Science.gov

Sample records for insect pathogen metarhizium

  1. Conidia of the insect pathogenic fungus, Metarhizium anisopliae, fail to adhere to mosquito larval cuticle

    PubMed Central

    Greenfield, Bethany P. J.; Lord, Alex M.; Dudley, Ed; Butt, Tariq M.

    2014-01-01

    Adhesion of conidia of the insect pathogenic fungus, Metarhizium anisopliae, to the arthropod host cuticle initially involves hydrophobic forces followed by consolidation facilitated by the action of extracellular enzymes and secretion of mucilage. Gene expression analysis and atomic force microscopy were used to directly quantify recognition and adhesion between single conidia of M. anisopliae and the cuticle of the aquatic larval stage of Aedes aegypti and a representative terrestrial host, Tenebrio molitor. Gene expression data indicated recognition by the pathogen of both hosts; however, the forces for adhesion to the mosquito were approximately five times lower than those observed for Tenebrio. Although weak forces were recorded in response to Aedes, Metarhizium was unable to consolidate firm attachment. An analysis of the cuticular composition revealed an absence of long-chain hydrocarbons in Aedes larvae which are thought to be required for fungal development on host cuticle. This study provides, to our knowledge, the first evidence that Metarhizium does not form firm attachment to Ae. aegypti larvae in situ, therefore preventing the normal route of invasion and pathogenesis from occuring. PMID:26064542

  2. Community composition and population genetics of insect pathogenic fungi in the genus Metarhizium from soils of a long-term agricultural research system.

    PubMed

    Kepler, Ryan M; Ugine, Todd A; Maul, Jude E; Cavigelli, Michel A; Rehner, Stephen A

    2015-08-01

    Fungi in the genus Metarhizium are insect pathogens able to function in other niches, including soil and plant rhizosphere habitats. In agroecosystems, cropping and tillage practices influence soil fungal communities with unknown effects on the distribution of Metarhizium, whose presence can reduce populations of crop pests. We report results from a selective media survey of Metarhizium in soils sampled from a long-term experimental farming project in the mid-Atlantic region. Field plots under soybean cultivation produced higher numbers of Metarhizium colony-forming units (cfu) than corn or alfalfa. Plots managed organically and via chisel-till harboured higher numbers of Metarhizium cfu than no-till plots. Sequence typing of Metarhizium isolates revealed four species, with M. robertsii and M. brunneum predominating. The M. brunneum population was essentially fixed for a single clone as determined by multilocus microsatellite genotyping. In contrast, M. robertsii was found to contain significant diversity, with the majority of isolates distributed between two principal clades. Evidence for recombination was observed only in the most abundant clade. These findings illuminate multiple levels of Metarhizium diversity that can be used to inform strategies by which soil Metarhizium populations may be manipulated to exert downward pressure on pest insects and promote plant health.

  3. Community composition and population genetics of insect pathogenic fungi in the genus Metarhizium from soils of a long-term agricultural research system

    USDA-ARS?s Scientific Manuscript database

    Fungi in the genus Metarhizium are facultative pathogens of insects with the capacity to function in other niches, including soil and plant rhizosphere habitats. In agroecosystems, cropping and tillage practices heavily influence soil fungal communities with unknown effects on the distribution of M...

  4. Protein analysis in a pleomorphically deteriorated strain of the insect-pathogenic fungus Metarhizium anisopliae.

    PubMed

    Kamp, Andrena M; Bidochka, Michael J

    2002-09-01

    Pleomorphic deterioration is a process where a fungal isolate loses the ability to produce conidia during repeated subculturing. We have previously isolated strains of the entomopathogenic fungus Metarhizium anisopliae that have irreversibly lost the ability to produce conidia and only produce mycelia when grown on agar. Gel electrophoresis was used to examine differences in intracellular protein patterns (urea-soluble proteins and urea-insoluble proteins (i.e., hydrophobins)) in conidiating and mycelial cultures of M. anisopliae. Two major proteins present in a conidiating culture and one from a mycelial culture were N-terminally sequenced but showed no homologies to known proteins. The presence of hydrophobins in conidiating and mycelial cultures was also examined, and it was shown that these proteins were abundant in conidiating cultures but not in mycelial cultures. We also used primers designed from regulatory genes involved in conidiation in Aspergillus nidulans. The amplified fragments were not homologous to A. nidulans genes.

  5. Interactions of two insect pathogens, Paranosema locustae (Protista: Microsporidia) and Metarhizium acridum (Fungi: Hypocreales), during a mixed infection of Locusta migratoria (Insecta: Orthoptera) nymphs.

    PubMed

    Tokarev, Yuri S; Levchenko, Maxim V; Naumov, Anton M; Senderskiy, Igor V; Lednev, Georgiy R

    2011-02-01

    Locusta migratoria nymphs were fed Paranosema locustae spores and/or surface-treated with Metarhizium acridum 3 (assay 1), 6 (assay 2) or 9 days (assay 3) post microsporidia application (p.m.a.). These three dates corresponded to the key phases of P. locustae development: (a) mass proliferation, (b) transition to sporogenesis and (c) onset of spore maturation, respectively. As a result, locust mortality due to mixed treatment increased slower, equally and faster, as compared to mortality expected from the combination of two pathogens in assays 1-3, respectively. However, a statistically significant difference in survival times was observed only in assay 3, indicating that only at the phase of spore maturation microsporidia drastically increase locust susceptibility to fungal infection. Analysis of perished nymphs showed that fungal treatment 3 days p.m.a. impeded development of microsporidia. Fungal sporulation on locust cadavers was not affected by co-occurring microsporidiosis. Copyright © 2010 Elsevier Inc. All rights reserved.

  6. Variability in the insect and plant adhesins, Mad1 and Mad2, within the fungal genus metarhizium suggest plant adaptation as an evolutionary force.

    PubMed

    Wyrebek, Michael; Bidochka, Michael J

    2013-01-01

    Several species of the insect pathogenic fungus Metarhizium are associated with certain plant types and genome analyses suggested a bifunctional lifestyle; as an insect pathogen and as a plant symbiont. Here we wanted to explore whether there was more variation in genes devoted to plant association (Mad2) or to insect association (Mad1) overall in the genus Metarhizium. Greater divergence within the genus Metarhizium in one of these genes may provide evidence for whether host insect or plant is a driving force in adaptation and evolution in the genus Metarhizium. We compared differences in variation in the insect adhesin gene, Mad1, which enables attachment to insect cuticle, and the plant adhesin gene, Mad2, which enables attachment to plants. Overall variation for the Mad1 promoter region (7.1%), Mad1 open reading frame (6.7%), and Mad2 open reading frame (7.4%) were similar, while it was higher in the Mad2 promoter region (9.9%). Analysis of the transcriptional elements within the Mad2 promoter region revealed variable STRE, PDS, degenerative TATA box, and TATA box-like regions, while this level of variation was not found for Mad1. Sequences were also phylogenetically compared to EF-1α, which is used for species identification, in 14 isolates representing 7 different species in the genus Metarhizium. Phylogenetic analysis demonstrated that the Mad2 phylogeny is more congruent with 5' EF-1α than Mad1. This would suggest that Mad2 has diverged among Metarhizium lineages, contributing to clade- and species-specific variation, while it appears that Mad1 has been largely conserved. While other abiotic and biotic factors cannot be excluded in contributing to divergence, these results suggest that plant relationships, rather than insect host, have been a major driving factor in the divergence of the genus Metarhizium.

  7. Can Insects Develop Resistance to Insect Pathogenic Fungi?

    PubMed Central

    Yaroslavtseva, Olga N.; Greig, Carolyn; Kryukov, Vadim Y.; Grizanova, Ekaterina V.; Mukherjee, Krishnendu; Vilcinskas, Andreas; Glupov, Viktor V.; Butt, Tariq M.

    2013-01-01

    Microevolutionary adaptations and mechanisms of fungal pathogen resistance were explored in a melanic population of the Greater wax moth, Galleria mellonella. Under constant selective pressure from the insect pathogenic fungus Beauveria bassiana, 25th generation larvae exhibited significantly enhanced resistance, which was specific to this pathogen and not to another insect pathogenic fungus, Metarhizium anisopliae. Defense and stress management strategies of selected (resistant) and non-selected (susceptible) insect lines were compared to uncover mechanisms underpinning resistance, and the possible cost of those survival strategies. We hypothesize that the insects developed a transgenerationally primed resistance to the fungus B. bassiana, a costly trait that was achieved not by compromising life-history traits but rather by prioritizing and re-allocating pathogen-species-specific augmentations to integumental front-line defenses that are most likely to be encountered by invading fungi. Specifically during B. bassiana infection, systemic immune defenses are suppressed in favour of a more limited but targeted repertoire of enhanced responses in the cuticle and epidermis of the integument (e.g. expression of the fungal enzyme inhibitor IMPI, and cuticular phenoloxidase activity). A range of putative stress-management factors (e.g. antioxidants) is also activated during the specific response of selected insects to B. bassiana but not M. anisopliae. This too occurs primarily in the integument, and probably contributes to antifungal defense and/or helps ameliorate the damage inflicted by the fungus or the host’s own immune responses. PMID:23560083

  8. Can insects develop resistance to insect pathogenic fungi?

    PubMed

    Dubovskiy, Ivan M; Whitten, Miranda M A; Yaroslavtseva, Olga N; Greig, Carolyn; Kryukov, Vadim Y; Grizanova, Ekaterina V; Mukherjee, Krishnendu; Vilcinskas, Andreas; Glupov, Viktor V; Butt, Tariq M

    2013-01-01

    Microevolutionary adaptations and mechanisms of fungal pathogen resistance were explored in a melanic population of the Greater wax moth, Galleria mellonella. Under constant selective pressure from the insect pathogenic fungus Beauveria bassiana, 25(th) generation larvae exhibited significantly enhanced resistance, which was specific to this pathogen and not to another insect pathogenic fungus, Metarhizium anisopliae. Defense and stress management strategies of selected (resistant) and non-selected (susceptible) insect lines were compared to uncover mechanisms underpinning resistance, and the possible cost of those survival strategies. We hypothesize that the insects developed a transgenerationally primed resistance to the fungus B. bassiana, a costly trait that was achieved not by compromising life-history traits but rather by prioritizing and re-allocating pathogen-species-specific augmentations to integumental front-line defenses that are most likely to be encountered by invading fungi. Specifically during B. bassiana infection, systemic immune defenses are suppressed in favour of a more limited but targeted repertoire of enhanced responses in the cuticle and epidermis of the integument (e.g. expression of the fungal enzyme inhibitor IMPI, and cuticular phenoloxidase activity). A range of putative stress-management factors (e.g. antioxidants) is also activated during the specific response of selected insects to B. bassiana but not M. anisopliae. This too occurs primarily in the integument, and probably contributes to antifungal defense and/or helps ameliorate the damage inflicted by the fungus or the host's own immune responses.

  9. Flexible metabolism in Metarhizium anisopliae and Beauveria bassiana: role of the glyoxylate cycle during insect pathogenesis.

    PubMed

    Padilla-Guerrero, Israel Enrique; Barelli, Larissa; González-Hernández, Gloria Angélica; Torres-Guzmán, Juan Carlos; Bidochka, Michael J

    2011-01-01

    Insect pathogenic fungi such as Metarhizium anisopliae and Beauveria bassiana have an increasing role in the control of agricultural insect pests and vectors of human diseases. Many of the virulence factors are well studied but less is known of the metabolism of these fungi during the course of insect infection or saprobic growth. Here, we assessed enzyme activity and gene expression in the central carbon metabolic pathway, including isocitrate dehydrogenase, aconitase, citrate synthase, malate synthase (MLS) and isocitrate lyase (ICL), with particular attention to the glyoxylate cycle when M. anisopliae and B. bassiana were grown under various conditions. We observed that ICL and MLS, glyoxylate cycle intermediates, were upregulated during growth on 2-carbon compounds (acetate and ethanol) as well as in insect haemolymph. We fused the promoter of the M. anisopliae ICL gene (Ma-icl) to a marker gene (mCherry) and showed that Ma-icl was upregulated when M. anisopliae was grown in the presence of acetate. Furthermore, Ma-icl was upregulated when fungi were engulfed by insect haemocytes as well as during appressorium formation. Addition of the ICL inhibitor 3-nitroproprionate delayed conidial germination and inhibited appressorium formation. These results show that these insect pathogenic fungi have a flexible metabolism that includes the glyoxylate cycle as an integral part of germination, pathogenesis and saprobic growth.

  10. Insect Pathogenic Fungi as Endophytes.

    PubMed

    Moonjely, S; Barelli, L; Bidochka, M J

    2016-01-01

    In this chapter, we explore some of the evolutionary, ecological, molecular genetics, and applied aspects of a subset of insect pathogenic fungi that also have a lifestyle as endophytes and we term endophytic insect pathogenic fungi (EIPF). We focus particularly on Metarhizium spp. and Beauveria bassiana as EIPF. The discussion of the evolution of EIPF challenges a view that these fungi were first and foremost insect pathogens that eventually evolved to colonize plants. Phylogenetic evidence shows that the lineages of EIPF are most closely related to grass endophytes that diverged c. 100MYA. We discuss the relationship between genes involved in "insect pathogenesis" and those involved in "endophytism" and provide examples of genes with potential importance in lifestyle transitions toward insect pathogenicity. That is, some genes for insect pathogenesis may have been coopted from genes involved in endophytic colonization. Other genes may be multifunctional and serve in both lifestyle capacities. The interactions of EIPF with their host plants are discussed in some detail. The genetic basis for rhizospheric competence, plant communication, and nutrient exchange is examined and we highlight, with examples, the benefits of EIPF to plants, and the potential reservoir of secondary metabolites hidden within these beneficial symbioses. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Agrobacterium-mediated disruption of a nonribosomal peptide synthetase gene in the invertebrate pathogen Metarhizium anisopliae reveals a peptide spore factor

    USDA-ARS?s Scientific Manuscript database

    Numerous secondary metabolites have been isolated from the insect pathogenic fungus Metarhizium anisopliae, but the roles of these compounds as virulence factors in disease development are poorly understood. We targeted for disruption by Agrobacterium tumefaciens-mediated transformation a putative n...

  12. The MrCYP52 Cytochrome P450 Monoxygenase Gene of Metarhizium robertsii Is Important for Utilizing Insect Epicuticular Hydrocarbons

    PubMed Central

    Lin, Liangcai; Fang, Weiguo; Liao, Xinggang; Wang, Fengqing; Wei, Dongzhi; St. Leger, Raymond J.

    2011-01-01

    Fungal pathogens of plants and insects infect their hosts by direct penetration of the cuticle. Plant and insect cuticles are covered by a hydrocarbon-rich waxy outer layer that represents the first barrier against infection. However, the fungal genes that underlie insect waxy layer degradation have received little attention. Here we characterize the single cytochrome P450 monoxygenase family 52 (MrCYP52) gene of the insect pathogen Metarhizium robertsii, and demonstrate that it encodes an enzyme required for efficient utilization of host hydrocarbons. Expressing a green florescent protein gene under control of the MrCYP52 promoter confirmed that MrCYP52 is up regulated on insect cuticle as well as by artificial media containing decane (C10), extracted cuticle hydrocarbons, and to a lesser extent long chain alkanes. Disrupting MrCYP52 resulted in reduced growth on epicuticular hydrocarbons and delayed developmental processes on insect cuticle, including germination and production of appressoria (infection structures). Extraction of alkanes from cuticle prevented induction of MrCYP52 and reduced growth. Insect bioassays against caterpillars (Galleria mellonella) confirmed that disruption of MrCYP52 significantly reduces virulence. However, MrCYP52 was dispensable for normal germination and appressorial formation in vitro when the fungus was supplied with nitrogenous nutrients. We conclude therefore that MrCYP52 mediates degradation of epicuticular hydrocarbons and these are an important nutrient source, but not a source of chemical signals that trigger infection processes. PMID:22194968

  13. Biochemical basis of synergism between pathogenic fungus Metarhizium anisopliae and insecticide chlorantraniliprole in Locusta migratoria (Meyen).

    PubMed

    Jia, Miao; Cao, Guangchun; Li, Yibo; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Whitman, Douglas W; Zhang, Zehua

    2016-06-22

    We challenged Locusta migratoria (Meyen) grasshoppers with simultaneous doses of both the insecticide chlorantraniliprole and the fungal pathogen, Metarhizium anisopliae. Our results showed synergistic and antagonistic effects on host mortality and enzyme activities. To elucidate the biochemical mechanisms that underlie detoxification and pathogen-immune responses in insects, we monitored the activities of 10 enzymes. After administration of insecticide and fungus, activities of glutathione-S-transferase (GST), general esterases (ESTs) and phenol oxidase (PO) decreased in the insect during the initial time period, whereas those of aryl acylamidase (AA) and chitinase (CHI) increased during the initial period and that of acetylcholinesterase (AChE) increased during a later time period. Activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) decreased at a later time period post treatment. Interestingly, treatment with chlorantraniliprole and M. anisopliae relieved the convulsions that normally accompany M. anisopliae infection. We speculate that locust mortality increased as a result of synergism via a mechanism related to Ca(2+) disruption in the host. Our study illuminates the biochemical mechanisms involved in insect immunity to xenobiotics and pathogens as well as the mechanisms by which these factors disrupt host homeostasis and induce death. We expect this knowledge to lead to more effective pest control.

  14. Biochemical basis of synergism between pathogenic fungus Metarhizium anisopliae and insecticide chlorantraniliprole in Locusta migratoria (Meyen)

    PubMed Central

    Jia, Miao; Cao, Guangchun; Li, Yibo; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Whitman, Douglas W.; Zhang, Zehua

    2016-01-01

    We challenged Locusta migratoria (Meyen) grasshoppers with simultaneous doses of both the insecticide chlorantraniliprole and the fungal pathogen, Metarhizium anisopliae. Our results showed synergistic and antagonistic effects on host mortality and enzyme activities. To elucidate the biochemical mechanisms that underlie detoxification and pathogen-immune responses in insects, we monitored the activities of 10 enzymes. After administration of insecticide and fungus, activities of glutathione-S-transferase (GST), general esterases (ESTs) and phenol oxidase (PO) decreased in the insect during the initial time period, whereas those of aryl acylamidase (AA) and chitinase (CHI) increased during the initial period and that of acetylcholinesterase (AChE) increased during a later time period. Activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) decreased at a later time period post treatment. Interestingly, treatment with chlorantraniliprole and M. anisopliae relieved the convulsions that normally accompany M. anisopliae infection. We speculate that locust mortality increased as a result of synergism via a mechanism related to Ca2+ disruption in the host. Our study illuminates the biochemical mechanisms involved in insect immunity to xenobiotics and pathogens as well as the mechanisms by which these factors disrupt host homeostasis and induce death. We expect this knowledge to lead to more effective pest control. PMID:27328936

  15. Fungi with multifunctional lifestyles: endophytic insect pathogenic fungi.

    PubMed

    Barelli, Larissa; Moonjely, Soumya; Behie, Scott W; Bidochka, Michael J

    2016-04-01

    This review examines the symbiotic, evolutionary, proteomic and genetic basis for a group of fungi that occupy a specialized niche as insect pathogens as well as endophytes. We focus primarily on species in the genera Metarhizium and Beauveria, traditionally recognized as insect pathogenic fungi but are also found as plant symbionts. Phylogenetic evidence suggests that these fungi are more closely related to grass endophytes and diverged from that lineage ca. 100 MYA. We explore how the dual life cycles of these fungi as insect pathogens and endophytes are coupled. We discuss the evolution of insect pathogenesis while maintaining an endophytic lifestyle and provide examples of genes that may be involved in the transition toward insect pathogenicity. That is, some genes for insect pathogenesis may have been co-opted from genes involved in endophytic colonization. Other genes may be multifunctional and serve in both lifestyle capacities. We suggest that their evolution as insect pathogens allowed them to effectively barter a specialized nitrogen source (i.e. insects) with host plants for photosynthate. These ubiquitous fungi may play an important role as plant growth promoters and have a potential reservoir of secondary metabolites.

  16. Host-to-Pathogen Gene Transfer Facilitated Infection of Insects by a Pathogenic Fungus

    PubMed Central

    Zhao, Hong; Xu, Chuan; Lu, Hsiao-Ling; Chen, Xiaoxuan; St. Leger, Raymond J.; Fang, Weiguo

    2014-01-01

    Metarhizium robertsii is a plant root colonizing fungus that is also an insect pathogen. Its entomopathogenicity is a characteristic that was acquired during evolution from a plant endophyte ancestor. This transition provides a novel perspective on how new functional mechanisms important for host switching and virulence have evolved. From a random T-DNA insertion library, we obtained a pathogenicity defective mutant that resulted from the disruption of a sterol carrier gene (Mr-npc2a). Phylogenetic analysis revealed that Metarhizium acquired Mr-npc2a from an insect by horizontal gene transfer (HGT). Mr-NPC2a binds to cholesterol, an animal sterol, rather than the fungal sterol ergosterol, indicating it retains the specificity of insect NPC2 proteins. Mr-NPC2a is an intracellular protein and is exclusively expressed in the hemolymph of living insects. The disruption of Mr-npc2a reduced the amount of sterol in cell membranes of the yeast-like hyphal bodies that facilitate dispersal in the host body. These were consequently more susceptible to insect immune responses than the wild type. Transgenic expression of Mr-NPC2a increased the virulence of Beauveria bassiana, an endophytic insect-pathogenic fungus that lacks a Mr-NPC2a homolog. PMID:24722668

  17. Pathogenicity of entomopathogenic fungus Metarhizium anisopliae (Deuteromycetes) to Ixodes scapularis (Acari: Ixodidae)

    USGS Publications Warehouse

    Zhioua, E.; Browning, M.; Johnson, P.W.; Ginsberg, H.S.; LeBrun, R.A.

    1997-01-01

    The entomopathogenic fungus Metarhizium anisopliae is highly pathogenic to the black-legged tick, Ixodes scapularis. Spore concentrations of 108/ml for engorged larvae and 107/ml for engorged females resulted in 100% tick mortality, 2 wk post-infection. The LC50 value for engorged larvae (concentration to kill 50% of ticks) was 107 spores/ml. Metarhizium anisopliae shows considerable potential as a microbial control agent for the management of Ixodes scapularis.

  18. Pathogenicity of Metarhizium anisopliae for Ceratitis capitata (Wied.) (Diptera: Tephritidae) in soil with different pesticides.

    PubMed

    Mochi, Dinalva A; Monteiro, Antonio C; De Bortoli, Sergio A; Dória, Háyda O S; Barbosa, José C

    2006-01-01

    This research intended to investigate if the presence of pesticides in the soil could affect the pathogenicity of Metarhizium anisopliae Metsch. (Sorokin) for Ceratitis capitata (Wied.) and assess the effect of conidia application as suspension or dry conidia. The fungicides chlorothalonyl and tebuconazol, the acaricide abamectin, the insecticide trichlorfon, and the herbicide ametrin were applied at the manufacturer-recommended doses. Soil samples were placed in glass flasks and were given the fungus as conidial suspension or dry. After pesticide application, 20 3rd-instar larvae were placed in the soil. The flasks were sealed with voile fabric and incubated at 27 +/- 0.5 masculineC for nine days, until adult emergence; incubation continued for four more days at room temperature. The total insect survival was significantly affected and pathogenic activity was detected from the pupa stage on. Pupa survival was reduced (P<0.05); the same occurred during the adult phase. No effect was observed at the larval stage. The pesticides applied to the soil affected the activity of M. anisopliae slightly: only in the dry conidia assay the fungicides chlorothalonyl and tebuconazole reduced (86.2% and 82.5%, respectively) the survival period of C. capitata compared to the control (95.0%). The techniques used for conidia application did not influence the total insect survival rate, but conidial suspension applied on soil surface reduced survival during the pupae and adult phases.

  19. Proteomic analysis of Metarhizium anisopliae secretion in the presence of the insect pest Callosobruchus maculatus.

    PubMed

    Murad, André M; Noronha, Eliane F; Miller, Robert N G; Costa, Fabio T; Pereira, Caroline D; Mehta, Angela; Caldas, Ruy A; Franco, Octávio L

    2008-12-01

    Crop improvement in agriculture generally focuses on yield, seed quality and nutritional characteristics, as opposed to resistance to biotic stresses. Consequently, natural antifeedant toxins are often rare in seed material, with commercial crops being prone to insect pest predation. In the specific case of cowpea (Vigna unguiculata), smallholder cropping is affected by insect pests that reproduce inside the stored seeds. Entomopathogenic organisms can offer an alternative to conventional pesticides for pest control, producing hydrolases that degrade insect exoskeleton. In this study, protein secretions of the ascomycete Metarhizium anisopliae, which conferred bioinsecticidal activity against Callosobruchus maculatus, were characterized via 2D electrophoresis and mass spectrometry. Proteases, reductases and acetyltransferase enzymes were detected. These may be involved in degradation and nutrient uptake from dehydrated C. maculatus. Proteins identified in this work allowed description of metabolic pathways. Their potential applications in biotechnology include both novel compound development and production of genetically modified plants resistant to insect pests.

  20. Genome-wide identification of pathogenicity, conidiation and colony sectorization genes in Metarhizium robertsii.

    PubMed

    Zeng, Guohong; Chen, Xiaoxuan; Zhang, Xing; Zhang, Qiangqiang; Xu, Chuan; Mi, Wubin; Guo, Na; Zhao, Hong; You, Yue; Dryburgh, Farah-Jade; Bidochka, Michael J; St Leger, Raymond J; Zhang, Lei; Fang, Weiguo

    2017-04-26

    Metarhizium robertsii occupies a wide array of ecological niches and has diverse lifestyle options (saprophyte, insect pathogen and plant symbiont), that renders it an unusually effective model for studying genetic mechanisms for fungal adaptation. Here over 20,000 M. robertsii T-DNA mutants were screened in order to elucidate genetic mechanism by which M. robertsii replicates and persists in diverse niches. About 287 conidiation, colony sectorization or pathogenicity loci, many of which have not been reported in other fungi were identified. By analysing a series of conidial pigmentation mutants, a new fungal pigmentation gene cluster, which contains Mr-Pks1, Mr-EthD and Mlac1 was identified. A conserved conidiation regulatory pathway containing Mr-BrlA, Mr-AbaA and Mr-WetA regulates expression of these pigmentation genes. During conidiation Mr-BlrA up-regulates Mr-AbaA, which in turn controls Mr-WetA. It was found that Hog1-MAPK regulates fungal conidiation by controlling the conidiation regulatory pathway, and that all three pigmentation genes exercise feedback regulation of conidiation. This work provided the foundation for deeper understanding of the genetic processes behind M. robertsii adaptive phenotypes, and advances our insights into conidiation and pigmentation in this fungus. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. Ubiquity of insect-derived nitrogen transfer to plants by endophytic insect-pathogenic fungi: an additional branch of the soil nitrogen cycle.

    PubMed

    Behie, Scott W; Bidochka, Michael J

    2014-03-01

    The study of symbiotic nitrogen transfer in soil has largely focused on nitrogen-fixing bacteria. Vascular plants can lose a substantial amount of their nitrogen through insect herbivory. Previously, we showed that plants were able to reacquire nitrogen from insects through a partnership with the endophytic, insect-pathogenic fungus Metarhizium robertsii. That is, the endophytic capability and insect pathogenicity of M. robertsii are coupled so that the fungus acts as a conduit to provide insect-derived nitrogen to plant hosts. Here, we assess the ubiquity of this nitrogen transfer in five Metarhizium species representing those with broad (M. robertsii, M. brunneum, and M. guizhouense) and narrower insect host ranges (M. acridum and M. flavoviride), as well as the insect-pathogenic fungi Beauveria bassiana and Lecanicillium lecanii. Insects were injected with (15)N-labeled nitrogen, and we tracked the incorporation of (15)N into two dicots, haricot bean (Phaseolus vulgaris) and soybean (Glycine max), and two monocots, switchgrass (Panicum virgatum) and wheat (Triticum aestivum), in the presence of these fungi in soil microcosms. All Metarhizium species and B. bassiana but not L. lecanii showed the capacity to transfer nitrogen to plants, although to various degrees. Endophytic association by these fungi increased overall plant productivity. We also showed that in the field, where microbial competition is potentially high, M. robertsii was able to transfer insect-derived nitrogen to plants. Metarhizium spp. and B. bassiana have a worldwide distribution with high soil abundance and may play an important role in the ecological cycling of insect nitrogen back to plant communities.

  2. Ubiquity of Insect-Derived Nitrogen Transfer to Plants by Endophytic Insect-Pathogenic Fungi: an Additional Branch of the Soil Nitrogen Cycle

    PubMed Central

    Behie, Scott W.

    2014-01-01

    The study of symbiotic nitrogen transfer in soil has largely focused on nitrogen-fixing bacteria. Vascular plants can lose a substantial amount of their nitrogen through insect herbivory. Previously, we showed that plants were able to reacquire nitrogen from insects through a partnership with the endophytic, insect-pathogenic fungus Metarhizium robertsii. That is, the endophytic capability and insect pathogenicity of M. robertsii are coupled so that the fungus acts as a conduit to provide insect-derived nitrogen to plant hosts. Here, we assess the ubiquity of this nitrogen transfer in five Metarhizium species representing those with broad (M. robertsii, M. brunneum, and M. guizhouense) and narrower insect host ranges (M. acridum and M. flavoviride), as well as the insect-pathogenic fungi Beauveria bassiana and Lecanicillium lecanii. Insects were injected with 15N-labeled nitrogen, and we tracked the incorporation of 15N into two dicots, haricot bean (Phaseolus vulgaris) and soybean (Glycine max), and two monocots, switchgrass (Panicum virgatum) and wheat (Triticum aestivum), in the presence of these fungi in soil microcosms. All Metarhizium species and B. bassiana but not L. lecanii showed the capacity to transfer nitrogen to plants, although to various degrees. Endophytic association by these fungi increased overall plant productivity. We also showed that in the field, where microbial competition is potentially high, M. robertsii was able to transfer insect-derived nitrogen to plants. Metarhizium spp. and B. bassiana have a worldwide distribution with high soil abundance and may play an important role in the ecological cycling of insect nitrogen back to plant communities. PMID:24334669

  3. Integrated control of sugarbeet root maggot by using resistant germplasm, an insect pathogen, and an insecticidal seed treatment

    USDA-ARS?s Scientific Manuscript database

    This investigation was carried out during the 2014 growing season to evaluate the following for SBRM management in the Red River Valley growing area: 1) a granular formulation of the fungal insect pathogen, Metarhizium anisopliae (Metschnikoff) Sorokin strain MA1200; 2) an experimental SBRM-resistan...

  4. Prospects of using Metarhizium anisopliae to check the breeding of insect pest, Oryctes rhinoceros L. in coconut leaf vermicomposting sites.

    PubMed

    Gopal, Murali; Gupta, Alka; Thomas, George V

    2006-10-01

    During vermicomposting of coconut leaves by the earthworm Eudrilus sp., Oryctes rhinoceros L. (rhinoceros beetle), an insect pest of palms, was found to breed in the decomposing organic material. Metarhizium anisopliae var. major was tried as a biocontrol agent for management of this pest. The effect of pathogen at spore loads of 10(3), 10(4) and 10(5) per 10 g of substrate was tested in laboratory on Eudrilus sp. kept with O. rhinoceros grubs and on Eudrilus sp. alone for the pathogenic capability of the fungus on the pest and its possible toxicity towards the vermin. The efficacy of the entomopathogen was also tested in the field in vermicomposting tanks. In laboratory bioassay, 100% mycosis of O. rhinoceros grubs could be obtained while the entomopathogen had no toxic effect on the earthworms. There was a positive change in the number and weight of the earthworms on treatment with M. anisopliae. In the field, application of M. anisopliae reduced O. rhinoceros grubs in the vermicomposting tanks upto an extent of 72%. In conclusion, M. anisopliae could effectively control O. rhinoceros in vermicomposting sites and was non-hazardous to the vermicomposting process as well as the Eudrilus sp.

  5. Genome sequence of the insect pathogenic fungus Cordyceps militaris, a valued traditional chinese medicine

    PubMed Central

    2011-01-01

    Background Species in the ascomycete fungal genus Cordyceps have been proposed to be the teleomorphs of Metarhizium species. The latter have been widely used as insect biocontrol agents. Cordyceps species are highly prized for use in traditional Chinese medicines, but the genes responsible for biosynthesis of bioactive components, insect pathogenicity and the control of sexuality and fruiting have not been determined. Results Here, we report the genome sequence of the type species Cordyceps militaris. Phylogenomic analysis suggests that different species in the Cordyceps/Metarhizium genera have evolved into insect pathogens independently of each other, and that their similar large secretomes and gene family expansions are due to convergent evolution. However, relative to other fungi, including Metarhizium spp., many protein families are reduced in C. militaris, which suggests a more restricted ecology. Consistent with its long track record of safe usage as a medicine, the Cordyceps genome does not contain genes for known human mycotoxins. We establish that C. militaris is sexually heterothallic but, very unusually, fruiting can occur without an opposite mating-type partner. Transcriptional profiling indicates that fruiting involves induction of the Zn2Cys6-type transcription factors and MAPK pathway; unlike other fungi, however, the PKA pathway is not activated. Conclusions The data offer a better understanding of Cordyceps biology and will facilitate the exploitation of medicinal compounds produced by the fungus. PMID:22112802

  6. Genome sequence of the insect pathogenic fungus Cordyceps militaris, a valued traditional Chinese medicine.

    PubMed

    Zheng, Peng; Xia, Yongliang; Xiao, Guohua; Xiong, Chenghui; Hu, Xiao; Zhang, Siwei; Zheng, Huajun; Huang, Yin; Zhou, Yan; Wang, Shengyue; Zhao, Guo-Ping; Liu, Xingzhong; St Leger, Raymond J; Wang, Chengshu

    2011-11-23

    Species in the ascomycete fungal genus Cordyceps have been proposed to be the teleomorphs of Metarhizium species. The latter have been widely used as insect biocontrol agents. Cordyceps species are highly prized for use in traditional Chinese medicines, but the genes responsible for biosynthesis of bioactive components, insect pathogenicity and the control of sexuality and fruiting have not been determined. Here, we report the genome sequence of the type species Cordyceps militaris. Phylogenomic analysis suggests that different species in the Cordyceps/Metarhizium genera have evolved into insect pathogens independently of each other, and that their similar large secretomes and gene family expansions are due to convergent evolution. However, relative to other fungi, including Metarhizium spp., many protein families are reduced in C. militaris, which suggests a more restricted ecology. Consistent with its long track record of safe usage as a medicine, the Cordyceps genome does not contain genes for known human mycotoxins. We establish that C. militaris is sexually heterothallic but, very unusually, fruiting can occur without an opposite mating-type partner. Transcriptional profiling indicates that fruiting involves induction of the Zn2Cys6-type transcription factors and MAPK pathway; unlike other fungi, however, the PKA pathway is not activated. The data offer a better understanding of Cordyceps biology and will facilitate the exploitation of medicinal compounds produced by the fungus.

  7. Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics

    USDA-ARS?s Scientific Manuscript database

    The genus Metarhizium traditionally refers to green-spored asexual insect pathogenic fungi. Through culturing and molecular methods, Metarhizium has been linked to Metacordyceps sexual states. Historically, fungal nomenclature has allowed separate names for the different life-stages of pleomorphic...

  8. Genetic diversity of the fungal pathogen Metarhizium spp., causing epizootics in Chinese burrower bugs in the Jingting Mountains, eastern China.

    PubMed

    Luan, Fenggang; Zhang, Shengli; Wang, Bin; Huang, Bo; Li, Zengzhi

    2013-01-01

    Based on the internal transcribed spacer and inter-simple sequence repeats (ISSR), the phylogenetic relationship and genetic diversity of Metarhizium spp., pathogens found in Chinese burrower bugs, Schiodtella formosana, were analyzed. The results showed that the causative agents of the epizootic green muscardine disease in populations of S. formosana were actually composed of M. anisopliae and its sister species, M. robertsii. The genetic structure of Metarhizium spp. populations were assessed using ten ISSR. A 3D principal component analysis of 51 isolates sampled on different occasions revealed that the Metarhizium spp. populations were temporally heterogeneous. They differentiated into two main clades including over 71 % of all strains causing epizootics, with a similarity of 83 %. The population differentiation was relatively low (G ( ST ), 0.2080), reflecting a large proportion of gene differentiation (79.2 %) within the populations. Further knowledge of the complex species and heterogeneous populations of Metarhizium spp. may be necessary for sustainable control methods of S. formosana.

  9. Influence of entomopathogenic fungus, Metarhizium anisopliae, alone and in combination with diatomaceous earth and thiamethoxam on mortality, progeny production, mycosis, and sporulation of the stored grain insect pests.

    PubMed

    Ashraf, Misbah; Farooq, Muhammad; Shakeel, Muhammad; Din, Naima; Hussain, Shahbaz; Saeed, Nadia; Shakeel, Qaiser; Rajput, Nasir Ahmed

    2017-10-10

    The stored grain insects cause great damage to grains under storage conditions. Synthetic insecticides and fumigants are considered as key measures to control these stored grain insect pests. However, the major issue with these chemicals is grain contamination with chemical residues and development of resistance by insect pests to these chemicals. Biological control is considered as a potential alternative to chemical control especially with the use of pathogens, alone or in combination with selective insecticides. The present study was conducted to evaluate the synergism of Metarhizium anisopliae with diatomaceous earth (DE) and thiamethoxam against four insect pests on the stored wheat grains. In the first bioassay, the M. anisopliae was applied at 1.4 × 10(4) and 1.4 × 10(6)conidia/ml alone and in integration with two concentrations (250 and 500 ppm) of tested DE. The tested fungus when combined with DE and thiamethoxam possessed synergistic impact as compared to their individual efficacy. Adult mortality increased with respect to increased exposure interval and doses. In the second bioassay, M. anisopliae was applied at 1.4 × 10(4) conidia/ml individually and in combination with three concentrations (0.50, 0.75, and 1.00 ppm) of thiamethoxam. Results concluded that M. anisopliae integrated with DE and thiamethoxam provides more effective control of stored grain insect pests.

  10. Carbon translocation from a plant to an insect-pathogenic endophytic fungus

    PubMed Central

    Behie, Scott W.; Moreira, Camila C.; Sementchoukova, Irina; Barelli, Larissa; Zelisko, Paul M.; Bidochka, Michael J.

    2017-01-01

    Metarhizium robertsii is a common soil fungus that occupies a specialized ecological niche as an endophyte and an insect pathogen. Previously, we showed that the endophytic capability and insect pathogenicity of Metarhizium are coupled to provide an active method of insect-derived nitrogen transfer to a host plant via fungal mycelia. We speculated that in exchange for this insect-derived nitrogen, the plant would provide photosynthate to the fungus. By using 13CO2, we show the incorporation of 13C into photosynthate and the subsequent translocation of 13C into fungal-specific carbohydrates (trehalose and chitin) in the root/endophyte complex. We determined the amount of 13C present in root-associated fungal biomass over a 21-day period by extracting fungal carbohydrates and analysing their composition using nuclear magnetic resonance (NMR) spectroscopy. These findings are evidence that the host plant is providing photosynthate to the fungus, likely in exchange for insect-derived nitrogen in a tripartite, and symbiotic, interaction. PMID:28098142

  11. Carbon translocation from a plant to an insect-pathogenic endophytic fungus.

    PubMed

    Behie, Scott W; Moreira, Camila C; Sementchoukova, Irina; Barelli, Larissa; Zelisko, Paul M; Bidochka, Michael J

    2017-01-18

    Metarhizium robertsii is a common soil fungus that occupies a specialized ecological niche as an endophyte and an insect pathogen. Previously, we showed that the endophytic capability and insect pathogenicity of Metarhizium are coupled to provide an active method of insect-derived nitrogen transfer to a host plant via fungal mycelia. We speculated that in exchange for this insect-derived nitrogen, the plant would provide photosynthate to the fungus. By using (13)CO2, we show the incorporation of (13)C into photosynthate and the subsequent translocation of (13)C into fungal-specific carbohydrates (trehalose and chitin) in the root/endophyte complex. We determined the amount of (13)C present in root-associated fungal biomass over a 21-day period by extracting fungal carbohydrates and analysing their composition using nuclear magnetic resonance (NMR) spectroscopy. These findings are evidence that the host plant is providing photosynthate to the fungus, likely in exchange for insect-derived nitrogen in a tripartite, and symbiotic, interaction.

  12. A bifunctional catalase-peroxidase, MakatG1, contributes to virulence of Metarhizium acridum by overcoming oxidative stress on the host insect cuticle.

    PubMed

    Li, Guohong; Fan, Anni; Peng, Guoxiong; Keyhani, Nemat O; Xin, Jiankang; Cao, Yueqing; Xia, Yuxian

    2017-09-19

    Microbial pathogens are exposed to damaging reactive oxygen species (ROS) produced from a variety of sources including chemical reactions due to exposure to stress (UV, heat) or by hosts as a defense response. Here we demonstrate that a bifunctional catalase-peroxidase, MakatG1, in the locust-specific fungal pathogen, Metarhizium acridum, functions as a ROS detoxification mechanism during host cuticle penetration. MakatG1 expression was highly induced during on-cuticle appressoria development as compared to vegetative (mycelia) growth or during in vivo growth in the insect hemocoel. A MakatG1 deletion mutant strain (ΔMakatG1) showed decreased catalase and peroxidase activities and significantly increased susceptibility to oxidative (H2 O2 and menadione) and UV stress as compared to wild type and complemented strains. Insect bioassays revealed significantly reduced virulence of the ΔMakatG1 mutant when topically inoculated, but no impairment when the insect cuticle was bypassed. Germination and appressoria formation rates for the ΔMakatG1 mutant were decreased on locust wings and quinone/phenolic compounds derived from locust wings, but were not affected on plastic surfaces compared with the wild type strain. These data indicate that MakatG1 plays a pivotal role in penetration, reacting to and detoxifying specific cuticular compounds present on the host cuticle during the early stages of fungal infection. This article is protected by copyright. All rights reserved. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  13. Insertion of an Esterase Gene into a Specific Locust Pathogen (Metarhizium acridum) Enables It to Infect Caterpillars

    PubMed Central

    Wang, Sibao; Fang, Weiguo; Wang, Chengshu; St. Leger, Raymond J.

    2011-01-01

    An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae) as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta) cuticle, M. robertsii up-regulates a gene (Mest1) that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta), while virulence to grasshoppers (Melanoplus femurrubrum) was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene. PMID:21731492

  14. Insertion of an esterase gene into a specific locust pathogen (Metarhizium acridum) enables it to infect caterpillars.

    PubMed

    Wang, Sibao; Fang, Weiguo; Wang, Chengshu; St Leger, Raymond J

    2011-06-01

    An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae) as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta) cuticle, M. robertsii up-regulates a gene (Mest1) that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta), while virulence to grasshoppers (Melanoplus femurrubrum) was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene.

  15. Susceptibility of Loxosceles sp. to the arthropod pathogenic fungus Metarhizium anisopliae: potential biocontrol of the brown spider.

    PubMed

    Beys-da-Silva, Walter O; Santi, Lucélia; Berger, Markus; Guimarães, Jorge A; Schrank, Augusto; Vainstein, Marilene H

    2013-01-01

    Loxosceles genus (brown spider) is an important pest with great impact on public health. Thus, more effective strategies for spider control are necessary. Three isolates of Metarhizium anisopliae fungus were tested for the control of Loxosceles sp. Metarhizium anisopliae isolate E6 was highly virulent to the Loxosceles sp. spider, causing 100% mortality at 10(9) conidia/ml after 12 days and 9 days for juvenile and adult spiders, respectively. This is the first report of the pathogenicity of M. anisopliae against a venomous arthropod. This fungus could offer an interesting alternative to reduce loxoscelism in future biocontrol strategies.

  16. Pathogenicity of Metarhizium anisopliae (Deuteromycetes) and permethrin to Ixodes scapularis (Acari: Ixodidae) nymphs

    USGS Publications Warehouse

    Hornbostel, V.L.; Zhioua, Elyes; Benjamin, Michael A.; Ginsberg, Howard S.; Ostfeld, Richard S.

    2005-01-01

    Effectiveness of the entomopathogenic fungus Metarhizium anisopliae, for controlling nymphal Ixodes scapularis, was tested in laboratory and field trials. In the laboratory, M. anisopliae (Metschnikoff) Sorokin strain ESC1 was moderately pathogenic, with an LC50 of 107 spores/ml and induced 70% mortality at 109 spores/ml. In a field study, however, 109 spores/ml M. anisopliae did not effectively control questing I. scapularis nymphs, and significant differences were not detected in pre- and post-treatment densities. For nymphs collected and returned to the laboratory for observation, mortality was low in treatment groups, ranging from 20 to 36%. To assess whether a chemical acaricide would synergistically enhance pathogenicity of the fungus, we challenged unfed nymphal I. scapularis with combinations of M. anisopliae and permethrin, a relatively safe pyrethroid acaricide, in two separate bioassays. Significant interactions between M. anisopliae and permethrin were not observed, supporting neither synergism nor antagonism.

  17. An in vivo transcriptome for entomopathogenic fungus Metarhizium robertsii ARSEF 2575

    USDA-ARS?s Scientific Manuscript database

    Molecular mechanisms underlying the pathogenic process of the insect pathogen Metarhizium robertsii ARSEF 2575 in its host are only partially understood. To probe the transcriptional responses of the fungus during the interaction with insects, we have developed a method to specifically recover patho...

  18. Insect pathogens: molecular approaches and techniques

    USDA-ARS?s Scientific Manuscript database

    This book serves as a primer for molecular techniques in insect pathology and is tailored for a wide scientific audience. Contributing authors are internationally recognized experts. The book comprises four sections: 1) pathogen identification and diagnostics, 2) pathogen population genetics and p...

  19. Hunting for insect pathogens: A genomics approach

    USDA-ARS?s Scientific Manuscript database

    Emerging methods within the field of genomics have increased the number of insect pathogens being discovered and characterized each year. These pathogens provide a rich resource for biological control agents, gene expression systems, and other molecular tools. Using Metagenomics, and gene expression...

  20. Assessing the optimal virulence of malaria-targeting mosquito pathogens: a mathematical study of engineered Metarhizium anisopliae.

    PubMed

    Konrad, Bernhard P; Lindstrom, Michael; Gumpinger, Anja; Zhu, Jielin; Coombs, Daniel

    2014-01-08

    Metarhizium anisopliae is a naturally occurring fungal pathogen of mosquitoes. Recently, Metarhizium has been engineered to act against malaria by directly killing the disease agent within mosquito vectors and also effectively blocking onward transmission. It has been proposed that efforts should be made to minimize the virulence of the fungal pathogen, in order to slow the development of resistant mosquitoes following an actual deployment. Two mathematical models were developed and analysed to examine the efficacy of the fungal pathogen. It was found that, in many plausible scenarios, the best effects are achieved with a reduced or minimal pathogen virulence, even if the likelihood of resistance to the fungus is negligible. The results for both models depend on the interplay between two main effects: the ability of the fungus to reduce the mosquito population, and the ability of fungus-infected mosquitoes to compete for resources with non-fungus-infected mosquitoes. The results indicate that there is no obvious choice of virulence for engineered Metarhizium or similar pathogens, and that all available information regarding the population ecology of the combined mosquito-fungus system should be carefully considered. The models provide a basic framework for examination of anti-malarial mosquito pathogens that should be extended and improved as new laboratory and field data become available.

  1. Metarhizium robertsii Produces an Extracellular Invertase (MrINV) That Plays a Pivotal Role in Rhizospheric Interactions and Root Colonization

    PubMed Central

    Liao, Xinggang; Fang, Weiguo; Lin, Liangcai; Lu, Hsiao-Ling; Leger, Raymond J. St.

    2013-01-01

    As well as killing pest insects, the rhizosphere competent insect-pathogenic fungus Metarhizium robertsii also boosts plant growth by providing nitrogenous nutrients and increasing resistance to plant pathogens. Plant roots secrete abundant nutrients but little is known about their utilization by Metarhizium spp. and the mechanistic basis of Metarhizium-plant associations. We report here that M. robertsii produces an extracellular invertase (MrInv) on plant roots. Deletion of MrInv (⊿MrInv) reduced M. robertsii growth on sucrose and rhizospheric exudates but increased colonization of Panicum virgatum and Arabidopsis thaliana roots. This could be accounted for by a reduction in carbon catabolite repression in ⊿MrInv increasing production of plant cell wall-degrading depolymerases. A non-rhizosphere competent scarab beetle specialist Metarhizium majus lacks invertase which suggests that rhizospheric competence may be related to the sugar metabolism of different Metarhizium species. PMID:24205119

  2. Metarhizium robertsii produces an extracellular invertase (MrINV) that plays a pivotal role in rhizospheric interactions and root colonization.

    PubMed

    Liao, Xinggang; Fang, Weiguo; Lin, Liangcai; Lu, Hsiao-Ling; St Leger, Raymond J

    2013-01-01

    As well as killing pest insects, the rhizosphere competent insect-pathogenic fungus Metarhizium robertsii also boosts plant growth by providing nitrogenous nutrients and increasing resistance to plant pathogens. Plant roots secrete abundant nutrients but little is known about their utilization by Metarhizium spp. and the mechanistic basis of Metarhizium-plant associations. We report here that M. robertsii produces an extracellular invertase (MrInv) on plant roots. Deletion of MrInv (ΔMrInv) reduced M. robertsii growth on sucrose and rhizospheric exudates but increased colonization of Panicum virgatum and Arabidopsis thaliana roots. This could be accounted for by a reduction in carbon catabolite repression in ΔMrInv increasing production of plant cell wall-degrading depolymerases. A non-rhizosphere competent scarab beetle specialist Metarhizium majus lacks invertase which suggests that rhizospheric competence may be related to the sugar metabolism of different Metarhizium species.

  3. Catalase overexpression reduces the germination time and increases the pathogenicity of the fungus Metarhizium anisopliae.

    PubMed

    Morales Hernandez, Claudia Erika; Padilla Guerrero, Israel Enrique; Gonzalez Hernandez, Gloria Angelica; Salazar Solis, Eduardo; Torres Guzman, Juan Carlos

    2010-07-01

    Catalases and peroxidases are the most important enzymes that degrade hydrogen peroxide into water and oxygen. These enzymes and superoxide dismutase are the first lines of cell defense against reactive oxygen species. Metarhizium anisopliae displays an increase in catalase-peroxidase activity during germination and growth. To determine the importance of catalase during the invasion process of M. anisopliae, we isolated the cat1 gene. cat1 cDNA expression in Escherichia coli and the subsequent purification of the protein confirmed that the cat1 gene codes for a monofunctional catalase. Expression analysis of this gene by RT-PCR from RNA isolated from fungus grown in liquid cultures showed a decrease in the expression level of the cat1 gene during germination and an increase during mycelium growth. The expression of this gene in the fungus during the infection process of the larvae of Plutella xylostella also showed a significant increase during invasive growth. Transgenic strains overexpressing the cat1 gene had twice the catalase activity of the wild-type strain. This increase in catalase activity was accompanied by a higher level of resistance to exogenous hydrogen peroxide and a reduction in the germination time. This improvement was also observed during the infection of P. xylostella larvae. M. anisopliae transgenic strains overexpressing the cat1 gene grew and spread faster in the soft tissue of the insect, reducing the time to death of the insect by 25% and the dose required to kill 50% of the population 14-fold.

  4. Swainsonine biosynthesis genes in diverse symbiotic and pathogenic fungi

    USDA-ARS?s Scientific Manuscript database

    Swainsonine, a cytotoxic fungal alkaloid and a potential cancer therapy drug, is produced by the insect pathogen and plant symbiont, Metarhizium robertsii, the clover pathogen Slafractonia leguminicola, locoweed symbionts belonging to Alternaria sect. Undifilum, and a recently discovered morning glo...

  5. Metabolic Conservation and Diversification of Metarhizium Species Correlate with Fungal Host-Specificity

    PubMed Central

    Xu, Yong-Jiang; Luo, Feifei; Li, Bing; Shang, Yanfang; Wang, Chengshu

    2016-01-01

    The ascomycete genus Metarhizium contains several species of insect pathogenic fungi ranging from specialists with narrow host ranges to generalists that can infect diverse invertebrates. Genetic and metabolic conservations and diversifications of Metarhizium species are not well understood. In this study, using the genome information of seven Metarhizium species, we performed a comparative analysis of gene clusters involved in secondary metabolisms (SMs) in these species. The results revealed that the generalist species contain more SM gene clusters than the specialists, and that both conserved and divergent evolutions may have occurred in SM genes during fungal speciation. In particular, the loss/gain events, as well as gene mutagenesis, are evident for the gene cluster responsible for the biosynthesis of non-ribosomal cyclopeptide destruxins. The presence of conserved SM gene clusters in Metarhizium and other divergently evolved insect pathogenic fungi implies their link to fungal entomopathogenicity. Mass spectrometry based metabolomic analyses were also conducted to investigate the chemical diversities of seven Metarhizium species. Consistent with the evolutionary relationships of SM genes among the seven species, significant differences are observed in fungal metabolic profiles, whether the same or different metabolites are produced in different species. Clustering analysis based on the metabolome data revealed that Metarhizium species could be grouped based on their association to fungal host specificity. Our metabolomics-based methods also facilitate the identification of bioactive metabolites that have not been reported previously in Metarhizium. The results of this study will benefit future investigations of the chemical biology of insect-fungal interactions. PMID:28018335

  6. Evolutionary interaction networks of insect pathogenic fungi.

    PubMed

    Boomsma, Jacobus J; Jensen, Annette B; Meyling, Nicolai V; Eilenberg, Jørgen

    2014-01-01

    Lineages of insect pathogenic fungi are concentrated in three major clades: Hypocreales (several genera), Entomophthoromycota (orders Entomophthorales and Neozygitales), and Onygenales (genus Ascosphaera). Our review focuses on aspects of the evolutionary biology of these fungi that have remained underemphasized in previous reviews. To ensure integration with the better-known domains of insect pathology research, we followed a conceptual framework formulated by Tinbergen, asking complementary questions on mechanism, ontogeny, phylogeny, and adaptation. We aim to provide an introduction to the merits of evolutionary approaches for readers with a background in invertebrate pathology research and to make the insect pathogenic fungi more accessible as model systems for evolutionary biologists. We identify a number of questions in which fundamental research can offer novel insights into the evolutionary forces that have shaped host specialization and life-history traits such as spore number and size, somatic growth rate, toxin production, and interactions with host immune systems.

  7. Soil Persistence of Metarhizium anisopliae Applied to Manage Sugarbeet Root Maggot in a Cover Crop Microenvironment

    USDA-ARS?s Scientific Manuscript database

    The sugarbeet root maggot, Tetanops myopaeformis (Röder), is a major insect pest of sugarbeet, Beta vulgaris L., in North Dakota, Minnesota, and Idaho. Three field trials using the insect pathogen Metarhizium anisopliae (Metch.) Sorok. ATCC 62176 in conjunction with cover crops were conducted in 200...

  8. Unveiling the biosynthetic puzzle of destruxins in Metarhizium species

    PubMed Central

    Wang, Bing; Kang, Qianjin; Lu, Yuzhen; Bai, Linquan; Wang, Chengshu

    2012-01-01

    Insect pathogenic fungi produce a plethora of insecticidally and pharmaceutically active compounds, including 39 cyclohexadepsipeptide destruxins (dtxs). Even though dtxs were first discovered more than 50 y ago, the genes responsible for their biosynthesis were unknown until this study. Based on our comparative genomic information and targeted gene disruptions, we report the gene cluster for dtx biosynthesis in the insect pathogen Metarhizium robertsii. The nonribosomal peptide synthetase DtxS1 has six adenylation domains, two of which are capable of selecting different amino acids to synthesize dtx B and its analogs. The cytochrome P450 enzyme DtxS2 converts dtx B into other dtxs by a chain of reactions, each producing a new derivative. The aldo-keto reductase DtxS3 and aspartic acid decarboxylase DtxS4 are responsible for the conversion and provision of the first and last substrates for the dtx assembly line, respectively. Insect bioassays showed that dtxs could suppress both cellular and humoral immune responses thereby assisting fungal propagation in insects. The differing abilities of Metarhizium species to produce toxins is dependent on the presence of the dtxS1 gene. The toxigenic species are capable of killing multiple orders of insects, whereas the nontoxigenic Metarhizium spp. have narrow host ranges. Thus, the acquisition or retention of the dtx biosynthesis gene cluster in Metarhizium lineages has been coordinated with the evolution of fungal host specificity. The data from this study will facilitate the development of dtxs as bioinsecticides or pharmaceuticals. PMID:22232661

  9. Assessing pathogen and insect succession functions in forest ecosystems

    Treesearch

    Susan K. Hagle; Sandra J. Kegley; Stephen B. Williams

    1995-01-01

    The pilot test of a method to assess the ecological function of pathogens and insects in forests is reported. The analysis is a practical application of current ecosystem management theory.The influences of pathogens and insects on forest succession are measured by relating successional transition rates and types to conditions for pathogen and insect activities which...

  10. Effect of the insect pathogenic bacterium Photorhabdus on insect phagocytes.

    PubMed

    Au, C; Dean, P; Reynolds, S E; ffrench-Constant, R H

    2004-01-01

    Photorhabdus are insect pathogenic bacteria that replicate within the insect haemocoel following release from their entomopathogenic nematode symbionts. To investigate how they escape the cellular immune response we examined the effects of two strains of Photorhabdus, W14 and K122, on Manduca sexta phagocytes (haemocytes), in vitro and in vivo. Following injection of Esherichia coli into Manduca larvae, these non-pathogenic bacteria are rapidly cleared from the haemolymph and the number of free haemocytes transiently increases. In contrast, following injection of either strain of pathogenic Photorhabdus, the bacteria grow rapidly while the number of haemocytes decreases dramatically. In vitro incubation of haemocytes with either Photorhabdus supernatant reduced haemocyte viability, and the W14 supernatant caused distinct changes in the actin cytoskeleton morphology of different haemocyte cell types. In phagocytosis assays both Photorhabdus strains can inhibit their own phagocytosis whether the bacterial cells are alive or dead. Further, the supernatant of W14 also contains a factor capable of inhibiting the phagocytosis of labelled E. coli. Together these results suggest that Photorhabdus evades the cellular immune response by killing haemocytes and suppressing phagocytosis by mechanisms that differ between strains.

  11. Differential Pathogenicity of Metarhizium Blastospores and Conidia Against Larvae of Three Mosquito Species.

    PubMed

    Alkhaibari, A M; Carolino, A T; Bull, J C; Samuels, R I; Butt, T M

    2017-05-01

    Biorational insecticides are being increasingly used in integrated pest management programs. In laboratory bioassays, the pathogenicity of blastospores and conidia of the entomopathogenic fungus Metarhizium brunneum ARSEF 4556 was evaluated against larvae of three mosquito species. Three propagule concentrations (1 × 106, 1 × 107, and 1 × 108 spores ml - 1) were used in the bioassays. Results showed that Aedes aegypti had lower survival rates when exposed to blastospores than when exposed to conidia, whereas the converse was true for Culex quinquefasciatus larvae. Anopheles stephensi larvae survival rates were similar when exposed to blastospores and conidia, except at the higher doses, where blastospores were more virulent. Several assays showed little difference in mortalities when using either 1 × 107 or 1 × 108 spores ml - 1, suggesting a threshold above which no higher control levels or economic benefit would be achieved. When tested at the lowest dose, the LT50 of Cx. quinquefasciatus using blastospores, wet conidia, and dry conidia was 3.2, 1.9, and 4.4 d, respectively. The LT50 of Ae. aegypti using blastospores, wet conidia, and dry conidia was 1.3, 3.3, and 6.2 d, respectively. The LT50 of An. stephensi using blastospores, wet conidia, and dry conidia was 2.0, 1.9, and 2.1 d, respectively. These observations suggest that for optimized control, two different formulations of the fungus may be needed when treating areas where there are mixed populations of Aedes, Anopheles, and Culex. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Metarhizium anisopliae enzymes and toxins.

    PubMed

    Schrank, Augusto; Vainstein, Marilene Henning

    2010-12-15

    Entomopathogenic fungi are both a feasible system for the control of insect pests in agriculture with a growing market and an important model for studies of host-pathogen interaction. In the last ten years the actual use of fungi, mainly Metarhizium anisopliae and Beauveria bassiana, is increasing reaching commercial scale in Countries like Brazil, China and Mexico among others. At the same time important progress has occurred in the understanding of the molecular aspects of the pathogenesis and in the development of tools to validate putative virulence factors by the construction of over-expressing and knock-out strains. This wealth of knowledge is helping to access more efficient strains from the biodiversity and to optimize formulation for large scale use of this efficient, economic and environmental safer form of insect plague control. Here we focus some of the progress accumulated specially in M. anisopliae and give an overview of the host infection process.

  13. Disturbance in forest ecosystems caused by pathogens and insects

    Treesearch

    Philip M. Wargo; Philip M. Wargo

    1995-01-01

    Pathogens and insects are major driving forces of processes in forested ecosystems. Disturbances caused by them are as intimately involved in ecosystem dynamics as the more sudden and obvious abiotic disturbances, for example, those caused by wind or fire. However, because pathogens and insects are selective and may affect only one or several related species of...

  14. Increased pathogenicity against coffee berry borer, Hypothenemus hampei (Coleoptera: Curculionidae) by Metarhizium anisopliae expressing the scorpion toxin (AaIT) gene.

    PubMed

    Pava-Ripoll, Monica; Posada, Francisco J; Momen, Bahram; Wang, Chengshu; St Leger, Raymond

    2008-10-01

    Coffee berry borer (CBB) is the Worlds most devastating coffee pest causing an estimated US$500 million worth of losses annually through damage and control costs. Beauveria bassiana and Metarhizium anisopliae have been employed to control this pest but their low virulence (slow kill and large inoculums) is an important factor constraining their use. M. anisopliae (AaIT-Ma549) has been modified to express the scorpion toxin (AaIT) in insect hemolymph and this greatly increased pathogenicity against Manduca sexta and Aedes aegypti. Here, we demonstrate that AaIT-Ma549 was also dramatically more virulent against CBB, and we provide a much more comprehensive analysis of infection processes and post-mortality development than in the previous research. We evaluated several spore concentrations (10(1) through 10(7)spores/ml) of both the wild type and recombinant strain. At concentrations of 10(1), 10(2) and 10(3)spores/ml, the recombinant strain significantly increased mortality of CBB by 32.2%, 56.6% and 24.6%, respectively. The medial lethal concentration (LC(50)) was reduced 15.7-fold and the average survival time (AST) was reduced by 20.1% to 2.98+/-0.1 days with 10(7)spores/ml. This is the first occasion that an entomopathogenic fungus has been found to kill CBB in less than 3 days. However, AaIT-Ma549 produces significantly fewer spores on cadavers than the parental strain.

  15. Production of Microsclerotia of Metarhizium anisopliae Using Deep-Tank Liquid Fermentation

    USDA-ARS?s Scientific Manuscript database

    The entomopathogenic fungus Metarhizium anisopliae is a pathogen of numerous soil-dwelling insects and has been registered in the United States and other countries as a bioinsecticide. Recent studies using various strains of M. anisopliae showed that small sclerotia (microsclerotia) were produced i...

  16. Identification of Metarhizium anisopliae transcripts expressed during the fungus- insect interaction

    USDA-ARS?s Scientific Manuscript database

    The identification of genes contributing to the establishment and disease progression of entomopathogenic fungi within their insect hosts has been conducted to date largely using in vitro systems mimicking specific phases of the infection. We are exploring the use of in vivo techniques to identify f...

  17. The extracellular constitutive production of chitin deacetylase in Metarhizium anisopliae: possible edge to entomopathogenic fungi in the biological control of insect pests.

    PubMed

    Nahar, Pallavi; Ghormade, Vandana; Deshpande, Mukund V

    2004-02-01

    The possible contribution of extracellular constitutively produced chitin deacetylase by Metarhizium anisopliae in the process of insect pathogenesis has been evaluated. Chitin deacetylase converts chitin, a beta-1,4-linked N-acetylglucosamine polymer, into its deacetylated form chitosan, a glucosamine polymer. When grown in a yeast extract-peptone medium, M. anisopliae constitutively produced the enzymes protease, lipase, and two chitin-metabolizing enzymes, viz. chitin deacetylase (CDA) and chitosanase. Chitinase activity was induced in chitin-containing medium. Staining of 7.5% native polyacrylamide gels at pH 8.9 revealed CDA activity in three bands. SDS-PAGE showed that the apparent molecular masses of the three isoforms were 70, 37, and 26 kDa, respectively. Solubilized melanin (10microg) inhibited chitinase activity, whereas CDA was unaffected. Following germination of M. anisopliae conidia on isolated Helicoverpa armigera, cuticle revealed the presence of chitosan by staining with 3-methyl-2-benzothiazoline hydrazone. Blue patches of chitosan were observed on cuticle, indicating conversion of chitin to chitosan. Hydrolysis of chitin with constitutively produced enzymes of M. anisopliae suggested that CDA along with chitosanase contributed significantly to chitin hydrolysis. Thus, chitin deacetylase was important in initiating pathogenesis of M. anisopliae softening the insect cuticle to aid mycelial penetration. Evaluation of CDA and chitinase activities in other isolates of Metarhizium showed that those strains had low chitinase activity but high CDA activity. Chemical assays of M. anisopliae cell wall composition revealed the presence of chitosan. CDA may have a dual role in modifying the insect cuticular chitin for easy penetration as well as for altering its own cell walls for defense from insect chitinase.

  18. Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics.

    PubMed

    Kepler, Ryan M; Humber, Richard A; Bischoff, Joseph F; Rehner, Stephen A

    2014-01-01

    The genus Metarhizium historically refers to green-spored asexual insect pathogenic fungi. Through culturing and molecular methods, Metarhizium has been linked to Metacordyceps sexual states. Historically fungal nomenclature has allowed separate names for the different life stages of pleomorphic fungi. However, with the move to one name for one fungus regardless of life stage, there is a need to determine which name is correct. For Metarhizium the situation is complicated by the fact that Metacordyceps sexual states are interspersed among additional asexual genera, including Pochonia, Nomuraea and Paecilomyces. Metarhizium has priority as the earliest available name, but delimiting the boundaries of this genus remains problematic. To clarify relationships among these taxa we have obtained representative material for each genus and established a molecular dataset of the protein-coding genes BTUB, RPB1, RPB2 and TEF. The resulting phylogeny supports Metarhizium combining the majority of species recognized in Metacordyceps as well as the green-spored Nomuraea species and those in the more recently described genus Chamaeleomyces. Pochonia is polyphyletic, and we restrict the definition of this genus to those species forming a monophyletic clade with P. chlamydosporia, and the excluded species are transferred to Metapochonia gen. nov. It is our hope that this unified concept of sexual and asexual states in Metarhizium will foster advances in communication and understanding the unique ecologies of the associated species. © 2014 by The Mycological Society of America.

  19. An alternative insect pathogenic strategy in an Aspergillus flavus auxotroph.

    PubMed

    Scully, Lisa R; Bidochka, Michael J

    2009-02-01

    In order to study fungal pathogen evolution, we used a model system whereby the opportunistic fungus Aspergillus flavus was serially propagated through the insect (Galleria mellonella) larvae, yielding a cysteine/methionine auxotroph of A. flavus with properties of an obligate insect pathogen. The auxotroph exhibited insect host restriction but did not show any difference in virulence when compared with the wild-type (Scully LR, Bidochka MJ, 2006. Microbiology 152, 223-232). Here, we report that on 1% insect cuticle medium and synthetic Galleria medium, the auxotroph displayed increased extracellular protease production, a virulence factor necessary for insect pathogenesis. In the wild-type strain, protease production was deregulated during carbon (glucose), nitrogen (nitrate), or sulphate deprivation. If all three were present, protease production was vastly reduced. However, in the cysteine/methionine auxotroph, protease production was deregulated in complete medium. We suggest that the deficiency in sulphate assimilation in the auxotroph resulted in deregulation of protease production. The auxotroph exhibited delayed germination and slower hyphal growth when compared to the wild-type but there were no differences in virulence or cuticle penetration, suggesting a shift in pathogenic strategy that compensated decreased growth with increased virulence factor (extracellular protease) production. We concluded that the biosynthetic deficiency that mediated insect host restriction also increased protease production in the slow-growing auxotroph, resulting in an alternate, more host-specific pathogenic strategy. However, we argue that transmission is not necessarily correlated with virulence as competition bioassays in insect larvae showed that the wild-type generally out-competed the auxotroph by producing the majority of the conidia on the sporulating cadavers. This is one of the few examples that highlight the effect of genome decay on nutrition acquisition

  20. Lack of acute pathogenicity and toxicity in mice of an isolate of Metarhizium anisopliae var. anisopliae from spittlebugs.

    PubMed

    Toriello, C; Pérez-Torres, A; Burciaga-Díaz, A; Navarro-Barranco, H; Pérez-Mejía, A; Lorenzana-Jiménez, M; Mier, T

    2006-10-01

    A monospore strain of Metarhizium anisopliae var. anisopliae (EH-479/2), isolated in Mexico from Aeneolamia sp., was tested for oral acute intragastric pathogenicity and toxicity in CD-1 mice, including a thorough histological study. Animals were inoculated by gavage with one dose (10(8) conidia/animal) of viable (72 mice) and nonviable (24 mice) conidia and compared to 18 control mice. Clinical observations were done daily; mycological and histological tests were performed during necropsies at days 3, 10, 17, and 21 after the inoculation. At the end of the study, no mice showed clinical symptoms of illness, and the animals' mean weight corresponded to that of healthy adults. No inflammatory reactions were identified in analyzed organs, suggesting the nonimmunogenic status of this fungal strain. Evidence of fungal germination was noted in two lymph nodes and in liver and lung of one dead mouse, out of 72 viable-conidia treated mice. There was no evidence of toxicity symptoms in mice inoculated with nonviable conidia. The results obtained support the nonpathogenic and nontoxic status of this fungal strain when administered in a sole intragastric dose in mice.

  1. Pathogens and insect herbivores drive rainforest plant diversity and composition.

    PubMed

    Bagchi, Robert; Gallery, Rachel E; Gripenberg, Sofia; Gurr, Sarah J; Narayan, Lakshmi; Addis, Claire E; Freckleton, Robert P; Lewis, Owen T

    2014-02-06

    Tropical forests are important reservoirs of biodiversity, but the processes that maintain this diversity remain poorly understood. The Janzen-Connell hypothesis suggests that specialized natural enemies such as insect herbivores and fungal pathogens maintain high diversity by elevating mortality when plant species occur at high density (negative density dependence; NDD). NDD has been detected widely in tropical forests, but the prediction that NDD caused by insects and pathogens has a community-wide role in maintaining tropical plant diversity remains untested. We show experimentally that changes in plant diversity and species composition are caused by fungal pathogens and insect herbivores. Effective plant species richness increased across the seed-to-seedling transition, corresponding to large changes in species composition. Treating seeds and young seedlings with fungicides significantly reduced the diversity of the seedling assemblage, consistent with the Janzen-Connell hypothesis. Although suppressing insect herbivores using insecticides did not alter species diversity, it greatly increased seedling recruitment and caused a marked shift in seedling species composition. Overall, seedling recruitment was significantly reduced at high conspecific seed densities and this NDD was greatest for the species that were most abundant as seeds. Suppressing fungi reduced the negative effects of density on recruitment, confirming that the diversity-enhancing effect of fungi is mediated by NDD. Our study provides an overall test of the Janzen-Connell hypothesis and demonstrates the crucial role that insects and pathogens have both in structuring tropical plant communities and in maintaining their remarkable diversity.

  2. Insect Immunity to Entomopathogenic Fungi.

    PubMed

    Lu, H-L; St Leger, R J

    2016-01-01

    The study of infection and immunity in insects has achieved considerable prominence with the appreciation that their host defense mechanisms share many fundamental characteristics with the innate immune system of vertebrates. Studies on the highly tractable model organism Drosophila in particular have led to a detailed understanding of conserved innate immunity networks, such as Toll. However, most of these studies have used opportunistic human pathogens and may not have revealed specialized immune strategies that have arisen through evolutionary arms races with natural insect pathogens. Fungi are the commonest natural insect pathogens, and in this review, we focus on studies using Metarhizium and Beauveria spp. that have addressed immune system function and pathogen virulence via behavioral avoidance, the use of physical barriers, and the activation of local and systemic immune responses. In particular, we highlight studies on the evolutionary genetics of insect immunity and discuss insect-pathogen coevolution. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Novel antibiotic compounds produced by the insect pathogenic bacterium photorhabdus.

    PubMed

    Eleftherianos, Ioannis G

    2009-06-01

    Phototorhabdus is an insect pathogenic enterobacterium which maintains a mutualistic interaction with heterorhabditid nematodes. While the bacteria live in the nematode gut, the nematodes live in the soil and infect insect larvae, releasing their symbiotic bacteria into the insect blood. Here the bacteria reproduce and kill the insect by septicaemia. The nematodes then feed on the bacterial biomass and undergo several rounds of reproduction before emerging from the cadaver carrying their bacterial symbionts. Photorhabdus secretes a versatile armory of antimicrobial molecules into the insect corpse. These biocides exert a range of antimicrobial killing activities and serve a dual function. They minimize competition from non-symbiotic bacteria and prevent microbial putrefaction of the nematode-infected insect cadaver. The goal of this review is to describe current knowledge of the molecular mechanisms involved in the production of bacteriocins by Photorhabdus. Recent important advances in identifying novel potent antibiotic compounds from Photorhabdus and elucidating their complex mode of action in relation to pathogenicity and symbiosis associations are also discussed. The last part of this review focuses on the potential role Photorhabdus antibiotics may play in contributing to the discovery of novel pharmaceutical and agrochemical products. The present article is a short review of recent patents on Photohabdus.

  4. Forest insect and fungal pathogen responses to drought [Chapter 6

    Treesearch

    Thomas E. Kolb; Christopher J. Fettig; Barbara J. Bentz; Jane E. Stewart; Aaron S. Weed; Jeffrey A. Hicke; Matthew P. Ayres

    2016-01-01

    Recent changes in precipitation patterns and in the occurrence of extreme temperature and precipitation events have been documented in many forested regions of the United States (Ryan and Vose 2012). Changes in drought intensity and frequency have the potential to alter populations and impacts of tree-damaging forest insects and pathogens (Ayers and Lombardero...

  5. Age, pathogen exposure, but not maternal care shape offspring immunity in an insect with facultative family life.

    PubMed

    Vogelweith, Fanny; Körner, Maximilian; Foitzik, Susanne; Meunier, Joël

    2017-03-07

    To optimize their resistance against pathogen infection, individuals are expected to find the right balance between investing into the immune system and other life history traits. In vertebrates, several factors were shown to critically affect the direction of this balance, such as the developmental stage of an individual, its current risk of infection and/or its access to external help such as parental care. However, the independent and/or interactive effects of these factors on immunity remain poorly studied in insects. Here, we manipulated maternal presence and pathogen exposure in families of the European earwig Forficula auricularia to measure whether and how the survival rate and investment into two key immune parameters changed during offspring development. The pathogen was the entomopathogenic fungus Metarhizium brunneum and the immune parameters were hemocyte concentration and phenol/pro-phenoloxidase enzyme activity (total-PO). Our results surprisingly showed that maternal presence had no effect on offspring immunity, but reduced offspring survival. Pathogen exposure also lowered the survival of offspring during their early development. The concentration of hemocytes and the total-PO activity increased during development, to be eventually higher in adult females compared to adult males. Finally, pathogen exposure overall increased the concentration of hemocytes-but not the total-PO activity-in adults, while it had no effect on these measures in offspring. Our results show that, independent of their infection risk and developmental stage, maternal presence does not shape immune defense in young earwigs. This reveals that pathogen pressure is not a universal evolutionary driver of the emergence and maintenance of post-hatching maternal care in insects.

  6. Insect Pathogenic Bacteria in Integrated Pest Management.

    PubMed

    Ruiu, Luca

    2015-04-14

    The scientific community working in the field of insect pathology is experiencing an increasing academic and industrial interest in the discovery and development of new bioinsecticides as environmentally friendly pest control tools to be integrated, in combination or rotation, with chemicals in pest management programs. In this scientific context, market data report a significant growth of the biopesticide segment. Acquisition of new technologies by multinational Ag-tech companies is the center of the present industrial environment. This trend is in line with the requirements of new regulations on Integrated Pest Management. After a few decades of research on microbial pest management dominated by Bacillus thuringiensis (Bt), novel bacterial species with innovative modes of action are being discovered and developed into new products. Significant cases include the entomopathogenic nematode symbionts Photorhabdus spp. and Xenorhabdus spp., Serratia species, Yersinia entomophaga, Pseudomonas entomophila, and the recently discovered Betaproteobacteria species Burkholderia spp. and Chromobacterium spp. Lastly, Actinobacteria species like Streptomyces spp. and Saccharopolyspora spp. have gained high commercial interest for the production of a variety of metabolites acting as potent insecticides. With the aim to give a timely picture of the cutting-edge advancements in this renewed research field, different representative cases are reported and discussed.

  7. Insect Pathogenic Bacteria in Integrated Pest Management

    PubMed Central

    Ruiu, Luca

    2015-01-01

    The scientific community working in the field of insect pathology is experiencing an increasing academic and industrial interest in the discovery and development of new bioinsecticides as environmentally friendly pest control tools to be integrated, in combination or rotation, with chemicals in pest management programs. In this scientific context, market data report a significant growth of the biopesticide segment. Acquisition of new technologies by multinational Ag-tech companies is the center of the present industrial environment. This trend is in line with the requirements of new regulations on Integrated Pest Management. After a few decades of research on microbial pest management dominated by Bacillus thuringiensis (Bt), novel bacterial species with innovative modes of action are being discovered and developed into new products. Significant cases include the entomopathogenic nematode symbionts Photorhabdus spp. and Xenorhabdus spp., Serratia species, Yersinia entomophaga, Pseudomonas entomophila, and the recently discovered Betaproteobacteria species Burkholderia spp. and Chromobacterium spp. Lastly, Actinobacteria species like Streptomyces spp. and Saccharopolyspora spp. have gained high commercial interest for the production of a variety of metabolites acting as potent insecticides. With the aim to give a timely picture of the cutting-edge advancements in this renewed research field, different representative cases are reported and discussed. PMID:26463190

  8. Insect symbiotic bacteria harbour viral pathogens for transovarial transmission.

    PubMed

    Jia, Dongsheng; Mao, Qianzhuo; Chen, Yong; Liu, Yuyan; Chen, Qian; Wu, Wei; Zhang, Xiaofeng; Chen, Hongyan; Li, Yi; Wei, Taiyun

    2017-03-06

    Many insects, including mosquitoes, planthoppers, aphids and leafhoppers, are the hosts of bacterial symbionts and the vectors for transmitting viral pathogens(1-3). In general, symbiotic bacteria can indirectly affect viral transmission by enhancing immunity and resistance to viruses in insects(3-5). Whether symbiotic bacteria can directly interact with the virus and mediate its transmission has been unknown. Here, we show that an insect symbiotic bacterium directly harbours a viral pathogen and mediates its transovarial transmission to offspring. We observe rice dwarf virus (a plant reovirus) binding to the envelopes of the bacterium Sulcia, a common obligate symbiont of leafhoppers(6-8), allowing the virus to exploit the ancient oocyte entry path of Sulcia in rice leafhopper vectors. Such virus-bacterium binding is mediated by the specific interaction of the viral capsid protein and the Sulcia outer membrane protein. Treatment with antibiotics or antibodies against Sulcia outer membrane protein interferes with this interaction and strongly prevents viral transmission to insect offspring. This newly discovered virus-bacterium interaction represents the first evidence that a viral pathogen can directly exploit a symbiotic bacterium for its transmission. We believe that such a model of virus-bacterium communication is a common phenomenon in nature.

  9. Genome Sequencing and Comparative Transcriptomics of the Model Entomopathogenic Fungi Metarhizium anisopliae and M. acridum

    PubMed Central

    Shang, Yanfang; Duan, Zhibing; Hu, Xiao; Xie, Xue-Qin; Zhou, Gang; Peng, Guoxiong; Luo, Zhibing; Huang, Wei; Wang, Bing; Fang, Weiguo; Wang, Sibao; Zhong, Yi; Ma, Li-Jun; St. Leger, Raymond J.; Zhao, Guo-Ping; Pei, Yan; Feng, Ming-Guang; Xia, Yuxian; Wang, Chengshu

    2011-01-01

    Metarhizium spp. are being used as environmentally friendly alternatives to chemical insecticides, as model systems for studying insect-fungus interactions, and as a resource of genes for biotechnology. We present a comparative analysis of the genome sequences of the broad-spectrum insect pathogen Metarhizium anisopliae and the acridid-specific M. acridum. Whole-genome analyses indicate that the genome structures of these two species are highly syntenic and suggest that the genus Metarhizium evolved from plant endophytes or pathogens. Both M. anisopliae and M. acridum have a strikingly larger proportion of genes encoding secreted proteins than other fungi, while ∼30% of these have no functionally characterized homologs, suggesting hitherto unsuspected interactions between fungal pathogens and insects. The analysis of transposase genes provided evidence of repeat-induced point mutations occurring in M. acridum but not in M. anisopliae. With the help of pathogen-host interaction gene database, ∼16% of Metarhizium genes were identified that are similar to experimentally verified genes involved in pathogenicity in other fungi, particularly plant pathogens. However, relative to M. acridum, M. anisopliae has evolved with many expanded gene families of proteases, chitinases, cytochrome P450s, polyketide synthases, and nonribosomal peptide synthetases for cuticle-degradation, detoxification, and toxin biosynthesis that may facilitate its ability to adapt to heterogenous environments. Transcriptional analysis of both fungi during early infection processes provided further insights into the genes and pathways involved in infectivity and specificity. Of particular note, M. acridum transcribed distinct G-protein coupled receptors on cuticles from locusts (the natural hosts) and cockroaches, whereas M. anisopliae transcribed the same receptor on both hosts. This study will facilitate the identification of virulence genes and the development of improved biocontrol strains

  10. A Plant Bacterial Pathogen Manipulates Its Insect Vector's Energy Metabolism.

    PubMed

    Killiny, Nabil; Hijaz, Faraj; Ebert, Timothy A; Rogers, Michael E

    2017-03-01

    Insect-transmitted plant-pathogenic bacteria may alter their vectors' fitness, survival, behavior, and metabolism. Because these pathogens interact with their vectors on the cellular and organismal levels, potential changes at the biochemical level might occur. "Candidatus Liberibacter asiaticus" (CLas) is transmitted in a persistent, circulative, and propagative manner. The genome of CLas revealed the presence of an ATP translocase that mediates the uptake of ATP and other nucleotides from medium to achieve its biological processes, such as growth and multiplication. Here, we showed that the levels of ATP and many other nucleotides were significantly higher in CLas-infected than healthy psyllids. Gene expression analysis showed upregulation for ATP synthase subunits, while ATPase enzyme activity showed a decrease in ATPase activity. These results indicated that CLas stimulated Diaphorina citri to produce more ATP and many other energetic nucleotides, while it may inhibit their consumption by the insect. As a result of ATP accumulation, the adenylated energy charge (AEC) increased and the AMP/ATP and ADP/ATP ratios decreased in CLas-infected D. citri psyllids. Survival analysis confirmed a shorter life span for CLas-infected D. citri psyllids. In addition, electropenetrography showed a significant reduction in total nonprobing time, salivation time, and time from the last E2 (phloem ingestion) to the end of recording, indicating that CLas-infected psyllids were at a higher hunger level and they tended to forage more often. This increased feeding activity reflects the CLas-induced energetic stress. In conclusion, CLas alters the energy metabolism of its psyllid vector, D. citri, in order to secure its need for energetic nucleotides.IMPORTANCE Insect transmission of plant-pathogenic bacteria involves propagation and circulation of the bacteria within their vectors. The transmission process is complex and requires specific interactions at the molecular and biochemical

  11. A Plant Bacterial Pathogen Manipulates Its Insect Vector's Energy Metabolism

    PubMed Central

    Hijaz, Faraj; Ebert, Timothy A.; Rogers, Michael E.

    2016-01-01

    ABSTRACT Insect-transmitted plant-pathogenic bacteria may alter their vectors' fitness, survival, behavior, and metabolism. Because these pathogens interact with their vectors on the cellular and organismal levels, potential changes at the biochemical level might occur. “Candidatus Liberibacter asiaticus” (CLas) is transmitted in a persistent, circulative, and propagative manner. The genome of CLas revealed the presence of an ATP translocase that mediates the uptake of ATP and other nucleotides from medium to achieve its biological processes, such as growth and multiplication. Here, we showed that the levels of ATP and many other nucleotides were significantly higher in CLas-infected than healthy psyllids. Gene expression analysis showed upregulation for ATP synthase subunits, while ATPase enzyme activity showed a decrease in ATPase activity. These results indicated that CLas stimulated Diaphorina citri to produce more ATP and many other energetic nucleotides, while it may inhibit their consumption by the insect. As a result of ATP accumulation, the adenylated energy charge (AEC) increased and the AMP/ATP and ADP/ATP ratios decreased in CLas-infected D. citri psyllids. Survival analysis confirmed a shorter life span for CLas-infected D. citri psyllids. In addition, electropenetrography showed a significant reduction in total nonprobing time, salivation time, and time from the last E2 (phloem ingestion) to the end of recording, indicating that CLas-infected psyllids were at a higher hunger level and they tended to forage more often. This increased feeding activity reflects the CLas-induced energetic stress. In conclusion, CLas alters the energy metabolism of its psyllid vector, D. citri, in order to secure its need for energetic nucleotides. IMPORTANCE Insect transmission of plant-pathogenic bacteria involves propagation and circulation of the bacteria within their vectors. The transmission process is complex and requires specific interactions at the molecular

  12. Responses of temperate forest productivity to insect and pathogen disturbances

    NASA Astrophysics Data System (ADS)

    Flower, C. E.; Gonzalez-Meler, M. A.

    2014-12-01

    Climate forcing factors have been documented to directly (e.g. CO2 fertilization) or indirectly (e.g. temperature and vapor pressure deficit) affect net primary productivity (NPP) of forests. Climate variations can also affect the vulnerability of forests to pests and pathogens, causing diffuse or widespread mortality. The introduction of novel pests is causing rapid mortality of targeted species with undetermined effects on forest productivity: NPP could decrease or increase depending on the severity (proportion of basal area impacted) and species diversity. We attempted to document the impact of diffuse mortality caused by insect outbreaks on North American temperate forests through synthesis of literature. Despite the large number of studies (>500) only a few (12) documented NPP in a systematic manner. The magnitude of insect and pathogen disturbance was larger in western than eastern forests due to the redundancy and functional diversity of temperate deciduous and mixed deciduous forests. Recovery from disturbance was more rapid from diffuse short duration defoliation events relative to the long lasting impacts of wood boring insects. Forest resilience may decrease as insect disturbance increases, particularly with generalist invasive pests that target a variety of species. We conclude that these biotic interactions, particularly when caused by invasive pests, impose biological forcing to forest NPP at similar magnitude and time scales than climate forcing.

  13. Jasmonate signaling and manipulation by pathogens and insects.

    PubMed

    Zhang, Li; Zhang, Feng; Melotto, Maeli; Yao, Jian; He, Sheng Yang

    2017-01-09

    Plants synthesize jasmonates (JAs) in response to developmental cues or environmental stresses, in order to coordinate plant growth, development or defense against pathogens and herbivores. Perception of pathogen or herbivore attack promotes synthesis of jasmonoyl-L-isoleucine (JA-Ile), which binds to the COI1-JAZ receptor, triggering the degradation of JAZ repressors and induction of transcriptional reprogramming associated with plant defense. Interestingly, some virulent pathogens have evolved various strategies to manipulate JA signaling to facilitate their exploitation of plant hosts. In this review, we focus on recent advances in understanding the mechanism underlying the enigmatic switch between transcriptional repression and hormone-dependent transcriptional activation of JA signaling. We also discuss various strategies used by pathogens and insects to manipulate JA signaling and how interfering with this could be used as a novel means of disease control.

  14. Conidial production, persistence and pathogenicity of hydromulch formulations of Metarhizium brunneum F52 microsclerotia under forest conditions

    USDA-ARS?s Scientific Manuscript database

    Microsclerotia granules of Metarhizium brunneum Petch strain F52 (Hypocreales: Clavicipitaceae) in hydromulch (water, wheat straw, and tackifier) were sprayed onto bark or wood samples during two spray trials in 2013 and six spray trials in 2014. Microsclerotial granules in hydromulch continued to p...

  15. Insect pathogens as biological control agents: Back to the future.

    PubMed

    Lacey, L A; Grzywacz, D; Shapiro-Ilan, D I; Frutos, R; Brownbridge, M; Goettel, M S

    2015-11-01

    The development and use of entomopathogens as classical, conservation and augmentative biological control agents have included a number of successes and some setbacks in the past 1years. In this forum paper we present current information on development, use and future directions of insect-specific viruses, bacteria, fungi and nematodes as components of integrated pest management strategies for control of arthropod pests of crops, forests, urban habitats, and insects of medical and veterinary importance. Insect pathogenic viruses are a fruitful source of microbial control agents (MCAs), particularly for the control of lepidopteran pests. Most research is focused on the baculoviruses, important pathogens of some globally important pests for which control has become difficult due to either pesticide resistance or pressure to reduce pesticide residues. Baculoviruses are accepted as safe, readily mass produced, highly pathogenic and easily formulated and applied control agents. New baculovirus products are appearing in many countries and gaining an increased market share. However, the absence of a practical in vitro mass production system, generally higher production costs, limited post application persistence, slow rate of kill and high host specificity currently contribute to restricted use in pest control. Overcoming these limitations are key research areas for which progress could open up use of insect viruses to much larger markets. A small number of entomopathogenic bacteria have been commercially developed for control of insect pests. These include several Bacillus thuringiensis sub-species, Lysinibacillus (Bacillus) sphaericus, Paenibacillus spp. and Serratia entomophila. B. thuringiensis sub-species kurstaki is the most widely used for control of pest insects of crops and forests, and B. thuringiensis sub-species israelensis and L. sphaericus are the primary pathogens used for control of medically important pests including dipteran vectors. These pathogens

  16. A Pathogenic Nematode Targets Recognition Proteins to Avoid Insect Defenses

    PubMed Central

    Toubarro, Duarte; Avila, Mónica Martinez; Montiel, Rafael; Simões, Nelson

    2013-01-01

    Steinernemacarpocapsae is a nematode pathogenic in a wide variety of insect species. The great pathogenicity of this nematode has been ascribed to its ability to overcome the host immune response; however, little is known about the mechanisms involved in this process. The analysis of an expressed sequence tags (EST) library in the nematode during the infective phase was performed and a highly abundant contig homologous to serine protease inhibitors was identified. In this work, we show that this contig is part of a 641-bp cDNA that encodes a BPTI-Kunitz family inhibitor (Sc-KU-4), which is up-regulated in the parasite during invasion and installation. Recombinant Sc-KU-4 protein was produced in Escherichia coli and shown to inhibit chymotrypsin and elastase activities in a dose-dependent manner by a competitive mechanism with Ki values of 1.8 nM and 2.6 nM, respectively. Sc-KU-4 also inhibited trypsin and thrombin activities to a lesser extent. Studies of the mode of action of Sc-KU-4 and its effects on insect defenses suggest that although Sc-KU-4 did not inhibit the activation of hemocytes or the formation of clotting fibers, it did inhibit hemocyte aggregation and the entrapment of foreign particles by fibers. Moreover, Sc-KU-4 avoided encapsulation and the deposition of clotting materials, which usually occurs in response to foreign particles. We show by protein-protein interaction that Sc-KU-4 targets recognition proteins of insect immune system such as masquerade-like and serine protease-like homologs. The interaction of Sc-KU-4 with these proteins explains the ability of the nematode to overcome host reactions and its large pathogenic spectrum, once these immune proteins are well conserved in insects. The discovery of this inhibitor targeting insect recognition proteins opens new avenues for the development of S. carpocapsae as a biological control agent and provides a new tool to study host-pathogen interactions. PMID:24098715

  17. Historical and current roles of insects and pathogens in eastern Oregon and Washington forested landscapes. Forest Service general technical report

    SciTech Connect

    Hessburg, P.F.; Mitchell, R.G.; Filip, G.M.

    1994-04-01

    The paper examines, by climax conifer series, historical and current roles of many important pathogens and insects of interior Northwest coniferious forests and their unique responses to changing successional conditions resulting from management. Future research on forest pathogens and insects should address three primary subject areas: insect and pathogen population dynamics in managed and unmanaged forests; ecological roles and effects of native and introduced pathogens and insects; and effects of natural disturbances and management practices on native insects, pathogens, and their natural enemies.

  18. Expressing a fusion protein with protease and chitinase activities increases the virulence of the insect pathogen Beauveria bassiana.

    PubMed

    Fang, Weiguo; Feng, Jin; Fan, Yanhua; Zhang, Yongjun; Bidochka, Michael J; Leger, Raymond J St; Pei, Yan

    2009-10-01

    Entomopathogenic fungi, such as Beauveria bassiana and Metarhizium anisopliae are being developed as alternatives to chemical insecticides. They infect insects by direct penetration of the cuticle using a combination of physical pressure and extracellular hydrolytic enzymes such as proteases and chitinases. Previously we found that overexpression of a subtilisin-like protease (Pr1A) or a chitinase (Bbchit1) resulted in increased virulence of M. anisopliae and B. bassiana, respectively. In this study, we found that a mixture of the B. bassiana Pr1A homolog (CDEP1) and Bbchit1 degraded insect cuticle in vitro more efficiently than either CDEP1 or Bbchit1 alone. Based on this we produced three plasmid constructs; (1) Bbchit1, (2) CDEP1, and (3) a fusion gene of Bbchit1 linked to CDEP1 each under the control of the constitutive gpd promoter from Aspergillus nidulans. B. bassiana transformants secreting the fusion protein (CDEP1:Bbchit1) penetrated the cuticle significantly faster than the wild type or transformants overexpressing either Bbchit1 or CDEP1. Compared to the wild type, the transformant overexpressing CDEP1 showed a 12.5% reduction in LT(50), without a reduction in LC(50). The LT(50) of the transformant expressing CDEP1:Bbchit1 was reduced by 24.9%. Strikingly, expression of CDEP1:Bbchit1 resulted in a 60.5% reduction in LC(50), more than twice the reduction obtained by overexpression of Bbchit1 (28.5%). This work represents a significant step towards the development of hypervirulent insect pathogens for effective pest control.

  19. Historical and current roles of insects and pathogens in eastern Oregon and Washington forested landscapes.

    Treesearch

    P.F. Hessburg; R.G. Mitchell; G.M. Filip

    1994-01-01

    This paper examines by climax conifer series, historical and current roles of many important pathogens and insects of interior Northwest coniferous forests, and their unique responses to changing successional conditions resulting from management. Insects and pathogens of the subalpine fir and mountain hemlock series historically reduced inter-tree competition for site...

  20. Pathogen Alarm Behavior in a Termite: A New Form of Communication in Social Insects

    NASA Astrophysics Data System (ADS)

    Rosengaus, R. B.; Jordan, C.; Lefebvre, M. L.; Traniello, J. F. A.

    Dampwood termites, Zootermopsis angusticollis, show an alarm response after detecting the presence of spores of the pathogenic fungus Metarhizium anisopliae. Termites in direct contact with a high concentration of spores (107 spores/ml) show a striking vibratory display which appears to convey information about the presence of pathogens to nearby unexposed nestmates through substrate vibration. Nestmates not directly in contact with spores that perceive the vibrational signal increase significantly their distance from the spore-exposed vibrating termites, apparently to escape from the source of infection. The fleeing response is not induced by the presence of the spores alone or by pheromones, and requires the perception of the vibrations propagated through the substrate. This "pathogen alarm behavior" appears to be a previously unrecognized communication mechanism that allows termites to reduce disease risks within the nest.

  1. Brevibacillus laterosporus inside the insect body: Beneficial resident or pathogenic outsider?

    PubMed

    Marche, Maria Giovanna; Mura, Maria Elena; Ruiu, Luca

    2016-06-01

    Brevibacillus laterosporus is an entomopathogenic bacterium showing varying degrees of virulence against diverse insect pests. Conversely, it is regarded as a beneficial component of the intestinal flora in different animals and in some insect species including the honeybee. B. laterosporus was detected through a species-specific PCR assay in the body of different insects, including Apis mellifera and Bombus terrestris. A strain isolated from a honeybee worker was pathogenic to the house fly Musca domestica, thus supporting the development of either mutualistic or pathogenic interactions of this bacterium with diverse insect species, as the result of a coevolutionary process.

  2. Evaluation of Pathogenicity of the Fungi Metarhizium anisopliae and Beauveria bassiana in Hazelnut Weevil (Curculio nucum L., Coleoptera, Curculionidae) Larvae.

    PubMed

    Cheng, Yunqing; Liu, Ting; Zhao, Yixin; Geng, Wanting; Chen, Longtao; Liu, Jianfeng

    2016-12-01

    The nut weevil (Curculio nucum) is one of the most important and widespread pests in hazelnut orchards. In order to screen entomopathogenic fungal strains with high virulence against C. nucum, the growth rate, sporulation, and cumulative mortality of different Metarhizium anisopliae and Beauveria bassiana strains were investigated, and the process by which M. anisopliae CoM 02 infects C. nucum larvae was observed using scanning electron microscopy. The results indicated that the growth rate and sporulation of different fungal strains significantly differed. Thirteen days after inoculation with M. anisopliae CoM 02, the cumulative mortality of C. nucum larvae reached 100 %, which was considerably higher than that of the other five strains. As the most virulent of the six test strains, the cadaver rate, LT50, and LT90 of M. anisopliae CoM 02 were 93.4 %, 7.05 and 11.90 days, respectively. Analysis of the infection process by scanning electron microscopy showed that the spore attachment, hyphal germination, hyphal rapid growth, and sporulation of M. anisopliae CoM 02 occurred on the 3rd, 5th, 7th, and 11th day after inoculation, respectively, indicating that the infection cycle takes approximately 11 days. This finding suggests that the highly virulent M. anisopliae plays an important role in the biocontrol of C. nucum in China.

  3. Transgenic tobacco expressing a modified spider peptide inhibits the growth of plant pathogens and insect larvae

    USDA-ARS?s Scientific Manuscript database

    The gene encoding lycotoxin I, an amphipathic pore-forming peptide, was modified to increase oral toxicity to insects. One of the most active modified genes was then constitutively expressed in tobacco (Nicotiana tabacum) and transformants were evaluated for insect and disease resistance. Pathogenic...

  4. Immunity in a Social Insect

    NASA Astrophysics Data System (ADS)

    Rosengaus, Rebeca B.; Traniello, James F. A.; Chen, Tammy; Brown, Julie J.; Karp, Richard D.

    Although pathogens appear to have exerted significant selective pressure on various aspects of sociality, mechanisms of disease resistance in the social insects are poorly understood. We report here on an immune response to infection by the dampwood termite, Zootermopsis angusticollis. Nymphs immunized with an injection of 7.6×107, 7.6×105, or 7.6×104 cells/ml glutaraldehyde-killed solution of the bacterium Pseudomonas aeruginosa had significantly higher survivorship than controls following a challenge with a lethal concentration of active bacteria. Similarly, nymphs exposed to a 9×10-1 spores/ml suspension of the fungus Metarhizium anisopliae had higher survivorship than controls after a challenge with a lethal concentration of spores. Prior exposure to a pathogen thus conferred upon termites a degree of protection during a subsequent encounter with the same pathogen. This represents the first demonstration of immune function in vivo in a social insect.

  5. Different pathogenicities of Rice stripe virus from the insect vector and from viruliferous plants.

    PubMed

    Zhao, Wan; Yang, Pengcheng; Kang, Le; Cui, Feng

    2016-04-01

    Persistent plant viruses usually depend on insects for their transmission; they cannot be transmitted between plants or through mechanical inoculation. However, the mechanism by which persistent viruses become pathogenic in insect vectors remains unknown. In this study, we used Rice stripe virus (RSV), its insect vector Laodelphax striatellus and host plant (Oryza sativa) to explore how persistent viruses acquire pathogenicity from insect vectors. RSV acquired phytopathogenicity in both the alimentary tract and the salivary gland of L. striatellus. We mechanically inoculated RSV into rice O. sativa leaves through midrib microinjection. Insect-derived RSV induced a typical stripe symptom, whereas plant-derived RSV only produced chlorosis in rice leaves. Insect-derived RSV had higher expression of genes rdrp, ns2, nsvc2, sp and nsvc4 than plant-derived RSV, and the latter had higher expression of genes cp and ns3 than the former in rice leaves. Different from plant-derived RSV, insect-derived RSV damaged grana stacks within the chloroplast and inhibited photosynthesis by suppressing the photosystem II subunit psbp. This study not only presented a convenient method to mechanically inoculate RSV into plants, but also provided insights into the different pathogenic mechanisms of RSV from the insect vector and from viruliferous plants. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  6. Differentially-expressed glycoproteins in Locusta migratoria hemolymph infected with Metarhizium anisopliae.

    PubMed

    Wang, Chutao; Cao, Yueqing; Wang, Zhongkang; Yin, Youping; Peng, Guoxiong; Li, Zhenlun; Zhao, Hua; Xia, Yuxian

    2007-11-01

    Glycoproteins play important roles in insect physiology. Infection with pathogen always results in the differential expression of some glycoproteins, which may be involved in host-pathogen interactions. In this report, differentially-expressed glycoproteins from the hemolymph of locusts infected with Metarhizium anisopliae were analyzed by two-dimensional electrophoresis (2-DE) and PDQuest software. The results showed that 13 spots were differentially expressed, of which nine spots were upregulated and four were downregulated. Using MS/MS with de novo sequencing and NCBI database searches, three upregulated proteins were identified as locust transferrin, apolipoprotein precursor, and hexameric storage protein 3. These proteins have been reported to be involved in the insect innate immune response to microbial challenge. Due to the limited available genome information and protein sequences of locusts, the possible functions of the other 10 differentially-expressed spots remain unknown.

  7. Transmission of Insect-Vectored Pathogens: Effects of Vector Fitness as a Function of Infectivity Status

    USDA-ARS?s Scientific Manuscript database

    The spread of insect vectored pathogens is dependent on the population dynamics of the vector. Epidemiology models typically assume that birth and death rates of pathogen-free and inoculative vectors are equal, an assumption which is not true for all pathosystems. Here a series of simple and gener...

  8. Production of destruxins from metarhizium spp. fungi in artificial medium and in endophytically colonized cowpea plants

    USDA-ARS?s Scientific Manuscript database

    Destruxins (DTXs) are cyclic depsipeptides produced by many Metarhizium isolates that have long been assumed to contribute to virulence of these entomopathogenic fungi. We evaluated the virulence of 20 Metarhizium isolates against insect larvae and measured the concentration of DTXs A, B, and E prod...

  9. Production of destruxins from Metarhizium spp. fungi in artificial medium and in endophytically colonized Cowpea Plants

    USDA-ARS?s Scientific Manuscript database

    Destruxins (DTXs) are cyclic depsipeptides produced by many Metarhizium isolates that have long been assumed to contribute to virulence of these entomopathogenic fungi. We evaluated the virulence of 20 Metarhizium isolates against insect larvae and measured the concentration of DTXs A, B, and E prod...

  10. Induced release of a plant-defense volatile 'deceptively' attracts insect vectors to plants infected with a bacterial pathogen

    USDA-ARS?s Scientific Manuscript database

    Transmission of plant pathogens by insect vectors is a complex biological process involving interactions between the plant, insect and pathogen. Pathogen-induced plant responses can include changes in volatile and nonvolatile secondary metabolites, as well as major plant nutrients. Experiments were ...

  11. An insect pathogenic symbiosis between a Caenorhabditis and Serratia

    PubMed Central

    Morrison, Julie; Cooper, Vaughn; Thomas, W. Kelley

    2011-01-01

    We described an association between a strain of the nematode Caenorhabditis briggsae, i.e. KT0001, and the bacteria Serratia sp. SCBI (South African Caenorhabditis briggsae isolate), which was able to kill the insect Galleria (G. mellonella). Here we show that the Serratia sp. SCBI lines the gut of the nematode, similar to the Heterorhabditis-Photorhabdus complex, indicating that the association is possibly internal. We also expand on the relevance of this tripartite, i.e. insect-nematode-bacteria, interaction in the broader evolutionary context and Caenorhabditis natural history. PMID:21389770

  12. Different Effects of Metarhizium anisopliae Strains IMI330189 and IBC200614 on Enzymes Activities and Hemocytes of Locusta migratoria L.

    PubMed Central

    Cao, Guangchun; Jia, Miao; Zhao, Xia; Wang, Lei; Tu, Xiongbing; Wang, Guangjun; Nong, Xiangqun; Zhang, Zehua

    2016-01-01

    Background Metarhizium is an important class of entomopathogenic fungi in the biocontrol of insects, but its virulence is affected by insect immunity. To clarify the mechanism in virulence of Metarhizium, we compared the immunological differences in Locusta migratoria L. when exposed to two strains of Metarhizium anisopliae (Ma). Results The virulence of Ma IMI330189 was significantly higher than that of Ma IBC200614 to locust, and IMI330189 overcame the hemocytes and began destroying the hemocytes of locust at 72 h after spray, while locust is immune to IBC200614. IMI330189 could overcome the humoral immunity of locust by inhibiting the activities of phenol oxidase (PO), esterases, multi-function oxidases (MFOs) and acetylcholinesterases in locust while increasing the activities of glutathione-S-transferases (GSTs), catalase and aryl-acylamidase (AA). However IBC200614 inhibit the activities of GSTs and AA in locust and increase the activities of MFOs, PO, superoxide dismutase, peroxidase and chitinase in locust. The changes of enzymes activities in period of infection showed that the time period between the 2nd and the 5th day after spray is critical in the pathogenic process. Conclusion These results found the phenomenon that Ma initiatively broke host hemocytes, revealed the correlation between the virulence of Ma and the changes of enzymes activities in host induced by Ma, and clarified the critical period in the infection of Ma. So, these results should provide guidance for the construction of efficient biocontrol Ma strains. PMID:27227835

  13. Microsporidia Biological Control Agents and Pathogens of Beneficial Insects

    USDA-ARS?s Scientific Manuscript database

    Microsporidian infections of insects are generally chronic, causing subtle pathologies of reduced fecundity and shorter lifespans. The lack of acute infections that cause rapid mortality, make microsporida ill-suited as biopesticides for arthropod control. Instead, they are considered to be more use...

  14. Diversity and role of cave-dwelling hematophagous insects in pathogen transmission in the Afrotropical region

    PubMed Central

    Obame-Nkoghe, Judicaël; Leroy, Eric-Maurice; Paupy, Christophe

    2017-01-01

    The progressive anthropization of caves for food resources or economic purposes increases human exposure to pathogens that naturally infect cave-dwelling animals. The presence of wild or domestic animals in the immediate surroundings of caves also may contribute to increasing the risk of emergence of such pathogens. Some zoonotic pathogens are transmitted through direct contact, but many others require arthropod vectors, such as blood-feeding insects. In Africa, hematophagous insects often play a key role in the epidemiology of many pathogens; however, their ecology in cave habitats remains poorly known. During the last decades, several investigations carried out in Afrotropical caves suggested the medical and veterinary importance particularly of insect taxa of the Diptera order. Therefore, the role of some of these insects as vectors of pathogens that infect cave-dwelling vertebrates has been studied. The present review summarizes these findings, brings insights into the diversity of cave-dwelling hematophagous Diptera and their involvement in pathogen transmission, and finally discusses new challenges and future research directions. PMID:28400590

  15. Diversity and role of cave-dwelling hematophagous insects in pathogen transmission in the Afrotropical region.

    PubMed

    Obame-Nkoghe, Judicaël; Leroy, Eric-Maurice; Paupy, Christophe

    2017-04-12

    The progressive anthropization of caves for food resources or economic purposes increases human exposure to pathogens that naturally infect cave-dwelling animals. The presence of wild or domestic animals in the immediate surroundings of caves also may contribute to increasing the risk of emergence of such pathogens. Some zoonotic pathogens are transmitted through direct contact, but many others require arthropod vectors, such as blood-feeding insects. In Africa, hematophagous insects often play a key role in the epidemiology of many pathogens; however, their ecology in cave habitats remains poorly known. During the last decades, several investigations carried out in Afrotropical caves suggested the medical and veterinary importance particularly of insect taxa of the Diptera order. Therefore, the role of some of these insects as vectors of pathogens that infect cave-dwelling vertebrates has been studied. The present review summarizes these findings, brings insights into the diversity of cave-dwelling hematophagous Diptera and their involvement in pathogen transmission, and finally discusses new challenges and future research directions.

  16. Gene-for-gene disease resistance: bridging insect pest and pathogen defense.

    PubMed

    Kaloshian, Isgouhi

    2004-12-01

    Active plant defense, also known as gene-for-gene resistance, is triggered when a plant resistance (R) gene recognizes the intrusion of a specific insect pest or pathogen. Activation of plant defense includes an array of physiological and transcriptional reprogramming. During the past decade, a large number of plant R genes that confer resistance to diverse group of pathogens have been cloned from a number of plant species. Based on predicted protein structures, these genes are classified into a small number of groups, indicating that structurally related R genes recognize phylogenetically distinct pathogens. An extreme example is the tomato Mi-1 gene, which confers resistance to potato aphid (Macrosiphum euphorbiae), whitefly (Bemisia tabaci), and root-knot nematodes (Meloidogyne spp.). While Mi-1 remains the only cloned insect R gene, there is evidence that gene-for-gene type of plant defense against piercing-sucking insects exists in a number of plant species.

  17. MALDI-TOF mass spectrometry applied to identifying species of insect-pathogenic fungi from the Metarhizium anisopliae complex

    USDA-ARS?s Scientific Manuscript database

    Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) has proven to be a powerful tool for taxonomic resolution of microorganisms. In this proof-of-concept study, we assessed the effectiveness of this technique to track the current gene sequence-based phylogenet...

  18. Responses of temperate forest productivity to insect and pathogen disturbances.

    PubMed

    Flower, Charles E; Gonzalez-Meler, Miquel A

    2015-01-01

    Pest and pathogen disturbances are ubiquitous across forest ecosystems, impacting their species composition, structure, and function. Whereas severe abiotic disturbances (e.g., clear-cutting and fire) largely reset successional trajectories, pest and pathogen disturbances cause diffuse mortality, driving forests into nonanalogous system states. Biotic perturbations that disrupt forest carbon dynamics either reduce or enhance net primary production (NPP) and carbon storage, depending on pathogen type. Relative to defoliators, wood borers and invasive pests have the largest negative impact on NPP and the longest recovery time. Forest diversity is an important contributing factor to productivity: NPP is neutral, marginally enhanced, or reduced in high-diversity stands in which a small portion of the canopy is affected (temperate deciduous or mixed forests) but very negative in low-diversity stands in which a large portion of the canopy is affected (western US forests). Pests and pathogens reduce forest structural and functional redundancy, affecting their resilience to future climate change or new outbreaks. Therefore, pests and pathogens can be considered biotic forcing agents capable of causing consequences of similar magnitude to climate forcing factors.

  19. Protein interaction networks at the host-microbe interface in Diaphorina citri, the insect vector of the citrus greening pathogen

    USDA-ARS?s Scientific Manuscript database

    The Asian citrus psyllid (Diaphorina citri) is the insect vector responsible for the worldwide spread of Candidatus Liberibacter asiaticus, the bacterial pathogen associated with citrus greening disease. Developmental changes in the insect vector impact pathogen transmission, such that D. citri tra...

  20. Coevolution between pathogen-derived proteinases and proteinase inhibitors of host insects.

    PubMed

    Vilcinskas, Andreas

    2010-01-01

    Virulence is thought to coevolve as a result of reciprocal selection between pathogens and their hosts. This paper focuses on coevolution between microbial proteinases operating as virulence factors and host defense molecules of insects. Owing to shorter generation times and smaller genomes, microbes exhibit a high evolutionary adaptability in comparison with their hosts. Indeed, the latter can only compete with pathogens if they evolve mechanisms providing a comparable genetic plasticity. Gene or domain duplication and shuffling by recombination is the driving force behind the countermeasures in host defense effectors. Recent literature provides evidence for both diversifications of fungal proteinases involved in pathogenesis and expansion host proteinase inhibitors subsets contributing to insect innate immunity. For example, the pathogen-associated spectrum of proteolytic enzymes encompasses thermolysin-like metalloproteinases that putatively promoted the evolution of corresponding host inhibitors of these virulence factors which complement the insect repertoire of antimicrobial defense molecules. Beyond mutual diversification of effector molecules coevolution resulted also in sophisticated molecular adaptations of host insects such as sensing and feedback-loop regulation of microbial metalloproteinases and corresponding countermeasures of pathogens providing evasion of host immunity induced by these virulence factors.

  1. Live plant imports: the major pathway for forest insect and pathogen invasions of the US

    Treesearch

    Andrew M. Liebhold; Eckehard G. Brockerhoff; Lynn J. Garrett; Jennifer L. Parke; Kerry O. Britton

    2012-01-01

    Trade in live plants has been recognized worldwide as an important invasion pathway for non-native plant pests. Such pests can have severe economic and ecological consequences. Nearly 70% of damaging forest insects and pathogens established in the US between 1860 and 2006 most likely entered on imported live plants. The current regulation of plant imports is outdated...

  2. Insect Outbreaks, Host-Pathogen Interactions, and Induced Plant Defenses

    DTIC Science & Technology

    2009-09-30

    field data, first by using a field experiment to show that, in the outbreaking North American gypsy moth , induced plant defenses affect pathogen... gypsy moth (Lymantria dispar), its baculovirus, and one of the gypsy moth’s main host trees in North America, the red oak, Quercus rubra17. A previous...red oaks increases hydrolyzable tannin concentrations20, an induced defense8 that strongly affects average gypsy - moth infection risk in the

  3. The genome sequence of the biocontrol fungus Metarhizium anisopliae and comparative genomics of Metarhizium species.

    PubMed

    Pattemore, Julie A; Hane, James K; Williams, Angela H; Wilson, Bree A L; Stodart, Ben J; Ash, Gavin J

    2014-08-07

    Metarhizium anisopliae is an important fungal biocontrol agent of insect pests of agricultural crops. Genomics can aid the successful commercialization of biopesticides by identification of key genes differentiating closely related species, selection of virulent microbial isolates which are amenable to industrial scale production and formulation and through the reduction of phenotypic variability. The genome of Metarhizium isolate ARSEF23 was recently published as a model for M. anisopliae, however phylogenetic analysis has since re-classified this isolate as M. robertsii. We present a new annotated genome sequence of M. anisopliae (isolate Ma69) and whole genome comparison to M. robertsii (ARSEF23) and M. acridum (CQMa 102). Whole genome analysis of M. anisopliae indicates significant macrosynteny with M. robertsii but with some large genomic inversions. In comparison to M. acridum, the genome of M. anisopliae shares lower sequence homology. While alignments overall are co-linear, the genome of M. acridum is not contiguous enough to conclusively observe macrosynteny. Mating type gene analysis revealed both MAT1-1 and MAT1-2 genes present in M. anisopliae suggesting putative homothallism, despite having no known teleomorph, in contrast with the putatively heterothallic M. acridum isolate CQMa 102 (MAT1-2) and M. robertsii isolate ARSEF23 (altered MAT1-1). Repetitive DNA and RIP analysis revealed M. acridum to have twice the repetitive content of the other two species and M. anisopliae to be five times more RIP affected than M. robertsii. We also present an initial bioinformatic survey of candidate pathogenicity genes in M. anisopliae. The annotated genome of M. anisopliae is an important resource for the identification of virulence genes specific to M. anisopliae and development of species- and strain- specific assays. New insight into the possibility of homothallism and RIP affectedness has important implications for the development of M. anisopliae as a

  4. Antibiotic-producing symbionts dynamically transition between plant pathogenicity and insect-defensive mutualism

    PubMed Central

    Flórez, Laura V.; Scherlach, Kirstin; Gaube, Paul; Ross, Claudia; Sitte, Elisabeth; Hermes, Cornelia; Rodrigues, Andre; Hertweck, Christian; Kaltenpoth, Martin

    2017-01-01

    Pathogenic and mutualistic bacteria associated with eukaryotic hosts often lack distinctive genomic features, suggesting regular transitions between these lifestyles. Here we present evidence supporting a dynamic transition from plant pathogenicity to insect-defensive mutualism in symbiotic Burkholderia gladioli bacteria. In a group of herbivorous beetles, these symbionts protect the vulnerable egg stage against detrimental microbes. The production of a blend of antibiotics by B. gladioli, including toxoflavin, caryoynencin and two new antimicrobial compounds, the macrolide lagriene and the isothiocyanate sinapigladioside, likely mediate this defensive role. In addition to vertical transmission, these insect symbionts can be exchanged via the host plant and retain the ability to initiate systemic plant infection at the expense of the plant's fitness. Our findings provide a paradigm for the transition between pathogenic and mutualistic lifestyles and shed light on the evolution and chemical ecology of this defensive mutualism. PMID:28452358

  5. Antibiotic-producing symbionts dynamically transition between plant pathogenicity and insect-defensive mutualism.

    PubMed

    Flórez, Laura V; Scherlach, Kirstin; Gaube, Paul; Ross, Claudia; Sitte, Elisabeth; Hermes, Cornelia; Rodrigues, Andre; Hertweck, Christian; Kaltenpoth, Martin

    2017-04-28

    Pathogenic and mutualistic bacteria associated with eukaryotic hosts often lack distinctive genomic features, suggesting regular transitions between these lifestyles. Here we present evidence supporting a dynamic transition from plant pathogenicity to insect-defensive mutualism in symbiotic Burkholderia gladioli bacteria. In a group of herbivorous beetles, these symbionts protect the vulnerable egg stage against detrimental microbes. The production of a blend of antibiotics by B. gladioli, including toxoflavin, caryoynencin and two new antimicrobial compounds, the macrolide lagriene and the isothiocyanate sinapigladioside, likely mediate this defensive role. In addition to vertical transmission, these insect symbionts can be exchanged via the host plant and retain the ability to initiate systemic plant infection at the expense of the plant's fitness. Our findings provide a paradigm for the transition between pathogenic and mutualistic lifestyles and shed light on the evolution and chemical ecology of this defensive mutualism.

  6. Insect-Borne Plant Pathogens and Their Vectors: Ecology, Evolution, and Complex Interactions.

    PubMed

    Eigenbrode, Sanford D; Bosque-Pérez, Nilsa; Davis, Thomas S

    2017-10-02

    The transmission of insect-borne plant pathogens, including viruses, bacteria, phytoplasmas, and fungi depends upon the abundance and behavior of their vectors. These pathogens should therefore be selected to influence their vectors to enhance their transmission, either indirectly, through the infected host plant, or directly, after acquisition of the pathogen by the vector. Accumulating evidence provides partial support for the occurrence of vector manipulation by plant pathogens, especially for plant viruses, for which a theoretical framework can explain patterns in the specific effects on vector behavior and performance depending on their modes of transmission. The variability in effects of pathogens on their vectors, however, suggests inconsistency in the occurrence of vector manipulation but also may reflect incomplete information about these systems. For example, manipulation can occur through combinations of specific effects, including direct and indirect effects on performance and behavior, and dynamics in those effects with disease progression or pathogen acquisition that together constitute syndromes that promote pathogen spread. Deciphering the prevalence and forms of vector manipulation by plant pathogens remains a compelling field of inquiry, but gaps and opportunities to advance it remain. A proposed research agenda includes examining vector manipulation syndromes comprehensively within pathosystems, expanding the taxonomic and genetic breadth of the systems studied, evaluating dynamic effects that occur during disease progression, incorporating the influence of biotic and abiotic environmental factors, evaluating the effectiveness of putative manipulation syndromes under field conditions, deciphering chemical and molecular mechanisms whereby pathogens can influence vectors, expanding the use of evolutionary and epidemiological models, and seeking opportunities to exploit these effects to improve management of insect-borne, economically important

  7. Ecological disequilibrium drives insect pest and pathogen accumulation in non-native trees

    PubMed Central

    Burgess, Treena I.; Le Roux, Johannes J.; Richardson, David M.; Slippers, Bernard; Wingfield, Michael J.

    2017-01-01

    Abstract Non-native trees have become dominant components of many landscapes, including urban ecosystems, commercial forestry plantations, fruit orchards and as invasives in natural ecosystems. Often, these trees have been separated from their natural enemies (i.e. insects and pathogens) leading to ecological disequilibrium, that is, the immediate breakdown of historically co-evolved interactions once introduced into novel environments. Long-established, non-native tree plantations provide useful experiments to explore the dimensions of such ecological disequilibria. We quantify the status quo of non-native insect pests and pathogens catching up with their tree hosts (planted Acacia, Eucalyptus and Pinus species) in South Africa, and examine which native South African enemy species utilize these trees as hosts. Interestingly, pines, with no confamilial relatives in South Africa and the longest residence time (almost two centuries), have acquired only one highly polyphagous native pathogen. This is in contrast to acacias and eucalypts, both with many native and confamilial relatives in South Africa that have acquired more native pathogens. These patterns support the known role of phylogenetic relatedness of non-native and native floras in influencing the likelihood of pathogen shifts between them. This relationship, however, does not seem to hold for native insects. Native insects appear far more likely to expand their feeding habits onto non-native tree hosts than are native pathogens, although they are generally less damaging. The ecological disequilibrium conditions of non-native trees are deeply rooted in the eco-evolutionary experience of the host plant, co-evolved natural enemies and native organisms from the introduced range. We should expect considerable spatial and temporal variation in ecological disequilibrium conditions among non-native taxa, which can be significantly influenced by biosecurity and management practices. PMID:28013250

  8. Ecological disequilibrium drives insect pest and pathogen accumulation in non-native trees.

    PubMed

    Crous, Casparus J; Burgess, Treena I; Le Roux, Johannes J; Richardson, David M; Slippers, Bernard; Wingfield, Michael J

    2016-12-23

    Non-native trees have become dominant components of many landscapes, including urban ecosystems, commercial forestry plantations, fruit orchards, and as invasives in natural ecosystems. Often, these trees have been separated from their natural enemies (i.e. insects and pathogens) leading to ecological disequilibrium, that is, the immediate breakdown of historically co-evolved interactions once introduced into novel environments. Long-established, non-native tree plantations provide useful experiments to explore the dimensions of such ecological disequilibria. We quantify the status quo of non-native insect pests and pathogens catching up with their tree hosts (planted Acacia, Eucalyptus and Pinus species) in South Africa, and examine which native South African enemy species utilise these trees as hosts. Interestingly, pines, with no confamilial relatives in South Africa and the longest residence time (almost two centuries), have acquired only one highly polyphagous native pathogen. This is in contrast to acacias and eucalypts, both with many native and confamilial relatives in South Africa that have acquired more native pathogens. These patterns support the known role of phylogenetic relatedness of non-native and native floras in influencing the likelihood of pathogen shifts between them. This relationship, however, does not seem to hold for native insects. Native insects appear far more likely to expand their feeding habits onto non-native tree hosts than are native pathogens, although they are generally less damaging. The ecological disequilibrium conditions of non-native trees are deeply rooted in the eco-evolutionary experience of the host plant, co-evolved natural enemies, and native organisms from the introduced range. We should expect considerable spatial and temporal variation in ecological disequilibrium conditions among non-native taxa, which can be significantly influenced by biosecurity and management practices. Published by Oxford University Press on

  9. Effect of Infection by Beauveria bassiana and Metarhizium anisopliae on the Feeding of Uvarovistia zebra

    PubMed Central

    Mohammadbeigi, A.; Port, G.

    2015-01-01

    To identify the susceptibility of long-horned grasshoppers to entomopathogenic fungi, the effect of infection with the fungi Beauveria bassiana (Balsamo) Vuillemin (Hypocreales: Clavicipitaceae) and Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae) on food consumption by Uvarovistia zebra (Uvarov) (Orthoptera: Tettigoniidae) was investigated. Preliminary results showed that both fungi had a negative effect on food consumption of the insects. For both fungi a significant reduction of food consumption and faeces production by insects were observed between the highest spore concentration (5 × 106 spores/ml) and other treatments. Compared with control insects, the insects treated with 5 × 106 spores/ml of B. bassiana and M. anisopliae showed 60 and 63% reduction in mean food consumption/insect, respectively. The corrected cumulative percent mortality of the insects treated with the highest concentration of B. bassiana and M. anisopliae were 57.7 and 55.5%, respectively. This was the first account of these entomopathogenic fungi being used against a species from this family, therefore based on the results obtained from this research, it could be said that the fungi have pathogenicity effect on U. zebra as a long-horned grasshopper.

  10. IDENTIFICATION OF ALLERGENS FROM METARHIZIUM ANISOPLIAE USING MASS SPECTROMETRY

    EPA Science Inventory

    Background
    The U.S. EPA, under the "Children at Risk" Program, is currently addressing the problem of indoor fungal bioaerosol contamination. The fungus Metarhizium Anisopliae has been used as a bio-pesticide for insect control since the 1800's. Recent studies have shown t...

  11. IDENTIFICATION OF ALLERGENS FROM METARHIZIUM ANISOPLIAE USING MASS SPECTROMETRY

    EPA Science Inventory

    Background
    The U.S. EPA, under the "Children at Risk" Program, is currently addressing the problem of indoor fungal bioaerosol contamination. The fungus Metarhizium Anisopliae has been used as a bio-pesticide for insect control since the 1800's. Recent studies have shown t...

  12. Virulence and Pathogen Multiplication: A Serial Passage Experiment in the Hypervirulent Bacterial Insect-Pathogen Xenorhabdus nematophila

    PubMed Central

    Chapuis, Élodie; Pagès, Sylvie; Emelianoff, Vanya; Givaudan, Alain; Ferdy, Jean-Baptiste

    2011-01-01

    The trade-off hypothesis proposes that the evolution of pathogens' virulence is shaped by a link between virulence and contagiousness. This link is often assumed to come from the fact that pathogens are contagious only if they can reach high parasitic load in the infected host. In this paper we present an experimental test of the hypothesis that selection on fast replication can affect virulence. In a serial passage experiment, we selected 80 lines of the bacterial insect-pathogen Xenorhabdus nematophila to multiply fast in an artificial culture medium. This selection resulted in shortened lag phase in our selected bacteria. We then injected these bacteria into insects and observed an increase in virulence. This could be taken as a sign that virulence in Xenorhabdus is linked to fast multiplication. But we found, among the selected lineages, either no link or a positive correlation between lag duration and virulence: the most virulent bacteria were the last to start multiplying. We then surveyed phenotypes that are under the control of the flhDC super regulon, which has been shown to be involved in Xenorhabdus virulence. We found that, in one treatment, the flhDC regulon has evolved rapidly, but that the changes we observed were not connected to virulence. All together, these results indicate that virulence is, in Xenorhabdus as in many other pathogens, a multifactorial trait. Being able to grow fast is one way to be virulent. But other ways exist which renders the evolution of virulence hard to predict. PMID:21305003

  13. Insect peptide metchnikowin confers on barley a selective capacity for resistance to fungal ascomycetes pathogens

    PubMed Central

    Rahnamaeian, Mohammad; Langen, Gregor; Imani, Jafargholi; Khalifa, Walaa; Altincicek, Boran; von Wettstein, Diter; Kogel, Karl-Heinz; Vilcinskas, Andreas

    2009-01-01

    The potential of metchnikowin, a 26-amino acid residue proline-rich antimicrobial peptide synthesized in the fat body of Drosophila melanogaster was explored to engineer disease resistance in barley against devastating fungal plant pathogens. The synthetic peptide caused strong in vitro growth inhibition (IC50 value ∼1 μM) of the pathogenic fungus Fusarium graminearum. Transgenic barley expressing the metchnikowin gene in its 52-amino acid pre-pro-peptide form under the control of the inducible mannopine synthase (mas) gene promoter from the Ti plasmid of Agrobacterium tumefaciens displayed enhanced resistance to powdery mildew as well as Fusarium head blight and root rot. In response to these pathogens, metchnikowin accumulated in plant apoplastic space, specifying that the insect signal peptide is functional in monocotyledons. In vitro and in vivo tests revealed that the peptide is markedly effective against fungal pathogens of the phylum Ascomycota but, clearly, less active against Basidiomycota fungi. Importantly, germination of the mutualistic basidiomycete mycorrhizal fungus Piriformospora indica was affected only at concentrations beyond 50 μM. These results suggest that antifungal peptides from insects are a valuable source for crop plant improvements and their differential activities toward different phyla of fungi denote a capacity for insect peptides to be used as selective measures on specific plant diseases. PMID:19734262

  14. O Antigen Modulates Insect Vector Acquisition of the Bacterial Plant Pathogen Xylella fastidiosa

    PubMed Central

    Rapicavoli, Jeannette N.; Kinsinger, Nichola; Perring, Thomas M.; Backus, Elaine A.; Shugart, Holly J.; Walker, Sharon

    2015-01-01

    Hemipteran insect vectors transmit the majority of plant pathogens. Acquisition of pathogenic bacteria by these piercing/sucking insects requires intimate associations between the bacterial cells and insect surfaces. Lipopolysaccharide (LPS) is the predominant macromolecule displayed on the cell surface of Gram-negative bacteria and thus mediates bacterial interactions with the environment and potential hosts. We hypothesized that bacterial cell surface properties mediated by LPS would be important in modulating vector-pathogen interactions required for acquisition of the bacterial plant pathogen Xylella fastidiosa, the causative agent of Pierce's disease of grapevines. Utilizing a mutant that produces truncated O antigen (the terminal portion of the LPS molecule), we present results that link this LPS structural alteration to a significant decrease in the attachment of X. fastidiosa to blue-green sharpshooter foreguts. Scanning electron microscopy confirmed that this defect in initial attachment compromised subsequent biofilm formation within vector foreguts, thus impairing pathogen acquisition. We also establish a relationship between O antigen truncation and significant changes in the physiochemical properties of the cell, which in turn affect the dynamics of X. fastidiosa adhesion to the vector foregut. Lastly, we couple measurements of the physiochemical properties of the cell with hydrodynamic fluid shear rates to produce a Comsol model that predicts primary areas of bacterial colonization within blue-green sharpshooter foreguts, and we present experimental data that support the model. These results demonstrate that, in addition to reported protein adhesin-ligand interactions, O antigen is crucial for vector-pathogen interactions, specifically in the acquisition of this destructive agricultural pathogen. PMID:26386068

  15. O antigen modulates insect vector acquisition of the bacterial plant pathogen Xylella fastidiosa.

    PubMed

    Rapicavoli, Jeannette N; Kinsinger, Nichola; Perring, Thomas M; Backus, Elaine A; Shugart, Holly J; Walker, Sharon; Roper, M Caroline

    2015-12-01

    Hemipteran insect vectors transmit the majority of plant pathogens. Acquisition of pathogenic bacteria by these piercing/sucking insects requires intimate associations between the bacterial cells and insect surfaces. Lipopolysaccharide (LPS) is the predominant macromolecule displayed on the cell surface of Gram-negative bacteria and thus mediates bacterial interactions with the environment and potential hosts. We hypothesized that bacterial cell surface properties mediated by LPS would be important in modulating vector-pathogen interactions required for acquisition of the bacterial plant pathogen Xylella fastidiosa, the causative agent of Pierce's disease of grapevines. Utilizing a mutant that produces truncated O antigen (the terminal portion of the LPS molecule), we present results that link this LPS structural alteration to a significant decrease in the attachment of X. fastidiosa to blue-green sharpshooter foreguts. Scanning electron microscopy confirmed that this defect in initial attachment compromised subsequent biofilm formation within vector foreguts, thus impairing pathogen acquisition. We also establish a relationship between O antigen truncation and significant changes in the physiochemical properties of the cell, which in turn affect the dynamics of X. fastidiosa adhesion to the vector foregut. Lastly, we couple measurements of the physiochemical properties of the cell with hydrodynamic fluid shear rates to produce a Comsol model that predicts primary areas of bacterial colonization within blue-green sharpshooter foreguts, and we present experimental data that support the model. These results demonstrate that, in addition to reported protein adhesin-ligand interactions, O antigen is crucial for vector-pathogen interactions, specifically in the acquisition of this destructive agricultural pathogen.

  16. Spread of plant pathogens and insect vectors at the northern range margin of cypress in Italy

    NASA Astrophysics Data System (ADS)

    Zocca, Alessia; Zanini, Corrado; Aimi, Andrea; Frigimelica, Gabriella; La Porta, Nicola; Battisti, Andrea

    2008-05-01

    The Mediterranean cypress ( Cupressus sempervirens) is a multi-purpose tree widely used in the Mediterranean region. An anthropogenic range expansion of cypress has taken place at the northern margin of the range in Italy in recent decades, driven by ornamental planting in spite of climatic constraints imposed by low winter temperature. The expansion has created new habitats for pathogens and pests, which strongly limit tree survival in the historical (core) part of the range. Based on the enemy release hypothesis, we predicted that damage should be lower in the expansion area. By comparing tree and seed cone damage by pathogens and pests in core and expansion areas of Trentino, a district in the southern Alps, we showed that tree damage was significantly higher in the core area. Seed cones of C. sempervirens are intensively colonized by an aggressive and specific pathogen (the canker fungus Seiridium cardinale, Coelomycetes), associated with seed insect vectors Megastigmus wachtli (Hymenoptera Torymidae) and Orsillus maculatus (Heteroptera Lygaeidae). In contrast, we observed lower tree damage in the expansion area, where a non-aggressive fungus ( Pestalotiopsis funerea, Coelomycetes) was more frequently associated with the same insect vectors. Our results indicate that both insect species have a great potential to reach the range margin, representing a continuous threat of the arrival of fungal pathogens to trees planted at extreme sites. Global warming may accelerate this process since both insects and fungi profit from increased temperature. In the future, cypress planted at the range margin may then face similar pest and pathogen threats as in the historical range.

  17. Invasive mutualisms between a plant pathogen and insect vectors in the Middle East and Brazil.

    PubMed

    Queiroz, Renan Batista; Donkersley, Philip; Silva, Fábio Nascimento; Al-Mahmmoli, Issa Hashil; Al-Sadi, Abdullah Mohammed; Carvalho, Claudine Márcia; Elliot, Simon L

    2016-12-01

    Complex multi-trophic interactions in vectorborne diseases limit our understanding and ability to predict outbreaks. Arthropod-vectored pathogens are especially problematic, with the potential for novel interspecific interactions during invasions. Variations and novelties in plant-arthropod-pathogen triumvirates present significant threats to global food security. We examined aspects of a phytoplasma pathogen of citrus across two continents. 'Candidatus Phytoplasma aurantifolia' causes Witches' Broom Disease of Lime (WBDL) and has devastated citrus production in the Middle East. A variant of this phytoplasma currently displays asymptomatic or 'silent' infections in Brazil. We first studied vector capacity and fitness impacts of the pathogen on its vectors. The potential for co-occurring weed species to act as pathogen reservoirs was analysed and key transmission periods in the year were also studied. We demonstrate that two invasive hemipteran insects-Diaphorina citri and Hishimonus phycitis-can vector the phytoplasma. Feeding on phytoplasma-infected hosts greatly increased reproduction of its invasive vector D. citri both in Oman and Brazil; suggesting that increased fitness of invasive insect vectors thereby further increases the pathogen's capacity to spread. Based on our findings, this is a robust system for studying the effects of invasions on vectorborne diseases and highlights concerns about its spread to warmer, drier regions of Brazil.

  18. MicroRNAs as mediators of insect host-pathogen interactions and immunity.

    PubMed

    Hussain, Mazhar; Asgari, Sassan

    2014-11-01

    Insects are the most successful group of animals on earth, owing this partly to their very effective immune responses to microbial invasion. These responses mainly include cellular and humoral responses as well as RNA interference (RNAi). Small non-coding RNAs (snRNAs) produced through RNAi are important molecules in the regulation of gene expression in almost all living organisms; contributing to important processes such as development, differentiation, immunity as well as host-microorganism interactions. The main snRNAs produced by the RNAi response include short interfering RNAs, microRNAs and piwi-interacting RNAs. In addition to the host snRNAs, some microorganisms encode snRNAs that affect the dynamics of host-pathogen interactions. In this review, we will discuss the latest developments in regards to the role of microRNA in insect host-pathogen interactions and provide some insights into this rapidly developing area of research.

  19. Potential nontarget effects of Metarhizium anisopliae (Deuteromycetes) used for biological control of ticks (Acari: Ixodidae)

    USGS Publications Warehouse

    Ginsberg, Howard S.; LeBrun, Roger A.; Heyer, Klaus; Zhioua, Elyes

    2002-01-01

    The potential for nontarget effects of the entomopathogenic fungus Metarhizium anisopliae (Metschnikoff) Sorokin, when used for biological control of ticks, was assessed in laboratory trials. Fungal pathogenicity was studied against convergent ladybird beetles, Hippodamia convergens Guérin-Méneville, house crickets, Acheta domesticus (L.), and the milkweed bugs Oncopeltus fasciatus (Dallas). Fungal spores applied with a spray tower produced significant mortality in H. convergens and A. domesticus, but effects on O. fasciatus were marginal. Placing treated insects with untreated individuals resulted in mortality from horizontal transmission to untreated beetles and crickets, but not milkweed bugs. Spread of fungal infection in the beetles resulted in mortality on days 4–10 after treatment, while in crickets mortality was on day 2 after treatment, suggesting different levels of pathogenicity and possibly different modes of transmission. Therefore, M. anisopliae varies in pathogenicity to different insects. Inundative applications can potentially affect nontarget species, but M. anisopliae is already widely distributed in North America, so applications for tick control generally would not introduce a novel pathogen into the environment. Pathogenicity in lab trials does not, by itself, demonstrate activity under natural conditions, so field trials are needed to confirm these results and to assess methods to minimize nontarget exposure.

  20. Mrt, a gene unique to fungi, encodes an oligosaccharide transporter and facilitates rhizosphere competency in Metarhizium robertsii.

    PubMed

    Fang, Weiguo; St Leger, Raymond J

    2010-11-01

    The symbiotic associations between rhizospheric fungi and plants have enormous environmental impact. Fungi are crucial to plant health as antagonists of pathogens and herbivores and facilitate the uptake of soil nutrients. However, little is known about the plant products obtained by fungi in exchange or how they are transported through the symbiotic interface. Here, we demonstrate that sucrose and raffinose family oligosaccharides in root exudates are important for rhizosphere competence in the insect pathogen Metarhizium robertsii (formerly known as Metarhizium anisopliae). We identified mutants in the Metarhizium raffinose transporter (Mrt) gene of M. robertsii that grew poorly in root exudate and were greatly reduced in rhizosphere competence on grass roots. Studies on sugar uptake, including competition assays, revealed that MRT was a sucrose and galactoside transporter. Disrupting MRT resulted in greatly reduced or no growth on sucrose and galactosides but did not affect growth on monosaccharides or oligosaccharides composed entirely of glucose subunits. Consistent with this, expression of Mrt is exclusively up-regulated by galactosides and sucrose. Expressing a green fluorescent protein gene under the control of the Mrt promoter confirmed that MRT was expressed by germlings in the vicinity of grass roots but not in surrounding bulk soil. Disrupting Mrt did not reduce virulence to insects, demonstrating that Mrt is exclusively involved in M. robertsii's interactions with plants. To our knowledge, MRT is the first oligosaccharide transporter identified and characterized in a fungus and is unique to filamentous fungi, but homologous genes in Magnaporthe, Ustilago, Aspergillus, Fusarium, Epichloe, and Penicillium species indicate that oligosaccharide transport is of widespread significance.

  1. Differential Adsorption of Occluded and Nonoccluded Insect-Pathogenic Viruses to Soil-Forming Minerals

    PubMed Central

    Christian, Peter D.; Richards, Andrew R.; Williams, Trevor

    2006-01-01

    Soil represents the principal environmental reservoir of many insect-pathogenic viruses. We compared the adsorption and infectivity of one occluded and two nonoccluded viruses, Helicoverpa armigera single nucleopolyhedrovirus (HaSNPV) (Baculoviridae), Cricket paralysis virus (CrPV) (Dicistroviridae), and Invertebrate iridescent virus 6 (IIV-6) (Iridoviridae), respectively, in mixtures with a selection of soil-forming minerals. The relative infective titers of HaSNPV and CrPV were unchanged or slightly reduced in the presence of different minerals compared to their titers in the absence of the mineral. In contrast, the infective titer of IIV-6 varied according to the mineral being tested. In adsorption studies, over 98% of HaSNPV occlusion bodies were adsorbed by all the minerals, and a particularly high affinity was observed with ferric oxide, attapulgite, and kaolinite. In contrast, the adsorption of CrPV and IIV-6 differed markedly with mineral type, with low affinity to bentonites and high affinity to ferric oxide and kaolinite. We conclude that interactions between soil-forming minerals and insect viruses appear to be most important in nucleopolyhedroviruses, followed by invertebrate iridescent viruses, and least important in CrPV, which may reflect the ecology of these pathogens. Moreover, soils with a high content of iron oxides or kaolinite would likely represent highly effective reservoirs for insect-pathogenic viruses. PMID:16820456

  2. Trade-offs shape the evolution of the vector-borne insect pathogen Xenorhabdus nematophila.

    PubMed

    Chapuis, Elodie; Arnal, Audrey; Ferdy, Jean-Baptiste

    2012-07-07

    Our current understanding on how pathogens evolve relies on the hypothesis that pathogens' transmission is traded off against host exploitation. In this study, we surveyed the possibility that trade-offs determine the evolution of the bacterial insect pathogen, Xenorhabdus nematophila. This bacterium rapidly kills the hosts it infects and is transmitted from host cadavers to new insects by a nematode vector, Steinernema carpocapsae. In order to detect trade-offs in this biological system, we produced 20 bacterial lineages using an experimental evolution protocol. These lineages differ, among other things, in their virulence towards the insect host. We found that nematode parasitic success increases with bacteria virulence, but their survival during dispersal decreases with the number of bacteria they carry. Other bacterial traits, such as production of the haemolytic protein XaxAB, have a strong impact on nematode reproduction. We then combined the result of our measurements with an estimate of bacteria fitness, which was divided into a parasitic component and a dispersal component. Contrary to what was expected in the trade-off hypothesis, we found no significant negative correlation between the two components of bacteria fitness. Still, we found that bacteria fitness is maximized when nematodes carry an intermediate number of cells. Our results therefore demonstrate the existence of a trade-off in X. nematophila, which is caused, in part, by the reduction in survival this bacterium causes to its nematode vectors.

  3. Bioassays for assessing jasmonate-dependent defenses triggered by pathogens, herbivorous insects, or beneficial rhizobacteria.

    PubMed

    Van Wees, Saskia C M; Van Pelt, Johan A; Bakker, Peter A H M; Pieterse, Corné M J

    2013-01-01

    Jasmonates, together with other plant hormones, are important orchestrators of the plant immune system. The different hormone-controlled signaling pathways cross-communicate in an antagonistic or a synergistic manner, providing the plant with a powerful capacity to finely regulate its immune response. Jasmonic acid (JA) signaling is required for plant resistance to harmful organisms, such as necrotrophic pathogens and herbivorous insects. Furthermore, JA signaling is essential in interactions of plants with beneficial microbes that induce systemic resistance to pathogens and insects. The role of JA signaling components in plant immunity can be studied by performing bioassays with different interacting organisms. Determination of the level of resistance and the induction of defense responses in plants with altered JA components, through mutation or ectopic expression, will unveil novel mechanisms of JA signaling. We provide detailed protocols of bioassays with the model plant Arabidopsis thaliana challenged with the pathogens Botrytis cinerea and Pseudomonas syringae, the insect herbivore Pieris rapae, and the beneficial microbe Pseudomonas fluorescens. In addition, we describe pharmacological assays to study the modulation of JA-regulated responses by exogenous application of combinations of hormones, because a simultaneous rise in hormone levels occurs during interaction of plants with other organisms.

  4. Risk and pathway assessment for the introduction of exotic insects and pathogens that could affect Hawai'i's native forests

    Treesearch

    Gregg A. DeNitto; Philip Cannon; Andris Eglitis; Jessie A. Glaeser; Helen Maffei; Sheri. Smith

    2015-01-01

    The unmitigated risk potential of the introduction of exotic insects and pathogens to Hawai'i was evaluated for its impact on native plants, specifically Acacia koa, Cibotium spp., Dicranopteris linearis, Diospyros sandwicensis, Dodonaea viscosa, ...

  5. The sudden emergence of pathogenicity in insect-fungus symbioses threatens naive forest ecosystems.

    PubMed

    Hulcr, Jiri; Dunn, Robert R

    2011-10-07

    Invasive symbioses between wood-boring insects and fungi are emerging as a new and currently uncontrollable threat to forest ecosystems, as well as fruit and timber industries throughout the world. The bark and ambrosia beetles (Curculionidae: Scolytinae and Platypodinae) constitute the large majority of these pests, and are accompanied by a diverse community of fungal symbionts. Increasingly, some invasive symbioses are shifting from non-pathogenic saprotrophy in native ranges to a prolific tree-killing in invaded ranges, and are causing significant damage. In this paper, we review the current understanding of invasive insect-fungus symbioses. We then ask why some symbioses that evolved as non-pathogenic saprotrophs, turn into major tree-killers in non-native regions. We argue that a purely pathology-centred view of the guild is not sufficient for explaining the lethal encounters between exotic symbionts and naive trees. Instead, we propose several testable hypotheses that, if correct, lead to the conclusion that the sudden emergence of pathogenicity is a new evolutionary phenomenon with global biogeographical dynamics. To date, evidence suggests that virulence of the symbioses in invaded ranges is often triggered when several factors coincide: (i) invasion into territories with naive trees, (ii) the ability of the fungus to either overcome resistance of the naive host or trigger a suicidal over-reaction, and (iii) an 'olfactory mismatch' in the insect whereby a subset of live trees is perceived as dead and suitable for colonization. We suggest that individual cases of tree mortality caused by invasive insect-fungus symbionts should no longer be studied separately, but in a global, biogeographically and phylogenetically explicit comparative framework.

  6. An amoeba phagocytosis model reveals a novel developmental switch in the insect pathogen Bacillus thuringiensis.

    PubMed

    Beeton, M L; Atkinson, D J; Waterfield, N R

    2013-02-01

    The Bacillus cereus group bacteria contain pathogens of economic and medical importance. From security and health perspectives, the lethal mammalian pathogen Bacillus anthracis remains a serious threat. In addition the potent insect pathogen Bacillus thuringiensis is extensively used as a biological control agent for insect pests. This relies upon the industrial scale induction of bacterial spore formation with the associated production of orally toxic Cry-toxins. Understanding the ecology and potential alternative developmental fates of these bacteria is therefore important. Here we describe the use of an amoeba host model to investigate the influence of environmental bactivorous protists on both spores and vegetative cells of these pathogens. We demonstrate that the bacteria can respond to different densities of amoeba by adopting different behaviours and developmental fates. We show that spores will germinate in response to factors excreted by the amoeba, and that the bacteria can grow and reproduce on these factors. We show that in low densities of amoeba, that the bacteria will seek to colonise the surface of the amoeba as micro-colonies, resisting phagocytosis. At high amoeba densities, the bacteria change morphology into long filaments and macroscopic rope-like structures which cannot be ingested due to size exclusion. We suggest these developmental fates are likely to be important both in the ecology of these bacteria and also during animal host colonisation and immune evasion.

  7. Invasive mutualisms between a plant pathogen and insect vectors in the Middle East and Brazil

    PubMed Central

    Queiroz, Renan Batista; Silva, Fábio Nascimento; Al-Mahmmoli, Issa Hashil; Al-Sadi, Abdullah Mohammed; Carvalho, Claudine Márcia; Elliot, Simon L.

    2016-01-01

    Complex multi-trophic interactions in vectorborne diseases limit our understanding and ability to predict outbreaks. Arthropod-vectored pathogens are especially problematic, with the potential for novel interspecific interactions during invasions. Variations and novelties in plant–arthropod–pathogen triumvirates present significant threats to global food security. We examined aspects of a phytoplasma pathogen of citrus across two continents. ‘Candidatus Phytoplasma aurantifolia’ causes Witches' Broom Disease of Lime (WBDL) and has devastated citrus production in the Middle East. A variant of this phytoplasma currently displays asymptomatic or ‘silent’ infections in Brazil. We first studied vector capacity and fitness impacts of the pathogen on its vectors. The potential for co-occurring weed species to act as pathogen reservoirs was analysed and key transmission periods in the year were also studied. We demonstrate that two invasive hemipteran insects—Diaphorina citri and Hishimonus phycitis—can vector the phytoplasma. Feeding on phytoplasma-infected hosts greatly increased reproduction of its invasive vector D. citri both in Oman and Brazil; suggesting that increased fitness of invasive insect vectors thereby further increases the pathogen's capacity to spread. Based on our findings, this is a robust system for studying the effects of invasions on vectorborne diseases and highlights concerns about its spread to warmer, drier regions of Brazil. PMID:28083099

  8. Stress tolerance and virulence of insect-pathogenic fungi are determined by environmental conditions during conidial formation.

    PubMed

    Rangel, Drauzio E N; Braga, Gilberto U L; Fernandes, Éverton K K; Keyser, Chad A; Hallsworth, John E; Roberts, Donald W

    2015-08-01

    The virulence to insects and tolerance to heat and UV-B radiation of conidia of entomopathogenic fungi are greatly influenced by physical, chemical, and nutritional conditions during mycelial growth. This is evidenced, for example, by the stress phenotypes of Metarhizium robertsii produced on various substrates. Conidia from minimal medium (Czapek's medium without sucrose), complex medium, and insect (Lepidoptera and Coleoptera) cadavers had high, moderate, and poor tolerance to UV-B radiation, respectively. Furthermore, conidia from minimal medium germinated faster and had increased heat tolerance and were more virulent to insects than those from complex medium. Low water-activity or alkaline culture conditions also resulted in production of conidia with high tolerance to heat or UV-B radiation. Conidia produced on complex media exhibited lower stress tolerance, whereas those from complex media supplemented with NaCl or KCl (to reduce water activity) were more tolerant to heat and UV-B than those from the unmodified complex medium. Osmotic and nutritive stresses resulted in production of conidia with a robust stress phenotype, but also were associated with low conidial yield. Physical conditions such as growth under illumination, hypoxic conditions, and heat shock before conidial production also induced both higher UV-B and heat tolerance; but conidial production was not decreased. In conclusion, physical and chemical parameters, as well as nutrition source, can induce great variability in conidial tolerance to stress for entomopathogenic fungi. Implications are discussed in relation to the ecology of entomopathogenic fungi in the field, and to their use for biological control. This review will cover recent technologies on improving stress tolerance of entomopathogenic fungi for biological control of insects.

  9. Agrobacterium-Mediated Co-transformation of Multiple Genes in Metarhizium robertsii

    PubMed Central

    Bidochka, Michael J.

    2017-01-01

    Fungi of the Metarhizium genus are a very versatile model for understanding pathogenicity in insects and their symbiotic relationship with plants. To establish a co-transformation system for the transformation of multiple M. robertsii genes using Agrobacterium tumefaciens, we evaluated whether the antibiotic nourseothricin has the same marker selection efficiency as phosphinothricin using separate vectors. Subsequently, in the two vectors containing the nourseothricin and phosphinothricin resistance cassettes were inserted eGFP and mCherry expression cassettes, respectively. These new vectors were then introduced independently into A. tumefaciens and used to transform M. robertsii either in independent events or in one single co-transformation event using an equimolar mixture of A. tumefaciens cultures. The number of transformants obtained by co-transformation was similar to that obtained by the individual transformation events. This method provides an additional strategy for the simultaneous insertion of multiple genes into M. robertsii. PMID:28781540

  10. Genes, enzymes and chemicals of terpenoid diversity in the constitutive and induced defence of conifers against insects and pathogens.

    PubMed

    Keeling, Christopher I; Bohlmann, Jörg

    2006-01-01

    Insects select their hosts, but trees cannot select which herbivores will feed upon them. Thus, as long-lived stationary organisms, conifers must resist the onslaught of varying and multiple attackers over their lifetime. Arguably, the greatest threats to conifers are herbivorous insects and their associated pathogens. Insects such as bark beetles, stem- and wood-boring insects, shoot-feeding weevils, and foliage-feeding budworms and sawflies are among the most devastating pests of conifer forests. Conifer trees produce a great diversity of compounds, such as an enormous array of terpenoids and phenolics, that may impart resistance to a variety of herbivores and microorganisms. Insects have evolved to specialize in resistance to these chemicals -- choosing, feeding upon, and colonizing hosts they perceive to be best suited to reproduction. This review focuses on the plant-insect interactions mediated by conifer-produced terpenoids. To understand the role of terpenoids in conifer-insect interactions, we must understand how conifers produce the wide diversity of terpenoids, as well as understand how these specific compounds affect insect behaviour and physiology. This review examines what chemicals are produced, the genes and proteins involved in their biosynthesis, how they work, and how they are regulated. It also examines how insects and their associated pathogens interact with, elicit, and are affected by conifer-produced terpenoids.

  11. Vector-Borne Bacterial Plant Pathogens: Interactions with Hemipteran Insects and Plants.

    PubMed

    Perilla-Henao, Laura M; Casteel, Clare L

    2016-01-01

    Hemipteran insects are devastating pests of crops due to their wide host range, rapid reproduction, and ability to transmit numerous plant-infecting pathogens as vectors. While the field of plant-virus-vector interactions has flourished in recent years, plant-bacteria-vector interactions remain poorly understood. Leafhoppers and psyllids are by far the most important vectors of bacterial pathogens, yet there are still significant gaps in our understanding of their feeding behavior, salivary secretions, and plant responses as compared to important viral vectors, such as whiteflies and aphids. Even with an incomplete understanding of plant-bacteria-vector interactions, some common themes have emerged: (1) all known vector-borne bacteria share the ability to propagate in the plant and insect host; (2) particular hemipteran families appear to be incapable of transmitting vector-borne bacteria; (3) all known vector-borne bacteria have highly reduced genomes and coding capacity, resulting in host-dependence; and (4) vector-borne bacteria encode proteins that are essential for colonization of specific hosts, though only a few types of proteins have been investigated. Here, we review the current knowledge on important vector-borne bacterial pathogens, including Xylella fastidiosa, Spiroplasma spp., Liberibacter spp., and 'Candidatus Phytoplasma spp.'. We then highlight recent approaches used in the study of vector-borne bacteria. Finally, we discuss the application of this knowledge for control and future directions that will need to be addressed in the field of vector-plant-bacteria interactions.

  12. Vector-Borne Bacterial Plant Pathogens: Interactions with Hemipteran Insects and Plants

    PubMed Central

    Perilla-Henao, Laura M.; Casteel, Clare L.

    2016-01-01

    Hemipteran insects are devastating pests of crops due to their wide host range, rapid reproduction, and ability to transmit numerous plant-infecting pathogens as vectors. While the field of plant–virus–vector interactions has flourished in recent years, plant–bacteria–vector interactions remain poorly understood. Leafhoppers and psyllids are by far the most important vectors of bacterial pathogens, yet there are still significant gaps in our understanding of their feeding behavior, salivary secretions, and plant responses as compared to important viral vectors, such as whiteflies and aphids. Even with an incomplete understanding of plant–bacteria–vector interactions, some common themes have emerged: (1) all known vector-borne bacteria share the ability to propagate in the plant and insect host; (2) particular hemipteran families appear to be incapable of transmitting vector-borne bacteria; (3) all known vector-borne bacteria have highly reduced genomes and coding capacity, resulting in host-dependence; and (4) vector-borne bacteria encode proteins that are essential for colonization of specific hosts, though only a few types of proteins have been investigated. Here, we review the current knowledge on important vector-borne bacterial pathogens, including Xylella fastidiosa, Spiroplasma spp., Liberibacter spp., and ‘Candidatus Phytoplasma spp.’. We then highlight recent approaches used in the study of vector-borne bacteria. Finally, we discuss the application of this knowledge for control and future directions that will need to be addressed in the field of vector–plant–bacteria interactions. PMID:27555855

  13. Molecular genetics of secondary chemistry in Metarhizium fungi

    USDA-ARS?s Scientific Manuscript database

    As with many microbes, entomopathogenic fungi from the genus Metarhizium produce a plethora of small molecule metabolites, often referred to as secondary metabolites. Although these intriguing compounds are a conspicuous feature of the biology of the producing fungi, their roles in pathogenicity and...

  14. A Metalloprotease Secreted by the Insect Pathogen Photorhabdus luminescens Induces Melanization▿

    PubMed Central

    Held, Kiara G.; LaRock, Christopher N.; D'Argenio, David A.; Berg, Celeste A.; Collins, Carleen M.

    2007-01-01

    Photorhabdus luminescens is a gram-negative insect pathogen that enters the hemocoel of infected hosts and produces a number of secreted proteins that promote colonization and subsequent death of the insect. In initial studies to determine the exact role of individual secreted proteins in insect pathogenesis, concentrated culture supernatants from various P. luminescens strains were injected into the tobacco hornworm Manduca sexta. Culture supernatants from P. luminescens TT01, the genome-sequenced strain, stimulated a rapid melanization reaction in M. sexta. Comparison of the profiles of secreted proteins from the various Photorhabdus strains revealed a single protein of approximately 37 kDa that was significantly overrepresented in the TT01 culture supernatant. This protein was purified by DEAE ion-exchange and Superdex 75 gel filtration chromatography and identified by matrix-assisted laser desorption ionization-time of flight analysis as the product of the TT01 gene plu1382 (NCBI accession number NC_005126); we refer to it here as PrtS. PrtS is a member of the M4 metalloprotease family. Injection of PrtS into larvae of M. sexta and Galleria mellonella and into adult Drosophila melanogaster and D. melanogaster melanization mutants (Bc) confirmed that the purified protein induced the melanization reaction. The prtS gene was transcribed by P. luminescens injected into M. sexta before death of the insect, suggesting that the protein was produced during infection. The exact function of this protease during infection is not clear. The bacteria might survive inside the insect despite the melanization process, or it might be that the bacterium is specifically activating melanization in an attempt to circumvent this innate immune response. PMID:17933944

  15. MrSkn7 Controls Sporulation, Cell Wall Integrity, Autolysis, and Virulence in Metarhizium robertsii

    PubMed Central

    Shang, Yanfang; Chen, Peilin; Chen, Yixiong; Lu, Yuzhen

    2015-01-01

    Two-component signaling pathways generally include sensor histidine kinases and response regulators. We identified an ortholog of the response regulator protein Skn7 in the insect-pathogenic fungus Metarhizium robertsii, which we named MrSkn7. Gene deletion assays and functional characterizations indicated that MrSkn7 functions as a transcription factor. The MrSkn7 null mutant of M. robertsii lost the ability to sporulate and had defects in cell wall biosynthesis but was not sensitive to oxidative and osmotic stresses compared to the wild type. However, the mutant was able to produce spores under salt stress. Insect bioassays using these spores showed that the virulence of the mutant was significantly impaired compared to that of the wild type due to the failures to form the infection structure appressorium and evade host immunity. In particular, deletion of MrSkn7 triggered cell autolysis with typical features such as cell vacuolization, downregulation of repressor genes, and upregulation of autolysis-related genes such as extracellular chitinases and proteases. Promoter binding assays confirmed that MrSkn7 could directly or indirectly control different putative target genes. Taken together, the results of this study help us understand the functional divergence of Skn7 orthologs as well as the mechanisms underlying the development and control of virulence in insect-pathogenic fungi. PMID:25710964

  16. Molecular diversity of the entomopathogenic fungal Metarhizium community within an agroecosystem.

    PubMed

    Steinwender, Bernhardt M; Enkerli, Jürg; Widmer, Franco; Eilenberg, Jørgen; Thorup-Kristensen, Kristian; Meyling, Nicolai V

    2014-11-01

    The entomopathogenic fungal Metarhizium anisopliae lineage harbors cryptic diversity and was recently split into several species. Metarhizium spp. are frequently isolated from soil environments, but the abundance and distribution of the separate species in local communities is still largely unknown. Entomopathogenic isolates of Metarhizium spp. were obtained from 32 bulked soil samples of a single agroecosystem in Denmark using Tenebrio molitor as bait insect. To assess the Metarhizium community in soil from the agricultural field and surrounding hedgerow, 123 isolates were identified by sequence analysis of 5' end of elongation factor 1-α and their genotypic diversity characterized by multilocus simple sequence repeat (SSR) typing. Metarhizium brunneum was most frequent (78.8%) followed by M. robertsii (14.6%), while M. majus and M. flavoviride were infrequent (3.3% each) revealing co-occurrence of at least four Metarhizium species in the soil of the same agroecosystem. Based on SSR fragment length analysis five genotypes of M. brunneum and six genotypes of M. robertsii were identified among the isolates. A single genotype within M. brunneum predominated (72.3% of all genotypes) while the remaining genotypes of M. brunneum and M. robertsii were found at low frequencies throughout the investigated area indicating a diverse Metarhizium community. The results may indicate potentially favorable adaptations of the predominant M. brunneum genotype to the agricultural soil environment. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. Insect-plant-pathogen interactions as shaped by future climate: effects on biology, distribution and implications for agriculture.

    PubMed

    Trębicki, Piotr; Dáder, Beatriz; Vassiliadis, Simone; Fereres, Alberto

    2017-08-26

    Carbon dioxide (CO2 ) is the main anthropogenic gas which has drastically increased since the industrial revolution, and current concentrations are projected to double by the end of this century. As a consequence, elevated CO2 is expected to alter the earths' climate, increase global temperatures and change weather patterns. This is likely to have both direct and indirect impacts on plants, insect pests, plant pathogens and their distribution, and is therefore problematic for the security of future food production. This review summarises the latest findings and highlights current knowledge gaps regarding the influence of climate change on insect, plant and pathogen interactions with an emphasis on agriculture and food production. Direct effects of climate change, including increased CO2 concentration, temperature, patterns of rainfall and severe weather events that impact insects (namely vectors of plant pathogens) are discussed. Elevated CO2 and temperature, together with plant pathogen infection, can considerably change plant biochemistry and therefore plant defence responses. This can have substantial consequences on insect fecundity, feeding rates, survival, population size, and dispersal. Generally, changes in host plant quality due to elevated CO2 (e.g., carbon to nitrogen ratios in C3 plants) negatively affect insect pests. However, compensatory feeding, increased population size and distribution have also been reported for some agricultural insect pests. This underlines the importance of additional research on more targeted, individual insect-plant scenarios at specific locations to fully understand the impact of a changing climate on insect-plant-pathogen interactions. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  18. Genetic basis of destruxin production in the entomopathogen Metarhizium robertsii.

    PubMed

    Giuliano Garisto Donzelli, Bruno; Krasnoff, Stuart B; Moon, Yong-Sun; Sun-Moon, Yong; Churchill, Alice C L; Gibson, Donna M

    2012-04-01

    Destruxins are among the most exhaustively researched secondary metabolites of entomopathogenic fungi, yet definitive evidence for their roles in pathogenicity and virulence has yet to be shown. To establish the genetic bases for the biosynthesis of this family of depsipeptides, we identified a 23,792-bp gene in Metarhizium robertsii ARSEF 2575 containing six complete nonribosomal peptide synthetase modules, with an N-methyltransferase domain in each of the last two modules. This domain arrangement is consistent with the positioning of the adjacent amino acids N-methyl-L: -valine and N-methyl-L: -alanine within the depsipeptide structure of destruxin. DXS expression levels in vitro and in vivo exhibited comparable patterns, beginning at low levels during the early growth phases and increasing with time. Targeted gene knockout using Agrobacterium-mediated transformation produced mutants that failed to synthesize destruxins, in comparison with wild type and ectopic control strains, indicating the involvement of this gene in destruxin biosynthesis. The destruxin synthetase (DXS) disruption mutant was as virulent as the control strain when conidial inoculum was topically applied to larvae of Spodoptera exigua, Galleria mellonella, and Tenebrio molitor indicating that destruxins are dispensable for virulence in these insect hosts. The DXS mutants exhibited no other detectable changes in morphology and development.

  19. Climate change triggers effects of fungal pathogens and insect herbivores on litter decomposition

    NASA Astrophysics Data System (ADS)

    Butenschoen, Olaf; Scheu, Stefan

    2014-10-01

    Increasing infestation by insect herbivores and pathogenic fungi in response to climate change will inevitably impact the amount and quality of leaf litter inputs into the soil. However, little is known on the interactive effect of infestation severity and climate change on litter decomposition, and no such study has been published for deciduous forests in Central Europe. We assessed changes in initial chemical quality of beech (Fagus sylvatica L.) and maple litter (Acer platanoides L.) in response to infestation by the gall midge Mikiola fagi Hart. and the pathogenic fungus Sawadaea tulasnei Fuckel, respectively, and investigated interactive effects of infestation severity, changes in temperature and soil moisture on carbon mineralization in a short-term laboratory study. We found that infestation by the gall midge M. fagi and the pathogenic fungus S. tulasnei significantly changed the chemical quality of beech and maple litter. Changes in element concentrations were generally positive and more pronounced, and if negative less pronounced for maple than beech litter most likely due to high quality fungal tissue remaining on litter after abscission. More importantly, alterations in litter chemical quality did not translate to distinct patterns of carbon mineralization at ambient conditions, but even low amounts of infested litter accelerated carbon mineralization at moderately increased soil moisture and in particular at higher temperature. Our results indicate that insect herbivores and fungal pathogens can markedly alter initial litter chemical quality, but that afterlife effects on carbon mineralization depend on soil moisture and temperature, suggesting that increased infestation severity under projected climate change potentially increases soil carbon release in deciduous forests in Central Europe.

  20. Dissection of the contributions of cyclophilin genes to development and virulence in a fungal insect pathogen.

    PubMed

    Zhou, Yonghong; Keyhani, Nemat O; Zhang, Yongjun; Luo, Zhibing; Fan, Yanhua; Li, Yujie; Zhou, Qiaosheng; Chen, Jianjun; Pei, Yan

    2016-11-01

    Cyclophilins are ubiquitous proteins found in all domains of life, catalyzing peptidyl-prolyl cis-trans isomerization (PPIase activity) and functioning in diverse cellular processes. The filamentous insect pathogenic fungus, Beauveria bassiana, contains 11 cyclophilin genes whose roles were probed via individual gene knockouts, construction of over-expression strains, and a simultaneous gene knockdown strategy using tandem SiRNA. Mutants were examined for effects on conidiation, hyphal growth, cyclosporine and stress resistance, and insect virulence. BbCypA was found to be the most highly expressed cyclophilin during growth and purified recombinant BbCypA displayed cyclosporine sensitive PPIase activity. Except for ΔBbCypA, targeted gene knockouts or overexpression of any cyclophilin resulted in temperature sensitivity (TS). Specific cyclophilin mutants showed impaired hyphal growth and differential effects on conidiation and cyclosporine resistance. Insect bioassays revealed decreased virulence for two cyclophilins (ΔBbCypE and ΔBbCyp6) and the simultaneous gene knockdown mutant constructs (SiRNA30). The BbSiRNA30 strains were unaffected in growth, conidiation, or under osmotic or cell wall perturbing stress, but did show increased resistance to cyclosporine and a TS phenotype. These results revealed common and unique roles for cyclophilins in B. bassiana and validate a method for examining the effects of multi-gene families via simultaneous gene knockdown. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  1. Field trials using the fungal pathogen, Metarhizium anisopliae (Deuteromycetes: Hyphomycetes) to control the ectoparasitic mite, Varroa destructor (Acari: Varroidae) in honey bee, Apis mellifera (Hymenoptera: Apidae) colonies.

    PubMed

    Kanga, Lambert Houssou Ble; Jones, Walker A; James, Rosalind R

    2003-08-01

    The potential for Metarhizium anisopliae (Metschinkoff) to control the parasitic mite, Varroa destructor (Anderson and Trueman) in honey bee colonies was evaluated in field trials against the miticide, tau-fluvalinate (Apistan). Peak mortality of V. destructor occurred 3-4 d after the conidia were applied; however, the mites were still infected 42 d posttreatments. Two application methods were tested: dusts and strips coated with the fungal conidia, and both methods resulted in successful control of mite populations. The fungal treatments were as effective as the Apistan, at the end of the 42-d period of the experiment. The data suggested that optimum mite control could be achieved when no brood is being produced, or when brood production is low, such as in the early spring or late fall. M. anisopliae was harmless to the honey bees (adult bees, or brood) and colony development was not affected. Mite mortality was highly correlated with mycosis in dead mites collected from sticky traps, indicating that the fungus was infecting and killing the mites. Because workers and drones drift between hives, the adult bees were able to spread the fungus between honey bee colonies in the apiary, a situation that could be beneficial to beekeepers.

  2. Hydroxyproline-rich glycopeptide signals in potato elicit signalling associated with defense against insects and pathogens.

    PubMed

    Bhattacharya, Ramcharan; Koramutla, Murali Krishna; Negi, Manisha; Pearce, Gregory; Ryan, Clarence A

    2013-06-01

    HypSys peptides are 18-20 amino acids glycopeptide defense signal first discovered in tobacco and tomato that activate expression of defensive genes against insect-herbivores. Discovery of their orthologs in other Solanaceaous and nonsolanaceous plants demonstrated their possible ubiquitous nature and species specific functional diversity. In our continued search to establish the paradigm of defense signalling by HypSys peptides, we isolated a cDNA from potato leaves encoding putative analogs of tomato HypSys peptides flanked by conserved proteolytic cleavage sites. The gene encoding the cDNA was a member of a gene family in the tetraploid genome of potato and its expression was transcriptionally activated by wounding and methyl jasmonate. The deduced precursor protein contained a leader peptidase splice site and three putative HypSys peptides with conserved N- and C-termini along with central proline-rich motifs. In defense signalling, the three HypSys peptides elicit H₂O₂ generation in vivo and activate several antioxidant defensive enzymes in young potato leaves. Similar to potato systemin, the HypSys peptides activate the expression of octadecanoid pathway genes and protease inhibitors for insect defense. In addition, the HypSys peptides also activate the essential genes of the innate pathogen defense response in young potato leaves, acting as common elicitors of signalling associated with anti-herbivore and anti-pathogen defense in potato.

  3. Saprolegnia strains isolated from river insects and amphipods are broad spectrum pathogens.

    PubMed

    Sarowar, Mohammad Nasif; van den Berg, Albert Hendrik; McLaggan, Debbie; Young, Mark R; van West, Pieter

    2013-01-01

    Saprolegnia species are destructive pathogens to many aquatic organisms and are found in most parts of the world. Reports based on phylogenetic analysis suggest that Saprolegnia strains isolated from aquatic animals such as crustaceans and frogs are close to Saprolegnia strains isolated from infected fish or fish eggs and vice versa. However, it has often been assumed that host specificity occurs for each individual isolate or strain. Here we demonstrate that Saprolegnia spp. can have multiple hosts and are thus capable of infecting different aquatic organisms. Saprolegnia delica, Saprolegnia hypogyna, and 2 strains of Saprolegnia diclina were isolated from aquatic insects and amphipods while S. delica, Saprolegnia ferax, Pythium pachycaule, and a Pythium sp. were isolated from the water of a medium to fast flowing river. The ITS region of the rRNA gene was sequenced for all isolates. In challenge experiments, all four isolates from insects were found to be highly pathogenic to eggs of Atlantic salmon (Salmo salar) and embryos of the African clawed frog (Xenopus laevis). We found that Saprolegnia spp. isolated from salmon eggs were also able to successfully establish infection in nymphs of stonefly (Perla bipunctata) and embryos of X. laevis). These results suggest that Saprolegnia spp. are capable of infecting multiple hosts, which may give them an advantage during seasonal variation in their natural environments. Copyright © 2013. Published by Elsevier Ltd.

  4. Reprint of: Saprolegnia strains isolated from river insects and amphipods are broad spectrum pathogens.

    PubMed

    Sarowar, Mohammad Nasif; van den Berg, Albert Hendrik; McLaggan, Debbie; Young, Mark R; van West, Pieter

    2014-07-01

    Saprolegnia species are destructive pathogens to many aquatic organisms and are found in most parts of the world. Reports based on phylogenetic analysis suggest that Saprolegnia strains isolated from aquatic animals such as crustaceans and frogs are close to Saprolegnia strains isolated from infected fish or fish eggs and vice versa. However, it has often been assumed that host specificity occurs for each individual isolate or strain. Here we demonstrate that Saprolegnia spp. can have multiple hosts and are thus capable of infecting different aquatic organisms. Saprolegnia delica, Saprolegnia hypogyna, and 2 strains of Saprolegnia diclina were isolated from aquatic insects and amphipods while S. delica, Saprolegnia ferax, Pythium pachycaule, and a Pythium sp. were isolated from the water of a medium to fast flowing river. The ITS region of the rRNA gene was sequenced for all isolates. In challenge experiments, all four isolates from insects were found to be highly pathogenic to eggs of Atlantic salmon (Salmo salar) and embryos of the African clawed frog (Xenopus laevis). We found that Saprolegnia spp. isolated from salmon eggs were also able to successfully establish infection in nymphs of stonefly (Perla bipunctata) and embryos of X. laevis). These results suggest that Saprolegnia spp. are capable of infecting multiple hosts, which may give them an advantage during seasonal variation in their natural environments. Copyright © 2014. Published by Elsevier Ltd.

  5. Pathogenicity of entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana (Hypocreales: Clavicipitaceae) isolates to the adult pea leafminer (Diptera: Agromyzidae) and prospects of an autoinoculation device for infection in the field.

    PubMed

    Migiro, L N; Maniania, N K; Chabi-Olaye, A; Vandenberg, J

    2010-04-01

    Seventeen isolates of Metarhizium anisopliae (Metschnikoff) Sorokin and three isolates of Beauveria bassiana (Balsamo) Vuillemin (Hypocreales: Clavicipitaceae) were evaluated for their pathogenicity to the adult pea leafminer, Liriomyza huidobrensis (Blanchard) (Diptera: Agromyzidae), in the laboratory. Flies were contaminated with dry conidia through a velvet material wrapped around the inner side of a cylindrical plastic tube. All the isolates were pathogenic to the pea leafminer, causing mortality between 40 and 100% at 5 d after exposure. The lethal time for 50% mortality (LT(50)) ranged from 2.6 to 5.4 d, whereas the LT(90) values varied between 3.2 and 9.1 d depending on the isolate. An autoinoculation device was evaluated in cage field experiments using only one of the virulent isolates, M. anisopliae ICIPE 20. The device was loaded with 2-3 g of dry conidia. Mortality of up to 100% was observed in flies captured from fungus-treated cages held under laboratory conditions. The average number of spores picked up by a single fly visiting the device increased with days after inoculation. One day after the inoculation, adults picked up an average of 4.1 +/- 0.7 x 10(5) conidia and 39.6 +/- 4.0 x 10(5) conidia 5 d after inoculation. Depending on the sampling date, the LT(50) varied between 1.8 and 3.4 d. Results indicate that some isolates of B. bassiana and M. anisopliae are highly pathogenic to L. huidobrensis, suggesting a potential for their use in the control of this pest. They also suggest the possibility of L. huidobrensis suppression with fungi using an autoinoculation device.

  6. From Insect to Man: Photorhabdus Sheds Light on the Emergence of Human Pathogenicity

    PubMed Central

    Mulley, Geraldine; Beeton, Michael L.; Wilkinson, Paul; Vlisidou, Isabella; Ockendon-Powell, Nina; Hapeshi, Alexia; Tobias, Nick J.; Nollmann, Friederike I.; Bode, Helge B.; van den Elsen, Jean; ffrench-Constant, Richard H.; Waterfield, Nicholas R.

    2015-01-01

    Photorhabdus are highly effective insect pathogenic bacteria that exist in a mutualistic relationship with Heterorhabditid nematodes. Unlike other members of the genus, Photorhabdus asymbiotica can also infect humans. Most Photorhabdus cannot replicate above 34°C, limiting their host-range to poikilothermic invertebrates. In contrast, P. asymbiotica must necessarily be able to replicate at 37°C or above. Many well-studied mammalian pathogens use the elevated temperature of their host as a signal to regulate the necessary changes in gene expression required for infection. Here we use RNA-seq, proteomics and phenotype microarrays to examine temperature dependent differences in transcription, translation and phenotype of P. asymbiotica at 28°C versus 37°C, relevant to the insect or human hosts respectively. Our findings reveal relatively few temperature dependant differences in gene expression. There is however a striking difference in metabolism at 37°C, with a significant reduction in the range of carbon and nitrogen sources that otherwise support respiration at 28°C. We propose that the key adaptation that enables P. asymbiotica to infect humans is to aggressively acquire amino acids, peptides and other nutrients from the human host, employing a so called “nutritional virulence” strategy. This would simultaneously cripple the host immune response while providing nutrients sufficient for reproduction. This might explain the severity of ulcerated lesions observed in clinical cases of Photorhabdosis. Furthermore, while P. asymbiotica can invade mammalian cells they must also resist immediate killing by humoral immunity components in serum. We observed an increase in the production of the insect Phenol-oxidase inhibitor Rhabduscin normally deployed to inhibit the melanisation immune cascade. Crucially we demonstrated this molecule also facilitates protection against killing by the alternative human complement pathway. PMID:26681201

  7. Neonicotinoid clothianidin adversely affects insect immunity and promotes replication of a viral pathogen in honey bees

    PubMed Central

    Di Prisco, Gennaro; Cavaliere, Valeria; Annoscia, Desiderato; Varricchio, Paola; Caprio, Emilio; Nazzi, Francesco; Gargiulo, Giuseppe; Pennacchio, Francesco

    2013-01-01

    Large-scale losses of honey bee colonies represent a poorly understood problem of global importance. Both biotic and abiotic factors are involved in this phenomenon that is often associated with high loads of parasites and pathogens. A stronger impact of pathogens in honey bees exposed to neonicotinoid insecticides has been reported, but the causal link between insecticide exposure and the possible immune alteration of honey bees remains elusive. Here, we demonstrate that the neonicotinoid insecticide clothianidin negatively modulates NF-κB immune signaling in insects and adversely affects honey bee antiviral defenses controlled by this transcription factor. We have identified in insects a negative modulator of NF-κB activation, which is a leucine-rich repeat protein. Exposure to clothianidin, by enhancing the transcription of the gene encoding this inhibitor, reduces immune defenses and promotes the replication of the deformed wing virus in honey bees bearing covert infections. This honey bee immunosuppression is similarly induced by a different neonicotinoid, imidacloprid, but not by the organophosphate chlorpyriphos, which does not affect NF-κB signaling. The occurrence at sublethal doses of this insecticide-induced viral proliferation suggests that the studied neonicotinoids might have a negative effect at the field level. Our experiments uncover a further level of regulation of the immune response in insects and set the stage for studies on neural modulation of immunity in animals. Furthermore, this study has implications for the conservation of bees, as it will contribute to the definition of more appropriate guidelines for testing chronic or sublethal effects of pesticides used in agriculture. PMID:24145453

  8. Neonicotinoid clothianidin adversely affects insect immunity and promotes replication of a viral pathogen in honey bees.

    PubMed

    Di Prisco, Gennaro; Cavaliere, Valeria; Annoscia, Desiderato; Varricchio, Paola; Caprio, Emilio; Nazzi, Francesco; Gargiulo, Giuseppe; Pennacchio, Francesco

    2013-11-12

    Large-scale losses of honey bee colonies represent a poorly understood problem of global importance. Both biotic and abiotic factors are involved in this phenomenon that is often associated with high loads of parasites and pathogens. A stronger impact of pathogens in honey bees exposed to neonicotinoid insecticides has been reported, but the causal link between insecticide exposure and the possible immune alteration of honey bees remains elusive. Here, we demonstrate that the neonicotinoid insecticide clothianidin negatively modulates NF-κB immune signaling in insects and adversely affects honey bee antiviral defenses controlled by this transcription factor. We have identified in insects a negative modulator of NF-κB activation, which is a leucine-rich repeat protein. Exposure to clothianidin, by enhancing the transcription of the gene encoding this inhibitor, reduces immune defenses and promotes the replication of the deformed wing virus in honey bees bearing covert infections. This honey bee immunosuppression is similarly induced by a different neonicotinoid, imidacloprid, but not by the organophosphate chlorpyriphos, which does not affect NF-κB signaling. The occurrence at sublethal doses of this insecticide-induced viral proliferation suggests that the studied neonicotinoids might have a negative effect at the field level. Our experiments uncover a further level of regulation of the immune response in insects and set the stage for studies on neural modulation of immunity in animals. Furthermore, this study has implications for the conservation of bees, as it will contribute to the definition of more appropriate guidelines for testing chronic or sublethal effects of pesticides used in agriculture.

  9. Effects of co-occurring Wolbachia and Spiroplasma endosymbionts on the Drosophila immune response against insect pathogenic and non-pathogenic bacteria.

    PubMed

    Shokal, Upasana; Yadav, Shruti; Atri, Jaishri; Accetta, Julia; Kenney, Eric; Banks, Katherine; Katakam, Akash; Jaenike, John; Eleftherianos, Ioannis

    2016-02-09

    Symbiotic interactions between microbes and animals are common in nature. Symbiotic organisms are particularly common in insects and, in some cases, they may protect their hosts from pathogenic infections. Wolbachia and Spiroplasma endosymbionts naturally inhabit various insects including Drosophila melanogaster fruit flies. Therefore, this symbiotic association is considered an excellent model to investigate whether endosymbiotic bacteria participate in host immune processes against certain pathogens. Here we have investigated whether the presence of Wolbachia alone or together with Spiroplasma endosymbionts in D. melanogaster adult flies affects the immune response against the virulent insect pathogen Photorhabdus luminescens and against non-pathogenic Escherichia coli bacteria. We found that D. melanogaster flies carrying no endosymbionts, those carrying both Wolbachia and Spiroplasma, and those containing Wolbachia only had similar survival rates after infection with P. luminescens or Escherichia coli bacteria. However, flies carrying both endosymbionts or Wolbachia only contained higher numbers of E. coli cells at early time-points post infection than flies without endosymbiotic bacteria. Interestingly, flies containing Wolbachia only had lower titers of this endosymbiont upon infection with the pathogen P. luminescens than uninfected flies of the same strain. We further found that the presence of Wolbachia and Spiroplasma in D. melanogaster up-regulated certain immune-related genes upon infection with P. luminescens or E. coli bacteria, but it failed to alter the phagocytic ability of the flies toward E. coli inactive bioparticles. Our results suggest that the presence of Wolbachia and Spiroplasma in D. melanogaster can modulate immune signaling against infection by certain insect pathogenic and non-pathogenic bacteria. Results from such studies are important for understanding the molecular basis of the interactions between endosymbiotic bacteria of insects

  10. Metarhizium anisopliae Pathogenesis of Mosquito Larvae: A Verdict of Accidental Death

    PubMed Central

    Butt, Tariq M.; Greenfield, Bethany P. J.; Greig, Carolyn; Maffeis, Thierry G. G.; Taylor, James W. D.; Piasecka, Justyna; Dudley, Ed; Abdulla, Ahmed; Dubovskiy, Ivan M.; Garrido-Jurado, Inmaculada; Quesada-Moraga, Enrique; Penny, Mark W.; Eastwood, Daniel C.

    2013-01-01

    Metarhizium anisopliae, a fungal pathogen of terrestrial arthropods, kills the aquatic larvae of Aedes aegypti, the vector of dengue and yellow fever. The fungus kills without adhering to the host cuticle. Ingested conidia also fail to germinate and are expelled in fecal pellets. This study investigates the mechanism by which this fungus adapted to terrestrial hosts kills aquatic mosquito larvae. Genes associated with the M. anisopliae early pathogenic response (proteinases Pr1 and Pr2, and adhesins, Mad1 and Mad2) are upregulated in the presence of larvae, but the established infection process observed in terrestrial hosts does not progress and insecticidal destruxins were not detected. Protease inhibitors reduce larval mortality indicating the importance of proteases in the host interaction. The Ae. aegypti immune response to M. anisopliae appears limited, whilst the oxidative stress response gene encoding for thiol peroxidase is upregulated. Cecropin and Hsp70 genes are downregulated as larval death occurs, and insect mortality appears to be linked to autolysis through caspase activity regulated by Hsp70 and inhibited, in infected larvae, by protease inhibitors. Evidence is presented that a traditional host-pathogen response does not occur as the species have not evolved to interact. M. anisopliae retains pre-formed pathogenic determinants which mediate host mortality, but unlike true aquatic fungal pathogens, does not recognise and colonise the larval host. PMID:24349111

  11. Plant genotype and induced defenses affect the productivity of an insect-killing obligate viral pathogen.

    PubMed

    Shikano, Ikkei; McCarthy, Elizabeth M; Elderd, Bret D; Hoover, Kelli

    2017-09-01

    Plant-mediated variations in the outcomes of host-pathogen interactions can strongly affect epizootics and the population dynamics of numerous species, including devastating agricultural pests such as the fall armyworm. Most studies of plant-mediated effects on insect pathogens focus on host mortality, but few have measured pathogen yield, which can affect whether or not an epizootic outbreak occurs. Insects challenged with baculoviruses on different plant species and parts can vary in levels of mortality and yield of infectious stages (occlusion bodies; OBs). We previously demonstrated that soybean genotypes and induced anti-herbivore defenses influence baculovirus infectivity. Here, we used a soybean genotype that strongly reduced baculovirus infectivity when virus was ingested on induced plants (Braxton) and another that did not reduce infectivity (Gasoy), to determine how soybean genotype and induced defenses influence OB yield and speed of kill. These are key fitness measures because baculoviruses are obligate-killing pathogens. We challenged fall armyworm, Spodoptera frugiperda, with the baculovirus S. frugiperda multi-nucleocapsid nucleopolyhedrovirus (SfMNPV) during short or long-term exposure to plant treatments (i.e., induced or non-induced genotypes). Caterpillars were either fed plant treatments only during virus ingestion (short-term exposure to foliage) or from the point of virus ingestion until death (long-term exposure). We found trade-offs of increasing OB yield with slower speed of kill and decreasing virus dose. OB yield increased more with longer time to death and decreased more with increasing virus dose after short-term feeding on Braxton compared with Gasoy. OB yield increased significantly more with time to death in larvae that fed until death on non-induced foliage than induced foliage. Moreover, fewer OBs per unit of host tissue were produced when larvae were fed induced foliage than non-induced foliage. These findings highlight the

  12. Evaluation of Metarhizium anisopliae, Beauveria bassiana and Paecilomyces fumosoroseus as entomopathogens of the cactus moth, Cactoblastis cactorum (Lepidoptera:Pyralidae)

    USDA-ARS?s Scientific Manuscript database

    The fungal pathogens Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), Paecilomyces fumosoroseus (Wize) Brown & Smith (Deuteromycotina: Hyphomycetes), and Beauveria bassiana (Bals.-Criv.) Vuill. (Hypocreales: Clavicipitaceae) were evaluated as potential biological control ...

  13. Initial tree mortality, and insect and pathogen response to fire and thinning restoration treatments in an old growth, mixed-conifer forest of the Sierra Nevada, California

    Treesearch

    P. Maloney; T. Smith; C. Jensen; J. Innes; D. Rizzo; M. North

    2008-01-01

    Fire and thinning restoration treatments in fire-suppressed forests often damage or stress leave trees, altering pathogen and insect affects. We compared types of insect- and pathogen-mediated mortality on mixed-conifer trees 3years after treatment. The number of bark beetle attacked trees was greater in burn treatments compared with no-burn treatments, and in some...

  14. Forest health in a changing world: Effects of globalization and climate change on forest insect and pathogen impacts

    Treesearch

    T. D. Ramsfield; Barbara Bentz; M. Faccoli; H. Jactel; E. G. Brockerhoff

    2016-01-01

    Forests and trees throughout the world are increasingly affected by factors related to global change. Expanding international trade has facilitated invasions of numerous insects and pathogens into new regions. Many of these invasions have caused substantial forest damage, economic impacts and losses of ecosystem goods and services provided by trees. Climate...

  15. Metabolomics Reveals the Heterogeneous Secretome of Two Entomopathogenic Fungi to Ex Vivo Cultured Insect Tissues

    PubMed Central

    de Bekker, Charissa; Smith, Philip B.; Patterson, Andrew D.; Hughes, David P.

    2013-01-01

    Fungal entomopathogens rely on cellular heterogeneity during the different stages of insect host infection. Their pathogenicity is exhibited through the secretion of secondary metabolites, which implies that the infection life history of this group of environmentally important fungi can be revealed using metabolomics. Here metabolomic analysis in combination with ex vivo insect tissue culturing shows that two generalist isolates of the genus Metarhizium and Beauveria, commonly used as biological pesticides, employ significantly different arrays of secondary metabolites during infectious and saprophytic growth. It also reveals that both fungi exhibit tissue specific strategies by a distinguishable metabolite secretion on the insect tissues tested in this study. In addition to showing the important heterogeneous nature of these two entomopathogens, this study also resulted in the discovery of several novel destruxins and beauverolides that have not been described before, most likely because previous surveys did not use insect tissues as a culturing system. While Beauveria secreted these cyclic depsipeptides when encountering live insect tissues, Metarhizium employed them primarily on dead tissue. This implies that, while these fungi employ comparable strategies when it comes to entomopathogenesis, there are most certainly significant differences at the molecular level that deserve to be studied. PMID:23940603

  16. Genomic changes associated with the evolutionary transition of an insect gut symbiont into a blood-borne pathogen.

    PubMed

    Segers, Francisca Hid; Kešnerová, Lucie; Kosoy, Michael; Engel, Philipp

    2017-05-01

    The genus Bartonella comprises facultative intracellular bacteria with a unique lifestyle. After transmission by blood-sucking arthropods they colonize the erythrocytes of mammalian hosts causing acute and chronic infectious diseases. Although the pathogen-host interaction is well understood, little is known about the evolutionary origin of the infection strategy manifested by Bartonella species. Here we analyzed six genomes of Bartonella apis, a honey bee gut symbiont that to date represents the closest relative of pathogenic Bartonella species. Comparative genomics revealed that B. apis encodes a large set of vertically inherited genes for amino acid and cofactor biosynthesis and nitrogen metabolism. Most pathogenic bartonellae have lost these ancestral functions, but acquired specific virulence factors and expanded a vertically inherited gene family for harvesting cofactors from the blood. However, the deeply rooted pathogen Bartonella tamiae has retained many of the ancestral genome characteristics reflecting an evolutionary intermediate state toward a host-restricted intraerythrocytic lifestyle. Our findings suggest that the ancestor of the pathogen Bartonella was a gut symbiont of insects and that the adaptation to blood-feeding insects facilitated colonization of the mammalian bloodstream. This study highlights the importance of comparative genomics among pathogens and non-pathogenic relatives to understand disease emergence within an evolutionary-ecological framework.

  17. Characterization of an Insecticidal Toxin and Pathogenicity of Pseudomonas taiwanensis against Insects

    PubMed Central

    Chen, Wen-Jen; Hsieh, Feng-Chia; Hsu, Fu-Chiun; Tasy, Yi-Fang; Liu, Je-Ruei; Shih, Ming-Che

    2014-01-01

    Pseudomonas taiwanensis is a broad-host-range entomopathogenic bacterium that exhibits insecticidal activity toward agricultural pests Plutella xylostella, Spodoptera exigua, Spodoptera litura, Trichoplusia ni and Drosophila melanogaster. Oral infection with different concentrations (OD = 0.5 to 2) of wild-type P. taiwanensis resulted in insect mortality rates that were not significantly different (92.7%, 96.4% and 94.5%). The TccC protein, a component of the toxin complex (Tc), plays an essential role in the insecticidal activity of P. taiwanensis. The ΔtccC mutant strain of P. taiwanensis, which has a knockout mutation in the tccC gene, only induced 42.2% mortality in P. xylostella, even at a high bacterial dose (OD = 2.0). TccC protein was cleaved into two fragments, an N-terminal fragment containing an Rhs-like domain and a C-terminal fragment containing a Glt symporter domain and a TraT domain, which might contribute to antioxidative stress activity and defense against macrophagosis, respectively. Interestingly, the primary structure of the C-terminal region of TccC in P. taiwanensis is unique among pathogens. Membrane localization of the C-terminal fragment of TccC was proven by flow cytometry. Sonicated pellets of P. taiwanensis ΔtccC strain had lower toxicity against the Sf9 insect cell line and P. xylostella larvae than the wild type. We also found that infection of Sf9 and LD652Y-5d cell lines with P. taiwanensis induced apoptotic cell death. Further, natural oral infection by P. taiwanensis triggered expression of host programmed cell death-related genes JNK-2 and caspase-3. PMID:25144637

  18. Characterization of an insecticidal toxin and pathogenicity of Pseudomonas taiwanensis against insects.

    PubMed

    Chen, Wen-Jen; Hsieh, Feng-Chia; Hsu, Fu-Chiun; Tasy, Yi-Fang; Liu, Je-Ruei; Shih, Ming-Che

    2014-08-01

    Pseudomonas taiwanensis is a broad-host-range entomopathogenic bacterium that exhibits insecticidal activity toward agricultural pests Plutella xylostella, Spodoptera exigua, Spodoptera litura, Trichoplusia ni and Drosophila melanogaster. Oral infection with different concentrations (OD = 0.5 to 2) of wild-type P. taiwanensis resulted in insect mortality rates that were not significantly different (92.7%, 96.4% and 94.5%). The TccC protein, a component of the toxin complex (Tc), plays an essential role in the insecticidal activity of P. taiwanensis. The ΔtccC mutant strain of P. taiwanensis, which has a knockout mutation in the tccC gene, only induced 42.2% mortality in P. xylostella, even at a high bacterial dose (OD = 2.0). TccC protein was cleaved into two fragments, an N-terminal fragment containing an Rhs-like domain and a C-terminal fragment containing a Glt symporter domain and a TraT domain, which might contribute to antioxidative stress activity and defense against macrophagosis, respectively. Interestingly, the primary structure of the C-terminal region of TccC in P. taiwanensis is unique among pathogens. Membrane localization of the C-terminal fragment of TccC was proven by flow cytometry. Sonicated pellets of P. taiwanensis ΔtccC strain had lower toxicity against the Sf9 insect cell line and P. xylostella larvae than the wild type. We also found that infection of Sf9 and LD652Y-5d cell lines with P. taiwanensis induced apoptotic cell death. Further, natural oral infection by P. taiwanensis triggered expression of host programmed cell death-related genes JNK-2 and caspase-3.

  19. Domain shuffling in a sensor protein contributed to the evolution of insect pathogenicity in plant-beneficial Pseudomonas protegens.

    PubMed

    Kupferschmied, Peter; Péchy-Tarr, Maria; Imperiali, Nicola; Maurhofer, Monika; Keel, Christoph

    2014-02-01

    Pseudomonas protegens is a biocontrol rhizobacterium with a plant-beneficial and an insect pathogenic lifestyle, but it is not understood how the organism switches between the two states. Here, we focus on understanding the function and possible evolution of a molecular sensor that enables P. protegens to detect the insect environment and produce a potent insecticidal toxin specifically during insect infection but not on roots. By using quantitative single cell microscopy and mutant analysis, we provide evidence that the sensor histidine kinase FitF is a key regulator of insecticidal toxin production. Our experimental data and bioinformatic analyses indicate that FitF shares a sensing domain with DctB, a histidine kinase regulating carbon uptake in Proteobacteria. This suggested that FitF has acquired its specificity through domain shuffling from a common ancestor. We constructed a chimeric DctB-FitF protein and showed that it is indeed functional in regulating toxin expression in P. protegens. The shuffling event and subsequent adaptive modifications of the recruited sensor domain were critical for the microorganism to express its potent insect toxin in the observed host-specific manner. Inhibition of the FitF sensor during root colonization could explain the mechanism by which P. protegens differentiates between the plant and insect host. Our study establishes FitF of P. protegens as a prime model for molecular evolution of sensor proteins and bacterial pathogenicity.

  20. Evolutionary patchwork of an insecticidal toxin shared between plant-associated pseudomonads and the insect pathogens Photorhabdus and Xenorhabdus.

    PubMed

    Ruffner, Beat; Péchy-Tarr, Maria; Höfte, Monica; Bloemberg, Guido; Grunder, Jürg; Keel, Christoph; Maurhofer, Monika

    2015-08-16

    Root-colonizing fluorescent pseudomonads are known for their excellent abilities to protect plants against soil-borne fungal pathogens. Some of these bacteria produce an insecticidal toxin (Fit) suggesting that they may exploit insect hosts as a secondary niche. However, the ecological relevance of insect toxicity and the mechanisms driving the evolution of toxin production remain puzzling. Screening a large collection of plant-associated pseudomonads for insecticidal activity and presence of the Fit toxin revealed that Fit is highly indicative of insecticidal activity and predicts that Pseudomonas protegens and P. chlororaphis are exclusive Fit producers. A comparative evolutionary analysis of Fit toxin-producing Pseudomonas including the insect-pathogenic bacteria Photorhabdus and Xenorhadus, which produce the Fit related Mcf toxin, showed that fit genes are part of a dynamic genomic region with substantial presence/absence polymorphism and local variation in GC base composition. The patchy distribution and phylogenetic incongruence of fit genes indicate that the Fit cluster evolved via horizontal transfer, followed by functional integration of vertically transmitted genes, generating a unique Pseudomonas-specific insect toxin cluster. Our findings suggest that multiple independent evolutionary events led to formation of at least three versions of the Mcf/Fit toxin highlighting the dynamic nature of insect toxin evolution.

  1. Domain Shuffling in a Sensor Protein Contributed to the Evolution of Insect Pathogenicity in Plant-Beneficial Pseudomonas protegens

    PubMed Central

    Kupferschmied, Peter; Péchy-Tarr, Maria; Imperiali, Nicola; Maurhofer, Monika; Keel, Christoph

    2014-01-01

    Pseudomonas protegens is a biocontrol rhizobacterium with a plant-beneficial and an insect pathogenic lifestyle, but it is not understood how the organism switches between the two states. Here, we focus on understanding the function and possible evolution of a molecular sensor that enables P. protegens to detect the insect environment and produce a potent insecticidal toxin specifically during insect infection but not on roots. By using quantitative single cell microscopy and mutant analysis, we provide evidence that the sensor histidine kinase FitF is a key regulator of insecticidal toxin production. Our experimental data and bioinformatic analyses indicate that FitF shares a sensing domain with DctB, a histidine kinase regulating carbon uptake in Proteobacteria. This suggested that FitF has acquired its specificity through domain shuffling from a common ancestor. We constructed a chimeric DctB-FitF protein and showed that it is indeed functional in regulating toxin expression in P. protegens. The shuffling event and subsequent adaptive modifications of the recruited sensor domain were critical for the microorganism to express its potent insect toxin in the observed host-specific manner. Inhibition of the FitF sensor during root colonization could explain the mechanism by which P. protegens differentiates between the plant and insect host. Our study establishes FitF of P. protegens as a prime model for molecular evolution of sensor proteins and bacterial pathogenicity. PMID:24586167

  2. Inducible expression of a fusion gene encoding two proteinase inhibitors leads to insect and pathogen resistance in transgenic rice.

    PubMed

    Quilis, Jordi; López-García, Belén; Meynard, Donaldo; Guiderdoni, Emmanuel; San Segundo, Blanca

    2014-04-01

    Plant proteinase inhibitors (PIs) are considered as candidates for increased insect resistance in transgenic plants. Insect adaptation to PI ingestion might, however, compromise the benefits received by transgenic expression of PIs. In this study, the maize proteinase inhibitor (MPI), an inhibitor of insect serine proteinases, and the potato carboxypeptidase inhibitor (PCI) were fused into a single open reading frame and introduced into rice plants. The two PIs were linked using either the processing site of the Bacillus thuringiensis Cry1B precursor protein or the 2A sequence from the foot-and-mouth disease virus (FMDV). Expression of each fusion gene was driven by the wound- and pathogen-inducible mpi promoter. The mpi-pci fusion gene was stably inherited for at least three generations with no penalty on plant phenotype. An important reduction in larval weight of Chilo suppressalis fed on mpi-pci rice, compared with larvae fed on wild-type plants, was observed. Expression of the mpi-pci fusion gene confers resistance to C. suppressalis (striped stem borer), one of the most important insect pest of rice. The mpi-pci expression systems described may represent a suitable strategy for insect pest control, better than strategies based on the use of single PI genes, by preventing insect adaptive responses. The rice plants expressing the mpi-pci fusion gene also showed enhanced resistance to infection by the fungus Magnaporthe oryzae, the causal agent of the rice blast disease. Our results illustrate the usefulness of the inducible expression of the mpi-pci fusion gene for dual resistance against insects and pathogens in rice plants.

  3. Dynamics of phytophagous insects and their pathogens in Alaskan boreal forests

    Treesearch

    Richard A. Werner; Kenneth F. Raffa; Barbara L. Illman

    2006-01-01

    Boreal forests support an array of insects, including phytophagous (plant-eating) insects, saprophagous (detritus-eating) insects, and their associated parasites, predators, and symbionts. The phytophagous species include folivorous leaf chewers and miners, phloeophagous cambial and sapwood borers, stem gallers, and root feeders. Biological diversity and distribution...

  4. Expression of a Peroral Infection Factor Determines Pathogenicity and Population Structure in an Insect Virus

    PubMed Central

    Simón, Oihane; Williams, Trevor; Cerutti, Martine; Caballero, Primitivo; López-Ferber, Miguel

    2013-01-01

    A Nicaraguan isolate of Spodoptera frugiperda multiple nucleopolyhedrovirus is being studied as a possible biological insecticide. This virus exists as a mixture of complete and deletion genotypes; the latter depend on the former for the production of an essential per os transmission factor (pif1) in coinfected cells. We hypothesized that the virus population was structured to account for the prevalence of pif1 defector genotypes, so that increasing the abundance of pif1 produced by a cooperator genotype in infected cells would favor an increased prevalence of the defector genotype. We tested this hypothesis using recombinant viruses with pif1 expression reprogrammed at its native locus using two exogenous promoters (egt, p10) in the pif2/pif1 intergenic region. Reprogrammed viruses killed their hosts markedly faster than the wild-type and rescue viruses, possibly due to an earlier onset of systemic infection. Group success (transmission) depended on expression of pif1, but overexpression was prejudicial to group-specific transmissibility, both in terms of reduced pathogenicity and reduced production of virus progeny from each infected insect. The presence of pif1-overproducing genotypes in the population was predicted to favor a shift in the prevalence of defector genotypes lacking pif1-expressing capabilities, to compensate for the modification in pif1 availability at the population level. As a result, defectors increased the overall pathogenicity of the virus population by diluting pif1 produced by overexpressing genotypes. These results offer a new and unexpected perspective on cooperative behavior between viral genomes in response to the abundance of an essential public good that is detrimental in excess. PMID:24223853

  5. DisturbED: A Generalized Framework for Modeling Forest Insects and Pathogens in the Earth System

    NASA Astrophysics Data System (ADS)

    Matthes, J. H.

    2016-12-01

    Forest insects and pathogens (FIPs) are ubiquitous agents of disturbance that cause major alterations to ecosystem function and billions of dollars in damage annually. Future feedbacks between FIPs, forests, and climate change are not well understood at continental scales, due in part to the absence of the processes modulated by FIPs within Earth System Models (ESMs). To address this challenge, we developed a generalized, globally-scalable framework — DisturbED — in which mechanistic impacts of FIPs on plant physiology are scaled up to ecosystem-level processes so they can be integrated into ESMs. This framework can be used to test a suite of hypotheses concerning the effects of FIPs on forest biogeochemistry, demography, and structure in response to FIPs that vary in their host specificity, timescale and intensity of attack, and sensitivity to climatic change. Both native and invasive FIPs initiate a vast range of ecophysiological responses within individual trees, from slight stress and recovery to rapid mortality. Rather than modeling FIPs as direct agents of mortality, DisturbED couples FIP functional types with changes in individual host plant physiology to simulate resulting changes in ecosystem processes within the Ecosystem Demography (ED) model. This bottom-up modeling framework will allow for investigation of interactions among tree and FIPs physiology; demography and ecosystem dynamics; and their contingency on climatic change.

  6. Pathogen Persistence in the Environment and Insect-Baculovirus Interactions: Disease-Density Thresholds, Epidemic Burnout and Insect Outbreaks

    PubMed Central

    Fuller, Emma; Elderd, Bret D.

    2013-01-01

    Classical epidemic theory focuses on directly transmitted pathogens, but many pathogens are instead transmitted when hosts encounter infectious particles. Theory has shown that for such diseases pathogen persistence time in the environment can strongly affect disease dynamics, but estimates of persistence time, and consequently tests of the theory, are extremely rare. We consider the consequences of persistence time for the dynamics of the gypsy moth baculovirus, a pathogen transmitted when larvae consume foliage contaminated with particles released from infectious cadavers. Using field-transmission experiments, we are able to estimate persistence time under natural conditions, and inserting our estimates into a standard epidemic model suggests that epidemics are often terminated by a combination of pupation and burnout, rather than by burnout alone as predicted by theory. Extending our models to allow for multiple generations, and including environmental transmission over the winter, suggests that the virus may survive over the long term even in the absence of complex persistence mechanisms, such as environmental reservoirs or covert infections. Our work suggests that estimates of persistence times can lead to a deeper understanding of environmentally transmitted pathogens, and illustrates the usefulness of experiments that are closely tied to mathematical models. PMID:22322229

  7. Constraints of simultaneous resistance to a fungal pathogen and an insect herbivore in lima bean (Phaseolus lunatus L.).

    PubMed

    Ballhorn, Daniel J

    2011-02-01

    The existence of tradeoffs among plant defenses is commonly accepted, however, actual evidence for these tradeoffs is scarce. In this study, I analyzed effects of different direct defenses of wild lima bean plants (Phaseolus lunatus) that were simultaneously exposed to a fungal pathogen (Colletotrichum lindemuthianum) and an insect herbivore, the Mexican bean beetle (Epilachna varivestis). Although plants were derived from spatially widely separated populations, I observed a common tradeoff between resistance to pathogens and herbivores. Plants with high levels of anti-herbivore defense (cyanogenesis) showed low levels of resistance to pathogens (polyphenol oxidase activity and phenolic compounds), and vice versa. Competition for resources generally is considered to be the basis for tradeoffs. However, I report direct inhibition of polyphenol oxidase by cyanide, making simultaneous expression of both defenses at high levels impossible. I argue that populations composed of individuals investing in one type of defense have an advantage in environments that periodically favor either pathogen or herbivore plant antagonists.

  8. Induced release of a plant-defense volatile 'deceptively' attracts insect vectors to plants infected with a bacterial pathogen.

    PubMed

    Mann, Rajinder S; Ali, Jared G; Hermann, Sara L; Tiwari, Siddharth; Pelz-Stelinski, Kirsten S; Alborn, Hans T; Stelinski, Lukasz L

    2012-01-01

    Transmission of plant pathogens by insect vectors is a complex biological process involving interactions between the plant, insect, and pathogen. Pathogen-induced plant responses can include changes in volatile and nonvolatile secondary metabolites as well as major plant nutrients. Experiments were conducted to understand how a plant pathogenic bacterium, Candidatus Liberibacter asiaticus (Las), affects host preference behavior of its psyllid (Diaphorina citri Kuwayama) vector. D. citri were attracted to volatiles from pathogen-infected plants more than to those from non-infected counterparts. Las-infected plants were more attractive to D. citri adults than non-infected plants initially; however after feeding, psyllids subsequently dispersed to non-infected rather than infected plants as their preferred settling point. Experiments with Las-infected and non-infected plants under complete darkness yielded similar results to those recorded under light. The behavior of psyllids in response to infected versus non-infected plants was not influenced by whether or not they were carriers of the pathogen. Quantification of volatile release from non-infected and infected plants supported the hypothesis that odorants mediate psyllid preference. Significantly more methyl salicylate, yet less methyl anthranilate and D-limonene, was released by infected than non-infected plants. Methyl salicylate was attractive to psyllids, while methyl anthranilate did not affect their behavior. Feeding on citrus by D. citri adults also induced release of methyl salicylate, suggesting that it may be a cue revealing location of conspecifics on host plants. Infected plants were characterized by lower levels of nitrogen, phosphorus, sulfur, zinc, and iron, as well as, higher levels of potassium and boron than non-infected plants. Collectively, our results suggest that host selection behavior of D. citri may be modified by bacterial infection of plants, which alters release of specific headspace

  9. Induced plant defenses, host–pathogen interactions, and forest insect outbreaks

    PubMed Central

    Elderd, Bret D.; Rehill, Brian J.; Haynes, Kyle J.; Dwyer, Greg

    2013-01-01

    Cyclic outbreaks of defoliating insects devastate forests, but their causes are poorly understood. Outbreak cycles are often assumed to be driven by density-dependent mortality due to natural enemies, because pathogens and predators cause high mortality and because natural-enemy models reproduce fluctuations in defoliation data. The role of induced defenses is in contrast often dismissed, because toxic effects of defenses are often weak and because induced-defense models explain defoliation data no better than natural-enemy models. Natural-enemy models, however, fail to explain gypsy moth outbreaks in North America, in which outbreaks in forests with a higher percentage of oaks have alternated between severe and mild, whereas outbreaks in forests with a lower percentage of oaks have been uniformly moderate. Here we show that this pattern can be explained by an interaction between induced defenses and a natural enemy. We experimentally induced hydrolyzable-tannin defenses in red oak, to show that induction reduces variability in a gypsy moth’s risk of baculovirus infection. Because this effect can modulate outbreak severity and because oaks are the only genus of gypsy moth host tree that can be induced, we extended a natural-enemy model to allow for spatial variability in inducibility. Our model shows alternating outbreaks in forests with a high frequency of oaks, and uniform outbreaks in forests with a low frequency of oaks, matching the data. The complexity of this effect suggests that detecting effects of induced defenses on defoliator cycles requires a combination of experiments and models. PMID:23966566

  10. Cofeeding intra- and interspecific transmission of an emerging insect-borne rickettsial pathogen.

    PubMed

    Brown, Lisa D; Christofferson, Rebecca C; Banajee, Kaikhushroo H; Del Piero, Fabio; Foil, Lane D; Macaluso, Kevin R

    2015-11-01

    Cat fleas (Ctenocephalides felis) are known as the primary vector and reservoir of Rickettsia felis, the causative agent of flea-borne spotted fever; however, field surveys regularly report molecular detection of this infectious agent from other blood-feeding arthropods. The presence of R. felis in additional arthropods may be the result of chance consumption of an infectious bloodmeal, but isolation of viable rickettsiae circulating in the blood of suspected vertebrate reservoirs has not been demonstrated. Successful transmission of pathogens between actively blood-feeding arthropods in the absence of a disseminated vertebrate infection has been verified, referred to as cofeeding transmission. Therefore, the principal route from systemically infected vertebrates to uninfected arthropods may not be applicable to the R. felis transmission cycle. Here, we show both intra- and interspecific transmission of R. felis between cofeeding arthropods on a vertebrate host. Analyses revealed that infected cat fleas transmitted R. felis to naïve cat fleas and rat fleas (Xenopsylla cheopis) via fleabite on a nonrickettsemic vertebrate host. Also, cat fleas infected by cofeeding were infectious to newly emerged uninfected cat fleas in an artificial system. Furthermore, we utilized a stochastic model to demonstrate that cofeeding is sufficient to explain the enzootic spread of R. felis amongst populations of the biological vector. Our results implicate cat fleas in the spread of R. felis amongst different vectors, and the demonstration of cofeeding transmission of R. felis through a vertebrate host represents a novel transmission paradigm for insect-borne Rickettsia and furthers our understanding of this emerging rickettsiosis.

  11. Improving Sterile Insect Technique (SIT) for tsetse flies through research on their symbionts and pathogens.

    PubMed

    Abd-Alla, Adly M M; Bergoin, Max; Parker, Andrew G; Maniania, Nguya K; Vlak, Just M; Bourtzis, Kostas; Boucias, Drion G; Aksoy, Serap

    2013-03-01

    Tsetse flies (Diptera: Glossinidae) are the cyclical vectors of the trypanosomes, which cause human African trypanosomosis (HAT) or sleeping sickness in humans and African animal trypanosomosis (AAT) or nagana in animals. Due to the lack of effective vaccines and inexpensive drugs for HAT, and the development of resistance of the trypanosomes against the available trypanocidal drugs, vector control remains the most efficient strategy for sustainable management of these diseases. Among the control methods used for tsetse flies, Sterile Insect Technique (SIT), in the frame of area-wide integrated pest management (AW-IPM), represents an effective tactic to suppress and/or eradicate tsetse flies. One constraint in implementing SIT is the mass production of target species. Tsetse flies harbor obligate bacterial symbionts and salivary gland hypertrophy virus which modulate the fecundity of the infected flies. In support of the future expansion of the SIT for tsetse fly control, the Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture implemented a six year Coordinated Research Project (CRP) entitled "Improving SIT for Tsetse Flies through Research on their Symbionts and Pathogens". The consortium focused on the prevalence and the interaction between the bacterial symbionts and the virus, the development of strategies to manage virus infections in tsetse colonies, the use of entomopathogenic fungi to control tsetse flies in combination with SIT, and the development of symbiont-based strategies to control tsetse flies and trypanosomosis. The results of the CRP and the solutions envisaged to alleviate the constraints of the mass rearing of tsetse flies for SIT are presented in this special issue.

  12. Protein interaction networks at the host–microbe interface in Diaphorina citri, the insect vector of the citrus greening pathogen

    PubMed Central

    Chavez, J. D.; Johnson, R.; Hosseinzadeh, S.; Mahoney, J. E.; Mohr, J. P.; Robison, F.; Zhong, X.; Hall, D. G.; MacCoss, M.; Bruce, J.; Cilia, M.

    2017-01-01

    The Asian citrus psyllid (Diaphorina citri) is the insect vector responsible for the worldwide spread of ‘Candidatus Liberibacter asiaticus’ (CLas), the bacterial pathogen associated with citrus greening disease. Developmental changes in the insect vector impact pathogen transmission, such that D. citri transmission of CLas is more efficient when bacteria are acquired by nymphs when compared with adults. We hypothesize that expression changes in the D. citri immune system and commensal microbiota occur during development and regulate vector competency. In support of this hypothesis, more proteins, with greater fold changes, were differentially expressed in response to CLas in adults when compared with nymphs, including insect proteins involved in bacterial adhesion and immunity. Compared with nymphs, adult insects had a higher titre of CLas and the bacterial endosymbionts Wolbachia, Profftella and Carsonella. All Wolbachia and Profftella proteins differentially expressed between nymphs and adults are upregulated in adults, while most differentially expressed Carsonella proteins are upregulated in nymphs. Discovery of protein interaction networks has broad applicability to the study of host–microbe relationships. Using protein interaction reporter technology, a D. citri haemocyanin protein highly upregulated in response to CLas was found to physically interact with the CLas coenzyme A (CoA) biosynthesis enzyme phosphopantothenoylcysteine synthetase/decarboxylase. CLas pantothenate kinase, which catalyses the rate-limiting step of CoA biosynthesis, was found to interact with a D. citri myosin protein. Two Carsonella enzymes involved in histidine and tryptophan biosynthesis were found to physically interact with D. citri proteins. These co-evolved protein interaction networks at the host–microbe interface are highly specific targets for controlling the insect vector responsible for the spread of citrus greening. PMID:28386418

  13. Protein interaction networks at the host-microbe interface in Diaphorina citri, the insect vector of the citrus greening pathogen.

    PubMed

    Ramsey, J S; Chavez, J D; Johnson, R; Hosseinzadeh, S; Mahoney, J E; Mohr, J P; Robison, F; Zhong, X; Hall, D G; MacCoss, M; Bruce, J; Cilia, M

    2017-02-01

    The Asian citrus psyllid (Diaphorina citri) is the insect vector responsible for the worldwide spread of 'Candidatus Liberibacter asiaticus' (CLas), the bacterial pathogen associated with citrus greening disease. Developmental changes in the insect vector impact pathogen transmission, such that D. citri transmission of CLas is more efficient when bacteria are acquired by nymphs when compared with adults. We hypothesize that expression changes in the D. citri immune system and commensal microbiota occur during development and regulate vector competency. In support of this hypothesis, more proteins, with greater fold changes, were differentially expressed in response to CLas in adults when compared with nymphs, including insect proteins involved in bacterial adhesion and immunity. Compared with nymphs, adult insects had a higher titre of CLas and the bacterial endosymbionts Wolbachia, Profftella and Carsonella. All Wolbachia and Profftella proteins differentially expressed between nymphs and adults are upregulated in adults, while most differentially expressed Carsonella proteins are upregulated in nymphs. Discovery of protein interaction networks has broad applicability to the study of host-microbe relationships. Using protein interaction reporter technology, a D. citri haemocyanin protein highly upregulated in response to CLas was found to physically interact with the CLas coenzyme A (CoA) biosynthesis enzyme phosphopantothenoylcysteine synthetase/decarboxylase. CLas pantothenate kinase, which catalyses the rate-limiting step of CoA biosynthesis, was found to interact with a D. citri myosin protein. Two Carsonella enzymes involved in histidine and tryptophan biosynthesis were found to physically interact with D. citri proteins. These co-evolved protein interaction networks at the host-microbe interface are highly specific targets for controlling the insect vector responsible for the spread of citrus greening.

  14. Disruption of Vector Host Preference with Plant Volatiles May Reduce Spread of Insect-Transmitted Plant Pathogens.

    PubMed

    Martini, Xavier; Willett, Denis S; Kuhns, Emily H; Stelinski, Lukasz L

    2016-05-01

    Plant pathogens can manipulate the odor of their host; the odor of an infected plant is often attractive to the plant pathogen vector. It has been suggested that this odor-mediated manipulation attracts vectors and may contribute to spread of disease; however, this requires further broad demonstration among vector-pathogen systems. In addition, disruption of this indirect chemical communication between the pathogen and the vector has not been attempted. We present a model that demonstrates how a phytophathogen (Candidatus Liberibacter asiaticus) can increase its spread by indirectly manipulating the behavior of its vector (Asian citrus psyllid, Diaphorina citri Kuwayama). The model indicates that when vectors are attracted to pathogen-infected hosts, the proportion of infected vectors increases, as well as, the proportion of infected hosts. Additionally, the peak of infected host populations occurs earlier as compared with controls. These changes in disease dynamics were more important during scenarios with higher vector mortality. Subsequently, we conducted a series of experiments to disrupt the behavior of the Asian citrus psyllid. To do so, we exposed the vector to methyl salicylate, the major compound released following host infection with the pathogen. We observed that during exposure or after pre-exposure to methyl salicylate, the host preference can be altered; indeed, the Asian citrus psyllids were unable to select infected hosts over uninfected counterparts. We suggest mechanisms to explain these interactions and potential applications of disrupting herbivore host preference with plant volatiles for sustainable management of insect vectors.

  15. Nonnative forest insects and pathogens in the United States: impacts and policy options

    Treesearch

    Gary M. Lovett; Marissa Weiss; Andrew M. Liebhold; Tom Holmes; Brian Leung; Kathy-Fallon Lambert; David A. Orwig; Faith T. Campbell; Jonathan Rosenthal; Deborah G. McCullough; Radka Wildova; Matthew P. Ayres; Charles D. Canham; David R. Foster; Shannon L. LaDeau; Troy Weldy

    2016-01-01

    We review and synthesize information on invasions of nonnative forest insects and diseases in the United States, including their ecological and economic impacts, pathways of arrival, distribution within the United States, and policy options for reducing future invasions. Nonnative insects have accumulated in United States forests at a rate of ~2.5 per yr over the last...

  16. Terpene down-regulation in orange reveals the role of fruit aromas in mediating interactions with insect herbivores and pathogens.

    PubMed

    Rodríguez, Ana; San Andrés, Victoria; Cervera, Magdalena; Redondo, Ana; Alquézar, Berta; Shimada, Takehiko; Gadea, José; Rodrigo, María Jesús; Zacarías, Lorenzo; Palou, Lluís; López, María M; Castañera, Pedro; Peña, Leandro

    2011-06-01

    Plants use volatile terpene compounds as odor cues for communicating with the environment. Fleshy fruits are particularly rich in volatiles that deter herbivores and attract seed dispersal agents. We have investigated how terpenes in citrus fruit peels affect the interaction between the plant, insects, and microorganisms. Because limonene represents up to 97% of the total volatiles in orange (Citrus sinensis) fruit peel, we chose to down-regulate the expression of a limonene synthase gene in orange plants by introducing an antisense construct of this gene. Transgenic fruits showed reduced accumulation of limonene in the peel. When these fruits were challenged with either the fungus Penicillium digitatum or with the bacterium Xanthomonas citri subsp. citri, they showed marked resistance against these pathogens that were unable to infect the peel tissues. Moreover, males of the citrus pest medfly (Ceratitis capitata) were less attracted to low limonene-expressing fruits than to control fruits. These results indicate that limonene accumulation in the peel of citrus fruit appears to be involved in the successful trophic interaction between fruits, insects, and microorganisms. Terpene down-regulation might be a strategy to generate broad-spectrum resistance against pests and pathogens in fleshy fruits from economically important crops. In addition, terpene engineering may be important for studying the basic ecological interactions between fruits, herbivores, and pathogens.

  17. Metarhizium brunneum Blastospore Pathogenesis in Aedes aegypti Larvae: Attack on Several Fronts Accelerates Mortality.

    PubMed

    Alkhaibari, Abeer M; Carolino, Aline T; Yavasoglu, Sare I; Maffeis, Thierry; Mattoso, Thalles C; Bull, James C; Samuels, Richard I; Butt, Tariq M

    2016-07-01

    Aedes aegypti is the vector of a wide range of diseases (e.g. yellow fever, dengue, Chikungunya and Zika) which impact on over half the world's population. Entomopathogenic fungi such as Metarhizium anisopliae and Beauveria bassiana have been found to be highly efficacious in killing mosquito larvae but only now are the underlying mechanisms for pathogenesis being elucidated. Recently it was shown that conidia of M. anisopliae caused stress induced mortality in Ae. aegypti larvae, a different mode of pathogenicity to that normally seen in terrestrial hosts. Blastospores constitute a different form of inoculum produced by this fungus when cultured in liquid media and although blastospores are generally considered to be more virulent than conidia no evidence has been presented to explain why. In our study, using a range of biochemical, molecular and microscopy methods, the infection process of Metarhizium brunneum (formerly M. anisopliae) ARSEF 4556 blastospores was investigated. It appears that the blastospores, unlike conidia, readily adhere to and penetrate mosquito larval cuticle. The blastospores are readily ingested by the larvae but unlike the conidia are able infect the insect through the gut and rapidly invade the haemocoel. The fact that pathogenicity related genes were upregulated in blastospores exposed to larvae prior to invasion, suggests the fungus was detecting host derived cues. Similarly, immune and defence genes were upregulated in the host prior to infection suggesting mosquitoes were also able to detect pathogen-derived cues. The hydrophilic blastospores produce copious mucilage, which probably facilitates adhesion to the host but do not appear to depend on production of Pr1, a cuticle degrading subtilisin protease, for penetration since protease inhibitors did not significantly alter blastospore virulence. The fact the blastospores have multiple routes of entry (cuticle and gut) may explain why this form of the inoculum killed Ae. aegypti larvae

  18. Metarhizium brunneum Blastospore Pathogenesis in Aedes aegypti Larvae: Attack on Several Fronts Accelerates Mortality

    PubMed Central

    Alkhaibari, Abeer M.; Carolino, Aline T.; Yavasoglu, Sare I.; Maffeis, Thierry; Mattoso, Thalles C.; Bull, James C.; Samuels, Richard I.; Butt, Tariq M.

    2016-01-01

    Aedes aegypti is the vector of a wide range of diseases (e.g. yellow fever, dengue, Chikungunya and Zika) which impact on over half the world’s population. Entomopathogenic fungi such as Metarhizium anisopliae and Beauveria bassiana have been found to be highly efficacious in killing mosquito larvae but only now are the underlying mechanisms for pathogenesis being elucidated. Recently it was shown that conidia of M. anisopliae caused stress induced mortality in Ae. aegypti larvae, a different mode of pathogenicity to that normally seen in terrestrial hosts. Blastospores constitute a different form of inoculum produced by this fungus when cultured in liquid media and although blastospores are generally considered to be more virulent than conidia no evidence has been presented to explain why. In our study, using a range of biochemical, molecular and microscopy methods, the infection process of Metarhizium brunneum (formerly M. anisopliae) ARSEF 4556 blastospores was investigated. It appears that the blastospores, unlike conidia, readily adhere to and penetrate mosquito larval cuticle. The blastospores are readily ingested by the larvae but unlike the conidia are able infect the insect through the gut and rapidly invade the haemocoel. The fact that pathogenicity related genes were upregulated in blastospores exposed to larvae prior to invasion, suggests the fungus was detecting host derived cues. Similarly, immune and defence genes were upregulated in the host prior to infection suggesting mosquitoes were also able to detect pathogen-derived cues. The hydrophilic blastospores produce copious mucilage, which probably facilitates adhesion to the host but do not appear to depend on production of Pr1, a cuticle degrading subtilisin protease, for penetration since protease inhibitors did not significantly alter blastospore virulence. The fact the blastospores have multiple routes of entry (cuticle and gut) may explain why this form of the inoculum killed Ae. aegypti

  19. Foliar pathogen and insect herbivore effects on two landslide tree species in Puerto Rico

    Treesearch

    Randall W. Myster

    2002-01-01

    To better understand pathogen/herbivore interactions and landslide regeneration, percent leaf area lost to disease and herbivory on two Puerto Rican trees over a 1-year period was sampled. Cecropia schreberiana saplings lost from 1 to 3% leaf area to pathogens and from 1 to 7% to herbivores. For Inga vera, both sapling and seedling losses to pathogens were minimal, but...

  20. THE PESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Metarhizium anisopliae is a parasitic fungus employed as a biological control agent against vermin and used in the US for indoor control of cockroaches. Sensitization to cockroach allergens is associated with development of asthma. This pesticide is non-pathogenic for humans and ...

  1. THE PESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Metarhizium anisopliae is a parasitic fungus employed as a biological control agent against vermin and used in the US for indoor control of cockroaches. Sensitization to cockroach allergens is associated with development of asthma. This pesticide is non-pathogenic for humans and ...

  2. Construction and preliminary analysis of a normalized cDNA library from Locusta migratoria manilensis topically infected with Metarhizium anisopliae var. acridum.

    PubMed

    Wang, Jie; Xia, Yuxian

    2010-08-01

    The insect immune response to fungal infection is poorly understood at the molecular level. To explore the molecular basis of this process, a novel method to analyze the gene transcripts of insects in response to pathogenic fungus was established. A normalized cDNA library based on the SMART method combined with DSN (duplex-specific nuclease) treatment was constructed using mRNA extracted from the fat body and hemocytes of Locusta migratoria manilensis 6-24h after being topically infected with Metarhizium anisopliae var. acridum. Analysis of 259 unigenes out of 303 sequenced inserts from the cDNA library revealed that the cDNA library was not contaminated with M. anisopliae transcripts and validated the presence of the immune-related genes characterized here. These results suggest that this method overcame the difficulties of contamination from a fungal source in constructing the host cDNA library from mycosed insects and proved that this method is reliable and feasible for investigation of host genes in response to fungal infection. Further studies of the expressed sequence tags from this library will provide insights into the molecular basis of insect immune response to fungal infection.

  3. Multiplexed microsatellite markers for seven Metarhizium species

    USDA-ARS?s Scientific Manuscript database

    Cross-species transferability of 41 previously published simple sequence repeat (SSR) markers was assessed for 11 species of the entomopathogenic fungus Metarhizium. A collection of 65 Metarhizium isolates including all 54 used in a recent phylogenetic revision of the genus were characterized. Betwe...

  4. Interaction of Phytophagous Insects with Salmonella enterica on Plants and Enhanced Persistence of the Pathogen with Macrosteles quadrilineatus Infestation or Frankliniella occidentalis Feeding

    PubMed Central

    Soto-Arias, José Pablo; Groves, Russell; Barak, Jeri D.

    2013-01-01

    Recently, most foodborne illness outbreaks of salmonellosis have been caused by consumption of contaminated fresh produce. Yet, the mechanisms that allow the human pathogen Salmonella enterica to contaminate and grow in plant environments remain poorly described. We examined the effect of feeding by phytophagous insects on survival of S. enterica on lettuce. Larger S. enterica populations were found on leaves infested with Macrosteles quadrilineatus. In contrast, pathogen populations among plants exposed to Frankliniella occidentalis or Myzus persicae were similar to those without insects. However, on plants infested with F. occidentalis, areas of the infested leaf with feeding damage sustained higher S. enterica populations than areas without damage. The spatial distribution of S. enterica cells on leaves infested with F. occidentalis may be altered resulting in higher populations in feeding lesions or survival may be different across a leaf dependent on local damage. Results suggest the possibility of some specificity with select insects and the persistence of S. enterica. Additionally, we demonstrated the potential for phytophagous insects to become contaminated with S. enterica from contaminated plant material. S. enterica was detected in approximately 50% of all M. quadrilineatus, F. occidentalis, and M. persicae after 24 h exposure to contaminated leaves. Particularly, 17% of F. occidentalis, the smallest of the insects tested, harbored more than 102 CFU/F. occidentalis. Our results show that phytophagous insects may influence the population dynamics of S. enterica in agricultural crops. This study provides evidence of a human bacterial pathogen interacting with phytophagous insect during plant infestation. PMID:24205384

  5. Susceptibility of Adults of the Cerambycid Beetle Hedypathes betulinus to the Entomopathogenic Fungi Beauveria bassiana, Metarhizium anisopliae, and Purpureocillium Lilacinum

    PubMed Central

    Schapovaloff, M. E.; Alves, L. F. A.; Fanti, A. L.; Alzogaray, R. A.; Lastra, C. C. López

    2014-01-01

    The cerambycid beetle Hedypathes betulinus (Klug) (Coleoptera: Cerambycidae) causes severe damage to yerba mate plants (Ilex paraguariensis (St. Hilaire) (Aquifoliales: Aquifoliaceae)), which results in large losses of production. In this study, the pathogenicity of entomopathogenic fungi of the species Beauveria bassiana (Balsamo-Crivelli) Vuillemin (Hypocreales: Cordycipitaceae), Metarhizium anisopliae sensu lato (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae), and Purpureocillium lilacinum (Thom) Luangsa-ard, Hywel-Jones, Houbraken and Samson (Hypocreales: Ophiocordycipitaceae) on yerba mate were evaluated. Fifteen isolates of B. bassiana, two of M. anisopliae, and seven of P. lilacinum on H. betulinus adults were analyzed under laboratory conditions. The raw mortality rate caused by B. bassiana isolates varied from 51.1 to 86.3%, and their LT50 values varied between 8.7 and 13.6 d. The isolates of M. anisopliae caused 69.6–81.8% mortality, and their LT50 values varied between 7.4 and 7.9 d. In contrast, isolates of P. lilacinum were not pathogenic. M. anisopliae and B. bassiana isolates were pathogenic against H. betulinus adults, suggesting that they may be useful in biological control programs for insect pests of yerba mate. PMID:25368071

  6. Emergent insects, pathogens and drought shape changing patterns in oak decline in North America and Europe

    Treesearch

    Laurel J. Haavik; Sharon A. Billings; James M. Guldin; Fred M. Stephen

    2015-01-01

    Forest declines are well-studied phenomena. However, recent patterns suggest that the traditional sequence of events and factors involved in forest decline are changing. Several reports in recent decades involve emergent mortality agents, many of which are native insects and diseases. In addition, changing climate and weather patterns place increasing emphasis on root...

  7. Forgotten natural enemies: interactions between Coccinellids and insect-pathogenic fungi

    USDA-ARS?s Scientific Manuscript database

    The research literature on insect pest species and entomopathogenic fungi is abundant. In stark contrast, little research has been done on the interactions of natural populations of Coccinellidae with entomopathogenic fungi. Most research on entomopathogens and Coccinellidae focuses on the non-tar...

  8. Plant-mediated effects on an insect-pathogen interaction vary with intraspecific genetic variation in plant defences.

    PubMed

    Shikano, Ikkei; Shumaker, Ketia L; Peiffer, Michelle; Felton, Gary W; Hoover, Kelli

    2017-04-01

    Baculoviruses are food-borne microbial pathogens that are ingested by insects on contaminated foliage. Oxidation of plant-derived phenolics, activated by insect feeding, can directly interfere with infections in the gut. Since phenolic oxidation is an important component of plant resistance against insects, baculoviruses are suggested to be incompatible with plant defences. However, plants among and within species invest differently in a myriad of chemical and physical defences. Therefore, we hypothesized that among eight soybean genotypes, some genotypes would be able to maintain both high resistance against an insect pest and high efficacy of a baculovirus. Soybean constitutive (non-induced) and jasmonic acid (JA)-induced (anti-herbivore response) resistance was measured against the fall armyworm Spodoptera frugiperda (weight gain, leaf consumption and utilization). Indicators of phenolic oxidation were measured as foliar phenolic content and peroxidase activity. Levels of armyworm mortality inflicted by baculovirus (SfMNPV) did not vary among soybean genotypes when the virus was ingested with non-induced foliage. Ingestion of the virus on JA-induced foliage reduced armyworm mortality, relative to non-induced foliage, on some soybean genotypes. Baculovirus efficacy was lower when ingested with foliage that contained higher phenolic content and defensive properties that reduced armyworm weight gain and leaf utilization. However, soybean genotypes that defended the plant by reducing consumption rate and strongly deterred feeding upon JA-induction did not reduce baculovirus efficacy, indicating that these defences may be more compatible with baculoviruses to maximize plant protection. Differential compatibility of defence traits with the third trophic level highlights an important cost/trade-off associated with plant defence strategies.

  9. A review of introductions of pathogens and nematodes for classical biological control of insects and mites

    Treesearch

    Ann E. Hajek; Michael L. McManus; Italo Delalibera Junior

    2007-01-01

    Compared with parasitoids and predators, classical biological control programs targeting arthropod pests have used pathogens and nematodes very little. However, some pathogens and nematodes that have been introduced have become established and provided excellent control and have been introduced in increasing numbers of areas over decades, often after distributions of...

  10. Temporal interactions of plant - insect - predator after infection of bacterial pathogen on rice plant

    USDA-ARS?s Scientific Manuscript database

    Pathogenic infection on plants may affect interactions of the host-plants with their herbivores, as well as the herbivores with their predators. In this study, the effects of infection by pathogenic bacterium Xanthomonas oryzae pv. oryzae (Xoo), which causes a vascular disease in rice, in rice plant...

  11. Glycerol-3-Phosphate Acyltransferase Contributes to Triacylglycerol Biosynthesis, Lipid Droplet Formation, and Host Invasion in Metarhizium robertsii

    PubMed Central

    Gao, Qiang; Shang, Yanfang; Huang, Wei

    2013-01-01

    Enzymes involved in the triacylglycerol (TAG) biosynthesis have been well studied in the model organisms of yeasts and animals. Among these, the isoforms of glycerol-3-phosphate acyltransferase (GPAT) redundantly catalyze the first and rate-limiting step in glycerolipid synthesis. Here, we report the functions of mrGAT, a GPAT ortholog, in an insect-pathogenic fungus, Metarhizium robertsii. Unlike in yeasts and animals, a single copy of the mrGAT gene is present in the fungal genome and the gene deletion mutant is viable. Compared to the wild type and the gene-rescued mutant, the ΔmrGAT mutant demonstrated reduced abilities to produce conidia and synthesize TAG, glycerol, and total lipids. More importantly, we found that mrGAT is localized to the endoplasmic reticulum and directly linked to the formation of lipid droplets (LDs) in fungal cells. Insect bioassay results showed that mrGAT is required for full fungal virulence by aiding fungal penetration of host cuticles. Data from this study not only advance our understanding of GPAT functions in fungi but also suggest that filamentous fungi such as M. robertsii can serve as a good model to elucidate the role of the glycerol phosphate pathway in fungal physiology, particularly to determine the mechanistic connection of GPAT to LD formation. PMID:24077712

  12. Variable virulence among isolates of Ascosphaera apis: testing the parasite-pathogen hypothesis for the evolution of polyandry in social insects.

    PubMed

    Lee, G M; McGee, P A; Oldroyd, B P

    2013-03-01

    The queens of many eusocial insect species are polyandrous. The evolution of polyandry from ancestral monoandry is intriguing because polyandry undermines the kin-selected benefits of high intracolonial relatedness that are understood to have been central to the evolution of eusociality. An accumulating body of evidence suggests that polyandry evolved from monoandry in part because genetically diverse colonies better resist infection by pathogens. However, a core assumption of the "parasite-pathogen hypothesis", that there is variation in virulence among strains of pathogens, remains largely untested in vivo. Here, we demonstrate variation in virulence among isolates of Ascosphaera apis, the causative organism of chalkbrood disease in its honey bee (Apis mellifera) host. More importantly, we show a pathogen-host genotypic interaction for resistance and pathogenicity. Our findings therefore support the parasite-parasite hypothesis as a factor in the evolution of polyandry among eusocial insects.

  13. Variable virulence among isolates of Ascosphaera apis: testing the parasite-pathogen hypothesis for the evolution of polyandry in social insects

    NASA Astrophysics Data System (ADS)

    Lee, G. M.; McGee, P. A.; Oldroyd, B. P.

    2013-03-01

    The queens of many eusocial insect species are polyandrous. The evolution of polyandry from ancestral monoandry is intriguing because polyandry undermines the kin-selected benefits of high intracolonial relatedness that are understood to have been central to the evolution of eusociality. An accumulating body of evidence suggests that polyandry evolved from monoandry in part because genetically diverse colonies better resist infection by pathogens. However, a core assumption of the "parasite-pathogen hypothesis", that there is variation in virulence among strains of pathogens, remains largely untested in vivo. Here, we demonstrate variation in virulence among isolates of Ascosphaera apis, the causative organism of chalkbrood disease in its honey bee ( Apis mellifera) host. More importantly, we show a pathogen-host genotypic interaction for resistance and pathogenicity. Our findings therefore support the parasite-parasite hypothesis as a factor in the evolution of polyandry among eusocial insects.

  14. Targeting of insect epicuticular lipids by the entomopathogenic fungus Beauveria bassiana: hydrocarbon oxidation within the context of a host-pathogen interaction

    PubMed Central

    Pedrini, Nicolás; Ortiz-Urquiza, Almudena; Huarte-Bonnet, Carla; Zhang, Shizhu; Keyhani, Nemat O.

    2013-01-01

    Broad host range entomopathogenic fungi such as Beauveria bassiana attack insect hosts via attachment to cuticular substrata and the production of enzymes for the degradation and penetration of insect cuticle. The outermost epicuticular layer consists of a complex mixture of non-polar lipids including hydrocarbons, fatty acids, and wax esters. Long chain hydrocarbons are major components of the outer waxy layer of diverse insect species, where they serve to protect against desiccation and microbial parasites, and as recognition molecules or as a platform for semiochemicals. Insect pathogenic fungi have evolved mechanisms for overcoming this barrier, likely with sets of lipid degrading enzymes with overlapping substrate specificities. Alkanes and fatty acids are substrates for a specific subset of fungal cytochrome P450 monooxygenases involved in insect hydrocarbon degradation. These enzymes activate alkanes by terminal oxidation to alcohols, which are further oxidized by alcohol and aldehyde dehydrogenases, whose products can enter β-oxidation pathways. B. bassiana contains at least 83 genes coding for cytochrome P450s (CYP), a subset of which are involved in hydrocarbon oxidation, and several of which represent new CYP subfamilies/families. Expression data indicated differential induction by alkanes and insect lipids and four CYP proteins have been partially characterized after heterologous expression in yeast. Gene knockouts revealed a phenotype for only one (cyp52X1) out of six genes examined to date. CYP52X1 oxidizes long chain fatty acids and participates in the degradation of specific epicuticular lipid components needed for breaching the insect waxy layer. Examining the hydrocarbon oxidizing CYP repertoire of pathogens involved in insect epicuticle degradation can lead to the characterization of enzymes with novel substrate specificities. Pathogen targeting may also represent an important co-evolutionary process regarding insect cuticular hydrocarbon

  15. Topography and Land Cover of Watersheds Predicts the Distribution of the Environmental Pathogen Mycobacterium ulcerans in Aquatic Insects

    PubMed Central

    Carolan, Kevin; Garchitorena, Andres; García-Peña, Gabriel E.; Morris, Aaron; Landier, Jordi; Fontanet, Arnaud; Le Gall, Philippe; Texier, Gaëtan; Marsollier, Laurent; Gozlan, Rodolphe E.; Eyangoh, Sara; Lo Seen, Danny; Guégan, Jean-Francois

    2014-01-01

    Background An understanding of the factors driving the distribution of pathogens is useful in preventing disease. Often we achieve this understanding at a local microhabitat scale; however the larger scale processes are often neglected. This can result in misleading inferences about the distribution of the pathogen, inhibiting our ability to manage the disease. One such disease is Buruli ulcer, an emerging neglected tropical disease afflicting many thousands in Africa, caused by the environmental pathogen Mycobacterium ulcerans. Herein, we aim to describe the larger scale landscape process describing the distribution of M. ulcerans. Methodology Following extensive sampling of the community of aquatic macroinvertebrates in Cameroon, we select the 5 dominant insect Orders, and conduct an ecological niche model to describe how the distribution of M. ulcerans positive insects changes according to land cover and topography. We then explore the generalizability of the results by testing them against an independent dataset collected in a second endemic region, French Guiana. Principal Findings We find that the distribution of the bacterium in Cameroon is accurately described by the land cover and topography of the watershed, that there are notable seasonal differences in distribution, and that the Cameroon model does not predict the distribution of M. ulcerans in French Guiana. Conclusions/Significance Future studies of M. ulcerans would benefit from consideration of local structure of the local stream network in future sampling, and further work is needed on the reasons for notable differences in the distribution of this species from one region to another. This work represents a first step in the identification of large-scale environmental drivers of this species, for the purposes of disease risk mapping. PMID:25375173

  16. Emergence and evolution of Arsenophonus bacteria as insect-vectored plant pathogens.

    PubMed

    Bressan, Alberto

    2014-03-01

    Arsenophonus bacteria are among the most biologically diverse and widespread endosymbionts of arthropods. Notably, two species, Phlomobacter fragariae and Arsenophonus phytopathogenicus, have been characterized as phloem-restricted plant pathogens that are obligatorily transmitted by and hosted in planthoppers of the family Cixiidae (Hemiptera: Auchenorrhyncha). Here, I review the current understanding on the lifestyle transition, evolution, host interaction, and infection cycles of these emerging plant pathogens.

  17. Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal.

    PubMed

    Martini, Xavier; Hoffmann, Mark; Coy, Monique R; Stelinski, Lukasz L; Pelz-Stelinski, Kirsten S

    2015-01-01

    The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas) affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama). CLas is the putative causal agent of huanglongbing (HLB), which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies.

  18. Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal

    PubMed Central

    Coy, Monique R.; Stelinski, Lukasz L.; Pelz-Stelinski, Kirsten S.

    2015-01-01

    The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas) affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama). CLas is the putative causal agent of huanglongbing (HLB), which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies. PMID:26083763

  19. Trajectory and genomic determinants of fungal-pathogen speciation and host adaptation

    PubMed Central

    Hu, Xiao; Xiao, Guohua; Zheng, Peng; Shang, Yanfang; Su, Yao; Zhang, Xinyu; Liu, Xingzhong; Zhan, Shuai; St. Leger, Raymond J.

    2014-01-01

    Much remains unknown regarding speciation. Host–pathogen interactions are a major driving force for diversification, but the genomic basis for speciation and host shifting remains unclear. The fungal genus Metarhizium contains species ranging from specialists with very narrow host ranges to generalists that attack a wide range of insects. By genomic analyses of seven species, we demonstrated that generalists evolved from specialists via transitional species with intermediate host ranges and that this shift paralleled insect evolution. We found that specialization was associated with retention of sexuality and rapid evolution of existing protein sequences whereas generalization was associated with protein-family expansion, loss of genome-defense mechanisms, genome restructuring, horizontal gene transfer, and positive selection that accelerated after reinforcement of reproductive isolation. These results advance understanding of speciation and genomic signatures that underlie pathogen adaptation to hosts. PMID:25368161

  20. Development of a population-based threshold model of conidial germination for analysing the effects of physiological manipulation on the stress tolerance and infectivity of insect pathogenic fungi.

    PubMed

    Andersen, M; Magan, N; Mead, A; Chandler, D

    2006-09-01

    Entomopathogenic fungi are being used as biocontrol agents of insect pests, but their efficacy can be poor in environments where water availability is reduced. In this study, the potential to improve biocontrol by physiologically manipulating fungal inoculum was investigated. Cultures of Beauveria bassiana, Lecanicillium muscarium, Lecanicillium longisporum, Metarhizium anisopliae and Paecilomyces fumosoroseus were manipulated by growing them under conditions of water stress, which produced conidia with increased concentrations of erythritol. The time-course of germination of conidia at different water activities (water activity, aw) was described using a generalized linear model, and in most cases reducing the water activity of the germination medium delayed the onset of germination without affecting the distribution of germination times. The germination of M. anisopliae, L. muscarium, L. longisporum and P. fumosoroseus was accelerated over a range of aw levels as a result of physiological manipulation. However, the relationship between the effect of physiological manipulation on germination and the osmolyte content of conidia varied according to fungal species. There was a linear relationship between germination rate, expressed as the reciprocal of germination time, and aw of the germination medium, but there was no significant effect of fungal species or physiological manipulation on the aw threshold for germination. In bioassays with M. anisopliae, physiologically manipulated conidia germinated more rapidly on the surface of an insect host, the melon cotton aphid Aphis gossypii, and fungal virulence was increased even when relative humidity was reduced after an initial high period. It is concluded that physiological manipulation may lead to improvements in biocontrol in the field, but choice of fungal species/isolate will be critical. In addition, the population-based threshold model used in this study, which considered germination in terms of physiological

  1. Pinellia ternata agglutinin expression in chloroplasts confers broad spectrum resistance against aphid, whitefly, Lepidopteran insects, bacterial and viral pathogens

    PubMed Central

    Jin, Shuangxia; Zhang, Xianlong; Daniell, Henry

    2012-01-01

    Summary Broad spectrum protection against different insects and pathogens requires multigene engineering. However, such broad spectrum protection against biotic stress is provided by a single protein in some medicinal plants. Therefore, tobacco chloroplasts were transformed with the agglutinin gene from Pinellia ternata (pta), a widely cultivated Chinese medicinal herb. Pinellia ternata agglutinin (PTA) was expressed up to 9.2% of total soluble protein in mature leaves. Purified PTA showed similar hemagglutination activity as snowdrop lectin. Artificial diet with purified PTA from transplastomic plants showed marked and broad insecticidal activity. In planta bioassays conducted with T0 or T1 generation PTA lines showed that the growth of aphid Myzus persicae (Sulzer) was reduced by 89%–92% when compared with untransformed (UT) plants. Similarly, the larval survival and total population of whitefly (Bemisia tabaci) on transplastomic lines were reduced by 91%–93% when compared with UT plants. This is indeed the first report of lectin controlling whitefly infestation. When transplastomic PTA leaves were fed to corn earworm (Helicoverpa zea), tobacco budworm (Heliothis virescens) or the beet armyworm (spodoptera exigua), 100% mortality was observed against all these three insects. In planta bioassays revealed Erwinia population to be 10 000-fold higher in control than in PTA lines. Similar results were observed with tobacco mosaic virus (TMV) challenge. Therefore, broad spectrum resistance to homopteran (sap-sucking), Lepidopteran insects as well as anti-bacterial or anti-viral activity observed in PTA lines provides a new option to engineer protection against biotic stress by hyper-expression of an unique protein that is naturally present in a medicinal plant. PMID:22077160

  2. Safe housing ensured by an electric field screen that excludes insect-net permeating haematophagous mosquitoes carrying human pathogens

    NASA Astrophysics Data System (ADS)

    Matsuda, Y.; Kakutani, K.; Nonomura, T.; Kimbara, J.; Osamura, K.; Kusakar, S.; Toyoda, H.

    2015-10-01

    An electric field screen can be used to keep mosquitoes out of houses with open windows. In this study, doubly charged dipolar electric field screens (DD-screens) were used to capture mosquitoes entering through a window. The screen had two components: three layers of insulated conductor iron wires (ICWs) in parallel arrays and two electrostatic direct current (DC) voltage generators that supplied negative or positive voltages to the ICWs. Within each layer, the ICWs were parallel at 5-mm intervals, and connected to each other and to a negative or positive voltage generator. The negatively and positively charged ICWs are represented as ICW(-) and ICW(+), respectively. The screen consisted of one ICW(+) layer with an ICW(-) layer on either side. The Asian tiger mosquito (Aedes albopictus) and house mosquito (Culex pipiens) were used as models of vectors carrying viral pathogens. Adult mosquitoes were blown into the space between the ICWs by sending compressed air through the tip of an insect aspirator to determine the voltage range that captured all of the test insects. Wind speed was measured at the surface of the ICW using a sensitive anemometer. The result showed that at ≥ 1.2 kV, the force was strong enough that the ICWs captured all of the mosquitoes, despite a wind speed of 7 m/s. Therefore, the DD-screen could serve as a physical barrier to prevent noxious mosquitoes from entering houses with good air penetration.

  3. Transcriptional control of fungal cell cycle and cellular events by Fkh2, a forkhead transcription factor in an insect pathogen

    PubMed Central

    Wang, Juan-Juan; Qiu, Lei; Cai, Qing; Ying, Sheng-Hua; Feng, Ming-Guang

    2015-01-01

    Transcriptional control of the cell cycle by forkhead (Fkh) transcription factors is likely associated with fungal adaptation to host and environment. Here we show that Fkh2, an ortholog of yeast Fkh1/2, orchestrates cell cycle and many cellular events of Beauveria bassiana, a filamentous fungal insect pathogen. Deletion of Fkh2 in B. bassiana resulted in dramatic down-regulation of the cyclin-B gene cluster and hence altered cell cycle (longer G2/M and S, but shorter G0/G1, phases) in unicellular blastospores. Consequently, ΔFkh2 produced twice as many, but smaller, blastospores than wild-type under submerged conditions, and formed denser septa and shorter/broader cells in aberrantly branched hyphae. In these hyphae, clustered genes required for septation and conidiation were remarkedly up-regulated, followed by higher yield and slower germination of aerial conidia. Moreover, ΔFkh2 displayed attenuated virulence and decreased tolerance to chemical and environmental stresses, accompanied with altered transcripts and activities of phenotype-influencing proteins or enzymes. All the changes in ΔFkh2 were restored by Fkh2 complementation. All together, Fkh2-dependent transcriptional control is vital for the adaptation of B. bassiana to diverse habitats of host insects and hence contributes to its biological control potential against arthropod pests. PMID:25955538

  4. The pathogen causing Dutch elm disease makes host trees attract insect vectors

    PubMed Central

    McLeod, Geoff; Gries, Regine; von Reuß, Stephan H; Rahe, James E; McIntosh, Rory; König, Wilfried A; Gries, Gerhard

    2005-01-01

    Dutch elm disease is caused by the fungal pathogen Ophiostoma novo-ulmi which is transmitted by the native elm bark beetle, Hylurgopinus rufipes. We have found that four semiochemicals (the monoterpene (−)-β-pinene and the sesquiterpenes (−)-α-cubebene, (+)-spiroaxa-5,7-diene and (+)-δ-cadinene) from diseased American elms, Ulmus americana, synergistically attract H. rufipes, and that sesquiterpene emission is upregulated in elm trees inoculated with O. novo-ulmi. The fungus thus manipulates host trees to enhance their apparency to foraging beetles, a strategy that increases the probability of transportation of the pathogen to new hosts. PMID:16271975

  5. Interactions Within Susceptible Hosts Drive Establishment of Genetically Distinct Variants of an Insect-Borne Pathogen.

    PubMed

    Blaisdell, G K; Zhang, S; Bratburd, J R; Daane, K M; Cooper, M L; Almeida, R P P

    2015-08-01

    Coinfections are common, leading to pathogen interactions during transmission and establishment in a host. However, few studies have tested the relative strengths of pathogen interactions in vectors and hosts that determine the outcome of infection. We tested interactions between two genetically distinct variants of the mealybug-transmitted Grapevine leafroll-associated virus 3. The transmission efficiency of each variant in single variant inoculations by two vector species was determined. The effects of vector species, a coinfected source, and simultaneous inoculation from multiple hosts to one host on variant establishment were examined. Within-vector interactions could have a role in transmission from hosts containing mixed infections, but not when vectors were moved from separate singly infected source plants to a single recipient plant. The invasive Planococcus ficus (Signoret) was a more efficient vector than Pseudococcus viburni (Signoret). Transmission efficiency of the two variants did not differ in single variant inoculations. Overall infections were the same whether from singly or coinfected source plants. In mixed inoculations, establishment of one variant was reduced. Mixed inoculations from two singly infected source plants resulted in fewer mixed infections than expected by chance. Therefore, the observed outcome was determined subsequent to host inoculation rather than in the vector. The outcome may be due to resource competition between pathogens. Alternatively apparent competition may be responsible; the pathogens' differential ability to overcome host defenses and colonize the host may determine the final outcome of new infections. Detailed knowledge of interactions between pathogens during transmission and establishment could improve understanding and management of disease spread.

  6. Sensitivity ofBeauveria bassiana to solanine and tomatine : Plant defensive chemicals inhibit an insect pathogen.

    PubMed

    Costa, S D; Gaugler, R R

    1989-02-01

    The alkaloids solanine and tomatine and the polyene antibiotic nystatin were tested in vitro against the entomopathogenic fungusBeauveria bassiana. Nystatin was the most inhibitory compound tested, reducing colony formation, growth, and development of conidiaphores to a greater degree and at lower concentrations than the alkaloids. Tomatine inhibited colony formation and growth more than solanine, which had relatively little effect on the fungus. The toxicity of tomatine suggests that germination of conidia and subsequent hyphal growth would be inhibited when an insect consumes conidia along with foliage containing 0.100 mg/g (fresh weight) of this compound. The sensitivity ofB. bassiana to alkaloids appears to be in the middle of the range found with other fungi.

  7. A plant pathogenic bacterium exploits the tricarboxylic acid cycle metabolic pathway of its insect vector.

    PubMed

    Killiny, Nabil; Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I

    2017-06-08

    Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L-serine, L-threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L-proline, L-aspartic acid, and L-pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L-proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector.

  8. Isolation of a nitrogen response regulator gene (nrr1) from Metarhizium anisopliae.

    PubMed

    Screen, S; Bailey, A; Charnley, K; Cooper, R; Clarkson, J

    1998-10-09

    Attempts to improve the effectiveness of entomopathogenic fungi as biological control agents require a clear understanding of the pathogenicity determinants at both the biochemical and molecular level. Proteases play a key role in entomopathogenicity, allowing the fungus to penetrate the insect cuticle and rapidly invade the host. The most extensively studied of these protease activities, PR1A and PR2, are both subject to nitrogen derepression. The Metarhizium anisopliae nrr1 (nitrogen response regulator 1) gene was identified using a PCR-based strategy; it encodes a putative DNA-binding protein with a single zinc finger motif defined by the C-X2-C-X17-C-X2-C sequence. M. anisopliae NRR1 shows a significant sequence similarity to Neurospora crassa NIT2. Sequence analysis identified the presence of two introns, suggesting a greater degree of similarity to N. crassa nit2 than to the areA-like genes that have been identified. However, functional equivalence of nrr1 to areA was demonstrated, by co-transformation and complementation of an A. nidulans areA loss-of-function mutant (areA18 argB2 pabaA1 inoB2) with the M. anisopliae nrr1 gene. The areA-/nrr1+ Aspergillus transformants were able to grow on media with nitrate and glutamate as the sole nitrogen source, whereas the areA- strain is unable to grow under these conditions. The possible relevance of nitrogen regulation to pathogenicity is discussed.

  9. Linking fruit traits to variation in predispersal vertebrate seed predation, insect seed predation, and pathogen attack.

    PubMed

    Beckman, Noelle G; Muller-Landau, Helene C

    2011-11-01

    The importance of vertebrates, invertebrates, and pathogens for plant communities has long been recognized, but their absolute and relative importance in early recruitment of multiple coexisting tropical plant species has not been quantified. Further, little is known about the relationship of fruit traits to seed mortality due to natural enemies in tropical plants. To investigate the influences of vertebrates, invertebrates, and pathogens on reproduction of seven canopy plant species varying in fruit traits, we quantified reductions in fruit development and seed germination due to vertebrates, invertebrates, and fungal pathogens through experimental removal of these enemies using canopy exclosures, insecticide, and fungicide, respectively. We also measured morphological fruit traits hypothesized to mediate interactions of plants with natural enemies of seeds. Vertebrates, invertebrates, and fungi differentially affected predispersal seed mortality depending on the plant species. Fruit morphology explained some variation among species; species with larger fruit and less physical protection surrounding seeds exhibited greater negative effects of fungi on fruit development and germination and experienced reduced seed survival integrated over fruit development and germination in response to vertebrates. Within species, variation in seed size also contributed to variation in natural enemy effects on seed viability. Further, seedling growth was higher for seeds that developed in vertebrate exclosures for Anacardium excelsum and under the fungicide treatment for Castilla elastica, suggesting that predispersal effects of natural enemies may carry through to the seedling stage. This is the first experimental test of the relative effects of vertebrates, invertebrates, and pathogens on seed survival in the canopy. This study motivates further investigation to determine the generality of our results for plant communities. If there is strong variation in natural enemy attack

  10. Factors affecting the initial adhesion and retention of the plant pathogen Xylella fastidiosa in the foregut of an insect vector.

    PubMed

    Killiny, Nabil; Almeida, Rodrigo P P

    2014-01-01

    Vector transmission of bacterial plant pathogens involves three steps: pathogen acquisition from an infected host, retention within the vector, and inoculation of cells into susceptible tissue of an uninfected plant. In this study, a combination of plant and artificial diet systems were used to determine the importance of several genes on the initial adhesion and retention of the bacterium Xylella fastidiosa to an efficient insect vector. Mutant strains included fimbrial (fimA and pilB) and afimbrial (hxfA and hxfB) adhesins and three loci involved in regulatory systems (rpfF, rpfC, and cgsA). Transmission assays with variable retention time indicated that HxfA and HxfB were primarily important for early adhesion to vectors, while FimA was necessary for both adhesion and retention. The long pilus protein PilB was not deficient in initial adhesion but may be important for retention. Genes upregulated under the control of rpfF are important for both initial adhesion and retention, as transmission rates of this mutant strain were initially low and decreased over time, while disruption of rpfC and cgsA yielded trends similar to that shown by the wild-type control. Because induction of an X. fastidiosa transmissible state requires pectin, a series of experiments were used to test the roles of a polygalacturonase (pglA) and the pectin and galacturonic acid carbohydrates on the transmission of X. fastidiosa. Results show that galacturonic acid, or PglA activity breaking pectin into its major subunit (galacturonic acid), is required for X. fastidiosa vector transmission using an artificial diet system. This study shows that early adhesion and retention of X. fastidiosa are mediated by different factors. It also illustrates that the interpretation of results of vector transmission experiments, in the context of vector-pathogen interaction studies, is highly dependent on experimental design.

  11. Production of Destruxins from Metarhizium spp. Fungi in Artificial Medium and in Endophytically Colonized Cowpea Plants

    PubMed Central

    Golo, Patrícia S.; Gardner, Dale R.; Grilley, Michelle M.; Takemoto, Jon Y.; Krasnoff, Stuart B.; Pires, Marcus S.; Fernandes, Éverton K. K.; Bittencourt, Vânia R. E. P.; Roberts, Donald W.

    2014-01-01

    Destruxins (DTXs) are cyclic depsipeptides produced by many Metarhizium isolates that have long been assumed to contribute to virulence of these entomopathogenic fungi. We evaluated the virulence of 20 Metarhizium isolates against insect larvae and measured the concentration of DTXs A, B, and E produced by these same isolates in submerged (shaken) cultures. Eight of the isolates (ARSEF 324, 724, 760, 1448, 1882, 1883, 3479, and 3918) did not produce DTXs A, B, or E during the five days of submerged culture. DTXs were first detected in culture medium at 2–3 days in submerged culture. Galleria mellonella and Tenebrio molitor showed considerable variation in their susceptibility to the Metarhizium isolates. The concentration of DTXs produced in vitro did not correlate with percent or speed of insect kill. We established endophytic associations of M. robertsii and M. acridum isolates in Vigna unguiculata (cowpeas) and Cucumis sativus (cucumber) plants. DTXs were detected in cowpeas colonized by M. robertsii ARSEF 2575 12 days after fungal inoculation, but DTXs were not detected in cucumber. This is the first instance of DTXs detected in plants endophytically colonized by M. robertsii. This finding has implications for new approaches to fungus-based biological control of pest arthropods. PMID:25127450

  12. Temporal interactions of plant - insect - predator after infection of bacterial pathogen on rice plants.

    PubMed

    Sun, Ze; Liu, Zhuang; Zhou, Wen; Jin, Huanan; Liu, Hao; Zhou, Aiming; Zhang, Aijun; Wang, Man-Qun

    2016-05-17

    Pathogenic infection on plants may affect interactions of host-plants with their herbivores, as well as the herbivores with their predators. In this study, the effects of infection by pathogenic bacterium Xanthomonas oryzae pv. oryzae (Xoo), which causes a vascular disease in rice, on rice plants and consequent interactions with a rice herbivore, brown rice planthopper (BPH) Nilaparvata lugens, and its major predator, Cyrtorhinus lividipennis, were investigated. The results showed that the rice plants exhibited increased resistance to BPH only at 3 d post-inoculation of Xoo, while the Xoo infection did not affect the development and fecundity of BPH. BPH exhibited a higher preference to Xoo infected rice plants, whereas C. lividipennis preferred the Xoo infected rice plants after BPH fed, but preferred healthy rice plants without BPH fed. Volatile organic compounds emitted from Xoo rice were significantly higher than those from healthy rice plants, Xoo infection on BPH fed plants caused rice plants to emit more the herbivore-induced plant volatiles, while all of these changes correlated to the temporal dimension. These results demonstrated that Xoo infection significantly influenced the interactions of rice plants with two non-vectors, BPH and its predator, although these effects exhibited in a temporal pattern after infection.

  13. Temporal interactions of plant - insect - predator after infection of bacterial pathogen on rice plants

    PubMed Central

    Sun, Ze; Liu, Zhuang; Zhou, Wen; Jin, Huanan; Liu, Hao; Zhou, Aiming; Zhang, Aijun; Wang, Man-Qun

    2016-01-01

    Pathogenic infection on plants may affect interactions of host-plants with their herbivores, as well as the herbivores with their predators. In this study, the effects of infection by pathogenic bacterium Xanthomonas oryzae pv. oryzae (Xoo), which causes a vascular disease in rice, on rice plants and consequent interactions with a rice herbivore, brown rice planthopper (BPH) Nilaparvata lugens, and its major predator, Cyrtorhinus lividipennis, were investigated. The results showed that the rice plants exhibited increased resistance to BPH only at 3 d post-inoculation of Xoo, while the Xoo infection did not affect the development and fecundity of BPH. BPH exhibited a higher preference to Xoo infected rice plants, whereas C. lividipennis preferred the Xoo infected rice plants after BPH fed, but preferred healthy rice plants without BPH fed. Volatile organic compounds emitted from Xoo rice were significantly higher than those from healthy rice plants, Xoo infection on BPH fed plants caused rice plants to emit more the herbivore-induced plant volatiles, while all of these changes correlated to the temporal dimension. These results demonstrated that Xoo infection significantly influenced the interactions of rice plants with two non-vectors, BPH and its predator, although these effects exhibited in a temporal pattern after infection. PMID:27185548

  14. Improving Sterile Insect Technique (SIT) for tsetse flies through research on their symbionts and pathogens

    PubMed Central

    Abd-Alla, Adly M.M.; Bergoin, Max; Parker, Andrew G.; Maniania, Nguya K.; Vlak, Just M.; Bourtzis, Kostas; Boucias, Drion G.; Aksoy, Serap

    2013-01-01

    Tsetse flies (Diptera: Glossinidae) are the cyclical vectors of the trypanosomes, which cause human African trypanosomosis (HAT) or sleeping sickness in humans and African animal trypanosomosis (AAT) or nagana in animals. Due to the lack of effective vaccines and inexpensive drugs for HAT, and the development of resistance of the trypanosomes against the available trypanocidal drugs, vector control remains the most efficient strategy for sustainable management of these diseases. Among the control methods used for tsetse flies, Sterile Insect Technique (SIT), in the frame of area-wide integrated pest management (AW-IPM), represents an effective tactic to suppress and/or eradicate tsetse flies. One constraint in implementing SIT is the mass production of target species. Tsetse flies harbor obligate bacterial symbionts and salivary gland hypertrophy virus which modulate the fecundity of the infected flies. In support of the future expansion of the SIT for tsetse fly control, the Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture implemented a six year Coordinated Research Project (CRP) entitled “Improving SIT for Tsetse Flies through Research on their Symbionts and Pathogens”. The consortium focused on the prevalence and the interaction between the bacterial symbionts and the virus, the development of strategies to manage virus infections in tsetse colonies, the use of entomopathogenic fungi to control tsetse flies in combination with SIT, and the development of symbiont-based strategies to control tsetse flies and trypanosomosis. The results of the CRP and the solutions envisaged to alleviate the constraints of the mass rearing of tsetse flies for SIT are presented in this special issue. PMID:22841636

  15. The Latex Protein MLX56 from Mulberry (Morus multicaulis) Protects Plants against Insect Pests and Pathogens.

    PubMed

    Gai, Ying-Ping; Zhao, Ya-Nan; Zhao, Huai-Ning; Yuan, Chuan-Zhong; Yuan, Shuo-Shuo; Li, Shuo; Zhu, Bing-Sen; Ji, Xian-Ling

    2017-01-01

    Biotic stresses are major constraints limiting the leaf quality and productivity of mulberry. MLX56 is a unique chitin-binding protein isolated from Shin-Ichinose (Morus alba) latex that displays toxicity against lepidopteran caterpillars. In this study, the full-length cDNA encoding MLX56 was isolated from Husang 32 (M. multicaulis) and designated HMLX56. Amino acid sequence analysis and protein modeling of three MLX56 proteins showed that they were highly conserved among Morus species. Tissue expression pattern analysis showed that the HMLX56 gene was strongly expressed in mulberry bark and leaves but only slightly expressed in fruits. In addition, analysis of GUS expression indicated that the promoter of HMLX56 showed higher transcriptional activity along the vascular strands, and its activity can be regulated by various environmental factors. Like the MLX56 protein from M. alba, the HMLX56 protein showed toxicity to Plutella xylostella. Moreover, when the HMLX56 gene was ectopically expressed in Arabidopsis, the transgenic plants showed enhanced resistance to aphids, the fungal pathogen Botrytis cinerea and the bacterial pathogen Pseudomonas syringae pv. tomato DC3000. Our data suggest that the HMLX56 protein has a lectin-like molecular structure consisting of two hevein-like chitin-binding domains which provide not only chitin-binding activities but also other mechanisms of defense. The information provided here improves our understanding of the potential functions and defense mechanisms of MLX56 proteins, enabling in-depth functional analysis of latex exudates and perhaps facilitating mulberry genetic improvement in the future.

  16. The Latex Protein MLX56 from Mulberry (Morus multicaulis) Protects Plants against Insect Pests and Pathogens

    PubMed Central

    Gai, Ying-Ping; Zhao, Ya-Nan; Zhao, Huai-Ning; Yuan, Chuan-Zhong; Yuan, Shuo-Shuo; Li, Shuo; Zhu, Bing-Sen; Ji, Xian-Ling

    2017-01-01

    Biotic stresses are major constraints limiting the leaf quality and productivity of mulberry. MLX56 is a unique chitin-binding protein isolated from Shin-Ichinose (Morus alba) latex that displays toxicity against lepidopteran caterpillars. In this study, the full-length cDNA encoding MLX56 was isolated from Husang 32 (M. multicaulis) and designated HMLX56. Amino acid sequence analysis and protein modeling of three MLX56 proteins showed that they were highly conserved among Morus species. Tissue expression pattern analysis showed that the HMLX56 gene was strongly expressed in mulberry bark and leaves but only slightly expressed in fruits. In addition, analysis of GUS expression indicated that the promoter of HMLX56 showed higher transcriptional activity along the vascular strands, and its activity can be regulated by various environmental factors. Like the MLX56 protein from M. alba, the HMLX56 protein showed toxicity to Plutella xylostella. Moreover, when the HMLX56 gene was ectopically expressed in Arabidopsis, the transgenic plants showed enhanced resistance to aphids, the fungal pathogen Botrytis cinerea and the bacterial pathogen Pseudomonas syringae pv. tomato DC3000. Our data suggest that the HMLX56 protein has a lectin-like molecular structure consisting of two hevein-like chitin-binding domains which provide not only chitin-binding activities but also other mechanisms of defense. The information provided here improves our understanding of the potential functions and defense mechanisms of MLX56 proteins, enabling in-depth functional analysis of latex exudates and perhaps facilitating mulberry genetic improvement in the future. PMID:28878804

  17. Identification of genes differentially expressed by Metarhizium anisopliae growing on Locusta migratoria wings using suppression subtractive hybridization.

    PubMed

    Zhang, Chuanbo; Xia, Yuxian; Li, Zhongyuan

    2011-05-01

    Insect-pathogenic fungi penetrate their hosts directly through the cuticle. To better understand this process, we identified genes that were up-regulated by Metarhizium anisopliae germinating and differentiating on Locusta migratoria wings using suppression subtractive hybridization (SSH). A total of 78 unique expressed sequence tags (ESTs) up-regulated more than twofold during fungal growth on locust wings were identified. Among these 78 ESTs, 30 (38.5%) shared significant similarity with NCBI annotated hypothetical proteins, 16 (20.5%) shared low similarity to known or predicted genes, might represent novel genes, and 32 (41.0%) shared significant similarity with known proteins that are involved in various cell and molecular processes such as cell metabolism, protein metabolism, stress response and defense, and cell structure and function. Semi-quantitative RT-PCR analysis of six randomly selected genes confirmed the SSH results, verifying the fidelity of the SSH data. The results of this study provide novel information on genes expressed during early stages of infection with M. anisopliae, and improve current understanding of fungal pathogenesis.

  18. Horizontal Transmission of Beauveria bassiana (Hypocreales: Cordycipitaceae) and Metarhizium anisopliae (Hypocreales: Clavicipitaceae) in Musca domestica (Diptera: Muscidae).

    PubMed

    Cárcamo, M C; Felchicher, F; Duarte, J P; Bernardi, E; Ribeiro, P B

    2015-08-01

    Beauveria bassiana Vuillemin and Metarhizium anisopliae (Metschnikoff) Sorokin are fungi with potential for controlling Musca domestica L. However, the impact on this dipteral may vary depending on the fungal isolates and the methodology used. This study evaluated the pathogenicity of direct application and horizontal transmission of B. bassiana (CG240) and M. anisopliae (CG34) on adult M. domestica individuals. The impact of B. bassiana and M. anisopliae on M. domestica was evaluated at the concentrations 2 × 10(4), 2 × 10(5), 2 × 10(6), and 2 × 10(7) conidia/ml. Horizontal transmission was also estimated between sexes at different infection periods of the vector insect. The mortality of adult M. domestica individuals directly infected with B. bassiana was above 90%, and the mortality of those infected with M. anisopliae ranged from 25.50 to 97.78%. Horizontal transmission of B. bassiana caused the death of 100% of individuals, in turn, that of M. anisopliae killed 55% of male and 100% of female individuals. Horizontal transmission of fungi was negatively influenced by time. This study shows the potential of these fungi for controlling M. domestica, both with the direct implementation strategy and horizontal transmission. However, field studies are needed to evaluate the capacity to decrease the M. domestica population using these alternatives.

  19. Identification of a new Alcaligenes faecalis strain MOR02 and assessment of its toxicity and pathogenicity to insects.

    PubMed

    Quiroz-Castañeda, Rosa Estela; Mendoza-Mejía, Ared; Obregón-Barboza, Verónica; Martínez-Ocampo, Fernando; Hernández-Mendoza, Armando; Martínez-Garduño, Felipe; Guillén-Solís, Gabriel; Sánchez-Rodríguez, Federico; Peña-Chora, Guadalupe; Ortíz-Hernández, Laura; Gaytán-Colín, Paul; Dantán-González, Edgar

    2015-01-01

    We report the isolation of a bacterium from Galleria mellonella larva and its identification using genome sequencing and phylogenomic analysis. This bacterium was named Alcaligenes faecalis strain MOR02. Microscopic analyses revealed that the bacteria are located in the esophagus and intestine of the nematodes Steinernema feltiae, S. carpocapsae, and H. bacteriophora. Using G. mellonella larvae as a model, when the larvae were injected with 24,000 CFU in their hemocoel, more than 96% mortality was achieved after 24 h. Additionally, toxicity assays determined that 1 μg of supernatant extract from A. faecalis MOR02 killed more than 70% G. mellonella larvae 96 h after injection. A correlation of experimental data with sequence genome analyses was also performed. We discovered genes that encode proteins and enzymes that are related to pathogenicity, toxicity, and host/environment interactions that may be responsible for the observed phenotypic characteristics. Our data demonstrates that the bacteria are able to use different strategies to colonize nematodes and kill insects to their own benefit. However, there remains an extensive group of unidentified microorganisms that could be participating in the infection process. Additionally, a nematode-bacterium association could be established probably as a strategy of dispersion and colonization.

  20. Laboratory evaluation of three strains of the entomopathogenic fungus Metarhizium anisopliae for controlling Dermanyssus gallinae.

    PubMed

    Tavassoli, M; Ownag, A; Pourseyed, S H; Mardani, K

    2008-06-01

    The pathogenicity of three strains of the entomopathogenic fungus Metarhizium anisopliae on different life stages of Dermanyssus gallinae was evaluated in the laboratory. All the strains tested were virulent to D. gallinae but pathogenicity varied among the strains. Strain V245 induced a higher mortality rate using different concentrations than other two strains. The estimated median lethal concentration of different strains of M. anisopliae against D. gallinae varied depending on the exposure time of D. gallinae to M. anisopliae. It was concluded that the pathogenicity of the entomopathogenic fungus M. anisopliae on different life stages of D. gallinae was concentration and time dependent.

  1. Basic Leucine Zipper (bZIP) Domain Transcription Factor MBZ1 Regulates Cell Wall Integrity, Spore Adherence, and Virulence in Metarhizium robertsii *

    PubMed Central

    Huang, Wei; Shang, Yanfang; Chen, Peilin; Cen, Kai; Wang, Chengshu

    2015-01-01

    Transcription factors (TFs) containing the basic leucine zipper (bZIP) domain are widely distributed in eukaryotes and display an array of distinct functions. In this study, a bZIP-type TF gene (MBZ1) was deleted and functionally characterized in the insect pathogenic fungus Metarhizium robertsii. The deletion mutant (ΔMBZ1) showed defects in cell wall integrity, adhesion to hydrophobic surfaces, and topical infection of insects. Relative to the WT, ΔMBZ1 was also impaired in growth and conidiogenesis. Examination of putative target gene expression indicated that the genes involved in chitin biosynthesis were differentially transcribed in ΔMBZ1 compared with the WT, which led to the accumulation of a higher level of chitin in mutant cell walls. MBZ1 exhibited negative regulation of subtilisin proteases, but positive control of an adhesin gene, which is consistent with the observation of effects on cell autolysis and a reduction in spore adherence to hydrophobic surfaces in ΔMBZ1. Promoter binding assays indicated that MBZ1 can bind to different target genes and suggested the possibility of heterodimer formation to increase the diversity of the MBZ1 regulatory network. The results of this study advance our understanding of the divergence of bZIP-type TFs at both intra- and interspecific levels. PMID:25673695

  2. Histopathology Caused by the Entomopathogenic Fungi, Beauveria bassiana and Metarhizium anisopliae, in the Adult Planthopper, Peregrinus maidis, a Maize Virus Vector

    PubMed Central

    Toledo, A.V.; de Remes Lenicov, A.M.M.; López Lastra, C.C.

    2010-01-01

    The planthopper Peregrinus maidis (Ashmead) (Hemiptera: Delphacidae) is an important vector of maize viruses in tropical and subtropical areas. Planthoppers are biologically controlled with several species of entomopathogenic fungi that have been isolated from these insect pests of rice in Asia. Beauveria bassiana (Balsamo-Crivelli) Vuillemin and Metarhizium anisopliae (Metschnikoff) Sorokin (Hypocreales: Clavicipitaceae) appear to be the most useful against planthoppers because of their ease of mass production, storage, virulence, and application. In the present study, adults of P. maidis infected with B. bassiana and M. anisopliae were observed under light and scanning electron microscopy to characterize morphologically the process of infection and the development of these fungi, prior to and after the death of the host. The hydrophobic conidia of both fungal species were able to attach to all body regions, with a preference for surfaces containing hairs. Few germinated conidia were observed on the insect's body surface at 24, 48, and 72 hr post-inoculation. On the cuticular surface of P. maidis treated with B. bassiana and M. anisopliae, bacillus-like bacteria were observed. These microorganisms could be interacting with fungal conidia, playing a role of antibiosis that will not allow the fungal pathogens to germinate and penetrate. In the colonization events observed in this study, the formation and multiplication of hyphal bodies by both fungal species inside the host's body was noted. The host's whole body was invaded by hyphae between five and six days post-inoculation, and body fat was the most affected tissue. PMID:20578956

  3. Basic leucine zipper (bZIP) domain transcription factor MBZ1 regulates cell wall integrity, spore adherence, and virulence in Metarhizium robertsii.

    PubMed

    Huang, Wei; Shang, Yanfang; Chen, Peilin; Cen, Kai; Wang, Chengshu

    2015-03-27

    Transcription factors (TFs) containing the basic leucine zipper (bZIP) domain are widely distributed in eukaryotes and display an array of distinct functions. In this study, a bZIP-type TF gene (MBZ1) was deleted and functionally characterized in the insect pathogenic fungus Metarhizium robertsii. The deletion mutant (ΔMBZ1) showed defects in cell wall integrity, adhesion to hydrophobic surfaces, and topical infection of insects. Relative to the WT, ΔMBZ1 was also impaired in growth and conidiogenesis. Examination of putative target gene expression indicated that the genes involved in chitin biosynthesis were differentially transcribed in ΔMBZ1 compared with the WT, which led to the accumulation of a higher level of chitin in mutant cell walls. MBZ1 exhibited negative regulation of subtilisin proteases, but positive control of an adhesin gene, which is consistent with the observation of effects on cell autolysis and a reduction in spore adherence to hydrophobic surfaces in ΔMBZ1. Promoter binding assays indicated that MBZ1 can bind to different target genes and suggested the possibility of heterodimer formation to increase the diversity of the MBZ1 regulatory network. The results of this study advance our understanding of the divergence of bZIP-type TFs at both intra- and interspecific levels. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. New ex vivo reporter assay system reveals that σ factors of an unculturable pathogen control gene regulation involved in the host switching between insects and plants.

    PubMed

    Ishii, Yoshiko; Kakizawa, Shigeyuki; Oshima, Kenro

    2013-08-01

    Analysis of the environmental regulation of bacterial gene expression is important for understanding the nature, pathogenicity, and infection route of many pathogens. "Candidatus Phytoplasma asteris", onion yellows strain M (OY-M), is a phytopathogenic bacterium that is able to adapt to quite different host environments, including plants and insects, with a relatively small ~850 kb genome. The OY-M genome encodes two sigma (σ) factors, RpoD and FliA, that are homologous to Escherichia coli σ(70) and σ(28) , respectively. Previous studies show that gene expression of OY-M dramatically changes upon the response to insect and plant hosts. However, very little is known about the relationship between the two σ factors and gene regulatory systems in OY-M, because phytoplasma cannot currently be cultured in vitro. Here, we developed an Escherichia coli-based ex vivo reporter assay (EcERA) system to evaluate the transcriptional induction of phytoplasmal genes by the OY-M-derived σ factors. EcERA revealed that highly expressed genes in insect and plant hosts were regulated by RpoD and FliA, respectively. We also demonstrated that rpoD expression was significantly higher in insect than in plant hosts and fliA expression was similar between the hosts. These data indicate that phytoplasma-derived RpoD and FliA play key roles in the transcriptional switching mechanism during host switching between insects and plants. Our study will be invaluable to understand phytoplasmal transmission, virulence expression in plants, and the effect of infection on insect fitness. In addition, the novel EcERA system could be broadly applied to reveal transcriptional regulation mechanisms in other unculturable bacteria.

  5. Distribution and occurrence of the insect pathogenic alga Helicosporidium sp. (Chlorophyta: Trebouxiophyceae) in the predator beetle Rhizophagus grandis G: yll. (Coleoptera: Rhizophagidae)-rearing laboratories.

    PubMed

    Yaman, M; Tosun, O; Aydın, C; Ertürk, O

    2011-01-01

    The distribution and occurrence of the insect pathogenic algae Helicosporidium sp. (Chlorophyta: Trebouxiophyceae) in the predator beetle Rhizophagus grandis (Coleoptera: Rhizophagidae)-rearing laboratories were studied and reported here for the first time. The insect pathogenic alga Helicosporidium sp. infection was observed in all R. grandis-rearing laboratories. The infection rate reached more than 20% which is significant among the samples in some R. grandis-rearing laboratories. The infection rates of the examined beetles showed noticeable differences between localities and years. There was no significant difference in the infection levels of male and female beetles. These results showed that Helicosporidium sp. is one of the factors that decrease efficiency of the R. grandis-rearing laboratories.

  6. Test Plan for the Large-Scale Operations Management Test of Insects and Pathogens for Control of Water Hyacinth in Louisiana.

    DTIC Science & Technology

    1979-06-01

    north end of Lake Concordia in Concordia Parish, Louisiana, and filled with waterhyacinth plants col- lected from the population that grows naturally on... naturally occurring Arzama as a control agent for waterhyacinth lies in its temporary or seasonal effects on large plants . Research on procedures for...identify by block numiber) Aquatic plant control Waterhyacinths Insects Management methods Pathogens ft AWACT (Cmaonmo ee ebbMs san Ilmend identify by block

  7. Induced Release of a Plant-Defense Volatile ‘Deceptively’ Attracts Insect Vectors to Plants Infected with a Bacterial Pathogen

    PubMed Central

    Mann, Rajinder S.; Ali, Jared G.; Hermann, Sara L.; Tiwari, Siddharth; Pelz-Stelinski, Kirsten S.; Alborn, Hans T.; Stelinski, Lukasz L.

    2012-01-01

    Transmission of plant pathogens by insect vectors is a complex biological process involving interactions between the plant, insect, and pathogen. Pathogen-induced plant responses can include changes in volatile and nonvolatile secondary metabolites as well as major plant nutrients. Experiments were conducted to understand how a plant pathogenic bacterium, Candidatus Liberibacter asiaticus (Las), affects host preference behavior of its psyllid (Diaphorina citri Kuwayama) vector. D. citri were attracted to volatiles from pathogen-infected plants more than to those from non-infected counterparts. Las-infected plants were more attractive to D. citri adults than non-infected plants initially; however after feeding, psyllids subsequently dispersed to non-infected rather than infected plants as their preferred settling point. Experiments with Las-infected and non-infected plants under complete darkness yielded similar results to those recorded under light. The behavior of psyllids in response to infected versus non-infected plants was not influenced by whether or not they were carriers of the pathogen. Quantification of volatile release from non-infected and infected plants supported the hypothesis that odorants mediate psyllid preference. Significantly more methyl salicylate, yet less methyl anthranilate and D-limonene, was released by infected than non-infected plants. Methyl salicylate was attractive to psyllids, while methyl anthranilate did not affect their behavior. Feeding on citrus by D. citri adults also induced release of methyl salicylate, suggesting that it may be a cue revealing location of conspecifics on host plants. Infected plants were characterized by lower levels of nitrogen, phosphorus, sulfur, zinc, and iron, as well as, higher levels of potassium and boron than non-infected plants. Collectively, our results suggest that host selection behavior of D. citri may be modified by bacterial infection of plants, which alters release of specific headspace

  8. Exposure of Bed Bugs to Metarhizium anisopliae at Different Humidities.

    PubMed

    Ulrich, Kevin R; Feldlaufer, Mark F; Kramer, Matthew; St Leger, Raymond J

    2014-12-01

    Bed bugs Cimex lectularius L. were exposed to conidia (spores) of the entomopathogenic fungus Metarhizium anisopliae by feeding, aerosol spray, or contact with a treated surface. Feeding experiments demonstrated that bed bugs were innately susceptible to this fungus. However, only at 98% humidity were mortality rates high, regardless of whether bed bugs were sprayed with a fungal solution or contacted a treated surface. Mortality in treated bed bugs at ambient humidity did not increase when these bed bugs were kept in aggregation with other bed bugs that had recently blood fed to repletion. Based on these laboratory studies, we conclude that M. anisopliae is a poor pathogen for use in control of bed bugs, particularly at humidities that would likely be encountered under field conditions.

  9. Melanization and Pathogenicity in the Insect, Tenebrio molitor, and the Crustacean, Pacifastacus leniusculus, by Aeromonas hydrophila AH-3

    PubMed Central

    Noonin, Chadanat; Jiravanichpaisal, Pikul; Söderhäll, Irene; Merino, Susana; Tomás, Juan M.; Söderhäll, Kenneth

    2010-01-01

    Aeromonas hydrophila is the most common Aeromonas species causing infections in human and other animals such as amphibians, reptiles, fish and crustaceans. Pathogenesis of Aeromonas species have been reported to be associated with virulence factors such as lipopolysaccharides (LPS), bacterial toxins, bacterial secretion systems, flagella, and other surface molecules. Several mutant strains of A. hydrophila AH-3 were initially used to study their virulence in two animal species, Pacifastacus leniusculus (crayfish) and Tenebrio molitor larvae (mealworm). The AH-3 strains used in this study have mutations in genes involving the synthesis of flagella, LPS structures, secretion systems, and some other factors, which have been reported to be involved in A. hydrophila pathogenicity. Our study shows that the LPS (O-antigen and external core) is the most determinant A. hydrophila AH-3 virulence factor in both animals. Furthermore, we studied the immune responses of these hosts to infection of virulent or non-virulent strains of A. hydrophila AH-3. The AH-3 wild type (WT) containing the complete LPS core is highly virulent and this bacterium strongly stimulated the prophenoloxidase activating system resulting in melanization in both crayfish and mealworm. In contrast, the ΔwaaE mutant which has LPS without O-antigen and external core was non-virulent and lost ability to stimulate this system and melanization in these two animals. The high phenoloxidase activity found in WT infected crayfish appears to result from a low expression of pacifastin, a prophenoloxidase activating enzyme inhibitor, and this gene expression was not changed in the ΔwaaE mutant infected animal and consequently phenoloxidase activity was not altered as compared to non-infected animals. Therefore we show that the virulence factors of A. hydrophila are the same regardless whether an insect or a crustacean is infected and the O-antigen and external core is essential for activation of the proPO system

  10. Pathogenicity of conidia-based preparations of entomopathogenic fungi against the greenhouse pest aphids Myzus persicae, Aphis gossypii, and Aulacorthum solani (Hemiptera: Aphididae).

    PubMed

    Jandricic, S E; Filotas, M; Sanderson, J P; Wraight, S P

    2014-05-01

    Seeking new isolates of entomopathogenic fungi with greater virulence against greenhouse aphid pests than those currently registered in North America for control of these insects, single-dose screening assays of 44 selected fungal isolates and 4 commercially available strains were conducted against first-instar nymphs of Myzus persicae and Aphis gossypii. The assays identified a number of Beauveria and Metarhizium isolates with virulence equal to or greater than that of the commercial strains against the nymphal aphids, but none exhibited exceptionally high virulence. Virulence of Isaria isolates was unexpectedly low (<31% mortality at doses>1000conidia/mm(2)). In dose-response assays, Beauveria ARSEF 5493 proved most virulent against M. persicae and A. gossypii; however, LC50s of this isolate did not differ significantly from those of B. bassiana commercial strain JW-1. Dose-response assays were also conducted with Aulacorthum solani, the first reported evaluations of Beauveria and Metarhizium against this pest. The novel isolate Metarhizium 5471 showed virulence⩾that of Beauveria 5493 in terms of LC25 and LC50, but 5493 produced a steeper dose response (slope). Additional tests showed that adult aphids are more susceptible than nymphs to fungal infection but confirmed that infection has a limited pre-mortem effect on aphid reproduction. Effects of assay techniques and the potential of fungal pathogens as aphid-control agents are discussed. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Potential of Tenebrio molitor (Coleoptera: Tenebrionidae) as a bioassay probe for Metarhizium brunneum (Hypocreales: Clavicipitaceae) activity against Ixodes scapularis (Acari: Ixodidae).

    PubMed

    Bharadwaj, Anuja; Stafford, Kirby C

    2011-12-01

    The yellow mealworm, Tenebrio molitor L., has been used to indicate qualitatively the presence of entomopathogenic fungi in the soil or as a model for evaluating stress and other factors on fungal activity. Although this beetle appears highly susceptible to many of these fungi, little quantitative information is available on the sensitivity of T. molitor to a specific fungus and, therefore, fungal presence or as an indicator for pathogenicity to other species. The purpose of this study was to establish the suitability of T. molitor larvae as a bioassay probe for Metarhizium brunneum for comparison against the blacklegged tick, Ixodes scapularis. Nine concentrations of M. brunneum strain F52 ranging from 1.0 x 10(1) to 8.4 x 10(8) conidial/ml were simultaneously tested against T. molitor larvae and I. scapularis adults. Larvae of yellow mealworm were less sensitive to M. brunneum than I. scapularis adults (LC50's 4.4 x 10(7) and 1.7 x 10(5) conidia/ml, respectively, 4-wk post-treatment). The greater sensitivity of I. scapularis to the fungus suggests that the detection of fungal mycosis in mealworms would indicate sufficient inoculum to be pathogenic to I. scapularis and make this insect a suitable probe for evaluation of the presence and activity of M. brunneum against the blacklegged tick in field applications.

  12. Identification of genes differentially expressed in vivo by Metarhizium anisopliae in the hemolymph of Locusta migratoria using suppression-subtractive hybridization.

    PubMed

    Zhang, Chuanbo; Xia, Yuxian

    2009-08-01

    Metarhizium anisopliae is an important insect pathogenic fungus widely used in biological pest control. The aim of this study was to identify genes differentially expressed in vivo by M. anisopliae CQMa102 in the hemolymph of infected Locusta migratoria. Suppression-subtractive hybridization was performed using cDNA generated from hyphal bodies purified from hemolymph and the fungus germinating and differentiating on locust wings. A total of 350/1,600 random clones screened by cDNA array dot blotting were sequenced, resulting in 120 uniquely expressed sequence tags (ESTs) that were up-regulated during colonization of hemolymph. Among these 120 ESTs, 42 (35.0%) had matches in the NR protein database, and 29 (24.2%) were significantly similar to known proteins involved in various cellular processes, including general metabolism, cell wall remodeling, protein synthesis, signal transduction and stress responses. In contrast, the remaining 78 ESTs (65.0%) either had low similarity in the NR database or represented novel genes. Semi-quantitative RT-PCR analysis of five randomly selected genes revealed that all were highly expressed in the host hemolymph. These results provide new insight into the underlying molecular mechanisms of adaptation to host hemolymph and may increase understanding of host-pathogen interactions.

  13. Secretome of the Biocontrol Agent Metarhizium anisopliae Induced by the Cuticle of the Cotton Pest Dysdercus peruvianus Reveals New Insights into Infection

    PubMed Central

    2015-01-01

    Metarhizium anisopliae is an entomopathogenic fungus that has evolved specialized strategies to infect insect hosts. Here we analyzed secreted proteins related to Dysdercus peruvianus infection. Using shotgun proteomics, abundance changes in 71 proteins were identified after exposure to host cuticle. Among these proteins were classical fungal effectors secreted by pathogens to degrade physical barriers and alter host physiology. These include lipolytic enzymes, Pr1A, B, C, I, and J proteases, ROS-related proteins, oxidorreductases, and signaling proteins. Protein interaction networks were generated postulating interesting candidates for further studies, including Pr1C, based on possible functional interactions. On the basis of these results, we propose that M. anisopliae is degrading host components and actively secreting proteins to manage the physiology of the host. Interestingly, the secretion of these factors occurs in the absence of a host response. The findings presented here are an important step in understanding the host–pathogen interaction and developing more efficient biocontrol of D. peruvianus by M. anisopliae. PMID:24702058

  14. Insect Resistance

    USDA-ARS?s Scientific Manuscript database

    Insect pests exhibit a diverse array of genetic-based responses when interacting with crop systems; these changes can be in response to pathogens, symbiotic microbes, host plants, chemicals, and the environment. Agricultural research has for decades focused on gathering crucial information on the bi...

  15. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIAE

    EPA Science Inventory

    Introduction

    The goal of this project is the identification and characterization of allergens from the fungus Metarhizium anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaer...

  16. PROTEOMIC ANALYSIS OF ALLERGENS FROM METARHIZIUM ANISOPLIAE

    EPA Science Inventory

    Introduction

    The goal of this project is the identification and characterization of allergens from the fungus Metarhizium anisopliae, using mass spectrometry (MS). The US EPA, under the "Children at Risk" program, is currently addressing the problem of indoor fungal bioaer...

  17. Two Volatile Organic Compounds Trigger Plant Self-Defense against a Bacterial Pathogen and a Sucking Insect in Cucumber under Open Field Conditions

    PubMed Central

    Song, Geun Cheol; Ryu, Choong-Min

    2013-01-01

    Systemic acquired resistance (SAR) is a plant self-defense mechanism against a broad-range of pathogens and insect pests. Among chemical SAR triggers, plant and bacterial volatiles are promising candidates for use in pest management, as these volatiles are highly effective, inexpensive, and can be employed at relatively low concentrations compared with agrochemicals. However, such volatiles have some drawbacks, including the high evaporation rate of these compounds after application in the open field, their negative effects on plant growth, and their inconsistent levels of effectiveness. Here, we demonstrate the effectiveness of volatile organic compound (VOC)-mediated induced resistance against both the bacterial angular leaf spot pathogen, Pseudononas syringae pv. lachrymans, and the sucking insect aphid, Myzus persicae, in the open field. Using the VOCs 3-pentanol and 2-butanone where fruit yields increased gave unexpectedly, a significant increase in the number of ladybird beetles, Coccinella septempunctata, a natural enemy of aphids. The defense-related gene CsLOX was induced by VOC treatment, indicating that triggering the oxylipin pathway in response to the emission of green leaf volatiles can recruit the natural enemy of aphids. These results demonstrate that VOCs may help prevent plant disease and insect damage by eliciting induced resistance, even in open fields. PMID:23698768

  18. [Organization and preservation of the collection of pathogenic and fungal symbionts of insects and other arthropods from CEPAVE (CONICET-UNLP), La Plata, Argentina].

    PubMed

    Gutierrez, Alejandra Concepción; Tornesello-Galván, Julieta; Manfrino, Romina Guadalupe; Hipperdinger, Marcela; Falvo, Marianel; D'Alessandro, Celeste; López Lastra, Claudia Cristina

    The collection of fungal pathogens and symbionts of insects and other arthropods of the Centro de Estudios Parasitológicos y de Vectores, La Plata, Argentina, is unique because it preserves in vivo and in vitro cultures of fungal pathogens. This culture collection is open for research, teaching, consulting services, and strain deposit. It contains 421 strains belonging to 23 genera (16 Ascomycota, 4 Entomophthoromycotina, 2 Glomeromycota and 1 Oomycota), and the cultures are preserved by different methods such as cryopreservation in freezer at -20°C and -70°C, paper, distilled water and lyophilization. Fungi were isolated from insects, other arthropods, and soil (by using insect baits and selective media). Species were identified by morphological features and in a few strains by molecular taxonomy (PCR of rDNA). This collection is a reference center for species identification/certifications, research and teaching purposes, strain deposit, transference and consultancy services, and its overall goal is to preserve the fungal germplasm and ex situ diversity. Most of the strains are native of Argentina. The collection was originated in 1988 and is registered in the Latin American Federation for Culture Collections and in the World Federation of Culture Collections. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  19. Maize terpene volatiles serve as precursors to an array of defensive phytoalexins following insect and pathogen attack

    USDA-ARS?s Scientific Manuscript database

    Phytoalexins are inducible biochemicals that locally protect plant tissues against biotic attack. Due to their agronomic significance, maize and rice have been extensively investigated for their terpenoid-based defenses which include insect-inducible monoterpene and sesquiterpene vol...

  20. Maize terpene volatiles serve as precursors to an array of defensive phytoalexins following insect and pathogen attack

    USDA-ARS?s Scientific Manuscript database

    Phytoalexins are inducible biochemicals that locally protect plant tissues against biotic attack. Due to their agronomic significance, maize and rice have been extensively investigated for their terpenoid-based defenses which include insect-inducible monoterpene and sesquiterpene volatiles. ...

  1. Insect E-probe Diagnostic Nucleic acid Analysis (EDNA): the application of a novel bioinformatic tool to detection of vectors and pathogens in individual insect and simulated insect trap metagenomes

    USDA-ARS?s Scientific Manuscript database

    Plant pathogen detection takes many forms. In simple cases, researchers are attempting to detect a known pathogen from a known host utilizing targeted nucleic acid or antigenic assays. However, in more complex scenarios researchers may not know the identity of a pathogen, or they may need to screen ...

  2. Terpene Down-Regulation in Orange Reveals the Role of Fruit Aromas in Mediating Interactions with Insect Herbivores and Pathogens1[C][W

    PubMed Central

    Rodríguez, Ana; San Andrés, Victoria; Cervera, Magdalena; Redondo, Ana; Alquézar, Berta; Shimada, Takehiko; Gadea, José; Rodrigo, María Jesús; Zacarías, Lorenzo; Palou, Lluís; López, María M.; Castañera, Pedro; Peña, Leandro

    2011-01-01

    Plants use volatile terpene compounds as odor cues for communicating with the environment. Fleshy fruits are particularly rich in volatiles that deter herbivores and attract seed dispersal agents. We have investigated how terpenes in citrus fruit peels affect the interaction between the plant, insects, and microorganisms. Because limonene represents up to 97% of the total volatiles in orange (Citrus sinensis) fruit peel, we chose to down-regulate the expression of a limonene synthase gene in orange plants by introducing an antisense construct of this gene. Transgenic fruits showed reduced accumulation of limonene in the peel. When these fruits were challenged with either the fungus Penicillium digitatum or with the bacterium Xanthomonas citri subsp. citri, they showed marked resistance against these pathogens that were unable to infect the peel tissues. Moreover, males of the citrus pest medfly (Ceratitis capitata) were less attracted to low limonene-expressing fruits than to control fruits. These results indicate that limonene accumulation in the peel of citrus fruit appears to be involved in the successful trophic interaction between fruits, insects, and microorganisms. Terpene down-regulation might be a strategy to generate broad-spectrum resistance against pests and pathogens in fleshy fruits from economically important crops. In addition, terpene engineering may be important for studying the basic ecological interactions between fruits, herbivores, and pathogens. PMID:21525333

  3. Diatomaceous earth and oil enhance effectiveness of Metarhizium anisopliae against Triatoma infestans.

    PubMed

    Luz, Christian; Rodrigues, Juscelino; Rocha, Luiz F N

    2012-04-01

    Entomopathogenic fungi, especially Metarhizium anisopliae, have potential for integrated control of peridomestic triatomine bugs. However, the high susceptibility of these vectors to fungal infection at elevated ambient humidities decreases in the comparatively dry conditions that often prevail in their microhabitats. A formulation adapted to this target pest that induces high and quick mortality can help to overcome these drawbacks. In the present study diatomaceous earth, which is used against pests of stored grains or as an additive to mycoinsecticides, delayed but did not reduce in vitro germination of M. anisopliae s.l. IP 46 conidia after >24h agitation without affecting viability, and did not hamper the survival of Triatoma infestans nymphs exposed to treated surfaces. The settling behavior of nymphs on a treated surface in choice tests depended on the concentration of diatomaceous earth and ambient light level. Conidia formulated with diatomaceous earth and a vegetable oil synergized the insecticidal effect of the fungus in nymphs, and quickly killed all treated insects, even at 75% relative humidity (LT(90) 8.3 days) where unformulated conidia caused only 25% mortality after a 25 days exposure. The improved performance of a combined oil and desiccant dust formulation of this Metarhizium isolate raises the likelihood for its successful mycoinsecticidal use for triatomine control and, apparently, against other domestic insect pests. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Phylogenetic diversity of Brazilian Metarhizium associated with sugarcane agriculture

    USDA-ARS?s Scientific Manuscript database

    Biological control of spittlebug with Metarhizium in sugarcane is an example of the successful application of sustainable pest management in Brazil. However little is known about the richness, distribution and ecology of Metarhizium species in the agroecosystems and natural environments of Brazil. W...

  5. Possible climate warming effects on vegetation, forests, biotic (insect, pathogene) disturbances and agriculture in Central Siberia for 1960- 2050

    NASA Astrophysics Data System (ADS)

    Tchebakova, N. M.; Parfenova, E. I.; Soja, A. J.; Lysanova, G. I.; Baranchikov, Y. N.; Kuzmina, N. A.

    2012-04-01

    Regional Siberian studies have already registered climate warming over the last half a century (1960-2010). Our analysis showed that winters are already 2-3°C warmer in the north and 1-2°C warmer in the south by 2010. Summer temperatures increased by 1°C in the north and by 1-2°C in the south. Change in precipitation is more complicated, increasing on average 10% in middle latitudes and decreasing 10-20% in the south, promoting local drying in already dry landscapes. Our goal was to summarize results of research we have done for the last decade in the context of climate warming and its consequences for biosystems in Central Siberia. We modeled climate change effects on vegetation shifts, on forest composition and agriculture change, on the insect Siberian moth (Dendrolimus suprans sibiricus Tschetv) and pathogene (Lophodermium pinastri Chev) ranges in Central Siberia for a century (1960-2050) based on historical climate data and GCM-predicted data. Principal results are: In the warmer and drier climate projected by these scenarios, Siberian forests are predicted to decrease and shift northwards and forest-steppe and steppe ecosystems are predicted to dominate over 50% of central Siberia due to the dryer climate by 2080. Permafrost is not predicted to thaw deep enough to sustain dark (Pinus sibirica, Abies sibirica, and Picea obovata) taiga. Over eastern Siberia, larch (Larix dahurica) taiga is predicted to continue to be the dominant zonobiome because of its ability to withstand continuous permafrost. The model also predicts new temperate broadleaf forest and forest-steppe habitats; At least half of central Siberia is predicted to be climatically suitable for agriculture at the end of the century although potential croplands would be limited by the availability of suitable soils agriculture in central Siberia would likely benefit from climate warming Crop production may twofold increase as climate warms during the century; traditional crops (grain, potato

  6. The PacC transcription factor regulates secondary metabolite production and stress response, but has only minor effects on virulence in the insect pathogenic fungus Beauveria bassiana.

    PubMed

    Luo, Zhibing; Ren, Hui; Mousa, Jarrod J; Rangel, Drauzio E N; Zhang, Yongjun; Bruner, Steven D; Keyhani, Nemat O

    2017-02-01

    The PacC transcription factor is an important component of the fungal ambient pH-responsive regulatory system. Loss of pacC in the insect pathogenic fungus Beauveria bassiana resulted in an alkaline pH-dependent decrease in growth and pH-dependent increased susceptibility to osmotic (salt, sorbitol) stress and SDS. Extreme susceptibility to Congo Red was noted irrespective of pH, and ΔBbpacC conidia showed subtle increases in UV susceptibility. The ΔBbPacC mutant showed a reduced ability to acidify media during growth due to failure to produce oxalic acid. The ΔBbPacC mutant also did not produce the insecticidal compound dipicolinic acid, however, production of a yellow-colored compound was noted. The compound, named bassianolone B, was purified and its structure determined. Despite defects in growth, stress resistance, and oxalate/insecticidal compound production, only a small decrease in virulence was seen for the ΔBbpacC strain in topical insect bioassays using larvae from the greater waxmoth, Galleria mellonella or adults of the beetle, Tenebrio molitor. However, slightly more pronounced decreases were seen in virulence via intrahemcoel injection assays (G. mellonella) and in assays using T. molitor larvae. These data suggest important roles for BbpacC in mediating growth at alkaline pH, regulating secondary metabolite production, and in targeting specific insect stages.

  7. Isolation, pathogenicity and disinfection of Staphylococcus aureus carried by insects in two public hospitals of Vitória da Conquista, Bahia, Brazil.

    PubMed

    Oliveira, Pollianna S; Souza, Simone G; Campos, Guilherme B; da Silva, Danilo C C; Sousa, Daniel S; Araújo, Suerda P F; Ferreira, Laiziane P; Santos, Verena M; Amorim, Aline T; Santos, Angelita M O G; Timenetsky, Jorge; Cruz, Mariluze P; Yatsuda, Regiane; Marques, Lucas M

    2014-01-01

    Currently, hospital infection is a serious public health problem, and several factors may influence the occurrence of these infections, including the presence of insects, which are carriers of multidrug-resistant bacterial species. The aim of this study was to isolate staphylococci carried by insects in two public hospitals of Vitoria da Conquista, Bahia and to identify the resistance profile, pathogenicity and efficacy of disinfection of the premises. A total of 91 insects were collected in 21 strategic points of these hospitals, and 32 isolated strains of Staphylococcus aureus were isolated. Based on antibiogram and Minimum Inhibitory Concentration results, 95% of these strains were susceptible to oxacillin. These strains were also evaluated for the presence of resistance genes encoding resistance to oxacillin/methicillin by polymerase chain reaction, but the sample was negative for this gene. Pathogenicity tests were performed in vitro biofilm formation induced by glucose, where it was found that eight (27.58%) strains were classified as biofilm producers and 21 (72.4%) as stronger producers. In addition, we performed PCR for their virulence genes: Sea (enterotoxin A), SEB (B), Sec (C), PVL (Panton-Valentine Leukocidin), ClfA (clumping factor A) and Spa (protein A). Of these, Sea, Spa PVL were positive in 7 (21.8%), 2 (6.3%) and 1 (3.1%) samples, respectively. The analysis of cytokine induction in the inflammatory response of J774 macrophages by isolates from the two hospitals did not show statistical difference at the levels of IL-6, TNF-α, IL-1 and IL-10 production. In addition, we verified the antimicrobial activity of disinfecting agents on these strains, quaternary ammonium, 0.5% sodium hypochlorite, 1% sodium hypochlorite, 2% sodium hypochlorite, 2% glutaraldehyde, Lysoform(®), 70% alcohol solution of chlorhexidine digluconate, 2% peracetic acid, and 100% vinegar. Resistance was seen in only for the following two disinfectants: 70% alcohol in 31 (96

  8. Pathogenicity, characterization and comparative virulence of Rhizoctonia spp. from insect-galled roots of Lepidium draba in Europe

    USDA-ARS?s Scientific Manuscript database

    The association of Rhizoctonia spp. with insect-damaged and diseased tissue of the invasive perennial Lepidium draba was documented throughout the range of L. draba that was surveyed in Europe, including Hungary, Austria, Switzerland and France. Samples that could be both maintained under cooled con...

  9. Cecropins from Plutella xylostella and Their Interaction with Metarhizium anisopliae

    PubMed Central

    Freed, Shoaib; Gao, Yanfu; Yu, Jing; Wang, Shuang; Ju, Wenyan; Zhang, Yuqing; Jin, Fengliang

    2015-01-01

    Cecropins are the most potent induced peptides to resist invading microorganisms. In the present study, two full length cDNA encoding cecropin2 (Px-cec2) and cecropin3 (Px-cec3) were obtained from P. xylostella by integrated analysis of genome and transcriptome data. qRT-PCR analysis revealed the high levels of transcripts of Px-cecs (Px-cec1, Px-cec2 and Px-cec3) in epidermis, fat body and hemocytes after 24, 30 and 36 h induction of Metarhizium anisopliae, respectively. Silencing of Spätzle and Dorsal separately caused the low expression of cecropins in the fat body, epidermis and hemocytes, and made the P.xylostella larvae more susceptible to M. anisopliae. Antimicrobial assays demonstrated that the purified recombinant cecropins, i.e., Px-cec1, Px-cec2 and Px-cec3, exerted a broad spectrum of antimicrobial activity against fungi, as well as Gram-positive and Gram-negative bacteria. Especially, Px-cecs showed higher activity against M. anisopliae than another selected fungi isolates. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) revealed that cecropins exerted the vital morphological alterations to the spores of M. anisopliae. Based on our results, cecropins played an imperative role in resisting infection of M. anisopliae, which will provide the foundation of biological control of insect pests by using cecorpins as a target in the future. PMID:26544076

  10. Combining 'omics and microscopy to visualize interactions between the Asian citrus psyllid vector and the Huanglongbing pathogen Candidatus Liberibacter asiaticus in the insect gut.

    PubMed

    Kruse, Angela; Fattah-Hosseini, Somayeh; Saha, Surya; Johnson, Richard; Warwick, EricaRose; Sturgeon, Kasie; Mueller, Lukas; MacCoss, Michael J; Shatters, Robert G; Cilia Heck, Michelle

    2017-01-01

    Huanglongbing, or citrus greening disease, is an economically devastating bacterial disease of citrus. It is associated with infection by the gram-negative bacterium Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by Diaphorina citri, the Asian citrus psyllid (ACP). For insect transmission to occur, CLas must be ingested during feeding on infected phloem sap and cross the gut barrier to gain entry into the insect vector. To investigate the effects of CLas exposure at the gut-pathogen interface, we performed RNAseq and mass spectrometry-based proteomics to analyze the transcriptome and proteome, respectively, of ACP gut tissue. CLas exposure resulted in changes in pathways involving the TCA cycle, iron metabolism, insecticide resistance and the insect's immune system. We identified 83 long non-coding RNAs that are responsive to CLas, two of which appear to be specific to the ACP. Proteomics analysis also enabled us to determine that Wolbachia, a symbiont of the ACP, undergoes proteome regulation when CLas is present. Fluorescent in situ hybridization (FISH) confirmed that Wolbachia and CLas inhabit the same ACP gut cells, but do not co-localize within those cells. Wolbachia cells are prevalent throughout the gut epithelial cell cytoplasm, and Wolbachia titer is more variable in the guts of CLas exposed insects. CLas is detected on the luminal membrane, in puncta within the gut epithelial cell cytoplasm, along actin filaments in the gut visceral muscles, and rarely, in association with gut cell nuclei. Our study provides a snapshot of how the psyllid gut copes with CLas exposure and provides information on pathways and proteins for targeted disruption of CLas-vector interactions at the gut interface.

  11. Transcriptome amplification coupled with nanopore sequencing as a surveillance tool for plant pathogens in plant and insect tissues

    USDA-ARS?s Scientific Manuscript database

    There are many plant pathogen-specific diagnostic assays, based on PCR and immune-detection. However, the ability to test for large numbers of pathogens simultaneously is lacking. Next generation sequencing (NGS) allows one to detect all organisms within a given sample, but has computational limitat...

  12. Beauveria bassiana, Metarhizium anisopliae, and Metarhizium anisopliae var. acridum conidia: tolerance to imbibitional damage

    USDA-ARS?s Scientific Manuscript database

    When dry fungal cells are immersed in water, rapid imbibition (water uptake) may compromise the plasma membrane, killing the cell. This study investigated the impact of imbibitional damage (measured in terms of reduced viability) on Beauveria bassiana (Bb), Metarhizium anisopliae (Ma) and M. anisop...

  13. Alternative oxidase in resistance to biotic stresses: Nicotiana attenuata AOX contributes to resistance to a pathogen and a piercing-sucking insect but not Manduca sexta larvae.

    PubMed

    Zhang, Lu; Oh, Youngjoo; Li, Hongyu; Baldwin, Ian T; Galis, Ivan

    2012-11-01

    The role of the alternative respiratory pathway in the protection of plants against biotic stress was examined in transgenic tobacco (Nicotiana attenuata) plants (irAOX) silenced in the expression of ALTERNATIVE OXIDASE (AOX) gene. Wild-type and irAOX plants were independently challenged with (1) chewing herbivores (Manduca sexta), (2) piercing-sucking insects (Empoasca spp.), and (3) bacterial pathogens (Pseudomonas syringae pv tomato DC3000), showing that all these treatments can strongly elicit accumulation of AOX gene transcripts in wild-type plants. When N. attenuata chemical defenses and resistance were examined, irAOX plants showed wild-type levels of defense-related phytohormones, secondary metabolites, and resistance to M. sexta. In contrast, piercing-sucking leafhoppers (Empoasca spp.) caused more leaf damage and induced significantly higher salicylic acid levels in irAOX compared with wild-type plants in the field and/or glasshouse. Subsequently, irAOX plants accumulated lower levels of defense metabolites, 17-hydroxygeranyllinalool diterpene glycosides, caffeoylputrescine, and nicotine compared with wild-type plants under prolonged attack of Empoasca spp. in the glasshouse. Finally, an accelerated cell death phenotype was observed in irAOX plants infected with P. syringae, which correlated with higher levels of salicylic acid and hydrogen peroxide levels in pathogen-infected irAOX compared with wild-type leaves. Overall, the AOX-associated changes in phytohormone and/or redox levels appear to support the resistance of N. attenuata plants against cell piercing-sucking insects and modulate the progression of cell death in pathogen-infected tissues but are not effective against rapidly feeding specialist herbivore M. sexta.

  14. Occurrence and Prevalence of Insect Pathogens in Populations of the Codling Moth, Cydia pomonella L.: A Long-Term Diagnostic Survey

    PubMed Central

    Zimmermann, Gisbert; Huger, Alois M.; Kleespies, Regina G.

    2013-01-01

    About 20,550 larvae, pupae and adults of the codling moth, Cydia pomonella L., were diagnosed for pathogens during long-term investigations (1955–2012) at the Institute for Biological Control in Darmstadt, Germany. The prevailing entomopathogens diagnosed in these studies were insect pathogenic fungi, especially Beauveria bassiana and Isaria farinosa, the microsporidium, Nosema carpocapsae, the Cydia pomonella granulovirus (CpGV), as well as mostly undetermined bacteria. While the CpGV was observed exclusively in larvae and pupae from laboratory colonies or from field experiments with this virus, entomopathogenic fungi were most frequently diagnosed in last instars in autumn and in diapausing larvae and pupae in spring. B. bassiana was identified as the major fungal pathogen, causing larval prevalences of 0.9% to 100% (mean, about 32%). During prognostic long-term studies in larvae and adults of C. pomonella, N. carpocapsae was diagnosed in codling moth populations from various locations in Germany. The mean prevalence generally ranged between 20% and 50%. Experiments revealed that the fecundity and fertility of microsporidia-infected female adults were significantly reduced compared to healthy ones. The results underpin the importance of naturally occurring microbial antagonists and represent a base for further ecological studies on developing new or additional biological and integrated control strategies. PMID:26462428

  15. Occurrence and Prevalence of Insect Pathogens in Populations of the Codling Moth, Cydia pomonella L.: A Long-Term Diagnostic Survey.

    PubMed

    Zimmermann, Gisbert; Huger, Alois M; Kleespies, Regina G

    2013-08-02

    About 20,550 larvae, pupae and adults of the codling moth, Cydia pomonella L., were diagnosed for pathogens during long-term investigations (1955-2012) at the Institute for Biological Control in Darmstadt, Germany. The prevailing entomopathogens diagnosed in these studies were insect pathogenic fungi, especially Beauveria bassiana and Isaria farinosa, the microsporidium, Nosema carpocapsae, the Cydia pomonella granulovirus (CpGV), as well as mostly undetermined bacteria. While the CpGV was observed exclusively in larvae and pupae from laboratory colonies or from field experiments with this virus, entomopathogenic fungi were most frequently diagnosed in last instars in autumn and in diapausing larvae and pupae in spring. B. bassiana was identified as the major fungal pathogen, causing larval prevalences of 0.9% to 100% (mean, about 32%). During prognostic long-term studies in larvae and adults of C. pomonella, N. carpocapsae was diagnosed in codling moth populations from various locations in Germany. The mean prevalence generally ranged between 20% and 50%. Experiments revealed that the fecundity and fertility of microsporidia-infected female adults were significantly reduced compared to healthy ones. The results underpin the importance of naturally occurring microbial antagonists and represent a base for further ecological studies on developing new or additional biological and integrated control strategies.

  16. Swainsonine Biosynthesis Genes in Diverse Symbiotic and Pathogenic Fungi.

    PubMed

    Cook, Daniel; Donzelli, Bruno G G; Creamer, Rebecca; Baucom, Deana L; Gardner, Dale R; Pan, Juan; Moore, Neil; Jaromczyk, Jerzy W; Schardl, Christopher L

    2017-04-04

    Swainsonine, a cytotoxic fungal alkaloid and a potential cancer therapy drug, is produced by the insect pathogen and plant symbiont, Metarhizium robertsii, the clover pathogen Slafractonia leguminicola, locoweed symbionts belonging to Alternaria sect. Undifilum, and a recently discovered morning glory symbiont belonging to order Chaetothyriales. Genome sequence analyses revealed that these fungi shared orthologous gene clusters, designated "SWN," which included a multifunctional swnK gene comprising predicted adenylylation and acyltransferase domains with their associated thiolation domains, a β-ketoacyl synthase domain, and two reductase domains. The role of swnK was demonstrated by inactivating it in M. robertsii through homologous gene replacement to give a ∆swnK mutant that produced no detectable swainsonine, then complementing the mutant with the wild-type gene to restore swainsonine biosynthesis. Other SWN cluster genes were predicted to encode two putative hydroxylases and two reductases, as expected to complete biosynthesis of swainsonine from the predicted SwnK product. SWN gene clusters were identified in six out of seven sequenced genomes of Metarhzium species, and in all 15 sequenced genomes of Arthrodermataceae, a family of fungi that cause athlete's foot and ringworm diseases in humans and other mammals. Representative isolates of all of these species were cultured, and all Metarhizium spp. with SWN clusters, as well as all but one of the Arthrodermataceae, produced swainsonine. These results suggested a new biosynthetic hypothesis for this alkaloid, extended the known taxonomic breadth of swainsonine producers to five orders of Ascomycota, and suggested that swainsonine has roles in mutualistic symbioses and diseases of plants and animals.

  17. Growth substrates and caleosin-mediated functions affect conidial virulence in the insect pathogenic fungus Beauveria bassiana.

    PubMed

    Ortiz-Urquiza, Almudena; Fan, Yanhua; Garrett, Timothy; Keyhani, Nemat O

    2016-11-01

    The entomopathogenic fungus, Beauveria bassiana, is a microbial biological control agent capable of infecting a wide range of insect hosts. Conidia (spores) initiate infection via adhesion, growth and penetration of the insect cuticle, whose outmost layer is rich in lipids. Conidial virulence was investigated in B. bassiana WT and caleosin mutants (ΔBbcal1), the latter a protein involved in lipid storage and turnover. Topical insect bioassays revealed that conidia of the WT strain showed up to 40-fold differences in LD50 values depending upon the growth substrate. The most virulent conidia were harvested from potato dextrose agar containing oleic acid, and the least potent were those derived from Sabouraud dextrose/yeast extract agar (SDAY). However, with the exception of conidia derived from SDAY and Czapek Dox agar, in which values were reduced, mean lethal times to kill (LT50) were essentially unaffected. In topical bioassays, the ΔBbcal1 mutant displayed LD50 values 5-40-fold higher than the WT depending upon the growth substrate, with ΔBbcal1 conidia derived from SDAY unable to effectively penetrate the host cuticle. The ΔBbcal1 mutant also showed concomitant dramatic increases in LT50 values from a mean of ~4.5 for WT to >8.5 days for the mutant. In contrast, intrahaemocoel injection bioassays that bypass cuticle penetration events revealed only minor effects on virulence for either WT or ΔBbcal1 conidia. These data highlight the importance of caleosin-dependent lipid mobilization and/or signalling in cuticle penetration events but suggest their dispensability for immune evasion and within-host growth.

  18. Combining 'omics and microscopy to visualize interactions between the Asian citrus psyllid vector and the Huanglongbing pathogen Candidatus Liberibacter asiaticus in the insect gut

    PubMed Central

    Kruse, Angela; Fattah-Hosseini, Somayeh; Saha, Surya; Johnson, Richard; Warwick, EricaRose; Sturgeon, Kasie; Mueller, Lukas; MacCoss, Michael J.; Shatters, Robert G.

    2017-01-01

    Huanglongbing, or citrus greening disease, is an economically devastating bacterial disease of citrus. It is associated with infection by the gram-negative bacterium Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by Diaphorina citri, the Asian citrus psyllid (ACP). For insect transmission to occur, CLas must be ingested during feeding on infected phloem sap and cross the gut barrier to gain entry into the insect vector. To investigate the effects of CLas exposure at the gut-pathogen interface, we performed RNAseq and mass spectrometry-based proteomics to analyze the transcriptome and proteome, respectively, of ACP gut tissue. CLas exposure resulted in changes in pathways involving the TCA cycle, iron metabolism, insecticide resistance and the insect’s immune system. We identified 83 long non-coding RNAs that are responsive to CLas, two of which appear to be specific to the ACP. Proteomics analysis also enabled us to determine that Wolbachia, a symbiont of the ACP, undergoes proteome regulation when CLas is present. Fluorescent in situ hybridization (FISH) confirmed that Wolbachia and CLas inhabit the same ACP gut cells, but do not co-localize within those cells. Wolbachia cells are prevalent throughout the gut epithelial cell cytoplasm, and Wolbachia titer is more variable in the guts of CLas exposed insects. CLas is detected on the luminal membrane, in puncta within the gut epithelial cell cytoplasm, along actin filaments in the gut visceral muscles, and rarely, in association with gut cell nuclei. Our study provides a snapshot of how the psyllid gut copes with CLas exposure and provides information on pathways and proteins for targeted disruption of CLas-vector interactions at the gut interface. PMID:28632769

  19. Screening of entomopathogenic Metarhizium anisopliae isolates and proteomic analysis of secretion synthesized in response to cowpea weevil (Callosobruchus maculatus) exoskeleton.

    PubMed

    Murad, André M; Laumann, Raul A; Lima, Thaina de A; Sarmento, Rubia B C; Noronha, Eliane F; Rocha, Thales L; Valadares-Inglis, Maria C; Franco, Octávio L

    2006-01-01

    Cowpea crops are severely attacked by Callosobruchus maculatus, a Coleopteran that at the larval stage penetrates into stored seeds and feeds on cotyledons. Cowpea weevil control could be based in utilization of bacteria and fungi to reduce pest development. Entomopathogenic fungi, such as Metarhizium anisopliae, are able to control insect-pests and are widely applied in biological control. This report evaluated ten M. anisopliae isolates according to their virulence, correlating chitinolytic, proteolytic and alpha-amylolytic activities, as well proteomic analysis by two dimensional gels of fungal secretions in response to an induced medium containing C. maculatus shells, indicating novel biotechnological tools capable of improving cowpea crop resistance.

  20. Fungal infection dynamics in response to temperature in the lepidopteran insect Galleria mellonella.

    PubMed

    Kryukov, Vadim Y; Yaroslavtseva, Olga N; Whitten, Miranda M A; Tyurin, Maksim V; Ficken, Katherine J; Greig, Carolyn; Melo, Nadja R; Glupov, Viktor V; Dubovskiy, Ivan M; Butt, Tariq M

    2016-11-29

    This study examines how the dynamics of fungus-insect interactions can be modulated by temperature. The wax moth, Galleria mellonella, is a well-studied and important model insect whose larvae in the wild develop optimally at around 34 °C in beehives. However, surprisingly little research on wax moths has been conducted at relevant temperatures. In this study, the entomopathogenic fungus Metarhizium robertsii inflicted rapid and substantial mortality on wax moth larvae maintained at a constant temperature of 24 °C, but at 34 °C a 10 fold higher dose was required to achieve an equivalent mortality. The cooler temperature favored fungal pathogenicity, with condial adhesion to the cuticle, germination and hemocoel invasion all significantly enhanced at 24 °C, compared with 34 °C. The wax moth larvae immune responses altered with the temperature, and with the infective dose of the fungus. Enzyme-based immune defenses (lysozyme and phenoloxidase) exhibited enhanced activity at the warmer temperature. A dramatic upregulation in the basal expression of galiomicin and gallerimycin was triggered by cooling, and this was augmented in the presence of the fungus. Profiling of the predominant insect epicuticular fatty acids revealed a 4-7 fold increase in palmetic, oleic and linoleic acids in larvae maintained at 24 °C compared with those at 34 °C, but these failed to exert fungistatic effects on topically applied fungus. This study demonstrates the importance of choosing environmental conditions relevant to the habitat of the insect host when determining the dynamics and outcome of insect/fungus interactions, and has particular significance for the application of entomopathogens as biocontrol agents.

  1. INFECTIVITY OF METARHIZIUM ANISOPLIAE IN GRASS SHRIMP EMBRYOS

    EPA Science Inventory

    Developing embryos of the estuarine grass shrimp, Palaemonetes pugio, were exposed to Metarhizium anisopliae conidiospores. Attachment of conidiospores was often followed by germination and outgrowth on embryo surface. Penetration of the embryonic envelopes by M. anisopliae allow...

  2. INFECTIVITY OF METARHIZIUM ANISOPLIAE IN GRASS SHRIMP EMBRYOS

    EPA Science Inventory

    Developing embryos of the estuarine grass shrimp, Palaemonetes pugio, were exposed to Metarhizium anisopliae conidiospores. Attachment of conidiospores was often followed by germination and outgrowth on embryo surface. Penetration of the embryonic envelopes by M. anisopliae allow...

  3. Survey of phytophagous insects and foliar pathogens in China for a biocontrol perspective on kudzu, Pueraria montana var. lobata (Willd.) Maesen and S. Almeida (Fabaceae)

    Treesearch

    Jiang-Hua Sun; Zhu-Dong Liu; Kerry O. Britton; Ping Cai; David Orr; Judith Hough-Goldstein

    2006-01-01

    A three-year survey of kudzu foliage, seed, stems, and roots for associated phytophagous insects was conducted to establish basic information about the insect communities that kudzu harbors in China and to assess the abundance, diversity and damage caused by these insects. Diseases of kudzu were also surveyed in southern China. A total of 116 phytophagous insect...

  4. A plant pathogen reduces the enemy-free space of an insect herbivore on a shared host plant.

    PubMed Central

    Biere, Arjen; Elzinga, Jelmer A; Honders, Sonja C; Harvey, Jeffrey A

    2002-01-01

    An important mechanism in stabilizing tightly linked host-parasitoid and prey-predator interactions is the presence of refuges that protect organisms from their natural enemies. However, the presence and quality of refuges can be strongly affected by the environment. We show that infection of the host plant Silene latifolia by its specialist fungal plant pathogen Microbotryum violaceum dramatically alters the enemy-free space of a herbivore, the specialist noctuid seed predator Hadena bicruris, on their shared host plant. The pathogen arrests the development of seed capsules that serve as refuges for the herbivore's offspring against the specialist parasitoid Microplitis tristis, a major source of mortality of H. bicruris in the field. Pathogen infection resulted both in lower host-plant food quality, causing reduced adult emergence, and in twofold higher rates of parasitism of the herbivore. We interpret the strong oviposition preference of H. bicruris for uninfected plants in the field as an adaptive response, positioning offspring on refuge-rich, high-quality hosts. To our knowledge, this is the first demonstration that plant-inhabiting micro-organisms can affect higher trophic interactions through alteration of host refuge quality. We speculate that such interference can potentially destabilize tightly linked multitrophic interactions. PMID:12427312

  5. A plant pathogen reduces the enemy-free space of an insect herbivore on a shared host plant.

    PubMed

    Biere, Arjen; Elzinga, Jelmer A; Honders, Sonja C; Harvey, Jeffrey A

    2002-11-07

    An important mechanism in stabilizing tightly linked host-parasitoid and prey-predator interactions is the presence of refuges that protect organisms from their natural enemies. However, the presence and quality of refuges can be strongly affected by the environment. We show that infection of the host plant Silene latifolia by its specialist fungal plant pathogen Microbotryum violaceum dramatically alters the enemy-free space of a herbivore, the specialist noctuid seed predator Hadena bicruris, on their shared host plant. The pathogen arrests the development of seed capsules that serve as refuges for the herbivore's offspring against the specialist parasitoid Microplitis tristis, a major source of mortality of H. bicruris in the field. Pathogen infection resulted both in lower host-plant food quality, causing reduced adult emergence, and in twofold higher rates of parasitism of the herbivore. We interpret the strong oviposition preference of H. bicruris for uninfected plants in the field as an adaptive response, positioning offspring on refuge-rich, high-quality hosts. To our knowledge, this is the first demonstration that plant-inhabiting micro-organisms can affect higher trophic interactions through alteration of host refuge quality. We speculate that such interference can potentially destabilize tightly linked multitrophic interactions.

  6. Global Insight into Lysine Acetylation Events and Their Links to Biological Aspects in Beauveria bassiana, a Fungal Insect Pathogen

    PubMed Central

    Wang, Zhi-Kang; Cai, Qing; Liu, Jin; Ying, Sheng-Hua; Feng, Ming-Guang

    2017-01-01

    Lysine acetylation (Kac) events in filamentous fungi are poorly explored. Here we show a lysine acetylome generated by LC-MS/MS analysis of immunoaffinity-based Kac peptides from normal hyphal cells of Beauveria bassiana, a fungal entomopathogen. The acetylome comprised 283 Kac proteins and 464 Kac sites. These proteins were enriched to eight molecular functions, 20 cellular components, 27 biological processes, 20 KEGG pathways and 12 subcellular localizations. All Kac sites were characterized as six Kac motifs, including a novel motif (KacW) for 26 Kac sites of 17 unknown proteins. Many Kac sites were predicted to be multifunctional, largely expanding the fungal Kac events. Biological importance of identified Kac sites was confirmed through functional analysis of Kac sites on Pmt1 and Pmt4, two O-mannosyltransferases. Singular site mutations (K88R and K482R) of Pmt1 resulted in impaired conidiation, attenuated virulence and decreased tolerance to oxidation and cell wall perturbation. These defects were close to or more severe than those caused by the deletion of pmt1. The Pmt4 K360R mutation facilitated colony growth under normal and stressful conditions and enhanced the fungal virulence. Our findings provide the first insight into the Kac events of B. bassiana and their links to the fungal potential against insect pests. PMID:28295016

  7. Interplay between calcineurin and the Slt2 MAP-kinase in mediating cell wall integrity, conidiation and virulence in the insect fungal pathogen Beauveria bassiana.

    PubMed

    Huang, Shuaishuai; He, Zhangjiang; Zhang, Shiwei; Keyhani, Nemat O; Song, Yulin; Yang, Zhi; Jiang, Yahui; Zhang, Wenli; Pei, Yan; Zhang, Yongjun

    2015-10-01

    The entomopathogenic fungus, Beauveria bassiana, is of environmental and economic importance as an insect pathogen, currently used for the biological control of a number of pests. Cell wall integrity and conidiation are critical parameters for the ability of the fungus to infect insects and for production of the infectious propagules. The contribution of calcineurin and the Slt2 MAP kinase to cell wall integrity and development in B. bassiana was investigated. Gene knockouts of either the calcineurin CNA1 subunit or the Slt2 MAP kinase resulted in decreased tolerance to calcofluor white and high temperature. In contrast, the Δcna1 strain was more tolerant to Congo red but more sensitive to osmotic stress (NaCl, sorbitol) than the wild type, whereas the Δslt2 strain had the opposite phenotype. Changes in cell wall structure and composition were seen in the Δslt2 and Δcna1 strains during growth under cell wall stress as compared to the wild type. Both Δslt2 and Δcna1 strains showed significant alterations in growth, conidiation, and viability. Elevation of intracellular ROS levels, and decreased conidial hydrophobicity and adhesion to hydrophobic surfaces, were also seen for both mutants, as well as decreased virulence. Under cell wall stress conditions, inactivation of Slt2 significantly repressed CN-mediated phosphatase activity suggesting some level of cross talk between the two pathways. Comparative transcriptome profiling of the Δslt2 and Δcna1 strains revealed alterations in the expression of distinct gene sets, with overlap in transcripts involved in cell wall integrity, stress response, conidiation and virulence. These data illustrate convergent and divergent phenotypes and targets of the calcineurin and Slt2 pathways in B. bassiana.

  8. Secondary metabolite gene clusters in the entomopathogen fungus Metarhizium anisopliae: genome identification and patterns of expression in a cuticle infection model.

    PubMed

    Sbaraini, Nicolau; Guedes, Rafael Lucas Muniz; Andreis, Fábio Carrer; Junges, Ângela; de Morais, Guilherme Loss; Vainstein, Marilene Henning; de Vasconcelos, Ana Tereza Ribeiro; Schrank, Augusto

    2016-10-25

    The described species from the Metarhizium genus are cosmopolitan fungi that infect arthropod hosts. Interestingly, while some species infect a wide range of hosts (host-generalists), other species infect only a few arthropods (host-specialists). This singular evolutionary trait permits unique comparisons to determine how pathogens and virulence determinants emerge. Among the several virulence determinants that have been described, secondary metabolites (SMs) are suggested to play essential roles during fungal infection. Despite progress in the study of pathogen-host relationships, the majority of genes related to SM production in Metarhizium spp. are uncharacterized, and little is known about their genomic organization, expression and regulation. To better understand how infection conditions may affect SM production in Metarhizium anisopliae, we have performed a deep survey and description of SM biosynthetic gene clusters (BGCs) in M. anisopliae, analyzed RNA-seq data from fungi grown on cattle-tick cuticles, evaluated the differential expression of BGCs, and assessed conservation among the Metarhizium genus. Furthermore, our analysis extended to the construction of a phylogeny for the following three BGCs: a tropolone/citrinin-related compound (MaPKS1), a pseurotin-related compound (MaNRPS-PKS2), and a putative helvolic acid (MaTERP1). Among 73 BGCs identified in M. anisopliae, 20 % were up-regulated during initial tick cuticle infection and presumably possess virulence-related roles. These up-regulated BGCs include known clusters, such as destruxin, NG39x and ferricrocin, together with putative helvolic acid and, pseurotin and tropolone/citrinin-related compound clusters as well as uncharacterized clusters. Furthermore, several previously characterized and putative BGCs were silent or down-regulated in initial infection conditions, indicating minor participation over the course of infection. Interestingly, several up-regulated BGCs were not conserved in host

  9. Efficacy of Metarhizium anisopliae isolate MAX-2 from Shangri-la, China under desiccation stress

    PubMed Central

    2014-01-01

    Background Metarhizium anisopliae, a soil-borne entomopathogen found worldwide, is an interesting fungus for biological control. However, its efficacy in the fields is significantly affected by environmental conditions, particularly moisture. To overcome the weakness of Metarhizium and determine its isolates with antistress capacity, the efficacies of four M. anisopliae isolates, which were collected from arid regions of Yunnan Province in China during the dry season, were determined at different moisture levels, and the efficacy of the isolate MAX-2 from Shangri-la under desiccation stress was evaluated at low moisture level. Results M. anisopliae isolates MAX-2, MAC-6, MAL-1, and MAQ-28 showed gradient descent efficacies against sterile Tenebrio molitor larvae, and gradient descent capacities against desiccation with the decrease in moisture levels. The efficacy of MAX-2 showed no significant differences at 35% moisture level than those of the other isolates. However, significant differences were found at 8% to 30% moisture levels. The efficacies of all isolates decreased with the decrease in moisture levels. MAX-2 was relatively less affected by desiccation stress. Its efficacy was almost unaffected by the decrease at moisture levels > 25%, but slowly decreased at moisture levels < 25%. By contrast, the efficacies of other isolates rapidly decreased with the decrease in moisture levels. MAX-2 caused different infection characteristics on T. molitor larvae under desiccation stress and in wet microhabitat. Local black patches were found on the cuticles of the insects, and the cadavers dried without fungal growth under desiccation stress. However, dark black internodes and fungal growth were found after death of the insects in the wet microhabitat. Conclusions MAX-2 showed significantly higher efficacy and superior antistress capacity than the other isolates under desiccation stress. The infection of sterile T. molitor larvae at low moisture level constituted a

  10. The effect of delayed host self-regulation on host-pathogen population cycles in forest insects.

    PubMed

    Xiao, Yanni; Bowers, Roger G; Tang, Sanyi

    2009-05-21

    Delayed host self-regulation using a Beverton-Holt function and delayed logistic self-regulation are included in a host-pathogen model with free-living infective stages (Anderson and May's model G) with the purpose of investigating whether adding the relatively complex self-regulations decrease the likelihood of population cycles. The main results indicate that adding delayed self-regulation to the baseline model increases the likelihood of population cycles. The dynamics display some of the key features seen in the field, such as cycle peak density exceeding the carrying capacity and a locally stable equilibrium coexisting with a stable cycle (bistability). Numerical studies show that the model with more complex forms of self-regulation can generate cycles which match most aspects of the cycles observed in nature.

  11. Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

    PubMed

    Bechara, I J; Destéfano, R H R; Bresil, C; Messias, C L

    2011-02-01

    The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

  12. The combination of the entomopathogenic fungus Metarhizium anisopliae with the insecticide Imidacloprid increases virulence against the dengue vector Aedes aegypti (Diptera: Culicidae).

    PubMed

    Paula, Adriano R; Carolino, Aline T; Paula, Cátia O; Samuels, Richard I

    2011-01-25

    Dengue fever transmitted by the mosquito Aedes aegypti, is one of the most rapidly spreading insect borne diseases, stimulating the search for alternatives to current control measures. The dengue vector A. aegypti has received less attention than anophelene species, although more than 2.5 billion people are at risk of infection worldwide. Entomopathogenic fungi are emerging as potential candidates for the control of mosquitoes. Here we continue our studies on the pathogenicity of the entomopathogenic fungus Metarhizium anisopliae against adult A. aegypti females. With the aim of further reducing mean survival times of A. aegypti exposed to fungus impregnated surfaces, a sub-lethal concentration of the neonicotinoid insecticide Imidacloprid (IMI) was added to fungal suspensions. A sub-lethal concentration of IMI that did not significantly alter the daily survival rates or mean survival percentages of mosquitoes was identified to be 0.1 ppm. This sub-lethal concentration was combined with M. anisopliae conidia (1 × 10(9) conidia mL(-1)). Both the combined treatment and the conidia alone were able to reduce the survival of A. aegypti compared with untreated or IMI treated mosquitoes. Importantly, mosquito survival following exposure to the combined treatment for 6 and 12 hrs was significantly reduced when compared with mosquitoes exposed to conidia alone. This is the first time that a combination of an insecticide and an entomopathogenic fungus has been tested against A. aegypti. Firstly, the study showed the potential of IMI as an alternative to the currently employed pyrethroid adulticides. Secondly, as an alternative to applications of high concentrations of chemical insecticides, we suggest that adult A. aegypti could be controlled by surface application of entomopathogenic fungi and that the efficiency of these fungi could be increased by combining the fungi with ultra-low concentrations of insecticides, resulting in higher mortality following relatively short

  13. Antifungal activity of the termite alkaloid norharmane against the mycelial growth of Metarhizium anisopliae and Aspergillus nomius.

    PubMed

    Chouvenc, Thomas; Su, Nan-Yao; Elliott, Monica I

    2008-11-01

    Antifungal activity of norharmane, a beta-carboline alkaloid found in termites (Isoptera, Rhinotermitidae) was tested against two entomopathogenic fungi, Metarhizium anisopliae and Aspergillus nomius. It was determined that, at physiological concentration (10 microg ml(-1)), norharmane had no significant effect on A. nomius mycelial growth rate but reduced M. anisopliae growth rate by 11.9%. Contrary to previous findings, we suggest that norharmane has a limited role in disease resistance against fungal pathogens in individual subterranean termites, and we discuss the potential role of this chemical at a colony level.

  14. The physiological effects of multi-walled carbon nanotubes (MWCNTs) on conidia and the development of the entomopathogenic fungus, Metarhizium anisopliae (Metsch.) Sorok.

    PubMed

    Gorczyca, Anna; Kasprowicz, Marek J; Lemek, Tadeusz

    2014-01-01

    The aim of the study was an in vitro evaluation of the effect of MWCNTs on the conidia of two strains of entomopathogenic fungus, Metarhizium anisopliae. The study made use of water suspensions of MWCNTs (concentration ∼ 3 mg·mL(-1)) made from commercial nanotubes and centrifuged. The conidia were placed in contact with nanotubes for 240 h. An assessment of MWCNT influence on conidia was performed after 1, 24, 72 and 240 h and focused on the linear growth of vegetative mycelium derived from these conidia, mycelium sporulation in subcultures and pathogenicity. Using TEM imaging, it was demonstrated that carbon nanotubes are able to damage cell membranes of the examined fungi conidia. However, the absence was noted of a significantly fungistatic effect of both MWCNT suspensions on the examined strains with respect to the physiological features in question. The increase in vegetative mycelium effected by spores after contact with MWCNTs was characterized by a slight modification in relation to the control. There was no strong trend (inhibition - stimulation), in relation to the effect of the tested suspension of carbon nanotubes, on the development of the vegetative mycelium in in vitro culture. Sporulation of the mycelium after completion of the culture only occurred in one case (strain Ma73F and culture of spores after 24-h contact with MWCNTs) significantly more intensely than in the controls. With respect to pathogenicity for test insects compared to the control strain, Ma73F spores grown from the longest contact with nanotubes suspensions performed significantly better. On the basis of the calculated of mycelium index growth rates and the time of death of the test insects (LT50), it was found that the adverse effects of water suspension MWCNTs on the spores of M. anisopliae were applied after a short contact with biological material. This indicates unfavorable physical rather than chemical effects on the tested cell. Over time, nanotube aggregation in water

  15. Independent origins of diploidy in Metarhizium.

    PubMed

    Kepler, Ryan Michael; Chen, Yuan; Kilcrease, James; Shao, Jonathan; Rehner, Stephen A

    2016-09-12

    In fungi, stable diploid genome arrangements are rare. Here we present evidence from nuclear intergenic DNA sequencing, microsatellite genotyping, and configuration of the mating-type locus to demonstrate two independent origins of persistent diploid genome organization in the Metarhizium majus species complex. Most taxa in the complex are genotypically haploid, with individual isolates consistently displaying a single allele across all nuclear loci, as well as having a single mating-type locus. In contrast, individuals of M. majus and the clade designated here MGT1 are shown to be diploid, based on a consistent finding of heterozygosity and the presence of both MAT1 and MAT2 mating-type loci. In single locus phylogenies, nuclear intergenic alleles of M. majus and MGT1 each form monophyletic groups, indicating that diploidy in both taxa likely originated by the union of conspecific individuals. Sequence divergence in the APN2/MAT1-1-3 and APN2/MAT2-1 intergenic spacers indicate the two MAT loci are physically separated in the genomes of both diploid taxa, although the linkage relationship of the MAT loci to one another is unknown. The presence of both mating genes in a single nucleus suggests these diploid genomes may represent a mating event that failed to complete meiosis. Whether or not these isolates are able to complete the sexual cycle under any conditions and form ascospores remains an open question.

  16. Inactivation of the major hemolysin gene influences expression of the nonribosomal peptide synthetase gene swrA in the insect pathogen Serratia sp. strain SCBI.

    PubMed

    Petersen, Lauren M; LaCourse, Kaitlyn; Schöner, Tim A; Bode, Helge; Tisa, Louis S

    2017-08-07

    Hemolysins are important virulence factors for many bacterial pathogens, including Serratia marcescens The role of the major hemolysin gene in the insect pathogen Serratia sp. SCBI was investigated using both forward and reverse genetics approaches. Introduction of the major hemolysin gene into Escherichia coli resulted in a gain of both virulence and hemolytic activity. Inactivation of this hemolysin in Serratia sp. SCBI resulted in loss of hemolysis, but did not attenuate insecticidal activity. Unexpectedly, inactivation of the hemolysin gene in Serratia sp. SCBI resulted in significantly increased motility as well as increased antimicrobial activity. qRT-PCR analysis of mutants with a disrupted hemolysin gene showed a dramatic increase in mRNA levels of a nonribosomal peptide synthetase gene, swrA, which produces the surfactant serrawettin W2. Mutation of the swrA gene in Serratia sp. SCBI resulted in highly variable antibiotic activity, motility, virulence and hemolysis phenotypes that were dependent on the site of disruption within this 17.75 KB gene. When introduced into E. coli, swrA increases rates of motility and confers antimicrobial activity. While it is unclear how inactivation of the major hemolysin gene influences expression of swrA, these results suggest swrA plays an important role in motility and antimicrobial activity in Serratia sp. SCBI.IMPORTANCE The opportunistic gram-negative bacteria of the genus Serratia are found widespread in the environment and can cause human illness. Comparative genomics analysis between S. marcescens and a new Serratia species from South Africa, termed SCBI, shows that these two organisms are closely related, but differed in pathogenesis. S. marcescens kills Caenorhabditis nematodes, while Serratia sp. SCBI is not harmful and forms a beneficial association with them. This distinction presented the opportunity to investigate potential differences in the regulation of common virulence mechanisms between these two

  17. A genetically engineered H5 protein expressed in insect cells confers protection against different clades of H5N1 highly pathogenic avian influenza viruses in chickens.

    PubMed

    Oliveira Cavalcanti, Marcia; Vaughn, Eric; Capua, Ilaria; Cattoli, Giovanni; Terregino, Calogero; Harder, Timm; Grund, Christian; Vega, Carlos; Robles, Francisco; Franco, Julio; Darji, Ayub; Arafa, Abdel-Satar; Mundt, Egbert

    2017-04-01

    The evolution of highly pathogenic H5N1 avian influenza viruses (HPAI-H5N1) has resulted in the appearance of a number of diverse groups of HPAI-H5N1 based on the presence of genetically similar clusters of their haemagglutinin sequences (clades). An H5 antigen encoded by a recombinant baculovirus and expressed in insect cells was used for oil-emulsion-based vaccine prototypes. In several experiments, vaccination was performed at 10 days of age, followed by challenge infection on day 21 post vaccination (PV) with HPAI-H5N1 clades 2.2, 2.2.1, and 2.3.2. A further challenge infection with HPAI-H5N1 clade 2.2.1 was performed at day 42 PV. High haemagglutination inhibition titres were observed for the recH5 vaccine antigen, and lower haemagglutination inhibition titres for the challenge virus antigens. Nevertheless, the rate of protection from mortality and clinical signs was 100% when challenged at 21 days PV and 42 days PV, indicating protection over the entire broiler chicken rearing period without a second vaccination. The unvaccinated control chickens mostly died between two and five days after challenge infection. A low level of viral RNA was detected by reverse transcription followed by a quantitative polymerase chain reaction in a limited number of birds for a short period after challenge infection, indicating a limited spread of HPAI-H5N1 at flock level. Furthermore, it was observed that the vaccine can be used in a differentiation infected from vaccinated animals (DIVA) approach, based on the detection of nucleoprotein antibodies in vaccinated/challenged chickens. The vaccine fulfilled all expectations of an inactivated vaccine after one vaccination against challenge with different clades of H5N1-HPAI and is suitable for a DIVA approach.

  18. Laboratory evaluation of Beauveria bassiana and Metarhizium anisopliae in the control of Haemaphysalis qinghaiensis in China.

    PubMed

    Ren, Qiaoyun; Chen, Ze; Luo, Jin; Liu, Guangyuan; Guan, Guiquan; Liu, Zhijie; Liu, Aihong; Li, Youquan; Niu, Qingli; Liu, Junlong; Yang, Jifei; Han, Xueqing; Yin, Hong; Luo, Jianxun

    2016-06-01

    Haemaphysalis qinghaiensis, a prevalent tick species in China, is an ectoparasite that preferentially infests small ruminants and can transmit Theileria sp. and Babesia sp. In this study, we evaluated the pathogenicity of individual and mixed infections of the fungi Beauveria bassiana and Metarhizium anisopliae to H. qinghaiensis nymphs. The estimated LC50 for ticks immersed in solutions of B. bassiana, M. anisopliae and a mixture thereof were: 5.88056 × 10(4), 2.65 × 10(4), and 2.85 × 10(4) conidia mL(-1) respectively, and the nymphal mortality ranged from 52 to 100 %. Thus, these results suggest a potential approach for the biocontrol of H. qinghaiensis.

  19. A natural fungal infection of a sylvatic cockroach with Metarhizium blattodeae sp. nov., a member of the M. flavoviride species complex.

    PubMed

    Montalva, Cristian; Collier, Karin; Rocha, Luiz Fernando Nunes; Inglis, Peter Ward; Lopes, Rogério Biaggioni; Luz, Christian; Humber, Richard A

    2016-05-01

    A wild, forest-dwelling cockroach from the subfamily Ectobiidae (order Blattodea) in a nature reserve in Cavalcante, in the state of Goiás, Brazil, was found to be infected by a new, genetically distinct species in the Metarhizium flavoviride species complex that we describe here as Metarhizium blattodeae. The status of this fungus as a new species is supported by both multigenic sequence comparisons and protein profiles generated by MALDI-TOF (matrix-assisted laser desorption/ionization time-of-flight) mass spectrometry. This is one of the first reports of a naturally occurring fungal pathogen affecting any sylvatic (forest-dwelling) cockroach from any part of the world. M. blattodeae caused up to 96 % mortality of Periplaneta americana nymphs (a serious peridomestic cockroach species) after 10 d. Published by Elsevier Ltd.

  20. Investigations on the destruxin production of the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    Wang, Chengshu; Skrobek, Anke; Butt, Tariq M

    2004-03-01

    The dynamics of cyclic peptide destruxins (dtxs) produced by Metarhizium anisopliae strains V245 and V275 were monitored both on solid and in liquid media. The results showed that both strains did not produce dtxs in large-scale fermenter cultures or solid Czapek Dox (CD) agar. Production of the major dtxs A and B could be determined in both strains when grown on rice for up to 10-30 days. The main dtxs A, B, E, and E diol were detected in CD liquid culture filtrate from both strains after three days post-inoculation on. Parallel decrease of dtx E and increase of E diol in the culture medium were found, indicating that the latter is the hydrolytic product from the former. Production of dtxs A and B was significantly positively correlated. A negative correlation was observed between the production of the metabolites and pH value of the medium. The influence of different nutrient sources on dtx production was evaluated by using media with different carbon and nitrogen ratios as well as with different insect homogenates. The findings showed that the amount of dtxs A, B, and E increased with the increasing content of peptone in the medium. When insect homogenate was used as single nutrient source or added to CD medium, no toxins were detected in the culture filtrate. The potential risk posed by the toxic metabolites during mass production is discussed.

  1. Production of Conidia by the Fungus Metarhizium anisopliae Using Solid-State Fermentation.

    PubMed

    Loera-Corral, Octavio; Porcayo-Loza, Javier; Montesinos-Matias, Roberto; Favela-Torres, Ernesto

    2016-01-01

    This chapter describes the production of conidia by Metarhizium anisopliae using solid-state fermentation. Before production of conidia, procedures for strains conservation, reactivation, and propagation are essential in order to provide genetic stability of the strains. The strain is conserved in freeze-dried vials and then reactivated through insect inoculation. Rice is used as a substrate for the conidia production in two different bioreactors: plastic bags and tubular bioreactor. The CO2 production in the tubular bioreactors is measured with a respirometer; this system allows calculating indirect growth parameters as lag time (tlag) (25-35 h), maximum rate of CO2 production (rCO2 max) (0.5-0.7 mg/gdm h), specific rate of CO2 production (μ) (0.10-0.15 1/h), and final CO2 production (CO2) (100-120 mg/gdm). Conidial yield per gram of dry substrate (gdm) should be above 1 × 10(9) conidia/gdm after 10 days of incubation. Germination and viability of conidia obtained after 10 days of incubation should be above 80 % and 75 %, respectively. Bioassays using of Tenebrio molitor as a host insect should yield a final mortality above 80 %.

  2. Metacridamides A and B from the biocontrol fungus metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. As part of an effort to catalog the secondary metabolites of this fungus we discovered that its conidia produce two novel 17-membered macrocycl...

  3. Serinocyclins A and B, Cyclic Heptapeptides from Metarhizium anisopliae

    USDA-ARS?s Scientific Manuscript database

    Two new cyclic heptapeptides, serinocyclins A (1) and B (2), were isolated from conidia of the entomopathogenic fungus Metarhizium anisopliae. Structures were elucidated by a combination of mass spectrometric, NMR, and X-ray diffraction techniques. Serinocyclin A (1) contains three serine units, a...

  4. Innovations: applications of insect transgenesis.

    PubMed

    Wimmer, Ernst A

    2003-03-01

    The recent establishment of broadly applicable genetic transformation systems will allow the analysis of gene function in diverse insect species. This will increase our understanding of developmental and evolutionary biology. Furthermore, insect transgenesis will provide new strategies for insect pest management and methods to impair the transmission of pathogens by human disease vectors. However, these powerful techniques must be applied with great care to avoid harm to our environment.

  5. Insect mycophagy: a preliminary bibliography.

    Treesearch

    Robert. Fogel

    1975-01-01

    Insects that feed on fungi are primary dispersal agents for many beneficial and pathogenic species. Nearly 300 references on the subject, published since the mid-19th century are listed in this bibliography.

  6. Insect immunology and hematopoiesis.

    PubMed

    Hillyer, Julián F

    2016-05-01

    Insects combat infection by mounting powerful immune responses that are mediated by hemocytes, the fat body, the midgut, the salivary glands and other tissues. Foreign organisms that have entered the body of an insect are recognized by the immune system when pathogen-associated molecular patterns bind host-derived pattern recognition receptors. This, in turn, activates immune signaling pathways that amplify the immune response, induce the production of factors with antimicrobial activity, and activate effector pathways. Among the immune signaling pathways are the Toll, Imd, Jak/Stat, JNK, and insulin pathways. Activation of these and other pathways leads to pathogen killing via phagocytosis, melanization, cellular encapsulation, nodulation, lysis, RNAi-mediated virus destruction, autophagy and apoptosis. This review details these and other aspects of immunity in insects, and discusses how the immune and circulatory systems have co-adapted to combat infection, how hemocyte replication and differentiation takes place (hematopoiesis), how an infection prepares an insect for a subsequent infection (immune priming), how environmental factors such as temperature and the age of the insect impact the immune response, and how social immunity protects entire groups. Finally, this review highlights some underexplored areas in the field of insect immunobiology.

  7. Coevolution of parasitic fungi and insect hosts.

    PubMed

    Joop, Gerrit; Vilcinskas, Andreas

    2016-08-01

    Parasitic fungi and their insect hosts provide an intriguing model system for dissecting the complex co-evolutionary processes, which result in Red Queen dynamics. To explore the genetic basis behind host-parasite coevolution we chose two parasitic fungi (Beauveria bassiana and Metarhizium anisopliae, representing the most important entomopathogenic fungi used in the biological control of pest or vector insects) and two established insect model hosts (the greater wax moth Galleria mellonella and the red flour beetle Tribolium castaneum) for which sequenced genomes or comprehensive transcriptomes are available. Focusing on these model organisms, we review the knowledge about the interactions between fungal molecules operating as virulence factors and insect host-derived defense molecules mediating antifungal immunity. Particularly the study of the intimate interactions between fungal proteinases and corresponding host-derived proteinase inhibitors elucidated novel coevolutionary mechanisms such as functional shifts or diversification of involved effector molecules. Complementarily, we compared the outcome of coevolution experiments using the parasitic fungus B. bassiana and two different insect hosts which were initially either susceptible (Galleria mellonella) or resistant (Tribolium castaneum). Taking a snapshot of host-parasite coevolution, we show that parasitic fungi can overcome host barriers such as external antimicrobial secretions just as hosts can build new barriers, both within a relatively short time of coevolution. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

  8. 40 CFR 180.1303 - Metarhizium anisopliae strain F52; exemption from the requirement of a tolerance.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Metarhizium anisopliae strain F52... RESIDUES IN FOOD Exemptions From Tolerances § 180.1303 Metarhizium anisopliae strain F52; exemption from... residues of Metarhizium anisopliae strain F52 in or on all food commodities when applied as an insecticide...

  9. Multiorganismal insects: diversity and function of resident microorganisms.

    PubMed

    Douglas, Angela E

    2015-01-07

    All insects are colonized by microorganisms on the insect exoskeleton, in the gut and hemocoel, and within insect cells. The insect microbiota is generally different from microorganisms in the external environment, including ingested food. Specifically, certain microbial taxa are favored by the conditions and resources in the insect habitat, by their tolerance of insect immunity, and by specific mechanisms for their transmission. The resident microorganisms can promote insect fitness by contributing to nutrition, especially by providing essential amino acids, B vitamins, and, for fungal partners, sterols. Some microorganisms protect their insect hosts against pathogens, parasitoids, and other parasites by synthesizing specific toxins or modifying the insect immune system. Priorities for future research include elucidation of microbial contributions to detoxification, especially of plant allelochemicals in phytophagous insects, and resistance to pathogens; as well as their role in among-insect communication; and the potential value of manipulation of the microbiota to control insect pests.

  10. Multiorganismal Insects: Diversity and Function of Resident Microorganisms

    PubMed Central

    Douglas, Angela E.

    2015-01-01

    All insects are colonized by microorganisms on the insect exoskeleton, in the gut and hemocoel, and within insect cells. The insect microbiota is generally different from microorganisms in the external environment, including ingested food. Specifically, certain microbial taxa are favored by the conditions and resources in the insect habitat, by their tolerance of insect immunity, and by specific mechanisms for their transmission. The resident microorganisms can promote insect fitness by contributing to nutrition, especially by providing essential amino acids, B vitamins, and, for fungal partners, sterols. Some microorganisms protect their insect hosts against pathogens, parasitoids, and other parasites by synthesizing specific toxins or modifying the insect immune system. Priorities for future research include elucidation of microbial contributions to detoxification, especially of plant allelochemicals in phytophagous insects, and resistance to pathogens; as well as their role in among-insect communication; and the potential value of manipulation of the microbiota to control insect pests. PMID:25341109

  11. Social Transfer of Pathogenic Fungus Promotes Active Immunisation in Ant Colonies

    PubMed Central

    Konrad, Matthias; Vyleta, Meghan L.; Theis, Fabian J.; Stock, Miriam; Tragust, Simon; Klatt, Martina; Drescher, Verena; Marr, Carsten; Ugelvig, Line V.; Cremer, Sylvia

    2012-01-01

    Due to the omnipresent risk of epidemics, insect societies have evolved sophisticated disease defences at the individual and colony level. An intriguing yet little understood phenomenon is that social contact to pathogen-exposed individuals reduces susceptibility of previously naive nestmates to this pathogen. We tested whether such social immunisation in Lasius ants against the entomopathogenic fungus Metarhizium anisopliae is based on active upregulation of the immune system of nestmates following contact to an infectious individual or passive protection via transfer of immune effectors among group members—that is, active versus passive immunisation. We found no evidence for involvement of passive immunisation via transfer of antimicrobials among colony members. Instead, intensive allogrooming behaviour between naive and pathogen-exposed ants before fungal conidia firmly attached to their cuticle suggested passage of the pathogen from the exposed individuals to their nestmates. By tracing fluorescence-labelled conidia we indeed detected frequent pathogen transfer to the nestmates, where they caused low-level infections as revealed by growth of small numbers of fungal colony forming units from their dissected body content. These infections rarely led to death, but instead promoted an enhanced ability to inhibit fungal growth and an active upregulation of immune genes involved in antifungal defences (defensin and prophenoloxidase, PPO). Contrarily, there was no upregulation of the gene cathepsin L, which is associated with antibacterial and antiviral defences, and we found no increased antibacterial activity of nestmates of fungus-exposed ants. This indicates that social immunisation after fungal exposure is specific, similar to recent findings for individual-level immune priming in invertebrates. Epidemiological modeling further suggests that active social immunisation is adaptive, as it leads to faster elimination of the disease and lower death rates than

  12. ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY

    EPA Science Inventory

    ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY. M D W Ward1, M E Viana2, L B Copeland1, and MJ K Selgrade1. 1US EPA, ORD, NHEERL, RTP, NC, USA. 2NCSU, College of Veterinary Medicine, Raleigh, NC, USA.
    Metarhizium anisopli...

  13. ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY

    EPA Science Inventory

    ASSESSMENT OF A CRUDE FUNGAL (METARHIZIUM ANISOPLIAE) EXTRACT AND IT'S COMPONENTS FOR ALLERGENICITY. M D W Ward1, M E Viana2, L B Copeland1, and MJ K Selgrade1. 1US EPA, ORD, NHEERL, RTP, NC, USA. 2NCSU, College of Veterinary Medicine, Raleigh, NC, USA.
    Metarhizium anisopli...

  14. Clavicipitaceous entomopathogens: New species of Metarhizium and a new genus Nigelia

    USDA-ARS?s Scientific Manuscript database

    In several surveys in the tropical forests in Thailand, specimens that looked morphologically similar to Metarhizium martialis and Cordyceps variegata, as well as Metarhizium species were collected and cultured in vitro. A combined phylogeny of several genes including the small (18S) and large (28S)...

  15. A Field Test of Selected Insects and Pathogens for Control of Waterhyacinths. Report 1. Preliminary Results for the 1975-76 Season.

    DTIC Science & Technology

    control agents against waterhyacinths, Eichhornia crassipes (Mart.) Solms. Floating frames, each approximately 2 m square, were anchored on the lake in...insects (Arzama densa Walker and Neochetina eichhorniae Warner) and two fungi (Acremonium zonatum (Sawada) Gams and Cercospora rodmanii Conway) in a

  16. Edible insects are the future?

    PubMed

    van Huis, Arnold

    2016-08-01

    The global increase in demand for meat and the limited land area available prompt the search for alternative protein sources. Also the sustainability of meat production has been questioned. Edible insects as an alternative protein source for human food and animal feed are interesting in terms of low greenhouse gas emissions, high feed conversion efficiency, low land use, and their ability to transform low value organic side streams into high value protein products. More than 2000 insect species are eaten mainly in tropical regions. The role of edible insects in the livelihoods and nutrition of people in tropical countries is discussed, but this food source is threatened. In the Western world, there is an increasing interest in edible insects, and examples are given. Insects as feed, in particular as aquafeed, have a large potential. Edible insects have about the same protein content as conventional meat and more PUFA. They may also have some beneficial health effects. Edible insects need to be processed and turned into palatable dishes. Food safety may be affected by toxicity of insects, contamination with pathogens, spoilage during conservation and allergies. Consumer attitude is a major issue in the Western world and a number of strategies are proposed to encourage insect consumption. We discuss research pathways to make insects a viable sector in food and agriculture: an appropriate disciplinary focus, quantifying its importance, comparing its nutritional value to conventional protein sources, environmental benefits, safeguarding food safety, optimising farming, consumer acceptance and gastronomy.

  17. Selectivity of Metarhizium anisopliae and Beauveria bassiana (Hypocreales: Clavicipitaceae) on adults of Cotesia flavipes (Hymenoptera: Braconidae).

    PubMed

    Rossoni, Camila; Loureiro, Elisângela De Souza; Pereira, Fabricio Fagundes; Kassab, Samir Oliveira; Costa, Daniele Perassa; Barbosa, Rogério Hidalgo

    2014-01-01

    Understanding mortality patterns and interactions between entomopathogenic fungi and parasitoids is important to improve insect biological control programs. The aim of this study was to evaluate the effect of Metarhizium anisopliae (Metschnikoff, 1879) Sorokin, 1833 and Beauveria bassiana (Balsamo) Vuillemin, 1912 (Hypocreales: Clavicipitaceae) on adults of Cotesia flavipes (Cameron, 1891) (Hymenoptera: Braconidae) with biological insecticides Biometha WP Plus (M. anisopliae), Biovéria G (B. bassiana), Boverril WP (B. bassiana), Metarril WP (M. anisopliae), and Metie WP (M. anisopliae) at concentrations of 1 x 10(9) conidia (con).mL(-1), 5 x 10(9) con.ml(-1), and 10 x 10(9) con.ml(-1). In the experimental, 10 females of C. flavipes were packed in disposable cups capped with a contact surface (filter paper, 9 cm2) treated with commercial product. The experimental design was completely randomized, with 16 treatments and five replicates of 10 females each. Mortality was assessed at 24, 48, 72, 96, and 120 hours after exposition (HAE) of the products. In general, B. bassiana and M. anisopliae in the concentrations of 1 x 10(9) con.ml(-1), 5 x 10(9) con.ml(-1), and 10 x 10(9) con.ml(-1) can't affect C. flavipes females because the peak of mortality in treatments with bioinsecticides was similar to the control and this demonstrated the selectivity of fungi B. bassiana and M. anisopliae on C. flavipes females.

  18. Infectivity of Metarhizium anisopliae (Hypocreales: Clavicipitaceae) to Phlebotomus papatasi (Diptera: Psychodidae) under laboratory conditions.

    PubMed

    Zayed, Alia; Soliman, Mustafa M; El-Shazly, Mohamed M

    2013-07-01

    Susceptibility of Phlebotomus papatasi Scopoli (Diptera: Psychodidae) larvae to the entomopathogenic fungus Metarhizium anisopliae (Metschinkoff) Sorokin (Ma79) (Hypocreales: Clavicipitaceae) was evaluated at two different temperatures. The ability of the fungus to reinfect healthy sand flies was followed up for approximately 20 wk and the effect of in vivo repassage on the enhancement of its virulence was assessed. The fungus reduced the adult emergence at 26 +/- 1 degrees C when applied to larval diet. Six spore concentrations were used in the bioassays ranging from 1 x 10(6) to 5 x 10(8) spores/ml. Mortality decreased significantly when the temperature was raised to 31 +/- 1 degrees C at all tested concentrations. Fungus-treated vials were assayed against sand fly larvae at different time lapses without additional reapplication of the fungus in the media to determine whether the level of inocula persisting in the media was sufficient to reinfect healthy sand flies. Twenty weeks postapplication, there were still enough infectious propagules of Ma79 to infect 40% of P. papatasi larvae. A comparison between the infectivity of 10 subsequent in vitro cultures and the host-passed inocula of the fungus against sand fly larvae was conducted. Mortalities of P. papatasi larvae changed significantly when exposed to inocula passed through different insects. Presented data can provide vector control decision makers and end users with fundamental information for the introduction and application of M. anisopliae as an effective control agent against the main cutaneous leishmaniasis old-world vector P. papatasi.

  19. Insect Allergy.

    PubMed

    Lee, Hobart; Halverson, Sara; Mackey, Regina

    2016-09-01

    Insect bites and stings are common. Risk factors are mostly associated with environmental exposure. Most insect bites and stings result in mild, local, allergic reactions. Large local reactions and systemic reactions like anaphylaxis are possible. Common insects that bite or sting include mosquitoes, ticks, flies, fleas, biting midges, bees, and wasps. The diagnosis is made clinically. Identification of the insect should occur when possible. Management is usually supportive. For anaphylaxis, patients should be given epinephrine and transported to the emergency department for further evaluation. Venom immunotherapy (VIT) has several different protocols. VIT is highly effective in reducing systemic reactions and anaphylaxis.

  20. Alternative Oxidase in Resistance to Biotic Stresses: Nicotiana attenuata AOX Contributes to Resistance to a Pathogen and a Piercing-Sucking Insect But Not Manduca sexta Larvae1[W][OA

    PubMed Central

    Zhang, Lu; Oh, Youngjoo; Li, Hongyu; Baldwin, Ian T.; Galis, Ivan

    2012-01-01

    The role of the alternative respiratory pathway in the protection of plants against biotic stress was examined in transgenic tobacco (Nicotiana attenuata) plants (irAOX) silenced in the expression of ALTERNATIVE OXIDASE (AOX) gene. Wild-type and irAOX plants were independently challenged with (1) chewing herbivores (Manduca sexta), (2) piercing-sucking insects (Empoasca spp.), and (3) bacterial pathogens (Pseudomonas syringae pv tomato DC3000), showing that all these treatments can strongly elicit accumulation of AOX gene transcripts in wild-type plants. When N. attenuata chemical defenses and resistance were examined, irAOX plants showed wild-type levels of defense-related phytohormones, secondary metabolites, and resistance to M. sexta. In contrast, piercing-sucking leafhoppers (Empoasca spp.) caused more leaf damage and induced significantly higher salicylic acid levels in irAOX compared with wild-type plants in the field and/or glasshouse. Subsequently, irAOX plants accumulated lower levels of defense metabolites, 17-hydroxygeranyllinalool diterpene glycosides, caffeoylputrescine, and nicotine compared with wild-type plants under prolonged attack of Empoasca spp. in the glasshouse. Finally, an accelerated cell death phenotype was observed in irAOX plants infected with P. syringae, which correlated with higher levels of salicylic acid and hydrogen peroxide levels in pathogen-infected irAOX compared with wild-type leaves. Overall, the AOX-associated changes in phytohormone and/or redox levels appear to support the resistance of N. attenuata plants against cell piercing-sucking insects and modulate the progression of cell death in pathogen-infected tissues but are not effective against rapidly feeding specialist herbivore M. sexta. PMID:22961128

  1. Newly discovered insect RNA viruses in China.

    PubMed

    Qiu, Yang; Wang, ZhaoWei; Liu, YongXiang; Qi, Nan; Si, Jie; Xiang, Xue; Xia, XiaoLing; Hu, YuanYang; Zhou, Xi

    2013-08-01

    Insects are a group of arthropods and the largest group of animals on Earth, with over one million species described to date. Like other life forms, insects suffer from viruses that cause disease and death. Viruses that are pathogenic to beneficial insects cause dramatic economic losses on agriculture. In contrast, viruses that are pathogenic to insect pests can be exploited as attractive biological control agents. All of these factors have led to an explosion in the amount of research into insect viruses in recent years, generating impressive quantities of information on the molecular and cellular biology of these viruses. Due to the wide variety of insect viruses, a better understanding of these viruses will expand our overall knowledge of their virology. Here, we review studies of several newly discovered RNA insect viruses in China.

  2. Machine learning for characterization of insect vector feeding

    USDA-ARS?s Scientific Manuscript database

    Insects that feed by ingesting plant and animal fluids cause devastating damage to humans, livestock, and agriculture worldwide, primarily by transmitting phytopathogenic and zoonotic pathogens. The feeding processes required for successful disease transmission by sucking insects can be recorded by ...

  3. Insect Keepers

    ERIC Educational Resources Information Center

    Moore, Virginia J.; Chessin, Debby A.; Theobald, Becky

    2010-01-01

    Insects are fascinating creatures--especially when you and your students get up close and personal with them! To that end, the authors facilitated an inquiry-based investigation with an emphasis on identification of the different types of insects found in the school yard, their characteristics, their habitat, and what they eat, while engaging the…

  4. III. Insects

    Treesearch

    Jose F. Negron

    2011-01-01

    RMRS research on insect pests focuses mostly on conifer pests. There is a long history of invasive insects causing significant impacts, mortality, and changes in forest ecosystem structure in North America. Perhaps the most evident example is the introduction of the gypsy moth, Lymantria dispar, into eastern North America in the 1860s (Forbush and Frenald 1896)....

  5. Insect Keepers

    ERIC Educational Resources Information Center

    Moore, Virginia J.; Chessin, Debby A.; Theobald, Becky

    2010-01-01

    Insects are fascinating creatures--especially when you and your students get up close and personal with them! To that end, the authors facilitated an inquiry-based investigation with an emphasis on identification of the different types of insects found in the school yard, their characteristics, their habitat, and what they eat, while engaging the…

  6. Incredible Insects.

    ERIC Educational Resources Information Center

    Braus, Judy, Ed.

    1989-01-01

    Ranger Rick's NatureScope is a creative education series dedicated to inspiring in children an understanding and appreciation of the natural world while developing the skills they will need to make responsible decisions about the environment. Contents are organized into the following sections: (1) "What Makes an Insect an Insect?,"…

  7. Insect phylogenomics.

    PubMed

    Behura, S K

    2015-08-01

    Phylogenomics, the integration of phylogenetics with genome data, has emerged as a powerful approach to study the evolution and systematics of species. Recently, several studies employing phylogenomic tools have provided better insights into insect evolution. Next-generation sequencing methods are now increasingly used by entomologists to generate genomic and transcript sequences of various insect species and strains. These data provide opportunities for comparative genomics and large-scale multigene phylogenies of diverse lineages of insects. Phy-logenomic investigations help us to better understand systematic and evolutionary relationships of insect species that play important roles as herbivores, predators, detritivores, pollinators and disease vectors. It is important that we critically assess the prospects and limitations of phylogenomic methods. In this review, I describe the current status, outline the major challenges and remark on potential future applications of phylogenomic tools in studying insect systematics and evolution. © 2015 The Royal Entomological Society.

  8. Characterization of Metarhizium species and varieties based on molecular analysis, heat tolerance and cold activity

    USGS Publications Warehouse

    Fernandes, E.K.K.; Keyser, C.A.; Chong, J.P.; Rangel, D.E.N.; Miller, M.P.; Roberts, D.W.

    2010-01-01

    Aims: The genetic relationships and conidial tolerances to high and low temperatures were determined for isolates of several Metarhizium species and varieties. Methods and Results: Molecular-based techniques [AFLP and rDNA (ITS1, ITS2 and 5??8S) gene sequencing] were used to characterize morphologically identified Metarhizium spp. isolates from a wide range of sources. Conidial suspensions of isolates were exposed to wet heat (45 ?? 0??2??C) and plated on potato dextrose agar plus yeast extract (PDAY) medium. After 8-h exposure, the isolates divided clearly into two groups: (i) all isolates of Metarhizium anisopliae var. anisopliae (Ma-an) and Metarhizium from the flavoviride complex (Mf) had virtually zero conidial relative germination (RG), (ii) Metarhizium anisopliae var. acridum (Ma-ac) isolates demonstrated high heat tolerance (c. 70-100% RG). Conidial suspensions also were plated on PDAY and incubated at 5??C for 15 days, during which time RGs for Ma-an and Ma-ac isolates were virtually zero, whereas the two Mf were highly cold active (100% RG). Conclusions: Heat and cold exposures can be used as rapid tools to tentatively identify some important Metarhizium species and varieties. Significance and Impact of the Study: Identification of Metarhizium spp. currently relies primarily on DNA-based methods; we suggest a simple temperature-based screen to quickly obtain tentative identification of isolates as to species or species complexes. ?? 2009 The Society for Applied Microbiology.

  9. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    St Leger, R J; Frank, D C; Roberts, D W; Staples, R C

    1992-03-15

    The proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. We report here the isolation and characterization of a cDNA clone of the cuticle-degrading protease (Pr1) of Metarhizium anisopliae. The cDNA sequence revealed that Pr1 is synthesized as a large precursor (40.3 kDa) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kDa. The primary structure of Pr1 has extensive similarity with enzymes of the subtilisin subclass of serine endopeptidases and the serine, histidine and aspartate components of the active site in subtilisins are preserved. Proteinase K demonstrated the closest sequence similarity to Pr1 (61%) but Pr1 was twofold more effective than proteinase K at degrading isolated cuticles of Manduca sexta and 33-fold more effective at degrading structural proteins bound to the cuticle by covalent bonds. We postulate that the additional positively charged residues on the surface of the Pr1 molecule, as determined using proteinase K, may facilitate electrostatic binding to cuticle proteins which is a prerequisite for activity. Northern-blot analysis of RNA and nuclear run-on assays demonstrated transcriptional control of the expression of Pr1 during nutrient deprivation and during the formation of infection structures. Southern-blot analysis demonstrated that genes with significant homologies to Metarhizium Pr1 were present in the entomopathogens Aspergillus flavus and Verticillium lecanii but not Zoophthora (= Erynia) radicans.

  10. The Metarhizium anisopliae trp1 gene: cloning and regulatory analysis.

    PubMed

    Staats, Charley Christian; Silva, Marcia Suzana Nunes; Pinto, Paulo Marcos; Vainstein, Marilene Henning; Schrank, Augusto

    2004-07-01

    The trp1 gene from the entomopathogenic fungus Metarhizium anisopliae, cloned by heterologous hybridization with the plasmid carrying the trpC gene from Aspergillus nidulans, was sequence characterized. The predicted translation product has the conserved catalytic domains of glutamine amidotransferase (G domain), indoleglycerolphosphate synthase (C domain), and phosphoribosyl anthranilate isomerase (F domain) organized as NH2-G-C-F-COOH. The ORF is interrupted by a single intron of 60 nt that is position conserved in relation to trp genes from Ascomycetes and length conserved in relation to Basidiomycetes species. RT-PCR analysis suggests constitutive expression of trp1 gene in M. anisopliae.

  11. Imbibitional damage in conidia of the entomopathogenic fungi Beauveria bassiana, Metarhizium anisopliae, and Metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    When dried organisms are immersed in water, rapid imbibition may cause severe damage to plasma membranes; in unicellular organisms, such damage is usually lethal. This study investigated effects of pre-immersion moisture levels and immersion temperature on imbibitional damage in three insect pathoge...

  12. Molecular characterization and pathogenicity of fungal isolates for use against the small hive beetle (Aethina tumida)

    USDA-ARS?s Scientific Manuscript database

    The analysis of DNA sequences from fungal pathogens obtained from cadavers of the small hive beetle (SHB) collected from several apiaries in Florida revealed a mixture of saprobes and two potential primary entomopathogens, Metarhizium anisopliae and Beauveria bassiana. Spray tower bioassays indicate...

  13. Cuticle Fatty Acid Composition and Differential Susceptibility of Three Species of Cockroaches to the Entomopathogenic Fungi Metarhizium anisopliae (Ascomycota, Hypocreales).

    PubMed

    Gutierrez, Alejandra C; Gołębiowski, Marek; Pennisi, Mariana; Peterson, Graciela; García, Juan J; Manfrino, Romina G; López Lastra, Claudia C

    2015-04-01

    Differences in free fatty acids (FFAs) chemical composition of insects may be responsible for susceptibility or resistance to fungal infection. Determination of FFAs found in cuticular lipids can effectively contribute to the knowledge concerning insect defense mechanisms. In this study, we have evaluated the susceptibility of three species of cockroaches to the entomopathogenic fungi Metarhizium anisopliae (Metschnikoff) Sorokin by topical application. Mortality due to M. anisopliae was highly significant on adults and nymphs of Blattella germanica L. (Blattodea: Blattellidae). However, mortality was faster in adults than in nymphs. Adults of Blatta orientalis L. (Blattodea: Blattidae) were not susceptible to the fungus, and nymphs of Blaptica dubia Serville (Blattodea: Blaberidae) were more susceptible to the fungus than adults. The composition of cuticular FFAs in the three species of cockroaches was also studied. The analysis indicated that all of the fatty acids were mostly straight-chain, long-chain, saturated or unsaturated. Cuticular lipids of three species of cockroaches contained 19 FFAs, ranging from C14:0 to C24:0. The predominant fatty acids found in the three studied species of cockroaches were oleic, linoleic, palmitic, and stearic acid. Only in adults of Bl. orientalis, myristoleic acid, γ-linolenic acid, arachidic acid, dihomolinoleic acid, and behenic acid were identified. Lignoceric acid was detected only in nymphs of Bl. orientalis. Heneicosylic acid and docosahexaenoic acid were identified in adults of Ba. dubia.

  14. Immune-physiological aspects of synergy between avermectins and the entomopathogenic fungus Metarhizium robertsii in Colorado potato beetle larvae.

    PubMed

    Tomilova, Oksana G; Kryukov, Vadim Yu; Duisembekov, Bahytzhan A; Yaroslavtseva, Olga N; Tyurin, Maksim V; Kryukova, Natalia A; Skorokhod, Valery; Dubovskiy, Ivan M; Glupov, Viktor V

    2016-10-01

    The interaction between the entomopathogenic fungus Metarhizium robertsii and natural avermectin metabolites of the actinomycete Streptomyces avermitilis were investigated on Colorado potato beetle larvae. A synergy in the mortality of larvae was detected after simultaneous treatment with half-lethal doses of avermectins (commercial name actarophit) 0.005% and fungus (5×10(5)conidia/ml). The treatment with avermectins led to rapid fungal colonization of the hemolymph. The defense strategies of insects infected by fungus and treated with avermectins and untreated insects were compared to investigate the mechanisms of this synergy. We have shown an increase in hemocytes, especially immunocompetent cells - plasmatocytes and granular cells in the initial stages of mycosis (third day post inoculation). In contrast, avermectins suppressed cellular immunity in hemolymph. Specifically, avermectins dramatically decreased the count of granular cells in larvae infected and uninfected with fungus. Apoptosis inducement and hemocyte necrosis under the influence of avermectins has been shown in vitro as one of the possible reasons for hemocyte mortality. In addition, avermectins enhanced the activity of phenoloxidases in integuments and hemolymph and increased the activity of glutathione-S-transferases activity in the fat body and hemolymph of infected and uninfected larvae, thereby intensifying the development of fungal infection by M. robertsii in Colorado potato beetle larvae. The combination of fungal infection and avermectins constitutes a new perspective for developing multicomponent bioinsecticides. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. Insects as a Nitrogen Source for Plants.

    PubMed

    Behie, Scott W; Bidochka, Michael J

    2013-07-31

    Many plants have evolved adaptations in order to survive in low nitrogen environments. One of the best-known adaptations is that of plant symbiosis with nitrogen-fixing bacteria; this is the major route by which nitrogen is incorporated into plant biomass. A portion of this plant-associated nitrogen is then lost to insects through herbivory, and insects represent a nitrogen reservoir that is generally overlooked in nitrogen cycles. In this review we show three specialized plant adaptations that allow for the recovery of insect nitrogen; that is, plants gaining nitrogen from insects. First, we show specialized adaptations by carnivorous plants in low nitrogen habitats. Insect carnivorous plants such as pitcher plants and sundews (Nepenthaceae/Sarraceniaceae and Drosera respectively) are able to obtain substantial amounts of nitrogen from the insects that they capture. Secondly, numerous plants form associations with mycorrhizal fungi that can provide soluble nitrogen from the soil, some of which may be insect-derived nitrogen, obtained from decaying insects or insect frass. Finally, a specialized group of endophytic, insect-pathogenic fungi (EIPF) provide host plants with insect-derived nitrogen. These soil-inhabiting fungi form a remarkable symbiosis with certain plant species. They can infect a wide range of insect hosts and also form endophytic associations in which they transfer insect-derived nitrogen to the plant. Root colonizing fungi are found in disparate fungal phylogenetic lineages, indicating possible convergent evolutionary strategies between taxa, evolution potentially driven by access to carbon-containing root exudates.

  16. Insects as a Nitrogen Source for Plants

    PubMed Central

    Behie, Scott W.; Bidochka, Michael J.

    2013-01-01

    Many plants have evolved adaptations in order to survive in low nitrogen environments. One of the best-known adaptations is that of plant symbiosis with nitrogen-fixing bacteria; this is the major route by which nitrogen is incorporated into plant biomass. A portion of this plant-associated nitrogen is then lost to insects through herbivory, and insects represent a nitrogen reservoir that is generally overlooked in nitrogen cycles. In this review we show three specialized plant adaptations that allow for the recovery of insect nitrogen; that is, plants gaining nitrogen from insects. First, we show specialized adaptations by carnivorous plants in low nitrogen habitats. Insect carnivorous plants such as pitcher plants and sundews (Nepenthaceae/Sarraceniaceae and Drosera respectively) are able to obtain substantial amounts of nitrogen from the insects that they capture. Secondly, numerous plants form associations with mycorrhizal fungi that can provide soluble nitrogen from the soil, some of which may be insect-derived nitrogen, obtained from decaying insects or insect frass. Finally, a specialized group of endophytic, insect-pathogenic fungi (EIPF) provide host plants with insect-derived nitrogen. These soil-inhabiting fungi form a remarkable symbiosis with certain plant species. They can infect a wide range of insect hosts and also form endophytic associations in which they transfer insect-derived nitrogen to the plant. Root colonizing fungi are found in disparate fungal phylogenetic lineages, indicating possible convergent evolutionary strategies between taxa, evolution potentially driven by access to carbon-containing root exudates. PMID:26462427

  17. Wright-Giemsa staining to observe phagocytes in Locusta migratoria infected with Metarhizium acridum.

    PubMed

    Yu, Ying; Cao, Yueqing; Xia, Yuxian; Liu, Feihong

    2016-09-01

    Hemocytes are the first line of defense in the invertebrate immune system. Understanding their roles in cellular immunity is important for developing more efficient mycoinsecticides. However, the exact classification of hemocytes has been inconsistent and the various types of phagocytes in Locusta migratoria are poorly defined. Herein, the Wright-Giemsa staining method and microscopy were employed to characterize the hemocytes of L. migratoria following infection by Metarhizium acridum. Hemocytes were classified into four types, including granulocytes, plasmatocytes, prohemocytes, and oenocytoids, based on size, morphology, and dye-staining properties. Each type of hemocyte was classified into several subtypes according to different ultrastructural features. At least four subtypes of granulocytes or plasmatocytes, including small-nucleus plasmatocytes, basophil vacuolated plasmatocytes, homogeneous plasmatocytes, and eosinophilic granulocytes, carried out phagocytosis. The percentage of total phagocytes increased two days after infection by M. acridum, then gradually declined during the next two days, and then increased sharply again at the fifth day. Our data suggested that plasmatocytes and granulocytes may be the major phagocytes that protect against invasion by a fungal pathogen in L. migratoria. Total hemocytes in locusts significantly increased in the initial days after infection and decreased in the late period of infection compared to controls. In the hemocoel, hyphal bodies were recognized, enwrapped, and digested by the phagocytes. Then, the broken hyphal pieces were packaged as vesicles to be secreted from the cell. Moreover, locusts might have a sensitive and efficient cellular immune system that can regulate phagocyte differentiation and proliferation before fungi colonize the host hemolymph.

  18. Virulence of Entomopathogenic Fungi Metarhizium anisopliae and Paecilomyces fumosoroseus for the Microbial Control of Spodoptera exigua

    PubMed Central

    Han, Ji Hee; Jin, Byung Rae; Lee, Sang Yeob

    2014-01-01

    The beet armyworm Spodoptera exigua (Lepidoptera: Noctuidae) is difficult to control using chemical insecticides because of the development of insecticide resistance. Several pest control agents are used to control the beet armyworm. Entomopathogenic fungi are one of the candidates for eco-friendly pest control instead of chemical control agents. In this study, among various entomopathogenic fungal strains isolated from soil two isolates were selected as high virulence pathogens against larva of beet armyworm. Control efficacy of fungal conidia was influenced by conidia concentration, temperature, and relative humidity (RH). The isolates Metarhizium anisopliae FT83 showed 100% cumulative mortality against second instar larvae of S. exigua 3 days after treatment at 1 × 107 conidia/mL and Paecilomyces fumosoroseus FG340 caused 100% mortality 6 days after treatment at 1 × 104 conidia/mL. Both M. anisopliae FT83 and P. fumosoroseus FG340 effectively controlled the moth at 20~30℃. M. anisopliae FT83 was significantly affected mortality by RH: mortality was 86.7% at 85% RH and 13.4% at 45% RH. P. fumosoroseus FG340 showed high mortality as 90% at 45% RH and 100% at 75% RH 6 days after conidia treatments. These results suggest that P. fumosoroseus FG340 and M. anisopliae FT83 have high potential to develop as a biocontrol agent against the beet armyworm. PMID:25606011

  19. Biocontrol of pigeon tick Argas reflexus (Acari: Argasidae) by entomopathogenic fungus Metarhizium Anisopliae (Ascomycota: Hypocreales)

    PubMed Central

    Tavassoli, Mosa; Pourseyed, Seyed Hassan; Ownagh, Abdulghaffar; Bernousi, Iraj; Mardani, Karim

    2011-01-01

    The pigeon tick Argas reflexus is a pathogen-transmitting soft tick that typically feeds on pigeons, but can also attack humans causing local and systemic reactions. Chemical control is made difficult due to environmental contamination and resistance development. As a result, there is much interest in increasing the role of other strategies like biological control. In this study, the efficacy of three strains (V245, 685 and 715C) of entomopathogenic fungus Metarhizium anisopliae for biological control of three life stages of pigeon tick A. reflexus including eggs, larvae, engorged and unfed adults was investigated under laboratory conditions. Five concentrations of different strains of M. anisopliae ranging from 103 to 107 conidia/ml were used. All fungal strains significantly decreased hatchability of A. reflexus eggs. Strain V245 was the most effective strain on the mortality of larval stage with nearly 100% mortality at the lowest concentration (103 conidia/ml) at 10 days post-inoculation. The mortality rate of both engorged and unfed adult ticks were also increased significantly exposed to different conidial concentrations compared to the control groups (P < 0.05) making this fungus a potential biological control agent of pigeon tick reducing the use of chemical acaricides. PMID:24031777

  20. Expression of a chitinase gene from Metarhizium anisopliae in tobacco plants confers resistance against Rhizoctonia solani.

    PubMed

    Kern, Marcelo Fernando; Maraschin, Simone de Faria; Vom Endt, Débora; Schrank, Augusto; Vainstein, Marilene Henning; Pasquali, Giancarlo

    2010-04-01

    The chit1 gene from the entomopathogenic fungus Metarhizium anisopliae, encoding the endochitinase CHIT42, was placed under the control of the CaMV 35S promoter, and the resulting construct was transferred to tobacco. Seventeen kanamycin-resistant transgenic lines were recovered, and the presence of the transgene was confirmed by polymerase chain reactions and Southern blot hybridization. The number of chit1 copies was determined to be varying from one to four. Copy number had observable effects neither on plant growth nor development. Substantial heterogeneity concerning production of the recombinant chitinase, and both general and specific chitinolytic activities were detected in leaf extracts from primary transformants. The highest chitinase activities were found in plants harboring two copies of chit1 inserts at different loci. Progeny derived from self-pollination of the primary transgenics revealed a stable inheritance pattern, with transgene segregation following a mendelian dihybrid ratio. Two selected plants expressing high levels of CHIT42 were consistently resistant to the soilborne pathogen Rhizoctonia solani, suggesting a direct relationship between enzyme activity and reduction of foliar area affected by fungal lesions. To date, this is the first report of resistance to fungal attack in plants mediated by a recombinant chitinase from an entomopathogenic and acaricide fungus.

  1. Metarhizium anisopliae as a biological control agent against Hyalomma anatolicum (Acari: Ixodidae).

    PubMed

    Suleiman, Elham A; Shigidi, M T; Hassan, S M

    2013-12-15

    In the Sudan, ticks and Tick-borne Diseases (TBDs) with subsequent costs of control and treatment are causing substantial economic loss. Control of ticks is mainly by chemical insecticides. The rising environmental hazards and problem of resistance has motivated research on biological agents as alternative methods of control. The present study aims at controlling livestock ticks using fungi for their unique mode of action besides their ability to adhere to the cuticle, to germinate and penetrate enzymatically. The study was conducted to evaluate the fungus Metarhizium anisopliae for tick control as an alternative mean to chemical acaricides. Pathogenicity of the fungus was tested on different developmental stages of the tick Hyalomma anatolicum. The fungus induced high mortality to flat immature stages. It, also, affected reproductive potential of the females. Egg laid, hatching percent, fertility and moulting percent of immature stages were significantly (p < or = 0.05) reduced. It was, also, shown that the fungus had ability to adhere to the cuticle and penetrate the integument of the tick. Conidia of the fungus were isolated from their internal tissues. This phenomenon is important in considering fungi as bioinsecticides. Infection of eggs laid by treated engorged female ticks, with the fungus might demonstrate suggesting transovarian transmission. The use of M. anisopliae to control ticks is discussed.

  2. Fungal tyrosine betaine, a novel secondary metabolite from conidia of entomopathogenic Metarhizium spp. fungi.

    PubMed

    Carollo, Carlos A; Calil, Ana Luiza A; Schiave, Letícia A; Guaratini, Thais; Roberts, Donald W; Lopes, Norberto P; Braga, Gilberto U L

    2010-01-01

    Fungi, including the entomopathogenic deuteromycete Metarhizium anisopliae, produce a wide diversity of secondary metabolites that either can be secreted or stored in specific developmental structures, e.g., conidia. Some secondary metabolites, such as pigments, polyols and mycosporines, are associated with pathogenicity and/or fungal tolerance to several stress-inducing environmental factors, including temperature and solar radiation extremes. Extracts of M. anisopliae var. anisopliae (strain ESALQ-1037) conidia were purified by chromatographic procedures and the isolated compounds analyzed by ¹H and ¹³C nuclear magnetic resonance spectroscopy and high-resolution mass spectrometry. LC-MS analyses were carried out to search for mycosporines (the initial targets), but no compounds of this class were detected. A molecule whose natural occurrence was previously undescribed was identified. It consists of betaine conjugated with tyrosine, and the structure was identified as 2-{[1-carboxy-2-(4-hydroxyphenyl)ethyl]amino}-N,N,N-trimethyl-2-oxoethanammonium. Mannitol was the predominant compound in the alcoholic conidial extract, but no amino acids other than tyrosine were found to be conjugated with betaine in conidia. The fungal tyrosine betaine was detected also in conidial extracts of three other M. anisopliae var. anisopliae (ARSEF 1095, 5626 and 5749) and three M. anisopliae var. acridum isolates (ARSEF 324, 3391 and 7486), but it was not detected in Aspergillus nidulans conidial extract (ATCC 10074).

  3. Transplastomic Nicotiana benthamiana plants expressing multiple defence genes encoding protease inhibitors and chitinase display broad-spectrum resistance against insects, pathogens and abiotic stresses.

    PubMed

    Chen, Peng-Jen; Senthilkumar, Rajendran; Jane, Wann-Neng; He, Yong; Tian, Zhihong; Yeh, Kai-Wun

    2014-05-01

    Plastid engineering provides several advantages for the next generation of transgenic technology, including the convenient use of transgene stacking and the generation of high expression levels of foreign proteins. With the goal of generating transplastomic plants with multiresistance against both phytopathogens and insects, a construct containing a monocistronic patterned gene stack was transformed into Nicotiana benthamiana plastids harbouring sweet potato sporamin, taro cystatin and chitinase from Paecilomyces javanicus. Transplastomic lines were screened and characterized by Southern/Northern/Western blot analysis for the confirmation of transgene integration and respective expression level. Immunogold localization analyses confirmed the high level of accumulation proteins that were specifically expressed in leaf and root plastids. Subsequent functional bioassays confirmed that the gene stacks conferred a high level of resistance against both insects and phytopathogens. Specifically, larva of Spodoptera litura and Spodoptera exigua either died or exhibited growth retardation after ingesting transplastomic plant leaves. In addition, the inhibitory effects on both leaf spot diseases caused by Alternaria alternata and soft rot disease caused by Pectobacterium carotovorum subsp. carotovorum were markedly observed. Moreover, tolerance to abiotic stresses such as salt/osmotic stress was highly enhanced. The results confirmed that the simultaneous expression of sporamin, cystatin and chitinase conferred a broad spectrum of resistance. Conversely, the expression of single transgenes was not capable of conferring such resistance. To the best of our knowledge, this is the first study to demonstrate an efficacious stacked combination of plastid-expressed defence genes which resulted in an engineered tolerance to various abiotic and biotic stresses. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  4. Differential allergy responses to Metarhizium anisopliae fungal component extracts in BALB/c mice

    EPA Science Inventory

    Intratracheal aspiration (IA) exposure to Metarhizium anisopliae crude antigen (MACA), which is composed of equal protein amounts of mycelium (MYC), conidia (CON) and inducible proteases/chitinases (IND) extracts/filtrates, has resulted in responses characteristic of human allerg...

  5. Evaluation of Metarhizium brunneum F52 (Hypocreales: Clavicipitaceae) for control of Japanese beetle larvae in turfgrass

    USDA-ARS?s Scientific Manuscript database

    Experimental and commercial preparations of Metarhizium brunneum strain F52 were evaluated for control of Japanese beetle Popillia japonica Newman (Coleoptera: Scarbaeidae) larvae (white grubs) in the laboratory and under field conditions. Experimental preparations consisted of granule and liquid f...

  6. Differential allergy responses to Metarhizium anisopliae fungal component extracts in BALB/c mice

    EPA Science Inventory

    Intratracheal aspiration (IA) exposure to Metarhizium anisopliae crude antigen (MACA), which is composed of equal protein amounts of mycelium (MYC), conidia (CON) and inducible proteases/chitinases (IND) extracts/filtrates, has resulted in responses characteristic of human allerg...

  7. Beauveria bassiana and Metarhizium anisopliae endophytically colonize cassava roots following soil drench inoculation

    USDA-ARS?s Scientific Manuscript database

    The fungal entomopathogens Beauveria bassiana and Metarhizium anisopliae were investigated to determine if endophytic colonization could be achieved in cassava. An inoculation method based on drenching the soil around cassava stems using conidial suspensions resulted in endophytic colonization of ca...

  8. First record of the insect pathogenic alga Helicosporidium sp. (Chlorophyta: Trebouxiophyceae) infection in larvae and pupae of Rhizophagusgrandis Gyll. (Coleoptera, Rhizophaginae) from Turkey.

    PubMed

    Yaman, Mustafa; Radek, Renate; Aydin, Ciçek; Tosun, Onur; Ertürk, Omer

    2009-10-01

    The predator beetle Rhizophagus grandis Gyll. (Coleoptera, Rhizophaginae) is one of the most important biological control agents, mass-bred and used to suppress populations of an important pest: the great spruce bark beetle, Dendroctonus micans. The achlorophyllous alga Helicosporidium sp. was first discovered in the pest. Later it was also found in the predator, but only in the adults. In this study, the pathogenic alga Helicosporidium sp. was discovered in larvae and early pupae of R. grandis for the first time. The morphological characteristics of the pathogenic alga were revealed by light and electron microscopy. Infection rates of Helicosporidium sp. in the larvae and pupae of R. grandis were 23.5% and 6.25%, respectively.

  9. Insect Repellents: Reducing Insect Bites

    MedlinePlus

    ... What is an insect repellent? Disease risk from mosquito and tick bites Ingredients in skin-applied repellents ... and Blogs Using Repellent Products to Protect against Mosquito-Borne Illnesses Federal Trade Commission Action on Deceptive ...

  10. Insect Phylogenomics

    PubMed Central

    Behura, Susanta K.

    2015-01-01

    With the advent of next-generation sequencing methods, phylogenetics has taken a new turn in the recent years. Phylogenomics, the integration of phylogenetics with genome data, has emerged as a powerful approach to study systematics and evolution of species. Recently, breakthrough researches employing phylogenomic tools have provided better insights into the timing and pattern of insect evolution. The next-generation sequencing methods are now increasingly used by entomologists to generate genomic and transcript sequences of various insect species and strains. These data provide opportunities for comparative genomics and large-scale multigene phylogenies of diverse lineages of insects. Phylogenomic investigations help us better understand systematic and evolutionary relationships of insect species that play important roles as herbivores, predators, detritivores, pollinators, or disease vectors. It is important that we critically assess the prospects and limitations of phylogenomic methods. In this review, I describe the current status, outline the major challenges, and remark on potential future applications of phylogenomic tools in studying insect systematics and evolution. PMID:25963452

  11. Genetic diversity and population structure of the Chinese Fungus Metarhizium rileyi causing green muscardine in silkworm.

    PubMed

    Zhang, Shengli; Chen, Xue; Luan, Fenggang; He, Lingmin; Pu, Shunchang; Li, Zengzhi

    2016-10-01

    Green muscardine caused by Metarhizium rileyi affects sericulture, and is typically enzootic and occurs frequently at low incidence. We collected 152 M. rileyi isolates from silkworm cadavers in eight sericulture areas in seven provinces of China, and four strains from other Lepidoptera larvae in Qianshan(QS) County, Anhui province. Nine microsatellite inter-simple sequence repeat (ISSR) primers produced 91 distinct and reproducible bands, revealing a high level (90.11%) of DNA polymorphism. Unweighted Pair Group Method with Arithmetic Mean (UPGMA) cluster analysis divided the populations into four groups, with isolates from Qianshan County forming a single branch. All the 156 M. rileyi isolates were heterogenic and polyphyletic and did not displayed typical regional distribution except strains from Qianshan country. PCA analysis of the nine populations of M. rileyi revealed similar phylogenies among accessions. Genetic differentiation index (Gst) among eight enzootic populations was 0.3789 and gene flow (Nm) was 0.4098, suggesting the low gene flow maintained a high degree of differentiation. Gst between the enzootic population of Qianshan County and other seven populations exceeded the threshold of severe differentiation, with moderate differentiation between the remaining seven enzootic populations. Analysis of molecular variance (AMOVA) showed most ISSR variation (61%) among isolates occurred within populations. No significant correlation was observed between geographical and genetic distance. According to cluster analysis based on single enzootic population, every enzootic population showed dominance, namely mainly constituted of strains with high genetic similarity. These data indicated that the green muscardine in each local silkworm population was predominantly caused by a native group of M. rileyi. Furthermore, Gst and Nm of M. rileyi from silkworm and other Lepidoptera larvae in Qianshan County were 0.1174 and 1.8791, respectively, suggesting strains

  12. Insect maintenance and transmission.

    PubMed

    Kingdom, Heather

    2013-01-01

    Phytoplasmas are plant pathogens of huge economic importance due to responsibility for crop yield losses worldwide. Institutions around the world are trying to understand and control this yield loss at a time when food security is high on government agendas. In order to fully understand the mechanisms of phytoplasma infection and spread, more insect vector and phytoplasma colonies will need to be established for research worldwide. Rearing and study of these colonies is essential in the research and development of phytoplasma control measures. This chapter highlights general materials and methods for raising insect vector colonies and maintenance of phytoplasmas. Specific methods of rearing the maize leafhopper and maize bushy stunt phytoplasma and the aster leafhopper and aster yellows phytoplasma strain witches' broom are also included.

  13. Caterpillar-induced plant volatiles remain a reliable signal for foraging wasps during dual attack with a plant pathogen or non-host insect herbivore.

    PubMed

    Ponzio, Camille; Gols, Rieta; Weldegergis, Berhane T; Dicke, Marcel

    2014-08-01

    Plants respond to herbivory with the emission of plant volatiles, which can be used by the herbivores' natural enemies to locate their hosts or prey. In nature, plants are often simultaneously confronted with insect herbivores and phytopathogens, potentially interfering with the attraction of the herbivores' enemies as a result of modifications of the induced volatile blend. Here, we investigated parasitoid (Cotesia glomerata) attraction to volatiles of plants challenged by different attackers, either alone or in combination with Pieris brassicae caterpillars, hosts of C. glomerata. We used a natural system consisting of Brassica nigra plants, eggs and larvae of P. brassicae, Brevicoryne brassicae aphids and the bacterial phytopathogen Xanthomonas campestris pv. campestris. In all cases, parasitoids successfully located host-infested plants, and wasp foraging behaviour was unaffected by the simultaneous presence of a non-host attacker or host eggs. Analysis of the volatile emissions show that the volatile blends of caterpillar-infested treatments were different from those without caterpillars. Furthermore, dually attacked plants could not be separated from those with only caterpillars, regardless of non-host identity, supporting the behavioural data. Our results suggest that, in this system, indirect plant defences may be more resistant to interference than is generally assumed, with volatiles induced during dual attack remaining reliable indicators of host presence for parasitoids. © 2014 John Wiley & Sons Ltd.

  14. 16S rDNA-based phylogeny of non-symbiotic bacteria of Entorno-pathogenic nematodes from infected insect cadavers.

    PubMed

    Razia, M; Karthikraja, R; Padmanaban, K; Chellapandi, P; Sivaramakrishnan, S

    2011-06-01

    Using 16S rDNA gene sequencing technique, three different species of non-symbiotic bacteria of entomopatho-genic nematodes (EPNs) (Steinernema sp. and Heterorhabditis sp.) were isolated and identified from infected insect cadavers {Galleria mellonella larvae) after 48-hour post infections. Sequence similarity analysis revealed that the strains SRK3, SRK4 and SRK5 belong to Ochrobactrum cytisi, Schineria larvae and Ochrobactrum anthropi, respectively. The isolates O. anthropi and S. larvae were found to be associated with Heterorhabditis indica strains BDU-17 and Yer-136, respectively, whereas O. cytisi was associated with Steinernema siamkayai strain BDU-87. Phenotypically, temporal EPN bacteria were fairly related to symbiotic EPN bacteria (Photorhabdus and Xenorhabdus genera). The strains SRK3 and SRK5 were phylogeographically similar to several non-symbionts and contaminated EPN bacteria isolated in Germany (LMG3311T) and China (X-14), while the strain SRK4 was identical to the isolates of S. larvae (Ll/57, Ll/58, Ll/68 and L2/11) from Wohlfahrtia magnifica in Hungary. The result was further confirmed by RNA secondary structure and minimum energy calculations of aligned sequences. This study suggested that the non-symbionts of these nematodes are phylogeographically diverged in some extent due to phase variation. Therefore, these strains are not host-dependent, but environment-specific isolates. Copyright © 2011 Beijing Genomics Institute. Published by Elsevier Ltd. All rights reserved.

  15. Meta-analysis of the Effects of Insect Vector Saliva on Host Immune Responses and Infection of Vector-Transmitted Pathogens: A Focus on Leishmaniasis

    PubMed Central

    Ockenfels, Brittany; Michael, Edwin; McDowell, Mary Ann

    2014-01-01

    A meta-analysis of the effects of vector saliva on the immune response and progression of vector-transmitted disease, specifically with regard to pathology, infection level, and host cytokine levels was conducted. Infection in the absence or presence of saliva in naïve mice was compared. In addition, infection in mice pre-exposed to uninfected vector saliva was compared to infection in unexposed mice. To control for differences in vector and pathogen species, mouse strain, and experimental design, a random effects model was used to compare the ratio of the natural log of the experimental to the control means of the studies. Saliva was demonstrated to enhance pathology, infection level, and the production of Th2 cytokines (IL-4 and IL-10) in naïve mice. This effect was observed across vector/pathogen pairings, whether natural or unnatural, and with single salivary proteins used as a proxy for whole saliva. Saliva pre-exposure was determined to result in less severe leishmaniasis pathology when compared with unexposed mice infected either in the presence or absence of sand fly saliva. The results of further analyses were not significant, but demonstrated trends toward protection and IFN-γ elevation for pre-exposed mice. PMID:25275509

  16. The InhA2 Metalloprotease of Bacillus thuringiensis Strain 407 Is Required for Pathogenicity in Insects Infected via the Oral Route

    PubMed Central

    Fedhila, Sinda; Nel, Patricia; Lereclus, Didier

    2002-01-01

    The entomopathogenic bacterium Bacillus thuringiensis is known to secrete a zinc metalloprotease (InhA) that specifically cleaves antibacterial peptides produced by insect hosts. We identified a second copy of the inhA gene, named inhA2, in B. thuringiensis strain 407 Cry−. The inhA2 gene encodes a putative polypeptide showing 66.2% overall identity with the InhA protein and harboring the zinc-binding domain (HEXXH), which is characteristic of the zinc-requiring metalloproteases. We used a transcriptional inhA2′-lacZ fusion to show that inhA2 expression is induced at the onset of the stationary phase and is overexpressed in a Spo0A minus background. The presence of a reverse Spo0A box in the promoter region of inhA2 suggests that Spo0A directly regulates the transcription of inhA2. To determine the role of the InhA and InhA2 metalloproteases in pathogenesis, we used allelic exchange to isolate single and double mutant strains for the two genes. Spores and vegetative cells of the mutant strains were as virulent as those of the parental strain in immunized Bombyx mori larvae infected by the intrahemocoelic route. Exponential phase cells of all the strains displayed the same in vitro potential for colonizing the vaccinated hemocoel. We investigated the synergistic effect of the mutant strain spores on the toxicity of Cry1C proteins against Galleria mellonella larvae infected via the oral pathway. The spores of ΔinhA2 mutant strain were ineffective in providing synergism whereas those of the ΔinhA mutant strain were not. These results indicate that the B. thuringiensis InhA2 zinc metalloprotease has a vital role in virulence when the host is infected via the oral route. PMID:12029046

  17. Forest Insect and Disease Tally System (FINDIT) user manual

    Treesearch

    Barbara J. Bentz

    2000-01-01

    FINDIT, the Forest Insect and Disease Tally System, is an easy-to-use tool for analyzing insect and disease population information taken during stand surveys. Incidence of insects, pathogens, and other biotic and abiotic influences on forest ecosystems are summarized using traditional mensurational measurements. Information is summarized by diameter class, tree species...

  18. Machine learning for characterization of insect vector feeding

    USDA-ARS?s Scientific Manuscript database

    Insects that feed by ingesting plant and animal fluids cause devastating damage to humans, livestock, and agriculture worldwide, primarily by transmitting pathogens of plants and animals. The feeding processes required for successful pathogen transmission by sucking insects can be recorded by monito...

  19. Insects: A nutritional alternative

    NASA Technical Reports Server (NTRS)

    Dufour, P. A.

    1981-01-01

    Insects are considered as potential food sources in space. Types of insects consumed are discussed. Hazards of insect ingestion are considered. Insect reproduction, requirements, and raw materials conversion are discussed. Nutrition properties and composition of insects are considered. Preparation of insects as human food is discussed.

  20. Laboratory bioassays and field-cage trials of Metarhizium spp. isolates with field-collected Mormon crickets (Anabrus simplex)

    USDA-ARS?s Scientific Manuscript database

    The Mormon cricket, Anabrus simplex, is an important pest in the western United States. This study evaluates the virulence of 32 isolates of Metarhizium towards field-collected Mormon crickets. Additionally, several isolates were tested in outdoor field-cage studies. All 32 Metarhizium isolates were...

  1. The effect of leaf biopesticide Mirabilis jalapa and fungi Metarhizium anisopliae to immune response and mortality of Spodoptera exigua instar IV

    NASA Astrophysics Data System (ADS)

    Suryani, A. Irma; Anggraeni, Tjandra

    2014-03-01

    Spodoptera exigua is one of insect causing damage in agriculture sector. This insect can be controlled by a natural biopesticide by combining two agents of biological control, biopesticides Mirabilis jalapa and entomopathogenic fungi Metarhizium anisopliae, considered to be virulent toward a wide range of insects. The objective of research was to determine the effect of biopesticides M. jalapa and fungi M. anisopliae against immune system and mortality of S. exigua. This research used a complete randomized block design with five concentrations Mirabilis jalapa and optimum dose of M. anisopliae. A high dose of M. jalapa (0.8% w/v) is the most effective one to decrease total haemocytes especially granulocyt and plasmatocyt (cellular immune) and decrease the concentration of lectin (humoral immune) from S. exigua (p < 0.05). The combination of M. jalapa (0, 8% w/v) and lethal dose of M. anisopliae 2.59 × 107 spore/ml were significant to increase mortality of S. exigua within 48 hours (p < 0.05).

  2. Harnessing insect-microbe chemical communications to control insect pest of agricultural systems

    USDA-ARS?s Scientific Manuscript database

    Insect pests have long been known to impose serious yield, economic, and food safety problems to managed crops worldwide, and are known to vector microbes, many of which are pathogenic or toxigenic. At the heart of many of these studies has been the vital understanding of the plant-insect interactio...

  3. Insect evolution.

    PubMed

    Engel, Michael S

    2015-10-05

    It goes without saying that insects epitomize diversity, and with over a million documented species they stand out as one of the most remarkable lineages in the 3.5-billion-year history of life on earth (Figure 1). This reality is passé to even the layperson and is taken for granted in the same way none of us think much of our breathing as we go about our day, and yet insects are just as vital to our existence. Insects are simultaneously familiar and foreign to us, and while a small fraction are beloved or reviled, most are simply ignored. These inexorable evolutionary overachievers outnumber us all, their segmented body plan is remarkably labile, they combine a capacity for high rates of speciation with low levels of natural extinction, and their history of successes eclipses those of the more familiar ages of dinosaurs and mammals alike. It is their evolution - persisting over vast expanses of geological time and inextricably implicated in the diversification of other lineages - that stands as one of the most expansive subjects in biology.

  4. Expression of scorpion toxin LqhIT2 increases the virulence of Metarhizium acridum towards Locusta migratoria manilensis.

    PubMed

    Peng, Guoxiong; Xia, Yuxian

    2014-11-01

    LqhIT2 is an insect-specific neurotoxin from the venom of scorpion. In this study, the LqhIT2 gene was introduced into the entomopathogenic fungus, Metarhizium acridum. The virulence of the genetically modified strain MaLqhIT2 was then evaluated against locusts (Locusta migratoria manilensis). Compared with the wild-type strain, the median lethal cell density (LC50) for MaLqhIT2 was a 22.6-fold lower, and the median times to death (LT50) for MaLqhIT2 were reduced by 30.3 and 29.6 %, respectively, after topical inoculation and injection. MaLqhIT2 also grew significantly faster in the hemolymph than wild-type strain. There were no significant differences in germination, appressorium formation and sporulation in locust carcasses between the MaLqhIT2 and wild-type strain. These results indicate that LqhIT2 increased the virulence of M. acridum towards locusts by shortening the in vivo infection period, without affecting cuticle penetration or conidia formation in the carcasses. LqhIT2 thus shows considerable potential for increasing fungal virulence against locusts.

  5. The effects of the fungus Metarhizium anisopliae var. acridum on different stages of Lutzomyia longipalpis (Diptera: Psychodidae).

    PubMed

    Amóra, Sthenia Santos Albano; Bevilaqua, Claudia Maria Leal; Feijó, Francisco Marlon Carneiro; Pereira, Romeika Hermínia de Macedo Assunção; Alves, Nilza Dutra; Freire, Fúlvio Aurélio de Morais; Kamimura, Michel Toth; de Oliveira, Diana Magalhães; Luna-Alves Lima, Elza Aurea; Rocha, Marcos Fábio Gadelha

    2010-03-01

    The control of Visceral Leishmaniasis (VL) vector is often based on the application of chemical residual insecticide. However, this strategy has not been effective. The continuing search for an appropriate vector control may include the use of biological control. This study evaluates the effects of the fungus Metarhizium anisopliae var. acridum on Lutzomyia longipalpis. Five concentrations of the fungus were utilized, 1 x 10(4) to 1 x 10(8) conidia/ml, accompanied by controls. The unhatched eggs, larvae and dead adults previously exposed to fungi were sown to reisolate the fungi and analysis of parameters of growth. The fungus was subsequently identified by PCR and DNA sequencing. M. anisopliae var. acridum reduced egg hatching by 40%. The mortality of infected larvae was significant. The longevity of infected adults was lower than that of negative controls. The effects of fungal infection on the hatching of eggs laid by infected females were also significant. With respect to fungal growth parameters post-infection, only vegetative growth was not significantly higher than that of the fungi before infection. The revalidation of the identification of the reisolated fungus was confirmed post-passage only from adult insects. In terms of larvae mortality and the fecundity of infected females, the results were significant, proving that the main vector species of VL is susceptible to infection by this entomopathogenic fungus in the adult stage. Copyright 2009 Elsevier B.V. All rights reserved.

  6. Ethanol production from chitosan by the nematophagous fungus Pochonia chlamydosporia and the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana.

    PubMed

    Aranda-Martinez, Almudena; Naranjo Ortiz, Miguel Ángel; Abihssira García, Isabel Sofía; Zavala-Gonzalez, Ernesto A; Lopez-Llorca, Luis Vicente

    2017-11-01

    Chitin is the second most abundant biopolymer after cellulose and virtually unexplored as raw material for bioethanol production. In this paper, we investigate chitosan, the deacetylated form of chitin which is the main component of shellfish waste, as substrate for bioethanol production by fungi. Fungal parasites of invertebrates such as the nematophagous Pochonia chlamydosporia (Pc) or the entomopathogens Beauveria bassiana (Bb) and Metarhizium anisopliae (Ma) are biocontrol agents of plant parasitic nematodes (eg. Meloidogyne spp.) or insect pests such as the red palm weevil (Rhynchophorus ferrugineus). These fungi degrade chitin-rich barriers for host penetration. We have therefore tested the chitin/chitosanolytic capabilities of Pc, Bb and Ma for generating reducing sugars using chitosan as only nutrient. Among the microorganisms used in this study, Pc is the best chitosan degrader, even under anaerobic conditions. These fungi have alcohol dehydrogenase (ADH) and pyruvate decarboxylase (PDC) encoding genes in their genomes. We have therefore analyzed their ethanol production under anaerobic conditions using chitosan as raw material. P. chlamydosporia is the largest ethanol producer from chitosan. Our studies are a starting point to develop chitin-chitosan based biofuels. Copyright © 2017 Elsevier GmbH. All rights reserved.

  7. Comparative transcriptomic analysis of the heat stress response in the filamentous fungus Metarhizium anisopliae using RNA-Seq.

    PubMed

    Wang, Zhang-Xun; Zhou, Xia-Zhi; Meng, Hui-Min; Liu, Yu-Jun; Zhou, Quan; Huang, Bo

    2014-06-01

    The entomopathogenic fungus Metarhizium anisopliae is widely used for biological control of a variety of insect pests. The effectiveness of the microbial pest control agent, however, is limited by poor thermotolerance. The molecular mechanism underlying the response to heat stress in the conidia of entomopathogenic fungi remains unclear. Here, we conducted high-throughput RNA-Seq to analyze the differential gene expression between control and heat treated conidia of M. anisopliae at the transcriptome level. RNA-Seq analysis generated 6,284,262 and 5,826,934 clean reads in the control and heat treated groups, respectively. A total of 2,722 up-regulated and 788 down-regulated genes, with a cutoff of twofold change, were identified by expression analysis. Among these differentially expressed genes, many were related to metabolic processes, biological regulation, cellular processes and response to stimuli. The majority of genes involved in endocytic pathways, proteosome pathways and regulation of autophagy were up-regulated, while most genes involved in the ribosome pathway were down-regulated. These results suggest that these differentially expressed genes may be involved in the heat stress response in conidia. As expected, significant changes in expression levels of genes encoding heat shock proteins and proteins involved in trehalose accumulation were observed in conditions of heat stress. These results expand our understanding of the molecular mechanisms of the heat stress response of conidia and provide a foundation for future investigations.

  8. The high osmotic response and cell wall integrity pathways cooperate to regulate morphology, microsclerotia development, and virulence in Metarhizium rileyi

    PubMed Central

    Song, Zhangyong; Zhong, Qiang; Yin, Youping; Shen, Ling; Li, Yan; Wang, Zhongkang

    2016-01-01

    Microsclerotia (MS) formation was successfully induced in Metarhizium rileyi under changing liquid culture conditions. Mitogen-activated protein kinases (MAPKs) play important roles in fungal development and in coordinating many stress responses. To investigate how M. rileyi transduces growth stress and regulates MS differentiation, we characterized the roles of two MAPKs, Hog1- and Slt2-type orthologues, in M. rileyi. Compared with the wild-type strain, the deletion mutants of Mrhog1 (ΔMrhog1) and Mrslt2 (ΔMrslt2) delayed germination and vegetative growth, displayed sensitivities to various stress, and produced morphologically abnormal clones. The ΔMrhog1 and ΔMrslt2 mutants significantly reduced conidial (42–99%) and MS (96–99%) yields. A transcriptional analysis showed that the two MAPKs regulate MS development in a cooperative manner. Insect bioassays revealed that ΔMrhog1 and ΔMrslt2 had decreased virulence levels in topical (36–56%) and injection (78–93%) bioassays. Our results confirmed the roles of MrHog1 and MrSlt2 in sensing growth-related stress and in regulating MS differentiation. PMID:27941838

  9. Ecological Considerations in Producing and Formulating Fungal Entomopathogens for Use in Insect Biocontrol

    USDA-ARS?s Scientific Manuscript database

    Insect pests persist in a wide variety of agricultural, arboreal, and urban environments. Effective control with fungal entomopathogens using inundation biocontrol requires an understanding of the ecology of the target insect, fungal pathogen, and the insect-pathogen interaction. Historically, the...

  10. Ecological Considerations in Producing and Formulating Fungal Entomopathogens for Use in Insect Biocontrol

    USDA-ARS?s Scientific Manuscript database

    Insect pests persist in a wide-variety of agricultural, arboreal, and urban environments. Effective control with fungal entomopathogens using inundation biocontrol requires an understanding of the ecology of the target insect, fungal pathogen, and the insect-pathogen interaction. Historically, the d...

  11. Autodissemination of the entomopathogenic fungus Metarhizium anisopliae amongst adults of the malaria vector Anopheles gambiae s.s.

    PubMed Central

    Scholte, Ernst-Jan; Knols, Bart GJ; Takken, Willem

    2004-01-01

    Background The entomopathogenic fungus Metarhizium anisopliae is being considered as a biocontrol agent for adult African malaria vectors. In the laboratory, work was carried out to assess whether horizontal transmission of the pathogen can take place during copulation, as this would enhance the impact of the fungus on target populations when compared with insecticides. Methods Virgin female Anopheles gambiae sensu stricto were exposed to conidia whilst resting on fungus-impregnated paper. These females were then placed together for one hour with uncontaminated males in proportions of either 1:1 or 1:10 shortly before the onset of mating activity. Results Males that had acquired fungal infection after mating indicate that passive transfer of the pathogen from infected females does occur, with mean male infection rates between 10.7 ± 3.2% and 33.3 ± 3.8%. The infections caused by horizontal transmission did not result in overall differences in survival between males from test and control groups, but in one of the three experiments the infected males had significantly shorter life spans than uninfected males (P < 0.05). Conclusion This study shows that autodissemination of fungal inoculum between An. gambiae s.s. mosquitoes during mating activity is possible under laboratory conditions. Field studies are required next, to assess the extent to which this phenomenon may augment the primary contamination pathway (i.e. direct contact with fungus-impregnated targets) of vector populations in the field. PMID:15566626

  12. Insect abatement system

    NASA Technical Reports Server (NTRS)

    Spiro, Clifford Lawrence (Inventor); Burnell, Timothy Brydon (Inventor); Wengrovius, Jeffrey Hayward (Inventor)

    1997-01-01

    An insect abatement system prevents adhesion of insect debris to surfaces which must be kept substantially free of insect debris. An article is coated with an insect abatement coating comprising polyorganosiloxane with a Shore A hardness of less than 50 and a tensile strength of less than 4 MPa. A method for preventing the adhesion of insect debris to surfaces includes the step of applying an insect abatement coating to a surface which must be kept substantially free of insect debris.

  13. Isolation of Metarhizium anisopliae carboxypeptidase A with native disulfide bonds from the cytosol of Escherichia coli BL21(DE3)

    PubMed Central

    Austin, Brian P.; Waugh, David S.

    2011-01-01

    The carboxypeptidase A enzyme from Metarhizium anisopliae (MeCPA) has broader specificity than the mammalian A-type carboxypeptidases, making it a more useful reagent for the removal of short affinity tags and disordered residues from the C-termini of recombinant proteins. When secreted from baculovirus-infected insect cells, the yield of pure MeCPA was 0.25 mg per liter of conditioned medium. Here, we describe a procedure for the production of MeCPA in the cytosol of Escherichia coli that yields approximately 0.5 mg of pure enzyme per liter of cell culture. The bacterial system is much easier to scale up and far less expensive than the insect cell system. The expression strategy entails maintaining the proMeCPA zymogen in a soluble state by fusing it to the C-terminus of maltose-binding protein (MBP) while simultaneously overproducing the protein disulfide isomerase DsbC in the cytosol from a separate plasmid. Unexpectedly, we found that the yield of active and properly oxidized MeCPA was highest when coexpressed with DsbC in BL21(DE3) cells that do not also contain mutations in the trxB and gor genes. Moreover, the formation of active MeCPA was only partially dependent on the disulfide-isomerase activity of DsbC. Intriguingly, we observed that most of the active MeCPA was generated after cell lysis and amylose affinity purification of the MBP-proMeCPA fusion protein, during the time that the partially purified protein was held overnight at 4 °C prior to activation with thermolysin. Following removal of the MBP-propeptide by thermolysin digestion, active MeCPA (with a C-terminal polyhistidine tag) was purified to homogeneity by immobilized metal affinity chromatography (IMAC), ion exchange chromatography and gel filtration. PMID:22197595

  14. Sweetpotato weevil, Cylas formicarius (Fab.) (Coleoptera: Brentidae) avoids its host plant when a virulent Metarhizium anisopliae isolate is present.

    PubMed

    Dotaona, Ronnie; Wilson, Bree A L; Ash, Gavin J; Holloway, Joanne; Stevens, Mark M

    2017-09-01

    Metarhizium anisopliae has a wide range of coleopteran hosts, including weevils. Some susceptible insects are known to modify their behavior to prevent infection, typically detecting virulent strains by olfaction, and avoiding physical contact with sources of infection. Laboratory olfactometer assays were conducted on the sweetpotato weevil Cylas formicarius to test the hypothesis that insects would avoid a more virulent strain of M. anisopliae when presented with a strain of low virulence or an untreated control. When adult weevils were allowed to choose between paired test arenas containing sweetpotato roots and M. anisopliae isolates on agar cores, weevils avoided arenas with the highly virulent isolate QS155, showing a preference for either roots with uninoculated agar cores or cores with the low virulence isolate QS002-3. When roots or whole sweetpotato plants were inoculated with M. anisopliae, the preferences of weevils remained broadly similar; weevils were repelled by the highly virulent isolate QS155 when tested against either QS002-3 or uninoculated roots and plants, however weevils were not repelled by the low virulence isolate QS002-3 tested against uninoculated controls. When single-sex groups of weevils were tested separately in the olfactometer using uninoculated whole plants and plants treated with isolate QS155, males and females responded similarly and statistically identical preferences were found for the untreated plants. When weevils were released singly at different times of the day the response time for males was significantly shorter in the afternoon compared to the morning. Males were always significantly faster to respond to olfactory stimuli than females. Understanding factors that may lead to avoidance of virulent M. anisopliae strains by C. formicarius will be an essential part of developing an 'attract-and-infect' strategy for the management of C. formicarius. Copyright © 2017. Published by Elsevier Inc.

  15. Insect inspiration

    NASA Astrophysics Data System (ADS)

    McIntosh, Andy; Beheshti, Novid

    2008-04-01

    The innocuous looking bombardier beetle is one of the most remarkable creatures around. This tiny insect is endowed with a defence mechanism that would be the envy of any comic-strip superhero - it can fight off any spider, frog, ant or bird that comes too close by blasting the attacker with a powerful jet of hot, toxic fluid. Furthermore, the beetle can aim its weapon in any direction (even over its head) with pinpoint accuracy, and can reach distances of up to 20 cm with its spray.

  16. Machine Learning for Characterization of Insect Vector Feeding.

    PubMed

    Willett, Denis S; George, Justin; Willett, Nora S; Stelinski, Lukasz L; Lapointe, Stephen L

    2016-11-01

    Insects that feed by ingesting plant and animal fluids cause devastating damage to humans, livestock, and agriculture worldwide, primarily by transmitting pathogens of plants and animals. The feeding processes required for successful pathogen transmission by sucking insects can be recorded by monitoring voltage changes across an insect-food source feeding circuit. The output from such monitoring has traditionally been examined manually, a slow and onerous process. We taught a computer program to automatically classify previously described insect feeding patterns involved in transmission of the pathogen causing citrus greening disease. We also show how such analysis contributes to discovery of previously unrecognized feeding states and can be used to characterize plant resistance mechanisms. This advance greatly reduces the time and effort required to analyze insect feeding, and should facilitate developing, screening, and testing of novel intervention strategies to disrupt pathogen transmission affecting agriculture, livestock and human health.

  17. Machine Learning for Characterization of Insect Vector Feeding

    PubMed Central

    Willett, Nora S.; Stelinski, Lukasz L.; Lapointe, Stephen L.

    2016-01-01

    Insects that feed by ingesting plant and animal fluids cause devastating damage to humans, livestock, and agriculture worldwide, primarily by transmitting pathogens of plants and animals. The feeding processes required for successful pathogen transmission by sucking insects can be recorded by monitoring voltage changes across an insect-food source feeding circuit. The output from such monitoring has traditionally been examined manually, a slow and onerous process. We taught a computer program to automatically classify previously described insect feeding patterns involved in transmission of the pathogen causing citrus greening disease. We also show how such analysis contributes to discovery of previously unrecognized feeding states and can be used to characterize plant resistance mechanisms. This advance greatly reduces the time and effort required to analyze insect feeding, and should facilitate developing, screening, and testing of novel intervention strategies to disrupt pathogen transmission affecting agriculture, livestock and human health. PMID:27832081

  18. Resistant ticks inhibit Metarhizium infection prior to haemocoel invasion by reducing fungal viability on the cuticle surface.

    PubMed

    Ment, Dana; Churchill, Alice C L; Gindin, Galina; Belausov, Eduard; Glazer, Itamar; Rehner, Stephen A; Rot, Asael; Donzelli, Bruno G G; Samish, Michael

    2012-06-01

    We studied disease progression of, and host responses to, four species in the Metarhizium anisopliae complex expressing green fluorescent protein (GFP). We compared development and determined their relative levels of virulence against two susceptible arthropods, the cattle tick Rhipicephalus annulatus and the lepidopteran Galleria mellonella, and two resistant ticks, Hyalomma excavatum and Rhipicephalus sanguineus. Metarhizium brunneum Ma7 caused the greatest mortality of R. annulatus, Metarhizium robertsii ARSEF 2575 and Metarhizium pingshaense PPRC51 exhibited intermediate levels of virulence, and Metarhizium majus PPRC27 caused low mortality of cattle ticks. Conidia of all four species germinated on all hosts examined, but on resistant hosts, sustained hyphal growth was inhibited and GFP emission steadily and significantly decreased over time, suggesting a loss of fungal viability. Cuticle penetration was observed only for the three most virulent species infecting susceptible hosts. Cuticles of resistant and susceptible engorged female ticks showed significant increases in red autofluorescence at sites immediately under fungal hyphae. This is the first report (i) of tick mortality occurring after cuticle penetration but prior to haemocoel colonization and (ii) that resistant ticks do not support development of Metarhizium germlings on the outer surface of the cuticle. Whether reduced Metarhizium viability on resistant tick cuticles is due to antibiosis or limited nutrient availability is unknown.

  19. Improved annotation of the insect vector of citrus greening disease: Biocuration by a diverse genomics community

    USDA-ARS?s Scientific Manuscript database

    The Asian citrus psyllid (Diaphorina citri Kuwayama) is the insect vector of the bacterium Candidatus Liberibacter asiaticus (CLas), the pathogen associated with citrus Huanglongbing (HLB, citrus greening). HLB threatens citrus production worldwide. Suppression or reduction of the insect vector usin...

  20. A high-throughput gene disruption methodology for the entomopathogenic fungus Metarhizium robertsii.

    PubMed

    Xu, Chuan; Zhang, Xing; Qian, Ying; Chen, Xiaoxuan; Liu, Ran; Zeng, Guohong; Zhao, Hong; Fang, Weiguo

    2014-01-01

    Systematic gene disruption is a direct way to interrogate a fungal genome to functionally characterize the full suite of genes involved in various biological processes. Metarhizium robertsii is extraordinarily versatile, and it is a pathogen of arthropods, a saprophyte and a beneficial colonizer of rhizospheres. Thus, M. robertsii can be used as a representative to simultaneously study several major lifestyles that are not shared by the "model" fungi Saccharomyces cerevisiae and Neurospora crassa; a systematic genetic analysis of M. robertsii will benefit studies in other fungi. In order to systematically disrupt genes in M. robertsii, we developed a high-throughput gene disruption methodology, which includes two technologies. One is the modified OSCAR-based, high-throughput construction of gene disruption plasmids. This technology involves two donor plasmids (pA-Bar-OSCAR with the herbicide resistance genes Bar and pA-Sur-OSCAR with another herbicide resistance gene Sur) and a recipient binary plasmid pPK2-OSCAR-GFP that was produced by replacing the Bar cassette in pPK2-bar-GFP with a ccdB cassette and recombination recognition sites. Using this technology, a gene disruption plasmid can be constructed in one cloning step in two days. The other is a highly efficient gene disruption technology based on homologous recombination using a Ku70 deletion mutant (ΔMrKu70) as the recipient strain. The deletion of MrKu70, a gene encoding a key component involved in nonhomologous end-joining DNA repair in fungi, dramatically increases the gene disruption efficiency. The frequency of disrupting the conidiation-associated gene Cag8 in ΔMrKu70 was 93% compared to 7% in the wild-type strain. Since ΔMrKu70 is not different from the wild-type strain in development, pathogenicity and tolerance to various abiotic stresses, it can be used as a recipient strain for a systematic gene disruption project to characterize the whole suite of genes involved in the biological processes of

  1. Evolutionary plasticity of insect immunity.

    PubMed

    Vilcinskas, Andreas

    2013-02-01

    Many insect genomes have been sequenced and the innate immune responses of several species have been studied by transcriptomics, inviting the comparative analysis of immunity-related genes. Such studies have demonstrated significant evolutionary plasticity, with the emergence of novel proteins and protein domains correlated with insects adapting to both abiotic and biotic environmental stresses. This review article focuses on effector molecules such as antimicrobial peptides (AMPs) and proteinase inhibitors, which display greater evolutionary dynamism than conserved components such as immunity-related signaling molecules. There is increasing evidence to support an extended role for insect AMPs beyond defense against pathogens, including the management of beneficial endosymbionts. The total number of AMPs varies among insects with completed genome sequences, providing intriguing examples of immunity gene expansion and loss. This plasticity is discussed in the context of recent developments in evolutionary ecology suggesting that the maintenance and deployment of immune responses reallocates resources from other fitness-related traits thus requiring fitness trade-offs. Based on our recent studies using both model and non-model insects, I propose that insect immunity genes can be lost when alternative defense strategies with a lower fitness penalty have evolved, such as the so-called social immunity in bees, the chemical sanitation of the microenvironment by some beetles, and the release of antimicrobial secondary metabolites in the hemolymph. Conversely, recent studies provide evidence for the expansion and functional diversification of insect AMPs and proteinase inhibitors to reflect coevolution with a changing pathosphere and/or adaptations to habitats or food associated with microbial contamination.

  2. Metabolomics reveals insect metabolic responses associated with fungal infection.

    PubMed

    Xu, Yong-Jiang; Luo, Feifei; Gao, Qiang; Shang, Yanfang; Wang, Chengshu

    2015-06-01

    The interactions between insects and pathogenic fungi are complex. We employed metabolomic techniques to profile insect metabolic dynamics upon infection by the pathogenic fungus Beauveria bassiana. Silkworm larvae were infected with fungal spores and microscopic observations demonstrated that the exhaustion of insect hemocytes was coupled with fungal propagation in the insect body cavity. Metabolomic analyses revealed that fungal infection could significantly alter insect energy and nutrient metabolisms as well as the immune defense responses, including the upregulation of carbohydrates, amino acids, fatty acids, and lipids, but the downregulation of eicosanoids and amines. The insect antifeedant effect of the fungal infection was evident with the reduced level of maclurin (a component of mulberry leaves) in infected insects but elevated accumulations in control insects. Insecticidal and cytotoxic mycotoxins like oosporein and beauveriolides were also detected in insects at the later stages of infection. Taken together, the metabolomics data suggest that insect immune responses are energy-cost reactions and the strategies of nutrient deprivation, inhibition of host immune responses, and toxin production would be jointly employed by the fungus to kill insects. The data obtained in this study will facilitate future functional studies of genes and pathways associated with insect-fungus interactions.

  3. Hemipterans as plant pathogens.

    PubMed

    Kaloshian, Isgouhi; Walling, Linda L

    2005-01-01

    Integration of the tools of genetics, genomics, and biochemistry has provided new approaches for identifying genes responding to herbivory. As a result, a picture of the complexity of plant-defense signaling to different herbivore feeding guilds is emerging. Plant responses to hemipteran insects have substantial overlap with responses mounted against microbial pathogens, as seen in changes in RNA profiles and emission of volatiles. Responses to known defense signals and characterization of the signaling pathways controlled by the first cloned insect R gene (Mi-1) indicate that perception and signal transduction leading to resistance may be similar to plant-pathogen interactions. Additionally, novel signaling pathways are emerging as important components of plant defense to insects. The availability of new tools and approaches will further enhance our understanding of the nature of defense in plant-hemipteran interactions.

  4. INSECTS & PATHOGENS Regulators of Forest Ecosystems

    Treesearch

    Robert A. Haack; James W. Byler

    1993-01-01

    Today's forest managers are challenged by issues such as soil productivity, biodiversity, threatened and endangered species, and ecosystem sustainability; and ecosystem management has been proposed as a way to deal with them. The Society of American Foresters (1993) defines this term as keeping forest ecosystems functioning well over long periods of time in order...

  5. What Makes an Insect an Insect?

    ERIC Educational Resources Information Center

    NatureScope, 1985

    1985-01-01

    Provides background information on characteristics common to all insects, activities, and student materials (ready-to-copy games, puzzles, coloring pages, worksheets, and/or mazes) which describe: how insects are classified; how they are different from other animals; and the main insect characteristics. Activities include recommended age levels,…

  6. Evolutionary genetics of insect innate immunity

    PubMed Central

    2015-01-01

    Patterns of evolution in immune defense genes help to understand the evolutionary dynamics between hosts and pathogens. Multiple insect genomes have been sequenced, with many of them having annotated immune genes, which paves the way for a comparative genomic analysis of insect immunity. In this review, I summarize the current state of comparative and evolutionary genomics of insect innate immune defense. The focus is on the conserved and divergent components of immunity with an emphasis on gene family evolution and evolution at the sequence level; both population genetics and molecular evolution frameworks are considered. PMID:25750410

  7. Evolutionary genetics of insect innate immunity.

    PubMed

    Viljakainen, Lumi

    2015-11-01

    Patterns of evolution in immune defense genes help to understand the evolutionary dynamics between hosts and pathogens. Multiple insect genomes have been sequenced, with many of them having annotated immune genes, which paves the way for a comparative genomic analysis of insect immunity. In this review, I summarize the current state of comparative and evolutionary genomics of insect innate immune defense. The focus is on the conserved and divergent components of immunity with an emphasis on gene family evolution and evolution at the sequence level; both population genetics and molecular evolution frameworks are considered. © The Author 2015. Published by Oxford University Press.

  8. Effect of Metarhizium anisopliae on the fertility and fecundity of two species of fruit flies and horizontal transmission of mycotic infection.

    PubMed

    Sookar, P; Bhagwant, S; Allymamod, M N

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M. anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius.

  9. Effect of Metarhizium anisopliae on the fertility and fecundity of two species of fruit flies and horizontal transmission of mycotic infection.

    PubMed

    Sookar, P; Bhagwant, S; Allymamod, M N

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius. This is an open access paper. We use the Creative Commons Attribution 3.0 license that permits unrestricted use, provided that the paper is properly attributed.

  10. Effect of Metarhizium anisopliae on the Fertility and Fecundity of Two Species of Fruit Flies and Horizontal Transmission of Mycotic Infection

    PubMed Central

    Sookar, P.; Bhagwant, S.; Allymamod, M.N.

    2014-01-01

    In Mauritius, the peach fruit fly, Bactrocera zonata Saunders (Diptera: Tephritidae), and the melon fly, Bactrocera cucurbitae (Coquillett), are the major pest of fruits and vegetables, respectively. Fruit growers make use of broad-spectrum insecticides to protect their crops from fruit fly attack. This method of fruit fly control is hazardous to the environment and is a threat to beneficial insects. The entomopathogenic fungus, Metarhizium anisopliae (Metchnikoff) Sorokin (Hypocreales: Clavicipitaceae), which was isolated from the soils of Mauritius, was used to investigate whether fungus-treated adult fruit flies could transfer conidia to non-treated flies during mating, and whether fungal infection could have an effect on mating behavior, fecundity, and fertility of the two female fruit fly species. When treated male flies were maintained together with non-treated female flies, they were able to transmit infection to untreated females, resulting in high mortalities. Similarly, fungus-infected female flies mixed with untreated males also transmitted infections to males, also resulting in high mortalities. Infection by M. anisopliae also resulted in the reduction of the number of eggs produced by females of B. cucurbitae. The results suggest that M. anisopliae may have potential for use in integrated control programs of B. zonata and B. cucurbitae using the sterile insect technique in Mauritius. PMID:25201230

  11. Differential susceptibility of adults and nymphs of Blattella germanica (L.) (Blattodea: Blattellidae) to infection by Metarhizium anisopliae and assessment of delivery strategies.

    PubMed

    Lopes, R B; Alves, S B

    2011-01-01

    Microbial insecticides for cockroach control, such as those containing entomopathogenic fungi, may be an alternative to reduce contamination by chemicals in housing and food storage environments. Virulence of isolate ESALQ1037 belonging to the Metarhizium anisopliae complex against nymphs and adults of Blattella germanica (L.), and its infectivity following exposure of insects to a contaminated surface or to M. anisopliae-bait were determined under laboratory conditions. Estimated LD50 15 d following topical inoculation was 2.69 x 10(5) conidia per adult, whereas for nymphs the maximum mortality was lower than 50%. Baits amended with M. anisopliae conidia had no repellent effect on targets; adult mortality was inferior to 25%, and nymphs were not susceptible. All conidia found in the digestive tract of M. anisopliae-bait fed cockroaches were unviable, and bait-treated insects that succumbed to fungal infection showed a typical mycelial growth on mouthparts and front legs, but not on the hind body parts. As opposed to baits, the use of a M. anisopliae powdery formulation for surface treatment was effective in attaining high mortality rates of B. germanica. Both nymphs and adults were infected when this delivery strategy was used, and mycelia growth occurred all over the body surface. Our results suggest that the development of powders or similar formulations of M. anisopliae to control B. germanica may provide faster and better results than some of the strategies based on baits currently available.

  12. Influence of Temperature and Relative Humidity on the Insecticidal Efficacy of Metarhizium anisopliae against Larvae of Ephestia kuehniella (Lepidoptera: Pyralidae) on Wheat

    PubMed Central

    Kavallieratos, Nickolas G.; Rumbos, Christos I.; Kontodimas, Demetrius C.

    2017-01-01

    A series of laboratory bioassays were conducted for the evaluation of the insecticidal efficacy of an isolate of Metarhizium anisopliae (Metschnikoff) Sorokin (Ascomycota: Hypocreales) against larvae of the Mediterranean flour moth, Ephestia kuehniella Zeller (Lepidoptera: Pyralidae), under various temperature–relative humidity (r.h.) conditions. The fungus was applied at four doses (0, 8 × 106, 8 × 108, and 8 × 1010 conidia ml−1) on wheat and insect mortality was assessed after exposure of 1, 2, 7, and 14 d. Bioassays were conducted at three temperatures (20, 25, and 30 °C) and two r.h. levels (55 and 75%). Although complete control was not achieved in any case, the fungus provided a considerable level of insect control. Mortality of E. kuehniella larvae on wheat treated with M. anisopliae ranged between 41.1 and 93.3% after 14 d of exposure, whereas the respective mortality levels in control dishes never exceeded 28.3%. The increase of temperature resulted in most cases to higher efficacy, indicating that temperature is an important factor for the performance of the fungus. In contrast, in most cases r.h. did not significantly affect the efficacy of the fungus, at least for the humidity levels tested.

  13. 76 FR 26194 - Metarhizium anisopliae Strain F52; Exemption From the Requirement of a Tolerance

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-06

    ... accordance with good agricultural practices. Novozymes Biologicals, Inc. submitted a petition to ] EPA under the Federal Food, Drug, and Cosmetic Act (FFDCA), requesting an exemption from the requirement of a... in accordance with good agricultural practices, Metarhizium anisopliae strain F52, a known...

  14. Species limits, phylogeography and reproductive mode in the Metarhizium anisopliae complex

    USDA-ARS?s Scientific Manuscript database

    An essential first step toward understanding the ecology and life histories of Metarhizium anisopliae-group species as entomopathogens, endophytes and soil-adapted fungi is the ability to accurately define species limits and confidently infer a species tree. Here we present a multilocus phylogeny of...

  15. THE IDENTIFICATION AND CHARACTERIZATION OF AN IGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    EPA Science Inventory

    The Identification and Characterization of an IgE-Inducing Protein in Metarhizium anisopliae Extract

    Marsha D.W. Ward1, Lisa B. Copeland1, Maura J. Donahue2, and Jody A. Shoemaker3
    1ORD, NHEERL, US EPA, RTP, NC; 2Oak Ridge Institute for Science and Education, Cincinnati...

  16. THE IDENTIFICATION AND CHARACTERIZATION OF AN IGE-INDUCING PROTEIN IN METARHIZIUM ANISOPLIAE EXTRACT

    EPA Science Inventory

    The Identification and Characterization of an IgE-Inducing Protein in Metarhizium anisopliae Extract

    Marsha D.W. Ward1, Lisa B. Copeland1, Maura J. Donahue2, and Jody A. Shoemaker3
    1ORD, NHEERL, US EPA, RTP, NC; 2Oak Ridge Institute for Science and Education, Cincinnati...

  17. Susceptibility of Agrilus planipennis (Coleoptera: Buprestidae) to Beauveria bassiana and Metarhizium anisopliae

    Treesearch

    Houping Lui; Leah S. Bauer

    2006-01-01

    The susceptibility of Agrilus planipennis Fairmaire (Coleoptera: Buprestidae) to selected strains of the entomopathogenic fungi Beauveria bassiana (Balsamo) Vuillemin and Metarhizium anisopliae (Metschnikoff) Sorokin was evaluated through bioassays with direct immersion or foliar exposure under laboratory conditions. Results showed that A. planipennis adults were...

  18. Ovicidal activity of Metarhizium brunneum (Mb F52) on dengue fever vector, Aedes aegypti

    USDA-ARS?s Scientific Manuscript database

    The ovicidal activity of Metarhizium brunneum F52 (Mb F52) grown from granules was evaluated against Aedes aegypti eggs over time. Survival of larvae from treated eggs was significantly less when compared with untreated eggs at 7, 10 and 14 days post treatment. Only 27 % of treated eggs produced vi...

  19. Metarhizium microsclerotia and hydrogel versus hydromulch: testing fungal formulations against Asian longhorned beetles

    USDA-ARS?s Scientific Manuscript database

    The efficacy of microsclerotia of Metarhizium brunneum (Petch) (Hypocreales: Clavicipitaceae) strain F52 (ARSEF 7711) was tested using samples that had been exposed on forest trees, allowing time for conidia to be produced. An aqueous mixture of microsclerotial granules (61.3% of dry mass), a straw ...

  20. Metachelins, mannosylated and N-oxidized coprogen-type siderophores from Metarhizium robertsii

    USDA-ARS?s Scientific Manuscript database

    Under iron-depleted culture conditions, the entomopathogenic fungus Metarhizium robertsii (Bischoff, Humber, and Rehner) (= M. anisopliae) produces a complex of extracellular siderophores including novel O-glycosylated and/or N-oxidized coprogen-type compounds as well as the known fungal siderophore...

  1. Metacridamides A and B, bioactive macrocycles from conidia of the entomopathogenic fungus Metarhizium acridum

    USDA-ARS?s Scientific Manuscript database

    Metarhizium acridum, an entomopathogenic fungus, has been commercialized and used successfully for biocontrol of grasshopper pests in Africa and Australia. Its conidia produce two novel 17-membered macrocycles, metacridamides A (1) and B (2), which consist of a Phe unit condensed with a nonaketide....

  2. New insecticidal antibiotics, hydroxyfungerins A and B, produced by Metarhizium sp. FKI-1079.

    PubMed

    Uchida, Ryuji; Imasato, Rie; Yamaguchi, Yuichi; Masuma, Rokuro; Shiomi, Kazuro; Tomoda, Hiroshi; Omura, Satoshi

    2005-12-01

    New insecticidal antibiotics designated hydroxyfungerins A and B were isolated from the culture broth of a fungal strain Metarhizium sp. FKI-1079 together with a known compound, fungerin. The structures of hydroxyfungerins A and B were elucidated by spectroscopic studies including various NMR experiments. Hydroxyfungerins A and B showed growth inhibitory activity against brine shrimps, Artemia salina.

  3. Production of microsclerotia by brazilian strains of metarhizium spp. using submerged liquid culture fermentation

    USDA-ARS?s Scientific Manuscript database

    We investigated the potential production and desiccation tolerance of microsclerotia (MS) by Brazilian strains of Metarhizium. anisopliae [Ma], M. acridum [Mc] and M. robertsii [Mr]. These fungi were grown in a liquid medium containing 16 g carbon l-1 with a carbon:nitrogen ratio of 50:1. One hundre...

  4. Comparative impact of artificial selection for fungicide resistance on Beauveria bassiana and Metarhizium brunncum

    USDA-ARS?s Scientific Manuscript database

    Hypocreales fungi such as Beauveria bassiana and Metarhizium anisopliae can be negatively affected by fungicides thereby reducing their biocontrol potential. The overall goal of this study was to investigate the impact of artificial selection for fungicide resistance on two commercial entomopathoge...

  5. Ultrastructure of Tuta absoluta parasitized eggs and the reproductive potential of females after parasitism by Metarhizium anisopliae.

    PubMed

    Pires, Laurici M; Marques, Edmilson J; Wanderley-Teixeira, Valéria; Teixeira, Alvaro A C; Alves, Luis C; Alves, E Sérgio B

    2009-02-01

    Among the microorganisms used in biological control, the muscadine fungus Metarhizium anisopliae (Metsch.) Sorok. is produced and formulated world wide aiming to control pests from several agricultural crops. This work evaluated effects of M. anisopliae isolate UFRPE-6 on the fecundity and mortality of Tuta absoluta (Lepidoptera: Gelechiidae) females and the mechanism of infection on eggs. The infection of the females by the fungus did not affect their oviposition and fecundity; however it affected the survival with total and confirmed mortality of 54.2% and 37.14%, respectively. The eggs were treated with suspension at concentration of 10(6)conidia/mL. The analysis under scanning electron microscopy showed that conidia germination and penetration processes in the eggs of T. absoluta started within the period of 6h after the inoculation. Several hyphal bodies were observed from 12h and an intense extrusion of the mycelium covering all the external surface of the eggs 72h after inoculation. Despite its moderate activity in adults, the isolate URPE-6 of M. anisopliae showed promising in the control of T. absoluta due to its pathogenicity and virulence to eggs from this pest.

  6. [Roles of phosphatases in pathogen infection: a review].

    PubMed

    Zhu, Pei; Li, Xinqiang; Li, Zhenlun

    2012-02-01

    Phosphatases play a key role not only in cell physiological functions of an organism, but also in host-pathogen interactions. Many studies demonstrated that some Gram-negative pathogenic bacteria could evade host immunity and promote pathogenicity by injecting phosphatases into host cells through type III secretion system. However, there were few reports about pathogenic fungi evading the immunity of hosts. Our researches indicated that the entomogenic fungus Metarhizium anisopliae could dephosphorylate the signal transduction substance of locust humoral immunity specifically in vitro by secreting extracellular protein tyrosine phosphatase, which implied that the fungus might interfere with the immune defense of locust. To provide reference for further studies of the functions of phosphatases, we reviewed the types of phosphatases and their roles in pathogen infection.

  7. Susceptibility of adult female Aedes aegypti (Diptera: Culicidae) to the entomopathogenic fungus Metarhizium anisopliae is modified following blood feeding.

    PubMed

    Paula, Adriano R; Carolino, Aline T; Silva, Carlos P; Samuels, Richard I

    2011-05-26

    The mosquito Aedes aegypti, vector of dengue fever, is a target for control by entomopathogenic fungi. Recent studies by our group have shown the susceptibility of adult A. aegypti to fungal infection by Metarhizium anisopliae. This fungus is currently being tested under field conditions. However, it is unknown whether blood-fed A. aegypti females are equally susceptible to infection by entomopathogenic fungi as sucrose fed females. Insect populations will be composed of females in a range of nutritional states. The fungus should be equally efficient at reducing survival of insects that rest on fungus impregnated surfaces following a blood meal as those coming into contact with fungi before host feeding. This could be an important factor when considering the behavior of A. aegypti females that can blood feed on multiple hosts over a short time period. Female A. aegypti of the Rockefeller strain and a wild strain were infected with two isolates of the entomopathogenic fungus M. anisopliae (LPP 133 and ESALQ 818) using an indirect contact bioassay at different times following blood feeding. Survival rates were monitored on a daily basis and one-way analysis of variance combined with Duncan's post-hoc test or Log-rank survival curve analysis were used for statistical comparisons of susceptibility to infection. Blood feeding rapidly reduced susceptibility to infection, determined by the difference in survival rates and survival curves, when females were exposed to either of the two M. anisopliae isolates. Following a time lag which probably coincided with digestion of the blood meal (96-120 h post-feeding), host susceptibility to infection returned to pre-blood fed (sucrose fed) levels. Reduced susceptibility of A. aegypti to fungi following a blood meal is of concern. Furthermore, engorged females seeking out intra-domicile resting places post-blood feeding, would be predicted to rest for prolonged periods on fungus impregnated black cloths, thus optimizing infection

  8. RNA Interference in Insect Vectors for Plant Viruses

    PubMed Central

    Kanakala, Surapathrudu; Ghanim, Murad

    2016-01-01

    Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446

  9. RNA Interference in Insect Vectors for Plant Viruses.

    PubMed

    Kanakala, Surapathrudu; Ghanim, Murad

    2016-12-12

    Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

  10. Microsclerotia of Metarhizium brunneum F52 applied in hydromulch for control of Asian longhorned beetles (Coleoptera: Cerambycidae)

    USDA-ARS?s Scientific Manuscript database

    The entomopathogenic fungus Metarhizium brunneum (Petch), strain F52 (Hypocreales: Clavicipitaceae) is able to produce environmentally persistent microsclerotia. Incorporating these desiccation-tolerant M. brunneum F52 microsclerotia (Mb MS) granules into hydromulch [a mixture of water + wheat straw...

  11. Evaluating different carriers of Metarhizium brunneum F52 microsclerotia for control of adult Asian longhorned beetles (Coleoptera: Cerambycidae)

    USDA-ARS?s Scientific Manuscript database

    Microsclerotia (MS) of Metarhizium brunneum strain F52 (Hypocreales: Clavicipitaceae), were processed as granules using three carriers: kaolin clay, microcrystalline cellulose (MCC) or diatomaceous earth (DE). In a series of experiments aimed at comparing viable conidial production and subsequent pe...

  12. Insect-ual Pursuits.

    ERIC Educational Resources Information Center

    Mallow, David

    1991-01-01

    Explains how insects can be used to stimulate student writing. Describes how students can create their own systems to classify and differentiate insects. Discusses insect morphology and includes three detailed diagrams. The author provides an extension activity where students hypothesize about the niche of an insect based on its anatomy. (PR)

  13. Insect-ual Pursuits.

    ERIC Educational Resources Information Center

    Mallow, David

    1991-01-01

    Explains how insects can be used to stimulate student writing. Describes how students can create their own systems to classify and differentiate insects. Discusses insect morphology and includes three detailed diagrams. The author provides an extension activity where students hypothesize about the niche of an insect based on its anatomy. (PR)

  14. Book Review: Insect Virology

    USDA-ARS?s Scientific Manuscript database

    Viruses that infect insects have long been of interest both as a means for controlling insect pest populations in an environmentally safe manner, and also as significant threats to beneficial insects of great value, such as honey bees and silkworms. Insect viruses also have been of intrinsic intere...

  15. Potential applications of insect symbionts in biotechnology.

    PubMed

    Berasategui, Aileen; Shukla, Shantanu; Salem, Hassan; Kaltenpoth, Martin

    2016-02-01

    Symbiotic interactions between insects and microorganisms are widespread in nature and are often the source of ecological innovations. In addition to supplementing their host with essential nutrients, microbial symbionts can produce enzymes that help degrade their food source as well as small molecules that defend against pathogens, parasites, and predators. As such, the study of insect ecology and symbiosis represents an important source of chemical compounds and enzymes with potential biotechnological value. In addition, the knowledge on insect symbiosis can provide novel avenues for the control of agricultural pest insects and vectors of human diseases, through targeted manipulation of the symbionts or the host-symbiont associations. Here, we discuss different insect-microbe interactions that can be exploited for insect pest and human disease control, as well as in human medicine and industrial processes. Our aim is to raise awareness that insect symbionts can be interesting sources of biotechnological applications and that knowledge on insect ecology can guide targeted efforts to discover microorganisms of applied value.

  16. Towards the elements of successful insect RNAi

    PubMed Central

    Scott, Jeffrey G.; Michel, Kristin; Bartholomay, Lyric; Siegfried, Blair D.; Hunter, Wayne B.; Smagghe, Guy; Zhu, Kun Yan; Douglas, Angela E.

    2013-01-01

    RNA interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that the efficiency of RNAi varies between different species, the mode of RNAi delivery, and the genes being targeted. There is also variation in the duration of transcript suppression. At present, we have a limited capacity to predict the ideal experimental strategy for RNAi of a particular gene/insect because of our incomplete understanding of whether and how the RNAi signal is amplified and spread among insect cells. Consequently, development of the optimal RNAi protocols is a highly empirical process. This limitation can be relieved by systematic analysis of the molecular physiological basis of RNAi mechanisms in insects. An enhanced conceptual understanding of RNAi function in insects will facilitate the application of RNAi for dissection of gene function, and to fast-track the application of RNAi to both control pests and develop effective methods to protect beneficial insects and non-insect arthropods, particularly the honey bee (Apis mellifera) and cultured Pacific white shrimp (Litopenaeus vannamei) from viral and parasitic diseases. PMID:24041495

  17. Towards the elements of successful insect RNAi.

    PubMed

    Scott, Jeffrey G; Michel, Kristin; Bartholomay, Lyric C; Siegfried, Blair D; Hunter, Wayne B; Smagghe, Guy; Zhu, Kun Yan; Douglas, Angela E

    2013-12-01

    RNA interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that the efficiency of RNAi varies between different species, the mode of RNAi delivery, and the genes being targeted. There is also variation in the duration of transcript suppression. At present, we have a limited capacity to predict the ideal experimental strategy for RNAi of a particular gene/insect because of our incomplete understanding of whether and how the RNAi signal is amplified and spread among insect cells. Consequently, development of the optimal RNAi protocols is a highly empirical process. This limitation can be relieved by systematic analysis of the molecular physiological basis of RNAi mechanisms in insects. An enhanced conceptual understanding of RNAi function in insects will facilitate the application of RNAi for dissection of gene function, and to fast-track the application of RNAi to both control pests and develop effective methods to protect beneficial insects and non-insect arthropods, particularly the honey bee (Apis mellifera) and cultured Pacific white shrimp (Litopenaeus vannamei) from viral and parasitic diseases.

  18. Dissemination of Metarhizium anisopliae of low and high virulence by mating behavior in Aedes aegypti

    PubMed Central

    2011-01-01

    Background Dengue is a viral disease transmitted by Aedes mosquitoes. It is a threat for public health worldwide and its primary vector Aedes aegypti is becoming resistant to chemical insecticides. These factors have encouraged studies to evaluate entomopathogenic fungi against the vector. Here we evaluated mortality, infection, insemination and fecundity rates in A. aegypti females after infection by autodissemination with two Mexican strains of Metarhizium anisopliae. Methods Two M. anisopliae strains were tested: The Ma-CBG-1 least virulent (lv), and the Ma-CBG-2 highly virulent (hv) strain. The lv was tested as non mosquito-passed (NMP), and mosquito-passed (MP), while the hv was examined only as MP version, therefore including the control four treatments were used. In the first bioassay virulence of fungal strains towards female mosquitoes was determined by indirect exposure for 48 hours to conidia-impregnated paper. In the second bioassay autodissemination of fungal conidia from fungus-contaminated males to females was evaluated. Daily mortality allowed computation of survival curves and calculation of the LT50 by the Kaplan-Meier model. All combinations of fungal sporulation and mating insemination across the four treatments were analyzed by χ2. The mean fecundity was analyzed by ANOVA and means contrasted with the Ryan test. Results Indirect exposure to conidia allowed a faster rate of mortality, but exposure to a fungal-contaminated male was also an effective method of infecting female mosquitoes. All females confined with the hv strain-contaminated male died in fifteen days with a LT50 of 7.57 (± 0.45) where the control was 24.82 (± 0.92). For the lv strain, it was possible to increase fungal virulence by passing the strain through mosquitoes. 85% of females exposed to hv-contaminated males became infected and of them just 10% were inseminated; control insemination was 46%. The hv strain reduced fecundity by up to 99%, and the lv strain caused a 40

  19. Microsclerotia of Metarhizium brunneum F52 Applied in Hydromulch for Control of Asian Longhorned Beetles (Coleoptera: Cerambycidae).

    PubMed

    Goble, Tarryn A; Hajek, Ann E; Jackson, Mark A; Gardescu, Sana

    2015-04-01

    The entomopathogenic fungus Metarhizium brunneum (Petch) strain F52 (Hypocreales: Clavicipitaceae) is able to produce environmentally persistent microsclerotia (hyphal aggregates). Microsclerotia of strain F52 produced as granules and incorporated into hydromulch (hydro-seeding straw, water, and a natural glue) provides a novel mycoinsecticide that could be sprayed onto urban, forest, or orchard trees. We tested this formulation against adult Asian longhorned beetles (Anoplophora glabripennis (Motschulsky)) using three substrates (moistened bark, dry bark, absorbent bench liner) sprayed with a low rate (9 microsclerotia granules/cm2) of hydromulch. Median survival times of beetles continuously exposed to sprayed moist bark or absorbent liner were 17.5 and 19.5 d, respectively. Beetles exposed to sprayed dry bark, which had a lower measured water activity, lived significantly longer. When moist bark pieces were sprayed with increased rates of microsclerotia granules in hydromulch, 50% died by 12.5 d at the highest application rate, significantly sooner than beetles exposed to lower application rates (16.5-17.5 d). To measure fecundity effects, hydromulch with or without microsclerotia was sprayed onto small logs and pairs of beetles were exposed for a 2-wk oviposition period in containers with 98 or 66% relative humidity. At 98% humidity, oviposition in the logs was highest for controls (18.3±1.4 viable offspring per female) versus 3.9±0.8 for beetles exposed to microsclerotia. At 66% humidity, fecundities of controls and beetles exposed to microsclerotia were not significantly different. This article presents the first evaluation of M. brunneum microsclerotia in hydromulch applied for control of an arboreal insect pest. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Virulence, horizontal transmission, and sublethal reproductive effects of Metarhizium anisopliae (Anamorphic fungi) on the German cockroach (Blattodea: Blattellidae).

    PubMed

    Quesada-Moraga, E; Santos-Quirós, R; Valverde-García, P; Santiago-Alvarez, C

    2004-09-01

    Virulence of Metarhizium anisopliae (Metschnikoff) Sorokin strain EAMa 01/121-Su against the German Cockroach, Blatella germanica (L.), was determined using four concentrations ranging from 4.2 x 10(6) to 4.2 x 10(9) spores per milliliter. The LD50 value was 1.4 x 10(7) spores per milliliter (56,000 spores per cockroach) and LT50 values were 14.8 days and 5.3 days for 4.2 x 10(8) and 4.2 x 10(9) spores per milliliter, respectively. An experiment was conducted to evaluate whether a fungal transmission could exist among infected and healthy cockroaches. Percentage mortality at a ratio of 1:10 of infected to unexposed cockroaches was 87.5% and LT50 was 12.2 days, which indicated the potential of this strain to be horizontally transmitted and to rapidly spread the infection in the insect population. The effect of a sublethal dose (ca. LD60) of M. anisopliae EAMa 01/121-Su strain, applied topically on German cockroaches, was studied by reciprocal crossing. Othecal production, oothecal hatchability, and nymphal production declined upon exposure to M. anisopliae EAMa 01/121-Su strain. The mean number of oothecae laid by female was progressively and significantly reduced by fungal treatment from second oviposition period onwards. Oothecal hatch of fungally challenged females was reduced by 46-49%, oothecal viability by 48-85%, and nymphal production by 22-35%. Only treated females showed an effect on oothecal production, oothecal hatch, and nymphal production, although oothecal hatch was also governed by treated males at a higher significance level. Our results on virulence and horizontal transmission of fungal conidia of M. anisopliae EAMa 01/121-Su strain and its sublethal reproductive effects on German cockroach females are discussed in terms of its potential to decrease the pest status of B. germanica in the short and long terms.

  1. Intracellular siderophore but not extracellular siderophore is required for full virulence in Metarhizium robertsii.

    PubMed

    Giuliano Garisto Donzelli, Bruno; Gibson, Donna M; Krasnoff, Stuart B

    2015-09-01

    Efficient iron acquisition mechanisms are fundamental for microbial survival in the environment and for pathogen virulence within their hosts. M. robertsii produces two known iron-binding natural products: metachelins, which are used to scavenge extracellular iron, and ferricrocin, which is strictly intracellular. To study the contribution of siderophore-mediated iron uptake and storage to M. robertsii fitness, we generated null mutants for each siderophore synthase gene (mrsidD and mrsidC, respectively), as well as for the iron uptake transcriptional repressor mrsreA. All of these mutants showed impaired germination speed, differential sensitivity to hydrogen peroxide, and differential ability to overcome iron chelation on growth-limiting iron concentrations. RT-qPCR data supported regulation of mrsreA, mrsidC, and mrsidD by supplied iron in vitro and during growth within the insect host, Spodoptera exigua. We also observed strong upregulation of the insect iron-binding proteins, transferrins, during infection. Insect bioassays revealed that ferricrocin is required for full virulence against S. exigua; neither the loss of metachelin production nor the deletion of the transcription factor mrsreA significantly affected M. robertsii virulence.

  2. Towards the elements of successful insect Ribonucleic acid interference (RNAi)

    USDA-ARS?s Scientific Manuscript database

    Ribonucleic acid interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that ...

  3. How to collect and process small polyhedral viruses of insects

    Treesearch

    Franklin B. Lewis

    1960-01-01

    The past few years have seen increased interest in and use of microbial agents for the control of destructive forest insects. One of the most successful applications of this control method has been the use of the polyhedral virus disease of the European pine sawfly, Neodiprion sertifer (Geoff.). Control of this insect by its specific pathogen has...

  4. Adenylate cyclase orthologues in two filamentous entomopathogens contribute differentially to growth, conidiation, pathogenicity, and multistress responses.

    PubMed

    Wang, Jie; Zhou, Gang; Ying, Sheng-Hua; Feng, Ming-Guang

    2014-04-01

    Adenylate cyclase (AC) is a core element of cAMP signalling network. Here we show functional diversity and differentiation of Beauveria bassiana AC (BbAC) and Metarhizium robertsii AC (MrAC). Severe growth defects occurred in ΔBbAC and ΔMrAC grown on nutrition-rich SDAY and several minimal media but were largely alleviated by adding cAMP to SDAY. Conidial yield increased greatly in ΔBbAC but decreased in ΔMrAC. During colony growth, ΔBbAC was highly sensitive to oxidation, high osmolarity, cell wall perturbation, carbendazim fungicide, Mn(2+), Zn(2+), Fe(3+), and EDTA but more tolerant to Cu(2+) while ΔMrAC showed higher osmotolerance, decreased sensitivity to Fe(3+), and null response to carbendazim or cell wall stress despite similar responses to oxidation and other metal ions. Conidial UV-B resistance decreased by 32% in ΔBbAC and 22% in ΔMrAC despite little change in their theromotolerance. Median lethal time (LT50) estimates of ΔBbAC and ΔMrAC against susceptible insects were 10.9 and 1.4 d longer than those from wild-type strains respectively. All the phenotypic changes were restored to wild-type levels by each gene complementation. Taken together, BbAC and MrAC regulated differentially conidiation, pathogenicity, and multistress responses in B. bassiana and M. robertsii, thereby making different contributions to their biocontrol potential. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  5. Infection of malaria (Anopheles gambiae s.s.) and filariasis (Culex quinquefasciatus) vectors with the entomopathogenic fungus Metarhizium anisopliae

    PubMed Central

    Scholte, Ernst-Jan; Njiru, Basilio N; Smallegange, Renate C; Takken, Willem; Knols, Bart GJ

    2003-01-01

    Background Current intra-domiciliary vector control depends on the application of residual insecticides and/or repellents. Although biological control agents have been developed against aquatic mosquito stages, none are available for adults. Following successful use of an entomopathogenic fungus against tsetse flies (Diptera: Glossinidae) we investigated the potency of this fungus as a biological control agent for adult malaria and filariasis vector mosquitoes. Methods In the laboratory, both sexes of Anopheles gambiae sensu stricto and Culex quinquefasciatus were passively contaminated with dry conidia of Metarhizium anisopliae. Pathogenicity of this fungus for An. gambiae was further tested for varying exposure times and different doses of oil-formulated conidia. Results Comparison of Gompertz survival curves and LT50 values for treated and untreated specimens showed that, for both species, infected mosquitoes died significantly earlier (p < 0.0001) than uninfected control groups. No differences in LT50 values were found for different exposure times (24, 48 hrs or continuous exposure) of An. gambiae to dry conidia. Exposure to oil-formulated conidia (doses ranging from 1.6 × 107 to 1.6 × 1010 conidia/m2) gave LT50 values of 9.69 ± 1.24 (lowest dose) to 5.89 ± 0.35 days (highest dose), with infection percentages ranging from 4.4–83.7%. Conclusion Our study marks the first to use an entomopathogenic fungus against adult Afrotropical disease vectors. Given its high pathogenicity for both adult Anopheles and Culex mosquitoes we recommend development of novel targeted indoor application methods for the control of endophagic host-seeking females. PMID:14565851

  6. Infection of malaria (Anopheles gambiae s.s.) and filariasis (Culex quinquefasciatus) vectors with the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    Scholte, Ernst-Jan; Njiru, Basilio N; Smallegange, Renate C; Takken, Willem; Knols, Bart G J

    2003-09-15

    Current intra-domiciliary vector control depends on the application of residual insecticides and/or repellents. Although biological control agents have been developed against aquatic mosquito stages, none are available for adults. Following successful use of an entomopathogenic fungus against tsetse flies (Diptera: Glossinidae) we investigated the potency of this fungus as a biological control agent for adult malaria and filariasis vector mosquitoes. In the laboratory, both sexes of Anopheles gambiae sensu stricto and Culex quinquefasciatus were passively contaminated with dry conidia of Metarhizium anisopliae. Pathogenicity of this fungus for An. gambiae was further tested for varying exposure times and different doses of oil-formulated conidia. Comparison of Gompertz survival curves and LT50 values for treated and untreated specimens showed that, for both species, infected mosquitoes died significantly earlier (p < 0.0001) than uninfected control groups. No differences in LT50 values were found for different exposure times (24, 48 hrs or continuous exposure) of An. gambiae to dry conidia. Exposure to oil-formulated conidia (doses ranging from 1.6 x 10(7) to 1.6 x 10(10) conidia/m2) gave LT50 values of 9.69 +/- 1.24 (lowest dose) to 5.89 +/- 0.35 days (highest dose), with infection percentages ranging from 4.4-83.7%. Our study marks the first to use an entomopathogenic fungus against adult Afrotropical disease vectors. Given its high pathogenicity for both adult Anopheles and Culex mosquitoes we recommend development of novel targeted indoor application methods for the control of endophagic host-seeking females.

  7. Laboratory evaluation of the entomopathogenic fungus, Metarhizium anisopliae for the control of the groundnut bruchid, Caryedon serratus on groundnut.

    PubMed

    Ekesi, S; Egwurube, E A.; Akpa, A D.; Onu, I

    2001-10-01

    The pathogenicity of five isolates of Metarhizium anisopliae to adult Caryedon serratus was evaluated in the laboratory. All the isolates tested were virulent to the beetle but pathogenicity varied among the isolates. One isolate, CPD 4 was consistently superior to all other isolates in terms of mortality of the beetle, protection of groundnut pods from damage, reduction in progeny production and repellency to the beetle. At 10 days post-treatment, adult mortality treated with 0.1, 0.5 and 1.0g of dry conidia equivalent to 3.6x10(8), 1.8x10(9) and 3.6x10(9) conidia of isolate CPD 4 per 50g of groundnut pods was 100% which did not differ significantly from pirimiphos-methyl-treated pods at 10ppm. At the lowest dosage of 0.1g of conidia per 50g of pods, damage in pods protected with isolate CPD 4 was 5% which did not differ significantly from the 2% damage in pods protected by pirimiphos-methyl at 10ppm but significantly differed from damage in untreated pods which was 26%. Isolate CPD 4 caused complete reduction in progeny emergence at all dosages tested. It also exhibited some degree of repellency to the beetle with percentage repellency values of between 40-79% at concentrations of 0.1-1.0g of conidia per 50g of groundnut pods. These combined virulence and repellency characteristics of this isolate may increase its protectant potential against C. serratus.

  8. Harnessing Insect-Microbe Chemical Communications To Control Insect Pests of Agricultural Systems.

    PubMed

    Beck, John J; Vannette, Rachel L

    2017-01-11

    Insect pests cause serious economic, yield, and food safety problems to managed crops worldwide. Compounding these problems, insect pests often vector pathogenic or toxigenic microbes to plants. Previous work has considered plant-insect and plant-microbe interactions separately. Although insects are well-understood to use plant volatiles to locate hosts, microorganisms can produce distinct and abundant volatile compounds that in some cases strongly attract insects. In this paper, we focus on the microbial contribution to plant volatile blends, highlighting the compounds emitted and the potential for variation in microbial emission. We suggest that these aspects of microbial volatile emission may make these compounds ideal for use in agricultural applications, as they may be more specific or enhance methods currently used in insect control or monitoring. Our survey of microbial volatiles in insect-plant interactions suggests that these emissions not only signal host suitability but may indicate a distinctive time frame for optimal conditions for both insect and microbe. Exploitation of these host-specific microbe semiochemicals may provide important microbe- and host-based attractants and a basis for future plant-insect-microbe chemical ecology investigations.

  9. Fungal dermatitis, glossitis and disseminated visceral mycosis caused by different Metarhizium granulomatis genotypes in veiled chameleons (Chamaeleo calyptratus) and first isolation in healthy lizards.

    PubMed

    Schmidt, Volker; Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

    2017-08-01

    Metarhizium (M.) granulomatis (formerly Chamaeleomyces granulomatis) invariably causes fatal fungal glossitis and systemic mycosis in veiled chameleons (Chamaeleo calyptratus). Isolation of M. granulomatis in other lizards thus far has not been described. The aim of this study therefore was to obtain information on the presence of M. granulomatis in reptiles kept as pets, and to examine whether there was an association between specific genotypes and clinical/pathological outcomes. Besides 18S ribosomal (r) DNA (SSU) and internal transcribed spacer1-5.8S (ITS1-5.8S) rDNA, a fragment of the large subunit of the 28S rDNA (LSU), including the domains 1 (D1) and D2, were sequenced for identification of the fungus and phylogenetic analysis. Metarhizium granulomatis was isolated from 23 veiled chameleons, two panther chameleons (Furcifer pardalis) and one central bearded dragon (Pogona vitticeps). Only the veiled chameleons revealed corresponding pathological findings in the form of glossal hemorrhage, granulomatous glossitis, pharyngitis, dermatitis and/or visceral mycosis. The infection site correlated to survival times of infected veiled chameleons. Combined long-term treatment with terbinafine and nystatin based on susceptibility testing may be helpful for prevention of disease and visceral spreading of the fungus, but elimination of the fungal pathogen or successful treatment of diseased veiled chameleons have not been achieved yet. Sequencing of the ribosomal genes yielded five different genotypes, with genotype A being strongly correlated with dermatitis, and remaining genotypes with pharyngitis and glossitis. However, disseminated visceral mycosis developed irrespective of the genotypes. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Grooming Behavior as a Mechanism of Insect Disease Defense

    PubMed Central

    Zhukovskaya, Marianna; Yanagawa, Aya; Forschler, Brian T.

    2013-01-01

    Grooming is a well-recognized, multipurpose, behavior in arthropods and vertebrates. In this paper, we review the literature to highlight the physical function, neurophysiological mechanisms, and role that grooming plays in insect defense against pathogenic infection. The intricate relationships between the physical, neurological and immunological mechanisms of grooming are discussed to illustrate the importance of this behavior when examining the ecology of insect-pathogen interactions. PMID:26462526

  11. Discovering the secondary metabolite potential encoded within Entomopathogenic Fungi

    USDA-ARS?s Scientific Manuscript database

    This article discusses the secondary metabolite potential of the insect pathogens Metarhizium and Beauveria, including a bioinformatics analysis of secondary metabolite genes for which no products are yet identified....

  12. Carbon regulation of the cuticle-degrading enzyme PR1 from Metarhizium anisopliae may involve a trans-acting DNA-binding protein CRR1, a functional equivalent of the Aspergillus nidulans CREA protein.

    PubMed

    Screen, S; Bailey, A; Charnley, K; Cooper, R; Clarkson, J

    1997-06-01

    The pr1 gene of the entomopathogenic fungus Metarhizium anisopliae encodes a serine protease that is highly active towards the insect cuticle and whose synthesis is subject to both carbon and nitrogen repression. The pr1 promoter region was sequenced revealing the presence of putative CREA- and AREA-binding sites. In vitro bandshift experiments demonstrated that an Aspergillus nidulans GST-CREA fusion protein was capable of binding to two of the three putative CREA sites. Using a PCR-based strategy the M. anisopliae crr1 gene was identified; it encodes a putative C2H2-type DNA-binding protein with significant sequence similarity to A. nidulans CREA. Complementation experiments with an A. nidulans strain carrying creA204 demonstrated that CRR1 can partially substitute for CREA function.

  13. Conservation and restoration of forest trees impacted by non-native pathogens: the role of genetics and tree improvement

    Treesearch

    R.A. Sniezko; L.A. Winn

    2017-01-01

    North American native tree species in forest ecosystems, as well as managed forests and urban plantings, are being severely impacted by pathogens and insects. The impacts of these pathogens and insects often increase over time, and they are particularly acute for those species affected by non-native pathogens and insects. For restoration of affected tree species or for...

  14. An insect pupal cell with antimicrobial properties

    USDA-ARS?s Scientific Manuscript database

    Soil-dwelling insects have developed various defense mechanisms to defend against pathogen infection. The pecan weevil, Curculio caryae, spends two to three years in the soil inside an earthen cell. We hypothesized that the cell may possess antimicrobial properties. In a laboratory study, we teste...

  15. Development of Baits for Insect Control

    USDA-ARS?s Scientific Manuscript database

    This article outlines the importance of baits. Baits are formulations that can be used to deliver a toxic chemical or a pathogen (active agent) via ingestion to an insect pest with the goal of killing it. A bait formulations consist of a bait matrix which is the carrier for an active agent. The bait...

  16. Insect prophenoloxidase: the view beyond immunity

    PubMed Central

    Lu, Anrui; Zhang, Qiaoli; Zhang, Jie; Yang, Bing; Wu, Kai; Xie, Wei; Luan, Yun-Xia; Ling, Erjun

    2014-01-01

    Insect prophenoloxidase (PPO) is an important innate immunity protein due to its involvement in cellular and humoral defense. It belongs to a group of type-3 copper-containing proteins that occurs in almost all organisms. Insect PPO has been studied for over a century, and the PPO activation cascade is becoming clearer. The insect PPO activation pathway incorporates several important proteins, including pattern-recognition receptors (PGRP, β GRP, and C-type lectins), serine proteases, and serine protease inhibitors (serpins). Due to their complexity, PPO activation mechanisms vary among insect species. Activated phenoloxidase (PO) oxidizes phenolic molecules to produce melanin around invading pathogens and wounds. The crystal structure of Manduca sexta PPO shows that a conserved amino acid, phenylalanine (F), can block the active site pocket. During activation, this blocker must be dislodged or even cleaved at the N-terminal sequence to expose the active site pockets and allow substrates to enter. Thanks to the crystal structure of M. sexta PPO, some domains and specific amino acids that affect PPO activities have been identified. Further studies of the relationship between PPO structure and enzyme activities will provide an opportunity to examine other type-3 copper proteins, and trace when and why their various physiological functions evolved. Recent researches show that insect PPO has a relationship with neuron activity, longevity, feces melanization (phytophagous insects) and development, which suggests that it is time for us to look back on insect PPO beyond the view of immunity in this review. PMID:25071597

  17. Insects and Scorpions

    MedlinePlus

    ... Workplace Safety and Health Topics Insects & Scorpions Bees, Wasps, and Hornets Fire Ants Scorpions Additional Resources Hazards ... outdoor workers. Stinging or biting insects include bees, wasps, hornets, and fire ants. The health effects of ...

  18. Hearing in Insects.

    PubMed

    Göpfert, Martin C; Hennig, R Matthias

    2016-01-01

    Insect hearing has independently evolved multiple times in the context of intraspecific communication and predator detection by transforming proprioceptive organs into ears. Research over the past decade, ranging from the biophysics of sound reception to molecular aspects of auditory transduction to the neuronal mechanisms of auditory signal processing, has greatly advanced our understanding of how insects hear. Apart from evolutionary innovations that seem unique to insect hearing, parallels between insect and vertebrate auditory systems have been uncovered, and the auditory sensory cells of insects and vertebrates turned out to be evolutionarily related. This review summarizes our current understanding of insect hearing. It also discusses recent advances in insect auditory research, which have put forward insect auditory systems for studying biological aspects that extend beyond hearing, such as cilium function, neuronal signal computation, and sensory system evolution.

  19. Respiration in Aquatic Insects.

    ERIC Educational Resources Information Center

    MacFarland, John

    1985-01-01

    This article: (1) explains the respiratory patterns of several freshwater insects; (2) describes the differences and mechanisms of spiracular cutaneous, and gill respiration; and (3) discusses behavioral aspects of selected aquatic insects. (ML)

  20. Insects: An Interdisciplinary Unit

    ERIC Educational Resources Information Center

    Leger, Heather

    2007-01-01

    The author talks about an interdisciplinary unit on insects, and presents activities that can help students practice communication skills (interpersonal, interpretive, and presentational) and learn about insects with hands-on activities.

  1. Ecophysiology and insect herbivory

    SciTech Connect

    Clancy, K.M.; Wagner, M.R.; Reich, P.B.

    1995-07-01

    The relationship of insect herbivory to conifer physiology is examined. Aspects of nutrient assimilation, nutrient distribution, water stress, and climatic change are correlated to defoliation by insects. Other factors examined include plant age, density, structure, soils, and plant genotype.

  2. Respiration in Aquatic Insects.

    ERIC Educational Resources Information Center

    MacFarland, John

    1985-01-01

    This article: (1) explains the respiratory patterns of several freshwater insects; (2) describes the differences and mechanisms of spiracular cutaneous, and gill respiration; and (3) discusses behavioral aspects of selected aquatic insects. (ML)

  3. Baculovirus enhancins and their role in viral pathogenicity. Chapter 9

    Treesearch

    James M. Slavicek

    2012-01-01

    Baculoviruses are a large group of viruses pathogenic to arthropods, primarily insects from the order Lepidoptera and also insects in the orders Hymenoptera and Diptera. Baculoviruses have been used to control insect pests on agricultural crops and forests around the world. Efforts have been ongoing for the last two decades to develop strains of baculoviruses with...

  4. A natural fungal infection of a sylvatic cockroach with Metarhizium blattodeae sp. nov., a member of the M. flavoviride species complex

    USDA-ARS?s Scientific Manuscript database

    A wild, forest-dwelling cockroach from the subfamily Ectobiidae (order Blattodea) in a nature reserve in Cavalcante, in the state of Goias, Brazil, was found to be infected by a new, genetically distinct species in the Metarhizium flavoviride species complex that we describe here as Metarhizium blat...

  5. The antileukaemic cell cycle regulatory activities of swainsonine purified from Metarhizium anisopliae fermentation broth.

    PubMed

    Singh, Digar; Kaur, Gurvinder

    2014-01-01

    Swainsonine is a Metarhizium secondary metabolite known differentially for its specific mannosidase inhibitory, toxic and therapeutic activities. Here, the standard and purified swainsonine from Metarhizium anisopliae fermentation broth were comparatively evaluated for their in situ antileukaemic activities in human promyelocytic cell line, HL-60. Both the standard (IC50 = 6.96 μM) and purified (IC50 = 9.50 μM) compounds inhibited the leukaemic cell proliferation without inflicting cell membrane disruption at 48 h of post-treatment incubation. The DNA cell cycle analysis showed approximately 48.81% and 60.72% of the treated cells arrested in the synthetic phase (S-phase) at 36 and 48 h, respectively, upon treatment with IC50 concentration of the purified swainsonine. However, only 29.62% of cells were arrested in S-phase with standard swainsonine at 48 h, suggesting the comprehensive action of certain other metabolites sharing the similar paradigm of antiproliferative properties in Metarhizium broth extract.

  6. Exploring Sound with Insects

    ERIC Educational Resources Information Center

    Robertson, Laura; Meyer, John R.

    2010-01-01

    Differences in insect morphology and movement during singing provide a fascinating opportunity for students to investigate insects while learning about the characteristics of sound. In the activities described here, students use a free online computer software program to explore the songs of the major singing insects and experiment with making…

  7. Sunflower insect pests

    USDA-ARS?s Scientific Manuscript database

    Like other annual crops, sunflowers are fed upon by a variety of insect pests capable of reducing yields. Though there are a few insects which are considered consistent or severe (e.g., sunflower moth, banded sunflower moth, red sunflower seed weevil), many more insects are capable of causing proble...

  8. Insects and Spiders.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of nine Audubon Nature Bulletins, providing teachers and students with informational reading on insects and spiders. The bulletins have these titles: What Good Are Insects, How Insects Benefit Man, Life of the Honey Bee, Ants and Their Fascinating Ways, Mosquitoes and Other Flies, Caterpillars, Spiders and Silk,…

  9. Insect phermones: diet related?

    PubMed

    Hendry, L B

    1976-04-09

    The question of the origin of insect pheromones is discussed in the light of new published information on the communication system of the oak leaf roller. It is concluded that compounds found in diets may be partially responsible for insect sexual behavior and that substructuring of insect populations in ecological and evolutionary time through dietary chemicals remains a hypothesis worthy of further testing.

  10. Exploring Sound with Insects

    ERIC Educational Resources Information Center

    Robertson, Laura; Meyer, John R.

    2010-01-01

    Differences in insect morphology and movement during singing provide a fascinating opportunity for students to investigate insects while learning about the characteristics of sound. In the activities described here, students use a free online computer software program to explore the songs of the major singing insects and experiment with making…

  11. Acoustic Monitoring of Insects

    USDA-ARS?s Scientific Manuscript database

    Farmers, grain elevator managers, and food processors often sample grain for insect damaged kernels and numbers of live adult insects but these easily obtained measurements of insect levels do not provide reliable estimates of the typically much larger populations of internally feeding immature inse...

  12. Insects and Spiders.

    ERIC Educational Resources Information Center

    National Audubon Society, New York, NY.

    This set of teaching aids consists of nine Audubon Nature Bulletins, providing teachers and students with informational reading on insects and spiders. The bulletins have these titles: What Good Are Insects, How Insects Benefit Man, Life of the Honey Bee, Ants and Their Fascinating Ways, Mosquitoes and Other Flies, Caterpillars, Spiders and Silk,…

  13. Insects and Others.

    ERIC Educational Resources Information Center

    Mills, Richard

    1984-01-01

    Several ideas for observing insects and soil animals in the classroom are provided. Also provided are: (1) procedures for making insect cages with milk cartons; (2) suggestions for collecting and feeding insects; and (3) techniques for collecting and identifying soil animals. (BC)

  14. InsectBase: a resource for insect genomes and transcriptomes.

    PubMed

    Yin, Chuanlin; Shen, Gengyu; Guo, Dianhao; Wang, Shuping; Ma, Xingzhou; Xiao, Huamei; Liu, Jinding; Zhang, Zan; Liu, Ying; Zhang, Yiqun; Yu, Kaixiang; Huang, Shuiqing; Li, Fei

    2016-01-04

    The genomes and transcriptomes of hundreds of insects have been sequenced. However, insect community lacks an integrated, up-to-date collection of insect gene data. Here, we introduce the first release of InsectBase, available online at http://www.insect-genome.com. The database encompasses 138 insect genomes, 116 insect transcriptomes, 61 insect gene sets, 36 gene families of 60 insects, 7544 miRNAs of 69 insects, 96,925 piRNAs of Drosophila melanogaster and Chilo suppressalis, 2439 lncRNA of Nilaparvata lugens, 22,536 pathways of 78 insects, 678,881 untranslated regions (UTR) of 84 insects and 160,905 coding sequences (CDS) of 70 insects. This release contains over 12 million sequences and provides search functionality, a BLAST server, GBrowse, insect pathway construction, a Facebook-like network for the insect community (iFacebook), and phylogenetic analysis of selected genes.

  15. InsectBase: a resource for insect genomes and transcriptomes

    PubMed Central

    Yin, Chuanlin; Shen, Gengyu; Guo, Dianhao; Wang, Shuping; Ma, Xingzhou; Xiao, Huamei; Liu, Jinding; Zhang, Zan; Liu, Ying; Zhang, Yiqun; Yu, Kaixiang; Huang, Shuiqing; Li, Fei

    2016-01-01

    The genomes and transcriptomes of hundreds of insects have been sequenced. However, insect community lacks an integrated, up-to-date collection of insect gene data. Here, we introduce the first release of InsectBase, available online at http://www.insect-genome.com. The database encompasses 138 insect genomes, 116 insect transcriptomes, 61 insect gene sets, 36 gene families of 60 insects, 7544 miRNAs of 69 insects, 96 925 piRNAs of Drosophila melanogaster and Chilo suppressalis, 2439 lncRNA of Nilaparvata lugens, 22 536 pathways of 78 insects, 678 881 untranslated regions (UTR) of 84 insects and 160 905 coding sequences (CDS) of 70 insects. This release contains over 12 million sequences and provides search functionality, a BLAST server, GBrowse, insect pathway construction, a Facebook-like network for the insect community (iFacebook), and phylogenetic analysis of selected genes. PMID:26578584

  16. Phytoplasmas: bacteria that manipulate plants and insects.

    PubMed

    Hogenhout, Saskia A; Oshima, Kenro; Ammar, El-Desouky; Kakizawa, Shigeyuki; Kingdom, Heather N; Namba, Shigetou

    2008-07-01

    Superkingdom Prokaryota; Kingdom Monera; Domain Bacteria; Phylum Firmicutes (low-G+C, Gram-positive eubacteria); Class Mollicutes; Candidatus (Ca.) genus Phytoplasma. Ca. Phytoplasma comprises approximately 30 distinct clades based on 16S rRNA gene sequence analyses of approximately 200 phytoplasmas. Phytoplasmas are mostly dependent on insect transmission for their spread and survival. The phytoplasma life cycle involves replication in insects and plants. They infect the insect but are phloem-limited in plants. Members of Ca. Phytoplasma asteris (16SrI group phytoplasmas) are found in 80 monocot and dicot plant species in most parts of the world. Experimentally, they can be transmitted by approximately 30, frequently polyphagous insect species, to 200 diverse plant species. In plants, phytoplasmas induce symptoms that suggest interference with plant development. Typical symptoms include: witches' broom (clustering of branches) of developing tissues; phyllody (retrograde metamorphosis of the floral organs to the condition of leaves); virescence (green coloration of non-green flower parts); bolting (growth of elongated stalks); formation of bunchy fibrous secondary roots; reddening of leaves and stems; generalized yellowing, decline and stunting of plants; and phloem necrosis. Phytoplasmas can be pathogenic to some insect hosts, but generally do not negatively affect the fitness of their major insect vector(s). In fact, phytoplasmas can increase fecundity and survival of insect vectors, and may influence flight behaviour and plant host preference of their insect hosts. The most common practices are the spraying of various insecticides to control insect vectors, and removal of symptomatic plants. Phytoplasma-resistant cultivars are not available for the vast majority of affected crops.

  17. Indirect effects of one plant pathogen on the transmission of a second pathogen and the behavior of its potato psyllid vector

    USDA-ARS?s Scientific Manuscript database

    Plant pathogens can influence the behavior and performance of insect herbivore vectors. Studies of these associations typically focus on tripartite interactions between a plant host, a plant pathogen, and its insect vector. However, an unrelated herbivore or pathogen also could influence host-pathog...

  18. Insect barcode information system.

    PubMed

    Pratheepa, Maria; Jalali, Sushil Kumar; Arokiaraj, Robinson Silvester; Venkatesan, Thiruvengadam; Nagesh, Mandadi; Panda, Madhusmita; Pattar, Sharath

    2014-01-01

    Insect Barcode Information System called as Insect Barcode Informática (IBIn) is an online database resource developed by the National Bureau of Agriculturally Important Insects, Bangalore. This database provides acquisition, storage, analysis and publication of DNA barcode records of agriculturally important insects, for researchers specifically in India and other countries. It bridges a gap in bioinformatics by integrating molecular, morphological and distribution details of agriculturally important insects. IBIn was developed using PHP/My SQL by using relational database management concept. This database is based on the client- server architecture, where many clients can access data simultaneously. IBIn is freely available on-line and is user-friendly. IBIn allows the registered users to input new information, search and view information related to DNA barcode of agriculturally important insects.This paper provides a current status of insect barcode in India and brief introduction about the database IBIn. http://www.nabg-nbaii.res.in/barcode.

  19. Potential of two entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae (Coleoptera: Scarabaeidae), as biological control agents against the June beetle

    PubMed Central

    Erler, Fedai; Ates, A. Ozgur

    2015-01-01

    The aim of this study was to evaluate the effectiveness of the entomopathogenic fungi (EPF), Beauveria bassiana (Bals.) Vuill. (Deuteromycotina: Hyphomycetes) strain PPRI 5339 [BroadBand, an emulsifiable spore concentrate (EC) formulation] and Metarhizium anisopliae (Metsch.) Sorokin (Hypocreales: Clavicipitaceae) strain F52 [Met52, both EC and granular (GR) formulations] against the larvae of Polyphylla fullo (L.) (Coleoptera: Scarabaeidae). Larvicidal bioassays were performed in foam boxes (100 by 75 by 50 cm; length by width by height), containing moist soil medium with some humus and potato tubers as food. Although the B. bassiana product (min. 4 × 109 conidia/ml) was applied at 100, 150, and 200 ml/100 l water; M. anisopliae strain F52 was applied at 500, 1,000, and 1,500 g/m3 of moist soil medium for GR (9 × 108 cfu/g) and 75, 100, and 125 ml/100 l water for EC (5.5 × 109 conidia/ml) formulation. Both fungi were pathogenic to larvae of the pest; however, young larvae (1st and 2nd instars) were more susceptible to infection than older ones (3rd instar). Mortality rates of young and older larvae varied with conidial concentration of both fungi and elapsed time after application. The B. bassiana product was more effective than both of the formulations of the M. anisopliae product, causing mortalities up to 79.8 and 71.6% in young and older larvae, respectively. The highest mortality rates of young and older larvae caused by the M. anisopliae product were 74.1 and 67.6% for the GR formulation, 70.2 and 61.8% for the EC formulation, respectively. These results may suggest that both fungi have potential to be used for management of P. fullo. PMID:25881632

  20. Potential of two entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae (Coleoptera: Scarabaeidae), as biological control agents against the June beetle.

    PubMed

    Erler, Fedai; Ates, A Ozgur

    2015-01-01

    The aim of this study was to evaluate the effectiveness of the entomopathogenic fungi (EPF), Beauveria bassiana (Bals.) Vuill. (Deuteromycotina: Hyphomycetes) strain PPRI 5339 [BroadBand, an emulsifiable spore concentrate (EC) formulation] and Metarhizium anisopliae (Metsch.) Sorokin (Hypocreales: Clavicipitaceae) strain F52 [Met52, both EC and granular (GR) formulations] against the larvae of Polyphylla fullo (L.) (Coleoptera: Scarabaeidae). Larvicidal bioassays were performed in foam boxes (100 by 75 by 50 cm; length by width by height), containing moist soil medium with some humus and potato tubers as food. Although the B. bassiana product (min. 4 × 10(9) conidia/ml) was applied at 100, 150, and 200 ml/100 l water; M. anisopliae strain F52 was applied at 500, 1,000, and 1,500 g/m(3) of moist soil medium for GR (9 × 10(8) cfu/g) and 75, 100, and 125 ml/100 l water for EC (5.5 × 10(9) conidia/ml) formulation. Both fungi were pathogenic to larvae of the pest; however, young larvae (1st and 2nd instars) were more susceptible to infection than older ones (3rd instar). Mortality rates of young and older larvae varied with conidial concentration of both fungi and elapsed time after application. The B. bassiana product was more effective than both of the formulations of the M. anisopliae product, causing mortalities up to 79.8 and 71.6% in young and older larvae, respectively. The highest mortality rates of young and older larvae caused by the M. anisopliae product were 74.1 and 67.6% for the GR formulation, 70.2 and 61.8% for the EC formulation, respectively. These results may suggest that both fungi have potential to be used for management of P. fullo.

  1. Characterization of Metarhizium viride Mycosis in Veiled Chameleons (Chamaeleo calyptratus), Panther Chameleons (Furcifer pardalis), and Inland Bearded Dragons (Pogona vitticeps)

    PubMed Central

    Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

    2016-01-01

    ABSTRACT Metarhizium viride has been associated with fatal systemic mycoses in chameleons, but subsequent data on mycoses caused by this fungus in reptiles are lacking. The aim of this investigation was therefore to obtain information on the presence of M. viride in reptiles kept as pets in captivity and its association with clinical signs and pathological findings as well as improvement of diagnostic procedures. Beside 18S ribosomal DNA (rDNA) (small subunit [SSU]) and internal transcribed spacer region 1 (ITS-1), a fragment of the large subunit (LSU) of 28S rDNA, including domain 1 (D1) and D2, was sequenced for the identification of the fungus and phylogenetic analysis. Cultural isolation and histopathological examinations as well as the pattern of antifungal drug resistance, determined by using agar diffusion testing, were additionally used for comparison of the isolates. In total, 20 isolates from eight inland bearded dragons (Pogona vitticeps), six veiled chameleons (Chamaeleo calyptratus), and six panther chameleons (Furcifer pardalis) were examined. Most of the lizards suffered from fungal glossitis, stomatitis, and pharyngitis or died due to visceral mycosis. Treatment with different antifungal drugs according to resistance patterns in all three different lizard species was unsuccessful. Sequence analysis resulted in four different genotypes of M. viride based on differences in the LSU fragment, whereas the SSU and ITS-1 were identical in all isolates. Sequence analysis of the SSU fragment revealed the first presentation of a valid large fragment of the SSU of M. viride. According to statistical analysis, genotypes did not correlate with differences in pathogenicity, antifungal susceptibility, or species specificity. PMID:28003420

  2. Characterization of Metarhizium viride Mycosis in Veiled Chameleons (Chamaeleo calyptratus), Panther Chameleons (Furcifer pardalis), and Inland Bearded Dragons (Pogona vitticeps).

    PubMed

    Schmidt, Volker; Klasen, Linus; Schneider, Juliane; Hübel, Jens; Pees, Michael

    2017-03-01

    Metarhizium viride has been associated with fatal systemic mycoses in chameleons, but subsequent data on mycoses caused by this fungus in reptiles are lacking. The aim of this investigation was therefore to obtain information on the presence of M. viride in reptiles kept as pets in captivity and its association with clinical signs and pathological findings as well as improvement of diagnostic procedures. Beside 18S ribosomal DNA (rDNA) (small subunit [SSU]) and internal transcribed spacer region 1 (ITS-1), a fragment of the large subunit (LSU) of 28S rDNA, including domain 1 (D1) and D2, was sequenced for the identification of the fungus and phylogenetic analysis. Cultural isolation and histopathological examinations as well as the pattern of antifungal drug resistance, determined by using agar diffusion testing, were additionally used for comparison of the isolates. In total, 20 isolates from eight inland bearded dragons (Pogona vitticeps), six veiled chameleons (Chamaeleo calyptratus), and six panther chameleons (Furcifer pardalis) were examined. Most of the lizards suffered from fungal glossitis, stomatitis, and pharyngitis or died due to visceral mycosis. Treatment with different antifungal drugs according to resistance patterns in all three different lizard species was unsuccessful. Sequence analysis resulted in four different genotypes of M. viride based on differences in the LSU fragment, whereas the SSU and ITS-1 were identical in all isolates. Sequence analysis of the SSU fragment revealed the first presentation of a valid large fragment of the SSU of M. viride According to statistical analysis, genotypes did not correlate with differences in pathogenicity, antifungal susceptibility, or species specificity.

  3. Laser system for identification, tracking, and control of flying insects

    USDA-ARS?s Scientific Manuscript database

    Flying insects are common vectors for transmission of pathogens and inflict significant harm on humans in large parts of the developing world. Besides the direct impact to humans, these pathogens also cause harm to crops and result in agricultural losses. Here, we present a laser-based system that c...

  4. Genetic engineering of fungal biocontrol agents to achieve greater efficacy against insect pests.

    PubMed

    St Leger, Raymond J; Wang, Chengshu

    2010-01-01

    Molecular biology methods have elucidated pathogenic processes in several fungal biocontrol agents including two of the most commonly applied entomopathogenic fungi, Metarhizium anisopliae and Beauveria bassiana. In this review, we describe how a combination of molecular techniques has: (1) identified and characterized genes involved in infection; (2) manipulated the genes of the pathogen to improve biocontrol performance; and (3) allowed expression of a neurotoxin from the scorpion Androctonus australis. The complete sequencing of four exemplar species of entomopathogenic fungi including B. bassiana and M. anisopliae will be completed in 2010. Coverage of these genomes will help determine the identity, origin, and evolution of traits needed for diverse lifestyles and host switching. Such knowledge combined with the precision and malleability of molecular techniques will allow design of multiple pathogens with different strategies to be used for different ecosystems and avoid the possibility of the host developing resistance.

  5. Genetic basis of destruxin production in the entomopathogen Metarhizium robertsii

    USDA-ARS?s Scientific Manuscript database

    Destruxins are among the most exhaustively researched secondary metabolites of entomopathogenic fungi, yet definitive evidence for their roles in pathogenicity and virulence has yet to be shown. To establish the genetic bases for the biosynthesis of this family of depsipeptides, we identified a 23,7...

  6. Divergent and Convergent Evolution of Fungal Pathogenicity.

    PubMed

    Shang, Yanfang; Xiao, Guohua; Zheng, Peng; Cen, Kai; Zhan, Shuai; Wang, Chengshu

    2016-05-12

    Fungal pathogens of plants and animals have multifarious effects; they cause devastating damages to agricultures, lead to life-threatening diseases in humans, or induce beneficial effects by reducing insect pest populations. Many virulence factors have been determined in different fungal pathogens; however, the molecular determinants contributing to fungal host selection and adaptation are largely unknown. In this study, we sequenced the genomes of seven ascomycete insect pathogens and performed the genome-wide analyses of 33 species of filamentous ascomycete pathogenic fungi that infect insects (12 species), plants (12), and humans (9). Our results revealed that the genomes of plant pathogens encode more proteins and protein families than the insect and human pathogens. Unexpectedly, more common orthologous protein groups are shared between the insect and plant pathogens than between the two animal group pathogens. We also found that the pathogenicity of host-adapted fungi evolved multiple times, and that both divergent and convergent evolutions occurred during pathogen-host cospeciation thus resulting in protein families with similar features in each fungal group. However, the role of phylogenetic relatedness on the evolution of protein families and therefore pathotype formation could not be ruled out due to the effect of common ancestry. The evolutionary correlation analyses led to the identification of different protein families that correlated with alternate pathotypes. Particularly, the effector-like proteins identified in plant and animal pathogens were strongly linked to fungal host adaptation, suggesting the existence of similar gene-for-gene relationships in fungus-animal interactions that has not been established before. These results well advance our understanding of the evolution of fungal pathogenicity and the factors that contribute to fungal pathotype formation. © The Author 2016. Published by Oxford University Press on behalf of the Society for

  7. Olfactory Mechanisms for Discovery of Odorants to Reduce Insect-Host Contact

    PubMed Central

    Clark, Jonathan T.; Ray, Anandasankar

    2016-01-01

    Insects have developed highly sophisticated and sensitive olfactory systems to find animal or plant hosts for feeding. Some insects vector pathogens that cause diseases in hundreds of millions of people and destroy billions of dollars of food products every year. There is great interest, therefore, in understanding how the insect olfactory system can be manipulated to reduce their contact with hosts. Here, we review recent advances in our understanding of insect olfactory detection mechanisms, which may serve as a foundation for designing insect control programs based on manipulation of their behaviors by using odorants. Because every insect species has a unique set of olfactory receptors and olfactory-mediated behaviors, we focus primarily on general principles of odor detection that potentially apply to most insects. While these mechanisms have emerged from studies on model systems for study of insect olfaction, such as Drosophila melanogaster, they provide a foundation for discovery of odorants to repel insects or reduce host-seeking behavior. PMID:27628342

  8. Molecular Genetics of Beauveria bassiana Infection of Insects.

    PubMed

    Ortiz-Urquiza, A; Keyhani, N O

    2016-01-01

    Research on the insect pathogenic filamentous fungus, Beauveria bassiana has witnessed significant growth in recent years from mainly physiological studies related to its insect biological control potential, to addressing fundamental questions regarding the underlying molecular mechanisms of fungal development and virulence. This has been in part due to a confluence of robust genetic tools and genomic resources for the fungus, and recognition of expanded ecological interactions with which the fungus engages. Beauveria bassiana is a broad host range insect pathogen that has the ability to form intimate symbiotic relationships with plants. Indeed, there is an increasing realization that the latter may be the predominant environmental interaction in which the fungus participates, and that insect parasitism may be an opportunist lifestyle evolved due to the carbon- and nitrogen-rich resources present in insect bodies. Here, we will review progress on the molecular genetics of B. bassiana, which has largely been directed toward identifying genetic pathways involved in stress response and virulence assumed to have practical applications in improving the insect control potential of the fungus. Important strides have also been made in understanding aspects of B. bassiana development. Finally, although increasingly apparent in a number of studies, there is a need for progressing beyond phenotypic mutant characterization to sufficiently investigate the molecular mechanisms underlying B. bassiana's unique and diverse lifestyles as saprophyte, insect pathogen, and plant mutualist.

  9. Insect enemies of birch

    Treesearch

    James G. Conklin

    1969-01-01

    Native birches are subject to attack by insects at all stages of growth from the germinating seedling to the mature tree. All parts of the tree—roots, stem, branches, foliage, and even the developing seed—may be utilized as feeding sites by insects of one kind or another. An enumeration of the many insects recorded in the literature as feeders on...

  10. Insect transferrins: multifunctional proteins.

    PubMed

    Geiser, Dawn L; Winzerling, Joy J

    2012-03-01

    Many studies have been done evaluating transferrin in insects. Genomic analyses indicate that insects could have more than one transferrin. However, the most commonly studied insect transferrin, Tsf1, shows greatest homology to mammalian blood transferrin. Aspects of insect transferrin structure compared to mammalian transferrin and the roles transferrin serves in insects are discussed in this review. Insect transferrin can have one or two lobes, and can bind iron in one or both. The iron binding ligands identified for the lobes of mammalian blood transferrin are generally conserved in the lobes of insect transferrins that have an iron binding site. Available information supports that the form of dietary iron consumed influences the regulation of insect transferrin. Although message is expressed in several tissues in many insects, fat body is the likely source of hemolymph transferrin. Insect transferrin is a vitellogenic protein that is down-regulated by Juvenile Hormone. It serves a role in transporting iron to eggs in some insects, and transferrin found in eggs appears to be endowed from the female. In addition to the roles of transferrin in iron delivery, this protein also functions to reduce oxidative stress and to enhance survival of infection. Future studies in Tsf1 as well as the other insect transferrins that bind iron are warranted because of the roles of transferrin in preventing oxidative stress, enhancing survival to infections and delivering iron to eggs for development. This article is part of a Special Issue entitled Transferrins: Molecular mechanisms of iron transport and disorders. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Transmission and Retention of Salmonella enterica by Phytophagous Hemipteran Insects

    PubMed Central

    Soto-Arias, José Pablo; Groves, Russell L.

    2014-01-01

    Several pest insects of human and livestock habitations are known as vectors of Salmonella enterica; however, the role of plant-feeding insects as vectors of S. enterica to agricultural crops remains unexamined. Using a hemipteran insect pest-lettuce system, we investigated the potential for transmission and retention of S. enterica. Specifically, Macrosteles quadrilineatus and Myzus persicae insects were fed S. enterica-inoculated lettuce leaf discs or artificial liquid diets confined in Parafilm sachets to allow physical contact or exclusively oral ingestion of the pathogen, respectively. After a 24-h acquisition access period, insects were moved onto two consecutive noninoculated leaf discs or liquid diets and allowed a 24-h inoculation access period on each of the two discs or sachets. Similar proportions of individuals from both species ingested S. enterica after a 24-h acquisition access period from inoculated leaf discs, but a significantly higher proportion of M. quadrilineatus retained the pathogen internally after a 48-h inoculation access period. S. enterica was also recovered from the honeydew of both species. After a 48-h inoculation access period, bacteria were recovered from a significantly higher proportion of honeydew samples from M. quadrilineatus than from M. persicae insects. The recovery of S. enterica from leaf discs and liquid diets postfeeding demonstrated that both species of insects were capable of transmitting the bacteria in ways that are not limited to mechanical transmission. Overall, these results suggest that phytophagous insects may serve as potential vectors of S. enterica in association with plants. PMID:24973069

  12. Divergent and Convergent Evolution of Fungal Pathogenicity

    PubMed Central

    Shang, Yanfang; Xiao, Guohua; Zheng, Peng; Cen, Kai; Zhan, Shuai; Wang, Chengshu

    2016-01-01

    Fungal pathogens of plants and animals have multifarious effects; they cause devastating damages to agricultures, lead to life-threatening diseases in humans, or induce beneficial effects by reducing insect pest populations. Many virulence factors have been determined in different fungal pathogens; however, the molecular determinants contributing to fungal host selection and adaptation are largely unknown. In this study, we sequenced the genomes of seven ascomycete insect pathogens and performed the genome-wide analyses of 33 species of filamentous ascomycete pathogenic fungi that infect insects (12 species), plants (12), and humans (9). Our results revealed that the genomes of plant pathogens encode more proteins and protein families than the insect and human pathogens. Unexpectedly, more common orthologous protein groups are shared between the insect and plant pathogens than between the two animal group pathogens. We also found that the pathogenicity of host-adapted fungi evolved multiple times, and that both divergent and convergent evolutions occurred during pathogen–host cospeciation thus resulting in protein families with similar features in each fungal group. However, the role of phylogenetic relatedness on the evolution of protein families and therefore pathotype formation could not be ruled out due to the effect of common ancestry. The evolutionary correlation analyses led to the identification of different protein families that correlated with alternate pathotypes. Particularly, the effector-like proteins identified in plant and animal pathogens were strongly linked to fungal host adaptation, suggesting the existence of similar gene-for-gene relationships in fungus–animal interactions that has not been established before. These results well advance our understanding of the evolution of fungal pathogenicity and the factors that contribute to fungal pathotype formation. PMID:27071652

  13. Density, Viability Conidia And Symptoms of Metarhizium anisopliae infection on Oryctes rhinoceros larvae

    NASA Astrophysics Data System (ADS)

    Indriyanti, D. R.; Putri, R. I. P.; Widiyaningrum, P.; Herlina, L.

    2017-04-01

    M. anisopliae is parasitic fungus on insect pests; it is used as a biocontrol agent. M. anisopliae can be propagated on maize or rice substrate. M. anisopliae is currently sold in the form of kaolin powder formulations. Before it is used to check the density, viability and pathogenicity of M. anisopliae. However the problem is the kaolin powder very soft, so it difficult to distinguish between kaolin and conidia. This article gives information on how to calculate conidia density, viability and symptoms of M. anisopliae infection on Oryctes rhinoceros larvae. The study was conducted in the laboratory to determine the density and viability. The pathogenicity testing was done using pots. The Pot is containing soil substrate mixed with M. Anispoliae and ten tails O. Rhinoceros larvae per pot. The results showed that the density of M. anisopliae conidia was 1.81 x 108 conidia mL-1 and the viability was 94% within 24 hours. The larval mortality began to emerge in the 1st week, and all larvae died at the sixth week. The symptom of M. anisopliae infection on Oryctes rhinoceros larvae, there was a black spot on the larval integument. The larvae movements become slow and poor appetite; it will die within 3-7 days. The larvae die hard, and the white hyphae grow on the body surface that turns green.

  14. Digital PCR for detection of citrus pathogens

    USDA-ARS?s Scientific Manuscript database

    Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...

  15. Mycoplasmas, plants, insect vectors: a matrimonial triangle.

    PubMed

    Garnier, M; Foissac, X; Gaurivaud, P; Laigret, F; Renaudin, J; Saillard, C; Bové, J M

    2001-10-01

    Plant pathogenic mycoplasmas were discovered by electron microscopy, in 1967, long after the discovery and culture in 1898 of the first pathogenic mycoplasma of animal origin, Mycoplasma mycoides. Mycoplasmas are Eubacteria of the class Mollicutes, a group of organisms phylogenetically related to Gram-positive bacteria. Their more characteristic features reside in the small size of their genomes, the low guanine (G) plus cytosine (C) content of their genomic DNA and the lack of a cell wall. Plant pathogenic mycoplasmas are responsible for several hundred diseases and belong to two groups: the phytoplasmas and the spiroplasmas. The phytoplasmas (previously called MLOs, for mycoplasma like organisms) were discovered first; they are pleiomorphic, and have so far resisted in vitro cultivation. Phytoplasmas represent the largest group of plant pathogenic Mollicutes. Only three plant pathogenic spiroplasmas are known today. Spiroplasma citri, the agent of citrus stubborn was discovered and cultured in 1970 and shown to be helical and motile. S. kunkelii is the causal agent of corn stunt. S. phoeniceum, responsible for periwinkle yellows, was discovered in Syria. There are many other spiroplasmas associated with insects and ticks. Plant pathogenic mycoplasmas are restricted to the phloem sieve tubes in which circulates the photosynthetically-enriched sap, the food for many phloem-feeding insects (aphids, leafhoppers, psyllids, etc.). Interestingly, phytopathogenic mycoplasmas are very specifically transmitted by leafhoppers or psyllid species. In this paper, the most recent knowledge on phytopathogenic mycoplasmas in relation with their insect and plant habitats is presented as well as the experiments carried out to control plant mycoplasma diseases, by expression of mycoplasma-directed-antibodies in plants (plantibodies).

  16. Development of Metarhizium anisopliae and Beauveria bassiana formulations for control of malaria mosquito larvae.

    PubMed

    Bukhari, Tullu; Takken, Willem; Koenraadt, Constantianus J M

    2011-02-22

    The entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana have demonstrated effectiveness against anopheline larvae in the laboratory. However, utilising these fungi for the control of anopheline larvae under field conditions, relies on development of effective means of application as well as reducing their sensitivity to UV radiation, high temperatures and the inevitable contact with water. This study was conducted to develop formulations that facilitate the application of Metarhizium anisopliae and Beauveria bassiana spores for the control of anopheline larvae, and also improve their persistence under field conditions. Laboratory bioassays were conducted to test the ability of aqueous (0.1% Tween 80), dry (organic and inorganic) and oil (mineral and synthetic) formulations to facilitate the spread of fungal spores over the water surface and improve the efficacy of formulated spores against anopheline larvae as well as improve spore survival after application. Field bioassays were then carried out to test the efficacy of the most promising formulation under field conditions in western Kenya. When formulated in a synthetic oil (ShellSol T), fungal spores of both Metarhizium anisopliae and Beauveria bassiana were easy to mix and apply to the water surface. This formulation was more effective against anopheline larvae than 0.1% Tween 80, dry powders or mineral oil formulations. ShellSol T also improved the persistence of fungal spores after application to the water. Under field conditions in Kenya, the percentage pupation of An. gambiae was significantly reduced by 39 - 50% by the ShellSol T-formulated Metarhizium anisopliae and Beauveria bassiana spores as compared to the effects of the application of unformulated spores. ShellSol T is an effective carrier for fungal spores when targeting anopheline larvae under both laboratory and field conditions. Entomopathogenic fungi formulated with a suitable carrier are a promising tool for control of larval

  17. Development of Metarhizium anisopliae and Beauveria bassiana formulations for control of malaria mosquito larvae

    PubMed Central

    2011-01-01

    Background The entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana have demonstrated effectiveness against anopheline larvae in the laboratory. However, utilising these fungi for the control of anopheline larvae under field conditions, relies on development of effective means of application as well as reducing their sensitivity to UV radiation, high temperatures and the inevitable contact with water. This study was conducted to develop formulations that facilitate the application of Metarhizium anisopliae and Beauveria bassiana spores for the control of anopheline larvae, and also improve their persistence under field conditions. Methods Laboratory bioassays were conducted to test the ability of aqueous (0.1% Tween 80), dry (organic and inorganic) and oil (mineral and synthetic) formulations to facilitate the spread of fungal spores over the water surface and improve the efficacy of formulated spores against anopheline larvae as well as improve spore survival after application. Field bioassays were then carried out to test the efficacy of the most promising formulation under field conditions in western Kenya. Results When formulated in a synthetic oil (ShellSol T), fungal spores of both Metarhizium anisopliae and Beauveria bassiana were easy to mix and apply to the water surface. This formulation was more effective against anopheline larvae than 0.1% Tween 80, dry powders or mineral oil formulations. ShellSol T also improved the persistence of fungal spores after application to the water. Under field conditions in Kenya, the percentage pupation of An. gambiae was significantly reduced by 39 - 50% by the ShellSol T-formulated Metarhizium anisopliae and Beauveria bassiana spores as compared to the effects of the application of unformulated spores. Conclusions ShellSol T is an effective carrier for fungal spores when targeting anopheline larvae under both laboratory and field conditions. Entomopathogenic fungi formulated with a suitable carrier are a

  18. Insects: Bugged Out!

    ERIC Educational Resources Information Center

    Piehl, Kathy

    2011-01-01

    Insects really need no introduction. They have lived on earth much longer than humans and vastly outnumber people and all other animal species combined. People encounter them daily in their houses and yards. Yet, when children want to investigate insects, books can help them start their explorations. "Paleo Bugs" carries readers back to the time…

  19. Insects and Bugs

    ERIC Educational Resources Information Center

    Sutherland, Karen

    2009-01-01

    They have been around for centuries. They sting, they bite. They cause intense itching or painful sores. They even cause allergic reactions and sometimes death. There are two types of insects that are pests to humans--those that sting and those that bite. The insects that bite do so with their mouths and include mosquitoes, chiggers, and ticks.…

  20. Magnetic compasses in insects

    USDA-ARS?s Scientific Manuscript database

    The use of magnetic information for orientation and navigation is a widespread phenomenon in animals. In contrast to navigational systems in vertebrates, our understanding of the mechanisms underlying the insect magnetic perception and use of the information is at an early stage. Some insects use ma...

  1. Great Basin insect outbreaks

    Treesearch

    Barbara Bentz; Diane Alston; Ted Evans

    2008-01-01

    Outbreaks of native and exotic insects are important drivers of ecosystem dynamics in the Great Basin. The following provides an overview of range, forest, ornamental, and agricultural insect outbreaks occurring in the Great Basin and the associated management issues and research needs.

  2. Insects: Bugged Out!

    ERIC Educational Resources Information Center

    Piehl, Kathy

    2011-01-01

    Insects really need no introduction. They have lived on earth much longer than humans and vastly outnumber people and all other animal species combined. People encounter them daily in their houses and yards. Yet, when children want to investigate insects, books can help them start their explorations. "Paleo Bugs" carries readers back to the time…

  3. Insects and Bugs

    ERIC Educational Resources Information Center

    Sutherland, Karen

    2009-01-01

    They have been around for centuries. They sting, they bite. They cause intense itching or painful sores. They even cause allergic reactions and sometimes death. There are two types of insects that are pests to humans--those that sting and those that bite. The insects that bite do so with their mouths and include mosquitoes, chiggers, and ticks.…

  4. Sugarcane insect update

    USDA-ARS?s Scientific Manuscript database

    Insect are an important group of pests affecting sugarcane production. Agricultural consultants play an important role is assisting sugarcane farmers to choose the most appropriated means of managing damaging infestations of insects in their crop. In this presentation, information will be presented ...

  5. Sterile Insect Quality

    USDA-ARS?s Scientific Manuscript database

    This chapter discusses the history of the development of quality control tchnology, the principles and philosophy of assessing insect quality, and the relative importance of the various parameters used to assess insect quality in the context of mass-rearing for the SIT. Quality control is most devel...

  6. Principal Areas of Insect Research

    ERIC Educational Resources Information Center

    Williams, Carroll M.

    1973-01-01

    Research for insect control has been quite complex. However, recent knowledge of using insect hormones against them has opened new vistas for producing insecticides which may be harmless to human population. Current areas of insect research are outlined. (PS)

  7. Insect and arachnid hypersensitivity.

    PubMed

    Bevier, D E

    1999-11-01

    Insect hypersensitivity reactions can have a large number of clinical presentations. The majority of reactions are pruritic and involve the short- or sparsely haired areas of the body. Most are associated with eosinophilic infiltration into the skin, often in a perivascular pattern. The diagnosis may be based on compatible clinical signs and improvement with aggressive insect control and, in some cases, confirmation via provocative exposure. Intradermal, prick, or serum testing for allergen-specific IgE can be used to document the presence of reaginic antibodies against insect allergens. Treatments include avoidance, aggressive insect control, and symptomatic support; in some cases, immunotherapy may be useful in decreasing the severity of clinical reactions to insects.

  8. Native and exotic insects and diseases in forest ecosystems in the Hoosier-Shawnee ecological assessment area

    Treesearch

    Dwight Scarbrough; Jennifer Juzwik

    2004-01-01

    Various native and exotic insects and diseases affect the forest ecosystems of the Hoosier-Shawnee Ecological Assessment Area. Defoliating insects have had the greatest effects in forests where oak species predominate. Increases in oak decline are expected with the imminent establishment of the European gypsy moth. Insects and pathogens of the pine forests are...

  9. Acoustic communication in insect disease vectors

    PubMed Central

    Vigoder, Felipe de Mello; Ritchie, Michael Gordon; Gibson, Gabriella; Peixoto, Alexandre Afranio

    2013-01-01

    Acoustic signalling has been extensively studied in insect species, which has led to a better understanding of sexual communication, sexual selection and modes of speciation. The significance of acoustic signals for a blood-sucking insect was first reported in the XIX century by Christopher Johnston, studying the hearing organs of mosquitoes, but has received relatively little attention in other disease vectors until recently. Acoustic signals are often associated with mating behaviour and sexual selection and changes in signalling can lead to rapid evolutionary divergence and may ultimately contribute to the process of speciation. Songs can also have implications for the success of novel methods of disease control such as determining the mating competitiveness of modified insects used for mass-release control programs. Species-specific sound “signatures” may help identify incipient species within species complexes that may be of epidemiological significance, e.g. of higher vectorial capacity, thereby enabling the application of more focussed control measures to optimise the reduction of pathogen transmission. Although the study of acoustic communication in insect vectors has been relatively limited, this review of research demonstrates their value as models for understanding both the functional and evolutionary significance of acoustic communication in insects. PMID:24473800

  10. Acoustic communication in insect disease vectors.

    PubMed

    Vigoder, Felipe de Mello; Ritchie, Michael Gordon; Gibson, Gabriella; Peixoto, Alexandre Afranio

    2013-01-01

    Acoustic signalling has been extensively studied in insect species, which has led to a better understanding of sexual communication, sexual selection and modes of speciation. The significance of acoustic signals for a blood-sucking insect was first reported in the XIX century by Christopher Johnston, studying the hearing organs of mosquitoes, but has received relatively little attention in other disease vectors until recently. Acoustic signals are often associated with mating behaviour and sexual selection and changes in signalling can lead to rapid evolutionary divergence and may ultimately contribute to the process of speciation. Songs can also have implications for the success of novel methods of disease control such as determining the mating competitiveness of modified insects used for mass-release control programs. Species-specific sound "signatures" may help identify incipient species within species complexes that may be of epidemiological significance, e.g. of higher vectorial capacity, thereby enabling the application of more focussed control measures to optimise the reduction of pathogen transmission. Although the study of acoustic communication in insect vectors has been relatively limited, this review of research demonstrates their value as models for understanding both the functional and evolutionary significance of acoustic communication in insects.

  11. Exposure of bed bugs to metarhizium anisopliae, and the effect of defensive secretions on fungal growth in vitro

    USDA-ARS?s Scientific Manuscript database

    Bed bugs Cimex lectularius were treated with conidia of the entomopathogenic fungus Metarhizium anisopliae by topical, spray, and contact exposure. One week post-exposure, inconsistent mortalities were observed, averaging 30% across all treatment groups and replicates. Microscopic examination of top...

  12. Laboratory mortality and mycosis of adult Curculio caryae (Coleoptera: Curculionidae) following application of Metarhizium anisopliae in the laboratory and field

    USDA-ARS?s Scientific Manuscript database

    The pecan weevil, Curculio caryae, is a key pest of pecans. Our objective was to determine the potential of Metarhizium anisopliae to control emerging C. caryae adults. First, a laboratory test was conducted to compare four Beauveria bassiana strains (Bb GA2, BbLA3, BbMS1, and GHA) and three M. an...

  13. Genome-assisted development of nuclear intergenic sequence markers for entomopathogenic fungi of the Metarhizium anisopliae species complex

    USDA-ARS?s Scientific Manuscript database

    Entomopathogenic fungi in the genus Metarhizium have proven useful for the biological control of economically important pests across the globe. Understanding the true diversity of this group is hampered by convergent morphologies between species. The application of molecular techniques has enabled...

  14. Effect of fermentation media on the production, efficacy and storage stability of Metarhizium brunneum microsclerotia formulated as a prototype granule

    USDA-ARS?s Scientific Manuscript database

    New liquid fermentation techniques for the production of the bioinsecticidal fungus Metarhizium brunneum strain F-52 have resulted in the formation of microsclerotia (MS), a compact, melonized-hyphal structure capable of surviving desiccation and formulation as dry granules. When rehydrated, these M...

  15. Heat-stressed Metarhizium anisopliae: Viability (in vitro) and virulence (in vivo) assessments against the tick Rhipicephalus sanguineus

    USDA-ARS?s Scientific Manuscript database

    The current study investigated the thermotolerance of Metarhizium anisopliae s.l. conidia from the commercial products Metarril® SP Organic and Metarril® WP. The efficacy of these M. anisopliae formulations against the tick Rhipicephalus sanguineus s.l. was studied in laboratory under optimum or hea...

  16. THE FUNGAL BIOPESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Background: Sensitisation to cockroaches is associated with asthma and hence, the elimination of this vermin is of interest. Metarhizium anisopliae is a parasitic fungus used as a pesticide to control cockroach infestation indoors. Previously M. anisopliae has been shown to cause...

  17. THE FUNGAL BIOPESTICIDE METARHIZIUM ANISOPLIAE HAS AN ADJUVANT EFFECT ON THE ALLERGIC RESPONSE TO OVALBUMIN IN MICE

    EPA Science Inventory

    Background: Sensitisation to cockroaches is associated with asthma and hence, the elimination of this vermin is of interest. Metarhizium anisopliae is a parasitic fungus used as a pesticide to control cockroach infestation indoors. Previously M. anisopliae has been shown to cause...

  18. Defense contracts: molecular protection in insect-microbe symbioses.

    PubMed

    Van Arnam, Ethan B; Currie, Cameron R; Clardy, Jon

    2017-07-26

    Insects cope with environmental threats using a broad array of strategies. A key strategy, widespread among insects but unappreciated until recently, is the use of molecular defenses from symbiotic microbes. Insect-microbe defensive symbioses span the diversity of insect lineages and microbial partners and use molecules ranging from reactive oxygen species to small molecules to protein toxins to defend against predators, parasites, and microbial pathogens. These systems have a strong initial track record as sources of novel biologically active compounds with therapeutic potential. This review surveys the molecular basis for insect-microbe defensive symbioses with a focus on the ecological contexts for defense and on emerging lessons about molecular diversity from bacterial genomes.

  19. Insects antiviral and anticancer peptides: new leads for the future?

    PubMed

    Slocinska, Malgorzata; Marciniak, Pawel; Rosinski, Grzegorz

    2008-01-01

    Insect produce wide range of protein and peptides as a first fast defense line against pathogen infection. These agents act in different ways including insect immune system activation or by direct impact on the target tumor cells or viruses. It has been shown that some of the insect peptides suppress viral gene and protein expression, rybosilate DNA, whereas others cause membrane lysis, induce apoptosis or arrest cell cycle. Several of the purified and characterized peptides of insect origin are very promising in treating of serious human diseases like human immunodeficiency virus (HIV), herpex simplex virus (HSV) or leukaemia. However, some obstacles need to be overcome. Cytotoxic activity of peptides, susceptibility to proteases or high cost of production remain still unsolved problems. Reports on the peptides antiviral and antitumour mechanisms are scanty. Thus, in this review we present characteristic, mode of action and potential medical applications of insects origin peptides with the antiviral and antitumour activity.

  20. The Interaction of Human Enteric Pathogens with Plants

    PubMed Central

    Lim, Jeong-A; Lee, Dong Hwan; Heu, Sunggi

    2014-01-01

    There are an increasing number of outbreaks of human pathogens related to fresh produce. Thus, the growth of human pathogens on plants should be explored. Human pathogens can survive under the harsh environments in plants, and can adhere and actively invade plants. Plant-associated microbiota or insects contribute to the survival and transmission of enteric pathogens in plants. Human enteric pathogens also trigger plant innate immunity, but some pathogens–such as Salmonella–can overcome this defense mechanism. PMID:25288993

  1. The insect microbiome modulates vector competence for arboviruses.

    PubMed

    Jupatanakul, Natapong; Sim, Shuzhen; Dimopoulos, George

    2014-11-11

    Diseases caused by arthropod-borne viruses (arboviruses), such as Dengue, West Nile, and Chikungunya, constitute a major global health burden and are increasing in incidence and geographic range. The natural microbiota of insect vectors influences various aspects of host biology, such as nutrition, reproduction, metabolism, and immunity, and recent studies have highlighted the ability of insect-associated bacteria to reduce vector competence for arboviruses and other pathogens. This reduction can occur through mechanisms, such as immune response activation, resource competition, or the production of anti-viral molecules. Studying the interactions between insect vectors and their microbiota is an important step toward developing alternative strategies for arbovirus transmission control.

  2. The Insect Microbiome Modulates Vector Competence for Arboviruses

    PubMed Central

    Jupatanakul, Natapong; Sim, Shuzhen; Dimopoulos, George

    2014-01-01

    Diseases caused by arthropod-borne viruses (arboviruses), such as Dengue, West Nile, and Chikungunya, constitute a major global health burden and are increasing in incidence and geographic range. The natural microbiota of insect vectors influences various aspects of host biology, such as nutrition, reproduction, metabolism, and immunity, and recent studies have highlighted the ability of insect-associated bacteria to reduce vector competence for arboviruses and other pathogens. This reduction can occur through mechanisms, such as immune response activation, resource competition, or the production of anti-viral molecules. Studying the interactions between insect vectors and their microbiota is an important step toward developing alternative strategies for arbovirus transmission control. PMID:25393895

  3. Chapter 2 - Large-scale patterns of insect and disease activity in the conterminous United States and Alaska from the National Insect and Disease Survey, 2011

    Treesearch

    Kevin M. Potter; Jeanine L. Paschke

    2014-01-01

    The impacts of insects and pathogens on forests vary from natural thinning to extraordinary levels of tree mortality, but the fact that insects and diseases kill trees does not necessarily make them enemies of the forest (Teale and Castello 2011). If disturbances, pests, and diseases are viewed in their full ecological context, then some amount can be considered “...

  4. Specific diversity of the entomopathogenic fungi Beauveria and Metarhizium in Mexican agricultural soils.

    PubMed

    Pérez-González, Víctor H; Guzmán-Franco, Ariel W; Alatorre-Rosas, Raquel; Hernández-López, Jorge; Hernández-López, Antonio; Carrillo-Benítez, María G; Baverstock, Jason

    2014-06-01

    Prior knowledge of the local population structure of entomopathogenic fungi is considered an important requisite when developing microbial control strategies against major pests of crops such as white grubs. An extensive survey in the estate of Guanajuato, one of the main agricultural regions of Mexico, was carried out to determine the abundance and diversity of entomopathogenic fungi in soil. Soil collected from 11 locations was baited for entomopathogenic fungi using Galleria mellonella. In addition, all isolates were morphologically identified and selected isolates of Beauveria and Metarhizium isolates identified using Bloc and ITS or Elongation Factor 1-α and ITS sequence information respectively. Genotypic diversity was then studied using microsatellite genotyping. The proportion of isolates belonging to each genus varied amongst all locations. The species Beauveria bassiana, B. pseudobassiana and Metarhizium robertsii were found, with B. bassiana being the most abundant and widely distributed. Microsatellite genotyping showed that the 36 B. bassiana isolates were grouped in 29 unique haplotypes, but with no separation according to geographical origin.

  5. Dosage response mortality of Japanese beetle, masked chafer, and June beetle (Coleoptera: Scarabaeidae) adults when exposed to experimental and commercially available granules containing Metarhizium brunneum

    USDA-ARS?s Scientific Manuscript database

    Adult beetles of three different white grub species, Japanese beetle, Popillia japonica, June beetle, Phyllophaga spp., and masked chafer, Cyclocephala spp. were exposed to experimental and commercially available granules containing Metarhizium brunneum (Petch) strain F52, to determine susceptibilit...

  6. Optimization of compatible non-ionic surfactant for formulation development of hydrophobic conidia of entomopathogenic fungi, Beauveria bassiana (Hypocreales:Cordycipitaceae) and Metarhizium anisopliae Hypocreales:Clavicipita

    USDA-ARS?s Scientific Manuscript database

    Aerial conidia, especially dried conidia of entomopathogenic fungi, Beauveria bassiana and Metarhizium anisopliae are hydrophobic, and therefore surfactants are needed for developing water-based formulations in laboratory studies, greenhouse bioassays, and field trials as well as commercial product ...

  7. Evolutionary Ecology of Multitrophic Interactions between Plants, Insect Herbivores and Entomopathogens.

    PubMed

    Shikano, Ikkei

    2017-06-01

    Plants play an important role in the interactions between insect herbivores and their pathogens. Since the seminal review by Cory and Hoover (2006) on plant-mediated effects on insect-pathogen interactions, considerable progress has been made in understanding the complexity of these tritrophic interactions. Increasing interest in the areas of nutritional and ecological immunology over the last decade have revealed that plant primary and secondary metabolites can influence the outcomes of insect-pathogen interactions by altering insect immune functioning and physical barriers to pathogen entry. Some insects use plant secondary chemicals and nutrients to prevent infections (prophylactic medication) and medicate to limit the severity of infections (therapeutic medication). Recent findings suggest that there may be selectable plant traits that enhance entomopathogen efficacy, suggesting that entomopathogens could potentially impose selection pressure on plant traits that improve both pathogen and plant fitness. Moreover, plants in nature are inhabited by diverse communities of microbes, in addition to entomopathogens, some of which can trigger immune responses in insect herbivores. Plants are also shared by numerous other herbivorous arthropods with different modes of feeding that can trigger different defensive responses in plants. Some insect symbionts and gut microbes can degrade ingested defensive phytochemicals and be orally secreted onto wounded plant tissue during herbivory to alter plant defenses. Since non-entomopathogenic microbes and other arthropods are likely to influence the outcomes of plant-insect-entomopathogen interactions, I discuss a need to consider these multitrophic interactions within the greater web of species interactions.

  8. Vision in flying insects.

    PubMed

    Egelhaaf, Martin; Kern, Roland

    2002-12-01

    Vision guides flight behaviour in numerous insects. Despite their small brain, insects easily outperform current man-made autonomous vehicles in many respects. Examples are the virtuosic chasing manoeuvres male flies perform as part of their mating behaviour and the ability of bees to assess, on the basis of visual motion cues, the distance travelled in a novel environment. Analyses at both the behavioural and neuronal levels are beginning to unveil reasons for such extraordinary capabilities of insects. One recipe for their success is the adaptation of visual information processing to the specific requirements of the behavioural tasks and to the specific spatiotemporal properties of the natural input.

  9. Beneficial Insects and Insect Pollinators on Milkweed in South Georgia

    USDA-ARS?s Scientific Manuscript database

    Insect pollinators are essential for the reproduction of more than two-thirds of the world’s crops, and beneficial insects play an important role in managing pest insects in agricultural farmscapes. These insects depend on nectar for their survival in these farmscapes. The flowers of tropical milkwe...

  10. Host-pathogen interactions and genome evolution in two generalist and specialist microsporidian pathogens of mosquitoes

    USDA-ARS?s Scientific Manuscript database

    The adaptation of two distantly related microsporidia to their mosquito hosts was investigated. Edhazardia aedis is a specialist pathogen that infects Aedes aegypti, the main vector of dengue and yellow fever arboviruses. Vavraia culicis is a generalist pathogen of several insects including Anophele...

  11. Feeding the insect industry

    USDA-ARS?s Scientific Manuscript database

    This article reports the use of insect colloidal artificial diets suitable for the rearing of economically important arthropods, such as Lygus lineolaris, Lygus hesperus, Coleomegilla maculata, and Phytoseiulus persimilis The different diets contain key nutrients such as proteins, carbohydrates, vit...

  12. Insect Bites and Stings

    MedlinePlus

    ... they sometimes cause discomfort. Bee, wasp, and hornet stings and fire ant bites usually hurt. Mosquito and ... have severe allergic reactions to insect bites and stings (such as anaphylaxis), carry an emergency epinephrine kit

  13. On-host control of the brown dog tick Rhipicephalus sanguineus Latreille (Acari: Ixodidae) by Metarhizium brunneum (Hypocreales: Clavicipitaceae).

    PubMed

    Rot, A; Gindin, G; Ment, D; Mishoutchenko, A; Glazer, I; Samish, M

    2013-03-31

    Ticks are obligatory blood-sucking arthropods. Their life cycle includes a relatively short period of feeding on a vertebrate host and a long off-host period spent in the upper layer of the soil. Entomopathogenic fungi are known to be highly effective tick pathogens and the on-host application of these fungi may be a promising economic approach for tick control. In this study, we evaluated the tick control provided by spraying Metarhizium brunneum onto the tick's vertebrate host, specifically gerbils (Meriones tristrami) and rabbits (Oryctolagus cuniculus). The efficacy of the fungal treatment was not limited to a direct effect on the mortality of feeding ticks, but continued during molting (off host) and, in the case of female ticks, the treatment reduced the production of eggs and their hatching rate. The direct control of the on-host stages was relatively low (from 19 to 38%); whereas the effects of the applied fungus on subsequent tick development reduced the yield of the following engorged stages up to 30-63%. Engorged females that dropped from rabbits sprayed with M. brunneum laid 21.5% fewer eggs than the control females. Moreover, these ticks transmitted conidia by contact to the eggs which they laid, resulting a 3-fold reduction in the rate of hatching relative to the control. Based on theoretical cumulative calculations, these results suggest that if the progeny of each unfed stage feed on fungus-sprayed hosts, there will be a 92% reduction in the tick population within one generation. Two spray formulations, one based on mineral oil and another based on a starch-sucrose mixture, significantly enhanced on-host tick control, in comparison with an unformulated conidial suspension. The reduction in the number of nymphs that fed on the treated host and later developed into unfed adults was 54.9% for unformulated conidia, 70.4% for the oil formulation and 86.4% for the starch-sucrose formulation. Increasing the environmental humidity around the gerbils while

  14. Evolution of the Insects

    NASA Astrophysics Data System (ADS)

    Grimaldi, David; Engel, Michael S.

    2005-05-01

    This book chronicles the complete evolutionary history of insects--their living diversity and relationships as well as 400 million years of fossils. Introductory sections cover the living species diversity of insects, methods of reconstructing evolutionary relationships, basic insect structure, and the diverse modes of insect fossilization and major fossil deposits. Major sections then explore the relationships and evolution of each order of hexapods. The volume also chronicles major episodes in the evolutionary history of insects from their modest beginnings in the Devonian and the origin of wings hundreds of millions of years before pterosaurs and birds to the impact of mass extinctions and the explosive radiation of angiosperms on insects, and how they evolved into the most complex societies in nature. Whereas other volumes focus on either living species or fossils, this is the first comprehensive synthesis of all aspects of insect evolution. Illustrated with 955 photo- and electron- micrographs, drawings, diagrams, and field photos, many in full color and virtually all of them original, this reference will appeal to anyone engaged with insect diversity--professional entomologists and students, insect and fossil collectors, and naturalists. David Grimaldi and Michael S. Engel have collectively published over 200 scientific articles and monographs on the relationships and fossil record of insects, including 10 articles in the journals Science, Nature, and Proceedings of the National Academy of Sciences. David Grimaldi is curator in the Division of Invertebrate Zoology, American Museum of Natural History and adjunct professor at Cornell University, Columbia University, and the City University of New York. David Grimaldi has traveled in 40 countries on 6 continents, collecting and studying recent species of insects and conducting fossil excavations. He is the author of Amber: Window to the Past (Abrams, 2003). Michael S. Engel is an assistant professor in the

  15. Important Insect Pests of Fruit - Important Insect Pests of Nuts - Field Crop Insect Pests - Insect Pests of Vegetable Crops.

    ERIC Educational Resources Information Center

    Gesell, Stanley G.; And Others

    This document consists of four agriculture extension service publications from Pennsylvania State University. The titles are: (1) Important Insect Pests of Fruit; (2) Important Insect Pests of Nuts; (3) Field Crop Insect Pests; and (4) Insect Pests of Vegetable Crops. The first publication gives the hosts, injury, and description of 22 insect…

  16. Important Insect Pests of Fruit - Important Insect Pests of Nuts - Field Crop Insect Pests - Insect Pests of Vegetable Crops.

    ERIC Educational Resources Information Center

    Gesell, Stanley G.; And Others

    This document consists of four agriculture extension service publications from Pennsylvania State University. The titles are: (1) Important Insect Pests of Fruit; (2) Important Insect Pests of Nuts; (3) Field Crop Insect Pests; and (4) Insect Pests of Vegetable Crops. The first publication gives the hosts, injury, and description of 22 insect…

  17. Insects and other invertebrates

    Treesearch

    John R. Jones; Norbert V. DeByle; Diane M. Bowers

    1985-01-01

    Quaking aspen throughout its range appears to be host to several insect and other invertebrate pests (fig. 1). It is a short-lived species that is palatable to a large variety of animals. Furniss and Carolin (1977) listed 33 insect species that use aspen as a food source. Some are quite damaging and may kill otherwise healthy stands of aspen; others feed on weakened or...

  18. Exploring Insect Vision

    ERIC Educational Resources Information Center

    Damonte, Kathleen

    2005-01-01

    A fly is buzzing around in the kitchen. You sneak up on it with a flyswatter, but just as you get close to it, it flies away. What makes flies and other insects so good at escaping from danger? The fact that insects have eyesight that can easily detect moving objects is one of the things that help them survive. In this month's Science Shorts,…

  19. Exploring Insect Vision

    ERIC Educational Resources Information Center

    Damonte, Kathleen

    2005-01-01

    A fly is buzzing around in the kitchen. You sneak up on it with a flyswatter, but just as you get close to it, it flies away. What makes flies and other insects so good at escaping from danger? The fact that insects have eyesight that can easily detect moving objects is one of the things that help them survive. In this month's Science Shorts,…

  20. Corazonin in insects.

    PubMed

    Predel, Reinhard; Neupert, Susanne; Russell, William K; Scheibner, Olaf; Nachman, Ronald J

    2007-01-01

    Corazonin is a peptidergic neurohormone of insects that is expressed in neurosecretory neurons of the pars lateralis of the protocerebrum and transported via nervi corporis cardiaci to the storage lobes of the corpora cardiaca. This peptide occurs with a single isoform in all insects studied so far, with the exception of the Coleoptera in which no corazonin form could be detected. Very few modifications of [Arg(7)]-corazonin, originally isolated from cockroaches, are known, namely [His(7)]-corazonin which is expressed in certain locusts and the stick insect Carausius morosus, and [Thr(4), His(7)]-corazonin recently described from the honey bee Apis mellifera. In this study, we performed a comprehensive screening for corazonin in the different insect groups after detecting of a fourth isoform in a crane fly, Tipula sp. ([Gln(10)]-corazonin). [Arg(7)]-corazonin is distributed in most major lineages of insects, and is thus the ancient form which was present at the time the phylum Insecta evolved. The replacement of Arg with His at position 7 from the N-terminus occurred several times in the evolution of insects. The third isoform, [Thr(4), His(7)]-corazonin, seems to be restricted to bees (Apidae); whereas wasps (Vespidae) and a bumble bee (Apidae) express other corazonins, specifically [His(7)]-corazonin and [Tyr(3), Gln(7), Gln(10)]-corazonin, respectively. A novel corazonin form, [His(4), Gln(7)]-corazonin, was also detected in all South African members of the newly described insect order Mantophasmatodea. The [His(4), Gln(7)]-corazonin separates these species from the Namibian Mantophasmatodea which express [Arg(7)]-corazonin and can be used as a distinct character to distinguish these morphologically similar insects.