of yeasts and moulds stored at 4°C and 7°C was analysed by plating and visual observation and yeast growth was modelled using the modified logistic growth model (Zwietering model). Results showed that the intensity of the electrical field strength had an influence on the degree of inactivation of yeast cells, resulting in a faster outgrowth over time at lower electrical field strength. Outgrowth of moulds over time was not affected by the intensity of the electrical field strength used. Application of PEF introduces a trade-off between type of spoilage: in untreated smoothie yeasts lead to spoilage after 8days when stored at 4 or 7°C, whereas in PEF treated smoothie yeasts were (partly

  15. Injectable barriers for waste isolation

    SciTech Connect

    Persoff, P.; Finsterle, S.; Moridis, G.J.; Apps, J.; Pruess, K.; Muller, S.J.

    1995-03-01

    In this paper the authors report laboratory work and numerical simulation done in support of development and demonstration of injectable barriers formed from either of two fluids: colloidal silica or polysiloxane. Two principal problems addressed here are control of gel time and control of plume emplacement in the vadose zone. Gel time must be controlled so that the viscosity of the barrier fluid remains low long enough to inject the barrier, but increases soon enough to gel the barrier in place. During injection, the viscosity must be low enough to avoid high injection pressures which could uplift or fracture the formation. To test the grout gel time in the soil, the injection pressure was monitored as grouts were injected into sandpacks. When grout is injected into the vadose zone, it slumps under the influence of gravity, and redistributes due to capillary forces as it gels. The authors have developed a new module for the reservoir simulator TOUGH2 to model grout injection into the vadose zone, taking into account the increase of liquid viscosity as a function of gel concentration and time. They have also developed a model to calculate soil properties after complete solidification of the grout. The numerical model has been used to design and analyze laboratory experiments and field pilot tests. The authors present the results of computer simulations of grout injection, redistribution, and solidification.

  16. OBSERVATIONS ON THE SUSCEPTIBILITY OF SOME WILD SPECIES OF THE GENUS NICOTINA AND OF SOME VARIETIES OF NICOTIANA TABACUM L. AND N. RUSTICA L. TO BLUE MOULD (PERONOSPORA TABACINA ADAM) -- PULAWY 1962

    DTIC Science & Technology

    Observations on the susceptibility of some wild species of the genus nicotina and of some varieties of nicotiana tabacum l. and n. rustica l. to blue mould (peronospora tabacina adam) -- pulawy 1962--Translation.

  17. Supersonic Jet Noise Reduction Using Flapping Injection and Pulsed Injection

    NASA Astrophysics Data System (ADS)

    Hafsteinsson, Haukur; Eriksson, Lars-Erik; Cuppoletti, Daniel; Gutmark, Ephraim; Department of Applied Mechanics, Chalmers University of Technology Team; Department of Aerospace Engineering, University of Cincinatti Team; Swedish Defence Material Administration, Sweden Team

    2013-11-01

    Aircraft are in general noisy and there is a high demand for reducing their noise levels. The jet exhaust is in most cases the main noise source of the aircraft, especially for low bypass ratio jet engines. Fluidic injection affecting the shear layer close to the nozzle exit is a promising noise reduction technique as it can be turned of while not needed and thus the negative effect on the engine performance will be minimized. In the presented work, LES is used to compare steady-state mass flow injection with steady-state mass flow flapping jet injection. The work is a direct continuation of a previous LES study on pulsed injection which showed that the pulsed injection induced pressure pulses in the jet which caused increased tonal noise in the downstream directions. The injection system considered in the presented work consists of eight evenly distributed injectors at the nozzle exit plane with a 90° injection angle relative to the flow direction. Flapping jet injection is believed to minimize the creation of these pressure pulses since it provides steady-state mass flow. This work is funded by Swedish Defense Material Administration (FMV).

  18. A comparison of molding procedures - Contact, injection and vacuum injection

    NASA Astrophysics Data System (ADS)

    Cathiard, G.

    1980-06-01

    The technical and economic aspects of the contact, injection and vacuum injection molding of reinforced plastic components are compared for the example of a tractor roof with a gel-coated surface. Consideration is given to the possibility of reinforcement, number of smooth faces, condition of the gel-coated surface, reliability, and labor and workplace requirements of the three processes, and advantages of molding between the mold and a countermold in smooth faces, reliability, labor requirements, working surface and industrial hygiene are pointed out. The times and labor requirements of each step in the molding cycles are examined, and material requirements and yields, investment costs, amortization and product cost prices of the processes are compared. It is concluded that, for the specific component examined, the processes of vacuum injection and injection molding appear very interesting, with injection molding processes resulting in lower cost prices than contact molding for any production volume.

  19. Sensor for Injection Rate Measurements

    PubMed Central

    Marcic, Milan

    2006-01-01

    A vast majority of the medium and high speed Diesel engines are equipped with multi-hole injection nozzles nowadays. Inaccuracies in workmanship and changing hydraulic conditions in the nozzles result in differences in injection rates between individual injection nozzle holes. The new deformational measuring method described in the paper allows injection rate measurement in each injection nozzle hole. The differences in injection rates lead to uneven thermal loads of Diesel engine combustion chambers. All today known measuring method, such as Bosch and Zeuch give accurate results of the injection rate in diesel single-hole nozzles. With multihole nozzles they tell us nothing about possible differences in injection rates between individual holes of the nozzle. At deformational measuring method, the criterion of the injected fuel is expressed by the deformation of membrane occurring due to the collision of the pressure wave against the membrane. The pressure wave is generated by the injection of the fuel into the measuring space. For each hole of the nozzle the measuring device must have a measuring space of its own into which fuel is injected as well as its measuring membrane and its own fuel outlet. During measurements procedure the measuring space must be filled with fuel to maintain an overpressure of 5 kPa. Fuel escaping from the measuring device is conducted into the graduated cylinders for measuring the volumetric flow through each hole of the nozzle.The membrane deformation is assessed by strain gauges. They are glued to the membrane and forming the full Wheatstone's bridge. We devoted special attention to the membrane shape and temperature compensation of the strain gauges.

  20. SNS Injection Foil Experience

    SciTech Connect

    Cousineau, Sarah M; Galambos, John D; Kim, Sang-Ho; Ladd, Peter; Luck, Chris; Peters, Charles C; Polsky, Yarom; Shaw, Robert W; Macek, Robert James; Raparia, Deepak; Plum, Michael A

    2010-01-01

    The Spallation Neutron Source comprises a 1 GeV, 1.4 MW linear accelerator followed by an accumulator ring and a liquid mercury target. To manage the beam loss caused by the H0 excited states created during the H charge exchange injection into the accumulator ring, the stripper foil is located inside one of the chicane dipoles. This has some interesting consequences that were not fully appreciated until the beam power reached about 840 kW. One consequence was sudden failure of the stripper foil system due to convoy electrons stripped from the incoming H beam, which circled around to strike the foil bracket and cause bracket failure. Another consequence is that convoy electrons can reflect back up from the electron catcher and strike the foil and bracket. An additional contributor to foil system failure is vacuum breakdown due to the charge developed on the foil by secondary electron emission. In this paper we will detail these and other interesting failure mechanisms, and describe the improvements we have made to mitigate them.

  1. Fuel injection system

    SciTech Connect

    Miyaki, M.; Iwanaga, T.; Fujisawa, H.

    1988-10-18

    This patent describes a fuel injection system for a diesel engine comprising: condition detection means for detecting operating conditions of the diesel engine including a rotational position thereof; low pressure fuel supply means for supplying fuel at a low pressure at an output port thereof; high pressure fuel pump means, having a pump chamber communicating with the output port of the low pressure fuel supply means, and plunger means reciprocable within the pump chamber for introducing fuel from the output port of the low pressure fuel supply means into the pump chamber during a movement in a predetermined direction of the plunger means and for pressurizing the introduced fuel during a movement of the plunger means in the opposite direction so that pressurized fuel is delivered from the high pressure fuel pump means at an output port thereof; common rail fuel storage means, connected to the output port of the high pressure fuel pump means, for storing pressurized fuel delivered from the high pressure pump therein at a substantially continuous pressure.

  2. Fuel injection pump

    SciTech Connect

    Miyaki, M.

    1986-01-07

    This patent describes a fuel injection pump for delivering fuel to the cylinders of an internal combustion engine consisting of: a pump housing with a fuel chamber therein to which fuel is supplied from a fuel tank; means for compressing fuel in the pump chamber and delivering the compressed fuel to the engine cylinders with such means including a pump plunger adapted to be reciprocated so as to introduce fuel into the pump chamber and to pressurize the introduced fuel; spill means for spilling to a low-pressure side on a fuel tank side the compressed fuel which was pressurized in the pump chamber to be delivered from the pump chamber to the engine cylinders, the spill mechanism including a spill passage communicating with the pump chamber and including a solenoid valve located in the spill passage for opening and closing the spill passage with predetermined timing; escape for allowing the compressed fuel pressurized in the pump chamber to escape to the low-pressure side of the fuel tank side.

  3. Fuel injection pump

    SciTech Connect

    Iiyama, A.; Nishimura, T.

    1988-12-06

    This patent describes a fuel injection pump comprising: (a) engageable first and second cam members, the first cam member reciprocating axially as the first cam member moves angularly relative to the second cam member when the first and second cam members are in engagement; (b) means for urging the first cam member toward the second cam member to engage the first and second cam members; (c) a plunger connected to the first cam member for reciprocation with the first cam member, the plunger defining at least a part of a pumping chamber, the pumping chamber contracting and expanding as the plunger reciprocates; (d) means for allowing fuel to move into the pumping chamber as the pumping chamber expands in a fuel intake stroke; (e) means for allowing the fuel to move out of the pumping chamber as the pumping chamber contracts in a fuel compression stroke; and (f) means for resisting movement of the plunger in at least part of the fuel compression stroke and relieving resistance to the movement of the plunger in the fuel intake stroke wherein the resisting means comprises a piston slidably mounted on the plunger, a spring urging the piston to seat the piston on a shoulder on the plunger so that the piston reciprocates as the plunger reciprocates, wherein the piston is seated on the shoulder in the fuel compression stroke and separates from the shoulder against the force of the spring in the fuel intake stroke, a second fluid chamber at least partially defined by the piston.

  4. The RHIC Injection Kicker

    NASA Astrophysics Data System (ADS)

    Hahn, H.; Tuozzolo, J. E.; Tsoupas, N.

    1997-05-01

    Beam transfer from the AGS to RHIC is performed in single-bunch mode. Close spacing of the bunches in the collider requires an injection kicker with a rise time of <95 nsec, suggesting adoption of a travelling wave solution. The required vertical kick of 0.186 T.m is provided by 4 units, each 1.12 m long with a 48.4× 48.4 mm aperture and operated at 1.6 kA. The kicker is constructed as a ``C'' cross section magnet, in which ferrite and high-permittivity ( ~ 100) dielectric sections alternate. The dielectric blocks provide the capacity necessary for the nominally 25 Ohm characteristic impedance of the travelling wave structure, but impose the practical limit on the peak voltage, and thus current, achievable. Computer studies to minimize local electric field enhancements resulted in a configuration capable of holding >50 kV, with adequate safety margin over the nominal 40 kV. Tests indicated the possibility of lowering the nominal voltage by operating mismatched into 20 Ohm terminations without degrading the pulse shape. In this paper, the experience gained in the fabrication of the four kicker units for the ``Sextant Test'' and the results from various single-unit tests and operation in beam are reported.

  5. The RHIC injection kicker

    SciTech Connect

    Hahn, H.; Tsoupas, N.; Tuozzolo, J.E.

    1997-07-01

    Beam transfer from the AGS to RHIC is performed in single-bunch mode. Close spacing of the bunches in the collider requires an injection kicker with a rise time of <90 nsec, suggesting adoption of a travelling wave structure. The required vertical kick of 0.186 t{center_dot}m is provided by 4 magnets, each 1.12 m long with a 48.4 x 48.4 mm aperture and operated at 1.6 kA. The kicker is constructed as a {open_quotes}C{close_quotes} cross section magnet, in which ferrite and high-permittivity dielectric sections alternate. The dielectric blocks provide the capacity necessary for the nominally 25 {Omega} characteristic impedance of the travelling wave structure, but impose the practical limit on the peak voltage, and thus current, achievable. Computer studies to minimize local electric field enhancements resulted in a configuration capable of holding {approximately} 50 kV, with adequate safety margin over the nominal 40 kV. Equivalent circuit analysis indicated the possibility of lowering the nominal voltage by operating mismatched into 20 {Omega} terminations without degrading the pulse shape. In this paper, the experience gained in the fabrication of the production units and the results from various single-unit tests and operation of four kickers with beam in the {open_quotes}Sextant Test{close_quotes} are reported.

  6. Effect of nanoparticles on the structure and properties of an aluminum alloy poured into a mould with the use of a magnetohydrodynamic disk pump

    NASA Astrophysics Data System (ADS)

    Katsnelson, S. S.; Pozdnyakov, G. A.; Cherepanov, A. N.

    2015-09-01

    The influence of two nanomodifiers with different compositions during their homogenization in the AL7 aluminum melt and moulding on the properties of the modified aluminum alloy is studied. Experiments are performed with the use of a centrifugal conductive magnetohydrodynamic pump. The melt is poured into a graphite mould with three cylindrical channels 38 mm in diameter and 160 mm long, which are designed for a metal mass of 500 g. Two compositions are used as modifying agents: nano-scale particles of the aluminum nitride powder 40-100 nm in size and metallized carbon nanotubes smaller than 25 nm, which are clad with aluminum to improve wetting of their surface. The analysis of the structure of the experimental and reference samples shows that the use of modifiers leads to refinement of the grain structure of the cast metal. According to the Hall-Petch theory, this effect may result in improvement of mechanical characteristics of the cast metal.

  7. Multichannel mould processing of 3D structures from microporous coralline hydroxyapatite granules and chitosan support materials for guided tissue regeneration/engineering.

    PubMed

    Baran, E T; Tuzlakoglu, K; Salgado, A J; Reis, R L

    2004-02-01

    A three-dimensional composite material was produced from microporous coralline origin hydroxyapatite (HA) microgranules, chitosan fibers and chitosan membrane. Cylindrical HA microgranules were oriented along channel direction within multichannel mould space and aligned particles were supported with fibers and a chitosan membrane. The positive replica of mould channels was clasp fixed to produce thicker scaffolds. Light microphotographs of the developed complex structure showed good adhesion between the HA particles, the fibers and the supporting membrane. The composite material showed 88% (w/w) swelling in one hour and preserved the complex structure of the original material upon long-term incubation in physiological medium. MEM extract test of HA chitosan complex showed no cell growth inhibition and cell viability assay (MTS) indicated over 90% cell viability.

  8. Injectable Foams for Regenerative Medicine

    PubMed Central

    Prieto, Edna M.; Page, Jonathan M.; Harmata, Andrew J.

    2013-01-01

    The design of injectable biomaterials has attracted considerable attention in recent years. Many injectable biomaterials, such as hydrogels and calcium phosphate cements, have nanoscale pores that limit the rate of cellular migration and proliferation. While introduction of macroporosity has been suggested to increase cellular infiltration and tissue healing, many conventional methods for generating macropores often require harsh processing conditions that preclude their use in injectable foams. In recent years, processes such as porogen leaching, gas foaming, and emulsion-templating have been adapted to generate macroporosity in injectable calcium phosphate cements, hydrogels, and hydrophobic polymers. While some of the more mature injectable foam technologies have been evaluated in clinical trials, there are challenges remaining to be addressed, such as the biocompatibility and ultimate fate of the sacrificial phase used to generate pores within the foam after it sets in situ. Furthermore, while implantable scaffolds can be washed extensively to remove undesirable impurities, all of the components required to synthesize injectable foams must be injected into the defect. Thus, every compound in the foam must be biocompatible and non-cytotoxic at the concentrations utilized. As future research addresses these critical challenges, injectable macroporous foams are anticipated to have an increasingly significant impact on improving patient outcomes for a number of clinical procedures. PMID:24127230

  9. VECTORCARDIOGRAPHIC CHANGES DURING INTRACORONARY INJECTIONS.

    DTIC Science & Technology

    artery blood with the changes in the surface electrocardiogram, simultaneous recordings were made from Frank leads X, Y, and Z during intracoronary ...could be produced by intracoronary injections of saline solutions, but minimal or no changes were observed with injections of hypertonic mannitol

  10. Blast furnace injection symposium: Proceedings

    SciTech Connect

    1996-12-31

    These proceedings contain 14 papers related to blast furnace injection issues. Topics include coal quality, coal grinding, natural gas injection, stable operation of the blast furnace, oxygen enrichment, coal conveying, and performance at several steel companies. All papers have been processed separately for inclusion on the data base.

  11. Injectable foams for regenerative medicine.

    PubMed

    Prieto, Edna M; Page, Jonathan M; Harmata, Andrew J; Guelcher, Scott A

    2014-01-01

    The design of injectable biomaterials has attracted considerable attention in recent years. Many injectable biomaterials, such as hydrogels and calcium phosphate cements (CPCs), have nanoscale pores that limit the rate of cellular migration and proliferation. While introduction of macroporosity has been suggested to increase cellular infiltration and tissue healing, many conventional methods for generating macropores often require harsh processing conditions that preclude their use in injectable foams. In recent years, processes such as porogen leaching, gas foaming, and emulsion-templating have been adapted to generate macroporosity in injectable CPCs, hydrogels, and hydrophobic polymers. While some of the more mature injectable foam technologies have been evaluated in clinical trials, there are challenges remaining to be addressed, such as the biocompatibility and ultimate fate of the sacrificial phase used to generate pores within the foam after it sets in situ. Furthermore, while implantable scaffolds can be washed extensively to remove undesirable impurities, all of the components required to synthesize injectable foams must be injected into the defect. Thus, every compound in the foam must be biocompatible and noncytotoxic at the concentrations utilized. As future research addresses these critical challenges, injectable macroporous foams are anticipated to have an increasingly significant impact on improving patient outcomes for a number of clinical procedures.

  12. Apatitic connecting rings in moulds of Baculites sp. from the middle part of the Smoky Hill Member, Niobrara Chalk (Santonian), of western Kansas

    USGS Publications Warehouse

    Hasenmueller, W.A.; Hattin, D.E.

    1985-01-01

    Moulds of Baculites sp. are common in the Smoky Hill Member but only five known specimens contain connecting rings that have been preserved because of mineralisation by carbonate apatite. Analysis of four of these specimens suggests that the connecting rings were originally composed of organic material and were mineralised during early diagenesis. Thin sections and scanning electron microscopy demonstrate that the connecting rings had a two-layered structure consisting of a thick siphuncular wall and a thin pellicle. ?? 1985.

  13. Urine Pretreat Injection System

    NASA Technical Reports Server (NTRS)

    1995-01-01

    A new method of introducing the OXONE (Registered Trademark) Monopersulfate Compound for urine pretreat into a two-phase urine/air flow stream has been successfully tested and evaluated. The feasibility of this innovative method has been established for purposes of providing a simple, convenient, and safe method of handling a chemical pretreat required for urine processing in a microgravity space environment. Also, the Oxone portion of the urine pretreat has demonstrated the following advantages during real time collection of 750 pounds of urine in a Space Station design two-phase urine Fan/Separator: Eliminated urine precipitate buildup on internal hardware and plumbing; Minimized odor from collected urine; and Virtually eliminated airborne bacteria. The urine pretreat, as presently defined for the Space Station program for proper downstream processing of urine, is a two-part chemical treatment of 5.0 grams of Oxone and 2.3 ml of H2SO4 per liter of urine. This study program and test demonstrated only the addition of the proper ratio of Oxone into the urine collection system upstream of the Fan/Separator. This program was divided into the following three major tasks: (1) A trade study, to define and recommend the type of Oxone injection method to pursue further; (2) The design and fabrication of the selected method; and (3) A test program using high fidelity hardware and fresh urine to demonstrate the method feasibility. The trade study was conducted which included defining several methods for injecting Oxone in different forms into a urine system. Oxone was considered in a liquid, solid, paste and powered form. The trade study and the resulting recommendation were presented at a trade study review held at Hamilton Standard on 24-25 October 94. An agreement was reached at the meeting to continue the solid tablet in a bag concept which included a series of tablets suspended in the urine/air flow stream. These Oxone tablets would slowly dissolve at a controlled rate

  14. NEUTRAL-BEAM INJECTION

    SciTech Connect

    Kunkel, W.B.

    1980-06-01

    The emphasis in the preceding chapters has been on magnetic confinement of high temperature plasmas. The question of production and heating of such plasmas has been dealt with relatively more briefly. It should not be inferred, however, that these matters must therefore be either trivial or unimportant. A review of the history reveals that in the early days all these aspects of the controlled fusion problem were considered to be on a par, and were tackled simultaneously and with equal vigor. Only the confinement problem turned out to be much more complex than initially anticipated, and richer in challenge to the plasma physicist than the questions of plasma production and heating. On the other hand, the properties of high-temperature plasmas and plasma confinement can only be studied experimentally after the problems of production and of heating to adequate temperatures are solved. It is the purpose of this and the next chapter to supplement the preceding discussions with more detail on two important subjects: neutral-beam injection and radio-frequency heating. These are the major contenders for heating in present and future tokamak and mirror fusion experiments, and even in several proposed reactors. For neutral beams we emphasize here the technology involved, which has undergone a rather remarkable development. The physics of particle and energy deposition in the plasma, and the discussion of the resulting effects on the confined plasma, have been included in previous chapters, and some experimental results are quoted there. Other heating processes of relevance to fusion are mentioned elsewhere in this book, in connection with the experiments where they are used: i.e. ohmic heating, adiabatic compression heating, and alpha-particle heating in Chapter 3 by H.P. Furth; more ohmic heating in Chapter 7, and shock-implosion heating, laser heating, and relativistic-electron beam heating in Chapter 8, both by W. E. Quinn. These methods are relatively straightforward in

  15. 3D evaluation of maxillary arches in unilateral cleft lip and palate patients treated with nasoalveolar moulding vs. Hotz's plate.

    PubMed

    Cerón-Zapata, A M; López-Palacio, A M; Rodriguez-Ardila, M J; Berrio-Gutiérrez, L M; De Menezes, M; Sforza, C

    2016-02-01

    To compare the three-dimensional changes occurring in the maxillary arch during the use of modified pre-surgical nasoalveolar moulding (PNAM) and Hotz's plate. A clinical trial including 32 children with unilateral cleft lip and palate (UCLP), 16 treated with Hotz's plate and 16 with PNAM, was performed. Impressions of the maxillary arches were taken: A. prior to pre-surgical orthopaedics, B. before cheiloplasty and C. after cheiloplasty. Models were digitised using a stereophotogrammetric instrument, and geodesic distances were calculated: anterior, canine and posterior widths of the arch, and lengths and cleft depths of the larger and shorter segments. The time and treatment effects were assessed by two-factor anova. A significant effect of treatment was found for cleft depth at the larger segment: children treated with Hotz's plate had significantly deeper cleft than children treated with PNAM. All distances significantly changed during time: the anterior and canine widths decreased, while the posterior width, the lengths and depths of the cleft segments increased. Significant treatment per time interactions was found. The anterior and canine widths reduced more with PNAM between time points A and B while Hotz's treatment was more effective between B and C. The shorter segment depth increased more between B and C with PNAM, and between A and B with Hotz's plate. During pre-surgical orthopaedics, therapy with PNAM obtained the best results in reducing the width at the anterior segment of the cleft. This treatment gave a lower increase in cleft depth than treatment with Hotz's plate.

  16. The influence of the mould cooling temperature on the surface appearance and the internal quality of ESR ingots

    NASA Astrophysics Data System (ADS)

    Kubin, M.; Ofner, B.; Holzgruber, H.; Schneider, R.; Enzenhofer, D.; Filzwieser, A.; Konetschnik, S.

    2016-07-01

    One of the main benefits of the ESR process is to obtain an ingot surface which is smooth and allows a subsequent forging operation without any surface dressing. The main influencing factor on surface quality is the precise controlling of the process such as melt rate and electrode immersion depth. However, the relatively strong cooling effect of water as a cooling medium can result in the solidification of the meniscus of the liquid steel on the boundary liquid steel and slag which is most likely the origin of surface defects. The usage of different cooling media like ionic liquids, a salt solution which can be heated up to 250°C operating temperature might diminish the meniscus solidification phenomenon. This paper shows the first results of the usage of an ionic liquid as a mould cooling medium. In doing so, 210mm diameter ESR ingots were produced with the laboratory scale ESR furnace at the university of applied science using an ionic liquid cooling device developed by the company METTOP. For each trial melt different inlet and outlet temperatures of the ionic liquid were chosen and the impact on the surface appearance and internal quality were analyzed. Furthermore the influence on the energy balance is also briefly highlighted. Ultimately, an effect of the usage of ionic liquids as a cooling medium could be determined and these results will be described in detail within the scope of this paper.

  17. Injection nozzle for a turbomachine

    DOEpatents

    Uhm, Jong Ho; Johnson, Thomas Edward; Kim, Kwanwoo

    2012-09-11

    A turbomachine includes a compressor, a combustor operatively connected to the compressor, an end cover mounted to the combustor, and an injection nozzle assembly operatively connected to the combustor. The injection nozzle assembly includes a first end portion that extends to a second end portion, and a plurality of tube elements provided at the second end portion. Each of the plurality of tube elements defining a fluid passage includes a body having a first end section that extends to a second end section. The second end section projects beyond the second end portion of the injection nozzle assembly.

  18. Infliximab, Infliximab-dyyb Injection

    MedlinePlus

    ... injection may cause serious allergic reactions during an infusion and for 2 hours afterward. A doctor or ... the following symptoms during or shortly after your infusion: hives; rash; itching; swelling of the face, eyes, ...

  19. Epidural Injections for Spinal Pain

    MedlinePlus

    ... back or leg pain after spinal surgery) Other injuries to spinal nerves, vertebrae and surrounding tissues Bone ... Bleeding if a blood vessel is inadvertently damaged. Injury to the nerves at the injection site. Temporary ...

  20. NSLS-II INJECTION CONCEPT.

    SciTech Connect

    SHAFTAN, T.; PINAYEV, I.; ROSE, J.; WANG, X.J.; ET AL.

    2005-05-16

    Currently the facility upgrade project is in progress at the NSLS (at Brookhaven National Laboratory). The goal of the NSLS-II is a 3 GeV ultra-low-emittance storage ring that will increase radiation brightness by three orders of magnitude over that of the present NSLS X-ray ring. The low emittance of the high brightness ring's lattice results in a short lifetime, so that a top-off injection mode becomes an operational necessity. Therefore, the NSLS-II injection system must provide, and efficiently inject, an electron beam at a high repetition rate. In this paper, we present our concept of the NSLS-II injection system and discuss the conditions for, and constraints on, its design.

  1. General Information About Injection Wells

    EPA Pesticide Factsheets

    This webpage provides general background information on injection wells used to place fluids in the subsurface. It also provides information on use, different categories, and how they are regulated. Information on the protection is also provided.

  2. Conditioning with delayed vitamin injections.

    PubMed

    Garcia, J; Ervin, F R; Yorke, C H; Koelling, R A

    1967-02-10

    Rats deficient in thiamine were allowed to drink saccharin-fla vored water. They were then given an injection of thiamine which caused their intake of the nonnutritive fluid to increase. Delay of the intramuscular injection up to 30 minutes had no effect upon the acquisition of this condi tioning. Presumably, this delay reflects specialization in the central integrative mechanisms which serve these afferent modalities.

  3. 77 FR 52717 - Underground Injection Control Program; Hazardous Waste Injection Restrictions; Petition for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-30

    ... AGENCY Underground Injection Control Program; Hazardous Waste Injection Restrictions; Petition for Exemption--Class I Hazardous Waste Injection; Cornerstone Chemical Company, Waggaman, LA AGENCY... granted to Cornerstone for four Class I injection wells located at Waggaman, Louisiana. The company...

  4. 78 FR 23246 - Underground Injection Control Program; Hazardous Waste Injection Restrictions; Petition for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-18

    ... AGENCY Underground Injection Control Program; Hazardous Waste Injection Restrictions; Petition for Exemption--Class I Hazardous Waste Injection; BASF Corporation Freeport, Texas AGENCY: Environmental... granted to BASF Corporation for three Class I injection wells located at Freeport, Texas. The company...

  5. Adaptive engine injection for emissions reduction

    DOEpatents

    Reitz, Rolf D. : Sun, Yong

    2008-12-16

    NOx and soot emissions from internal combustion engines, and in particular compression ignition (diesel) engines, are reduced by varying fuel injection timing, fuel injection pressure, and injected fuel volume between low and greater engine loads. At low loads, fuel is injected during one or more low-pressure injections occurring at low injection pressures between the start of the intake stroke and approximately 40 degrees before top dead center during the compression stroke. At higher loads, similar injections are used early in each combustion cycle, in addition to later injections which preferably occur between about 90 degrees before top dead center during the compression stroke, and about 90 degrees after top dead center during the expansion stroke (and which most preferably begin at or closely adjacent the end of the compression stroke). These later injections have higher injection pressure, and also lower injected fuel volume, than the earlier injections.

  6. Fluid injection and induced seismicity

    NASA Astrophysics Data System (ADS)

    Kendall, Michael; Verdon, James

    2016-04-01

    The link between fluid injection, or extraction, and induced seismicity has been observed in reservoirs for many decades. In fact spatial mapping of low magnitude events is routinely used to estimate a stimulated reservoir volume. However, the link between subsurface fluid injection and larger felt seismicity is less clear and has attracted recent interest with a dramatic increase in earthquakes associated with the disposal of oilfield waste fluids. In a few cases, hydraulic fracturing has also been linked to induced seismicity. Much can be learned from past case-studies of induced seismicity so that we can better understand the risks posed. Here we examine 12 case examples and consider in particular controls on maximum event size, lateral event distributions, and event depths. Our results suggest that injection volume is a better control on maximum magnitude than past, natural seismicity in a region. This might, however, simply reflect the lack of baseline monitoring and/or long-term seismic records in certain regions. To address this in the UK, the British Geological Survey is leading the deployment of monitoring arrays in prospective shale gas areas in Lancashire and Yorkshire. In most cases, seismicity is generally located in close vicinity to the injection site. However, in some cases, the nearest events are up to 5km from the injection point. This gives an indication of the minimum radius of influence of such fluid injection projects. The most distant events are never more than 20km from the injection point, perhaps implying a maximum radius of influence. Some events are located in the target reservoir, but most occur below the injection depth. In fact, most events lie in the crystalline basement underlying the sedimentary rocks. This suggests that induced seismicity may not pose a leakage risk for fluid migration back to the surface, as it does not impact caprock integrity. A useful application for microseismic data is to try and forecast induced seismicity

  7. Development of a HOG-based real-time PCR method to detect stress response changes in mycotoxigenic moulds.

    PubMed

    Rodríguez, Alicia; Medina, Ángel; Córdoba, Juan J; Magan, Naresh

    2016-08-01

    There is a need to understand the mechanism of adaptation of toxigenic fungal species which are able to colonise highly specialised foods such as cured meats where there is a high osmotic stress due to the presence up to 20-22% NaCl during the ripening process. A new tool able to detect changes in stress related genes would be useful to understand the ecological reasons for the ability of these species to grow in specialised niches. In this work a real-time PCR (qPCR) using SYBR Green was developed. Primers were designed from the Hog1 gene involved in osmo-adaptation in fungi. For this, conserved regions resulting from the alignment of 26 published partial sequences of such gene were used. Specificity of primers HogF2/R2 was demonstrated when amplified, producing a unique 131-bp PCR product with a Tm value of 84 °C. The qPCR method showed an efficiency of 98%, R(2) value > 0.99 and a detection limit of 0.7 log Hog1 gene copies. The qPCR method to measure changes in the Hog1 gene expression in relation to growth in ionic and non-ionic stressed environments (using 10-40% NaCl and sorbitol concentrations) was found to be suitable for two mycotoxigenic species (Penicillium nordicum, P. expansum). This assay will be a valuable tool for generating relevant Hog1 expression data from different mould species in relation to different stresses in food habitats. It will also be a good tool for a better understanding of the ability of xerophilic and xerotolerant species to colonise extreme environments.

  8. Genetic structure and natural variation associated with host of origin in Penicillium expansum strains causing blue mould.

    PubMed

    Sanzani, S M; Montemurro, C; Di Rienzo, V; Solfrizzo, M; Ippolito, A

    2013-07-15

    Blue mould, caused by Penicillium expansum, is one of the most economically damaging postharvest diseases of pome fruits, although it may affect a wider host range, including sweet cherries and table grapes. Several reports on the role of mycotoxins in plant pathogenesis have been published, but few focussed on the influence of mycotoxins on the variation in host preference amongst producing fungi. In the present study the influence of the host on P. expansum pathogenicity/virulence was investigated, focussing mainly on the relationship with patulin production. Three P. expansum strain groups, originating from apples, sweet cherries, and table grapes (7 strains per host) were grown on their hosts of isolation and on artificial media derived from them. Strains within each P. expansum group proved to be more aggressive and produced more patulin than the other two groups under evaluation when grown on the host from which they originated. Table grape strains were the most aggressive (81% disease incidence) and strongest patulin producers (up to 554μg/g). The difference in aggressiveness amongst strains was appreciable only in the presence of a living host, suggesting that the complex pathogen-host interaction significantly influenced the ability of P. expansum to cause the disease. Incidence/severity of the disease and patulin production proved to be positively correlated, supporting the role of patulin as virulence/pathogenicity factor. The existence of genetic variation amongst isolates was confirmed by the High Resolution Melting method that was set up herein, which permitted discrimination of P. expansum from other species (P. chrysogenum and P. crustosum) and, within the same species, amongst the host of origin. Host effect on toxin production appeared to be exerted at a transcriptional level.

  9. The Effects of Temperature Variation on the Sensitivity to Pesticides: a Study on the Slime Mould Dictyostelium discoideum (Protozoa).

    PubMed

    Amaroli, Andrea

    2015-07-01

    Slime moulds live in agricultural ecosystems, where they play an important role in the soil fertilization and in the battle against crop pathogens. In an agricultural soil, the amoebae are exposed to different stress factors such as pesticides and weather conditions. The use of pesticides increased up from 0.49 kg per hectare in 1961 to 2 kg in 2004, and the global greenhouse gas emission has grown 70% between 1970 and 2004 leading to a global fluctuation of average surface temperature. Therefore, the European Directive 2009/128/EC has led to a new approach to agriculture, with the transition from an old concept based on high use of pesticides and fossil fuels to an agriculture aware of biodiversity and health issues. We studied the effects of temperature variations and pesticides on Dictyostelium discoideum. We measured the fission rate, the ability to differentiate and the markers of stress such as the activity and presence of pseudocholinesterase and the presence of heat shock protein 70. Our results highlight how the sensitivity to zinc, aluminium, silver, copper, cadmium, mercury, diazinon and dicofol changes for a 2 °C variation from nothing/low to critical. Our work suggests considering, in future regulations, about the use of pesticides as their toxic effect on non-target organisms is strongly influenced by climate temperatures. In addition, there is a need for a new consideration of the protozoa, which takes into account recent researches about the presence in this microorganism of classical neurotransmitters that, similar to those in animals, make protozoa an innocent target of neurotoxic pesticides in the battle against the pest crops.

  10. Fabrication of anti-adhesion surfaces on aluminium substrates of rubber plastic moulds using electrolysis plasma treatment

    NASA Astrophysics Data System (ADS)

    Meng, Jianbing; Dong, Xiaojuan; Wei, Xiuting; Yin, Zhanmin

    2015-04-01

    An anti-adhesion surface with a water contact angle of 167° was fabricated on aluminium samples of rubber plastic moulds by electrolysis plasma treatment using mixed electrolytes of C6H5O7(NH4)3 and Na2SO4, followed by fluorination. To optimise the fabrication conditions, several important processing parameters such as the discharge voltage, discharge time, concentrations of supporting electrolyte and stearic acid ethanol solution were examined systematically. Using scanning electron microscopy (SEM) to analyse surfaces morphology, micrometer scale pits, and protrusions were found on the surface, with numerous nanometer mastoids contained in the protrusions. These binary micro/nano-scale structures, which are similar to the micro-structures of soil-burrowing animals, play a critical role in achieving low adhesion properties. Otherwise, the anti-adhesion behaviours of the resulting samples were analysed by the atomic force microscope (AFM), Fourier-transform infrared spectrophotometer (FTIR), electrons probe micro-analyzer (EPMA), optical contact angle meter, digital Vickers microhardness (Hv) tester, and electronic universal testing. The results show that the electrolysis plasma treatment does not require complex processing parameters, using a simple device, and is an environment-friendly and effective method. Under the optimised conditions, the contact angle (CA) for the modified anti-adhesion surface is up to 167°, the sliding angle (SA) is less than 2°, roughness of the sample surface is only 0.409μm. Moreover, the adhesion force and Hv are 0. 9KN and 385, respectively.

  11. The use of powder and essential oil of Cymbopogon citratus against mould deterioration and aflatoxin contamination of "egusi" melon seeds.

    PubMed

    Bankole, S A; Joda, A O; Ashidi, J S

    2005-01-01

    Experiments were carried out to determine the potential of using the powder and essential oil from dried ground leaves of Cymbopogon citratus (lemon grass) to control storage deterioration and aflatoxin contamination of melon seeds. Four mould species: Aspergillus flavus, A. niger, A. tamarii and Penicillium citrinum were inoculated in the form of conidia suspension (approx. 10(6) conidia per ml) unto shelled melon seeds. The powdered dry leaves and essential oil from lemon grass were mixed with the inoculated seeds at levels ranging from 1-10 g/100 g seeds and 0.1 to 1.0 ml/100 g seeds respectively. The ground leaves significantly reduced the extent of deterioration in melon seeds inoculated with different fungi compared to the untreated inoculated seeds. The essential oil at 0.1 and 0.25 ml/100 g seeds and ground leaves at 10 g/100 g seeds significantly reduced deterioration and aflatoxin production in shelled melon seeds inoculated with toxigenic A. flavus. At higher dosages (0.5 and 1.0 ml/100 g seeds), the essential oil completely prevented aflatoxin production. After 6 months in farmers' stores, unshelled melon seeds treated with 0.5 ml/ 100 g seeds of essential oil and 10 g/100 g seeds of powdered leaves of C. citratus had significantly lower proportion of visibly diseased seeds and Aspergillus spp. infestation levels and significantly higher seed germination compared to the untreated seeds. The oil content, free fatty acid and peroxide values in seeds protected with essential oil after 6 months did not significantly differ from the values in seeds before storage. The efficacy of the essential oil in preserving the quality of melon seeds in stores was statistically at par with that of fungicide (iprodione) treatment.

  12. Fabrication of anti-adhesion surfaces on aluminium substrates of rubber plastic moulds using electrolysis plasma treatment

    SciTech Connect

    Meng, Jianbing Dong, Xiaojuan; Wei, Xiuting; Yin, Zhanmin

    2015-04-15

    An anti-adhesion surface with a water contact angle of 167° was fabricated on aluminium samples of rubber plastic moulds by electrolysis plasma treatment using mixed electrolytes of C{sub 6}H{sub 5}O{sub 7}(NH{sub 4}){sub 3} and Na{sub 2}SO{sub 4}, followed by fluorination. To optimise the fabrication conditions, several important processing parameters such as the discharge voltage, discharge time, concentrations of supporting electrolyte and stearic acid ethanol solution were examined systematically. Using scanning electron microscopy (SEM) to analyse surfaces morphology, micrometer scale pits, and protrusions were found on the surface, with numerous nanometer mastoids contained in the protrusions. These binary micro/nano-scale structures, which are similar to the micro-structures of soil-burrowing animals, play a critical role in achieving low adhesion properties. Otherwise, the anti-adhesion behaviours of the resulting samples were analysed by the atomic force microscope (AFM), Fourier-transform infrared spectrophotometer (FTIR), electrons probe micro-analyzer (EPMA), optical contact angle meter, digital Vickers microhardness (Hv) tester, and electronic universal testing. The results show that the electrolysis plasma treatment does not require complex processing parameters, using a simple device, and is an environment-friendly and effective method. Under the optimised conditions, the contact angle (CA) for the modified anti-adhesion surface is up to 167°, the sliding angle (SA) is less than 2°, roughness of the sample surface is only 0.409μm. Moreover, the adhesion force and H{sub v} are 0. 9KN and 385, respectively.

  13. Mould and mycotoxin exposure assessment of melon and bush mango seeds, two common soup thickeners consumed in Nigeria.

    PubMed

    Ezekiel, Chibundu N; Sulyok, Michael; Somorin, Yinka; Odutayo, Foluke I; Nwabekee, Stella U; Balogun, Afeez T; Krska, Rudolf

    2016-11-21

    An examination of the mould and fungal metabolite pattern in melon and bush mango seeds locally produced in Nigeria was undertaken in order to understand the mycotoxicological risk posed to consumers of both of these important and commonly consumed soup thickeners. The variation in mycotoxin levels in graded categories of both foodstuffs were also determined. Aspergillus, Fusarium, Penicillium, Mucorales and Trichoderma were the recovered fungi from the foodstuffs with Aspergillus species dominating (melon=97.8%; bush mango=89.9%). Among the Aspergillus species identified Aspergillus section Flavi dominated (melon: 72%; bush mango: 57%) and A. flavus, A. parasiticus, A. parvisclerotigenus and A. tamarii were the recovered species. About 56% and 73% of the A. flavus isolates from melon and bush mango seed samples, respectively were aflatoxigenic. Thirty-four and 59 metabolites including notable mycotoxins were found in the melon and bush mango seeds respectively. Mean aflatoxin levels (μg/kg) in melon (aflatoxin B1 (AFB1)=37.5 and total aflatoxins=142) and bush mango seeds (AFB1=68.1 and total aflatoxins=61.7) were higher than other mycotoxins, suggesting potential higher exposure for consumer populations. Significantly (p<0.05) higher levels of mycotoxins were found in hand-peeled melon and discoloured bush mango seeds than in machine-peeled melon and non-discoloured seeds except for HT-2 and T-2 toxins which occurred conversely. All melon and bush mango seeds exceeded the 2μg/kg AFB1 limit whereas all melon and 55% of bush mango seeds exceeded the 4μg/kg total aflatoxin EU limit adopted in Nigeria. This is the first report of (1) mycotoxin co-occurrence in bush mango seeds, (2) cyclopiazonic acid, HT-2 toxin, moniliformin, mycophenolic acid, T-2 toxin and tenuazonic acid occurrence, and (3) mycotoxin exposure assessment of both foodstuffs.

  14. Staged direct injection diesel engine

    DOEpatents

    Baker, Quentin A.

    1985-01-01

    A diesel engine having staged injection for using lower cetane number fuels than No. 2 diesel fuel. The engine includes a main fuel injector and a pilot fuel injector. Pilot and main fuel may be the same fuel. The pilot injector injects from five to fifteen percent of the total fuel at timings from 20.degree. to 180.degree. BTDC depending upon the quantity of pilot fuel injected, the fuel cetane number and speed and load. The pilot fuel injector is directed toward the centerline of the diesel cylinder and at an angle toward the top of the piston, avoiding the walls of the cylinder. Stratification of the early injected pilot fuel is needed to reduce the fuel-air mixing rate, prevent loss of pilot fuel to quench zones, and keep the fuel-air mixture from becoming too fuel lean to become effective. In one embodiment, the pilot fuel injector includes a single hole for injection of the fuel and is directed at approximately 48.degree. below the head of the cylinder.

  15. Injection molding of engineering plastics

    NASA Astrophysics Data System (ADS)

    Kalyon, Dilhan M.

    1991-03-01

    This final report summarizes the findings of a study in injection molding of engineering plastics. Two engineering plastic resins, i.e., unmodified grades of a polyetherimide and a poly (2,6-dimethyl-1,4-phenylene ether) were thoroughly characterized. The characterization included rheology, thermal properties and P-V-T behavior. The data were employed to predict various microstructural distributions including density, residual stress and birefringence distributions in compression and injection molded specimens of these two engineering plastics. The detailed microstructural distributions were also studied experimentally upon processing the two engineering plastics, employing instrumented machines and industrial practices. The experimental findings were elucidated under the light of the numerical simulation results. Overall, this study should furnish a first order understanding of the microstructure development in articles injection molded from amorphous engineering plastic resins.

  16. A feasibility study for using ABS plastic and a low-cost 3D printer for patient-specific brachytherapy mould design.

    PubMed

    Harris, Benjamin D; Nilsson, Sanna; Poole, Christopher M

    2015-09-01

    This feasibility study aims to determine if a low-cost 3D printer (BitsFromBytes 3D Touch) with ABS plastic can print custom mould structures and catheter channels defined in a brachytherapy treatment planning system (Nucletron Oncentra) for patient-specific treatment. Printer accuracy was evaluated through physical measurement, and print quality was investigated by adjusting print parameters (print speed, layer thickness, percentage infill). Catheter positioning and reproducibility were measured over repeated insertions. ABS plastic water equivalency was investigated by comparing Ir-192 HDR source dose distributions, measured with radiochromic film, in ABS plastic and in water. Structures and catheter channels were printed accurately to within 0.5 mm laterally and 1 mm in the vertical print direction. Adjusting print parameters could reduce print time, albeit with reduced print quality. 3.5 mm channel diameters allowed for easy catheter insertion. Catheter positioning was reproducible to within 0.5 mm but, because of catheter flex within the channel, was on average 1 mm offset from defined TPS positions. This offset could be accounted for by repeating the treatment planning CT scan with the printed mould positioned on the patient. Dose attenuation in ABS plastic and in water was equivalent to within the measurement limitations. While clinical uses for this particular low-cost printer and ABS plastic are limited by print size restrictions and non-certification for biocompatibility, it has been demonstrated that a low-cost 3D printer set-up can accurately create custom moulds and catheter channels potentially acceptable for clinical use.

  17. In vitro antifungal susceptibility of the yeast- and mould-phases of the dimorphic fungal pathogen, Emergomyces africanus (formerly Emmonsia species), from HIV-infected South African patients.

    PubMed

    Maphanga, Tsidiso G; Britz, Erika; Zulu, Thokozile G; Mpembe, Ruth S; Naicker, Serisha D; Schwartz, Ilan S; Govender, Nelesh P

    2017-03-29

    Introduction: Disseminated emmonsiosis is an important AIDS-related mycosis in South Africa caused by Emergomyces africanus, a newly-described and -renamed dimorphic fungal pathogen. In vitro antifungal susceptibility data can guide management.Materials and Methods: Identification of invasive clinical isolates was confirmed phenotypically and by sequencing the internal transcribed spacer region. Yeast and mould-phase MICs for fluconazole, voriconazole, itraconazole, posaconazole, caspofungin, anidulafungin, micafungin and flucytosine were determined using custom-made frozen broth microdilution (BMD) panels, as per Clinical and Laboratory Standards Institute recommendations. MICs for amphotericin B, itraconazole, posaconazole and voriconazole were determined by Etest.Results: Fifty unique Emergomyces africanus isolates were tested. Yeast- and mould-phase geometric mean (GM) BMD and Etest MICs values were 0.01 mg/L for itraconazole. Voriconazole and posaconazole GM BMD MICs were 0.01 mg/L for both phases, while GM Etest MICs were 0.001 mg/L and 0.002 mg/L, respectively. Fluconazole GM BMD MICs were 0.18 mg/L for both phases. For amphotericin B, GM Etest MICs for the yeast- and mould-phases were 0.03 mg/L and 0.01 mg/L. The echinocandins and flucytosine had very limited in vitro activity. Treatment and outcome data were available for 37 patients; in a multivariable model including MIC data, only isolation from blood (OR 8.6, 95% CI 1.3 - 54.4, p = 0.02) or bone marrow (OR 12.1, 95% CI 1.2 - 120.2, p = 0.03) (vs. skin biopsy) was associated with death.Conclusions:In vitro susceptibility data support management of disseminated emmonsiosis with amphotericin B followed by itraconazole, voriconazole or posaconazole. Fluconazole was a relatively less potent agent.

  18. Characterization of phase development in non-isothermally annealed mould-cast and heat-treated Al-Mn-Sc-Zr alloys

    SciTech Connect

    Vlach, M. Stulikova, I.; Smola, B.; Zaludova, N.

    2010-12-15

    The effect of Mn addition on microstructure and mechanical properties during isochronal annealing in the temperature range of 20 deg. C - 570 deg. C of the mould-cast and heat-treated Al-Sc-Zr alloys with a various content of Mn and Zr was studied. The electrical resistometry together with the microhardness (HV0.3) measurements were compared to microstructure development. The microstructure development was examined by scanning electron microscopy, transmission electron microscopy and electron diffraction. Relative resistivity changes and the microhardness of the mould-cast and heat-treated Al-Mn-Sc-Zr alloys exhibit similar dependence on annealing temperature. Precipitation of the Al{sub 3}Sc particles is responsible for the peak microhardness in all these alloys. The microhardness decrease is slightly delayed during the isochronal annealing and during the high temperature heat treatment in the mould-cast alloy with the higher Zr-content due to a higher oversaturation of Zr. The decomposition sequence of the oversaturated solid solution of the studied Al-Mn-Sc-Zr alloys is compatible with the recently published decomposition sequence of the Al-Sc-Zr system and also with the formation of Mn,Fe-containing particles. It seems very probable that the addition of Mn does not influence the decomposition of solid solution of the ternary Al-Sc-Zr system. - Research Highlights: {yields} Al{sub 3}Sc particles are responsible for the peak microhardness in all the studied alloys. {yields} The microhardness decrease is delayed in the alloy with the higher Zr-content. {yields} The peak hardening of the heat-treated alloys is shifted to higher temperatures. {yields} Mn does not influence the decomposition sequence of the Al-Sc-Zr system.

  19. Influence of post-harvest application rates of cyprodinil, treatment time and temperature on residue levels and efficacy in controlling green mould on 'Valencia' oranges.

    PubMed

    Schirra, Mario; D'Aquino, Salvatore; Cabras, Paolo; Angioni, Alberto

    2009-07-01

    The effectiveness of heat treatments with water and cyprodinil in controlling post-harvest green mould caused by Penicillium digitatum was investigated on artificially inoculated 'Valencia' oranges. Residue levels of cyprodinil were determined in the oranges as a function of active ingredient concentration, temperature and treatment time. Cyprodinil residues were significantly dependent on treatment time when applied at 600 mg l(-1) and 20 degrees C, but not when fruit were treated at 150-300 mg l(-1). The application of cyprodinil at 50 or 100 mg l(-1) at 55 degrees C for 30 s produced similar residue levels, while residues increased when the application rate was 150 mg l(-1). Cyprodinil at 100 mg l(-1) and 60 degrees C produced a significant increase in residues compared to treatment at 50 mg l(-1); no significant increase in residues was found when the application rate was raised from 100 to 150 mg l(-1). In comparison to treatments performed at 20 degrees C, the application of a heated cyprodinil mixture resulted in significantly higher residues in fruit. All treatments with cyprodinil at 20 degrees C similarly reduced green mould after 7 days of storage at 20 degrees C. After 18 days, treatment with cyprodinil at 600 mg l(-1) for 30 s was more effective than at 150-300 mg l(-1). When dip time was extended to 90 or 180 s, treatment efficacy was positively related to fungicide concentration. Treatments with water at 55 degrees C for 30 s were as effective as cyprodinil at 50-100 mg l(-1), but less effective than cyprodinil at 150 mg l(-1). After 7 days, treatment with water or cyprodinil at 50-150 mg l(-1) and 60 degrees C were equally effective in controlling green mould; while, after 18 days, treatment with cyprodinil at 150 mg l(-1) was consistently more effective than at 50-100 mg l(-1) or hot water alone.

  20. Sodium storage and injection system

    NASA Technical Reports Server (NTRS)

    Keeton, A. R. (Inventor)

    1979-01-01

    A sodium storage and injection system for delivering atomized liquid sodium to a chemical reactor employed in the production of solar grade silicon is disclosed. The system is adapted to accommodate start-up, shut-down, normal and emergency operations, and is characterized by (1) a jacketed injection nozzle adapted to atomize liquefied sodium and (2) a supply circuit connected to the nozzle for delivering the liquefied sodium. The supply circuit is comprised of a plurality of replaceable sodium containment vessels, a pump interposed between the vessels and the nozzle, and a pressurizing circuit including a source of inert gas connected with the vessels for maintaining the sodium under pressure.

  1. Line10 Charge Injection Biases

    NASA Astrophysics Data System (ADS)

    Baggett, Sylvia

    2012-10-01

    Radiation damage on-orbit, in the form of charge traps, gradually reduces the charge transfer efficiency {CTE} of CCDs over time. In WFC3, one option for mitigating CTE losses is charge injection i.e. electronically inserting charge every Nth row. The benefit of this method is the significantly lower noise penalty, much less than the traditional Poissonian noise imparted by a pre- or post-flash of the same charge level. This program acquires the calibration data necessary to support science observations using charge injection.

  2. [On the history of injection].

    PubMed

    Norn, Svend; Kruse, Poul R; Kruse, Edith

    2006-01-01

    Although the effect of snake bites and poisoned arrows was known from ancient time, the development of the syringe and the needle lasted several centuries. Forms of intravenous injection and infusion are clearly documented in the 1650s. Sir Christopher Wren used a syringe made of animal bladder fixed to a goose quill to inject wine and opium into the veins of dogs. J.D. Major from Kiel and J.S. Elsholtz from Berlin probably were the first to deliberately administer intravenous injections to people in the 1660s. However, these early injections were not successful and injections did not come into fashion again until the latter part of the 1800s. Forerunners of subcutaneous administration were either the introduction of the drug under the epidermis by means of a vaccination-lancet or the application of a vesicant to remove the epidermis, after which the drug was applied to the denuded cutis. Lafargue, Lembert and Lesieur described these methods in the first half of the 1800s, and the methods continued to be of use in the second part of the century until the advent of subcutaneous injection. Alexander Wood of Edinburgh and Charles-Gabriel Pravaz from Lyon are known commonly as the inventors of the syringe for subcutaneous injection, but other pioneers such as Taylor, Washington and Rynd had already begun this form of administration. Increased use, safety and accuracy were accomplished by the progressive steps introduced by Wood, Pravaz and Luer. Thus, the syringe of Luer was fitted for aseptic heating, and a sharp needle readily perforated the skin. Sterilization by heating in an autoclave was developed by Pasteur, Chamberland and Koch, after managing aseptic conditions by the addition of preservatives such as carbolic acid. A safe method for the storage of sterile injectates was provided by Limousin's ampoule from 1886, and later by the introduction of multi-dose containers. The evolution of the syringe and its needle continues with the introduction of transdermal

  3. Use of NH4Cl-H2O Analogue Castings to Model Aspects of Continuous Casting. Part 1; Asymmetry in Inclined Moulds

    NASA Technical Reports Server (NTRS)

    Jang, J.; Hellawell, A.

    1991-01-01

    Crystallisation of NH4Cl from aqueous solutions has been used to examine grain formation in a configuration similar to that existing in the curved mould of a continuous, steel casting machine. The observations show how falling equiaxed crystals accumulate at the lower (outer) columnar front earlier than at the upper (inner) front and, thus, lead to an asymmetric grain structure. The usefulness of the aqueous system as a realistic model for steel casting is discussed in terms of relative temperature profiles, materials properties, and observed columnar and eutectic growth rates.

  4. 21 CFR 878.4520 - Polytetrafluoroethylene injectable.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Polytetrafluoroethylene injectable. 878.4520 Section 878.4520 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Polytetrafluoroethylene injectable. (a) Identification. Polytetrafluoroethylene injectable is an injectable...

  5. 21 CFR 878.4520 - Polytetrafluoroethylene injectable.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Polytetrafluoroethylene injectable. 878.4520 Section 878.4520 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Polytetrafluoroethylene injectable. (a) Identification. Polytetrafluoroethylene injectable is an injectable...

  6. 21 CFR 878.4520 - Polytetrafluoroethylene injectable.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Polytetrafluoroethylene injectable. 878.4520 Section 878.4520 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Polytetrafluoroethylene injectable. (a) Identification. Polytetrafluoroethylene injectable is an injectable...

  7. 21 CFR 878.4520 - Polytetrafluoroethylene injectable.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Polytetrafluoroethylene injectable. 878.4520 Section 878.4520 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Polytetrafluoroethylene injectable. (a) Identification. Polytetrafluoroethylene injectable is an injectable...

  8. 21 CFR 878.4520 - Polytetrafluoroethylene injectable.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Polytetrafluoroethylene injectable. 878.4520 Section 878.4520 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Polytetrafluoroethylene injectable. (a) Identification. Polytetrafluoroethylene injectable is an injectable...

  9. Bubble injected hydrocyclone flotation cell

    SciTech Connect

    Stanley, D.A.; Jordon, C.E.

    1990-11-20

    This patent describes an apparatus for selective separation of a mixture of hydrophobic and hydrophilic mineral particles. It comprises: a bubble-injected hydrocyclone flotation cell and a bubble slurry. The cell comprises an enclosed body section; a mineral pulp feed port; a bubble slurry feed port; and a vortex finder.

  10. Tuning superconductivity by carrier injection

    NASA Astrophysics Data System (ADS)

    Müller, Paul

    2011-03-01

    All high-Tc cuprates are stacking sequences of Cu O2 layers and charge reservoir layers consisting of metal oxides. Upon doping the Cu O2 layers, antiferromagnetic order is destroyed and metallic conductivity is established. Usually doping is achieved by a non-stoichiometric composition of the charge reservoir layer. However, we already have shown that we can change the carrier concentration of Bi 2 Sr 2 CaCu 2 O8 + δ single crystals by current injection along the c- axis. Critical temperature, c-axis resistivity and critical current of intrinsic Josephson junctions can be tuned in a large range from underdoping to extreme overdoping. This effect is persistent up to annealing temperatures of approximately 270 K. Using current injection at higher bias, we were able to reduce the carrier concentration again. We investigated in detail the superconducting properties by performing macroscopic quantum tunneling experiments of intrinsic Josephson junctions. The experiments have been carried out repeatedly on samples, whose properties were changed only by current injection. An exponential increase of the critical current density with hole concentration was observed. At the same time, the capacitance of intrinsic Josephson junctions increased significantly. Finally, only by current injection, we were able to convert into the superconducting state a nonsuperconducting, oxygen depleted sample. This work was done in collaboration with Y. Koval, X.Y. Jin, S. Probst, Y. Simsek, C. Steiner (Universität Erlangen), H. B. Wang (NIMS, Tsukuba), and G. Behr, B. Büchner (IFW Dresden).

  11. Initial NSTX Lithium Pellet Injection

    NASA Astrophysics Data System (ADS)

    Kugel, H. W.; Bell, M.; Bell, R.; Biewer, T.; Gates, D.; Jardin, S.; Kaita, R.; Leblanc, B.; Paul, S.; Samtaney, R.; Skinner, C. H.; Raman, R.; Bush, C.; Maingi, R.; Soukhanovskii, V.; Nishino, N.; Lee, K. C.; Stutman, D.

    2004-11-01

    A cartridge style Lithium Pellet Injector was installed on NSTX for midplane radial injection. Deuterium gas was used to propel a Li pellet-bearing cartridge down a barrel to a cartridge stop, and the pellet continued into the NSTX plasma at about 150 m/s. 16 lithium pellets, about 2 mg each were injected into LSN and DND, NBI-heated, H-mode plasmas, and into L-mode LSN Ohmic plasmas, and were observed with a Li I filtered Plasma-TV. Li pellets injected into NBI-heated LSN and DND plasmas appeared to ablate in the outer boundary. The pellets injected into OH plasmas exhibited good penetration to the HFS region. Lastly, a NBI preheat was added prior to pellet arrival, and the penetration depth was found to be very sensitive to the NBI turn-off time relative to pellet arrival. As this work progressed, Li luminosity started to be observed from the very initiation of discharges, due to depositions from preceding discharges. Initial modeling results will be presented.

  12. [Lethal intravenous injection of benzine].

    PubMed

    Zirwes, Christian; Ritz-Timme, Stefanie; Hinsch, Nora; Kardel, Bernd; Hartung, Benno

    2015-01-01

    A man who suffered from chronic pain syndrome died two days after intravenous injection of 2 ml benzine. Previous suicide attempts by drug intoxication and strangulation had failed. Death occurred due to multi-organ failure. We present the results of the clinical, morphological and toxicological examinations performed.

  13. Blast Furnace Granulated Coal Injection

    SciTech Connect

    1998-09-30

    Production levels on each furnace exceeded 7000 NTHM/day during July. The combined production of 14,326 was a result of lower coke rates and below average delay rates on both furnaces, The combined production was at its highest level since September 1997. In August, the combined productivity declined to less than 13,500 NTHM/day. Although D furnace maintained a production rate in excess of 7000 NTHM/day, C furnace was lower because of a castfloor breakout and subsequent five day repair from August 26-30. Despite the lower productivity in August, injected coal and furnace coke rates were very good during the month. During September, the operation was difficult as a result of higher delays on both furnaces. The combined average monthly delay rate was considerably above the twenty-month average of 113 minutes per day and the combined average monthly production was less than 14,000 NTHM/day. Higher furnace coke rates at lower coal injection levels also contributed to the decrease. Additionally, the coke rate on both furnaces was increased substantially and the injected coal rate was decreased in preparation for the high volatile Colorado coal trial that started on September 28. The furnace process results for this quarter are shown in Tables 1A and 1B. In addition, the last twelve months of injected coal and coke rates for each furnace are shown in Figures 1 and 2.

  14. Penicillin G (Potassium, Sodium) Injection

    MedlinePlus

    ... if you have or have ever had asthma, allergies, hay fever, hives, heart failure, or kidney or liver disease.tell your doctor if you are pregnant, plan to become pregnant, or are breastfeeding. If you become pregnant while receiving penicillin G injection, call your doctor.

  15. High injection vs low injection behaviour of solar cells

    SciTech Connect

    Luque, A.; Araujo, G.L.; Calleja, M.J.

    1984-05-01

    An unitary model similar to the Ebers Moll one is presented to describe the behaviour of BSF cells working under either high or low injection. The model is applied to bifacial cells. The influence of the base resistivity on the front to back illumination short-circuit current is explained, as well as the cross-over presented by the I-V curve under front and back illuminations.

  16. Rapid evaluation technique to differentiate mushroom disease-related moulds by detecting microbial volatile organic compounds using HS-SPME-GC-MS.

    PubMed

    Radványi, Dalma; Gere, Attila; Jókai, Zsuzsa; Fodor, Péter

    2015-01-01

    Headspace solid-phase microextraction (HS-SPME) coupled with gas chromatography-mass spectrometry (GC-MS) was used to analyse microbial volatile organic compounds (MVOCs) of mushroom disease-related microorganisms. Mycogone perniciosa, Lecanicillum fungicola var. fungicola, and Trichoderma aggressivum f. europaeum species, which are typically harmful in mushroom cultivation, were examined, and Agaricus bisporus (bisporic button mushroom) was also examined as a control. For internal standard, a mixture of alkanes was used; these were introduced as the memory effect of primed septa in the vial seal. Several different marker compounds were found in each sample, which enabled us to distinguish the different moulds and the mushroom mycelium from each other. Monitoring of marker compounds enabled us to investigate the behaviour of moulds. The records of the temporal pattern changes were used to produce partial least squares regression (PLS-R) models that enabled determination of the exact time of contamination (the infection time of the media). Using these evaluation techniques, the presence of mushroom disease-related fungi can be easily detected and monitored via their emitted MVOCs.

  17. Chitosan/whey Protein (CWP) Edible Films Efficiency for Controlling Mould Growth and on Microbiological, Chemical and Sensory Properties During Storage of Göbek Kashar Cheese

    PubMed Central

    2015-01-01

    The objective of present study was to evaluate the effects of the application of chitosan and chitosan/whey protein on the chemical, microbial and organoleptic properties of Göbek Kashar cheese during ripening time (on 3rd, 30th, 60th and 90th d). Difference in microbiological and chemical changes between samples was found to be significant (p<0.05) during ripening period. Cheese samples with edible coating had statistically lower mould counts compared to the uncoated samples. Furthermore the highest and lowest mould counts were determined in control (4.20 Log CFU/g) and other samples (<1 Log CFU/g) at 60th and 90th d of storage. All samples exhibited higher levels of water soluble nitrogen and ripening index at the end of storage process. At the end of 90 day storage period, no signicant dierences in salt and fat values were observed among the cheeses studied. The edible coatings had a beneficial effect on the sensory quality of cheese samples. In the result of sensory analysis, while cheese C and the chitosan coated cheese samples were more preferred by the panellists, the chitosan/whey protein film-coated cheese samples received the lowest scores. This study shows coating suggests could be used to improve the quality of cheese during ripening time. PMID:26761831

  18. 3D-Cultivation of bone marrow stromal cells on hydroxyapatite scaffolds fabricated by dispense-plotting and negative mould technique.

    PubMed

    Detsch, R; Uhl, F; Deisinger, U; Ziegler, G

    2008-04-01

    The main principle of a bone tissue engineering (BTE) strategy is to cultivate osteogenic cells in an osteoconductive porous scaffold. Ceramic implants for osteogenesis are based mainly on hydroxyapatite (HA), since this is the inorganic component of bone. Rapid Prototyping (RP) is a new technology in research for producing ceramic scaffolds. This technology is particularly suitable for the fabrication of individually and specially tailored single implants. For tissue engineering these scaffolds are seeded with osteoblast or osteoblast precursor cells. To supply the cultured osteoblastic cells efficiently with nutrition in these 3D-geometries a bioreactor system can be used. The aim of this study was to analyse the influence of differently fabricated HA-scaffolds on bone marrow stromal cells. For this, two RP-techniques, dispense-plotting and a negative mould method, were used to produce porous ceramics. The manufactured HA-scaffolds were then cultivated in a dynamic system (bioreactor) with an osteoblastic precursor cell line. In our study, the applied RP-techniques give the opportunity to design and process HA-scaffolds with defined porosity, interconnectivity and 3D pore distribution. A higher differentiation of bone marrow stromal cells could be detected on the negative mould fabricated scaffolds, while cell proliferation was higher on the dispense-plotted scaffolds. Nevertheless, both scaffold types can be used in tissue engineering applications.

  19. Diesel engine fuel injection pump capable of injection timing adjustment

    SciTech Connect

    Wakasa, S.; Okazaki, T.

    1987-12-15

    A diesel engine fuel injection pump capable of injection timing adjustment is described comprising: (a) housing means; (b) a plunger assembly reciprocably mounted within the housing means and defining a pumping chamber therein; (c) the housing means having defined therein a fuel inlet port to the pumping chamber in a predetermined position in the longitudinal direction of the pumping chamber; (d) drive means for reciprocably moving the plunger assembly within the pumping chamber between a first extreme position; (e) the plunger assembly being formed of at least two transversely split segments movable toward and away from each other within limits and including resilient means biasing the segments of the plunger assembly toward each other; and (f) the housing means further including a timing fluid inlet port for introduction of a timing fluid under variable pressure between the segments of the plunger assembly to move the plunger assembly segments away from each other to an extent that timing fluid pressure is counterbalanced by force of the resilient means for controllably varying the distance therebetween and, in consequence, for varying the prestroke of the plunger assembly solely in response to variation of the timing fluid pressure to effect adjustment of injection timing.

  20. Sequential injection gas guns for accelerating projectiles

    DOEpatents

    Lacy, Jeffrey M [Idaho Falls, ID; Chu, Henry S [Idaho Falls, ID; Novascone, Stephen R [Idaho Falls, ID

    2011-11-15

    Gas guns and methods for accelerating projectiles through such gas guns are described. More particularly, gas guns having a first injection port located proximate a breech end of a barrel and a second injection port located longitudinally between the first injection port and a muzzle end of the barrel are described. Additionally, modular gas guns that include a plurality of modules are described, wherein each module may include a barrel segment having one or more longitudinally spaced injection ports. Also, methods of accelerating a projectile through a gas gun, such as injecting a first pressurized gas into a barrel through a first injection port to accelerate the projectile and propel the projectile down the barrel past a second injection port and injecting a second pressurized gas into the barrel through the second injection port after passage of the projectile and to further accelerate the projectile are described.